Directory of Open Access Journals (Sweden)
Murphy Colleen
2008-09-01
Full Text Available Abstract Background Aeromonas salmonicida subsp. salmonicida is a Gram-negative bacterium that is the causative agent of furunculosis, a bacterial septicaemia of salmonid fish. While other species of Aeromonas are opportunistic pathogens or are found in commensal or symbiotic relationships with animal hosts, A. salmonicida subsp. salmonicida causes disease in healthy fish. The genome sequence of A. salmonicida was determined to provide a better understanding of the virulence factors used by this pathogen to infect fish. Results The nucleotide sequences of the A. salmonicida subsp. salmonicida A449 chromosome and two large plasmids are characterized. The chromosome is 4,702,402 bp and encodes 4388 genes, while the two large plasmids are 166,749 and 155,098 bp with 178 and 164 genes, respectively. Notable features are a large inversion in the chromosome and, in one of the large plasmids, the presence of a Tn21 composite transposon containing mercury resistance genes and an In2 integron encoding genes for resistance to streptomycin/spectinomycin, quaternary ammonia compounds, sulphonamides and chloramphenicol. A large number of genes encoding potential virulence factors were identified; however, many appear to be pseudogenes since they contain insertion sequences, frameshifts or in-frame stop codons. A total of 170 pseudogenes and 88 insertion sequences (of ten different types are found in the A. salmonicida genome. Comparison with the A. hydrophila ATCC 7966T genome reveals multiple large inversions in the chromosome as well as an approximately 9% difference in gene content indicating instances of single gene or operon loss or gain. A limited number of the pseudogenes found in A. salmonicida A449 were investigated in other Aeromonas strains and species. While nearly all the pseudogenes tested are present in A. salmonicida subsp. salmonicida strains, only about 25% were found in other A. salmonicida subspecies and none were detected in other
Subunit vaccine candidates against Aeromonas salmonicida in rainbow trout Oncorhynchus mykiss
DEFF Research Database (Denmark)
Marana, Moonika Haahr; Jørgensen, Louise von Gersdorff; Skov, Jakob
2017-01-01
rainbow trout (Oncorhynchus mykiss, Walbaum) aquaculture furunculosis outbreaks still occur. In this study we tested the efficacy of experimental subunit vaccines against A. salmonicida infection in rainbow trout. We utilized in silico screening of the proteome of A. salmonicida subsp. salmonicida strain...... A449 and identified potential protective protein antigens that were tested by in vivo challenge trial. A total of 14 proteins were recombinantly expressed in Escherichia coli and prepared in 3 different subunit vaccine combinations to immunize 3 groups of rainbow trout by intraperitoneal (i...
Subunit vaccine candidates against Aeromonas salmonicida in rainbow trout Oncorhynchus mykiss.
Marana, Moonika Haahr; Jørgensen, Louise von Gersdorff; Skov, Jakob; Chettri, Jiwan Kumar; Holm Mattsson, Andreas; Dalsgaard, Inger; Kania, Per Walter; Buchmann, Kurt
2017-01-01
Aeromonas salmonicida subsp. salmonicida is the etiological agent of furunculosis and a major fish health problem in salmonid aquaculture worldwide. Injection vaccination with commercial mineral oil-adjuvanted bacterin vaccines has been partly successful in preventing the disease but in Danish rainbow trout (Oncorhynchus mykiss, Walbaum) aquaculture furunculosis outbreaks still occur. In this study we tested the efficacy of experimental subunit vaccines against A. salmonicida infection in rainbow trout. We utilized in silico screening of the proteome of A. salmonicida subsp. salmonicida strain A449 and identified potential protective protein antigens that were tested by in vivo challenge trial. A total of 14 proteins were recombinantly expressed in Escherichia coli and prepared in 3 different subunit vaccine combinations to immunize 3 groups of rainbow trout by intraperitoneal (i.p.) injection. The fish were exposed to virulent A. salmonicida 7 weeks after immunization. To assess the efficacy of the subunit vaccines we evaluated the immune response in fish after immunization and challenge infection by measuring the antibody levels and monitoring the survival of fish in different groups. The survival of fish at 3 weeks after challenge infection showed that all 3 groups of fish immunized with 3 different protein combinations exhibited significantly lower mortalities (17-30%) compared to the control groups (48% and 56%). The ELISA results revealed significantly elevated antibody levels in fish against several protein antigens, which in some cases were positively correlated to the survival.
Kim, J H; Choresca, C H; Shin, S P; Han, J E; Jun, J W; Park, S C
2015-02-01
The potential control efficacy of Aeromonas phage PAS-1 was evaluated against Aeromonas salmonicida subsp. salmonicida infection in rainbow trout (Oncorhynchus mykiss) model in this study. The phage was co-cultured with the virulent A. salmonicida subsp. salmonicida strain AS05 that possesses the type III secretion system (TTSS) ascV gene, and efficient bacteriolytic activity was observed against the bacteria. The administration of PAS-1 in rainbow trout demonstrated that the phage was cleared from the fish within 200 h post-administration, and a temporal neutralizing activity against the phage was detected in the sera of phage-administrated fish. The administration of PAS-1 (multiplicity of infection: 10 000) in A. salmonicida subsp. salmonicida infected rainbow trout model showed notable protective effects, with increased survival rates and mean times to death. These results demonstrated that Aeromonas phage PAS-1 could be considered as an alternative biological control agent against A. salmonicida subsp. salmonicida infections in rainbow trout culture. © 2013 Blackwell Verlag GmbH.
DEFF Research Database (Denmark)
Long, Meng; Nielsen, Tue K; Leisner, Jørgen J
2016-01-01
Two strains of Aeromonas salmonicida, YK and BG, were isolated from largemouth bronze gudgeon and northern whitefish in China, and identified as A. salmonicida subsp. salmonicida based on phylogenetic analysis of vapA and 16S rRNA gene sequences. YK and BG originated from freshwater fish, one...
NCBI nr-aa BLAST: CBRC-DSIM-04-0091 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-DSIM-04-0091 ref|YP_001143655.1| imidazolonepropionase [Aeromonas salmonicida subsp. salmon...icida A449] gb|ABO91907.1| imidazolonepropionase [Aeromonas salmonicida subsp. salmonicida A449] YP_001143655.1 0.71 22% ...
NCBI nr-aa BLAST: CBRC-AGAM-07-0064 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-AGAM-07-0064 ref|YP_001143407.1| sulfatase [Aeromonas salmonicida subsp. salmon...icida A449] gb|ABO91659.1| sulfatase [Aeromonas salmonicida subsp. salmonicida A449] YP_001143407.1 0.0 87% ...
DEFF Research Database (Denmark)
Bartkova, Simona; Leekitcharoenphon, Pimlapas; Aarestrup, Frank Møller
2017-01-01
transmission of the bacterium could have been from seawater to freshwater or vice versa, and most minor clades include a mixture of strains from different fresh- and seawater farms. Genomic variation of A. salmonicida subsp. salmonicida mostly appeared to be associated with their plasmids and plasmid encoded...
Serological comparison of selected isolates of Aeromonas salmonicida ssp. Salmonicida
Hahnel, G.B.; Gould, R.W.; Boatman, E.S.
1983-01-01
Eight isolates of Acronionus salmonicida ssp. salmonicida were collected during furunculosis epizootics in North American Pacific coast states and provinces. Both virulent and avirulent forms of each isolate, confirmed by challenge and electron microscopy, were examined. Serological comparisons by cross-absorption agglutination tests revealed no serological differences between isolates. Using the double diffusion precipitin test, a single band was observed when antigen from a sonicated virulent strain was reacted with antiserum against a sonicated, virulent strain absorbed with homologous, avirulent strain. The presence of the single band was eliminated by excess sonication.
NCBI nr-aa BLAST: CBRC-OLAT-18-0005 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-OLAT-18-0005 ref|YP_001142445.1| membrane protein [Aeromonas salmonicida subsp. salmon...icida A449] gb|ABO90697.1| membrane protein [Aeromonas salmonicida subsp. salmonicida A449] YP_001142445.1 0.001 25% ...
NCBI nr-aa BLAST: CBRC-AGAM-07-0002 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-AGAM-07-0002 ref|YP_001142445.1| membrane protein [Aeromonas salmonicida subsp. salmon...icida A449] gb|ABO90697.1| membrane protein [Aeromonas salmonicida subsp. salmonicida A449] YP_001142445.1 1e-130 93% ...
NCBI nr-aa BLAST: CBRC-CREM-01-1309 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-CREM-01-1309 ref|YP_001140721.1| membrane protein [Aeromonas salmonicida subsp. salmon...icida A449] gb|ABO88973.1| membrane protein [Aeromonas salmonicida subsp. salmonicida A449] YP_001140721.1 9e-50 46% ...
NCBI nr-aa BLAST: CBRC-AGAM-07-0022 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-AGAM-07-0022 ref|YP_001140043.1| O-antigen ligase [Aeromonas salmonicida subsp. salmon...icida A449] gb|ABO88295.1| O-antigen ligase [Aeromonas salmonicida subsp. salmonicida A449] YP_001140043.1 1e-145 76% ...
NCBI nr-aa BLAST: CBRC-AGAM-07-0060 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-AGAM-07-0060 ref|YP_001141367.1| GGDEF domain protein [Aeromonas salmonicida subsp. salmon...icida A449] gb|ABO89619.1| GGDEF domain protein [Aeromonas salmonicida subsp. salmonicida A449] YP_001141367.1 1e-165 88% ...
NCBI nr-aa BLAST: CBRC-AGAM-07-0060 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-AGAM-07-0060 ref|YP_001142002.1| GGDEF domain protein [Aeromonas salmonicida subsp. salmon...icida A449] gb|ABO90254.1| GGDEF domain protein [Aeromonas salmonicida subsp. salmonicida A449] YP_001142002.1 6e-21 30% ...
NCBI nr-aa BLAST: CBRC-AGAM-07-0010 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-AGAM-07-0010 ref|YP_001141362.1| amino acid permease [Aeromonas salmonicida subsp. salmon...icida A449] gb|ABO89614.1| amino acid permease [Aeromonas salmonicida subsp. salmonicida A449] YP_001141362.1 1e-132 96% ...
NCBI nr-aa BLAST: CBRC-VPAC-01-0406 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-VPAC-01-0406 ref|YP_001141292.1| O-antigen acetylase [Aeromonas salmonicida subsp. salmon...icida A449] gb|ABO89544.1| O-antigen acetylase [Aeromonas salmonicida subsp. salmonicida A449] YP_001141292.1 2.1 28% ...
NCBI nr-aa BLAST: CBRC-DSIM-02-0033 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-DSIM-02-0033 ref|YP_001141368.1| regulator of uhpT [Aeromonas salmonicida subsp. salmon...icida A449] gb|ABO89620.1| regulator of uhpT [Aeromonas salmonicida subsp. salmonicida A449] YP_001141368.1 3.1 20% ...
NCBI nr-aa BLAST: CBRC-AGAM-07-0021 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-AGAM-07-0021 ref|YP_001140588.1| Na+/H antiporter NhaA [Aeromonas salmonicida subsp. salmon...icida A449] gb|ABO88840.1| Na+/H antiporter NhaA [Aeromonas salmonicida subsp. salmonicida A449] YP_001140588.1 1e-123 94% ...
Resistance patterns of Aeromonas salmonicida to common ...
African Journals Online (AJOL)
Twenty eight isolates, including A. salmonicida fcs strain and A. salmonicida 1102, were subjected to antimicrobial sensitivity testing of 11 antimicrobial agents by a disc diffusion method and an agar dilution method to determine minimum inhibitory concentrations (mic's). The semi-quantitative results of the disc test were ...
Resistance of Salmonds Against Aeromonas Salmonicida
DEFF Research Database (Denmark)
Holten-Andersen, Lars; Dalsgaard, Inger; Buchmann, Kurt
2011-01-01
Furunculosis, caused by Aeromonas salmonicida, continues to be a health problem for the growing salmonid aquaculture. Despite effective vaccination programs regular outbreaks occur at Danish trout farms calling for repeated antibiotic treatment. We hypothesized that a difference in natural...... over a 30-day period post challenge and the results were summarized in mortality curves. A. salmonicida was recovered from mortalities during the entire test period. At day 30 the survival was 6.2 % and 34.0 % for rainbow trout and Baltic salmon, respectively. Significant differences in susceptibility...... to A. salmonicida were demonstrated between the two salmonids and hazard ratio estimation between rainbow trout and Baltic salmon showed a 3.36 higher risk of dying from the infection in the former. The finding that Baltic salmon carries a high level of natural resistance to furunculosis might raise...
Characterization of atypical Aeromonas salmonicida isolates by ribotyping and plasmid profiling
DEFF Research Database (Denmark)
Pedersen, Karl; Dalsgaard, Inger; Larsen, J.L.
1996-01-01
A total of 38 strains of atypical Aeromonas salmonicida, three oxidase-negative but otherwise typical Aer. salmonicida, three typical Aer. salmonicida, and two reference strains, isolated from several countries and fish species were examined with respect to rRNA gene restriction patterns (ribotypes...
Directory of Open Access Journals (Sweden)
Clara Fernández-Álvarez
2016-11-01
Full Text Available This work represents the first description of Aeromonas salmonicida subsp. salmonicida as causative agent of furunculosis in cultured sea bass, Dicentrarchus labrax (L.. Cumulative mortality in affected fish from two floating cages in the Mediterranean coast of Spain was 3.8%. Affected sea bass did not show the typical external signs of furunculosis in the first stages of the disease, however, when the disease progressed, open ulcers appeared on the skin and muscle. Internally, splenomegaly was the only pathological sign observed. Samples from diseased fish were subjected to standardized assays for pathogens screening. Negative results were obtained for parasites and fish viruses. A Gram-stain-negative rod-shaped bacterium was observed in smears from liver, kidney and spleen of all analysed fish. Pure bacterial cultures were recovered from liver, kidney and spleen of all diseased fish sampled during the two different outbreaks. Bacteriological, serological, molecular and chemotaxonomic analysis allowed the identification of the causative agent of sea bass mortalities as Aeromonas salmonicida subsp. salmonicida. The bacterial strains were susceptible to most of antimicrobial agents usually employed in aquaculture except to oxytetracycline. Pathogenicity assays demonstrated that the isolated bacteria were virulent for sea bass, turbot and rainbow trout.
DEFF Research Database (Denmark)
Dalsgaard, Inger; Gudmundsdottir, B.K.; Helgason, S.
1998-01-01
the biochemical identification of atypical Aer. salmonicida before and after standardization of media and methods. Five laboratories examined 25 isolates of Aer. salmonicida from diverse fish species and geographical locations including the reference strains of Aer. salmonicida subsp, salmonicida (NCMB 1102......) and Aer. salmonicida subsp. achromogenes (NCMB 1110), Without standardization of the methods, 100% agreement was obtained only for two tests: motility and ornithine decarboxylase. The main reason for the discrepancies found was the variation of the incubation time prior to reading the biochemical...
MicroRNAs-449a and -449b exhibit tumor suppressive effects in retinoblastoma
Energy Technology Data Exchange (ETDEWEB)
Martin, Alissa [Division of Hematology, Oncology, and Stem Cell Transplantation, Ann and Robert H. Lurie Children’s Hospital of Chicago, Chicago, IL 60611 (United States); Jones, Aunica [Cancer Biology and Epigenomics Program, Ann and Robert H. Lurie Children’s Hospital of Chicago Research Center, Chicago, IL 60611 (United States); Bryar, Paul J. [Departments of Ophthalmology and Pathology, Northwestern University Feinberg School of Medicine, Chicago, IL 60611 (United States); Mets, Marilyn [Division of Ophthalmology, Ann and Robert H. Lurie Children’s Hospital of Chicago, Chicago, IL 60611 (United States); Department of Ophthalmology, Northwestern University, Feinberg School of Medicine, Chicago, IL 60611 (United States); Weinstein, Joanna [Department of Pediatrics, Northwestern University, Feinberg School of Medicine, Chicago, IL 60611 (United States); Division of Hematology, Oncology, and Stem Cell Transplantation, Ann and Robert H. Lurie Children’s Hospital of Chicago, Chicago, IL 60611 (United States); Zhang, Gang [Biostatistics Research Core, Ann and Robert H. Lurie Children’s Hospital of Chicago Research Center, Chicago, IL 60611 (United States); Laurie, Nikia A., E-mail: n-laurie@northwestern.edu [Cancer Biology and Epigenomics Program, Ann and Robert H. Lurie Children’s Hospital of Chicago Research Center, Chicago, IL 60611 (United States); Department of Pediatrics, Northwestern University, Feinberg School of Medicine, Chicago, IL 60611 (United States)
2013-11-01
Highlights: •We validate miR-449a/b expression in primary human retinoblastomas and cell lines. •Exogenous miRs-449a/b inhibited proliferation in retinoblastoma cell lines. •Exogenous miRs-449a/b increased apoptosis in retinoblastoma cell lines. •miRs-449a/b could serve as viable therapeutic targets for retinoblastoma treatment. -- Abstract: Retinoblastoma is the most common pediatric cancer of the eye. Currently, the chemotherapeutic treatments for retinoblastoma are broad-based drugs such as vincristine, carboplatin, or etoposide. However, therapies targeted directly to aberrant signaling pathways may provide more effective therapy for this disease. The purpose of our study is to illustrate the relationship between the expressions of miRs-449a and -449b to retinoblastoma proliferation and apoptosis. We are the first to confirm an inhibitory effect of miR-449a and -449b in retinoblastoma by demonstrating significantly impaired proliferation and increased apoptosis of tumor cells when these miRNAs are overexpressed. This study suggests that these miRNAs could serve as viable therapeutic targets for retinoblastoma treatment.
Directory of Open Access Journals (Sweden)
Christine Ann Moore
2017-01-01
Full Text Available Aeromonas salmonicida is associated with superficial skin infections in fish. Its virulence factors allow colonization of water including surface water such as salt water, beaches, and fresh water wells. Moreover, it is possible for immunocompromised patients to develop invasive disease after chronic exposure to Aeromonas spp. through contaminated water. While there are reports of Aeromonas spp. bacteremia following water ingestion, there have been no reports of A. salmonicida bacteremia from water consumption. We report the first case of A. salmonicida bacteremia in a patient with diabetes due to chronic consumption of well water.
Aeromonas salmonicida - Epidemiology, whole genome sequencing, detection and in vivo imaging
DEFF Research Database (Denmark)
Bartkova, Simona
causes problems in sea reared rainbow trout (Oncorhynchus mykiss) production. Outbreaks occur repeatedly during stressful conditions such as elevated temperatures, in spite of commercial vaccines being applied. Besides seemingly lacking adequate protection, the vaccines also produce undesirable side...... of the concerns regarding A. salmonicida. First, we focused on investigation of the route of entry and initial dissemination of A. salmonicida in fish. This was done by tracing the bacterium using in vivo bioluminescence imaging. A Danish strain was transformed with a plasmid vector containing a green...... was subsequently turned to finding a sensitive method for detecting A. salmonicida in infected and possible carrier fish. For this, a previously developed quantitative real-time polymerase chain reaction (real-time PCR) targeting the aopP gene located on A. salmonicida plasmid pAsal1 was assessed. The real...
DEFF Research Database (Denmark)
Høie, S.; Dalsgaard, Inger; Aase, I.L.
1999-01-01
. salmonicida subsp. salmonicida isolates tested, belonged to group 1. The PCR primer-sets separated A. salmonicida from other reference strains of Aeromonas species and related bacteria with the exception of Aeromonas hydrophila. The results indicated that PCR typing is a useful framework for characterization...
Lifescience Database Archive (English)
Full Text Available MeCab user dictionary for science technology term Aeromonas salmonicida 名詞 一般 * * * * Aeromonas salmon...icida ... MeSH D048409 200906081596351600 C LS07 UNKNOWN_2 Aeromonas salmonicida
Lifescience Database Archive (English)
Full Text Available MeCab user dictionary for science technology term Aliivibrio salmonicida 名詞 一般 * * * * Aliivibrio salmon...icida ... MeSH D044165 200906023365578059 C LS07 UNKNOWN_2 Aliivibrio salmonicida
Gao, Xi-Yan; Liu, Ying; Miao, Li-Li; Li, Er-Wei; Sun, Guo-Xiang; Liu, Ying; Liu, Zhi-Pei
2017-05-01
The bacterium Aeromonas salmonicida is the causative agent of furunculosis, a systemic, ubiquitous disease of fish in the salmon family, characterized by high mortality and morbidity. Probiotics are a promising approach for prevention of furunculosis in aquaculture. A bacterial strain with anti-A. salmonicida properties, Bacillus velezensis V4, was isolated and the mechanisms underlying these properties were investigated. Anti-A. salmonicida compounds present in cell-free supernatant of V4 were purified and structurally identified as members of the iturin, macrolactin, and difficidin groups. The compounds contributed jointly to inhibition of A. salmonicida, and the diversity of the compounds was related to the versatility of their mode of action. Addition of the compounds to A. salmonicida cell suspensions reduced cell density. Analyses by confocal microscopy and scanning electron microscopy revealed cell membrane disruption, deletion of cellular content, and cell lysis of A. salmonicida. The V4 genome was sequenced, and gene clusters involved in synthesis of anti-Aeromonas compounds were detected and identified. A possible probiotic effect on growth performance of Oncorhynchus mykiss (rainbow trout) was investigated by addition of 0, 1, and 3 % (v/w) V4. Relative to control, mortality was reduced 27.25 % in the 1 % addition group and 81.86 % in the 3 % addition group. Feed coefficient ratio was reduced 19.49 % and weight gain ratio was increased 71.22 % in the 1 % addition group. Our findings demonstrate that V4 is an effective probiotic strain in O. mykiss and has clear potential for both control of furunculosis and growth promotion of aquaculture animals.
Raeder, Inger Lin Uttakleiv; Paulsen, Steinar M; Smalås, Arne O; Willassen, Nils Peder
2007-01-01
Vibrio salmonicida is the causative agent of cold-water vibriosis in farmed marine fish species. Adherence of pathogenic bacteria to mucosal surfaces is considered to be the first steps in the infective processes, and proteins involved are regarded as virulence factors. The global protein expression profile of V. salmonicida, grown with and without the presence of fish skin mucus in the synthetic media, was compared. Increased levels of proteins involved in motility, oxidative stress responses, and general stress responses were demonstrated as an effect of growth in the presence of mucus compared to non-mucus containing media. Enhanced levels of the flagellar proteins FlaC, FlaD and FlaE indicate increased motility capacity, while enhanced levels of the heat shock protein DnaK and the chaperonin GroEL indicate a general stress response. In addition, we observed that peroxidases, TPx.Grx and AhpC, involved in the oxidative stress responses, were induced by mucus proteins. The addition of mucus to the culture medium did not significantly alter the growth rate of V. salmonicida. An analysis of mucus proteins suggests that the mucus layer harbours a protein species that potentially possesses catalytic activity against DNA, and a protein with iron chelating activity. This study represents the first V. salmonicida proteomic analysis, and provides specific insight into the proteins necessary for the bacteria to challenge the skin mucus barrier of the fish.
Vincent, Antony T; Trudel, Mélanie V; Freschi, Luca; Nagar, Vandan; Gagné-Thivierge, Cynthia; Levesque, Roger C; Charette, Steve J
2016-01-12
Aeromonads make up a group of Gram-negative bacteria that includes human and fish pathogens. The Aeromonas salmonicida species has the peculiarity of including five known subspecies. However, few studies of the genomes of A. salmonicida subspecies have been reported to date. We sequenced the genomes of additional A. salmonicida isolates, including three from India, using next-generation sequencing in order to gain a better understanding of the genomic and phylogenetic links between A. salmonicida subspecies. Their relative phylogenetic positions were confirmed by a core genome phylogeny based on 1645 gene sequences. The Indian isolates, which formed a sub-group together with A. salmonicida subsp. pectinolytica, were able to grow at either at 18 °C and 37 °C, unlike the A. salmonicida psychrophilic isolates that did not grow at 37 °C. Amino acid frequencies, GC content, tRNA composition, loss and gain of genes during evolution, pseudogenes as well as genes under positive selection and the mobilome were studied to explain this intraspecies dichotomy. Insertion sequences appeared to be an important driving force that locked the psychrophilic strains into their particular lifestyle in order to conserve their genomic integrity. This observation, based on comparative genomics, is in agreement with previous results showing that insertion sequence mobility induced by heat in A. salmonicida subspecies causes genomic plasticity, resulting in a deleterious effect on the virulence of the bacterium. We provide a proof-of-concept that selfish DNAs play a major role in the evolution of bacterial species by modeling genomes.
Detection and quantification of Aeromonas salmonicida in fish tissue by real-time PCR
DEFF Research Database (Denmark)
Bartkova, Simona; Kokotovic, Branco; Skall, H. F.
2017-01-01
Furunculosis, a septicaemic infection caused by the bacterium Aeromonas salmonicida subsp. salmonicida, currently causes problems in Danish seawater rainbow trout production. Detection has mainly been achieved by bacterial culture, but more rapid and sensitive methods are needed. A previously...
AEROMONAS SALMONICIDA INFECTION IN VACCINATED RAINBOW TROUT
DEFF Research Database (Denmark)
Chettri, Jiwan Kumar; Skov, Jakob; Mohammad, Rezkar Jaafar
In vivo testing of any candidate vaccine is influenced by the choice of challenge method and the external environmental conditions. In the present study, a comparative challenge study was performed to evaluate the efficacy of different vaccines against the bacterial pathogen Aeromonas salmonicida...
MicroRNA-449a deficiency promotes colon carcinogenesis.
Niki, Masanori; Nakajima, Kohei; Ishikawa, Daichi; Nishida, Jun; Ishifune, Chieko; Tsukumo, Shin-Ichi; Shimada, Mitsuo; Nagahiro, Shinji; Mitamura, Yoshinori; Yasutomo, Koji
2017-09-06
MicroRNAs have broad roles in tumorigenesis and cell differentiation through regulation of target genes. Notch signaling also controls cell differentiation and tumorigenesis. However, the mechanisms through which Notch mediates microRNA expression are still unclear. In this study, we aimed to identify microRNAs regulated by Notch signaling. Our analysis found that microRNA-449a (miR-449a) was indirectly regulated by Notch signaling. Although miR-449a-deficient mice did not show any Notch-dependent defects in immune cell development, treatment of miR-449a-deficient mice with azoxymethane (AOM) or dextran sodium sulfate (DSS) increased the numbers and sizes of colon tumors. These effects were associated with an increase in intestinal epithelial cell proliferation following AOM/DSS treatment. In patients with colon cancer, miR-449a expression was inversely correlated with disease-free survival and histological scores and was positively correlated with the expression of MLH1 for which loss-of function mutations have been shown to be involved in colon cancer. Colon tissues of miR-449a-deficient mice showed reduced Mlh1 expression compared with those of wild-type mice. Thus, these data suggested that miR-449a acted as a key regulator of colon tumorigenesis by controlling the proliferation of intestinal epithelial cells. Additionally, activation of miR-449a may represent an effective therapeutic strategy and prognostic marker in colon cancer.
DEFF Research Database (Denmark)
Marana, M. H.; Skov, J.; Chettri, Jiwan Kumar
2017-01-01
Rainbow trout, Oncorhynchus mykiss (Walbaum), are able to raise a protective immune response against Aeromonas salmonicida subsp. salmonicida (AS) following injection vaccination with commercial vaccines containing formalin-killed bacteria, but the protection is often suboptimal under Danish...... mariculture conditions. We elucidated whether protection can be improved by increasing the concentration of antigen (formalin-killed bacteria) in the vaccine. Rainbow trout juveniles were vaccinated by intraperitoneal (i.p.) injection with a bacterin of Aeromonas salmonicida subsp. salmonicida strain 090710...... bacteria. The infection method proved to be efficient and could differentiate efficacies of different vaccines. It was shown that protection and antibody production in exposed fish were positively correlated to the AS antigen concentration in the vaccine....
Characterization of atypical Aeromonas salmonicida by different methods
DEFF Research Database (Denmark)
Austin, B.; Austin, D.A.; Dalsgaard, Inger
1998-01-01
Fifty two isolates of atypical Aeromonas salmonicida, recovered from a wide range of hosts and geographical locations, were heterogeneous in terms of molecular and phenotypic characteristics, and represented taxa which could not be accommodated by the current classification of four subspecies...
DEFF Research Database (Denmark)
Meinelt, Thomas; Phan, T.; Behrens, S.
2015-01-01
contribute to sustainable aquaculture. The aim of our study was to compare the effectiveness of 6 commercial PAA products with different molecular PAA:H2O2 ratios to reduce bacterial growth of Aeromonas salmonicida and Yersinia ruckeri and to determine effective concentrations and exposure times. All...... products reduced colony-forming units (CFUs) of A. salmonicida and Y. ruckeri. Products with higher molecular PAA:H2O2 ratios inhibited growth better than products with lower molecular PAA:H2O2 ratios at the same PAA concentration; this indicates that H2O2 is not the driving force in the reduction of A....... salmonicida and Y. ruckeri growth by PAA in vitro. The practical application of the products with high molecular PAA:H2O2 ratios should be prioritized if these pathogens are diagnosed...
DEFF Research Database (Denmark)
Villumsen, Kasper Rømer; Raida, Martin Kristian
in fish immunology and vaccinology, resulting in the development of both oral, immersion and injectable vaccine strategies over time. Applying mineral oil adjuvants, injectable vaccines inducing high levels of protection in salmon (Salmo salar) rose to prominence in the 1990’s. In general injectable......, adjuvanted vaccines have been shown to induce long-lasting increases in specific antibody levels. In general the majority of the published work concerning vaccination against A. salmonicida has been conducted on salmon. Using injectable oil-adjuvanted vaccines, we have previously shown that the induced level...... against A. salmonicida. The effect of immersion vaccination against A. salmonicida has been questioned over time. While some have presented excellent protection as a result of immersion vaccines, others have reported limited or absent protective effects. We have performed experiments on the protection...
Ma, Xiaona; Li, Xian; Sun, Guoxiang; Sharawy, Zaki Zaki; Qiu, Tianlong; Du, Yishuai; Liu, Ying
2017-07-01
Pathogen contamination in the environment is inevitable with the rapid development of intensive aquaculture. Therefore, alternative ecofriendly biological strategies to control pathogenic bacteria are required. However, our aim was to investigate the ability of oysters (Crassostrea gigas) to filter the important opportunistic pathogen, Aeromonas salmonicida (strain C4), using a green fluorescent protein tag (GFP) in the Atlantic salmon (Salmo salar) farming wastewater. Hence, A. salmonicida removal efficiency and ingestion rate were detected in two different oyster stages (larvae and adults). To evaluate the practical performance of oysters as A. salmonicida biofilter, adult oysters were applied to an integrated constructed wetlands system (ICWS) and their long-term C4-GFP removal efficiency was recorded for 60 days. Overall, our results clearly indicated that oysters had substantial A. salmonicida removal ability via their ingestion process when observed under a fluorescent microscope. Approximately 88-95% of C4-GFP was removed by oyster larvae at an ingestion rate of 6.4 × 10 3 -6.2 × 10 5 CFU/h·ind, while 79-92% of C4-GFP was removed by adult oysters at an ingestion rate of 2.1 × 10 4 -3.1 × 10 6 CFU/h·ind. Furthermore, 57.9 ± 17.2% of C4-GFP removal efficiency was achieved when oysters were applied to ICWS. We, therefore, concluded that using oysters as a biofilter represents an effective alternative for removing A. salmonicida from aquaculture wastewater. However, the fate of oysters after ingesting the pathogenic bacteria, acting as a potential reservoir or vector for pathogens, is still debatable. This research provides the basis for the application of oysters as a biofilter to remove pathogens from aquaculture wastewater in industrialized production.
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLC449 (Link to dictyBase) - - - - SLC449Z (Link to Original site) - - SLC4...49Z 384 - - - - Show SLC449 Library SL (Link to library) Clone ID SLC449 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC4...49Q.Seq.d/ Representative seq. ID SLC449Z (Link to Original site) R...epresentative DNA sequence >SLC449 (SLC449Q) /CSM/SL/SLC4-C/SLC449Q.Seq.d/ XXXXXXXXXXGTAAAAAGGAACACCAAGCCACT
2010-10-01
... 46 Shipping 5 2010-10-01 2010-10-01 false Model test. 154.449 Section 154.449 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SAFETY STANDARDS FOR SELF... § 154.449 Model test. The following analyzed data of a model test of structural elements for independent...
Meinelt, Thomas; Phan, Thy-My; Behrens, Sascha; Wienke, Andreas; Pedersen, Lars-Flemming; Liu, Dibo; Straus, David L
2015-04-08
Peracetic acid (PAA) is a therapeutic agent used for disinfection in aquaculture, but it must be investigated thoroughly in order to mitigate diseases without harming the fish. Successful disinfectants (like PAA) should not leave dangerous residues in the environment in order to successfully contribute to sustainable aquaculture. The aim of our study was to compare the effectiveness of 6 commercial PAA products with different molecular PAA:H2O2 ratios to reduce bacterial growth of Aeromonas salmonicida and Yersinia ruckeri and to determine effective concentrations and exposure times. All products reduced colony-forming units (CFUs) of A. salmonicida and Y. ruckeri. Products with higher molecular PAA:H2O2 ratios inhibited growth better than products with lower molecular PAA:H2O2 ratios at the same PAA concentration; this indicates that H2O2 is not the driving force in the reduction of A. salmonicida and Y. ruckeri growth by PAA in vitro. The practical application of the products with high molecular PAA:H2O2 ratios should be prioritized if these pathogens are diagnosed.
DEFF Research Database (Denmark)
Schwenteit, Johanna; Gram, Lone; Nielsen, Kristian Fog
2011-01-01
The Gram-negative fish pathogenic bacterium Aeromonas salmonicida possesses the LuxIRtype quorum sensing (QS) system, termed AsaIR. In this study the role of QS in A. salmonicida subsp. achromogenes virulence and pigment production was investigated. Five wild-type Asa strains induced the N......Ideficient mutant was 20-fold higher than that of the isogenic wt strain and the mean day to death of the mutant was significantly prolonged. Furthermore, the expression of two virulence factors (a toxic protease, AsaP1, and a cytotoxic factor) and a brown pigment were reduced in the mutant. AsaP1 productionwas...... virulence in fish and QS has not previously been associated with A. salmonicida infections in fish. Furthermore, AsaP1 production has not previously been shown to be QS regulated. The simplicity of the A. salmonicida subsp. achromogenes LuxIR-type QS system and the observation that synthetic QSI can inhibit...
Maftuch; Wulan, N. D. A.; Suprastyani, H.; Wijayanto, E.; Noercholis, M.; Prihanto, A. A.; Kurniawan, A.
2018-04-01
The application of C. calcitrans extract in carp (C. carpio) is expected to inhibit the growth of A. salmonicida. A. salmonicida-infected common carp (C. carpio) were treated with the extract of C. calcitrans. Hematology, erythrocyte, leukocyte, hematocrit and hemoglobin test analysis was observed. The result indicated that the extract can be used to treat the infected fish. The best dose was treatment of D with 45.3 ppm.
International Nuclear Information System (INIS)
Riise, Ellen Kristin; Lorentzen, Marit Sjo; Helland, Ronny; Willassen, Nils Peder
2005-01-01
Monoclinic (P2 1 ) crystals of a His-tagged form of V. salmonicida catalase without cofactor diffract X-rays to 1.96 Å. Catalase (EC 1.11.1.6) catalyses the breakdown of hydrogen peroxide to water and molecular oxygen. Recombinant Vibrio salmonicida catalase (VSC) possesses typical cold-adapted features, with higher catalytic efficiency, lower thermal stability and a lower temperature optimum than its mesophilic counterpart from Proteus mirabilis. Crystals of VSC were produced by the hanging-drop vapour-diffusion method using ammonium sulfate as precipitant. The crystals belong to the monoclinic space group P2 1 , with unit-cell parameters a = 98.15, b = 217.76, c = 99.28 Å, β = 110.48°. Data were collected to 1.96 Å and a molecular-replacement solution was found with eight molecules in the asymmetric unit
Energy Technology Data Exchange (ETDEWEB)
Riise, Ellen Kristin [The Norwegian Structural Biology Centre, Faculty of Science, University of Tromsø, N-9037 Tromsø (Norway); Lorentzen, Marit Sjo [Department of Molecular Biotechnology, Institute of Medical Biology, Faculty of Medicine, University of Tromsø, N-9037 Tromsø (Norway); Helland, Ronny [The Norwegian Structural Biology Centre, Faculty of Science, University of Tromsø, N-9037 Tromsø (Norway); Willassen, Nils Peder, E-mail: nilspw@fagmed.uit.no [The Norwegian Structural Biology Centre, Faculty of Science, University of Tromsø, N-9037 Tromsø (Norway); Department of Molecular Biotechnology, Institute of Medical Biology, Faculty of Medicine, University of Tromsø, N-9037 Tromsø (Norway)
2006-01-01
Monoclinic (P2{sub 1}) crystals of a His-tagged form of V. salmonicida catalase without cofactor diffract X-rays to 1.96 Å. Catalase (EC 1.11.1.6) catalyses the breakdown of hydrogen peroxide to water and molecular oxygen. Recombinant Vibrio salmonicida catalase (VSC) possesses typical cold-adapted features, with higher catalytic efficiency, lower thermal stability and a lower temperature optimum than its mesophilic counterpart from Proteus mirabilis. Crystals of VSC were produced by the hanging-drop vapour-diffusion method using ammonium sulfate as precipitant. The crystals belong to the monoclinic space group P2{sub 1}, with unit-cell parameters a = 98.15, b = 217.76, c = 99.28 Å, β = 110.48°. Data were collected to 1.96 Å and a molecular-replacement solution was found with eight molecules in the asymmetric unit.
30 CFR 44.9 - Posting of petition.
2010-07-01
... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Posting of petition. 44.9 Section 44.9 Mineral... REQUIREMENTS RULES OF PRACTICE FOR PETITIONS FOR MODIFICATION OF MANDATORY SAFETY STANDARDS General § 44.9 Posting of petition. An operator of a mine for which there is no representative of miners shall post a...
Directory of Open Access Journals (Sweden)
Kasper Rømer Villumsen
Full Text Available Furunculosis caused by infection with Aeromonas salmonicida subsp. salmonicida has been a known threat to aquaculture for more than a century. Efficient prophylactic approaches against this disease are essential for continued growth of salmonid aquaculture. Since the introduction of successful oil-adjuvanted vaccines in the early 1990's, a number of studies have been published on the protective as well as adverse effects of these vaccines. Most studies focus on vaccination of salmon (Salmo salar. However, rainbow trout (Oncorhynchus mykiss are also very susceptible to infection and are vaccinated accordingly. In this study we have examined the protection against infection with a Danish strain of A. salmonicida in both vaccinated and non-vaccinated rainbow trout. A commercial and an experimental auto-vaccine were tested. The protective effects of the vaccines were evaluated through an A. salmonicida challenge 18 weeks post vaccination. Both vaccines resulted in a significantly increased survival in the vaccinated fish during a 28 day challenge period relative to non-vaccinated fish (P = 0.01 and P = 0.001 for the commercial and experimental vaccine, respectively. Throughout the entire experiment, the presence of specific antibodies in plasma was monitored using ELISA. A significant increase in specific antibody levels was seen in fish vaccinated with both vaccines during the 18 weeks between vaccination and challenge. Within 3 days post challenge, a significant decrease in specific antibodies occurred in vaccinated fish. A positive correlation was found between mean levels of specific antibodies pre challenge and overall survival. This correlation, along with the observed depletion of antibodies during the initial phase of infection, suggests that specific antibodies play an essential role in vaccine mediated protection against A. salmonicida in rainbow trout.
Viršek, Manca Kovač; Lovšin, Marija Nika; Koren, Špela; Kržan, Andrej; Peterlin, Monika
2017-12-15
Microplastics is widespread in the marine environment where it can cause numerous negative effects. It can provide space for the growth of organisms and serves as a vector for the long distance transfer of marine microorganisms. In this study, we examined the sea surface concentrations of microplastics in the North Adriatic and characterized bacterial communities living on the microplastics. DNA from microplastics particles was isolated by three different methods, followed by PCR amplification of 16S rDNA, clone libraries preparation and phylogenetic analysis. 28 bacterial species were identified on the microplastics particles including Aeromonas spp. and hydrocarbon-degrading bacterial species. Based on the 16S rDNA sequences the pathogenic fish bacteria Aeromonas salmonicida was identified for the first time on microplastics. Because A. salmonicida is responsible for illnesses in fish, it is crucial to get answers if and how microplastics pollution is responsible for spreading of diseases. Copyright © 2017 Elsevier Ltd. All rights reserved.
48 CFR 449.402-3 - Procedure for default.
2010-10-01
... 48 Federal Acquisition Regulations System 4 2010-10-01 2010-10-01 false Procedure for default. 449.402-3 Section 449.402-3 Federal Acquisition Regulations System DEPARTMENT OF AGRICULTURE CONTRACT MANAGEMENT TERMINATION OF CONTRACTS Termination for Default 449.402-3 Procedure for default. In addition to...
Recovery of atypical Aeromonas salmonicida from ulcerated fish from the Baltic Sea
DEFF Research Database (Denmark)
Wiklund, T.; Tabolina, I; Bezgachina, T.V.
1999-01-01
Ulcerated fish of six different species were collected during the BMB/ICES Sea-going Workshop "Fish Diseases and Parasites in the Baltic Sea", 25 November to 8 December 1994, and examined for bacteriological infections. Atypical Aeromonas salmonicida strains were isolated from the majority...
DEFF Research Database (Denmark)
Rasch, Maria; Kastbjerg, Vicky Gaedt; Bruhn, Jesper Bartholin
2007-01-01
Many pathogens control production of virulence factors by self-produced signals in a process called quorum sensing (QS). We demonstrate that acyl homoserine lactone (AHL) signals, which enable bacteria to express certain phenotypes in relation to cell density, are produced by a wide spectrum...... of Aeromonas salmonicida strains. All 31 typical strains were AHL producers as were 21 of 26 atypical strains, but on a strain population basis, production of virulence factors such as protease, lipase, A-layer or pigment did not correlate with the production and accumulation of AHLs in the growth medium...... of Aeromonas salmonicida. The most efficient compound N-(heptylsulfanylacetyl)-L-homoserine lactone (HepS-AHL), reduced protease production by a factor of 10. Five extracellular proteases were detected on gelatin-containing sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE) gels and 3...
Lifescience Database Archive (English)
Full Text Available MeCab user dictionary for science technology term Aeromonas salmonicida 名詞 一般 * * *... * Aeromonas salmonicida Aeromonas salmonicida エイイーアールオーエムオーエヌエイエス エスエイエルエムオーエヌアイシーアイディーエイ Thesaurus2015 200906081596351600 C LS07 UNKNOWN_2 Aeromonas salmonicida
Directory of Open Access Journals (Sweden)
Sabrina A Attéré
2015-11-01
Full Text Available Furunculosis, which is caused by Aeromonas salmonicida subsp. salmonicida, is a major salmonid disease in fish farms worldwide. Several plasmids found in this bacterium confer phenotypes such drug resistance and virulence. Small plasmids (pAsa1, pAsa2, pAsa3, and pAsal1 related to ColE1- and ColE2-type replicons are usually present in its normal plasmidome. In the present study, with the objective to investigate if these plasmids display particularities related to the origin of the isolates bearing them, a total of 153 isolates, including 78 new and 75 previously described, were analyzed for the presence of small plasmids by PCR and DNA restriction fragment profiling. A geographical dichotomy between Canadian and European isolates for their propensity to do not have pAsa3 or pAsal1 was found. In addition, the genotyping analysis led to the identification of two European isolates harboring an unusual pAsal1. An investigation by next-generation sequencing (NGS of these two isolates shed light on two pAsal1 variants (pAsal1C and pAsal1D. As with pAsal1B, another pAsal1 variant previously described, these two new variants bore a second insertion sequence (ISAS5 in addition to the usual ISAS11. The characterization of these variants suggested that they could predominate over the wild-type pAsal1 in stressful conditions such as growth at temperatures of 25°C and above. To obtain a comprehensive portrait of the mutational pressure on small plasmids, 26 isolates whose DNA had been sequenced by NGS were investigated. pAsa3 and pAsal1 were more prone to mutations than pAsa1 and pAsa2, especially in the mobA gene, which encodes a relaxase and a primase. Lastly, the average copy number of each plasmid per cell was assessed using raw sequencing data. A clear trend with respect to the relative proportion per cell of each plasmid was identified. Our large-scale study revealed a geographical dichotomy in small plasmid repertoire in addition to a clear trend
Bowden, T J; Bricknell, I R; Preziosi, B M
2018-01-01
Juvenile Atlantic halibut (~100 mg, Hippoglossus hippoglossus) were exposed to Vibrio proteolyticus, a Vibrio spp. isolate, Photobacterium damselae ssp. damselae and five different isolates of Aeromonas salmonicida ssp. achromogenes via an hour-long bath immersion to ascertain their variation in pathogenicity to this fish species. Results were analysed using Kaplan-Meier survival analysis. Analysis of the data from challenges using A. salmonicida ssp. achromogenes revealed three survival values of zero and a spread of values from 0 to 28.43. Challenges using a Vibrio spp isolate, V. proteolyticus and P. damselae resulted in Kaplan-Meier survival estimates of 31.21, 50.41 and 57.21, respectively. As all bacterial species tested could induce juvenile halibut mortalities, they must all be considered as potential pathogens. However, the degree of pathogenicity of A. salmonicida is isolate dependent. © 2017 John Wiley & Sons Ltd.
Inhibitory Effect of Lactococcus lactis HY 449 on Cariogenic Biofilm.
Kim, Young-Jae; Lee, Sung-Hoon
2016-11-28
Dental caries is caused by cariogenic biofilm, an oral biofilm including Streptococcus mutans . Recently, the prevention of dental caries using various probiotics has been attempted. Lactococcus lactis HY 449 is a probiotic bacterium. The aim of this study was to investigate the effect of L. lactis HY 449 on cariogenic biofilm and to analyze its inhibitory mechanisms. Cariogenic biofilm was formed in the presence or absence of L. lactis HY 449 and L. lactis ATCC 19435, and analyzed with a confocal laser microscope. The formation of cariogenic biofilm was reduced in cultures spiked with both L. lactis strains, and L. lactis HY 449 exhibited more inhibitory effects than L. lactis ATCC 19435. In order to analyze and to compare the inhibitory mechanisms, the antibacterial activity of the spent culture medium from both L. lactis strains against S. mutans was investigated, and the expression of glucosyltransferases ( gtfs ) of S. mutans was then analyzed by real-time RT-PCR. In addition, the sucrose fermentation ability of both L. lactis strains was examined. Both L. lactis strains showed antibacterial activity and inhibited the expression of gtfs , and the difference between both strains did not show. In the case of sucrose-fermenting ability, L. lactis HY 449 fermented sucrose but L. lactis ATCC 19435 did not. L. lactis HY 449 inhibited the uptake of sucrose and the gtfs expression of S. mutans , whereby the development of cariogenic biofilm may be inhibited. In conclusion, L. lactis HY 449 may be a useful probiotic for the prevention of dental caries.
International Nuclear Information System (INIS)
Cornwell, T.J.; Perley, R.A.
1982-01-01
Bridle (this volume) has summarized the overall characteristics of the jets found in numerous low-luminosity and some high-luminosity radio sources. Previous observations made with the partially completed VLA at wavelengths of 6 and 2O cm indicated that 3C449 was an archetypal radio source obeying all the ''rules'' summarized by Bridle. New observations with the VLA of the polarization structure at 6 and 2O cm have destroyed this simple picture and identify 3C449 as a ''rogue'' jet source. (Auth.)
Pfeiffer, Friedhelm; Zamora-Lagos, Maria-Antonia; Blettinger, Martin; Yeroslaviz, Assa; Dahl, Andreas; Gruber, Stephan; Habermann, Bianca H
2018-01-05
Due to the predominant usage of short-read sequencing to date, most bacterial genome sequences reported in the last years remain at the draft level. This precludes certain types of analyses, such as the in-depth analysis of genome plasticity. Here we report the finalized genome sequence of the environmental strain Aeromonas salmonicida subsp. pectinolytica 34mel, for which only a draft genome with 253 contigs is currently available. Successful completion of the transposon-rich genome critically depended on the PacBio long read sequencing technology. Using finalized genome sequences of A. salmonicida subsp. pectinolytica and other Aeromonads, we report the detailed analysis of the transposon composition of these bacterial species. Mobilome evolution is exemplified by a complex transposon, which has shifted from pathogenicity-related to environmental-related gene content in A. salmonicida subsp. pectinolytica 34mel. Obtaining the complete, circular genome of A. salmonicida subsp. pectinolytica allowed us to perform an in-depth analysis of its mobilome. We demonstrate the mobilome-dependent evolution of this strain's genetic profile from pathogenic to environmental.
Cipriano, R.C.; Ford, L.A.; Smith, D.R.; Schachte, J.H.; Petrie, C.J.
1997-01-01
Accurate detection of Aeromonas salmonicida subsp. salmonicida (the cause of furunculosis disease) in covertly infected salmonids is difficult and is a cause of concern for those involved in fish health inspection and resource management programs. In this study, we examined populations of brook trout Salvelinus fontinalis, Atlantic salmon Salmo salar, and lake trout Salvelinus namaycush that previously sustained natural episodes of furunculosis. Consequently, the sampled fish were presumed to harbor latent infections. Mucus, gill, liver, kidney, heart, spleen, and intestine samples (N = 100 fish per group sampled) were processed and examined by (1) direct dilution counts and (2) quadrant streaking after a 48-h pre-enrichment in trypticase soy broth (TSB). Another subsample of fish from each group was then subjected to stress-inducible furunculosis tests. Stress tests detected A. salmonicida in three of four groups of fish that were examined whereas the pathogen was detected in only two of the groups analyzed with culture-based assays. Although pre-enrichment in TSB enhanced detection within internal sampling sites including the liver, heart, spleen, and kidney, enrichment did not enhance detection from mucus, gill, or intestinal samples.
DEFF Research Database (Denmark)
Chettri, Jiwan Kumar; Skov, Jakob; Jaafar, Rzgar M.
2015-01-01
When testing vaccine-induced protection an effective and reliable challenge method is a basic requirement and we here present a comparative study on different challenge methods used for infection of rainbow trout Oncorhynchus mykiss with Aeromonas salmonicida, a bacterial pathogen eliciting...
DEFF Research Database (Denmark)
Wiklund, T.; Dalsgaard, Inger
1998-01-01
, non-salmonids as well as salmonids, inhabiting fresh water, brackish water and marine environments in northern and central Europe, South Africa, North America, Japan and Australia. In non-salmonid fish species, infections with atypical strains often manifest themselves as superficial skin ulcerations...... information is available about the ecology, spread and survival of atypical strains in water. The commonly used therapeutic methods for the control of diseases in farmed fish caused by atypical A. salmonicida are generally effective against the atypical strains. Resistance to different antibiotics...
Directory of Open Access Journals (Sweden)
Syohibahttul Islamiyah BAHAR
2017-02-01
Full Text Available Aeromonas salmonicida are specific bacteria that can cause infections and death to the cultivation of carp (Cyprinus carpio during larval stage. Death in carp can be prevented by a vaccine, but the vaccine can only be given on the seed over the age of 3 weeks. Maternal vaccination needs to be done to improve the immune system of the larvae by means of inactivated whole cell vaccine A. salmonicida on broodstock ready to spawn. Aims to determine the effectiveness of vaccines on breeders carp to the parent antibody titer test and larvae, as well Survival Rate (SR and the Relative Percent Survival (RPS larvae. This research was conducted with a completely randomized design, 4 treatments A (control; B (0.3 ml/kg; C (0.4 ml/kg; D (0.5 ml/kg and 3 repetitions. The results show that the antibody titer of 0.3 ml dose capable of providing agglutination reaction to pitting 7th (64x dilution in broodstock, and vaccine doses 0,4ml on broodstock able to give agglutination reaction to the larvae until all 6 wells (32x dilution. A dose of 0.4 ml/kg resulted the highest SR and RPS with 96.11% and 81.25% respectively. Clinical symptoms of redness in control larvae was spread throughout the body whereas on the vaccine treatment was only in certain body parts. Keywords: A. salmonicida, vaccines, maternal immunity, larva, specific immune respon
The miR-449b polymorphism, rs10061133 A>G, is associated with premature ovarian insufficiency.
Pan, Hong; Chen, Beili; Wang, Jing; Wang, Xi; Hu, Ping; Wu, Shinan; Liu, Yunyun; Xu, Zuying; Zhang, Wei; Wang, Binbin; Cao, Yunxia
2016-09-01
To determine if the miR-449b polymorphism, rs10061133 A>G, is associated with premature ovarian insufficiency (POI) pathogenesis. From January 2011 to December 2014, a total of 148 individuals with POI and 225 age-matched controls were collected from the Center for Reproductive Medicine, 1st Affiliated Hospital of Anhui Medical University (Hefei, China). Genotyping of miR-449b rs1006113 was performed using matrix-assisted laser desorption ionization time-of-flight-based mass spectrometry. Rs10061133 A>G is a highly conserved SNP locus in the mature area of miR-449b. Association analysis shows that the rs10061133 AA genotype is a risk factor for POI. Our study provides the first evidence that the miR-449b rs10061133 AA genotype is associated with POI risk.
DEFF Research Database (Denmark)
Marana, M. H.; Skov, J.; Chettri, J. K.
2015-01-01
Challenge methods used to induce furunculosis in rainbow trout when testing the potency of vaccines may include exposure to Aeromonas salmonicida by intraperitoneal injection, cohabitation or bath immersion. Intraperitoneal injection is effective but will not reflect systemic immunity because...... inflammatory cells at the vaccine injection site may combat injected bacteria fast. The cohabitation and bath immersion methods both mimic the natural infection route but are less effective in inducing the disease. We have tested a new challenge method mimicking that rainbow trout in fish farms might...... to be efficient in inducing a more natural disease progression in fish and a stable mortality. The method could differentiate efficacies of different vaccines with regard to adjuvant formulations and content of antigen....
Li, Zongyu; Huang, Xin; Xu, Jinkai; Su, Qinghua; Zhao, Jun; Ma, Jiancang
2016-10-01
Papillary thyroid carcinoma (PTC) is the most common thyroid cancer and represent approximately 80% of all thyroid cancers. The present study is aimed to investigate the role of microRNA (miR)-449 in the progression of PTC. Our results revealed that miR-449 was underexpressed in the collected PTC specimens compared with non-cancerous PTC tissues. Overexpression of miR-449 induced a cell cycle arrest at G0/G1 phase and inhibited PTC cell growth in vitro. Further studies revealed that RET proto-oncogene (RET) is a novel miR-449 target, due to miR-449 bound directly to its 3'-untranslated region and miR-449 mimic reduced the protein expression of RET. Similar to the effects of miR-449 overexpression, RET downregulation inhibited cell growth, whereas RET overexpression reversed the inhibitive effect of miR-449 mimic. Furthermore, miR-449 overexpression inhibited the nuclear translocation of β-catenin and reduced the expression of several downstream genes, including c-Myc, cyclin D1, T cell-specific transcription factor (TCF) and lymphoid enhancer-binding factor 1 (LEF-1), and inactivated the β-catenin pathway in TPC-1 cells. Moreover, overexpression of β-catenin prevented miR-449-reduced cell cycle arrest and cell viability. In xenograft animal experiments, miR-449 overexpression effectively suppressed the tumor growth of PTC. Taken together, our research indicated that miR-449 functions as an anti-oncogene by targeting RET, and that miR-449 overexpression inhibited the growth of PTC by inactivating the β-catenin pathway. Thus, miR-449 may serve as a potential therapeutic strategy for the treatment of PTC.
Pavan, María Elisa; Pavan, Esteban E.; López, Nancy Irene; Levin, Laura Noemí; Pettinari, María Julia
2017-01-01
The genome of Aeromonas salmonicida subsp. pectinolytica strain 34melT, isolated from a heavily polluted river, contains several genomic islands and putative virulence genes. The identification of genes involved in resistance to different kinds of stress sheds light on the mechanisms used by this strain to thrive in an extreme environment. Fil: Pavan, María Elisa. Universidad de Buenos Aires. Facultad de Ciencias Exactas y Naturales. Departamento de Química Biológica; Argentina Fil: Pav...
Testing experimental subunit furunculosis vaccines for rainbow trout
DEFF Research Database (Denmark)
Marana, Moonika H.; Chettri, Jiwan Kumar; Skov, Jakob
2016-01-01
Aeromonas salmonicida subsp. salmonicida (AS) is the etiological agent of typical furunculosis in salmonid fish. The disease causes bacterial septicemia and is a major fish health problem in salmonid aquaculture worldwide, inducing high morbidity and mortality. In this study we vaccinated rainbow...... trout with subunit vaccines containing protein antigens that were selected based on an in silico antigen discovery approach. Thus, the proteome of AS strain A449 was analyzed by an antigen discovery platform and its proteins consequently ranked by their predicted ability to evoke protective immune...... response against AS. Fourteen proteins were prepared in 3 different experimental subunit vaccine combinations and used to vaccinate rainbow trout by intraperitoneal (i.p.) injection. We tested the proteins for their ability to elicit antibody production and protection. Thus, fish were exposed to virulent...
Taylor, P.W.; Winton, J.R.
2002-01-01
Nested polymerase chain reaction (PCR) assays were developed using first-round primers complementary to highly conserved regions within the bacterial 16S ribosomal RNA (rRNA) gene (universal eubacterial primers) and second-round primers specific for sequences within the 16S rRNA genes of Aeromonas salmonicida, Yersinia ruckeri, andFlavobacterium psychrophilum. Following optimization of the MgCl2 concentration and primer annealing temperature, PCR employing the universal eubacterial primers was used to amplify a 1,500-base-pair (bp) product visible in agarose gels stained with ethidium bromide. The calculated detection limit of this single-round assay was less than 1.4 × 104 colony-forming units (CFU) per reaction for all bacterial species tested. Single-round PCR using primer sets specific for A. salmonicida, Y. ruckeri, and F. psychrophilumamplified bands of 271, 575, and 1,100 bp, respectively, with detection limits of less than 1.4 × 104, 1.4 × 105, and 1.4 × 105 CFU per reaction. Using the universal eubacterial primers in the first round and the species-specific primer sets in the second round of nested PCR assays improved the detection ability by approximately four orders of magnitude to fewer than 14 CFU per sample for each of the three bacterial species. Such nested assays could be adapted to a wide variety of bacterial fish pathogens for which 16S sequences are available.
Dynamical behaviors of Rb-E2F pathway including negative feedback loops involving miR449.
Yan, Fang; Liu, Haihong; Hao, Junjun; Liu, Zengrong
2012-01-01
MiRNAs, which are a family of small non-coding RNAs, regulate a broad array of physiological and developmental processes. However, their regulatory roles have remained largely mysterious. E2F is a positive regulator of cell cycle progression and also a potent inducer of apoptosis. Positive feedback loops in the regulation of Rb-E2F pathway are predicted and shown experimentally. Recently, it has been discovered that E2F induce a cluster of miRNAs called miR449. In turn, E2F is inhibited by miR449 through regulating different transcripts, thus forming negative feedback loops in the interaction network. Here, based on the integration of experimental evidence and quantitative data, we studied Rb-E2F pathway coupling the positive feedback loops and negative feedback loops mediated by miR449. Therefore, a mathematical model is constructed based in part on the model proposed in Yao-Lee et al. (2008) and nonlinear dynamical behaviors including the stability and bifurcations of the model are discussed. A comparison is given to reveal the implication of the fundamental differences of Rb-E2F pathway between regulation and deregulation of miR449. Coherent with the experiments it predicts that miR449 plays a critical role in regulating the cell cycle progression and provides a twofold safety mechanism to avoid excessive E2F-induced proliferation by cell cycle arrest and apoptosis. Moreover, numerical simulation and bifurcation analysis shows that the mechanisms of the negative regulation of miR449 to three different transcripts are quite distinctive which needs to be verified experimentally. This study may help us to analyze the whole cell cycle process mediated by other miRNAs more easily. A better knowledge of the dynamical behaviors of miRNAs mediated networks is also of interest for bio-engineering and artificial control.
Dynamical behaviors of Rb-E2F pathway including negative feedback loops involving miR449.
