Antileishmanial activity of berenil and methylglyoxal bis (guanylhydrazone) and its correlation with S-adenosylmethionine decarboxylase and polyamines.

Science.gov (United States)

Mukhopadhyay, R; Madhubala, R

1995-01-01

Leishmania donovani S-adenosyl-L-methionine (AdoMet) decarboxylase was found to show a growth related pattern. Methylglyoxal bis (guanylhydrazone) (MGBG) and Berenil inhibited the growth of Leishmania donovani promastigotes (strain UR6) in a dose dependent manner. The concentrations of MGBG and Berenil required for 50% inhibition of rate of growth were 67 and 47 microM, respectively. The growth inhibition of MGBG was partially reversed by spermidine (100 microM) and spermine (100 microM). Berenil inhibition of promastigote growth was partially reversed by 100 microM spermidine whereas 100 microM spermine did not result in any reversal of growth. The reduction in parasitemia in vitro by these inhibitors was accompanied by inhibition of AdoMet decarboxylase activity and spermidine levels.

Enhanced flux of substrates into polyamine biosynthesis but not ethylene in tomato fruit engineered with yeast S-adenosylmethionine decarboxylase gene

Science.gov (United States)

Yi Lasanajak; Rakesh Minocha; Subhash C. Minocha; Ravinder Goyal; Tahira Fatima; Avtar K. Handa; Autar K. Mattoo

2014-01-01

S-adenosylmethionine (SAM), a major substrate in 1-C metabolism is a common precursor in the biosynthetic pathways of polyamines and ethylene, two important plant growth regulators, which exhibit opposing developmental effects, especially during fruit ripening. However, the flux of various substrates including SAM into the two competing pathways in...

Diethylglyoxal bis(guanylhydrazone), a potent inhibitor of mammalian S-adenosylmethionine decarboxylase. Effects on cell proliferation and polyamine metabolism in L1210 leukemia cells.

Science.gov (United States)

Svensson, F; Kockum, I; Persson, L

1993-07-21

The polyamines are cell constituents essential for growth and differentiation. S-Adenosylmethionine decarboxylase (AdoMetDC) catalyzes a key step in the polyamine biosynthetic pathway. Methylglyoxal bis(guanylhydrazone) (MGBG) is an anti-leukemic agent with a strong inhibitory effect against AdoMetDC. However, the lack of specificity limits the usefulness of MGBG. In the present report we have used an analog of MGBG, diethylglyoxal bis(guanylhydrazone) (DEGBG), with a much greater specificity and potency against AdoMetDC, to investigate the effects of AdoMetDC inhibition on cell proliferation and polyamine metabolism in mouse L1210 leukemia cells. DEGBG was shown to effectively inhibit AdoMetDC activity in exponentially growing L1210 cells. The inhibition of AdoMetDC was reflected in a marked decrease in the cellular concentrations of spermidine and spermine. The concentration of putrescine, on the other hand, was greatly increased. Treatment with DEGBG resulted in a compensatory increase in the synthesis of AdoMetDC demonstrating an efficient feedback control. Cells seeded in the presence of DEGBG ceased to grow after a lag period of 1-2 days, indicating that the cells contained an excess of polyamines which were sufficient for one or two cell cycles in the absence of polyamine synthesis. The present results indicate that analogs of MGBG, having a greater specificity against AdoMetDC, might be valuable for studies concerning polyamines and cell proliferation.

Biochemical properties and crystal structure of ethylmethylglyoxal bis(guanylhydrazone) sulfate--an extremely powerful novel inhibitor of adenosylmethionine decarboxylase.

Science.gov (United States)

Elo, H; Mutikainen, I; Alhonen-Hongisto, L; Laine, R; Jänne, J; Lumme, P

1986-01-01

Ethylmethylglyoxal bis(guanylhydrazone) (EMGBG) sulfate, an analog of the well-known anti-leukemic drug methylglyoxal bis(guanylhydrazone), was synthesized. It was shown to be an extremely powerful competitive inhibitor of eukaryotic S-adenosylmethionine decarboxylase, with an apparent Ki value 12 nM. Thus, it appears to be the most powerful known inhibitor of the enzyme, being almost an order of magnitude more powerful than the corresponding ethylglyoxal derivative. It neither inhibited the proliferation of mouse L1210 leukemia cells in vitro, nor did it potentiate the growth inhibition produced by alpha-difluoromethyl ornithine. In this respect, its properties are closely related to those of dimethylglyoxal, ethylglyoxal and propylglyoxal bis(guanylhydrazones), while in striking contrast to those of the antiproliferative glyoxal and methylglyoxal analogs. EMGBG also inhibited intestinal diamine oxidase activity (Ki 0.7 microM). EMGBG sulfate was crystallized from water, giving orthorhombic crystals (space group Pbcn). Their crystal and molecular structure was determined by X-ray diffraction methods. The carbon-nitrogen double bonds between the ethylmethylglyoxal part and the aminoguanidine moieties were found to have the same configuration as they are known to have in the salts of glyoxal, methylglyoxal and propylglyoxal bis(guanylhydrazones). The glyoxal bis(guanylhydrazone) chain of the EMGBG cation deviated strongly from planarity, thus differing dramatically from the corresponding chains of the glyoxal, methylglyoxal and propylglyoxal analogs.

Polyamine and amino acid content, and activity of polyamine-synthesizing decarboxylases, in liver of streptozotocin-induced diabetic and insulin-treated diabetic rats

OpenAIRE

Brosnan, Margaret E.; Roebothan, Barbara V.; Hall, Douglas E.

1980-01-01

1. Concentrations of polyamines, amino acids, glycogen, nucleic acids and protein, and activities of ornithine decarboxylase and S-adenosylmethionine decarboxylase, were measured in livers from control, streptozotocin-diabetic and insulin-treated diabetic rats. 2. Total DNA per liver and protein per mg of DNA were unaffected by diabetes, whereas RNA per mg of DNA and glycogen per g of liver were decreased. Insulin treatment of diabetic rats induced both hypertrophy and hyperplasia, as indicat...

Combined Use of α‐Difluoromethylornithine and an Inhibitor of S‐Adenosylmethionine Decarboxylase in Mice Bearing P388 Leukemia or Lewis Lung Carcinoma

Science.gov (United States)

Nakaike, Shiro; Kashiwagi, Keiko; Terao, Kiyoshi; Iio, Kokoro

1988-01-01

The antitumor and antimetastatic effects of α‐difluoromethylornithine (DFMO), an inhibitor of ornithine decarboxylase, combined with an inhibitor of S‐adenosylmethionine decarboxylase, either methylglyoxal bis(guanylhydrazone) (MGBG) or ethylglyoxal bis(guanylhydrazone) (EGBG), were studied in mice bearing P388 leukemia or Lewis lung carcinoma. Although EGBG is a more specific inhibitor of polyamine biosynthesis than the widely used MGBG, the antitumor effect of the DFMO‐EGBG combination on P388 leukemia‐bearing mice was less than that of the DFMO‐MGBG combination. The prolongation of survival time by the DFMOC1000 mg/kg)‐MGBG(25 mg/kg) combination was 2.65‐fold, while that of the DFMO(1000 mg/kg)‐EGBG(50 mg/kg) combination was 1.34‐fold. When mice were fed a polyamine‐deficient diet, stronger antitumor effects were exerted; the prolongation of survival time by the DFMO‐MGBG and the DFMO‐EGBG combinations was 2.89‐fold and 2.03‐fold, respectively. The antitumor effect of combined use of the two polyamine antimetabolites with mice on normal and polyamine‐deficient diets correlated with a decrease of polyamine charge contents in the tumor cells. The above in vivo results were confirmed clearly in the KB cell culture system. The antimetastatic activity of DFMO on Lewis lung carcinoma‐bearing mice was strengthened by the addition of MGBG or EGBG. The antimetastatic activity of the DFMO‐MGBG or DFMO‐EGBG combination did not parallel the polyamine charge contents in the primary tumor and blood. PMID:3133338

Use of a Chimeric Hsp70 to Enhance the Quality of Recombinant Plasmodium falciparum S-Adenosylmethionine Decarboxylase Protein Produced in Escherichia coli

Science.gov (United States)

Makhoba, Xolani Henry; Burger, Adélle; Coertzen, Dina; Zininga, Tawanda; Birkholtz, Lyn-Marie; Shonhai, Addmore

2016-01-01

S-adenosylmethionine decarboxylase (PfAdoMetDC) from Plasmodium falciparum is a prospective antimalarial drug target. The production of recombinant PfAdoMetDC for biochemical validation as a drug target is important. The production of PfAdoMetDC in Escherichia coli has been reported to result in unsatisfactory yields and poor quality product. The co-expression of recombinant proteins with molecular chaperones has been proposed as one way to improve the production of the former in E. coli. E. coli heat shock proteins DnaK, GroEL-GroES and DnaJ have previously been used to enhance production of some recombinant proteins. However, the outcomes were inconsistent. An Hsp70 chimeric protein, KPf, which is made up of the ATPase domain of E. coli DnaK and the substrate binding domain of P. falciparum Hsp70 (PfHsp70) has been previously shown to exhibit chaperone function when it was expressed in E. coli cells whose resident Hsp70 (DnaK) function was impaired. We proposed that because of its domain constitution, KPf would most likely be recognised by E. coli Hsp70 co-chaperones. Furthermore, because it possesses a substrate binding domain of plasmodial origin, KPf would be primed to recognise recombinant PfAdoMetDC expressed in E. coli. First, using site-directed mutagenesis, followed by complementation assays, we established that KPf with a mutation in the hydrophobic residue located in its substrate binding cavity was functionally compromised. We further co-expressed PfAdoMetDC with KPf, PfHsp70 and DnaK in E. coli cells either in the absence or presence of over-expressed GroEL-GroES chaperonin. The folded and functional status of the produced PfAdoMetDC was assessed using limited proteolysis and enzyme assays. PfAdoMetDC co-expressed with KPf and PfHsp70 exhibited improved activity compared to protein co-expressed with over-expressed DnaK. Our findings suggest that chimeric KPf may be an ideal Hsp70 co-expression partner for the production of recombinant plasmodial

Transgenic Centipedegrass (Eremochloa ophiuroides [Munro] Hack. Overexpressing S-Adenosylmethionine Decarboxylase (SAMDC Gene for Improved Cold Tolerance Through Involvement of H2O2 and NO Signaling

Directory of Open Access Journals (Sweden)

Jianhao Luo

2017-09-01

Full Text Available Centipedegrass (Eremochloa ophiuroides [Munro] Hack. is an important warm-season turfgrass species. Transgenic centipedgrass plants overexpressing S-adenosylmethionine decarboxylase from bermudagrass (CdSAMDC1 that was induced in response to cold were generated in this study. Higher levels of CdSAMDC1 transcript and sperimidine (Spd and spermin (Spm concentrations and enhanced freezing and chilling tolerance were observed in transgenic plants as compared with the wild type (WT. Transgenic plants had higher levels of polyamine oxidase (PAO activity and H2O2 than WT, which were blocked by pretreatment with methylglyoxal bis (guanylhydrazone or MGBG, inhibitor of SAMDC, indicating that the increased PAO and H2O2 were a result of expression of CdSAMDC1. In addition, transgenic plants had higher levels of nitrate reductase (NR activity and nitric oxide (NO concentration. The increased NR activity were blocked by pretreatment with MGBG and ascorbic acid (AsA, scavenger of H2O2, while the increased NO level was blocked by MGBG, AsA, and inhibitors of NR, indicating that the enhanced NR-derived NO was dependent upon H2O2, as a result of expression CdSAMDC1. Elevated superoxide dismutase (SOD and catalase (CAT activities were observed in transgenic plants than in WT, which were blocked by pretreatment with MGBG, AsA, inhibitors of NR and scavenger of NO, indicating that the increased activities of SOD and CAT depends on expression of CdSAMDC1, H2O2, and NR-derived NO. Our results suggest that the elevated cold tolerance was associated with PAO catalyzed production of H2O2, which in turn led to NR-derived NO production and induced antioxidant enzyme activities in transgenic plants.

Transgenic Centipedegrass (Eremochloa ophiuroides [Munro] Hack.) Overexpressing S-Adenosylmethionine Decarboxylase (SAMDC) Gene for Improved Cold Tolerance Through Involvement of H2O2 and NO Signaling.

Science.gov (United States)

Luo, Jianhao; Liu, Mingxi; Zhang, Chendong; Zhang, Peipei; Chen, Jingjing; Guo, Zhenfei; Lu, Shaoyun

2017-01-01

Centipedegrass ( Eremochloa ophiuroides [Munro] Hack.) is an important warm-season turfgrass species. Transgenic centipedgrass plants overexpressing S-adenosylmethionine decarboxylase from bermudagrass ( CdSAMDC1 ) that was induced in response to cold were generated in this study. Higher levels of CdSAMDC1 transcript and sperimidine (Spd) and spermin (Spm) concentrations and enhanced freezing and chilling tolerance were observed in transgenic plants as compared with the wild type (WT). Transgenic plants had higher levels of polyamine oxidase (PAO) activity and H 2 O 2 than WT, which were blocked by pretreatment with methylglyoxal bis (guanylhydrazone) or MGBG, inhibitor of SAMDC, indicating that the increased PAO and H 2 O 2 were a result of expression of CdSAMDC1 . In addition, transgenic plants had higher levels of nitrate reductase (NR) activity and nitric oxide (NO) concentration. The increased NR activity were blocked by pretreatment with MGBG and ascorbic acid (AsA), scavenger of H 2 O 2 , while the increased NO level was blocked by MGBG, AsA, and inhibitors of NR, indicating that the enhanced NR-derived NO was dependent upon H 2 O 2 , as a result of expression CdSAMDC1 . Elevated superoxide dismutase (SOD) and catalase (CAT) activities were observed in transgenic plants than in WT, which were blocked by pretreatment with MGBG, AsA, inhibitors of NR and scavenger of NO, indicating that the increased activities of SOD and CAT depends on expression of CdSAMDC1 , H 2 O 2 , and NR-derived NO. Our results suggest that the elevated cold tolerance was associated with PAO catalyzed production of H 2 O 2 , which in turn led to NR-derived NO production and induced antioxidant enzyme activities in transgenic plants.

Differential effects of 2-difluoromethylornithine and methylglyoxal bis(guanylhydrazone) on the testosterone-induced growth of ventral prostate and seminal vesicles of castrated rats.

Science.gov (United States)

Käpyaho, K; Kallio, A; Jänne, J

1984-05-01

2-Difluoromethylornithine totally prevented any increases in putrescine and spermidine concentrations in the ventral prostate of castrated rats during a 6-day testosterone treatment. Prostatic ornithine decarboxylase activity was inhibited by 80%, whereas S-adenosylmethionine decarboxylase was stimulated by more than 9-fold. In seminal vesicle, the inhibition of putrescine and spermidine accumulation, as well as of ornithine decarboxylase activity, was only minimal, and no stimulation of S-adenosylmethionine decarboxylase was observed. Administration of methylglyoxal bis(guanylhydrazone) to castrated androgen-treated rats resulted in a marked increase in concentrations of all prostatic polyamines. Prostatic ornithine decarboxylase activity was nearly 2 times and adenosylmethionine decarboxylase activity 9 times higher than that of the testosterone-treated animals. In contrast with ventral prostate, methylglyoxal bis(guanylhydrazone) treatment inhibited moderately the accumulation of spermidine and spermine in seminal vesicle, although both ornithine decarboxylase and S-adenosylmethionine decarboxylase activities were stimulated. Difluoromethylornithine inhibited significantly the weight gain of ventral prostate, but methylglyoxal bis(guanylhydrazone) produced a substantial increase in prostatic weight. These changes were largely due to the fact that the volume of prostatic secretion was greatly decreased by difluoromethylornithine, whereas methylglyoxal bis(guanylhydrazone) increased the amount of secretion. Treatment with difluoromethylornithine strikingly increased the methylglyoxal bis(guanylhydrazone) content of both ventral prostate and seminal vesicle, but even under these conditions the drug concentration remained low in comparison with other tissues. The results indicate that a combined use of these two polyamine anti-metabolites does not necessarily result in a synergistic growth inhibition of the androgen-induced growth of male accessory sexual glands.

S-adenosylmethionine is associated with fat mass and truncal adiposity in older adults

NARCIS (Netherlands)

Elshorbagy, A.K.; Nijpels, G.; Valdivia-Garcia, M.; Stehouwer, C.D.; Ocke, M.; Refsum, H.; Dekker, J.M.

2013-01-01

S-adenosylmethionine (SAM) is synthesized from methionine, which is abundant in animal-derived protein, in an energyconsuming reaction. SAM and S-adenosylhomocysteine (SAH) correlate with body mass index (BMI). Plasma total concentration of the SAM-associated product cysteine (tCys) correlates with

Effects of bis(guanylhydrazones) on the activity and expression of ornithine decarboxylase.

Science.gov (United States)

Nikula, P; Alhonen-Hongisto, L; Jänne, J

1985-01-01

Derivatives of glyoxal bis(guanylhydrazone) (GBG), such as methylglyoxal bis(guanylhydrazone) and ethylglyoxal bis(guanylhydrazone), are potent inhibitors of S-adenosylmethionine decarboxylase (EC 4.1.1.50), the key enzyme required for the synthesis of spermidine and spermine. These compounds, but not the parent compound, induce a massive accumulation of putrescine, partly by blocking the conversion of putrescine into spermidine, but also by strikingly stimulating ornithine decarboxylase (ODC; EC 4.1.1.17) activity. The mechanism of the stimulation of ODC activity and enhanced accumulation of the enzyme protein apparently involved a distinct stabilization of the enzyme against intracellular degradation. However, although the parent compound GBG also stabilized ODC, it powerfully inhibited the enzyme activity and the accumulation of immunoreactive protein in cultured L1210 leukaemia cells. Kinetic considerations indicated that, in addition to the stabilization, all three compounds, GBG in particular, inhibited the expression of ODC. It is unlikely that the decreased rate of synthesis of ODC was attributable to almost unaltered amounts of mRNA in drug-treated cells, thus supporting the view that especially GBG apparently depressed the expression of ODC at some post-transcriptional level. Images PMID:4062886

Adenovirus type 5 induces progression of quiescent rat cells into S phase without polyamine accumulation.

Science.gov (United States)

Cheetham, B F; Shaw, D C; Bellett, A J

1982-01-01

Adenovirus type 5 induces cellular DNA synthesis and thymidine kinase in quiescent rat cells but does not induce ornithine decarboxylase. We now show that unlike serum, adenovirus type 5 fails to induce S-adenosylmethionine decarboxylase or polyamine accumulation. The inhibition by methylglyoxal bis(guanylhydrazone) of the induction of thymidine kinase by adenovirus type 5 is probably unrelated to its effects on polyamine biosynthesis. Thus, induction of cellular thymidine kinase and DNA replication by adenovirus type 5 is uncoupled from polyamine accumulation. PMID:7177112

Comparative Effects of Triflusal, S-Adenosylmethionine, and Dextromethorphan over Intestinal Ischemia/Reperfusion Injury

Directory of Open Access Journals (Sweden)

Carlos R. Cámara-Lemarroy

2011-01-01

Full Text Available Ischemia/reperfusion (I/R is a condition that stimulates an intense inflammatory response. No ideal treatment exists. Triflusal is an antiplatelet salicylate derivative with anti-inflammatory effects. S-adenosylmethionine is a metabolic precursor for glutathione, an endogenous antioxidant. Dextromethorphan is a low-affinity N-methyl-D-aspartate receptor inhibitor. There is evidence that these agents modulate some of the pathways involved in I/R physiopathology. Intestinal I/R was induced in rats by clamping the superior mesenteric artery for 60 minutes, followed by 60 minutes of reperfusion. Rats either received saline or the drugs studied. At the end of the procedure, serum concentrations of tumor necrosis factor-alpha (TNF-alpha, malonaldehyde (MDA, and total antioxidant capacity (TAC were determined and intestinal morphology analyzed. I/R resulted in tissue damage, serum TNF-alpha and MDA elevations, and depletion of TAC. All drugs showed tissue protection. Only triflusal reduced TNF-alpha levels. All drugs lowered MDA levels, but only triflusal and S-adenosylmethionine maintained the serum TAC.

Monitoring of the specific radioactivity of S-adenosylmethionine in kidney in vivo

Energy Technology Data Exchange (ETDEWEB)

Stoecker, W; Roos, G; Lange, H W; Hempel, K [Wuerzburg Univ. (Germany, F.R.). Inst. fuer Medizinische Strahlenkunde

1977-02-01

The specific radioactivity of S-adenosylmethionine was followed in the cat kidney during the infusion of L-(Me-/sup 3/H)methionine into the corresponding renal artery. For this purpose /sup 14/C-labelled 4-(2-aminoethyl)pyrocatechol((/sup 14/C)dopamine) as methyl acceptor was injected locally every 15 min and the /sup 3/H and /sup 14/C activity of the methylation product homovanillic acid, isolated from urine, was measured. Approximately 5% of the /sup 14/C label is excreted during the first renal passage as (/sup 14/C)homovanillic acid. The specific activity of S-adenosyl(Me-/sup 3/H)methionine in the kidney was calculated from the known specific radioactivity of (/sup 14/C)dopamine injected and the measured radioactivity atio, /sup 3/H : /sup 14/C, of homovanillic acid isolated from urine. The specific activity of S-adenosyn(Me-/sup 3/H)methionine reaches a constant value in kidney about 30 to 60 min after the beginning of the L-(Me-/sup 3/H)methionine infusion. This plateau value was 28% +- 14% lower than the specific activity of L-(Me-/sup 3/H)methionine in the venous blood from the corresponding kidney. The difference between the specific radioactivity of S-adenosyl(Me-/sup 3/H)-methionine in kidney and of free methionine in plasma is explained by the existence of a methionine source of minor specific activity in the kidney. The average life span of S-adenosylmethionine in the kidney is 19.5 +- 8.9 min.

Boron Deprivation Decreases Liver S-Adenosylmethionine and Spermidine and Increases Plasma Homocysteine and Cysteine in Rats

Science.gov (United States)

Two experiments were conducted with weanling Sprague-Dawley rats to determine whether changes in S-adenosylmethionine utilization or metabolism contribute to the diverse responses to boron deprivation. In both experiments, four treatment groups of 15 male rats were fed ground corn-casein based diets...

Differential effects of 2-difluoromethylornithine and methylglyoxal bis(guanylhydrazone) on the testosterone-induced growth of ventral prostate and seminal vesicles of castrated rats.

OpenAIRE

Käpyaho, K; Kallio, A; Jänne, J

1984-01-01

2-Difluoromethylornithine totally prevented any increases in putrescine and spermidine concentrations in the ventral prostate of castrated rats during a 6-day testosterone treatment. Prostatic ornithine decarboxylase activity was inhibited by 80%, whereas S-adenosylmethionine decarboxylase was stimulated by more than 9-fold. In seminal vesicle, the inhibition of putrescine and spermidine accumulation, as well as of ornithine decarboxylase activity, was only minimal, and no stimulation of S-ad...

Polyamine regulation of ornithine decarboxylase and its antizyme in intestinal epithelial cells.

Science.gov (United States)

Yuan, Q; Ray, R M; Viar, M J; Johnson, L R

2001-01-01

Ornithine decarboxylase (ODC) is feedback regulated by polyamines. ODC antizyme mediates this process by forming a complex with ODC and enhancing its degradation. It has been reported that polyamines induce ODC antizyme and inhibit ODC activity. Since exogenous polyamines can be converted to each other after they are taken up into cells, we used an inhibitor of S-adenosylmethionine decarboxylase, diethylglyoxal bis(guanylhydrazone) (DEGBG), to block the synthesis of spermidine and spermine from putrescine and investigated the specific roles of individual polyamines in the regulation of ODC in intestinal epithelial crypt (IEC-6) cells. We found that putrescine, spermidine, and spermine inhibited ODC activity stimulated by serum to 85, 46, and 0% of control, respectively, in the presence of DEGBG. ODC activity increased in DEGBG-treated cells, despite high intracellular putrescine levels. Although exogenous spermidine and spermine reduced ODC activity of DEGBG-treated cells close to control levels, spermine was more effective than spermidine. Exogenous putrescine was much less effective in inducing antizyme than spermidine or spermine. High putrescine levels in DEGBG-treated cells did not induce ODC antizyme when intracellular spermidine and spermine levels were low. The decay of ODC activity and reduction of ODC protein levels were not accompanied by induction of antizyme in the presence of DEGBG. Our results indicate that spermine is the most, and putrescine the least, effective polyamine in regulating ODC activity, and upregulation of antizyme is not required for the degradation of ODC protein.

The influence of nerve section on the metabolism of polyamines in rat diaphragm muscle.

Science.gov (United States)

Hopkins, D; Manchester, K L

1981-01-01

Concentrations of spermidine, spermine and putrescine have been measured in rat diaphragm muscle after unilateral nerve section. The concentration of putrescine increased approx. 10-fold 2 days after nerve section, that of spermidine about 3-fold by day 3, whereas an increase in the concentration of spermine was only observed after 7-10 days. It was not possible to show enhanced uptake of either exogenous putrescine or spermidine by the isolated tissue during the hypertrophy. Consistent with the accumulation of putrescine, activity of ornithine decarboxylase increased within 1 day of nerve section, was maximally elevated by the second day and then declined. Synthesis of spermidine from [14C]putrescine and either methionine or S-adenosylmethionine bt diaphragm cytosol rose within 1 day of nerve section, but by day 3 had returned to normal or below normal values. Activity of adenosylmethionine decarboxylase similarly increased within 1 day of nerve section, but by day 3 had declined to below normal values. Activity of methionine adenosyltransferase was elevated throughout the period studied. The concentration of S-adenosylmethionine was likewise enhanced during hypertrophy. Administration of methylglyoxal bis(guanylhydrazone) produced a marked increase in adenosylmethionine decarboxylase activity and a large increase in putrescine concentration, but did not prevent the rise in spermidine concentration produced by denervation. Possible regulatory mechanisms of polyamine metabolism consistent with the observations are discussed. PMID:7316998

Reprogramming of gene expression during compression wood formation in pine: Coordinated modulation of S-adenosylmethionine, lignin and lignan related genes

Science.gov (United States)

2012-01-01

Background Transcript profiling of differentiating secondary xylem has allowed us to draw a general picture of the genes involved in wood formation. However, our knowledge is still limited about the regulatory mechanisms that coordinate and modulate the different pathways providing substrates during xylogenesis. The development of compression wood in conifers constitutes an exceptional model for these studies. Although differential expression of a few genes in differentiating compression wood compared to normal or opposite wood has been reported, the broad range of features that distinguish this reaction wood suggest that the expression of a larger set of genes would be modified. Results By combining the construction of different cDNA libraries with microarray analyses we have identified a total of 496 genes in maritime pine (Pinus pinaster, Ait.) that change in expression during differentiation of compression wood (331 up-regulated and 165 down-regulated compared to opposite wood). Samples from different provenances collected in different years and geographic locations were integrated into the analyses to mitigate the effects of multiple sources of variability. This strategy allowed us to define a group of genes that are consistently associated with compression wood formation. Correlating with the deposition of a thicker secondary cell wall that characterizes compression wood development, the expression of a number of genes involved in synthesis of cellulose, hemicellulose, lignin and lignans was up-regulated. Further analysis of a set of these genes involved in S-adenosylmethionine metabolism, ammonium recycling, and lignin and lignans biosynthesis showed changes in expression levels in parallel to the levels of lignin accumulation in cells undergoing xylogenesis in vivo and in vitro. Conclusions The comparative transcriptomic analysis reported here have revealed a broad spectrum of coordinated transcriptional modulation of genes involved in biosynthesis of

Reprogramming of gene expression during compression wood formation in pine: Coordinated modulation of S-adenosylmethionine, lignin and lignan related genes

Directory of Open Access Journals (Sweden)

Villalobos David P

2012-06-01

Full Text Available Abstract Background Transcript profiling of differentiating secondary xylem has allowed us to draw a general picture of the genes involved in wood formation. However, our knowledge is still limited about the regulatory mechanisms that coordinate and modulate the different pathways providing substrates during xylogenesis. The development of compression wood in conifers constitutes an exceptional model for these studies. Although differential expression of a few genes in differentiating compression wood compared to normal or opposite wood has been reported, the broad range of features that distinguish this reaction wood suggest that the expression of a larger set of genes would be modified. Results By combining the construction of different cDNA libraries with microarray analyses we have identified a total of 496 genes in maritime pine (Pinus pinaster, Ait. that change in expression during differentiation of compression wood (331 up-regulated and 165 down-regulated compared to opposite wood. Samples from different provenances collected in different years and geographic locations were integrated into the analyses to mitigate the effects of multiple sources of variability. This strategy allowed us to define a group of genes that are consistently associated with compression wood formation. Correlating with the deposition of a thicker secondary cell wall that characterizes compression wood development, the expression of a number of genes involved in synthesis of cellulose, hemicellulose, lignin and lignans was up-regulated. Further analysis of a set of these genes involved in S-adenosylmethionine metabolism, ammonium recycling, and lignin and lignans biosynthesis showed changes in expression levels in parallel to the levels of lignin accumulation in cells undergoing xylogenesis in vivo and in vitro. Conclusions The comparative transcriptomic analysis reported here have revealed a broad spectrum of coordinated transcriptional modulation of genes

Effect of piroxicam, metamizol, and S-adenosylmethionine in a murine model of experimental trichomoniasis

Directory of Open Access Journals (Sweden)

Nogal-Ruiz J.J.

2005-03-01

Full Text Available Biological effects of piroxicam, metamizol, and S-adenosylmethionine (S-AMET have been tested in NMRI mice infected intraperitoneally with Trichomonas vaginalis. An intraperitoneal treatment during ten preinfection days with piroxicam (10 mg/Kg/day, or metamizol (275 mg/Kg/day, but not with S-AMET (17 mg/Kg/day induced a significant decrease of abdominal lesions and mortality, assessed by means of a pathogenicity index. The trichomonicidal activity of piroxicam, metamizol, and S-AMET was tested in vitro at the concentration of 300 μM, but found ineffective. These assays have shown the usefulness of the experimental trichomoniasis model for the study of the immunomodulating activity of synthetic drugs.

Radical S-adenosylmethionine (SAM) enzymes in cofactor biosynthesis: a treasure trove of complex organic radical rearrangement reactions.

Science.gov (United States)

Mehta, Angad P; Abdelwahed, Sameh H; Mahanta, Nilkamal; Fedoseyenko, Dmytro; Philmus, Benjamin; Cooper, Lisa E; Liu, Yiquan; Jhulki, Isita; Ealick, Steven E; Begley, Tadhg P

2015-02-13

In this minireview, we describe the radical S-adenosylmethionine enzymes involved in the biosynthesis of thiamin, menaquinone, molybdopterin, coenzyme F420, and heme. Our focus is on the remarkably complex organic rearrangements involved, many of which have no precedent in organic or biological chemistry. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Identification of the orotidine-5'-monophosphate decarboxylase gene of the oleaginous yeast Rhodosporidium toruloides.

Science.gov (United States)

Yang, Fan; Zhang, Sufang; Tang, Wei; Zhao, Zongbao K

2008-09-01

Oleaginous yeast Rhodosporidium toruloides is an excellent microbial lipid producer of great industrial potential, yet there is no effective genetic tool for rationally engineering this microorganism. To develop a marker recycling system, the orotidine-5'-monophosphate (OMP) decarboxylase gene of R. toruloides (RtURA3) was isolated using methods of degenerate polymerase chain reaction (PCR) together with rapid amplification of cDNA ends. The results showed that RtURA3 contains four extrons and three introns, and that the encoded polypeptide holds a sequence of 279 amino acid residues with significant homology to those of OMP decarboxylases from other yeasts. A shuttle vector pYES2/CT-RtURA3 was constructed via site-specific insertion of RtURA3 into the commercial vector pYES2/CT. Transformation of the shuttle vector into Saccharomyces cerevisiae BY4741, a URA3-deficient yeast strain, ensured the viability of the strain on synthetic dextrose agar plate without uracil, suggesting that the isolated RtURA3 was functionally equivalent to the URA3 gene from S. cerevisiae.

Crystallization and preliminary X-ray crystallographic analysis of the ArsM arsenic(III) S-adenosylmethionine methyltransferase

International Nuclear Information System (INIS)

Marapakala, Kavitha; Ajees, A. Abdul; Qin, Jie; Sankaran, Banumathi; Rosen, Barry P.

2010-01-01

A common biotransformation of arsenic is methylation to monomethylated, dimethylated and trimethylated species, which is catalyzed by the ArsM (or AS3MT) arsenic(III) S-adenosylmethionine methyltransferase. ArsM from the acidothermophilic alga Cyanidioschyzon sp. 5508 was expressed, purified and crystallized by the hanging-drop vapor-diffusion method and diffraction data were collected to 1.76 Å resolution. Arsenic is the most ubiquitous environmental toxin and carcinogen and consequently ranks first on the Environmental Protection Agency’s Superfund Priority List of Hazardous Substances. It is introduced primarily from geochemical sources and is acted on biologically, creating an arsenic biogeocycle. A common biotransformation is methylation to monomethylated, dimethylated and trimethylated species. Methylation is catalyzed by the ArsM (or AS3MT) arsenic(III) S-adenosylmethionine methyltransferase, an enzyme (EC 2.1.1.137) that is found in members of every kingdom from bacteria to humans. ArsM from the thermophilic alga Cyanidioschyzon sp. 5508 was expressed, purified and crystallized. Crystals were obtained by the hanging-drop vapor-diffusion method. The crystals belonged to the monoclinic space group C2, with unit-cell parameters a = 84.85, b = 46.89, c = 100.35 Å, β = 114.25° and one molecule in the asymmetric unit. Diffraction data were collected at the Advanced Light Source and were processed to a resolution of 1.76 Å

S-adenosylmethionine blood levels in major depression: changes with drug treatment.

Science.gov (United States)

Bell, K M; Potkin, S G; Carreon, D; Plon, L

1994-01-01

The relationship between plasma levels of S-adenosylmethionine (SAMe), an endogenous methyl donor, and clinical response were studied in patients with a DSM-III-R diagnosis of major depression. A double-blind randomized protocol comparing oral SAMe with oral desipramine, involving a total of 26 patients, was employed. At the end of the 4-week trial, 62% of the patients treated with SAMe and 50% of the patients treated with desipramine had significantly improved. Regardless of the type of treatment, patients with a 50% decrease in their Hamilton Depression Scale (HAM-D) score showed a significant increase in plasma SAMe concentration. The significant correlation between plasma SAMe levels and the degree of clinical improvement in depressed patients regardless of the type of treatment suggests that SAMe may play an important role in regulating mood.

Analysis of S-methylmethionine and S-adenosylmethionine in plant tissue by a dansylation, Dual-isotope method

International Nuclear Information System (INIS)

Macnicol, P.K.

1986-01-01

A method is presented for determining the levels of S-methylmethionine (MeMet) and S-adenosylmethionine (AdoMet) in the same plant tissue sample, utilizing readily available equipment. The bottom limit of sensitivity, ca. 100 pmol, can be lowered if required. A trichloracetic acid homogenate of the tissue is supplemented with [carboxyl- 14 C]MeMet and [carboxyl- 14 C]AdoMet. After separation of MeMet and AdoMet from each other and from endogenous homoserine on a phosphocellulose column, the two fractions are heat treated at appropriate pH values to liberate [ 14 C]homoserine. Quantitation is via the 3 H/ 14 C ratio of [ 3 H]dansyl-[ 14 C]homoserine isolated by thin-layer chromatography. The method is validated with pea cotyledon, corn root, and cauliflower leaf

5-methyl-tetrahydrofolate and the S-adenosylmethionine cycle in C57BL/6J mouse tissues: gender differences and effects of arylamine N-acetyltransferase-1 deletion.

Directory of Open Access Journals (Sweden)

Katey L Witham

Full Text Available Folate catabolism involves cleavage of the C(9-N(10 bond to form p-aminobenzoylgluamate (PABG and pterin. PABG is then acetylated by human arylamine N-acetyltransferase 1 (NAT1 before excretion in the urine. Mice null for the murine NAT1 homolog (Nat2 show several phenotypes consistent with altered folate homeostasis. However, the exact role of Nat2 in the folate pathway in vivo has not been reported. Here, we examined the effects of Nat2 deletion in male and female mice on the tissue levels of 5-methyl-tetrahydrofolate and the methionine-S-adenosylmethionine cycle. We found significant gender differences in hepatic and renal homocysteine, S-adenosylmethionine and methionine levels consistent with a more active methionine-S-adenosylmethionine cycle in female tissues. In addition, methionine levels were significantly higher in female liver and kidney. PABG was higher in female liver tissue but lower in kidney compared to male tissues. In addition, qPCR of mRNA extracted from liver tissue suggested a significantly lower level of Nat2 expression in female animals. Deletion of Nat2 affected liver 5- methyl-tetrahydrofolate in female mice but had little effect on other components of the methionine-S-adenosylmethionine cycle. No N-acetyl-PABG was observed in any tissues in Nat2 null mice, consistent with the role of Nat2 in PABG acetylation. Surprisingly, tissue PABG levels were similar between wild type and Nat2 null mice. These results show that Nat2 is not required to maintain tissue PABG homeostasis in vivo under normal conditions.

Sequence of a cloned cDNA encoding human ribosomal protein S11

Energy Technology Data Exchange (ETDEWEB)

Lott, J B; Mackie, G A

1988-02-11

The authors have isolated a cloned cDNA that encodes human ribosomal protein (rp) S11 by screening a human fibroblast cDNA library with a labelled 204 bp DNA fragment encompassing residues 212-416 of pRS11, a rat rp Sll cDNA clone. The human rp S11 cloned cDNA consists of 15 residues of the 5' leader, the entire coding sequence and all 51 residues of the 3' untranslated region. The predicted amino acid sequence of 158 residues is identical to rat rpS11. The nucleotide sequence in the coding region differs, however, from that in rat in the first position in two codons and in the third position in 44 codons.

Analysis of S-methylmethionine and S-adenosylmethionine in plant tissue by a dansylation, Dual-isotope method

Energy Technology Data Exchange (ETDEWEB)

Macnicol, P.K.

1986-10-01

A method is presented for determining the levels of S-methylmethionine (MeMet) and S-adenosylmethionine (AdoMet) in the same plant tissue sample, utilizing readily available equipment. The bottom limit of sensitivity, ca. 100 pmol, can be lowered if required. A trichloracetic acid homogenate of the tissue is supplemented with (carboxyl-/sup 14/C)MeMet and (carboxyl-/sup 14/C)AdoMet. After separation of MeMet and AdoMet from each other and from endogenous homoserine on a phosphocellulose column, the two fractions are heat treated at appropriate pH values to liberate (/sup 14/C)homoserine. Quantitation is via the /sup 3/H//sup 14/C ratio of (/sup 3/H)dansyl-(/sup 14/C)homoserine isolated by thin-layer chromatography. The method is validated with pea cotyledon, corn root, and cauliflower leaf.

Chemical labeling of gluatmate decarboxylase in vivo

International Nuclear Information System (INIS)

Rando, R.R.

1981-01-01

Mouse brain glutamate decarboxylase(s) was specifically titrated in vivo and in crude brain homogenates by a combination of gabaculine and [alpha-3H]acetylenic gamma-aminobutyric acid. This specific titration is based on the differential spectra of action of these two mechanism-based enzyme inactivators. The specificity of the titration in vitro was demonstrated by showing that the time course of radioactivity incorporation exactly paralleled the time course for glutamate of decarboxylase inactivation. This means that there is approximately 0.66 nmol of glutamate decarboxylase/0.5 g of mouse brain, assuming the stoichiometry of inactivator bound to enzyme is one. This value is similar to the one obtained from a calculation based on the enzyme purification data

S-Adenosylmethionine and S-adenosylhomocystein metabolism in isolated rat liver. Effects of L-methionine, L-homocystein, and adenosine.

Science.gov (United States)

Hoffman, D R; Marion, D W; Cornatzer, W E; Duerre, J A

1980-11-25

The effects of varying concentrations of L-methionine, L-homocysteine, and adenosine on the tissue levels of S-adenosylmethionine (AdoMet) and S-adenosyl-homocystein (AdoHcy) were investigated in perfused liver. In the normal liver, the intracellular concentration of AdoMet was dependent upon the availability of methionine. In the presence of high concentrations of methionine the maximum level of AdoMet attainable was 300 nmol/g of liver. The exogenous concentration of methionine did not alter the hepatic concentration of AdoHcy (8 to 20 nmol/g) while adenosine or homocysteine blocked hydrolysis of AdoHcy resulting in elevated levels of AdoHcy (400 to 600 nmol/g) and AdoMet (300 to 600 nmol/g). The addition of both adenosine (4mM) and homocysteine (3.4 mM) to the perfusate further increased the levels of AdoHcy (4 mumol/g) and AdoMet (1.2 mumol/g). As the concentration of AdoHcy increased, significant amounts of this compound were released into the perfusate, while AdoMet was not detected. Under all conditions where AdoHcy accumulated in the cell, a concomitant increase in the AdoMet level occurred. Apparently AdoHcy acts as a positive effector of the S-adenosylmethionine synthase. The hepatocytes did not take up significant amounts of [methyl-14C]AdoMet from the perfusate nor were any [14C]methyl groups from this compound incorporated into histones, DNA, or phospholipids. In contrast, [14C]methyl groups were readily incorporated into these macromolecules from exogenous [methyl-14C]methionine. The addition of adenosine (4 mM) and homocystein (3.4 mM) shifted the AdoMet:AdoHcy ratio from 8.2 to 0.3. Under these conditions, transmethylation was inhibited markedly.

Pyruvate decarboxylases from the petite-negative yeast Saccharomyces kluyveri

DEFF Research Database (Denmark)

Møller, Kasper; Langkjær, Rikke Breinhold; Nielsen, Jens

2004-01-01

was controlled by variations in the amount of mRNA. The mRNA level and the pyruvate decarboxylase activity responded to anaerobiosis and growth on different carbon sources in essentially the same fashion as in S. cerevisiae. This indicates that the difference in ethanol formation between these two yeasts...... is not due to differences in the regulation of pyruvate decarboxylase(s), but rather to differences in the regulation of the TCA cycle and the respiratory machinery. However, the PDC genes of Saccharomyces/Kluyveromyces yeasts differ in their genetic organization and phylogenetic origin. While S. cerevisiae...

S-Adenosylmethionine conformations in solution and in protein complexes: Conformational influences of the sulfonium group

DEFF Research Database (Denmark)

Markham, George D.; Norrby, Per-Ola; Bock, Charles W.

2002-01-01

S-Adenosylmethionine (AdoMet) and other sulfonium ions play central roles in the metabolism of all organisms. The conformational preferences of AdoMet and two other biologically important sulfonium ions, S-methylmethionine and dimethylsulfonioproprionic acid, have been investigated by NMR...... and computational studies. Molecular mechanics parameters for the sulfonium center have been developed for the AMBER force field to permit analysis of NMR results and to enable comparison of the relative energies of the different conformations of AdoMet that have been found in crystal structures of complexes...... with proteins. S-Methylmethionine and S-dimethylsulfonioproprionate adopt a variety of conformations in aqueous solution; a conformation with an electrostatic interaction between the sulfonium sulfur and the carboxylate group is not noticeably favored, in contrast to the preferred conformation found by in vacuo...

Characterization of Trypanosoma brucei brucei S-adenosyl-L-methionine decarboxylase and its inhibition by Berenil, pentamidine and methylglyoxal bis(guanylhydrazone).

Science.gov (United States)

Bitonti, A J; Dumont, J A; McCann, P P

1986-01-01

Trypanosoma brucei brucei S-adenosyl-L-methionine (AdoMet) decarboxylase was found to be relatively insensitive to activation by putrescine as compared with the mammalian enzyme, being stimulated by only 50% over a 10,000-fold range of putrescine concentrations. The enzyme was not stimulated by up to 10 mM-Mg2+. The Km for AdoMet was 30 microM, similar to that of other eukaryotic AdoMet decarboxylases. T.b. brucei AdoMet decarboxylase activity was apparently irreversibly inhibited in vitro by Berenil and reversibly by pentamidine and methylglyoxal bis(guanylhydrazone). Berenil also inhibited trypanosomal AdoMet decarboxylase by 70% within 4 h after administration to infected rats and markedly increased the concentration of putrescine in trypanosomes that were exposed to the drug in vivo. Spermidine and spermine blocked the curative effect of Berenil on model mouse T.b. brucei infections. This effect of the polyamines was probably not due to reversal of Berenil's inhibitory effects on the AdoMet decarboxylase. PMID:3800910

The preparation of 3-aminoxy-1-amino[1,1'-3H2]propane

International Nuclear Information System (INIS)

Pankaskie, M.C.; Scholtz, S.J.

1989-01-01

3-Aminoxy-1-aminopropane (APA) has previously been shown to be a potent inhibitor of the polyamine biosynthesis enzymes ornithine decarboxylase, adenosylmethionine decarboxylase, and spermidine synthase. Little information is known, however, regarding its mechanism of action, binding site mode(s), or cellular distribution. This report presents a relatively simple three step synthesis of 3-aminoxy-1-amino[1,1'- 3 H 2 ]propane via the catalytic tritiation of 3-aminoxypropionitrile hydrochloride. (author)

Suppression of TNF-alpha production by S-adenosylmethionine in human mononuclear leukocytes is not mediated by polyamines

DEFF Research Database (Denmark)

Yu, J.; Parlesak, Alexandr; Sauter, S.

2006-01-01

precursors or metabolites [phosphatidylcholine, choline, betaine, S-adenosylmethionine (SAM)] have a modulating effect on tumor necrosis factor alpha (TNF-alpha) production by endotoxin-stimulated human mononuclear leukocytes and whether SAM-dependent polyamines (spermidine, spermine) are mediators of SAM......-induced inhibition of TNF-alpha synthesis. Methionine and betaine had a moderate stimulatory effect on TNF-alpha production, whereas phosphatidylcholine (ID(50) 5.4 mM), SAM (ID(50) 131 microM), spermidine (ID(50) 4.5 microM) and spermine (ID(50) 3.9 microM) had a predominantly inhibitory effect. Putrescine did...

A Rich Man, Poor Man Story of S-Adenosylmethionine and Cobalamin Revisited.

Science.gov (United States)

Bridwell-Rabb, Jennifer; Grell, Tsehai A J; Drennan, Catherine L

2018-06-20

S-adenosylmethionine (AdoMet) has been referred to as both "a poor man's adenosylcobalamin (AdoCbl)" and "a rich man's AdoCbl," but today, with the ever-increasing number of functions attributed to each cofactor, both appear equally rich and surprising. The recent characterization of an organometallic species in an AdoMet radical enzyme suggests that the line that differentiates them in nature will be constantly challenged. Here, we compare and contrast AdoMet and cobalamin (Cbl) and consider why Cbl-dependent AdoMet radical enzymes require two cofactors that are so similar in their reactivity. We further carry out structural comparisons employing the recently determined crystal structure of oxetanocin-A biosynthetic enzyme OxsB, the first three-dimensional structural data on a Cbl-dependent AdoMet radical enzyme. We find that the structural motifs responsible for housing the AdoMet radical machinery are largely conserved, whereas the motifs responsible for binding additional cofactors are much more varied.

Kinetic isotope effect studies of the S-adenosylmethionine synthetase reaction

International Nuclear Information System (INIS)

Markham, G.D.; Parkin, D.W.; Schramm, V.L.

1986-01-01

S-adenosylmethionine (AdoMet) synthetase catalyzes a unique substitution reaction at the 5' carbon of MgATP. Kinetic isotope effect (V/K) measurements have been used to investigate the mechanism of AdoMet synthetase from E. coli. Changes in 3 H/ 14 C ratios when AdoMet is formed from a mixture of either ([5'- 14 C]ATP and [5'- 12 C,1'- 3 H]ATP) or ([5'- 3 H]ATP and [5'- 1 H,1'- 14 C]ATP) were examined. The effects of varying the concentrations of the co-substrate methionine and the monovalent cation activator K + were investigated. Substitution of 14 C for 12 C at the 5' position of ATP yields a primary V/K kinetic isotope effect ( 12 C/ 14 C) of 1.128 +/- 0.004 at low K + and methionine concentrations. The observed isotope effect diminishes slightly to 1.107 +/- 0.003 when both K + and methionine are present at saturating concentrations, suggesting that MgATP has only a low commitment to catalysis from at conditions near Vmax. No secondary V/K 3 H isotope effect from [5'- 3 H]ATP was detected ( 1 H/ 3 H) = 0.997 +/- 0.003. The magnitude of the primary 14 C isotope effect and the small secondary 3 H effect demonstrate that AdoMet synthesis occurs with a S/sub N/ 2 transition state which is symmetric with respect to the sulfur nucleophile and the departing tripolyphosphate group

In vitro trypanocidal activities of new S-adenosylmethionine decarboxylase inhibitors.

Science.gov (United States)

Brun, R; Bühler, Y; Sandmeier, U; Kaminsky, R; Bacchi, C J; Rattendi, D; Lane, S; Croft, S L; Snowdon, D; Yardley, V; Caravatti, G; Frei, J; Stanek, J; Mett, H

1996-01-01

A series of novel aromatic derivatives based on the structure of methylglyoxal bis(guanylhydrazone) (MGBG) was examined for in vitro antitrypanosomal activities and cytotoxicities for human cells. One-third of the compounds tested showed trypanocidal activity at concentrations below 0.5 microM after an incubation period of 72 h. Structure-activity analysis revealed that bicyclic compounds with homocyclic rings and unmodified termini were the most active compounds. Results obtained in three laboratories employing different methods and trypanosome populations consistently ranked compound CGP 40215A highest. This compound had a 50% inhibitory concentration of 0.0045 microM for Trypanosoma brucei rhodesiense, was also active against other trypanosome species, including a multidrug-resistant Trypanosoma brucei brucei, and was significantly less toxic than other compounds tested for a human adenocarcinoma cell line, with a 50% inhibitory concentration of 1.14 mM. The effect of CGP 40215A was time and dose dependent, and low concentrations of the compound required exposure times of > 2 days to exert trypanocidal activity. Compounds were inactive against Leishmania donovani and Trypanosoma cruzi amastigotes in murine macrophages in vitro. PMID:8726017

Protective role of S-Adenosylmethionine against fructose-induced oxidative damage in obesity

Directory of Open Access Journals (Sweden)

Kameliya Zh Bratoeva

2017-10-01

Full Text Available Introduction. It has been shown that S-adenosylmethionine (S-AMe stimulates glutathione synthesis and increases cell resistance to the cytotoxic action of free radicals and pro-inflammatory cytokines. The aim of this study was to determine the effect of Sadenosylmethionine on the oxidative stress in adipose tissue in a model of fructose-induced obesity. Methods. The study was performed on male Wistar rats divided into 3 groups: control, fructose fed (HFD (35%, 16 weeks, and HFD + S-AMe (20 mg/kg. We examined the changes in the ratio of retroperitoneal adipose tissue weight / body weight; levels of reduced glutathione (GSH and malondialdehyde (MDA in the retroperitoneal adipose tissue, and serum levels of GSH and TNF-α. Results. Significant increases in the retroperitoneal adipose tissue, MDA, and serum TNF-α were identified, as well as decreased tissue and serum levels of GSH in rats fed with a high-fructose diet as compared with the control group. In the group fed with HFD and SAMe, we found significant reduction in the retroperitoneal adipose tissue and decreased levels of MDA and serum TNF-α, as well as increased tissue and serum levels of GSH as compared with the group only on HFD. In conclusion, our results show that fructose-induced obesity causes oxidative stress in hypertrophic visceral adipose tissue. The administration of S-AMe improves the antioxidative protection of adipocytes, and reduces oxidative damage and excessive accumulation of lipids and inflammation.

SAM-VI RNAs selectively bind S-adenosylmethionine and exhibit similarities to SAM-III riboswitches.

Science.gov (United States)

Mirihana Arachchilage, Gayan; Sherlock, Madeline E; Weinberg, Zasha; Breaker, Ronald R

2018-03-04

Five distinct riboswitch classes that regulate gene expression in response to the cofactor S-adenosylmethionine (SAM) or its metabolic breakdown product S-adenosylhomocysteine (SAH) have been reported previously. Collectively, these SAM- or SAH-sensing RNAs constitute the most abundant collection of riboswitches, and are found in nearly every major bacterial lineage. Here, we report a potential sixth member of this pervasive riboswitch family, called SAM-VI, which is predominantly found in Bifidobacterium species. SAM-VI aptamers selectively bind the cofactor SAM and strongly discriminate against SAH. The consensus sequence and structural model for SAM-VI share some features with the consensus model for the SAM-III riboswitch class, whose members are mainly found in lactic acid bacteria. However, there are sufficient differences between the two classes such that current bioinformatics methods separately cluster representatives of the two motifs. These findings highlight the abundance of RNA structures that can form to selectively recognize SAM, and showcase the ability of RNA to utilize diverse strategies to perform similar biological functions.

Radiometric microassay for ornithine decarboxylase

Energy Technology Data Exchange (ETDEWEB)

Maderdrut, J L; Oppenheim, R W [North Carolina Univ., Chapel Hill (USA). School of Medicine

1978-01-01

A simple method for purifying (/sup 3/H)L-ornithine and incubation conditions suitable for estimating L-ornithine decarboxylase activity are described. Routine and recycle cation exchange procedures for separating putrescine from ornithine are outlined. Blanks using the routine cation exchange method average approx. 0.04% of the radioactivity contained in the substrate; product recovery is approx. 94%. The L-ornithine decarboxylase assay is proportional to time for at least 8 h. The relationship between substrate purity and the sensitivity of the cation exchange procedures is assessed. Radiochemical purity is the critical determinant of sensitivity for recycled assays. The cation exchange method is compared with the commonly used CO/sub 2/-trapping method. The cation exchange method is more specific and approximately three orders of magnitude more sensitive than the CO/sub 2/-trapping method. L-ornithine decarboxylase activity can be measured reliably in samples of embryonic neural tissues having wet-weights of approx. 1 ..mu..g. L-ornithine decarboxylase activity in the lumbar spinal cord of the chick embryo decreases 25-30 fold from day 5 to day 18 of embryonic development. A cation exchange procedure for estimating L-lysine decarboxylase activity is also described. Failure to detect L-lysine decarboxylase activity in the chick embryo lumbar spinal cord is contrasted with the previous report of high cadaverine levels in chick embryos.

Equilibria and partitioning of complexes in the S-adenosylmethionine synthetase reaction

International Nuclear Information System (INIS)

Markham, G.D.

1987-01-01

S-adenosylmethionine synthetase (ATP: L-methionine S-adenosyltransferase) catalyzes a reaction in which the [enzyme-ATP-methionine] complex reacts to form an intermediate [enzyme-AdoMet-PPPi] complex: hydrolysis of PPPi yields an [enzyme-AdoMet-PPi-Pi] complex from which AdoMet is the last product to dissociate. Analysis of reaction mixtures which were quenched with acid during turnover of E. coli AdoMet synthetase with saturating substrates containing [α - 32 P]ATP showed that PPPi is present in an amount corresponding to 45% of the total enzyme active sites, reflecting the portion of enzyme present in an [enzyme-AdoMet-PPPi] complex. Similar experiments in which excess pyrophosphatase was included (to hydrolyze PPi as it was released from AdoMet synthetase), showed that enzyme-bound PPi is present in an amount corresponding to 22% of the total AdoMet synthetase. The enzyme not present in complexes with PPPi or PPi is probably distributed between the [enzyme-ATP-methionine] and the [enzyme-AdoMet] complexes. AdoMet synthetase forms enzyme-bound 32 PPPi from added 32 PPi and Pi; the equilibrium constant [enzyme-AdoMet-PPi-Pi]/[enzyme-AdoMet-PPPi] is 2.0, greatly displaced from the equilibrium for hydrolysis of free PPPi. Since the ratio of enzyme-bound PPi to PPPi is 0.5 during the steady state, the PPPi hydrolysis step is not at equilibrium during turnover. Formation of [ 32 P]ATP from the [enzyme-AdoMet- 32 PPPi] complex was not detected

Redox Behavior of the S-Adenosylmethionine (SAM)-Binding Fe-S Cluster in Methylthiotransferase RimO, toward Understanding Dual SAM Activity.

Science.gov (United States)

Molle, Thibaut; Moreau, Yohann; Clemancey, Martin; Forouhar, Farhad; Ravanat, Jean-Luc; Duraffourg, Nicolas; Fourmond, Vincent; Latour, Jean-Marc; Gambarelli, Serge; Mulliez, Etienne; Atta, Mohamed

2016-10-18

RimO, a radical-S-adenosylmethionine (SAM) enzyme, catalyzes the specific C 3 methylthiolation of the D89 residue in the ribosomal S 12 protein. Two intact iron-sulfur clusters and two SAM cofactors both are required for catalysis. By using electron paramagnetic resonance, Mössbauer spectroscopies, and site-directed mutagenesis, we show how two SAM molecules sequentially bind to the unique iron site of the radical-SAM cluster for two distinct chemical reactions in RimO. Our data establish that the two SAM molecules bind the radical-SAM cluster to the unique iron site, and spectroscopic evidence obtained under strongly reducing conditions supports a mechanism in which the first molecule of SAM causes the reoxidation of the reduced radical-SAM cluster, impeding reductive cleavage of SAM to occur and allowing SAM to methylate a HS - ligand bound to the additional cluster. Furthermore, by using density functional theory-based methods, we provide a description of the reaction mechanism that predicts the attack of the carbon radical substrate on the methylthio group attached to the additional [4Fe-4S] cluster.