Directory of Open Access Journals (Sweden)
Fang Yan
Full Text Available MiRNAs, which are a family of small non-coding RNAs, regulate a broad array of physiological and developmental processes. However, their regulatory roles have remained largely mysterious. E2F is a positive regulator of cell cycle progression and also a potent inducer of apoptosis. Positive feedback loops in the regulation of Rb-E2F pathway are predicted and shown experimentally. Recently, it has been discovered that E2F induce a cluster of miRNAs called miR449. In turn, E2F is inhibited by miR449 through regulating different transcripts, thus forming negative feedback loops in the interaction network. Here, based on the integration of experimental evidence and quantitative data, we studied Rb-E2F pathway coupling the positive feedback loops and negative feedback loops mediated by miR449. Therefore, a mathematical model is constructed based in part on the model proposed in Yao-Lee et al. (2008 and nonlinear dynamical behaviors including the stability and bifurcations of the model are discussed. A comparison is given to reveal the implication of the fundamental differences of Rb-E2F pathway between regulation and deregulation of miR449. Coherent with the experiments it predicts that miR449 plays a critical role in regulating the cell cycle progression and provides a twofold safety mechanism to avoid excessive E2F-induced proliferation by cell cycle arrest and apoptosis. Moreover, numerical simulation and bifurcation analysis shows that the mechanisms of the negative regulation of miR449 to three different transcripts are quite distinctive which needs to be verified experimentally. This study may help us to analyze the whole cell cycle process mediated by other miRNAs more easily. A better knowledge of the dynamical behaviors of miRNAs mediated networks is also of interest for bio-engineering and artificial control.
Breyer, Kate E.; Getchell, Rodman G.; Cornwell, Emily R.; Wooster, Gregory A.; Ketola, H. George; Bowser, Paul R.
2015-01-01
Juvenile rainbow trout, Oncorhynchus mykiss, were fed diets containing 0, 0.5, 1.0, and 2.0% of a garlic extract, challenged with a modified 50% lethal dose of Aeromonas salmonicida and monitored for 28 d. There were significant increases in survival of trout fed 0.5 and 1.0% garlic extract as compared to the control and 2.0% garlic extract groups. A target animal safety study was performed at varying increments using the target dose of 0.5% garlic extract at 0× (0% garlic extract), 1× (0.5% garlic extract), 3× (1.5% garlic extract), and 5× (2.5% garlic extract) for 3× (6 wk) the duration of the original study. There was a significant increase in the level of circulating lymphocytes and a significant decrease in the level of circulating monocytes. The latter correlated to an increased level of pigment-containing macrophage centers within the renal tissue as garlic extract dosing increased, denoting a potential deleterious inflammatory effect as macrophage infiltration became severe at the highest dose. These studies suggest that feeding low-dose (0.5% or 1.0%) garlic extract improves survivability in rainbow trout when challenged with A. salmonicida and appears safe; however, higher levels do not appear to be effective and may cause deleterious effects on health.
THE SOURCE STRUCTURE OF 0642+449 DETECTED FROM THE CONT14 OBSERVATIONS
Energy Technology Data Exchange (ETDEWEB)
Xu, Ming H.; Wang, Guang L. [Shanghai Astronomical Observatory, Chinese Academy of Sciences, No. 80 Nandan Raod, 200030, Shanghai (China); Heinkelmann, Robert; Anderson, James M.; Mora-Diaz, Julian; Schuh, Harald, E-mail: mhxu@shao.ac.cn [DeutschesGeoForschungsZentrum (GFZ), Potsdam, Telegrafenberg, D-14473 Potsdam (Germany)
2016-11-01
The CONT14 campaign with state-of-the-art very long baseline interferometry (VLBI) data has observed the source 0642+449 with about 1000 observables each day during a continuous observing period of 15 days, providing tens of thousands of closure delays—the sum of the delays around a closed loop of baselines. The closure delay is independent of the instrumental and propagation delays and provides valuable additional information about the source structure. We demonstrate the use of this new “observable” for the determination of the structure in the radio source 0642+449. This source, as one of the defining sources in the second realization of the International Celestial Reference Frame, is found to have two point-like components with a relative position offset of −426 microarcseconds ( μ as) in R.A. and −66 μ as in decl. The two components are almost equally bright, with a flux-density ratio of 0.92. The standard deviation of closure delays for source 0642+449 was reduced from 139 to 90 ps by using this two-component model. Closure delays larger than 1 ns are found to be related to the source structure, demonstrating that structure effects for a source with this simple structure could be up to tens of nanoseconds. The method described in this paper does not rely on a priori source structure information, such as knowledge of source structure determined from direct (Fourier) imaging of the same observations or observations at other epochs. We anticipate our study to be a starting point for more effective determination of the structure effect in VLBI observations.
THE SOURCE STRUCTURE OF 0642+449 DETECTED FROM THE CONT14 OBSERVATIONS
International Nuclear Information System (INIS)
Xu, Ming H.; Wang, Guang L.; Heinkelmann, Robert; Anderson, James M.; Mora-Diaz, Julian; Schuh, Harald
2016-01-01
The CONT14 campaign with state-of-the-art very long baseline interferometry (VLBI) data has observed the source 0642+449 with about 1000 observables each day during a continuous observing period of 15 days, providing tens of thousands of closure delays—the sum of the delays around a closed loop of baselines. The closure delay is independent of the instrumental and propagation delays and provides valuable additional information about the source structure. We demonstrate the use of this new “observable” for the determination of the structure in the radio source 0642+449. This source, as one of the defining sources in the second realization of the International Celestial Reference Frame, is found to have two point-like components with a relative position offset of −426 microarcseconds ( μ as) in R.A. and −66 μ as in decl. The two components are almost equally bright, with a flux-density ratio of 0.92. The standard deviation of closure delays for source 0642+449 was reduced from 139 to 90 ps by using this two-component model. Closure delays larger than 1 ns are found to be related to the source structure, demonstrating that structure effects for a source with this simple structure could be up to tens of nanoseconds. The method described in this paper does not rely on a priori source structure information, such as knowledge of source structure determined from direct (Fourier) imaging of the same observations or observations at other epochs. We anticipate our study to be a starting point for more effective determination of the structure effect in VLBI observations.
MicroRNA-449a enhances radiosensitivity in CL1-0 lung adenocarcinoma cells.
Directory of Open Access Journals (Sweden)
Yi-Jyun Liu
Full Text Available Lung cancer is the leading cause of cancer-related mortality worldwide. Radiotherapy is often applied for treating lung cancer, but it often fails because of the relative non-susceptibility of lung cancer cells to radiation. MicroRNAs (miRNAs have been reported to modulate the radiosensitivity of lung cancer cells and have the potential to improve the efficacy of radiotherapy. The purpose of this study was to identify a miRNA that can adjust radiosensitivity in lung adenocarcinoma cells. Two lung adenocarcinoma cell lines (CL1-0 and CL1-5 with different metastatic ability and radiosensitivity were used. In order to understand the regulatory mechanisms of differential radiosensitivity in these isogenic tumor cells, both CL1-0 and CL1-5 were treated with 10 Gy radiation, and were harvested respectively at 0, 1, 4, and 24 h after radiation exposure. The changes in expression of miRNA upon irradiation were examined using Illumina Human microRNA BeadChips. Twenty-six miRNAs were identified as having differential expression post-irradiation in CL1-0 or CL1-5 cells. Among these miRNAs, miR-449a, which was down-regulated in CL1-0 cells at 24 h after irradiation, was chosen for further investigation. Overexpression of miR-449a in CL1-0 cells effectively increased irradiation-induced DNA damage and apoptosis, altered the cell cycle distribution and eventually led to sensitization of CL1-0 to irradiation.
DEFF Research Database (Denmark)
Schmidt, A.S.; Bruun, Morten Sichlau; Larsen, J.L.
2001-01-01
Class 1 integrons were found in 26 of 40 antibiotic-resistant isolates of the fish pathogen Aeromonas salmonicida from Northern Europe and North America. Three different dhfr genes, conferring trimethoprim resistance, and one ant(3 " )1a aminoglycoside resistance gene were identified as gene...... inserts. The gene cassettes tended to be conserved among isolates from a particular geographical area. Nineteen isolates transferred R- plasmids carrying different tet determinants to Escherichia coli in filter mating assays, and in 15 cases, the class 1 integrons were co-transferred. Transferable...... sulphadiazine, trimethoprim and streptomycin resistances were invariably encoded by integrons. It thus appears that integron-encoded antibiotic resistance genes contribute substantially to the horizontal spread of antimicrobial resistance within this species, being associated with conjugative plasmids....
Oligoasthenoteratozoospermia and infertility in mice deficient for miR-34b/c and miR-449 loci.
Directory of Open Access Journals (Sweden)
Stefano Comazzetto
2014-10-01
Full Text Available Male fertility requires the continuous production of high quality motile spermatozoa in abundance. Alterations in all three metrics cause oligoasthenoteratozoospermia, the leading cause of human sub/infertility. Post-mitotic spermatogenesis inclusive of several meiotic stages and spermiogenesis (terminal spermatozoa differentiation are transcriptionally inert, indicating the potential importance for the post-transcriptional microRNA (miRNA gene-silencing pathway therein. We found the expression of miRNA generating enzyme Dicer within spermatogenesis peaks in meiosis with critical functions in spermatogenesis. In an expression screen we identified two miRNA loci of the miR-34 family (miR-34b/c and miR-449 that are specifically and highly expressed in post-mitotic male germ cells. A reduction in several miRNAs inclusive of miR-34b/c in spermatozoa has been causally associated with reduced fertility in humans. We found that deletion of both miR34b/c and miR-449 loci resulted in oligoasthenoteratozoospermia in mice. MiR-34bc/449-deficiency impairs both meiosis and the final stages of spermatozoa maturation. Analysis of miR-34bc-/-;449-/- pachytene spermatocytes revealed a small cohort of genes deregulated that were highly enriched for miR-34 family target genes. Our results identify the miR-34 family as the first functionally important miRNAs for spermatogenesis whose deregulation is causal to oligoasthenoteratozoospermia and infertility.
Directory of Open Access Journals (Sweden)
Catarina Moreirinha
2018-03-01
Full Text Available The occurrence of infections by pathogenic bacteria is one of the main sources of financial loss for the aquaculture industry. This problem often cannot be solved with antibiotic treatment or vaccination. Phage therapy seems to be an alternative environmentally-friendly strategy to control infections. Recognizing the cellular modifications that bacteriophage therapy may cause to the host is essential in order to confirm microbial inactivation, while understanding the mechanisms that drive the development of phage-resistant strains. The aim of this work was to detect cellular modifications that occur after phage AS-A treatment in A. salmonicida, an important fish pathogen. Phage-resistant and susceptible cells were subjected to five successive streak-plating steps and analysed with infrared spectroscopy, a fast and powerful tool for cell study. The spectral differences of both populations were investigated and compared with a phage sensitivity profile, obtained through the spot test and efficiency of plating. Changes in protein associated peaks were found, and these results were corroborated by 1-D electrophoresis of intracellular proteins analysis and by phage sensitivity profiles. Phage AS-A treatment before the first streaking-plate step clearly affected the intracellular proteins expression levels of phage-resistant clones, altering the expression of distinct proteins during the subsequent five successive streak-plating steps, making these clones recover and be phenotypically more similar to the sensitive cells.
Order-disorder transformation in the Ni-4.49 at.% Al alloy
International Nuclear Information System (INIS)
Adorno, A.T.; Garlipp, W.; Cilense, M.; Silva, R.A.G.
2006-01-01
The order-disorder transformation in the Ni-4.49 at.% Al alloy was studied using electrical resistivity measurements, microhardness measurements, differential scanning calorimetry (DSC) and transmission electron microscopy (TEM). The results confirmed the ordering behavior expected for Ni-Al dilute alloys and the suggested relation between resistivity changes and microhardness changes with anti-ferromagnetic spin ordering. The higher value obtained for the activation energy of vacancy migration was associated with a decrease in the Al concentration gradient near solute-depleted regions
Directory of Open Access Journals (Sweden)
William A Buggele
Full Text Available The mammalian antiviral response relies on the alteration of cellular gene expression, to induce the production of antiviral effectors and regulate their activities. Recent research has indicated that virus infections can induce the accumulation of cellular microRNA (miRNA species that influence the stability of host mRNAs and their protein products. To determine the potential for miRNA regulation of cellular responses to influenza A virus infection, small RNA profiling was carried out using next generation sequencing. Comparison of miRNA expression profiles in uninfected human A549 cells to cells infected with influenza A virus strains A/Udorn/72 and A/WSN/33, revealed virus-induced changes in miRNA abundance. Gene expression analysis identified mRNA targets for a cohort of highly inducible miRNAs linked to diverse cellular functions. Experiments demonstrate that the histone deacetylase, HDAC1, can be regulated by influenza-inducible miR-449b, resulting in altered mRNA and protein levels. Expression of miR-449b enhances virus and poly(I:C activation of the IFNβ promoter, a process known to be negatively regulated by HDAC1. These findings demonstrate miRNA induction by influenza A virus infection and elucidate an example of miRNA control of antiviral gene expression in human cells, defining a role for miR-449b in regulation of HDAC1 and antiviral cytokine signaling.
GPM GROUND VALIDATION NOAA UHF 449 PROFILER RAW DATA SPC FORMAT MC3E V1
National Aeronautics and Space Administration — The NOAA UHF 449 Profiler Raw SPC foramt data was collected during the NASA supported Midlatitude Continental Convective Clouds Experiment (MC3E). The Ultra High...
GPM GROUND VALIDATION NOAA UHF 449 PROFILER RAW DATA SPC FORMAT MC3E V1
National Aeronautics and Space Administration — The GPM Ground Validation NOAA UHF 449 Profiler Raw Data SPC Format MC3E dataset was collected during the NASA supported Midlatitude Continental Convective Clouds...
Directory of Open Access Journals (Sweden)
Scott L Weiss
Full Text Available Genetic variability in the regulation of the nitric oxide (NO pathway may influence hemodynamic changes in pediatric sepsis. We sought to determine whether functional polymorphisms in DDAH2, which metabolizes the NO synthase inhibitor asymmetric dimethylarginine (ADMA, are associated with susceptibility to sepsis, plasma ADMA, distinct hemodynamic states, and vasopressor requirements in pediatric septic shock.In a prospective study, blood and buccal swabs were obtained from 82 patients ≤ 18 years (29 with severe sepsis/septic shock plus 27 febrile and 26 healthy controls. Plasma ADMA was measured using tandem mass spectrometry. DDAH2 gene was partially sequenced to determine the -871 6g/7 g insertion/deletion and -449G/C single nucleotide polymorphisms. Shock type ("warm" versus "cold" was characterized by clinical assessment. The -871 7g allele was more common in septic (17% then febrile (4% and healthy (8% patients, though this was not significant after controlling for sex and race (p = 0.96. ADMA did not differ between -871 6g/7 g genotypes. While genotype frequencies also did not vary between groups for the -449G/C SNP (p = 0.75, septic patients with at least one -449G allele had lower ADMA (median, IQR 0.36, 0.30-0.41 µmol/L than patients with the -449CC genotype (0.55, 0.49-0.64 µmol/L, p = 0.008 and exhibited a higher incidence of "cold" shock (45% versus 0%, p = 0.01. However, after controlling for race, the association with shock type became non-significant (p = 0.32. Neither polymorphism was associated with inotrope score or vasoactive infusion duration.The -449G polymorphism in the DDAH2 gene was associated with both low plasma ADMA and an increased likelihood of presenting with "cold" shock in pediatric sepsis, but not with vasopressor requirement. Race, however, was an important confounder. These results support and justify the need for larger studies in racially homogenous populations to further examine whether genotypic
International Nuclear Information System (INIS)
Niu, Man; Gao, Dan; Wen, Qiuyuan; Wei, Pingpin; Pan, Suming; Shuai, Cijun; Ma, Huiling; Xiang, Juanjuan; Li, Zheng; Fan, Songqing; Li, Guiyuan; Peng, Shuping
2016-01-01
Nasopharyngeal carcinoma (NPC) is prevalent in South East Asia and Southern China particularly, despite the reported 5-year survival ratio is relative higher than other deadly cancers such as liver, renal, pancreas cancer, the lethality is characterized by high metastatic potential in the early stage and high recurrence rate after radiation treatment. MicroRNA-29c was found to be down-regulated in the serum as well as in the tissue of nasopharyngeal carcinoma tissue. In this study, we found accidentally that the transfection of pre-miR-29c or miR-29c mimics significantly increases the expression level of miR-34c and miR-449a but doesn’t affect that of miR-222 using real-time quantitative PCR in nasopharyngeal carcinoma cell lines. To explore the molecular mechanism of the regulatory role, the cells are treated with 5-Aza-2-deoxycytidine (5-Aza-CdR) treatment and the level of miR-34c and miR-449a but not miR-222 accumulated by the treatment. DNA methyltransferase 3a, 3b were down-regulated by the 5-Aza-CdR treatment with western blot and real-time quantitative PCR. We found that pre-miR-29c or miR-29c mimics significantly increases the expression level of miR-34c and miR-449a. We further found DNA methyltransferase 3a and 3b are the target gene of miR-29c. Restoration of miR-29c in NPC cells down-regulated DNA methyltransferase 3a, 3b, but not DNA methyltransferase T1. The regulation of miR-29c/DNMTs/miR-34c/449a is an important molecular axis of NPC development and targeting DNMTs or restoring of miR-29c might be a promising therapy strategy for the prevention of NPC
Pionnier, Nicolas; Falco, Alberto; Miest, Joanna; Frost, Patrick; Irnazarow, Ilgiz; Shrive, Annette; Hoole, Dave
2013-03-01
The effect of β-glucans as feed additive on the profile of C-reactive protein (CRP) and complement acute phase responses was studied in common carp Cyprinus carpio after exposition to a bacterial infection with Aeromonas salmonicida. Carp were orally administered with β-glucan (MacroGard®) for 14 days with a daily β-glucan intake of 6 mg per kg body weight. Fish were then intraperitoneally injected with either PBS or 1 × 10⁸ bacteria per fish and sampled at time 0, 6, 12, 24, 48, 72, 96 and 120 h post-injection (p.i.) for serum and head kidney, liver and mid-gut tissues. CRP levels and complement activity were determined in the serum samples whilst the gene expression profiles of CRP and complement related genes (crp1, crp2, c1r/s, bf/c2, c3 and masp2) were analysed in the tissues by quantitative PCR. Results obtained showed that oral administration of β-glucan for 14 days significantly increased serum CRP levels up to 2 fold and serum alternative complement activity (ACP) up to 35 fold. The bacterial infection on its own (i.e. not combined with a β-glucan feeding) did have significant effects on complement response whilst CRP was not detectably induced during the carp acute phase reaction. However, the combination of the infection and the β-glucan feeding did show significant effects on both CRP and complement profiles with higher serum CRP levels and serum ACP activity in the β-glucan fed fish than in the control fed fish. In addition, a distinct organ and time dependent expression profile pattern was detected for all the selected genes: a peak of gene expression first occurred in the head kidney tissue (6 h p.i. or 12 h p.i.), then an up-regulation in the liver several hours later (24 h p.i.) and finally up- or down-regulations in the mid-gut at 24 h p.i. and 72 h p.i. In conclusion, the results of this study suggest that MacroGard® stimulated CRP and complement responses to A. salmonicida infection in common carp. Copyright © 2013 Elsevier Ltd. All
Czech Academy of Sciences Publication Activity Database
Krejčí, Pavel; Murakami, S.; Procházková, J.; Trantírek, L.; Chlebová, K.; Ouyang, Z.; Aklian, A.; Smutný, J.; Bryja, Vítězslav; Kozubík, Alois; Wilcox, W.R.
2010-01-01
Roč. 285, č. 27 (2010), s. 20644-20653 ISSN 0021-9258 Grant - others:GA ČR(CZ) GA301/09/0587 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : NF449 * fibroblast growth factor receptor * antagonist Subject RIV: BO - Biophysics Impact factor: 5.328, year: 2010
Lunar Meteorites Sayh Al Uhaymir 449 and Dhofar 925, 960, and 961: Windows into South Pole
Ziegler, Ryan A.; Jolliff, B. L.; Korotev, R. L.
2013-01-01
In 2003, three lunar meteorites were collected in close proximity to each other in the Dhofar region of Oman: Dhofar 925 (49 g), Dhofar 960 (35 g), and Dhofar 961 (22 g). In 2006, lunar meteorite Sayh al Uhaymir (SaU) 449 (16.5 g) was found about 100 km to the NE. Despite significant differences in the bulk composition of Dhofar 961 relative to Dhofar 925/960 and SaU 449 (which are identical to each other), these four meteorites are postulated to be paired based on their find locations, bulk composition, and detailed petrographic analysis. Hereafter, they will collectively be referred to as the Dhofar 961 clan. Comparison of meteorite and component bulk compositions to Lunar Prospector 5-degree gamma-ray data suggest the most likely provenance of this meteorite group is within the South Pole-Aitken Basin. As the oldest, largest, and deepest recognizable basin on the Moon, the composition of the material within the SPA basin is of particular importance to lunar science. Here we review and expand upon the geochemistry and petrography of the Dhofar 961 clan and assess the likelihood that these meteorites come from within the SPA basin based on their bulk compositions and the compositions and characteristics of the major lithologic components found within the breccia.
Directory of Open Access Journals (Sweden)
Witold Uhrynowski
2017-05-01
Full Text Available Aeromonas spp. are among the most ubiquitous microorganisms, as they have been isolated from different environmental niches including waters, soil, as well as wounds and digestive tracts of poikilothermic animals and humans. Although much attention has been paid to the pathogenicity of Aeromonads, the role of these bacteria in environmentally important processes, such as transformation of heavy metals, remains to be discovered. Therefore, the aim of this study was a detailed genomic characterization of Aeromonas sp. O23A, the first representative of this genus capable of dissimilatory arsenate reduction. The strain was isolated from microbial mats from the Zloty Stok mine (SW Poland, an environment strongly contaminated with arsenic. Previous physiological studies indicated that O23A may be involved in both mobilization and immobilization of this metalloid in the environment. To discover the molecular basis of the mechanisms behind the observed abilities, the genome of O23A (∼5.0 Mbp was sequenced and annotated, and genes for arsenic respiration, heavy metal resistance (hmr and other phenotypic traits, including siderophore production, were identified. The functionality of the indicated gene modules was assessed in a series of minimal inhibitory concentration analyses for various metals and metalloids, as well as mineral dissolution experiments. Interestingly, comparative analyses revealed that O23A is related to a fish pathogen Aeromonas salmonicida subsp. salmonicida A449 which, however, does not carry genes for arsenic respiration. This indicates that the dissimilatory arsenate reduction ability may have been lost during genome reduction in pathogenic strains, or acquired through horizontal gene transfer. Therefore, particular emphasis was placed upon the mobilome of O23A, consisting of four plasmids, a phage, and numerous transposable elements, which may play a role in the dissemination of hmr and arsenic metabolism genes in the
Uhrynowski, Witold; Decewicz, Przemyslaw; Dziewit, Lukasz; Radlinska, Monika; Krawczyk, Pawel S; Lipinski, Leszek; Adamska, Dorota; Drewniak, Lukasz
2017-01-01
Aeromonas spp. are among the most ubiquitous microorganisms, as they have been isolated from different environmental niches including waters, soil, as well as wounds and digestive tracts of poikilothermic animals and humans. Although much attention has been paid to the pathogenicity of Aeromonads, the role of these bacteria in environmentally important processes, such as transformation of heavy metals, remains to be discovered. Therefore, the aim of this study was a detailed genomic characterization of Aeromonas sp. O23A, the first representative of this genus capable of dissimilatory arsenate reduction. The strain was isolated from microbial mats from the Zloty Stok mine (SW Poland), an environment strongly contaminated with arsenic. Previous physiological studies indicated that O23A may be involved in both mobilization and immobilization of this metalloid in the environment. To discover the molecular basis of the mechanisms behind the observed abilities, the genome of O23A (∼5.0 Mbp) was sequenced and annotated, and genes for arsenic respiration, heavy metal resistance ( hmr ) and other phenotypic traits, including siderophore production, were identified. The functionality of the indicated gene modules was assessed in a series of minimal inhibitory concentration analyses for various metals and metalloids, as well as mineral dissolution experiments. Interestingly, comparative analyses revealed that O23A is related to a fish pathogen Aeromonas salmonicida subsp. salmonicida A449 which, however, does not carry genes for arsenic respiration. This indicates that the dissimilatory arsenate reduction ability may have been lost during genome reduction in pathogenic strains, or acquired through horizontal gene transfer. Therefore, particular emphasis was placed upon the mobilome of O23A, consisting of four plasmids, a phage, and numerous transposable elements, which may play a role in the dissemination of hmr and arsenic metabolism genes in the environment. The obtained
Uhrynowski, Witold; Decewicz, Przemyslaw; Dziewit, Lukasz; Radlinska, Monika; Krawczyk, Pawel S.; Lipinski, Leszek; Adamska, Dorota; Drewniak, Lukasz
2017-01-01
Aeromonas spp. are among the most ubiquitous microorganisms, as they have been isolated from different environmental niches including waters, soil, as well as wounds and digestive tracts of poikilothermic animals and humans. Although much attention has been paid to the pathogenicity of Aeromonads, the role of these bacteria in environmentally important processes, such as transformation of heavy metals, remains to be discovered. Therefore, the aim of this study was a detailed genomic characterization of Aeromonas sp. O23A, the first representative of this genus capable of dissimilatory arsenate reduction. The strain was isolated from microbial mats from the Zloty Stok mine (SW Poland), an environment strongly contaminated with arsenic. Previous physiological studies indicated that O23A may be involved in both mobilization and immobilization of this metalloid in the environment. To discover the molecular basis of the mechanisms behind the observed abilities, the genome of O23A (∼5.0 Mbp) was sequenced and annotated, and genes for arsenic respiration, heavy metal resistance (hmr) and other phenotypic traits, including siderophore production, were identified. The functionality of the indicated gene modules was assessed in a series of minimal inhibitory concentration analyses for various metals and metalloids, as well as mineral dissolution experiments. Interestingly, comparative analyses revealed that O23A is related to a fish pathogen Aeromonas salmonicida subsp. salmonicida A449 which, however, does not carry genes for arsenic respiration. This indicates that the dissimilatory arsenate reduction ability may have been lost during genome reduction in pathogenic strains, or acquired through horizontal gene transfer. Therefore, particular emphasis was placed upon the mobilome of O23A, consisting of four plasmids, a phage, and numerous transposable elements, which may play a role in the dissemination of hmr and arsenic metabolism genes in the environment. The obtained
Digital Repository Service at National Institute of Oceanography (India)
Khandeparker, L.; KrishnaKumar, S.
and artificial biofilms of Aeromonas salmonicida salmonicida and Bacillus brevis and their culture supernatants and exopolysaccharides obtained under different nutritional conditions was evaluated. Natural biofilm facilitated cyprid metamorphosis in Balanus...
DISCOVERY OF ULTRA-STEEP SPECTRUM GIANT RADIO GALAXY WITH RECURRENT RADIO JET ACTIVITY IN ABELL 449
International Nuclear Information System (INIS)
Hunik, Dominika; Jamrozy, Marek
2016-01-01
We report a discovery of a 1.3 Mpc diffuse radio source with extremely steep spectrum fading radio structures in the vicinity of the Abell 449 cluster of galaxies. Its extended diffuse lobes are bright only at low radio frequencies and their synchrotron age is about 160 Myr. The parent galaxy of the extended relic structure, which is the dominant galaxy within the cluster, is starting a new jet activity. There are three weak X-rays sources in the vicinity of the cluster as found in the ROSAT survey, however it is not known if they are connected with this cluster of galaxies. Just a few radio galaxy relics are currently known in the literature, as finding them requires sensitive and high angular resolution low-frequency radio observations. Objects of this kind, which also are starting a new jet activity, are important for understanding the life cycle and evolution of active galactic nuclei. A new 613 MHz map as well as the archival radio data pertaining to this object are presented and analyzed
DEFF Research Database (Denmark)
Gieseker, Charles M.; Mayer, Tamara D.; Crosby, Tina C.
2012-01-01
salmonicida subsp. salmonicida ATCC 33658 against 10 antimicrobials (ampicillin, enrofloxacin, erythromycin, florfenicol, flumequine, gentamicin, ormetoprim/sulfadimethoxine, oxolinic acid, oxytetracycline, and trimethoprim/sulfamethoxazole) in diluted (4 g l−1) cation-adjusted Mueller-Hinton broth incubated...
Shaalan, Mohamed Ibrahim; El-Mahdy, Magdy Mohamed; Theiner, Sarah; El-Matbouli, Mansour; Saleh, Mona
2017-07-21
Antibiotic resistance is a global issue that threatens public health. The excessive use of antibiotics contributes to this problem as the genes of antibiotic resistance can be transferred between the bacteria in humans, animals and aquatic organisms. Metallic nanoparticles could serve as future substitutes for some conventional antibiotics because of their antimicrobial activity. The aim of this study was to evaluate the antimicrobial effects of silver and zinc oxide nanoparticles against major fish pathogens and assess their safety in vitro. Silver nanoparticles were synthesized by chemical reduction and characterized with UV-Vis spectroscopy, transmission electron microscopy and zeta sizer. The concentrations of silver and zinc oxide nanoparticles were measured using inductively coupled plasma-mass spectrometry. Subsequently, silver and zinc oxide nanoparticles were tested for their antimicrobial activity against Aeromonas hydrophila, Aeromonas salmonicida subsp. salmonicida, Edwardsiella ictaluri, Edwardsiella tarda, Francisella noatunensis subsp. orientalis, Yersinia ruckeri and Aphanomyces invadans and the minimum inhibitory concentrations were determined. MTT assay was performed on eel kidney cell line (EK-1) to determine the cell viability after incubation with nanoparticles. The interaction between silver nanoparticles and A. salmonicida was investigated by transmission electron microscopy. The tested nanoparticles exhibited marked antimicrobial activity. Silver nanoparticles inhibited the growth of both A. salmonicida and A. invadans at a concentration of 17 µg/mL. Zinc oxide nanoparticles inhibited the growth of A. salmonicida, Y. ruckeri and A. invadans at concentrations of 15.75, 31.5 and 3.15 µg/mL respectively. Silver nanoparticles showed higher cell viability when compared to zinc oxide nanoparticles in the MTT assay. Transmission electron microscopy showed the attachment of silver nanoparticles to the bacterial membrane and disruption of its
Directory of Open Access Journals (Sweden)
Idalina Thiomi Inumaru Nojimoto
1997-10-01
Full Text Available Foram analisadas 163 amostras de fezes de crianças com idade abaixo de 5 anos no período de 1995 a 1996, sendo 91 de fezes diarréicas e 72 de fezes não diarréicas. O material foi coletado em meio para transporte e submetido ao processo de enriquecimento a 4oC por 7 dias. Para o isolamento primário foi utilizado ágar amido ampicilina e incubado a 35oC por 18 a 24 horas. Foram isoladas 20 (21,9% das seguintes espécies: Aeromonas A. caviae (7,7%, A. salmonicida salmonicida (6,6%, A. sobria (4,3%, A. hydrophila (2,2% e Salmonicida achromogenes (1,1%. Nenhuma Aeromonas spp foi isolada dos 72 pacientes-controles. A susceptibilidade das amostras de Aeromonas spp aos antimicrobianos foi maior com a ciprofloxacina, diminuindo gradativamente com cloranfenicol, gentamicina, ampicilina e eritromicina.From 1995 through 1996, 163 fecal specimens of children aged under 5 years were analysed, 91 being from diarrhea feces and 72 without diarrhea. The material was collected in transport medium and submitted to the enrichment procedure at 4oC for 7 days. For the primary isolation starch ampicillin agar was used and incubated at 35oC for 18 to 24 hours. Twenty (20.9% from the following specimens were isolated: Aeromonas A. caviae (7.7%, A. salmonicida salmonicida (6.6%, A. sobria (4.3%, A. hydrophila (2.2% e Salmonicida achromogenes (1.1%. No Aeromonas spp was isolated from the 72 control subjects. The Aeromonas spp susceptibility to antimicrobian was greater with ciprofloxacin, being this susceptibility gradually diminished with chloranphenicol, gentamicin, ampicillin and erythromycin.
Insight in schizophrenia: a review.
Dam, Jesper
2006-01-01
The issue of insight in schizophrenia must be assumed to be one of the most important aspects of the clinical examination. Comprehensive studies have shown that between 50% and 80% of all patients suffering from schizophrenia do not believe that they have a disorder. In recent years, poor insight in schizophrenia has been the subject of increasing interest, as manifested in a number of studies discussed in the present review. Some of these studies focus on insight correlated to various parameters such as psychopathology, neuropsychology, clinical relevance and compliance. Other studies refer to more theoretical implications, among these the issue of defining the concept of insight: whether insight can be seen as a "primary" phenomenon in schizophrenia, and whether insight may be graduated, dimensioned or increased. Several authors have developed rating scales in an attempt to obtain a measure for the degree or dimension of insight. Here, the range of parameters employed gives an excellent impression of the complexity of the concept of insight. In the concluding discussion, a phenomenological aspect is brought in, in an attempt to place the concept of insight in relation to disturbances of the self in schizophrenia and to primary symptoms in schizophrenia, amongst these autism.
Gas Sloshing and Radio Galaxy Dynamics in the Core of the 3C 449 Group
Lal, Dharam V.; Kraft, Ralph P.; Randall, Scott W.; Forman, William R.; Nulsen, Paul E.; Roediger, Elke; ZuHone, John A.; Hardcastle, Martin J.; Jones, Christine; Croston, Judith H.
2013-01-01
We present results from a 140 ks Chandra/ACIS-S observation of the hot gas around the canonical FR I radio galaxy 3C 449. An earlier, shorter 30 ks Chandra observation of the group gas showed an unusual entropy distribution and a surface brightness edge in the gas that could be a strong shock around the inner radio lobes. In our deeper data we find no evidence for a temperature increase inside of the brightness edge, but a temperature decrease across part of the edge. This suggests that the edge is a "sloshing" cold front due to a merger within the last 1.3-1.6 Gyr. Both the northern and southern inner jets are bent slightly to the west in projection as they enter their respective lobes, suggesting that the sloshing core is moving to the east. The straight inner jet flares at approximately the position where it crosses the contact edge, suggesting that the jet is entraining and thermalizing some of the hot gas as it crosses the edge.We also detect filaments of X-ray emission around the southern inner radio jet and lobe which we attribute to low entropy entrained gas. The lobe flaring and gas entrainment were originally predicted in simulations of Loken et al. and are confirmed in our deep observation.
Cognitive insight: A systematic review.
Van Camp, L S C; Sabbe, B G C; Oldenburg, J F E
2017-07-01
Cognitive insight is the ability to re-evaluate thoughts and beliefs in order to make thoughtful conclusions. It differs from clinical insight, as it focuses on more general metacognitive processes. Therefore, it could be relevant to diverse disorders and non-clinical subjects. There is a growing body of research on cognitive insight in individuals with and without psychosis. This review has summarised the current state of the art regarding this topic. We conclude that while cognitive insight in its current form seems valid for use in individuals with psychosis, it is less so for individuals without psychosis. Additionally, higher cognitive insight not always leads to better psychological functioning. For instance, higher levels of self-reflection are often associated with depressive mood. We therefore recommend the sub-components of cognitive insight to be studied separately. Also, it is unclear what position cognitive insight takes within the spectrum of metacognitive processes and how it relates to other self-related concepts that have been defined previously in literature. Combining future and past research on cognitive insight and its analogue concepts will help in the formation of a uniform definition that fits all subjects discussed here. Copyright © 2017. Published by Elsevier Ltd.
Directory of Open Access Journals (Sweden)
Surya Amanu
2015-05-01
Full Text Available Fresh water and marine fish horticulture in Bali is often harmed by the outbreak of diseases such asthose caused by Aeromonas sp (aeromonad disease.Aims ofstudy were 1 to find out the primary agent ofthe aeomonad disease in the fresh water aquaculture in Bali based on conventional and molecularidentification, 2 to find out the genetic variability of Aeromonas species, 3 to determine the effectiveantibiotic against the agent. Samples of fishes were collected from 5 different locations of fresh wateraquaculture that had high number of morbidity and mortality. Many different fishes which showed clinicalsign such as skin lesion and exophthalmus were collected.Aeromonas hydrophila and A. salmonicida wereisolated and identified from fishes, they were then identified molecularly with DNA extraction, DNAamplification in 16S rRNA gene, purification and sequencing. Sequences of both Aeromonas species fromdifferent location were analysed to create the phylogenetic tree with Maximum Parsimony and NeighborJoining method. Sensitivity of 5 antibiotics to both species of Aeromonas were done to determine the bestantibiotic against the disease. Aeromonad disease were found only in 3 regions in Bali. As many as 10isolates of A.salmonicida and 11 isolates of A.hydrophila were examined. The histopathological examinationshowed dermatitis, epicarditis, retinitis, liver and kidney congestion in fish.There were two clusters ofA.salmonicida, subspecies smithiaand subspecies achromogenes.Aeromomas hydrophyla had a close relationwith A. veronii.Aeromonas salmonicida subspecies salmonicida has not been found in Bali. Enrofloxacineand gentamycin was the best antibiotic for treating the Aeromonad disease which were more effective ascompared to3 other antibiot ics (Ampicillin, Doxycycline, and Eritromycin.
DOE's 449 MHz Wind Profiling Radars on the U.S. West Coast: Annual Report for Fiscal Year 2016
Energy Technology Data Exchange (ETDEWEB)
Flaherty, Julia E.; Wilczak, J. M.; King, Clark W.; Shaw, William J.; White, A. B.; Ayers, Tom
2016-09-30
The three coastal wind profilers and associated meteorological instruments located in Forks, WA, Astoria, OR, and North Bend, OR, provide important observations at high temporal and vertical spatial resolution to characterize the meteorological inflow to the western region of the United States. These instruments have been operating for a year or more, and furnish boundary conditions for the modeling efforts of the WFIP2 project. The data have been delivered to archives at both NOAA and the DOE A2e DAP at a data recovery rate in excess of 98%. Site maintenance activities have been relatively minor, with a few component replacements and repairs to RASS foam. Bird mortality surveys have found no bird nests or carcasses, and the U.S. Fish and Wildlife Service has regularly been provided survey reports. This project represents a successful collaboration between PNNL and NOAA to procure, test, deploy, maintain, and operate three 449 MHz radar wind profilers.
DEFF Research Database (Denmark)
Bruhn, Jesper Bartholin; Dalsgaard, Inger; Nielsen, K.F.
2005-01-01
The aim of the present study was to investigate the production of quorum sensing signals (specifically acylated homoserine lactones, AHLs) among a selection of strains of Gram-negative fish bacterial pathogens. These signals are involved in the regulation of virulence factors in some human...... salmonicida and Vibrio splendidus were also positive. Aeromonas species produced N-butanoyl homoserine lactone (BHL) and N-hexanoyl homoserine lactone (HHL) and 1 additional product, whereas N-3-oxo-hexanoyl homoserine lactone (OHHL) and HHL were detected in Vibrio salmonicida. N-3-oxo-octanoyl homoserine...... lactone (OOHL) and N-3-octanoyl homoserine lactone (OHL) were detected in Y. ruckeii. AHLs were not detected from strains of Photobacterium damselae, Flavobacterium psychrophilum or Moritella viscosa. AHLs were extracted from fish infected with Y. ruckeri but not from fish infected with A. salmonicida...
Ibacache-Quiroga, C; Ojeda, J; Espinoza-Vergara, G; Olivero, P; Cuellar, M; Dinamarca, M A
2013-01-01
Summary Biosurfactants are produced by hydrocarbon-degrading marine bacteria in response to the presence of water-insoluble hydrocarbons. This is believed to facilitate the uptake of hydrocarbons by bacteria. However, these diffusible amphiphilic surface-active molecules are involved in several other biological functions such as microbial competition and intra-or inter-species communication. We report the isolation and characterization of a marine bacterial strain identified as Cobetia sp. MM1IDA2H-1, which can grow using the sulfur-containing heterocyclic aromatic hydrocarbon dibenzothiophene (DBT). As with DBT, when the isolated strain is grown in the presence of a microbial competitor, it produces a biosurfactant. Because the obtained biosurfactant was formed by hydroxy fatty acids and extracellular lipidic structures were observed during bacterial growth, we investigated whether the biosurfactant at its critical micelle concentration can interfere with bacterial communication systems such as quorum sensing. We focused on Aeromonas salmonicida subsp. salmonicida, a fish pathogen whose virulence relies on quorum sensing signals. Using biosensors for quorum sensing based on Chromobacterium violaceum and Vibrio anguillarum, we showed that when the purified biosurfactant was mixed with N-acyl homoserine lactones produced by A. salmonicida, quorum sensing was inhibited, although bacterial growth was not affected. In addition, the transcriptional activities of A. salmonicida virulence genes that are controlled by quorum sensing were repressed by both the purified biosurfactant and the growth in the presence of Cobetia sp. MM1IDA2H-1. We propose that the biosurfactant, or the lipid structures interact with the N-acyl homoserine lactones, inhibiting their function. This could be used as a strategy to interfere with the quorum sensing systems of bacterial fish pathogens, which represents an attractive alternative to classical antimicrobial therapies in fish
Stigma as a predictor of insight in schizophrenia.
Pruß, Linda; Wiedl, Karl Heinz; Waldorf, Manuel
2012-07-30
Insight in schizophrenia can be seen as a multifactorial phenomenon. Although multifactorial pathways have also been suggested for insight formation, motivational explanations have rarely been tested. The present study explores stigma as one possible determinant of a motivated lack of insight in integrated models of insight formation. It examines the contribution of socio-demographic and clinical variables, neurocognitive functions, symptoms, and stigma to the prediction of insight into illness. Patients diagnosed with schizophrenia spectrum disorders (N=111) participated in a comprehensive battery of instruments to measure insight dimensions, stigma, neurocognitive functions, symptoms, socio-demographic and clinical variables. Blockwise multiple regression analysis indicates significant association of variability in insight dimensions with gender (7%) and stigma (i. e., stereotype agreement: 5%). Our findings demonstrate an incremental validity of stigma, which indicates a motivational pathway of insight formation. This study enables better understanding of the multifactorial nature of insight, which should be considered in therapeutic interventions to improve insight. The roles of gender and neurocognitive functions in insight formation are also discussed. Copyright © 2012 Elsevier Ltd. All rights reserved.
DEFF Research Database (Denmark)
Holten-Andersen, Lars; Dalsgaard, Inger; Buchmann, Kurt
2012-01-01
Background: Furunculosis, caused by Aeromonas salmonicida, continues to be a major health problem for the growing salmonid aquaculture. Despite effective vaccination programs regular outbreaks occur at the fish farms calling for repeated antibiotic treatment. We hypothesized that a difference...... in susceptibility to A. salmonicida were demonstrated between the two salmonids and hazard ratio estimation between rainbow trout and Baltic salmon showed a 3.36 higher risk of dying from the infection in the former. Conclusion: The finding that Baltic salmon carries a high level of natural resistance...
Human Performance on Insight Problem Solving: A Review
Chu, Yun; MacGregor, James N.
2011-01-01
The article provides a review of recent research on insight problem-solving performance. We discuss what insight problems are, the different types of classic and newer insight problems, and how we can classify them. We also explain some of the other aspects that affect insight performance, such as hints, analogs, training, thinking aloud, and…
Installation and Initial Operation of DOE's 449-MHz Wind Profiling Radars on the U.S. West Coast
Energy Technology Data Exchange (ETDEWEB)
Flaherty, Julia E. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Shaw, William J. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Morris, Victor R. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Wilczak, J. M. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); White, A. B. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Ayers, Tom [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Jordan, Jim [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); King, Clark W. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States)
2015-10-30
The U.S. Department of Energy (DOE), in collaboration with the National Oceanic and Atmospheric Administration (NOAA), has recently completed the installation of three new wind profiling radars on the Washington and Oregon coasts. These systems operate at a frequency of 449 MHz and provide mean wind profiles to a height of roughly 8 km, with the maximum measurement height depending on time-varying atmospheric conditions. This is roughly half the depth of the troposphere at these latitudes. Each system is also equipped with a radio acoustic sounding system (RASS), which provides a measure of the temperature profile to heights of approximately 2 km. Other equipment deployed alongside the radar includes a surface meteorological station and GPS for column water vapor. This project began in fiscal year 2014, starting with equipment procurements and site selection. In addition, environmental reviews, equipment assembly and testing, site access agreements, and infrastructure preparations have been performed. Finally, with equipment deployment with data collection and dissemination, the primary tasks of this project have been completed. The three new wind profiling radars have been deployed at airports near Coos Bay, OR, and Astoria, OR, and at an industrial park near Forks, WA. Data are available through the NOAA Earth Systems Research Laboratory Data Display website, and will soon be made available through the DOE Atmosphere to Electrons data archive and portal as well.
Neurobiological Basis of Insight in Schizophrenia: A Systematic Review.
Xavier, Rose Mary; Vorderstrasse, Allison
2016-01-01
Insight in schizophrenia is defined as awareness into illness, symptoms, and need for treatment and has long been associated with cognition, other psychopathological symptoms, and several adverse clinical and functional outcomes. However, the biological basis of insight is not clearly understood. The aim of this systematic review was to critically evaluate and summarize advances in the study of the biological basis of insight in schizophrenia and to identify gaps in this knowledge. A literature search of PubMed, CINAHL, PsycINFO, and EMBASE databases was conducted using search terms to identify articles relevant to the biology of insight in schizophrenia published in the last 6 years. Articles that focused on etiology of insight in schizophrenia and those that examined the neurobiology of insight in schizophrenia or psychoses were chosen for analysis. Articles on insight in conditions other than schizophrenia or psychoses and which did not investigate the neurobiological underpinnings of insight were excluded from the review. Twenty-six articles met the inclusion criteria for this review. Of the 26 articles, 3 focused on cellular abnormalities and 23 were neuroimaging studies. Preliminary data identify the prefrontal cortex, cingulate cortex, and regions of the temporal and parietal lobe (precuneus, inferior parietal lobule) and hippocampus as the neural correlates of insight. A growing body of literature attests to the neurobiological basis of insight in schizophrenia. Current evidence supports the neurobiological basis of insight in schizophrenia and identifies specific neural correlates for insight types and its dimensions. Further studies that examine the precise biological mechanisms of insight are needed to apply this knowledge to effective clinical intervention development.
Riedel, O; Dodel, R; Deuschl, G; Förstl, H; Henn, F; Heuser, I; Oertel, W; Reichmann, H; Riederer, P; Trenkwalder, C; Wittchen, H U
2011-08-01
Parkinson's disease (PD) is frequently accompanied by dementia or depression which can aggravate the clinical picture of the disease and increase the risk of care dependency (CD). Little is known about the associations between PD, these neuropsychiatric comorbidities and CD in outpatients. A nationwide sample of outpatients (n=1,449) was examined by office-based neurologists (n=315) comprising the documentation of the general, neurological status and the degree of CD. The dementia status was clinically rated according to the established DSM-IV criteria. Depression was screened with the Montgomery-Asberg Depression Rating Scale (MADRS). Overall, 18.3% of all patients were care dependent. Even after adjustment for PD severity, patients with depression (OR=2.8; 95% CI 1.8-4.3), dementia (OR=2.7; 95% CI 1.8-4.1) or both (OR=3.9; 95% CI 2.5-60,0) were at higher risk for CD than patients without dementia or depression. Patients aged ≥76 years were fourfold more likely to be care dependent than patients aged ≤65 years (OR=3.5; 95% CI 2.3-5.5). Across all age groups, patients with depression featured the highest increments (from 11.9 to 42.0%). The risk for CD is substantially elevated in outpatients with PD when further neuropsychiatric symptoms are present. The data suggest that depression contributes equally to disability as does dementia.
Digital Repository Service at National Institute of Oceanography (India)
Majik, M.S.; Rodrigues, C.; Mascarenhas, S.; DeSouza, L.
Planococcus donghaensis, Erythrobacter litoralis, Alivibrio salmonicida, Vibrio furnisii. Overall, the modified analogues showed stronger activity than the parent marine natural product (isatin) and hence 1H-indole-2,3-dione scaffold has immense potential...
Is Insight Always the Same? A Protocol Analysis of Insight in Compound Remote Associate Problems
Cranford, Edward A.; Moss, Jarrod
2012-01-01
Compound Remote Associate (CRA) problems have been used to investigate insight problem solving using both behavioral and neuroimaging techniques. However, it is unclear to what extent CRA problems exhibit characteristics of insight such as impasses and restructuring. CRA problem-solving characteristics were examined in a study in which…
Insight and suicidality in psychosis: A cross-sectional study.
Massons, Carmen; Lopez-Morinigo, Javier-David; Pousa, Esther; Ruiz, Ada; Ochoa, Susana; Usall, Judith; Nieto, Lourdes; Cobo, Jesus; David, Anthony S; Dutta, Rina
2017-06-01
We aimed to test whether specific insight dimensions are associated with suicidality in patients with psychotic disorders. 143 patients with schizophrenia spectrum disorders were recruited. Suicidality was assessed by item 8 of the Calgary Depression Scale for Schizophrenia (CDSS). Insight was measured by the Scale of Unawareness of Mental Disorder (SUMD) and the Markova and Berrios Insight Scale. Bivariate analyses and multivariable logistic regression models were conducted. Those subjects aware of having a mental illness and its social consequences had higher scores on suicidality than those with poor insight. Awareness of the need for treatment was not linked with suicidality. The Markova and Berrios Insight scale total score and two specific domains (awareness of "disturbed thinking and loss of control over the situation" and "having a vague feeling that something is wrong") were related to suicidality. However, no insight dimensions survived the multivariable regression model, which found depression and previous suicidal behaviour to predict suicidality. Suicidality in psychosis was linked with some insight dimensions: awareness of mental illness and awareness of social consequences, but not compliance. Depression and previous suicidal behaviour mediated the associations with insight; thus, predicting suicidality. Copyright © 2017. Published by Elsevier B.V.
Far from superficial: microbial diversity associated with the skin and mucus of fish
Cipriano, Rocco C.; Dove, Alistair; Cipriano, R.C.; Bruckner, A.W.; Shchelkunov, I.S.
2011-01-01
During horizontal or water-borne infection involving an obligate pathogen (e.g. – Aeromonas salmonicida, cause of furunculosis), the pathogen interacted with and influenced the microbial diversity of the dermal mucus of fish. Prior to infection, the prevalent bacterial flora cultured from juvenile Atlantic salmon (Salmo salar) included Pseudomonas fluorescens, Comomonas terrigenia, Acinetobacter sp., Moraxella sp., Pseudomonas dimunita, Alcaligenes denitrificans, Pseudomonas pseudoalcaligenes, and Pseudomonas alcaligenes, Serratia liquefaciens, Aeromonas hydrophila, other motile Aeromonas spp., and Corynebacterium aquaticum. After A. salmonicida was initially detected in this population as an external mucus infection, Acinetobacter sp., Moraxella sp., C. terrigenia, P. fluorescens, and P. dimunita, Staphylococcus sp., and A. hydrophila, were also present in appreciable numbers. Within several weeks, however, the A. salmonicida infection amplified and composed 78% of the total flora in the mucus. Only P. dimunita (4%). P. fluorescens (2%), and C. terrigenia (1%) were cultured at that time and more than a third of these fish showed evidence of a systemic A. salmonicida infection within their kidneys. Eight weeks after oral oxytetracycline treatments, A. salmonicida was no longer isolated from the mucus or kidneys of any fish and glucose inert or other oxidative microbes (e.g., P. fluorescens, C. terrigenia, Acinetobacter sp., Moraxella sp.) were beginning to repopulate the external surface of the salmon in increasing frequency. Still present and composing fairly large percentages of the total flora were A. hydrophila, as well as Enterobacter sp., and P. putrefaciens. A normal microbial diversity was re-established as the fish recovered. In another investigation, reduced biological diversity was noted in the dermal mucus among smallmouth bass that were sampled from the Jackson River (Covington, VA). In these fish, A. hydrophila and P. putrefaciens were the two
Clinical and Cognitive Insight in a Compensatory Cognitive Training Intervention
Burton, Cynthia Z.; Vella, Lea; Twamley, Elizabeth W.
2013-01-01
The impact of limited insight is a crucial consideration in the treatment of individuals with psychiatric illness. In the context of psychosis, both clinical and cognitive insight have been described. This study aimed to evaluate the relationships between clinical and cognitive insight and neuropsychological functioning, psychiatric symptom severity, and everyday functioning in patients with a primary psychotic disorder participating in a compensatory cognitive training (CT) intervention. Sixty-nine individuals diagnosed with a primary psychotic disorder were randomized to a 3-month CT intervention or to standard pharmacotherapy, and they completed a comprehensive neuropsychological, clinical, and functional battery at baseline, 3 months, and 6 months. The CT intervention focused on habit formation and compensatory strategy learning in four domains: prospective memory, attention and vigilance, learning and memory, and problem-solving/cognitive flexibility. At baseline, better clinical insight was significantly related to better executive functioning and less severe negative symptoms. There was no significant association between cognitive insight and cognitive functioning, symptom severity, or everyday functioning ability. The CT intervention did not have an effect on clinical or cognitive insight, but better cognitive insight prior to participation in CT significantly predicted decreased positive and depressive symptom severity posttreatment, and better clinical insight predicted improved self-reported quality of life. Although clinical insight is related to executive functioning, the correlates of cognitive insight remain elusive. Intact insight appears to be beneficial in ameliorating clinical symptomatology like positive symptoms and depression, rather than augmenting cognition. It may be valuable to develop brief interventions aimed at improving clinical and cognitive insight prior to other psychosocial rehabilitation in order to maximize the benefit of
INSIGHT AGONISTES: A READING OF SOPHOCLES'S OEDIPUS THE KING.
Mahon, Eugene J
2015-07-01
In this reading of Sophocles's Oedipus the King, the author suggests that insight can be thought of as the main protagonist of the tragedy. He personifies this depiction of insight, calling it Insight Agonistes, as if it were the sole conflicted character on the stage, albeit masquerading at times as several other characters, including gods, sphinxes, and oracles. This psychoanalytic reading of the text lends itself to an analogy between psychoanalytic process and Sophocles's tragic hero. The author views insight as always transgressing against, always at war with a conservative, societal, or intrapsychic chorus of structured elements. A clinical vignette is presented to illustrate this view of insight. © 2015 The Psychoanalytic Quarterly, Inc.
A Microgenetic Study of Insightful Problem Solving
Luwel, Koen; Siegler, Robert S.; Verschaffel, Lieven
2008-01-01
An eight-session microgenetic study of acquisition of an insightful problem-solving strategy was conducted. A total of 35 second graders who did not use this insightful strategy initially were assigned to two groups that differed in the frequency of problems likely to facilitate discovery and generalization of the strategy. Children in the…
A study of poor insight in social anxiety disorder.
Vigne, Paula; de Menezes, Gabriela B; Harrison, Ben J; Fontenelle, Leonardo F
2014-11-30
We investigated levels of insight among patients with Social Anxiety Disorder (SAD) as compared to patients with Obsessive-Compulsive Disorder (OCD) and evaluated whether levels of insight in SAD were related to specific sociodemographic and/or clinical features. Thirty-seven SAD patients and 51 OCD patients attending a tertiary obsessive-compulsive and anxiety disorders clinic were assessed with a sociodemographic and clinical questionnaire, a structured diagnostic interview, the Brown Assessment of Beliefs Scale (BABS), the Social Phobia Inventory (SPIN), the Beck Depression Inventory (BDI), the Sheehan Disability Scale (SDS), and the Treatment Adherence Survey-patient version (TAS-P). According to the BABS, SAD patients exhibited insight levels that were as low as those exhibited by OCD patients, with up to 29.7% of them being described as "poor insight" SAD. Although poor insight SAD patients were more frequently married, less depressed and displayed a statistical trend towards greater rates of early drop-out from cognitive-behavioral therapy, their insight levels were not associated with other variables of interest, including sex, age, employment, age at onset, duration of illness, associated psychiatric disorders, SPIN and SDS scores. Patients with poor insight SAD might perceive their symptoms as being less distressful and thus report fewer depressive symptoms and high rates of treatment non-adherence. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Ovington, Linda A.; Saliba, Anthony J.; Goldring, Jeremy
2016-01-01
This article reports the development of a brief self-report measure of dispositional insight problem solving, the Dispositional Insight Scale (DIS). From a representative Australian database, 1,069 adults (536 women and 533 men) completed an online questionnaire. An exploratory and confirmatory factor analysis revealed a 5-item scale, with all…
Insight Is Not in the Problem: Investigating Insight in Problem Solving across Task Types.
Webb, Margaret E; Little, Daniel R; Cropper, Simon J
2016-01-01
The feeling of insight in problem solving is typically associated with the sudden realization of a solution that appears obviously correct (Kounios et al., 2006). Salvi et al. (2016) found that a solution accompanied with sudden insight is more likely to be correct than a problem solved through conscious and incremental steps. However, Metcalfe (1986) indicated that participants would often present an inelegant but plausible (wrong) answer as correct with a high feeling of warmth (a subjective measure of closeness to solution). This discrepancy may be due to the use of different tasks or due to different methods in the measurement of insight (i.e., using a binary vs. continuous scale). In three experiments, we investigated both findings, using many different problem tasks (e.g., Compound Remote Associates, so-called classic insight problems, and non-insight problems). Participants rated insight-related affect (feelings of Aha-experience, confidence, surprise, impasse, and pleasure) on continuous scales. As expected we found that, for problems designed to elicit insight, correct solutions elicited higher proportions of reported insight in the solution compared to non-insight solutions; further, correct solutions elicited stronger feelings of insight compared to incorrect solutions.
Bactericidal efficacy of elevated pH on fish pathogenic and environmental bacteria
Directory of Open Access Journals (Sweden)
Clifford E. Starliper
2013-07-01
Full Text Available Ship ballast water is a recognized medium for transfer and introductions of nonindigenous species. There is a need for new ballast water treatment methods that effectively and safely eliminate or greatly minimize movements of these species. The present study employed laboratory methods to evaluate the bactericidal efficacy of increased pH (pH 10.0–12.0 for exposure durations of up to 72 h to kill a variety of Gram-negative and Gram-positive bacteria including fish pathogens (Aeromonas spp., Yersinia ruckeri, Edwardsiella ictaluri, Serratia liquefaciens, Carnobacterium sp., other common aquatic-inhabitant bacteria (Serratia marcescens, Pseudomonas fluorescens, Staphylococcus sp., Bacillus sp. and indicators listed in International Maritime Organization D2 Standards; namely, Vibrio cholera (an environmental isolate from fish, Escherichia coli and Enterococcus faecalis. Volumes of 5 N NaOH were added to tryptic soy broth to obtain desired pH adjustments. Viable cells were determined after 0, 4, 12, 24, 48, and 72 h. Initial (0 h cell numbers ranged from 3.40 × 104 cfu/mL for Bacillus sp. to 2.44 × 107 cfu/mL for E. faecalis. The effective endpoints of pH and treatment duration necessary to realize 100% bactericidal effect varied; however, all bacteria tested were killed within 72 h at pH 12.0 or lower. The lowest parameters examined, 4 h at pH 10.0, were bactericidal to V. cholera, E. ictaluri, three of four isolates of E. coli, and (three of four Aeromonas salmonicida subsp. salmonicida. Bactericidal effect was attained at pH 10.0 within 12 h for the other A. salmonicida subsp. salmonicida, and within 24 h for P. fluorescens, and the remaining E. coli.
Bactericidal efficacy of elevated pH on fish pathogenic and environmental bacteria
Starliper, Clifford E.; Watten, Barnaby J.