Regulation of homocysteine metabolism and methylation in human and mouse tissues

Science.gov (United States)

Chen, Natalie C.; Yang, Fan; Capecci, Louis M.; Gu, Ziyu; Schafer, Andrew I.; Durante, William; Yang, Xiao-Feng; Wang, Hong

2010-01-01

Hyperhomocysteinemia is an independent risk factor for cardiovascular disease. Homocysteine (Hcy) metabolism involves multiple enzymes; however, tissue Hcy metabolism and its relevance to methylation remain unknown. Here, we established gene expression profiles of 8 Hcy metabolic and 12 methylation enzymes in 20 human and 19 mouse tissues through bioinformatic analysis using expression sequence tag clone counts in tissue cDNA libraries. We analyzed correlations between gene expression, Hcy, S-adenosylhomocysteine (SAH), and S-adenosylmethionine (SAM) levels, and SAM/SAH ratios in mouse tissues. Hcy metabolic and methylation enzymes were classified into two types. The expression of Type 1 enzymes positively correlated with tissue Hcy and SAH levels. These include cystathionine β-synthase, cystathionine-γ-lyase, paraxonase 1, 5,10-methylenetetrahydrofolate reductase, betaine:homocysteine methyltransferase, methionine adenosyltransferase, phosphatidylethanolamine N-methyltransferases and glycine N-methyltransferase. Type 2 enzyme expressions correlate with neither tissue Hcy nor SAH levels. These include SAH hydrolase, methionyl-tRNA synthase, 5-methyltetrahydrofolate:Hcy methyltransferase, S-adenosylmethionine decarboxylase, DNA methyltransferase 1/3a, isoprenylcysteine carboxyl methyltransferases, and histone-lysine N-methyltransferase. SAH is the only Hcy metabolite significantly correlated with Hcy levels and methylation enzyme expression. We established equations expressing combined effects of methylation enzymes on tissue SAH, SAM, and SAM/SAH ratios. Our study is the first to provide panoramic tissue gene expression profiles and mathematical models of tissue methylation regulation.—Chen, N. C., Yang, F., Capecci, L. M., Gu, Z., Schafer, A. I., Durante, W., Yang, X.-F., Wang, H. Regulation of homocysteine metabolism and methylation in human and mouse tissues. PMID:20305127

Ornithine decarboxylase, polyamines, and pyrrolizidine alkaloids in senecio and crotalaria.

Science.gov (United States)

Birecka, H; Birecki, M; Cohen, E J; Bitonti, A J; McCann, P P

1988-01-01

When tested for ornithine and arginine decarboxylases, pyrrolizidine alkaloid-bearing Senecio riddellii, S. longilobus (Compositae), and Crotalaria retusa (Leguminosae) plants exhibited only ornithine decarboxylase activity. This contrasts with previous studies of four species of pyrrolizidine alkaloid-bearing Heliotropium (Boraginaceae) in which arginine decarboxylase activity was very high relative to that of ornithine decarboxylase. Unlike Heliotropium angiospermum and Heliotropium indicum, in which endogenous arginine was the only detectable precursor of putrescine channeled into pyrrolizidines, in the species studied here-using difluoromethylornithine and difluoromethylarginine as the enzyme inhibitors-endogenous ornithine was the main if not the only precursor of putrescine converted into the alkaloid aminoalcohol moiety. In S. riddellii and C. retusa at flowering, ornithine decarboxylase activity was present mainly in leaves, especially the young ones. However, other very young organs such as inflorescence and growing roots exhibited much lower or very low activities; the enzyme activity in stems was negligible. There was no correlation between the enzyme activity and polyamine or alkaloid content in either species. In both species only free polyamines were detected except for C. retusa roots and inflorescence-with relatively very high levels of these compounds-in which conjugated putrescine, spermidine, and spermine were also found; agmatine was not identified by HPLC in any plant organ except for C. retusa roots with rhizobial nodules. Organ- or age-dependent differences in the polyamine levels were small or insignificant. The highest alkaloid contents were found in young leaves and inflorescence.

Membrane topology of Golgi-localized probable S-adenosylmethionine-dependent methyltransferase in tobacco (Nicotiana tabacum) BY-2 cells.

Science.gov (United States)

Liu, Jianping; Hayashi, Kyoko; Matsuoka, Ken

2015-01-01

S-adenosylmethionine (SAM)-dependent methyltransferases (MTases) transfer methyl groups to substrates. In this study, a novel putative tobacco SAM-MTase termed Golgi-localized methyl transferase 1 (GLMT1) has been characterized. GLMT1 is comprised of 611 amino acids with short N-terminal region, putative transmembrane region, and C-terminal SAM-MTase domain. Expression of monomeric red fluorescence protein (mRFP)-tagged protein in tobacco BY-2 cell indicated that GLMT1 is a Golgi-localized protein. Analysis of the membrane topology by protease digestion suggested that both C-terminal catalytic region and N-terminal region seem to be located to the cytosolic side of the Golgi apparatus. Therefore, GLMT1 might have a different function than the previously studied SAM-MTases in plants.

Radiometric microassay for glutamic acid decarboxylase

Energy Technology Data Exchange (ETDEWEB)

Maderdrut, J L [North Carolina Dept. of Mental Health, Raleigh (USA); North Carolina Univ., Chapel Hill (USA). School of Medicine)

1979-01-01

A simple method for purifying L-(/sup 3/H) glutamic acid and incubation conditions suitable for estimating L-glutamic acid decarboxylase activity are described. Routine and recycled cation-exchange procedure for separating ..gamma..-aminobutyric acid from L-glutamate are outlined and compared. Recycling increases the sensitivity of the cation-exchange method by 6-7 fold. L-Glutamate decarboxylase activity can be measured reliably in samples of embryonic neural tissue having wet-weights of approximately 1 ..mu..g. The cation-exchange method is compared with the anion-exchange and CO/sub 2/-trapping methods. L-Glutamate decarboxylase activity has been detected in the lumbar spinal cord of the chick embryo at Day 21/4 (stage 14) using the cation-exchange method. This is 5-6 days earlier than L-glutamate decarboxylase activity has been detected in embryonic neural tissue by previous investigators. L-Glutamate decarboxylase is present in the lumbar spinal cord at least as early as the birth of the first lumbar spinal cord neurons and at least 1-2 days before the initiation of synaptogenesis.

Development of a novel ultrasensitive enzyme immunoassay for human glutamic acid decarboxylase 65 antibody.

Science.gov (United States)

Numata, Satoshi; Katakami, Hideki; Inoue, Shinobu; Sawada, Hirotake; Hashida, Seiichi

2016-07-01

We developed a novel, ultrasensitive enzyme immunoassay (immune complex transfer enzyme immunoassay) for determination of glutamic acid decarboxylase autoantibody concentrations in serum samples from patients with type 2 diabetes. We developed an immune complex transfer enzyme immunoassay for glutamic acid decarboxylase autoantibody and measured glutamic acid decarboxylase autoantibody from 22 patients with type 1 diabetes, 29 patients with type 2 diabetes, and 32 healthy controls. A conventional ELISA kit identified 10 patients with type 1 diabetes and one patient with type 2 diabetes as glutamic acid decarboxylase autoantibody positive, whereas 15 patients with type 1 diabetes and six patients with type 2 diabetes were identified as glutamic acid decarboxylase autoantibody positive using immune complex transfer enzyme immunoassay. Immune complex transfer enzyme immunoassay is a highly sensitive and specific assay for glutamic acid decarboxylase autoantibody and might be clinically useful for diabetic onset prediction and early diagnosis. © The Author(s) 2016.

Evaluation of Brachypodium distachyon L-Tyrosine Decarboxylase Using L-Tyrosine Over-Producing Saccharomyces cerevisiae.

Directory of Open Access Journals (Sweden)

Shuhei Noda

Full Text Available To demonstrate that herbaceous biomass is a versatile gene resource, we focused on the model plant Brachypodium distachyon, and screened the B. distachyon for homologs of tyrosine decarboxylase (TDC, which is involved in the modification of aromatic compounds. A total of 5 candidate genes were identified in cDNA libraries of B. distachyon and were introduced into Saccharomyces cerevisiae to evaluate TDC expression and tyramine production. It is suggested that two TDCs encoded in the transcripts Bradi2g51120.1 and Bradi2g51170.1 have L-tyrosine decarboxylation activity. Bradi2g51170.1 was introduced into the L-tyrosine over-producing strain of S. cerevisiae that was constructed by the introduction of mutant genes that promote deregulated feedback inhibition. The amount of tyramine produced by the resulting transformant was 6.6-fold higher (approximately 200 mg/L than the control strain, indicating that B. distachyon TDC effectively converts L-tyrosine to tyramine. Our results suggest that B. distachyon possesses enzymes that are capable of modifying aromatic residues, and that S. cerevisiae is a suitable host for the production of L-tyrosine derivatives.

Sensing and adaptation to low pH mediated by inducible amino acid decarboxylases in Salmonella.

Science.gov (United States)

Viala, Julie P M; Méresse, Stéphane; Pocachard, Bérengère; Guilhon, Aude-Agnès; Aussel, Laurent; Barras, Frédéric

2011-01-01

During the course of infection, Salmonella enterica serovar Typhimurium must successively survive the harsh acid stress of the stomach and multiply into a mild acidic compartment within macrophages. Inducible amino acid decarboxylases are known to promote adaptation to acidic environments. Three low pH inducible amino acid decarboxylases were annotated in the genome of S. Typhimurium, AdiA, CadA and SpeF, which are specific for arginine, lysine and ornithine, respectively. In this study, we characterized and compared the contributions of those enzymes in response to acidic challenges. Individual mutants as well as a strain deleted for the three genes were tested for their ability (i) to survive an extreme acid shock, (ii) to grow at mild acidic pH and (iii) to infect the mouse animal model. We showed that the lysine decarboxylase CadA had the broadest range of activity since it both had the capacity to promote survival at pH 2.3 and growth at pH 4.5. The arginine decarboxylase AdiA was the most performant in protecting S. Typhimurium from a shock at pH 2.3 and the ornithine decarboxylase SpeF conferred the best growth advantage under anaerobiosis conditions at pH 4.5. We developed a GFP-based gene reporter to monitor the pH of the environment as perceived by S. Typhimurium. Results showed that activities of the lysine and ornithine decarboxylases at mild acidic pH did modify the local surrounding of S. Typhimurium both in culture medium and in macrophages. Finally, we tested the contribution of decarboxylases to virulence and found that these enzymes were dispensable for S. Typhimurium virulence during systemic infection. In the light of this result, we examined the genomes of Salmonella spp. normally responsible of systemic infection and observed that the genes encoding these enzymes were not well conserved, supporting the idea that these enzymes may be not required during systemic infection.

Sensing and adaptation to low pH mediated by inducible amino acid decarboxylases in Salmonella.

Directory of Open Access Journals (Sweden)

Julie P M Viala

Full Text Available During the course of infection, Salmonella enterica serovar Typhimurium must successively survive the harsh acid stress of the stomach and multiply into a mild acidic compartment within macrophages. Inducible amino acid decarboxylases are known to promote adaptation to acidic environments. Three low pH inducible amino acid decarboxylases were annotated in the genome of S. Typhimurium, AdiA, CadA and SpeF, which are specific for arginine, lysine and ornithine, respectively. In this study, we characterized and compared the contributions of those enzymes in response to acidic challenges. Individual mutants as well as a strain deleted for the three genes were tested for their ability (i to survive an extreme acid shock, (ii to grow at mild acidic pH and (iii to infect the mouse animal model. We showed that the lysine decarboxylase CadA had the broadest range of activity since it both had the capacity to promote survival at pH 2.3 and growth at pH 4.5. The arginine decarboxylase AdiA was the most performant in protecting S. Typhimurium from a shock at pH 2.3 and the ornithine decarboxylase SpeF conferred the best growth advantage under anaerobiosis conditions at pH 4.5. We developed a GFP-based gene reporter to monitor the pH of the environment as perceived by S. Typhimurium. Results showed that activities of the lysine and ornithine decarboxylases at mild acidic pH did modify the local surrounding of S. Typhimurium both in culture medium and in macrophages. Finally, we tested the contribution of decarboxylases to virulence and found that these enzymes were dispensable for S. Typhimurium virulence during systemic infection. In the light of this result, we examined the genomes of Salmonella spp. normally responsible of systemic infection and observed that the genes encoding these enzymes were not well conserved, supporting the idea that these enzymes may be not required during systemic infection.

A radiometric microassay for glutamic acid decarboxylase

International Nuclear Information System (INIS)

Maderdrut, J.L.; North Carolina Univ., Chapel Hill

1979-01-01

A simple method for purifying L-[ 3 H] glutamic acid and incubation conditions suitable for estimating L-glutamic acid decarboxylase activity are described. Routine and recycled cation-exchange procedure for separating γ-aminobutyric acid from L-glutamate are outlined and compared. Recycling increases the sensitivity of the cation-exchange method by 6-7 fold. L-Glutamate decarboxylase activity can be measured reliably in samples of embryonic neural tissue having wet-weights of approximately 1 μg. The cation-exchange method is compared with the anion-exchange and CO 2 -trapping methods. L-Glutamate decarboxylase activity has been detected in the lumbar spinal cord of the chick embryo at Day 21/4 (stage 14) using the cation-exchange method. This is 5-6 days earlier than L-glutamate decarboxylase activity has been detected in embryonic neural tissue by previous investigators. L-Glutamate decarboxylase is present in the lumbar spinal cord at least as early as the birth of the first lumbar spinal cord neurons and at least 1-2 days before the initiation of synaptogenesis. (author)

Expression of S-adenosylmethionine Hydrolase in Tissues Synthesizing Secondary Cell Walls Alters Specific Methylated Cell Wall Fractions and Improves Biomass Digestibility

Directory of Open Access Journals (Sweden)

Aymerick Eudes

2016-07-01

Full Text Available Plant biomass is a large source of fermentable sugars for the synthesis of bioproducts using engineered microbes. These sugars are stored as cell wall polymers, mainly cellulose and hemicellulose, and are embedded with lignin, which makes their enzymatic hydrolysis challenging. One of the strategies to reduce cell wall recalcitrance is the modification of lignin content and composition. Lignin is a phenolic polymer of methylated aromatic alcohols and its synthesis in tissues developing secondary cell walls is a significant sink for the consumption of the methyl donor S-adenosylmethionine (AdoMet. In this study, we demonstrate in Arabidopsis stems that targeted expression of S-adenosylmethionine hydrolase (AdoMetase, E.C. 3.3.1.2 in secondary cell-wall synthesizing tissues reduces the AdoMet pool and impacts lignin content and composition. In particular, both NMR analysis and pyrolysis gas chromatography mass spectrometry of lignin in engineered biomass showed relative enrichment of non-methylated p-hydroxycinnamyl (H units and a reduction of dimethylated syringyl (S units. This indicates a lower degree of methylation compared to that in wild-type lignin. Quantification of cell wall-bound hydroxycinnamates revealed a reduction of ferulate in AdoMetase transgenic lines. Biomass from transgenic lines, in contrast to that in control plants, exhibits an enrichment of glucose content and a reduction in the degree of hemicellulose glucuronoxylan methylation. We also show that these modifications resulted in a reduction of cell wall recalcitrance, because sugar yield generated by enzymatic biomass saccharification was greater than that of wild type plants. Considering that transgenic plants show no important diminution of biomass yields, and that heterologous expression of AdoMetase protein can be spatiotemporally optimized, this novel approach provides a valuable option for the improvement of lignocellulosic biomass feedstock.

AhR and SHP regulate phosphatidylcholine and S-adenosylmethionine levels in the one-carbon cycle.

Science.gov (United States)

Kim, Young-Chae; Seok, Sunmi; Byun, Sangwon; Kong, Bo; Zhang, Yang; Guo, Grace; Xie, Wen; Ma, Jian; Kemper, Byron; Kemper, Jongsook Kim

2018-02-07

Phosphatidylcholines (PC) and S-adenosylmethionine (SAM) are critical determinants of hepatic lipid levels, but how their levels are regulated is unclear. Here, we show that Pemt and Gnmt, key one-carbon cycle genes regulating PC/SAM levels, are downregulated after feeding, leading to decreased PC and increased SAM levels, but these effects are blunted in small heterodimer partner (SHP)-null or FGF15-null mice. Further, aryl hydrocarbon receptor (AhR) is translocated into the nucleus by insulin/PKB signaling in the early fed state and induces Pemt and Gnmt expression. This induction is blocked by FGF15 signaling-activated SHP in the late fed state. Adenoviral-mediated expression of AhR in obese mice increases PC levels and exacerbates steatosis, effects that are blunted by SHP co-expression or Pemt downregulation. PEMT, AHR, and PC levels are elevated in simple steatosis patients, but PC levels are robustly reduced in steatohepatitis-fibrosis patients. This study identifies AhR and SHP as new physiological regulators of PC/SAM levels.

The efficiency of metabolic impact of S-adenosylmethionine and meldonium on parameters of lipid profile and insulin resistance during comorbid course of nonalcocholic steatohepatitis, obesity and chronic kidney disease stage І-ІІ

Directory of Open Access Journals (Sweden)

O. S. Khukhlina

2018-02-01

Full Text Available Objective – to investigate the influence of the complex of S-adenosylmethionine (Agepta and meldonium (Vasonat on the course of NASH with obesity and CKD, the state of the lipid profile of the blood, and the degree of insulin resistance. Materials and methods. The study involved 75 patients with NASH with comorbid obesity of the 1st degree and CKH of І–ІІ st. Three groups of patients were randomized by age, sex, obesity, activity of the cytolytic syndrome of NASH and the stage of CKN (chronic uncomplicated pyelonephritis with latent course in the phase of subsiding acute exacerbation to determine the treatment effectiveness. The control group (24 persons received hypocaloric diet, metformin 500 mg twice daily, rosuvastatin 10 mg 1 time per day, essentiale H as a hepatoprotective drug (1 capsule 3 times a day, canephron N (50 mg 3 times a day during 90 days. The second group (26 people received hypocaloric diet, metformin 500 mg twice daily, rosuvastatin 10 mg 1 time per day, canephron N (50 mg 3 times a day, S-adenosylmethionine (Agepta (SAM as hepatoprotective drug (200 mg 3 times daily sublingually during 90 days. The third group (25 people received hypocaloric diet, metformin 500 mg twice daily, rosuvastatin 10 mg 1 time per day, canephron N (50 mg 3 times a day, SAM (Agepta (200 mg 3 times a day sublingually and meldonium (Vazonat (250 mg 2 times a day during 90 days. The analysis of clinical manifestations of NASH and CKN of the III stage, biochemical, laboratory parameters of the functional state of the liver, kidneys, endothelium, ultrasonographic data were studied in dynamics in 30 and 90 days during treatment and in 3 months after the treatment. Results. The investigation found that S-adenosylmethionine (Agepta and meldonium (Vasonat in patients with non-alcoholic steatohepatitis with obesity and chronic kidney disease of I–II stage have positive metabolic effects which potentiate the effect of statins and insulin sensitizers

Diurnal changes in polyamine content, arginine and ornithine decarboxylase, and diamine oxidase in tobacco leaves

Czech Academy of Sciences Publication Activity Database

Gemperlová, Lenka; Nováková, Marie; Vaňková, Radomíra; Eder, Josef; Cvikrová, Milena

2006-01-01

Roč. 57, č. 6 (2006), s. 1413-1421 ISSN 0022-0957 R&D Projects: GA ČR GA206/03/0369 Institutional research plan: CEZ:AV0Z50380511 Keywords : Arginine decarboxylase * diamine oxidase * ornithine decarboxylase Subject RIV: ED - Physiology Impact factor: 3.630, year: 2006

Evolutionary Profiling of Group II Pyridoxal-Phosphate-Dependent Decarboxylases Suggests Expansion and Functional Diversification of Histidine Decarboxylases in Tomato

Directory of Open Access Journals (Sweden)

Rahul Kumar

2016-03-01

Full Text Available Pyridoxal phosphate (PLP-dependent enzymes are one of the most important enzymes involved in plant N metabolism. Here, we explored the evolution of group II PLP-dependent decarboxylases (PLP_deC, including aromatic L-amino acid decarboxylase, glutamate decarboxylase, and histidine decarboxylase in the plant lineage. Gene identification analysis revealed a higher number of genes encoding PLP_deC in higher plants than in lower plants. Expression profiling of PLP_deC orthologs and syntelogs in (L. Heynh., pepper ( L., and tomato ( L. pointed toward conserved as well as distinct roles in developmental processes such as fruit maturation and ripening and abiotic stress responses. We further characterized a putative promoter of tomato ripening-associated gene ( operating in a complex regulatory circuit. Our analysis provides a firm basis for further in-depth exploration of the PLP_deC gene family, particularly in the economically important Solanaceae family.

Sugarcane genes differentially expressed in response to Puccinia melanocephala infection: identification and transcript profiling.

Science.gov (United States)

Oloriz, María I; Gil, Víctor; Rojas, Luis; Portal, Orelvis; Izquierdo, Yovanny; Jiménez, Elio; Höfte, Monica

2012-05-01

Brown rust caused by the fungus Puccinia melanocephala is a major disease of sugarcane (Saccharum spp.). A sugarcane mutant, obtained by chemical mutagenesis of the susceptible variety B4362, showed a post-haustorial hypersensitive response (HR)-mediated resistance to the pathogen and was used to identify genes differentially expressed in response to P. melanocephala via suppression subtractive hybridization (SSH). Tester cDNA was derived from the brown rust-resistant mutant after inoculation with P. melanocephala, while driver cDNAs were obtained from the non-inoculated resistant mutant and the inoculated susceptible donor variety B4362. Database comparisons of the sequences of the SSH recombinant clones revealed that, of a subset of 89 non-redundant sequences, 88% had similarity to known functional genes, while 12% were of unknown function. Thirteen genes were selected for transcript profiling in the resistant mutant and the susceptible donor variety. Genes involved in glycolysis and C4 carbon fixation were up-regulated in both interactions probably due to disturbance of sugarcane carbon metabolism by the pathogen. Genes related with the nascent polypeptide associated complex, post-translational proteome modulation and autophagy were transcribed at higher levels in the compatible interaction. Up-regulation of a putative L-isoaspartyl O-methyltransferase S-adenosylmethionine gene in the compatible interaction may point to fungal manipulation of the cytoplasmatic methionine cycle. Genes coding for a putative no apical meristem protein, S-adenosylmethionine decarboxylase, non-specific lipid transfer protein, and GDP-L-galactose phosphorylase involved in ascorbic acid biosynthesis were up-regulated in the incompatible interaction at the onset of haustorium formation, and may contribute to the HR-mediated defense response in the rust-resistant mutant.

S-Adenosylmethionine attenuates bile duct early warm ischemia reperfusion injury after rat liver transplantation.

Science.gov (United States)

Tang, Yong; Chu, Hongpeng; Cao, Guojun; Du, Xiaolong; Min, Xiaobo; Wan, Chidan

2018-03-01

Warm ischemia reperfusion injury (IRI) plays a key role in biliary complication, which is a substantial vulnerability of liver transplantation. The early pathophysiological changes of IRI are characterized by an excessive inflammatory response. S-Adenosylmethionine (SAM) is an important metabolic intermediate that modulates inflammatory reactions; however, its role in bile duct warm IRI is not known. In this study, male rats were treated with or without SAM (170 μmol/kg body weight) after orthotopic autologous liver transplantation. The histopathological observations showed that bile duct injury in the IRI group was more serious than in the SAM group. The alanine aminotransferase (ALT), alkaline phosphatase (ALP) and direct bilirubin (DBIL) levels in the serum of the IRI group were significantly increased compared to the SAM group (P liver and bile duct tissues, down-regulated TNF-α levels and up-regulated IL-10 expression in bile duct tissues compared to the IRI group (P livers were much higher compared to those in SAM-treated rats at 24 h after liver transplantation (P bile ducts against warm IRI by suppressing oxidative stress, inflammatory reactions and apoptosis of biliary epithelial cells after liver transplantation.α. Copyright © 2018 Elsevier Ltd. All rights reserved.

MCD encodes peroxisomal and cytoplasmic forms of malonyl-CoA decarboxylase and is mutated in malonyl-CoA decarboxylase deficiency

NARCIS (Netherlands)

Sacksteder, K. A.; Morrell, J. C.; Wanders, R. J.; Matalon, R.; Gould, S. J.

1999-01-01

Malonyl-CoA decarboxylase (MCD) catalyzes the proton-consuming conversion of malonyl-CoA to acetyl-CoA and CO(2). Although defects in MCD activity are associated with malonyl-CoA decarboxylase deficiency, a lethal disorder characterized by cardiomyopathy and developmental delay, the metabolic role

Retinoic acid modulation of ultraviolet light-induced epidermal ornithine decarboxylase activity

International Nuclear Information System (INIS)

Lowe, N.J.; Breeding, J.

1982-01-01

Irradiation of skin with ultraviolet light of sunburn range (UVB) leads to a large and rapid induction of the polyamine biosynthetic enzyme ornithine decarboxylase in the epidermis. Induction of epidermal ornithine decarboxylase also occurs following application of the tumor promoting agent 12-0-tetradecanoylphorbol-13 acetate and topical retinoic acid is able to block both this ornithine decarboxylase induction and skin tumor promotion. In the studies described below, topical application of retinoic acid to hairless mouse skin leads to a significant inhibition of UVB-induced epidermal ornithine decarboxylase activity. The degree of this inhibition was dependent on the dose, timing, and frequency of the application of retinoic acid. To show significant inhibition of UVB-induced ornithine decarboxylase the retinoic acid had to be applied within 5 hr of UVB irradiation. If retinoic acid treatment was delayed beyond 7 hr following UVB, then no inhibition of UVB-induced ornithine decarboxylase was observed. The quantities of retinoic acid used (1.7 nmol and 3.4 nmol) have been shown effective at inhibiting 12-0-tetradecanoyl phorbol-13 acetate induced ornithine decarboxylase. The results show that these concentrations of topical retinoic acid applied either before or immediately following UVB irradiation reduces the UVB induction of epidermal ornithine decarboxylase. The effect of retinoic acid in these regimens on UVB-induced skin carcinogenesis is currently under study

Aroma biosynthesis in strawberry: s-adenosylmethionine:furaneol o-methyltransferase activity in ripening fruits.

Science.gov (United States)

Lavid, Noa; Schwab, Wilfried; Kafkas, Ebru; Koch-Dean, Margery; Bar, Einat; Larkov, Olga; Ravid, Uzi; Lewinsohn, Efraim

2002-07-03

Among the most important volatile compounds in the aroma of strawberries are 2,5-dimethyl-4-hydroxy-3(2H)-furanone (Furaneol) and its methoxy derivative (methoxyfuraneol, mesifuran). Three strawberry varieties, Malach, Tamar, and Yael, were assessed for total volatiles, Furaneol, and methoxyfuraneol. The content of these compounds sharply increased during fruit ripening, with maximum values at the ripe stage. An enzymatic activity that transfers a methyl group from S-adenosylmethionine (SAM) to Furaneol sharply increases during ripening of strawberry fruits. The in vitro generated methoxyfuraneol was identified by radio-TLC and GC-MS. The partially purified enzyme had a native molecular mass of approximately 80 kDa, with optimum activity at pH 8.5 and 37 degrees C. A high apparent K(m) of 5 mM was calculated for Furaneol, whereas this enzyme preparation apparently accepted as substrates other o-dihydroxyphenol derivatives (such as catechol, caffeic acid, and protocatechuic aldehyde) with much higher affinities (K(m) approximately 105, 130, and 20 microM, respectively). A K(m) for SAM was found to be approximately 5 microM, regardless of the acceptor used. Substrates that contained a phenolic group with only one OH group, such as p-coumaric and trans-ferulic acid, as well as trans-anol and coniferyl alcohol, were apparently not accepted by this activity. It is suggested that Furaneol methylation is mediated by an O-methyltransferase activity and that this activity increases during fruit ripening.

Molecular cloning and expression of gene encoding aromatic amino acid decarboxylase in 'Vidal blanc' grape berries.

Science.gov (United States)

Pan, Qiu-Hong; Chen, Fang; Zhu, Bao-Qing; Ma, Li-Yan; Li, Li; Li, Jing-Ming

2012-04-01

The pleasantly fruity and floral 2-phenylethanol are a dominant aroma compound in post-ripening 'Vidal blanc' grapes. However, to date little has been reported about its synthetic pathway in grapevine. In the present study, a full-length cDNA of VvAADC (encoding aromatic amino acid decarboxylase) was firstly cloned from the berries of 'Vidal blanc', an interspecific hybrid variety of Vitis vinifera × Vitis riparia. This sequence encodes a complete open reading frame of 482 amino acids with a calculated molecular mass of 54 kDa and isoelectric point value (pI) of 5.73. The amino acid sequence deduced shared about 79% identity with that of aromatic L: -amino acid decarboxylases (AADCs) from tomato. Real-time PCR analysis indicated that VvAADC transcript abundance presented a small peak at 110 days after full bloom and then a continuous increase at the berry post-ripening stage, which was consistent with the accumulation of 2-phenylethanol, but did not correspond to the trends of two potential intermediates, phenethylamine and 2-phenylacetaldehyde. Furthermore, phenylalanine still exhibited a continuous increase even in post-ripening period. It is thus suggested that 2-phenylethanol biosynthetic pathway mediated by AADC exists in grape berries, but it has possibly little contribution to a considerable accumulation of 2-phenylethanol in post-ripening 'Vidal blanc' grapes.

Evaluation of oxalate decarboxylase and oxalate oxidase for industrial applications.

Science.gov (United States)

Cassland, Pierre; Sjöde, Anders; Winestrand, Sandra; Jönsson, Leif J; Nilvebrant, Nils-Olof

2010-05-01

Increased recirculation of process water has given rise to problems with formation of calcium oxalate incrusts (scaling) in the pulp and paper industry and in forest biorefineries. The potential in using oxalate decarboxylase from Aspergillus niger for oxalic acid removal in industrial bleaching plant filtrates containing oxalic acid was examined and compared with barley oxalate oxidase. Ten different filtrates from chemical pulping were selected for the evaluation. Oxalate decarboxylase degraded oxalic acid faster than oxalate oxidase in eight of the filtrates, while oxalate oxidase performed better in one filtrate. One of the filtrates inhibited both enzymes. The potential inhibitory effect of selected compounds on the enzymatic activity was tested. Oxalate decarboxylase was more sensitive than oxalate oxidase to hydrogen peroxide. Oxalate decarboxylase was not as sensitive to chlorate and chlorite as oxalate oxidase. Up to 4 mM chlorate ions, the highest concentration tested, had no inhibitory effect on oxalate decarboxylase. Analysis of the filtrates suggests that high concentrations of chlorate present in some of the filtrates were responsible for the higher sensitivity of oxalate oxidase in these filtrates. Oxalate decarboxylase was thus a better choice than oxalate oxidase for treatment of filtrates from chlorine dioxide bleaching.

Activities of arginine and ornithine decarboxylases in various plant species.

Science.gov (United States)

Birecka, H; Bitonti, A J; McCann, P P

1985-10-01

In extracts from the youngest leaves of Avena sativa, Hordeum vulgare, Zea Mays, Pisum sativum, Phaseolus vulgaris, Lactuca sativa, and four pyrrolizidine alkaloid-bearing species of Heliotropium, the activities of ornithine decarboxylase, close to V(max), ranged between traces and 1.5 nanomoles per hour per gram fresh weight when based on putrescine formed during incubation with labeled ornithine. The arginine decarboxylase activities in the same extracts ranged between 8 and 8000 nanomoles per hour per gram fresh weight being lowest in the borages and highest in oat and barley. alpha-Difluoromethylornithine and alpha-difluoromethylarginine inhibited ornithine and arginine decarboxylases, respectively, in all species. Agmatine, putrescine, spermidine, and spermine were found in all, diaminopropane in eight, and cadaverine in three species.No correlation was observed between arginine or ornithine decarboxylase level and the levels of total polyamines. The in vitro decarboxylase activities found in the borages cannot explain the high accumulation of putrescine-derived pyrrolizidines in their youngest leaves if the pyrrolizidines are produced in situ from arginine and/or ornithine as precursors; other possibilities are discussed.In assays of ornithine decarboxylase, an interference of decarboxylation not due to this enzyme was observed in extracts from all species. In arginine decarboxylase assays, the interfering decarboxylation as well as the interference of arginase were apparent in two species. Addition of aminoguanidine was needed to suppress oxidative degradation of putrescine and agmatine during incubation of extracts from pea, bean, lettuce, Heliotropium angiospermum, and Heliotropium indicum.

Methionine metabolism in apple tissue: implications of S-adenosylmethionine as an intermediate in the conversion of methionine to ethylene

International Nuclear Information System (INIS)

Adams, D.O.; Yang, S.F.

1977-01-01

If S-adenosylmethionine (SAM) is the direct precursor of ethylene as previously proposed, it is expected that 5'-S-methyl-5'-thioadenosine (MTA) would be the fragment nucleoside. When [Me- 14 C] or ( 35 S)methionine was fed to climacteric apple (Malus sylvestris Mill) tissue, radioactive 5-S-methyl-5-thioribose (MTR) was identified as the predominant product and MTA as a minor one. When the conversion of methionine into ethylene was inhibited by L-2-amino-4-(2'-amino-ethoxy)-trans-3-butenoic acid, the conversion of ( 35 S) or (Me- 14 C)methionine into MTR was similarly inhibited. Furthermore, the formation of MTA and MTR from ( 35 S)methionine was observed only in climacteric tissue which produced ethylene and actively converted methionine to ethylene but not in preclimacteric tissue which did not produce ethylene or convert methionine to ethylene. These observations suggest that the conversion of methionine into MTA and MTR is closely related to ethylene biosynthesis and provide indirect evidence that SAM may be an intermediate in the conversion of methionine to ethylene. When ( 35 S)MTA was fed to climacteric or preclimacteric apple tissue, radioactivity was efficiently incorporated into MTR and methionine. However, when ( 35 S)MTR was administered, radioactivity was efficiently incorporated into methionine but not MTA. A scheme is presented for the production of ethylene from methionine

A Dopa Decarboxylase Modulating the Immune Response of Scallop Chlamys farreri

Science.gov (United States)

Zhou, Zhi; Yang, Jialong; Wang, Lingling; Zhang, Huan; Gao, Yang; Shi, Xiaowei; Wang, Mengqiang; Kong, Pengfei; Qiu, Limei; Song, Linsheng

2011-01-01

Background Dopa decarboxylase (DDC) is a pyridoxal 5-phosphate (PLP)-dependent enzyme that catalyzes the decarboxylation of L-Dopa to dopamine, and involved in complex neuroendocrine-immune regulatory network. The function for DDC in the immunomodulation remains unclear in invertebrate. Methodology The full-length cDNA encoding DDC (designated CfDDC) was cloned from mollusc scallop Chlamys farreri. It contained an open reading frame encoding a polypeptide of 560 amino acids. The CfDDC mRNA transcripts could be detected in all the tested tissues, including the immune tissues haemocytes and hepatopancreas. After scallops were treated with LPS stimulation, the mRNA expression level of CfDDC in haemocytes increased significantly (5.5-fold, PDDC inhibitor methyldopa, the ROS level in haemocytes of scallops was decreased significantly to 0.41-fold (PDDC in scallop, modulated the immune responses such as haemocytes encapsulation as well as the ROS level through its catalytic activity, functioning as an indispensable immunomodulating enzyme in the neuroendocrine-immune regulatory network of mollusc. PMID:21533240

cDNA library information - Dicty_cDB | LSDB Archive [Life Science Database Archive metadata

Lifescience Database Archive (English)

Full Text Available List Contact us Dicty_cDB cDNA library information Data detail Data name cDNA library information DOI 10.189...s Data item Description cDNA library name Names of cDNA libraries (AF, AH, CF, CH, FC, FC-IC, FCL, SF, SH, S...(C) 5) sexually fusion-competent KAX3 cells (Gamete phase) (F) cDNA library construction method How to construct cDNA library...dir) 2) Full-length cDNA libraries (oligocapped method)(fl) 3) Gamete-specific subtraction library (sub) cDNA library... construction protocol Link to the webpage describing the protocol for generating cDNA library Size

Cysteinesulfinate decarboxylase: Characterization, inhibition, and metabolic role in taurine formation

International Nuclear Information System (INIS)

Weinstein, C.L.

1988-01-01

Cysteinesulfinate decarboxylase, an enzyme that plays a major role in the formation of taurine from cysteine, has been purified from rat liver to homogeneity and characterized. The physical properties of the enzyme were studied, along with its substrate specificity. Multiple forms of the enzyme were found in rat liver, kidney, and brain with isoelectric points ranging from pH 5.6 to 4.9. These multiple forms did not differ in their substrate specificity. It was found by using gel electrofocusing and polyclonal antibodies raised to the liver enzyme that the different forms of cysteinesulfinate decarboxylase are identical in the various rat tissues studied. Various inhibitors of the enzyme were tested both in vitro and in vivo in order to evaluate the role of cysteinesulfinate decarboxylase in taurine formation in mammalian tissues. In in vitro studies, cysteinesulfinate decarboxylase was irreversibly inhibited by β-ethylidene-DL-aspartate (Ki = 10 mM), and competitive inhibition was found using mercaptomethylsuccinate (Ki = 0.1 mM) and D-cysteinesulfinate (Ki = 0.32 mM) when L-cysteinesulfinate was used as a substrate. In order to be able to test these inhibitors in vivo, L-[1- 14 C]cysteinesulfonate was evaluated as a probe for the in vivo measurement of cysteinesulfinate decarboxylase activity. The metabolism of cysteinesulfonate and the product of its transamination, β-sulfopyruvate, was studied, and it was found that L-[1- 14 C]cysteinesulfonate is an accurate and convenient probe for cysteinesulfinate decarboxylase activity. Using L-[1- 14 C]cysteinesulfonate, it was found that D-cysteinesulfinate inhibits cysteinesulfinate decarboxylase activity by greater than 90% in the intact mouse and that inhibition lasts for up to fifteen hours

Uncovering the Lactobacillus plantarum WCFS1 Gallate Decarboxylase Involved in Tannin Degradation

Science.gov (United States)

Jiménez, Natalia; Curiel, José Antonio; Reverón, Inés; de las Rivas, Blanca

2013-01-01

Lactobacillus plantarum is a lactic acid bacterium able to degrade tannins by the subsequent action of tannase and gallate decarboxylase enzymes. The gene encoding tannase had previously been identified, whereas the gene encoding gallate decarboxylase is unknown. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) of gallic-acid induced L. plantarum extracts showed a 54-kDa protein which was absent in the uninduced cells. This protein was identified as Lp_2945, putatively annotated UbiD. Homology searches identified ubiD-like genes located within three-gene operons which encoded the three subunits of nonoxidative aromatic acid decarboxylases. L. plantarum is the only bacterium in which the lpdC (lp_2945) gene and the lpdB and lpdD (lp_0271 and lp_0272) genes are separated in the chromosome. Combination of extracts from recombinant Escherichia coli cells expressing the lpdB, lpdC, and lpdC genes demonstrated that LpdC is the only protein required to yield gallate decarboxylase activity. However, the disruption of these genes in L. plantarum revealed that the lpdB and lpdC gene products are essential for gallate decarboxylase activity. Similar to L. plantarum tannase, which exhibited activity only in esters derived from gallic and protocatechuic acids, purified His6-LpdC protein from E. coli showed decarboxylase activity against gallic and protocatechuic acids. In contrast to the tannase activity, gallate decarboxylase activity is widely present among lactic acid bacteria. This study constitutes the first genetic characterization of a gallate decarboxylase enzyme and provides new insights into the role of the different subunits of bacterial nonoxidative aromatic acid decarboxylases. PMID:23645198

Activities of Arginine and Ornithine Decarboxylases in Various Plant Species 1

Science.gov (United States)

Birecka, Helena; Bitonti, Alan J.; McCann, Peter P.

1985-01-01

In extracts from the youngest leaves of Avena sativa, Hordeum vulgare, Zea Mays, Pisum sativum, Phaseolus vulgaris, Lactuca sativa, and four pyrrolizidine alkaloid-bearing species of Heliotropium, the activities of ornithine decarboxylase, close to Vmax, ranged between traces and 1.5 nanomoles per hour per gram fresh weight when based on putrescine formed during incubation with labeled ornithine. The arginine decarboxylase activities in the same extracts ranged between 8 and 8000 nanomoles per hour per gram fresh weight being lowest in the borages and highest in oat and barley. α-Difluoromethylornithine and α-difluoromethylarginine inhibited ornithine and arginine decarboxylases, respectively, in all species. Agmatine, putrescine, spermidine, and spermine were found in all, diaminopropane in eight, and cadaverine in three species. No correlation was observed between arginine or ornithine decarboxylase level and the levels of total polyamines. The in vitro decarboxylase activities found in the borages cannot explain the high accumulation of putrescine-derived pyrrolizidines in their youngest leaves if the pyrrolizidines are produced in situ from arginine and/or ornithine as precursors; other possibilities are discussed. In assays of ornithine decarboxylase, an interference of decarboxylation not due to this enzyme was observed in extracts from all species. In arginine decarboxylase assays, the interfering decarboxylation as well as the interference of arginase were apparent in two species. Addition of aminoguanidine was needed to suppress oxidative degradation of putrescine and agmatine during incubation of extracts from pea, bean, lettuce, Heliotropium angiospermum, and Heliotropium indicum. PMID:16664442

cDNA Cloning, expression and characterization of an allergenic 60s ribosomal protein of almond (prunus dulcis).

Science.gov (United States)

Abolhassani, Mohsen; Roux, Kenneth H

2009-06-01

Tree nuts, including almond (prunus dulcis) are a source of food allergens often associated with life-threatening allergic reactions in susceptible individuals. Although the proteins in almonds have been biochemically characterized, relatively little has been reported regarding the identity of the allergens involved in almond sensitivity. The present study was undertaken to identify the allergens of the almond by cDNA library approach. cDNA library of almond seeds was constructed in Uni-Zap XR lamda vector and expressed in E. coli XL-1 blue. Plaques were immunoscreened with pooled sera of allergic patients. The cDNA clone reacting significantly with specific IgE antibodies was selected and subcloned and subsequently expressed in E. coli. The amino acids deducted from PCR product of clone showed homology to 60s acidic ribosomal protein of almond. The expressed protein was 11,450 Dalton without leader sequence. Immunoreactivity of the recombinant 60s ribosomal protein (r60sRP) was evaluated with dot blot analysis using pooled and individual sera of allergic patients. The data showed that r60sRP and almond extract (as positive control) possess the ability to bind the IgE antibodies. The results showed that expressed protein is an almond allergen.Whether this r60sRP represents a major allergen of almond needs to be further studied which requires a large number of sera from the almond atopic patients and also need to determine the IgE-reactive frequencies of each individual allergen.

[Preparation of the cDNA microarray on the differential expressed cDNA of senescence-accelerated mouse's hippocampus].

Science.gov (United States)

Cheng, Xiao-Rui; Zhou, Wen-Xia; Zhang, Yong-Xiang

2006-05-01

Alzheimer' s disease (AD) is the most common form of dementia in the elderly. AD is an invariably fatal neurodegenerative disorder with no effective treatment. Senescence-accelerated mouse prone 8 (SAMP8) is a model for studying age-related cognitive impairments and also is a good model to study brain aging and one of mouse model of AD. The technique of cDNA microarray can monitor the expression levels of thousands of genes simultaneously and can be used to study AD with the character of multi-mechanism, multi-targets and multi-pathway. In order to disclose the mechanism of AD and find the drug targets of AD, cDNA microarray containing 3136 cDNAs amplified from the suppression subtracted cDNA library of hippocampus of SAMP8 and SAMR1 was prepared with 16 blocks and 14 x 14 pins, the housekeeping gene beta-actin and G3PDH as inner conference. The background of this microarray was low and unanimous, and dots divided evenly. The conditions of hybridization and washing were optimized during the hybridization of probe and target molecule. After the data of hybridization analysis, the differential expressed cDNAs were sequenced and analyzed by the bioinformatics, and some of genes were quantified by the real time RT-PCR and the reliability of this cDNA microarray were validated. This cDNA microarray may be the good means to select the differential expressed genes and disclose the molecular mechanism of SAMP8's brain aging and AD.

Low sulfide levels and a high degree of cystathionine β-synthase (CBS activation by S-adenosylmethionine (SAM in the long-lived naked mole-rat

Directory of Open Access Journals (Sweden)

Maja Dziegelewska

2016-08-01

Full Text Available Hydrogen sulfide (H2S is a gaseous signalling molecule involved in many physiological and pathological processes. There is increasing evidence that H2S is implicated in aging and lifespan control in the diet-induced longevity models. However, blood sulfide concentration of naturally long-lived species is not known. Here we measured blood sulfide in the long-lived naked mole-rat and five other mammalian species considerably differing in lifespan and found a negative correlation between blood sulfide and maximum longevity residual. In addition, we show that the naked mole-rat cystathionine β-synthase (CBS, an enzyme whose activity in the liver significantly contributes to systemic sulfide levels, has lower activity in the liver and is activated to a higher degree by S-adenosylmethionine compared to other species. These results add complexity to the understanding of the role of H2S in aging and call for detailed research on naked mole-rat transsulfuration.

Regulation of polyamine synthesis in plants. Final progress report, July 1, 1991--December 31, 1994

Energy Technology Data Exchange (ETDEWEB)

Malmberg, R.L.

1995-07-01

This research focused on unusual post-translational modifications occuring in a arginine decarboxylase cDNA clone in oats. A novel regulatory mechanism for polyamines was explored and an attempt was made to characterize it. A plant ornithine decarboxylase cDNA was identified in Arabidopsis. Further work remains on the mechanisms of polyamine regulation and function in plants.

Second-strand cDNA synthesis: classical method

International Nuclear Information System (INIS)

Gubler, U.

1987-01-01

The classical scheme for the synthesis of double-stranded cDNA as it was reported in 1976 is described. Reverse transcription of mRNA with oligo(dT) as the primer generates first strands with a small loop at the 3' end of the cDNA (the end that corresponds to the 5' end of the mRNA). Subsequent removal of the mRNA by alkaline hydrolysis leaves single-stranded cDNA molecules again with a small 3' loop. This loop can be used by either reverse transcriptase or Klenow fragment of DNA polymerase I as a primer for second-strand synthesis. The resulting products are double-stranded cDNA molecules that are covalently closed at the end corresponding to the 5' end of the original mRNA. Subsequent cleavage of the short piece of single-stranded cDNA within the loop with the single-strand-specific S 1 nuclease generate open double-stranded molecules that can be used for molecular cloning in plasmids or in phage. Useful variations of this scheme have been described

Role of polyamines at the G1/S boundary and G2/M phase of the cell cycle.

Science.gov (United States)

Yamashita, Tomoko; Nishimura, Kazuhiro; Saiki, Ryotaro; Okudaira, Hiroyuki; Tome, Mayuko; Higashi, Kyohei; Nakamura, Mizuho; Terui, Yusuke; Fujiwara, Kunio; Kashiwagi, Keiko; Igarashi, Kazuei

2013-06-01

The role of polyamines at the G1/S boundary and in the G2/M phase of the cell cycle was studied using synchronized HeLa cells treated with thymidine or with thymidine and aphidicolin. Synchronized cells were cultured in the absence or presence of α-difluoromethylornithine (DFMO), an inhibitor of ornithine decarboxylase, plus ethylglyoxal bis(guanylhydrazone) (EGBG), an inhibitor of S-adenosylmethionine decarboxylase. When polyamine content was reduced by treatment with DFMO and EGBG, the transition from G1 to S phase was delayed. In parallel, the level of p27(Kip1) was greatly increased, so its mechanism was studied in detail. Synthesis of p27(Kip1) was stimulated at the level of translation by a decrease in polyamine levels, because of the existence of long 5'-untranslated region (5'-UTR) in p27(Kip1) mRNA. Similarly, the transition from the G2/M to the G1 phase was delayed by a reduction in polyamine levels. In parallel, the number of multinucleate cells increased by 3-fold. This was parallel with the inhibition of cytokinesis due to an unusual distribution of actin and α-tubulin at the M phase. Since an association of polyamines with chromosomes was not observed by immunofluorescence microscopy at the M phase, polyamines may have only a minor role in structural changes of chromosomes at the M phase. In general, the involvement of polyamines at the G2/M phase was smaller than that at the G1/S boundary. Copyright © 2013 Elsevier Ltd. All rights reserved.

Characterisation of a thiamine diphosphate-dependent alpha-keto acid decarboxylase from Proteus mirabilis JN458.

Science.gov (United States)

Wang, Biying; Bai, Yajun; Fan, Taiping; Zheng, Xiaohui; Cai, Yujie

2017-10-01

Alpha-keto acid decarboxylases can convert keto acids to their corresponding aldehydes, which are often volatile aroma compounds. The gene encoding α-keto acid decarboxylase in Proteus mirabilis JN458 was cloned, and the enzyme overexpressed in Escherichia coli BL21 (DE3), purified in high yield, and characterised. The molecular weight is 62.291kDa by MALDI-TOF MS, and optimum activity at pH 6.0 and 40-50°C. The enzyme is a typical decarboxylase, dependent on thiamine diphosphate and Mg 2+ as cofactors. For the decarboxylation reaction, the enzyme displayed a broad substrate range. Kinetic parameters were determined using 4-methyl-2-oxopentanoic acid, phenyl pyruvate and 3-methyl-2-oxopentanoic acid as substrates. K m and k cat values for phenyl pyruvate were 0.62mM and 77.38s -1 , respectively, and the k cat /K m value was 124.81mM -1 s -1 . The enzyme properties suggest it may act effectively under cheese ripening conditions. Copyright © 2017. Published by Elsevier Ltd.

Mouse tetranectin: cDNA sequence, tissue-specific expression, and chromosomal mapping

DEFF Research Database (Denmark)

Ibaraki, K; Kozak, C A; Wewer, U M

1995-01-01

regulation, mouse tetranectin cDNA was cloned from a 16-day-old mouse embryo library. Sequence analysis revealed a 992-bp cDNA with an open reading frame of 606 bp, which is identical in length to the human tetranectin cDNA. The deduced amino acid sequence showed high homology to the human cDNA with 76......(s) of tetranectin. The sequence analysis revealed a difference in both sequence and size of the noncoding regions between mouse and human cDNAs. Northern analysis of the various tissues from mouse, rat, and cow showed the major transcript(s) to be approximately 1 kb, which is similar in size to that observed...

Polyunsaturated Fatty Acid and S-Adenosylmethionine Supplementation in Predementia Syndromes and Alzheimer's Disease: A Review

Directory of Open Access Journals (Sweden)

Francesco Panza

2009-01-01

Full Text Available A growing body of evidence indicates that nutritional supplements can improve cognition; however, which supplements are effective remains controversial. In this review article, we focus on dietary supplementation suggested for predementia syndromes and Alzheimer’s disease (AD, with particular emphasis on S-adenosylmethionine (SAM and polyunsaturated fatty acids (PUFA. Very recent findings confirmed that SAM can exert a direct effect on glutathione S-transferase (GST activity. AD is accompanied by reduced GST activity, diminished SAM, and increased S-adenosylhomocysteine (SAH, the downstream metabolic product resulting from SAM-mediated transmethylation reactions, when deprived of folate. Therefore, these findings underscored the critical role of SAM in maintenance of neuronal health, suggesting a possible role of SAM as a neuroprotective dietary supplement for AD patients. In fact, very recent studies on early-stage AD patients and moderate- to late-stage AD patients were conducted with a nutriceutical supplementation that included SAM, with promising results. Given recent findings from randomized clinical trials (RCTs in which n-3 PUFA supplementation was effective only in very mild AD subgroups or mild cognitive impairment (MCI, we suggest future intervention trials using measures of dietary supplementation (dietary n-3 PUFA and SAM plus B vitamin supplementation to determine if such supplements will reduce the risk for cognitive decline in very mild AD and MCI. Therefore, key supplements are not necessarily working in isolation and the most profound impact, or in some cases the only impact, is noted very early in the course of AD, suggesting that nutriceutical supplements may bolster pharmacological approaches well past the window where supplements can work on their own. Recommendations regarding future research on the effects of SAM or n-3 PUFA supplementation on predementia syndromes and very mild AD include properly designed RCTs that are

Low sulfide levels and a high degree of cystathionine β-synthase (CBS) activation by S-adenosylmethionine (SAM) in the long-lived naked mole-rat.

Science.gov (United States)

Dziegelewska, Maja; Holtze, Susanne; Vole, Christiane; Wachter, Ulrich; Menzel, Uwe; Morhart, Michaela; Groth, Marco; Szafranski, Karol; Sahm, Arne; Sponholz, Christoph; Dammann, Philip; Huse, Klaus; Hildebrandt, Thomas; Platzer, Matthias

2016-08-01

Hydrogen sulfide (H2S) is a gaseous signalling molecule involved in many physiological and pathological processes. There is increasing evidence that H2S is implicated in aging and lifespan control in the diet-induced longevity models. However, blood sulfide concentration of naturally long-lived species is not known. Here we measured blood sulfide in the long-lived naked mole-rat and five other mammalian species considerably differing in lifespan and found a negative correlation between blood sulfide and maximum longevity residual. In addition, we show that the naked mole-rat cystathionine β-synthase (CBS), an enzyme whose activity in the liver significantly contributes to systemic sulfide levels, has lower activity in the liver and is activated to a higher degree by S-adenosylmethionine compared to other species. These results add complexity to the understanding of the role of H2S in aging and call for detailed research on naked mole-rat transsulfuration. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

PCR-based cDNA library construction: general cDNA libraries at the level of a few cells.

OpenAIRE

Belyavsky, A; Vinogradova, T; Rajewsky, K

1989-01-01

A procedure for the construction of general cDNA libraries is described which is based on the amplification of total cDNA in vitro. The first cDNA strand is synthesized from total RNA using an oligo(dT)-containing primer. After oligo(dG) tailing the total cDNA is amplified by PCR using two primers complementary to oligo(dA) and oligo(dG) ends of the cDNA. For insertion of the cDNA into a vector a controlled trimming of the 3' ends of the cDNA by Klenow enzyme was used. Starting from 10 J558L ...

Glutamic acid decarboxylase isoform distribution in transgenic mouse septum: an anti-GFP immunofluorescence study.

Science.gov (United States)

Verimli, Ural; Sehirli, Umit S

2016-09-01

The septum is a basal forebrain region located between the lateral ventricles in rodents. It consists of lateral and medial divisions. Medial septal projections regulate hippocampal theta rhythm whereas lateral septal projections are involved in processes such as affective functions, memory formation, and behavioral responses. Gamma-aminobutyric acidergic neurons of the septal region possess the 65 and 67 isoforms of the enzyme glutamic acid decarboxylase. Although data on the glutamic acid decarboxylase isoform distribution in the septal region generally appears to indicate glutamic acid decarboxylase 67 dominance, different studies have given inconsistent results in this regard. The aim of this study was therefore to obtain information on the distributions of both of these glutamic acid decarboxylase isoforms in the septal region in transgenic mice. Two animal groups of glutamic acid decarboxylase-green fluorescent protein knock-in transgenic mice were utilized in the experiment. Brain sections from the region were taken for anti-green fluorescent protein immunohistochemistry in order to obtain estimated quantitative data on the number of gamma-aminobutyric acidergic neurons. Following the immunohistochemical procedures, the mean numbers of labeled cells in the lateral and medial septal nuclei were obtained for the two isoform groups. Statistical analysis yielded significant results which indicated that the 65 isoform of glutamic acid decarboxylase predominates in both lateral and medial septal nuclei (unpaired two-tailed t-test p glutamic acid decarboxylase isoform 65 in the septal region in glutamic acid decarboxylase-green fluorescent protein transgenic mice.