2013-01-01
Ship ballast water is a recognized medium for transfer and introductions of nonindigenous species. There is a need for new ballast water treatment methods that effectively and safely eliminate or greatly minimize movements of these species. The present study employed laboratory methods to evaluate the bactericidal efficacy of increased pH (pH 10.0–12.0) for exposure durations of up to 72 h to kill a variety of Gram-negative and Gram-positive bacteria including fish pathogens (Aeromonas spp., Yersinia ruckeri, Edwardsiella ictaluri, Serratia liquefaciens, Carnobacterium sp.), other common aquatic-inhabitant bacteria (Serratia marcescens, Pseudomonas fluorescens, Staphylococcus sp., Bacillus sp.) and indicators listed in International Maritime Organization D2 Standards; namely, Vibrio cholera (an environmental isolate from fish), Escherichia coli and Enterococcus faecalis. Volumes of 5 N NaOH were added to tryptic soy broth to obtain desired pH adjustments. Viable cells were determined after 0, 4, 12, 24, 48, and 72 h. Initial (0 h) cell numbers ranged from 3.40 × 104 cfu/mL for Bacillus sp. to 2.44 × 107 cfu/mL for E. faecalis. The effective endpoints of pH and treatment duration necessary to realize 100% bactericidal effect varied; however, all bacteria tested were killed within 72 h at pH 12.0 or lower. The lowest parameters examined, 4 h at pH 10.0, were bactericidal to V. cholera, E. ictaluri, three of four isolates of E. coli, and (three of four) Aeromonas salmonicida subsp. salmonicida. Bactericidal effect was attained at pH 10.0 within 12 h for the other A. salmonicida subsp. salmonicida, and within 24 h for P. fluorescens, and the remaining E. coli.
Zhang, Qi; Li, Xu; Parker, Giverny J; Hong, Xiao-Hong; Wang, Yi; Lui, Simon S Y; Neumann, David L; Cheung, Eric F C; Shum, David H K; Chan, Raymond C K
2016-03-30
Research on the relationship between insight and social cognition, in particular Theory of Mind (ToM), in schizophrenia has yielded mixed findings to date. Very few studies, however, have assessed both clinical insight and cognitive insight when examining their relationships with ToM in schizophrenia. The current study thus investigated the relationship between clinical insight, cognitive insight, and ToM in a sample of 56 patients with schizophrenia and 30 healthy controls. Twenty-seven patients were classified as low in clinical insight according to their scores on the 'insight' item (G12) of the Positive and Negative Syndrome Scale (PANSS). Moreover, cognitive insight and ToM were assessed with the Beck Cognitive Insight Scale (BCIS) and the Yoni task, respectively. The results indicated that patients with poor clinical insight performed worse on tasks of second-order cognitive and affective ToM, while the ToM performance of patients with high clinical insight was equivalent to that of healthy controls. Furthermore, while clinical insight was correlated with ToM and clinical symptoms, cognitive insight did not correlate with clinical insight, ToM, or clinical symptoms. Clinical insight thus appears to be an important factor related to ToM in schizophrenia. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
The unconscious nature of insight: A dual-task paradigm investigation
Directory of Open Access Journals (Sweden)
Lebed A. A.
2017-09-01
Full Text Available Background. Insight is a specific part of the thinking process during creative problem solving. The experience of a sudden unexpected solution of the problem makes it distinct from other problem solving. Though the insight problem solving process is hidden from the observer and the solver himself, it is possible to study working memory changes during the problem-solving process in order to observe the tracks of insight. Objective. A critical experiment was carried out to determine whether it is legitimate to measure insight-problem-solving dynamics within a dual-task paradigm and working memory model. Also a verification was conducted of the hypothesis of whether insight problem solving competes for cognitive resources with unconscious processes. Design. We designed a special procedure based on Kahneman’s (1973 modified dual-task paradigm, allowing simultaneous performance of the problem-solving process and probe tasks of different types. The reaction time was measured for the probe task. ere were two problems conditions (insight and regular, and two probe tasks conditions (implicit and explicit. Participants: 32 participants, aged from 18 to 32 years (M = 19.81; σ = 2.51. Results. Significant differences in implicit probe reaction time were found between the dual-task condition (implicit categorization and insight problem solving and solo implicit probe condition (t(15 = –3.21, p = .006, d = –.76. A joint effect of problem type and probe type was found (F(1, 60= 4.85, p = .035, ηp2 = .07. Conclusion. The results support the idea that information processing of conscious and of unconscious processes are separate. Unconscious processing capacity is limited. Implicit skill seems to be operated by the same mechanisms as insight problem solving, therefore competing for a common resource. It was also shown that such hidden creative unconscious processes as insight can be tracked via working memory load.
Insight in seasonal affective disorder.
Ghaemi, S N; Sachs, G S; Baldassano, C F; Truman, C J
1997-01-01
Lack of insight complicates the evaluation and treatment of patients with psychotic and affective disorders. No studies of insight in seasonal affective disorder (SAD) have been reported. Thirty patients with SAD diagnosed by the Structured Clinical Interview for DSM-III-R but no other axis I conditions were treated short-term with light-therapy. Insight was measured with the Scale to Assess Unawareness of Mental Disorder (SUMD) as modified by the authors to assess the self-report of insight into depressive symptoms. Increasing scores (1 to 5) indicated increasing unawareness of illness (i.e., less insight). SAD patients displayed a moderate amount of insight when depressed (mean SUMD score, 2.5). When recovered, they showed no significant change in insight into past depressive symptoms (mean SUMD score, 2.8). Greater insight into current depressive symptoms correlated with more depressive symptoms on the Hamilton Rating Scale for Depression score ([HRSD] r = .35, P depressive symptoms that does not change after recovery, a result in agreement with studies of insight in psychosis and mania. Further, in SAD, increased severity of illness may be associated with increased insight into depressive symptoms, consistent with the hypothesis of depressive realism.
The effects of aging on insight into illness in schizophrenia: a review†
Gerretsen, Philip; Plitman, Eric; Rajji, Tarek K.; Graff-Guerrero, Ariel
2015-01-01
Objectives Impaired insight into illness is a prevalent feature of schizophrenia, which negatively influences treatment adherence and clinical outcomes. Little is known about the effects of aging on insight impairment. We aimed to review the available research literature on the effects of aging on insight into illness in schizophrenia, in relation to positive, negative, and cognitive symptoms. Ultimately, we propose a trajectory of insight in schizophrenia across the lifespan. Method A systematic Medline® literature search was conducted, searching for English language studies describing the relationship of insight into illness in schizophrenia with aging. Results We identified 62 studies. Insight impairment is associated with illness severity, premorbid intellectual function (i.e. IQ), executive function, and memory. Insight impairment improves modestly during midlife, worsening again in late life. It tends to fluctuate with each episode of psychosis, likely in relation to worsening positive symptoms that improve with antipsychotic treatment. The relationship between insight impairment and cognitive dysfunction appears to attenuate with age, while the relationship with lower premorbid intellectual function is preserved. The association between impaired insight and negative symptoms is unclear. Conclusions The available literature suggests that the course of insight impairment follows a U-shaped curve, where insight impairment is severe during the first episode of psychosis, modestly improves over midlife, and declines again in late life. Future studies are required to investigate the trajectory of insight into illness and its core domains across the lifespan from prodromal phase to late life. PMID:25055980
Insightful practice: a reliable measure for medical revalidation
Guthrie, Bruce; Sullivan, Frank M; Mercer, Stewart W; Russell, Andrew; Bruce, David A
2012-01-01
Background Medical revalidation decisions need to be reliable if they are to reassure on the quality and safety of professional practice. This study tested an innovative method in which general practitioners (GPs) were assessed on their reflection and response to a set of externally specified feedback. Setting and participants 60 GPs and 12 GP appraisers in the Tayside region of Scotland, UK. Methods A feedback dataset was specified as (1) GP-specific data collected by GPs themselves (patient and colleague opinion; open book self-evaluated knowledge test; complaints) and (2) Externally collected practice-level data provided to GPs (clinical quality and prescribing safety). GPs' perceptions of whether the feedback covered UK General Medical Council specified attributes of a ‘good doctor’ were examined using a mapping exercise. GPs' professionalism was examined in terms of appraiser assessment of GPs' level of insightful practice, defined as: engagement with, insight into and appropriate action on feedback data. The reliability of assessment of insightful practice and subsequent recommendations on GPs' revalidation by face-to-face and anonymous assessors were investigated using Generalisability G-theory. Main outcome measures Coverage of General Medical Council attributes by specified feedback and reliability of assessor recommendations on doctors' suitability for revalidation. Results Face-to-face assessment proved unreliable. Anonymous global assessment by three appraisers of insightful practice was highly reliable (G=0.85), as were revalidation decisions using four anonymous assessors (G=0.83). Conclusions Unlike face-to-face appraisal, anonymous assessment of insightful practice offers a valid and reliable method to decide GP revalidation. Further validity studies are needed. PMID:22653078
Relationship between insight and theory of mind in schizophrenia: A meta-analysis.
Bora, Emre
2017-12-01
Poor insight in schizophrenia has been associated with executive dysfunction and deficits in general cognitive ability. The overall outcome of available neurocognitive studies suggests that there is a significant but modest relationship between cognitive deficits and poor insight in schizophrenia. However, social cognitive abilities, particularly, theory of mind (ToM), might also play a role in poor insight in schizophrenia. A novel meta-analysis of the relationship between ToM and insight in schizophrenia was conducted. Current meta-analysis included 16 studies including 1085 patients with schizophrenia-spectrum disorders. There was a significant association between ToM and clinical insight (r=0.28, CI=0.20-0.36). By contrast, there was no significant relationship between ToM and cognitive insight. Current findings suggest that there is a small but significant relationship between ToM and clinical insight in schizophrenia. ToM impairment is one of the factors contributing to poor insight in schizophrenia. Copyright © 2017 Elsevier B.V. All rights reserved.
The role of an active site Mg2+ in HDV ribozyme self-cleavage: insights from QM/MM calculations
Czech Academy of Sciences Publication Activity Database
Mlýnský, V.; Walter, Nils G.; Šponer, Jiří; Otyepka, Michal; Banáš, Pavel
2015-01-01
Roč. 17, č. 1 (2015), s. 670-679 ISSN 1463-9076 R&D Projects: GA ČR(CZ) GAP208/12/1878 Institutional support: RVO:68081707 Keywords : HEPATITIS-DELTA-VIRUS * MOLECULAR-DYNAMICS SIMULATIONS * 2'-HYDROXYL GROUP Subject RIV: BO - Biophysics Impact factor: 4.449, year: 2015
Gerretsen, Philip; Menon, Mahesh; Mamo, David C.; Fervaha, Gagan; Remington, Gary; Pollock, Bruce G.; Graff-Guerrero, Ariel
2015-01-01
Background Impaired insight into illness (clinical insight) in schizophrenia has negative effects on treatment adherence and clinical outcomes. Schizophrenia is described as a disorder of disrupted brain connectivity. In line with this concept, resting state networks (RSNs) appear differentially affected in persons with schizophrenia. Therefore, impaired clinical, or the related construct of cognitive insight (which posits that impaired clinical insight is a function of metacognitive deficits), may reflect alterations in RSN functional connectivity (fc). Based on our previous research, which showed that impaired insight into illness was associated with increased left hemisphere volume relative to right, we hypothesized that impaired clinical insight would be associated with increased connectivity in the DMN with specific left hemisphere brain regions. Methods Resting state MRI scans were acquired for participants with schizophrenia or schizoaffective disorder (n = 20). Seed-to-voxel and ROI-to-ROI fc analyses were performed using the CONN-fMRI fc toolbox v13 for established RSNs. Clinical and cognitive insight were measured with the Schedule for the Assessment of Insight—Expanded Version and Beck Cognitive Insight Scale, respectively, and included as the regressors in fc analyses. Results As hypothesized, impaired clinical insight was associated with increased connectivity in the default mode network (DMN) with the left angular gyrus, and also in the self-referential network (SRN) with the left insula. Cognitive insight was associated with increased connectivity in the dorsal attention network (DAN) with the right inferior frontal cortex (IFC) and left anterior cingulate cortex (ACC). Conclusion Increased connectivity in DMN and SRN with the left angular gyrus and insula, respectively, may represent neural correlates of impaired clinical insight in schizophrenia spectrum disorders, and is consistent with the literature attributing impaired insight to left
Edwards, Christopher L.; Ruby, Perrine M.; Malinowski, Josie E.; Bennett, Paul D.; Blagrove, Mark T.
2013-01-01
This paper addresses claims that dreams can be a source of personal insight. Whereas there has been anecdotal backing for such claims, there is now tangential support from findings of the facilitative effect of sleep on cognitive insight, and of REM sleep in particular on emotional memory consolidation. Furthermore, the presence in dreams of metaphorical representations of waking life indicates the possibility of novel insight as an emergent feature of such metaphorical mappings. In order to assess whether personal insight can occur as a result of the consideration of dream content, 11 dream group discussion sessions were conducted which followed the Ullman Dream Appreciation technique, one session for each of 11 participants (10 females, 1 male; mean age = 19.2 years). Self-ratings of deepened self-perception and personal gains from participation in the group sessions showed that the Ullman technique is an effective procedure for establishing connections between dream content and recent waking life experiences, although wake life sources were found for only 14% of dream report text. The mean Exploration-Insight score on the Gains from Dream Interpretation questionnaire was very high and comparable to outcomes from the well-established Hill (1996) therapist-led dream interpretation method. This score was associated between-subjects with pre-group positive Attitude Toward Dreams (ATD). The need to distinguish “aha” experiences as a result of discovering a waking life source for part of a dream, from “aha” experiences of personal insight as a result of considering dream content, is discussed. Difficulties are described in designing a control condition to which the dream report condition can be compared. PMID:24550849
What are System Dynamics Insights?
Stave, K.; Zimmermann, N. S.; Kim, H.
2016-01-01
This paper explores the concept of system dynamics insights. In our field, the term “insight” is generally understood to mean dynamic insight, that is, a deep understanding about the relationship between structure and behavior. We argue this is only one aspect of the range of insights possible from system dynamics activities, and describe a broader range of potential system dynamics insights. We also propose an initial framework for discussion that relates different types of system dynamics a...
Illness Insight and Recovery: How Important is Illness Insight in Peoples’ Recovery Process?
DEFF Research Database (Denmark)
Korsbek, Lisa
2013-01-01
. Sources Used:The writing is based on research literature related to illness insight and on personal recovery experiences.Conclusions and Implications for Practice: It is helpful to consider the integration of the issue of illness insight when addressing the questions and consequences of diagnosis......Topic: This account reflects on the topic of illness insight and recovery. Purpose: The purpose of the account is to clarify our understanding about the importance of illness insight in peoples’ recovery process, especially when relating the question of illness insight to the question of identity......, and to assist individuals to work through the false analogy between illness and identity while supporting the transformation from patient to person. It is also necessary for clinicians to develop a clear understanding of peoples’ actual needs and gain more knowledge about peoples’ own views and experiences...
Effects of treated sewage effluent on immune function in rainbow trout (Oncorhynchus mykiss)
Energy Technology Data Exchange (ETDEWEB)
Hoeger, Birgit [Environmental Toxicology, University of Konstanz, P.O. Box X918, D-78457 Constance (Germany); Heuvel, Michael R. van den [Forest Research, Private Bag 3020, Sala St., Rotorua (New Zealand); Hitzfeld, Bettina C. [Swiss Agency for the Environment, Forests and Landscape (SAEFL), Substances, Soil, Biotechnology Division, Section Substances, 3003 Bern (Switzerland); Dietrich, Daniel R. [Environmental Toxicology, University of Konstanz, P.O. Box X918, D-78457 Constance (Germany)]. E-mail: daniel.dietrich@uni-konstanz.de
2004-12-20
In this study, the immune reactions of rainbow trout (Oncorhynchus mykiss) were examined, after exposure to 10, 30 and 70% of tertiary-treated municipal sewage effluent for 27 days. Exposures were conducted concurrently with and without an immune challenge using intraperitoneal injections of inactivated Aeromonas salmonicida salmonicida. Due to the time required to prepare and analyse samples, fish sampling was conducted over two consecutive days. There was no trout mortality for any of the experimental treatments. The exposure to effluent increased in vitro lymphocyte proliferation, decreased circulating lymphocytes and increased degrading erythrocytes in peripheral blood samples. Circulating lymphocytes were only decreased in the sham-injected, but not in the A. salmonicida-injected group. In addition to effluent effects, circulating lymphocytes and lymphocyte proliferation were decreased on day 2 of sampling as compared to day 1. Concentration-dependent degradation of erythrocytes was only observed on day 2 of sampling. Capture and removal of trout on day 1 of sampling presumably caused low-level stress that affected some results on day 2. Oxidative burst, phagocytosis, lysozyme, leucocyte populations other than lymphocytes and A. salmonicida-specific IgM production were not affected by exposure to effluent, and of these parameters, only oxidative burst and total leucocytes showed sampling day effects. From these results it can be observed, that with the exception of oxidative burst, those variables affected by effluent exposure were also significantly changed by the low-level sampling stress imposed by staggered sampling. Elevated liver mixed-function oxygenase activity as measured by 7-ethoxyresorufin-O-deethylase activity, and increased bile polycyclic aromatic hydrocarbon (PAH) metabolites were observed in response to sewage effluent exposure. As both PAHs and stress are known immune suppressors, it is difficult to conclude whether or not changes in immune
Effects of treated sewage effluent on immune function in rainbow trout (Oncorhynchus mykiss)
International Nuclear Information System (INIS)
Hoeger, Birgit; Heuvel, Michael R. van den; Hitzfeld, Bettina C.; Dietrich, Daniel R.
2004-01-01
In this study, the immune reactions of rainbow trout (Oncorhynchus mykiss) were examined, after exposure to 10, 30 and 70% of tertiary-treated municipal sewage effluent for 27 days. Exposures were conducted concurrently with and without an immune challenge using intraperitoneal injections of inactivated Aeromonas salmonicida salmonicida. Due to the time required to prepare and analyse samples, fish sampling was conducted over two consecutive days. There was no trout mortality for any of the experimental treatments. The exposure to effluent increased in vitro lymphocyte proliferation, decreased circulating lymphocytes and increased degrading erythrocytes in peripheral blood samples. Circulating lymphocytes were only decreased in the sham-injected, but not in the A. salmonicida-injected group. In addition to effluent effects, circulating lymphocytes and lymphocyte proliferation were decreased on day 2 of sampling as compared to day 1. Concentration-dependent degradation of erythrocytes was only observed on day 2 of sampling. Capture and removal of trout on day 1 of sampling presumably caused low-level stress that affected some results on day 2. Oxidative burst, phagocytosis, lysozyme, leucocyte populations other than lymphocytes and A. salmonicida-specific IgM production were not affected by exposure to effluent, and of these parameters, only oxidative burst and total leucocytes showed sampling day effects. From these results it can be observed, that with the exception of oxidative burst, those variables affected by effluent exposure were also significantly changed by the low-level sampling stress imposed by staggered sampling. Elevated liver mixed-function oxygenase activity as measured by 7-ethoxyresorufin-O-deethylase activity, and increased bile polycyclic aromatic hydrocarbon (PAH) metabolites were observed in response to sewage effluent exposure. As both PAHs and stress are known immune suppressors, it is difficult to conclude whether or not changes in immune
African Journals Online (AJOL)
made it possible to save very low-birth-weight (VLBW; <1 500 g) and extremely .... premature babies regardless of birth weight, even with a 50% chance of being handicapped if the child .... of adolescent children. J Pediatr 2000;137:701-. 706.
REFLEX : A metacognitive group treatment to improve insight in psychosis
Pijnenborg, M.; Van der Meer, L.; De Vos, A.; Bockting, C. L. H.; Van der Gaag, M.; Aleman, A.
2013-01-01
Background: Many people with schizophrenia (50-80%) demonstrate impaired insight. A number of interventions aiming to improve insight have been proposed and evaluated, for example cognitive behavioral therapy and psycho-education. Results of these interventions leave room for improvement. Therefore,
A Network Perspective on Individual-Level Ambidexterity in Organizations
DEFF Research Database (Denmark)
Rogan, Michelle; Mors, Marie Louise
2014-01-01
in the internal and external networks of 79 senior managers in a management consulting firm revealed significant differences in the density, contact heterogeneity, and informality of ties in the networks of senior managers who engaged in both exploration and exploitation compared with managers that predominately......Addressing the call for a deeper understanding of ambidexterity at the individual level, we propose that managers’ networks are an important yet understudied factor in the ability to balance the trade-off between exploring for new business and exploiting existing business. Analyses of 1,449 ties...... explored or exploited. The findings suggest that managers’ networks are important levers for their ability to behave ambidextrously and offer insights into the microfoundations of organizational ambidexterity....
Proteus, New Insights for a New Age
National Research Council Canada - National Science Library
Waddell, William; Kim, Joanne; Smith, Jack
2004-01-01
.... The Proteus concept offers a range of new insights that, when used in the planning process, will assist military, intelligence, and industry leaders in their efforts to prepare for future success...
Weber, Keith
2010-01-01
Many mathematics educators have noted that mathematicians do not only read proofs to gain conviction but also to obtain insight. The goal of this article is to discuss what this insight is from mathematicians' perspective. Based on interviews with nine research-active mathematicians, two sources of insight are discussed. The first is reading a…
Measuring cognitive insight in schizophrenia and bipolar disorder: a comparative study
Engh, John A; Friis, Svein; Birkenaes, Astrid B; Jónsdóttir, Halldóra; Ringen, Petter A; Ruud, Torleif; Sundet, Kjetil S; Opjordsmoen, Stein; Andreassen, Ole A
2007-01-01
Background Beck Cognitive Insight Scale (BCIS) has been designed for assessment of self-reflection on patients' anomalous experiences and interpretations of own beliefs. The scale has been developed and validated for patients with schizophrenia. We wanted to study the utility of the scale for patients with bipolar disorder. The relationship between the BCIS as a measure of cognitive insight and established methods for assessment of insight of illness was explored in both di...
The Association of Insight and Change in Insight with Clinical Symptoms in Depressed Inpatients.
He, Hongbo; Chang, Qing; Ma, Yarong
2018-04-25
Lack of insight has been extensively studied and was found to be adversely correlated with impaired treatment compliance and worse long term clinical outcomes among patients with schizophrenia, while not much is known about this phenonmenon in patients with severe depression. To explore the correlates of insight and its relation to symptom changes among the most seriously ill patients with affective disorders, those who require hospitalization. Patients hospitalized in a large psychiatric hospital in south China with either major depressive disorder (MDD)(N=55) or bipolar depression (BD) (N=85) based on ICD-10 diagnostic criteria were assessed with the Insight and Treatment Attitudes Questionnaire (ITAQ) one week after admission and at the time of discharge. Clinical symptoms were measured at the same time with the Hamilton Rating Scale for Depression (HAMD-17) and the Depression subscale of the Symptom Check list-90 (SCL-90). Length of stay (LOS), duration of illness, duration of untreated mood disorder, number of previous episodes of depression and previous admissions for depression were documented during interviews with patients and their families and from a review of medical records. Bivariate correlations and multiple regression analysis were used to examine the relationship of sociodemographic characteristics, clinical symptomatology and clinical history, to insight at the time of admission. The relationships between change in clinical symptoms and change in insight from admission to discharge were also examined. Stepwise multiple regression models suggested that any previous admissions for depression and higher anxiety factor scores on the HAMD-17 are significant independent predictors of insight accounting for 22.9% of the variance. Multiple regression analysis residual change scores (change scores adjusted for baseline values) on the ITAQ showed that improved insight over average stays of 51 days were inversely related to the residual psychomotor
Parental insightfulness: retrospect and prospect.
Koren-Karie, Nina; Oppenheim, David
2018-06-01
We open this introductory paper to the special issue with the theoretical and clinical roots of the insightfulness concept. Next, the Insightfulness Assessment (IA) is presented, followed by a review of key empirical findings supporting the IA. The central points in the papers in this special issue are reviewed next. These include the use of the IA with parents of children ranging in age from infancy to adolescence, its applicability outside the parent-child relationship (e.g. insightfulness toward a close friend), its use with high-risk mothers, and the usefulness of insightfulness both as a continuous and a categorical measure. The clinical applications of the IA are discussed, and we close with future directions for IA research.
PRA insights applicable to the design of a broad applications test reactor
International Nuclear Information System (INIS)
Khericha, S.T.; Reilly, H.J.
1993-01-01
Design insights applicable to the design of a new Broad Applications Test Reactor (BATR), studied during Fiscal Years 1992 an d1993 at Idaho National Engineering Laboratory (INEL), are summarized. Sources of design insights include past probabilistic risk assessments (PRAs) and related studies for Department of Energy (DOE)-owned Class A reactors and for commercial reactors. The report includes preliminary risk allocations for the BATR. The survey addressed those design insights that would affect the reactor core damage frequency (CDF). The design insights, while selected specifically for BATR, should be applicable to any new advanced test reactor
Konsztowicz, Susanna; Schmitz, Norbert; Lepage, Martin
2018-03-10
Insight in schizophrenia is regarded as a multidimensional construct that comprises aspects such as awareness of the disorder and recognition of the need for treatment. The proposed number of underlying dimensions of insight is variable in the literature. In an effort to identify a range of existing dimensions of insight, we conducted a factor analysis on combined items from multiple measures of insight. We recruited 165 participants with enduring schizophrenia (treated for >3years). Exploratory factor analysis was conducted on itemized scores from two interviewer-rated measures of insight: the Schedule for the Assessment of Insight-Expanded and the abbreviated Scale to assess Unawareness of Mental Disorder; and two self-report measures: the Birchwood Insight Scale and the Beck Cognitive Insight Scale. A five-factor solution was selected as the best-fitting model, with the following dimensions of insight: 1) awareness of illness and the need for treatment; 2) awareness and attribution of symptoms and consequences; 3) self-certainty; 4) self-reflectiveness for objectivity and fallibility; and 5) self-reflectiveness for errors in reasoning and openness to feedback. Insight in schizophrenia is a multidimensional construct comprised of distinct clinical and cognitive domains of awareness. Multiple measures of insight, both clinician- and self-rated, are needed to capture all of the existing dimensions of insight. Future exploration of associations between the various dimensions and their potential determinants will facilitate the development of clinically useful models of insight and effective interventions to improve outcome. Copyright © 2018 Elsevier B.V. All rights reserved.
Insights into business student's book
Lannon, Michael; Trappe, Tonya
1993-01-01
With Challenging reading and listening texts from a range of authentic business sources, New Insights into Business will really engage your students. The thorough language and vocabulary syllabus together with the strong focus on business skills development gives students everything they need to function effectively in the workplace. New Insights into Business is a self-contained course and is also an ideal follow-on to First Insights into Business.
High Concentration of Red Clay as an Alternative for Antibiotics in Aquaculture.
Jung, Jaejoon; Jee, Seung Cheol; Sung, Jung-Suk; Park, Woojun
2016-01-01
The use of antibiotics in aquaculture raises environmental and food safety concerns because chronic exposure of an aquatic ecosystem to antibiotics can result in the spread of antibiotic resistance, bioaccumulation of antibiotics in the organisms, and transfer of antibiotics to humans. In an attempt to overcome these problems, high-concentration red clay was applied as an alternative antibiotic against the following common fish pathogens: Aeromonas salmonicida, Vibrio alginolyticus, and Streptococcus equinus. The growth of A. salmonicida and V. alginolyticus was retarded by red clay, whereas that of S. equinus was promoted. Phase contrast and scanning electron microscopy analyses confirmed the attachment of red clay on cell surfaces, resulting in rapid gravitational removal and cell surface damage in both A. salmonicida and V. alginolyticus, but not in S. equinus. Different cell wall properties of grampositive species may explain the unharmed cell surface of S. equinus. Significant levels of oxidative stress were generated in only the former two species, whereas significant changes in membrane permeability were found only in S. equinus, probably because of its physiological adaptation. The bacterial communities in water samples from Oncorhynchus mykiss aquacultures supplemented with red clay showed similar structure and diversity as those from oxytetracycline-treated water. Taken together, the antibiotic effects of high concentrations of red clay in aquaculture can be attributed to gravitational removal, cell surface damage, and oxidative stress production, and suggest that red clay may be used as an alternative for antibiotics in aquaculture.
Mehdizadeh, Mahsa; Rezaei, Omid
2016-01-01
According to the previous findings, the third-person technique improved the clinical insight of psychotic patients, therefore the present study aims to examine the effect of a third-person interview compared to a first-person interview on the level of cognitive insight of psychotic patients with an insight at the denial level. In this study, using interviews and questionnaires, a total number of 44 patients of Razi Psychiatric Educational and Treatment Center with an insight at the denial level being assessed using diagnostic interviews were divided randomly into two groups. Then, the two groups of patients' cognitive insights were evaluated using Beck Cognitive Insight Scale. The findings indicated that in psychotic patients with an insight at the denial level, the third-person technique of interview compared to the first-person had little effect on the improvement of overall cognitive insight and its components, including self-reflection and self-assurance; however, this effect was not strong enough to make a significant difference between the two groups of patients. According to the study findings, we can conclude that the third-person interview compared to the first-person interview has no effect on the improvement of the cognitive insight of psychotic patients with an insight at the denial level. This finding is consistent with the previous studies indicating that although the theory of mind has some correlations with the clinical insight of patients, it has no effect on their cognitive insight.
Changes in insight during treatment for psychotic disorders : A meta-analysis
Pijnenborg, Gerdina H. M.; van Donkersgoed, Rozanne J. M.; David, Anthony S.; Aleman, Andre
Objective: Poor insight, or awareness of illness, has a negative impact on the outcome of the psychosis, and is therefore a logical target for treatment. A meta-analysis of the effect of psychological and pharmacological treatments on insight in psychosis was conducted to give a comprehensive
Rothmaler, Katrin; Nigbur, Roland; Ivanova, Galina
2017-01-27
Insight refers to a situation in which a problem solver immediately changes his understanding of a problem situation. This representational change can either be triggered by external stimuli, like a hint or the solution itself, or by internal solution attempts. In the present paper, the differences and similarities between these two phenomena, namely "extrinsic" and "intrinsic" insight, are examined. To this end, electroencephalogram (EEG) is recorded while subjects either recognize or generate solutions to German verbal compound remote associate problems (CRA). Based on previous studies, we compare the alpha power prior to insightful solution recognition with the alpha power prior to insightful solution generation. Results show that intrinsic insights are preceded by an increase in alpha power at right parietal electrodes, while extrinsic insights are preceded by a respective decrease. These results can be interpreted in two ways. In consistency with other studies, the increase in alpha power before intrinsic insights can be interpreted as an increased internal focus of attention. Accordingly, the decrease in alpha power before extrinsic insights may be associated with a more externally oriented focus of attention. Alternatively, the increase in alpha power prior to intrinsic insights can be interpreted as an active inhibition of solution-related information, while the alpha power decrease prior to extrinsic insights may reflect its activation. Regardless of the interpretation, the results provide strong evidence that extrinsic and intrinsic insight differ on the behavioral as well as the neurophysiological level. Copyright © 2016 Elsevier Ltd. All rights reserved.
Self-disorders and schizophrenia: a phenomenological reappraisal of poor insight and noncompliance.
Henriksen, Mads G; Parnas, Josef
2014-05-01
Poor insight into illness is considered the primary cause of treatment noncompliance in schizophrenia. In this article, we critically discuss the predominant conceptual accounts of poor insight, which consider it as an ineffective self-reflection, caused either by psychological defenses or impaired metacognition. We argue that these accounts are at odds with the phenomenology of schizophrenia, and we propose a novel account of poor insight. We suggest that the reason why schizophrenia patients have no or only partial insight and consequently do not comply with treatment is rooted in the nature of their anomalous self-experiences (ie, self- disorders) and the related articulation of their psychotic symptoms. We argue that self-disorders destabilize the patients' experiential framework, thereby weakening their basic sense of reality (natural attitude) and enabling another sense of reality (solipsistic attitude) to emerge and coexist. This coexistence of attitudes, which Bleuler termed "double bookkeeping," is, in our view, central to understanding what poor insight in schizophrenia really is. We suggest that our phenomenologically informed account of poor insight may have important implications for early intervention, psychoeducation, and psychotherapy for schizophrenia.
Isolation of putative probionts from cod rearing environment
DEFF Research Database (Denmark)
Lauzon, H.L.; Gudmundsdottir, S.; Pedersen, M.H.
2008-01-01
, metabolite production and adhesion to fish cell lines. Our study demonstrated that 14% of screened bacteria (n = 188) had antagonistic properties towards fish pathogens. The majority of these isolates were Gram-positive (81%), belonging to Firmicutes (69.2%) and Actinobacteria (11.5%) phyla based on 16S r...... was designed to search for new probiotics to target this critical period in cod rearing. Potential probionts were selected from the naturalmicrobiota of cod aquacultural environment. The selection was based on several criteria: pathogen inhibition potential, growth characteristics, strain identification......RNA gene sequencing. Only 6 (3.2%) of 188 isolates could inhibit all three pathogens tested: Vibrio anguillarum, Aeromonas salmonicida subsp. achromogenes and Vibrio salmonicida. Differences observed in activity intensity and spectrum among inhibitory isolates emphasise the need to develop probiotic...
Lien, Y-J; Chang, H-A; Kao, Y-C; Tzeng, N-S; Lu, C-W; Loh, C-H
2018-04-01
Poor insight is prevalent in patients with schizophrenia and has been associated with acute illness severity, medication non-adherence and poor treatment outcomes. Paradoxically, high insight has been associated with various undesirable outcomes, including low self-esteem, depression and low subjective quality of life (QoL) in patients with schizophrenia. Despite the growing body of studies conducted in Western countries supporting the pernicious effects of improved insight in psychosis, which bases on the level of self-stigma, the effects are unclear in non-Western societies. The current study examined the role of self-stigma in the relationship between insight and psychosocial outcomes in a Chinese population. A total of 170 outpatients with schizophrenia spectrum disorders were recruited from two general university hospitals. Sociodemographic data and clinical variables were recorded and self-report scales were employed to measure self-stigma, depression, insight, self-esteem and subjective QoL. Structural equation modelling (SEM) was used to analyse the cross-sectional data. High levels of self-stigma were reported by 39% of the participants (n = 67). The influences of insight, self-stigma, self-esteem and depression on subjective QoL were confirmed by the SEM results. Our model with the closest fit to the data (χ 2 = 33.28; df = 20; p = 0.03; χ 2/df = 1.66; CFI = 0.98; TLI = 0.97; RMSEA = 0.06) demonstrated that self-stigma might fully mediate the association of insight with low self-esteem, depression and poor subjective QoL. High insight into illness contributed to self-stigma, which caused low self-esteem and depression and, consequently, low QoL. Notably, insight did not directly affect self-esteem, depression or QoL. Furthermore, the association of insight with poor psychosocial outcomes was not moderated by self-stigma. Our findings support the mediating model of insight relevant to the poor psychosocial outcomes of individuals diagnosed with
Course of insight in manic episode
Directory of Open Access Journals (Sweden)
A Kumar
2013-01-01
Full Text Available Background: Insight is an important factor associated with non compliance and poor outcome. Poor level of insight has been described as a characteristic in patients with acute bipolar disorder with more unawareness in social consequences with increasing severity in manic episode. Aim: Main aim of study was to see the baseline and longitudinal relationship between dimensions of insight with improvement in psychopathology. Setting and Design: Forty four patients diagnosed with mania, were selected from an inpatient setting at Institute of Mental Health and Hospital, Agra with mean age of 31.07(±9.00 years. They were assessed at base line and were followed up weekly or psychopathology and insight. Materials and Methods: The Young′s mania rating scale for psychopathology and insight was assessed on three dimensions of SUMD. Results: Twenty five patients eventually completed the study. There was a positive correlation with global insight and with psychopathology consistent in longitudinal follow-up (P<0.05, but not correlating for awareness for achieved effect of medication and social consequences. Linear regression showed a positive relationship at the first and second week of assessment of SUMD and YMRS scores (P=0.001; 0.019. Conclusion: Improvement in insight is graded in a manic episode as compared to psychopathology. There is slower improvement in awareness of social consequences of mental disorder. It means that improvement in psychopathology may not necessarily indicate remission and need further supervision to improve insight and hence monitoring.
2013-01-01
Background Factors predicting treatment outcome in pediatric patients with obsessive-compulsive disorder (OCD) include disease severity, functional impairment, comorbid disorders, insight, and family accommodation (FA). Treatment of pediatric OCD is often only partly successful as some of these predictors are not targeted with conventional therapy. Among these, insight and FA were identified to be modifiable predictors of special relevance to pediatric OCD. Despite their clinical relevance, insight and FA remain understudied in youth with OCD. This study examined the clinical correlates of insight and FA and determined whether FA mediates the relationship between symptom severity and functional impairment in pediatric OCD. Methods This was a cross-sectional, outpatient study. Thirty-five treatment-naive children and adolescentswith DSM-IV diagnosis of OCD (mean age: 13.11 ± 3.16; 54.3% males) were included. Standard questionnaires were administered for assessing the study variables. Insight and comorbidities were assessed based on clinician’s interview. Subjects were categorized as belonging to a high insight or a low insight group, and the differences between these two groups were analyzed using ANOVA. Pearson’s correlation coefficients were calculated for the remaining variables of interest. Mediation analysis was carried out using structural equation modeling. Results Relative to those in the high insight group, subjects in the low insight group were younger, had more severe disease and symptoms, and were accommodated to a greater extent by their families. In addition, comorbid depression was more frequent in subjects belonging to the low insight group. Family accommodation was positively related to disease severity, symptom severity, and functional impairment. Family accommodation totally mediated the relationship between symptom severity and functional impairment. Conclusions Results support the differences in the diagnostic criteria between adult and
An evolutionary explanation of the value premium puzzle
Hens, Thorsten; Lensberg, Terje; Schenk-Hoppé, Klaus Reiner; Wöhrmann, Peter
2011-01-01
As early as 1934 Graham and Dodd conjectured that excess returns from value investment originate from a tendency of stock prices to converge towards a fundamental value. This paper confirms their insights within the evolutionary finance model of Evstigneev et al. (Econ Theory 27:449–468, (Evstigneev et al. 2006)). Our empirical results show the predictive power of the evolutionary benchmark valuation for the relative market capitalization and its dynamics in the sample of firms listed in the ...
Right frontal gamma and beta band enhancement while solving a spatial puzzle with insight.
Rosen, A; Reiner, M
2017-12-01
Solving a problem with an "a-ha" effect is known as insight. Unlike incremental problem solving, insight is sudden and unique, and the question about its distinct brain activity, intrigues many researchers. In this study, electroencephalogram signals were recorded from 12 right handed, human participants before (baseline) and while they solved a spatial puzzle known as the '10 coin puzzle' that could be solved incrementally or by insight. Participants responded as soon as they reached a solution and reported whether the process was incremental or by sudden insight. EEG activity was recorded from 19 scalp locations. We found significant differences between insight and incremental solvers in the Gamma and Beta 2 bands in frontal areas (F8) and in the alpha band in right temporal areas (T6). The right-frontal gamma indicates a process of restructuring which leads to an insight solution, in spatial problems, further suggesting a universal role of gamma in restructuring. These results further suggest that solving a spatial puzzle via insight requires exclusive brain areas and neurological-cognitive processes which may be important for meta-cognitive components of insight solutions, including attention and monitoring of the solution. Copyright © 2016 Elsevier B.V. All rights reserved.
Environmental factors affecting challenge success in vaccination studies
DEFF Research Database (Denmark)
Chettri, J. K.; Skov, J.; Dalsgaard, Inger
2013-01-01
We have tested the efficacies of two different vaccines (a commercial versus an experimental vaccine – both being oil adjuvanted) for rainbow trout against furunculosis caused by Aeromonas salmonicida infections. However, when challenging fish with live bacteria in order to assess protection...
Measuring cognitive insight in schizophrenia and bipolar disorder: a comparative study
Directory of Open Access Journals (Sweden)
Jónsdóttir Halldóra
2007-12-01
Full Text Available Abstract Background Beck Cognitive Insight Scale (BCIS has been designed for assessment of self-reflection on patients' anomalous experiences and interpretations of own beliefs. The scale has been developed and validated for patients with schizophrenia. We wanted to study the utility of the scale for patients with bipolar disorder. The relationship between the BCIS as a measure of cognitive insight and established methods for assessment of insight of illness was explored in both diagnostic groups. Methods The BCIS self-report inventory was administered to patients with schizophrenia (n = 143, bipolar disorder (n = 92 and controls (n = 64. The 15 items of the inventory form two subscales, self-reflectiveness and self-certainty. Results The internal consistency of the subscales was good for the patient groups and the controls. The mean subscale scores were not significantly different for the three groups. Four items in subscale self-reflectiveness referring to psychotic experiences gave, however, different results in the control subjects. Self-certainty and scores on insight item PANSS correlated significantly in the schizophrenia, but not in the bipolar group. Conclusion BCIS with its two subscales seems applicable for patients with bipolar disorder as well as for patients with schizophrenia. The self-report inventory can also be applied to control subjects if the items referring to psychotic experiences are omitted. In schizophrenia high scores on self-certainty is possibly associated with poor insight of illness. For the bipolar group the subscales are largely independent of traditional insight measures.
Self-disorders and Schizophrenia: A Phenomenological Reappraisal of Poor Insight and Noncompliance
Henriksen, Mads G.; Parnas, Josef
2013-01-01
Poor insight into illness is considered the primary cause of treatment noncompliance in schizophrenia. In this article, we critically discuss the predominant conceptual accounts of poor insight, which consider it as an ineffective self-reflection, caused either by psychological defenses or impaired metacognition. We argue that these accounts are at odds with the phenomenology of schizophrenia, and we propose a novel account of poor insight. We suggest that the reason why schizophrenia patient...
DEFF Research Database (Denmark)
Hansen, E.H.; Albertsen, Line; Johansen, Charlotte
2003-01-01
, to antimicrobial compounds. The Curvularia haloperoxidase system caused several-log-unit reductions in counts of bacteria (Pseudomonas spp., Escherichia coli, Serratia marcescens, Aeromonas salmonicida, Shewanella putrefaciens, Staphylococcus epidermidis, and Listeria monocytogenes), yeasts (Candida sp....... and Rhodotorula sp.), and filamentous fungi (Aspergillus niger, Aspergillus tubigensis, Aspergillus versicolor, Fusarium oxysporum, Penicillium chrysogenum, and Penicillium paxilli) cultured in suspension. Also, bacteria adhering to the surfaces of contact lenses were killed. The numbers of S. marcescens and S...
Directory of Open Access Journals (Sweden)
Katre ÇAMLI
2012-03-01
Full Text Available Objective: The aim of the present study was to test hypothesis that obsessive compulsive disorder (OCD patients who have autogenous obsessions and reactive obsessions show different sociodemographic and clinical characteristics with different insight and cognitive insight levels. Method: Sixty-one patients diagnosed as OCD according to the Structured Clinical Interview for DSM-III-R (SCID-I are recruited. 31 patients had reactive obsessions and 30 had autogenous obsessions. The sociodemographic characteristics of patients and the symptomatology were evaluated using psychiatric scales including SCID-I, Yale Brown Obsessive- Compulsive Scale (YBOCS, Yale Brown Obsessive-Compulsive Scale-Symptom Checklist (YBOCS-SC and Beck Insight Scale. Results: The percentage of women in reactive obsessive group was higher and also this group had significantly less antipsychotic medication prescribed than the autogenous obsessive group. No significant difference was found for the other demographic variables. No significant difference was identified for the Beck Insight Self-Reflectiveness subscale but for the Self-Certainty subscale, reactive obsessives had higher scores. Although there was no significant difference for the composit index points, which is the subtraction of the two subscales, the p value was close to the limit. On the other hand YBOCS item- 11 scores which evaluates insight were higher in autogenous obsessives meaning low levels of insight. Conclusion: For the sociodemographic and clinical characteristics; there was no significant difference between the groups except gender distribution and antipsychotic medication. Our data about insight seems inconsistent but insight and cognitive insight can be different entities which show different levels of insight. Further investigation with different obsession types is needed.
Giotakos, O
2017-01-01
A variety of phenomena might be considered as reflecting impaired insight in psychosis, like failure to recognize signs, symptoms or disease, failure to derive appropriate cognitive representations, despite recognition of the disease, and misattribution of the source or cause of the disease. The unawareness of tardive dyskinesia symptoms in schizophrenic patients points that self-awareness deficits in schizophrenia may be domain specific. Poor insight is an independent phenomenological and a prevalent feature in psychotic disorders in general, and in schizophrenia in particular, but we don't know yet if delusions in schizophrenia are the result of an entirely normal attempt to account for abnormal perceptual experiences or a product of abnormal experience but of normal reasoning. The theoretical approaches regarding impaired insight include the disturbed perceptual input, the impaired linkage between thought and emotion and the breakdown of the process of self-monitoring and error checking. The inability to distinguish between internally and externally generated mental events has been described by the metarepresentation theory. This theory includes the awareness of ones' goals, which leads to disorders of willed action, the awareness of intention, which leads to movement disorders, and the awareness of intentions of others, which leads to paranoid delusions. The theory of metarepresentation implies mainly output mechanisms, like the frontal cortex, while the input mechanism implies posterior brain systems, including the parietal lobe. There are many similarities between the disturbances of awareness seen in schizophrenia and those seen as a result of known neurological impairment. Neuropsychological models of impaired insight typically attribute the disturbance to any of a variety of core deficits in the processing of information. In this respect, lack of insight is on conceptual par with alogia, apraxia or aphasia in reflecting disturbed cognitive processing. In
Genetic correlates of insight in schizophrenia.
Xavier, Rose Mary; Vorderstrasse, Allison; Keefe, Richard S E; Dungan, Jennifer R
2018-05-01
Insight in schizophrenia is clinically important as it is associated with several adverse outcomes. Genetic contributions to insight are unknown. We examined genetic contributions to insight by investigating if polygenic risk scores (PRS) and candidate regions were associated with insight. Schizophrenia case-only analysis of the Clinical Antipsychotics Trials of Intervention Effectiveness trial. Schizophrenia PRS was constructed using Psychiatric Genomics Consortium (PGC) leave-one out GWAS as discovery data set. For candidate regions, we selected 105 schizophrenia-associated autosomal loci and 11 schizophrenia-related oligodendrocyte genes. We used regressions to examine PRS associations and set-based testing for candidate analysis. We examined data from 730 subjects. Best-fit PRS at p-threshold of 1e-07 was associated with total insight (R 2 =0.005, P=0.05, empirical P=0.054) and treatment insight (R 2 =0.005, P=0.048, empirical P=0.048). For models that controlled for neurocognition, PRS significantly predicted treatment insight but at higher p-thresholds (0.1 to 0.5) but did not survive correction. Patients with highest polygenic burden had 5.9 times increased risk for poor insight compared to patients with lowest burden. PRS explained 3.2% (P=0.002, empirical P=0.011) of variance in poor insight. Set-based analyses identified two variants associated with poor insight- rs320703, an intergenic variant (within-set P=6e-04, FDR P=0.046) and rs1479165 in SOX2-OT (within-set P=9e-04, FDR P=0.046). To the best of our knowledge, this is the first study examining genetic basis of insight. We provide evidence for genetic contributions to impaired insight. Relevance of findings and necessity for replication are discussed. Copyright © 2017 Elsevier B.V. All rights reserved.
Insight in schizophrenia: involvement of self-reflection networks?
van der Meer, Lisette; de Vos, Annerieke E; Stiekema, Annemarie P M; Pijnenborg, Gerdina H M; van Tol, Marie-José; Nolen, Willem A; David, Anthony S; Aleman, André
2013-11-01
Impaired insight is a common feature in psychosis and an important predictor of variables such as functional outcome, prognosis, and treatment adherence. A cognitive process that may underlie insight in psychosis is self-reflection, or the conscious evaluation of one's traits and characteristics. The current study aims to investigate the neural correlates of self-reflective processing and its relationship with insight in schizophrenia. Forty-seven schizophrenia patients and 21 healthy controls performed a self-reflection task in a functional magnetic resonance imaging (fMRI) scanner. The tasks comprised a self-reflection, close other-reflection, and a semantic (baseline) condition. Insight scores were obtained with the Schedule of Assessment of Insight Expanded. In addition, cognitive insight scores were obtained (Beck Cognitive Insight Scale [BCIS]). Schizophrenia patients demonstrated less activation in the posterior cingulate cortex in the self- and other-reflection conditions and less activation in the precuneus in the other-reflection condition compared with healthy controls. Better insight was associated with greater response in the inferior frontal gyrus, anterior insula, and inferior parietal lobule during self-reflection. In addition, better cognitive insight was associated with higher activation in ventromedial prefrontal cortex during self-reflection. In the current study, evidence for a relationship between self-reflection and insight in patients with schizophrenia was found in brain areas related to self-reflection, self/other distinction and source attribution. The findings support the rationale for a treatment that is currently under evaluation, which attempts to increase insight by enhancing self-reflection.
Obsessive-compulsive skin disorders: a novel classification based on degree of insight.
Zhu, Tian Hao; Nakamura, Mio; Farahnik, Benjamin; Abrouk, Michael; Reichenberg, Jason; Bhutani, Tina; Koo, John
2017-06-01
Individuals with obsessive-compulsive features frequently visit dermatologists for complaints of the skin, hair or nails, and often progress towards a chronic relapsing course due to the challenge associated with accurate diagnosis and management of their psychiatric symptoms. The current DSM-5 formally recognizes body dysmorphic disorder, trichotillomania, neurotic excoriation and body focused repetitive behavior disorder as psychodermatological disorders belonging to the category of Obsessive-Compulsive and Related Disorders. However there is evidence that other relevant skin diseases such as delusions of parasitosis, dermatitis artefacta, contamination dermatitis, AIDS phobia, trichotemnomania and even lichen simplex chronicus possess prominent obsessive-compulsive characteristics that do not necessarily fit the full diagnostic criteria of the DSM-5. Therefore, to increase dermatologists' awareness of this unique group of skin disorders with OCD features, we propose a novel classification system called Obsessive-Compulsive Insight Continuum. Under this new classification system, obsessive-compulsive skin manifestations are categorized along a continuum based on degree of insight, from minimal insight with delusional obsessions to good insight with minimal obsessions. Understanding the level of insight is thus an important first step for clinicians who routinely interact with these patients.
Directory of Open Access Journals (Sweden)
Júlia M. Fontenelle
2010-03-01
Full Text Available OBJETIVO: Atualizar os clínicos sobre a existência de um possível subtipo do transtorno obsessivo-compulsivo caracterizado por pouco insight. MÉTODO: Revisão opinativa baseada em estudos indexados na base de dados PubMed e PsychINFO, identificados por meio dos unitermos "obsessive-compulsive disorder" e "insight" ou "ego-dystonic" e publicados entre 1966 e outubro de 2009. Os resultados foram examinados de acordo com a estratégia utilizada para abordar o insight, i.e. categórica vs. dimensional. RESULTADOS: Análise dos estudos nos permitiu identificar pontos que colocam em dúvida a existência de um subtipo do transtorno obsessivo-compulsivo bem delimitado caracterizado por pouco insight. Estes pontos incluem 1 prevalência extremamente variável do transtorno obsessivo-compulsivo com insight reduzido encontrada em estudos categóricos, 2 homogeneidade dos achados fenotípicos (i.e. maior gravidade associados a baixo insight em estudos categóricos e dimensionais e 3 ausência de estudos que investigam "zonas de raridade" entre as formas de transtorno obsessivo-compulsivo com pouco e bom insight. CONCLUSÃO: Embora uma abordagem categórica do insight no transtorno obsessivo-compulsivo seja importante em ambientes clínicos, uma vez que neles existem demandas prementes para tomada de decisões, a abordagem dimensional do insight parece refletir de forma mais fidedigna o fenômeno apresentado pelos pacientes em tela.OBJECTIVE: To update clinicians regarding the existence of a putative subtype of obsessive-compulsive disorder based on poor insight. METHOD: Opinionative review based on studies indexed in the PubMed and PsychINFO databases, identified by means of the keywords "obsessive-compulsive disorder" AND "insight" OR "ego-syntonic", and published between 1966 and October 2009. The results were analyzed according to the approach adopted, i.e. a categorical or dimensional view of insight in obsessive-compulsive disorder. RESULTS: The
Innovative Leadership: Insights from a Learning Technologist
Campbell, Bruce
2012-01-01
Professor Ricardo Torres Kompen is a leading proponent for, and researcher in, personal learning environments (PLEs). During his interview, Torres Kompen clarified his research on PLEs, particularly the digital toolbox within PLEs. He elaborated on experiences with implementing PLE initiatives, personal insights on using social media and Web 2.0…
[Insight and psychiatric dangerousness: A review of the literature].
Bonnet, S; Lacambre, M; Schandrin, A; Capdevielle, D; Courtet, P
2017-04-01
Violence committed by individuals with severe mental illness has become an increasing focus of concern among clinicians, policy makers, and the general public, often as the result of tragic events. Research has shown in the past two decades an increased risk of violence among patients with mental disorder. Nevertheless, of those suffering from mental illness, perpetrators of other directed violence form a minority subgroup. The means by which there is this association between mental illness and violence has remained controversial. Factors such as positive psychotic symptoms, medication non-adherence, alcohol or psychoactive substance abuse and antisocial personality were found to be predictive of violence. Overall, literature provides support to the assertion that violent behavior of mentally ill patients is a heterogeneous phenomenon that is driven by multiple inter-related and independent factors. Furthermore, psychiatrists are often asked to predict an individual's future dangerousness, in a medical or a legal context. In the process of risk assessment of dangerousness, more focus has been placed on dynamic risk factor. In this context, lack of insight has established itself both as a part of violence risk models and as a clinical item in structured approaches to measure dangerousness. However, few studies have tested these associations. The main purpose of this paper is to review the literature concerning the relationship between insight and dangerousness and discuss the contributions of the insight in the assessment of dangerousness in patients with mental illness. We included twenty studies that evaluated the association between insight and variable such as physical or verbal violence, aggressiveness, hostility or sexual aggression. According to the findings of this review, the strength and specific nature of this relationship remain unclear due to considerable methodological and conceptual shortcomings, including heterogeneity in the definition and
Belvederi Murri, Martino; Amore, Mario; Calcagno, Pietro; Respino, Matteo; Marozzi, Valentina; Masotti, Mattia; Bugliani, Michele; Innamorati, Marco; Pompili, Maurizio; Galderisi, Silvana; Maj, Mario
2016-09-01
The so-called "insight paradox" posits that among patients with schizophrenia higher levels of insight are associated with increased levels of depression. Although different studies examined this issue, only few took in account potential confounders or factors that could influence this association. In a sample of clinically stable patients with schizophrenia, insight and depression were evaluated using the Scale to assess Unawareness of Mental Disorder and the Calgary Depression Scale for Schizophrenia. Other rating scales were used to assess the severity of psychotic symptoms, extrapyramidal symptoms, hopelessness, internalized stigma, self-esteem, and service engagement. Regression models were used to estimate the magnitude of the association between insight and depression while accounting for the role of confounders. Putative psychological and sociodemographic factors that could act as mediators and moderators were examined using the PROCESS macro. By accounting for the role of confounding factors, the strength of the association between insight into symptoms and depression increased from 13% to 25% explained covariance. Patients with lower socioeconomic status (F = 8.5, P = .04), more severe illness (F = 4.8, P = .03) and lower levels of service engagement (F = 4.7, P = .03) displayed the strongest association between insight and depression. Lastly, hopelessness, internalized stigma and perceived discrimination acted as significant mediators. The relationship between insight and depression should be considered a well established phenomenon among patients with schizophrenia: it seems stronger than previously reported especially among patients with lower socioeconomic status, severe illness and poor engagement with services. These findings may have relevant implications for the promotion of insight among patients with schizophrenia. © The Author 2016. Published by Oxford University Press on behalf of the Maryland Psychiatric Research Center. All rights reserved
Belvederi Murri, Martino; Amore, Mario; Calcagno, Pietro; Respino, Matteo; Marozzi, Valentina; Masotti, Mattia; Bugliani, Michele; Innamorati, Marco; Pompili, Maurizio; Galderisi, Silvana; Maj, Mario
2016-01-01
The so-called “insight paradox” posits that among patients with schizophrenia higher levels of insight are associated with increased levels of depression. Although different studies examined this issue, only few took in account potential confounders or factors that could influence this association. In a sample of clinically stable patients with schizophrenia, insight and depression were evaluated using the Scale to assess Unawareness of Mental Disorder and the Calgary Depression Scale for Schizophrenia. Other rating scales were used to assess the severity of psychotic symptoms, extrapyramidal symptoms, hopelessness, internalized stigma, self-esteem, and service engagement. Regression models were used to estimate the magnitude of the association between insight and depression while accounting for the role of confounders. Putative psychological and sociodemographic factors that could act as mediators and moderators were examined using the PROCESS macro. By accounting for the role of confounding factors, the strength of the association between insight into symptoms and depression increased from 13% to 25% explained covariance. Patients with lower socioeconomic status (F = 8.5, P = .04), more severe illness (F = 4.8, P = .03) and lower levels of service engagement (F = 4.7, P = .03) displayed the strongest association between insight and depression. Lastly, hopelessness, internalized stigma and perceived discrimination acted as significant mediators. The relationship between insight and depression should be considered a well established phenomenon among patients with schizophrenia: it seems stronger than previously reported especially among patients with lower socioeconomic status, severe illness and poor engagement with services. These findings may have relevant implications for the promotion of insight among patients with schizophrenia. PMID:27069064
Aripiprazole augmentation in poor insight obsessive-compulsive disorder: a case report
Directory of Open Access Journals (Sweden)
Vinciguerra Valentina
2008-12-01
Full Text Available Abstract Background Obsessive-compulsive disorder is associated with a relevant impairment in social and interpersonal functioning and severe disability. This seems to be particularly true for the poor insight subtype, characterised by a lack of consciousness of illness and, consequently, compliance with treatment. Poor responsiveness to serotonergic drugs in poor insight obsessive-compulsive patients may also require an augmentation therapy with atypical antipsychotics. Methods We reviewed a case in which a patient with a long history of poor insight obsessive-compulsive disorder was treated with a high dosage of serotonin reuptake inhibitors. Results The treatment resulted in a poor outcome. This patient was therefore augmentated with aripiprazole. Conclusion Doctors should consider aripiprazole as a possible augmentation strategy for serotonergic poor responder obsessive-compulsive patients, but further research on these subjects is needed.
Insight in Schizophrenia: Involvement of Self-Reflection Networks?
de Vos, Annerieke E.
2013-01-01
Background: Impaired insight is a common feature in psychosis and an important predictor of variables such as functional outcome, prognosis, and treatment adherence. A cognitive process that may underlie insight in psychosis is self-reflection, or the conscious evaluation of one’s traits and characteristics. The current study aims to investigate the neural correlates of self-reflective processing and its relationship with insight in schizophrenia. Methods: Forty-seven schizophrenia patients and 21 healthy controls performed a self-reflection task in a functional magnetic resonance imaging (fMRI) scanner. The tasks comprised a self-reflection, close other-reflection, and a semantic (baseline) condition. Insight scores were obtained with the Schedule of Assessment of Insight Expanded. In addition, cognitive insight scores were obtained (Beck Cognitive Insight Scale [BCIS]). Results: Schizophrenia patients demonstrated less activation in the posterior cingulate cortex in the self- and other-reflection conditions and less activation in the precuneus in the other-reflection condition compared with healthy controls. Better insight was associated with greater response in the inferior frontal gyrus, anterior insula, and inferior parietal lobule during self-reflection. In addition, better cognitive insight was associated with higher activation in ventromedial prefrontal cortex during self-reflection. Conclusion: In the current study, evidence for a relationship between self-reflection and insight in patients with schizophrenia was found in brain areas related to self-reflection, self/other distinction and source attribution. The findings support the rationale for a treatment that is currently under evaluation, which attempts to increase insight by enhancing self-reflection. PMID:23104865
Cozzi, Patrick
2012-01-01
Get Real-World Insight from Experienced Professionals in the OpenGL Community With OpenGL, OpenGL ES, and WebGL, real-time rendering is becoming available everywhere, from AAA games to mobile phones to web pages. Assembling contributions from experienced developers, vendors, researchers, and educators, OpenGL Insights presents real-world techniques for intermediate and advanced OpenGL, OpenGL ES, and WebGL developers. Go Beyond the Basics The book thoroughly covers a range of topics, including OpenGL 4.2 and recent extensions. It explains how to optimize for mobile devices, explores the design
Approaching the Distinction between Intuition and Insight.
Zhang, Zhonglu; Lei, Yi; Li, Hong
2016-01-01
Intuition and insight share similar cognitive and neural basis. Though, there are still some essential differences between the two. Here in this short review, we discriminated between intuition, and insight in two aspects. First, intuition, and insight are toward different aspects of information processing. Whereas intuition involves judgment about "yes or no," insight is related to "what" is the solution. Second, tacit knowledge play different roles in between intuition and insight. On the one hand, tacit knowledge is conducive to intuitive judgment. On the other hand, tacit knowledge may first impede but later facilitate insight occurrence. Furthermore, we share theoretical, and methodological views on how to access the distinction between intuition and insight.