Nonalcoholic fatty liver disease: Update on pathogenesis, diagnosis, treatment and the role of S-adenosylmethionine

Science.gov (United States)

Mato, José M; Lu, Shelly C

2015-01-01

Nonalcoholic fatty liver disease (NAFLD) is currently the most common liver disease worldwide affecting over one-third of the population in the U.S. It has been associated with obesity, type 2 diabetes, hyperlipidemia, and insulin resistance and is initiated by the accumulation of triglycerides in hepatocytes. Isolated hepatic steatosis (IHS) remains a benign process, while a subset develops superimposed inflammatory activity and progression to nonalcoholic steatohepatitis (NASH) with or without fibrosis. However, the molecular mechanisms underlying NAFLD progression are not completely understood. Liver biopsy is still required to differentiate IHS from NASH as easily accessible noninvasive biomarkers are lacking. In terms of treatments for NASH, pioglitazone, vitamin E, and obeticholic acid have shown some benefit. All of these agents have potential complications associated with long-term use. Nowadays, a complex hypothesis suggests that multiple parallel hits are involved in NASH development. However, the ‘key switch’ between IHS and NASH remains to be discovered. We have recently shown that knocking out enzymes involved in S-adenosylmethionine (SAMe) metabolism, the main biological methyl donor in humans that is abundant in the liver, will lead to NASH development in mice. This could be due to the fact that a normal SAMe level is required to establish the proper ratio of phosphatidylethanolamine to phosphatidylcholine that has been found to be important in NAFLD progression. New data from humans have also suggested that these enzymes play a role in the pathogenesis of NAFLD and that some of SAMe cycle metabolites may serve as noninvasive biomarkers of NASH. In this review, we discuss the evidence of the role of SAMe in animal models and humans with NAFLD and how studying this area may lead to the discovery of new noninvasive biomarkers and possibly personalized treatment for NASH. PMID:25873078

A systematic review on aromatic L-amino acid decarboxylase (5-hydroxytryptophan decarboxylase)

International Nuclear Information System (INIS)

Rahman, M.K.; Nagatsu, T.

1988-11-01

Aromatic L-amino acid decarboxylase (AADC, EC. 4.1.1.28) with L-5-hydroxytryptophan as a substrate (also called L-5-hydroxytryptophan decarboxylase, 5-HTPDC) decarboxylates L-5-hydroxytryptophan to serotonin (5-HT), an important neurotransmitter that involved in the regulation of neuronal functions, behaviour and emotion of higher animals. As it is an important enzyme, many researchers are now working on its physiological functions and properties and also on its isolation, purification and characterization from mammalian tissues. But up to now no systematic review studies have been done on this enzyme. We made systematic studies on this enzyme in tissues and brains of rats, and human subjects. We also developed highly sensitive assay methods of the enzyme. This new method led us to discover the enzyme in the sera of various animals. We examined the developmental changes of 5-HTPDC in the sera of animals. We discovered an endogenous inhibitor of the enzyme in the monkey blood. The purification of the enzyme were performed by us and other researches from the sera, brains, adrenals, liver and kidneys of mammals. These and other results of up to date research papers on 5-HTPDC have been reviewed in this paper. (author). 71 refs, 10 figs, 14 tabs

Normalized cDNA libraries

Science.gov (United States)

Soares, Marcelo B.; Efstratiadis, Argiris

1997-01-01

This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library.

Ornithine decarboxylase antizyme induces hypomethylation of genome DNA and histone H3 lysine 9 dimethylation (H3K9me2 in human oral cancer cell line.

Directory of Open Access Journals (Sweden)

Daisuke Yamamoto

2010-09-01

Full Text Available Methylation of CpG islands of genome DNA and lysine residues of histone H3 and H4 tails regulates gene transcription. Inhibition of polyamine synthesis by ornithine decarboxylase antizyme-1 (OAZ in human oral cancer cell line resulted in accumulation of decarboxylated S-adenosylmethionine (dcSAM, which acts as a competitive inhibitor of methylation reactions. We anticipated that accumulation of dcSAM impaired methylation reactions and resulted in hypomethylation of genome DNA and histone tails.Global methylation state of genome DNA and lysine residues of histone H3 and H4 tails were assayed by Methylation by Isoschizomers (MIAMI method and western blotting, respectively, in the presence or absence of OAZ expression. Ectopic expression of OAZ mediated hypomethylation of CpG islands of genome DNA and histone H3 lysine 9 dimethylation (H3K9me2. Protein level of DNA methyltransferase 3B (DNMT3B and histone H3K9me specific methyltransferase G9a were down-regulated in OAZ transfectant.OAZ induced hypomethylation of CpG islands of global genome DNA and H3K9me2 by down-regulating DNMT3B and G9a protein level. Hypomethylation of CpG islands of genome DNA and histone H3K9me2 is a potent mechanism of induction of the genes related to tumor suppression and DNA double strand break repair.

cDNA sequence quality data - Budding yeast cDNA sequencing project | LSDB Archive [Life Science Database Archive metadata

Lifescience Database Archive (English)

Full Text Available List Contact us Budding yeast cDNA sequencing project cDNA sequence quality data Data detail Data name cDNA sequence quality... data DOI 10.18908/lsdba.nbdc00838-003 Description of data contents Phred's quality score. P...tion Download License Update History of This Database Site Policy | Contact Us cDNA sequence quality

Disease-specific monoclonal antibodies targeting glutamate decarboxylase impair GABAergic neurotransmission and affect motor learning and behavioral functions

Directory of Open Access Journals (Sweden)

Mario U Manto

2015-03-01

Full Text Available Autoantibodies to the smaller isoform of glutamate decarboxylase can be found in patients with type 1 diabetes and a number of neurological disorders, including stiff-person syndrome, cerebellar ataxia and limbic encephalitis. The detection of disease-specific autoantibody epitopes led to the hypothesis that distinct glutamate decarboxylase autoantibodies may elicit specific neurological phenotypes. We explored the in vitro/in vivo effects of well-characterized monoclonal glutamate decarboxylase antibodies. We found that glutamate decarboxylase autoantibodies present in patients with stiff person syndrome (n = 7 and cerebellar ataxia (n = 15 recognized an epitope distinct from that recognized by glutamate decarboxylase autoantibodies present in patients with type 1 diabetes mellitus (n = 10 or limbic encephalitis (n = 4. We demonstrated that the administration of a monoclonal glutamate decarboxylase antibody representing this epitope specificity (1 disrupted in vitro the association of glutamate decarboxylase with γ-Aminobutyric acid containing synaptic vesicles, (2 depressed the inhibitory synaptic transmission in cerebellar slices with a gradual time course and a lasting suppressive effect, (3 significantly decreased conditioned eyelid responses evoked in mice, with no modification of learning curves in the classical eyeblink-conditioning task, (4 markedly impaired the facilitatory effect exerted by the premotor cortex over the motor cortex in a paired-pulse stimulation paradigm, and (5 induced decreased exploratory behavior and impaired locomotor function in rats. These findings support the specific targeting of glutamate decarboxylase by its autoantibodies in the pathogenesis of stiff-person syndrome and cerebellar ataxia. Therapies of these disorders based on selective removal of such glutamate decarboxylase antibodies could be envisioned.

Characterization of arginine decarboxylase from Dianthus caryophyllus.

Science.gov (United States)

Ha, Byung Hak; Cho, Ki Joon; Choi, Yu Jin; Park, Ky Young; Kim, Kyung Hyun

2004-04-01

Arginine decarboxylase (ADC, EC 4.1.1.9) is a key enzyme in the biosynthesis of polyamines in higher plants, whereas ornithine decarboxylase represents the sole pathway of polyamine biosynthesis in animals. Previously, we characterized a genomic clone from Dianthus caryophyllus, in which the deduced polypeptide of ADC was 725 amino acids with a molecular mass of 78 kDa. In the present study, the ADC gene was subcloned into the pGEX4T1 expression vector in combination with glutathione S-transferase (GST). The fusion protein GST-ADC was water-soluble and thus was purified by sequential GSTrap-arginine affinity chromatography. A thrombin-mediated on-column cleavage reaction was employed to release free ADC from GST. Hiload superdex gel filtration FPLC was then used to obtain a highly purified ADC. The identity of the ADC was confirmed by immunoblot analysis, and its specific activity with respect to (14)C-arginine decarboxylation reaction was determined to be 0.9 CO(2) pkat mg(-1) protein. K(m) and V(max) of the reaction between ADC and the substrate were 0.077 +/- 0.001 mM and 6.0 +/- 0.6 pkat mg(-1) protein, respectively. ADC activity was reduced by 70% in the presence of 0.1 mM Cu(2+) or CO(2+), but was only marginally affected by Mg(2+), or Ca(2+) at the same concentration. Moreover, spermine at 1 mM significantly reduced its activity by 30%.

The effect of S-adenosylmethionine on cognitive performance in mice: an animal model meta-analysis.

Directory of Open Access Journals (Sweden)

Sarah E Montgomery

Full Text Available Alzheimer's disease (AD is the most frequently diagnosed form of dementia resulting in cognitive impairment. Many AD mouse studies, using the methyl donor S-adenosylmethionine (SAM, report improved cognitive ability, but conflicting results between and within studies currently exist. To address this, we conducted a meta-analysis to evaluate the effect of SAM on cognitive ability as measured by Y maze performance. As supporting evidence, we include further discussion of improvements in cognitive ability, by SAM, as measured by the Morris water maze (MWM.We conducted a comprehensive literature review up to April 2014 based on searches querying MEDLINE, EMBASE, Web of Science, the Cochrane Library and Proquest Theses and Dissertation databases. We identified three studies containing a total of 12 experiments that met our inclusion criteria and one study for qualitative review. The data from these studies were used to evaluate the effect of SAM on cognitive performance according to two scenarios: 1. SAM supplemented folate deficient (SFD diet compared to a folate deficient (FD diet and 2. SFD diet compared to a nutrient complete (NC diet. Hedge's g was used to calculate effect sizes and mixed effects model meta-regression was used to evaluate moderating factors.Our findings showed that the SFD diet was associated with improvements in cognitive performance. SFD diet mice also had superior cognitive performance compared to mice on an NC diet. Further to this, meta-regression analyses indicated a significant positive effect of study quality score and treatment duration on the effect size estimate for both the FD vs SFD analysis and the SFD vs NC analysis.The findings of this meta-analysis demonstrate efficacy of SAM in acting as a cognitive performance-enhancing agent. As a corollary, SAM may be useful in improving spatial memory in patients suffering from many dementia forms including AD.

Construction of full-length cDNA library of white flower Salvia ...

African Journals Online (AJOL)

In order to screen and isolate secondary metabolite biosynthesis related gene, we construct a cDNA library of white flower Salvia miltiorrhiza bge. f.alba. High quality of total RNA was successfully isolated from roots of white flower S. miltiorrhiza using modified CTAB method. Double strand cDNA was cloned into pDNR-LIB ...

On the influence of ionizing radiation on polyamine biosynthesis and content in animal cells and on the possibility of involvement of polyamines in the formation and recovery from radiation damage

International Nuclear Information System (INIS)

Rosiek, O.

1979-01-01

The initial section of this monograph provides a review of the present data on distribution, biosynthesis, catabolism and biological function of polyamines, putrescine, spermidine, and spermine in animal cells. The conclusion is drawn that there is a possibility of participation of these compounds in the formation and recovery from radiation damage. In the investigations presented in the experimental section, it was established that ionizing radiation can induce changes of the polyamine content and activity of the enzymes of polyamine metabolism (ornithine decarboxylase, S-adenosylmethionine decarboxylase, diamine oxidase, and polyamine oxidase) in animal cells. The results were also obtained which indicate that a close relationship exists between the post-irradiation synthesis and accumulation of polyamines and such recovery processes from radiation insult as restorative cell proliferation and repair of chromosome damage. Moreover, it was found that products of enzymatic and radiolytic oxidative deamination of spermidine and spermine can cause inhibition of cell proliferation and induction of chromosome aberrations. (author)

cDNA encoding a polypeptide including a hevein sequence

Energy Technology Data Exchange (ETDEWEB)

Raikhel, Natasha V. (Okemos, MI); Broekaert, Willem F. (Dilbeek, BE); Chua, Nam-Hai (Scarsdale, NY); Kush, Anil (New York, NY)

1993-02-16

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a pu GOVERNMENT RIGHTS This application was funded under Department of Energy Contract DE-AC02-76ER01338. The U.S. Government has certain rights under this application and any patent issuing thereon.

The mthA mutation conferring low-level resistance to streptomycin enhances antibiotic production in Bacillus subtilis by increasing the S-adenosylmethionine pool size.

Science.gov (United States)

Tojo, Shigeo; Kim, Ji-Yun; Tanaka, Yukinori; Inaoka, Takashi; Hiraga, Yoshikazu; Ochi, Kozo

2014-04-01

Certain Str(r) mutations that confer low-level streptomycin resistance result in the overproduction of antibiotics by Bacillus subtilis. Using comparative genome-sequencing analysis, we successfully identified this novel mutation in B. subtilis as being located in the mthA gene, which encodes S-adenosylhomocysteine/methylthioadenosine nucleosidase, an enzyme involved in the S-adenosylmethionine (SAM)-recycling pathways. Transformation experiments showed that this mthA mutation was responsible for the acquisition of low-level streptomycin resistance and overproduction of bacilysin. The mthA mutant had an elevated level of intracellular SAM, apparently acquired by arresting SAM-recycling pathways. This increase in the SAM level was directly responsible for bacilysin overproduction, as confirmed by forced expression of the metK gene encoding SAM synthetase. The mthA mutation fully exerted its effect on antibiotic overproduction in the genetic background of rel(+) but not the rel mutant, as demonstrated using an mthA relA double mutant. Strikingly, the mthA mutation activated, at the transcription level, even the dormant ability to produce another antibiotic, neotrehalosadiamine, at concentrations of 150 to 200 μg/ml, an antibiotic not produced (antibiotic production, by introducing either the rsmG mutation to Streptomyces or the mthA mutation to eubacteria, since many eubacteria have mthA homologues.

Benzoylformate analogues exhibit differential rate-determining steps in the benzoylformate decarboxylase reaction

International Nuclear Information System (INIS)

Garcia, G.A.; Weiss, P.M.; Cook, P.F.; Kenyon, G.L.; Cleland, W.W.

1987-01-01

Benzoylformate decarboxylase from Pseudomonas putida is a thiamine pyrophosphate (TPP)-dependent enzyme which converts benzoylformate to benzaldehyde and CO 2 . The rate-determining step(s) in the benzoylformate decarboxylase reaction for a series of substituted benzoylformates (p-CH 3 O, p-CH 3 , p-Cl, and m-F) were studied using solvent deuterium and 13 C kinetic isotope effects. The normal substrate was found to have two partially rate-determining steps; initial tetrahedral adduct formation (D 2 O-sensitive) and decarboxylation ( 13 C-sensitive). D 2 O and 13 C isotope effects indicate that electron-withdrawing substituents (p-Cl and m-F) remove the rate dependence upon decarboxylation such that only a D 2 O effect on (V/K) is observed. Conversely, electron-donating substituents increase the rate-dependence upon decarboxylation such that a larger 13 (V/K) is seen while the D 2 O effects on (V) and (V/K) are not dramatically different from those for benzoylformate. All of the data are consistent with substituent stabilization or destabilization of the carbanionic intermediate formed upon decarboxylation

Keto-isovalerate decarboxylase enzymes and methods of use thereof

Science.gov (United States)

McElvain, Jessica; O'Keefe, Daniel P.; Paul, Brian James; Payne, Mark S.; Rothman, Steven Cary; He, Hongxian

2016-01-19

Provided herein are polypeptides and polynucleotides encoding such polypeptides which have ketoisovalerate decarboxylase activity. Also provided are recombinant host cells comprising such polypeptides and polynucleotides and methods of use thereof.

Ornithine Decarboxylase Activity Is Required for Prostatic Budding in the Developing Mouse Prostate.

Directory of Open Access Journals (Sweden)

Melissa Gamat

Full Text Available The prostate is a male accessory sex gland that produces secretions in seminal fluid to facilitate fertilization. Prostate secretory function is dependent on androgens, although the mechanism by which androgens exert their effects is still unclear. Polyamines are small cationic molecules that play pivotal roles in DNA transcription, translation and gene regulation. The rate-limiting enzyme in polyamine biosynthesis is ornithine decarboxylase, which is encoded by the gene Odc1. Ornithine decarboxylase mRNA decreases in the prostate upon castration and increases upon administration of androgens. Furthermore, testosterone administered to castrated male mice restores prostate secretory activity, whereas administering testosterone and the ornithine decarboxylase inhibitor D,L-α-difluromethylornithine (DFMO to castrated males does not restore prostate secretory activity, suggesting that polyamines are required for androgens to exert their effects. To date, no one has examined polyamines in prostate development, which is also androgen dependent. In this study, we showed that ornithine decarboxylase protein was expressed in the epithelium of the ventral, dorsolateral and anterior lobes of the adult mouse prostate. Ornithine decarboxylase protein was also expressed in the urogenital sinus (UGS epithelium of the male and female embryo prior to prostate development, and expression continued in prostatic epithelial buds as they emerged from the UGS. Inhibiting ornithine decarboxylase using DFMO in UGS organ culture blocked the induction of prostatic buds by androgens, and significantly decreased expression of key prostate transcription factor, Nkx3.1, by androgens. DFMO also significantly decreased the expression of developmental regulatory gene Notch1. Other genes implicated in prostatic development including Sox9, Wif1 and Srd5a2 were unaffected by DFMO. Together these results indicate that Odc1 and polyamines are required for androgens to exert their

Screening method for detection of immediate amino acid decarboxylases--producing bacteria implicated in food poisoning.

Science.gov (United States)

Hussain, Husniza; Mohd Fuat, A R; Vimala, B; Ghazali, H M

2011-08-01

Assessment of amino acid decarboxylase activity can be conducted using tubed broth or plated agar. In this study, the test was carried out in microtitre plates containing lysine, ornithine, arginine, tyrosine, tryptophan, phenylalanine or histidine as biogenic amine precursors. Møller decarboxylase base broth (MDB) with or without 1% of a known amino acid were added to wells of a 96 well-microtitre plate. The wells were inoculated with Escherichia coli, Klebsiella pneumoniae, Acinetobacter anitratus or Staphylococcus aureus to the final concentration of 6.0 x 10(7) cfu/ml and incubated at 35ºC. The absorbance of the culture broth was read at 570 nm at 0, 1.0, 2.0, 3.0, 4.0, 5.5, 6.5 and 7.5 hour. Comparison of means of A'(570) between 0 hour and a specified incubation time was determined statistically. Positive decarboxylase activities were detected in the media inoculated with E. coli and K. pneumoniae in less than 6 hours. The current method is suitable for immediate producers of amino acid decarboxylase enzymes. It costs less as it uses less amino acid and it has the potential to be used for screening aliquots of food materials for amino acid decarboxylase activities.

Directed evolution of pyruvate decarboxylase-negative Saccharomyces cerevisiae, yielding a C2-independent, glucose-tolerant, and pyruvate-hyperproducing yeast

NARCIS (Netherlands)

A.J. van Maris; J.M. Geertman; A. Vermeulen; M.K. Groothuizen; A.A. Winkler; M.D. Piper; J.P. van Dijken; J.T. Pronk

2004-01-01

textabstractThe absence of alcoholic fermentation makes pyruvate decarboxylase-negative (Pdc(-)) strains of Saccharomyces cerevisiae an interesting platform for further metabolic engineering of central metabolism. However, Pdc(-) S. cerevisiae strains have two growth defects:

An internal deletion in MTH1 enables growth on glucose of pyruvate-decarboxylase negative, non-fermentative Saccharomyces cerevisiae

NARCIS (Netherlands)

Oud, B.; Flores, C.L.; Gancedo, C.; Zhang, X.; Trueheart, J.; Daran, J.M.; Pronk, J.T.; Van Maris, A.J.A.

2012-01-01

Background Pyruvate-decarboxylase negative (Pdc-) strains of Saccharomyces cerevisiae combine the robustness and high glycolytic capacity of this yeast with the absence of alcoholic fermentation. This makes Pdc-S. cerevisiae an interesting platform for efficient conversion of glucose towards

Volatile arsenic species released from Escherichia coli expressing the AsIII S-adenosylmethionine methyltransferase gene.

Science.gov (United States)

Yuan, Chungang; Lu, Xiufen; Qin, Jie; Rosen, Barry P; Le, X Chris

2008-05-01

Biological systems, ranging from bacteria and fungi to humans, can methylate arsenic. Recent studies have suggested that the AsIII S-adenosylmethionine methyltransferase (arsM) gene in bacteria was responsible for the removal of arsenic as the volatile arsines from the bacteria. However, there has been no direct measure of the arsines released from bacteria cultures. We describe here an integrated system incorporating the bacterial incubation and volatile arsenic species analysis, and we demonstrate its application to the identification of the volatile arsines produced in bacterial cultures. The headspace of the bacterial cultures was purged with helium, and the volatile arsenic species were trapped in a chromatographic column immersed in liquid nitrogen. The cryogenically trapped arsines [AsH3, (CH3)AsH2, (CH3)2AsH, and (CH3)3As] were separated by gas chromatography and were detected by inductively coupled plasma mass spectrometry. A hydride generation system was coupled to the bacterial culture system, allowing for spiking standards and for generating calibration arsines necessary for quantitative analysis. Both bacteria containing the arsM gene or its variant arsMC2 gene were able to produce 400-500 ng of trimethylarsine. No trimethylarsine was detectable in bacteria lacking the arsM gene (containing the vector plasmid as negative control). These results confirm that arsM is responsible for releasing arsenic as volatile species from the arsenic-resistant bacteria. Our results also show traces of AsH3, CH3AsH2, and (CH3)2AsH in cultures of bacteria expressing arsM. The method detection limits for AsH3, CH3AsH2, (CH3)2AsH, and (CH3)3As were 0.5, 0.5, 0.7, and 0.6 pg, respectively. The ability to quantify trace levels of these volatile arsenic species makes it possible to study the biotransformation and biochemical roles of the evolution of these volatile arsenic species by biological systems.

The function analysis of full-length cDNA sequence from IRM-2 mouse cDNA library

International Nuclear Information System (INIS)

Wang Qin; Liu Xiaoqiu; Xu Chang; Du Liqing; Sun Zhijuan; Wang Yan; Liu Qiang; Song Li; Li Jin; Fan Feiyue

2013-01-01

Objective: To identify the function of full-length cDNA sequence from IRM-2 mouse cDNA library. Methods: Full-length cDNA products were amplified by PCR from IRM-2 mouse cDNA library according to twenty-one pieces of expressed sequence tag. The expression of full-length cDNAs were detected after mouse embryonic fibroblasts were exposed to 6.5 Gy γ-ray radiation. And the effect on the growth of radiosensitivity cells AT5B1VA transfected with full-length cDNAs was investigated. Results: The expression of No.4, 5 and 2 full-length cDNAs from IRM-2 mouse were higher than that of parental ICR and 615 mouse after mouse embryonic fibroblasts irradiated with γ-ray radiation. And the survival rate of AT5B1VA cells transfected with No.4, 5 and 2 full-length cDNAs was high. Conclusion: No.4, 5 and 2 full-length cDNAs of IRM-2 mouse are of high radioresistance. (authors)

[cDNA library construction from panicle meristem of finger millet].

Science.gov (United States)

Radchuk, V; Pirko, Ia V; Isaenkov, S V; Emets, A I; Blium, Ia B

2014-01-01

The protocol for production of full-size cDNA using SuperScript Full-Length cDNA Library Construction Kit II (Invitrogen) was tested and high quality cDNA library from meristematic tissue of finger millet panicle (Eleusine coracana (L.) Gaertn) was created. The titer of obtained cDNA library comprised 3.01 x 10(5) CFU/ml in avarage. In average the length of cDNA insertion consisted about 1070 base pairs, the effectivity of cDNA fragment insertions--99.5%. The selective sequencing of cDNA clones from created library was performed. The sequences of cDNA clones were identified with usage of BLAST-search. The results of cDNA library analysis and selective sequencing represents prove good functionality and full length character of inserted cDNA clones. Obtained cDNA library from meristematic tissue of finger millet panicle represents good and valuable source for isolation and identification of key genes regulating metabolism and meristematic development and for mining of new molecular markers to conduct out high quality genetic investigations and molecular breeding as well.

Human beta 2 chain of laminin (formerly S chain): cDNA cloning, chromosomal localization, and expression in carcinomas

DEFF Research Database (Denmark)

Wewer, U M; Gerecke, D R; Durkin, M E

1994-01-01

or other known laminin genes. Immunostaining showed that the beta 2 chain is localized to the smooth muscle basement membranes of the arteries, while the homologous beta 1 chain is confined to the subendothelial basement membranes. The beta 2 chain was found in the basement membranes of ovarian carcinomas......Overlapping cDNA clones that encode the full-length human laminin beta 2 chain, formerly called the S chain, were isolated. The cDNA of 5680 nt contains a 5391-nt open reading frame encoding 1797 amino acids. At the amino terminus is a 32-amino-acid signal peptide that is followed by the mature...... beta 2 chain polypeptide of 1765 amino acids with a calculated molecular mass of 192,389 Da. The human beta 2 chain is predicted to have all of the seven structural domains typical of the beta chains of laminin, including the short cysteine-rich alpha region. The amino acid sequence of human beta 2...

Molecular cloning of lupin leghemoglobin cDNA

DEFF Research Database (Denmark)

Konieczny, A; Jensen, E O; Marcker, K A

1987-01-01

Poly(A)+ RNA isolated from root nodules of yellow lupin (Lupinus luteus, var. Ventus) has been used as a template for the construction of a cDNA library. The ds cDNA was synthesized and inserted into the Hind III site of plasmid pBR 322 using synthetic Hind III linkers. Clones containing sequences...... specific for nodules were selected by differential colony hybridization using 32P-labeled cDNA synthesized either from nodule poly(A)+ RNA or from poly(A)+ RNA of uninfected root as probes. Among the recombinant plasmids, the cDNA gene for leghemoglobin was identified. The protein structure derived from...... its nucleotide sequence was consistent with known amino acid sequence of lupin Lb II. The cloned lupin Lb cDNA hybridized to poly(A)+ RNA from nodules only, which is in accordance with the general concept, that leghemoglobin is expressed exclusively in nodules. Udgivelsesdato: 1987-null...

Swit_4259, an acetoacetate decarboxylase-like enzyme from Sphingomonas wittichii RW1

Energy Technology Data Exchange (ETDEWEB)

Mydy, Lisa S.; Mashhadi, Zahra; Knight, T. William; Fenske, Tyler; Hagemann, Trevor; Hoppe, Robert W.; Han, Lanlan; Miller, Todd R.; Schwabacher, Alan W.; Silvaggi, Nicholas R. (UW); (Vanderbilt)

2017-11-14

The Gram-negative bacteriumSphingomonas wittichiiRW1 is notable for its ability to metabolize a variety of aromatic hydrocarbons. Not surprisingly, theS. wittichiigenome contains a number of putative aromatic hydrocarbon-degrading gene clusters. One of these includes an enzyme of unknown function, Swit_4259, which belongs to the acetoacetate decarboxylase-like superfamily (ADCSF). Here, it is reported that Swit_4259 is a small (28.8 kDa) tetrameric ADCSF enzyme that, unlike the prototypical members of the superfamily, does not have acetoacetate decarboxylase activity. Structural characterization shows that the tertiary structure of Swit_4259 is nearly identical to that of the true decarboxylases, but there are important differences in the fine structure of the Swit_4259 active site that lead to a divergence in function. In addition, it is shown that while it is a poor substrate, Swit_4259 can catalyze the hydration of 2-oxo-hex-3-enedioate to yield 2-oxo-4-hydroxyhexanedioate. It is also demonstrated that Swit_4259 has pyruvate aldolase-dehydratase activity, a feature that is common to all of the family V ADCSF enzymes studied to date. The enzymatic activity, together with the genomic context, suggests that Swit_4259 may be a hydratase with a role in the metabolism of an as-yet-unknown hydrocarbon. These data have implications for engineering bioremediation pathways to degrade specific pollutants, as well as structure–function relationships within the ADCSF in general.

Cfr and RlmN contain a single [4Fe-4S] cluster, which directs two distinct reactivities for S-adenosylmethionine: methyl transfer by SN2 displacement and radical generation.

Science.gov (United States)

Grove, Tyler L; Radle, Matthew I; Krebs, Carsten; Booker, Squire J

2011-12-14

The radical SAM (RS) proteins RlmN and Cfr catalyze methylation of carbons 2 and 8, respectively, of adenosine 2503 in 23S rRNA. Both reactions are similar in scope, entailing the synthesis of a methyl group partially derived from S-adenosylmethionine (SAM) onto electrophilic sp(2)-hybridized carbon atoms via the intermediacy of a protein S-methylcysteinyl (mCys) residue. Both proteins contain five conserved Cys residues, each required for turnover. Three cysteines lie in a canonical RS CxxxCxxC motif and coordinate a [4Fe-4S]-cluster cofactor; the remaining two are at opposite ends of the polypeptide. Here we show that each protein contains only the one "radical SAM" [4Fe-4S] cluster and the two remaining conserved cysteines do not coordinate additional iron-containing species. In addition, we show that, while wild-type RlmN bears the C355 mCys residue in its as-isolated state, RlmN that is either engineered to lack the [4Fe-4S] cluster by substitution of the coordinating cysteines or isolated from Escherichia coli cultured under iron-limiting conditions does not bear a C355 mCys residue. Reconstitution of the [4Fe-4S] cluster on wild-type apo RlmN followed by addition of SAM results in rapid production of S-adenosylhomocysteine (SAH) and the mCys residue, while treatment of apo RlmN with SAM affords no observable reaction. These results indicate that in Cfr and RlmN, SAM bound to the unique iron of the [4Fe-4S] cluster displays two reactivities. It serves to methylate C355 of RlmN (C338 of Cfr), or to generate the 5'-deoxyadenosyl 5'-radical, required for substrate-dependent methyl synthase activity. © 2011 American Chemical Society

Cloning, sequencing, and expression of cDNA for human β-glucuronidase

International Nuclear Information System (INIS)

Oshima, A.; Kyle, J.W.; Miller, R.D.

1987-01-01

The authors report here the cDNA sequence for human placental β-glucuronidase (β-D-glucuronoside glucuronosohydrolase, EC 3.2.1.31) and demonstrate expression of the human enzyme in transfected COS cells. They also sequenced a partial cDNA clone from human fibroblasts that contained a 153-base-pair deletion within the coding sequence and found a second type of cDNA clone from placenta that contained the same deletion. Nuclease S1 mapping studies demonstrated two types of mRNAs in human placenta that corresponded to the two types of cDNA clones isolated. The NH 2 -terminal amino acid sequence determined for human spleen β-glucuronidase agreed with that inferred from the DNA sequence of the two placental clones, beginning at amino acid 23, suggesting a cleaved signal sequence of 22 amino acids. When transfected into COS cells, plasmids containing either placental clone expressed an immunoprecipitable protein that contained N-linked oligosaccharides as evidenced by sensitivity to endoglycosidase F. However, only transfection with the clone containing the 153-base-pair segment led to expression of human β-glucuronidase activity. These studies provide the sequence for the full-length cDNA for human β-glucuronidase, demonstrate the existence of two populations of mRNA for β-glucuronidase in human placenta, only one of which specifies a catalytically active enzyme, and illustrate the importance of expression studies in verifying that a cDNA is functionally full-length

Cloning of the human androgen receptor cDNA

International Nuclear Information System (INIS)

Govindan, M.V.; Burelle, M.; Cantin, C.; Kabrie, C.; Labrie, F.; Lachance, Y.; Leblanc, G.; Lefebvre, C.; Patel, P.; Simard, J.

1988-01-01

The authors discuss how in order to define the functional domains of the human androgen receptor, complementary DNA (cDNA) clones encoding the human androgen receptor (hAR) have been isolated from a human testis λgtll cDNA library using synthetic oligonnucleotide probes, homologous to segments of the human glucocorticoid, estradiol and progesterone receptors. The cDNA clones corresponding to the human glucocorticoid, estradiol and progesterone receptors were eliminated after cross-hybridization with their respective cDNA probes and/or after restriction mapping of the cDNA clones. The remaining cDNA clones were classified into different groups after analysis by restriction digestion and cross-hybridization. Two of the largest cDNA clones from each group were inserted into an expression vector in both orientations. The linearized plasmids were used as templates in in vitro transcription with T7 RNA polymerase. Subsequent in vitro translation of the purified transcripts in rabbit reticulocyte lysate followed by sodium dodecylsulfate polyacrylamide gel electrophoresis (SDS-PAGE) permitted the characterization of the encoded polyeptides. The expressed proteins larger than 30,000 Da were analyzed for their ability to bind tritium-labelled dihydrotestosterone ([ 3 H] DHT) with high affinity and specificity

Glyoxal bis(guanylhydrazone) as an inhibitor of polyamine biosynthesis in tumour cells.

OpenAIRE

Seppänen, P; Fagerström, R; Alhonen-Hongisto, L; Elo, H; Lumme, P; Jänne, J

1984-01-01

Glyoxal bis(guanylhydrazone), the parent compound of methylglyoxal bis(guanylhydrazone), was synthesized and tested for its ability to inhibit the biosynthesis of polyamines. It was found to be a powerful competitive inhibitor of adenosylmethionine decarboxylase (EC 4.1.1.50), yet the lack of the methyl group at the glyoxal portion increased the apparent Ki value for the enzyme by about 30-fold in comparison with methylglyoxal bis(guanylhydrazone). Glyoxal bis(guanylhydrazone) inhibited diami...

Perturbation of the Monomer-Monomer Interfaces of the Benzoylformate Decarboxylase Tetramer

Energy Technology Data Exchange (ETDEWEB)

Andrews, Forest H.; Rogers, Megan P.; Paul, Lake N.; McLeish, Michael J. [IUPUI; (Purdue)

2014-08-14

The X-ray structure of benzoylformate decarboxylase (BFDC) from Pseudomonas putida ATCC 12633 shows it to be a tetramer. This was believed to be typical of all thiamin diphosphate-dependent decarboxylases until recently when the structure of KdcA, a branched-chain 2-keto acid decarboxylase from Lactococcus lactis, showed it to be a homodimer. This lent credence to earlier unfolding experiments on pyruvate decarboxylase from Saccharomyces cerevisiae that indicated that it might be active as a dimer. To investigate this possibility in BFDC, we sought to shift the equilibrium toward dimer formation. Point mutations were made in the noncatalytic monomer–monomer interfaces, but these had a minimal effect on both tetramer formation and catalytic activity. Subsequently, the R141E/Y288A/A306F variant was shown by analytical ultracentrifugation to be partially dimeric. It was also found to be catalytically inactive. Further experiments revealed that just two mutations, R141E and A306F, were sufficient to markedly alter the dimer–tetramer equilibrium and to provide an ~450-fold decrease in k_cat. Equilibrium denaturation studies suggested that the residual activity was possibly due to the presence of residual tetramer. The structures of the R141E and A306F variants, determined to <1.5 Å resolution, hinted that disruption of the monomer interfaces will be accompanied by movement of a loop containing Leu109 and Leu110. As these residues contribute to the hydrophobicity of the active site and the correct positioning of the substrate, it seems that tetramer formation may well be critical to the catalytic activity of BFDC.

S-adenosylmethionine blocks osteosarcoma cells proliferation and invasion in vitro and tumor metastasis in vivo: therapeutic and diagnostic clinical applications

International Nuclear Information System (INIS)

Parashar, Surabhi; Cheishvili, David; Arakelian, Ani; Hussain, Zahid; Tanvir, Imrana; Khan, Haseeb Ahmed; Szyf, Moshe; Rabbani, Shafaat A

2015-01-01

Osteosarcoma (OS) is an aggressive and highly metastatic form of primary bone cancer affecting young children and adults. Previous studies have shown that hypomethylation of critical genes is driving metastasis. Here, we examine whether hypermethylation treatment can block OS growth and pulmonary metastasis. Human OS cells LM-7 and MG-63 were treated with the ubiquitous methyl donor S-adenosylmethionine (SAM) or its inactive analog S-adenosylhomocystine (SAH) as control. Treatment with SAM resulted in a dose-dependent inhibition of tumor cell proliferation, invasion, cell migration, and cell cycle characteristics. Inoculation of cells treated with 150 μmol/L SAM for 6 days into tibia or via intravenous route into Fox Chase severe combined immune deficient (SCID) mice resulted in the development of significantly smaller skeletal lesions and a marked reduction in pulmonary metastasis as compared to control groups. Epigenome wide association studies (EWAS) showed differential methylation of several genes involved in OS progression and prominent signaling pathways implicated in bone formation, wound healing, and tumor progression in SAM-treated LM-7 cells. Real-time polymerase chain reaction (qPCR) analysis confirmed that SAM treatment blocked the expression of several prometastatic genes and additional genes identified by EWAS analysis. Immunohistochemical analysis of normal human bone and tissue array from OS patients showed significantly high levels of expression of one of the identified gene platelet-derived growth factor alpha (PDGFA). These studies provide a possible mechanism for the role of DNA demethylation in the development and metastasis of OS to provide a rationale for the use of hypermethylation therapy for OS patients and identify new targets for monitoring OS development and progression

Current concepts on the physiology and genetics of neurotransmitters-mediating enzyme-aromatic L-amino acid decarboxylase

International Nuclear Information System (INIS)

Rahman, M.K.

1993-03-01

Two most important neurotransmitters, dopamine and serotonin are mediated by the enzyme aromatic L-amino acid decarboxylase (AADC). Because of their importance in the regulation of neuronal functions, behaviour and emotion of higher animals, many researchers are working on this enzyme to elucidate its physiological properties, structure and genetic aspects. We have discovered this enzyme in the mammalian blood, we established sensitive assay methods for the assay of the activities of this enzyme. We have made systematic studies on this enzyme in the tissues and brains of rats, and human subjects. We have found an endogenous inhibitor of this enzyme in the monkey's blood. The amino acid sequences of human AADC has been compared to rat or bovine. A full-length cDNA clone encoding human AADC has been isolated. Very recently the structure of human AADC gene including 5'-flaking region has been characterized and the transcriptional starting point has been determined. The human AADC gene assigned to chromosome 7. Up-to-date research data have shown that AADC is encoded by a single gene. Recently two patients with AADC deficiency were reported. This paper describes the systematic up-to-date review studies on AADC. (author). 62 refs, 5 figs, 8 tabs

Preparation of a differentially expressed, full-length cDNA expression library by RecA-mediated triple-strand formation with subtractively enriched cDNA fragments

NARCIS (Netherlands)

Hakvoort, T. B.; Spijkers, J. A.; Vermeulen, J. L.; Lamers, W. H.

1996-01-01

We have developed a fast and general method to obtain an enriched, full-length cDNA expression library with subtractively enriched cDNA fragments. The procedure relies on RecA-mediated triple-helix formation of single-stranded cDNA fragments with a double-stranded cDNA plasmid library. The complexes

DNA methylation regulates expression of VEGF-C, and S-adenosylmethionine is effective for VEGF-C methylation and for inhibiting cancer growth

Energy Technology Data Exchange (ETDEWEB)

Da, M.X. [Department of Surgical Oncology, Gansu Provincial Hospital, Lanzhou (China); Zhang, Y.B. [Department of Surgery, Ningxia Medical University, Yinchuan (China); Yao, J.B. [Department of Surgical Oncology, Gansu Provincial Hospital, Lanzhou (China); Duan, Y.X. [Department of Surgery, Ningxia Medical University, Yinchuan (China)

2014-09-30

DNA hypomethylation may activate oncogene transcription, thus promoting carcinogenesis and tumor development. S-adenosylmethionine (SAM) is a methyl donor in numerous methylation reactions and acts as an inhibitor of intracellular demethylase activity, which results in hypermethylation of DNA. The main objectives of this study were to determine whether DNA hypomethylation correlated with vascular endothelial growth factor-C (VEGF-C) expression, and the effect of SAM on VEGF-C methylation and gastric cancer growth inhibition. VEGF-C expression was assayed by Western blotting and RT-qPCR in gastric cancer cells, and by immunohistochemistry in tumor xenografts. VEGF-C methylation was assayed by bisulfite DNA sequencing. The effect of SAM on cell apoptosis was assayed by flow cytometry analyses and its effect on cancer growth was assessed in nude mice. The VEGF-C promoters of MGC-803, BGC-823, and SGC-7901 gastric cancer cells, which normally express VEGF-C, were nearly unmethylated. After SAM treatment, the VEGF-C promoters in these cells were highly methylated and VEGF-C expression was downregulated. SAM also significantly inhibited tumor growth in vitro and in vivo. DNA methylation regulates expression of VEGF-C. SAM can effectively induce VEGF-C methylation, reduce the expression of VEGF-C, and inhibit tumor growth. SAM has potential as a drug therapy to silence oncogenes and block the progression of gastric cancer.

Folate and S-adenosylmethionine modulate synaptic activity in cultured cortical neurons: acute differential impact on normal and apolipoprotein-deficient mice

International Nuclear Information System (INIS)

Serra, Michael; Chan, Amy; Dubey, Maya; Shea, Thomas B; Gilman, Vladimir

2008-01-01

Folate deficiency is accompanied by a decline in the cognitive neurotransmitter acetylcholine and a decline in cognitive performance in mice lacking apolipoprotein E (ApoE−/− mice), a low-density lipoprotein that regulates aspects of lipid metabolism. One direct consequence of folate deficiency is a decline in S-adenosylmethionine (SAM). Since dietary SAM supplementation maintains acetylcholine levels and cognitive performance in the absence of folate, we examined herein the impact of folate and SAM on neuronal synaptic activity. Embryonic cortical neurons from mice expressing or lacking ApoE (ApoE+/+ or −/−, respectively) were cultured for 1 month on multi-electrode arrays, and signaling was recorded. ApoE+/+ cultures displayed significantly more frequent spontaneous signals than ApoE−/− cultures. Supplementation with 166 µm SAM (not normally present in culture medium) increased signal frequency and decreased signal amplitude in ApoE+/+ cultures. SAM also increased the frequency of tightly clustered signal bursts. Folate deprivation reversibly reduced signal frequency in ApoE+/+ cultures; SAM supplementation maintained signal frequency despite folate deprivation. These findings support the importance of dietary supplementation with folate and SAM on neuronal health. Supplementation with 166 µm SAM did not alter signaling in ApoE−/− cultures, which may be a reflection of the reduced SAM levels in ApoE−/− mice. The differential impact of SAM on ApoE+/+ and −/− neurons underscores the combined impact of nutritional and genetic deficiencies on neuronal homeostasis. (communication)

Molecular characterization of a Leishmania donovani cDNA clone with similarity to human 20S proteasome a-type subunit

DEFF Research Database (Denmark)

Christensen, C B; Jørgensen, L; Jensen, A T

2000-01-01

Using plasma from patients infected or previously infected with Leishmania donovanii, we isolated a L. donovanii cDNA clone with similarity to the proteasome a-type subunit from humans and other eukaryotes. The cDNA clone, designated LePa, was DNA sequenced and Northern blot analysis of L....... donovanii poly(A(+))mRNA indicated the isolation of a full length cDNA clone with a transcript size of 1.9 kb. The expressed recombinant LePa fusion protein induced proliferation of peripheral blood mononuclear cells in one out of seven patients who had suffered from visceral leishmaniasis. Plasma from 16...

Sequence of human protamine 2 cDNA

Energy Technology Data Exchange (ETDEWEB)

Domenjoud, L; Fronia, C; Uhde, F; Engel, W [Universitaet Goettingen (West Germany)

1988-08-11

The authors report the cloning and sequencing of a cDNA clone for human protamine 2 (hp2), isolated from a human testis cDNA library cloned in the vector {lambda}-gt11. A 66mer oligonucleotide, that corresponds to an amino acid sequence which is highly conserved between hp2 and mouse protamine 2 (mp2) served as hybridization probe. The homology between the amino acid sequence deduced from our cDNA and the published amino acid sequence for hp2 is 100%.

Expression of the neurotransmitter-synthesizing enzyme glutamic acid decarboxylase in male germ cells.

Science.gov (United States)

Persson, H; Pelto-Huikko, M; Metsis, M; Söder, O; Brene, S; Skog, S; Hökfelt, T; Ritzén, E M

1990-09-01

The gene encoding glutamic acid decarboxylase (GAD), the key enzyme in the synthesis of the inhibitory neurotransmitter gamma-aminobutyric acid, is shown to be expressed in the testis of several different species. Nucleotide sequence analysis of a cDNA clone isolated from the human testis confirmed the presence of GAD mRNA in the testis. The major GAD mRNA in the testis was 2.5 kilobases. Smaller amounts of a 3.7-kilobase mRNA with the same size as GAD mRNA in the brain was also detected in the testis. In situ hybridization using a GAD-specific probe revealed GAD mRNA expressing spermatocytes and spermatids located in the middle part of rat seminiferous tubules. Studies on the ontogeny of GAD mRNA expression showed low levels of GAD mRNA in testes of prepubertal rats, with increasing levels as sexual maturation is reached, compatible with GAD mRNA expression in germ cells. In agreement with this, fractionation of cells from the rat seminiferous epithelium followed by Northern (RNA) blot analysis showed the highest levels of GAD mRNA associated with spermatocytes and spermatids. Evidence for the presence of GAD protein in the rat testis was obtained from the demonstration of GAD-like immunoreactivity in seminiferous tubules, predominantly at a position where spermatids and spermatozoa are found. Furthermore, GAD-like immunoreactivity was seen in the midpiece of ejaculated human spermatozoa, the part that is responsible for generating energy for spermatozoan motility.

Requirement of a Functional Flavin Mononucleotide Prenyltransferase for the Activity of a Bacterial Decarboxylase in a Heterologous Muconic Acid Pathway in Saccharomyces cerevisiae.

Science.gov (United States)

Weber, Heike E; Gottardi, Manuela; Brückner, Christine; Oreb, Mislav; Boles, Eckhard; Tripp, Joanna

2017-05-15

Biotechnological production of cis , cis -muconic acid from renewable feedstocks is an environmentally sustainable alternative to conventional, petroleum-based methods. Even though a heterologous production pathway for cis , cis -muconic acid has already been established in the host organism Saccharomyces cerevisiae , the generation of industrially relevant amounts of cis , cis -muconic acid is hampered by the low activity of the bacterial protocatechuic acid (PCA) decarboxylase AroY isomeric subunit C iso (AroY-C iso ), leading to secretion of large amounts of the intermediate PCA into the medium. In the present study, we show that the activity of AroY-C iso in S. cerevisiae strongly depends on the strain background. We could demonstrate that the strain dependency is caused by the presence or absence of an intact genomic copy of PAD1 , which encodes a mitochondrial enzyme responsible for the biosynthesis of a prenylated form of the cofactor flavin mononucleotide (prFMN). The inactivity of AroY-C iso in strain CEN.PK2-1 could be overcome by plasmid-borne expression of Pad1 or its bacterial homologue AroY subunit B (AroY-B). Our data reveal that the two enzymes perform the same function in decarboxylation of PCA by AroY-C iso , although coexpression of Pad1 led to higher decarboxylase activity. Conversely, AroY-B can replace Pad1 in its function in decarboxylation of phenylacrylic acids by ferulic acid decarboxylase Fdc1. Targeting of the majority of AroY-B to mitochondria by fusion to a heterologous mitochondrial targeting signal did not improve decarboxylase activity of AroY-C iso , suggesting that mitochondrial localization has no major impact on cofactor biosynthesis. IMPORTANCE In Saccharomyces cerevisiae , the decarboxylation of protocatechuic acid (PCA) to catechol is the bottleneck reaction in the heterologous biosynthetic pathway for production of cis , cis -muconic acid, a valuable precursor for the production of bulk chemicals. In our work, we demonstrate

Method for construction of normalized cDNA libraries

Science.gov (United States)

Soares, Marcelo B.; Efstratiadis, Argiris

1998-01-01

This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to appropriate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. This invention also provides normalized cDNA libraries generated by the above-described method and uses of the generated libraries.

cDNA - ASTRA | LSDB Archive [Life Science Database Archive metadata

Lifescience Database Archive (English)

Full Text Available ontents List of cDNA in locus Data file File name: astra_cdna.zip File URL: ftp://ftp.biosciencedbc.jp/archive/astra/LATEST/astra_cdn...a.zip File size: 3.3 MB Simple search URL http://togodb.biosciencedbc.jp/togodb/view/astra_cdna...n, Department of Molecular Genetics, National Institute of Agrobiological Sciences (Kikuchi et al., 2003; ftp://cdna

Isolation of full-length putative rat lysophospholipase cDNA using improved methods for mRNA isolation and cDNA cloning

International Nuclear Information System (INIS)

Han, J.H.; Stratowa, C.; Rutter, W.J.

1987-01-01

The authors have cloned a full-length putative rat pancreatic lysophospholipase cDNA by an improved mRNA isolation method and cDNA cloning strategy using [ 32 P]-labelled nucleotides. These new methods allow the construction of a cDNA library from the adult rat pancreas in which the majority of recombinant clones contained complete sequences for the corresponding mRNAs. A previously recognized but unidentified long and relatively rare cDNA clone containing the entire sequence from the cap site at the 5' end to the poly(A) tail at the 3' end of the mRNA was isolated by single-step screening of the library. The size, amino acid composition, and the activity of the protein expressed in heterologous cells strongly suggest this mRNA codes for lysophospholipase

Altered subcellular localization of ornithine decarboxylase in Alzheimer's disease brain

DEFF Research Database (Denmark)

Nilsson, Tatjana; Bogdanovic, Nenad; Volkman, Inga

2006-01-01

The amyloid precursor protein can through ligand-mimicking induce expression of ornithine decarboxylase (ODC), the initial and rate-limiting enzyme in polyamine biosynthesis. We report here the regional distribution and cellular localization of ODC immunoreactivity in Alzheimer's disease (AD...

cDNA, genomic cloning and sequence analysis of ribosomal protein ...

African Journals Online (AJOL)

enoh

2012-03-13

Mar 13, 2012 ... cDNA and the genomic sequence of RPS4X were cloned successfully from ... S4 genes plays a role in Turner syndrome; however, this ..... Project of Educational Committee of Sichuan Province ... Molecular biology of the cell.

Arginase and Arginine Decarboxylase - Where Do the Putative Gate Keepers of Polyamine Synthesis Reside in Rat Brain?

Directory of Open Access Journals (Sweden)

Daniela Peters

Full Text Available Polyamines are important regulators of basal cellular functions but also subserve highly specific tasks in the mammalian brain. With this respect, polyamines and the synthesizing and degrading enzymes are clearly differentially distributed in neurons versus glial cells and also in different brain areas. The synthesis of the diamine putrescine may be driven via two different pathways. In the "classical" pathway urea and carbon dioxide are removed from arginine by arginase and ornithine decarboxylase. The alternative pathway, first removing carbon dioxide by arginine decarboxlyase and then urea by agmatinase, may serve the same purpose. Furthermore, the intermediate product of the alternative pathway, agmatine, is an endogenous ligand for imidazoline receptors and may serve as a neurotransmitter. In order to evaluate and compare the expression patterns of the two gate keeper enzymes arginase and arginine decarboxylase, we generated polyclonal, monospecific antibodies against arginase-1 and arginine decarboxylase. Using these tools, we immunocytochemically screened the rat brain and compared the expression patterns of both enzymes in several brain areas on the regional, cellular and subcellular level. In contrast to other enzymes of the polyamine pathway, arginine decarboxylase and arginase are both constitutively and widely expressed in rat brain neurons. In cerebral cortex and hippocampus, principal neurons and putative interneurons were clearly labeled for both enzymes. Labeling, however, was strikingly different in these neurons with respect to the subcellular localization of the enzymes. While with antibodies against arginine decarboxylase the immunosignal was distributed throughout the cytoplasm, arginase-like immunoreactivity was preferentially localized to Golgi stacks. Given the apparent congruence of arginase and arginine decarboxylase distribution with respect to certain cell populations, it seems likely that the synthesis of agmatine

Procedure for normalization of cDNA libraries

Science.gov (United States)

Bonaldo, Maria DeFatima; Soares, Marcelo Bento

1997-01-01

This invention provides a method to normalize a cDNA library constructed in a vector capable of being converted to single-stranded circles and capable of producing complementary nucleic acid molecules to the single-stranded circles comprising: (a) converting the cDNA library in single-stranded circles; (b) generating complementary nucleic acid molecules to the single-stranded circles; (c) hybridizing the single-stranded circles converted in step (a) with complementary nucleic acid molecules of step (b) to produce partial duplexes to an appropriate Cot; (e) separating the unhybridized single-stranded circles from the hybridized single-stranded circles, thereby generating a normalized cDNA library.

AUTOANTIBODIES TO GLUTAMIC ACID DECARBOXYLASE AS A PATHOGENETIC MARKER OF TYPE I DIABETES MELLITUS

Directory of Open Access Journals (Sweden)

N. V. Piven

2011-01-01

Full Text Available Abstract. A new method of enzyme-linked immunosorbent assay (in solid-phase ELISA format has been developed to determine concentrations of autoantibodies to glutamic acid decarboxylase, as well as an evidencebased methodology is proposed for its medical implications, as a quantitative pathogenetic predictive marker of autoimmune diagnostics in type 1 diabetes mellitus. This technique could be implied for serial production of diagnostic reagent kits, aimed for detection of autoantibodies to glutamic acid decarboxylase by means of ELISA approach. (Med. Immunol., 2011, vol. 13, N 2-3, pp 257-260

Paramyosin from the parasitic mite Sarcoptes scabiei: cDNA cloning and heterologous expression.

Science.gov (United States)

Mattsson, J G; Ljunggren, E L; Bergström, K

2001-05-01

The burrowing mite Sarcoptes scabiei is the causative agent of the highly contagious disease sarcoptic mange or scabies. So far, there is no in vitro propagation system for S. scabiei available, and mites used for various purposes must be isolated from infected hosts. Lack of parasite-derived material has limited the possibilities to study several aspects of scabies, including pathogenesis and immunity. It has also hampered the development of high performance serological assays. We have now constructed an S. scabiei cDNA expression library with mRNA purified from mites isolated from red foxes. Immunoscreening of the library enabled us to clone a full-length cDNA coding for a 102.5 kDa protein. Sequence similarity searches identified the protein as a paramyosin. Recombinant S. scabiei paramyosin expressed in Escherichia coli was recognized by sera from dogs and swine infected with S. scabiei. We also designed a small paramyosin construct of about 17 kDa that included the N-terminal part, an evolutionary variable part of the helical core, and the C-terminal part of the molecule. The miniaturized protein was efficiently expressed in E. coli and was recognized by sera from immunized rabbits. These data demonstrate that the cDNA library can assist in the isolation of important S. scabiei antigens and that recombinant proteins can be useful for the study of scabies.

FIELD VALIDATION OF A SHEEPSHEAD MINNOW ESTROGEN-RESPONSIVE CDNA MACROARRAY

Science.gov (United States)

Hemmer, Michael J., Iris Knoebl, Becky L. Hemmer, Patrick Larkin, Peggy S. Harris and Nancy D. Denslow. In press. Field Validation of a Sheepshead Minnow Estrogen-Responsive cDNA Macroarray (Abstract). To be presented at the SETAC Fourth World Congress, 14-18 November 2004, Portl...

Lectin cDNA and transgenic plants derived therefrom

Science.gov (United States)

Raikhel, Natasha V.

2000-10-03

Transgenic plants containing cDNA encoding Gramineae lectin are described. The plants preferably contain cDNA coding for barley lectin and store the lectin in the leaves. The transgenic plants, particularly the leaves exhibit insecticidal and fungicidal properties.

cDNA table - RPD | LSDB Archive [Life Science Database Archive metadata

Lifescience Database Archive (English)

Full Text Available of data contents Results of homology search to cDNA clones in the KOME. Data file File name: rpd_cdna.zip F...ile URL: ftp://ftp.biosciencedbc.jp/archive/rpd/LATEST/rpd_cdna.zip File size: 15 KB Simple search URL http:...//togodb.biosciencedbc.jp/togodb/view/rpd_cdna#en Data acquisition method - Data

Preparation of fluorescent-dye-labeled cDNA from RNA for microarray hybridization.

Science.gov (United States)

Ares, Manuel

2014-01-01

This protocol describes how to prepare fluorescently labeled cDNA for hybridization to microarrays. It consists of two steps: first, a mixture of anchored oligo(dT) and random hexamers is used to prime amine-modified cDNA synthesis by reverse transcriptase using a modified deoxynucleotide with a reactive amine group (aminoallyl-dUTP) and an RNA sample as a template. Second, the cDNA is purified and exchanged into bicarbonate buffer so that the amine groups in the cDNA react with the dye N-hydroxysuccinimide (NHS) esters, covalently joining the dye to the cDNA. The dye-coupled cDNA is purified again, and the amount of dye incorporated per microgram of cDNA is determined.

Constructing and detecting a cDNA library for mites.

Science.gov (United States)

Hu, Li; Zhao, YaE; Cheng, Juan; Yang, YuanJun; Li, Chen; Lu, ZhaoHui

2015-10-01

RNA extraction and construction of complementary DNA (cDNA) library for mites have been quite challenging due to difficulties in acquiring tiny living mites and breaking their hard chitin. The present study is to explore a better method to construct cDNA library for mites that will lay the foundation on transcriptome and molecular pathogenesis research. We selected Psoroptes cuniculi as an experimental subject and took the following steps to construct and verify cDNA library. First, we combined liquid nitrogen grinding with TRIzol for total RNA extraction. Then, switching mechanism at 5' end of the RNA transcript (SMART) technique was used to construct full-length cDNA library. To evaluate the quality of cDNA library, the library titer and recombination rate were calculated. The reliability of cDNA library was detected by sequencing and analyzing positive clones and genes amplified by specific primers. The results showed that the RNA concentration was 836 ng/μl and the absorbance ratio at 260/280 nm was 1.82. The library titer was 5.31 × 10(5) plaque-forming unit (PFU)/ml and the recombination rate was 98.21%, indicating that the library was of good quality. In the 33 expressed sequence tags (ESTs) of P. cuniculi, two clones of 1656 and 1658 bp were almost identical with only three variable sites detected, which had an identity of 99.63% with that of Psoroptes ovis, indicating that the cDNA library was reliable. Further detection by specific primers demonstrated that the 553-bp Pso c II gene sequences of P. cuniculi had an identity of 98.56% with those of P. ovis, confirming that the cDNA library was not only reliable but also feasible.