Probabilistic safety assessment applications and insights
International Nuclear Information System (INIS)
Hitchler, M.J.; Burns, N.L.; Liparulo, N.J.; Mink, F.J.
1987-01-01
The insights gained through a comparison of seven PRA studies (Italian PUN, Sizewell B, Ringhals 2, Millstone 3, Zion 1 and 2, Oconee 3, and Seabrook) included insights regarding the adequacy of the PRA technology utilized in the studies and the potential areas for improvement and insights regarding the adequacy of plant designs and how PRA has been utilized to enhance the design and operation of nuclear power plants. (orig.)
Kaplan, Craig A.; Simon, Herbert A.
1990-01-01
Attaining the insight needed to solve the Mutilated Checkerboard problem, which requires discovery of an effective problem representation (EPR), is described. Performance on insight problems can be predicted from the availability of generators and constraints in the search for an EPR. Data for 23 undergraduates were analyzed. (TJH)
Directory of Open Access Journals (Sweden)
Fabio Marino
2016-10-01
Full Text Available Several compounds from marine organisms have been studied for their potential use in aquaculture. Among the red algae, Asparagopsis taxiformis is considered one of the most promising species for the production of bioactive metabolites with numerous proposed applications. Here, the in vitro antibacterial activity, the easy handling and the absence of adverse effects on marine fish species are reported. Depending on the seasonal period of sampling, ethanol extracts of A. taxiformis exhibited significantly different inhibitory activity against fish pathogenic bacteria. The extract obtained in late spring showed strong antibacterial activity against Aeromonas salmonicida subsp. salmonicida, Vibrio alginolyticus, and V. vulnificus, and moderate activity against Photobacterium damselae subsp. damselae, P. damselae subsp. piscicida, V. harveyi and V. parahaemolyticus. Sea bass and gilthead sea bream were fed with pellets supplied with algae and algal extracts. The absence of undesired effects was demonstrated. Hematological and biochemical investigations allowed to confirm that the whole alga and its extracts could be proposed for a future application in aquaculture.
Insights gained through probabilistic risk assessments
International Nuclear Information System (INIS)
Hitchler, M.J.; Burns, N.L.; Liparulo, N.J.; Mink, F.J.
1987-01-01
The insights gained through a comparison of seven probabilistic risk assessments (PRA) studies (Italian PUN, Sizewell B, Ringhals 2, Millstone 3, Zion 1 and 2, Oconee 3, and Seabrook) included insights regarding the adequacy of the PRA technology utilized in the studies and the potential areas for improvement and insights regarding the adequacy of plant designs and how PRA has been utilized to enhance the design and operation of nuclear power plants
INSIGHT AND SELF-STIGMA IN PATIENTS WITH SCHIZOPHRENIA.
Vidović, Domagoj; Brecić, Petrana; Vilibić, Maja; Jukić, Vlado
2016-03-01
Poor insight and high level of self-stigma are often present among patients with schizophrenia and are related to poorer treatment adherence, poorer social function and rehabilitation, aggressive behavior, higher level of depression, social anxiety, lower quality of life and self-esteem. Reports on a relationship between insight and stigma are controversial. We examined the relationship of the level of insight and self-stigma in a sample of 149 patients with schizophrenia. Insight was measured with the Scale to assess Unawareness of Mental Disorder and self-stigma with the Internalized Stigma of Mental Illness. Results showed 88.6% of the patients to have high or moderate insight, with a mean value of 2.73. General insight showed the highest level (2.58) and insight in positive symptoms the lowest level (2.9). The self-stigma score in general was 2.13, with stereotype endorsement being lowest (1.98). According to study results, 77.1% of patients felt minimal or low self-stigma across all subscales, except for stigma resistance subscale. Statistically significant correlation was found between insight and four subscales of self-stigma, while no correlation was found for the stigma resistance subscale only. These results imply the need of individually tailored antistigma and insight promoting programs for patients with schizophrenia.
Clinical correlates of loss of insight in bipolar depression
Directory of Open Access Journals (Sweden)
Rafael de Assis da Silva
Full Text Available Abstract Introduction Affective state may influence insight, especially regarding mania. Nevertheless, studies have so far suggested that depression seems not to significantly impair insight. To the best of our knowledge, this study pioneers the evaluation of how insight variations in bipolar depression correlate with clinical variables. Method A group of 165 bipolar patients, 52 of whom had depressive episodes according to DSM-5 criteria, were followed during a year. All patients underwent clinical assessment, and insight was evaluated through the Insight Scale for Affective Disorders (ISAD. Repeated-measures ANOVA was calculated comparing scores on the four ISAD factors (insight into symptoms, the condition itself, self-esteem and social relationships in order to investigate differences in insight according to different objects. Correlational analysis explored which clinical symptoms were linked to reduced insight. Results Worse total insight correlated with suicide attempt/ideation and fewer subsyndromal manic symptoms such as mood elevation, increased energy and sexual interest. Worse self-esteem insight was associated with not only suicide ideation/attempt but also with activity reduction and psychomotor retardation. Worse symptom insight also correlated with psychomotor retardation. Better insight into having an affective disorder was associated with more intense hypochondria symptoms. Finally, worse insight into having an illness was associated with psychotic episodes. Conclusion Our study found that symptoms other than psychosis – suicide ideation, psychomotor retardation and reduction of activity and work – correlate with insight impairment in bipolar depression.
Insight in psychosis: Metacognitive processes and treatment
de Vos, Annerieke
2016-01-01
Insight is impaired in 50- 80% of the patients with schizophrenia. Annerieke de Vos working at GGZ Drenthe and the University Medical Hospital Groningen, aimed to elucidate which processes underlie impaired insight and tried to improve insight in patients by targeting these processes. On September 21st she will defend her thesis entitled: "Insight in psychosis. Metacognitive processes and treatment.". Patients with impaired insight may fail to recognize that things in life are not going well ...
Blindness and Insight in King Lear
Institute of Scientific and Technical Information of China (English)
岳元玉
2008-01-01
This paper intends to explore how William Shakespeare illustrates the theme of blindness and insight in his great tragedy "King Lear".Four characters’ deeds and their fate are used as a case study to examine what blindness is,what insight is,and the relationship between the two.The writer finds that by depicting the characters’ deeds and their fate in a double plot,Shakespeare renders the folly of blindness,the transition from blindness to insight,and the use of reason and thought to understand the truth.
Gaziel, M; Hasson-Ohayon, I; Morag-Yaffe, M; Schapir, L; Zalsman, G; Shoval, G
2015-02-01
The purpose of the current study was to assess the associations of illness perception-related variables with satisfaction with life (SwL) among adolescents with mental disorders. Insight into mental disorder (SAI-E), Internalized stigma of mental illness (ISMI) and Multidimensional Students' Life Satisfaction Scale (MSLSS) were administrated to 30 adolescent patients. Adapted version for parents of the SAI-E was also administrated to 37 of their parents. Significant positive correlations were found between insight into the illness, self-stigma and parental insight. Insight and self-stigma were significantly negatively related to the total score of SwL and few of its dimensions while parental insight was significantly associated only with the SwL dimensions of school and self. Regression models revealed main negative effects of insight and self-stigma on SwL and no interaction effect. The possible independent contribution of insight and self-stigma to SwL should be addressed in interventions designed for family and adolescents coping with mental illness. Special attention should be given to the possible negative implications that insight possesses. In lack of support of the moderation role of self-stigma, reported in studies among adults with mental illness, future studies should trace other variables in order to further understand the insight paradox among adolescents. Copyright © 2014 Elsevier Masson SAS. All rights reserved.
Vohs, Jenifer L; Leonhardt, Bethany L; James, Alison V; Francis, Michael M; Breier, Alan; Mehdiyoun, Nikki; Visco, Andrew C; Lysaker, Paul H
2018-05-01
Poor insight impedes treatment in early phase psychosis (EPP). This manuscript outlines preliminary findings of an investigation of the novel metacognitively oriented integrative psychotherapy, Metacognitive Reflection and Insight Therapy, for individuals with early phase psychosis (MERIT-EP). Twenty adults with EPP and poor insight were randomized to either six months of MERIT-EP or treatment as usual (TAU). Therapists were trained and therapy was successfully delivered under routine, outpatient conditions. Insight, assessed before and after treatment, revealed significant improvement for the MERIT-EP, but not TAU, group. These results suggest MERIT-EP is feasible to deliver, accepted by patients, and leads to clinically significant improvements in insight. Copyright © 2017 Elsevier B.V. All rights reserved.
Pousa, Esther; Ochoa, Susana; Cobo, Jesús; Nieto, Lourdes; Usall, Judith; Gonzalez, Beatriz; Garcia-Ribera, Carles; Pérez Solà, Victor; Ruiz, Ada-I; Baños, Iris; Cobo, Jesús; García-Ribera, Carles; González, Beatriz; Massons, Carmina; Nieto, Lourdes; Monserrat, Clara; Ochoa, Susana; Pousa, Esther; Ruiz, Ada-Inmaculada; Ruiz, Isabel; Sanchez-Cabezudo, Dolores; Usall, Judith
2017-11-01
1. To describe insight in a large sample of schizophrenia subjects from a multidimensional point of view, including unawareness of general insight dimensions as well as unawareness and misattribution of particular symptoms. 2. To explore the relationship between unawareness and clinical and socio-demographic variables. 248 schizophrenia patients were assessed with the Positive and Negative Syndrome Scale (PANSS, five factor model of Lindenmayer) and the full Scale of Unawareness of Mental Disorder (SUMD). Bivariate associations and multiple linear regression analyses were used to investigate the relationship between unawareness, symptoms and socio-demographic variables. Around 40% of the sample showed unawareness of mental disorder, of the need for medication and of the social consequences. Levels of unawareness and misattribution of particular symptoms varied considerably. General unawareness dimensions showed small significant correlations with positive, cognitive and excitement factors of psychopathology, whereas these symptom factors showed higher correlations with unawareness of particular symptoms. Similarly, regression models showed a small significant predictive value of positive symptoms in the three general unawareness dimensions while a moderate one in the prediction of particular symptoms. Misattribution showed no significant correlations with any symptom factors. Results confirm that insight in schizophrenia is a multi-phased phenomenon and that unawareness into particular symptoms varies widely. The overlap between unawareness dimensions and psychopathology is small and seems to be restricted to positive and cognitive symptoms, supporting the accounts from cognitive neurosciences that suggest that besides basic cognition poor insight may be in part a failure of self-reflection or strategic metacognition. Copyright © 2017 Elsevier B.V. All rights reserved.
Nair, Akshay; Palmer, Emma Claire; Aleman, Andre; David, Anthony S.
The neurocognitive theory of insight posits that poor insight in psychotic illnesses is related to cognitive deficits in cognitive self-appraisal mechanisms. In this paper we perform a comprehensive meta-analysis examining relationships between clinical insight and neurocognition in psychotic
Improving insight and non-insight problem solving with brief interventions.
Wen, Ming-Ching; Butler, Laurie T; Koutstaal, Wilma
2013-02-01
Developing brief training interventions that benefit different forms of problem solving is challenging. In earlier research, Chrysikou (2006) showed that engaging in a task requiring generation of alternative uses of common objects improved subsequent insight problem solving. These benefits were attributed to a form of implicit transfer of processing involving enhanced construction of impromptu, on-the-spot or 'ad hoc' goal-directed categorizations of the problem elements. Following this, it is predicted that the alternative uses exercise should benefit abilities that govern goal-directed behaviour, such as fluid intelligence and executive functions. Similarly, an indirect intervention - self-affirmation (SA) - that has been shown to enhance cognitive and executive performance after self-regulation challenge and when under stereotype threat, may also increase adaptive goal-directed thinking and likewise should bolster problem-solving performance. In Experiment 1, brief single-session interventions, involving either alternative uses generation or SA, significantly enhanced both subsequent insight and visual-spatial fluid reasoning problem solving. In Experiment 2, we replicated the finding of benefits of both alternative uses generation and SA on subsequent insight problem-solving performance, and demonstrated that the underlying mechanism likely involves improved executive functioning. Even brief cognitive- and social-psychological interventions may substantially bolster different types of problem solving and may exert largely similar facilitatory effects on goal-directed behaviours. © 2012 The British Psychological Society.
Understanding Insight in the Context of Q
Coghlan, David
2012-01-01
In Revans' learning formula, L = P + Q, Q represents "questioning insight", by which Revans means that insight comes out of the process of questioning programmed knowledge (P) in the light of experience. We typically focus on the content of an insight rather than on the act of insight. Drawing primarily on the work of Bernard Lonergan this paper…
Proteus, New Insights for a New Age (Briefing Charts)
National Research Council Canada - National Science Library
Waddell, William O; Kim, Joanne; Smith, Jack
2004-01-01
.... The Proteus concept offers a range of new insights that, when used in the planning process, will assist military, intelligence, and industry leaders in their efforts to prepare for future success...
Palmer, Emma C; Gilleen, James; David, Anthony S
2015-08-01
Lack of insight is a commonly observed problem in patients with psychosis and schizophrenia. Clinical insight in patients has been associated with low mood. Cognitive insight is a recently defined concept, relating to the ability to self-reflect and the degree to which patients are over-confident regarding their interpretations of illness-related experiences, and is related to clinical insight. We therefore sought to investigate whether there is a positive relationship between cognitive insight and mood. A literature search identified 17 relevant papers published between 2004 and 2014. Our analysis indicated that there was a small but significant positive correlation between the composite index (CI) of the Beck Cognitive Insight Scale (BCIS) and depression scores, but this was driven by a significant positive relationship between depression and the BCIS self-reflection (SR) sub-scale, where low mood was related to higher SR scores. There was no significant relationship between the self-certainty sub-scale and depression. Post-hoc analysis indicated that different depression scales did not significantly affect the relationship with SR. Our results support the idea that cognitive insight is significantly related to mood in schizophrenia, and the effect size is similar to that between clinical insight and mood. Potential applications of this knowledge into treatment and rehabilitation are discussed and a model of cognitive insight is proposed. Copyright © 2015 Elsevier B.V. All rights reserved.
African Journals Online (AJOL)
Africa Insight is a quarterly, peer-reviewed journal of the Africa Institute of South Africa. It is accredited by the South African National Department of Higher Education and Training (DHET) and is indexed in the International Bibliography of Social Science (IBSS). It is a multi-disciplinary journal primarily focusing on African ...
Hyperons: Insights into baryon structures
International Nuclear Information System (INIS)
Lach, J.
1991-08-01
The baryon octet is composed mainly of hyperons. Modern high energy hyperon beams provide a tool for the study of hyperon static properties and interactions. Experiments with these beams have provided new insights into hyperon rare decays, magnetic moments, and interactions. These experiments provide us with insights into the strong, weak, and electromagnetic structure of the baryons. 65 refs., 45 figs., 5 tabs
Salvi, Carola; Cristofori, Irene; Grafman, Jordan; Beeman, Mark
2016-01-01
Previous studies showed that liberals and conservatives differ in cognitive style. Liberals are more flexible, and tolerant of complexity and novelty, whereas conservatives are more rigid, are more resistant to change, and prefer clear answers. We administered a set of compound remote associate problems, a task extensively used to differentiate problem-solving styles (via insight or analysis). Using this task, several researches have proven that self-reports, which differentiate between insight and analytic problem-solving, are reliable and are associated with two different neural circuits. In our research we found that participants self-identifying with distinct political orientations demonstrated differences in problem-solving strategy. Liberals solved significantly more problems via insight instead of in a step-by-step analytic fashion. Our findings extend previous observations that self-identified political orientations reflect differences in cognitive styles. More specifically, we show that type of political orientation is associated with problem-solving strategy. The data converge with previous neurobehavioural and cognitive studies indicating a link between cognitive style and the psychological mechanisms that mediate political beliefs.
Salvi, Carola; Cristofori, Irene; Grafman, Jordan; Beeman, Mark
2016-01-01
Previous studies showed that liberals and conservatives differ in cognitive style. Liberals are more flexible, and tolerant of complexity and novelty, whereas conservatives are more rigid, are more resistant to change, and prefer clear answers. We administered a set of compound remote associate problems, a task extensively used to differentiate problem-solving styles (via insight or analysis). Using this task, several researches have proven that self-reports, which differentiate between insight and analytic problem-solving, are reliable and are associated with two different neural circuits. In our research we found that participants self-identifying with distinct political orientations demonstrated differences in problem-solving strategy. Liberals solved significantly more problems via insight instead of in a step-by-step analytic fashion. Our findings extend previous observations that self-identified political orientations reflect differences in cognitive styles. More specifically, we show that type of political orientation is associated with problem-solving strategy. The data converge with previous neurobehavioural and cognitive studies indicating a link between cognitive style and the psychological mechanisms that mediate political beliefs. PMID:26810954
Epidémiologie de la furonculose des salmonidés.
Directory of Open Access Journals (Sweden)
DUBOIS-DARNAUDPEYS A.
1977-04-01
Full Text Available L'antagonisme bactérien dû à la flore d'accompagnement est le seul facteur jouant un rôle dans la dynamique des populations de A. salmonicida. L'action lytique des bactériophages ou de Bdellovibrio bacteriovorus est inactive sur cette bactérie.
The association of lifetime insight and cognition in psychosis.
Sánchez-Torres, Ana M; Zarzuela, Amalia; Peralta, Victor; Cuesta, Manuel J
2015-03-01
Poor insight has been related to poor course in psychosis. However, the role of cognition in insight remains unclear. The aim of this study was to examine the influence of cognition and lifetime psychopathological dimensions on insight in psychosis. We followed up 42 patients with psychotic disorders over 10years. Lifetime psychopathological dimensions and cognitive performance were assessed. Patients were divided into two groups by lifetime patterns of insight and compared with 42 healthy volunteers. Lower IQ and poorer social cognition were associated with higher risks of poorer lifetime insight of feeling ill and global insight respectively. Lifetime negative symptoms were associated with a higher risk of poorer lifetime insight into symptoms. Lifetime lack of insight is independent of cognitive impairment in specific domains, except for social cognition. Higher IQ may contribute to better lifetime awareness of illness, while better ability to manage emotions is involved in lifetime global insight. Copyright © 2014 Elsevier B.V. All rights reserved.
Insight and its relationship with stigma in psychiatric patients
Directory of Open Access Journals (Sweden)
Deepak K Mishra
2009-01-01
Full Text Available Background: The literature on insight has paid insufficient attention to the social experiences that are associated with receiving and endorsing a diagnosis of mental illness. The psychological and behavioral commitments associated with insight extend beyond agreeing with a diagnosis and accepting treatment to include taking on the identity of an individual diagnosed with mental illness. This study sought to examine the relationship between insight and stigma in psychiatric patients. Materials and Methods: Cross-sectional assessment of insight and stigma was done using the system adopted by Kaplan and Sadock in their comprehensive textbook of psychiatry and Felt Stigma Scale in 100 psychiatric patients (40 patients suffering from Bipolar affective disorder, 30 Schizophrenics, 20 Substance dependents and 10 with Obsessive Compulsive disorder. Results: It was found that the level of stigma felt by patients with insight was significantly higher than that felt by patients without insight. Conclusion: Though there is a certain extent of stigma present in patients without insight, as is expected, the level of stigma increases as the patients develop insight.
Bolide Airbursts as a Seismic Source for the 2018 Mars InSight Mission
Stevanović, J.; Teanby, N. A.; Wookey, J.; Selby, N.; Daubar, I. J.; Vaubaillon, J.; Garcia, R.
2017-10-01
In 2018, NASA will launch InSight, a single-station suite of geophysical instruments, designed to characterise the martian interior. We investigate the seismo-acoustic signal generated by a bolide entering the martian atmosphere and exploding in a terminal airburst, and assess this phenomenon as a potential observable for the SEIS seismic payload. Terrestrial analogue data from four recent events are used to identify diagnostic airburst characteristics in both the time and frequency domain. In order to estimate a potential number of detectable events for InSight, we first model the impactor source population from observations made on the Earth, scaled for planetary radius, entry velocity and source density. We go on to calculate a range of potential airbursts from the larger incident impactor population. We estimate there to be {˜} 1000 events of this nature per year on Mars. To then derive a detectable number of airbursts for InSight, we scale this number according to atmospheric attenuation, air-to-ground coupling inefficiencies and by instrument capability for SEIS. We predict between 10-200 detectable events per year for InSight.
Training the non-specialist music teacher: insights from a ...
African Journals Online (AJOL)
Training the non-specialist music teacher: insights from a Zimbabwean case study. ... music education in primary schools is taught by general classroom teachers, who ... JOURNAL OF THE MUSICAL ARTS IN AFRICA VOLUME 7 2010, 1–15 ...
IPE data base structure and insights
International Nuclear Information System (INIS)
Lehner, J.; Youngblood, R.
1993-01-01
A data base (the ''IPE Insights Data Base''), has been developed that stores data obtained from the Individual Plant Examinations (IPEs) which licensees of nuclear power plants are conducting in response to the Nuclear Regulatory Commission's (NRC) Generic Letter GL88-20. The data base, which is a collection of linked dbase files, stores information about individual plant designs, core damage frequency, and containment performance in a uniform, structured way. This data base can be queried and used as a computational tool to derive insights regarding the plants for which data is stored. This paper sets out the objectives of the IPE Insights Data Base, describes its structure and contents, illustrates sample queries, and discusses possible future uses
Characteristics of Kodak Insight, an F-speed intraoral film.
Ludlow, J B; Platin, E; Mol, A
2001-01-01
This study reports film speed, contrast, exposure latitude, resolution, and response to processing solution depletion of Kodak Insight intraoral film. Densitometric curves were generated by using International Standards Organization protocol. Additional curves were generated for Ultra-speed, Ektaspeed Plus, and Insight films developed in progressively depleted processing solutions. Eight observers viewed images of a resolution test tool for maximum resolution assessment. Images of an aluminum step-wedge were reviewed to determine useful exposure latitude. Insight's sensitivity in fresh automatic processor solutions places it in the F-speed group. An average gradient of 1.8 was found with all film types. Insight provided 93% of the useful exposure latitude of Ektaspeed Plus film. Insight maintained contrast in progressively depleted processing solutions. Like Ektaspeed Plus, Insight was able to resolve at least 20 line-pairs per millimeter. Under International Standards Organization conditions, Insight required only 77% of the exposure of Ektaspeed Plus film. Insight film provided stable contrast in depleted processing solutions.
Gray, Sarah A. O.; Forbes, Danielle; Briggs-Gowan, Margaret; Carter, Alice S.
2016-01-01
This study employed a relational post-traumatic stress frame to explore the co-contribution of young children’s exposure to violence and caregiver insightfulness on child behavioral outcomes in a high-risk, non-referred sample of caregivers and preschoolers (n = 64; mean age 3.83 years, SD = .77). Caregiver insightfulness did not have a main effect on child outcomes but did moderate the relation between violence exposure and child behavior across all observed outcomes. Violence-exposed children with non-insightful caregivers demonstrated higher caregiver-rated internalizing and externalizing behaviors and observer-rated negative affect than all other groups. Among children not exposed to violence, insightfulness was not related to children’s behavior problems or negative affect, suggesting violence-specific processes. Though cross-sectional, results suggest that the effects of violence and caregiver insightfulness on child outcomes are contingent on one another and that caregiver insightfulness may play a protective role in contexts of violence. PMID:26503175
Insight in psychosis : Metacognitive processes and treatment
de Vos, Annerieke
2016-01-01
Insight is impaired in 50- 80% of the patients with schizophrenia. Annerieke de Vos working at GGZ Drenthe and the University Medical Hospital Groningen, aimed to elucidate which processes underlie impaired insight and tried to improve insight in patients by targeting these processes. On September
Directory of Open Access Journals (Sweden)
Helen J Renaud
Full Text Available Nutritional intake is a fundamental determinant of health. Many studies have correlated excess caloric intake, as well as a high ratio of n-6:n-3 fatty acids, with detrimental health outcomes, such as the metabolic syndrome. In contrast, low-calorie diets have beneficial health effects. Despite these associations, our understanding of the causal relationship between diet and health remains largely elusive. The present study examined the molecular changes elicited by nine diets with varying fat, sugar, cholesterol, omega-3 fatty acids, omega-6 fatty acids, and calories in C57BL/6 male mice. Microarray analyses were conducted on liver samples from three mice per diet and detected 20,449 genes of which 3,734 were responsive to changes in dietary components. Principal component analysis showed that diet restriction correlated the least with the other diets and also affected more genes than any other diet. Interestingly, Gene Set Enrichment Analysis (GSEA identified gene sets involved in glutathione metabolism, immune response, fatty acid metabolism, cholesterol metabolism, ABC transporters, and oxidative phosphorylation as being highly responsive to changes in diet composition. On the gene level, this study reveals novel findings such as the induction of the drug efflux pump Abcb1a (p-glycoprotein by diet restriction and an atherogenic diet, as well as the suppression of the rate limiting step of bile acid synthesis, Cyp7a1, by a high fructose diet. This study provides considerable insight into the molecular changes incurred by a variety of diets and furthers our understanding of the causal relationships between diet and health.
Renaud, Helen J.; Cui, Julia Y.; Lu, Hong; Klaassen, Curtis D.
2014-01-01
Nutritional intake is a fundamental determinant of health. Many studies have correlated excess caloric intake, as well as a high ratio of n-6:n-3 fatty acids, with detrimental health outcomes, such as the metabolic syndrome. In contrast, low-calorie diets have beneficial health effects. Despite these associations, our understanding of the causal relationship between diet and health remains largely elusive. The present study examined the molecular changes elicited by nine diets with varying fat, sugar, cholesterol, omega-3 fatty acids, omega-6 fatty acids, and calories in C57BL/6 male mice. Microarray analyses were conducted on liver samples from three mice per diet and detected 20,449 genes of which 3,734 were responsive to changes in dietary components. Principal component analysis showed that diet restriction correlated the least with the other diets and also affected more genes than any other diet. Interestingly, Gene Set Enrichment Analysis (GSEA) identified gene sets involved in glutathione metabolism, immune response, fatty acid metabolism, cholesterol metabolism, ABC transporters, and oxidative phosphorylation as being highly responsive to changes in diet composition. On the gene level, this study reveals novel findings such as the induction of the drug efflux pump Abcb1a (p-glycoprotein) by diet restriction and an atherogenic diet, as well as the suppression of the rate limiting step of bile acid synthesis, Cyp7a1, by a high fructose diet. This study provides considerable insight into the molecular changes incurred by a variety of diets and furthers our understanding of the causal relationships between diet and health. PMID:24551121
BDML Metadata: 449 [SSBD[Archive
Lifescience Database Archive (English)
Full Text Available Ce_AK BDML file for the result of computer simulation of male pronuclear migration ...in C. elegans embryo the result of computer simulation of male pronuclear migration in C. elegans embryo (me
Neural activity when people solve verbal problems with insight.
Directory of Open Access Journals (Sweden)
Mark Jung-Beeman
2004-04-01
Full Text Available People sometimes solve problems with a unique process called insight, accompanied by an "Aha!" experience. It has long been unclear whether different cognitive and neural processes lead to insight versus noninsight solutions, or if solutions differ only in subsequent subjective feeling. Recent behavioral studies indicate distinct patterns of performance and suggest differential hemispheric involvement for insight and noninsight solutions. Subjects solved verbal problems, and after each correct solution indicated whether they solved with or without insight. We observed two objective neural correlates of insight. Functional magnetic resonance imaging (Experiment 1 revealed increased activity in the right hemisphere anterior superior temporal gyrus for insight relative to noninsight solutions. The same region was active during initial solving efforts. Scalp electroencephalogram recordings (Experiment 2 revealed a sudden burst of high-frequency (gamma-band neural activity in the same area beginning 0.3 s prior to insight solutions. This right anterior temporal area is associated with making connections across distantly related information during comprehension. Although all problem solving relies on a largely shared cortical network, the sudden flash of insight occurs when solvers engage distinct neural and cognitive processes that allow them to see connections that previously eluded them.
Forming a Perceived Franchise Value: Theoretical Insights
Levickaitė, Rasa; Reimeris, Ramojus
2011-01-01
The article is based on literature review, theoretical insights and deals with the topic of perceived franchise value. The objective of the paper is – what elements form the franchisee's perceived value in service business (comparing with alternative of own business model). The aim of the paper is to propose systematic value elements in the process of forming a value of a franchise business model perceived by the franchisee. In terms of practical meaning, this article should be relevant to en...
IPE data base structure and insights
International Nuclear Information System (INIS)
Lehner, J.; Youngblood, R.
1994-01-01
A data base (the open-quotes IPE Insights Data Baseclose quotes), has been developed that stores data obtained from the Individual Plant Examinations (IPEs) which licensees of nuclear power plants are conducting in response to the Nuclear Regulatory Commission's (NRC) Generic Letter GL88-20. The data base, which is a collection of linked dBase files, stores information about individual plant designs, core damage frequency, and containment performance in a uniform, structured way. This data base can be queried and used as a computational tool to derive insights regarding the plants for which data is stored. This paper sets out the objectives of the IPE Insights Data Base, describes its structure and contents, illustrates sample queries, and discusses possible future uses
Quantifying the Qualitative: Measuring the Insight Experience
Jarman, Matthew S.
2014-01-01
No scales currently exist that measure variability in the insight experience. Two scales were created to measure two factors hypothesized to be key drivers of the insight experience: insight radicality (i.e., perceived deviation between previous and new problem representations) and restructuring experience (i.e., the subjective experience of the…
Directory of Open Access Journals (Sweden)
Qingbai Zhao
Full Text Available The key components of insight include breaking mental sets and forming the novel, task-related associations. The majority of researchers have agreed that the anterior cingulate cortex may mediate processes of breaking one's mental set, while the exact neural correlates of forming novel associations are still debatable. In the present study, we used a paradigm of answer selection to explore brain activations of insight by using event-related functional magnetic resonance imaging during solving Chinese 'chengyu' (in Chinese pinyin riddles. Based on the participant's choice, the trials were classified into the insight and non-insight conditions. Both stimulus-locked and response-locked analyses are conducted to detect the neural activity corresponding to the early and late periods of insight solution, respectively. Our data indicate that the early period of insight solution shows more activation in the middle temporal gyrus, the middle frontal gyrus and the anterior cingulate cortex. These activities might be associated to the extensive semantic processing, as well as detecting and resolving cognitive conflicts. In contrast, the late period of insight solution produced increased activities in the hippocampus and the amygdala, possibly reflecting the forming of novel association and the concomitant "Aha" feeling. Our study supports the key role of hippocampus in forming novel associations, and indicates a dynamic neural network during insight solution.
Marino, Fabio; Di Caro, Gianfranco; Gugliandolo, Concetta; Spanò, Antonio; Faggio, Caterina; Genovese, Giuseppa; Morabito, Marina; Russo, Annamaria; Barreca, Davide; Fazio, Francesco; Santulli, Andrea
2016-01-01
Several compounds from marine organisms have been studied for their potential use in aquaculture. Among the red algae, Asparagopsis taxiformis is considered one of the most promising species for the production of bioactive metabolites with numerous proposed applications. Here, the in vitro antibacterial activity, the easy handling and the absence of adverse effects on marine fish species are reported. Depending on the seasonal period of sampling, ethanol extracts of A. taxiformis exhibited significantly different inhibitory activity against fish pathogenic bacteria. The extract obtained in late spring showed strong antibacterial activity against Aeromonas salmonicida subsp. salmonicida, Vibrio alginolyticus, and V. vulnificus, and moderate activity against Photobacterium damselae subsp. damselae, P. damselae subsp. piscicida, V. harveyi and V. parahaemolyticus. Sea bass and gilthead sea bream were fed with pellets supplied with the alga and algal extracts. The absence of undesired effects on fish was demonstrated. Hematological and biochemical investigations allowed to confirm that the whole alga and its extracts could be proposed for a future application in aquaculture. PMID:27826246
Energy Technology Data Exchange (ETDEWEB)
NONE
2011-11-15
The World Energy Insight 2011 is the official publication of the World Energy Council. It includes interviews, articles and case studies from a distinguished panel of World Energy Council Officers, CEOs, government ministers, academics and opinion formers from all areas of the energy sector and provides perspectives from around the globe. Government, industry and NGO's offer both policy and technology perspectives. The insights within this publication add to the work that WEC is doing to provide the forum for energy leaders, along with the on-going WEC studies and programmes on Energy Policies, 2050 Energy Scenarios, Energy Resources & Technologies, Energy for Urban Innovation, Rules Of Energy Trade and Global Energy Access.
Significance of relative velocity in the estimation of drag force of a tethered spherical float
Digital Repository Service at National Institute of Oceanography (India)
Vethamony, P; Sastry, J.S.
stream_size 9 stream_content_type text/plain stream_name Ocean_Eng_20_449.pdf.txt stream_source_info Ocean_Eng_20_449.pdf.txt Content-Encoding ISO-8859-1 Content-Type text/plain; charset=ISO-8859-1 ...
Insight in psychosis: Standards, science, ethics and value judgment.
Jacob, K S
2017-06-01
The clinical assessment of insight solely employs biomedical perspectives and criteria to the complete exclusion of context and culture and to the disregard of values and value judgments. The aim of this discussion article is to examine recent research from India on insight and explanatory models in psychosis and re-examine the framework of assessment, diagnosis and management of insight and explanatory models. Recent research from India on insight in psychosis and explanatory models is reviewed. Recent research, which has used longitudinal data and adjusted for pretreatment variables, suggests that insight and explanatory models of illness at baseline do not predict course, outcome and treatment response in schizophrenia, which seem to be dependent on the severity and quality of the psychosis. It supports the view that people with psychosis simultaneously hold multiple and contradictory explanatory models of illness, which change over time and with the trajectory of the illness. It suggests that insight, like all explanatory models, is a narrative of the person's reality and a coping strategy to handle with the varied impact of the illness. This article argues that the assessment of insight necessarily involves value entailments, commitments and consequences. It supports a need for a broad-based approach to assess awareness, attribution and action related to mental illness and to acknowledge the role of values and value judgment in the evaluation of insight in psychosis.
A Cross-sectional, Comparative Study of Insight in Schizophrenia and Bipolar Patients in Remission.
Ramachandran, Arul Saravanan; Ramanathan, Rajkumar; Praharaj, Samir Kumar; Kanradi, Haridas; Sharma, Podila Satya Venkata Narasimha
2016-01-01
To study insight correlates in schizophrenia and bipolar mood disorder in remission among out-patients attending the Psychiatry Department of a Tertiary Care Hospital. In a cross-sectional, naturalistic study, adult patients with schizophrenia and bipolar mood disorder in remission (n = 80; schizophrenia-40, mania-20, bipolar depression-20) were compared on insight measures and clinical correlates. Scale to Assess the Unawareness of Mental Disorders (SUMD) was used as the main tool to assess current and past measures of insight. Hogan's Drug Attitude Inventory was used to assess the drug attitude and compliance. Positive and Negative Symptom Scale for Schizophrenia, Young's Mania Rating Scale, and HAMD were used to rate psychopathology. Clinical Global Improvement was used as a screening tool for remission. For comparison of the three clinical groups, analysis of variance and Chi-square test were used. In the post-hoc analysis, the Ryan-Einot-Gabriel-Welsch test was used to find the group difference. About 40% in the schizophrenia group were unaware of their mental illness as against none in the bipolar group. The awareness of mental disorder for the current period, the awareness of the achieved effects of medications, and the awareness of social consequence was better in the bipolar group. The drug attitude (compliant positive attitude) increased as the SUMD item scale decreased or in other words, as the insight improved. Insight, both current and retrospect, showed significant differences between the schizophrenia and bipolar patients. Insight is significantly correlated with the observed compliance and drug attitude of the patient groups.
Chio, Floria H N; Mak, Winnie W S; Chan, Randolph C H; Tong, Alan C Y
2018-01-30
The promotion of insight among people with schizophrenia spectrum disorders has posed a dilemma to service providers as higher insight has been linked to positive clinical outcomes but negative psychological outcomes. The negative meaning that people attached to the illness (self-stigma content) and the recurrence of such stigmatizing thoughts (self-stigma process) may explain why increased insight is associated with negative outcomes. The present study examined how the presence of high self-stigma content and self-stigma process may contribute to the negative association between insight and life satisfaction. A total of 181 people with schizophrenia spectrum disorders were assessed at baseline. 130 and 110 participants were retained and completed questionnaire at 6-month and 1-year follow-up, respectively. Results showed that baseline insight was associated with lower life satisfaction at 6-month when self-stigma process or self-stigma content was high. Furthermore, baseline insight was predictive of better life satisfaction at 1-year follow-up when self-stigma process was low. Findings suggested that the detrimental effects of insight can be a result from both the presence of cognitive content and habitual process of self-stigma. Future insight promotion interventions should also address self-stigma content and process among people with schizophrenia spectrum disorders so as to maximize the beneficial effects of insight. Copyright © 2018 Elsevier B.V. All rights reserved.
Segers, Rien; Fischer, Ingrid
Journal in which the Groningen Confucius Institute (GCI) shares different perspectives on China and provides insights into China from as many different aspects as possible. GCI aims to provide a full view of real China to the readers as well as featuring international and comprehensive perspectives,
Segers, Rien; Havinga, Marieke; Fischer, Ingrid
2013-01-01
Journal in which the Groningen Confucius Institute (GCI) shares different perspectives on China and provides insights into China from as many different aspects as possible. GCI aims to provide a full view of real China to the readers as well as featuring international and comprehensive perspectives,
Male-biased recombination in odonates: insights from a linkage map ...
Indian Academy of Sciences (India)
2013-04-05
Apr 5, 2013 ... Male-biased recombination in odonates: insights from a linkage map of the damselfly ... particular, odonates are emerging model systems for biotic effects of .... sex with highest variance in reproductive success (Trivers. 1988).
How to Detect Insight Moments in Problem Solving Experiments
Directory of Open Access Journals (Sweden)
Ruben E. Laukkonen
2018-03-01
Full Text Available Arguably, it is not possible to study insight moments during problem solving without being able to accurately detect when they occur (Bowden and Jung-Beeman, 2007. Despite over a century of research on the insight moment, there is surprisingly little consensus on the best way to measure them in real-time experiments. There have also been no attempts to evaluate whether the different ways of measuring insight converge. Indeed, if it turns out that the popular measures of insight diverge, then this may indicate that researchers who have used one method may have been measuring a different phenomenon to those who have used another method. We compare the strengths and weaknesses of the two most commonly cited ways of measuring insight: The feelings-of-warmth measure adapted from Metcalfe and Wiebe (1987, and the self-report measure adapted from Bowden and Jung-Beeman (2007. We find little empirical agreement between the two measures, and conclude that the self-report measure of Aha! is superior both methodologically and theoretically, and provides a better representation of what is commonly regarded as insight. We go on to describe and recommend a novel visceral measure of insight using a dynamometer as described in Creswell et al. (2016.
How to Detect Insight Moments in Problem Solving Experiments.
Laukkonen, Ruben E; Tangen, Jason M
2018-01-01
Arguably, it is not possible to study insight moments during problem solving without being able to accurately detect when they occur (Bowden and Jung-Beeman, 2007). Despite over a century of research on the insight moment, there is surprisingly little consensus on the best way to measure them in real-time experiments. There have also been no attempts to evaluate whether the different ways of measuring insight converge. Indeed, if it turns out that the popular measures of insight diverge , then this may indicate that researchers who have used one method may have been measuring a different phenomenon to those who have used another method. We compare the strengths and weaknesses of the two most commonly cited ways of measuring insight: The feelings-of-warmth measure adapted from Metcalfe and Wiebe (1987), and the self-report measure adapted from Bowden and Jung-Beeman (2007). We find little empirical agreement between the two measures, and conclude that the self-report measure of Aha! is superior both methodologically and theoretically, and provides a better representation of what is commonly regarded as insight. We go on to describe and recommend a novel visceral measure of insight using a dynamometer as described in Creswell et al. (2016).
Energy Technology Data Exchange (ETDEWEB)
NONE
2011-11-15
The World Energy Insight 2011 is the official publication of the World Energy Council. It includes interviews, articles and case studies from a distinguished panel of World Energy Council Officers, CEOs, government ministers, academics and opinion formers from all areas of the energy sector and provides perspectives from around the globe. Government, industry and NGO's offer both policy and technology perspectives. The insights within this publication add to the work that WEC is doing to provide the forum for energy leaders, along with the on-going WEC studies and programmes on Energy Policies, 2050 Energy Scenarios, Energy Resources & Technologies, Energy for Urban Innovation, Rules Of Energy Trade and Global Energy Access.
Do behavioural insights matter for competition policy?
CIRIOLO Emanuele
2016-01-01
Behavioural insights make use of behavioural economics and psychology to analyse how humans behave when adopting economic decisions. The use of behavioural insights to improve policy-making is becoming increasing popular all over the world. Pensions, taxes, unemployment, energy efficiency, adult education, charitable giving and, of course, competition policy have benefitted from the application of behavioural insights. Emanuele Ciriolo, from the European Commission Joint Research Centre, expl...
A pilot study of cognitive insight and structural covariance in first-episode psychosis.
Kuang, Corin; Buchy, Lisa; Barbato, Mariapaola; Makowski, Carolina; MacMaster, Frank P; Bray, Signe; Deighton, Stephanie; Addington, Jean
2017-01-01
Cognitive insight is described as a balance between one's self-reflectiveness (recognition and correction of dysfunctional reasoning), and self-certainty (overconfidence). Neuroimaging studies have linked the ventrolateral prefrontal cortex (VLPFC) to cognitive insight in people with psychosis. However, the relationship between cognitive insight and structural connectivity between the VLPFC and other brain areas is unknown. Here, we investigated the modulation of cognitive insight on structural covariance networks involving the VLPFC in a first-episode psychosis sample. Fifteen patients with a first-episode psychosis provided magnetic resonance (MR) scans and completed the Beck Cognitive Insight Scale (BCIS). MR scans were also available for 15 historical controls. Seed-based analysis of structural covariance was conducted using the Mapping Anatomical Correlations Across the Cerebral Cortex (MACACC) methodology, whereby Pearson correlation coefficients were extracted between seed regions in left and right VLPFC and cortical thickness across the brain. Structural covariance maps between groups were compared at each vertex. In first-episode subjects, we evaluated the modulation of BCIS scores on cortical covariance between VLPFC and every other vertex. Findings showed no significant group difference between first-episode psychosis subjects and controls in thickness covariance seeded from left or right VLPFC. However, in first-episode psychosis subjects, a positive association with self-certainty was found in networks seeded from both left and right VLPFC with thickness in medial frontal cortex and right pars triangularis. No significant associations were found for self-reflectiveness. These results suggest that self-certainty, but not self-reflectiveness, positively modulated cortical covariance in a frontal network in patients with a first-episode psychosis. Copyright © 2016 Elsevier B.V. All rights reserved.
Mining Login Data for Actionable Student Insight
Agnihotri, Lalitha; Aghababyan, Ani; Mojarad, Shirin; Riedesel, Mark; Essa, Alfred
2015-01-01
Student login data is a key resource for gaining insight into their learning experience. However, the scale and the complexity of this data necessitate a thorough exploration to identify potential actionable insights, thus rendering it less valuable compared to student achievement data. To compensate for the underestimation of login data…
Directory of Open Access Journals (Sweden)
Johnson Shanthi
2012-09-01
Full Text Available Abstract Background The sole focus of models of insight on bio-medical perspectives to the complete exclusion of local, non-medical and cultural constructs mandates review. This study attempted to investigate the impact of insight, psychopathology, explanatory models of illness on outcome of first episode schizophrenia. Method Patients diagnosed to have DSM IV schizophrenia (n = 131 were assessed prospectively for insight, psychopathology, explanatory models of illness at baseline, 6, 12 and 60 months using standard instruments. Multiple linear and logistic regression and generalized estimating equations (GEE were employed to assess predictors of outcome. Results We could follow up 95 (72.5% patients. Sixty-five of these patients (68.4% achieved remission. There was a negative relationship between psychosis rating and insight scores. Urban residence, fluctuating course of the initial illness, and improvement in global functioning at 6 months and lower psychosis rating at 12 months were significantly related to remission at 5 years. Insight scores, number of non-medical explanatory models and individual explanatory models held during the later course of the illness were significantly associated with outcome. Analysis of longitudinal data using GEE showed that women, rural residence, insight scores and number of non-medical explanatory models of illness held were significantly associated with BPRS scores during the study period. Conclusions Insight, the disease model and the number of non-medical model positively correlated with improvement in psychosis arguing for a complex interaction between the culture, context and illness variables. These finding argue that insight and explanatory models are secondary to psychopathology, course and outcome of the illness. The awareness of mental illness is a narrative act in which people make personal sense of the many challenges they face. The course and outcome of the illness, cultural context
Reading skills, creativity, and insight: exploring the connections.
Mourgues, Catalina V; Preiss, David D; Grigorenko, Elena L
2014-08-04
Studies of the relationship between creativity and specific reading disabilities have produced inconclusive results. We explored their relationship in a sample of 259 college students (age range: 17 to 38 years-old) from three Chilean universities. The students were tested on their verbal ability, creativity, and insight. A simple linear regression was performed on the complete sample, and on high- and low-achievement groups that were formed based on reading test scores. We observed a significant correlation in the total sample between outcomes on the verbal ability tasks, and on the creativity and insight tasks (range r =. 152 to r =. 356, ps creativity and insight tasks (range β = .315 to β = .155, ps creative tasks. Instead, higher verbal ability was found to be associated with higher creativity and insight.
African Journals Online (AJOL)
Author Guidelines. Africa Insight is a quarterly, peer-reviewed journal of the Africa Institute of South Africa (AISA). It is accredited by the Department of Higher ... Abstract: All articles should be accompanied by an abstract of between 100 and 125 words stating the main research problem, major findings and conclusion(s).
Insight and illness perception in Mexican patients with psychosis.
Gómez-de-Regil, Lizzette
2015-03-01
Insight and illness perception are two concepts of interest in the study of factors related to clinical outcome in patients with psychosis. Insight implies a risk of emotional distress for the patient. Illness perceptions, regardless of their accuracy, might be favorable or not to illness. Literature provides evidence of significant correlates of these factors with clinical outcome, but they are rarely included in a single study. 1) assessing insight and illness perception in a sample of Mexican patients who have experienced psychosis and, 2) analyzing how insight and illness perception relate to each other and how they relate to clinical status (i.e., positive, negative, and general psychopathology, depression, and anxiety). Sixty-one participants (55.7% females) were recruited from a public psychiatric hospital; insight and illness perceptions were assessed with the SUMD and the Brief-IPQ, respectively. Clinical status was assessed with the PANSS, CDS and BAI scales. Participants showed good insight, favorable illness perceptions for the cognitive and comprehension dimensions, but unfavorable for the emotional dimension. Clinical status of sample was characterized by mild symptoms. Poor insight related to positive symptoms and general psychopathology. Cognitive and emotional perceptions of illness were significantly associated to most clinical status parameters, whereas comprehension showed no significant results. The study not only replicates the significant association on insight and illness perception with clinical outcome, but shows how their patterns of interactions are different, reinforcing the idea that they are two distinct factors worthy of being habitually acknowledged in research and clinical practice.
Archiving InSight Lander Science Data Using PDS4 Standards
Stein, T.; Guinness, E. A.; Slavney, S.
2017-12-01
The InSight Mars Lander is scheduled for launch in 2018, and science data from the mission will be archived in the NASA Planetary Data System (PDS) using the new PDS4 standards. InSight is a geophysical lander with a science payload that includes a seismometer, a probe to measure subsurface temperatures and heat flow, a suite of meteorology instruments, a magnetometer, an experiment using radio tracking, and a robotic arm that will provide soil physical property information based on interactions with the surface. InSight is not the first science mission to archive its data using PDS4. However, PDS4 archives do not currently contain examples of the kinds of data that several of the InSight instruments will produce. Whereas the existing common PDS4 standards were sufficient for most of archiving requirements of InSight, the data generated by a few instruments required development of several extensions to the PDS4 information model. For example, the seismometer will deliver a version of its data in SEED format, which is standard for the terrestrial seismology community. This format required the design of a new product type in the PDS4 information model. A local data dictionary has also been developed for InSight that contains attributes that are not part of the common PDS4 dictionary. The local dictionary provides metadata relevant to all InSight data sets, and attributes specific to several of the instruments. Additional classes and attributes were designed for the existing PDS4 geometry dictionary that will capture metadata for the lander position and orientation, along with camera models for stereo image processing. Much of the InSight archive planning and design work has been done by a Data Archiving Working Group (DAWG), which has members from the InSight project and the PDS. The group coordinates archive design, schedules and peer review of the archive documentation and test products. The InSight DAWG archiving effort for PDS is being led by the PDS Geosciences
Diagnostic accuracy of insight intraoral film on dental caries
Energy Technology Data Exchange (ETDEWEB)
Yoon, Young Nam; Lee, Byung Do [Wonkwang University College of Medicine, Iksan (Korea, Republic of); Lee, Sang Rae [Kyunghee University College of Medicine, Seoul (Korea, Republic of)
2004-03-15
To compare the diagnostic accuracy of Kodak Insight film with other intra-oral films in the detection of dental caries. Periapical radiographs of 99 extracted human teeth with sound proximal surfaces and interproximal artificial cavities were made on Kodak Ultra speed, Ektaspeed, Agfa Ektaspeed and Kodak Insight films and automatically processed. Six dentists examined the presence of dental caries using a five-point confidence rating scale and compared the diagnostic accuracy by ROC (Receiver Operating Characteristic) analysis and ANOVA test. The sensitivity of Kodak Ultra speed, Ektaspeed, Agfa Ektaspeed and Insight film were 0.84, 0.77, 0.75 and 0.79 respectively. The specificity of Kodak Ultra speed, Ektaspeed, Agfa Ektaspeed and Insight film were 0.97, 0.95, 0.96 and 0.94 respectively. The mean ROC areas (Az) of Kodak Ultra speed, Ektaspeed, Agfa Ektaspeed and Insight film were 0.917, 0.910, 0.894, 0.909 respectively. There was no significant differences between Az of Insight film and other films (p = 0.178). Theses results suggested that Kodak Insight film have the comparative diagnostic accuracy of dental caries with Ultraspeed and Ektaspeed films. (77)
Diagnostic accuracy of insight intraoral film on dental caries
International Nuclear Information System (INIS)
Yoon, Young Nam; Lee, Byung Do; Lee, Sang Rae
2004-01-01
To compare the diagnostic accuracy of Kodak Insight film with other intra-oral films in the detection of dental caries. Periapical radiographs of 99 extracted human teeth with sound proximal surfaces and interproximal artificial cavities were made on Kodak Ultra speed, Ektaspeed, Agfa Ektaspeed and Kodak Insight films and automatically processed. Six dentists examined the presence of dental caries using a five-point confidence rating scale and compared the diagnostic accuracy by ROC (Receiver Operating Characteristic) analysis and ANOVA test. The sensitivity of Kodak Ultra speed, Ektaspeed, Agfa Ektaspeed and Insight film were 0.84, 0.77, 0.75 and 0.79 respectively. The specificity of Kodak Ultra speed, Ektaspeed, Agfa Ektaspeed and Insight film were 0.97, 0.95, 0.96 and 0.94 respectively. The mean ROC areas (Az) of Kodak Ultra speed, Ektaspeed, Agfa Ektaspeed and Insight film were 0.917, 0.910, 0.894, 0.909 respectively. There was no significant differences between Az of Insight film and other films (p = 0.178). Theses results suggested that Kodak Insight film have the comparative diagnostic accuracy of dental caries with Ultraspeed and Ektaspeed films. (77)
Self-esteem and insight as predictors of symptom change in schizophrenia: a longitudinal study.
Erickson, Molly A; Lysaker, Paul H
2012-07-01
Though it is known that symptom profiles in schizophrenia change throughout the course of the illness, it is not yet clear which psychological antecedents predict these changes. The purpose of the present study was to explore "level of insight into mental illness" and "self-esteem" as predictors of positive symptom change in schizophrenia patients. Fifty-seven schizophrenia patients completed assessments of self-esteem, insight into mental illness, positive symptoms and paranoia once every four weeks for a total of eight individual testing sessions. Hierarchical linear regression analysis revealed that changes in self-esteem predicted future changes in paranoia as well as positive symptoms more broadly; decreases in self-esteem at any given time point were associated with an increase in persecutory beliefs and other positive symptoms at the following assessment. On the other hand, decreases in insight were not significantly associated with paranoia or positive symptoms, either as a stable trait of the mental illness or as a predictor of change over time. Taken together, these results suggest that change in self-esteem, but not insight, has a significant and unique association with positive symptoms of schizophrenia, and may be a valuable target for future treatment.
Insight in psychotic disorder: relation with psychopathology and frontal lobe function.
Kumar, Atmesh; Sharma, Pranjal; Das, Shyamanta; Nath, Kamal; Talukdar, Uddip; Bhagabati, Dipesh
2014-01-01
Through conceptualising poor insight in psychotic disorders as a form of anosognosia, frontal lobe dysfunction is often ascribed a vital role in its pathogenesis. The objective of this study was to compare the relation of insight in patients with psychotic illness to that of psychopathology and frontal lobe function. Forty patients with psychotic disorder were selected from those attending the Department of Psychiatry in a tertiary care teaching hospital. The evaluation of insight was carried out using the Schedule for Assessment of Insight (SAI), that of frontal lobe function by the Frontal Assessment Battery (FAB) and psychopathology by the Brief Psychiatric Rating Scale (BPRS). The correlation coefficients were determined. A negative correlation between SAI and BPRS scores means that the BPRS score is opposite to SAI scores. When the SAI total score was compared with the FAB total score, the correlation coefficient demonstrated a positive correlation. Better insight predicted lesser psychopathology and also that poor insight would exist with greater psychopathology. Better insight predicted a higher functional status of frontal lobes and prefrontal cortex in particular. Insight deficits in schizophrenia and other psychotic illnesses are multidimensional. Integration of different aetiological factors like biological, psychopathological, environmental ones and others are necessary for a better understanding of insight in psychosis. Copyright © 2013 S. Karger AG, Basel.
"Combining equity and utilitarianism"-additional insights into a novel approach
Lemmen-Gerdessen, van Joke; Kanellopoulos, Argyris; Claassen, Frits
2018-01-01
Recently, a novel approach (to be referred to as CEU) was introduced for the frequently arising problem of combining the conflicting criteria of equity and utilitarianism. This paper provides additional insights into CEU and assesses its added value for practice by comparing it with a commonly used
Insight in Schizophrenia : Involvement of Self-Reflection Networks?
van der Meer, Lisette; de Vos, Annerieke E.; Stiekema, Annemarie P. M.; Pijnenborg, Gerdina H. M.; van Tol, Marie-Jose; Nolen, Willem A.; David, Anthony S.; Aleman, Andre
2013-01-01
Background: Impaired insight is a common feature in psychosis and an important predictor of variables such as functional outcome, prognosis, and treatment adherence. A cognitive process that may underlie insight in psychosis is self-reflection, or the conscious evaluation of one's traits and
Franchise Business Model: Theoretical Insights
Levickaitė, Rasa; Reimeris, Ramojus
2010-01-01
The article is based on literature review, theoretical insights, and deals with the topic of franchise business model. The objective of the paper is to analyse peculiarities of franchise business model and its developing conditions in Lithuania. The aim of the paper is to make an overview on franchise business model and its environment in Lithuanian business context. The overview is based on international and local theoretical insights. In terms of practical meaning, this article should be re...
The Association of DRD2 with Insight Problem Solving.
Zhang, Shun; Zhang, Jinghuan
2016-01-01
Although the insight phenomenon has attracted great attention from psychologists, it is still largely unknown whether its variation in well-functioning human adults has a genetic basis. Several lines of evidence suggest that genes involved in dopamine (DA) transmission might be potential candidates. The present study explored for the first time the association of dopamine D2 receptor gene ( DRD2 ) with insight problem solving. Fifteen single-nucleotide polymorphisms (SNPs) covering DRD2 were genotyped in 425 unrelated healthy Chinese undergraduates, and were further tested for association with insight problem solving. Both single SNP and haplotype analysis revealed several associations of DRD2 SNPs and haplotypes with insight problem solving. In conclusion, the present study provides the first evidence for the involvement of DRD2 in insight problem solving, future studies are necessary to validate these findings.
Insight and white matter fractional anisotropy in first-episode schizophrenia.
Asmal, Laila; du Plessis, Stefan; Vink, Matthijs; Fouche, Jean-Paul; Chiliza, Bonginkosi; Emsley, Robin
2017-05-01
Impaired insight is a hallmark feature of schizophrenia. Structural studies implicate predominantly prefrontal, cingulate, cuneus/precuneus, and inferior temporal brain regions. The cortical midline structures (CMS) are also implicated in functional studies primarily through self-reflective processing tasks. However, few studies have explored the relationship between white matter tracts and insight in schizophrenia, and none in first-episode schizophrenia (FES). Here, we examined for fractional anisotropy (FA) differences in 89 minimally treated FES patients and 98 matched controls, and identified those FA differences associated with impaired clinical insight in patients. We found widespread FA reduction in FES patients compared to controls. Poorer insight in patients was predicted by lower FA values in a number of white matter tracts with a predilection for tracts associated with cortical midline structures (fronto-occipital, cingulate, cingulate hippocampus, uncinate, anterior corona radiata), and more severe depressive symptoms. The association between FA abnormalities and insight was most robust for the awareness of symptoms and illness awareness domains. Our study implicates a network of tracts involved in impaired insight in schizophrenia with a predilection for the CMS. This study is a first step in delineating the white matter tracts involved in insight impairment in schizophrenia prior to chronicity. Copyright © 2016. Published by Elsevier B.V.
The impact of insight on social functioning in patients with schizophrenia.
Erol, Almila; Delibas, Hakan; Bora, Ozlem; Mete, Levent
2015-06-01
It is still unclear whether insight has a direct association with social functioning in schizophrenia, independent of its association with symptoms. This study aimed to investigate the relationship of insight and its dimensions with social functioning in schizophrenia. A total of 170 outpatients with schizophrenia were included in this study. All patients were evaluated with the Scale to Assess Unawareness of Mental Disorder (SUMD), Positive and Negative Syndrome Scale (PANSS) and Personal and Social Performance Scale (PSP). Patients with impaired insight and patients with unimpaired insight were compared for PSP score through independent samples t test. Pearson's correlation analysis was used to determine the correlations between study variables. Multiple stepwise linear regression analysis was used in order to determine the variables that predict social performance. The PSP score of patients with impaired insight was significantly lower than that of patients with unimpaired insight. There were significant correlations between insight dimensions and PSP score. PANSS negative scale score, awareness of achieved effects of medication and awareness of anhedonia/asociality were significant predictors of social performance. Insight has a significant impact on social functioning in schizophrenia, and some, but not all, insight dimensions have direct impact on social performance, independent of their association with symptoms. © The Author(s) 2014.
Training for Future Operations: Digital Leaders' Transformation Insights
National Research Council Canada - National Science Library
Johnston, John
2003-01-01
... and insights to expand the understanding of issues and requirements Finally, the team developed specific recommendations intended to give transformation leaders a distinctive training advantage The practical insights and recommendations point to initiatives the Army can take to establish Objective Force training as a decisive combat multiplier.
Association between prefrontal N-acetylaspartate and insight in psychotic disorders.
Larabi, Daouia I; Liemburg, Edith J; Pijnenborg, Gerdina H M; Sibeijn-Kuiper, Anita; de Vos, Annerieke E; Bais, Leonie; Knegtering, Henderikus; Ćurčić-Blake, Branislava; Aleman, André
2017-01-01
Insight is impaired in most patients with psychosis and has been associated with poorer prognosis. The exact neural basis of impaired insight is still unknown, but it may involve disrupted prefrontal neural connectivity. Numerous studies have indeed found white matter (WM) abnormalities in psychosis. The association between prefrontal WM abnormalities and insight has not been studied yet by means of proton magnetic resonance spectroscopy ( 1 H-MRS). 1 H-MRS can be used to measure N-acetylaspartate (NAA), which is considered to be a marker of neuronal integrity. We measured insight with the Birchwood Insight Scale (BIS) as well as item G12 of the Positive and Negative Syndrome Scale (PANSS) in 88 patients with psychosis. Prefrontal WM concentrations of NAA and ratios of NAA to creatine (Cr) were assessed with 1 H-MRS. Nonparametric partial correlational analyses were conducted between NAA concentrations and insight controlling for illness duration, standardized antipsychotic dose, symptom scores, voxel grey matter content and voxel cerebrospinal fluid content. We found a significant correlation between reduced NAA/Cr ratios and poorer insight as measured with the BIS, which remained significant after additional correction for full width at half maximum, signal/noise and age. This is the first study reporting a relationship between lower prefrontal concentrations of a marker of neuronal integrity and impaired insight, providing further evidence that prefrontal pathology may play an important role in impaired insight in psychosis. This may be explained by the involvement of the prefrontal cortex in several executive and metacognitive functions, such as cognitive flexibility and perspective taking. Copyright © 2016 Elsevier B.V. All rights reserved.
Hyperlipemia in a population of aged donkeys: description, prevalence, and potential risk factors.
Burden, F A; Du Toit, N; Hazell-Smith, E; Trawford, A F
2011-01-01
Hyperlipemia is a common disorder of the donkey, with mortality rates of up to 80% reported. Such a poor prognosis makes prevention of this disorder or amelioration in the early stages crucial. The objective of this study was to describe and determine the prevalence of hyperlipemia in a population of donkeys and to determine risk factors for development of the disease. A total of 449 cases were investigated from a population of 3829 donkeys; donkeys were resident at The Donkey Sanctuary, a charity providing refuge for unwanted donkeys in the UK. Animals were selected on the basis of presence of clinical disease. A retrospective case-control study design was used, and all donkeys presenting with hyperlipemia over a 4-year period were included. Each case was matched with 2 controls that had not suffered from hyperlipemia in the previous month. Multivariable analysis was carried out to determine risk factors. A total of 449 clinical cases of hyperlipemia were reported with an associated mortality rate of 48.5%. Concurrent disease was present in 72% of donkeys and was the greatest risk factor (OR = 76.98); others included cardboard bedding (OR = 3.86), movement (OR = 3.94), weight loss (OR = 6.4), dental disease (OR = 1.73), and concentrate feeding (OR = 1.87). This study shows that this population of donkeys in the UK often develops hyperlipemia, particularly in response to stress or primary illness, and provides useful insights in to health and management risk factors that may be addressed to decrease the risk of hyperlipemia both in the study population and in other similar donkey populations. Copyright © 2011 by the American College of Veterinary Internal Medicine.
Insight in Schizophrenia: Relationship to Positive, Negative and Neurocognitive Dimensions
Joseph, Boban; Narayanaswamy, Janardhanan C.; Venkatasubramanian, Ganesan
2015-01-01
Impairment of insight is considered as the hallmark of schizophrenia. Substantial proportion of patients with schizophrenia has either poor or absent insight. Insight is a multidimensional and dynamic construct which appears to have intricate links with other symptom dimensions of the psychotic illness. A better appreciation of the association that insight shares with other symptom clusters in psychosis could help us in gaining knowledge about aetiology, prognosis and treatment-related facets of the disorder. This is likely to have critical implications in the understanding and therapeutics of schizophrenia. PMID:25722504
Sensitivity of planktonic and biofilm-associated Aeromonas spp. to ionizing radiation
International Nuclear Information System (INIS)
Nagar, Vandan; Bandekar, J.R.
2015-01-01
Genus Aeromonas has emerged as an important human pathogen because it causes a variety of diseases including gastroenteritis and extra-intestinal infections. Aeromonas have the ability to adhere and form biofilms on food surfaces and food contact surfaces. Biofilm formation on foods and food contact surfaces is the major reason for contamination, cross contamination and post-processing contamination of the final food product leading to food spoilage, product rejection, economic losses and food-borne diseases. Biofilms have shown high resistance to heat, desiccation, acidic condition, high salt concentration, antibiotics and other food preservatives. Earlier studies in our laboratory have shown that ionizing radiation effectively inactivates Aeromonas in different food products. However, the relative efficacy of this process against biofilm associated cells versus free-living planktonic cells of Aeromonas is not well documented. Therefore, the dose of gamma radiation required to reduce the population by 90% (D10) was calculated for planktonic and biofilm-associated A. salmonicida Y567 and A. hydrophila A331 cells. Both A. hydrophila A331 and A. salmonicida Y567 expressed significant ability to attach and grow on glass surface following incubation at 30℃ in TSB. Ionizing radiation effectively reduced the populations of both planktonic and biofilm-associated cells for both the strains. Mean cell counts of survivors and surviving fraction of planktonic and biofilm-associated cells decreased with increased irradiation doses. The D10 values of planktonic cells and biofilm cells for A. salmonicida (Y567) were 232.65 Gy and 248.41 Gy, respectively; whereas, the D10 values of planktonic cells and biofilm cells for A. hydrophila (A331) were 249.2 Gy and 240.2 Gy respectively. No significant difference in the D10 values of planktonic and biofilm associated Aeromonas was observed. The influence of the cultured state of the organism, i.e., planktonic versus biofilm associated
Self-Reflection, Insight, and Individual Differences in Various Language Tasks
Xu, Xu
2011-01-01
This study explored the relationships of self-reflection and insight with individuals' performances on various language tasks. The Self-Reflection and Insight Scale (SRIS; Grant, Franklin, & Langford, 2002) assessed individual differences in three factors: engagement in reflection, need for reflection, and insight. A high need for reflection was…
DEFF Research Database (Denmark)
Dalsgaard, Inger; Madsen, Lone
2000-01-01
of fry and larger fish. All isolates of F. psychrophilum showed proteolytic activities; however, a few isolates, belonging to serotype Fp(T) did not degrade elastin and were not associated with mortality. Increasing resistance problems to oxytetracycline were demonstrated. More than half of the F....... psychrophilum isolates showed resistance to oxolinic acid and oxytetracycline. No antibiotic resistant isolates were found among Y. ruckeri and A. salmonicida....
Study on the characteristics of insight dental x-ray film
International Nuclear Information System (INIS)
Song, Young Han; Lee, Wan; Lee, Byung Do
2003-01-01
To investigate the characteristics of the newly marketed, Insight dental X-ray film. Kodak Ultraspeed (DF-58), E-speed, Agfa Dentus M2, and Kodak Insight (IP-21) films were radiographed using a Trophy intra-oral radiographic machine. 10 step exposure times were prepared and each step exposure was monitored using a FH 40G (ESM Eberline Instruments) dosimeter for each of the 4 types of intra-oral film. All films were manually processed and the radiographic densities at 6 site of each processed film were measured, and the characteristic curves of each of the 4 types intra-oral films were created utilizing these dosimetric data and radiographic densities, based on ISO 5779. The film contrast, speed, and base plus fog density of Insight film were compared with those of the 3 other films examined in this experiment. E-speed film showed greatest average gradients followed by Insight film. E-speed and Ultraspeed film showed great average gradients at low density levels. Insight film showed the fastest speed followed by E-speed, Dentus M2 and Ultraspeed film. Dentus M2 film showed greatest base plus fog density level followed by Insight film. Kodak Insight film showed fastest film speed with comparable film contrast on characteristic curve.
The art of insight in science and engineering mastering complexity
Mahajan, Sanjoy
2014-01-01
In this book, Sanjoy Mahajan shows us that the way to master complexity is through insight rather than precision. Precision can overwhelm us with information, whereas insight connects seemingly disparate pieces of information into a simple picture. Unlike computers, humans depend on insight. Based on the author's fifteen years of teaching at MIT, Cambridge University, and Olin College, The Art of Insight in Science and Engineering shows us how to build insight and find understanding, giving readers tools to help them solve any problem in science and engineering. To master complexity, we can organize it or discard it. The Art of Insight in Science and Engineering first teaches the tools for organizing complexity, then distinguishes the two paths for discarding complexity: with and without loss of information. Questions and problems throughout the text help readers master and apply these groups of tools. Armed with this three-part toolchest, and without complicated mathematics, readers can estimate the flight ...
Insight and analysis problem solving in microbes to machines.
Clark, Kevin B
2015-11-01
A key feature for obtaining solutions to difficult problems, insight is oftentimes vaguely regarded as a special discontinuous intellectual process and/or a cognitive restructuring of problem representation or goal approach. However, this nearly century-old state of art devised by the Gestalt tradition to explain the non-analytical or non-trial-and-error, goal-seeking aptitude of primate mentality tends to neglect problem-solving capabilities of lower animal phyla, Kingdoms other than Animalia, and advancing smart computational technologies built from biological, artificial, and composite media. Attempting to provide an inclusive, precise definition of insight, two major criteria of insight, discontinuous processing and problem restructuring, are here reframed using terminology and statistical mechanical properties of computational complexity classes. Discontinuous processing becomes abrupt state transitions in algorithmic/heuristic outcomes or in types of algorithms/heuristics executed by agents using classical and/or quantum computational models. And problem restructuring becomes combinatorial reorganization of resources, problem-type substitution, and/or exchange of computational models. With insight bounded by computational complexity, humans, ciliated protozoa, and complex technological networks, for example, show insight when restructuring time requirements, combinatorial complexity, and problem type to solve polynomial and nondeterministic polynomial decision problems. Similar effects are expected from other problem types, supporting the idea that insight might be an epiphenomenon of analytical problem solving and consequently a larger information processing framework. Thus, this computational complexity definition of insight improves the power, external and internal validity, and reliability of operational parameters with which to classify, investigate, and produce the phenomenon for computational agents ranging from microbes to man-made devices. Copyright
Fetal programming by maternal stress: Insights from a conflict perspective.
Del Giudice, Marco
2012-10-01
Maternal stress during pregnancy has pervasive effects on the offspring's physiology and behavior, including the development of anxious, reactive temperament and increased stress responsivity. These outcomes can be seen as the result of adaptive developmental plasticity: maternal stress hormones carry useful information about the state of the external world, which can be used by the developing fetus to match its phenotype to the predicted environment. This account, however, neglects the inherent conflict of interest between mother and fetus about the outcomes of fetal programming. The aim of this paper is to extend the adaptive model of prenatal stress by framing mother-fetus interactions in an evolutionary conflict perspective. In the paper, I show how a conflict perspective provides many new insights in the functions and mechanisms of fetal programming, with particular emphasis on human pregnancy. I then take advantage of those insights to make sense of some puzzling features of maternal and fetal physiology and generate novel empirical predictions. Copyright © 2012 Elsevier Ltd. All rights reserved.
PDB: CBRC-PTRO-06-0041 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-PTRO-06-0041 2R4R,2RH1,3D4S,2R4S, Region:85-449(Identity=99%) PDB:2R4R Chain:A... (X-ray Resolution=3.40),Region:85-449(Identity=99%) PDB:2RH1 Chain:A (X-ray Resolution=2.40),Region:85-449(Identity...=99%) PDB:3D4S Chain:A (X-ray Resolution=2.80),Region:108-449(Identity=99%) PDB:2R4S Chain:A (X-ray Resolution=3.40), ...
Facilitate insight by non-invasive brain stimulation.
Directory of Open Access Journals (Sweden)
Richard P Chi
Full Text Available Our experiences can blind us. Once we have learned to solve problems by one method, we often have difficulties in generating solutions involving a different kind of insight. Yet there is evidence that people with brain lesions are sometimes more resistant to this so-called mental set effect. This inspired us to investigate whether the mental set effect can be reduced by non-invasive brain stimulation. 60 healthy right-handed participants were asked to take an insight problem solving task while receiving transcranial direct current stimulation (tDCS to the anterior temporal lobes (ATL. Only 20% of participants solved an insight problem with sham stimulation (control, whereas 3 times as many participants did so (p = 0.011 with cathodal stimulation (decreased excitability of the left ATL together with anodal stimulation (increased excitability of the right ATL. We found hemispheric differences in that a stimulation montage involving the opposite polarities did not facilitate performance. Our findings are consistent with the theory that inhibition to the left ATL can lead to a cognitive style that is less influenced by mental templates and that the right ATL may be associated with insight or novel meaning. Further studies including neurophysiological imaging are needed to elucidate the specific mechanisms leading to the enhancement.
Administrator Responses to Financial Incentives: Insights from a TIF Program
King Rice, Jennifer; Malen, Betty; Jackson, Cara; Hoyer, Kathleen Mulvaney
2017-01-01
This article provides evidence and generates insights about the power of financial rewards to motivate school administrators and the design features that influence their motivational potency. The multi-year mixed-methods study is grounded in expectancy and goal setting theories that suggest (a) awards must be salient and sizable enough to appeal…
Fitzpatrick, Austin J.; Leon, Nancy J.; Novati, Alexander; Lincoln, Laura K.; Fisher, Diane K.
2012-01-01
GOES-R: Satellite Insight seeks to bring awareness of the GOES-R (Geostationary Operational Environmental Satellite -- R Series) satellite currently in development to an audience of all ages on the emerging medium of mobile games. The iPhone app (Satellite Insight) was created for the GOES-R Program. The app describes in simple terms the types of data products that can be produced from GOES-R measurements. The game is easy to learn, yet challenging for all audiences. It includes educational content and a path to further information about GOESR, its technology, and the benefits of the data it collects. The game features action-puzzle game play in which the player must prevent an overflow of data by matching falling blocks that represent different types of GOES-R data. The game adds more different types of data blocks over time, as long as the player can prevent a data overflow condition. Points are awarded for matches, and players can compete with themselves to beat their highest score.
Risk insights from seismic margin reviews
International Nuclear Information System (INIS)
Budnitz, R.J.
1990-01-01
This paper discusses the information that has been derived from the three seismic-margin reviews conducted so far, and the information that is potentially available from using the seismic-margin method more generally. There are two different methodologies for conducting seismic margin reviews of nuclear power plants, one developed under NRC sponsorship and one developed under sponsorship of the Electric Power Research Institute. Both methodologies will be covered in this paper. The paper begins with a summary of the steps necessary to complete a margin review, and will then outline the key technical difficulties that need to be addressed. After this introduction, the paper covers the safety and operational insights derived from the three seismic-margin reviews already completed: the NRC-sponsored review at Maine Yankee; the EPRI-sponsored review at Catawba; and the joint EPRI/NRC/utility effort at Hatch. The emphasis is on engineering insights, with attention to the aspects of the reviews that are easiest to perform and that provide the most readily available insights
Insight in bipolar mania: evaluation of its heterogeneity and correlation with clinical symptoms.
Silva, Rafael de Assis da; Mograbi, Daniel C; Bifano, Jaqueline; Santana, Cristina M T; Cheniaux, Elie
2016-07-15
Studies on insight in bipolar mania are not numerous and usually consider insight as a unitary construct. Evaluate how different facets of insight are affected in bipolar mania and investigate correlations between insight for each specific object in bipolar disorder and manic symptomatology. A group of 165 bipolar patients were followed during a year, with 51 patients having manic episodes according to DSM-IV-TR criteria. Patients underwent a clinical assessment and insight was evaluated through the Insight Scale for Affective Disorders. The study found that insight regarding symptoms is worse than insight of having bipolar disorder, social relationships and self esteem. Moreover, poor global insight (total ISAD) correlates with more severe changes in mood, speech and thought structure, with worse insight about symptoms correlating with the same alterations and also with more severe symptoms of agitation/energy. Although a large sample of bipolar patients was followed up, the final sample composed of patients with at least one manic episode was relatively smaller. Moreover, the fact that the study was performed in a university hospital may have led to selection biases. Results suggest that patients with BD are reasonably capable of identifying that their condition implies consequences but have more impaired awareness of their energy and activity levels. A lower level of insight specifically about symptoms correlates with more severe symptoms of agitation/energy, which suggests a psychomotor nucleus able to impair insight in mania. Copyright © 2016 Elsevier B.V. All rights reserved.
Klaas, H S; Clémence, A; Marion-Veyron, R; Antonietti, J-P; Alameda, L; Golay, P; Conus, P
2017-03-01
Awareness of illness (insight) has been found to have contradictory effects for different functional outcomes after the early course of psychosis. Whereas it is related to psychotic symptom reduction and medication adherence, it is also associated with increased depressive symptoms. In this line, the specific effects of insight on the evolution of functioning over time have not been identified, and social indicators, such as socio-occupational functioning have barely been considered. Drawing from social identity theory we investigated the impact of insight on the development of psychosocial outcomes and the interactions of these variables over time. The participants, 240 patients in early phase of psychosis from the Treatment and Early Intervention in Psychosis Program (TIPP) of the University Hospital of Lausanne, Switzerland, were assessed at eight time points over 3 years. Cross-lagged panel analyses and multilevel analyses were conducted on socio-occupational and general functioning [Social and Occupational Functioning Assessment Scale (SOFAS) and Global Assessment of Functioning (GAF)] with insight, time and depressive symptoms as independent variables. Results from multilevel analyses point to an overall positive impact of insight on psychosocial functioning, which increases over time. Yet the cross-lagged panel analysis did not reveal a systematic positive and causal effect of insight on SOFAS and GAF scores. Depressive symptoms seem only to be relevant in the beginning of the treatment process. Our results point to a complex process in which the positive impact of insight on psychosocial functioning increases over time, even when considering depressive symptoms. Future studies and treatment approaches should consider the procedural aspect of insight.
Publications | Page 449 | IDRC - International Development ...
International Development Research Centre (IDRC) Digital Library (Canada)
Results 4481 - 4490 of 6335 ... Although households engage in tobacco farming to improve ... to achieve their goals of positively impacting learning processes ... The prevalence of smoking among health professionals, especially among male physicians (17%), ... Cessation programmes in the heath care setting and training on ...
Publications | Page 449 | IDRC - International Development ...
International Development Research Centre (IDRC) Digital Library (Canada)
Results 4481 - 4490 of 6357 ... ... institutions to build local capacity through funding, knowledge sharing, and training. Through books, articles, research publications, and studies, we ... world where agriculture represents food security and stability, ...
Xavier, Rose Mary; Pan, Wei; Dungan, Jennifer R; Keefe, Richard S E; Vorderstrasse, Allison
2018-03-01
Insight in schizophrenia is long known to have a complex relationship with psychopathology symptoms and cognition. However, very few studies have examined models that explain these interrelationships. In a large sample derived from the NIMH Clinical Antipsychotic Trials of Intervention Effectiveness (CATIE) schizophrenia trial (N=1391), we interrogated these interrelationships for potential causal pathways using structural equation modeling. Using the NIMH consensus model, latent variables were constructed for psychopathology symptom dimensions, including positive, negative, disorganized, excited and depressed from the Positive and Negative Syndrome Scale (PANSS) items. Neurocognitive variables were created from five predefined domains of working memory, verbal memory, reasoning, vigilance and processing speed. Illness insight and treatment insight were tested using latent variables constructed from the Illness and Treatment Attitude Questionnaire (ITAQ). Disorganized symptoms had the strongest effect on insight. Illness insight mediated the relationship of positive, depressed, and disorganized symptoms with treatment insight. Neurocognition mediated the relationship between disorganized and treatment insight and depressed symptoms and treatment insight. There was no effect of negative symptoms on either illness insight or treatment insight. Taken together, our results indicate overlapping and unique relational paths for illness and treatment insight dimensions, which could suggest differences in causal mechanisms and potential interventions to improve insight. Copyright © 2017 Elsevier B.V. All rights reserved.
Insight, Neurocognition, and Schizophrenia: Predictive Value of the Wisconsin Card Sorting Test
Yanos, Philip T.
2013-01-01
Lack of insight in schizophrenia is a key feature of the illness and is associated with both positive and negative clinical outcomes. Previous research supports that neurocognitive dysfunction is related to lack of insight, but studies have not examined how neurocognition relates to change in insight over time. Therefore, the current study sought to understand how performance on the Wisconsin Card Sorting Test (WCST) differed between participants with varying degrees of change in insight over a 6-month period. Fifty-two patients with schizophrenia or schizoaffective disorder were administered the WCST and Positive and Negative Syndrome Scale (PANSS) at baseline, and the PANSS was again administered at a 6-month follow-up assessment. Results indicated that while neurocognition was related to insight at baseline, it was not related to subsequent change in insight. The implications of findings for conceptualization and assessment of insight are discussed. PMID:24303216
Self-clarity and different clusters of insight and self-stigma in mental illness.
Hasson-Ohayon, Ilanit; Mashiach-Eizenberg, Michal; Lysaker, Paul H; Roe, David
2016-06-30
The current study explored the self-experience of persons with Serious Mental Illness (SMI) by investigating the associations between different insight and self-stigma clusters, self-clarity, hope, recovery, and functioning. One hundred seven persons diagnosed with a SMI were administered six scales: self-concept clarity, self-stigma, insight into the illness, hope, recovery, and functioning. Correlations and cluster analyses were performed. Insight, as measured by a self-report scale was not related to any other variable. Self-stigma was negatively associated with self-clarity, hope, recovery and functioning. Three clusters emerged: moderate stigma/high insight (n=31), high stigma/moderate insight (n=28), and low stigma/low insight (n=42). The group with low stigma and low insight had higher mean levels of self-clarity and hope than the other two groups. There were no significant differences between cluster 1 (moderate stigma/high insight) and cluster 2 (high stigma/moderate insight) in all the variables beside self-clarity. The group with moderate stigma and high insight had significantly higher mean levels of self-clarity than the group with high stigma and moderate insight. Results reveal that when people diagnosed with SMI do not have high levels of self-stigma they often report a positive and clear sense of self accompanied with hope, regardless of having low insight. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
The relationship between theory of mind and insight in obsessive-compulsive disorder.
Tulacı, Rıza Gökçer; Cankurtaran, Eylem Şahin; Özdel, Kadir; Öztürk, Nefise; Kuru, Erkan; Özdemir, İlker
2018-02-09
It is known that obsessive-compulsive disorder (OCD) patients with poor insight display more severe neuropsychological impairments than other patients with OCD. There are limited studies of OCD and theory of mind (ToM). To investigate ToM skills in patients with OCD and the relationship between insight and ToM skills by comparing OCD patients with good and poor insight. Eighty patients with OCD and 80 healthy controls completed the structured clinical interview for DSM-IV axis I disorders, the Yale Brown Obsessive-Compulsive Scale, the Beck Anxiety and Beck Depression Inventories, and the Brown Assessment of Beliefs Scale. To assess ToM skills, first- and second-order false-belief tests, a hinting test, a faux pas test, a reading the mind in the eyes test, and a double-bluff test were administered. Patients with OCD had poorer ToM abilities than healthy controls. All ToM scores were significantly lower in the poor insight group than in the good insight group (p insight than in OCD with good insight may contribute to the idea of OCD with poor insight being a subtype with different clinical and neuropsychological characteristics.
International Nuclear Information System (INIS)
Yoon, Suk Ja
2001-01-01
To compare the film density of Insight dental X-ray film (Eastman Kodak Co., Rochester, NY, USA) with that of Ektaspeed Plus film (Eastman Kodak) under manual and automatic processing conditions. Insight and wedge on the film under the three different exposure times. The exposed films were processed by both manual and automatic ways. The Base plus fog density and the optical density and the optical density made by exposing step wedge were calculated using a digital densitometer (model 07-443, Victoreen Inc, Cleveland, Ohio, USA). The optical densities of the Insight and Ektaspeed film versus thickness of aluminum wedge at the same exposure time were plotted on the graphs. Statistical analyses were applied for comparing the optical densities of the two films. The film density of both Insight films and Ektaspeed Plus films under automatic processing condition was significantly higher over the manual processing. The film density of Insight over Ektaspeed Plus film. To take the full advantage of reducing exposure time, Insight film should be processed automatically
Cortical thickness and low insight into symptoms in enduring schizophrenia.
Emami, Seema; Guimond, Synthia; Mallar Chakravarty, M; Lepage, Martin
2016-01-01
Poor insight is a common, multidimensional phenomenon in patients with schizophrenia, associated with poorer outcomes and treatment non-adherence. Yet scant research has investigated the neuronal correlates of insight into symptoms (IS), a dimension of insight that may be particularly significant in enduring schizophrenia. Sixty-six patients with enduring schizophrenia (duration >4years) and 33 healthy controls completed MRI scanning and IQ, depression, and anxiety assessments. The Scale to Assess Insight-Expanded (SAI-E) measured insight into patients' four most prominent symptoms and patients were classified into two groups: low IS (0-2; n=33), and high IS (>2; n=33). We evaluated the association between cortical thickness (CT) and insight into symptoms using two methods: (1) a between-patients region-of-interest analysis in the insula, superior temporal gyrus (STG) and frontal lobe; and (2) a whole-brain exploratory regression between patient and controls. Brain regions were segmented using a neuroanatomical atlas and vertex-wise CT analyses were conducted with CIVET, covaried for age and sex. ROI analysis revealed thinner insula cortex in patients with low IS (pinsight-related differences in CT that has been previously unexplored in enduring schizophrenia. Copyright © 2015 Elsevier B.V. All rights reserved.
Improved understanding of protein complex offers insight into DNA
Summer Science Writing Internship Improved understanding of protein complex offers insight into DNA clearer understanding of the origin recognition complex (ORC) - a protein complex that directs DNA replication - through its crystal structure offers new insight into fundamental mechanisms of DNA replication
Neural pathway in the right hemisphere underlies verbal insight problem solving.
Zhao, Q; Zhou, Z; Xu, H; Fan, W; Han, L
2014-01-03
Verbal insight problem solving means to break mental sets, to select the novel semantic information and to form novel, task-related associations. Although previous studies have identified the brain regions associated with these key processes, the interaction among these regions during insight is still unclear. In the present study, we explored the functional connectivity between the key regions during solving Chinese 'chengyu' riddles by using event-related functional magnetic resonance imaging. Results showed that both insight and noninsight solutions activated the bilateral inferior frontal gyri, middle temporal gyri and hippocampi, and these regions constituted a frontal to temporal to hippocampal neural pathway. Compared with noninsight solution, insight solution had a stronger functional connectivity between the inferior frontal gyrus and middle temporal gyrus in the right hemisphere. Our study reveals the neural pathway of information processing during verbal insight problem solving, and supports the right-hemisphere advantage theory of insight. Copyright © 2013 IBRO. Published by Elsevier Ltd. All rights reserved.
A Storytelling Approach: Insights from the Shambaa.
Lamanna, Camillo
2018-03-19
Narrative medicine explores the stories that patients tell; this paper, conversely, looks at some of the stories that patients are told. The paper starts by examining the 'story' told by the Shambaa people of Tanzania to explain the bubonic plague and contrasts this with the stories told by Ghanaian communities to explain lymphatic filariasis. By harnessing insights from memory studies, these stories' memorability is claimed to be due to their use mnemonic devices woven into stories. The paper suggests that stories can be unpatronising, informative, and appropriate vehicles for communicating medical information to all age groups across all cultures.
Jacob, K. S.
2016-01-01
Recent studies related to insight, explanatory models (EMs) of illness and their relationship to outcome of psychosis are reviewed. The traditional argument that insight predicts outcome in psychosis is not supported by recent longitudinal data, which has been analyzed using multivariable statistics that adjust for severity and quality of illness. While all cognition will have a neurobiological representation, if “insight” is related to the primary psychotic process, then insight cannot be seen as an independent predictor of outcome but a part of the progression of illness. The evidence suggests insight, like all EMs, is belief which interacts with the trajectory of the person's illness and the local culture to produce a unique understanding of the illness for the particular individual and his/her family. PMID:27335513
Reduced connectivity in the self-processing network of schizophrenia patients with poor insight.
Directory of Open Access Journals (Sweden)
Edith J Liemburg
Full Text Available Lack of insight (unawareness of illness is a common and clinically relevant feature of schizophrenia. Reduced levels of self-referential processing have been proposed as a mechanism underlying poor insight. The default mode network (DMN has been implicated as a key node in the circuit for self-referential processing. We hypothesized that during resting state the DMN network would show decreased connectivity in schizophrenia patients with poor insight compared to patients with good insight. Patients with schizophrenia were recruited from mental health care centers in the north of the Netherlands and categorized in groups having good insight (n= 25 or poor insight (n = 19. All subjects underwent a resting state fMRI scan. A healthy control group (n = 30 was used as a reference. Functional connectivity of the anterior and posterior part of the DMN, identified using Independent Component Analysis, was compared between groups. Patients with poor insight showed lower connectivity of the ACC within the anterior DMN component and precuneus within the posterior DMN component compared to patients with good insight. Connectivity between the anterior and posterior part of the DMN was lower in patients than controls, and qualitatively different between the good and poor insight patient groups. As predicted, subjects with poor insight in psychosis showed decreased connectivity in DMN regions implicated in self-referential processing, although this concerned only part of the network. This finding is compatible with theories implying a role of reduced self-referential processing as a mechanism contributing to poor insight.
Cunningham, J. Barton; MacGregor, James N.; Gibb, Jenny; Haar, Jarrod
2009-01-01
A central question in creativity concerns how insightful ideas emerge. Anecdotal examples of insightful scientific and technical discoveries include Goodyear's discovery of the vulcanization of rubber, and Mendeleev's realization that there may be gaps as he tried to arrange the elements into the Periodic Table. Although most people would regard…
Right Hemispheric Dominance of Creative Insight: An Event-Related Potential Study
Shen, Wangbing; Liu, Chang; Zhang, Xiaojiang; Zhao, Xiaojun; Zhang, Jing; Yuan, Yuan; Chen, Yalin
2013-01-01
The purpose of this study was to investigate the hemispheric effect of creative insight. This study used high-density ERPs to record participants' brain activity while they performed an insight task. Results showed that both insight solutions and incomprehension solutions elicited a more negative ERP deflection (N320~550) than noninsight solutions…
Directory of Open Access Journals (Sweden)
Lu Chien-Wen
2011-10-01
Full Text Available Abstract Background The Beck Cognitive Insight Scale (BCIS was designed for the assessment of the cognitive processes involved in self-reflection and the ability to modify erroneous beliefs and misinterpretations. Studies investigating the factor structure of the BCIS have indicated a two-factor model in the psychotic population. The factor structure of the BCIS, however, has not received much consideration in the nonpsychiatric population. The present study examined the factor structure and validity of the BCIS and compared its scores between nonpsychiatric individuals and outpatients with psychosis. Method The Taiwanese version of the BCIS was administered to 507 nonpsychiatric individuals and 118 outpatients with schizophrenia. The psychometric properties of the BCIS were examined through the following analyses: exploratory and confirmatory factor analyses, reliability, correlation analyses, and discriminative validity. Results The BCIS showed adequate internal consistency and stability over time. Exploratory and confirmatory factor analyses on the 15-item measure indicated a two-factor solution that supported the two dimensions of the Taiwanese BCIS, which was also observed with the original BCIS. Following the construct validation, we obtained a composite index (self-reflectiveness minus self-certainty of the Taiwanese BCIS that reflected cognitive insight. Consistent with previous studies, our results indicated that psychosis is associated with low self-reflectiveness and high self-certainty, which possibly reflect lower cognitive insight. Our results also showed that better cognitive insight is related to worse depression in patients with schizophrenia spectrum disorders, but not in nonpsychiatric individuals. The receiver operating characteristic (ROC analyses revealed that the area under the curve (AUC was 0.731. A composite index of 3 was a good limit, with a sensitivity of 87% and a specificity of 51%. Conclusion The BCIS proved to be
Evaluation of the spoilage potential of bacteria isolated from chilled chicken in vitro and in situ.
Wang, Guang-Yu; Wang, Hu-Hu; Han, Yi-Wei; Xing, Tong; Ye, Ke-Ping; Xu, Xing-Lian; Zhou, Guang-Hong
2017-05-01
Microorganisms play an important role in the spoilage of chilled chicken. In this study, a total of 53 isolates, belonging to 7 species of 3 genera, were isolated using a selective medium based on the capacity to spoil chicken juice. Four isolates, namely Aeromonas salmonicida 35, Pseudomonas fluorescens H5, Pseudomonas fragi H8 and Serratia liquefaciens 17, were further characterized to assess their proteolytic activities in vitro using meat protein extracts and to evaluate their spoilage potential in situ. The in vitro studies showed that A. salmonicida 35 displayed the strongest proteolytic activity against both sarcoplasmic and myofibrillar proteins. However, the major spoilage isolate in situ was P. fragi H8, which exhibited a fast growth rate, slime formation and increased pH and total volatile basic nitrogen (TVBN) on chicken breast fillets. The relative amounts of volatile organic compounds (VOCs) originating from the microorganisms, including alcohols, aldehydes, ketones and several sulfur compounds, increased during storage. In sum, this study demonstrated the characteristics of 4 potential spoilage bacteria on chilled yellow-feather chicken and provides a simple and convenient method to assess spoilage bacteria during quality management. Copyright © 2016 Elsevier Ltd. All rights reserved.
Insight in paranoia: The role of experiential avoidance and internalized stigma.
Valiente, Carmen; Provencio, Maria; Espinosa, Regina; Duque, Almudena; Everts, Franziska
2015-05-01
Evidence suggests that insight in psychosis has been related to treatment adherence, recovery and good prognosis, but also to depression, low self-esteem, and diminished quality of life. Thus, insight might not be advantageous under all circumstances. Internalized-stigma (i.e. self-acceptance of stigmatizing images of illness) and experiential avoidance (i.e. unwillingness to experience negative private events) have been proposed as moderating variables between insight, and psychological health variables and/or distress. We investigated the patterns of association of insight with satisfaction with life, self-esteem, depression, anxiety and psychotic psychopathology as moderated by self-stigmatizing beliefs and experiential avoidance, in a sample of 47 participants with persecutory beliefs and diagnosed with schizophrenia or other psychotic disorder. Moderation analyses confirm the importance of internalized-stigma and experiential avoidance. The presence of insight was associated with more depression when there were high levels of self-stigma. Whereas, the absence of insight was associated with a greater life satisfaction when there were high levels of experiential avoidance. To summarize, our results help understand the complex relationship between insight, psychological health variables and emotional distress, pointing to a differential pattern of moderation for negative and positive outcomes. We discuss the implications of these results for research and treatment of paranoia. Copyright © 2015 Elsevier B.V. All rights reserved.
Bouvet, C; Bouchoux, A
2015-10-01
depression decreased moderately with CDSS and with small intensity with SAIQ, but clearly. So, ISMI is probably a mediating variable between IS and BDI-CDSS. In conclusion, internalized stigma could be a mediating variable between insight and depression. This validates our second hypothesis. Our results suggest that the relationship between insight and depression is mediated by internalized stigma. Patients with good insight who internalize stigma seem to be more depressed than those who don't. This result could have important consequences in clinical practice: improving insight level should be completed by a specific attention to the level and evolution of internalized stigma to avoid increasing depression. Further studies need to be conducted to confirm these results. Copyright © 2014 L’Encéphale, Paris. Published by Elsevier Masson SAS. All rights reserved.
Civilian Health and Medical Program of the Uniformed Services (CHAMPUS). Change 5
1993-09-17
addressed in the therapy session; a statement summarizing the therapeutic interventions attempted during the therapy session; descriptions of the response...4-49 32. Dyslexia . 4-49 33. Surgical sterilization, reversal. 4-49 34. Artificial insemination, in-vitro fertilization. gamete intrafallopian...a 24-hour basis by skilled nursing staff, and/or requires continued intervention by a multidisciplinary treatment team; and in addition, at least one
The relationship between insight and psychosis in state patients with ...
African Journals Online (AJOL)
Objective. State patients committed under the Mental Health Act must have insight into their illness and the crime they committed before they can be discharged. Patients with schizophrenia are described as having poor insight into the nature and severity of their disorder. Various factors influence insight, and in some studies ...
Gillet, Nicolas; Fouquereau, Evelyne; Lafrenière, Marc-André K; Huyghebaert, Tiphaine
2016-07-03
Past research in the self-determination theory has shown that autonomous motivation is associated with positive outcomes (e.g., work satisfaction), whereas controlled motivation is related to negative outcomes (e.g., anxiety). The purpose of the present research was to examine the moderating function of role ambiguity on the relationships between work autonomous and controlled motivations on the one hand, and work satisfaction and anxiety on the other. Six hundred and ninety-eight workers (449 men and 249 women) participated in this study. Results revealed that autonomous motivation was most strongly related to satisfaction when ambiguity was low. In addition, controlled motivation was most strongly related to anxiety when ambiguity was high. In other words, the present findings suggest that the outcomes associated with each form of motivation may vary as a function of role ambiguity. The present study thus offers meaningful insights for organizations, managers, and employees.
Insight and subjective measures of quality of life in chronic schizophrenia.
Siu, Cynthia O; Harvey, Philip D; Agid, Ofer; Waye, Mary; Brambilla, Carla; Choi, Wing-Kit; Remington, Gary
2015-09-01
Lack of insight is a well-established phenomenon in schizophrenia, and has been associated with reduced rater-assessed functional performance but increased self-reported well-being in previous studies. The objective of this study was to examine factors that might influence insight (as assessed by the Insight and Treatment Attitudes Questionnaire [ITAQ] or PANSS item G12) and subjective quality-of-life (as assessed by Lehman QoL Interview [LQOLI]), using the large National Institute of Mental Health Clinical Antipsychotic Trials of Intervention Effectiveness (CATIE) dataset. Uncooperativeness was assessed by PANSS item G8 ("Uncooperativeness"). In the analysis, we found significant moderating effects for insight on the relationships of subjective life satisfaction assessment to symptom severity (as assessed by CGI-S score), objective everyday functioning (as assessed by rater-administered Heinrichs-Carpenter Quality of Life scale), clinically rated uncooperativeness (as assessed by PANSS G8), and discontinuation of treatment for all causes (all P > 0.05 for statistical interaction between insight and subject QoL). Patients with chronic schizophrenia who reported being "pleased" or "delighted" on LQOLI were found to have significantly lower neurocognitive reasoning performance and poorer insight (ITAQ total score). Our findings underscore the importance of reducing cognitive and insight impairments for both treatment compliance and improved functional outcomes.
Insight Into Illness and Cognition in Schizophrenia in Earlier and Later Life.
Gerretsen, Philip; Voineskos, Aristotle N; Graff-Guerrero, Ariel; Menon, Mahesh; Pollock, Bruce G; Mamo, David C; Mulsant, Benoit H; Rajji, Tarek K
2017-04-01
Impaired insight into illness in schizophrenia is associated with illness severity and deficits in premorbid intellectual function, executive function, and memory. A previous study of patients aged 60 years and older found that illness severity and premorbid intellectual function accounted for variance in insight impairment. As such, we aimed to test whether similar relationships would be observed in earlier life. A retrospective analysis was performed on 1 large sample of participants (n = 171) with a DSM-IV-TR diagnosis of schizophrenia aged 19 to 79 years acquired from 2 studies: (1) a psychosocial intervention trial for older persons with schizophrenia (June 2008 to May 2014) and (2) a diffusion tensor imaging and genetics study of psychosis across the life span (February 2007 to December 2013). We assessed insight into illness using the Positive and Negative Syndrome Scale (PANSS) item G12 and explored its relationship to illness severity (PANSS total modified), premorbid intellectual function (Wechsler Test of Adult Reading [WTAR]), and cognition. Insight impairment was more severe in later life (≥ 60 years) than in earlier years (t = -3.75, P insight was explained by PANSS total modified (Exp[B] = 1.070, P insight, they did not independently contribute to its variance. However, the relationships between impaired insight and illness severity and between impaired insight and cognition, particularly working memory, were stronger in later life than in earlier life. These results suggest an opportunity for intervention may exist with cognitive-enhancing neurostimulation or medications to improve insight into illness in schizophrenia across the life span. Original study registered on ClinicalTrials.gov (identifier: NCT00832845). © Copyright 2017 Physicians Postgraduate Press, Inc.
O insight no transtorno bipolar: uma revisão sistemática
Directory of Open Access Journals (Sweden)
Rafael de Assis da Silva
2014-09-01
Full Text Available Objetivos Realizar uma revisão sistemática para compreender que fatores estão relacionados a uma maior ou menor consciência de morbidade no transtorno bipolar (TB, como o insight varia em função do estado afetivo e estabelecer uma comparação com outros transtornos mentais. Métodos Realizou-se uma revisão sistemática da literatura científica sobre o insight em pacientes com TB. Foram buscados estudos clínicos originais sobre o tema nas bases de dados Medline, ISI e SciELO. Os termos de busca empregados foram: “insight” OR “awareness” AND “bipolar” OR “mania” OR “manic”. Resultados Foram selecionados 55 artigos. O insight no TB parece ser mais prejudicado do que na depressão unipolar, porém menos do que na esquizofrenia. Com relação ao TB, um menor nível de insight está relacionado à presença de sintomas psicóticos e de alterações cognitivas. Além disso, um comprometimento do insight está associado a uma menor adesão ao tratamento. Por outro lado, uma maior preservação do insight pode estar associada a maior ideação suicida. Finalmente, a fase maníaca cursa com um nível inferior de insight quando comparada à fase depressiva ou de eutimia. Conclusão No TB, o insight está significativamente prejudicado, especialmente na mania. Diversos fatores clínicos parecem influenciar o nível de insight.
The effects of gender and self-insight on early semantic processing.
Directory of Open Access Journals (Sweden)
Xu Xu
Full Text Available This event-related potential (ERP study explored individual differences associated with gender and level of self-insight in early semantic processing. Forty-eight Chinese native speakers completed a semantic judgment task with three different categories of words: abstract neutral words (e.g., logic, effect, concrete neutral words (e.g., teapot, table, and emotion words (e.g., despair, guilt. They then assessed their levels of self-insight. Results showed that women engaged in greater processing than did men. Gender differences also manifested in the relationship between level of self-insight and word processing. For women, level of self-insight was associated with level of semantic activation for emotion words and abstract neutral words, but not for concrete neutral words. For men, level of self-insight was related to processing speed, particularly in response to abstract and concrete neutral words. These findings provide electrophysiological evidence for the effects of gender and self-insight on semantic processing and highlight the need to take into consideration subject variables in related research.
Jing, Rixing; Huang, Jiangjie; Jiang, Deguo; Lin, Xiaodong; Ma, Xiaolei; Tian, Hongjun; Li, Jie; Zhuo, Chuanjun
2018-01-23
Schizophrenia is associated with widespread and complex cerebral blood flow (CBF) disturbance. Auditory verbal hallucinations (AVH) and insight are the core symptoms of schizophrenia. However, to the best of our knowledge, very few studies have assessed the CBF characteristics of the AVH suffered by schizophrenic patients with and without insight. Based on our previous findings, Using a 3D pseudo-continuous ASL (pcASL) technique, we investigated the differences in AVH-related CBF alterations in schizophrenia patients with and without insight. We used statistical parametric mapping (SPM8) and statistical non-parametric mapping (SnPM13) to perform the fMRI analysis. We found that AVH-schizophrenia patients without insight showed an increased CBF in the left temporal pole and a decreased CBF in the right middle frontal gyrus when compared to AVH-schizophrenia patients with insight. Our novel findings suggest that AVH-schizophrenia patients without insight possess a more complex CBF disturbance. Simultaneously, our findings also incline to support the idea that the CBF aberrant in some specific brain regions may be the common neural basis of insight and AVH. Our findings support the mostly current hypotheses regarding AVH to some extent. Although our findings come from a small sample, it provide the evidence that indicate us to conduct a larger study to thoroughly explore the mechanisms of schizophrenia, especially the core symptoms of AVHs and insight.
A medley of meanings: Insights from an instance of gameplay in League of Legends
Directory of Open Access Journals (Sweden)
Max Watson
2015-06-01
Full Text Available This article engages with the notion of insightful gameplay. It recounts debates about what, if anything, makes play meaningful. Through these, it contends that while some games are explicitly designed to foster insightful gameplay, most are not and many might even be considered utterly meaningless. It notes how discussions about what makes playing games meaningful raise concomitant questions about what playing means. It then strives to reconcile these two interrelated questions by offering the notion of a medley of meanings. A medley of meanings is the notion that each player brings their own subjective disposition to playing to a particular instance of gameplay; no participant to gameplay should be considered as in a state that is “not playing”. Because these subjective dispositions to playing can be quite divergent, players can and often do clash in instances of gameplay. This article then contends that these clashes can in turn render the most seemingly meaningless games potential hotbeds of insightful gameplay. The second half of this article discusses the ethnographic example of an instance of gameplay in the digital game League of Legends in order to explicate the notion of a medley of meanings.
Insight, rumination, and self-reflection as predictors of well-being.
Harrington, Rick; Loffredo, Donald A
2011-01-01
Dispositional private self-focused attention variables such as insight, internal self-awareness (ISA), and self-reflectiveness (SR) have been found to relate to well-being. The present study sought to determine which dispositional private self-focused attention variables have the most predictive power for subjective well-being as measured by the Satisfaction With Life Scale (E. Diener, R. A. Emmons, R. J. Larsen, & S. Griffin, 1985) and for a eudaemonic form of well-being as measured by the Psychological Well-Being Scale (C. D. Ryff, 1989). A total of 121 college student participants completed an online version of the Self-Consciousness Scale-Revised, the Rumination-Reflection Questionnaire, the Self-Reflection and Insight Scale, the Satisfaction With Life Scale, and the Psychological WellBeing Scale. Results of a multivariate regression analysis using the Self-Consciousness Scale-Revised's (M. F. Scheier & C. S. Carver, 1985) subfactors of SR and ISA, the Rumination-Reflection Questionnaire's (P. D. Trapnell & J. D. Campbell, 1999) subscales of Rumination and Reflection, and the Self-Reflection and Insight Scale's (A. M. Grant, J. Franklin, & P. Langford, 2002) Self-Reflection and Insight subscales revealed that the Insight subscale was the only statistically significant predictor (a positive predictor) for all 6 dimensions of psychological well-being. Insight was also the only significant positive predictor for satisfaction with life. The Rumination subscale was a significant negative predictor for 3 dimensions of psychological well-being, and the Reflection subscale was a significant positive predictor for 1 dimension. Implications of dispositional self-awareness variables and their relation to dimensions of well-being are discussed.
Adaptation Insights: Lessons from participatory research in Africa ...
International Development Research Centre (IDRC) Digital Library (Canada)
21 avr. 2016 ... The Adaptation Insights series consists of nine case studies from seven projects supported by the Climate Change Adaptation in Africaprogram. Each brief presents insights from research carried out with the active involvement of communities at risk from climate change. The series includes case studies ...
Hwang, Samuel Suk-Hyun; Ahn, Yong Min; Kim, Yong Sik
2015-12-30
Based on the neuropsychological deficit model of insight in schizophrenia, we constructed exploratory prediction models for insight, designating neurocognitive measures as the intermediary variables between psychopathology and insight into patients with schizophrenia. The models included the positive, negative, and autistic preoccupation symptoms as primary predictors, and activation symptoms as an intermediary variable for insight. Fifty-six Korean patients, in the acute stage of schizophrenia, completed the Positive and Negative Syndrome Scale, as well as a comprehensive neurocognitive battery of tests at the baseline, 8-weeks, and 1-year follow-ups. Among the neurocognitive measures, the Korean Wechsler Adult Intelligence Scale (K-WAIS) picture arrangement, Controlled Oral Word Association Test (COWAT) perseverative response, and the Continuous Performance Test (CPT) standard error of reaction time showed significant correlations with the symptoms and the insight. When these measures were fitted into the model as intermediaries between the symptoms and the insight, only the perseverative response was found to have a partial mediating effect - both cross-sectionally, and in the 8-week longitudinal change. Overall, the relationship between insight and neurocognitive functioning measures was found to be selective and weak. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Insight na psicose: uma análise conceitual
Directory of Open Access Journals (Sweden)
Lucas F. B. Mella
2011-01-01
Full Text Available INTRODUÇÃO: No contexto da psiquiatria clínica, insight ou crítica da doença é definida como uma subcategoria do autoconhecimento dos pacientes relativa ao reconhecimento das manifestações patológicas que os afetam e também à apreciação das mudanças que tais manifestações causam na sua interação com o mundo. OBJETIVO: Examinar as formas de apresentação do insight na esquizofrenia e em outras psicoses. MÉTODOS: Análise conceitual, com vinhetas clínicas ilustrativas, da relação entre insight e as diversas dimensões sintomatológicas da esquizofrenia e condições relacionadas, considerando aspectos clínicos, neurocognitivos, psicodinâmicos e transculturais. RESULTADOS: Do ponto de vista conceitual, o construto é conformado pela perspectiva teórica adotada; do ponto de vista clínico, sua apresentação nas psicoses é a resultante da interação com os diferentes domínios sintomatológicos e aspectos subjetivos e culturais do paciente. CONCLUSÃO: A avaliação psicopatológica do insight deve levar em conta a complexidade do fenômeno, o recorte teórico em que está situada e a finalidade clínica com que é realizada.
Evaluation of insight training of ambulance drivers in Sweden using DART, a new e-learning tool.
Albertsson, Pontus; Sundström, Anna
2011-12-01
The aim of the study was to evaluate whether a new e-learning tool for insight training of ambulance drivers can have an effect on drivers' driving behaviors, perceived driving competence, competence to assess risks, self-reflection, and safety attitudes. A quasi-experimental study design, with participants nonrandomly assigned into a control and intervention group, was used. The intervention group participated in the insight-training course and the control group did not. Both groups completed a self- and peer assessment online questionnaire before and after the training. The main finding is that the ambulance drivers assessed themselves through the instruments after the training, with the e-learning tool Driver Access Recording Tool (DART), as safer drivers in the areas of speed adaptation, closing up, and overtaking. In the answers from the group-based evaluation, the ambulance drivers responded that they were more reflective/analytical, had increased their risk awareness, and had changed their driving behaviors. After insight training, the ambulance drivers in this study assessed themselves as safer drivers in several important areas, including speed adaptation, closing up, and overtaking. In future training of ambulance drivers there should be more focus on insight training instead of previous training focusing on maneuvering capabilities.
Investigating Insight as Sudden Learning
Ash, Ivan K.; Jee, Benjamin D.; Wiley, Jennifer
2012-01-01
Gestalt psychologists proposed two distinct learning mechanisms. Associative learning occurs gradually through the repeated co-occurrence of external stimuli or memories. Insight learning occurs suddenly when people discover new relationships within their prior knowledge as a result of reasoning or problem solving processes that re-organize or…
The relationship between insight and neurological dysfunction in first-episode psychosis.
LENUS (Irish Health Repository)
Hill, M
2012-04-01
Impaired insight is commonly seen in psychosis and some studies have proposed that is a biologically based deficit. Support for this view comes from the excess of neurological soft signs (NSS) observed in patients with psychoses and their neural correlates which demonstrate a degree of overlap with the regions of interest implicated in neuroimaging studies of insight. The aim was to examine the relationship between NSS and insight in a sample of 241 first-episode psychosis patients.
Jørgensen, R; Licht, R W; Lysaker, P H; Munk-Jørgensen, P; Buck, K D; Jensen, S O W; Hansson, L; Zoffmann, V
2015-07-01
Poor insight has a negative impact on the outcome in schizophrenia; consequently, poor insight is a logical target for treatment. However, neither medication nor psychosocial interventions have been demonstrated to improve poor insight. A method originally designed for diabetes patients to improve their illness management, Guided Self-Determination (GSD), has been adapted for use in patients with schizophrenia (GSD-SZ). The purpose of this study was to investigate the effect on insight of GSD-SZ as a supplement to treatment as usual (TAU) as compared to TAU alone in outpatients diagnosed with schizophrenia. The design was an open randomized trial. The primary hypothesis was cognitive insight would improve in those patients who received GSD-SZ+TAU as assessed by the BCIS. We additionally explored whether the intervention led to changes in clinical insight, self-perceived recovery, self-esteem, social functioning and symptom severity. Assessments were conducted at baseline, and at 3-, 6- and 12-month follow-up. Analysis was based on the principles of intention to treat and potential confounders were taken into account through applying a multivariate approach. A total of 101 participants were randomized to GSD-SZ+TAU (n=50) or to TAU alone (n=51). No statistically significant differences were found on the cognitive insight. However, at 12-month follow-up, clinical insight (measured by G12 from the Positive and Negative Syndrome Scale), symptom severity, and social functioning had statistically significantly improved in the intervention group as compared to the control group. "Improving insight in patients diagnosed with schizophrenia", NCT01282307, http://clinicaltrials.gov/. Copyright © 2015 Elsevier Masson SAS. All rights reserved.
Salvi, Carola; Cristofori, Irene; Grafman, Jordan; Beeman, Mark
2016-01-01
Previous studies showed that liberals and conservatives differ in cognitive style. Liberals are more flexible, and tolerant of complexity and novelty, whereas conservatives are more rigid, are more resistant to change, and prefer clear answers. We administered a set of compound remote associate problems, a task extensively used to differentiate problem-solving styles (via insight or analysis). Using this task, several researches have proven that self-reports, which differentiate between insig...
Overlap and distinction between measures of insight and self-stigma.
Hasson-Ohayon, Ilanit
2018-05-24
Multiple studies on insight into one's illness and self-stigma among patients with serious mental illness and their relatives have shown that these constructs are related to one another and that they affect outcome. However, a critical exploration of the items used to assess both constructs raises questions with regard to the possible overlapping and centrality of items. The current study used five different samples to explore the possible overlap and distinction between insight and self-stigma, and to identify central items, via network analyses and principal component factor analysis. Findings from the network analyses showed overlap between insight and self-stigma exist with a relatively clearer observational distinction between the constructs among the two parent samples in comparison to the patient samples. Principal component factor analysis constrained to two factors showed that a relatively high percentage of items were not loaded on either factor, and in a few datasets, several insight items were loaded on the self-stigma scale and vice versa. The author discusses implications for research and calls for rethinking the way insight is assessed. Clinical implications are also discussed in reference to central items of social isolation, future worries and stereotype endorsement among the different study groups. Copyright © 2018 Elsevier B.V. All rights reserved.
Insight solutions are correct more often than analytic solutions
Salvi, Carola; Bricolo, Emanuela; Kounios, John; Bowden, Edward; Beeman, Mark
2016-01-01
How accurate are insights compared to analytical solutions? In four experiments, we investigated how participants’ solving strategies influenced their solution accuracies across different types of problems, including one that was linguistic, one that was visual and two that were mixed visual-linguistic. In each experiment, participants’ self-judged insight solutions were, on average, more accurate than their analytic ones. We hypothesised that insight solutions have superior accuracy because they emerge into consciousness in an all-or-nothing fashion when the unconscious solving process is complete, whereas analytic solutions can be guesses based on conscious, prematurely terminated, processing. This hypothesis is supported by the finding that participants’ analytic solutions included relatively more incorrect responses (i.e., errors of commission) than timeouts (i.e., errors of omission) compared to their insight responses. PMID:27667960
Danek, Amory H.; Wiley, Jennifer; Öllinger, Michael
2016-01-01
Insightful problem solving is a vital part of human thinking, yet very difficult to grasp. Traditionally, insight has been investigated by using a set of established "insight tasks," assuming that insight has taken place if these problems are solved. Instead of assuming that insight takes place during every solution of the 9 Dot, 8 Coin,…
Balcázar, José Luis; de Blas, Ignacio; Ruiz-Zarzuela, Imanol; Vendrell, Daniel; Gironés, Olivia; Muzquiz, José Luis
2007-10-01
We analysed the effect of probiotic strains on the cellular and humoral immune responses of rainbow trout (Oncorhynchus mykiss), and their capacity to prevent furunculosis during a challenge trial. Probiotic strains (Lactococcus lactis ssp. lactis CLFP 100, Leuconostoc mesenteroides CLFP 196, and Lactobacillus sakei CLFP 202) were administered orally to fish for 2 weeks at 10(6) CFU g(-1) of feed. In comparison to untreated control fish, the phagocytic activity of head kidney leukocytes and the alternative complement activity in serum were significantly greater in all probiotic groups at the end of the second week. With the exception of the group fed with Lactobacillus sakei, superoxide anion production was also significantly increased in the probiotic groups. Analysis of lysozyme activity did not exhibit any significant difference in the probiotic and control groups. Fifteen days after the start of the probiotic feeding, fish were challenged with Aeromonas salmonicida ssp. salmonicida. The fish supplemented with probiotics exhibited survival rates ranging from 97.8% to 100%, whereas survival was 65.6% in fish not treated with the probiotics. These results demonstrate that probiotic supplementation to fish can reduce the severity of furunculosis, and suggest that this reduction may be associated with enhanced humoral and cellular immune response.
Cognitive Psychology--An Educational Insight
Muirhead, Brent
2007-01-01
Cognitive psychology offers relevant insights into improving the teaching and learning process. The author has selected ten questions from a graduate class in cognition and learning taken at The Teachers College, Columbia University. The questions will be used to examine the most effective ways to learn and recall information.
Fu, Yan-Nan; Cao, Xiao-Lan; Hou, Cai-Lan; Ng, Chee H; Ungvari, Gabor S; Chiu, Helen F K; Lin, Yong-Qiang; Wang, Lihui; Zheng, Xiaocong; Jia, Fu-Jun; Xiang, Yu-Tao
2017-09-01
There are no published data on insight in homeless patients with psychiatric disorders in China. This study examined insight in homeless and non-homeless Chinese psychiatric inpatients in relation to demographic and clinical variables. A total of 278 homeless and 222 non-homeless inpatients matched in age and gender were included in the study. Demographic and clinical characteristics were collected based on a review of medical charts and a clinical interview with standardized instruments. Insight was evaluated with the Insight and Treatment Attitudes Questionnaire. Altogether 20.5% of homeless inpatients and 43.7% of the non-homeless controls had good insight. Compared with homeless inpatients with impaired insight, homeless inpatients with good insight had higher physical quality of life, longer duration of illness and less severe positive and negative symptoms. Impaired insight appeared more common in homeless psychiatric inpatients in China. Further studies should address the need for effective therapeutic interventions that promote homeless patients' insight. Copyright © 2017 Elsevier Ireland Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Laurent Boyer
Full Text Available OBJECTIVE: The aim of this study was to examine the complex relationships among neurocognition, insight and nonadherence in patients with schizophrenia. METHODS: DESIGN: Cross-sectional study. INCLUSION CRITERIA: Diagnosis of schizophrenia according to the DSM-IV-TR criteria. DATA COLLECTION: Neurocognition was assessed using a global approach that addressed memory, attention, and executive functions; insight was analyzed using the multidimensional 'Scale to assess Unawareness of Mental Disorder;' and nonadherence was measured using the multidimensional 'Medication Adherence Rating Scale.' ANALYSIS: Structural equation modeling (SEM was applied to examine the non-straightforward relationships among the following latent variables: neurocognition, 'awareness of positive symptoms' and 'negative symptoms', 'awareness of mental disorder' and nonadherence. RESULTS: One hundred and sixty-nine patients were enrolled. The final testing model showed good fit, with normed χ(2 = 1.67, RMSEA = 0.063, CFI = 0.94, and SRMR = 0.092. The SEM revealed significant associations between (1 neurocognition and 'awareness of symptoms,' (2 'awareness of symptoms' and 'awareness of mental disorder' and (3 'awareness of mental disorder' and nonadherence, mainly in the 'attitude toward taking medication' dimension. In contrast, there were no significant links between neurocognition and nonadherence, neurocognition and 'awareness of mental disorder,' and 'awareness of symptoms' and nonadherence. CONCLUSIONS: Our findings support the hypothesis that neurocognition influences 'awareness of symptoms,' which must be integrated into a higher level of insight (i.e., the 'awareness of mental disorder' to have an impact on nonadherence. These findings have important implications for the development of effective strategies to enhance medication adherence.
Valiente, Carmen; Provencio, María; Espinosa, Regina; Chaves, Covadonga; Fuentenebro, Filiberto
2011-09-30
In schizophrenia, poor insight has been associated with negative outcome. In fact, some studies have found insight to be associated with greater treatment adherence and lower levels of symptomatology, as well as better psychosocial functioning. However, others have found that insight into illness is associated with an increase in depression, low self-esteem, and possibly higher risk of suicide. We investigated the relationship between insight and well-being in a sample of 40 people presenting paranoid symptoms and diagnosed with schizophrenia or other psychotic disorder. Independent-samples t-tests revealed that compared to a paranoid group with high insight, paranoid participants with low insight had more self-acceptance, higher sense of autonomy and personal growth, and greater orientation towards gratification. Moderation analyses showed that when experiential avoidance was high, insight into paranoia had a detrimental effect on self-acceptance. Overall, our results support the need to explore which psychological variables moderate insight in patients with persecutory beliefs. We discuss the implications of these results for the research of paranoia. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.