Molecular cloning of growth hormone encoding cDNA of Indian

Indian Academy of Sciences (India)

A modified rapid amplification of cDNA ends (RACE) strategy has been developed for cloning highly conserved cDNA sequences. Using this modified method, the growth hormone (GH) encoding cDNA sequences of Labeo rohita, Cirrhina mrigala and Catla catla have been cloned, characterized and overexpressed in ...

l-Histidine Decarboxylase and Tourette's Syndrome

Science.gov (United States)

Ercan-Sencicek, A. Gulhan; Stillman, Althea A.; Ghosh, Ananda K.; Bilguvar, Kaya; O'Roak, Brian J.; Mason, Christopher E.; Abbott, Thomas; Gupta, Abha; King, Robert A.; Pauls, David L.; Tischfield, Jay A.; Heiman, Gary A.; Singer, Harvey S.; Gilbert, Donald L.; Hoekstra, Pieter J.; Morgan, Thomas M.; Loring, Erin; Yasuno, Katsuhito; Fernandez, Thomas; Sanders, Stephan; Louvi, Angeliki; Cho, Judy H.; Mane, Shrikant; Colangelo, Christopher M.; Biederer, Thomas; Lifton, Richard P.; Gunel, Murat; State, Matthew W.

2010-01-01

Summary Tourette's syndrome is a common developmental neuropsychiatric disorder characterized by chronic motor and vocal tics. Despite a strong genetic contribution, inheritance is complex, and risk alleles have proven difficult to identify. Here, we describe an analysis of linkage in a two-generation pedigree leading to the identification of a rare functional mutation in the HDC gene encoding l-histidine decarboxylase, the rate-limiting enzyme in histamine biosynthesis. Our findings, together with previously published data from model systems, point to a role for histaminergic neurotransmission in the mechanism and modulation of Tourette's syndrome and tics. PMID:20445167

Cloning of the cDNA for human 12-lipoxygenase

International Nuclear Information System (INIS)

Izumi, T.; Hoshiko, S.; Radmark, O.; Samuelsson, B.

1990-01-01

A full-length cDNA clone encoding 12-lipoxygenase was isolated from a human platelet cDNA library by using a cDNA for human reticulocyte 15-lipoxygenase as probe for the initial screening. The cDNA had an open reading frame encoding 662 amino acid residues with a calculated molecular weight of 75,590. Three independent clones revealed minor heterogeneities in their DNA sequences. Thus, in three positions of the deduced amino acid sequence, there is a choice between two different amino acids. The deduced sequence from the clone plT3 showed 65% identity with human reticulocyte 15-lipoxygenase and 42% identity with human leukocyte 5-lipoxygenase. The 12-lipoxygenase cDNA recognized a 3.0-kilobase mRNA species in platelets and human erythroleukemia cells (HEL cells). Phorbol 12-tetradecanoyl 13-acetate induced megakaryocytic differentiation of HEL cells and 12-lipoxygenase activity and increased mRNA for 12-lipoxygenase. The identity of the cloned 12-lipoxygenase was assured by expression in a mammalian cell line (COS cells). Human platelet 12-lipoxygenase has been difficult to purify to homogeneity. The cloning of this cDNA will increase the possibilities to elucidate the structure and function of this enzyme

cDNA, genomic sequence cloning and overexpression of ribosomal ...

African Journals Online (AJOL)

RPS16 of eukaryote is a component of the 40S small ribosomal subunit encoded by RPS16 gene and is also a homolog of prokaryotic RPS9. The cDNA and genomic sequence of RPS16 was cloned successfully for the first time from the Giant Panda (Ailuropoda melanoleuca) using reverse transcription-polymerase chain ...

Functional cloning using pFB retroviral cDNA expression libraries.

Science.gov (United States)

Felts, Katherine A; Chen, Keith; Zaharee, Kim; Sundar, Latha; Limjoco, Jamie; Miller, Anna; Vaillancourt, Peter

2002-09-01

Retroviral cDNA expression libraries allow the efficient introduction of complex cDNA libraries into virtually any mitotic cell type for screening based on gene function. The cDNA copy number per cell can be easily controlled by adjusting the multiplicity of infection, thus cell populations may be generated in which >90% of infected cells contain one to three cDNAs. We describe the isolation of two known oncogenes and one cell-surface receptor from a human Burkitt's lymphoma (Daudi) cDNA library inserted into the high-titer retroviral vector pFB.

Cloning and analysis of the mouse Fanconi anemia group a cDNA and an overlapping penta zinc finger cDNA

NARCIS (Netherlands)

Wong, JCY; Alon, N; Norga, K; Kruyt, FAE; Youssoufian, H; Buchwald, M

2000-01-01

Despite the cloning of four disease-associated genes for Fanconi anemia (FA), the molecular pathogenesis of FA remains largely unknown. To study FA complementation group A using the mouse as a mode I system, we cloned and characterized the mouse homolog of the human FANCA cDNA, The mouse cDNA

cDNA library construction of two human Demodexspecies.

Science.gov (United States)

Niu, DongLing; Wang, RuiLing; Zhao, YaE; Yang, Rui; Hu, Li; Lei, YuYang; Dan, WeiChao

2017-06-01

The research of Demodex, a type of pathogen causing various dermatoses in animals and human beings, is lacking at RNA level. This study aims at extracting RNA and constructing cDNA library for Demodex. First, P. cuniculiand D. farinaewere mixed to establish homogenization method for RNA extraction. Second, D. folliculorumand D. breviswere collected and preserved in Trizol, which were mixed with D. farinaerespectively to extract RNA. Finally, cDNA library was constructed and its quality was assessed. The results indicated that for D. folliculorum& D. farinae, the recombination rate of cDNA library was 90.67% and the library titer was 7.50 × 104 pfu/ml. 17 of the 59 positive clones were predicted to be of D. folliculorum; For D. brevis& D. farinae, the recombination rate was 90.96% and the library titer was 7.85 x104 pfu/ml. 40 of the 59 positive clones were predicted to be of D. brevis. Further detection by specific primers demonstrated that mtDNA cox1, cox3and ATP6 detected from cDNA libraries had 96.52%-99.73% identities with the corresponding sequences in GenBank. In conclusion, the cDNA libraries constructed for Demodexmixed with D. farinaewere successful and could satisfy the requirements for functional genes detection.

Inhibition by derivatives of diguanidines of cell proliferation in Ehrlich ascites cells grown in cultures.

Science.gov (United States)

Alhonen-Hongisto, L; Pösö, H; Jänne, J

1980-01-01

The anti-proliferative effects of 1,1'-[(methylethanediylidene)dinitrilo]diguanidine [methylglyoxal bis(guanylhydrazone)] and 1,1'-[(metHYLETHANEDIYLIDENE)dinitrilo]bis-(3-aminoguaNIDINE) HAVE BEEN STUDIED IN Ehrlich ascites carcinoma cells grown in suspension cultures. Both compounds are potent inhibitors of S-adenosyl-L-methionine decarboxylase from the tumour cells. In the presence of putrescine (but not in its absence), the inhibition produced by 1,1'-[methylethanediylidene)dinitrilo]bis-(3-aminoguanadine) was apparently irreversible, as judged by persistent depression of the enzyme activity even after extensive dialysis. The two compounds produced similar increases in adenosylmethionine decarboxylase activity, which resulted from a striking stabilization of the enzyme in cells grown in the presence of the drugs. The inhibitory effect of the two diguanidine derivatives on the synthesis of DNA and protein became evident after an exposure of 4--8 h. At that time, the only change seen in tumour polyamines in cells grown in the presence of the inhibitors was an increase in cellular putrescine. To find out whether the compounds initially interfered with the energy production of the tumour cells, the cultures were grown in the presence of uniformly labelled glucose, and the formation of lactate, as well as the oxidation of the sugar into CO2, were measured. The activation of glycolysis upon dilution of the tumour cells with fresh medium and the subsequent formation of labelled CO2 were siliar in control cells and in cells exposed to methylglyoxal bis(buanylhydrazone), 1,1'-[(methylethanediylidene)dinitrilo]bis-(3-aminoguanidine) or diaminopropanol. Only a marginal decrease in the cellular content of ATP was found in cells exposed to the inhibitors for 24 h. The diguanidine-induced growth inhibition was fully reversed by low concentrations of exogenous polyamines. However, the possibility remained that the reversal by polyamines was due to a decrease of intracellular

Mechanisms of asbestos-induced squamous metaplasia in tracheobronchial epithelial cells

International Nuclear Information System (INIS)

Cameron, G.; Woodworth, C.D.; Edmondson, S.; Mossman, B.T.

1989-01-01

Within 1 to 4 weeks after exposure to asbestos, differentiated rodent and human tracheobronchial epithelial cells in organ culture undergo squamous metaplasia, a putative preneoplastic lesion characterized by conversion of mucociliary cell types to keratinizing cells. The exogenous addition of retinal acetate (RA) to culture medium of hamster tracheal organ cultures reverses preestablished, asbestos-induced squamous metaplasia, although data suggest that the effectiveness of RA decreases as the length of time between exposure to asbestos and initial application of RA increases. Difluoromethylornithine (DFMO), an irreversible inhibitor of ornithine decarboxylase (ODC), inhibits squamous metaplasia caused by asbestos or vitamin A deficiency, whereas addition of methylglyoxal bis(guanyl-hydrazone) (MGBG), a structural analog of spermidine and inhibitor of S-adenosylmethionine decarboxylase, causes an enhancement of metaplasia under both circumstances. Basal cell hyperplasia and increased incorporation of 3 H-thymidine by tracheal epithelial cells also are seen after addition of the polyamines, putrescine or spermidine, to tracheal organ cultures, an observation supporting the importance of polyamines in the development of this lesion. The use of retinoids and inhibitors of ODC could be promising as preventive and/or therapeutic approaches for individuals at high risk for development of asbestos-associated diseases

cDNA library Table - KAIKOcDNA | LSDB Archive [Life Science Database Archive metadata

Lifescience Database Archive (English)

Full Text Available c00951-005 Description of data contents List of Bombyx mori cDNA libraries. Data file File name: kaiko_cdna_...library.zip File URL: ftp://ftp.biosciencedbc.jp/archive/kaiko-cdna/LATEST/kaiko_cdna_library.zip File size:... 4.8 KB Simple search URL http://togodb.biosciencedbc.jp/togodb/view/kaiko_cdna_l

cDNA sequencing improves the detection of P53 missense mutations in colorectal cancer

International Nuclear Information System (INIS)

Szybka, Malgorzata; Kordek, Radzislaw; Zakrzewska, Magdalena; Rieske, Piotr; Pasz-Walczak, Grazyna; Kulczycka-Wojdala, Dominika; Zawlik, Izabela; Stawski, Robert; Jesionek-Kupnicka, Dorota; Liberski, Pawel P

2009-01-01

Recently published data showed discrepancies beteween P53 cDNA and DNA sequencing in glioblastomas. We hypothesised that similar discrepancies may be observed in other human cancers. To this end, we analyzed 23 colorectal cancers for P53 mutations and gene expression using both DNA and cDNA sequencing, real-time PCR and immunohistochemistry. We found P53 gene mutations in 16 cases (15 missense and 1 nonsense). Two of the 15 cases with missense mutations showed alterations based only on cDNA, and not DNA sequencing. Moreover, in 6 of the 15 cases with a cDNA mutation those mutations were difficult to detect in the DNA sequencing, so the results of DNA analysis alone could be misinterpreted if the cDNA sequencing results had not also been available. In all those 15 cases, we observed a higher ratio of the mutated to the wild type template by cDNA analysis, but not by the DNA analysis. Interestingly, a similar overexpression of P53 mRNA was present in samples with and without P53 mutations. In terms of colorectal cancer, those discrepancies might be explained under three conditions: 1, overexpression of mutated P53 mRNA in cancer cells as compared with normal cells; 2, a higher content of cells without P53 mutation (normal cells and cells showing K-RAS and/or APC but not P53 mutation) in samples presenting P53 mutation; 3, heterozygous or hemizygous mutations of P53 gene. Additionally, for heterozygous mutations unknown mechanism(s) causing selective overproduction of mutated allele should also be considered. Our data offer new clues for studying discrepancy in P53 cDNA and DNA sequencing analysis

Construction and characterization of cDNA library for IRM-2 mice

International Nuclear Information System (INIS)

Wang Qin; Li Jin; Song Li; Liu Qiang; Yue Jingyin; Mu Chuanjie; Tang Weisheng; Fan Feiyue

2010-01-01

Objective: To screen and isolate the radioresistance related genes of IRM-2 mice. Methods: cDNA library of IRM-2 mice was constructed by SMART technique. Total RNA was isolated from spleens of IRM-2 male mice. The first-strand cDNA was synthesized by using PowerScript reverse transcriptase, and double-strand cDNA was synthesized and amplified by long PCR. The PCR products were purified, digested with restriction enzyme Sfi I. The ds-cDNA fragment less than 500 bp was fractionated and ligated to the Sfi I-digested pDNR-LIB vector. The ligation mixture was transformed into E. coil DH5 α by electroporation transformation to generate the unamplified cDNA library. The quality of cDNA library was identified by PCR technique. 130 clones from cDNA library were sequenced and compared with GenBank database. Results: The cDNA library contained 2.25 x 10 6 independent clones with an average insert size of 1.2 kb. The ratio of recombination and full-length was 95% and 55%, respectively. 21 pieces of EST sequences from cDNA library were not the same as the known mice genes and registered into GenBank EST database, with registered number DW474856-DW474876. Conclusions: cDNA library of IRM-2 mice has been constructed successfully. 21 pieces of EST implies that radioresistance correlative genes may be in IRM-2 mice, which will lay a foundation for isolating and identifying radioresistance related genes in further study. (authors)

Nové možnosti v diagnostice kolorektálního karcinomu s využitím technologie cDNA mikročipů

Czech Academy of Sciences Publication Activity Database

Jansová, E.; Krontorád, P.; Svoboda, Z.; Pavlík, T.; Koutná, I.; Kozubek, Michal; Žaloudík, J.; Kozubek, Stanislav

2004-01-01

Roč. 6, č. 17 (2004), s. 203-207 ISSN 0862-495X R&D Projects: GA MZd(CZ) NC6987 Institutional research plan: CEZ:AV0Z5004920 Keywords : cDNA microarray technology - cluster analysis - colorectal cancer Subject RIV: BO - Biophysics

Construction of cDNA libraries from Pseudocercospora fijiensis Morelet infected leaves of the cultivars Calcutta 4 and Niyarma Yik

Directory of Open Access Journals (Sweden)

Milady Mendoza-Rodríguez

2004-01-01

Full Text Available Molecular studies of plant-pathogen interaction are very important for the identification of gene (s related with the pathogenic process, as well as with the plant resistance. These gene (s could be use for the genetic improvement programs in order to obtain resistant cultivars. The aim of this work was to construct complementary DNA (cDNA libraries from infected leaves with Pseudocercospora fijiensis CCIBP-Pf1 isolated of two banana cultivars (a resistant one Calcutta4 and another one susceptible Niyarma Yik. First-strand cDNA synthesis, was made beginning with one microgram of total RNA by using oligo dT primer and cDNA quality was checked by Polimerase chain reaction (PCR with cytochrome b specific primers. Second-strand cDNA synthesis was performed by using the homopolymeric tailing with dC-BamH I + dT-Not I primer combination. Four cDNA libraries of infected plants at different times of infection with the pathogen were obtained. Forty one clones of one of the libraries of Niyarma Yik were sequenced and the obtained sequences correspond with genes related to fungi. Key words: Banana-Mycosphaerella fijiensis interaction,Black Sigatoka, Musa spp.

Agdc1p - a Gallic Acid Decarboxylase Involved in the Degradation of Tannic Acid in the Yeast Blastobotrys (Arxula) adeninivorans.

Science.gov (United States)

Meier, Anna K; Worch, Sebastian; Böer, Erik; Hartmann, Anja; Mascher, Martin; Marzec, Marek; Scholz, Uwe; Riechen, Jan; Baronian, Kim; Schauer, Frieder; Bode, Rüdiger; Kunze, Gotthard

2017-01-01

Tannins and hydroxylated aromatic acids, such as gallic acid (3,4,5-trihydroxybenzoic acid), are plant secondary metabolites which protect plants against herbivores and plant-associated microorganisms. Some microbes, such as the yeast Arxula adeninivorans are resistant to these antimicrobial substances and are able to use tannins and gallic acid as carbon sources. In this study, the Arxula gallic acid decarboxylase (Agdc1p) which degrades gallic acid to pyrogallol was characterized and its function in tannin catabolism analyzed. The enzyme has a higher affinity for gallic acid (K m -0.7 ± 0.2 mM, k cat -42.0 ± 8.2 s -1 ) than to protocatechuic acid (3,4-dihydroxybenzoic acid) (K m -3.2 ± 0.2 mM, k cat -44.0 ± 3.2 s -1 ). Other hydroxylated aromatic acids, such as 3-hydroxybenzoic acid, 4-hydroxybenzoic acid, 2,3-dihydroxybenzoic acid, 2,4-dihydroxybenzoic acid and 2,5-dihydroxybenzoic acid are not gallic acid decarboxylase substrates. A. adeninivorans G1212/YRC102-AYNI1-AGDC1, which expresses the AGDC1 gene under the control of the strong nitrate inducible AYNI1 promoter achieved a maximum gallic acid decarboxylase activity of 1064.4 U/l and 97.5 U/g of dry cell weight in yeast grown in minimal medium with nitrate as nitrogen source and glucose as carbon source. In the same medium, gallic acid decarboxylase activity was not detected for the control strain G1212/YRC102 with AGDC1 expression under the control of the endogenous promoter. Gene expression analysis showed that AGDC1 is induced by gallic acid and protocatechuic acid. In contrast to G1212/YRC102-AYNI1-AGDC1 and G1212/YRC102, A. adeninivorans G1234 [Δ agdc1 ] is not able to grow on medium with gallic acid as carbon source but can grow in presence of protocatechuic acid. This confirms that Agdc1p plays an essential role in the tannic acid catabolism and could be useful in the production of catechol and cis,cis -muconic acid. However, the protocatechuic acid catabolism via Agdc1p to catechol seems to be

Characterization of the porcine carboxypeptidase E cDNA

DEFF Research Database (Denmark)

Hreidarsdôttir, G.E.; Cirera, Susanna; Fredholm, Merete

2007-01-01

the sequence of the cDNA for the porcine CPE gene including all the coding region and the 3'-UTR region was generated. Comparisons with bovine, human, mouse, and rat CPE cDNA sequences showed that the coding regions of the gene are highly conserved both at the nucleotide and at the amino acid level. A very low...

Fiscal 2000 report on result of the full-length cDNA structure analysis; 2000 nendo kanzen cho cDNA kozo kaiseki seika hokokusho

Energy Technology Data Exchange (ETDEWEB)

NONE

2001-03-01

This paper explains the results of research on full-length cDNA structure analysis for the period from April, 2000 to March, 2001. The outline of human genome sequence was published in June, 2000. In Japan, human gene analysis was such that, as the basic technology of the bio industry, a millennium project was decided in the budget of fiscal 2000. The full-length cDNA structure analysis is the core of the project. The libraries of cDNA were prepared using full-length and more than 4-5kbp-long cDNAs by oligo-capping method. It began from determining partial sequence data at end cDNA, and then, with new clones selected therefrom, full-length human cDNA sequence data were determined. The partial sequence data determined by fiscal 2000 were 1,035,000 clones while the full-length sequence data were 12,144 clones. The sequence data obtained were analyzed by homology search and translated into amino acid coding sequences, with predictions conducted on protein functions. A clustering method was examined that selects new clones from partial sequences. Database was constructed on gene expression profiles and disease-related gene sequence data. (NEDO)

Reorientation of the Methyl Group in MAs(III) is the Rate-Limiting Step in the ArsM As(III) S-Adenosylmethionine Methyltransferase Reaction.

Science.gov (United States)

Packianathan, Charles; Li, Jiaojiao; Kandavelu, Palani; Sankaran, Banumathi; Rosen, Barry P

2018-03-01

The most common biotransformation of trivalent inorganic arsenic (As(III)) is methylation to mono-, di-, and trimethylated species. Methylation is catalyzed by As(III) S -adenosylmethionine (SAM) methyltransferase (termed ArsM in microbes and AS3MT in animals). Methylarsenite (MAs(III)) is both the product of the first methylation step and the substrate of the second methylation step. When the rate of the overall methylation reaction was determined with As(III) as the substrate, the first methylation step was rapid, whereas the second methylation step was slow. In contrast, when MAs(III) was used as the substrate, the rate of methylation was as fast as the first methylation step when As(III) was used as the substrate. These results indicate that there is a slow conformational change between the first and second methylation steps. The structure of CmArsM from the thermophilic alga Cyanidioschyzon merolae sp. 5508 was determined with bound MAs(III) at 2.27 Å resolution. The methyl group is facing the solvent, as would be expected when MAs(III) is bound as the substrate rather than facing the SAM-binding site, as would be expected for MAs(III) as a product. We propose that the rate-limiting step in arsenic methylation is slow reorientation of the methyl group from the SAM-binding site to the solvent, which is linked to the conformation of the side chain of a conserved residue Tyr70.

EFFECT OF AERO-/ANAEROBIOSIS ON DECARBOXYLASE ACTIVITY OF SELECTED LACTIC ACID BACTERIA

Directory of Open Access Journals (Sweden)

Stanislav Kráčmar

2010-05-01

Full Text Available Biogenic amines are undesirable compounds produced in foods mainly through bacterial decarboxylase activity. The aim of this study was to investigate some environmental conditions (particularly aero/anaerobiosis, sodium chloride concentration (0–2% w/w, and amount of lactose (0–1% w/w on the activity of tyrosine decarboxylase enzymes of selected six technological important Lactococcus lactis strains. The levels of parameters tested were chosen according to real situation in fermented dairy products technology (especially cheese-making. Tyramine was determined by the ion-exchange chromatography with post-column ninhydrine derivatization and spectrophotometric detection. Tyrosine decarboxylation occurred during the active growth phase. Under the model conditions used, oxygen availability had influence on tyramine production, anaerobiosis seemed to favour the enzyme activity because all L. lactis strains produced higher tyramine amount. doi:10.5219/43

cDNA, genomic sequence cloning and analysis of the ribosomal ...

African Journals Online (AJOL)

Ribosomal protein L37A (RPL37A) is a component of 60S large ribosomal subunit encoded by the RPL37A gene, which belongs to the family of ribosomal L37AE proteins, located in the cytoplasm. The complementary deoxyribonucleic acid (cDNA) and the genomic sequence of RPL37A were cloned successfully from giant ...

Tryptophan decarboxylase plays an important role in ajmalicine biosynthesis in Rauvolfia verticillata.

Science.gov (United States)

Liu, Wanhong; Chen, Rong; Chen, Min; Zhang, Haoxing; Peng, Meifang; Yang, Chunxian; Ming, Xingjia; Lan, Xiaozhong; Liao, Zhihua

2012-07-01

Tryptophan decarboxylase (TDC) converts tryptophan into tryptamine that is the indole moiety of ajmalicine. The full-length cDNA of Rauvolfia verticillata (RvTDC) was 1,772 bps that contained a 1,500-bp ORF encoding a 499-amino-acid polypeptide. Recombinant 55.5 kDa RvTDC converted tryptophan into tryptamine. The K (m) of RvTDC for tryptophan was 2.89 mM, higher than those reported in other TIAs-producing plants. It demonstrated that RvTDC had lower affinity to tryptophan than other plant TDCs. The K (m) of RvTDC was also much higher than that of strictosidine synthase and strictosidine glucosidase in Rauvolfia. This suggested that TDC might be the committed-step enzyme involved in ajmalicine biosynthesis in R. verticillata. The expression of RvTDC was slightly upregulated by MeJA; the five MEP pathway genes and SGD showed no positive response to MeJA; and STR was sharply downregulated by MeJA. MeJA-treated hairy roots produced higher level of ajmalicine (0.270 mg g(-1) DW) than the EtOH control (0.183 mg g(-1) DW). Highest RvTDC expression level was detected in hairy root, about respectively 11, 19, 65, and 109-fold higher than in bark, young leaf, old leaf, and root. Highest ajmalicine content was also found in hairy root (0.249 mg g(-1) DW) followed by in bark (0.161 mg g(-1) DW) and young leaf (0.130 mg g(-1) DW), and least in root (0.014 mg g(-1) DW). Generally, the expression level of RvTDC was positively consistent with the accumulation of ajmalicine. Therefore, it could be deduced that TDC might be the key enzyme involved in ajmalicine biosynthesis in Rauvolfia.

Effect of hexoses on the levels of pyruvate decarboxylase in Mucor rouxii.

OpenAIRE

Barrera, C R; Corral, J

1980-01-01

Pyruvate decarboxylase activity in the dimorphic fungus Mucor rouxii increased 25- to 35-fold in yeastlike and mycelial cells grown in the presence of glucose as compared to the activity observed in mycelial cultures grown in the absence of glucose.

cDNA microarray screening in food safety

International Nuclear Information System (INIS)

Roy, Sashwati; Sen, Chandan K.

2006-01-01

The cDNA microarray technology and related bioinformatics tools presents a wide range of novel application opportunities. The technology may be productively applied to address food safety. In this mini-review article, we present an update highlighting the late breaking discoveries that demonstrate the vitality of cDNA microarray technology as a tool to analyze food safety with reference to microbial pathogens and genetically modified foods. In order to bring the microarray technology to mainstream food safety, it is important to develop robust user-friendly tools that may be applied in a field setting. In addition, there needs to be a standardized process for regulatory agencies to interpret and act upon microarray-based data. The cDNA microarray approach is an emergent technology in diagnostics. Its values lie in being able to provide complimentary molecular insight when employed in addition to traditional tests for food safety, as part of a more comprehensive battery of tests

Glutamate decarboxylase activity in rat brain during experimental epileptic seizures induced by pilocarpine

Energy Technology Data Exchange (ETDEWEB)

Netopilova, M; Drsata, J [Department of Biochemical Sciences, Faculty of Pharmacy, Charles University, 50005 Hradec Kralove (Czech Republic); Haugvicova, R; Kubova, H; Mares, P [Institute of Physiology, Czech Academy of Sciences, 14220 Prague (Czech Republic)

1998-07-01

Glutamate decarboxylase (GAD) activity was studied rat brain parts in a pilocarpine model of epileptic seizures. An increased enzyme activity was found in hippocampus a cerebellum during the acute phase of seizures, while the cortex and cerebellum showed increased GAD activity in the chronic phase of the process. Systematic administration of pilocarpine to rats induces status epilepticus. The aim of this research was to find out if seizures induced by pilocarpine are connected changes in glutamate decarboxylase activity, the enzyme that catalyzes synthesis of inhibitory neurotransmitter GABA. GAD was assayed by means of radiometric method using {sup 14}C-carboxyl-labelled glutamate and measurement of {sup 14}CO{sub 2} radioactivity. Obtained results suggest that pilocarpine seizures are connected with changes of GAD activity in individual parts of rat brain. (authors)

Glutamate decarboxylase activity in rat brain during experimental epileptic seizures induced by pilocarpine

International Nuclear Information System (INIS)

Netopilova, M.; Drsata, J.; Haugvicova, R.; Kubova, H.; Mares, P.

1998-01-01

Glutamate decarboxylase (GAD) activity was studied rat brain parts in a pilocarpine model of epileptic seizures. An increased enzyme activity was found in hippocampus a cerebellum during the acute phase of seizures, while the cortex and cerebellum showed increased GAD activity in the chronic phase of the process. Systematic administration of pilocarpine to rats induces status epilepticus. The aim of this research was to find out if seizures induced by pilocarpine are connected changes in glutamate decarboxylase activity, the enzyme that catalyzes synthesis of inhibitory neurotransmitter GABA. GAD was assayed by means of radiometric method using 14 C-carboxyl-labelled glutamate and measurement of 14 CO 2 radioactivity. Obtained results suggest that pilocarpine seizures are connected with changes of GAD activity in individual parts of rat brain. (authors)

Tumor-promoting phorbol ester amplifies the inductions of tyrosine aminotransferase and ornithine decarboxylase by glucocorticoid

International Nuclear Information System (INIS)

Kido, H.; Fukusen, N.; Katunuma, N.

1987-01-01

In adrenalectomized rats, the tumor-promoting phorbol ester 12-O-tetradecanoylphorbol 13-acetate (TPA) markedly enhanced the inductions of tyrosine aminotransferase (TAT) and ornithine decarboxylase by glucocorticoids, even with sufficient concentration of glucocorticoids to have a maximal effect, whereas it had no effect on TAT activity and increased ornithine decarboxylase activity only slightly in the absence of glucocorticoids. Phorbol derivatives and components of TPA such as 4β-phorbol, phorbol 12-tetradecanoate, phorbol 13-acetate, and 4-O-methylphorbol 12-tetradecanoate 13-acetate, which have no tumor-promoting activity or ability to activate protein kinase C, did not have any effect on TAT induction by glucocorticoid. TPA enhanced the induction of TAT by various glucocorticoids but had no effect on induction of TAT by glucagon or insulin and did not enhance the induction of glucose-6-phosphate dehydrogenase by 17β-estradiol. These results suggest that TPA specifically enhances the induction of TAT and ornithine decarboxylase by glucocorticoids. Similar effects of TPA on TAT induction by glucocorticoid were observed in primary cultures of adult rat hepatocytes. Another activator of protein kinase C, rac-1,2-dioctanoylglycerol, was also found to have similar effects on the cells

cDNA structure, genomic organization and expression patterns of ...

African Journals Online (AJOL)

Visfatin was a newly identified adipocytokine, which was involved in various physiologic and pathologic processes of organisms. The cDNA structure, genomic organization and expression patterns of silver Prussian carp visfatin were described in this report. The silver Prussian carp visfatin cDNA cloned from the liver was ...

Enhancement of protocatechuate decarboxylase activity for the effective production of muconate from lignin-related aromatic compounds.

Science.gov (United States)

Sonoki, Tomonori; Morooka, Miyuki; Sakamoto, Kimitoshi; Otsuka, Yuichiro; Nakamura, Masaya; Jellison, Jody; Goodell, Barry

2014-12-20

The decarboxylation reaction of protocatechuate has been described as a bottleneck and a rate-limiting step in cis,cis-muconate (ccMA) bioproduction from renewable feedstocks such as sugar. Because sugars are already in high demand in the development of many bio-based products, our work focuses on improving protocatechuate decarboxylase (Pdc) activity and ccMA production in particular, from lignin-related aromatic compounds. We previously had transformed an Escherichia coli strain using aroY, which had been used as a protocatechuate decarboxylase encoding gene from Klebsiella pneumoniae subsp. pneumoniae A170-40, and inserted other required genes from Pseudomonas putida KT2440, to allow the production of ccMA from vanillin. This recombinant strain produced ccMA from vanillin, however the Pdc reaction step remained a bottleneck during incubation. In the current study, we identify a way to increase protocatechuate decarboxylase activity in E. coli through enzyme production involving both aroY and kpdB; the latter which encodes for the B subunit of 4-hydroxybenzoate decarboxylase. This permits expression of Pdc activity at a level approximately 14-fold greater than the strain with aroY only. The expression level of AroY increased, apparently as a function of the co-expression of AroY and KpdB. Our results also imply that ccMA may inhibit vanillate demethylation, a reaction step that is rate limiting for efficient ccMA production from lignin-related aromatic compounds, so even though ccMA production may be enhanced, other challenges to overcome vanilate demethylation inhibition still remain.

Molecular cloning of a cDNA and chromosomal localization of a human theta-class glutathione S-transferase gene (GSTT2) to chromosome 22

Energy Technology Data Exchange (ETDEWEB)

Tan, K.L.; Baker, R.T.; Board, P.G. [Australian National Univ., Canberra (Australia)] [and others

1995-01-20

Until recently the Theta-class glutathione S-transferases (GSTs) were largely overlooked due to their low activity with the model substrate 1-chloro-2,4-dinitrobenzene (CDNB) and their failure to bind to immobilized glutathione affinity matrices. Little is known about the number of genes in this class. Recently, Pemble et al. reported the cDNA cloning of a human Theta-class GST, termed GSTT1. In this study, we describe the molecular cloning of a cDNA encoding a second human Theta-class GST (GSTT2) from a {lambda}gt11 human liver 5{prime}-stretch cDNA library. The encoded protein contains 244 amino acids and has 78.3% sequence identity with the rat subunit 12 and only 55.0% identity with human GSTT1. GSTT2 has been mapped to chromosome 22 by somatic cell hybrid analysis. The precise position of the gene was localized to subband 22q11.2 by in situ hybridization. The absence of other regions of hybridization suggests that there are no closely related sequences (e.g., reverse transcribed pseudogenes) scattered throughout the genome and that if there are closely related genes, they must be clustered near GSTT2. Southern blot analysis of human DNA digested with BamHI shows that the size of the GSTT2 gene is relatively small, as the coding sequence falls within a 3.6-kb BamHI fragment. 35 refs., 6 figs.

Infectious Maize rayado fino virus from cloned cDNA

Science.gov (United States)

Maize rayado fino virus (MRFV) is the type member of the marafiviruses within the family Tymoviridae. A cDNA clone from which infectious RNA can be transcribed was produced from a US isolate of MRFV (MRFV-US). Infectivity of transcripts derived from cDNA clones was demonstrated by infection of mai...

Cloning and functional expression of a human pancreatic islet glucose-transporter cDNA

International Nuclear Information System (INIS)

Permutt, M.A.; Koranyi, L.; Keller, K.; Lacy, P.E.; Scharp, D.W.; Mueckler, M.

1989-01-01

Previous studies have suggested that pancreatic islet glucose transport is mediated by a high-K m , low-affinity facilitated transporter similar to that expressed in liver. To determine the relationship between islet and liver glucose transporters, liver-type glucose-transporter cDNA clones were isolated from a human liver cDNA library. The liver-type glucose-transporter cDNA clone hybridized to mRNA transcripts of the same size in human liver and pancreatic islet RNA. A cDNA library was prepared from purified human pancreatic islet tissue and screened with human liver-type glucose-transporter cDNA. The authors isolated two overlapping cDNA clones encompassing 2600 base pairs, which encode a pancreatic islet protein identical in sequence to that of the putative liver-type glucose-transporter protein. Xenopus oocytes injected with synthetic mRNA transcribed from a full-length cDNA construct exhibited increased uptake of 2-deoxyglucose, confirming the functional identity of the clone. These cDNA clones can now be used to study regulation of expression of the gene and to assess the role of inherited defects in this gene as a candidate for inherited susceptibility to non-insulin-dependent diabetes mellitus

A rapid method for screening arrayed plasmid cDNA library by PCR

International Nuclear Information System (INIS)

Hu Yingchun; Zhang Kaitai; Wu Dechang; Li Gang; Xiang Xiaoqiong

1999-01-01

Objective: To develop a PCR-based method for rapid and effective screening of arrayed plasmid cDNA library. Methods: The plasmid cDNA library was arrayed and screened by PCR with a particular set of primers. Results: Four positive clones were obtained through about one week. Conclusion: This method can be applied to screening not only normal cDNA clones, but also cDNA clones-containing small size fragments. This method offers significant advantages over traditional screening method in terms of sensitivity, specificity and efficiency

cDNA cloning and primary structure analysis of invariant chain in ...

African Journals Online (AJOL)

cDNA cloning and primary structure analysis of invariant chain in Chinese Pengze crucian carp. X Liu, W Yu, J Li, F Chen, S Liu, C Wu, J Xu. Abstract. Invariant chain (Ii) plays an important role in MHC class II molecules assembly and exogenous peptide presentation in vertebrates. Although mammalian Ii has been ...

Evolutionary Trails of Plant Group II Pyridoxal Phosphate-Dependent Decarboxylase Genes.

Science.gov (United States)

Kumar, Rahul

2016-01-01

Type II pyridoxal phosphate-dependent decarboxylase (PLP_deC) enzymes play important metabolic roles during nitrogen metabolism. Recent evolutionary profiling of these genes revealed a sharp expansion of histidine decarboxylase genes in the members of Solanaceae family. In spite of the high sequence homology shared by PLP_deC orthologs, these enzymes display remarkable differences in their substrate specificities. Currently, limited information is available on the gene repertoires and substrate specificities of PLP_deCs which renders their precise annotation challenging and offers technical challenges in the immediate identification and biochemical characterization of their full gene complements in plants. Herein, we explored their evolutionary trails in a comprehensive manner by taking advantage of high-throughput data accessibility and computational approaches. We discussed the premise that has enabled an improved reconstruction of their evolutionary lineage and evaluated the factors offering constraints in their rapid functional characterization, till date. We envisage that the synthesized information herein would act as a catalyst for the rapid exploration of their biochemical specificity and physiological roles in more plant species.

The Degradation of 14C-Glutamic Acid by L-Glutamic Acid Decarboxylase.

Science.gov (United States)

Dougherty, Charles M; Dayan, Jean

1982-01-01

Describes procedures and semi-micro reaction apparatus (carbon dioxide trap) to demonstrate how a particular enzyme (L-Glutamic acid decarboxylase) may be used to determine the site or sites of labeling in its substrate (carbon-14 labeled glutamic acid). Includes calculations, solutions, and reagents used. (Author/SK)

Isolation, nucleotide sequence and expression of a cDNA encoding feline granulocyte colony-stimulating factor.

Science.gov (United States)

Dunham, S P; Onions, D E

2001-06-21

A cDNA encoding feline granulocyte colony stimulating factor (fG-CSF) was cloned from alveolar macrophages using the reverse transcriptase-polymerase chain reaction. The cDNA is 949 bp in length and encodes a predicted mature protein of 174 amino acids. Recombinant fG-CSF was expressed as a glutathione S-transferase fusion and purified by affinity chromatography. Biological activity of the recombinant protein was demonstrated using the murine myeloblastic cell line GNFS-60, which showed an ED50 for fG-CSF of approximately 2 ng/ml. Copyright 2001 Academic Press.

cDNA encoding a polypeptide including a hevein sequence

Energy Technology Data Exchange (ETDEWEB)

Raikhel, N.V.; Broekaert, W.F.; Namhai Chua; Kush, A.

1993-02-16

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids.

A coenzyme-independent decarboxylase/oxygenase cascade for the efficient synthesis of vanillin.

Science.gov (United States)

Furuya, Toshiki; Miura, Misa; Kino, Kuniki

2014-10-13

Vanillin is one of the most widely used flavor compounds in the world as well as a promising versatile building block. The biotechnological production of vanillin from plant-derived ferulic acid has attracted much attention as a new alternative to chemical synthesis. One limitation of the known metabolic pathway to vanillin is its requirement for expensive coenzymes. Here, we developed a novel route to vanillin from ferulic acid that does not require any coenzymes. This artificial pathway consists of a coenzyme-independent decarboxylase and a coenzyme-independent oxygenase. When Escherichia coli cells harboring the decarboxylase/oxygenase cascade were incubated with ferulic acid, the cells efficiently synthesized vanillin (8.0 mM, 1.2 g L(-1) ) via 4-vinylguaiacol in one pot, without the generation of any detectable aromatic by-products. The efficient method described here might be applicable to the synthesis of other high-value chemicals from plant-derived aromatics. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Cloning and analysis of the mouse Fanconi anemia group A cDNA and an overlapping penta zinc finger cDNA.

Science.gov (United States)

Wong, J C; Alon, N; Norga, K; Kruyt, F A; Youssoufian, H; Buchwald, M

2000-08-01

Despite the cloning of four disease-associated genes for Fanconi anemia (FA), the molecular pathogenesis of FA remains largely unknown. To study FA complementation group A using the mouse as a model system, we cloned and characterized the mouse homolog of the human FANCA cDNA. The mouse cDNA (Fanca) encodes a 161-kDa protein that shares 65% amino acid sequence identity with human FANCA. Fanca is located at the distal region of mouse chromosome 8 and has a ubiquitous pattern of expression in embryonic and adult tissues. Expression of the mouse cDNA in human FA-A cells restores the cellular drug sensitivity to normal levels. Thus, the expression pattern, protein structure, chromosomal location, and function of FANCA are conserved in the mouse. We also isolated a novel zinc finger protein, Zfp276, which has five C(2)H(2) domains. Interestingly, Zfp276 is situated in the Fanca locus, and the 3'UTR of its cDNA overlaps with the last four exons of Fanca in a tail-to-tail manner. Zfp276 is expressed in the same tissues as Fanca, but does not complement the mitomycin C (MMC)-sensitive phenotype of FA-A cells. The overlapping genomic organization between Zfp276 and Fanca may have relevance to the disease phenotype of FA. Copyright 2000 Academic Press.

Histidine Decarboxylase Deficiency Prevents Autoimmune Diabetes in NOD Mice

OpenAIRE

Alkan , Manal; Machavoine , François; Rignault , Rachel; Dam , Julie; Dy , Michel; Thieblemont , Nathalie

2015-01-01

International audience; Recent evidence has highlighted the role of histamine in inflammation. Since this monoamine has also been strongly implicated in the pathogenesis of type-1 diabetes, we assessed its effect in the nonobese diabetic (NOD) mouse model. To this end, we used mice (inactivated) knocked out for the gene encoding histidine decarboxylase, the unique histamine-forming enzyme, backcrossed on a NOD genetic background. We found that the lack of endogenous histamine in NOD HDC −/− m...

Brain cDNA clone for human cholinesterase

International Nuclear Information System (INIS)

McTiernan, C.; Adkins, S.; Chatonnet, A.; Vaughan, T.A.; Bartels, C.F.; Kott, M.; Rosenberry, T.L.; La Du, B.N.; Lockridge, O.

1987-01-01

A cDNA library from human basal ganglia was screened with oligonucleotide probes corresponding to portions of the amino acid sequence of human serum cholinesterase. Five overlapping clones, representing 2.4 kilobases, were isolated. The sequenced cDNA contained 207 base pairs of coding sequence 5' to the amino terminus of the mature protein in which there were four ATG translation start sites in the same reading frame as the protein. Only the ATG coding for Met-(-28) lay within a favorable consensus sequence for functional initiators. There were 1722 base pairs of coding sequence corresponding to the protein found circulating in human serum. The amino acid sequence deduced from the cDNA exactly matched the 574 amino acid sequence of human serum cholinesterase, as previously determined by Edman degradation. Therefore, our clones represented cholinesterase rather than acetylcholinesterase. It was concluded that the amino acid sequences of cholinesterase from two different tissues, human brain and human serum, were identical. Hybridization of genomic DNA blots suggested that a single gene, or very few genes coded for cholinesterase

Overexpression, purification, crystallization and preliminary structural studies of p-coumaric acid decarboxylase from Lactobacillus plantarum

International Nuclear Information System (INIS)

Rodríguez, Héctor; Rivas, Blanca de las; Muñoz, Rosario; Mancheño, José M.

2007-01-01

The enzyme p-coumaric acid decarboxylase (PDC) from L. plantarum has been recombinantly expressed, purified and crystallized. The structure has been solved at 2.04 Å resolution by the molecular-replacement method. The substrate-inducible p-coumaric acid decarboxylase (PDC) from Lactobacillus plantarum has been overexpressed in Escherichia coli, purified and confirmed to possess decarboxylase activity. The recombinant His 6 -tagged enzyme was crystallized using the hanging-drop vapour-diffusion method from a solution containing 20%(w/v) PEG 4000, 12%(w/v) 2-propanol, 0.2 M sodium acetate, 0.1 M Tris–HCl pH 8.0 with 0.1 M barium chloride as an additive. Diffraction data were collected in-house to 2.04 Å resolution. Crystals belonged to the tetragonal space group P4 3 , with unit-cell parameters a = b = 43.15, c = 231.86 Å. The estimated Matthews coefficient was 2.36 Å 3 Da −1 , corresponding to 48% solvent content, which is consistent with the presence of two protein molecules in the asymmetric unit. The structure of PDC has been determined by the molecular-replacement method. Currently, the structure of PDC complexed with substrate analogues is in progress, with the aim of elucidating the structural basis of the catalytic mechanism

Overexpression, purification, crystallization and preliminary structural studies of p-coumaric acid decarboxylase from Lactobacillus plantarum

Energy Technology Data Exchange (ETDEWEB)

Rodríguez, Héctor; Rivas, Blanca de las; Muñoz, Rosario [Instituto de Fermentaciones Industriales, CSIC, Juan de la Cierva 3, 28006 Madrid (Spain); Mancheño, José M., E-mail: xjosemi@iqfr.csic.es [Grupo de Cristalografía Macromolecular y Biología Estructural, Instituto Rocasolano, CSIC, Serrano 119, 28006 Madrid (Spain); Instituto de Fermentaciones Industriales, CSIC, Juan de la Cierva 3, 28006 Madrid (Spain)

2007-04-01

The enzyme p-coumaric acid decarboxylase (PDC) from L. plantarum has been recombinantly expressed, purified and crystallized. The structure has been solved at 2.04 Å resolution by the molecular-replacement method. The substrate-inducible p-coumaric acid decarboxylase (PDC) from Lactobacillus plantarum has been overexpressed in Escherichia coli, purified and confirmed to possess decarboxylase activity. The recombinant His{sub 6}-tagged enzyme was crystallized using the hanging-drop vapour-diffusion method from a solution containing 20%(w/v) PEG 4000, 12%(w/v) 2-propanol, 0.2 M sodium acetate, 0.1 M Tris–HCl pH 8.0 with 0.1 M barium chloride as an additive. Diffraction data were collected in-house to 2.04 Å resolution. Crystals belonged to the tetragonal space group P4{sub 3}, with unit-cell parameters a = b = 43.15, c = 231.86 Å. The estimated Matthews coefficient was 2.36 Å{sup 3} Da{sup −1}, corresponding to 48% solvent content, which is consistent with the presence of two protein molecules in the asymmetric unit. The structure of PDC has been determined by the molecular-replacement method. Currently, the structure of PDC complexed with substrate analogues is in progress, with the aim of elucidating the structural basis of the catalytic mechanism.

Cloning and characterization of the human colipase cDNA

International Nuclear Information System (INIS)

Lowe, M.E.; Rosenblum, J.L.; McEwen, P.; Strauss, A.W.

1990-01-01

Pancreatic lipase hydrolyzes dietary triglycerides to monoglycerides and fatty acids. In the presence of bile salts, the activity of pancreatic lipase is markedly decreased. The activity can be restored by the addition of colipase, a low molecular weight protein secreted by the pancreas. The action of pancreatic lipase in the gut lumen is dependent upon its interaction with colipase. As a first step in elucidating the molecular events governing the interaction of lipase and colipase with each other and with fatty acids, a cDNA encoding human colipase was isolated from a λgt11 cDNA library with a rabbit polyclonal anti-human colipase antibody. The full-length 525 bp cDNA contained an open reading frame encoding 112 amino acids, including a 17 amino acid signal peptide. The predicted sequence contains 100% of the published protein sequence for human colipase determined by chemical methods, but predicts the presence of five additional NH 2 -terminal amino acids and four additional COOH-terminal amino acids. Comparison of the predicted protein sequence with the known sequences of colipase from other species reveals regions of extensive identity. The authors report, for the first time, a cDNA for colipase. The cDNA predicts a human procolipase an suggests that there may also be processing at the COOH-terminus. The regions of identity with colipase from other species will aid in defining the interaction with lipase and lipids through site-specific mutagenesis

RICD: A rice indica cDNA database resource for rice functional genomics

Directory of Open Access Journals (Sweden)

Zhang Qifa

2008-11-01

Full Text Available Abstract Background The Oryza sativa L. indica subspecies is the most widely cultivated rice. During the last few years, we have collected over 20,000 putative full-length cDNAs and over 40,000 ESTs isolated from various cDNA libraries of two indica varieties Guangluai 4 and Minghui 63. A database of the rice indica cDNAs was therefore built to provide a comprehensive web data source for searching and retrieving the indica cDNA clones. Results Rice Indica cDNA Database (RICD is an online MySQL-PHP driven database with a user-friendly web interface. It allows investigators to query the cDNA clones by keyword, genome position, nucleotide or protein sequence, and putative function. It also provides a series of information, including sequences, protein domain annotations, similarity search results, SNPs and InDels information, and hyperlinks to gene annotation in both The Rice Annotation Project Database (RAP-DB and The TIGR Rice Genome Annotation Resource, expression atlas in RiceGE and variation report in Gramene of each cDNA. Conclusion The online rice indica cDNA database provides cDNA resource with comprehensive information to researchers for functional analysis of indica subspecies and for comparative genomics. The RICD database is available through our website http://www.ncgr.ac.cn/ricd.

Role of diamine oxidase during the treatment of tumour-bearing mice with combinations of polyamine anti-metabolites.

Science.gov (United States)

Kallio, A; Jänne, J

1983-01-01

Treatment of mice bearing L1210 leukaemia with 2-difluoromethylornithine, a specific inhibitor of ornithine decarboxylase (EC 4.1.1.17), produced a profound depletion of putrescine and spermidine in the tumour cells. Sequential combination of methylglyoxal bis(guanylhydrazone), an inhibitor of adenosylmethionine decarboxylase (EC 4.1.1.50), with difluoromethylornithine largely reversed the polyamine depletion and led to a marked accumulation of cadaverine in the tumour cells. Experiments carried out with the combination of difluoromethylornithine and aminoguanidine, a potent inhibitor of diamine oxidase (EC 1.4.3.6), indicated that the methylglyoxal bis(guanylhydrazone)-induced reversal of polyamine depletion was mediated by the known inhibition of diamine oxidase by the diguanidine. In spite of the normalization of the tumour cell polyamine pattern upon administration of methylglyoxal bis(guanylhydrazone) to difluoromethylornithine-treated animals, the combination of these two drugs produced a growth-inhibitory effect not achievable with either of the compounds alone. PMID:6411077

Novel infectious cDNA clones of hepatitis C virus genotype 3a (strain S52) and 4a (strain ED43): genetic analyses and in vivo pathogenesis studies

DEFF Research Database (Denmark)

Gottwein, Judith; Scheel, Troels; Callendret, Benoit

2010-01-01

Previously, RNA transcripts of cDNA clones of hepatitis C virus (HCV) genotypes 1a (strains H77, HCV-1, and HC-TN), 1b (HC-J4, Con1, and HCV-N), and 2a (HC-J6 and JFH1) were found to be infectious in chimpanzees. However, only JFH1 was infectious in human hepatoma Huh7 cells. We performed genetic...... analysis of HCV genotype 3a (strain S52) and 4a (strain ED43) prototype strains and generated full-length consensus cDNA clones (pS52 and pED43). Transfection of Huh7.5 cells with RNA transcripts of these clones did not yield cells expressing HCV Core. However, intrahepatic transfection of chimpanzees...... resulted in robust infection with peak HCV RNA titers of approximately 5.5 log(10) international units (IU)/ml. Genomic consensus sequences recovered from serum at the times of peak viral titers were identical to the sequences of the parental plasmids. Both chimpanzees developed acute hepatitis...

Radioenzymatic assay of DOPA (3,4-dihydroxyphenylalanine)

International Nuclear Information System (INIS)

Johnson, G.A.; Gren, J.M.; Kupiecki, R.

1978-01-01

We modified the single-isotope radioenzymatic assay for catecholamines [Life Sci. 21, 625(1977)] to assay 3,4-dihydroxyphenylalanine (DOPA). DOPA decarboxylase is used to convert DOPA to dopamine, which concurrently is converted to [ 3 H]-3-O-methyldopamine in the presence of catechol-O-methyltransferase and [methyl- 3 H]-S-adenosylmethionine and assayed radioenzymatically. For assay of plasma DOPA, 50 μl of untreated plasma is added directly into the incubation mixture. A duplicate mixture containing an internal standard requires a second 50-μl aliquot of plasma. Because the assay measures both DOPA and endogenous dopamine, two additional aliquots of plasma must be assayed for dopamine in the absence of the decarboxylase by the differential assay; DOPA is estimated by difference. The assay is sensitive to 25 pg (500 ng/liter of plasma). Analysis of DOPA (DOPA plus dopamine) and the concurrent differential assay of catecholamines in at least 10 samples can be done in a single working day. Plasma DOPA concentrations for 42 normotensive adults were 1430 +- 19 ng/liter (mean +- SEM). In contrast, dopamine concentrations for these same subjects averaged 23 +- 20 ng/liter. Values for the 24 women subjects (1510 +- 62 ng/liter) significantly (P = 0.04) exceeded those for the men

Cloning and expression of human deoxycytidine kinase cDNA

International Nuclear Information System (INIS)

Chottiner, E.G.; Shewach, D.S.; Datta, N.S.; Ashcraft, E.; Gribbin, D.; Ginsburg, D.; Fox, I.H.; Mitchell, B.S.

1991-01-01

Deoxycytidine (dCyd) kinase is required for the phosphorylation of several deoxyribonucleosides and certain nucleoside analogs widely employed as antiviral and chemotherapeutic agents. Detailed analysis of this enzyme has been limited, however, by its low abundance and instability. Using oligonucleotides based on primary amino acid sequence derived from purified dCyd kinase, the authors have screened T-lymphoblast cDNA libraries and identified a cDNA sequence that encodes a 30.5-kDa protein corresponding to the subunit molecular mass of the purified protein. Expression of the cDNA in Escherichia coli results in a 40-fold increase in dCyd kinase activity over control levels. Northern blot analysis reveals a single 2.8-kilobase mRNA expressed in T lymphoblasts at 5- to 10-fold higher levels than in B lymphoblasts, and decreased dCyd kinase mRNA levels are present in T-lymphoblast cell lines resistant to arabinofuranosylcytosine and dideoxycytidine. These findings document that this cDNA encodes the T-lymphoblast dCyd kinase responsible for the phosphorylation of dAdo and dGuo as well as dCyd and arabinofuranosylcytosine

Overexpression of pyruvate decarboxylase in the yeast Hansenula polymorpha results in increased ethanol yield in high-temperature fermentation of xylose.

Science.gov (United States)

Ishchuk, Olena P; Voronovsky, Andriy Y; Stasyk, Oleh V; Gayda, Galina Z; Gonchar, Mykhailo V; Abbas, Charles A; Sibirny, Andriy A

2008-11-01

Improvement of xylose fermentation is of great importance to the fuel ethanol industry. The nonconventional thermotolerant yeast Hansenula polymorpha naturally ferments xylose to ethanol at high temperatures (48-50 degrees C). Introduction of a mutation that impairs ethanol reutilization in H. polymorpha led to an increase in ethanol yield from xylose. The native and heterologous (Kluyveromyces lactis) PDC1 genes coding for pyruvate decarboxylase were expressed at high levels in H. polymorpha under the control of the strong constitutive promoter of the glyceraldehyde-3-phosphate dehydrogenase gene (GAPDH). This resulted in increased pyruvate decarboxylase activity and improved ethanol production from xylose. The introduction of multiple copies of the H. polymorpha PDC1 gene driven by the strong constitutive promoter led to a 20-fold increase in pyruvate decarboxylase activity and up to a threefold elevation of ethanol production.

Molecular cloning and mammalian expression of human beta 2-glycoprotein I cDNA

DEFF Research Database (Denmark)

Kristensen, Torsten; Schousboe, Inger; Boel, Espen

1991-01-01

Human β2-glycoprotein (β2gpI) cDNA was isolated from a liver cDNA library and sequenced. The cDNA encoded a 19-residue hydrophobic signal peptide followed by the mature β2gpI of 326 amino acid residues. In liver and in the hepatoma cell line HepG2 there are two mRNA species of about 1.4 and 4.3 kb......, respectively, hybridizing specifically with the β2gpI cDNA. Upon isoelectric focusing, recombinant β2gpI obtained from expression of β2gpI cDNA in baby hamster kidney cells showed the same pattern of bands as β2gpI isolated from plasma, and at least 5 polypeptides were visible...

In silico screening of potent natural inhibitor compounds against Human DOPA Decarboxylase for management of Parkinson’s Disease

Directory of Open Access Journals (Sweden)

Surya Narayan Rath

2017-12-01

Full Text Available Loss of dopaminergic neurons of the substantia nigra of the mid brain is a well studied pathophysiology of Parkinson’s disease (PD, is the second most common neurodegenerative disorder. To compensate dopamine levels at the Central Nervous System (CNS exogenous L-Dopa is generally administered. But the major part of the L-Dopa is metabolized by Dopa decarboxylase (DDC, E.C. 4.1.1.28, a pyridoxal 5’ –phosphate (PLP enzyme, which is abundant in CNS and hence, only 1-5% of L-Dopa reaches to dopaminergic neurons. In this context, co-administration of peripheral DDC inhibitors (carbidopa or benserazide has been successfully used for the symptomatic treatment of PD patients. But, due to use of synthetic drugs many adverse effects have been reported during treatment. Therefore, the current study is planned to discover some plant based potent natural inhibitors against human DDC as an alternative way for the management of PD. This study was conducted through virtual screening and molecular docking of DDC enzyme with phytochemicals like withania somnifera (ashwagandha, glycine max (soybean, vicia faba (broad bean, and marsilea quadrifolia (sunsunia etc to evaluate their inhibition properties. In silico study results shown a good binding affinity and predicted some of the phytochemicals as potent natural inhibitors against human DDC. This work could be validated further through experimental procedures.

Construction of a T7 Human Lung Cancer cDNA Library

Directory of Open Access Journals (Sweden)

Wentao YUE

2008-10-01

Full Text Available Background and objective Currently, only a limited numbers of tumor markers for non small lung cancer (NSCLC diagnosis, new biomarker, such as serum autoantibody may improve the early detection of lung cancer. Our objective is construction human lung squamous carcinoma and adenocarcinoma T7 phage display cDNA library from the tissues of NSCLC patients. Methods mRNA was isolated from a pool of total RNA extract from NSCLC tissues obtained from 5 adenocarcinomas and 5 squamous carcinomas, and then mRNA was reverse transcribed into double stranded cDNA. After digestion, the cDNA was inserted into T7Select 10-3 vector. The phage display cDNA library was constructed by package reaction in vitro and plate proliferation. Plaque assay and PCR were used to evaluate the library.Results Two T7 phage display cDNA library were established. Plaque assay show the titer of lung squamas carcinoma library was 1.8×106 pfu, and the adenocarcinoma library was 5×106 pfu. The phage titer of the amplified library were 3.2×1010 pfu/mL and 2.5×1010 pfu/mL. PCR amplification of random plaque show insert ratio were 100% (24/24 in adenocarcinoma library and 95.8% in human lung squamas carcinoma library (23/24. Insert range from 300 bp to 1 500 bp. Conclusion Two phage display cDNA library from NSCLC were constructed.

Neurological disorders associated with glutamic acid decarboxylase antibodies: a Brazilian series

Directory of Open Access Journals (Sweden)

Maurício Fernandes

2012-09-01

Full Text Available Neurological disorders associated with glutamic acid decarboxylase (GAD antibodies are rare pleomorphic diseases of uncertain cause, of which stiff-person syndrome (SPS is the best-known. Here, we described nine consecutive cases of neurological disorders associated with anti-GAD, including nine patients with SPS and three cases with cerebellar ataxia. Additionally, four had hypothyroidism, three epilepsy, two diabetes mellitus and two axial myoclonus.

5'-end sequences of budding yeast full-length cDNA clones and quality scores - Budding yeast cDNA sequencing project | LSDB Archive [Life Science Database Archive metadata

Lifescience Database Archive (English)

Full Text Available east_seq_qual.zip File URL: ftp://ftp.biosciencedbc.jp/archive/yeast_cdna/LATEST/...yeast_seq_qual.zip File size: 59.9MB Simple search URL http://togodb.biosciencedbc.jp/togodb/view/budding_yeast_cdna

[Cloning of cDNA for RNA polymerase subunit from the fission yeast Schizosaccharomyces pombe by heterospecific complementation in Saccharomyces cerevisiae].

Science.gov (United States)

Shpakovskiĭ, G V; Lebedenko, E N; Thuriaux, P

1997-02-01

The rpb10 cDNA of the fission yeast Schizosaccharomyces pombe, encoding one of the five small subunits common to all three nuclear DNA-dependent RNA polymerases, was isolated from an expression cDNA library by two independent approaches: PCR-based screening and direct suppression by means of heterospecific complementation of a temperature-sensitive mutant defective in the corresponding gene of Saccharomyces cerevisiae. The cloned Sz. pombe cDNA encodes a protein Rpb10 of 71 amino acids with an M of 8,275 Da, sharing 51 amino acids (71% identity) with the subunit ABC10 beta of RNA polymerases I-III from S. cerevisiae. All eukaryotic members of this protein family have the same general organization featuring two highly conserved motifs (RCFT/SCGK and RYCCRRM) around an atypical zinc finger and an additional invariant HVDLIEK motif toward the C-terminal end. The last motif is only characteristics for homologs from eukaryotes. In keeping with this remarkable structural conservation, the Sz. pombe cDNA also fully complemented a S. cerevisiae deletion mutant lacking subunit ABC10 beta (null allele rpb10-delta 1::HIS3).

Infectious Maize rayado fino virus from Cloned cDNA.

Science.gov (United States)

Edwards, Michael C; Weiland, John J; Todd, Jane; Stewart, Lucy R

2015-06-01

A full-length cDNA clone was produced from a U.S. isolate of Maize rayado fino virus (MRFV), the type member of the genus Marafivirus within the family Tymoviridae. Infectivity of transcripts derived from cDNA clones was demonstrated by infection of maize plants and protoplasts, as well as by transmission via the known leafhopper vectors Dalbulus maidis and Graminella nigrifrons that transmit the virus in a persistent-propagative manner. Infection of maize plants through vascular puncture inoculation of seed with transcript RNA resulted in the induction of fine stipple stripe symptoms typical of those produced by wild-type MRFV and a frequency of infection comparable with that of the wild type. Northern and Western blotting confirmed the production of MRFV-specific RNAs and proteins in infected plants and protoplasts. An unanticipated increase in subgenomic RNA synthesis over levels in infected plants was observed in protoplasts infected with either wild-type or cloned virus. A conserved cleavage site motif previously demonstrated to function in both Oat blue dwarf virus capsid protein and tymoviral nonstructural protein processing was identified near the amino terminus of the MRFV replicase polyprotein, suggesting that cleavage at this site also may occur.

Isolation and characterization of a cDNA clone coding for a glutathione S-transferase class delta enzyme from the biting midge Culicoides variipennis sonorensis Wirth and Jones.

Science.gov (United States)

Abdallah, M A; Pollenz, R S; Droog, F N; Nunamaker, R A; Tabachnick, W J; Murphy, K E

2000-12-01

Culicoides variipennis sonorensis is the primary vector of bluetongue viruses in North America. Glutathione S-transferases (GSTs) are enzymes that catalyze nucleophilic substitutions, converting reactive lipophilic molecules into soluble conjugates. Increased GST activity is associated with development of insecticide resistance. Described here is the isolation of the first cDNA encoding a C. variipennis GST. The clone consists of 720 translated bases encoding a protein with a M(r) of approximately 24,800 composed of 219 amino acids. The deduced amino acid sequence is similar (64%-74%) to class Delta (previously named Theta) GSTs from the dipteran genera Musca, Drosophila, Lucilia and Anopheles. The cDNA was subcloned into pET-11b, expressed in Epicurian coli BL21 (DE3) and has a specific activity of approximately 28,000 units/mg for the substrate 1-chloro-2,4-dinitrobenzene.

Cloning of cDNA encoding steroid 11β-hydroxylase (P450c11)

International Nuclear Information System (INIS)

Chua, S.C.; Szabo, P.; Vitek, A.; Grzeschik, K.H.; John, M.; White, P.C.

1987-01-01

The authors have isolated bovine and human adrenal cDNA clones encoding the adrenal cytochrome P-450 specific for 11β-hydroxylation (P450c11). A bovine adrenal cDNA library constructed in the bacteriophage λ vector gt10 was probed with a previously isolated cDNA clone corresponding to part of the 3' untranslated region of the 4.2-kilobase (kb) mRNA encoding P450c11. Several clones with 3.2-kb cDNA inserts were isolated. Sequence analysis showed that they overlapped the original probe by 300 base pairs (bp). Combined cDNA and RNA sequence data demonstrated a continuous open reading frame of 1509 bases. P450c11 is predicted to contain 479 amino acid residues in the mature protein in addition to a 24-residue amino-terminal mitochondrial signal sequence. A bovine clone was used to isolate a homologous clone with a 3.5-kb insert from a human adrenal cDNA library. A region of 1100 bp was 81% homologous to 769 bp of the coding sequence of the bovine cDNA except for a 400-bp segment presumed to be an unprocessed intron. Hybridization of the human cDNA to DNA from a panel of human-rodent somatic cell hybrid lines and in situ hybridization to metaphase spreads of human chromosomes localized the gene to the middle of the long arm of chromosome 8. These data should be useful in developing reagents for heterozygote detection and prenatal diagnosis of 11β-hydroxylase deficiency, the second most frequent cause of congenital adrenal hyperplasia

Higher intake of fish and fat is associated with lower plasma s-adenosylhomocysteine

DEFF Research Database (Denmark)

Lind, Mads Vendelbo; Lauritzen, Lotte; Pedersen, Oluf Borbye

2017-01-01

. In addition we assessed whole-blood fatty acid composition and plasma alkylresorcinols. Plasma s-adenosylmethionine (SAM), s-adenosylhomocysteine (SAH), homocysteine (Hcy) and vitamin B12 was included as one-carbon metabolism markers. We used principal component analysis (PCA) to explore dietary patterns...

Human Monoclonal Islet Cell Antibodies From a Patient with Insulin- Dependent Diabetes Mellitus Reveal Glutamate Decarboxylase as the Target Antigen

Science.gov (United States)

Richter, Wiltrud; Endl, Josef; Eiermann, Thomas H.; Brandt, Michael; Kientsch-Engel, Rosemarie; Thivolet, Charles; Jungfer, Herbert; Scherbaum, Werner A.

1992-09-01

The autoimmune phenomena associated with destruction of the β cell in pancreatic islets and development of type 1 (insulin-dependent) diabetes mellitus (IDDM) include circulating islet cell antibodies. We have immortalized peripheral blood lymphocytes from prediabetic individuals and patients with newly diagnosed IDDM by Epstein-Barr virus transformation. IgG-positive cells were selected by anti-human IgG-coupled magnetic beads and expanded in cell culture. Supernatants were screened for cytoplasmic islet cell antibodies using the conventional indirect immunofluorescence test on cryostat sections of human pancreas. Six islet cell-specific B-cell lines, originating from a patient with newly diagnosed IDDM, could be stabilized on a monoclonal level. All six monoclonal islet cell antibodies (MICA 1-6) were of the IgG class. None of the MICA reacted with human thyroid, adrenal gland, anterior pituitary, liver, lung, stomach, and intestine tissues but all six reacted with pancreatic islets of different mammalian species and, in addition, with neurons of rat cerebellar cortex. MICA 1-6 were shown to recognize four distinct antigenic epitopes in islets. Islet cell antibody-positive diabetic sera but not normal human sera blocked the binding of the monoclonal antibodies to their target epitopes. Immunoprecipitation of 35S-labeled human islet cell extracts revealed that a protein of identical size to the enzyme glutamate decarboxylase (EC 4.1.1.15) was a target of all MICA. Furthermore, antigen immunotrapped by the MICA from brain homogenates showed glutamate decarboxylase enzyme activity. MICA 1-6 therefore reveal glutamate decarboxylase as the predominant target antigen of cytoplasmic islet cell autoantibodies in a patient with newly diagnosed IDDM.

Sequence of a cDNA encoding turtle high mobility group 1 protein.

Science.gov (United States)

Zheng, Jifang; Hu, Bi; Wu, Duansheng

2005-07-01

In order to understand sequence information about turtle HMG1 gene, a cDNA encoding HMG1 protein of the Chinese soft-shell turtle (Pelodiscus sinensis) was amplified by RT-PCR from kidney total RNA, and was cloned, sequenced and analyzed. The results revealed that the open reading frame (ORF) of turtle HMG1 cDNA is 606 bp long. The ORF codifies 202 amino acid residues, from which two DNA-binding domains and one polyacidic region are derived. The DNA-binding domains share higher amino acid identity with homologues sequences of chicken (96.5%) and mammalian (74%) than homologues sequence of rainbow trout (67%). The polyacidic region shows 84.6% amino acid homology with the equivalent region of chicken HMG1 cDNA. Turtle HMG1 protein contains 3 Cys residues located at completely conserved positions. Conservation in sequence and structure suggests that the functions of turtle HMG1 cDNA may be highly conserved during evolution. To our knowledge, this is the first report of HMG1 cDNA sequence in any reptilian.

Cloning and expression of cDNA coding for bouganin.

Science.gov (United States)

den Hartog, Marcel T; Lubelli, Chiara; Boon, Louis; Heerkens, Sijmie; Ortiz Buijsse, Antonio P; de Boer, Mark; Stirpe, Fiorenzo

2002-03-01

Bouganin is a ribosome-inactivating protein that recently was isolated from Bougainvillea spectabilis Willd. In this work, the cloning and expression of the cDNA encoding for bouganin is described. From the cDNA, the amino-acid sequence was deduced, which correlated with the primary sequence data obtained by amino-acid sequencing on the native protein. Bouganin is synthesized as a pro-peptide consisting of 305 amino acids, the first 26 of which act as a leader signal while the 29 C-terminal amino acids are cleaved during processing of the molecule. The mature protein consists of 250 amino acids. Using the cDNA sequence encoding the mature protein of 250 amino acids, a recombinant protein was expressed, purified and characterized. The recombinant molecule had similar activity in a cell-free protein synthesis assay and had comparable toxicity on living cells as compared to the isolated native bouganin.

LEDGF/p75 Deficiency Increases Deletions at the HIV-1 cDNA Ends.

Science.gov (United States)

Bueno, Murilo T D; Reyes, Daniel; Llano, Manuel

2017-09-15

Processing of unintegrated linear HIV-1 cDNA by the host DNA repair system results in its degradation and/or circularization. As a consequence, deficient viral cDNA integration generally leads to an increase in the levels of HIV-1 cDNA circles containing one or two long terminal repeats (LTRs). Intriguingly, impaired HIV-1 integration in LEDGF/p75-deficient cells does not result in a correspondent increase in viral cDNA circles. We postulate that increased degradation of unintegrated linear viral cDNA in cells lacking the lens epithelium-derived growth factor (LEDGF/p75) account for this inconsistency. To evaluate this hypothesis, we characterized the nucleotide sequence spanning 2-LTR junctions isolated from LEDGF/p75-deficient and control cells. LEDGF/p75 deficiency resulted in a significant increase in the frequency of 2-LTRs harboring large deletions. Of note, these deletions were dependent on the 3' processing activity of integrase and were not originated by aberrant reverse transcription. Our findings suggest a novel role of LEDGF/p75 in protecting the unintegrated 3' processed linear HIV-1 cDNA from exonucleolytic degradation.

Construction of Infectious cDNA Clone of a Chrysanthemum stunt viroid Korean Isolate

Directory of Open Access Journals (Sweden)

Ju-Yeon Yoon

2014-03-01

Full Text Available Chrysanthemum stunt viroid (CSVd, a noncoding infectious RNA molecule, causes seriously economic losses of chrysanthemum for 3 or 4 years after its first infection. Monomeric cDNA clones of CSVd isolate SK1 (CSVd-SK1 were constructed in the plasmids pGEM-T easy vector and pUC19 vector. Linear positive-sense transcripts synthesized in vitro from the full-length monomeric cDNA clones of CSVd-SK1 could infect systemically tomato seedlings and chrysanthemum plants, suggesting that the linear CSVd RNA transcribed from the cDNA clones could be replicated as efficiently as circular CSVd in host species. However, direct inoculation of plasmid cDNA clones containing full-length monomeric cDNA of CSVd-SK1 failed to infect tomato and chrysanthemum and linear negative-sense transcripts from the plasmid DNAs were not infectious in the two plant species. The cDNA sequences of progeny viroid in systemically infected tomato and chrysanthemum showed a few substitutions at a specific nucleotide position, but there were no deletions and insertions in the sequences of the CSVd progeny from tomato and chrysanthemum plants.

Crystallization and preliminary X-ray analysis of the inducible lysine decarboxylase from Escherichia coli

International Nuclear Information System (INIS)

Alexopoulos, Eftichia; Kanjee, Usheer; Snider, Jamie; Houry, Walid A.; Pai, Emil F.

2008-01-01

The structure of the decameric inducible lysine decarboxylase from E. coli was determined by SIRAS using a hexatantalum dodecabromide (Ta 6 Br 12 2+ ) derivative. Model building and refinement are under way. The decameric inducible lysine decarboxylase (LdcI) from Escherichia coli has been crystallized in space groups C2 and C222 1 ; the Ta 6 Br 12 2+ cluster was used to derivatize the C2 crystals. The method of single isomorphous replacement with anomalous scattering (SIRAS) as implemented in SHELXD was used to solve the Ta 6 Br 12 2+ -derivatized structure to 5 Å resolution. Many of the Ta 6 Br 12 2+ -binding sites had twofold and fivefold noncrystallographic symmetry. Taking advantage of this feature, phase modification was performed in DM. The electron-density map of LdcI displays many features in agreement with the low-resolution negative-stain electron-density map [Snider et al. (2006 ▶), J. Biol. Chem.281, 1532–1546

3G vector-primer plasmid for constructing full-length-enriched cDNA libraries.

Science.gov (United States)

Zheng, Dong; Zhou, Yanna; Zhang, Zidong; Li, Zaiyu; Liu, Xuedong

2008-09-01

We designed a 3G vector-primer plasmid for the generation of full-length-enriched complementary DNA (cDNA) libraries. By employing the terminal transferase activity of reverse transcriptase and the modified strand replacement method, this plasmid (assembled with a polydT end and a deoxyguanosine [dG] end) combines priming full-length cDNA strand synthesis and directional cDNA cloning. As a result, the number of steps involved in cDNA library preparation is decreased while simplifying downstream gene manipulation, sequencing, and subcloning. The 3G vector-primer plasmid method yields fully represented plasmid primed libraries that are equivalent to those made by the SMART (switching mechanism at 5' end of RNA transcript) approach.

cDNA, genomic sequence cloning and overexpression of ribosomal protein S25 gene (RPS25) from the Giant Panda.

Science.gov (United States)

Hao, Yan-Zhe; Hou, Wan-Ru; Hou, Yi-Ling; Du, Yu-Jie; Zhang, Tian; Peng, Zheng-Song

2009-11-01

RPS25 is a component of the 40S small ribosomal subunit encoded by RPS25 gene, which is specific to eukaryotes. Studies in reference to RPS25 gene from animals were handful. The Giant Panda (Ailuropoda melanoleuca), known as a "living fossil", are increasingly concerned by the world community. Studies on RPS25 of the Giant Panda could provide scientific data for inquiring into the hereditary traits of the gene and formulating the protective strategy for the Giant Panda. The cDNA of the RPS25 cloned from Giant Panda is 436 bp in size, containing an open reading frame of 378 bp encoding 125 amino acids. The length of the genomic sequence is 1,992 bp, which was found to possess four exons and three introns. Alignment analysis indicated that the nucleotide sequence of the coding sequence shows a high homology to those of Homo sapiens, Bos taurus, Mus musculus and Rattus norvegicus as determined by Blast analysis, 92.6, 94.4, 89.2 and 91.5%, respectively. Primary structure analysis revealed that the molecular weight of the putative RPS25 protein is 13.7421 kDa with a theoretical pI 10.12. Topology prediction showed there is one N-glycosylation site, one cAMP and cGMP-dependent protein kinase phosphorylation site, two Protein kinase C phosphorylation sites and one Tyrosine kinase phosphorylation site in the RPS25 protein of the Giant Panda. The RPS25 gene was overexpressed in E. coli BL21 and Western Blotting of the RPS25 protein was also done. The results indicated that the RPS25 gene can be really expressed in E. coli and the RPS25 protein fusioned with the N-terminally his-tagged form gave rise to the accumulation of an expected 17.4 kDa polypeptide. The cDNA and the genomic sequence of RPS25 were cloned successfully for the first time from the Giant Panda using RT-PCR technology and Touchdown-PCR, respectively, which were both sequenced and analyzed preliminarily; then the cDNA of the RPS25 gene was overexpressed in E. coli BL21 and immunoblotted, which is the first

Purification of Single-Stranded cDNA Based on RNA Degradation Treatment and Adsorption Chromatography.

Science.gov (United States)

Trujillo-Esquivel, Elías; Franco, Bernardo; Flores-Martínez, Alberto; Ponce-Noyola, Patricia; Mora-Montes, Héctor M

2016-08-02

Analysis of gene expression is a common research tool to study networks controlling gene expression, the role of genes with unknown function, and environmentally induced responses of organisms. Most of the analytical tools used to analyze gene expression rely on accurate cDNA synthesis and quantification to obtain reproducible and quantifiable results. Thus far, most commercial kits for isolation and purification of cDNA target double-stranded molecules, which do not accurately represent the abundance of transcripts. In the present report, we provide a simple and fast method to purify single-stranded cDNA, exhibiting high purity and yield. This method is based on the treatment with RNase H and RNase A after cDNA synthesis, followed by separation in silica spin-columns and ethanol precipitation. In addition, our method avoids the use of DNase I to eliminate genomic DNA from RNA preparations, which improves cDNA yield. As a case report, our method proved to be useful in the purification of single-stranded cDNA from the pathogenic fungus Sporothrix schenckii.

CDNA encoding a polypeptide including a hevein sequence

Science.gov (United States)

Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil

1995-03-21

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

Overexpression of SAMDC1 gene in Arabidopsis thaliana increases expression of defense-related genes as well as resistance to Pseudomonas syringae and Hyaloperonospora arabidopsidis

Directory of Open Access Journals (Sweden)

Francisco eMarco

2014-03-01

Full Text Available It has been previously described that elevation of endogenous spermine levels in Arabidopsis could be achieved by transgenic overexpression of S-Adenosylmethionine decarboxylase (SAMDC or Spermine synthase (SPMS. In both cases, spermine accumulation had an impact on the plant transcriptome, with up-regulation of a set of genes enriched in functional categories involved in defense-related processes against both biotic and abiotic stresses. In this work, the response of SAMDC1-overexpressing plants against bacterial and oomycete pathogens has been tested. The expression of several pathogen defense-related genes was induced in these plants as well as in wild type plants exposed to an exogenous supply of spermine. SAMDC1-overexpressing plants showed an increased tolerance to infection by Pseudomonas syringae and by Hyaloperonospora arabidopsidis. Both results add more evidence to the hypothesis that spermine plays a key role in plant resistance to biotic stress.

A dopa decarboxylase modulating the immune response of scallop Chlamys farreri.

Directory of Open Access Journals (Sweden)

Zhi Zhou

Full Text Available BACKGROUND: Dopa decarboxylase (DDC is a pyridoxal 5-phosphate (PLP-dependent enzyme that catalyzes the decarboxylation of L-Dopa to dopamine, and involved in complex neuroendocrine-immune regulatory network. The function for DDC in the immunomodulation remains unclear in invertebrate. METHODOLOGY: The full-length cDNA encoding DDC (designated CfDDC was cloned from mollusc scallop Chlamys farreri. It contained an open reading frame encoding a polypeptide of 560 amino acids. The CfDDC mRNA transcripts could be detected in all the tested tissues, including the immune tissues haemocytes and hepatopancreas. After scallops were treated with LPS stimulation, the mRNA expression level of CfDDC in haemocytes increased significantly (5.5-fold, P<0.05 at 3 h and reached the peak at 12 h (9.8-fold, P<0.05, and then recovered to the baseline level. The recombinant protein of CfDDC (rCfDDC was expressed in Escherichia coli BL21 (DE3-Transetta, and 1 mg rCfDDC could catalyze the production of 1.651±0.22 ng dopamine within 1 h in vitro. When the haemocytes were incubated with rCfDDC-coated agarose beads, the haemocyte encapsulation to the beads was increased significantly from 70% at 6 h to 93% at 24 h in vitro in comparison with that in the control (23% at 6 h to 25% at 24 h, and the increased haemocyte encapsulation was repressed by the addition of rCfDDC antibody (which is acquired via immunization 6-week old rats with rCfDDC. After the injection of DDC inhibitor methyldopa, the ROS level in haemocytes of scallops was decreased significantly to 0.41-fold (P<0.05 of blank group at 12 h and 0.47-fold (P<0.05 at 24 h, respectively. CONCLUSIONS: These results collectively suggested that CfDDC, as a homologue of DDC in scallop, modulated the immune responses such as haemocytes encapsulation as well as the ROS level through its catalytic activity, functioning as an indispensable immunomodulating enzyme in the neuroendocrine-immune regulatory network of mollusc.

DPD epitope-specific glutamic acid decarboxylase GAD)65 autoantibodies in children with Type 1 diabetes

Science.gov (United States)

To study whether DPD epitope-specific glutamate decarboxylase autoantibodies are found more frequently in children with milder forms of Type 1 diabetes. We prospectively evaluated 75 children with new-onset autoimmune Type 1 diabetes, in whom we collected demographic, anthropometric and clinical dat...

Crystal Structure and Substrate Specificity of Drosophila 3,4-Dihydroxyphenylalanine Decarboxylase

Energy Technology Data Exchange (ETDEWEB)

Han, Q.; Ding, H; Robinson, H; Christensen, B; Li, J

2010-01-01

3,4-Dihydroxyphenylalanine decarboxylase (DDC), also known as aromatic L-amino acid decarboxylase, catalyzes the decarboxylation of a number of aromatic L-amino acids. Physiologically, DDC is responsible for the production of dopamine and serotonin through the decarboxylation of 3,4-dihydroxyphenylalanine and 5-hydroxytryptophan, respectively. In insects, both dopamine and serotonin serve as classical neurotransmitters, neuromodulators, or neurohormones, and dopamine is also involved in insect cuticle formation, eggshell hardening, and immune responses. In this study, we expressed a typical DDC enzyme from Drosophila melanogaster, critically analyzed its substrate specificity and biochemical properties, determined its crystal structure at 1.75 Angstrom resolution, and evaluated the roles residues T82 and H192 play in substrate binding and enzyme catalysis through site-directed mutagenesis of the enzyme. Our results establish that this DDC functions exclusively on the production of dopamine and serotonin, with no activity to tyrosine or tryptophan and catalyzes the formation of serotonin more efficiently than dopamine. The crystal structure of Drosophila DDC and the site-directed mutagenesis study of the enzyme demonstrate that T82 is involved in substrate binding and that H192 is used not only for substrate interaction, but for cofactor binding of drDDC as well. Through comparative analysis, the results also provide insight into the structure-function relationship of other insect DDC-like proteins.

Crystal structure and substrate specificity of Drosophila 3,4-dihydroxyphenylalanine decarboxylase.

Directory of Open Access Journals (Sweden)

Qian Han

2010-01-01

Full Text Available 3,4-Dihydroxyphenylalanine decarboxylase (DDC, also known as aromatic L-amino acid decarboxylase, catalyzes the decarboxylation of a number of aromatic L-amino acids. Physiologically, DDC is responsible for the production of dopamine and serotonin through the decarboxylation of 3,4-dihydroxyphenylalanine and 5-hydroxytryptophan, respectively. In insects, both dopamine and serotonin serve as classical neurotransmitters, neuromodulators, or neurohormones, and dopamine is also involved in insect cuticle formation, eggshell hardening, and immune responses.In this study, we expressed a typical DDC enzyme from Drosophila melanogaster, critically analyzed its substrate specificity and biochemical properties, determined its crystal structure at 1.75 Angstrom resolution, and evaluated the roles residues T82 and H192 play in substrate binding and enzyme catalysis through site-directed mutagenesis of the enzyme. Our results establish that this DDC functions exclusively on the production of dopamine and serotonin, with no activity to tyrosine or tryptophan and catalyzes the formation of serotonin more efficiently than dopamine.The crystal structure of Drosophila DDC and the site-directed mutagenesis study of the enzyme demonstrate that T82 is involved in substrate binding and that H192 is used not only for substrate interaction, but for cofactor binding of drDDC as well. Through comparative analysis, the results also provide insight into the structure-function relationship of other insect DDC-like proteins.

CDNA cloning, characterization and expression of an endosperm-specific barley peroxidase

DEFF Research Database (Denmark)

Rasmussen, Søren Kjærsgård; Welinder, K.G.; Hejgaard, J.

1991-01-01

A barley peroxidase (BP 1) of pI ca. 8.5 and M(r) 37000 has been purified from mature barley grains. Using antibodies towards peroxidase BP 1, a cDNA clone (pcR7) was isolated from cDNA expression library. The nucleotide sequence of pcR7 gave a derived amino acid sequence identical to the 158 C...

Glucocorticoids and Polyamine Inhibitors Synergize to Kill Human Leukemic CEM Cells1

Science.gov (United States)

Miller, Aaron L; Johnson, Betty H; Medh, Rheem D; Townsend, Courtney M; Thompson, E Brad

2002-01-01

Abstract Glucocorticoids are well-known apoptotic agents in certain classes of lymphoid cell malignancies. Reduction of intracellular polyamine levels by use of inhibitors that block polyamine synthesis slows or inhibits growth of many cells in vitro. Several such inhibitors have shown efficacy in clinical trials, though the toxicity of some compounds has limited their usefulness. We have tested the effects of combinations of the glucocorticoid dexamethasone (Dex) and two polyamine inhibitors, difluoromethylornithine (DFMO) and methyl glyoxal bis guanylhydrazone (MGBG), on the clonal line of human acute lymphoblastic leukemia cells, CEM-C7-14. Dex alone kills these cells, though only after a delay of at least 24 hours. We also evaluated a partially glucocorticoid-resistant c-Myc-expressing CEM-C7-14 clone. We show that Dex downregulates ornithine decarboxylase (ODC), the rate-limiting enzyme in polyamine synthesis. Pretreatment with the ODC inhibitor DFMO, followed by addition of Dex, enhances steroid-evoked kill slightly. The combination of pretreatment with sublethal concentrations of both DFMO and the inhibitor of S-adenosylmethionine decarboxylase, MGBG, followed by addition of Dex, results in strong synergistic cell kill. Both the rapidity and extent of cell kill are enhanced compared to the effects of Dex alone. These results suggest that use of such combinations in vivo may result in apoptosis of malignant cells with lower overall toxicity. PMID:11922393

Glucocorticoids and Polyamine Inhibitors Synergize to Kill Human Leukemic CEM Cells

Directory of Open Access Journals (Sweden)

Aaron L. Miller

2002-01-01

Full Text Available Glucocorticoids are well-known apoptotic agents in certain classes of lymphoid cell malignancies. Reduction of intracellular polyamine levels by use of inhibitors that block polyamine synthesis slows or inhibits growth of many cells in vitro. Several such inhibitors have shown efficacy in clinical trials, though the toxicity of some compounds has limited their usefulness. We have tested the effects of combinations of the glucocorticoid dexamethasone. (20Dex and two polyamine inhibitors, difluoromethylornithine. (20DFMO and methyl glyoxal bis guanylhydrazone. (20MGBG, on the clonal line of human acute lymphoblastic leukemia cells, CEM-C7-14. Dex alone kills these cells, though only after a delay of at least 24 hours. We also evaluated a partially glucocorticoid-resistant c-Myc-expressing CEM-C7-14 clone. We show that Dex downregulates ornithine decarboxylase. (20ODC, the rate-limiting enzyme in polyamine synthesis. Pretreatment with the ODC inhibitor DFMO, followed by addition of Dex, enhances steroid-evoked kill slightly. The combination of pretreatment with sublethal concentrations of both DFMO and the inhibitor of S-adenosylmethionine decarboxylase, MGBG, followed by addition of Dex, results in strong synergistic cell kill. Both the rapidity and extent of cell kill are enhanced compared to the effects of Dex alone. These results suggest that use of such combinations in vivo may result in apoptosis of malignant cells with lower overall toxicity.

cDNA sequence analysis of a 29-kDa cysteine-rich surface antigen of pathogenic Entamoeba histolytica

International Nuclear Information System (INIS)

Torian, B.E.; Stroeher, V.L.; Stamm, W.E.; Flores, B.M.; Hagen, F.S.

1990-01-01

A λgt11 cDNA library was constructed from poly(U)-Spharose-selected Entamoeba histolytica trophozoite RNA in order to clone and identify surface antigens. The library was screened with rabbit polyclonal anti-E. histolytica serum. A 700-base-pair cDNA insert was isolated and the nucleotide sequence was determined. The deduced amino acid sequence of the cDNA revealed a cysteine-rich protein. DNA hybridizations showed that the gene was specific to E. histolytica since the cDNA probe reacted with DNA from four axenic strains of E. histolytica but did not react with DNA from Entamoeba invadens, Acanthamoeba castellanii, or Trichomonas vaginalis. The insert was subcloned into the expression vector pGEX-1 and the protein was expressed as a fusion with the C terminus of glutathione S-transferase. Purified fusion protein was used to generate 22 monoclonal antibodies (mAbs) and a mouse polyclonal antiserum specific for the E. histolytica portion of the fusion protein. A 29-kDa protein was identified as a surface antigen when mAbs were used to immunoprecipitate the antigen from metabolically 35 S-labeled live trophozoites. The surface location of the antigen was corroborated by mAb immunoprecipitation of a 29-kDa protein from surface- 125 I-labeled whole trophozoites as well as by the reaction of mAbs with live trophozoites in an indirect immunofluorescence assay performed at 4 degree C. Immunoblotting with mAbs demonstrated that the antigen was present on four axenic isolates tested. mAbs recognized epitopes on the 29-kDa native antigen on some but not all clinical isolates tested

cDNA sequence analysis of a 29-kDa cysteine-rich surface antigen of pathogenic Entamoeba histolytica

Energy Technology Data Exchange (ETDEWEB)

Torian, B.E.; Stroeher, V.L.; Stamm, W.E. (Univ. of Washington, Seattle (USA)); Flores, B.M. (Louisiana State Univ. Medical Center, New Orleans (USA)); Hagen, F.S. (Zymogenetics Incorporated, Seattle, WA (USA))

1990-08-01

A {lambda}gt11 cDNA library was constructed from poly(U)-Spharose-selected Entamoeba histolytica trophozoite RNA in order to clone and identify surface antigens. The library was screened with rabbit polyclonal anti-E. histolytica serum. A 700-base-pair cDNA insert was isolated and the nucleotide sequence was determined. The deduced amino acid sequence of the cDNA revealed a cysteine-rich protein. DNA hybridizations showed that the gene was specific to E. histolytica since the cDNA probe reacted with DNA from four axenic strains of E. histolytica but did not react with DNA from Entamoeba invadens, Acanthamoeba castellanii, or Trichomonas vaginalis. The insert was subcloned into the expression vector pGEX-1 and the protein was expressed as a fusion with the C terminus of glutathione S-transferase. Purified fusion protein was used to generate 22 monoclonal antibodies (mAbs) and a mouse polyclonal antiserum specific for the E. histolytica portion of the fusion protein. A 29-kDa protein was identified as a surface antigen when mAbs were used to immunoprecipitate the antigen from metabolically {sup 35}S-labeled live trophozoites. The surface location of the antigen was corroborated by mAb immunoprecipitation of a 29-kDa protein from surface-{sup 125}I-labeled whole trophozoites as well as by the reaction of mAbs with live trophozoites in an indirect immunofluorescence assay performed at 4{degree}C. Immunoblotting with mAbs demonstrated that the antigen was present on four axenic isolates tested. mAbs recognized epitopes on the 29-kDa native antigen on some but not all clinical isolates tested.

Nucleotide sequence of Phaseolus vulgaris L. alcohol dehydrogenase encoding cDNA and three-dimensional structure prediction of the deduced protein.

Science.gov (United States)

Amelia, Kassim; Khor, Chin Yin; Shah, Farida Habib; Bhore, Subhash J

2015-01-01

Common beans (Phaseolus vulgaris L.) are widely consumed as a source of proteins and natural products. However, its yield needs to be increased. In line with the agenda of Phaseomics (an international consortium), work of expressed sequence tags (ESTs) generation from bean pods was initiated. Altogether, 5972 ESTs have been isolated. Alcohol dehydrogenase (AD) encoding gene cDNA was a noticeable transcript among the generated ESTs. This AD is an important enzyme; therefore, to understand more about it this study was undertaken. The objective of this study was to elucidate P. vulgaris L. AD (PvAD) gene cDNA sequence and to predict the three-dimensional (3D) structure of deduced protein. positive and negative strands of the PvAD cDNA clone were sequenced using M13 forward and M13 reverse primers to elucidate the nucleotide sequence. Deduced PvAD cDNA and protein sequence was analyzed for their basic features using online bioinformatics tools. Sequence comparison was carried out using bl2seq program, and tree-view program was used to construct a phylogenetic tree. The secondary structures and 3D structure of PvAD protein were predicted by using the PHYRE automatic fold recognition server. The sequencing results analysis showed that PvAD cDNA is 1294 bp in length. It's open reading frame encodes for a protein that contains 371 amino acids. Deduced protein sequence analysis showed the presence of putative substrate binding, catalytic Zn binding, and NAD binding sites. Results indicate that the predicted 3D structure of PvAD protein is analogous to the experimentally determined crystal structure of s-nitrosoglutathione reductase from an Arabidopsis species. The 1294 bp long PvAD cDNA encodes for 371 amino acid long protein that contains conserved domains required for biological functions of AD. The predicted deduced PvAD protein's 3D structure reflects the analogy with the crystal structure of Arabidopsis thaliana s-nitrosoglutathione reductase. Further study is required

[Primary culture of cat intestinal epithelial cell and construction of its cDNA library].

Science.gov (United States)

Ye, L; Gui-Hua, Z; Kun, Y; Hong-Fa, W; Ting, X; Gong-Zhen, L; Wei-Xia, Z; Yong, C

2017-04-12

Objective To establish the primary cat intestinal epithelial cells (IECs) culture methods and construct the cDNA library for the following yeast two-hybrid experiment, so as to screen the virulence interaction factors among the final host. Methods The primary cat IECs were cultured by the tissue cultivation and combined digestion with collagenase XI and dispase I separately. Then the cat IECs cultured was identified with the morphological observation and cyto-keratin detection, by using goat anti-cyto-keratin monoclonal antibodies. The mRNA of cat IECs was isolated and used as the template to synthesize the first strand cDNA by SMART™ technology, and then the double-strand cDNAs were acquired by LD-PCR, which were subsequently cloned into the plasmid PGADT7-Rec to construct yeast two-hybrid cDNA library in the yeast strain Y187 by homologous recombination. Matchmaker™ Insert Check PCR was used to detect the size distribution of cDNA fragments after the capacity calculation of the cDNA library. Results The comparison of the two cultivation methods indicated that the combined digestion of collagenase XI and dispase I was more effective than the tissue cultivation. The cat IECs system of continuous culture was established and the cat IECs with high purity were harvested for constructing the yeast two-hybrid cDNA library. The library contained 1.1×10 6 independent clones. The titer was 2.8×10 9 cfu/ml. The size of inserted fragments was among 0.5-2.0 kb. Conclusion The yeast two-hybrid cDNA library of cat IECs meets the requirements of further screen research, and this study lays the foundation of screening the Toxoplasma gondii virulence interaction factors among the cDNA libraries of its final hosts.

Heterogeneity of rat tropoelastin mRNA revealed by cDNA cloning

International Nuclear Information System (INIS)

Pierce, R.A.; Deak, S.B.; Stolle, C.A.; Boyd, C.D.

1990-01-01

A λgt11 library constructed from poly(A+) RNA isolated from aortic tissue of neonatal rats was screened for rat tropoelastin cDNAs. The first, screen, utilizing a human tropoelastin cDNA clone, provided rat tropoelastin cDNAs spanning 2.3 kb of carboxy-terminal coding sequence and extended into the 3'-untranslated region. A subsequent screen using a 5' rat tropoelastin cDNA clone yielded clones extending into the amino-terminal signal sequence coding region. Sequence analysis of these clones has provided the complete derived amino acid sequence of rat tropoelastin and allowed alignment and comparison with published bovine cDNA sequence. While the overall structure of rat tropoelastin is similar to bovine sequence, numerous substitutions, deletions, and insertions demonstrated considerable heterogeneity between species. In particular, the pentapeptide repeat VPGVG, characteristic of all tropoelastins analyzed to date, is replaced in rat tropoelastin by a repeating pentapeptide, IPGVG. The hexapeptide repeat VGVAPG, the bovine elastin receptor binding peptide, is not encoded by rat tropoelastin cDNAs. Variations in coding sequence between rat tropoelastin CDNA clones were also found which may represent mRNA heterogeneity produced by alternative splicing of the rat tropoelastin pre-mRNA

Danish children born with glutamic acid decarboxylase-65 and islet antigen-2 autoantibodies at birth had an increased risk to develop type 1 diabetes

DEFF Research Database (Denmark)

Eising, Stefanie; Nilsson, Anita; Carstensen, Bendix

2011-01-01

A large, population-based case-control cohort was used to test the hypothesis that glutamic acid decarboxylase-65 (GAD65) and islet antigen-2 autoantibodies (IA-2A) at birth predict type 1 diabetes.......A large, population-based case-control cohort was used to test the hypothesis that glutamic acid decarboxylase-65 (GAD65) and islet antigen-2 autoantibodies (IA-2A) at birth predict type 1 diabetes....

Peptidomics combined with cDNA library unravel the diversity of centipede venom

DEFF Research Database (Denmark)

Rong, Mingqiang; Yang, Shilong; Wen, Bo

2015-01-01

of centipede venom. In the present study, we use peptidomics combined with cDNA library to uncover the diversity of centipede Scolopendra subspinipes mutilans L. Koch. 192 peptides were identified by LC-MS/MS and 79 precursors were deduced by cDNA library. Surprisingly, the signal peptides of centipede toxins...

Structural Characterization of the Molecular Events during a Slow Substrate-Product Transition in Orotidine 5'-Monophosphate Decarboxylase

Energy Technology Data Exchange (ETDEWEB)

Fujihashi, Masahiro; Wei, Lianhu; Kotra, Lakshmi P; Pai, Emil F; (TGRI); (Toronto); (Kyoto)

2009-04-06

Crystal structures of substrate-product complexes of Methanobacterium thermoautotrophicum orotidine 5'-monophosphate decarboxylase, obtained at various steps in its catalysis of the unusual transformation of 6-cyano-uridine 5'-monophosphate (UMP) into barbituric acid ribosyl monophosphate, show that the cyano substituent of the substrate, when bound to the active site, is first bent significantly from the plane of the pyrimidine ring and then replaced by an oxygen atom. Although the K72A and D70A/K72A mutants are either catalytically impaired or even completely inactive, they still display bending of the C6 substituent. Interestingly, high-resolution structures of the D70A and D75N mutants revealed a covalent bond between C6 of UMP and the Lys72 side chain after the -CN moiety's release. The same covalent bond was observed when the native enzyme was incubated with 6-azido-UMP and 6-iodo-UMP; in contrast, the K72A mutant transformed 6-iodo-UMP to barbituric acid ribosyl 5'-monophosphate. These results demonstrate that, given a suitable environment, native orotidine 5'-monophosphate decarboxylase and several of its mutants are not restricted to the physiologically relevant decarboxylation; they are able to catalyze even nucleophilic substitution reactions but consistently maintain distortion on the C6 substituent as an important feature of catalysis.

Molecular cloning and nucleotide sequence of cDNA for human liver arginase

International Nuclear Information System (INIS)

Haraguchi, Y.; Takiguchi, M.; Amaya, Y.; Kawamoto, S.; Matsuda, I.; Mori, M.

1987-01-01

Arginase (EC3.5.3.1) catalyzes the last step of the urea cycle in the liver of ureotelic animals. Inherited deficiency of the enzyme results in argininemia, an autosomal recessive disorder characterized by hyperammonemia. To facilitate investigation of the enzyme and gene structures and to elucidate the nature of the mutation in argininemia, the authors isolated cDNA clones for human liver arginase. Oligo(dT)-primed and random primer human liver cDNA libraries in λ gt11 were screened using isolated rat arginase cDNA as a probe. Two of the positive clones, designated λ hARG6 and λ hARG109, contained an overlapping cDNA sequence with an open reading frame encoding a polypeptide of 322 amino acid residues (predicted M/sub r/, 34,732), a 5'-untranslated sequence of 56 base pairs, a 3'-untranslated sequence of 423 base pairs, and a poly(A) segment. Arginase activity was detected in Escherichia coli cells transformed with the plasmid carrying λ hARG6 cDNA insert. RNA gel blot analysis of human liver RNA showed a single mRNA of 1.6 kilobases. The predicted amino acid sequence of human liver arginase is 87% and 41% identical with those of the rat liver and yeast enzymes, respectively. There are several highly conserved segments among the human, rat, and yeast enzymes

Acid Evolution of Escherichia coli K-12 Eliminates Amino Acid Decarboxylases and Reregulates Catabolism.

Science.gov (United States)

He, Amanda; Penix, Stephanie R; Basting, Preston J; Griffith, Jessie M; Creamer, Kaitlin E; Camperchioli, Dominic; Clark, Michelle W; Gonzales, Alexandra S; Chávez Erazo, Jorge Sebastian; George, Nadja S; Bhagwat, Arvind A; Slonczewski, Joan L

2017-06-15

Acid-adapted strains of Escherichia coli K-12 W3110 were obtained by serial culture in medium buffered at pH 4.6 (M. M. Harden, A. He, K. Creamer, M. W. Clark, I. Hamdallah, K. A. Martinez, R. L. Kresslein, S. P. Bush, and J. L. Slonczewski, Appl Environ Microbiol 81:1932-1941, 2015, https://doi.org/10.1128/AEM.03494-14). Revised genomic analysis of these strains revealed insertion sequence (IS)-driven insertions and deletions that knocked out regulators CadC (acid induction of lysine decarboxylase), GadX (acid induction of glutamate decarboxylase), and FNR (anaerobic regulator). Each acid-evolved strain showed loss of one or more amino acid decarboxylase systems, which normally help neutralize external acid (pH 5 to 6) and increase survival in extreme acid (pH 2). Strains from populations B11, H9, and F11 had an IS 5 insertion or IS-mediated deletion in cadC , while population B11 had a point mutation affecting the arginine activator adiY The cadC and adiY mutants failed to neutralize acid in the presence of exogenous lysine or arginine. In strain B11-1, reversion of an rpoC (RNA polymerase) mutation partly restored arginine-dependent neutralization. All eight strains showed deletion or downregulation of the Gad acid fitness island. Strains with the Gad deletion lost the ability to produce GABA (gamma-aminobutyric acid) and failed to survive extreme acid. Transcriptome sequencing (RNA-seq) of strain B11-1 showed upregulated genes for catabolism of diverse substrates but downregulated acid stress genes (the biofilm regulator ariR , yhiM , and Gad). Other strains showed downregulation of H 2 consumption mediated by hydrogenases ( hya and hyb ) which release acid. Strains F9-2 and F9-3 had a deletion of fnr and showed downregulation of FNR-dependent genes ( dmsABC , frdABCD , hybABO , nikABCDE , and nrfAC ). Overall, strains that had evolved in buffered acid showed loss or downregulation of systems that neutralize unbuffered acid and showed altered regulation of

Display of a Maize cDNA library on baculovirus infected insect cells

Directory of Open Access Journals (Sweden)

Jones Ian M

2008-08-01

Full Text Available Abstract Background Maize is a good model system for cereal crop genetics and development because of its rich genetic heritage and well-characterized morphology. The sequencing of its genome is well advanced, and new technologies for efficient proteomic analysis are needed. Baculovirus expression systems have been used for the last twenty years to express in insect cells a wide variety of eukaryotic proteins that require complex folding or extensive posttranslational modification. More recently, baculovirus display technologies based on the expression of foreign sequences on the surface of Autographa californica (AcMNPV have been developed. We investigated the potential of a display methodology for a cDNA library of maize young seedlings. Results We constructed a full-length cDNA library of young maize etiolated seedlings in the transfer vector pAcTMVSVG. The library contained a total of 2.5 × 105 independent clones. Expression of two known maize proteins, calreticulin and auxin binding protein (ABP1, was shown by western blot analysis of protein extracts from insect cells infected with the cDNA library. Display of the two proteins in infected insect cells was shown by selective biopanning using magnetic cell sorting and demonstrated proof of concept that the baculovirus maize cDNA display library could be used to identify and isolate proteins. Conclusion The maize cDNA library constructed in this study relies on the novel technology of baculovirus display and is unique in currently published cDNA libraries. Produced to demonstrate proof of principle, it opens the way for the development of a eukaryotic in vivo display tool which would be ideally suited for rapid screening of the maize proteome for binding partners, such as proteins involved in hormone regulation or defence.

Reverse transcription using random pentadecamer primers increases yield and quality of resulting cDNA

DEFF Research Database (Denmark)

Stangegaard, Michael; Dufva, I.H.; Dufva, Hans Martin

2006-01-01

oligonucleotides (pentadecamers) consistently, yielded at least 2 fold as much cDNA as did random hexamers using either-poly(A) RNA or an amplified version of messenger RNA (aRNA) as a template. The cDNA generated using pentadecamers did not differ in size distribution or the amount of incorporated label compared...... with cDNA generated with random hexamers. The increased efficiency of priming using random pentadecamers resulted in reverse transcription of > 80% of the template aRNA, while random hexamers induced reverse transcription of only 40% of the template aRNA. This suggests a better coverage...... that random pentadecamers can replace random hexamers in reverse transcription reactions on both poly(A) RNA and amplified RNA, resulting in higher cDNA yields and quality....

Effects of hyperhomocysteinemia and betaine-homocysteine S-methyltransferase inhibition on hepatocyte metabolites and the proteome

Czech Academy of Sciences Publication Activity Database

Selicharová, Irena; Kořínek, M.; Demianova, Zuzana; Chrudinová, Martina; Mládková, Jana; Jiráček, Jiří

2013-01-01

Roč. 1834, č. 8 (2013), s. 1596-1606 ISSN 1570-9639 R&D Projects: GA ČR(CZ) GAP207/10/1277 Institutional support: RVO:61388963 Keywords : apolipoprotein * fibrinogen * one-carbon metabolism * S-Adenosylmethionine * two-dimensional electrophoresis Subject RIV: CE - Biochemistry Impact factor: 3.191, year: 2013

Complete cDNA sequence of human complement C1s and close physical linkage of the homologous genes C1s and C1r

International Nuclear Information System (INIS)

Tosi, M.; Duponchel, C.; Meo, T.; Julier, C.

1987-01-01

Overlapping molecular clones encoding the complement subcomponent C1s were isolated from a human liver cDNA library. The nucleotide sequence reconstructed from these clones spans about 85% of the length of the liver C1s messenger RNAs, which occur in three distinct size classes around 3 kilobases in length. Comparisons with the sequence of C1r, the other enzymatic subcomponent of C1, reveal 40% amino acid identity and conservation of all the cysteine residues. Beside the serine protease domain, the following sequence motifs, previously described in C1r, were also found in C1s: (a) two repeats of the type found in the Ba fragment of complement factor B and in several other complement but also noncomplement proteins, (b) a cysteine-rich segment homologous to the repeats of epidermal growth factor precursor, and (c) a duplicated segment found only in C1r and C1s. Differences in each of these structural motifs provide significant clues for the interpretation of the functional divergence of these interacting serine protease zymogens. Hybridizations of C1r and C1s probes to restriction endonuclease fragments of genomic DNA demonstrate close physical linkage of the corresponding genes. The implications of this finding are discussed with respect to the evolution of C1r and C1s after their origin by tandem gene duplication and to the previously observed combined hereditary deficiencies of Clr and Cls

A Potato cDNA Encoding a Homologue of Mammalian Multidrug Resistant P-Glycoprotein

Science.gov (United States)

Wang, W.; Takezawa, D.; Poovaiah, B. W.

1996-01-01

A homologue of the multidrug resistance (MDR) gene was obtained while screening a potato stolon tip cDNA expression library with S-15-labeled calmodulin. The mammalian MDR gene codes for a membrane-bound P-glycoprotein (170-180 kDa) which imparts multidrug resistance to cancerous cells. The potato cDNA (PMDR1) codes for a polypeptide of 1313 amino acid residues (ca. 144 kDa) and its structural features are very similar to the MDR P-glycoprotein. The N-terminal half of the PMDR1-encoded protein shares striking homology with its C-terminal half, and each half contains a conserved ATP-binding site and six putative transmembrane domains. Southern blot analysis indicated that potato has one or two MDR-like genes. PMDR1 mRNA is constitutively expressed in all organs studied with higher expression in the stem and stolon tip. The PMDR1 expression was highest during tuber initiation and decreased during tuber development.

cDNA encoding a polypeptide including a hevein sequence

Energy Technology Data Exchange (ETDEWEB)

Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

2000-07-04

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

cDNA encoding a polypeptide including a hevein sequence

Energy Technology Data Exchange (ETDEWEB)

Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

1999-05-04

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 12 figs.

cDNA encoding a polypeptide including a hevein sequence

Energy Technology Data Exchange (ETDEWEB)

Raikhel, Natasha V. (Okemos, MI); Broekaert, Willem F. (Dilbeek, BE); Chua, Nam-Hai (Scarsdale, NY); Kush, Anil (New York, NY)

1999-05-04

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

cDNA encoding a polypeptide including a hevein sequence

Energy Technology Data Exchange (ETDEWEB)

Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

1995-03-21

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 11 figures.

Pyruvate Decarboxylase Activity Assay in situ of Different Industrial Yeast Strains

Directory of Open Access Journals (Sweden)

Dorota Kręgiel

2009-01-01

Full Text Available Cytoplasmic pyruvate decarboxylase (PDC, EC 4.1.1.1 is one of the key enzymes of yeast fermentative metabolism. PDC is the first enzyme which, under anaerobic conditions, leads to decarboxylation of pyruvate with acetaldehyde as the end product. The aim of this study is to develop a suitable method for PDC activity assay in situ for different industrial yeast strains. Saccharomyces sp. and Debaryomyces sp. yeast strains grew in fermentative medium with 12 % of glucose. Enzymatic assay was conducted in cell suspension treated with digitonin as permeabilisation agent, and with sodium pyruvate as a substrate, at temperature of 30 °C. Metabolites of PDC pathway were detected using gas chromatographic (GC technique. Various parameters like type and molar concentration of the substrate, minimal effective mass fraction of digitonin, cell concentration, reaction time and effect of pyrazole (alcohol dehydrogenase inhibitor were monitored to optimize PDC enzymatic assay in situ. In the concentration range of yeast cells from 1⋅10^7 to 1⋅10^8 per mL, linear correlation between the produced acetaldehyde and cell density was noticed. Only pyruvate was the specific substrate for pyruvate decarboxylase. In the presence of 0.05 M sodium pyruvate and 0.05 % digitonin, the enzymatic reaction was linear up to 20 min of the assay. During incubation, there was no formation of ethanol and, therefore, pyrazole was not necessary for the assay.

The nucleotide sequence of human transition protein 1 cDNA

Energy Technology Data Exchange (ETDEWEB)

Luerssen, H; Hoyer-Fender, S; Engel, W [Universitaet Goettingen (West Germany)

1988-08-11

The authors have screened a human testis cDNA library with an oligonucleotide of 81 mer prepared according to a part of the published nucleotide sequence of the rat transition protein TP 1. They have isolated a cDNA clone with the length of 441 bp containing the coding region of 162 bp for human transition protein 1. There is about 84% homology in the coding region of the sequence compared to rat. The human cDNA-clone encodes a polypeptide of 54 amino acids of which 7 are different to that of rat.

Regulation of ribonucleic acid synthesis by polyamines. Reversal by spermine of inhibition by methylglyoxal bis(guanylhydrazone) of ribonucleic acid synthesis and histone acetylation in rabbit heart.

Science.gov (United States)

Caldarera, C M; Casti, A; Guarnier, C; Moruzzi, G

1975-10-01

The relationship between polyamines and RNA synthesis was studied by considering the action of spermine on histone acetylation in perfused heart. In addition, the effect of methylglyoxal bis(guanylhydrazone), inhibitor of putrescine-activated S-adenosylmethionine decarboxylase activity, on RNA and polyamine specific radioactivity and on acetylation of histone fractions was also investigated in perfused heart. Different concentrations of spermine and/or methylglyoxas bis(guanylhydrazone) were injected into the heart, 15 min after beginning the perfusion. The results demonstrate that spermine stimulates the specific radioactivity of RNA of subcellular fractions. Acetylation of the arginine-rich histone fractions, involved in the regulation of RNA transcription, is enhanced by spermine. The perfusion with methylglyoxal bis(guanylhydrazone) causes a decrease in the specific radioactivity of polyamines and RNA, and in acetylation of histone fractions. However, spermine is able to reverse the methylglyoxal bis(guanylhydrazone) inhibition when injected simultaneously. From these results we may assume a possible role for spermine in the regulation of RNA transcription.

Biochemical characterization of propylglyoxal bis(guanylhydrazone). Facile synthesis of monoalkylglyoxal bis(guanylhydrazones).

Science.gov (United States)

Elo, H; Laine, R; Alhonen-Hongisto, L; Jänne, J; Mutikainen, I; Lumme, P

1985-01-01

Propylglyoxal bis(guanylhydrazone) sulfate, a novel analog of the well-known antileukemic drug methylglyoxal bis(guanylhydrazone), has been prepared from 2,2-dibromopentanal, and the compound has been characterized biochemically. Although it is a powerful inhibitor of S-adenosylmethionine decarboxylase, its Ki value (0.2 microM) is considerably higher than that of ethylglyoxal bis(guanylhydrazone) (0.06 microM). The compound is only poorly taken up by tumor cells, and its accumulation is not stimulated by a prior exposure of the tumor cells to difluoromethylornithine, a compound that causes polyamine depletion. Thus, the uptake characteristics of the compound are similar to those of ethylglyoxal bis(guanylhydrazone), but in striking contrast to those of methylglyoxal and glyoxal bis(guanylhydrazones). Since the configuration of the double bonds in glyoxal, methylglyoxal and propylglyoxal bis(guanylhydrazones) has been shown to be identical, the different uptake characteristics are probably only due to differences in side chain size and/or hydrophobicity.