2011-01-01
Power 6 ( Davinci ) systems. We have also made use of the Air Force Research Laboratory DSRC Altix (Hawk) and the Engineer Research and Development...the design and development of high performance gas turbine combustion systems both as a pretest analysis tool to predict static and dynamic...application while gaining insight into MATLAB’s value as an engineering tool . I would like to thank the MHPCC and the Akamai Workforce Initiative
Villa, Jennifer; Choi, Jennifer; Kangas, Julie L; Kaufmann, Christopher N; Harvey, Philip D; Depp, Colin A
2018-02-01
Previous literature suggests that better cognitive ability and insight are associated with greater lifetime risk of suicide attempts in schizophrenia, counter to the direction of association in the general population. However, the conjoint association between distinct cognitive domains, insight, and suicidality has not been assessed. In a cross-sectional study, 162 adults with schizophrenia or schizoaffective disorder completed cognitive testing via the MATRICS battery, symptom and cognitive insight assessments, along with the Columbia Suicide Severity Rating Scale. We then contrasted participants based on history of suicidality by cognitive domains and insight measures and conducted multivariate analyses. Although a history of any passive ideation was not associated with cognitive ability or insight, verbal learning was positively associated with a greater history of suicidal attempt and prior ideation with a plan and intent. Higher cognitive insight, and the self-reflectiveness subscale insight, was also associated with history of passive or active suicidal ideation. Cognitive insight and cognitive ability were independent from each other, and there were no moderating influences of insight on the effect of cognitive ability on suicide related history. Exploratory analyses revealed that history of planned attempts were associated with greater verbal learning, whereas histories of aborted attempts were associated with poorer reasoning and problem-solving. Although cross-sectional and retrospective, this study provides support that greater cognitive ability, specifically verbal learning, along with self-reflectiveness, may confer elevated risk for more severe suicidal ideation and behavior in an independent fashion. Interestingly, poorer problem-solving was associated with aborted suicide attempts. Published by Elsevier B.V.
Czech Academy of Sciences Publication Activity Database
Mládková, Jana; Šanda, Miloslav; Matoušková, E.; Selicharová, Irena
2010-01-01
Roč. 10, - (2010), 449/1-449/10 ISSN 1471-2407 R&D Projects: GA MŠk(CZ) LC06077 Institutional research plan: CEZ:AV0Z40550506 Keywords : 2-DE * breast cancer * glutathione Subject RIV: CC - Organic Chemistry Impact factor: 3.153, year: 2010 http://www.biomedcentral.com/1471-2407/10/449
Ultraviolet radiation as disinfection for fish surgical tools
Energy Technology Data Exchange (ETDEWEB)
Walker, Ricardo W.; Markillie, Lye Meng; Colotelo, Alison HA; Geist, David R.; Gay, Marybeth E.; Woodley, Christa M.; Eppard, M. B.; Brown, Richard S.
2013-04-04
Telemetry is frequently used to examine the behavior of fish, and the transmitters used are normally surgically implanted into the coelomic cavity of fish. Implantation requires the use of surgical tools such as scalpels, forceps, needle holders, and sutures. When fish are implanted consecutively, as in large telemetry studies, it is common for surgical tools to be sterilized or, at minimum, disinfected between each use so that pathogens that may be present are not spread among fish. To determine the efficacy for this application, ultraviolet (UV) radiation was used to disinfect surgical tools exposed to one of four aquatic organisms that typically lead to negative health issues for salmonids. These organisms included Aeromonas salmonicida, Flavobacterium psychrophilum, Renibacterium salmoninarum, and Saprolegnia parasitica, causative agents of furunculosis, coldwater disease, bacterial kidney disease, and saprolegniasis (water mold), respectively. Four experiments were conducted to address the question of UV efficacy. In the first experiment, forceps were exposed to the three bacteria at three varying concentrations. After exposure to the bacterial culture, tools were placed into a mobile Millipore UV sterilization apparatus. The tools were then exposed for three different time periods – 2, 5, or 15 min. UV radiation exposures at all durations were effective at killing all three bacteria on forceps at the highest bacteria concentrations. In the second experiment, stab scalpels, sutures, and needle holders were exposed to A. salmonicida using the same methodology as used in Experiment 1. UV radiation exposure at 5 and 15 min was effective at killing A. salmonicida on stab scalpels and sutures but not needle holders. In the third experiment, S. parasitica, a water mold, was tested using an agar plate method and forceps-pinch method. UV radiation was effective at killing the water mold at all three exposure durations. Collectively, this study shows that UV
Reflections on the theoretical contributions and clinical applications of parental insightfulness.
Lieberman, Alicia F
2018-06-01
This paper outlines the theoretical antecedents that contextualize parental insightfulness and examines this concept's value in assessing parental functioning and in monitoring treatment progress with parents and young children who experience mental health and relationship problems. As a concept, parental insightfulness provides a much-needed bridge linking important aspects of attachment theory with their psychoanalytic origins, including early contributions that conceptualize parenting as a developmental process that furthers the unfolding capacities of the adult self. The paper examines the compatibility between the dimensions of parental insightfulness and the criteria for a healthy adult sense of self. The empirical body of knowledge generated by the concept of parental insightfulness is briefly reviewed as the basis for using the concept as a valuable tool for the empirical exploration of intrapsychic, interpersonal, and clinical processes in parents and their children.
FREEDOM OF COMBINATION AND HETEROGENEITY: A CORPUS LINGUIST’S LOOK AT TWO SAUSSUREAN INSIGHTS
Directory of Open Access Journals (Sweden)
Tony Berber Sardinha
2014-06-01
Full Text Available This article offers a reexamination of two of Saussure’s insights from the point of view of corpus linguistics—namely, freedom of combination and heterogeneity in language in use. Regarding the first insight, an analysis of word combinations in a corpus of newspaper texts written in Brazilian Portuguese was carried out to determine how many of these combinations were actual collocations—that is, were used frequently enough in a very large reference corpus (the Brazilian corpus to warrant statistical significance. The results suggested that most word combinations are not free; rather, they follow previously established preferences among speakers. Regarding the second notion, that of heterogeneity, the collocations in the newspaper texts were tracked as they were deployed one after the other along each text, and this flow was visually depicted. The inspection of the charts revealed unique patterns of the distribution of collocation, thereby suggesting that the evidence supports the view of heterogeneity. A cluster analysis was later conducted on the amount of collocations in each text, revealing three basic collocation bands onto which all the texts can be fitted. This was interpreted as suggesting that heterogeneity, despite being present and noticeable, is constrained rather than limitless. The article concludes that the methods and techniques afforded by present-day corpus linguistics can shed light onto Saussure’s many valuable insights. ------------------------------------------------------------------------------ LIBERDADE DE COMBINAÇÃO E HETEROGENEIDADE: UM OLHAR DA LINGUÍSTICA DE CORPUS EM DOIS INSIGHTS SAUSSUREANOS O artigo reexamina dois dos insights de Saussure a partir da perspectiva da linguística de corpus, a saber a liberdade de combinação e a heterogeneidade no uso da língua. Com relação ao primeiro, foi feita uma análise de combinações de palavras em corpus de textos de jornais para determinar quantas eram
Verification of Accurate Technical Insight: A Prerequisite for Self-Directed Surgical Training
Hu, Yinin; Kim, Helen; Mahmutovic, Adela; Choi, Joanna; Le, Ivy; Rasmussen, Sara
2015-01-01
Simulation-based surgical skills training during preclinical education is a persistent challenge due to time constraints of trainees and instructors alike. Self-directed practice is resource-efficient and flexible; however, insight into technical proficiency among trainees is often lacking. The purpose of this study is to prospectively assess the…
Insight, grey matter and cognitive function in first-onset psychosis.
LENUS (Irish Health Repository)
Morgan, Kevin D
2010-08-01
Several studies have suggested that neuropsychological and structural brain deficits are implicated in poor insight. Few insight studies however have combined neurocognitive and structural neuroanatomical measures.
Is it me? Verbal self-monitoring neural network and clinical insight in schizophrenia.
Sapara, Adegboyega; Ffytche, Dominic H; Cooke, Michael A; Williams, Steven C R; Kumari, Veena
2015-12-30
Self-monitoring, defined as the ability to distinguish between self-generated stimuli from other-generated ones, is known to be impaired in schizophrenia. This impairment has been theorised as the basis for many of the core psychotic symptoms, in particular, poor clinical insight. This study aimed to investigate verbal self-monitoring related neural substrates of preserved and poor clinical insight in schizophrenia. It involved 40 stable schizophrenia outpatients, 20 with preserved and 20 with poor insight, and 20 healthy participants. All participants underwent functional magnetic resonance imaging with brain coverage covering key areas in the self-monitoring network during a verbal self-monitoring task. Healthy participants showed higher performance accuracy and greater thalamic activity than both preserved and poor insight patient groups. Preserved insight patients showed higher activity in the putamen extending into the caudate, insula and inferior frontal gyrus, compared to poor insight patients, and in the anterior cingulate and medial frontal gyrus, compared to healthy participants. Poor insight patients did not show greater activity in any brain area compared to preserved insight patients or healthy participants. Future studies may pursue therapeutic avenues, such as meta-cognitive therapies to promote self-monitoring or targeted stimulation of relevant brain areas, as means of enhancing insight in schizophrenia. Copyright © 2015 The Authors. Published by Elsevier Ireland Ltd.. All rights reserved.
Béland, Sophie; Lepage, Martin
2017-12-01
Poor clinical insight represents a major barrier to recovery in schizophrenia. Research suggests that higher-order social cognitive abilities such as theory of mind (TOM) and metacognition contribute to levels of clinical insight. However, few studies have examined whether social cognitive abilities other than TOM are related to clinical insight. Moreover, to date, no investigation has attempted to determine whether the contribution of metacognitive ability to clinical insight can be differentiated from the contribution of higher-order social cognition, despite their conceptual similarity. Therefore, the purpose of this study was to examine the relative contribution of different social cognitive abilities, as well as metacognition, to clinical insight in a large sample of 139 enduring schizophrenia patients, and controlling for established predictors of clinical insight. Hierarchical regression analyses were used to evaluate the portion of variance explained by 3 social cognitive abilities: emotion recognition, TOM, and affective empathy, and the metacognitive ability of self-reflectiveness. Clinical insight levels were assessed using the Schedule for the Assessment of Insight-Expanded version. Results indicated that affective empathy and self-reflectiveness are the strongest predictors of clinical insight. These results provide insights on the development of targeted interventions for improving clinical insight in this population. Copyright © 2017 Elsevier B.V. All rights reserved.
Recent enhancements of the INSIGHT integrated in-core fuel management tool
International Nuclear Information System (INIS)
Akio, Yamamoto
2001-01-01
Recent enhancements of the INSIGHT system are described in this paper. The INSIGHT system is an integrated in-core fuel management tool for pressurized water reactors (PWRs) runs on UNIX workstations. The INSIGHT system provides various capabilities which contribute to reduce fuel cycle cost and workload of in-core fuel management tasks, i.e. core follow calculations, interactive loading pattern design, automated multicycle analysis and interface between detailed core calculation codes. To minimize engineers' workload, most of input data for analysis modules are automatically generated by the INSIGHT system through specification of calculation conditions in the graphic user interface. Recent enhancements of the INSIGHT system are mainly focused to improve efficiency of loading pattern optimization and flexibility of multicycle analyses. To increase optimization efficiency, a parallel calculation capability, various optimization theories, extension of heuristic rules, screening by neural networks and so on were incorporated in the loading pattern optimization module. The multicycle analyses module was rewritten to increase flexibility such as cycle dependent specification of loading pattern search methods and so on. The INSIGHT system is currently used by Japanese utilities not only for regular in-core fuel management tasks but also for strategic fuel management studies to reduce fuel cycle cost
Young Children's Analogical Problem Solving: Gaining Insights from Video Displays
Chen, Zhe; Siegler, Robert S.
2013-01-01
This study examined how toddlers gain insights from source video displays and use the insights to solve analogous problems. Two- to 2.5-year-olds viewed a source video illustrating a problem-solving strategy and then attempted to solve analogous problems. Older but not younger toddlers extracted the problem-solving strategy depicted in the video…
A hundred-year-old insight into the gut microbiome!
Aziz, Ramy Karam
2009-12-07
As the National Institutes of Health-funded Human Microbiome Project enters its second phase, and as a major part of this project focuses on the human gut microbiome and its effects on human health, it might help us to travel a century back in time and examine how microbiologists dealt with microbiome-related challenges similar to those of the 21st century using the tools of their time. An article by Arthur I. Kendall, published in The Journal of Biological Chemistry in November 1909 (Some observations on the study of the intestinal bacteria J Biol Chem 1909, 6:499-507), offers a visionary insight into many of today's hot research questions.
Insights from Human/Mouse genome comparisons
Energy Technology Data Exchange (ETDEWEB)
Pennacchio, Len A.
2003-03-30
Large-scale public genomic sequencing efforts have provided a wealth of vertebrate sequence data poised to provide insights into mammalian biology. These include deep genomic sequence coverage of human, mouse, rat, zebrafish, and two pufferfish (Fugu rubripes and Tetraodon nigroviridis) (Aparicio et al. 2002; Lander et al. 2001; Venter et al. 2001; Waterston et al. 2002). In addition, a high-priority has been placed on determining the genomic sequence of chimpanzee, dog, cow, frog, and chicken (Boguski 2002). While only recently available, whole genome sequence data have provided the unique opportunity to globally compare complete genome contents. Furthermore, the shared evolutionary ancestry of vertebrate species has allowed the development of comparative genomic approaches to identify ancient conserved sequences with functionality. Accordingly, this review focuses on the initial comparison of available mammalian genomes and describes various insights derived from such analysis.
Some new insights into collimator design
International Nuclear Information System (INIS)
Metz, C.E.; Atkins, F.B.; Tsui, B.M.W.; Beck, R.N.
1978-01-01
Relationships among collimator design parameters, physical properties of the resulting images, and human observer performance are discussed. The insight provided by these relationships hopefully will prove useful to the individual who must design or select a collimator for a particular imaging task
[Relationship of insight with depression and suicidal ideation in psychotic disorders].
Patelaros, E; Zournatzis, E; Kontstantakopoulos, G
2015-01-01
The associations of insight into psychosis (i.e., awareness of illness) with clinical variables have been examined by a great number of studies. Most of these studies revealed that the level of insight is negatively correlated with psychotic symptoms but positively correlated with depression and suicidal ideation. The aim of this study was to test these findings in a Greek sample of patients. Forty-three outpatients (30 men and 13 women) with schizophrenia or delusional disorder being followed up at the Mental Health Centre of Kavala took part in the study. Patients with bipolar or schizoaffective disorder were excluded. Patients' mean age was 40.7 years and the mean duration of illness was 18.67 years. All participants were under treatment and clinically stable at the time of the study. We used the Positive and Negative Syndrome Scale (PANSS) for the assessment of positive and negative symptoms, the Schedule for the Assessment of Insight-Expanded (SAI-E) to assess the insight into psychosis, and the Montgomery-Asberg Depression Rating Scale (MADRS) for the evaluation of depression recording separately the score for item 10 as an estimate of suicidal ideation. All the scales used have been adapted to Greek population. We used Spearman rho coefficient to assess the strength of correlations between the scales because the distributions of some scores were not normal. In order to assess the predictive value of insight for depression and suicidal ideation, we used hierarchical linear regression analysis. Correlation coefficients between SAI-E and the clinical scales of psychopathology, depression and suicide ideation was statistically significant at the pregression analysis showed that our model of positive and negative psychopathology and insight explained 47.4% of the variance of depression and 32.2% of the variance of suicidal ideation. The predictive value of insight was critically important, because only after the introduction of the SAI-E score in the analysis our
Psychosis: clinical insight and beliefs in immigrants in their first episode.
Berg, Akiah Ottesen; Barrett, Elizabeth Ann; Nerhus, Mari; Büchman, Camilla; Simonsen, Carmen; Faerden, Ann; Andreassen, Ole A; Melle, Ingrid
2018-04-01
Lack of insight into illness is frequent in psychotic disorders and seen as part of their primary pathology. The recognition of symptoms as psychotic, and beliefs about treatment alternatives, is also influenced by socio-cultural factors. Here we examined clinical insight into illness and beliefs about psychosis in immigrants in their first episode of psychosis compared with a reference group. A total of 277 first-episode psychosis participants were recruited to this cross-sectional study; 40 first- and 40 second-generation immigrants from Europe, Americas and Oceania (n = 37), Asia including Turkey (n = 28) or Africa (n = 15). The Birchwood Insight Scale was used to measure clinical insight and 'The Attitudes and Beliefs about Mental Health Problems' schizophrenia version to assess socio-cultural beliefs. Immigrants did not differ from the reference sample in clinical insight. After controlling for education level, first-generation immigrants were less likely to recognize psychotic symptoms (odds ratio (OR) 2.9; Wald = 8.977, degrees of freedom (d.f.) 1, P = 0.003) and viewed hospitalization (OR 5.2; Wald = 20.388, d.f. 1, P = 0.001) and treatment by a psychiatrist (OR 4.9; Wald = 6.609, d.f. 1, P = 0.01)) as less beneficial than the reference group. Immigrants from Asia held more alternative explanations (OR 0.3; Wald = 6.567, d.f. 1, P = 0.010). There were significantly stronger associations between clinical insight and socio-cultural beliefs in the reference group. Socio-cultural beliefs about psychosis in immigrants in first-episode psychosis call for more tailored information to this group, and emphasize the importance of treatment interventions involving both a cultural and personal perspective of insight. © 2015 Wiley Publishing Asia Pty Ltd.
Annuity factors, duration and convexity : insights from a financial engineering perspective
Ekern, Steinar
1998-01-01
This paper applies a unified and integrative financial engineering perspective to key derived concepts in traditional fixed income analysis, with the purpose of enhancing conceptual insights and motivating computational applications. The emphasis on annuity factors and their impact on duration and convexity differs from the focus prevailing in related discussions. By decomposing the cashflow streams of a coupon bond into different, specific, and clearly defined portfolios of component bonds w...
Jiang, Weili; Shang, Siyuan; Su, Yanjie
2015-01-01
People may experience an "aha" moment, when suddenly realizing a solution of a puzzling problem. This experience is called insight problem solving. Several findings suggest that catecholamine-related genes may contribute to insight problem solving, among which the catechol-O-methyltransferase (COMT) gene is the most promising candidate. The current study examined 753 healthy individuals to determine the associations between 7 candidate single nucleotide polymorphisms on the COMT gene and insight problem-solving performance, while considering gender differences. The results showed that individuals carrying A allele of rs4680 or T allele of rs4633 scored significantly higher on insight problem-solving tasks, and the COMT gene rs5993883 combined with gender interacted with correct solutions of insight problems, specifically showing that this gene only influenced insight problem-solving performance in males. This study presents the first investigation of the genetic impact on insight problem solving and provides evidence that highlights the role that the COMT gene plays in insight problem solving.
Insights on a Feminist Ethnography of the Free Software Community in Colombia
Directory of Open Access Journals (Sweden)
Tania Pérez Bustos
2010-01-01
Full Text Available The article presents the ethnographic insights of a woman researcher that investigates the role of a group of women inside the Free Software community in Colombia. Particularly the article questions how the ethnographic practice, from a feminist perspective, contributes to the (reconstruction of gender as an analytical category on the social realities it studies.
Using the Enneagram for Client Insight and Transformation: A Type Eight Illustration
Tapp, Karen; Engebretson, Ken
2010-01-01
The purpose of this article is to demonstrate how mental health practitioners can use the Enneagram's system of human personality development as a source of insight and a tool for personality transformation. The article provides an introduction to the Enneagram and its orientation to personality types and defines a linear process of how to use the…
Psychophysiological prediction of choice: relevance to insight and drug addiction
Moeller, Scott J.; Hajcak, Greg; Parvaz, Muhammad A.; Dunning, Jonathan P.; Volkow, Nora D.
2012-01-01
An important goal of addiction research and treatment is to predict behavioural responses to drug-related stimuli. This goal is especially important for patients with impaired insight, which can interfere with therapeutic interventions and potentially invalidate self-report questionnaires. This research tested (i) whether event-related potentials, specifically the late positive potential, predict choice to view cocaine images in cocaine addiction; and (ii) whether such behaviour prediction differs by insight (operationalized in this study as self-awareness of image choice). Fifty-nine cocaine abusers and 32 healthy controls provided data for the following laboratory components that were completed in a fixed-sequence (to establish prediction): (i) event-related potential recordings while passively viewing pleasant, unpleasant, neutral and cocaine images, during which early (400–1000 ms) and late (1000–2000 ms) window late positive potentials were collected; (ii) self-reported arousal ratings for each picture; and (iii) two previously validated tasks: one to assess choice for viewing these same images, and the other to group cocaine abusers by insight. Results showed that pleasant-related late positive potentials and arousal ratings predicted pleasant choice (the choice to view pleasant pictures) in all subjects, validating the method. In the cocaine abusers, the predictive ability of the late positive potentials and arousal ratings depended on insight. Cocaine-related late positive potentials better predicted cocaine image choice in cocaine abusers with impaired insight. Another emotion-relevant event-related potential component (the early posterior negativity) did not show these results, indicating specificity of the late positive potential. In contrast, arousal ratings better predicted respective cocaine image choice (and actual cocaine use severity) in cocaine abusers with intact insight. Taken together, the late positive potential could serve as a biomarker
Insights from an overview of four PRAs
International Nuclear Information System (INIS)
Fitzpatrick, R.; Arrieta, L.; Teichmann, T.; Davis, P.
1987-01-01
This paper summarizes the findings of an investigation of four probabilistic risk assessments (PRAs), those for Millstone 3 Seabrook, Shoreham, and Oconee 3, performed by Brookhaven National Laboratory (BNL) for the Reliability and Risk Assessment branch of the U.S. Nuclear Regulatory Commission (NRC). This group of four PRAs was subjected to an overview process with the basic goal of ascertaining what insights might be gained (beyond those already documented within the individual PRAs) by an independent evaluation of the group with respect to nuclear plant safety and vulnerability. Specifically, the objectives of the study were 1) to identify and rank initiators, systems, components, and failure modes from dominant accident sequences according to their contribution to core melt probability and public risk; and 2) to derive from this process plant-specific and generic insights. The effort was not intended to verify the specific details and results of each PRA but rather - having accepted the results - to see what they might mean in a more global context. This paper also presents some comments and insights into the amenability of certain features of these PRAs to this type of overview process
The Spot 42 RNA: A regulatory small RNA with roles in the central metabolism
Bækkedal, Cecilie; Haugen, Peik
2015-01-01
The Spot 42 RNA is a 109 nucleotide long (in Escherichia coli) noncoding small regulatory RNA (sRNA) encoded by the spf (spot fourty-two) gene. spf is found in gamma-proteobacteria and the majority of experimental work on Spot 42 RNA has been performed using E. coli, and recently Aliivibrio salmonicida. In the cell Spot 42 RNA plays essential roles as a regulator in carbohydrate metabolism and uptake, and its expression is activated by glucose, and inhibited by the cAMP-CRP complex. Here we summarize the current knowledge on Spot 42, and present the natural distribution of spf, show family-specific secondary structural features of Spot 42, and link highly conserved structural regions to mRNA target binding. PMID:26327359
The Spot 42 RNA: A regulatory small RNA with roles in the central metabolism.
Bækkedal, Cecilie; Haugen, Peik
2015-01-01
The Spot 42 RNA is a 109 nucleotide long (in Escherichia coli) noncoding small regulatory RNA (sRNA) encoded by the spf (spot fourty-two) gene. spf is found in gamma-proteobacteria and the majority of experimental work on Spot 42 RNA has been performed using E. coli, and recently Aliivibrio salmonicida. In the cell Spot 42 RNA plays essential roles as a regulator in carbohydrate metabolism and uptake, and its expression is activated by glucose, and inhibited by the cAMP-CRP complex. Here we summarize the current knowledge on Spot 42, and present the natural distribution of spf, show family-specific secondary structural features of Spot 42, and link highly conserved structural regions to mRNA target binding.
Lysaker, Paul H; Roe, David; Yanos, Philip T
2007-01-01
Research has paradoxically linked awareness of illness to both better function outcomes and lesser hope and self-esteem. One possible explanation for these findings is that acceptance of having schizophrenia may impact outcomes differently depending on the meanings the person attaches to this acceptance, particularly whether he or she accepts stigmatizing beliefs about mental illness. To explore this possibility we performed a cluster analysis of 75 persons with schizophrenia spectrum disorders based on single measures of insight using the Positive and Negative Syndrome Scale, internalized stigma using the Internalized Stigma of Mental Illness Scale, and compared groups on concurrent assessments of hope and self-esteem. Three groups were produced by the cluster analyses: low in sight/mild stigma (n = 23), high insight/minimal stigma (n = 25), and high insight/moderate stigma (n = 27). As predicted, analysis of variance-comparing groups revealed that the high insight/moderate stigma group had significantly the lowest levels of hope on the Beck Hopelessness Scale and self-esteem using the Multidimensional Self-esteem Inventory. As predicted, the high insight/minimal stigma group also had significantly less impaired social function than the other groups. Implications for assisting persons to come to cope with awareness of illness and stigma are discussed.
Mentalization, insightfulness, and therapeutic action. The importance of mental organization.
Sugarman, Alan
2006-08-01
Continuing debates over the relative importance of the role of interpretation leading to insight versus the relationship with the analyst as contributing to structural change are based on traditional definitions of insight as gaining knowledge of unconscious content. This definition inevitably privileges verbal interpretation as self-knowledge becomes equated with understanding the contents of the mind. It is suggested that a way out of this debate is to redefine insight as a process, one that is called insightfulness. This term builds on concepts such as mentalization, or theory of mind, and suggests that patients present with difficulties being able to fully mentalize. Awareness of repudiated content will usually accompany the attainment of insightfulness. But the point of insightfulness is to regain access to inhibited or repudiated mentalization, not to specific content, per se. Emphasizing the process of insightfulness integrates the importance of the relationship with the analyst with the facilitation of insightfulness. A variety of interventions help patients gain the capacity to reflect upon and become aware of the intricate workings of their minds, of which verbal interpretation is only one. For example, often it seems less important to focus on a particular conflict than to show interest in our patients' minds. Furthermore, analysands develop insightfulness by becoming interested in and observing our minds in action. Because the mind originates in bodily experience, mental functioning will always fluctuate between action modes of experiencing and expressing and verbal, symbolic modes. The analyst's role becomes making the patient aware of regressions to action modes, understanding the reasons for doing so, and subordinating this tendency to the verbal, symbolic mode. All mental functions work better and facilitate greater self-regulation when they work in abstract, symbolic ways. Psychopathology can be understood as failing to develop or losing the
New Insights into Behavioral Finance
G. Baltussen (Guido)
2008-01-01
textabstractThis thesis applies insights from psychology and other behavioral sciences to overcome the shortcomings of the traditional finance approach (which assumes that agents and markets are rational) and improves our understanding of financial markets and its participants. More specific, this
The Neurocircuitry of Impaired Insight in Drug Addiction
Goldstein, Rita Z.; Craig, A. D. (Bud); Bechara, Antoine; Garavan, Hugh; Childress, Anna Rose; Paulus, Martin P.; Volkow, Nora D.
2010-01-01
More than 80% of addicted individuals fail to seek treatment, which might reflect impairments in recognition of severity of disorder. Considered by some as intentional deception, such `denial' might instead reflect dysfunction of brain networks subserving insight and selfawareness. Here we review the scant literature on insight in addiction and integrate this perspective with the role of: (i) the insula in interoception, self-awareness and drug craving; (ii) the anterior cingulate in behavioral monitoring and response selection (relevant to disadvantageous choices in addiction); (iii) the dorsal striatum in automatic habit formation; and (iv) drug related stimuli that predict emotional behavior in addicted individuals, even without conscious awareness. We discuss implications for clinical treatment including the design of interventions to improve insight into illness severity in addiction. PMID:19716751
The Neurocircuitry of Impaired Insight in Drug Addiction
Energy Technology Data Exchange (ETDEWEB)
Goldstein, R.Z.; Craig, A.D.; Bechara, A.; Garavan, H.; Childress, A.R.; Paulus, M.P.; Volkow, N.D.
2009-08-27
More than 80% of addicted individuals fail to seek treatment, which might reflect impairments in recognition of severity of disorder. Considered by some as intentional deception, such 'denial' might instead reflect dysfunction of brain networks subserving insight and self-awareness. Here we review the scant literature on insight in addiction and integrate this perspective with the role of: (i) the insula in interoception, self-awareness and drug craving; (ii) the anterior cingulate in behavioral monitoring and response selection (relevant to disadvantageous choices in addiction); (iii) the dorsal striatum in automatic habit formation; and (iv) drug-related stimuli that predict emotional behavior in addicted individuals, even without conscious awareness. We discuss implications for clinical treatment including the design of interventions to improve insight into illness severity in addiction.
Complexity of International Sign for inexperienced interpreters: Insights From a Deaf IS Instructor
Oyserman, J.; Rosenstock, R.; Napier, J.
2016-01-01
In lieu of an abstract, here is a brief excerpt of the content: 192 Complexity of International Sign for Inexperienced Interpreters: Insights From a Deaf IS Instructor Joni Oyserman In this chapter, I focus on how inexperienced interpreters view, acquire, and use International Sign (IS). A profile
Productive and Re-Productive Thinking in Solving Insight Problems
Cunningham, J. Barton; MacGregor, James N.
2014-01-01
Many innovations in organizations result when people discover insightful solutions to problems. Insightful problem-solving was considered by Gestalt psychologists to be associated with productive, as opposed to re-productive, thinking. Productive thinking is characterized by shifts in perspective which allow the problem solver to consider new,…
Insightful problem solving in an Asian elephant.
Directory of Open Access Journals (Sweden)
Preston Foerder
Full Text Available The "aha" moment or the sudden arrival of the solution to a problem is a common human experience. Spontaneous problem solving without evident trial and error behavior in humans and other animals has been referred to as insight. Surprisingly, elephants, thought to be highly intelligent, have failed to exhibit insightful problem solving in previous cognitive studies. We tested whether three Asian elephants (Elephas maximus would use sticks or other objects to obtain food items placed out-of-reach and overhead. Without prior trial and error behavior, a 7-year-old male Asian elephant showed spontaneous problem solving by moving a large plastic cube, on which he then stood, to acquire the food. In further testing he showed behavioral flexibility, using this technique to reach other items and retrieving the cube from various locations to use as a tool to acquire food. In the cube's absence, he generalized this tool utilization technique to other objects and, when given smaller objects, stacked them in an attempt to reach the food. The elephant's overall behavior was consistent with the definition of insightful problem solving. Previous failures to demonstrate this ability in elephants may have resulted not from a lack of cognitive ability but from the presentation of tasks requiring trunk-held sticks as potential tools, thereby interfering with the trunk's use as a sensory organ to locate the targeted food.
Insightful problem solving in an Asian elephant.
Foerder, Preston; Galloway, Marie; Barthel, Tony; Moore, Donald E; Reiss, Diana
2011-01-01
The "aha" moment or the sudden arrival of the solution to a problem is a common human experience. Spontaneous problem solving without evident trial and error behavior in humans and other animals has been referred to as insight. Surprisingly, elephants, thought to be highly intelligent, have failed to exhibit insightful problem solving in previous cognitive studies. We tested whether three Asian elephants (Elephas maximus) would use sticks or other objects to obtain food items placed out-of-reach and overhead. Without prior trial and error behavior, a 7-year-old male Asian elephant showed spontaneous problem solving by moving a large plastic cube, on which he then stood, to acquire the food. In further testing he showed behavioral flexibility, using this technique to reach other items and retrieving the cube from various locations to use as a tool to acquire food. In the cube's absence, he generalized this tool utilization technique to other objects and, when given smaller objects, stacked them in an attempt to reach the food. The elephant's overall behavior was consistent with the definition of insightful problem solving. Previous failures to demonstrate this ability in elephants may have resulted not from a lack of cognitive ability but from the presentation of tasks requiring trunk-held sticks as potential tools, thereby interfering with the trunk's use as a sensory organ to locate the targeted food.
The relationship between insight and subjective experience in schizophrenia
Directory of Open Access Journals (Sweden)
Kako Y
2014-07-01
Full Text Available Yuki Kako, Koki Ito, Naoki Hashimoto, Kuniyoshi Toyoshima, Yusuke Shimizu, Nobuyuki Mitsui, Yutaka Fujii, Teruaki Tanaka, Ichiro Kusumi Department of Psychiatry, Hokkaido University Graduate School of Medicine, Sapporo, Japan Objectives: To examine the relationship between level of insight and various subjective experiences for patients with schizophrenia.Materials and methods: Seventy-four patients with schizophrenia who were discharged from our hospital were evaluated. The level of insight into their illness and various subjective experiences were evaluated at discharge. We used the Scale to Assess Unawareness of Mental Disorder (SUMD for evaluation of insight. In addition, five different rating scales were used to evaluate subjective experiences: Subjective Experience of Deficits in Schizophrenia (SEDS, Subjective Well-being under Neuroleptic drug treatment Short form (SWNS, Schizophrenia Quality of Life Scale (SQLS, Beck Depression Inventory (BDI, and the Drug Attitude Inventory (DAI-30.Results: The SWNS and the scores for awareness of mental disorder and awareness of the social consequences of mental disorder on SUMD showed a weak positive correlation. The DAI-30 showed a significant negative correlation with most general items on SUMD and a negative correlation between the subscale scores for the awareness and attribution of past symptoms. SEDS, SWNS, SQLS, and the BDI significantly correlated with the subscale scores for awareness of current symptoms on SUMD, and weakly correlated with the subscale scores for attribution of current negative symptoms.Conclusion: Awareness of subjective distress was related to awareness of having a mental disorder. Feeling subjective distress was related to awareness of current symptoms, as well as to the ability to attribute current negative symptoms to a mental disorder. Positive attitudes toward medication correlated with better general insight into the illness. Keywords: schizophrenia, insight
Intuition, insight, and the right hemisphere: Emergence of higher sociocognitive functions
Directory of Open Access Journals (Sweden)
Simon M McCrea
2010-03-01
Full Text Available Simon M McCreaDepartments of Neurology and Neuroophthalmology, University of British Columbia, Vancouver, British Columbia, CanadaAbstract: Intuition is the ability to understand immediately without conscious reasoning and is sometimes explained as a ‘gut feeling’ about the rightness or wrongness of a person, place, situation, temporal episode or object. In contrast, insight is the capacity to gain accurate and a deep understanding of a problem and it is often associated with movement beyond existing paradigms. Examples include Darwin, Einstein and Freud’s theories of natural selection, relativity, or the unconscious; respectively. Many cultures name these concepts and acknowledge their value, and insight is recognized as particularly characteristic of eminent achievements in the arts, sciences and politics. Considerable data suggests that these two concepts are more related than distinct, and that a more distributed intuitive network may feed into a predominately right hemispheric insight-based functional neuronal architecture. The preparation and incubation stages of insight may rely on the incorporation of domain-specific automatized expertise schema associated with intuition. In this manuscript the neural networks associated with intuition and insight are reviewed. Case studies of anomalous subjects with ability–achievement discrepancies are summarized. This theoretical review proposes the prospect that atypical localization of cognitive modules may enhance intuitive and insightful functions and thereby explain individual achievement beyond that expected by conventionally measured intelligence tests. A model and theory of intuition and insight’s neuroanatomical basis is proposed which could be used as a starting point for future research and better understanding of the nature of these two distinctly human and highly complex poorly understood abilities.Keywords: intuition, insight, nonverbal decoding, nonverbal sequencing
First Insights with a Vibrotactile Interface for Children with Multiple Disabilities
DEFF Research Database (Denmark)
Manresa-Yee, Cristina; Morrison, Ann; Jordi Muntaner, Joan
2015-01-01
for users with multiple disabilities. We developed V-Sense, a vibrotactile interface that encourages children with multiple disabilities to move their arms by using vibrations and exploiting the saltation perceptual illusion. In this paper we describe our initial experience evaluating the interface with 5...... children for 7 weeks and we discuss the first insights concerning the use of the interface and the difficulties encountered while conducting the evaluation sessions....
An investigation of the bactericidal activity of selected essential oils to Aeromonas spp.
Directory of Open Access Journals (Sweden)
Clifford E. Starliper
2015-01-01
Full Text Available Diseases of fishes caused by Aeromonas spp. are common, have broad host ranges and may cause high mortality. Treatments of captive-reared populations using antimicrobials are limited with concerns for bacterial resistance development and environmental dissemination. This study was done to determine whether selected plant-derived essential oils were bactericidal to Aeromonas spp. Initially, twelve essential oils were evaluated using a disk diffusion assay to an isolate of A. salmonicida subsp. salmonicida, cause of fish furunculosis. The greatest zones of inhibition were obtained with oils of cinnamon Cinnamomum cassia, oregano Origanum vulgare, lemongrass Cymbopogon citratus and thyme Thymus vulgaris. Minimum bactericidal concentrations (MBC’s were determined for these four oils, Allimed® (garlic extract, Allium sativum and colloidal silver to sixty-nine isolates representing nine Aeromonas spp. The lowest mean MBCs (0.02–0.04% were obtained with three different sources of cinnamon oil. MBCs for three sources of oregano and lemongrass oils ranged from 0.14% to 0.30% and 0.10% to 0.65%, respectively, and for two thyme oils were 2.11% and 2.22%. The highest concentration (5% of Allimed® tested resulted in MBCs to twelve isolates. A concentration of silver greater than 15 mg/L would be required to determine MBCs for all but one isolate.
A hundred-year-old insight into the gut microbiome!
Directory of Open Access Journals (Sweden)
Aziz Ramy
2009-12-01
Full Text Available Abstract As the National Institutes of Health-funded Human Microbiome Project enters its second phase, and as a major part of this project focuses on the human gut microbiome and its effects on human health, it might help us to travel a century back in time and examine how microbiologists dealt with microbiome-related challenges similar to those of the 21st century using the tools of their time. An article by Arthur I. Kendall, published in The Journal of Biological Chemistry in November 1909 (Some observations on the study of the intestinal bacteria J Biol Chem 1909, 6:499-507, offers a visionary insight into many of today's hot research questions.
Walvoort, Serge JW; van der Heijden, Paul T; Kessels, Roy PC; Egger, Jos IM
2016-01-01
Aim Impaired illness insight may hamper treatment outcome in patients with alcohol-related cognitive deficits. In this study, a short questionnaire for the assessment of illness insight (eg, the Q8) was investigated in patients with Korsakoff’s syndrome (KS) and in alcohol use disorder (AUD) patients with mild neurocognitive deficits. Methods First, reliability coefficients were computed and internal structure was investigated. Then, comparisons were made between patients with KS and patients with AUD. Furthermore, correlations with the Dysexecutive Questionnaire (DEX) were investigated. Finally, Q8 total scores were correlated with neuropsychological tests for processing speed, memory, and executive function. Results Internal consistency of the Q8 was acceptable (ie, Cronbach’s α =0.73). The Q8 items represent one factor, and scores differ significantly between AUD and KS patients. The Q8 total score, related to the DEX discrepancy score and scores on neuropsychological tests as was hypothesized, indicates that a higher degree of illness insight is associated with a higher level of cognitive functioning. Conclusion The Q8 is a short, valid, and easy-to-administer questionnaire to reliably assess illness insight in patients with moderate-to-severe alcohol-related cognitive dysfunction. PMID:27445476
Directory of Open Access Journals (Sweden)
Swarmistha Devi Aribam
Full Text Available Salmonella-specific antibodies play an important role in host immunity; however, the mechanisms of Salmonella clearance by pathogen-specific antibodies remain to be completely elucidated since previous studies on antibody-mediated protection have yielded inconsistent results. These inconsistencies are at least partially attributable to the use of polyclonal antibodies against Salmonella antigens. Here, we developed a new monoclonal antibody (mAb-449 and identified its related immunogen that protected BALB/c mice from infection with Salmonella enterica serovar Typhimurium. In addition, these data indicate that the mAb-449 immunogen is likely a major protective antigen. Using in vitro infection studies, we also analyzed the mechanism by which mAb-449 conferred host protection. Notably, macrophages infected with mAb-449-treated S. Typhimurium showed enhanced pathogen uptake compared to counterparts infected with control IgG-treated bacteria. Moreover, these macrophages produced elevated levels of pro-inflammatory cytokine TNFα and nitric oxide, indicating that mAb-449 enhanced macrophage activation. Finally, the number of intracellular bacteria in mAb-449-activated macrophages decreased considerably, while the opposite was found in IgG-treated controls. Based on these findings, we suggest that, although S. Typhimurium has the potential to survive and replicate within macrophages, host production of a specific antibody can effectively mediate macrophage activation for clearance of intracellular bacteria.
Ćurčić-Blake, Branislava; van der Meer, Lisette; Pijnenborg, Gerdina H M; David, Anthony S; Aleman, André
2015-12-01
Impaired insight into illness, associated with worse treatment outcome, is common in schizophrenia. Insight has been related to the self-reflective processing, centred on the medial frontal cortex. We hypothesized that anatomical and functional routes to and from the ventromedial prefrontal cortex (vmPFC) would differ in patients according to their degree of impaired insight. Forty-five schizophrenia patients and 19 healthy subjects performed a self-reflection task during fMRI, and underwent diffusion tensor imaging. Using dynamic causal modelling we observed increased effective connectivity from the posterior cingulate cortex (PCC), inferior parietal lobule (IPL), and dorsal mPFC (dmPFC) towards the vmPFC with poorer insight and decrease from vmPFC to the IPL. Stronger connectivity from the PCC to vmPFC during judgment of traits related to self was associated with poorer insight. We found small-scale significant changes in white matter integrity associated with clinical insight. Self-reflection may be influenced by synaptic changes that lead to the observed alterations in functional connectivity accompanied by the small-scale but measurable alterations in anatomical connections. Our findings may point to a neural compensatory response to an impairment of connectivity between self-processing regions. Similarly, the observed hyper-connectivity might be a primary deficit linked to inefficiency in the component cognitive processes that lead to impaired insight. We suggest that the stronger cognitive demands placed on patients with poor insight is reflected in increased effective connectivity during the task in this study. © 2015 Wiley Periodicals, Inc.
Marketing biofortified crops: insights from consumer research ...
African Journals Online (AJOL)
Marketing biofortified crops: insights from consumer research. ... To develop a global strategy for consumer marketing of biofortified crops, research is needed to understand consumer ... EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT
Directory of Open Access Journals (Sweden)
Angelo Giovanni Icro eMaremmani
2012-07-01
Full Text Available In a group of 1066 heroin addicts, who were seeking treatment for opioid agonist treatment, we looked for differences in historical, demographic and clinical characteristics, between patients with different levels of awareness of illness (insight. The results showed that, in the cohort studied, a majority of subjects lacked insight into their heroin-use behaviour. Compared with the impaired-insight group, those who possessed insight into their illness showed significantly greater awareness of past social, somatic and psychopathological impairments, and had a greater number of past treatment-seeking events for heroin addiction. In contrast with other psychiatric illnesses, the presence of awareness appears to be related to the passing of time and to the worsening of the illness. Methodologies to improve the insight of patients should, therefore, be targeted more directly on patients early in their history of heroin dependence, because the risk of lack of insight is greatest during this period.
Insight in schizophrenia : Associations with empathy
Pijnenborg, G. H. M.; Spikman, J. M.; Jeronimus, B. F.; Aleman, A.
Many people with schizophrenia (50-80 %) demonstrate impaired insight, something which has been associated with a poorer outcome. Two types of empathy can be distinguished: affective empathy via shared emotions and cognitive empathy, also referred to as Theory of Mind (ToM). ToM can be subdivided
Overview and Insights from ‘Systems Education for a Sustainable Planet’
Directory of Open Access Journals (Sweden)
Robert Y. Cavana
2018-02-01
Full Text Available An announcement by Bosch and Cavana, in Systems, called for new papers to provide updated perspectives about and fresh insights into developments that influence ‘systems education for a sustainable planet’. This paper’s objective is to provide an overview of the 14 papers that were published in the special issue, and present some insights and findings from their content. It does this by classifying the papers into five distinct themes, then analysing their content and the linkages between the themes. This process revealed that: (1 Specialised systems education at a tertiary level is predominantly at graduate level, using a diverse range of approaches; and (2 Delivering specialised systems education remains a challenge for programs that endeavour to provide an integrated and interdisciplinary learning experience. Barriers include current institutional structures and the need for students to be both big picture thinkers and detail-oriented technocrats; (3 Teaching systems approaches outside of specialised programs for students (both young and mature help to expose systems thinking to a wider demographic; (4 The strong links that exist between systems approaches and sustainability goals are increasingly being recognised. Systems education can help transition towards a sustainable planet, as it helps people appreciate that individual actions are not isolated events but contribute to an interconnected system that determines both the well-being of humans and the planet.
Once more with feeling: Normative data for the aha experience in insight and noninsight problems.
Webb, Margaret E; Little, Daniel R; Cropper, Simon J
2017-10-19
Despite the presumed ability of insight problems to elicit the subjective feeling of insight, as well as the use of so-called insight problems to investigate this phenomenon for over 100 years, no research has collected normative data regarding the ability of insight problems to actually elicit the feeling of insight in a given individual. The work described in this article provides an overview of both classic and contemporary problems used to examine the construct of insight and presents normative data on the success rate, mean time to solution, and mean rating of aha experience for each problem and task type. We suggest using these data in future work as a reference for selecting problems on the basis of their ability to elicit an aha experience.
Belvederi Murri, Martino; Respino, Matteo; Innamorati, Marco; Cervetti, Alice; Calcagno, Pietro; Pompili, Maurizio; Lamis, Dorian A; Ghio, Lucio; Amore, Mario
2015-03-01
Among patients with schizophrenia, better insight may be associated with depression, but the findings on this issue are mixed. We examined the association between insight and depression in schizophrenia by conducting a systematic review and meta-analysis. The meta-analysis was based on 59 correlational studies and showed that global clinical insight was associated weakly, but significantly with depression (effect size r=0.14), as were the insight into the mental disorder (r=0.14), insight into symptoms (r=0.14), and symptoms' attributions (r=0.17). Conversely, neither insight into the social consequences of the disorder nor into the need for treatment was associated with symptoms of depression. Better cognitive insight was significantly associated with higher levels of depression. The exploratory meta-regression showed that methodological factors (e.g. the instrument used to assess depression and the phase of the illness) can significantly influence the magnitude of the association between insight and depression. Moreover, results from longitudinal studies suggest that the relation between insight and depression might be stronger than what is observed at the cross-sectional level. Finally, internalized stigma, illness perception, recovery attitudes, ruminative style, and premorbid adjustment seem to be relevant moderators and/or mediators of the association between insight and depression. In conclusion, literature indicates that among patients with schizophrenia, better insight is associated with higher levels of depressive symptoms. Thus, interventions aimed at promoting patients' insight should take into account the clinical implications of these findings. Copyright © 2015 Elsevier B.V. All rights reserved.
Mullick, M; Miller, L J; Jacobsen, T
2001-04-01
This study examined the relationship between insight into mental illness and current child maltreatment risk among mothers who had a major psychiatric disorder and who had lost custody of a child because of abuse, neglect, or having placed the child at risk of harm. Specifically, a measure of insight was examined in relation to systematically observed parenting behaviors known to be correlated with past child maltreatment and in relation to a comprehensive clinical determination of risk. Forty-four mothers who had a major psychiatric disorder were independently rated for their insight into their illness, the quality of mother-child interaction, and the overall clinical risk of maltreatment. Better insight into mental illness was associated with more sensitive mothering behavior and with lower assessed clinical risk of maltreatment. The association remained when mothers with current psychotic symptoms were excluded from the analyses. Better insight did not appear to be associated with past psychotic symptoms, maternal psychiatric diagnosis, or the mother's level of education. Insight into mental illness may function as a protective factor that influences the risk of child maltreatment in mothers with mental illness. Measures of insight could be usefully incorporated into comprehensive parenting assessments for mothers with psychiatric disorders.
Use of Human Reliability Insights to Improve Decision-Making
International Nuclear Information System (INIS)
Julius, J. A.; Moieni, P.; Grobbelaar, J.; Kohlhepp, K.
2016-01-01
This paper describes the use of insights obtained during the development and application of human reliability analysis (HRA) as part of a probabilistic risk assessment (PRA) to support decision-making, including improvements to operations, training, and safety culture. Insights have been gained from the development and application of HRA as part of a PRA for nuclear power plants in the USA, Europe and Asia over the last two decades. These models consist of Level 1 and Level 2 PRA models of internal and external events, during full power and shutdown modes of plant operation. These insights include the use of human factors information to improve the qualitative portion of the HRA. The subsequent quantification in the HRA effectively prioritises the contributors to the unreliability of operator actions, and the process facilitates the identification of the factors that are important to the success of the operator actions. Additionally, the tools and techniques also allow for the evaluation of key assumptions and sources of uncertainty. The end results have been used to effectively support decision-making for day-to-day plant operations as well as licensing issues. HRA results have been used to provide feedback and improvements to plant procedures, operator training and other areas contributing the plant safety culture. Examples of the types of insights are presented in this paper. (author)
2016 Mars Insight Mission Design and Navigation
Abilleira, Fernando; Frauenholz, Ray; Fujii, Ken; Wallace, Mark; You, Tung-Han
2014-01-01
Scheduled for a launch in the 2016 Earth to Mars opportunity, the Interior Exploration using Seismic Investigations, Geodesy, and Heat Transport (InSight) Mission will arrive to Mars in late September 2016 with the primary objective of placing a science lander on the surface of the Red Planet followed by the deployment of two science instruments to investigate the fundamental processes of terrestrial planet formation and evolution. In order to achieve a successful landing, the InSight Project has selected a launch/arrival strategy that satisfies the following key and driving requirements: (1) Deliver a total launch mass of 727 kg, (2) target a nominal landing site with a cumulative Delta V99 less than 30 m/s, and (3) approach EDL with a V-infinity upper limit of 3.941 km/s and (4) an entry flight-path angle (EFPA) of -12.5 +/- 0.26 deg, 3-sigma; the InSight trajectories have been designed such that they (5) provide UHF-band communications via Direct-To-Earth and MRO from Entry through landing plus 60 s, (6) with injection aimpoints biased away from Mars such that the probability of the launch vehicle upper stage impacting Mars is less than 1.0 X 10(exp 4) for fifty years after launch, and (7) non-nominal impact probabilities due to failure during the Cruise phase less than 1.0 X 10(exp 2).
Noordraven, Ernst L; Wierdsma, André I; Blanken, Peter; Bloemendaal, Anthony Ft; Mulder, Cornelis L
2016-01-01
Noncompliance is a major problem for patients with a psychotic disorder. Two important risk factors for noncompliance that have a severe negative impact on treatment outcomes are impaired illness insight and lack of motivation. Our cross-sectional study explored how they are related to each other and their compliance with depot medication. Interviews were conducted in 169 outpatients with a psychotic disorder taking depot medication. Four patient groups were defined based on low or high illness insight and on low or high motivation. The associations between depot-medication compliance, motivation, and insight were illustrated using generalized linear models. Generalized linear model showed a significant interaction effect between motivation and insight. Patients with poor insight and high motivation for treatment were more compliant (94%) (95% confidence interval [CI]: 1.821, 3.489) with their depot medication than patients with poor insight and low motivation (61%) (95% CI: 0.288, 0.615). Patients with both insight and high motivation for treatment were less compliant (73%) (95% CI: 0.719, 1.315) than those with poor insight and high motivation. Motivation for treatment was more strongly associated with depot-medication compliance than with illness insight. Being motivated to take medication, whether to get better or for other reasons, may be a more important factor than having illness insight in terms of improving depot-medication compliance. Possible implications for clinical practice are discussed.
Impaired insight in cocaine addiction: laboratory evidence and effects on cocaine-seeking behaviour
Energy Technology Data Exchange (ETDEWEB)
Moeller, S.J.; Moeller, S.J.; Maloney, T.; Parvaz, M.A.; Alia-Klein, N.; Woicik, P.A.; Telang, F.; Wang, G.-J.; Volkow, N.D.; Goldstein, R.Z.
2010-04-15
Neuropsychiatric disorders are often characterized by impaired insight into behaviour. Such an insight deficit has been suggested, but never directly tested, in drug addiction. Here we tested for the first time this impaired insight hypothesis in drug addiction, and examined its potential association with drug-seeking behaviour. We also tested potential modulation of these effects by cocaine urine status, an individual difference known to impact underlying cognitive functions and prognosis. Sixteen cocaine addicted individuals testing positive for cocaine in urine, 26 cocaine addicted individuals testing negative for cocaine in urine, and 23 healthy controls completed a probabilistic choice task that assessed objective preference for viewing four types of pictures (pleasant, unpleasant, neutral and cocaine). This choice task concluded by asking subjects to report their most selected picture type; correspondence between subjects self-reports with their objective choice behaviour provided our index of behavioural insight. Results showed that the urine positive cocaine subjects exhibited impaired insight into their own choice behaviour compared with healthy controls; this same study group also selected the most cocaine pictures (and fewest pleasant pictures) for viewing. Importantly, however, it was the urine negative cocaine subjects whose behaviour was most influenced by insight, such that impaired insight in this subgroup only was associated with higher cocaine-related choice on the task and more severe actual cocaine use. These findings suggest that interventions to enhance insight may decrease drug-seeking behaviour, especially in urine negative cocaine subjects, potentially to improve their longer-term clinical outcomes.
Physiological and molecular insights into drought tolerance ...
African Journals Online (AJOL)
Physiological and molecular insights into drought tolerance. Sagadevan G Mundree, Bienyameen Baker, Shaheen Mowla, Shaun Peters, Saberi Marais, Clare Vander Willigen, Kershini Govender, Alice Maredza, Samson Muyanga, Jill M Farrant, Jennifer A Thomson ...
Getting the Joke: Insight during Humor Comprehension - Evidence from an fMRI Study.
Tian, Fang; Hou, Yuling; Zhu, Wenfeng; Dietrich, Arne; Zhang, Qinglin; Yang, Wenjing; Chen, Qunlin; Sun, Jiangzhou; Jiang, Qiu; Cao, Guikang
2017-01-01
As a high-level cognitive activity, humor comprehension requires incongruity detection and incongruity resolution, which then elicits an insight moment. The purpose of the study was to explore the neural basis of humor comprehension, particularly the moment of insight, by using both characters and language-free cartoons in a functional magnetic resonance imaging study. The results showed that insight involving jokes elicited greater activation in language and semantic-related brain regions as well as a variety of additional regions, such as the superior frontal gyrus (SFG), the inferior frontal gyrus (IFG), the middle temporal gyrus (MTG), the superior temporal gyrus (STG), the temporoparietal junctions (TPJ), the hippocampus and visual areas. These findings indicate that the MTG might play a role in incongruity detection, while the SFG, IFG and the TPJ might be involved in incongruity detection. The passive insight event elicited by jokes appears to be mediated by a limited number of brain areas. Our study showed that the brain regions associated with humor comprehension were not affected by the type of stimuli and that humor and insight shared common brain areas. These results indicate that one experiences a feeling of insight during humor comprehension, which contributes to the understanding of humor comprehension.
Ethics in Publishing: Complexity Science and Human Factors Offer Insights to Develop a Just Culture.
Saurin, Tarcisio Abreu
2016-12-01
While ethics in publishing has been increasingly debated, there seems to be a lack of a theoretical framework for making sense of existing rules of behavior as well as for designing, managing and enforcing such rules. This letter argues that systems-oriented disciplines, such as complexity science and human factors, offer insights into new ways of dealing with ethics in publishing. Some examples of insights are presented. Also, a call is made for empirical studies that unveil the context and details of both retracted papers and the process of writing and publishing academic papers. This is expected to shed light on the complexity of the publication system as well as to support the development of a just culture, in which all participants are accountable.
Marriott, Michael R; Thompson, Andrew R; Cockshutt, Graham; Rowse, Georgina
2018-03-25
When considering psychosis, the concept of narrative insight has been offered as an alternative to clinical insight in determining individuals' responses to their difficulties, as it allows for a more holistic and person-centred framework to be embraced within professional practice. This study aims to explore the validity of the narrative insight construct within a group of people who have experienced psychosis. Inductive qualitative methods were used to explore how eight participants utilized spiritual or religious explanatory frameworks for their experiences of psychosis and to consider these in relation to the construct of narrative insight. Semi-structured interviews were undertaken with individuals who identified themselves as interested in spiritual or religious ideas and whose self-reported experiences which were identified as akin to psychosis by experienced academic clinicians. Transcriptions from these interviews were subject to interpretative phenomenological analysis within a broader research question; a selection of themes and data from the resultant phenomenological structure are explored here for their relevance to narrative insight. Participants discussed spiritual and biological explanations for their experiences and were able to hold alternative potential explanations alongside each other. They were reflective regarding the origins of their explanations and would describe a process of testing and proof in relation to them. These findings suggest that the narrative insight construct has the potential to be a valid approach to understanding experiences of psychosis, and challenge the dominance of the clinical insight construct within clinical practice. Clinicians should value the explanatory framework for experiences which are provided by individuals experiencing psychosis, and encourage them to develop a framework which is coherent to their own world view rather than predominantly pursuing a biomedical explanation. Assessments of psychosis should
Association between prefrontal N-acetylaspartate and insight in psychotic disorders
Larabi, Daouia I.; Liemburg, Edith; Pijnenborg, Gerdina H.M. Pijnenborg; Sibeijn-Kuiper, Anita; de Vos, Annerieke E.; Bais, Leonie; Knegtering, Henderikus; Curcic-Blake, Branisalava; Aleman, Andre
Insight is impaired in most patients with psychosis and has been associated with poorer prognosis. The exact neural basis of impaired insight is still unknown, but it may involve disrupted prefrontal neural connectivity. Numerous studies have indeed found white matter (WM) abnormalities in
Insights from implementation of a risk management methodology
International Nuclear Information System (INIS)
Mahn, J.A.; Germann, R.P.; Jacobs, R.R.
1992-01-01
In 1988, GPU Nuclear (GPUN) Corporation embarked on a research effort to identify or develop an appropriate methodology for proactively managing risks. The objective of this effort was to increase its ability to identify potential risks and to aid resource allocation decision making for risk control. Such a methodology was presented at a risk management symposium sponsored by GPUN in September of 1989. A pilot project based on this methodology has been conducted at GPUN to test and validate the elements of the methodology and to compare the results of its application with current corporate methods for guiding risk decision making. The pilot project also led to a follow-up policy-capturing study to elicit information about the various risk decision-making models of GPUN decision makers. The combination of these endeavors provided an opportunity to gain numerous insights with respect to understanding the real value of a risk management process, obtaining acceptance of and commitment to risk management and improving operational aspects of the methodology
Ogunmolu, Funso Emmanuel; Kaur, Inderjeet; Gupta, Mayank; Bashir, Zeenat; Pasari, Nandita; Yazdani, Syed Shams
2015-10-02
The quest for cheaper and better enzymes needed for the efficient hydrolysis of lignocellulosic biomass has placed filamentous fungi in the limelight for bioprospecting research. In our search for efficient biomass degraders, we identified a strain of Penicillium funiculosum whose secretome demonstrates high saccharification capabilities. Our probe into the secretome of the fungus through qualitative and label-free quantitative mass spectrometry based proteomics studies revealed a high abundance of inducible CAZymes and several nonhydrolytic accessory proteins. The preferential association of these proteins and the attending differential biomass hydrolysis gives an insight into their interactions and clues about possible roles of novel hydrolytic and nonhydrolytic proteins in the synergistic deconstruction of lignocellulosic biomass. Our study thus provides the first comprehensive insight into the repertoire of proteins present in a high-performing secretome of a hypercellulolytic Penicillium funiculosum, their relative abundance in the secretome, and the interaction dynamics of the various protein groups in the secretome. The gleanings from the stoichiometry of these interactions hold a prospect as templates in the design of cost-effective synthetic cocktails for the optimal hydrolysis of biomass.
SOME INSIGHTS THAT ORALITY-LITERACY STUDIES CAN ...
African Journals Online (AJOL)
literacy studies can offer language teachers any insights ... 3.2 Literacy development takes place in a single direction. Another ... and cognitive consequences, is based on the assumption that literacy is .... and as influential with regard to other.
Impaired insight in cocaine addiction: laboratory evidence and effects on cocaine-seeking behaviour
Maloney, Thomas; Parvaz, Muhammad A.; Alia-Klein, Nelly; Woicik, Patricia A.; Telang, Frank; Wang, Gene-Jack; Volkow, Nora D.; Goldstein, Rita Z.
2010-01-01
Neuropsychiatric disorders are often characterized by impaired insight into behaviour. Such an insight deficit has been suggested, but never directly tested, in drug addiction. Here we tested for the first time this impaired insight hypothesis in drug addiction, and examined its potential association with drug-seeking behaviour. We also tested potential modulation of these effects by cocaine urine status, an individual difference known to impact underlying cognitive functions and prognosis. Sixteen cocaine addicted individuals testing positive for cocaine in urine, 26 cocaine addicted individuals testing negative for cocaine in urine, and 23 healthy controls completed a probabilistic choice task that assessed objective preference for viewing four types of pictures (pleasant, unpleasant, neutral and cocaine). This choice task concluded by asking subjects to report their most selected picture type; correspondence between subjects’ self-reports with their objective choice behaviour provided our index of behavioural insight. Results showed that the urine positive cocaine subjects exhibited impaired insight into their own choice behaviour compared with healthy controls; this same study group also selected the most cocaine pictures (and fewest pleasant pictures) for viewing. Importantly, however, it was the urine negative cocaine subjects whose behaviour was most influenced by insight, such that impaired insight in this subgroup only was associated with higher cocaine-related choice on the task and more severe actual cocaine use. These findings suggest that interventions to enhance insight may decrease drug-seeking behaviour, especially in urine negative cocaine subjects, potentially to improve their longer-term clinical outcomes. PMID:20395264
Intuition and insight: Two processes that build on each other or fundamentally differ?
Directory of Open Access Journals (Sweden)
Thea Zander
2016-09-01
Full Text Available Intuition and insight are intriguing phenomena of non-analytical mental functioning: Whereas intuition denotes ideas that have been reached by sensing the solution without any explicit representation of it, insight has been understood as the sudden and unexpected apprehension of the solution by recombining the single elements of a problem. By face validity, the two processes appear similar; according to a lay perspective, it is assumed that intuition precedes insight. Yet, predominant scientific conceptualizations of intuition and insight consider the two processes to differ with regard to their (dis-continuous unfolding. That is, intuition has been understood as an experience-based and gradual process, whereas insight is regarded as a genuinely discontinuous phenomenon. Unfortunately, both processes have been investigated differently and without much reference to each other. In this contribution, we therefore set out to fill this lacuna by examining the conceptualizations of the assumed underlying cognitive processes of both phenomena, and by also referring to the research traditions and paradigms of the respective field. Based on early work put forward by Bowers and colleagues (1990 and Bowers and colleagues (1995, we referred to semantic coherence tasks consisting of convergent word triads (i.e., the solution has the same meaning to all three clue words and/or divergent word triads (i.e., the solution means something different with respect to each clue word as an excellent kind of paradigm that may be used in the future to disentangle intuition and insight experimentally. By scrutinizing the underlying mechanisms of intuition and insight, with this theoretical contribution, we hope to launch lacking but needed experimental studies and to initiate scientific cooperation between the research fields of intuition and insight that are currently still separated from each other.
Intuition and Insight: Two Processes That Build on Each Other or Fundamentally Differ?
Zander, Thea; Öllinger, Michael; Volz, Kirsten G
2016-01-01
Intuition and insight are intriguing phenomena of non-analytical mental functioning: whereas intuition denotes ideas that have been reached by sensing the solution without any explicit representation of it, insight has been understood as the sudden and unexpected apprehension of the solution by recombining the single elements of a problem. By face validity, the two processes appear similar; according to a lay perspective, it is assumed that intuition precedes insight. Yet, predominant scientific conceptualizations of intuition and insight consider the two processes to differ with regard to their (dis-)continuous unfolding. That is, intuition has been understood as an experience-based and gradual process, whereas insight is regarded as a genuinely discontinuous phenomenon. Unfortunately, both processes have been investigated differently and without much reference to each other. In this contribution, we therefore set out to fill this lacuna by examining the conceptualizations of the assumed underlying cognitive processes of both phenomena, and by also referring to the research traditions and paradigms of the respective field. Based on early work put forward by Bowers et al. (1990, 1995), we referred to semantic coherence tasks consisting of convergent word triads (i.e., the solution has the same meaning to all three clue words) and/or divergent word triads (i.e., the solution means something different with respect to each clue word) as an excellent kind of paradigm that may be used in the future to disentangle intuition and insight experimentally. By scrutinizing the underlying mechanisms of intuition and insight, with this theoretical contribution, we hope to launch lacking but needed experimental studies and to initiate scientific cooperation between the research fields of intuition and insight that are currently still separated from each other.
Effect of video self-observations vs. observations of others on insight in psychotic disorders.
David, Anthony S; Chis Ster, Irina; Zavarei, Hooman
2012-04-01
Improving insight in patients with schizophrenia and related disorders is a worthwhile goal. Previous work has suggested that patients' insight may improve if they see videos of themselves taken when ill. Our aim was to test the hypothesis that schizophrenia patients improve their insight after viewing videos of themselves when unwell more so than after viewing an actor. Forty patients admitted with an acute psychotic disorder underwent a videotaped recording of a clinical interview. The patients were then randomized to viewing this or a "control" video of a same-sex actor displaying psychotic symptoms approximately 3 weeks later. Insight, psychopathology, and mood were assessed before and 24 to 48 hours after viewing the videos. All participants showed general improvement across all measures. There was a trend for scores on the Schedule for the Assessment of Insight to improve more in those who viewed themselves when ill, but there were no clear statistically significant differences between the "self" and "other" video groups. In conclusion, video self-confrontation seems to be a safe and potentially effective means of enhancing insight, but evidence for a specific effect is lacking.
The rarely reported tet(31) tetracycline resistance determinant is common in Gallibacterium anatis
DEFF Research Database (Denmark)
Bojesen, Anders M.; Bager, Ragnhild J.; Ifrah, Dan
2011-01-01
The present investigation was undertaken to identify and characterize the tetracycline resistance determinant in 22 Gallibacterium anatis strains for which no determinant was identified using primers specific for tet(A, B, C, D, E, G, H, K, L, M, O). A recent study found tet(B) to be the most pre...... from very different production systems and localities. In addition, tet(31) was identified in strains isolated over a 30-year period. This is the first report on tet(31) since its original identification in Aeromonas salmonicida....
Directory of Open Access Journals (Sweden)
Andréa Nunes Carvalho
2017-09-01
Full Text Available Abstract The academic literature presents a research-practice gap on the application of decision support tools to address tactical planning problems in real-world organisations. This paper addresses this gap and extends a previous action research relative to an optimisation model applied for tactical capacity planning in an engineer-to-order industrial setting. The issues discussed herein raise new insights to better understand the practical results that can be achieved through the proposed model. The topics presented include the modelling of objectives, the representation of the production process and the costing approach, as well as findings regarding managerial decisions and the scope of action considered. These insights may inspire ideas to academics and practitioners when developing tools for capacity planning problems in similar contexts.
Visual Attention Modulates Insight versus Analytic Solving of Verbal Problems
Wegbreit, Ezra; Suzuki, Satoru; Grabowecky, Marcia; Kounios, John; Beeman, Mark
2012-01-01
Behavioral and neuroimaging findings indicate that distinct cognitive and neural processes underlie solving problems with sudden insight. Moreover, people with less focused attention sometimes perform better on tests of insight and creative problem solving. However, it remains unclear whether different states of attention, within individuals,…
Lei, Hui; Cui, Yan; Fan, Jie; Zhang, Xiaocui; Zhong, Mingtian; Yi, Jinyao; Cai, Lin; Yao, Dezhong; Zhu, Xiongzhao
2017-09-01
There are limited data on neurobiological correlates of poor insight in obsessive-compulsive disorder (OCD). This study explored whether specific changes occur in small-world network (SWN) properties in the brain functional network of OCD patients with poor insight. Resting-state electroencephalograms (EEGs) were recorded for 12 medication-free OCD patients with poor insight, 50 medication-free OCD patients with good insight, and 36 healthy controls. Both of the OCD groups exhibited topological alterations in the brain functional network characterized by abnormal small-world parameters at the beta band. However, the alterations at the theta band only existed in the OCD patients with poor insight. A relatively small sample size. Subjects were naïve to medications and those with Axis I comorbidity were excluded, perhaps limiting generalizability. Disrupted functional integrity at the beta bands of the brain functional network may be related to OCD, while disrupted functional integrity at the theta band may be associated with poor insight in OCD patients, thus this study might provide novel insight into our understanding of the pathophysiology of OCD. Copyright © 2017 Elsevier B.V. All rights reserved.
Billingsley, Berry; Taber, Keith; Riga, Fran; Newdick, Helen
2013-08-01
A number of previous studies have shown that there is a widespread view among young people that science and religion are opposed. In this paper, we suggest that it requires a significant level of what can be termed "epistemic insight" to access the idea that some people see science and religion as compatible while others do not. To explore this further, we draw on previous work to devise a methodology to discover students' thinking about apparent contradictions between scientific and religious explanations of the origins of the universe. In our discussion of the findings, we highlight that students' epistemic insight in this context does seem in many cases to be limited and we outline some of the issues emerging from the study that seem to boost or limit students' progress in this area.
Tracking Online Data with YouTube's Insight Tracking Tool
Kinsey, Joanne
2012-01-01
YouTube users have access to the powerful data collection tool, Insight. Insight allows YouTube content producers to collect data about the number of online views, geographic location of viewers by country, the demographics of the viewers, how a video was discovered, and the attention span of the viewer while watching the video. This article…
Directory of Open Access Journals (Sweden)
Walvoort SJW
2016-07-01
Full Text Available Serge JW Walvoort,1–3 Paul T van der Heijden,3,4 Roy PC Kessels,1,2,5 Jos IM Egger1–3,6 1Centre of Excellence for Korsakoff and Alcohol-Related Cognitive Disorders, Vincent van Gogh Institute for Psychiatry, Venray, 2Donders Institute for Brain, Cognition and Behaviour, 3Behavioural Science Institute, Radboud University, Nijmegen, 4Reinier van Arkel Mental Health Institute, ‘s-Hertogenbosch, 5Department of Medical Psychology, Radboud University Medical Center, Nijmegen, 6Centre of Excellence for Neuropsychiatry, Vincent van Gogh Institute for Psychiatry, Venray, the Netherlands Aim: Impaired illness insight may hamper treatment outcome in patients with alcohol-related cognitive deficits. In this study, a short questionnaire for the assessment of illness insight (eg, the Q8 was investigated in patients with Korsakoff’s syndrome (KS and in alcohol use disorder (AUD patients with mild neurocognitive deficits. Methods: First, reliability coefficients were computed and internal structure was investigated. Then, comparisons were made between patients with KS and patients with AUD. Furthermore, correlations with the Dysexecutive Questionnaire (DEX were investigated. Finally, Q8 total scores were correlated with neuropsychological tests for processing speed, memory, and executive function. Results: Internal consistency of the Q8 was acceptable (ie, Cronbach’s α =0.73. The Q8 items represent one factor, and scores differ significantly between AUD and KS patients. The Q8 total score, related to the DEX discrepancy score and scores on neuropsychological tests as was hypothesized, indicates that a higher degree of illness insight is associated with a higher level of cognitive functioning. Conclusion: The Q8 is a short, valid, and easy-to-administer questionnaire to reliably assess illness insight in patients with moderate-to-severe alcohol-related cognitive dysfunction. Keywords: illness insight, anosognosia, alcohol use disorder, Korsakoff
Directory of Open Access Journals (Sweden)
Ai Sian Ng
2017-07-01
Full Text Available The world decided in December 2015 to take actions to reduce global warming. To contribute toward this goal, this research examines possible policy levers for inclusion in the climate change ratification plan. A case study of the measures taken by the Republic of Singapore, a low-lying 719.2 km2 island without natural resources in Asia, is conducted. Being vulnerable to climate change impact and yet having to balance her people’s needs and economic progress with limited resources, the measures taken by this small country could offer policy insights for small states and states without access to alternative energy sources. This research analyzes the online policy documents posted by eleven organizations to answer the main research question of identifying policy levers as theoretical constructs to form a framework that can be used to study climate change policies. A qualitative data analysis software, QSR NVivo 10, is used to classify the proposed nodes developed by the researchers using a system perspective integrating the insights from the key international climate change frameworks with the theoretical concepts from the model of pro-environmental behavior. The findings can offer insights toward developing a new contextual influence framework, which can help strengthen policy development and outcome measurement.
New Insights Offered by a Computational Model of Deep Brain Stimulation
DEFF Research Database (Denmark)
Modolo, J.; Mosekilde, Erik; Beuter, A.
2007-01-01
Deep brain stimulation (DBS) is a standard neurosurgical procedure used to treat motor symptoms in about 5% of patients with Parkinson's disease (PD). Despite the indisputable success of this procedure, the biological mechanisms underlying the clinical benefits of DBS have not yet been fully...... and exploring the physiological mechanisms which respond to this treatment strategy (i.e., DBS). Finally, we present new insights into the ways this computational model may help to elucidate the dynamic network effects produced in a cerebral structure when DBS is applied. (C) 2007 Elsevier Ltd. All rights...
Sleep Does Not Promote Solving Classical Insight Problems and Magic Tricks
Schönauer, Monika; Brodt, Svenja; Pöhlchen, Dorothee; Breßmer, Anja; Danek, Amory H.; Gais, Steffen
2018-01-01
During creative problem solving, initial solution attempts often fail because of self-imposed constraints that prevent us from thinking out of the box. In order to solve a problem successfully, the problem representation has to be restructured by combining elements of available knowledge in novel and creative ways. It has been suggested that sleep supports the reorganization of memory representations, ultimately aiding problem solving. In this study, we systematically tested the effect of sleep and time on problem solving, using classical insight tasks and magic tricks. Solving these tasks explicitly requires a restructuring of the problem representation and may be accompanied by a subjective feeling of insight. In two sessions, 77 participants had to solve classical insight problems and magic tricks. The two sessions either occurred consecutively or were spaced 3 h apart, with the time in between spent either sleeping or awake. We found that sleep affected neither general solution rates nor the number of solutions accompanied by sudden subjective insight. Our study thus adds to accumulating evidence that sleep does not provide an environment that facilitates the qualitative restructuring of memory representations and enables problem solving. PMID:29535620
Mind Wandering and the Incubation Effect in Insight Problem Solving
Tan, Tengteng; Zou, Hong; Chen, Chuansheng; Luo, Jin
2015-01-01
Although many anecdotes suggest that creative insights often arise during mind wandering, empirical research is still sparse. In this study, the number reduction task (NRT) was used to assess whether insightful solutions were related to mind wandering during the incubation stage of the creative process. An experience sampling paradigm was used to…
The Mediating Role of Insight for Long-Term Improvements in Psychodynamic Therapy
Johansson, Paul; Hoglend, Per; Ulberg, Randi; Amlo, Svein; Marble, Alice; Bogwald, Kjell-Petter; Sorbye, Oystein; Sjaastad, Mary Cosgrove; Heyerdahl, Oscar
2010-01-01
Objective: According to psychoanalytic theory, interpretation of transference leads to increased insight that again leads to improved interpersonal functioning over time. In this study, we performed a full mediational analysis to test whether insight gained during treatment mediates the long-term effects of transference interpretation in dynamic…
Water inSight : An exploration into landscape architectonic transformations of polder water
Bobbink, I.; Loen, S.
2013-01-01
Water inSight provides insight into the ‘water machine’ that forms the basis of the Dutch polder landscape. Authors Inge Bobbink and Suzanne Loen approach the polder landscape from a landscape-architectonic point of view, using technical and spatial analysis drawings, images, plans and experiments
DEFF Research Database (Denmark)
Hannibal, Niels
1999-01-01
This article will focus on the question of how verbal reflection about music, and musical reflection while playing, can be described with the purpose of assessing a person's possibility to achieve insight in music therapy: The insight potential. The concept of the insight potential is related to ...
Harvey, Philip D; Siu, Cynthia O; Loebel, Antony D
2017-12-01
Objective: The objective of this post-hoc analysis was to evaluate the effect of lurasidone and quetiapine extended-release (XR) on insight and judgment and assess the longitudinal relationships between improvement in insight and cognitive performance, functional capacity, quality of well-being, and depressive symptoms in patients with schizophrenia. Design: Clinically unstable patients with schizophrenia (N=488) were randomized to once-daily, fixed-dose treatment with lurasidone 80mg, lurasidone 160mg, quetiapine XR 600mg, or placebo, followed by a long-term, double-blind, flexible-dose continuation study involving these agents. Results: Significantly greater improvement in insight and judgment (assessed by the Positive and Negative Syndrome Scale G12 item) for the lurasidone and quetiapine XR groups, compared to the placebo group, was observed at Week 6. Over a subsequent six-month continuation period, the flexible dose lurasidone group showed significantly greater improvement in insight from acute phase baseline compared to the flexible-dose quetiapine XR group (QXR-QXR) (p=0.032). Improvement in insight was significantly correlated with improvement in cognition ( p =0.014), functional capacity (p=0.006, UPSA-B), quality of well-being ( p =0.033, QWB), and depressive symptoms ( p =0.05, Montgomery-Åsberg Depression Rating Scale [MADRS] score) across treatment groups and study periods. Conclusion: In this post-hoc analysis, flexibly dosed lurasidone 40 to 160mg/d was found to be associated with significantly greater improvement in insight compared to flexibly dosed quetiapine XR 200 to 800mg/d over long-term treatment in patients with schizophrenia. Across treatment groups, improvement in insight and judgment was significantly associated with improvement in cognition, functional capacity, quality of well-being, and depressive symptoms over time.
Listening with a narrative ear: Insights from a study of fall stories in older adults.
Pereles, Laurie; Jackson, Roberta; Rosenal, Tom; Nixon, Lara
2017-01-01
To determine the value of adding a patient narrative to the clinical assessment of falls in the elderly. Qualitative study of interviews. A fall prevention clinic in Calgary, Alta. Fifteen older adults on a wait list for assessment by the fall clinic and the physiotherapists who assessed them. Participants' stories were audiorecorded and later transcribed and summarized. Stories were collected using open-ended questions, first inviting participants to tell the interviewer about themselves, and then the circumstances of their falls and their reflections on them. In a subsequent visit, transcriptions or summaries were returned to patients for member checking. Narratives were read and analyzed by all 4 investigators using a narrative approach and a close-reading technique. With the patients' additional consent, stories were shared with the fall prevention team for their insights and reactions. Interviews with physiotherapists were audiorecorded and transcribed. The narrative analysis provided new insights into the attitudes about and perceptions of the causes of falls, their effects, and rehabilitation. Close reading exposed presentation of self, locus of control, and underlying social and emotional issues. The addition of patient narratives to clinical assessments offers clinicians an understanding of patients' perspectives, which can be used to better engage patients in rehabilitation. Copyright© the College of Family Physicians of Canada.
Li, Yadan; Xiao, Xiao; Ma, Wenjuan; Jiang, Jun; Qiu, Jiang; Zhang, Qinglin
2013-11-13
Accumulating evidence suggests that insight can be substantially influenced by task-irrelevant emotion stimuli and interpersonal competitive situation, and a close link might exist between them. Using a learning-testing paradigm and Event-Related Potentials (ERPs), the present study investigated the independent and joint effects of emotional and competitive information on insight problem solving especially their neural mechanisms. Subjects situated in either competitive or non-competitive condition learned heuristic logogriphs first and then viewed task-irrelevant positive or negative emotional pictures, which were followed by test logogriphs to solve. Both behavioral and ERP findings showed a more evident insight boost following negative emotional pictures in competitive context. Results demonstrated that negative emotion and competitive situation might promote insight by a defocused mode of attention (as indicated by N1 and P2), the enhanced semantic integration and breaking mental set (as indicated by N450), and the increased forming of novel associations activated by motivational arousal originating from competition (as indicated by P800-1600 and P1600-2500). These results indicate that the dynamic interactions between emotional valence and competitive arousal effects on insight. © 2013 Elsevier B.V. All rights reserved.
Cooke, Michael A; Peters, Emmanuelle R; Fannon, Dominic; Aasen, Ingrid; Kuipers, Elizabeth; Kumari, Veena
2010-07-30
Cognitive insight in schizophrenia encompasses the evaluation and reinterpretation of distorted beliefs and appraisals. We investigated the neuropsychological basis of cognitive insight in psychosis. It was predicted that, like clinical insight, cognitive insight would be associated with a wide range of neuropsychological functions, but would be most strongly associated with measures of executive function. Sixty-five outpatients with schizophrenia or schizoaffective disorder were assessed on tests of intelligence quotient (IQ), executive function, verbal fluency, attention and memory, and completed the Beck Cognitive Insight Scale, which includes two subscales, self-certainty and self-reflection. Higher self-certainty scores reflect greater certainty about being right and more resistant to correction (poor insight), while higher self-reflection scores indicate the expression of introspection and the willingness to acknowledge fallibility (good insight). The self-certainty dimension of poor cognitive insight was significantly associated with lower scores on the Behavioural Assessment of Dysexecutive Syndrome; this relationship was not mediated by IQ. There were no relationships between self-reflection and any neuropsychological measures. We conclude that greater self-certainty (poor cognitive insight) is modestly associated with poorer executive function in psychotic individuals; self-reflection has no association with executive function. The self-certainty and self-reflection dimensions of cognitive insight have differential correlates, and probably different mechanisms, in psychosis. Copyright 2009 Elsevier Ireland Ltd. All rights reserved.
Developmental Social Cognitive Neuroscience: Insights from Deafness
Corina, David; Singleton, Jenny
2009-01-01
The condition of deafness presents a developmental context that provides insight into the biological, cultural, and linguistic factors underlying the development of neural systems that impact social cognition. Studies of visual attention, behavioral regulation, language development, and face and human action perception are discussed. Visually…
Safeguarding our environment: insight from an African ...
African Journals Online (AJOL)
The care and management of the natural environment constitutes an important aspect of environmental philosophy; an area of study that critically scrutinizes and evaluates human activities in his environment. African environmental ethics approaches problematic fundamental issues in deep ecology with a unique insight, ...
PRA insights applicable to the design of the Broad Applications Test Reactor
International Nuclear Information System (INIS)
Khericha, S.T.; Reilly, H.J.
1993-01-01
Design insights applicable to the design of a new Broad Applications Test Reactor (BATR), being studied at Idaho National Engineering Laboratory, are summarized. Sources of design insights include past probabilistic risk assessments and related studies for department of Energy-owned Class A reactors and for commercial reactors. The report includes a preliminary risk allocation scheme for the BATR
‘Graphic Medicine’ as a Mental Health Information Resource: Insights from Comics Producers
Directory of Open Access Journals (Sweden)
Anthony Farthing
2016-02-01
Full Text Available Recent literature suggests that a growing number of comics are being published on health-related topics, including aspects of mental health and social care (Williams 2012; Czerwiec et al 2015 and that comics are increasingly being used in higher education settings as information resources. This article offers insights from comics creators and disseminators and explores the wider context of comics production and distribution (with a focus on 'Graphic Medicine' or health-related comics as part of a larger examination of the interface between these documents and potential academic audiences. Original data was gathered through semi-structured interviews with 15 participants actively involved in comics creation and production. Elements of domain analysis (Hjørland 2002 were used to obtain insights into attitudes to the creation, dissemination and use of mental health-related comics. Though potentially useful comics material is being produced in the mental health domain, significant challenges remain for producers in enabling their work to be accessed within higher education settings. This paper suggests that comics producers need to make a concerted effort to reach academia, and academia - including information professionals - need to embrace new types of material to enhance teaching.
Lien, Yin-Ju; Chang, Hsin-An; Kao, Yu-Chen; Tzeng, Nian-Sheng; Lu, Chien-Wen; Loh, Ching-Hui
2018-02-01
Impaired quality of life (QoL) is a common and clinically relevant feature of schizophrenia. In the present study, we attempted to formulate a model of QoL in the chronic stage of schizophrenia by including key variables-namely cognitive insight, self-stigma, insight into treatment, and medication compliance-that were proposed as its significant predictors in previous studies. We employed structural equation modeling (SEM) to simultaneously test the associations between these variables. A total of 170 community-dwelling patients with schizophrenia participated in this study. Cognitive insight, self-stigma, insight into treatment, medication compliance, and QoL were assessed through self-reporting. Symptoms were rated by interviewers. The influences of cognitive insight, stigma, insight into treatment, and medication compliance on QoL were supported using SEM. Our findings indicated that cognitive insight had a significant, positive, and direct effect on both self-stigma and insight into treatment; in contrast, it had a negative and direct effect on medication compliance. Notably, no evidence indicated a direct effect of cognitive insight on QoL. Thus, individuals with high cognitive insight reported low QoL because of stigma, low medication compliance, and their increased insight into treatment. In contrast, cognitive insight might indirectly ameliorate QoL mediated by the effect of insight into treatment on medication compliance. The findings provide additional support of the links between cognitive and clinical insight, self-stigma, medication compliance, and QoL in those with schizophrenia and suggest the need for screening and intervention services appropriate for this high-risk population.
Edwards, Christopher L; Malinowski, Josie E; McGee, Shauna L; Bennett, Paul D; Ruby, Perrine M; Blagrove, Mark T
2015-01-01
There have been reports and claims in the psychotherapeutic literature that the consideration of recent dreams can result in personal realizations and insight. There is theoretical support for these claims from work on rapid eye movement (REM) sleep having a function of the consolidation of emotional memories and the creative formation of connections between new and older memories. To investigate these claims, 11 participants (10 females, one male) reported and considered a recent home dream in a dream discussion group that following the "Appreciating dreams" method of Montague Ullman. The group ran 11 times, each participant attending and participating once. A further nine participants (seven females, two males) reported and considered a recent home dream in a group that followed the "Listening to the dreamer" method of Michael Schredl. The two studies each had a control condition where the participant also reported a recent event, the consideration of which followed the same technique as was followed for the dream report. Outcomes of the discussions were assessed by the participants on the Gains from Dream Interpretation (GDI) scale, and on its counterpart, the Gains from Event Interpretation scale. High ratings on the GDI experiential-insight subscale were reported for both methods, when applied to dreams, and for the Ullman method Exploration-Insight ratings for the dream condition were significantly higher than for the control event condition. In the Ullman method, self-assessment of personal insight due to consideration of dream content was also significantly higher than for the event consideration condition. The findings support the view that benefits can be obtained from the consideration of dream content, in terms of identifying the waking life sources of dream content, and because personal insight may also occur. To investigate the mechanisms for the findings, the studies should be repeated with REM and non-REM dream reports, hypothesizing greater insight
Directory of Open Access Journals (Sweden)
Christopher Lloyd Edwards
2015-06-01
Full Text Available There have been reports and claims in the psychotherapeutic literature that the consideration of recent dreams can result in personal realizations and insight. There is theoretical support for these claims from work on Rapid Eye Movement sleep having a function of the consolidation of emotional memories and the creative formation of connections between new and older memories. To investigate these claims, 11 participants (10 females, 1 male reported and considered a recent home dream in a dream discussion group that following the ‘Appreciating dreams’ method of Montague Ullman. The group ran 11 times, each participant attending and participating once. A further nine participants (7 females, 2 males reported and considered a recent home dream in a group that followed the ‘Listening to the dreamer’ method of Michael Schredl. The two studies each had a control condition where the participant also reported a recent event, the consideration of which followed the same technique as was followed for the dream report. Outcomes of the discussions were assessed by the participants on the Gains from Dream Interpretation scale, and on its counterpart, the Gains from Event Interpretation scale. High ratings on the GDI experiential-insight subscale were reported for both methods, when applied to dreams, and for the Ullman method exploration-insight ratings for the dream condition were significantly higher than for the control event condition. In the Ullman method, self-assessment of personal insight due to consideration of dream content was also significantly higher than for the event consideration condition. The findings support the view that benefits can be obtained from the consideration of dream content, in terms of identifying the waking life sources of dream content, and because personal insight may also occur. To investigate the mechanisms for the findings, the studies should be repeated with REM and NREM dream reports, hypothesizing greater
Insights and their emergence in everyday practices
DEFF Research Database (Denmark)
Trasmundi, Sarah Bro; Linell, Per
2017-01-01
of sense-making, problem-solving and task performance in naturalistic contexts. Second, it presents a promising method for the analysis of cognitive activities, Cognitive Event Analysis (CEA), with which we investigate real-life medical interactions, especially the emergence of insights in procedural task......-cultural patterns of behaviour....
Reduced Connectivity in the Self-Processing Network of Schizophrenia Patients with Poor Insight
Liemburg, Edith J.; van der Meer, Lisette; Swart, Marte; Curcic-Blake, Branislava; Bruggeman, Richard; Knegtering, Henderikus; Aleman, Andre
2012-01-01
Lack of insight (unawareness of illness) is a common and clinically relevant feature of schizophrenia. Reduced levels of self-referential processing have been proposed as a mechanism underlying poor insight. The default mode network (DMN) has been implicated as a key node in the circuit for
Vitamin B12: advances and insights
DEFF Research Database (Denmark)
individuals in critical life phases. This book has been written by experts who documented latest developments in the field. It is written for individuals looking for in depth knowledge of the nutritional, chemistry, biochemistry, health and medical relevance of the vitamin. The book provides insights...
Brief Report: Insight into Illness and Social Attributional Style in Asperger's Syndrome
Didehbani, Nyaz; Shad, Mujeeb U.; Kandalaft, Michelle R.; Allen, Tandra T.; Tamminga, Carol A.; Krawczyk, Daniel C.; Chapman, Sandra B.
2012-01-01
A number of psychiatric illnesses have been recognized to have some level of insight deficits, including developmental disorders, such as Asperger's Syndrome (ASP). However insight into illness has not been empirically investigated in ASP and little research has examined how individuals with ASP view their deficits. This is the first study to…
Working in Dyads and Alone: Examining Process Variables in Solving Insight Problems
Tidikis, Viktoria; Ash, Ivan K.
2013-01-01
This study investigated the effects of working in dyads and their associated gender composition on performance (solution rate and time) and process variables (number of impasses, number of passed solutions, and number of problem solving suggestions and interactions) in a set of classic insight problem solving tasks. Two types of insight problems…
Ozkiris, Ayse; Essizoglu, Altan; Gulec, Gulcan; Aksaray, Gokay
2015-04-01
The aim of this study is firstly to compare the obsessive-compulsive disorder (OCD) patients with good insight and OCD patients with poor insight in terms of socio-demographic and clinical features; to investigate the relation between insight and the level of the expressed emotion (EE) in the patients; and lastly to specify the factors that predict level of insight. OCD patients with good insight and patients with poor insight were compared in terms of clinical features and the perceived EE level of the patients and the individuals that they live with in order to specify the factors that predict the insight level, and to investigate the relationship between insight level and EE. It was found that the total Expressed Emotion Scale, total Level of Expressed Emotion (LEE), LEE-Emotional Response and LEE-Tolerance/Expectation subscale scores of the group comprised of patients with poor insight are higher than the other group. The results also show that the duration of illness and Yale-Brown Obsessive Compulsive Scale (Y-BOCS) total score predict insight level. This study shows that the level of EE perceived by the patients with poor insight and the person that he/she lives with, is higher than the group with good insight. The studies that investigate the relationship between the factors of insight level and EE level, which are indicated to determine the level of the illness severity and its chronicity, will enable the researchers to understand the importance of the role of the family on the treatment processes of OCD.
Baksi, Krishanu D; Kuntal, Bhusan K; Mande, Sharmila S
2018-01-01
Realization of the importance of microbiome studies, coupled with the decreasing sequencing cost, has led to the exponential growth of microbiome data. A number of these microbiome studies have focused on understanding changes in the microbial community over time. Such longitudinal microbiome studies have the potential to offer unique insights pertaining to the microbial social networks as well as their responses to perturbations. In this communication, we introduce a web based framework called 'TIME' (Temporal Insights into Microbial Ecology'), developed specifically to obtain meaningful insights from microbiome time series data. The TIME web-server is designed to accept a wide range of popular formats as input with options to preprocess and filter the data. Multiple samples, defined by a series of longitudinal time points along with their metadata information, can be compared in order to interactively visualize the temporal variations. In addition to standard microbiome data analytics, the web server implements popular time series analysis methods like Dynamic time warping, Granger causality and Dickey Fuller test to generate interactive layouts for facilitating easy biological inferences. Apart from this, a new metric for comparing metagenomic time series data has been introduced to effectively visualize the similarities/differences in the trends of the resident microbial groups. Augmenting the visualizations with the stationarity information pertaining to the microbial groups is utilized to predict the microbial competition as well as community structure. Additionally, the 'causality graph analysis' module incorporated in TIME allows predicting taxa that might have a higher influence on community structure in different conditions. TIME also allows users to easily identify potential taxonomic markers from a longitudinal microbiome analysis. We illustrate the utility of the web-server features on a few published time series microbiome data and demonstrate the
Cross-cultural psychometric assessment of the VAGUS insight into psychosis scale - Spanish version.
de León, Patricia Ponce; Gerretsen, Philip; Shah, Parita; Saracco-Alvarez, Ricardo; Graff-Guerrero, Ariel; Fresán, Ana
2018-01-01
Impaired insight into illness, a core feature of schizophrenia with negative clinical implications, is a multidimensional phenomenon existing on a continuum. However, the degree to which illness perception in distinct cultures influences the appraisal of insight into illness in schizophrenia remains unclear. As such, we aimed to determine if the psychometric properties of the VAGUS insight into psychosis scale (www.vagusonline.com), which was originally assessed in English speaking Canadians, were similar in a sample of Latino Mexican Spanish speaking patients with schizophrenia. To accomplish this, the VAGUS - Self-Report (SR) version was translated from English to Spanish and psychometrically evaluated in 95 participants. The Spanish version of the VAGUS-SR was internally consistent (ᾳ = 0.713), and demonstrated good convergent and discriminant validity with the subscales of the Positive and Negative Syndrome Scale. Factor analysis identified two components of insight, congruent with two of the components of the English version of the VAGUS-SR. In conclusion, the VAGUS-SR is a brief, novel, and valid measure of insight into illness in schizophrenia, which demonstrated similar psychometric properties in two culturally and linguistically distinct samples with schizophrenia. Future studies should assess whether the VAGUS demonstrates similar psychometric properties in non-Western cultures. Copyright © 2017 Elsevier B.V. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Wendelberger, Joanne Roth [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)
2014-11-05
This presentation will provide career advice for individuals seeking to go beyond just having a job to building a successful career in the areas of Science, Technology, Engineering, and Mathematics. Careful planning can be used to turn a job into a springboard for professional advancement and personal satisfaction. Topics to be addressed include setting priorities, understanding career ladders, making tough choices, overcoming stereotypes and assumptions by others, networking, developing a professional identify, and balancing a career with family and other personal responsibilities. Insights on the transition from individual technical work to leadership will also be provided. The author will draw upon experiences gained in academic, industrial, and government laboratory settings, as well as extensive professional service and community involvement.
A practical view of the insights from scaling thermal-hydraulic tests
Energy Technology Data Exchange (ETDEWEB)
Levin, A.E.; McPherson, G.D.
1995-09-01
The authors review the broad concept of scaling of thermal-hydraulic test facilities designed to acquire data for application to modeling the behavior of nuclear power plants, especially as applied to the design certification of passive advanced light water reactors. Distortions and uncertainties in the scaling process are described, and the possible impact of these effects on the test data are discussed. A practical approach to the use of data from the facilities is proposed, with emphasis on the insights to be gained from the test results rather than direct application of test results to behavior of a large plant.
Implicit and explicit self-related processing in relation to insight in patients with schizophrenia
de Vos, Annerieke E.; Pijnenborg, Gerdina H. M.; Aleman, Andre; van der Meer, Lisette
2015-01-01
Introduction. Self-related processing (SRP) has been associated with clinical and cognitive insight. We investigated the relationship between implicit SRP (ISRP) and explicit SRP (ESRP) and insight. We first hypothesised that impaired insight is associated with the extent to which implicit feedback
Kim, Jong-Hoon; Lee, Seul; Han, Ah-Young; Kim, Kyungwook; Lee, Jinyoung
2015-01-01
The concept of cognitive insight refers to the cognitive processes involved in patients' re-evaluation of their anomalous experiences and of their misinterpretations. The purpose of the present study was to examine the relationship between cognitive insight and subjective quality of life in patients with schizophrenia to further shed light on the nature of cognitive insight and its functional correlates in schizophrenia. Seventy-one stable outpatients with schizophrenia were evaluated for cognitive insight and subjective quality of life using the Beck Cognitive Insight Scale (BCIS) and the Schizophrenia Quality of Life Scale Revision 4 (SQLS-R4). The symptoms of schizophrenia were also assessed. Pearson's correlation analysis and partial correlation analysis that controlled for the severity of symptoms were performed to adjust for the possible effects of symptoms. The self-reflectiveness subscale score of the BCIS had significant positive correlations with the SQLS-R4 psychosocial domain and total SQLS-R4 scores, indicating that the higher the level of cognitive insight, the lower the subjective quality of life. In partial correlation analysis controlling for symptoms, the BCIS self-reflectiveness subscale score still had a significant correlation with the SQLS-R4 psychosocial domain score. The correlation coefficient between the BCIS self-reflectiveness and total SQLS-R4 scores was reduced to a nonsignificant statistical tendency. The results of our study suggest that cognitive insight, particularly the level of self-reflectiveness, is negatively associated with the level of subjective quality of life in outpatients with schizophrenia and that this relationship is not wholly due to the confounding effect of symptoms. Future studies are necessary to explore possible mediating and moderating factors and to evaluate the effects of therapeutic interventions on the relationship.
Nukuleka as a founder colony for West Polynesian settlement : new insights from recent excavations
International Nuclear Information System (INIS)
Burley, D.V.; Barton, A.; Dickinson, W.R.; Connaughton, S.P.; Tache, K.
2010-01-01
Previous archaeological studies in the village of Nukuleka, Tongatapu, Kingdom of Tonga proposed it as a founder colony for Polynesia. Additional excavation and survey were undertaken in 2007 to evaluate this status further and to gain new insight into the nature of the occupation and its role in the subsequent peopling of west Polynesia. A review of this project and its findings are presented. Decorated ceramics of western Lapita style, the presence of tan paste ceramics foreign to Tonga, and new radiocarbon dates support Nukuleka as a site of first landfall in the interval 2850 to 2900 cal BP. The ceramic assemblage is distinct from west and central Fiji, and an independent origin for Fijian and Polynesian colonizers is argued. The settlement quickly expanded on the Nukuleka Peninsula to 20 ha or more in size, forming a central place for the eastern Lapita province in Tonga, Samoa and the Lau islands of Fiji. Nukuleka, we believe, provides insight into the cultural if not biological base from which ancestral Polynesian society emerged. (author). 35 refs., 11 figs., 3 tabs.
Gestures and Insight in Advanced Mathematical Thinking
Yoon, Caroline; Thomas, Michael O. J.; Dreyfus, Tommy
2011-01-01
What role do gestures play in advanced mathematical thinking? We argue that the role of gestures goes beyond merely communicating thought and supporting understanding--in some cases, gestures can help generate new mathematical insights. Gestures feature prominently in a case study of two participants working on a sequence of calculus activities.…
Rathee, Ruchika; Luhrmann, Tanya M; Bhatia, Triptish; Deshpande, Smita N
2018-01-01
Poor cognitive insight in schizophrenia has been linked to delusions, hallucinations, and negative symptoms as well as to depressive/anxiety symptoms. Its impact on quality of life has been less studied, especially in schizophrenia subjects with ongoing auditory hallucinations. The Beck Cognitive Insight Scale (BCIS) and the Quality of Life Scale (QLS) were administered to subjects who met DSM IV criteria for schizophrenia after due translation and validation. All subjects reported ongoing auditory hallucinations at recruitment. Mean composite cognitive insight scores from participants (N = 60) (2.97 ± 2.649) were in the lower range as compared to published literature. Cognitive insight scores as well as self-reflectiveness subscale scores, but not self-certainty scores, correlated significantly with the QLS scores p insight, especially self-reflectiveness, may be linked to better quality of life. Self-reflectiveness could be a useful construct to address in psychotherapy to improve rehabilitation. Copyright © 2017. Published by Elsevier B.V.
Structure of Human GIVD Cytosolic Phospholipase A2 Reveals Insights into Substrate Recognition
Energy Technology Data Exchange (ETDEWEB)
Wang, Hui; Klein, Michael G.; Snell, Gyorgy; Lane, Weston; Zou, Hua; Levin, Irena; Li, Ke; Sang, Bi-Ching (Takeda Cali)
2016-07-01
Cytosolic phospholipases A2 (cPLA2s) consist of a family of calcium-sensitive enzymes that function to generate lipid second messengers through hydrolysis of membrane-associated glycerophospholipids. The GIVD cPLA2 (cPLA2δ) is a potential drug target for developing a selective therapeutic agent for the treatment of psoriasis. Here, we present two X-ray structures of human cPLA2δ, capturing an apo state, and in complex with a substrate-like inhibitor. Comparison of the apo and inhibitor-bound structures reveals conformational changes in a flexible cap that allows the substrate to access the relatively buried active site, providing new insight into the mechanism for substrate recognition. The cPLA2δ structure reveals an unexpected second C2 domain that was previously unrecognized from sequence alignments, placing cPLA2δ into the class of membrane-associated proteins that contain a tandem pair of C2 domains. Furthermore, our structures elucidate novel inter-domain interactions and define three potential calcium-binding sites that are likely important for regulation and activation of enzymatic activity. These findings provide novel insights into the molecular mechanisms governing cPLA2's function in signal transduction.
Hydrogeology of Montserrat review and new insights
Directory of Open Access Journals (Sweden)
Brioch Hemmings
2015-03-01
Full Text Available Study region: The tropical, active volcanic arc island of Montserrat, Lesser Antilles, Caribbean. Study focus: New insights into hydrological recharge distribution, measurements of aquifer permeability, and geological and hydrological field observations from Montserrat are combined with a review of the current understanding of volcanic island hydrology. The aim is to begin to develop a conceptual model for the hydrology of Montserrat, and to inform and stimulate further investigation into the hydrology of volcanic arc islands, by combining a review of the current understanding of essential components of the hydrological system with fresh analysis of existing data, and new observations, data collection and analysis. This study provides new insights into hydrological recharge distribution, measurements of aquifer permeability, and geological and hydrological field observations from Montserrat. New hydrological insights for the region: A new groundwater recharge model predicts whole island recharge of 266 mm/year, between 10% and 20% of annual rainfall. Core scale permeability tests reveal ranges from 10−14 to 10−12 m2 for volcaniclastic rocks with coarse matrix, to a minimum of 10−18 m2 for andesitic lavas and volcaniclastics with fine or altered matrix. Analysis of historical pumping tests on aquifers in reworked, channel and alluvial sediment indicate permeabilities ∼10−10 m2. Springs at elevations between 200 and 400 m above mean sea level on Centre Hills currently discharge over 45 L/s. High discharge require a reasonably laterally continuous low permeability body. Contrasting conceptual models are presented to illustrate two potential hydrogeological scenarios. New field observations also reveal systematic spatial variations in spring water temperature and specific electrical conductivity indicating that meteoric waters supplying the springs are mixed with a deeper groundwater source at some sites. Keywords: Volcanic island
Trickett, Edison J
2015-12-01
The intellectual legacy of Seymour Sarason continues to serve as a critical resource for the field of community psychology. The present paper draws on one of Sarason's favorite aphorisms and two of his seminal writings to suggest the relevance of ideas articulated 35-40 years ago for the current time. Each in their own way highlights the importance of unearthing and interrogating core assumptions underlying our research and our efforts to make a positive difference. The aphorism reminds us that the rhetoric of change is far easier to articulate than to enact and all too often ignores or disguises issues of power among actors. The "misdirection" of Psychology reflected his assertion that the asocial, acultural, and ahistorical nature of American Psychology reflected American culture more generally and ill prepared it to understand and engage in social change, particularly with respect to educational reform. The "anarchist insight" articulated his belief in interrogating the implications of the increasingly interdependent relationship of science and the state for the autonomy of scientists and scientific inquiry. The evidence-based practice movement is offered as an example of the current day relevance of the aphorism and core insights of these two papers. The paper concludes with a plea to rekindle the discussion and continued examination of Sarason's paradigmatic insights for the intellectual and social development of the field.
Tour Guiding Research Insights, Issues and Implications
DEFF Research Database (Denmark)
Meged, Jane Widtfeldt
2017-01-01
The book Tour guiding research – insights, issues and implications by Betty Weiler and Rosemary Black is a most welcome contribution to the specific research field of guided tours within tourism studies. It sets forth to “give an authoritative state-of-art review of the scholarly literature on tour...
Risk Insights Gained from Fire Incidents
International Nuclear Information System (INIS)
Kazarians, Mardy; Nowlen, Steven P.
1999-01-01
There now exist close to 20 years of history in the application of Probabilistic Risk Assessment (PRA) for the analysis of fire risk at nuclear power plants. The current methods are based on various assumptions regarding fire phenomena, the impact of fire on equipment and operator response, and the overall progression of a fire event from initiation through final resolution. Over this same time period, a number of significant fire incidents have occurred at nuclear power plants around the world. Insights gained from US experience have been used in US studies as the statistical basis for establishing fire initiation frequencies both as a function of the plant area and the initiating fire source.To a lesser extent, the fire experience has also been used to assess the general severity and duration of fires. However, aside from these statistical analyses, the incidents have rarely been scrutinized in detail to verify the underlying assumptions of fire PRAs. This paper discusses an effort, under which a set of fire incidents are being reviewed in order to gain insights directly relevant to the methods, data, and assumptions that form the basis for current fire PRAs. The paper focuses on the objectives of the effort, the specific fire events being reviews methodology, and anticipated follow-on activities
Distributed large-scale dimensional metrology new insights
Franceschini, Fiorenzo; Maisano, Domenico
2011-01-01
Focuses on the latest insights into and challenges of distributed large scale dimensional metrology Enables practitioners to study distributed large scale dimensional metrology independently Includes specific examples of the development of new system prototypes
XPIWIT--an XML pipeline wrapper for the Insight Toolkit.
Bartschat, Andreas; Hübner, Eduard; Reischl, Markus; Mikut, Ralf; Stegmaier, Johannes
2016-01-15
The Insight Toolkit offers plenty of features for multidimensional image analysis. Current implementations, however, often suffer either from a lack of flexibility due to hard-coded C++ pipelines for a certain task or by slow execution times, e.g. caused by inefficient implementations or multiple read/write operations for separate filter execution. We present an XML-based wrapper application for the Insight Toolkit that combines the performance of a pure C++ implementation with an easy-to-use graphical setup of dynamic image analysis pipelines. Created XML pipelines can be interpreted and executed by XPIWIT in console mode either locally or on large clusters. We successfully applied the software tool for the automated analysis of terabyte-scale, time-resolved 3D image data of zebrafish embryos. XPIWIT is implemented in C++ using the Insight Toolkit and the Qt SDK. It has been successfully compiled and tested under Windows and Unix-based systems. Software and documentation are distributed under Apache 2.0 license and are publicly available for download at https://bitbucket.org/jstegmaier/xpiwit/downloads/. johannes.stegmaier@kit.edu Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Systematic review adherence to methodological or reporting quality
DEFF Research Database (Denmark)
Pussegoda, Kusala; Turner, Lucy; Garritty, Chantelle
2017-01-01
/1741) provided a rationale for the review and less than 6% (102/1741) provided protocol information. For reports using QUOROM, only 9% (40/449) of SRs provided a trial flow diagram. However, 90% (402/449) described the explicit clinical problem and review rationale in the introduction section. Of reports using...
Therapeutic alliance in schizophrenia: the role of recovery orientation, self-stigma, and insight.
Kvrgic, Sara; Cavelti, Marialuisa; Beck, Eva-Marina; Rüsch, Nicolas; Vauth, Roland
2013-08-30
The present study examined variables related to the quality of the therapeutic alliance in out-patients with schizophrenia. We expected recovery orientation and insight to be positively, and self-stigma to be negatively associated with a good therapeutic alliance. We expected these associations to be independent from age, clinical symptoms (i.e. positive and negative symptoms, depression), and more general aspects of relationship building like avoidant attachment style and the duration of treatment by the current therapist. The study included 156 participants with DSM-IV diagnoses of schizophrenia or schizoaffective disorder in the maintenance phase of treatment. Therapeutic alliance, recovery orientation, self-stigma, insight, adult attachment style, and depression were assessed by self-report. Symptoms were rated by interviewers. Hierarchical multiple regressions revealed that more recovery orientation, less self-stigma, and more insight independently were associated with a better quality of the therapeutic alliance. Clinical symptoms, adult attachment style, age, and the duration of treatment by current therapist were unrelated to the quality of the therapeutic alliance. Low recovery orientation and increased self-stigma might undermine the therapeutic alliance in schizophrenia beyond the detrimental effect of poor insight. Therefore in clinical settings, besides enhancing insight, recovery orientation, and self-stigma should be addressed. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.
Data smart using data science to transform information into insight
Foreman, John W
2013-01-01
Data Science gets thrown around in the press like it's magic. Major retailers are predicting everything from when their customers are pregnant to when they want a new pair of Chuck Taylors. It's a brave new world where seemingly meaningless data can be transformed into valuable insight to drive smart business decisions. But how does one exactly do data science? Do you have to hire one of these priests of the dark arts, the ""data scientist,"" to extract this gold from your data? Nope. Data science is little more than using straight-forward steps to process raw data into actionable insight.
Pärt, Arvo: Litany. Psalom. Trisagion / Robert Cowan
Cowan, Robert
1996-01-01
Uuest heliplaadist "Pärt, Arvo: Litany. Psalom. Trisagion. Hilliard Ensemble, Estonian Philharmonic Chamber Choir, Tallinn Chamber Orchestra, Tõnu Kaljuste; Lithuanian Chamber Orchestra, Saulius Sondeckis" ECM New Series 449 810-4; 449 810-2 (42 minutes: DDD)
Determining criminal responsibility: How relevant are insight and personal attitudes to mock jurors?
Jung, Sandy
2015-01-01
High levels of insight are interpreted as indications of a treatment compliance and good outcome by clinical professionals. However, it is unclear whether a defendant's insight plays a role in the decision-making of jurors when determining criminal responsibility. It may be the case that personal biases and attitudes toward the mentally ill and the insanity defense are more relevant in such decisions. This study examines the influence of two core dimensions of insight and personal attitudes on juror decision-making. Participants read trial scenarios describing a defendant who is accused of a violent crime and is diagnosed with schizophrenia. Assigning a verdict of not criminally responsible to the defendant was not influenced by insight, but instead, by supportive attitudes of the insanity defense and higher attributions of blame to external factors and to psychological factors. These findings highlight the need for continued investigation in the area of extra-legal factors that guide legal decision-making when defendants have a mental disorder. Copyright © 2015 Elsevier Ltd. All rights reserved.
Creativity and Insight in Problem Solving
Golnabi, Laura
2016-01-01
This paper analyzes the thought process involved in problem solving and its categorization as creative thinking as defined by psychologist R. Weisberg (2006). Additionally, the notion of insight, sometimes present in unconscious creative thinking and often leading to creative ideas, is discussed in the context of geometry problem solving. In…
Directory of Open Access Journals (Sweden)
Kim JH
2015-08-01
Full Text Available Jong-Hoon Kim,1 Seul Lee,1 Ah-Young Han,1 Kyungwook Kim,2 Jinyoung Lee1 1Neuroscience Research Institute, Department of Psychiatry, Gil Medical Center, Gachon University School of Medicine, Gachon University, Incheon, Republic of Korea; 2Department of Medicine, Gachon University School of Medicine, Gachon University, Incheon, Republic of Korea Background: The concept of cognitive insight refers to the cognitive processes involved in patients’ re-evaluation of their anomalous experiences and of their misinterpretations. The purpose of the present study was to examine the relationship between cognitive insight and subjective quality of life in patients with schizophrenia to further shed light on the nature of cognitive insight and its functional correlates in schizophrenia.Methods: Seventy-one stable outpatients with schizophrenia were evaluated for cognitive insight and subjective quality of life using the Beck Cognitive Insight Scale (BCIS and the Schizophrenia Quality of Life Scale Revision 4 (SQLS-R4. The symptoms of schizophrenia were also assessed. Pearson’s correlation analysis and partial correlation analysis that controlled for the severity of symptoms were performed to adjust for the possible effects of symptoms.Results: The self-reflectiveness subscale score of the BCIS had significant positive correlations with the SQLS-R4 psychosocial domain and total SQLS-R4 scores, indicating that the higher the level of cognitive insight, the lower the subjective quality of life. In partial correlation analysis controlling for symptoms, the BCIS self-reflectiveness subscale score still had a significant correlation with the SQLS-R4 psychosocial domain score. The correlation coefficient between the BCIS self-reflectiveness and total SQLS-R4 scores was reduced to a nonsignificant statistical tendency.Conclusion: The results of our study suggest that cognitive insight, particularly the level of self-reflectiveness, is negatively associated with
Chuderski, Adam; Jastrzębski, Jan
2018-02-01
A battery comprising 4 fluid reasoning tests as well as 13 working memory (WM) tasks that involved storage, recall, updating, binding, and executive control, was applied to 318 adults in order to evaluate the true relationship of reasoning ability and WM capacity (WMC) to insight problem solving, measured using 40 verbal, spatial, math, matchstick, and remote associates problems (insight problems). WMC predicted 51.8% of variance in insight problem solving and virtually explained its almost isomorphic link to reasoning ability (84.6% of shared variance). The strong link between WMC and insight pertained generally to most WM tasks and insight problems, was identical for problems solved with and without reported insight, was linear throughout the ability levels, and was not mediated by age, motivation, anxiety, psychoticism, and openness to experience. In contrast to popular views on the sudden and holistic nature of insight, the solving of insight problems results primarily from typical operations carried out by the basic WM mechanisms that are responsible for the maintenance, retrieval, transformation, and control of information in the broad range of intellectual tasks (including fluid reasoning). Little above and beyond WM is unique about insight. (PsycINFO Database Record (c) 2018 APA, all rights reserved).
INSIGHT: an integrated scoping analysis tool for in-core fuel management of PWR
International Nuclear Information System (INIS)
Yamamoto, Akio; Noda, Hidefumi; Ito, Nobuaki; Maruyama, Taiji.
1997-01-01
An integrated software tool for scoping analysis of in-core fuel management, INSIGHT, has been developed to automate the scoping analysis and to improve the fuel cycle cost using advanced optimization techniques. INSIGHT is an interactive software tool executed on UNIX based workstations that is equipped with an X-window system. INSIGHT incorporates the GALLOP loading pattern (LP) optimization module that utilizes hybrid genetic algorithms, the PATMAKER interactive LP design module, the MCA multicycle analysis module, an integrated database, and other utilities. Two benchmark problems were analyzed to confirm the key capabilities of INSIGHT: LP optimization and multicycle analysis. The first was the single cycle LP optimization problem that included various constraints. The second one was the multicycle LP optimization problem that includes the assembly burnup limitation at rod cluster control (RCC) positions. The results for these problems showed the feasibility of INSIGHT for the practical scoping analysis, whose work almost consists of LP generation and multicycle analysis. (author)
Edwards, Christopher L.; Malinowski, Josie E.; McGee, Shauna L.; Bennett, Paul D.; Ruby, Perrine M.; Blagrove, Mark T.
2015-01-01
There have been reports and claims in the psychotherapeutic literature that the consideration of recent dreams can result in personal realizations and insight. There is theoretical support for these claims from work on rapid eye movement (REM) sleep having a function of the consolidation of emotional memories and the creative formation of connections between new and older memories. To investigate these claims, 11 participants (10 females, one male) reported and considered a recent home dream in a dream discussion group that following the “Appreciating dreams” method of Montague Ullman. The group ran 11 times, each participant attending and participating once. A further nine participants (seven females, two males) reported and considered a recent home dream in a group that followed the “Listening to the dreamer” method of Michael Schredl. The two studies each had a control condition where the participant also reported a recent event, the consideration of which followed the same technique as was followed for the dream report. Outcomes of the discussions were assessed by the participants on the Gains from Dream Interpretation (GDI) scale, and on its counterpart, the Gains from Event Interpretation scale. High ratings on the GDI experiential-insight subscale were reported for both methods, when applied to dreams, and for the Ullman method Exploration-Insight ratings for the dream condition were significantly higher than for the control event condition. In the Ullman method, self-assessment of personal insight due to consideration of dream content was also significantly higher than for the event consideration condition. The findings support the view that benefits can be obtained from the consideration of dream content, in terms of identifying the waking life sources of dream content, and because personal insight may also occur. To investigate the mechanisms for the findings, the studies should be repeated with REM and non-REM dream reports, hypothesizing greater
Cavelti, Marialuisa; Kvrgic, Sara; Beck, Eva-Marina; Rüsch, Nicolas; Vauth, Roland
2012-07-01
Paradoxically, insight is associated with positive outcomes, such as better treatment adherence and recovery, and negative outcomes, such as depression, hopelessness, low self-esteem, and quality of life. Self-stigma as a moderating variable can be decisive whether more insight leads to better or worse outcome. On the other hand, self-stigma can act as a mediator between insight and outcomes. We therefore examined self-stigma both as a moderator and a mediator. Insight, self-stigma, demoralization, symptoms, and functioning were assessed among 145 outpatients with schizophrenia spectrum disorders using questionnaires and structured interviews. Structural equation modeling was used to analyze the cross-sectional data. Results confirmed self-stigma as a moderator: The association of insight and demoralization was stronger as self-stigma increased. Self-stigma also partially mediated the positive relationship between insight and demoralization. Moreover, demoralization fully mediated the adverse associations of self-stigma with psychotic symptoms and global functioning. Given the decisive role of self-stigma regarding the detrimental consequences of insight, interventions should address self-stigma, particularly if psychoeducational or other interventions have increased insight. Therapeutic implications for changes of dysfunctional beliefs related to illness and self and change of self-concept in the context of recovery at the level of narrative identity are discussed. Copyright © 2012 Elsevier Inc. All rights reserved.
Roberts, Chris; Stark, Patsy
2008-11-01
Self-reflection, the practice of inspecting and evaluating one's own thoughts, feelings and behaviour, and insight, the ability to understand one's own thoughts, feelings and behaviour, are central to the self-regulation of behaviours. The Self-Reflection and Insight Scale (SRIS) measures three factors in the self-regulation cycle: need for reflection; engagement in reflection, and insight. We used structural equation modelling to undertake a confirmatory factor analysis of the SRIS. We re-specified our model to analyse all of the data to explain relationships between the SRIS, medical student characteristics, and responses to issues of teaching and learning in professionalism. The factorial validity of a modified SRIS showed all items loading significantly on their expected factors, with a good fit to the data. Each subscale had good internal reliability (> 0.8). There was a strong relationship between the need for reflection and engagement in reflection (r = 0.77). Insight was related to need for reflection (0.22) and age (0.21), but not to the process of engaging in reflection (0.06). Validation of the SRIS provides researchers with a new instrument with which to measure and investigate the processes of self-reflection and insight in the context of students' self-regulation of their professionalism. Insight is related to the motive or need for reflection, but the process of reflection does not lead to insight. Attending to feelings is an important and integral aspect of self-reflection and insight. Effective strategies are needed to develop students' insight as they reflect on their professionalism.
Energy, the Environment and Behaviour Change: A survey of insights from behavioural economics
Baddeley, M.
2011-01-01
Evidence of climate change is largely undisputed but moderating the impacts not only of climate change but also of resource depletion is a complex, multi-faceted problem. Technical solutions will have a large role to play but engineering behaviour change within households and firms is essential to harnessing the potential for energy efficient consumption, production and investment. To inform debates about behavior change, this paper explores some insights from behavioural economics including ...
‘Graphic Medicine’ as a Mental Health Information Resource: Insights from Comics Producers
Anthony Farthing; Ernesto Priego
2016-01-01
Recent literature suggests that a growing number of comics are being published on health-related topics, including aspects of mental health and social care (Williams 2012; Czerwiec et al 2015) and that comics are increasingly being used in higher education settings as information resources. This article offers insights from comics creators and disseminators and explores the wider context of comics production and distribution (with a focus on 'Graphic Medicine' or health-related comics) as par...
Exploring Insight: Focus on Shifts of Attention
Palatnik, Alik; Koichu, Boris
2015-01-01
The paper presents and analyses a sequence of events that preceded an insight solution to a challenging problem in the context of numerical sequences. A threeweek long solution process by a pair of ninth-grade students is analysed by means of the theory of shifts of attention. The goal for this article is to reveal the potential of this theory…
Numerical Experiments Providing New Insights into Plasma Focus Fusion Devices
Directory of Open Access Journals (Sweden)
Sing Lee
2010-04-01
Full Text Available Recent extensive and systematic numerical experiments have uncovered new insights into plasma focus fusion devices including the following: (1 a plasma current limitation effect, as device static inductance is reduced towards very small values; (2 scaling laws of neutron yield and soft x-ray yield as functions of storage energies and currents; (3 a global scaling law for neutron yield as a function of storage energy combining experimental and numerical data showing that scaling deterioration has probably been interpreted as neutron ‘saturation’; and (4 a fundamental cause of neutron ‘saturation’. The ground-breaking insights thus gained may completely change the directions of plasma focus fusion research.