D22S15 - a fetal brain cDNA with BanII and SacI RFLP

Energy Technology Data Exchange (ETDEWEB)

Rouleau, G A; Kurnit, D M; Neve, R L; Bazanowsky, A; Patterson, D; Gusella, J F

1988-02-25

A .58 kb single copy EcoRI fragment was isolated from a human fetal brain cDNA library and cloned into pBR322. This fragment recognizes a two allele polymorphism when used to probe human genomic DNA digested with SacI. There are no constant bands. Additional polymorphisms recognized by BanII and Bsp1286 are in disequilibrium with the BanII polymorphism. It has been localized to chromosome 22 by somatic cell hybrid analysis and linkage analysis. Co-dominant segregation has been observed in 15 informative families.

High-throughput screening of suppression subtractive hybridization cDNA libraries using DNA microarray analysis

CSIR Research Space (South Africa)

Van den Berg, N

2004-11-01

Full Text Available Efficient construction of cDNA libraries enriched for differentially expressed transcripts is an important first step in many biological investigations. We present a quantitative procedure for screening cDNA libraries constructed by suppression...

Construction and identification of subtracted cDNA library in bone marrow cells of radon-exposed mice

International Nuclear Information System (INIS)

Li Jianxiang; Nie Jihua; Tong Jian; Fu Chunling; Zhou Jianwei

2008-01-01

Objective: To construct and identify subtracted cDNA library in bone marrow cells of mice exposed to radon inhalation. Methods: Adult male BALB/c mice, weighing 18-22 g, were placed in a multi- functional radon chamber. One group of mice was exposed to radon up to the accumulative dose of 105 work level month (WLM). The control group of mice was housed in a room with an accumulative dose of 1 WLM. To construct a subtracted cDNA library enriched with differentially expressed genes, the SMART technique and the suppression subtractive hybridization were performed. The obtained forward and reverse cDNA fragments were directly inserted into pMD18-T vector and transformed into E. coli JM109. The inserting cDNA fragments were screened by the blue-and-white blot screening and nested PCR of bacterium liquid. Results: The 244 of 285 white bacteria clones obtained randomly were positive clones contained 100-1100 bp inserted cDNA fragments. Conclusions: The forward and reverse subtracted cDNA library in bone marrow cells of mice exposed to radon inhalation is successfully constructed. (authors)

Structural analysis of Bacillus pumilus phenolic acid decarboxylase, a lipocalin-fold enzyme

International Nuclear Information System (INIS)

Matte, Allan; Grosse, Stephan; Bergeron, Hélène; Abokitse, Kofi; Lau, Peter C. K.

2010-01-01

The crystal structure of phenolic acid decarboxylase from B. pumilus strain UI-670 has been determined and refined at 1.69 Å resolution. The enzyme is a dimer, with each subunit adopting a β-barrel structure belonging to the lipocalin fold. The decarboxylation of phenolic acids, including ferulic and p-coumaric acids, to their corresponding vinyl derivatives is of importance in the flavouring and polymer industries. Here, the crystal structure of phenolic acid decarboxylase (PAD) from Bacillus pumilus strain UI-670 is reported. The enzyme is a 161-residue polypeptide that forms dimers both in the crystal and in solution. The structure of PAD as determined by X-ray crystallography revealed a β-barrel structure and two α-helices, with a cleft formed at one edge of the barrel. The PAD structure resembles those of the lipocalin-fold proteins, which often bind hydrophobic ligands. Superposition of structurally related proteins bound to their cognate ligands shows that they and PAD bind their ligands in a conserved location within the β-barrel. Analysis of the residue-conservation pattern for PAD-related sequences mapped onto the PAD structure reveals that the conservation mainly includes residues found within the hydrophobic core of the protein, defining a common lipocalin-like fold for this enzyme family. A narrow cleft containing several conserved amino acids was observed as a structural feature and a potential ligand-binding site

The cDNA sequence of a neutral horseradish peroxidase.

Science.gov (United States)

Bartonek-Roxå, E; Eriksson, H; Mattiasson, B

1991-02-16

A cDNA clone encoding a horseradish (Armoracia rusticana) peroxidase has been isolated and characterized. The cDNA contains 1378 nucleotides excluding the poly(A) tail and the deduced protein contains 327 amino acids which includes a 28 amino acid leader sequence. The predicted amino acid sequence is nine amino acids shorter than the major isoenzyme belonging to the horseradish peroxidase C group (HRP-C) and the sequence shows 53.7% identity with this isoenzyme. The described clone encodes nine cysteines of which eight correspond well with the cysteines found in HRP-C. Five potential N-glycosylation sites with the general sequence Asn-X-Thr/Ser are present in the deduced sequence. Compared to the earlier described HRP-C this is three glycosylation sites less. The shorter sequence and fewer N-glycosylation sites give the native isoenzyme a molecular weight of several thousands less than the horseradish peroxidase C isoenzymes. Comparison with the net charge value of HRP-C indicates that the described cDNA clone encodes a peroxidase which has either the same or a slightly less basic pI value, depending on whether the encoded protein is N-terminally blocked or not. This excludes the possibility that HRP-n could belong to either the HRP-A, -D or -E groups. The low sequence identity (53.7%) with HRP-C indicates that the described clone does not belong to the HRP-C isoenzyme group and comparison of the total amino acid composition with the HRP-B group does not place the described clone within this isoenzyme group. Our conclusion is that the described cDNA clone encodes a neutral horseradish peroxidase which belongs to a new, not earlier described, horseradish peroxidase group.

[Construction of fetal mesenchymal stem cell cDNA subtractive library].

Science.gov (United States)

Yang, Li; Wang, Dong-Mei; Li, Liang; Bai, Ci-Xian; Cao, Hua; Li, Ting-Yu; Pei, Xue-Tao

2002-04-01

To identify differentially expressed genes between fetal mesenchymal stem cell (MSC) and adult MSC, especially specified genes expressed in fetal MSC, a cDNA subtractive library of fetal MSC was constructed using suppression subtractive hybridization (SSH) technique. At first, total RNA was isolated from fetal and adult MSC. Using SMART PCR synthesis method, single-strand and double-strand cDNAs were synthesized. After Rsa I digestion, fetal MSC cDNAs were divided into two groups and ligated to adaptor 1 and adaptor 2 respectively. Results showed that the amplified library contains 890 clones. Analysis of 890 clones with PCR demonstrated that 768 clones were positive. The positive rate is 86.3%. The size of inserted fragments in these positive clones was between 0.2 - 1 kb, with an average of 400 - 600 bp. SSH is a convenient and effective method for screening differentially expressed genes. The constructed cDNA subtractive library of fetal MSC cDNA lays solid foundation for screening and cloning new and specific function related genes of fetal MSC.

cDNA cloning of rat and human medium chain acyl-CoA dehydrogenase (MCAD)

International Nuclear Information System (INIS)

Matsubara, Y.; Kraus, J.P.; Rosenberg, L.E.; Tanaka, K.

1986-01-01

MCAD is one of three mitochondrial flavoenzymes which catalyze the first step in the β-oxidation of straight chain fatty acids. It is a tetramer with a subunit Mr of 45 kDa. MCAD is synthesized in the cytosol as a 49 kDa precursor polypeptide (pMCAD), imported into mitochondria, and cleaved to the mature form. Genetic deficiency of MCAD causes recurrent episodes of hypoglycemic coma accompanied by medium chain dicarboxylic aciduria. Employing a novel approach, the authors now report isolation of partial rat and human cDNA clones encoding pMCAD. mRNA encoding pMCAD was purified to near homogeneity by polysome immunoadsorption using polyclonal monospecific antibody. Single-stranded [ 32 P]labeled cDNA probe was synthesized using the enriched mRNA as template, and was used to screen directly 16,000 colonies from a total rat liver cDNA library constructed in pBR322. One clone (600 bp) was detected by in situ hybridization. Hybrid-selected translation with this cDNA yielded a 49 kDa polypeptide indistinguishable in size from rat pMCAD and immunoprecipitable with anti-MCAD antibody. Using the rat cDNA as probe, 43,000 colonies from a human liver cDNA library were screened. Four identical positive clones (400 bp) were isolated and positively identified by hybrid-selected translation and immunoprecipitation. The sizes of rat and human mRNAs encoding pMCAD were 2.2 kb and 2.4 kb, respectively, as determined by Northern blotting

GENE EXPRESSION IN THE TESTES OF NORMOSPERMIC VERSUS TERATOSPERMIC DOMESTIC CATS USING HUMAN CDNA MICROARRAY ANALYSES

Science.gov (United States)

GENE EXPRESSION IN THE TESTES OF NORMOSPERMIC VERSUS TERATOSPERMIC DOMESTIC CATS USING HUMAN cDNA MICROARRAY ANALYSESB.S. Pukazhenthi1, J. C. Rockett2, M. Ouyang3, D.J. Dix2, J.G. Howard1, P. Georgopoulos4, W.J. J. Welsh3 and D. E. Wildt11Department of Reproductiv...

Styl RFLP recognized by a human IRBP cDNA localized to chromosome 10

Energy Technology Data Exchange (ETDEWEB)

Chin, K S; Mathew, C G.P.; Fong, S L; Bridges, C D; Ponder, B A.J.

1988-02-25

A 2184 bp cDNA (H.4 IRBP) encoding human interstitial retinol-biding protein isolated from a human retina cDNA library in lambdagt10 by screening with a bovine IRBP cDNA probe. Styl identifies a 2-allele polymorphism with bands at 2.3 kb (Cl) and 1.95 kb (C2) and invariant bands at 1.1, 1.0 and 0.8kb. Codominant segregation was observed in two informative families. The RFLP was mapped to chromosome 10 using somatic cell hybrids. In situ hybridization suggests regional assignments near p11.2 -q11.2 with a secondary site of hybridization at q24-25.

Efficacy Testing of H56 cDNA Tattoo Immunization against Tuberculosis in a Mouse Model.

Science.gov (United States)

Platteel, Anouk C M; Nieuwenhuizen, Natalie E; Domaszewska, Teresa; Schürer, Stefanie; Zedler, Ulrike; Brinkmann, Volker; Sijts, Alice J A M; Kaufmann, Stefan H E

2017-01-01

Tuberculosis (TB), caused by Mycobacterium tuberculosis ( Mtb ), remains a global threat. The only approved vaccine against TB, Mycobacterium bovis bacillus Calmette-Guérin (BCG), provides insufficient protection and, being a live vaccine, can cause disseminated disease in immunocompromised individuals. Previously, we found that intradermal cDNA tattoo immunization with cDNA of tetanus toxoid fragment C domain 1 fused to cDNA of the fusion protein H56, comprising the Mtb antigens Ag85B, ESAT-6, and Rv2660c, induced antigen-specific CD8 + T cell responses in vivo . As cDNA tattoo immunization would be safer than a live vaccine in immunocompromised patients, we tested the protective efficacy of intradermal tattoo immunization against TB with H56 cDNA, as well as with H56_E, a construct optimized for epitope processing in a mouse model. As Mtb antigens can be used in combination with BCG to boost immune responses, we also tested the protective efficacy of heterologous prime-boost, using dermal tattoo immunization with H56_E cDNA to boost BCG immunization in mice. Dermal H56 and H56_E cDNA immunization induced H56-specific CD4 + and CD8 + T cell responses and Ag85B-specific IgG antibodies, but did not reduce bacterial loads, although immunization with H56_E ameliorated lung pathology. Both subcutaneous and intradermal immunization with BCG resulted in broad cellular immune responses, with increased frequencies of CD4 + T effector memory cells, T follicular helper cells, and germinal center B cells, and resulted in reduced bacterial loads and lung pathology. Heterologous vaccination with BCG/H56_E cDNA induced increased H56-specific CD4 + and CD8 + T cell cytokine responses compared to vaccination with BCG alone, and lung pathology was significantly decreased in BCG/H56_E cDNA immunized mice compared to unvaccinated controls. However, bacterial loads were not decreased after heterologous vaccination compared to BCG alone. CD4 + T cells responding to Ag85B- and ESAT-6

Limbic encephalitis with antibodies to glutamic acid decarboxylase presenting with brainstem symptoms

Directory of Open Access Journals (Sweden)

Faruk Incecik

2015-01-01

Full Text Available Limbic encephalitis (LE is a neurological syndrome that may present in association with cancer, infection, or as an isolate clinical condition often accompanying autoimmune disorders. LE associated with glutamic acid decarboxylase antibodies (anti-GAD is rare in children. Here, we characterized the clinical and laboratory features of a patient presenting with brainstem involvement with non-paraneoplastic LE associated with anti-GAD antibodies. In our patient, after plasma exchange, we determined a dramatic improvement of the neurological deficits.

The effect of different doses of epidermal growth factor on liver ornithine decarboxylase and Na-K ATPase activities in newborn rats.

Science.gov (United States)

Bilgihan, A; Turkozkan, N; Isman, F; Kilinc, M; Demirsoy, S

1998-08-01

1. Ornithine decarboxylase and Na-K ATPase activities were studied in rat livers that were treated with different doses of epidermal growth factor (EGF). 2. The ornithine decarboxylase activities were studied with spectrophotometry, and results were expressed as micromoles of putrescine per hour per milligram of protein. Na-K ATPase activities were studied on the basis of the principle of measuring the amount of inorganic phosphates released by the hydrolysis of ATP, and the results were expressed as micromoles of inorganic phosphate per hour per milligram of protein. 3. When compared with the controls, although the Na-K ATPase activities were decreased at low doses of EGF, their activities were found to be increased at high doses of EGF. On the other hand, there was a positive correlation between ornithine decarboxylase activities and EGF doses. 4. The results of this study suggest that, whereas the decrease in Na-K ATPase activities at low doses of EGF can be due to the utilization of the enzyme, the increase in Na-K ATPase activities at high doses of EGF can be attributed to its enhanced synthesis.

Glutamic acid decarboxylase 67 expression by a distinct population of mouse vestibular supporting cells.

Science.gov (United States)

Tavazzani, Elisa; Tritto, Simona; Spaiardi, Paolo; Botta, Laura; Manca, Marco; Prigioni, Ivo; Masetto, Sergio; Russo, Giancarlo

2014-01-01

The function of the enzyme glutamate decarboxylase (GAD) is to convert glutamate in γ-aminobutyric acid (GABA). Glutamate decarboxylase exists as two major isoforms, termed GAD65 and GAD67, that are usually expressed in GABA-containing neurons in the central nervous system. GAD65 has been proposed to be associated with GABA exocytosis whereas GAD67 with GABA metabolism. In the present immunofluorescence study, we have investigated the presence of the two GAD isoforms in the semicircular canal cristae of wild type and GAD67-GFP knock-in mice. While no evidence for GAD65 expression was found, GAD67 was detected in a distinct population of peripherally-located supporting cells, but not in hair cells or in centrally-located supporting cells. GABA, on the other hand, was found in all supporting cells. The present result indicate that only a discrete population of supporting cells use GAD67 to synthesize GABA. This is the first report of a marker that allows to distinguish two populations of supporting cells in the vestibular epithelium. On the other hand, the lack of GABA and GAD enzymes in hair cells excludes its involvement in afferent transmission.

Radioactive cDNA microarray in neurospsychiatry

International Nuclear Information System (INIS)

Choe, Jae Gol; Shin, Kyung Ho; Lee, Min Soo; Kim, Meyoung Kon

2003-01-01

Microarray technology allows the simultaneous analysis of gene expression patterns of thousands of genes, in a systematic fashion, under a similar set of experimental conditions, thus making the data highly comparable. In some cases arrays are used simply as a primary screen leading to downstream molecular characterization of individual gene candidates. In other cases, the goal of expression profiling is to begin to identify complex regulatory networks underlying developmental processes and disease states. Microarrays were originally used with cell lines or other simple model systems. More recently, microarrays have been used in the analysis of more complex biological tissues including neural systems and the brain. The application of cDNA arrays in neuropsychiatry has lagged behind other fields for a number of reasons. These include a requirement for a large amount of input probe RNA in fluorescent-glass based array systems and the cellular complexity introduced by multicellular brain and neural tissues. An additional factor that impacts the general use of microarrays in neuropsychiatry is the lack of availability of sequenced clone sets from model systems. While human cDNA clones have been widely available, high quality rat, mouse, and drosophilae, among others are just becoming widely available. A final factor in the application of cDNA microarrays in neuropsychiatry is cost of commercial arrays. As academic microarray facilitates become more commonplace custom made arrays will become more widely available at a lower cost allowing more widespread applications. In summary, microarray technology is rapidly having an impact on many areas of biomedical research. Radioisotope-nylon based microarrays offer alternatives that may in some cases be more sensitive, flexible, inexpensive, and universal as compared to other array formats, such as fluorescent-glass arrays. In some situations of limited RNA or exotic species, radioactive membrane microarrays may be the most

Radioactive cDNA microarray in neurospsychiatry

Energy Technology Data Exchange (ETDEWEB)

Choe, Jae Gol; Shin, Kyung Ho; Lee, Min Soo; Kim, Meyoung Kon [Korea University Medical School, Seoul (Korea, Republic of)

2003-02-01

Microarray technology allows the simultaneous analysis of gene expression patterns of thousands of genes, in a systematic fashion, under a similar set of experimental conditions, thus making the data highly comparable. In some cases arrays are used simply as a primary screen leading to downstream molecular characterization of individual gene candidates. In other cases, the goal of expression profiling is to begin to identify complex regulatory networks underlying developmental processes and disease states. Microarrays were originally used with cell lines or other simple model systems. More recently, microarrays have been used in the analysis of more complex biological tissues including neural systems and the brain. The application of cDNA arrays in neuropsychiatry has lagged behind other fields for a number of reasons. These include a requirement for a large amount of input probe RNA in fluorescent-glass based array systems and the cellular complexity introduced by multicellular brain and neural tissues. An additional factor that impacts the general use of microarrays in neuropsychiatry is the lack of availability of sequenced clone sets from model systems. While human cDNA clones have been widely available, high quality rat, mouse, and drosophilae, among others are just becoming widely available. A final factor in the application of cDNA microarrays in neuropsychiatry is cost of commercial arrays. As academic microarray facilitates become more commonplace custom made arrays will become more widely available at a lower cost allowing more widespread applications. In summary, microarray technology is rapidly having an impact on many areas of biomedical research. Radioisotope-nylon based microarrays offer alternatives that may in some cases be more sensitive, flexible, inexpensive, and universal as compared to other array formats, such as fluorescent-glass arrays. In some situations of limited RNA or exotic species, radioactive membrane microarrays may be the most

Human tissue factor: cDNA sequence and chromosome localization of the gene

International Nuclear Information System (INIS)

Scarpati, E.M.; Wen, D.; Broze, G.J. Jr.; Miletich, J.P.; Flandermeyer, R.R.; Siegel, N.R.; Sadler, J.E.

1987-01-01

A human placenta cDNA library in λgt11 was screened for the expression of tissue factor antigens with rabbit polyclonal anti-human tissue factor immunoglobulin G. Among 4 million recombinant clones screened, one positive, λHTF8, expressed a protein that shared epitopes with authentic human brain tissue factor. The 1.1-kilobase cDNA insert of λHTF8 encoded a peptide that contained the amino-terminal protein sequence of human brain tissue factor. Northern blotting identified a major mRNA species of 2.2 kilobases and a minor species of ∼ 3.2 kilobases in poly(A) + RNA of placenta. Only 2.2-kilobase mRNA was detected in human brain and in the human monocytic U937 cell line. In U937 cells, the quantity of tissue factor mRNA was increased several fold by exposure of the cells to phorbol 12-myristate 13-acetate. Additional cDNA clones were selected by hybridization with the cDNA insert of λHTF8. These overlapping isolates span 2177 base pairs of the tissue factor cDNA sequence that includes a 5'-noncoding region of 75 base pairs, an open reading frame of 885 base pairs, a stop codon, a 3'-noncoding region of 1141 base pairs, and a poly(a) tail. The open reading frame encodes a 33-kilodalton protein of 295 amino acids. The predicted sequence includes a signal peptide of 32 or 34 amino acids, a probable extracellular factor VII binding domain of 217 or 219 amino acids, a transmembrane segment of 23 acids, and a cytoplasmic tail of 21 amino acids. There are three potential glycosylation sites with the sequence Asn-X-Thr/Ser. The 3'-noncoding region contains an inverted Alu family repetitive sequence. The tissue factor gene was localized to chromosome 1 by hybridization of the cDNA insert of λHTF8 to flow-sorted human chromosomes

Cognitive decline in a patient with anti-glutamic acid decarboxylase autoimmunity; case report

OpenAIRE

Takagi, Masahito; Yamasaki, Hiroshi; Endo, Keiko; Yamada, Tetsuya; Kaneko, Keizo; Oka, Yoshitomo; Mori, Etsuro

2011-01-01

Abstract Background Glutamic acid decarboxylase (GAD) is the rate-limiting enzyme for producing γ-aminobutyric acid, and it has been suggested that antibodies against GAD play a role in neurological conditions and type 1 diabetes. However, it is not known whether dementia appears as the sole neurological manifestation associated with anti-GAD antibodies in the central nervous system. Case presentation We describe the clinical, neuropsychological, and neuroradiological findings of a 73-year-ol...

Purification, reactivity with IgE and cDNA cloning of parvalbumin as the major allergen of mackerels.

Science.gov (United States)

Hamada, Y; Tanaka, H; Ishizaki, S; Ishida, M; Nagashima, Y; Shiomi, K

2003-08-01

Three species of mackerels (Scomber japonicus, S. australasicus and S. scombrus) are widely consumed and considered to be most frequently involved in incidents of IgE-mediated fish allergy in Japan. In this study, parvalbumin, a possible candidate for the major allergen, was purified from the white muscle of three species of mackerels by gel filtration on Sephadex G-75 and reverse-phase HPLC on TSKgel ODS-120T. All the purified preparations from three species gave a single band of about 11 kDa and were clearly identified as parvalbumins by analyses of their partial amino acid sequences. In ELISA experiments, four of five sera from fish-allergic patients reacted to all the purified parvalbumins, demonstrating that parvalbumin is the major allergen in common with the mackerels. Antigenic cross-reactivity among the mackerel parvalbumins was also established by ELISA inhibition experiments. A cDNA library was constructed from the white muscle of S. japonicus and the cDNA encoding parvalbumin was cloned. The amino acid sequence translated from the nucleotide sequence revealed that the S. japonicus parvalbumin is composed of 108 residues, being a member of beta-type parvalbumins.

Involvement of the ornithine decarboxylase gene in acid stress response in probiotic Lactobacillus delbrueckii UFV H2b20.

Science.gov (United States)

Ferreira, A B; Oliveira, M N V de; Freitas, F S; Paiva, A D; Alfenas-Zerbini, P; Silva, D F da; Queiroz, M V de; Borges, A C; Moraes, C A de

2015-01-01

Amino acid decarboxylation is important for the maintenance of intracellular pH under acid stress. This study aims to carry out phylogenetic and expression analysis by real-time PCR of two genes that encode proteins involved in ornithine decarboxylation in Lactobacillus delbrueckii UFV H2b20 exposed to acid stress. Sequencing and phylogeny analysis of genes encoding ornithine decarboxylase and amino acid permease in L. delbrueckii UFV H2b20 showed their high sequence identity (99%) and grouping with those of L. delbrueckii subsp. bulgaricus ATCC 11842. Exposure of L. delbrueckii UFV H2b20 cells in MRS pH 3.5 for 30 and 60 min caused a significant increase in expression of the gene encoding ornithine decarboxylase (up to 8.1 times higher when compared to the control treatment). Increased expression of the ornithine decarboxylase gene demonstrates its involvement in acid stress response in L. delbrueckii UFV H2b20, evidencing that the protein encoded by that gene could be involved in intracellular pH regulation. The results obtained show ornithine decarboxylation as a possible mechanism of adaptation to an acidic environmental condition, a desirable and necessary characteristic for probiotic cultures and certainly important to the survival and persistence of the L. delbrueckii UFV H2b20 in the human gastrointestinal tract.

Dicty_cDB: Contig-U16287-1 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available zed ... 46 0.12 2 ( CK269023 ) EST715101 potato abiotic stress cDNA library Sola... 46 0.12 2 ( U54774 ) Nicotiana tabacu...a... 36 0.26 3 ( DV114899 ) CV03010A1H02.f1 CV03-normalized library Euphorbia... 36 0.26 3 ( BT013106 ) Lycopersicon esculentu...mate decarboxylase isozyme... 58 1e-06 2 ( CK273593 ) EST719671 potato abiotic stress cDNA library Sola... 5... from flowers,8... 62 7e-05 1 ( CV516768 ) 0048P0016Z_H01_SP6 Mimulus guttatus library 1 Mim... 62...e-04 1 ( CK278060 ) EST724138 potato abiotic stress cDNA library Sola... 60 3e-04 1 ( AP009552 ) Microcystis

A pathogenic S250F missense mutation results in a mouse model of mild aromatic l-amino acid decarboxylase (AADC) deficiency.

Science.gov (United States)

Caine, Charlotte; Shohat, Meytal; Kim, Jeong-Ki; Nakanishi, Koki; Homma, Shunichi; Mosharov, Eugene V; Monani, Umrao R

2017-11-15

Homozygous mutations in the aromatic l-amino acid decarboxylase (AADC) gene result in a severe depletion of its namesake protein, triggering a debilitating and often fatal form of infantile Parkinsonism known as AADC deficiency. AADC deficient patients fail to produce normal levels of the monoamine neurotransmitters dopamine and serotonin, and suffer a multi-systemic disorder characterized by movement abnormalities, developmental delay and autonomic dysfunction; an absolute loss of dopamine is generally considered incompatible with life. There is no optimal treatment for AADC deficiency and few truly good models in which to investigate disease mechanisms or develop and refine therapeutic strategies. In this study, we introduced a relatively frequently reported but mildly pathogenic S250F missense mutation into the murine Aadc gene. We show that mutants homozygous for the mutation are viable and express a stable but minimally active form of the AADC protein. Although the low enzymatic activity of the protein resulted in only modestly reduced concentrations of brain dopamine, serotonin levels were markedly diminished, and this perturbed behavior as well as autonomic function in mutant mice. Still, we found no evidence of morphologic abnormalities of the dopaminergic cells in mutant brains. The striatum as well as substantia nigra appeared normal and no loss of dopamine expressing cells in the latter was detected. We conclude that even minute levels of active AADC are sufficient to allow for substantial amounts of dopamine to be produced in model mice harboring the S250F mutation. Such mutants represent a novel, mild model of human AADC deficiency. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

A BIOINFORMATIC STRATEGY TO RAPIDLY CHARACTERIZE CDNA LIBRARIES

Science.gov (United States)

A Bioinformatic Strategy to Rapidly Characterize cDNA LibrariesG. Charles Ostermeier1, David J. Dix2 and Stephen A. Krawetz1.1Departments of Obstetrics and Gynecology, Center for Molecular Medicine and Genetics, & Institute for Scientific Computing, Wayne State Univer...

Nucleotide sequence of cloned cDNA for human sphingolipid activator protein 1 precursor

International Nuclear Information System (INIS)

Dewji, N.N.; Wenger, D.A.; O'Brien, J.S.

1987-01-01

Two cDNA clones encoding prepro-sphingolipid activator protein 1 (SAP-1) were isolated from a λ gt11 human hepatoma expression library using polyclonal antibodies. These had inserts of ≅ 2 kilobases (λ-S-1.2 and λ-S-1.3) and both were both homologous with a previously isolated clone (λ-S-1.1) for mature SAP-1. The authors report here the nucleotide sequence of the longer two EcoRI fragments of S-1.2 and S-1.3 that were not the same and the derived amino acid sequences of mature SAP-1 and its prepro form. The open reading frame encodes 19 amino acids, which are colinear with the amino-terminal sequence of mature SAP-1, and extends far beyond the predicted carboxyl terminus of mature SAP-1, indicating extensive carboxyl-terminal processing. The nucleotide sequence of cDNA encoding prepro-SAP-1 includes 1449 bases from the assigned initiation codon ATG at base-pair 472 to the stop codon TGA at base-pair 1921. The first 23 amino acids coded after the initiation ATG are characteristic of a signal peptide. The calculated molecular mass for a polypeptide encoded by 1449 bases is ≅ 53 kDa, in keeping with the reported value for pro-SAP-1. The data indicate that after removal of the signal peptide mature SAP-1 is generated by removing an additional 7 amino acids from the amino terminus and ≅ 373 amino acids from the carboxyl terminus. One potential glycosylation site was previously found in mature SAP-1. Three additional potential glycosylation sites are present in the processed carboxyl-terminal polypeptide, which they designate as P-2

cDNA cloning of chicken orexin receptor and tissue distribution: sexually dimorphic expression in chicken gonads.

Science.gov (United States)

Ohkubo, T; Tsukada, A; Shamoto, K

2003-12-01

Orexin-A and -B are known to stimulate food intake in mammals. However, the critical roles of orexins in birds are not fully understood, since orexins have no stimulatory effect on food intake in the chicken. To understand the physiological role(s) of orexins in birds, we have cloned chicken orexin receptor (cOXR) cDNA by RT-PCR, and analysed the tIssue distribution of OXR mRNA in the chicken. The cOXR cDNA is 1869 bp long and encodes 501 amino acids. The cloned cDNA for cOXR corresponds to the type 2 OXR in mammals, and shows approximately 80% similarity to those of mammals at the amino acid level. Expression analysis by RNase protection assay revealed OXR mRNA was distributed widely in brain regions, and expression in the cerebrum, hypothalamus and optic tectum were abundant. In peripheral tIssues, OXR mRNA was expressed in the pituitary gland, adrenal gland and testis, but no mRNA expression was observed in other tIssues examined. Furthermore, we found that the amount of cOXR mRNA was different between testis and ovary, while prepro-orexin mRNA is equally expressed in the gonads of both sexes in the chicken. These data indicate that the orexins have neuroendocrine actions in chickens, which are mediated through hypothalamic receptors as has been observed in mammals. In addition, orexin may have specific role(s) in the regulation of gonadal function in which sex-dependent mechanisms could be involved.

Mass spectrometry-based cDNA profiling as a potential tool for human body fluid identification.

Science.gov (United States)

Donfack, Joseph; Wiley, Anissa

2015-05-01

Several mRNA markers have been exhaustively evaluated for the identification of human venous blood, saliva, and semen in forensic genetics. As new candidate human body fluid specific markers are discovered, evaluated, and reported in the scientific literature, there is an increasing trend toward determining the ideal markers for cDNA profiling of body fluids of forensic interest. However, it has not been determined which molecular genetics-based technique(s) should be utilized to assess the performance of these markers. In recent years, only a few confirmatory, mRNA/cDNA-based methods have been evaluated for applications in body fluid identification. The most frequently described methods tested to date include quantitative polymerase chain reaction (qPCR) and capillary electrophoresis (CE). However these methods, in particular qPCR, often favor narrow multiplex PCR due to the availability of a limited number of fluorescent dyes/tags. In an attempt to address this technological constraint, this study explored matrix-assisted laser desorption/ionization-time of flight mass spectrometry (MALDI-TOF MS) for human body fluid identification via cDNA profiling of venous blood, saliva, and semen. Using cDNA samples at 20pg input phosphoglycerate kinase 1 (PGK1) amounts, body fluid specific markers for the candidate genes were amplified in their corresponding body fluid (i.e., venous blood, saliva, or semen) and absent in the remaining two (100% specificity). The results of this study provide an initial indication that MALDI-TOF MS is a potential fluorescent dye-free alternative method for body fluid identification in forensic casework. However, the inherent issues of low amounts of mRNA, and the damage caused to mRNA by environmental exposures, extraction processes, and storage conditions are important factors that significantly hinder the implementation of cDNA profiling into forensic casework. Published by Elsevier Ireland Ltd.

Molecular cloning and characterization of an acetylcholinesterase cDNA in the brown planthopper, Nilaparvata lugens.

Science.gov (United States)

Yang, Zhifan; Chen, Jun; Chen, Yongqin; Jiang, Sijing

2010-01-01

A full cDNA encoding an acetylcholinesterase (AChE, EC 3.1.1.7) was cloned and characterized from the brown planthopper, Nilaparvata lugens Stål (Hemiptera: Delphacidae). The complete cDNA (2467 bp) contains a 1938-bp open reading frame encoding 646 amino acid residues. The amino acid sequence of the AChE deduced from the cDNA consists of 30 residues for a putative signal peptide and 616 residues for the mature protein with a predicted molecular weight of 69,418. The three residues (Ser242, Glu371, and His485) that putatively form the catalytic triad and the six Cys that form intra-subunit disulfide bonds are completely conserved, and 10 out of the 14 aromatic residues lining the active site gorge of the AChE are also conserved. Northern blot analysis of poly(A)+ RNA showed an approximately 2.6-kb transcript, and Southern blot analysis revealed there likely was just a single copy of this gene in N. lugens. The deduced protein sequence is most similar to AChE of Nephotettix cincticeps with 83% amino acid identity. Phylogenetic analysis constructed with 45 AChEs from 30 species showed that the deduced N. lugens AChE formed a cluster with the other 8 insect AChE2s. Additionally, the hypervariable region and amino acids specific to insect AChE2 also existed in the AChE of N. lugens. The results revealed that the AChE cDNA cloned in this work belongs to insect AChE2 subgroup, which is orthologous to Drosophila AChE. Comparison of the AChEs between the susceptible and resistant strains revealed a point mutation, Gly185Ser, is likely responsible for the insensitivity of the AChE to methamidopho in the resistant strain.

Construction of Agrobacterium tumefaciens-mediated tomato black ring virus infectious cDNA clones.

Science.gov (United States)

Zarzyńska-Nowak, Aleksandra; Ferriol, Inmaculada; Falk, Bryce W; Borodynko-Filas, Natasza; Hasiów-Jaroszewska, Beata

2017-02-15

Tomato black ring virus (TBRV, genus Nepovirus) infects a wide range of economically important plants such as tomato, potato, tobacco and cucumber. Here, a successful construction of infectious full-length cDNA clones of the TBRV genomic RNAs (RNA1 and RNA2) is reported for the first time. The engineered constructs consisting of PCR-amplified DNAs were cloned into binary vector pJL89 immediately downstream of a double cauliflower mosaic virus (CaMV) 35S promoter, and upstream of the hepatitis delta virus (HDV) ribozyme and nopaline synthase terminator (NOS). The symptoms induced on plants agroinoculated with both constructs were indistinguishable from those caused by the wild-type virus. The infectivity of obtained clones was verified by reinoculation to Nicotiana tabacum cv. Xanthi, Chenopodium quinoa and Cucumis sativus. The presence of viral particles and RNA was confirmed by electron microscopy and reverse transcription polymerase chain reaction, respectively. Constructed full-length infectious cDNA clones will serve as an excellent tool to study virus-host-vector interactions. Copyright © 2017 Elsevier B.V. All rights reserved.

Cloning and expression of a cDNA encoding human sterol carrier protein 2

International Nuclear Information System (INIS)

Yamamoto, Ritsu; Kallen, C.B.; Babalola, G.O.; Rennert, H.; Strauss, J.F. III; Billheimer, J.T.

1991-01-01

The authors report the cloning and expression of a cDNA encoding human sterol carrier protein 2 (SCP 2 ). The 1.3-kilobase (kb) cDNA contains an open reading frame which encompasses a 143-amino acid sequence which is 89% identical to the rat SCP 2 amino acid sequence. The deduced amino acid sequence of the polypeptide reveals a 20-residue amino-terminal leader sequence in front of the mature polypeptide, which contains a carboxyl-terminal tripeptide (Ala-Lys-Leu) related to the peroxisome targeting sequence. The expressed cDNA in COS-7 cells yields a 15.3-kDa polypeptide and increased amounts of a 13.2-kDa polypeptide, both reacting with a specific rabbit antiserum to rat liver SCP 2 . The cDNA insert hybridizes with 3.2- and 1.8-kb mRNA species in human liver poly(A) + RNA. In human fibroblasts and placenta the 1.8-kb mRNA was most abundant. Southern blot analysis suggests either that there are multiple copies of the SCP 2 gene in the human genome or that the SCP 2 gene is very large. Coexpression of the SCP 2 cDNA with expression vectors for cholesterol side-chain cleavage enzyme and adrenodoxin resulted in a 2.5-fold enhancement of progestin synthesis over that obtained with expression of the steroidogenic enzyme system alone. These findings are concordant with the notion that SCP 2 plays a role in regulating steroidogenesis, among other possible functions

Construction of a cDNA microarray derived from the ascidian Ciona intestinalis.

Science.gov (United States)

Azumi, Kaoru; Takahashi, Hiroki; Miki, Yasufumi; Fujie, Manabu; Usami, Takeshi; Ishikawa, Hisayoshi; Kitayama, Atsusi; Satou, Yutaka; Ueno, Naoto; Satoh, Nori

2003-10-01

A cDNA microarray was constructed from a basal chordate, the ascidian Ciona intestinalis. The draft genome of Ciona has been read and inferred to contain approximately 16,000 protein-coding genes, and cDNAs for transcripts of 13,464 genes have been characterized and compiled as the "Ciona intestinalis Gene Collection Release I". In the present study, we constructed a cDNA microarray of these 13,464 Ciona genes. A preliminary experiment with Cy3- and Cy5-labeled probes showed extensive differential gene expression between fertilized eggs and larvae. In addition, there was a good correlation between results obtained by the present microarray analysis and those from previous EST analyses. This first microarray of a large collection of Ciona intestinalis cDNA clones should facilitate the analysis of global gene expression and gene networks during the embryogenesis of basal chordates.

An alternative method for cDNA cloning from surrogate eukaryotic cells transfected with the corresponding genomic DNA.

Science.gov (United States)

Hu, Lin-Yong; Cui, Chen-Chen; Song, Yu-Jie; Wang, Xiang-Guo; Jin, Ya-Ping; Wang, Ai-Hua; Zhang, Yong

2012-07-01

cDNA is widely used in gene function elucidation and/or transgenics research but often suitable tissues or cells from which to isolate mRNA for reverse transcription are unavailable. Here, an alternative method for cDNA cloning is described and tested by cloning the cDNA of human LALBA (human alpha-lactalbumin) from genomic DNA. First, genomic DNA containing all of the coding exons was cloned from human peripheral blood and inserted into a eukaryotic expression vector. Next, by delivering the plasmids into either 293T or fibroblast cells, surrogate cells were constructed. Finally, the total RNA was extracted from the surrogate cells and cDNA was obtained by RT-PCR. The human LALBA cDNA that was obtained was compared with the corresponding mRNA published in GenBank. The comparison showed that the two sequences were identical. The novel method for cDNA cloning from surrogate eukaryotic cells described here uses well-established techniques that are feasible and simple to use. We anticipate that this alternative method will have widespread applications.

[Construction of forward and reverse subtracted cDNA libraries between muscle tissue of Meishan and Landrace pigs].

Science.gov (United States)

Xu, De-Quan; Zhang, Yi-Bing; Xiong, Yuan-Zhu; Gui, Jian-Fang; Jiang, Si-Wen; Su, Yu-Hong

2003-07-01

Using suppression subtractive hybridization (SSH) technique, forward and reverse subtracted cDNA libraries were constructed between Longissimus muscles from Meishan and Landrace pigs. A housekeeping gene, G3PDH, was used to estimate the efficiency of subtractive cDNA. In two cDNA libraries, G3PDH was subtracted very efficiently at appropriate 2(10) and 2(5) folds, respectively, indicating that some differentially expressed genes were also enriched at the same folds and the two subtractive cDNA libraries were very successful. A total of 709 and 673 positive clones were isolated from forward and reverse subtracted cDNA libraries, respectively. Analysis of PCR showed that most of all plasmids in the clones contained 150-750 bp inserts. The construction of subtractive cDNA libraries between muscle tissue from different pig breeds laid solid foundations for isolating and identifying the genes determining muscle growth and meat quality, which will be important to understand the mechanism of muscle growth, determination of meat quality and practice of molecular breeding.

cDNA encoding a polypeptide including a hev ein sequence

Energy Technology Data Exchange (ETDEWEB)

Raikhel, Natasha V. (Okemos, MI); Broekaert, Willem F. (Dilbeek, BE); Chua, Nam-Hai (Scarsdale, NY); Kush, Anil (New York, NY)

2000-07-04

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

cDNA fingerprinting of osteoprogenitor cells to isolate differentiation stage-specific genes.

OpenAIRE

Candeliere, G A; Rao, Y; Floh, A; Sandler, S D; Aubin, J E

1999-01-01

A cDNA fingerprinting strategy was developed to identify genes based on their differential expression pattern during osteoblast development. Preliminary biological and molecular staging of cDNA pools prepared by global amplification PCR allowed discrim-inating choices to be made in selection of expressed sequence tags (ESTs) to be isolated. Sequencing of selected ESTs confirmed that both known and novel genes can be isolated from any developmental stage of interest, e.g. from primitive progen...

RFLP for Duchenne muscular dystrophy cDNA clone 44-1

Energy Technology Data Exchange (ETDEWEB)

Laing, N G; Siddique, T; Bartlett, R J; Yamaoka, L H; Chen, J C; Walker, A P; Hung, W Y; Roses, A D [Duke Univ. Medical Center, Durham, NC (USA)

1988-07-25

Clone 44-1 is one of six cDNA clones which comprise the cDNA for the Duchenne muscular dystrophy gene. It is a 0.9kb fragment in the EcoR1 site of Bluescript. Taq1 (TlCGA) identifies two alleles with bands at 6.8 and 5.7kb, as well as four constant bands at 4.8, 3.9, 3.5 and 2.5kb. Its frequency was studied in 62 unrelated individuals. Mendelian inheritance was demonstrated in one three generation and three two generation informative families, 26 individuals. There were no problems on RFLP analysis under normal stringency conditions.

AUTOANTIBODIES TO GLUTAMIC ACID DECARBOXYLASE AS A PATHOGENETIC MARKER OF TYPE I DIABETES MELLITUS

OpenAIRE

N. V. Piven; L. N. Lukhverchyk; A. I. Burakovsky; N. V. Polegenkaya; M. V. Karpovich

2011-01-01

Abstract. A new method of enzyme-linked immunosorbent assay (in solid-phase ELISA format) has been developed to determine concentrations of autoantibodies to glutamic acid decarboxylase, as well as an evidencebased methodology is proposed for its medical implications, as a quantitative pathogenetic predictive marker of autoimmune diagnostics in type 1 diabetes mellitus. This technique could be implied for serial production of diagnostic reagent kits, aimed for detection of autoantibodies to g...

Avoiding cross hybridization by choosing nonredundant targets on cDNA arrays

DEFF Research Database (Denmark)

Nielsen, Henrik Bjørn; Knudsen, Steen

2002-01-01

PROBEWIZ designs PCR primers for amplifying probes for cDNA arrays. The probes are designed to have minimal homology to other expressed sequences from a given organism. The primer selection is based on user-defined penalties for homology, primer quality, and proximity to the 3' end.......PROBEWIZ designs PCR primers for amplifying probes for cDNA arrays. The probes are designed to have minimal homology to other expressed sequences from a given organism. The primer selection is based on user-defined penalties for homology, primer quality, and proximity to the 3' end....

cDNA cloning and mRNA expression of heat shock protein 70 gene ...

African Journals Online (AJOL)

In this study, the full-length heat shock protein 70 of Tegillarca granosa was cloned from cDNA library by rapid amplification of cDNA end (RACE). The open reading frame (ORF) of heat shock protein 70 was 1968 bp, and it encoded a protein of 655 amino acids with a predicted molecular weight of 71.48 kDa and an ...

Inhibitors of polyamine metabolism: review article.

Science.gov (United States)

Wallace, H M; Fraser, A V

2004-07-01

The identification of increased polyamine concentrations in a variety of diseases from cancer and psoriasis to parasitic infections has led to the hypothesis that manipulation of polyamine metabolism is a realistic target for therapeutic or preventative intervention in the treatment of certain diseases. The early development of polyamine biosynthetic single enzyme inhibitors such as alpha-difluoromethylornithine (DFMO) and methylglyoxal bis(guanylhydrazone) showed some interesting early promise as anticancer drugs, but ultimately failed in vivo. Despite this, DFMO is currently in use as an effective anti-parasitic agent and has recently also been shown to have further potential as a chemopreventative agent in colorectal cancer. The initial promise in vitro led to the development and testing of other potential inhibitors of the pathway namely the polyamine analogues. The analogues have met with greater success than the single enzyme inhibitors possibly due to their multiple targets. These include down regulation of polyamine biosynthesis through inhibition of ornithine decarboxylase and S-adenosylmethionine decarboxylase and decreased polyamine uptake. This coupled with increased activity of the catabolic enzymes, polyamine oxidase and spermidine/spermine N1-acetyltransferase, and increased polyamine export has made the analogues more effective in depleting polyamine pools. Recently, the identification of a new oxidase (PAO-h1/SMO) in polyamine catabolism and evidence of induction of both PAO and PAO-h1/SMO in response to polyamine analogue treatment, suggests the analogues may become an important part of future chemotherapeutic and/or chemopreventative regimens.

Aromatic L-amino acid decarboxylase (AADC) is crucial for brain development and motor functions.

Science.gov (United States)

Shih, De-Fen; Hsiao, Chung-Der; Min, Ming-Yuan; Lai, Wen-Sung; Yang, Chianne-Wen; Lee, Wang-Tso; Lee, Shyh-Jye

2013-01-01

Aromatic L-amino acid decarboxylase (AADC) deficiency is a rare pediatric neuro-metabolic disease in children. Due to the lack of an animal model, its pathogenetic mechanism is poorly understood. To study the role of AADC in brain development, a zebrafish model of AADC deficiency was generated. We identified an aadc gene homolog, dopa decarboxylase (ddc), in the zebrafish genome. Whole-mount in situ hybridization analysis showed that the ddc gene is expressed in the epiphysis, locus caeruleus, diencephalic catecholaminergic clusters, and raphe nuclei of 36-h post-fertilization (hpf) zebrafish embryos. Inhibition of Ddc by AADC inhibitor NSD-1015 or anti-sense morpholino oligonucleotides (MO) reduced brain volume and body length. We observed increased brain cell apoptosis and loss of dipencephalic catecholaminergic cluster neurons in ddc morphants (ddc MO-injected embryos). Seizure-like activity was also detected in ddc morphants in a dose-dependent manner. ddc morphants had less sensitive touch response and impaired swimming activity that could be rescued by injection of ddc plasmids. In addition, eye movement was also significantly impaired in ddc morphants. Collectively, loss of Ddc appears to result in similar phenotypes as that of ADCC deficiency, thus zebrafish could be a good model for investigating pathogenetic mechanisms of AADC deficiency in children.

Aromatic L-amino acid decarboxylase (AADC is crucial for brain development and motor functions.

Directory of Open Access Journals (Sweden)

De-Fen Shih

Full Text Available Aromatic L-amino acid decarboxylase (AADC deficiency is a rare pediatric neuro-metabolic disease in children. Due to the lack of an animal model, its pathogenetic mechanism is poorly understood. To study the role of AADC in brain development, a zebrafish model of AADC deficiency was generated. We identified an aadc gene homolog, dopa decarboxylase (ddc, in the zebrafish genome. Whole-mount in situ hybridization analysis showed that the ddc gene is expressed in the epiphysis, locus caeruleus, diencephalic catecholaminergic clusters, and raphe nuclei of 36-h post-fertilization (hpf zebrafish embryos. Inhibition of Ddc by AADC inhibitor NSD-1015 or anti-sense morpholino oligonucleotides (MO reduced brain volume and body length. We observed increased brain cell apoptosis and loss of dipencephalic catecholaminergic cluster neurons in ddc morphants (ddc MO-injected embryos. Seizure-like activity was also detected in ddc morphants in a dose-dependent manner. ddc morphants had less sensitive touch response and impaired swimming activity that could be rescued by injection of ddc plasmids. In addition, eye movement was also significantly impaired in ddc morphants. Collectively, loss of Ddc appears to result in similar phenotypes as that of ADCC deficiency, thus zebrafish could be a good model for investigating pathogenetic mechanisms of AADC deficiency in children.

Isolation of the human anionic glutathione S-transferase cDNA and the relation of its gene expression to estrogen-receptor content in primary breast cancer

International Nuclear Information System (INIS)

Moscow, J.A.; Townsend, A.J.; Goldsmith, M.E.; Whang-Peng, J.; Vickers, P.J.; Poisson, R.; Legault-Poisson, S.; Myers, C.E.; Cowan, K.H.

1988-01-01

The development of multidrug resistance in MCF7 human breast cancer cells is associated with overexpression of P-glycoprotein, changes in activities of several detoxication enzymes, and loss of hormone sensitivity and estrogen receptors (ERs). The authors have cloned the cDNA for one of the drug-detoxifying enzymes overexpressed in multidrug-resistant MCF7 cells (Adr R MCF7), the anionic isozyme of glutathione S-transferase (GSTπ). Hybridization with this GSTπ cDNA, GSTπ-1, demonstrated that increased GSTπ activity in Adr R MCF7 cells is associated with overexpression but not with amplification of the gene. They mapped the GSTπ gene to human chromosome 11q13 by in situ hybridization. Since multidrug resistance and GSTπ overexpression are associated with the loss of ERs in Adr R MCF7 cells, they examined several other breast cancer cell lines that were not selected for drug resistance. In each of these cell lines they found an inverse association between GSTπ expression and ER content. They also examined RNA from 21 primary breast cancers and found a similar association between GSTπ expression and ER content in vivo. The finding of similar patterns of expression of a drug-detoxifying enzyme and of ERs in vitro as well as in vivo suggests that ER-negative breast cancer cells may have greater protection against antineoplastic agents conferred by GSTπ than ER-positive tumors

Cloning and cDNA sequence of the dihydrolipoamide dehydrogenase component of human α-ketoacid dehydrogenase complexes

International Nuclear Information System (INIS)

Pons, G.; Raefsky-Estrin, C.; Carothers, D.J.; Pepin, R.A.; Javed, A.A.; Jesse, B.W.; Ganapathi, M.K.; Samols, D.; Patel, M.S.

1988-01-01

cDNA clones comprising the entire coding region for human dihydrolipoamide dehydrogenase have been isolated from a human liver cDNA library. The cDNA sequence of the largest clone consisted of 2082 base pairs and contained a 1527-base open reading frame that encodes a precursor dihydrolipoamide dehydrogenase of 509 amino acid residues. The first 35-amino acid residues of the open reading frame probably correspond to a typical mitochondrial import leader sequence. The predicted amino acid sequence of the mature protein, starting at the residue number 36 of the open reading frame, is almost identical (>98% homology) with the known partial amino acid sequence of the pig heart dihydrolipoamide dehydrogenase. The cDNA clone also contains a 3' untranslated region of 505 bases with an unusual polyadenylylation signal (TATAAA) and a short poly(A) track. By blot-hybridization analysis with the cDNA as probe, two mRNAs, 2.2 and 2.4 kilobases in size, have been detected in human tissues and fibroblasts, whereas only one mRNA (2.4 kilobases) was detected in rat tissues

Cloning, sequencing and expression of cDNA encoding growth ...

Indian Academy of Sciences (India)

Unknown

of medicine, animal husbandry, fish farming and animal ..... northern pike (Esox lucius) growth hormone; Mol. Mar. Biol. ... prolactin 1-luciferase fusion gene in African catfish and ... 1988 Cloning and sequencing of cDNA that encodes goat.

Isolation and characterization of cDNA clones for carrot extensin and a proline-rich 33-kDa protein

International Nuclear Information System (INIS)

Chen, J.; Varner, J.E.

1985-01-01

Extensins are hydroxyproline-rich glycoproteins associated with most dicotyledonous plant cell walls. To isolate cDNA clones encoding extensin, the authors started by isolating poly(A) + RNA from carrot root tissue, and then translating the RNA in vitro, in the presence of tritiated leucine or proline. A 33-kDa peptide was identified in the translation products as a putative extensin precursor. From a cDNA library constructed with poly(A) + RNA from wounded carrots, one cDNA clone (pDC5) was identified that specifically hybridized to poly(A) + RNA encoding this 33-kDa peptide. They isolated three cDNA clones (pDC11, pDC12, and pDC16) from another cDNA library using pCD5 as a probe. DNA sequence data, RNA hybridization analysis, and hybrid released in vitro translation indicate that the cDNA clones pDC11 encodes extensin and that cDNA clones pDC12 and pDC16 encode the 33-kDa peptide, which as yet has an unknown identity and function. The assumption that the 33-kDa peptide was an extensin precursor was invalid. RNA hybridization analysis showed that RNA encoded by both clone types is accumulated upon wounding

Contribution of glutamate decarboxylase in Lactobacillus reuteri to acid resistance and persistence in sourdough fermentation.

Science.gov (United States)

Su, Marcia S; Schlicht, Sabine; Gänzle, Michael G

2011-08-30

Acid stress impacts the persistence of lactobacilli in industrial sourdough fermentations, and in intestinal ecosystems. However, the contribution of glutamate to acid resistance in lactobacilli has not been demonstrated experimentally, and evidence for the contribution of acid resistance to the competitiveness of lactobacilli in sourdough is lacking. It was therefore the aim of this study to investigate the ecological role of glutamate decarboxylase in L. reuteri. A gene coding for a putative glutamate decarboxylase, gadB, was identified in the genome of L. reuteri 100-23. Different from the organization of genetic loci coding for glutamate decarboxylase in other lactic acid bacteria, gadB was located adjacent to a putative glutaminase gene, gls3. An isogenic deletion mutant, L. reuteri ∆gadB, was generated by a double crossover method. L. reuteri 100-23 but not L. reuteri ∆gadB converted glutamate to γ-aminobutyrate (GABA) in phosphate butter (pH 2.5). In sourdough, both strains converted glutamine to glutamate but only L. reuteri 100-23 accumulated GABA. Glutamate addition to phosphate buffer, pH 2.5, improved survival of L. reuteri 100-23 100-fold. However, survival of L. reuteri ∆gadB remained essentially unchanged. The disruption of gadB did not affect growth of L. reuteri in mMRS or in sourdough. However, the wild type strain L. reuteri 100-23 displaced L. reuteri ∆gadB after 5 cycles of fermentation in back-slopped sourdough fermentations. The conversion of glutamate to GABA by L. reuteri 100-23 contributes to acid resistance and to competitiveness in industrial sourdough fermentations. The organization of the gene cluster for glutamate conversion, and the availability of amino acids in cereals imply that glutamine rather than glutamate functions as the substrate for GABA formation. The exceptional coupling of glutamine deamidation to glutamate decarboxylation in L. reuteri likely reflects adaptation to cereal substrates.

Development of three full-length infectious cDNA clones of distinct brassica yellows virus genotypes for agrobacterium-mediated inoculation.

Science.gov (United States)

Zhang, Xiao-Yan; Dong, Shu-Wei; Xiang, Hai-Ying; Chen, Xiang-Ru; Li, Da-Wei; Yu, Jia-Lin; Han, Cheng-Gui

2015-02-02

Brassica yellows virus is a newly identified species in the genus of Polerovirus within the family Luteoviridae. Brassica yellows virus (BrYV) is prevalently distributed throughout Mainland China and South Korea, is an important virus infecting cruciferous crops. Based on six BrYV genomic sequences of isolates from oilseed rape, rutabaga, radish, and cabbage, three genotypes, BrYV-A, BrYV-B, and BrYV-C, exist, which mainly differ in the 5' terminal half of the genome. BrYV is an aphid-transmitted and phloem-limited virus. The use of infectious cDNA clones is an alternative means of infecting plants that allows reverse genetic studies to be performed. In this study, full-length cDNA clones of BrYV-A, recombinant BrYV5B3A, and BrYV-C were constructed under control of the cauliflower mosaic virus 35S promoter. An agrobacterium-mediated inoculation system of Nicotiana benthamiana was developed using these cDNA clones. Three days after infiltration with full-length BrYV cDNA clones, necrotic symptoms were observed in the inoculated leaves of N. benthamiana; however, no obvious symptoms appeared in the upper leaves. Reverse transcription-PCR (RT-PCR) and western blot detection of samples from the upper leaves showed that the maximum infection efficiency of BrYVs could reach 100%. The infectivity of the BrYV-A, BrYV-5B3A, and BrYV-C cDNA clones was further confirmed by northern hybridization. The system developed here will be useful for further studies of BrYV, such as host range, pathogenicity, viral gene functions, and plant-virus-vector interactions, and especially for discerning the differences among the three genotypes. Copyright © 2014 Elsevier B.V. All rights reserved.

Phenol emulsion-enhanced DNA-driven subtractive cDNA cloning: isolation of low-abundance monkey cortex-specific mRNAs

International Nuclear Information System (INIS)

Travis, G.H.; Sutcliffe, J.G.