2010-09-17
... stage recruitment process consisting of a telephone interview and a physical exam. The Stage One... Request; Recruitment and Screening for the Insight Into Determination of Exceptional Aging and Longevity... approval. Proposed Collection: Title: Recruitment and Screening for the Insight into Determination of...
Differential Modulation of Performance in Insight and Divergent Thinking Tasks with tDCS
Goel, Vinod; Eimontaite, Iveta; Goel, Amit; Schindler, Igor
2015-01-01
While both insight and divergent thinking tasks are used to study creativity, there are reasons to believe that the two may call upon very different mechanisms. To explore this hypothesis, we administered a verbal insight task (riddles) and a divergent thinking task (verbal fluency) to 16 native English speakers and 16 non-native English speakers…
Scientific Visualization: From Data to Insight
Indian Academy of Sciences (India)
Home; Journals; Resonance – Journal of Science Education; Volume 18; Issue 7. Scientific Visualization: From Data to Insight. Vijay Natarajan. General Article Volume 18 Issue 7 July 2013 pp 615-629. Fulltext. Click here to view fulltext PDF. Permanent link: https://www.ias.ac.in/article/fulltext/reso/018/07/0615-0629 ...
Insights on some chiral smectic phases
Indian Academy of Sciences (India)
journal of. August 2003 physics pp. 285–295. Insights on some chiral ... Liquid crystals; smectics; chirality; frustrated phases; twist grain boundary phases. ... molecules are more or less packed in layers and smectic phases can be seen ..... (imaging plate or CCD camera) which was located at about 300 mm from the sample.
Biblical Leadership: Insights for Today's Managers
Friedman, Hershey H.; Friedman, Linda
2004-01-01
The scholarly literature in management has paid little attention to the study of Biblical figures as leaders. This paper aims to advance the effort to fill this gap by demonstrating that many insights about successful and unsuccessful leadership may be derived from the Bible. Successful leaders demonstrated a willingness to be different, a passion for justice, humility, and a concern for others. Unsuccessful leaders were sidetracked from their mission by the hunger for power or by lust and envy.
Constant, Sandra|info:eu-repo/dai/nl/374650519; Wienk, Hans L J|info:eu-repo/dai/nl/203884884; Frissen, Augustinus E.; Peinder, Peter De|info:eu-repo/dai/nl/325810818; Boelens, Rolf|info:eu-repo/dai/nl/070151407; Van Es, Daan S.; Grisel, Ruud J H; Weckhuysen, Bert M.|info:eu-repo/dai/nl/285484397; Huijgen, Wouter J J; Gosselink, Richard J A; Bruijnincx, Pieter C A|info:eu-repo/dai/nl/33799529X
2016-01-01
Detailed insight into the structure and composition of industrial (technical) lignins is needed to devise efficient thermal, bio- or chemocatalytic valorisation strategies. Six such technical lignins covering three main industrial pulping methods (Indulin AT Kraft, Protobind 1000 soda lignin and
Constant, Sandra; Wienk, Hans L.J.; Frissen, A.E.; Peinder, de Peter; Boelens, Rolf; Es, van D.S.; Grisel, Ruud J.H.; Weckhuysen, Bert M.; Huijgen, W.J.J.; Gosselink, R.J.A.; Bruijnincx, Pieter C.A.
2016-01-01
Detailed insight into the structure and composition of industrial (technical) lignins is needed to devise efficient thermal, bio- or chemocatalytic valorisation strategies. Six such technical lignins covering three main industrial pulping methods (Indulin AT Kraft, Protobind 1000 soda lignin and
Analyzing Social Media Networks with NodeXL Insights from a Connected World
Hansen, Derek; Smith, Marc A
2010-01-01
Businesses, entrepreneurs, individuals, and government agencies alike are looking to social network analysis (SNA) tools for insight into trends, connections, and fluctuations in social media. Microsoft's NodeXL is a free, open-source SNA plug-in for use with Excel. It provides instant graphical representation of relationships of complex networked data. But it goes further than other SNA tools -- NodeXL was developed by a multidisciplinary team of experts that bring together information studies, computer science, sociology, human-computer interaction, and over 20 years of visual analytic theor
DMPD: New insights into the regulation of TLR signaling. [Dynamic Macrophage Pathway CSML Database
Lifescience Database Archive (English)
Full Text Available 16698941 New insights into the regulation of TLR signaling. Miggin SM, O'Neill LA. ...J Leukoc Biol. 2006 Aug;80(2):220-6. Epub 2006 May 12. (.png) (.svg) (.html) (.csml) Show New insights into ...the regulation of TLR signaling. PubmedID 16698941 Title New insights into the regulation of TLR signaling.
P.J. Quee (P.); L. van der Meer (Lisette); L. Krabbendam (Lydia); L. de Haan (Lieuwe); W. Cahn (Wiepke); D. Wiersma (Durk); N.J.M. van Beveren (Nico); G.H.M. Pijnenborg (G. H M); C.L. Mulder (Niels); R. Bruggeman (Richard); A. Aleman (André)
2014-01-01
textabstractObjective: Impaired insight is an important and prevalent symptom of psychosis. It remains unclear whether cognitive disturbances hamper improvements in insight. We investigated the neurocognitive, social cognitive, and clinical correlates of changes in insight. Method: One hundred and
Insight-HXMT observations of the first binary neutron star merger GW170817
Li, TiPei; Xiong, ShaoLin; Zhang, ShuangNan; Lu, FangJun; Song, LiMing; Cao, XueLei; Chang, Zhi; Chen, Gang; Chen, Li; Chen, TianXiang; Chen, Yong; Chen, YiBao; Chen, YuPeng; Cui, Wei; Cui, WeiWei; Deng, JingKang; Dong, YongWei; Du, YuanYuan; Fu, MinXue; Gao, GuanHua; Gao, He; Gao, Min; Ge, MingYu; Gu, YuDong; Guan, Ju; Guo, ChengCheng; Han, DaWei; Hu, Wei; Huang, Yue; Huo, Jia; Jia, ShuMei; Jiang, LuHua; Jiang, WeiChun; Jin, Jing; Jin, YongJie; Li, Bing; Li, ChengKui; Li, Gang; Li, MaoShun; Li, Wei; Li, Xian; Li, XiaoBo; Li, XuFang; Li, YanGuo; Li, ZiJian; Li, ZhengWei; Liang, XiaoHua; Liao, JinYuan; Liu, CongZhan; Liu, GuoQing; Liu, HongWei; Liu, ShaoZhen; Liu, XiaoJing; Liu, Yuan; Liu, YiNong; Lu, Bo; Lu, XueFeng; Luo, Tao; Ma, Xiang; Meng, Bin; Nang, Yi; Nie, JianYin; Ou, Ge; Qu, JinLu; Sai, Na; Sun, Liang; Tan, Yin; Tao, Lian; Tao, WenHui; Tuo, YouLi; Wang, GuoFeng; Wang, HuanYu; Wang, Juan; Wang, WenShuai; Wang, YuSa; Wen, XiangYang; Wu, BoBing; Wu, Mei; Xiao, GuangCheng; Xu, He; Xu, YuPeng; Yan, LinLi; Yang, JiaWei; Yang, Sheng; Yang, YanJi; Zhang, AiMei; Zhang, ChunLei; Zhang, ChengMo; Zhang, Fan; Zhang, HongMei; Zhang, Juan; Zhang, Qiang; Zhang, Shu; Zhang, Tong; Zhang, Wei; Zhang, WanChang; Zhang, WenZhao; Zhang, Yi; Zhang, Yue; Zhang, YiFei; Zhang, YongJie; Zhang, Zhao; Zhang, ZiLiang; Zhao, HaiSheng; Zhao, JianLing; Zhao, XiaoFan; Zheng, ShiJie; Zhu, Yue; Zhu, YuXuan; Zou, ChangLin
2018-03-01
Finding the electromagnetic (EM) counterpart of binary compact star merger, especially the binary neutron star (BNS) merger, is critically important for gravitational wave (GW) astronomy, cosmology and fundamental physics. On Aug. 17, 2017, Advanced LIGO and Fermi/GBM independently triggered the first BNS merger, GW170817, and its high energy EM counterpart, GRB 170817A, respectively, resulting in a global observation campaign covering gamma-ray, X-ray, UV, optical, IR, radio as well as neutrinos. The High Energy X-ray telescope (HE) onboard Insight-HXMT (Hard X-ray Modulation Telescope) is the unique high-energy gamma-ray telescope that monitored the entire GW localization area and especially the optical counterpart (SSS17a/AT2017gfo) with very large collection area ( 1000 cm2) and microsecond time resolution in 0.2-5 MeV. In addition, Insight-HXMT quickly implemented a Target of Opportunity (ToO) observation to scan the GW localization area for potential X-ray emission from the GW source. Although Insight-HXMT did not detect any significant high energy (0.2-5 MeV) radiation from GW170817, its observation helped to confirm the unexpected weak and soft nature of GRB 170817A. Meanwhile, Insight-HXMT/HE provides one of the most stringent constraints ( 10‒7 to 10‒6 erg/cm2/s) for both GRB170817A and any other possible precursor or extended emissions in 0.2-5 MeV, which help us to better understand the properties of EM radiation from this BNS merger. Therefore the observation of Insight-HXMT constitutes an important chapter in the full context of multi-wavelength and multi-messenger observation of this historical GW event.
Quee, P. J.; van der Meer, L.; Krabbendam, L.; de Haan, L.; Cahn, W.; Wiersma, D.; van Beveren, N.; Pijnenborg, G. H. M.; Mulder, C. L.; Bruggeman, R.; Aleman, A.
Objective: Impaired insight is an important and prevalent symptom of psychosis. It remains unclear whether cognitive disturbances hamper improvements in insight. We investigated the neurocognitive, social cognitive, and clinical correlates of changes in insight. Method: One hundred and fifty-four
Insights into Modern Human Prehistory Using Ancient Genomes.
Yang, Melinda A; Fu, Qiaomei
2018-03-01
The genetic relationship of past modern humans to today's populations and each other was largely unknown until recently, when advances in ancient DNA sequencing allowed for unprecedented analysis of the genomes of these early people. These ancient genomes reveal new insights into human prehistory not always observed studying present-day populations, including greater details on the genetic diversity, population structure, and gene flow that characterized past human populations, particularly in early Eurasia, as well as increased insight on the relationship between archaic and modern humans. Here, we review genetic studies on ∼45000- to 7500-year-old individuals associated with mainly preagricultural cultures found in Eurasia, the Americas, and Africa. Copyright © 2017 Elsevier Ltd. All rights reserved.
Welten, Carlijn C M; Koeter, Maarten W J; Wohlfarth, Tamar D; Storosum, Jitschak G; van den Brink, Wim; Gispen-de Wied, Christine C; Leufkens, Hubert G M; Denys, Damiaan A J P
2016-02-01
Patients having an acute manic episode of bipolar disorder often lack insight into their condition. Because little is known about the possible effect of insight on treatment efficacy, we examined whether insight at the start of treatment affects the efficacy of antipsychotic treatment in patients with acute mania. We used individual patient data from 7 randomized, double-blind, placebo-controlled registration studies of 4 antipsychotics in patients with acute mania (N = 1904). Insight was measured with item 11 of the Young Mania Rating Scale (YMRS) at baseline and study endpoint 3 weeks later. Treatment outcome was defined by (a) mean change score, (b) response defined as 50% or more improvement on YMRS, and (c) remission defined as YMRS score less than 8 at study endpoint. We used multilevel mixed effect linear (or logistic) regression analyses of individual patient data to assess the interaction between baseline insight and treatment outcomes. At treatment initiation, 1207 (63.5%) patients had impaired or no insight into their condition. Level of insight significantly modified the efficacy of treatment by mean change score (P = 0.039), response rate (P = 0.033), and remission rate (P = 0.043), with greater improvement in patients with more impaired insight. We therefore recommend that patients experiencing acute mania should be treated immediately and not be delayed until patients regain insight.
Hedne, Mikael R.; Norman, Elisabeth; Metcalfe, Janet
2016-01-01
The focus of the current study is on intuitive feelings of insight during problem solving and the extent to which such feelings are predictive of successful problem solving. We report the results from an experiment (N = 51) that applied a procedure where the to-be-solved problems were 32 short (15 s) video recordings of magic tricks. The procedure included metacognitive ratings similar to the “warmth ratings” previously used by Metcalfe and colleagues, as well as confidence ratings. At regular intervals during problem solving, participants indicated the perceived closeness to the correct solution. Participants also indicated directly whether each problem was solved by insight or not. Problems that people claimed were solved by insight were characterized by higher accuracy and higher confidence than noninsight solutions. There was no difference between the two types of solution in warmth ratings, however. Confidence ratings were more strongly associated with solution accuracy for noninsight than insight trials. Moreover, for insight trials the participants were more likely to repeat their incorrect solutions on a subsequent recognition test. The results have implications for understanding people's metacognitive awareness of the cognitive processes involved in problem solving. They also have general implications for our understanding of how intuition and insight are related. PMID:27630598
Insightfulness and later infant attachment in clinically depressed and nonclinical mothers.
Ramsauer, Brigitte; Lotzin, Annett; Quitmann, Julia H; Becker-Stoll, Fabienne; Tharner, Anne; Romer, Georg
2014-01-01
The aim of this pilot study was to investigate the relationship between maternal insightfulness and sensitivity and subsequent infant attachment security and disorganization in clinically depressed and nonclinical mother-infant groups. Nineteen depressed mothers with infants ages 3 to 11 months participated in this study. Twenty nonclinical mother-infant dyads were matched to the clinical sample according to infant sex and age. Maternal depression was assessed using the Diagnostic and Statistical Manual of Mental Disorders, fourth edition (American Psychiatric Association, 1994), insightfulness using the Insightfulness Assessment (IA), and sensitivity using the Maternal Sensitivity Scales (M.D.S. Ainsworth, 1969). IA classifications and subscales were considered separately. Later infant attachment was assessed by the Strange Situation Procedure (M.D.S. Ainsworth, M.C. Blehar, E. Waters, & S. Wall, 1978). Depressed mothers tended to have less securely attached children than did nonclinical mothers. Within the clinical sample, the insightfulness categories correlated slightly moderately with attachment security, but were not related to attachment disorganization. Within the nonclinical sample, the IA categories were slightly moderately associated with attachment security and with disorganization. On IA subscales, relationship patterns differed in clinically depressed and nonclinical mother-infant dyads. These findings provide the first evidence of the predictive power of the IA categorization and subscales on subsequent infant attachment. They also may allow the development of different foci of intervention for enhancing insightful caregiving. © 2014 Michigan Association for Infant Mental Health.
Competency to stand trial and defendants who lack insight into their mental illness.
Reisner, Andrew D; Piel, Jennifer; Makey, Miller
2013-01-01
Forensic evaluators often assess patients who lack insight into their mental illnesses. This lack of insight can have a significant impact on the defendant's ability to make legal strategy decisions that rely on their acceptance of their mental illness. In this article, the relationship between refusing an insanity plea and competency to stand trial will be explored in the context of defendants who lack insight into their mental illness. The authors argue that an adequate competency assessment should take into account the defendant's ability to consider his available pleas rationally. Such evaluations may have the effect of negating the necessity of a Frendak inquiry in those jurisdictions that can impose the insanity defense on defendants.
Consumer Insight as Competitive Advantage Using Big Data and Analytics
Directory of Open Access Journals (Sweden)
Adnan Veysel Ertemel
2015-12-01
Full Text Available Digital revolution serves as a competitive advantage to businesses that are able to analyze consumer behavior in order to gain insights for their strategic advantage. After the advent of Internet, the past two decades witnessed generation of vast amount of business data. The amount of data is so huge that traditional database management system approaches falls short of managing and analyzing this data. This paper explores the characteristics of this phenomenon called Big Data together with Analytics as a tool for marketers to gain insights about consumer behavior and hence provide competitive advantage to the businesses. It also discusses some best practices as case studies.
Genomic Insights into Growth and Its Disorders: An Update
de Bruin, Christiaan; Dauber, Andrew
2016-01-01
Purpose of review To provide an update of the most striking new developments in the field of growth genetics over the past 12 months Recent findings A number of large genome-wide association studies have identified new genetic loci and pathways associated to human growth and adult height as well as related traits and comorbidities. New genetic etiologies of primordial dwarfism and several short stature syndromes have been elucidated. Moreover, a breakthrough finding of Xq26 microduplications as a cause of pituitary gigantism was made. Several new developments in imprinted growth-related genes (including the first human mutation in IGF-II) and novel insights into the epigenetic regulation of growth have been reported. Summary Genomic investigations continue to provide new insights into the genetic basis of human growth as well as its disorders. PMID:26702851
Molecular Electronics: Insight from First-Principles Transport Simulations
DEFF Research Database (Denmark)
Paulsson, Magnus; Frederiksen, Thomas; Brandbyge, Mads
2010-01-01
Conduction properties of nanoscale contacts can be studied using first-principles simulations. Such calculations give insight into details behind the conductance that is not readily available in experiments. For example, we may learn how the bonding conditions of a molecule to the electrodes affect...
Macgregor, Alexandra; Norton, Joanna; Bortolon, Catherine; Robichon, Melissa; Rolland, Camille; Boulenger, Jean-Philippe; Raffard, Stéphane; Capdevielle, Delphine
2015-08-30
Poor insight is found in up to 80% of schizophrenia patients and has been associated with multiple factors of which cognitive functioning, social and environmental factors. Few studies have explored associations between patient insight and that of their biological parents', and the influence of parental factors. Insight was assessed in 41 patients and their biological parents with Amador's Scale for the assessment of Unawareness of Mental Disorder (SUMD). Parents' knowledge about schizophrenia and critical attitudes were assessed with validated self-report questionnaires. Both groups underwent cognitive assessments for working memory and executive functioning. Insight in patients and their parents was not associated for any of the SUMD dimensions but a significant correlation was found between patient and parent awareness of treatment effect for patient-parent dyads with frequent daily contact. Low parental critical attitude was associated with higher patient awareness of symptoms and a high parental memory task score with high patient insight. Our study is the first to suggest a possible influence of parental factors such as critical attitudes and cognitive performance on patient insight. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Krishanu D. Baksi
2018-01-01
Full Text Available Realization of the importance of microbiome studies, coupled with the decreasing sequencing cost, has led to the exponential growth of microbiome data. A number of these microbiome studies have focused on understanding changes in the microbial community over time. Such longitudinal microbiome studies have the potential to offer unique insights pertaining to the microbial social networks as well as their responses to perturbations. In this communication, we introduce a web based framework called ‘TIME’ (Temporal Insights into Microbial Ecology’, developed specifically to obtain meaningful insights from microbiome time series data. The TIME web-server is designed to accept a wide range of popular formats as input with options to preprocess and filter the data. Multiple samples, defined by a series of longitudinal time points along with their metadata information, can be compared in order to interactively visualize the temporal variations. In addition to standard microbiome data analytics, the web server implements popular time series analysis methods like Dynamic time warping, Granger causality and Dickey Fuller test to generate interactive layouts for facilitating easy biological inferences. Apart from this, a new metric for comparing metagenomic time series data has been introduced to effectively visualize the similarities/differences in the trends of the resident microbial groups. Augmenting the visualizations with the stationarity information pertaining to the microbial groups is utilized to predict the microbial competition as well as community structure. Additionally, the ‘causality graph analysis’ module incorporated in TIME allows predicting taxa that might have a higher influence on community structure in different conditions. TIME also allows users to easily identify potential taxonomic markers from a longitudinal microbiome analysis. We illustrate the utility of the web-server features on a few published time series microbiome
Psychological insights in Shakespeare's final play, The Two Noble Kinsmen.
Mahon, E J
2001-01-01
Shakespeare's final play, The Two Noble Kinsmen, contains profound psychological insights. Like all of Shakespeare's reworkings of old material, the result is not merely a variation on a theme but a psychological statement in and of itself, which respects and revisits the past even as it presents a new and original statement. In this paper I argue that the transformation of the Chaucerian into the Shakespearean has a premonition of the Freudian in it also: Shakespeare not only delivers insights on development and sexuality, he anticipates an important Freudian concept in his introduction of the theme of the jailer's daughter whose "love-sickness" requires on understanding of transference before sense can be made of it!
Making Sustainable Energy Choices: Insights on the Energy/Water/Land Nexus
Energy Technology Data Exchange (ETDEWEB)
2014-10-01
This periodic publication summarizes insights from the body of NREL analysis work. In this issue of Analysis Insights, we examine the implications of our energy choices on water, land use, climate, developmental goals, and other factors. Collectively, NREL's work helps policymakers and investors understand and evaluate energy choices within the complex web of connections, or nexus, between energy, water, and land.
Thaksinomics: A New Asian Paradigm; Strategic Insights: v.2, issue 12 (December 2003)
Looney, Robert
2003-01-01
This article appeared in Strategic Insights (December 2003), v.2 no.12 Prior to the Asian Economic Crisis sparked by the collapse of the Thai baht in 1997, Southeast Asia looked like a sure bet for a long period of high sustained economic growth. As a region, Southeast Asia's economies are the most open to international trade. While such openness spurred their growth for several decades, in the post 1997 period it has left them increasingly vulnerable to adverse economic and political sh...
Nendaz, Mathieu R; Gut, Anne M; Louis-Simonet, Martine; Perrier, Arnaud; Vu, Nu V
2011-04-01
Facets of reasoning competence influenced by an explicit insight into cognitive psychology features during clinical reasoning seminars have not been specifically explored. This prospective, controlled study, conducted at the University of Geneva Faculty of Medicine, Switzerland, assessed the impact on sixth-year medical students' patient work-up of case-based reasoning seminars, bringing them explicit insight into cognitive aspects of their reasoning. Volunteer students registered for our three-month Internal Medicine elective were assigned to one of two training conditions: standard (control) or modified (intervention) case-based reasoning seminars. These seminars start with the patient's presenting complaint and the students must ask the tutor for additional clinical information to progress through case resolution. For this intervention, the tutors made each step explicit to students and encouraged self-reflection on their reasoning processes. At the end of their elective, students' performances were assessed through encounters with two standardized patients and chart write-ups. Twenty-nine students participated, providing a total of 58 encounters. The overall differences in accuracy of the final diagnosis given to the patient at the end of the encounter (control 63% vs intervention 74%, p = 0.53) and of the final diagnosis mentioned in the patient chart (61% vs 70%, p = 0.58) were not statistically significant. The students in the intervention group significantly more often listed the correct diagnosis among the differential diagnoses in their charts (75% vs 97%, p = 0.02). This case-based clinical reasoning seminar intervention, designed to bring students insight into cognitive features of their reasoning, improved aspects of diagnostic competence.
Neuman, Donald R.
This study compared the effects of professional and subprofessional counselors using group insight and group desensitization techniques with high and low imagery arousal test anxious college students. Two professional and two subprofessional counselors met with groups of three students for five interviews to administer insight and desensitization…
Enter the Matrix: Building Creative Industry through Delivering Insights in Comics
Directory of Open Access Journals (Sweden)
Hafiz Ahmad Aziz
2014-10-01
Full Text Available Comic is a media which delivers its content through visual sequence. This media has negative preference in Indonesia’s community because viewed as mild entertainment for children. Yet in modern society, comics observed and researched as one of media which could penetrate deep within its reader’s mind. In re-create cultural insight through comic, the content must encrypt into visual and sequential mode which form a matrix of insight. This matrix will encompasses the effective transformation of cultural content in comic and also other visual media through media linkage strategy. The media linkage strategy is to surround the children’s access of information and visual entertainment in order to build certain knowledge and understanding. It’s a system that crystallized from global marketing practices of visual media industry over decades. This paper urges to highlight the visual communication design study in creating a matrix of cultural insight in translating cultures of Archipelago and media linkage strategy in order to strengthen cultural understanding among children.
Ogawa, Takeshi; Aihara, Takatsugu; Shimokawa, Takeaki; Yamashita, Okito
2018-04-24
Creative insight occurs with an "Aha!" experience when solving a difficult problem. Here, we investigated large-scale networks associated with insight problem solving. We recruited 232 healthy participants aged 21-69 years old. Participants completed a magnetic resonance imaging study (MRI; structural imaging and a 10 min resting-state functional MRI) and an insight test battery (ITB) consisting of written questionnaires (matchstick arithmetic task, remote associates test, and insight problem solving task). To identify the resting-state functional connectivity (RSFC) associated with individual creative insight, we conducted an exploratory voxel-based morphometry (VBM)-constrained RSFC analysis. We identified positive correlations between ITB score and grey matter volume (GMV) in the right insula and middle cingulate cortex/precuneus, and a negative correlation between ITB score and GMV in the left cerebellum crus 1 and right supplementary motor area. We applied seed-based RSFC analysis to whole brain voxels using the seeds obtained from the VBM and identified insight-positive/negative connections, i.e. a positive/negative correlation between the ITB score and individual RSFCs between two brain regions. Insight-specific connections included motor-related regions whereas creative-common connections included a default mode network. Our results indicate that creative insight requires a coupling of multiple networks, such as the default mode, semantic and cerebral-cerebellum networks.
Directory of Open Access Journals (Sweden)
O. I. Osokina
2018-06-01
Full Text Available Relevance. Phenomenon of patients' unawareness of their illness (insight is a pathognomonic diagnostic criterion that distinguishes schizophrenia from many other psychiatric disorders. More than half of patients with schizophrenia do not realize their illness that makes their treatment more difficult. Diagnosis of insight in patients with schizophrenia is an important issue. The volume and content of rehabilitation programs depends on it. The purpose of research is to study the structure of insight in patients with schizophrenia, its relationship with certain clinical, social and psychological indicators, and to assess the influence of insight-oriented psychotherapy on the outcomes of schizophrenia. Material and methods. 237 patients with schizophrenia were studied: 139 (58.6 % men and 98 (41.4 % women aged 18-35 years. Patients of the main group (122 people received pharmacotherapy and were included in the program of insight-oriented psychotherapy. Patients of the comparison group (115 people received standard treatment. Measurement of the insight level was carried out using the scale of unawareness of mental disorder (SUMD. To study social indicators the scale of social functioning in various spheres was used (Zaitsev, 1999. The quality of life level and social stigma were measured by WHOQOL-BREF and adapted version of the self-stigmatization scale (SSMIS. Evaluation of outcomes in schizophrenia was carried out using the IMR and RMQ scales. The level of cognitive functioning was assessed by the GACF-CogFu scale. The severity of depression was measured by the scale developed by Beck (BDI. The mechanisms of psychological defense were assessed using the scale of R. Plutchik, H. Kellerman (1979. Mathematical processing of the results was also carried out. Results. Correlations were found between a higher level of patient awareness of the disease and its better prognosis (r= -0.507; p<0.05, a higher level of social functioning (r= 0.478; p<0
DEFF Research Database (Denmark)
Borsotti, Valeria
2018-01-01
This paper contributes to the growing literature on the gender gap in computer science education by focusing on an exploratory case study conducted at the IT University of Copenhagen (ITU), Denmark. The specific objective of this study was to draw on existing research in order to empirically...... investigate the main sociocultural barriers to female participation in the bachelor of Software Development at ITU, and to generate insights that would inform concrete and effective interventions. This investigation takes the form of an exploratory case study, providing insights into influential factors...... such as students’ perceptions, attitudes and behavior towards software development education and gender differences in pre-university coding skills. Empirical evidence has been collected through semi-structured interviews with 38 students (undergraduate and high school) and surveys with 395 students (undergraduate...
Self-evaluation in schizophrenia: an fMRI study with implications for the understanding of insight
Directory of Open Access Journals (Sweden)
Bedford Nicholas J
2012-08-01
Full Text Available Abstract Background Lack of insight is a core feature of schizophrenia and is associated with structural brain abnormalities. The functional neuroanatomy of insight has only recently been investigated. When people evaluate their personality traits compared to those of another, activation is seen in central midline structures (CMS of the brain. This study set out to compare cerebral activation in schizophrenia patients versus controls during a self-evaluation task which included positive and negative traits as well as mental and physical illness terms. Methods Eleven schizophrenia patients and 8 healthy controls, matched for age were studied. Insight was assessed using the Schedule for the Assessment of Insight-expanded version (SAI-E. FMRI data were obtained with a 1.5 Tesla GE system and interactions between participant group, self versus other, significant at the cluster level, were recorded. Results Significant hypoactivation in the medial superior frontal gyrus (dorsomedial prefrontal cortex was observed in patients vs. controls during self-evaluation of all traits combined. A second cluster of hypoactivation in the posterior cingulate was also detected. When the response to individual traits was explored, underactivation in other frontal regions plus right inferior parietal lobule emerged and this tended to correlate, albeit weakly with lower insight scores. Further, there were areas of hyperactivation relative to controls in anterior cingulate, frontal and parietal regions (especially precuneus which showed moderate inverse correlations with insight scores. Conclusions We have demonstrated that the CMS, identified as a key system underpinning self-evaluation, is dysfunctional in patients with schizophrenia, particularly dorso-medial PFC. This may have implications for lack of insight in schizophrenia. Hypofunction within the dorsomedial prefrontal region seems to be particularly important although other posterior and lateral cortical
Insights on the poster preparation and presentation process.
Moore, L W; Augspurger, P; King, M O; Proffitt, C
2001-05-01
Dissemination of research findings and effective clinical innovations is key to the growth and development of the nursing profession. Several avenues exist for the dissemination of information. One forum for communication that has gained increased recognition over the past decade is the poster presentation. Poster presentations are often a significant part of regional, national, and international nursing conferences. Although posters are frequently used to disseminate information to the nursing community, little is reported about actual poster presenters' experiences with preparation and presentation of their posters. The purpose of this article is to present insights derived from information shared by poster presenters regarding the poster preparation and presentation process. Such insights derived from the personal experiences of poster presenters may assist others to efficiently and effectively prepare and present scholarly posters that disseminate information to the nursing community. Copyright 2001 by W.B. Saunders Company
de Assis da Silva, Rafael; Mograbi, Daniel C; Camelo, Evelyn Vieira Miranda; Peixoto, Ursula; Santana, Cristina Maria Teixeira; Landeira-Fernandez, Jesus; Morris, Robin G; Cheniaux, Elie
2017-11-01
Although many studies have explored the effect of current affective episodes on insight into bipolar disorder, the potential interaction between current mood state and previous affective episodes has not been consistently investigated. To explore the influence of dominant polarity, number of previous affective episodes and current affective state on insight in bipolar disorder patients in euthymia or mania. A total of 101 patients with bipolar disorder were recruited for the study, including 58 patients in euthymia (30 with no defined predominant polarity and 28 with manic predominant polarity) and 43 in mania (26 with no defined predominant polarity and 17 with manic predominant polarity). Patients underwent a clinical assessment and insight was evaluated through the Insight Scale for Affective Disorders. Bipolar disorder patients in mania had worse insight than those in euthymia, with no effect of dominant polarity. In addition, positive psychotic symptoms showed a significant effect on insight and its inclusion as a covariate eliminated differences related to mood state. Finally, the number of previous manic or depressive episodes did not correlate with insight level. Mania is a predictor of loss of insight into bipolar disorder. However, it is possible that its contribution is linked to the more frequent presence of psychotic symptoms in this state. Dominant polarity and number/type of previous affective episodes have a limited impact on insight.
Paris after Trump: An Inconvenient Insight
Böhringer, Christoph; Rutherford, Thomas F.
2017-01-01
With his announcement to pull the US out of the Paris Agreement US President Donald Trump has snubbed the international climate policy community. Key remaining parties to the Agreement such as Europe and China might call for carbon tariffs on US imports as a sanctioning instrument to coerce US compliance. Our analysis, however, reveals an inconvenient insight for advocates of carbon tariffs: given the possibility of retaliatory tariffs across all imported goods, carbon tariffs do not constitu...
A Representation for Gaining Insight into Clinical Decision Models
Jimison, Holly B.
1988-01-01
For many medical domains uncertainty and patient preferences are important components of decision making. Decision theory is useful as a representation for such medical models in computer decision aids, but the methodology has typically had poor performance in the areas of explanation and user interface. The additional representation of probabilities and utilities as random variables serves to provide a framework for graphical and text insight into complicated decision models. The approach allows for efficient customization of a generic model that describes the general patient population of interest to a patient- specific model. Monte Carlo simulation is used to calculate the expected value of information and sensitivity for each model variable, thus providing a metric for deciding what to emphasize in the graphics and text summary. The computer-generated explanation includes variables that are sensitive with respect to the decision or that deviate significantly from what is typically observed. These techniques serve to keep the assessment and explanation of the patient's decision model concise, allowing the user to focus on the most important aspects for that patient.
Hip fracture discrimination by the Achilles Insight QUS imaging device
International Nuclear Information System (INIS)
Damilakis, John; Papadokostakis, George; Perisinakis, Kostas; Maris, Thomas G.; Karantanas, Apostolos H.
2007-01-01
The importance of osteoporosis as a major health problem is well recognized. Its major clinical manifestation is low energy fractures. Considerable effort has been directed towards search of noninvasive methods for assessing osteoporotic fracture risk. The aim of this study was to evaluate the ability of quantitative ultrasound (QUS) variables measured by a new heel QUS imaging device to discriminate between postmenopausal women with and without hip fracture. The subjects included 30 postmenopausal female patients with hip fracture and 30 age-matched healthy women. Measurements were acquired using the Achilles Insight QUS imaging device. Bone mineral density (BMD) measurements were carried out using the Lunar Prodigy DXA scanner. Achilles Insight provides images of the heel bone and measures broadband ultrasound attenuation (BUA) and speed of sound (SOS) values in a circular region of interest. A third QUS variable, the stiffness index (SI) was also determined. The short-term precision for healthy subjects was 2.05%, 0.17% and 1.91% for BUA, SOS and SI, respectively. Corresponding values for patients with fractures were 1.80%, 0.16% and 2.04%. All QUS variables measured using the Achilles Insight were significant discriminators of hip fractures (area under ROC curve = 0.77, 0.74 and 0.77 for BUA, SOS and SI, respectively). BMD measurements of the hip had the greatest discriminatory ability (area under ROC curve = 0.88). Statistically significant differences were found between the area under the ROC curve of BMD and the corresponding curves of the QUS variables (P < 0.05 for each of the three comparisons). QUS variables measured by Achilles Insight can be expected to be useful as indicators of the risk of hip fracture in postmenopausal women
A New Furunculosis Challenge Method for Evaluation of Vaccine Efficacy in Rainbow Trout
DEFF Research Database (Denmark)
Marana, Moonika Haahr; Chettri, Jiwan Kumar; Skov, Jakob
2016-01-01
Experimental infection of fish for vaccine efficacy studies is associated with several limitations. Administration of live bacteria with the purpose of causing disease in fish can be performed by co-habitation, immersion or injection. We have developed a new Aeromonas salmonicida challenge method...... for rainbow trout and have applied it for evaluation of furunculosis vaccine efficacy. The method reveals development of systemic immunity in fish as live bacteria are introduced in the tail fin epidermis distant from the vaccine injection site (peritoneal cavity). This method seeks to mimic natural infection...... in fish farms where tail biting and therefore bacterial expo- sure to tail fin ulcers is widespread. By use of a multi-needle device ten epidermal perforations were introduced in the dorsal part of the tail fin of anaesthetized rainbow trout (vaccinated or naive). Subsequently 100 μL (3.4 × 108 colony-forming...
Outsourcing/Offshoring Insights
DEFF Research Database (Denmark)
Tate, Wendy; Bals, Lydia
2017-01-01
Findings: Both the geographical and governance dimensions are part of the rightshoring decision which is an important conceptual foundation for this special issue, as it invited insightful pieces on all of these phenomena (e.g. outsourcing, insourcing, offshoring, reshoring), acknowledging...... for future research out of the six papers are summarized in Table III. There is ample opportunity to further shed light on these suggestions as well as to cover parts of the “rightshoring” framework presented, that remain less covered here (e.g. insourcing and/or reshoring). Practical implications: The array...... of potential “rightshoring” options fosters clarity about the phenomena studied and their implications. The main practical implications of the six papers are summarized in Table II. Originality/value: The overall conceptual framework highlights the positioning of the final papers included into the special...
Perioperative leadership: managing change with insights, priorities, and tools.
Taylor, David L
2014-07-01
The personal leadership of the perioperative director is a critical factor in the success of any change management initiative. This article presents an approach to perioperative nursing leadership that addresses obstacles that prevent surgical departments from achieving high performance in clinical and financial outcomes. This leadership approach consists of specific insights, priorities, and tools: key insights include self-understanding of personal barriers to leadership and accuracy at understanding economic and strategic considerations related to the OR environment; key priorities include creating a customer-centered organization, focusing on process improvement, and concentrating on culture change; and key tools include using techniques (e.g., direct engagement, collaborative leadership) to align surgical organizations with leadership priorities and mitigate specific perioperative management risks. Included in this article is a leadership development plan for perioperative directors. Copyright © 2014 AORN, Inc. Published by Elsevier Inc. All rights reserved.
van der Werf - Eldering, Marieke; van der Meer, Lisette; Burger, Huibert; Holthausen, Esther; Nolen, W.A.; Aleman, Andre
Objective: To investigate the multifactorial relationship between illness insight, cognitive and emotional processes, and illness characteristics in bipolar disorder patients. Methods: Data from 85 euthymic or mildly to moderately depressed bipolar disorder patients were evaluated. Insight was
Perspective on US NRC Policy Issues Concerning Use of Risk Insights for Non-LWR
International Nuclear Information System (INIS)
Ha, Jun Su; Kim, In Goo; Huh, Chang Wook; Kim, Kyun Tae
2011-01-01
Since the PRA Implementation plan of US NRC (1994), PRA has been applied to all NPPs in USA and risk insights have been used for the regulation as a complement of the deterministic approaches. RIRIP (Risk-Informed Regulation Implementation Plan, 2000) and RPP (Risk-Informed and Performance-Based Plan, 2007) were announced by US NRC thereafter, which recommended enhanced use of risk insights. In the meantime, there have been lots of policy issues concerning use of risk insights for licensing Non-LWR designs, which will be discussed in this paper to understand the stream of perspectives on US NRC's approach
Issues and insights of PRA methodology in nuclear and space applications
International Nuclear Information System (INIS)
Hsu, F.
2005-01-01
This paper presents some important issues and technical insights on the scope, conceptual framework, and essential elements of nuclear power plant Probabilistic Risk Assessments (PRAs) and that of the PRAs in general applications of the aerospace industry, such as the Space Shuttle PRA being conducted by NASA. Discussions are focused on various lessons learned in nuclear power plant PRA applications and their potential applicability to the PRAs in the aerospace and launch vehicle systems. Based on insights gained from PRA projects for nuclear power plants and from the current Space Shuttle PRA effort, the paper explores the commonalities and the differences between the conduct of the different PRAs and the key issues and risk insights derived from extensive modeling practices in both industries of nuclear and space. (author)
Insights to regenerate materials: learning from nature
García-Aznar, J. M.; Valero, C.; Gómez-Benito, M. J.; Javierre, E.
2016-08-01
Self-healing materials, both biological and engineered, integrate the ability to repair themselves and recover their functionality using the resources inherently available to them. Although significant advances have been made, in recent years, for the design of different concepts of self-healing materials, this work aims to provide some insights into how living materials are able to regenerate or heal when a fracture or injury occurs. The main sensors that regulate this adaptive and regenerative behavior are the cells. These are able to sense the mechanical alterations in their surroundings and regulate their activity in order to remove dead tissue and/or create new tissue. Therefore, understanding how cells are able to regenerate tissues under complex and multiphysics conditions can define the biomimetics guidelines to heal through inert or traditional engineering materials. In this work, we present a combination of experiments and different kinds of multiscale and multiphysics models in order to understand how mechanics regulate some mechanisms at cell and tissue level. This combination of results aims to gain insight into the development of novel strategies for self-healing materials, mimicking the behavior induced by cells and biological tissues.
Hydrodeoxygenation by deuterium gas--a powerful way to provide insight into the reaction mechanisms.
Ben, Haoxi; Ferguson, Glen A; Mu, Wei; Pu, Yunqiao; Huang, Fang; Jarvis, Mark; Biddy, Mary; Deng, Yulin; Ragauskas, Arthur J
2013-11-28
This study demonstrates the use of isotopic labelling and NMR to study the HDO process. As far as we know, this is the first reported effort to trace the incorporation of hydrogen in the HDO process of lignin pyrolysis oil thereby providing key fundamental insight into its reaction mechanism.
Innovate or perish : The RSM Insight debate
R. Gilbert (Russell)
2014-01-01
markdownabstract__Abstract__ Although innovation is one the hottest management topics of the 21st century, very few firms excel at it. Here, in the first RSM Insight debate, three of the school’s leading management scholars discuss how firms should approach the subject of innovation and what
2012-03-13
...., Including On-Site Leased Workers From Balance Staffing, Insight Global Staffing, and Technisource..., Insight Global Staffing, and Technisource, Scarborough, Maine. The workers are engaged in activities... leased workers from Balance Staffing, Insight Global Staffing, and Technisource, Scarborough, Maine, who...
Nagaraj, Anil Kumar Mysore
2013-01-01
Sex is a mysterious phenomenon, which has puzzled even great sages. Human beings have researched and mastered the biology of sex. But that is not all. Sex needs to be understood from the spiritual perspective too. The vision of Osho is an enlightening experience in this regard. Out of the thousands of lectures, five lectures on sex made Osho most notorious. Born into a Jain family of Madhya Pradesh, Rajneesh, who later wanted himself to be called Osho, is a great master. He has spoken volumes on a wide range of topics ranging from sex to super-consciousness. His contributions in the area of sex are based on the principles of "Tantra" which has its origin from Buddhism. This article focuses on his life and insights on sex, which if understood properly, can be a stepping stone for enlightenment.
Safety insights from forensics evaluations at Daiichi
Directory of Open Access Journals (Sweden)
J. Rempe
2017-01-01
Information obtained from Daiichi is required to inform Decontamination and Decommissioning activities, improving the ability of the Tokyo Electric Power Company (TEPCO to characterize potential hazards and to ensure the safety of workers involved with cleanup activities. This paper reports initial results from the US Forensics Effort to utilize examination information obtained by TEPCO to enhance the safety of existing and future nuclear power plant designs. In this paper, three examples are presented in which examination information, such as visual images, dose surveys, sample evaluations, and muon tomography examinations, along with data from plant instrumentation, are used to obtain significant safety insights in the areas of component performance, fission product release and transport, debris end-state location, and combustible gas generation and transport. In addition to reducing uncertainties related to severe accident modeling progression, these insights confirm actions, such as the importance of water addition and containment venting, that are emphasized in updated guidance for severe accident prevention, mitigation, and emergency planning.
Containment performance observations and insights of LWRs based on the IPEs
International Nuclear Information System (INIS)
Lehner, J.; Pratt, W.T.; Lane, J.; Chow, E.; Ridgely, J.
1994-01-01
Generic Letter 88-20, open-quotes Individual Plant Examination for Severe Accident Vulnerabilities - 10CFR 50.54(f),close quotes requesting the IPEs, was issued by the NRC on November 23, 1988. U.S. licensee were requested to conduct an Individual Plant Examination (IPE) in order to identify potential severe accident vulnerabilities at their plant and to implement cost-effective plant improvements to reduce or eliminate these vulnerabilities. Supplements to the Generic Letter forwarded technical insights obtained by the NRC staff through its Containment Performance Improvement (CPI) program. These insights were deemed important enough by the staff to bring to the attention of the licensees for use, as they deemed appropriate, in the IPEs which they were preparing. Coupled to their Level 1 results, licensees were requested to report the results of their analyses regarding containment performance. These results included those related to the general methodology used, plant data, plant features, plant damage states, models and methods used in the accident progression analysis, containment failure characterization, containment event trees and their end states, and radionuclide release characterization. At this time, most of the IPEs have been submitted by the licensees. In a follow-up effort to support regulatory activities, the NRC staff with assistance from Brookhaven National Laboratory, has initiated a program involving a global examination of the containment performance results documented in the IPEs. The objective is to identify insights of potential generic safety significance relative to plant design, operation and maintenance, as well as to assess response to the previously forwarded CPI insights
Mead, Walter B.
2011-01-01
This is intended as an introductory statement to the explorations undertaken in the essays that follow. The authors of these essays attempt to introduce the reader to some of the insights of Michael Polanyi and their implications for the reader who wishes to come to a greater understanding of modern technological society, which--for better or…
Sex Change in Clownfish: Molecular Insights from Transcriptome Analysis
Casas, Laura; Saborido-Rey, Fran; Ryu, Tae Woo; Michell, Craig; Ravasi, Timothy; Irigoien, Xabier
2016-01-01
steroidogenic machinery during sex change in clownfish, with the aromatase gene playing a central role, both in the brain and the gonad. This work constitutes the first genome-wide study in a social sex-changing species and provides insights into the genetic
DMPD: New insights into NF-kappaB regulation and function. [Dynamic Macrophage Pathway CSML Database
Lifescience Database Archive (English)
Full Text Available 18775672 New insights into NF-kappaB regulation and function. Sun SC, Ley SC. Trend...ction. PubmedID 18775672 Title New insights into NF-kappaB regulation and function....s Immunol. 2008 Oct;29(10):469-78. Epub 2008 Sep 3. (.png) (.svg) (.html) (.csml) Show New insights into NF-kappaB regulation and fun
Modeling Double Subjectivity for Gaining Programmable Insights: Framing the Case of Uber
Directory of Open Access Journals (Sweden)
Loretta Henderson Cheeks
2017-09-01
Full Text Available The Internet is the premier platform that enable the emergence of new technologies. Online news is unstructured narrative text that embeds facts, frames, and amplification that can influence society attitudes about technology adoption. Online news sources are carriers of voluminous amounts of news for reaching significantly large audience and have no geographical or time boundaries. The interplay of complex and dynamical forces among authors and readers allow for progressive emergent and latent properties to exhibit. Our concept of “Double subjectivity” provides a new paradigm for exploring complementary programmable insights of deeply buried meanings in a system. The ability to understand internal embeddedness in a large collection of related articles are beyond the reach of existing computational tools, and are hence left to human readers with unscalable results. This paper uncovers the potential to utilize advanced machine learning in a new way to automate the understanding of implicit structures and their associated latent meanings to give an early human-level insight into emergent technologies, with a concrete example of “Uber”. This paper establishes the new concept of double subjectivity as an instrument for large-scale machining of unstructured text and introduces a social influence model for the discovery of distinct pathways into emerging technology, and hence an insight. The programmable insight reveals early spatial and temporal opinion shift monitoring in complex networks in a structured way for computational treatment and visualization.
Swahili residential architecture reconsidered | Steyn | Africa Insight
African Journals Online (AJOL)
Africa Insight. Journal Home · ABOUT THIS JOURNAL · Advanced Search · Current Issue · Archives · Journal Home > Vol 32, No 2 (2002) >. Log in or Register to get access to full text downloads. Username, Password, Remember me, or Register. DOWNLOAD FULL TEXT Open Access DOWNLOAD FULL TEXT ...
Ruminant Nutrition Symposium: Acidosis: new insights into the persistent problem.
Oba, M; Wertz-Lutz, A E
2011-04-01
The Ruminant Nutrition Symposium titled "Acidosis: New insights into the persistent problem" was held at the Joint Annual Meeting of the American Dairy Science Association, American Society of Animal Science, Poultry Science Association, Asociación Mexicana de Producción Animal, Western Section-ASAS, and the Canadian Society of Animal Science in Denver, Colorado, July 11 to 15, 2010. The objective of the symposium was to provide the ruminant nutrition community with new insights and perspectives from recent research findings on acidosis. Under modern production systems, ruminants are fed high-grain diets to maximize their energy intake and productivity. However, feeding highly fermentable diets often causes excess fermentation and results in accumulation of fermentation acids in the rumen, leading to a decrease in feed intake, poor feed efficiency, liver abscesses, and lameness in feedlot cattle or lactating dairy cows. Although our understanding of nutritional factors (i.e., effects of type and processing method of grains and importance of physically effective fiber) affecting rumen pH have increased substantially over the past few decades, rumen acidosis has continued to be a common problem in the ruminant livestock industry. The symposium program was organized to review recent research findings in acidosis with more emphasis on physiological aspects, and provide novel insights into the persistent problem.
Van Camp, L S C; Oldenburg, J F E; Sabbe, B G C
2016-01-01
The pattern of associations between clinical insight, cognitive insight, and neurocognitive functioning was assessed in bipolar disorder patients. Data from 42 bipolar disorder patients were examined. Cognitive insight was measured using the Beck Cognitive Insight Scale (BCIS). The BCIS is a 15-item self-report instrument consisting of two subscales, self-reflectiveness and self-certainty. Clinical insight was measured by the use of the item G12 of the Positive and Negative Syndrome Scale. Neurocognitive functioning was assessed using the International Society for Bipolar Disorders-Battery for Assessment of Neurocognition. Correlation analyses revealed significant positive associations between self-reflectiveness and speed of processing, attention, working memory, visual learning, and reasoning and problem solving. The subscale self-certainty was negatively correlated to working memory, however, this correlation disappeared when we controlled for confounding variables. No correlations between clinical insight and neurocognition were found. In addition, there was no association between cognitive insight and clinical insight. Better neurocognitive functioning was more related to higher levels of self-reflectiveness than to diminished self-certainty.
Inspiration & Insight - a tribute to Niels Reeh
Ahlstrom, A. P.; Vieli, A.
2009-12-01
Niels Reeh was highly regarded for his contributions to glaciology, specifically through his rigorous combination of numerical modelling and field observations. In 1966 he began his work on the application of beam mechanics to floating glaciers and ice shelves and throughout his life, Niels retained a strong interest in modelling glacier dynamics. In the early 1980s Niels developed a 3D-model for ice sheets and in the late 1980s an advanced flow-line model. Niels Reeh also took part in the early ice-core drilling efforts in Greenland and later pioneered the concept of retrieving similar records from the surface of the ice-sheet margin. Mass balance of glaciers and ice sheets was another theme in Niels Reeh’s research, with a number of important contributions and insights still used when teaching the subject to students. Niels developed elegant models for ablation and snow densification, notable for their applicability in large-scale ice-sheet models and studied the impact of climate change on ice sheets and glaciers. Niels also took his interest in ice-dynamics and mass balance into remote sensing and worked successfully on methods to utilize radar and laser data from airborne surveys and satellites in glaciology. In this, he pioneered the combination of field experiments, satellite observations and numerical modelling to solve problems on the Greenland Ice Sheet. In this presentation we will attempt to provide an overview of Niels Reeh’s many-facetted career in acknowledgement of his contributions to the field of glaciology.
Accounting choices of controllers : An insight into controller deliberations
de Groot, Therèse
2015-01-01
This doctoral thesis provides insights into the accounting choice process of business controllers. The main contribution is a new approach in analyzing financial accounting choices, using an interpretive methodology. Moreover, the overall framework of analysis developed in this thesis can help
2012-07-10
..., Inc., Including On-Site Leased Workers From Insight Global Stone Staffing, and Randstad Formerly Known..., Massachusetts, including on-site leased workers from Insight Global, Stone Staffing, Randstad formerly known as... Insight Global, Stone Staffing, Randstad, formerly known as Sapphire Technologies, were employed on-site...
Application of insights from the IREP analyses to the IREP procedures guide
International Nuclear Information System (INIS)
Carlson, D.D.; Murphy, J.A.; Young, J.
1982-01-01
One of the objectives of the Interim Reliability Evaluation Program (IREP) was to prepare a set of procedures based on experience gained in the study for use in future IREP-type analyses. The current analyses used a set of procedures and, over the course of the program, a concerted effort was made to develop insights which could improve these procedures. Insights have been gained into the organization and content of th procedures guide, into the performance and management of an IREP analysis, and into the methods to be used in the analysis
Ekinci, Okan; Ekinci, Asli
2016-11-01
Cognitive insight, a recently developed insight measure, refers to metacognitive processes of the re-evaluation and correction of distorted beliefs and misinterpretations. However, to the best of the authors' knowledge, no study has specifically examined cognitive insight, demographics, psychopathological variables, and distorted beliefs in OCD. The aim of this research was to examine links between cognitive insight and demographics, clinical factors, and distorted beliefs among patients with OCD. Eighty-four consecutive outpatients with a diagnosis of OCD underwent a detailed clinical assessment for OCD, including the Yale-Brown Obsessive-Compulsive Scale (Y-BOCS), Beck Cognitive Insight Scale (BCIS), Thought-Action Fusion Scale (TAFS), White Bear Thought Suppression Inventory, Metacognition Questioniarre-30 (MCQ-30), and a sociodemographic questionnaire. In addition, 82 control subjects matched for age, education, and gender were tested. BCIS-self-certainty scores were all substantially higher in subjects with remitted and unremitted OCD than in healthy comparison subjects, while BCIS-composite scores were significantly lower in both patient groups than controls. Obsession and compulsion severity had significant effects on BCIS scores. In addition, it was found that the specific symptoms were linked to self-certainty scores. Self-reflectiveness and composite scores had positive correlations with the sub-scale scores of the MCQ-30, while the TAF-morality score was positively correlated with self-certainty scores. The results demonstrated poor cognitive insight among remitted and unremitted OCD patients. In addition, the present study suggested significant associations between sociodemographic and clinical features and dysfunctional appraisals. Cognitive-behavioural techniques aimed at enhancing cognitive insight may be beneficial for patients with OCD, particularly patients who have prominent dysfunctional beliefs.
Pai, Hsiang-Chu
2015-01-01
Nurses have to solve complex problems for their patients and their families, and as such, nursing care capability has become a focus of attention. The aim of this longitudinal study was to develop a self-reflection practice exercise program for nursing students to be used during clinical practice and to evaluate the effects of this program empirically and longitudinally on change in students' clinical competence, self-reflection, stress, and perceived teaching quality. An additional aim was to determine the predictors important to nursing competence. We sampled 260 nursing students from a total of 377 practicum students to participate in this study. A total of 245 students nurse completed 4 questionnaires, Holistic Nursing Competence Scale, Self-Reflection and Insight Scale, Perceived Stress Scale, and Clinical Teaching Quality Scale, at 2, 4, and 6 months after clinical practice experience. Generalized estimating equation models were used to examine the change in scores on each of the questionnaires. The findings showed that, at 6 months after clinical practice, nursing competence was significantly higher than at 2 and 4 months, was positively related to self-reflection and insight, and was negatively related to practice stress. Nursing students' competence at each time period was positively related to clinical teachers' instructional quality at 4 and 6 months. These results indicate that a clinical practice program with self-reflection learning exercise improves nursing students' clinical competence and that nursing students' self-reflection and perceived practice stress affect their nursing competence. Nursing core competencies are enhanced with a self-reflection program, which helps nursing students to improve self-awareness and decrease stress that may interfere with learning. Further, clinical practice experience, self-reflection and insight, and practice stress are predictors of nursing students' clinical competence. Copyright © 2015 Elsevier Inc. All
Directory of Open Access Journals (Sweden)
Ana Margarida P. Cardoso
2008-12-01
Full Text Available O sinal de que algo está a acontecer contribui para que o paciente reconheça que alguma coisa de estranho se está a passar consigo. Este reconhecimento faz com que o sujeito possa desempenhar uma função activa e seja um elemento colaborante do seu processo de recuperação. Cada doença apresenta, contudo, diferentes sintomas, uma vez que cada doença psiquiátrica consiste em diferentes perturbações com diversos efeitos sobre o funcionamento mental. Desta maneira, o fenómeno do insight que é registado em cada doença é diferente e expressa-se sob diferentes formas, não somente devido às manifestações clínicas da doença mas também devido às características individuais do sujeito.
It's a sentence, not a word: insights from a keyword analysis in cancer communication.
Taylor, Kimberly; Thorne, Sally; Oliffe, John L
2015-01-01
Keyword analysis has been championed as a methodological option for expanding the insights that can be extracted from qualitative datasets using various properties available in qualitative software. Intrigued by the pioneering applications of Clive Seale and his colleagues in this regard, we conducted keyword analyses for word frequency and "keyness" on a qualitative database of interview transcripts from a study on cancer communication. We then subjected the results from these operations to an in-depth contextual inquiry by resituating word instances within their original speech contexts, finding that most of what had initially appeared as group variations broke down under close analysis. In this article, we illustrate the various threads of analysis, and explain how they unraveled under closer scrutiny. On the basis of this tentative exercise, we conclude that a healthy skepticism for the benefits of keyword analysis within a qualitative investigative process seems warranted. © The Author(s) 2014.
Tveit, Anne Dorthe; Sunde, Annikken Louise
2016-01-01
The purpose of this paper is to explore how different insights from a variety of theories might help ethical decision making in educational counselling and highlight the need for reflection. A framework for ethical decision making based on basic features of counselling, namely the interlocutors' practice or "acts", is proposed. There are…
Insights gained from NRC research investigations at the Maxey Flats LLW SLB facility
International Nuclear Information System (INIS)
O'Donnell, E.
1983-01-01
The NRC funded program of research at Maxey Flats was done to assist an Agreement State in assessing the performance of the site. That program has yielded both site specific insights and generic insights which are likely to be useful in licensing future sites. They are as follows: Site Specific Insights: (1) The principal pathway of water entry into burial trenches at Maxey Flats is through the trench caps. (2) Sampling of vegetation, soils, and streams adjoining the site indicates that the small but measureable amounts of radionuclides found offsite were from surface runoff or the site evaporator. (3) There is limited onsite subsurface movement of radionuclides where open fractures intersect burial trenches. Generic Insights: (1) Tritium in the plant transpiration stream appears useful for mapping trench boundaries. (2) Trees offer a promising means of monitoring subsurface radionuclide movement in fractured rocks of low permeability. (3) Complexing with EDTA appears to be a potentially important mechanism that increases mobility of such radionuclides as Co-60, Pu-238, Am-241, and Sr-90. (4) Changes in soil solution chemistry encountered as leachate moves from trenches generally reduce the solubility of migrating radionuclides. (5) Agronomic management techniques appear promising as a means to control deep water percolation through waste burial trench caps. 18 references
The Intervention Nurses Start Infants Growing on Healthy Trajectories (INSIGHT) study.
Paul, Ian M; Williams, Jennifer S; Anzman-Frasca, Stephanie; Beiler, Jessica S; Makova, Kateryna D; Marini, Michele E; Hess, Lindsey B; Rzucidlo, Susan E; Verdiglione, Nicole; Mindell, Jodi A; Birch, Leann L
2014-07-18
Because early life growth has long-lasting metabolic and behavioral consequences, intervention during this period of developmental plasticity may alter long-term obesity risk. While modifiable factors during infancy have been identified, until recently, preventive interventions had not been tested. The Intervention Nurses Starting Infants Growing on Healthy Trajectories (INSIGHT). Study is a longitudinal, randomized, controlled trial evaluating a responsive parenting intervention designed for the primary prevention of obesity. This "parenting" intervention is being compared with a home safety control among first-born infants and their parents. INSIGHT's central hypothesis is that responsive parenting and specifically responsive feeding promotes self-regulation and shared parent-child responsibility for feeding, reducing subsequent risk for overeating and overweight. 316 first-time mothers and their full-term newborns were enrolled from one maternity ward. Two weeks following delivery, dyads were randomly assigned to the "parenting" or "safety" groups. Subsequently, research nurses conduct study visits for both groups consisting of home visits at infant age 3-4, 16, 28, and 40 weeks, followed by annual clinic-based visits at 1, 2, and 3 years. Both groups receive intervention components framed around four behavior states: Sleeping, Fussy, Alert and Calm, and Drowsy. The main study outcome is BMI z-score at age 3 years; additional outcomes include those related to patterns of infant weight gain, infant sleep hygiene and duration, maternal responsiveness and soothing strategies for infant/toddler distress and fussiness, maternal feeding style and infant dietary content and physical activity. Maternal outcomes related to weight status, diet, mental health, and parenting sense of competence are being collected. Infant temperament will be explored as a moderator of parenting effects, and blood is collected to obtain genetic predictors of weight status. Finally, second