1988-01-01

To isolate cDNA clones of low-abundance mRNAs expressed in monkey cerebral cortex but absent from cerebellum, the authors developed an improved subtractive cDNA cloning procedure that requires only modest quantities of mRNA. Plasmid DNA from a monkey cerebellum cDNA library was hybridized in large excess to radiolabeled monkey cortex cDNA in a phenol emulsion-enhanced reaction. The unhybridized cortex cDNA was isolated by chromatography on hydroxyapatite and used to probe colonies from a monkey cortex cDNA library. Of 60,000 colonies screened, 163 clones were isolated and confirmed by colony hybridization or RNA blotting to represent mRNAs, ranging from 0.001% to 0.1% abundance, specific to or highly enriched in cerebral cortex relative to cerebellum. Clones of one medium-abundance mRNA were recovered almost quantitatively. Two of the lower-abundance mRNAs were expressed at levels reduced by a factor of 10 in Alzheimer disease relative to normal human cortex. One of these was identified as the monkey preprosomatostatin I mRNA

Characterisation of the broad substrate specificity 2-keto acid decarboxylase Aro10p of Saccharomyces kudriavzevii and its implication in aroma development.

Science.gov (United States)

Stribny, Jiri; Romagnoli, Gabriele; Pérez-Torrado, Roberto; Daran, Jean-Marc; Querol, Amparo

2016-03-12

The yeast amino acid catabolism plays an important role in flavour generation since higher alcohols and acetate esters, amino acid catabolism end products, are key components of overall flavour and aroma in fermented products. Comparative studies have shown that other Saccharomyces species, such as S. kudriavzevii, differ during the production of aroma-active higher alcohols and their esters compared to S. cerevisiae. In this study, we performed a comparative analysis of the enzymes involved in the amino acid catabolism of S. kudriavzevii with their potential to improve the flavour production capacity of S. cerevisiae. In silico screening, based on the severity of amino acid substitutions evaluated by Grantham matrix, revealed four candidates, of which S. kudriavzevii Aro10p (SkAro10p) had the highest score. The analysis of higher alcohols and esters produced by S. cerevisiae then revealed enhanced formation of isobutanol, isoamyl alcohol and their esters when endogenous ARO10 was replaced with ARO10 from S. kudriavzevii. Also, significant differences in the aroma profile were found in fermentations of synthetic wine must. Substrate specificities of SkAro10p were compared with those of S. cerevisiae Aro10p (ScAro10p) by their expression in a 2-keto acid decarboxylase-null S. cerevisiae strain. Unlike the cell extracts with expressed ScAro10p which showed greater activity for phenylpyruvate, which suggests this phenylalanine-derivative to be the preferred substrate, the decarboxylation activities measured in the cell extracts with SkAro10p ranged with all the tested substrates at the same level. The activities of SkAro10p towards substrates (except phenylpyruvate) were higher than of those for ScAro10p. The results indicate that the amino acid variations observed between the orthologues decarboxylases encoded by SkARO10 and ScARO10 could be the reason for the distinct enzyme properties, which possibly lead to the enhanced production of several flavour compounds. The

Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor.

OpenAIRE

Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P

1988-01-01

Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding t...

Molecular cloning of a human glycophorin B cDNA: nucleotide sequence and genomic relationship to glycophorin A

International Nuclear Information System (INIS)

Siebert, P.D.; Fukuda, M.

1987-01-01

The authors describe the isolation and nucleotide sequence of a human glycophorin B cDNA. The cDNA was identified by differential hybridization of synthetic oligonucleotide probes to a human erythroleukemic cell line (K562) cDNA library constructed in phage vector λgt10. The nucleotide sequence of the glycophorin B cDNA was compared with that of a previously cloned glycophorin A cDNA. The nucleotide sequences encoding the NH 2 -terminal leader peptide and first 26 amino acids of the two proteins are nearly identical. This homologous region is followed by areas specific to either glycophorin A or B and a number of small regions of homology, which in turn are followed by a very homologous region encoding the presumed membrane-spanning portion of the proteins. They used RNA blot hybridization with both cDNA and synthetic oligonucleotide probes to prove our previous hypothesis that glycophorin B is encoded by a single 0.5- to 0.6-kb mRNA and to show that glycophorins A and B are negatively and coordinately regulated by a tumor-promoting phorbol ester, phorbol 12-myristate 13-acetate. They established the intron/exon structure of the glycophorin A and B genes by oligonucleotide mapping; the results suggest a complex evolution of the glycophorin genes

Identification and Molecular Characterization of the cDNA Encoding Cucumis melo Allergen, Cuc m 3, a Plant Pathogenesis-Related Protein

Directory of Open Access Journals (Sweden)

Mojtaba Sankian

2014-05-01

Full Text Available Background: Melon (Cucumis melo allergy is one of the most common food allergies, characterized by oral allergy syndrome. To date, two allergen molecules, Cuc m 1 and Cuc m 2, have been fully characterized in melon pulp, but there are few reports about the molecular characteristics of Cuc m 3. Methods:The Cuc m 3 cDNA has been characterized by rapid amplification of cDNA ends (RACE, which revealed a 456 base-pair (bp fragment encoding a 151-amino acid polypeptide with a predicted molecular mass of 16.97 kDa, and identified 79 and 178 bp untranslated sequences at the 5′ and 3´ ends, respectively. Results: In silico analysis showed strong similarities between Cuc m 3 and other plant pathogen-related protein 1s from cucumber, grape, bell pepper, and tomato. Conclusion: Here we report the identification and characterization of the Cuc m 3 cDNA, which will be utilized for further analyses of structural and allergenic features of this allergen

The function of glycine decarboxylase complex is optimized to maintain high photorespiratory flux via buffering of its reaction products

DEFF Research Database (Denmark)

Bykova, Natalia V; Møller, Ian Max; Gardeström, Per

2014-01-01

oxidase. We discuss here possible mechanisms of high photorespiratory flux maintenance in mitochondria and suggest that it is fulfilled under conditions where the concentrations of glycine decarboxylase reaction products NADH and CO2 achieve an equilibrium provided by malate dehydrogenase and carbonic...

NORMAL NASAL GENE EXPRESSION LEVELS USING CDNA ARRAY TECHNOLOGY

Science.gov (United States)

Normal Nasal Gene Expression Levels Using cDNA Array Technology. The nasal epithelium is a target site for chemically-induced toxicity and carcinogenicity. To detect and analyze genetic events which contribute to nasal tumor development, we first defined the gene expressi...

Two human cDNA molecules coding for the Duchenne muscular dystrophy (DMD) locus are highly homologous

Energy Technology Data Exchange (ETDEWEB)

Rosenthal, A.; Speer, A.; Billwitz, H. (Zentralinstitut fuer Molekularbiologie, Berlin-Buch (Germany Democratic Republic)); Cross, G.S.; Forrest, S.M.; Davies, K.E. (Univ. of Oxford (England))

1989-07-11

Recently the complete sequence of the human fetal cDNA coding for the Duchenne muscular dystrophy (DMD) locus was reported and a 3,685 amino acid long, rod-shaped cytoskeletal protein (dystrophin) was predicted as the protein product. Independently, the authors have isolated and sequenced different DMD cDNA molecules from human adult and fetal muscle. The complete 12.5 kb long sequence of all their cDNA clones has now been determined and they report here the nucleotide (nt) and amino acid (aa) differences between the sequences of both groups. The cDNA sequence comprises the whole coding region but lacks the first 110 nt from the 5{prime}-untranslated region and the last 1,417 nt of the 3{prime}-untranslated region. They have found 11 nt differences (approximately 99.9% homology) from which 7 occurred at the aa level.

Cloning of affecting pyruvate decarboxylase gene in the production bioethanol of agricultural waste in the E.coli bacteria

Directory of Open Access Journals (Sweden)

Masome Zeinali

2016-09-01

Full Text Available Introduction: Ethanol made by a biomass is one of the useful strategies in terms of economic and environmental and as a clean and safe energy to replace fossil fuels considered and examined. Materials and methods: In this study, key enzyme in the production of ethanol (Pyruvate decarboxylase from Zymomonas mobilis bacteria was isolated and cloned at E. coli bacteria by freeze and thaw method. For gene cloning, we used specific primers of pdc and PCR reaction and then pdc gene isolated and pET 28a plasmid double digested with (Sal I and Xho I enzymes. Digestion Products were ligated by T4 DNA ligase in 16 °C for 16 hours. Results: Results of bacteria culture showed that a few colonies containing pET 28a plasmid could grow. Result of colony pcr of pdc gene with specific primers revealed 1700 bp bands in 1% agarose gel electrophoresis. The results of PCR with T7 promotor forward primer and pdc revers primer have proved the accurate direction of integration of pdc gene into plasmid and revealed 1885 bp band. Double digestion of recombinant plasmid with SalI and XhoI enzymes revealed same bands. Finally, RT showed the expected band of 1700 bp that implies the desired gene expression in the samples. Discussion and conclusion: Due to the increased production of ethanol via pyruvate decarboxylase gene cloning in expression plasmids with a strong promoter upstream of the cloning site can conclude that, pyruvate decarboxylase cloning as a key gene would be useful and according to beneficial properties of E. coli bacteria, transfering the gene to bacteria appears to be reasonable.

ESTs, cDNA microarrays, and gene expression profiling: tools for dissecting plant physiology and development.

Science.gov (United States)

Alba, Rob; Fei, Zhangjun; Payton, Paxton; Liu, Yang; Moore, Shanna L; Debbie, Paul; Cohn, Jonathan; D'Ascenzo, Mark; Gordon, Jeffrey S; Rose, Jocelyn K C; Martin, Gregory; Tanksley, Steven D; Bouzayen, Mondher; Jahn, Molly M; Giovannoni, Jim

2004-09-01

Gene expression profiling holds tremendous promise for dissecting the regulatory mechanisms and transcriptional networks that underlie biological processes. Here we provide details of approaches used by others and ourselves for gene expression profiling in plants with emphasis on cDNA microarrays and discussion of both experimental design and downstream analysis. We focus on methods and techniques emphasizing fabrication of cDNA microarrays, fluorescent labeling, cDNA hybridization, experimental design, and data processing. We include specific examples that demonstrate how this technology can be used to further our understanding of plant physiology and development (specifically fruit development and ripening) and for comparative genomics by comparing transcriptome activity in tomato and pepper fruit.

Cloning and molecular characterization of the salt-regulated jojoba ScRab cDNA encoding a small GTP-binding protein.

Science.gov (United States)

Mizrahi-Aviv, Ela; Mills, David; Benzioni, Aliza; Bar-Zvi, Dudy

2002-10-01

Salt stress results in a massive change in gene expression. An 837 bp cDNA designated ScRab was cloned from shoot cultures of the salt tolerant jojoba (Simmondsia chinesis). The cloned cDNA encodes a full length 200 amino acid long polypeptide that bears high homology to the Rab subfamily of small GTP binding proteins, particularly, the Rab5 subfamily. ScRab expression is reduced in shoots grown in the presence of salt compared to shoots from non-stressed cultures. His6-tagged ScRAB protein was expressed in E. coli, and purified to homogeneity. The purified protein bound radiolabelled GTP. The unlabelled guanine nucleotides GTP, GTP gamma S and GDP but not ATP, CTP or UTP competed with GTP binding.

Glyoxal bis(guanylhydrazone) as an inhibitor of polyamine biosynthesis in tumour cells.

Science.gov (United States)

Seppänen, P; Fagerström, R; Alhonen-Hongisto, L; Elo, H; Lumme, P; Jänne, J

1984-07-15

Glyoxal bis(guanylhydrazone), the parent compound of methylglyoxal bis(guanylhydrazone), was synthesized and tested for its ability to inhibit the biosynthesis of polyamines. It was found to be a powerful competitive inhibitor of adenosylmethionine decarboxylase (EC 4.1.1.50), yet the lack of the methyl group at the glyoxal portion increased the apparent Ki value for the enzyme by about 30-fold in comparison with methylglyoxal bis(guanylhydrazone). Glyoxal bis(guanylhydrazone) inhibited diamine oxidase (EC 1.4.3.6) activity as effectively as did methylglyoxal bis(guanylhydrazone). The cellular accumulation curves of glyoxal bis(guanylhydrazone) in L1210 cells were practically superimposable with those of methylglyoxal bis(guanylhydrazone), and the uptake of both compounds was distinctly stimulated by a prior treatment with 2-difluoromethylornithine. The drug decreased the concentration of spermidine in a dose-dependent manner and, in contrast with methylglyoxal bis(guanylhydrazone), without a concomitant accumulation of putrescine. The fact that putrescine concentrations were decreased in cells exposed to glyoxal bis(guanylhydrazone) was, at least in part, attributable to an inhibition of ornithine decarboxylase (EC 4.1.1.17) activity in cells treated with the compound. Under these experimental conditions equivalent concentrations of methylglyoxal bis(guanylhydrazone) [1,1'-[(methylethanediylidine)dinitrilo]diguanidine] elicited large increases in the enzyme activity. When combined with difluoromethylornithine, glyoxal bis(guanylhydrazone) potentiated the growth-inhibitory effect of that drug. Taking into consideration the proven anti-leukaemic activity of glyoxal bis(guanylhydrazone), its effectiveness to inhibit spermidine biosynthesis (without raising the concentration of putrescine) as well as its suitability for combined use with inhibitors of ornithine decarboxylase, this drug is apparently worthy of further testing in tumour-bearing animals, especially in

Hypothalamic L-Histidine Decarboxylase Is Up-Regulated During Chronic REM Sleep Deprivation of Rats.

Directory of Open Access Journals (Sweden)

Gloria E Hoffman

Full Text Available A competition of neurobehavioral drives of sleep and wakefulness occurs during sleep deprivation. When enforced chronically, subjects must remain awake. This study examines histaminergic neurons of the tuberomammillary nucleus of the posterior hypothalamus in response to enforced wakefulness in rats. We tested the hypothesis that the rate-limiting enzyme for histamine biosynthesis, L-histidine decarboxylase (HDC, would be up-regulated during chronic rapid eye movement sleep deprivation (REM-SD because histamine plays a major role in maintaining wakefulness. Archived brain tissues of male Sprague Dawley rats from a previous study were used. Rats had been subjected to REM-SD by the flowerpot paradigm for 5, 10, or 15 days. For immunocytochemistry, rats were transcardially perfused with acrolein-paraformaldehyde for immunodetection of L-HDC; separate controls used carbodiimide-paraformaldehyde for immunodetection of histamine. Immunolocalization of histamine within the tuberomammillary nucleus was validated using carbodiimide. Because HDC antiserum has cross-reactivity with other decarboxylases at high antibody concentrations, titrations localized L-HDC to only tuberomammillary nucleus at a dilution of ≥ 1:300,000. REM-SD increased immunoreactive HDC by day 5 and it remained elevated in both dorsal and ventral aspects of the tuberomammillary complex. Our results suggest that up-regulation of L-HDC within the tuberomammillary complex during chronic REM-SD may be responsible for maintaining wakefulness.

Cloning and sequence analysis of cDNA coding for rat nucleolar protein C23

International Nuclear Information System (INIS)

Ghaffari, S.H.; Olson, M.O.J.

1986-01-01

Using synthetic oligonucleotides as primers and probes, the authors have isolated and sequenced cDNA clones encoding protein C23, a putative nucleolus organizer protein. Poly(A + ) RNA was isolated from rat Novikoff hepatoma cells and enriched in C23 mRNA by sucrose density gradient ultracentrifugation. Two deoxyoligonuleotides, a 48- and a 27-mer, were synthesized on the basis of amino acid sequence from the C-terminal half of protein C23 and cDNA sequence data from CHO cell protein. The 48-mer was used a primer for synthesis of cDNA which was then inserted into plasmid pUC9. Transformed bacterial colonies were screened by hybridization with 32 P labeled 27-mer. Two clones among 5000 gave a strong positive signal. Plasmid DNAs from these clones were purified and characterized by blotting and nucleotide sequence analysis. The length of C23 mRNA was estimated to be 3200 bases in a northern blot analysis. The sequence of a 267 b.p. insert shows high homology with the CHO cDNA with only 9 nucleotide differences and an identical amino acid sequence. These studies indicate that this region of the protein is highly conserved

Generation of a reliable full-length cDNA of infectiousTembusu virus using a PCR-based protocol.

Science.gov (United States)

Liang, Te; Liu, Xiaoxiao; Cui, Shulin; Qu, Shenghua; Wang, Dan; Liu, Ning; Wang, Fumin; Ning, Kang; Zhang, Bing; Zhang, Dabing

2016-02-02

Full-length cDNA of Tembusu virus (TMUV) cloned in a plasmid has been found instable in bacterial hosts. Using a PCR-based protocol, we generated a stable full-length cDNA of TMUV. Different cDNA fragments of TMUV were amplified by reverse transcription (RT)-PCR, and cloned into plasmids. Fragmented cDNAs were amplified and assembled by fusion PCR to produce a full-length cDNA using the recombinant plasmids as templates. Subsequently, a full-length RNA was transcribed from the full-length cDNA in vitro and transfected into BHK-21 cells; infectious viral particles were rescued successfully. Following several passages in BKH-21 cells, the rescued virus was compared with the parental virus by genetic marker checks, growth curve determinations and animal experiments. These assays clearly demonstrated the genetic and biological stabilities of the rescued virus. The present work will be useful for future investigations on the molecular mechanisms involved in replication and pathogenesis of TMUV. Copyright © 2015 Elsevier B.V. All rights reserved.

CDNA CLONING OF FATHEAD MINNOW (PIMEPHALES PROMELAS) ESTROGEN AND ANDROGEN RECEPTORS FOR USE IN STEROID RECEPTOR EXTRAPOLATION STUDIES FOR ENDOCRINE DISRUPTING CHEMICALS

Science.gov (United States)

cDNA Cloning of Fathead minnow (Pimephales promelas) Estrogen and Androgen Receptors for Use in Steroid Receptor Extrapolation Studies for Endocrine Disrupting Chemicals. Wilson, V.S.1,, Korte, J.2, Hartig P. 1, Ankley, G.T.2, Gray, L.E., Jr 1, , and Welch, J.E.1. 1U.S...

Isolation and characterization of cDNA clones for human erythrocyte β-spectrin

International Nuclear Information System (INIS)

Prchal, J.T.; Morley, B.J.; Yoon, S.H.; Coetzer, T.L.; Palek, J.; Conboy, J.G.; Kan, Y.W.

1987-01-01

Spectrin is an important structural component of the membrane skeleton that underlies and supports the erythrocyte plasma membrane. It is composed of nonidentical α (M/sub r/ 240,000) and β (M/sub r/ 220,000) subunits, each of which contains multiple homologous 106-amino acid segments. The authors report here the isolation and characterization of a human erythroid-specific β-spectrin cDNA clone that encodes parts of the β-9 through β-12 repeat segments. This cDNA was used as a hybridization probe to assign the β-spectrin gene to human chromosome 14 and to begin molecular analysis of the gene and its mRNA transcripts. RNA transfer blot analysis showed that the reticulocyte β-spectrin mRNA is 7.8 kilobases in length. Southern blot analysis of genomic DNA revealed the presence of restriction fragment length polymorphisms (RFLPs) within the β-spectrin gene locus. The isolation of human spectrin cDNA probes and the identification of closely linked RFLPs will facilitate analysis of mutant spectrin genes causing congenital hemolytic anemias associated with quantitative and qualitative spectrin abnormalities

Expression of wild-type and mutant medium-chain acyl-CoA dehydrogenase (MCAD) cDNA in eucaryotic cells

DEFF Research Database (Denmark)

Jensen, T G; Andresen, B S; Bross, P

1992-01-01

An effective EBV-based expression system for eucaryotic cells has been developed and used for the study of the mitochondrial enzyme medium-chain acyl-CoA dehydrogenase (MCAD). 1325 bp of PCR-generated MCAD cDNA, containing the entire coding region, was placed between the SV40 early promoter...... and polyadenylation signals in the EBV-based vector. Both wild-type MCAD cDNA and cDNA containing the prevalent disease-causing mutation A to G at position 985 of the MCAD cDNA were tested. In transfected COS-7 cells, the steady state amount of mutant MCAD protein was consistently lower than the amount of wild......-type human enzyme. The enzyme activity in extracts from cells harbouring the wild-type MCAD cDNA was dramatically higher than in the controls (harbouring the vector without the MCAD gene) while only a slightly higher activity was measured with the mutant MCAD. The mutant MCAD present behaves like wild...

Construction and expression of pEgr-sHemopexin recombinant plasmid induced by ionizing radiation in vitro

International Nuclear Information System (INIS)

Wang Guiquan; Jilin Univ., Changchun; Xu Chuanjie; Yang Wen; Piao Chunji; Dong Zhen

2005-01-01

Objective: To clone mouse secretable Hemopexin (sPEX) cDNA, construct pEgr-sPEX recombinant plasmid and detect the expression of recombinant plasmid in B16F10 cells. Methods: Hemopexin cDNA was amplified from the NIH3T3 cells by RT-PCR. After the cDNA identified by sequencing, the pEgr-sPEX recombinant plasmid was constructed and the plasmid was transfected into B16F10 cells with liposome and the expression of PEX induced by ionizing radiation in B16F10 cells was detected by Western blotting. Results: The sequencing results proved the cloned sPEX cDNA to be completely identical with that reported in the GenBank. The mouse sPEX cDNA was inserted correctly into expression vector and expressed successfully. Conclusion: The mouse sPEX cDNA is cloned successfully and it is confirmed that pEgr-sPEX possesses the radiation inducing expression characteristics in vitro. (authors)

RFLP for Duchenne muscular dystrophy cDNA clone 30-2

Energy Technology Data Exchange (ETDEWEB)

Walker, A P; Bartlett, R J; Laing, N G; Siddique, T; Yamaoka, L H; Chen, J C; Hung, W Y; Roses, A D [Duke Univ. Medical Center, Durham, NC (USA)

1988-09-26

30-2 is one of 6 cDNA clones which comprise the cDNA for the Duchenne muscular dystrophy gene. It is a 1.15 kb fragment in the EcoRI site of Bluescribe. TaqI (T{down arrow}CGA) identifies two bands with alleles at 3.7 and 3.5 kb, as well as eight constant bands at 9.0, 7.5, 4.6, 3.6, 3.4, 2.5, 1.7 and 1.4 kb. The allele frequency was studied in 47 unrelated DMD males: 3.7 kb allele 0.45; and 3.5 kb allele 0.55. Co-dominant X-linked segregation was demonstrated in two 2-generation families. 1.1% agarose gels required to resolve the bands. The polymorphism is also recognized by PERT 87-15.

Cloning a cDNA for the lysosomal alpha-glucosidase

NARCIS (Netherlands)

KONINGS, A.; HUPKES, P.; Versteeg, R.; Grosveld, G.; Reuser, A.; Galjaard, H.

1984-01-01

Messenger RNA was isolated from monkey testes and size-fractionated on sucrose gradients. In vitro translation of these mRNA fractions resulted in nascent, labeled alpha-glucosidase that could be precipitated with anti human alpha-glucosidase antiserum. A cDNA library was constructed from the most

Construction and biological activities of the first infectious cDNA clones of the genus Foveavirus

Energy Technology Data Exchange (ETDEWEB)

Meng, Baozhong, E-mail: bmeng@uoguelph.ca [Department of Molecular and Cellular Biology, University of Guelph, 50 Stone Road, Guelph, Ontario, Canada N1G2W1 (Canada); Venkataraman, Srividhya; Li, Caihong; Wang, Weizhou [Department of Molecular and Cellular Biology, University of Guelph, 50 Stone Road, Guelph, Ontario, Canada N1G2W1 (Canada); Dayan-Glick, Cathy; Mawassi, Munir [The Plant Pathology Department-The Virology Unit, Plant Protection Institute, Agricultural Research Organization, The Volcani Center, Bet-Dagan 50250 (Israel)

2013-01-20

Grapevine rupestris stem pitting-associated virus (GRSPaV, genus Foveavirus, family Betaflexiviridae) is one of the most prevalent viruses in grapevines and is associated with three distinct diseases: rupestris stem pitting, vein necrosis and Syrah decline. Little is known about the biology and pathological properties of GRSPaV. In this work, we engineered a full-length infectious cDNA clone for GRSPaV and a GFP-tagged variant, both under the transcriptional control of Cauliflower mosaic virus 35 S promoter. We demonstrated that these cDNA clones were infectious in grapevines and Nicotiana benthamiana through fluorescence microscopy, RT-PCR, Western blotting and immuno electron microscopy. Interestingly, GRSPaV does not cause systemic infection in four of the most commonly used herbaceous plants, even in the presence of the movement proteins of two other viruses which are known to complement numerous movement-defective viruses. These infectious clones are the first of members of Foveavirus which would allow further investigations into mechanisms governing different aspects of replication for GRSPaV and perhaps related viruses.

Construction and application of a bovine immune-endocrine cDNA microarray.

Science.gov (United States)

Tao, Wenjing; Mallard, Bonnie; Karrow, Niel; Bridle, Byram

2004-09-01

A variety of commercial DNA arrays specific for humans and rodents are widely available; however, microarrays containing well-characterized genes to study pathway-specific gene expression are not as accessible for domestic animals, such as cattle, sheep and pigs. Therefore, a small-scale application-targeted bovine immune-endocrine cDNA array was developed to evaluate genetic pathways involved in the immune-endocrine axis of cattle during periods of altered homeostasis provoked by physiological or environmental stressors, such as infection, vaccination or disease. For this purpose, 167 cDNA sequences corresponding to immune, endocrine and inflammatory response genes were collected and categorized. Positive controls included 5 housekeeping genes (glyceraldehydes-3-phosphate dehydrogenase, hypoxanthine phosphoribosyltransferase, ribosomal protein L19, beta-actin, beta2-microglobulin) and bovine genomic DNA. Negative controls were a bacterial gene (Rhodococcus equi 17-kDa virulence-associated protein) and a partial sequence of the plasmid pACYC177. In addition, RNA extracted from un-stimulated, as well as superantigen (Staphylococcus aureus enterotoxin-A, S. aureus Cowan Pansorbin Cells) and mitogen-stimulated (LPS, ConA) bovine blood leukocytes was mixed, reverse transcribed and PCR amplified using gene-specific primers. The endocrine-associated genes were amplified from cDNA derived from un-stimulated bovine hypothalamus, pituitary, adrenal and thyroid gland tissues. The array was constructed in 4 repeating grids of 180 duplicated spots by coupling the PCR amplified 213-630 bp gene fragments onto poly-l-lysine coated glass slides. The bovine immune-endocrine arrays were standardized and preliminary gene expression profiles generated using Cy3 and Cy5 labelled cDNA from un-stimulated and ConA (5 microg/ml) stimulated PBMC of 4 healthy Holstein cows (2-4 replicate arrays/cow) in a time course study. Mononuclear cell-derived cytokine and chemokine (IL-2, IL-1alpha

cDNA sequences of two inducible T-cell genes

Energy Technology Data Exchange (ETDEWEB)

Kwon, B.S. (Indiana Univ. School of Medicine, Indianapolis (USA) Guthrie Research Institute, Sayre, PA (USA)); Weissman, S.M. (Yale Univ., New Haven, CT (USA))

1989-03-01

The authors have previously described a set of human T-lymphocyte-specific cDNA clones isolated by a modified differential screening procedure. Apparent full-length cDNAs containing the sequences of 14 of the 16 initial isolates were sequenced and were found to represent five different species of mRNA; three of the five species were identical to previously reported cDNA sequences of preproenkephalin, T-cell-replacing factor, and a serine esterase, respectively. The other two species, 4-1BB and L2G25B, were inducible sequences found in mRNA from both a cytolytic T-lymphocyte and a helper T-lymphocyte clone and were not previously described in T-cell mRNA; these mRNA sequences encode peptides of 256 and 92 amino acids, respectively. Both peptides contain putative leader sequences. The protein encoded by 4-1BB also has a potential membrane anchor segment and other features also seen in known receptor proteins.

Multiplex cDNA quantification method that facilitates the standardization of gene expression data

Science.gov (United States)

Gotoh, Osamu; Murakami, Yasufumi; Suyama, Akira

2011-01-01

Microarray-based gene expression measurement is one of the major methods for transcriptome analysis. However, current microarray data are substantially affected by microarray platforms and RNA references because of the microarray method can provide merely the relative amounts of gene expression levels. Therefore, valid comparisons of the microarray data require standardized platforms, internal and/or external controls and complicated normalizations. These requirements impose limitations on the extensive comparison of gene expression data. Here, we report an effective approach to removing the unfavorable limitations by measuring the absolute amounts of gene expression levels on common DNA microarrays. We have developed a multiplex cDNA quantification method called GEP-DEAN (Gene expression profiling by DCN-encoding-based analysis). The method was validated by using chemically synthesized DNA strands of known quantities and cDNA samples prepared from mouse liver, demonstrating that the absolute amounts of cDNA strands were successfully measured with a sensitivity of 18 zmol in a highly multiplexed manner in 7 h. PMID:21415008

cDNA cloning, sequence analysis, and chromosomal localization of the gene for human carnitine palmitoyltransferase

International Nuclear Information System (INIS)

Finocchiaro, G.; Taroni, F.; Martin, A.L.; Colombo, I.; Tarelli, G.T.; DiDonato, S.; Rocchi, M.

1991-01-01

The authors have cloned and sequenced a cDNA encoding human liver carnitine palmitoyltransferase an inner mitochondrial membrane enzyme that plays a major role in the fatty acid oxidation pathway. Mixed oligonucleotide primers whose sequences were deduced from one tryptic peptide obtained from purified CPTase were used in a polymerase chain reaction, allowing the amplification of a 0.12-kilobase fragment of human genomic DNA encoding such a peptide. A 60-base-pair (bp) oligonucleotide synthesized on the basis of the sequence from this fragment was used for the screening of a cDNA library from human liver and hybridized to a cDNA insert of 2255 bp. This cDNA contains an open reading frame of 1974 bp that encodes a protein of 658 amino acid residues including 25 residues of an NH 2 -terminal leader peptide. The assignment of this open reading frame to human liver CPTase is confirmed by matches to seven different amino acid sequences of tryptic peptides derived from pure human CPTase and by the 82.2% homology with the amino acid sequence of rat CPTase. The NH 2 -terminal region of CPTase contains a leucine-proline motif that is shared by carnitine acetyl- and octanoyltransferases and by choline acetyltransferase. The gene encoding CPTase was assigned to human chromosome 1, region 1q12-1pter, by hybridization of CPTase cDNA with a DNA panel of 19 human-hanster somatic cell hybrids

Relief of autoinhibition by conformational switch explains enzyme activation by a catalytically dead paralog

Energy Technology Data Exchange (ETDEWEB)

Volkov, Oleg A.; Kinch, Lisa; Ariagno, Carson; Deng, Xiaoyi; Zhong, Shihua; Grishin, Nick; Tomchick, Diana R.; Chen, Zhe; Phillips, Margaret A.

2016-12-15

Catalytically inactive enzyme paralogs occur in many genomes. Some regulate their active counterparts but the structural principles of this regulation remain largely unknown. We report X-ray structures ofTrypanosoma brucei S-adenosylmethionine decarboxylase alone and in functional complex with its catalytically dead paralogous partner, prozyme. We show monomericTbAdoMetDC is inactive because of autoinhibition by its N-terminal sequence. Heterodimerization with prozyme displaces this sequence from the active site through a complex mechanism involving acis-to-transproline isomerization, reorganization of a β-sheet, and insertion of the N-terminal α-helix into the heterodimer interface, leading to enzyme activation. We propose that the evolution of this intricate regulatory mechanism was facilitated by the acquisition of the dimerization domain, a single step that can in principle account for the divergence of regulatory schemes in the AdoMetDC enzyme family. These studies elucidate an allosteric mechanism in an enzyme and a plausible scheme by which such complex cooperativity evolved.

Study of pyruvate decarboxylase and thiamine kinase from brewer's yeast by SERS

Science.gov (United States)

Maskevich, Sergei A.; Chernikevich, Ivan P.; Gachko, Gennedy A.; Kivach, Leonid N.; Strekal, Nataliya D.

1993-06-01

The Surface Enhanced Raman Scattering (SERS) spectra of holopyruvate decarboxylase (PDC) and thiamine kinase (ThK) adsorbed on silver electrode were obtained. In contrast to the Raman, the SERS spectrum of PDC contained no modes of tryptophan residues, it indicates a removal of this moiety from the surface. In the SERS spectrum of ThK the bands belonging to ligands bound to the protein were observed. A correlation between the SERS signal intensity and the enzymatic activity of the ThK separate fraction and found. The influence of amino acids on SERS spectra of thiamine (Th) was studied to determine the possible composition on microsurrounding of coenzyme.

Full-length cDNA sequences from Rhesus monkey placenta tissue: analysis and utility for comparative mapping

Directory of Open Access Journals (Sweden)

Lee Sang-Rae

2010-07-01

Full Text Available Abstract Background Rhesus monkeys (Macaca mulatta are widely-used as experimental animals in biomedical research and are closely related to other laboratory macaques, such as cynomolgus monkeys (Macaca fascicularis, and to humans, sharing a last common ancestor from about 25 million years ago. Although rhesus monkeys have been studied extensively under field and laboratory conditions, research has been limited by the lack of genetic resources. The present study generated placenta full-length cDNA libraries, characterized the resulting expressed sequence tags, and described their utility for comparative mapping with human RefSeq mRNA transcripts. Results From rhesus monkey placenta full-length cDNA libraries, 2000 full-length cDNA sequences were determined and 1835 rhesus placenta cDNA sequences longer than 100 bp were collected. These sequences were annotated based on homology to human genes. Homology search against human RefSeq mRNAs revealed that our collection included the sequences of 1462 putative rhesus monkey genes. Moreover, we identified 207 genes containing exon alterations in the coding region and the untranslated region of rhesus monkey transcripts, despite the highly conserved structure of the coding regions. Approximately 10% (187 of all full-length cDNA sequences did not represent any public human RefSeq mRNAs. Intriguingly, two rhesus monkey specific exons derived from the transposable elements of AluYRa2 (SINE family and MER11B (LTR family were also identified. Conclusion The 1835 rhesus monkey placenta full-length cDNA sequences described here could expand genomic resources and information of rhesus monkeys. This increased genomic information will greatly contribute to the development of evolutionary biology and biomedical research.

Cloning of soluble alkaline phosphatase cDNA and molecular basis of the polymorphic nature in alkaline phosphatase isozymes of Bombyx mori midgut.

Science.gov (United States)

Itoh, M; Kanamori, Y; Takao, M; Eguchi, M

1999-02-01

A cDNA coding for soluble type alkaline phosphatase (sALP) of Bombyx mori was isolated. Deduced amino acid sequence showed high identities to various ALPs and partial similarities to ATPase of Manduca sexta. Using this cDNA sequence as a probe, the molecular basis of electrophoretic polymorphism in sALP and membrane-bound type ALP (mALP) was studied. As for mALP, the result suggested that post-translational modification was important for the proteins to express activity and to represent their extensive polymorphic nature, whereas the magnitude of activities was mainly regulated by transcription. On the other hand, sALP zymogram showed poor polymorphism, but one exception was the null mutant, in which the sALP gene was largely lost. Interestingly, the sALP gene was shown to be transcribed into two mRNAs of different sizes, 2.0 and 2.4 Kb. In addition to the null mutant of sALP, we found a null mutant for mALP. Both of these mutants seem phenotypically silent, suggesting that the functional differentiation between these isozymes is not perfect, so that they can still work mutually and complement each other as an indispensable enzyme for B. mori.

Isolation and characterization of a cDNA encoding (S)-cis-N-methylstylopine 14-hydroxylase from opium poppy, a key enzyme in sanguinarine biosynthesis.

Science.gov (United States)

Beaudoin, Guillaume A W; Facchini, Peter J

2013-02-15

Sanguinarine is a benzo[c]phenenthridine alkaloid with potent antimicrobial properties found commonly in plants of the Papaveraceae, including the roots of opium poppy (Papaver somniferum). Sanguinarine is formed from the central 1-benzylisoquinoline intermediate (S)-reticuline via the protoberberine alkaloid (S)-scoulerine, which undergoes five enzymatic oxidations and an N-methylation. The first four oxidations from (S)-scoulerine are catalyzed by cytochromes P450, whereas the final conversion involves a flavoprotein oxidase. All but one gene in the biosynthetic pathway from (S)-reticuline to sanguinarine has been identified. In this communication, we report the isolation and characterization of (S)-cis-N-methylstylopine 14-hydroxylase (MSH) from opium poppy based on the transcriptional induction in elicitor-treated cell suspension cultures and root-specific expression of the corresponding gene. Along with protopine 6-hydroxylase, which catalyzes the subsequent and penultimate step in sanguinarine biosynthesis, MSH is a member of the CYP82N subfamily of cytochromes P450. The full-length MSH cDNA was expressed in Saccharomyces cerevisiae and the recombinant microsomal protein was tested for enzymatic activity using 25 benzylisoquinoline alkaloids representing a wide range of structural subgroups. The only enzymatic substrates were the N-methylated protoberberine alkaloids N-methylstylopine and N-methylcanadine, which were converted to protopine and allocryptopine, respectively. Copyright © 2013. Published by Elsevier Inc.

Influence of ornithine decarboxylase antizymes and antizyme inhibitors on agmatine uptake by mammalian cells.

Science.gov (United States)

Ramos-Molina, Bruno; López-Contreras, Andrés J; Lambertos, Ana; Dardonville, Christophe; Cremades, Asunción; Peñafiel, Rafael

2015-05-01

Agmatine (4-aminobutylguanidine), a dicationic molecule at physiological pH, exerts relevant modulatory actions at many different molecular target sites in mammalian cells, having been suggested that the administration of this compound may have therapeutic interest. Several plasma membrane transporters have been implicated in agmatine uptake by mammalian cells. Here we report that in kidney-derived COS-7 cell line, at physiological agmatine levels, the general polyamine transporter participates in the plasma membrane translocation of agmatine, with an apparent Km of 44 ± 7 µM and Vmax of 17.3 ± 3.3 nmol h(-1) mg(-1) protein, but that at elevated concentrations, agmatine can be also taken up by other transport systems. In the first case, the physiological polyamines (putrescine, spermidine and spermine), several diguanidines and bis(2-aminoimidazolines) and the polyamine transport inhibitor AMXT-1501 markedly decreased agmatine uptake. In cells transfected with any of the three ornithine decarboxylase antizymes (AZ1, AZ2 and AZ3), agmatine uptake was dramatically reduced. On the contrary, transfection with antizyme inhibitors (AZIN1 and AZIN2) markedly increased the transport of agmatine. Furthermore, whereas putrescine uptake was significantly decreased in cells transfected with ornithine decarboxylase (ODC), the accumulation of agmatine was stimulated, suggesting a trans-activating effect of intracellular putrescine on agmatine uptake. All these results indicate that ODC and its regulatory proteins (antizymes and antizyme inhibitors) may influence agmatine homeostasis in mammalian tissues.

Characterization of the cDNA encoding human nucleophosmin and studies of its role in normal and abnormal growth

International Nuclear Information System (INIS)

Chan, Waiyee; Liu, Qingrong; Borjigin, J.; Busch, H.; Rennert, O.M.; Tease, L.A.; Chan, Puikwong

1989-01-01

A cDNA encoding human nucleophosmin (protein B23) was obtained by screening a human placental cDNA library in δgtll first with monoclonal antibody to rat nucleophosmin and then with confirmed partial cDNA of human nucleophosmin as probes. The cDNA had 1,311 bp with a coding sequence encoding a protein of 294 amino acids. The identity of the cDNA was confirmed by the presence of encoded amino acid sequences identical with those determined by sequencing pure rat nucleophosmin (a total of 138 amino acids). The most striking feature of the sequence is an acidic cluster located in the middle of the molecule. The cluster consists of 26 Asp/Glu and 1 Phe and Ala. Comparison of human nucleophosmin and Xenopus nucleolar protein NO38 shows 64.3% sequence identity. The N-terminal 130 amino acids of human nucleophosmin also bear 50% identity with that of Xenopus nucleoplasmin. Northern blot analysis of rat liver total RNA with a partial nucleophosmin cDNA as probe demonstrated a homogeneous mRNA band of about 1.6 kb. Similar observations were made in hypertrophic rat liver and Novikoff hepatoma. When the protein levels were compared with Western blot immunoassays, Navikoff hepatoma showed 20 times more nucleophosmin, while only about 5 times more nucleophosmin was observed in hypertrophic rat liver than in unstimulated normal liver

Characterization and immunological identification of cDNA clones encoding two human DNA topoisomerase II isozymes

International Nuclear Information System (INIS)

Chung, T.D.Y.; Drake, F.H.; Tan, K.B.; Per, S.R.; Crooke, S.T.; Mirabelli, C.K.

1989-01-01

Several DNA topoisomerase II partial cDNA clones obtained from a human Raji-HN2 cDNA library were sequenced and two classes of nucleotide sequences were found. One member of the first class, SP1, was identical to an internal fragment of human HeLa cell Topo II cDNA described earlier. A member of the second class, SP11, shared extensive nucleotide (75%) and predicted peptide (92%) sequence similarities with the first two-thirds of HeLa Topo II. Each class of cDNAs hybridized to unique, nonoverlapping restriction enzyme fragments of genomic DNA from several human cell lines. Synthetic 24-mer oligonucleotide probes specific for each cDNA class hybridized to 6.5-kilobase mRNAs; furthermore, hybridization of probe specific for one class was not blocked by probe specific for the other. Antibodies raised against a synthetic SP1-encoded dodecapeptide specifically recognized the 170-kDa form of Topo II, while antibodies raised against the corresponding SP11-encoded dodecapeptide, or a second unique SP11-encoded tridecapeptide, selectively recognized the 180-kDa form of Topo II. These data provide genetic and immunochemical evidence for two Topo II isozymes

Molecular characterization of MHC-DRB cDNA in water buffalo (Bubalus bubalis

Directory of Open Access Journals (Sweden)

Soumen Naskar

2012-01-01

Full Text Available In the present study, water buffalo MHC (Bubu-DRB cDNA was cloned and characterized. The 1022 base long-amplified cDNA product encompassed a single open reading frame of 801 bases that coded for 266 amino acids. The Bubu-DRB sequence showed maximum homology with the BoLA-DRB3*0101 allele of cattle. A total of seven amino acid residues were found to be unique for the Bubu-DRB sequence. The majority of amino acid substitutions was observed in the β1 domain. Residues associated with important functions were mostly conserved. Water buffalo DRB was phylogenetically closer to goat DRB*A.

Primary culture of cat intestinal epithelial cells in vitro and the cDNA library construction.

Science.gov (United States)

Zhao, Gui Hua; Liu, Ye; Cheng, Yun Tang; Zhao, Qing Song; Qiu, Xiao; Xu, Chao; Xiao, Ting; Zhu, Song; Liu, Gong Zhen; Yin, Kun

2018-06-26

Felids are the only definitive hosts of Toxoplasma gondii. To lay a foundation for screening the T. gondii-felids interaction factors, we have developed a reproducible primary culture method for cat intestinal epithelial cells (IECs). The primary IECs were isolated from a new born cat's small intestine jejunum region without food ingress, and respectively in vitro cultured by tissue cultivation and combined digestion method with collagenase XI and dispase I, then purified by trypsinization. After identification, the ds cDNA of cat IECs was synthesized for constructing pGADT7 homogenization three-frame plasmid, and transformed into the yeast Y187 for generating the cDNA library. Our results indicated that cultivation of primary cat IECs relays on combined digestion to form polarized and confluent monolayers within 3 days with typical features of normal epithelial cells. The purified cells cultured by digestion method were identified to be nature intestinal epithelial cells using immunohistochemical analysis and were able to maintain viability for at least 15 passages. The homogenizable ds cDNA, which is synthesized from the total RNA extracted from our cultured IECs, distributed among 0.5-2.0 kb, and generated satisfying three-frame cDNA library with the capacity of 1.2 × 106 and the titer of 5.2 × 107 pfu/mL. Our results established an optimal method for the culturing and passage of cat IECs model in vitro, and laid a cDNA library foundation for the subsequent interaction factors screening by yeast two-hybrid.

An endosymbiont positively modulates ornithine decarboxylase in host trypanosomatids

International Nuclear Information System (INIS)

Frossard, Mariana Lins; Seabra, Sergio Henrique; Matta, Renato Augusto da; Souza, Wanderley de; Garcia de Mello, Fernando; Motta, Maria Cristina Machado

2006-01-01

Summary: Some trypanosomatids, such as Crithidia deanei, are endosymbiont-containing species. Aposymbiotic strains are obtained after antibiotic treatment, revealing interesting aspects of this symbiotic association. Ornithine decarboxylase (ODC) promotes polyamine biosynthesis and contributes to cell proliferation. Here, we show that ODC activity is higher in endosymbiont-bearing trypanosomatids than in aposymbiotic cells, but isolated endosymbionts did not display this enzyme activity. Intriguingly, expressed levels of ODC were similar in both strains, suggesting that ODC is positively modulated in endosymbiont-bearing cells. When the aposymbiotic strain was grown in conditioned medium, obtained after cultivation of the endosymbiont-bearing strain, cellular proliferation as well as ODC activity and localization were similar to that observed in the endosymbiont-containing trypanosomatids. Furthermore, dialyzed-heated medium and trypsin treatment reduced ODC activity of the aposymbiont strain. Taken together, these data indicate that the endosymbiont can enhance the protozoan ODC activity by providing factors of protein nature, which increase the host polyamine metabolism

Cost-effective sequencing of full-length cDNA clones powered by a de novo-reference hybrid assembly.

Science.gov (United States)

Kuroshu, Reginaldo M; Watanabe, Junichi; Sugano, Sumio; Morishita, Shinichi; Suzuki, Yutaka; Kasahara, Masahiro

2010-05-07

Sequencing full-length cDNA clones is important to determine gene structures including alternative splice forms, and provides valuable resources for experimental analyses to reveal the biological functions of coded proteins. However, previous approaches for sequencing cDNA clones were expensive or time-consuming, and therefore, a fast and efficient sequencing approach was demanded. We developed a program, MuSICA 2, that assembles millions of short (36-nucleotide) reads collected from a single flow cell lane of Illumina Genome Analyzer to shotgun-sequence approximately 800 human full-length cDNA clones. MuSICA 2 performs a hybrid assembly in which an external de novo assembler is run first and the result is then improved by reference alignment of shotgun reads. We compared the MuSICA 2 assembly with 200 pooled full-length cDNA clones finished independently by the conventional primer-walking using Sanger sequencers. The exon-intron structure of the coding sequence was correct for more than 95% of the clones with coding sequence annotation when we excluded cDNA clones insufficiently represented in the shotgun library due to PCR failure (42 out of 200 clones excluded), and the nucleotide-level accuracy of coding sequences of those correct clones was over 99.99%. We also applied MuSICA 2 to full-length cDNA clones from Toxoplasma gondii, to confirm that its ability was competent even for non-human species. The entire sequencing and shotgun assembly takes less than 1 week and the consumables cost only approximately US$3 per clone, demonstrating a significant advantage over previous approaches.

cDNA sequence of human transforming gene hst and identification of the coding sequence required for transforming activity

International Nuclear Information System (INIS)

Taira, M.; Yoshida, T.; Miyagawa, K.; Sakamoto, H.; Terada, M.; Sugimura, T.

1987-01-01

The hst gene was originally identified as a transforming gene in DNAs from human stomach cancers and from a noncancerous portion of stomach mucosa by DNA-mediated transfection assay using NIH3T3 cells. cDNA clones of hst were isolated from the cDNA library constructed from poly(A) + RNA of a secondary transformant induced by the DNA from a stomach cancer. The sequence analysis of the hst cDNA revealed the presence of two open reading frames. When this cDNA was inserted into an expression vector containing the simian virus 40 promoter, it efficiently induced the transformation of NIH3T3 cells upon transfection. It was found that one of the reading frames, which coded for 206 amino acids, was responsible for the transforming activity

Altered subcellular localization of ornithine decarboxylase in Alzheimer's disease brain

International Nuclear Information System (INIS)

Nilsson, Tatjana; Bogdanovic, Nenad; Volkman, Inga; Winblad, Bengt; Folkesson, Ronnie; Benedikz, Eirikur

2006-01-01

The amyloid precursor protein can through ligand-mimicking induce expression of ornithine decarboxylase (ODC), the initial and rate-limiting enzyme in polyamine biosynthesis. We report here the regional distribution and cellular localization of ODC immunoreactivity in Alzheimer's disease (AD) brains. In frontal cortex and hippocampus of control cases, the most pronounced ODC immunoreactivity was found in the nucleus. In possible and definite AD the immunoreactivity had shifted to the cytoplasm. In cerebellum of control cases, ODC staining was found in a small portion of Purkinje cells, mostly in the nucleus. In AD, both possible and definite, the number of stained Purkinje cells increased significantly and immunoreactivity was shifted to the cytoplasm, even though it was still prominent in the nucleus. In conclusion, our study reveals an early shift of the ODC immunoreactivity in AD from the nuclear compartment towards the cytoplasm

Agdc1p – a Gallic Acid Decarboxylase Involved in the Degradation of Tannic Acid in the Yeast Blastobotrys (Arxula adeninivorans

Directory of Open Access Journals (Sweden)

Anna K. Meier

2017-09-01

Full Text Available Tannins and hydroxylated aromatic acids, such as gallic acid (3,4,5-trihydroxybenzoic acid, are plant secondary metabolites which protect plants against herbivores and plant-associated microorganisms. Some microbes, such as the yeast Arxula adeninivorans are resistant to these antimicrobial substances and are able to use tannins and gallic acid as carbon sources. In this study, the Arxula gallic acid decarboxylase (Agdc1p which degrades gallic acid to pyrogallol was characterized and its function in tannin catabolism analyzed. The enzyme has a higher affinity for gallic acid (Km −0.7 ± 0.2 mM, kcat −42.0 ± 8.2 s−1 than to protocatechuic acid (3,4-dihydroxybenzoic acid (Km −3.2 ± 0.2 mM, kcat −44.0 ± 3.2 s−1. Other hydroxylated aromatic acids, such as 3-hydroxybenzoic acid, 4-hydroxybenzoic acid, 2,3-dihydroxybenzoic acid, 2,4-dihydroxybenzoic acid and 2,5-dihydroxybenzoic acid are not gallic acid decarboxylase substrates. A. adeninivorans G1212/YRC102-AYNI1-AGDC1, which expresses the AGDC1 gene under the control of the strong nitrate inducible AYNI1 promoter achieved a maximum gallic acid decarboxylase activity of 1064.4 U/l and 97.5 U/g of dry cell weight in yeast grown in minimal medium with nitrate as nitrogen source and glucose as carbon source. In the same medium, gallic acid decarboxylase activity was not detected for the control strain G1212/YRC102 with AGDC1 expression under the control of the endogenous promoter. Gene expression analysis showed that AGDC1 is induced by gallic acid and protocatechuic acid. In contrast to G1212/YRC102-AYNI1-AGDC1 and G1212/YRC102, A. adeninivorans G1234 [Δagdc1] is not able to grow on medium with gallic acid as carbon source but can grow in presence of protocatechuic acid. This confirms that Agdc1p plays an essential role in the tannic acid catabolism and could be useful in the production of catechol and cis,cis-muconic acid. However, the protocatechuic acid catabolism via Agdc1p to

Agdc1p – a Gallic Acid Decarboxylase Involved in the Degradation of Tannic Acid in the Yeast Blastobotrys (Arxula) adeninivorans

Science.gov (United States)

Meier, Anna K.; Worch, Sebastian; Böer, Erik; Hartmann, Anja; Mascher, Martin; Marzec, Marek; Scholz, Uwe; Riechen, Jan; Baronian, Kim; Schauer, Frieder; Bode, Rüdiger; Kunze, Gotthard

2017-01-01

Tannins and hydroxylated aromatic acids, such as gallic acid (3,4,5-trihydroxybenzoic acid), are plant secondary metabolites which protect plants against herbivores and plant-associated microorganisms. Some microbes, such as the yeast Arxula adeninivorans are resistant to these antimicrobial substances and are able to use tannins and gallic acid as carbon sources. In this study, the Arxula gallic acid decarboxylase (Agdc1p) which degrades gallic acid to pyrogallol was characterized and its function in tannin catabolism analyzed. The enzyme has a higher affinity for gallic acid (Km −0.7 ± 0.2 mM, kcat −42.0 ± 8.2 s−1) than to protocatechuic acid (3,4-dihydroxybenzoic acid) (Km −3.2 ± 0.2 mM, kcat −44.0 ± 3.2 s−1). Other hydroxylated aromatic acids, such as 3-hydroxybenzoic acid, 4-hydroxybenzoic acid, 2,3-dihydroxybenzoic acid, 2,4-dihydroxybenzoic acid and 2,5-dihydroxybenzoic acid are not gallic acid decarboxylase substrates. A. adeninivorans G1212/YRC102-AYNI1-AGDC1, which expresses the AGDC1 gene under the control of the strong nitrate inducible AYNI1 promoter achieved a maximum gallic acid decarboxylase activity of 1064.4 U/l and 97.5 U/g of dry cell weight in yeast grown in minimal medium with nitrate as nitrogen source and glucose as carbon source. In the same medium, gallic acid decarboxylase activity was not detected for the control strain G1212/YRC102 with AGDC1 expression under the control of the endogenous promoter. Gene expression analysis showed that AGDC1 is induced by gallic acid and protocatechuic acid. In contrast to G1212/YRC102-AYNI1-AGDC1 and G1212/YRC102, A. adeninivorans G1234 [Δagdc1] is not able to grow on medium with gallic acid as carbon source but can grow in presence of protocatechuic acid. This confirms that Agdc1p plays an essential role in the tannic acid catabolism and could be useful in the production of catechol and cis,cis-muconic acid. However, the protocatechuic acid catabolism via Agdc1p to catechol seems to be

Local anesthetics inhibit induction of ornithine decarboxylase by the tumor promoter 12-O-tetradecanoylphorbol 13-acetate.

OpenAIRE

Yuspa, S H; Lichti, U; Ben, T

1980-01-01

The induction of ornithine decarboxylase (L-ornithine carboxy-lyase, EC 4.1.1.17) activity in mouse epidermal cells in vivo and in vitro occurs rapidly after exposure to the tumor promoter 12-O-tetradecanoylphorbol 13-acetate (TPA). This induction has characteristics of a cell surface receptor-mediated process. Local anesthetics modify a variety of cellular responses mediated by membrane receptors. When cultured mouse epidermal cells were exposed to the local anesthetics lidocaine, tetracaine...

MOLECULAR CHARACTERIZATION OF ENDOCRINE DISRUPTION IN FISH USING CDNA ARRAYS.

Science.gov (United States)

We are developing cDNA macroarrays to measure the induction of gene expression in sheepshead minnows and largemouth bass exposed to anthropogenic chemicals that can mimic the action of endogenous hormones. For sheepshead minnows exposed in aqua, we observed similar genetic profil...

Transcription analysis of apple fruit development using cDNA microarrays

NARCIS (Netherlands)

Soglio, V.; Costa, F.; Molthoff, J.W.; Weemen-Hendriks, M.; Schouten, H.J.; Gianfranceschi, L.

2009-01-01

The knowledge of the molecular mechanisms underlying fruit quality traits is fundamental to devise efficient marker-assisted selection strategies and to improve apple breeding. In this study, cDNA microarray technology was used to identify genes whose expression changes during fruit development and

Isolation and characterization of the cDNA for cystic fibrosis antigen

Energy Technology Data Exchange (ETDEWEB)

Dorin, J R

1987-01-01

Cystic fibrosis antigen (CFAg) is a protein which is present in the serum of cystic fibrosis (CF) patients and clinically normal heterozygotes, but not in normal individuals. CFAg has been shown to be a major granulocyte protein in normals, and the gene mapped to chromosome 1. This thesis describes the molecular cloning and subsequent characterization of the cDNA for CFAg. The availability of monoclonal antibodies to CFAg facilitated the identification of myeloid tissues which were actively synthesizing the protein. A specific radiolabeled protein could be immunoprecipitated from /sup 35/S-methionine labelled extracts of chronic myeloid leukemia cells (CML), normal granulocytes and HL-60 cells differentiated towards granulocytes. In CML and granulocytes, CFAg appeared to be one of the most abundantly synthesized proteins.

Isolation and expression of a pea vicilin cDNA in the yeast Saccharomyces cerevisiae.

OpenAIRE

Watson, M D; Lambert, N; Delauney, A; Yarwood, J N; Croy, R R; Gatehouse, J A; Wright, D J; Boulter, D

1988-01-01

A cDNA clone containing the complete coding sequence for vicilin from pea (Pisum sativum L.) was isolated. It specifies a 50,000-Mr protein that in pea is neither post-translationally processed nor glycosylated. The cDNA clone was expressed in yeast from a 2 micron plasmid by using the yeast phosphoglycerate kinase promoter and initiator codon. The resultant fusion protein, which contains the first 16 amino acid residues of phosphoglycerate kinase in addition to the vicilin sequence, was puri...

L-DOPA decarboxylase mRNA expression is associated with tumor stage and size in head and neck squamous cell carcinoma: a retrospective cohort study

Directory of Open Access Journals (Sweden)

Geomela Panagiota-Aikaterini

2012-10-01

Full Text Available Abstract Background Head and neck squamous cell carcinoma (HNSCC represents one of the most commonly diagnosed malignancies worldwide. The DDC gene encodes L-DOPA decarboxylase, an enzyme catalyzing the decarboxylation of L-DOPA to dopamine. We have recently shown that DDC mRNA is a significant predictor of patients’ prognosis in colorectal adenocarcinoma and prostate cancer. The aim of the current study was to analyze the DDC mRNA expression in HNSCC patients. Methods 53 malignant tumors were resected from the larynx, pharynx, tongue, buccal mucosa, parotid glands, and nasal cavity, as well as from 34 adjacent non-cancerous tissues of HNSCC patients, and were homogenized. Total RNA was isolated and converted into first-strand cDNA. An ultrasensitive real-time PCR method based on the SYBR Green chemistry was used for DDC mRNA quantification in head and neck tissue specimens. Relative quantification was performed using the comparative Ct (2-ddCt method. Results DDC mRNA levels were lower in squamous cell carcinomas (SCCs of the larynx and tongue than in adjacent non-cancerous tissue specimens. Furthermore, low DDC mRNA expression was noticed in laryngeal and tongue tumors of advanced TNM stage or bigger size, compared to early-stage or smaller tumors, respectively. No statistically significant differences were observed between SCCs resected from pharynx, buccal mucosa, or nasal cavity, and their normal counterparts. Conclusion This is the first study examining the DDC mRNA expression in HNSCC. According to our results, DDC mRNA expression may constitute a potential prognostic biomarker in tongue and/or larynx SCCs, which principally represent the overwhelming majority of HNSCC cases.

L-DOPA decarboxylase mRNA expression is associated with tumor stage and size in head and neck squamous cell carcinoma: a retrospective cohort study

International Nuclear Information System (INIS)

Geomela, Panagiota-Aikaterini; Kontos, Christos K; Yiotakis, Ioannis; Fragoulis, Emmanuel G; Scorilas, Andreas

2012-01-01

Head and neck squamous cell carcinoma (HNSCC) represents one of the most commonly diagnosed malignancies worldwide. The DDC gene encodes L-DOPA decarboxylase, an enzyme catalyzing the decarboxylation of L-DOPA to dopamine. We have recently shown that DDC mRNA is a significant predictor of patients’ prognosis in colorectal adenocarcinoma and prostate cancer. The aim of the current study was to analyze the DDC mRNA expression in HNSCC patients. 53 malignant tumors were resected from the larynx, pharynx, tongue, buccal mucosa, parotid glands, and nasal cavity, as well as from 34 adjacent non-cancerous tissues of HNSCC patients, and were homogenized. Total RNA was isolated and converted into first-strand cDNA. An ultrasensitive real-time PCR method based on the SYBR Green chemistry was used for DDC mRNA quantification in head and neck tissue specimens. Relative quantification was performed using the comparative Ct (2 -ddCt ) method. DDC mRNA levels were lower in squamous cell carcinomas (SCCs) of the larynx and tongue than in adjacent non-cancerous tissue specimens. Furthermore, low DDC mRNA expression was noticed in laryngeal and tongue tumors of advanced TNM stage or bigger size, compared to early-stage or smaller tumors, respectively. No statistically significant differences were observed between SCCs resected from pharynx, buccal mucosa, or nasal cavity, and their normal counterparts. This is the first study examining the DDC mRNA expression in HNSCC. According to our results, DDC mRNA expression may constitute a potential prognostic biomarker in tongue and/or larynx SCCs, which principally represent the overwhelming majority of HNSCC cases

DOPA Decarboxylase Modulates Tau Toxicity.

Science.gov (United States)

Kow, Rebecca L; Sikkema, Carl; Wheeler, Jeanna M; Wilkinson, Charles W; Kraemer, Brian C

2018-03-01

The microtubule-associated protein tau accumulates into toxic aggregates in multiple neurodegenerative diseases. We found previously that loss of D 2 -family dopamine receptors ameliorated tauopathy in multiple models including a Caenorhabditis elegans model of tauopathy. To better understand how loss of D 2 -family dopamine receptors can ameliorate tau toxicity, we screened a collection of C. elegans mutations in dopamine-related genes (n = 45) for changes in tau transgene-induced behavioral defects. These included many genes responsible for dopamine synthesis, metabolism, and signaling downstream of the D 2 receptors. We identified one dopamine synthesis gene, DOPA decarboxylase (DDC), as a suppressor of tau toxicity in tau transgenic worms. Loss of the C. elegans DDC gene, bas-1, ameliorated the behavioral deficits of tau transgenic worms, reduced phosphorylated and detergent-insoluble tau accumulation, and reduced tau-mediated neuron loss. Loss of function in other genes in the dopamine and serotonin synthesis pathways did not alter tau-induced toxicity; however, their function is required for the suppression of tau toxicity by bas-1. Additional loss of D 2 -family dopamine receptors did not synergize with bas-1 suppression of tauopathy phenotypes. Loss of the DDC bas-1 reduced tau-induced toxicity in a C. elegans model of tauopathy, while loss of no other dopamine or serotonin synthesis genes tested had this effect. Because loss of activity upstream of DDC could reduce suppression of tau by DDC, this suggests the possibility that loss of DDC suppresses tau via the combined accumulation of dopamine precursor levodopa and serotonin precursor 5-hydroxytryptophan. Published by Elsevier Inc.

ISOLASI cDNA SUCROSE TRANSPORTER (SUT DARI BATANG TANAMAN TEBU (Saccharum officinarum L.

Directory of Open Access Journals (Sweden)

- Slameto

2010-09-01

Full Text Available Sucrose Transporter (SUT is kind of protein transporter that control in sucrose translocation. Sucrose Transporter is intermediate in translocation of sucrose from apoplasmic to simplasmic. SUT facilitates sucrose transportation from vascular tissues to parenchyma cells toward in node sugarcane stem. This research was purposed to isolate cDNA SUT from sugarcane stem, and cloned in Escherichia coli strain DH5α. Total RNA of sugarcane stem was isolated by single step method, then add with oligo dT in order to obtain the first strand of SUT cDNA then used as template for PCR. The primer used for PCR is 5’ –ggg ctg att gtg gcc atg tc- ‘3 (SUT-F and 5’ –tgc cct ttg tct ccg gaa cc- ‘3 (SUT-R. PCR was programmed as follow denaturation at 94°C for 2 minutes and 30 second, annealing at 54°C for 30 s, extension at 72°C 2 min and 7 min, and storage at 4°C for unlimited, It was for 30 cycles. Complementary DNA SUT from PCR ligalized to pTOPO bunt-end, then it cloned in to E. coli strain DH5α. The cloning resulted then be sequenced in order to observe the homologues with other nucleotides sequences of some plant using BLASTn program in GENE BANK NCBI and the level of homology determined by Genetyx program. The concentrated of total RNA isolated was 5,024 μg/μl, with purity of 1,85. Complementary DNA SUT fragment from PCR with size 2037 bp appropriated to the both of primer was used. Complementary DNA SUT fragment showed by analyzed some of restriction enzyme e.g. EcoRI, PstI and BamHI. Homologues of this cDNA SUT fragment was 100% to SoSUT 2A of sugarcane stem and 84% to OsSUT of rice plant (Casu et al ., 2003.

Complete cDNA sequence coding for human docking protein

Energy Technology Data Exchange (ETDEWEB)

Hortsch, M; Labeit, S; Meyer, D I

1988-01-11

Docking protein (DP, or SRP receptor) is a rough endoplasmic reticulum (ER)-associated protein essential for the targeting and translocation of nascent polypeptides across this membrane. It specifically interacts with a cytoplasmic ribonucleoprotein complex, the signal recognition particle (SRP). The nucleotide sequence of cDNA encoding the entire human DP and its deduced amino acid sequence are given.

Cloning and characterization of transferrin cDNA and rapid detection of transferrin gene polymorphism in rainbow trout (Oncorhynchus mykiss).

Science.gov (United States)

Tange, N; Jong-Young, L; Mikawa, N; Hirono, I; Aoki, T

1997-12-01

A cDNA clone of rainbow trout (Oncorhynchus mykiss) transferrin was obtained from a liver cDNA library. The 2537-bp cDNA sequence contained an open reading frame encoding 691 amino acids and the 5' and 3' noncoding regions. The amino acid sequences at the iron-binding sites and the two N-linked glycosylation sites, and the cysteine residues were consistent with known, conserved vertebrate transferrin cDNA sequences. Single N-linked glycosylation sites existed on the N- and C-lobe. The deduced amino acid sequence of the rainbow trout transferrin cDNA had 92.9% identities with transferrin of coho salmon (Oncorhynchus kisutch); 85%, Atlantic salmon (Salmo salar); 67.3%, medaka (Oryzias latipes); 61.3% Atlantic cod (Gadus morhua); and 59.7%, Japanese flounder (Paralichthys olivaceus). The long and accurate polymerase chain reaction (LA-PCR) was used to amplify approximately 6.5 kb of the transferrin gene from rainbow trout genomic DNA. Restriction fragment length polymorphisms (RFLPs) of the LA-PCR products revealed three digestion patterns in 22 samples.

An analysis of expressed sequence tags of developing castor endosperm using a full-length cDNA library

Directory of Open Access Journals (Sweden)

Wallis James G

2007-07-01

Full Text Available Abstract Background Castor seeds are a major source for ricinoleate, an important industrial raw material. Genomics studies of castor plant will provide critical information for understanding seed metabolism, for effectively engineering ricinoleate production in transgenic oilseeds, or for genetically improving castor plants by eliminating toxic and allergic proteins in seeds. Results Full-length cDNAs are useful resources in annotating genes and in providing functional analysis of genes and their products. We constructed a full-length cDNA library from developing castor endosperm, and obtained 4,720 ESTs from 5'-ends of the cDNA clones representing 1,908 unique sequences. The most abundant transcripts are genes encoding storage proteins, ricin, agglutinin and oleosins. Several other sequences are also very numerous, including two acidic triacylglycerol lipases, and the oleate hydroxylase (FAH12 gene that is responsible for ricinoleate biosynthesis. The role(s of the lipases in developing castor seeds are not clear, and co-expressing of a lipase and the FAH12 did not result in significant changes in hydroxy fatty acid accumulation in transgenic Arabidopsis seeds. Only one oleate desaturase (FAD2 gene was identified in our cDNA sequences. Sequence and functional analyses of the castor FAD2 were carried out since it had not been characterized previously. Overexpression of castor FAD2 in a FAH12-expressing Arabidopsis line resulted in decreased accumulation of hydroxy fatty acids in transgenic seeds. Conclusion Our results suggest that transcriptional regulation of FAD2 and FAH12 genes maybe one of the mechanisms that contribute to a high level of ricinoleate accumulation in castor endosperm. The full-length cDNA library will be used to search for additional genes that affect ricinoleate accumulation in seed oils. Our EST sequences will also be useful to annotate the castor genome, which whole sequence is being generated by shotgun sequencing at

Fiscal 1998 achievement report. Industrial technology research and development project. (Strategic human cDNA genome application technology development); 1998 nendo senryakuteki hito cDNA genome oyo gijutsu kaihatsu seika hokokusho

Energy Technology Data Exchange (ETDEWEB)

NONE

2000-03-01

A human genome related project named above was started, and studies were conducted for base sequence determination and function analysis for approximately 10,000 kinds of full-length or long-chain human cDNA clones owned by research organizations in this country. The Institute of Medical Science of University of Tokyo and Helix Research Institute dealt with a full-length human cDNA library constructed by oligo-capping, and determined the base sequences of all specimens in the library. The Kazusa DNA Research Institute determined partial sequences for long-chain clones which are not shorter than 4-5kbp, and determined entire sequences for some bases. The obtained base sequence data were subjected to homology analysis, the base sequences were converted into amino acid sequences, and functions of proteins were predicted. In the analysis of gene functions, ATAC-PCR (adaptor tagged competitive-polymerase chain reaction) was applied to the clones covered by this project, and a database was prepared by use of the results of analyses of frequency-related information. For the preparation of a comprehensive gene expression profile, technologies for cDNA microarray construction were established. (NEDO)

Isolation of an insulin-like growth factor II cDNA with a unique 5' untranslated region from human placenta

International Nuclear Information System (INIS)

Shen, Shujane; Daimon, Makoto; Wang, Chunyeh; Ilan, J.; Jansen, M.

1988-01-01

Human insulin-like growth factor II (IGF-II) cDNA from a placental library was isolated and sequenced. The 5' untranslated region (5'-UTR) sequence of this cDNA differs completely from that of adult human liver and has considerable base sequence identity to the same region of an IGF-II cDNA of a rat liver cell line, BRL-3A. Human placental poly(A) + RNA was probed with either the 5'-UTR of the isolated human placental IGF-II cDNA or the 5'-UTR of the IGF-II cDNA obtained from adult human liver. No transcripts were detected by using the 5'-UTR of the adult liver IGF-II as the probe. In contrast, three transcripts of 6.0, 3.2, and 2.2 kilobases were detected by using the 5'-UTR of the placental IGF-II cDNA as the probe or the probe from the coding sequence. A fourth IGF-II transcript of 4.9 kilobases presumably containing a 5'-UTR consisting of a base sequence dissimilar to that of either IGF-II 5'-UTR was apparent. Therefore, IGF-II transcripts detected may be products of alternative splicing as their 5'-UTR sequence is contained within the human IGF-II gene or they may be a consequence of alternative promoter utilization in placenta

cDNA sequences of two apolipoproteins from lamprey

International Nuclear Information System (INIS)

Pontes, M.; Xu, X.; Graham, D.; Riley, M.; Doolittle, R.F.

1987-01-01

The messages for two small but abundant apolipoproteins found in lamprey blood plasma were cloned with the aid of oligonucleotide probes based on amino-terminal sequences. In both cases, numerous clones were identified in a lamprey liver cDNA library, consistent with the great abundance of these proteins in lamprey blood. One of the cDNAs (LAL1) has a coding region of 105 amino acids that corresponds to a 21-residue signal peptide, a putative 8-residue propeptide, and the 76-residue mature protein found in blood. The other cDNA (LAL2) codes for a total of 191 residues, the first 23 of which constitute a signal peptide. The two proteins, which occur in the high-density lipoprotein fraction of ultracentrifuged plasma, have amino acid compositions similar to those of apolipoproteins found in mammalian blood; computer analysis indicates that the sequences are largely helix-permissive. When the sequences were searched against an amino acid sequence data base, rat apolipoprotein IV was the best matching candidate in both cases. Although a reasonable alignment can be made with that sequence and LAL1, definitive assignment of the two lamprey proteins to typical mammalian classes cannot be made at this point

Crystallization and preliminary crystallographic analysis of orotidine 5′-monophosphate decarboxylase from the human malaria parasite Plasmodium falciparum

International Nuclear Information System (INIS)

Krungkrai, Sudaratana R.; Tokuoka, Keiji; Kusakari, Yukiko; Inoue, Tsuyoshi; Adachi, Hiroaki; Matsumura, Hiroyoshi; Takano, Kazufumi; Murakami, Satoshi; Mori, Yusuke; Kai, Yasushi; Krungkrai, Jerapan; Horii, Toshihiro

2006-01-01

Orotidine 5′-monophosphate decarboxylase of human malaria parasite P. falciparum was crystallized by the seeding method in a hanging drop using PEG 3000 as a precipitant. A complete set of diffraction data from a native crystal was collected to 2.7 Å resolution at 100 K using synchrotron radiation. Orotidine 5′-monophosphate (OMP) decarboxylase (OMPDC; EC 4.1.1.23) catalyzes the final step in the de novo synthesis of uridine 5′-monophosphate (UMP) and defects in the enzyme are lethal in the malaria parasite Plasmodium falciparum. Active recombinant P. falciparum OMPDC (PfOMPDC) was crystallized by the seeding method in a hanging drop using PEG 3000 as a precipitant. A complete set of diffraction data from a native crystal was collected to 2.7 Å resolution at 100 K using synchrotron radiation at the Swiss Light Source. The crystal exhibits trigonal symmetry (space group R3), with hexagonal unit-cell parameters a = b = 201.81, c = 44.03 Å. With a dimer in the asymmetric unit, the solvent content is 46% (V M = 2.3 Å 3 Da −1 )

Benchmarking of the Oxford Nanopore MinION sequencing for quantitative and qualitative assessment of cDNA populations.

Science.gov (United States)

Oikonomopoulos, Spyros; Wang, Yu Chang; Djambazian, Haig; Badescu, Dunarel; Ragoussis, Jiannis

2016-08-24

To assess the performance of the Oxford Nanopore Technologies MinION sequencing platform, cDNAs from the External RNA Controls Consortium (ERCC) RNA Spike-In mix were sequenced. This mix mimics mammalian mRNA species and consists of 92 polyadenylated transcripts with known concentration. cDNA libraries were generated using a template switching protocol to facilitate the direct comparison between different sequencing platforms. The MinION performance was assessed for its ability to sequence the cDNAs directly with good accuracy in terms of abundance and full length. The abundance of the ERCC cDNA molecules sequenced by MinION agreed with their expected concentration. No length or GC content bias was observed. The majority of cDNAs were sequenced as full length. Additionally, a complex cDNA population derived from a human HEK-293 cell line was sequenced on an Illumina HiSeq 2500, PacBio RS II and ONT MinION platforms. We observed that there was a good agreement in the measured cDNA abundance between PacBio RS II and ONT MinION (rpearson = 0.82, isoforms with length more than 700bp) and between Illumina HiSeq 2500 and ONT MinION (rpearson = 0.75). This indicates that the ONT MinION can sequence quantitatively both long and short full length cDNA molecules.

cDNA and deduced primary structure of basic phospholipase A2 with neurotoxic activity from the venom secretion of the Crotalus durissus collilineatus rattlesnake

Directory of Open Access Journals (Sweden)

F.H.R. Fagundes

2010-03-01

Full Text Available To illustrate the construction of precursor complementary DNAs, we isolated mRNAs from whole venom samples. After reverse transcription polymerase chain reaction (RT-PCR, we amplified the cDNA coding for a neurotoxic protein, phospholipase A2 D49 (PLA2 D49, from the venom of Crotalus durissus collilineatus (Cdc PLA2. The cDNA encoding Cdc PLA2 from whole venom was sequenced. The deduced amino acid sequence of this cDNA has high overall sequence identity with the group II PLA2 protein family. Cdc PLA2 has 14 cysteine residues capable of forming seven disulfide bonds that characterize this group of PLA2 enzymes. Cdc PLA2 was isolated using conventional Sephadex G75 column chromatography and reverse-phase high performance liquid chromatography (RP-HPLC. The molecular mass was estimated using matrix-assisted laser desorption ionization-time-of-flight (MALDI-TOF mass spectrometry. We tested the neuromuscular blocking activities on chick biventer cervicis neuromuscular tissue. Phylogenetic analysis of Cdc PLA2 showed the existence of two lines of N6-PLA2, denominated F24 and S24. Apparently, the sequences of the New World’s N6-F24-PLA2 are similar to those of the agkistrodotoxin from the Asian genus Gloydius. The sequences of N6-S24-PLA2 are similar to the sequence of trimucrotoxin from the genus Protobothrops, found in the Old World.

Isolation and structure of a cDNA encoding the B1 (CD20) cell-surface antigen of human B lymphocytes

International Nuclear Information System (INIS)

Tender, T.F.; Streuli, M.; Schlossman, S.F.; Saito, H.

1988-01-01

The B1 (CD20) molecule is a M/sub r/ 33,000 phosphoprotein on the surface of human B lymphocytes that may serve a central role in the homoral immune response by regulating B-cell proliferation and differentiation. In this report, a cDNA clone that encodes the B1 molecule was isolated and the amino acid sequence of B1 was determined. B-cell-specific cDNA clones were selected from a human tonsillar cDNA library by differential hybridization with labeled cDNA derived from either size-fractionated B-cell mRNA or size-fractionated T-cell mRNA. Of the 261 cDNA clones isolated, 3 cross-hybridizing cDNA clones were chosen as potential candidates for encoding B1 based on their selective hybridization to RNA from B1-positive cell lines. The longest clone, pB1-21, contained a 2.8-kilobase insert with an 891-base-pair open reading frame that encodes a protein of 33 kDa. mRNA synthesized from the pB1-21 cDNA clone in vitro was translated into a protein of the same apparent molecular weight as B1. Limited proteinase digestion of the pB1-21 translation product and B1 generated peptides of the same sizes, indicating that the pB1-21 cDNA encodes the B1 molecule. Gel blot analysis indicated that pB1-21 hybridized with two mRNA species of 2.8 and 3.4 kilobases only in B1-positive cell lines. The amino acid sequence deduced from the pB1-21 nucleotide sequence apparently lacks a signal sequence and contains three extensive hydrophobic regions. The deduced B1 amino acid sequence shows no significant homology with other known patients

A linear concatenation strategy to construct 5'-enriched amplified cDNA libraries using multiple displacement amplification.

Science.gov (United States)

Gadkar, Vijay J; Filion, Martin

2013-06-01

In various experimental systems, limiting available amounts of RNA may prevent a researcher from performing large-scale analyses of gene transcripts. One way to circumvent this is to 'pre-amplify' the starting RNA/cDNA, so that sufficient amounts are available for any downstream analysis. In the present study, we report the development of a novel protocol for constructing amplified cDNA libraries using the Phi29 DNA polymerase based multiple displacement amplification (MDA) system. Using as little as 200 ng of total RNA, we developed a linear concatenation strategy to make the single-stranded cDNA template amenable for MDA. The concatenation, made possible by the template switching property of the reverse transcriptase enzyme, resulted in the amplified cDNA library with intact 5' ends. MDA generated micrograms of template, allowing large-scale polymerase chain reaction analyses or other large-scale downstream applications. As the amplified cDNA library contains intact 5' ends, it is also compatible with 5' RACE analyses of specific gene transcripts. Empirical validation of this protocol is demonstrated on a highly characterized (tomato) and an uncharacterized (corn gromwell) experimental system.

Molecular cloning and expression of cDNA encoding a lumenal calcium binding glycoprotein from sarcoplasmic reticulum

International Nuclear Information System (INIS)

Leberer, E.; Charuk, J.H.M.; MacLennan, D.H.; Green, N.M.

1989-01-01

Antibody screening was used to isolate a cDNA encoding the 160-kDa glycoprotein of rabbit skeletal muscle sarcoplasmic reticulum. The cDNA is identical to that encoding the 53-kDa glycoprotein except that it contains an in-frame insertion of 1,308 nucleotides near its 5' end, apparently resulting from alternative splicing. The protein encoded by the cDNA would contain a 19-residue NH 2 -terminal signal sequence and a 453-residue COOH-terminal sequence identical to the 53-kDa glycoprotein. It would also contain a 436-amino acid insert between these sequences. This insert would be highly acidic, suggesting that it might bind Ca 2+ . The purified 160-kDa glycoprotein and the glycoprotein expressed in COS-1 cells transfected with cDNA encoding the 160-kDa glycoprotein were shown to bind 45 C 2+ in a gel overlay assay. The protein was shown to be located in the lumen of the sarcoplasmic reticulum and to be associated through Ca 2+ with the membrane. The authors propose that this lumenal Ca 2+ binding glycoprotein of the sarcoplasmic reticulum be designated sarcalumenin

A putative peroxidase cDNA from turnip and analysis of the encoded protein sequence.

Science.gov (United States)

Romero-Gómez, S; Duarte-Vázquez, M A; García-Almendárez, B E; Mayorga-Martínez, L; Cervantes-Avilés, O; Regalado, C

2008-12-01

A putative peroxidase cDNA was isolated from turnip roots (Brassica napus L. var. purple top white globe) by reverse transcriptase-polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE). Total RNA extracted from mature turnip roots was used as a template for RT-PCR, using a degenerated primer designed to amplify the highly conserved distal motif of plant peroxidases. The resulting partial sequence was used to design the rest of the specific primers for 5' and 3' RACE. Two cDNA fragments were purified, sequenced, and aligned with the partial sequence from RT-PCR, and a complete overlapping sequence was obtained and labeled as BbPA (Genbank Accession No. AY423440, named as podC). The full length cDNA is 1167bp long and contains a 1077bp open reading frame (ORF) encoding a 358 deduced amino acid peroxidase polypeptide. The putative peroxidase (BnPA) showed a calculated Mr of 34kDa, and isoelectric point (pI) of 4.5, with no significant identity with other reported turnip peroxidases. Sequence alignment showed that only three peroxidases have a significant identity with BnPA namely AtP29a (84%), and AtPA2 (81%) from Arabidopsis thaliana, and HRPA2 (82%) from horseradish (Armoracia rusticana). Work is in progress to clone this gene into an adequate host to study the specific role and possible biotechnological applications of this alternative peroxidase source.

Identification of a cryptic prokaryotic promoter within the cDNA encoding the 5' end of dengue virus RNA genome.

Directory of Open Access Journals (Sweden)

Dongsheng Li

Full Text Available Infectious cDNA clones of RNA viruses are important research tools, but flavivirus cDNA clones have proven difficult to assemble and propagate in bacteria. This has been attributed to genetic instability and/or host cell toxicity, however the mechanism leading to these difficulties has not been fully elucidated. Here we identify and characterize an efficient cryptic bacterial promoter in the cDNA encoding the dengue virus (DENV 5' UTR. Following cryptic transcription in E. coli, protein expression initiated at a conserved in-frame AUG that is downstream from the authentic DENV initiation codon, yielding a DENV polyprotein fragment that was truncated at the N-terminus. A more complete understanding of constitutive viral protein expression in E. coli might help explain the cloning and propagation difficulties generally observed with flavivirus cDNA.

Isolation of CYP3A5P cDNA from human liver: a reflection of a novel cytochrome P-450 pseudogene.

Science.gov (United States)

Schuetz, J D; Guzelian, P S

1995-03-14

We have isolated, from a human liver cDNA library, a 1627 bp CYP3A5 cDNA variant (CYP3A5P) that contains several large insertions, deletions, and in-frame termination codons. By comparison with the genomic structure of other CYP3A genes, the major insertions in CYP3A5P cDNA demarcate the inferred sites of several CYP3A5 exons. The segments inserted in CYP3A5P have no homology with splice donor acceptor sites. It is unlikely that CYP3A5P cDNA represents an artifact of the cloning procedures since Southern blot analysis of human genomic DNA disclosed that CYP3A5P cDNA hybridized with a DNA fragment distinct from fragments that hybridized with either CYP3A5, CYP3A3 or CYP3A4. Moreover, analysis of adult human liver RNA on Northern blots hybridized with a CYP3A5P cDNA fragment revealed the presence of an mRNA with the predicted size of CYP3A5P. We conclude that CYP3A5P cDNA was derived from a separate gene, CYP3A5P, most likely a pseudogene evolved from CYP3A5.

Structural basis of enzymatic activity for the ferulic acid decarboxylase (FADase from Enterobacter sp. Px6-4.

Directory of Open Access Journals (Sweden)

Wen Gu

Full Text Available Microbial ferulic acid decarboxylase (FADase catalyzes the transformation of ferulic acid to 4-hydroxy-3-methoxystyrene (4-vinylguaiacol via non-oxidative decarboxylation. Here we report the crystal structures of the Enterobacter sp. Px6-4 FADase and the enzyme in complex with substrate analogues. Our analyses revealed that FADase possessed a half-opened bottom β-barrel with the catalytic pocket located between the middle of the core β-barrel and the helical bottom. Its structure shared a high degree of similarity with members of the phenolic acid decarboxylase (PAD superfamily. Structural analysis revealed that FADase catalyzed reactions by an "open-closed" mechanism involving a pocket of 8 × 8 × 15 Å dimension on the surface of the enzyme. The active pocket could directly contact the solvent and allow the substrate to enter when induced by substrate analogues. Site-directed mutagenesis showed that the E134A mutation decreased the enzyme activity by more than 60%, and Y21A and Y27A mutations abolished the enzyme activity completely. The combined structural and mutagenesis results suggest that during decarboxylation of ferulic acid by FADase, Trp25 and Tyr27 are required for the entering and proper orientation of the substrate while Glu134 and Asn23 participate in proton transfer.

Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor

International Nuclear Information System (INIS)

Antalis, T.M.; Clark, M.A.; Barnes, T.; Lehrbach, P.R.; Devine, P.L.; Schevzov, G.; Goss, N.H.; Stephens, R.W.; Tolstoshev, P.

1988-01-01

Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A) + RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the λ P/sub L/ promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated M/sub r/ of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators

Dopa decarboxylase (Ddc) affects variation in Drosophila longevity.

Science.gov (United States)

De Luca, Maria; Roshina, Nataliya V; Geiger-Thornsberry, Gretchen L; Lyman, Richard F; Pasyukova, Elena G; Mackay, Trudy F C

2003-08-01

Mutational analyses in model organisms have shown that genes affecting metabolism and stress resistance regulate life span, but the genes responsible for variation in longevity in natural populations are largely unidentified. Previously, we mapped quantitative trait loci (QTLs) affecting variation in longevity between two Drosophila melanogaster strains. Here, we show that the longevity QTL in the 36E;38B cytogenetic interval on chromosome 2 contains multiple closely linked QTLs, including the Dopa decarboxylase (Ddc) locus. Complementation tests to mutations show that Ddc is a positional candidate gene for life span in these strains. Linkage disequilibrium (LD) mapping in a sample of 173 alleles from a single population shows that three common molecular polymorphisms in Ddc account for 15.5% of the genetic contribution to variance in life span from chromosome 2. The polymorphisms are in strong LD, and the effects of the haplotypes on longevity suggest that the polymorphisms are maintained by balancing selection. DDC catalyzes the final step in the synthesis of the neurotransmitters, dopamine and serotonin. Thus, these data implicate variation in the synthesis of bioamines as a factor contributing to natural variation in individual life span.

Construction of C35 gene bait recombinants and T47D cell cDNA library.

Science.gov (United States)

Yin, Kun; Xu, Chao; Zhao, Gui-Hua; Liu, Ye; Xiao, Ting; Zhu, Song; Yan, Ge

2017-11-20

C35 is a novel tumor biomarker associated with metastasis progression. To investigate the interaction factors of C35 in its high expressed breast cancer cell lines, we constructed bait recombinant plasmids of C35 gene and T47D cell cDNA library for yeast two-hybrid screening. Full length C35 sequences were subcloned using RT-PCR from cDNA template extracted from T47D cells. Based on functional domain analysis, the full-length C35 1-348bp was also truncated into two fragments C351-153bp and C35154-348bp to avoid auto-activation. The three kinds of C35 genes were successfully amplified and inserted into pGBKT7 to construct bait recombinant plasmids pGBKT7-C351-348bp, pGBKT7-C351-153bp and pGBKT7-C35154-348bp, then transformed into Y187 yeast cells by the lithium acetate method. Auto-activation and toxicity of C35 baits were detected using nutritional deficient medium and X-α-Gal assays. The T47D cell ds cDNA was generated by SMART TM technology and the library was constructed using in vivo recombination-mediated cloning in the AH109 yeast strain using a pGADT7-Rec plasmid. The transformed Y187/pGBKT7-C351-348bp line was intensively inhibited while the truncated Y187/pGBKT7-C35 lines had no auto-activation and toxicity in yeast cells. The titer of established cDNA library was 2 × 10 7 pfu/mL with high transformation efficiency of 1.4 × 10 6 , and the insert size of ds cDNA was distributed homogeneously between 0.5-2.0 kb. Our research generated a T47D cell cDNA library with high titer, and the constructed two C35 "baits" contained a respective functional immunoreceptor tyrosine based activation motif (ITAM) and the conserved last four amino acids Cys-Ile-Leu-Val (CILV) motif, and therefore laid a foundation for screening the C35 interaction factors in a BC cell line.

Detection of reverse transcriptase termination sites using cDNA ligation and massive parallel sequencing

DEFF Research Database (Denmark)

Kielpinski, Lukasz J; Boyd, Mette; Sandelin, Albin

2013-01-01

Detection of reverse transcriptase termination sites is important in many different applications, such as structural probing of RNAs, rapid amplification of cDNA 5' ends (5' RACE), cap analysis of gene expression, and detection of RNA modifications and protein-RNA cross-links. The throughput...... of these methods can be increased by applying massive parallel sequencing technologies.Here, we describe a versatile method for detection of reverse transcriptase termination sites based on ligation of an adapter to the 3' end of cDNA with bacteriophage TS2126 RNA ligase (CircLigase™). In the following PCR...

Enhanced specificity in immunoscreening of expression cDNA clones using radiolabeled antigen overlay

International Nuclear Information System (INIS)

Chao, S.; Chao, L.; Chao, J.

1989-01-01

A highly sensitive and specific method has been developed for immunoscreening clones from an expression cDNA library. The procedures utilize a radiolabeled antigen detection method described originally for the immunoblotting of plasma proteins. Screening of rat alpha 1-antitrypsin clones was used. Comparison between Western blots of alpha 1-antitrypsin using both labeled antigen and protein A detection methods showed that the former yielded lower background and greater sensitivity than the latter. Further, this technique was shown to have a lower detection limit of less than 20 ng through Western blot analysis of varying concentrations of alpha 1-antitrypsin. The procedures are based on the expression of the protein by cDNA clones containing the DNA inserts in the correct reading frame. Following the transfer of phage proteins to nitrocellulose membranes, the bivalent antibodies bind monovalently to both nitrocellulose-bound-antigen in the phage lysates and radiolabeled antigen. The radiolabeled antigen overlay method is superior to the protein A detection method in sensitivity, specificity and reproducibility. This improved method can be applied in general for screening expression cDNA libraries, provided that the specific antiserum and radiolabeled antigen are available

Cloning, molecular characterization and expression of a cDNA encoding a functional NADH-cytochrome b5 reductase from Mucor racemosus PTCC 5305 in E. coli

Directory of Open Access Journals (Sweden)

NED A SETAYESH

2009-01-01

Full Text Available The present work aims to study a new NADH-cytochrome b5 reductase (cb5r from Mucor racemosus PTCC 5305. A cDNA coding for cb s r was isolated from a Mucor racemosus PTCC 5305 cDNA library. The nucleotide sequence of the cDNA including coding and sequences flanking regions was determined. The open reading frame starting from ATG and ending with TAG stop codon encoded 228 amino acids and displayed the closest similarity (73% with Mortierella alpina cb s r. Lack of hydrophobic residues in the N-terminal sequence was apparent, suggesting that the enzyme is a soluble isoform. The coding sequence was then cloned in the pET16b transcription vector carrying an N-terminal-linked His-Tag® sequence and expressed in Escherichia coli BL21 (DE3. The enzyme was then homogeneously purified by a metal affinity column. The recombinant Mucor enzyme was shown to have its optimal activity at pH and temperature of about 7.5 and 40 °C, respectively. The apparent Km value was calculated to be 13 μM for ferricyanide. To our knowledge, this is the first report on cloning and expression of a native fungal soluble isoform of NADH-cytochrome b5 reductase in E. coli.

Isolation and characterization of human glycophorin A cDNA clones by a synthetic oligonucleotide approach: nucleotide sequence and mRNA structure

International Nuclear Information System (INIS)

Siebert, P.D.; Fukuda, M.

1986-01-01

In an effort to understand the relationships among and the regulation of human glycophorins, the authors have isolated and characterized several glycophorin A-specific cDNA clones obtained from a human erythroleukemic K562 cell cDNA library. This was accomplished by using mixed synthetic oligonucleotides, corresponding to various regions of the known amino acid sequence, to prime the synthesis of the cDNA as well as to screen the cDNA library. They also used synthetic oligonucleotides to sequence the largest of the glycophorin cDNAs. The nucleotide sequence obtained suggests the presence of a potential leader peptide, consistent with the membrane localization of this glycoprotein. Examination of the structure of glycophorin mRNA by blot hybridization revealed the existence of several electrophoretically distinct mRNAs numbering three or four, depending on the size of the glycophorin cDNA used as a hybridization probe. The smaller cDNA hybridized to three mRNAs of approximately 2.8, 1.7, and 1.0 kilobases. In contrast, the larger cDNA hybridized to an additional mRNA of approximately 0.6 kilobases. Further examination of the relationships between these multiple mRNAs by blot hybridization was conducted with the use of exact-sequence oligonucleotide probes constructed from various regions of the cDNA representing portions of the amino acid sequence of glycophorin A with or without known homology with glycophorin B. In total, the results obtained are consistent with the hypothesis that the three larger mRNAs represent glycophorin A gene transcripts and that the smallest (0.6 kilobase) mRNA may be specific for glycophorin B

Structures of the N47A and E109Q mutant proteins of pyruvoyl-dependent arginine decarboxylase from Methanococcus jannaschii

International Nuclear Information System (INIS)

Soriano, Erika V.; McCloskey, Diane E.; Kinsland, Cynthia; Pegg, Anthony E.; Ealick, Steven E.

2008-01-01

The crystal structures of two arginine decarboxylase mutant proteins provide insights into the mechanisms of pyruvoyl-group formation and the decarboxylation reaction. Pyruvoyl-dependent arginine decarboxylase (PvlArgDC) catalyzes the first step of the polyamine-biosynthetic pathway in plants and some archaebacteria. The pyruvoyl group of PvlArgDC is generated by an internal autoserinolysis reaction at an absolutely conserved serine residue in the proenzyme, resulting in two polypeptide chains. Based on the native structure of PvlArgDC from Methanococcus jannaschii, the conserved residues Asn47 and Glu109 were proposed to be involved in the decarboxylation and autoprocessing reactions. N47A and E109Q mutant proteins were prepared and the three-dimensional structure of each protein was determined at 2.0 Å resolution. The N47A and E109Q mutant proteins showed reduced decarboxylation activity compared with the wild-type PvlArgDC. These residues may also be important for the autoprocessing reaction, which utilizes a mechanism similar to that of the decarboxylation reaction

Automation of cDNA Synthesis and Labelling Improves Reproducibility

Directory of Open Access Journals (Sweden)

Daniel Klevebring

2009-01-01

Full Text Available Background. Several technologies, such as in-depth sequencing and microarrays, enable large-scale interrogation of genomes and transcriptomes. In this study, we asses reproducibility and throughput by moving all laboratory procedures to a robotic workstation, capable of handling superparamagnetic beads. Here, we describe a fully automated procedure for cDNA synthesis and labelling for microarrays, where the purification steps prior to and after labelling are based on precipitation of DNA on carboxylic acid-coated paramagnetic beads. Results. The fully automated procedure allows for samples arrayed on a microtiter plate to be processed in parallel without manual intervention and ensuring high reproducibility. We compare our results to a manual sample preparation procedure and, in addition, use a comprehensive reference dataset to show that the protocol described performs better than similar manual procedures. Conclusions. We demonstrate, in an automated gene expression microarray experiment, a reduced variance between replicates, resulting in an increase in the statistical power to detect differentially expressed genes, thus allowing smaller differences between samples to be identified. This protocol can with minor modifications be used to create cDNA libraries for other applications such as in-depth analysis using next-generation sequencing technologies.

Coordinate regulation of stromelysin and collagenase genes determined with cDNA probes

International Nuclear Information System (INIS)

Frisch, S.M.; Clark, E.J.; Werb, Z.

1987-01-01

Secreted proteinases are required for tumor metastasis, angiogenesis, and tissue remodeling during wound healing and embryonic growth. Thus, the regulation of the genes of secreted proteinases may serve as an interesting model for growth-controlled genes in general. The authors studied the genes of the secreted proteinases stromelysin and collagenase by using molecularly cloned cDNAs from each proteinase. Stromelysin cDNA was cloned by differential screening of a total cDNA library from rabbit synovial cells treated with phorbol 12-myristate 13-acetate, which yielded a clone of 1.2 kilobase pairs; collagenase cDNA was obtained by cloning reverse transcripts of anti-collagenase-immunoadsorbed polysomal mRNA, which yielded a clone of 0.8 kilobase pairs. Stromelysin and collagenase mRNA species of 2.2 and 2.4 kilobases, respectively, were detected on hybridization blots of RNA from phorbol 12-myristate 13-acetate-treated but not untreated rabbit synovial cells. Expression of stromelysin mRNA was also induced in rabbit alveolar macrophages and rabbit brain capillary endothelial cells treated with phorbol 12-myristate 13-acetate. Stromelysin and collagenase mRNA were both induced by phorbol 12-myristate 13-acetate and cytochalasin B at a constant ratio of the two gene products; this suggest coordinate regulation. The fact that induction was blocked after inhibition of protein synthesis by cycloheximide implicates an indirect signal transduction pathway that requires new protein synthesis

A porphodimethene chemical inhibitor of uroporphyrinogen decarboxylase.

Directory of Open Access Journals (Sweden)

Kenneth W Yip

Full Text Available Uroporphyrinogen decarboxylase (UROD catalyzes the conversion of uroporphyrinogen to coproporphyrinogen during heme biosynthesis. This enzyme was recently identified as a potential anticancer target; its inhibition leads to an increase in reactive oxygen species, likely mediated by the Fenton reaction, thereby decreasing cancer cell viability and working in cooperation with radiation and/or cisplatin. Because there is no known chemical UROD inhibitor suitable for use in translational studies, we aimed to design, synthesize, and characterize such a compound. Initial in silico-based design and docking analyses identified a potential porphyrin analogue that was subsequently synthesized. This species, a porphodimethene (named PI-16, was found to inhibit UROD in an enzymatic assay (IC50 = 9.9 µM, but did not affect porphobilinogen deaminase (at 62.5 µM, thereby exhibiting specificity. In cellular assays, PI-16 reduced the viability of FaDu and ME-180 cancer cells with half maximal effective concentrations of 22.7 µM and 26.9 µM, respectively, and only minimally affected normal oral epithelial (NOE cells. PI-16 also combined effectively with radiation and cisplatin, with potent synergy being observed in the case of cisplatin in FaDu cells (Chou-Talalay combination index <1. This work presents the first known synthetic UROD inhibitor, and sets the foundation for the design, synthesis, and characterization of higher affinity and more effective UROD inhibitors.

Cloning of low dose radiation induced gene RIG1 by RACE based on non-cloned cDNA library

International Nuclear Information System (INIS)

Luo Ying; Sui Jianli; Tie Yi; Zhang Yuanping; Zhou Pingkun; Sun Zhixian

2001-01-01

Objective: To obtain full-length cDNA of radiation induced new gene RIG1 based on its EST fragment. Methods: Based on non-cloned cDNA library, enhanced nested RACE PCR and biotin-avidin labelled probe for magnetic bead purification was used to obtain full-length cDNA of RIG1. Results: About 1 kb of 3' end of RIG1 gene was successfully cloned by this set of methods and cloning of RIG1 5' end is proceeding well. Conclusion: The result is consistent with the design of experiment. This set of protocol is useful for cloning of full-length gene based on EST fragment

Human pro. cap alpha. 1)(I) collagen: cDNA sequence for the C-propeptide domain

Energy Technology Data Exchange (ETDEWEB)

Maekelae, J K; Raassina, M; Virta, A; Vuorio, E

1988-01-11

The authors have previously constructed a cDNA clone pHCAL1, covering most of the C-terminal propeptide domain of human pro..cap alpha..1(I) collagen mRNA,by inserting a 678 bp EcoRI-XhoI fragment of cDNA into pBR322. Since the XhoI/SalI ligation prevented removal of the insert, they used the same strategy to obtain a similar clone in pUC8. RNA was isolated from fetal calvarial bones. The cDNA was digested with EcoRI and XhoI and fractionated on a 1 % agarose gel. Fragments of 650-700 bp were cloned in pUC8 at the polylinker site, which now permits easy removal of the insert. The new clone was named pHCAL1U since the RNA was isolated from another individual. The approach outlined is useful for studies on individual variation which is important to recognize when searching for disease-related mutations in type I collagen.

EXPRESSION PROFILING OF ESTROGENIC COMPOUNDS USING A SHEEPSHEAD MINNOW CDNA MACROARRAY

Science.gov (United States)

Larkin, Patrick, Leroy C. Folmar, Michael J. Hemmer, Arianna J. Poston and Nancy D. Denslow. 2003. Expression Profiling of Estrogenic Compounds Using a Sheepshead Minnow cDNA Macroarray. Environ. Health Perspect. 111(6):839-846. (ERL,GB 1171). A variety of anthropogenic c...

Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor.

Science.gov (United States)

Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P

1988-02-01

Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A)+ RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the lambda PL promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated Mr of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 (3 amino acid differences) and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). Like ovalbumin, mPAI-2 appears to have no typical amino-terminal signal sequence. The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators.

Three human alcohol dehydrogenase subunits: cDNA structure and molecular and evolutionary divergence

International Nuclear Information System (INIS)

Ikuta, T.; Szeto, S.; Yoshida, A.

1986-01-01

Class I human alcohol dehydrogenase (ADH; alcohol:NAD + oxidoreductase, EC 1.1.1.1) consists of several homo- and heterodimers of α, β, and γ subunits that are governed by the ADH1, ADH2, and ADH3 loci. The authors previously cloned a full length of cDNA for the β subunit, and the complete sequence of 374 amino acid residues was established. cDNAs for the α and γ subunits were cloned and characterized. A human liver cDNA library, constructed in phage λgt11, was screened by using a synthetic oligonucleotide probe that was matched to the γ but not to the β sequence. Clone pUCADHγ21 and clone pUCADHα15L differed from β cDNA with respect to restriction sites and hybridization with the nucleotide probe. Clone pUCADHγ21 contained an insertion of 1.5 kilobase pairs (kbp) and encodes 374 amino acid residues compatible with the reported amino acid sequence of the γ subunit. Clone pUCADHα15L contained an insertion of 2.4 kbp and included nucleotide sequences that encode 374 amino acid residues for another subunit, the γ subunit. In addition, this clone contained the sequences that encode the COOH-terminal part of the β subunit at its extended 5' region. The amino acid sequences and coding regions of the cDNAs of the three subunits are very similar. A high degree of resemblance is observed also in their 3' noncoding regions. However, distinctive differences exist in the vicinity of the Zn-binding cysteine residue at position 46. Based on the cDNA sequences and the deduced amino acid sequences of the three subunits, their structural and evolutionary relationships are discussed

Construction and characterization of a cDNA library from human ...

African Journals Online (AJOL)

The tumor-suppressor gene p53 and its downstream genes consist of a complicated gene network, and the challenge to understand the network is to identify p53 downstream genes. In order to isolate and identify new p53 regulated genes, we constructed and characterized a normalized cDNA library from human brain ...

Observation of intermittency in gene expression on cDNA microarrays

CERN Document Server

Peterson, L E

2002-01-01

We used scaled factorial moments to search for intermittency in the log expression ratios (LERs) for thousands of genes spotted on cDNA microarrays (gene chips). Results indicate varying levels of intermittency in gene expression. The observation of intermittency in the data analyzed provides a complimentary handle on moderately expressed genes, generally not tackled by conventional techniques.

cDNA sequence and tissue expression analysis of glucokinase from ...

African Journals Online (AJOL)

Yomi

2012-01-10

Jan 10, 2012 ... distribution of GK mRNA in brain, mesenteric adipose tissue, spleen, white muscle and liver of grass ... expression profile of GK mRNA in liver normalized with β-actin level was 31, 454 and 649-fold compared .... Primers and expected products used for GK gene cDNA RT-PCR, RACE and real-time PCR.

The Effect of Exogenous Spermidine Concentration on Polyamine Metabolism and Salt Tolerance in Zoysiagrass (Zoysia japonica Steud) Subjected to Short-Term Salinity Stress.

Science.gov (United States)

Li, Shucheng; Jin, Han; Zhang, Qiang

2016-01-01

Salt stress, particularly short-term salt stress, is among the most serious abiotic factors limiting plant survival and growth in China. It has been established that exogenous spermidine (Spd) stimulates plant tolerance to salt stress. The present study utilized two zoysiagrass cultivars commonly grown in China that exhibit either sensitive (cv. Z081) or tolerant (cv. Z057) adaptation capacity to salt stress. The two cultivars were subjected to 200 mM salt stress and treated with different exogenous Spd concentrations for 8 days. Polyamine [diamine putrescine (Put), tetraamine spermine (Spm), and Spd], H2O2 and malondialdehyde (MDA) contents and polyamine metabolic (ADC, ODC, SAMDC, PAO, and DAO) and antioxidant (superoxide dismutase, catalase, and peroxidase) enzyme activities were measured. The results showed that salt stress induced increases in Spd and Spm contents and ornithine decarboxylase (ODC), S-adenosylmethionine decarboxylase (SAMDC), and diamine oxidase (DAO) activities in both cultivars. Exogenous Spd application did not alter polyamine contents via regulation of polyamine-degrading enzymes, and an increase in polyamine biosynthetic enzyme levels was observed during the experiment. Increasing the concentration of exogenous Spd resulted in a tendency of the Spd and Spm contents and ODC, SAMDC, DAO, and antioxidant enzyme activities to first increase and then decrease in both cultivars. H2O2 and MDA levels significantly decreased in both cultivars treated with Spd. Additionally, in both cultivars, positive correlations between polyamine biosynthetic enzymes (ADC, SAMDC), DAO, and antioxidant enzymes (SOD, POD, CAT), but negative correlations with H2O2 and MDA levels, and the Spd + Spm content were observed with an increase in the concentration of exogenous Spd.

Recovery of avian metapneumovirus subgroup C from cDNA: cross-recognition of avian and human metapneumovirus support proteins.

Science.gov (United States)

Govindarajan, Dhanasekaran; Buchholz, Ursula J; Samal, Siba K

2006-06-01

Avian metapneumovirus (AMPV) causes an acute respiratory disease in turkeys and is associated with "swollen head syndrome" in chickens, contributing to significant economic losses for the U.S. poultry industry. With a long-term goal of developing a better vaccine for controlling AMPV in the United States, we established a reverse genetics system to produce infectious AMPV of subgroup C entirely from cDNA. A cDNA clone encoding the entire 14,150-nucleotide genome of AMPV subgroup C strain Colorado (AMPV/CO) was generated by assembling five cDNA fragments between the T7 RNA polymerase promoter and the autocatalytic hepatitis delta virus ribozyme of a transcription plasmid, pBR 322. Transfection of this plasmid, along with the expression plasmids encoding the N, P, M2-1, and L proteins of AMPV/CO, into cells stably expressing T7 RNA polymerase resulted in the recovery of infectious AMPV/CO. Characterization of the recombinant AMPV/CO showed that its growth properties in tissue culture were similar to those of the parental virus. The potential of AMPV/CO to serve as a viral vector was also assessed by generating another recombinant virus, rAMPV/CO-GFP, that expressed the enhanced green fluorescent protein (GFP) as a foreign protein. Interestingly, GFP-expressing AMPV and GFP-expressing human metapneumovirus (HMPV) could be recovered using the support plasmids of either virus, denoting that the genome promoters are conserved between the two metapneumoviruses and can be cross-recognized by the polymerase complex proteins of either virus. These results indicate a close functional relationship between AMPV/CO and HMPV.

cDNA cloning of human DNA topoisomerase I. Catalytic activity of a 67.7-kDa carboxyl-terminal fragment

International Nuclear Information System (INIS)

D'Arpa, P.; Machlin, P.S.; Ratrie, H. III; Rothfield, N.F.; Cleveland, D.W.; Earnshaw, W.C.

1988-01-01

cDNA clones encoding human topoisomerase I were isolated from an expression vector library (λgt11) screened with autoimmune anti-topoisomerase I serum. One of these clones has been expressed as a fusion protein comprised of a 32-kDa fragment of the bacterial TrpE protein linked to 67.7 kDa of protein encoded by the cDNA. Three lines of evidence indicate that the cloned cDNA encodes topoisomerase I. (i) Proteolysis maps of the fusion protein and human nuclear topoisomerase I are essentially identical. (ii) The fusion protein relaxes supercoiled DNA, an activity that can be immunoprecipitated by anti-topoisomerase I serum. (iii) Sequence analysis has revealed that the longest cDNA clone (3645 base pairs) encodes a protein of 765 amino acids that shares 42% identity with Saccharomyces cerevisiae topoisomerase I. The sequence data also show that the catalytically active 67.7-kDa fragment is comprised of the carboxyl terminus

Cloning and Expression Vector Construction of Glutamate Decarboxylase Gene from Lactobacillus Plantarum

Directory of Open Access Journals (Sweden)

B Arabpour

2016-06-01

Full Text Available BACKGROUND AND OBJECTIVE: Gamma-aminobutyric acid (GABA is a four-carbon non-protein amino acid used in the treatment of hypertension, diabetes, inflammation, and depression. GABA is synthesized by glutamic acid decarboxylase (GAD enzyme in many organisms, including bacteria. Therefore, cloning of this enzyme is essential to the optimization of GABA production. This study aimed to clone and construct the expression vector of GAD gene from Lactobacillus plantarum PTCC 1058 bacterium. METHODS: In this experimental study, we investigated the morphological, biochemical, genetic and 16s rDNA sequencing of L. plantarum PTCC 1058 strain. Genomic DNA of the bacterium was isolated and amplified using the GAD gene via polymerase chain reaction (PCR. Afterwards, the gene was inserted into the pJET1.2/blunt cloning vector and subcloned in vector pET32a. Plasmid pET32a-gad expression vector was transformed in Escherichia coli BL21 strain, and protein expression was assessed using sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE. FINDINGS: Morphological, biochemical and genetic analyses of 16s rDNA sequencing indicated that the studied substrain was of the L. plantarum strain. In addition, results of nucleotide sequencing of the fragmented segment via PCR showed the presence of GAD gene. Results of colony PCR and SDS-PAGE analysis confirmed the accuracy of the cloning and gene expression of the recombinant Escherichia coli BL21 strain. CONCLUSION: According to the results of this study, cloning of GAD gene from L. plantarum PTCC 1058 was successful. These cloned genes could grow rapidly in prokaryotic and eukaryotic systems and be used in cost-effective culture media and even non-recyclable waste.

Characterization of cDNA encoding human placental anticoagulant protein (PP4): Homology with the lipocortin family

International Nuclear Information System (INIS)

Grundmann, U.; Abel, K.J.; Bohn, H.; Loebermann, H.; Lottspeich, F.; Kuepper, H.

1988-01-01

A cDNA library prepared from human placenta was screened for sequences encoding the placental protein 4 (PP4). PP4 is an anticoagulant protein that acts as an indirect inhibitor of the thromboplastin-specific complex, which is involved in the blood coagulation cascade. Partial amino acid sequence information from PP4-derived cyanogen bromide fragments was used to design three oligonucleotide probes for screening the library. From 10 6 independent recombinants, 18 clones were identified that hybridized to all three probes. These 18 recombinants contained cDNA inserts encoding a protein of 320 amino acid residues. In addition to the PP4 cDNA the authors identified 9 other recombinants encoding a protein with considerable similarity (74%) to PP4, which was termed PP4-X. PP4 and PP4-X belong to the lipocortin family, as judged by their homology to lipocortin I and calpactin I

Cdna cloning and expression analyses of the isoflavone reductase-like gene of dendrobium officinale

International Nuclear Information System (INIS)

Qian, X.; Xu, S.Z.

2015-01-01

The full length of the isoflavone reductase-like gene (IRL) cDNA of Dendrobium officinale was cloned by using reverse transcription (RT) PCR combined with cDNA library, the IRL function was identified by Bioinformatics and prokaryotic expression analyses, and the IRL expression levels in the organs and tissues of D. officinale plants with different ages were determined by using real-time quantitative PCR (RT-qPCR). The results indicated that the full length of the cDNA of D. officinale IRL, DoIRL, was 1238 bp (accession no. KJ661023). Its open reading frame (ORF) was 930 bp which encoded 309 amino acids with a predicted molecular mass of 34 kDa, the 5 untranslated region (UTR) was 61 bp and the 3 UTR containing a poly (A) tail was 247 bp. The deduced amino acid sequence of DoIRL, DoIRL, was forecast to contain a NAD(P)H-binding motif (GGTGYIG) in the N-terminal region, two conserved N-glycosylation sites, a conserved nitrogen metabolite repression regulator (NmrA) domain and a phenylcoumaran benzylic ether reductase (PCBER) domain, to hold the nearest phylogenetic relationship with the PCBER of Striga asiatica, and to share both 73% identity with the isoflavone reductases-like (IRLs) of Cucumis sativus and Striga asiatica. In Escherichia coli 'BL21' cells, the DoIRL cDNA expression produced a protein band holding the predicted molecular mass of 34 kDa. DoIRL expressed in all organs and tissues of D. officinale plants with different ages at comparatively low levels, and the expression level in the leaves of the two-year-old plants was the highest. (author)

Urtica dioica Effect on Malonyl-CoA Decarboxylase

Directory of Open Access Journals (Sweden)

Qujeq

2014-09-01

Full Text Available Background The malonyl-CoA decarboxylase (MCD, EC.4.1.1.9 enzyme regulates malonyl-CoA levels. The effect of aerial parts extracts of Urtica dioica (UD on MCD is poorly understood. Objectives The present experiment was undertaken to evaluate the effect of UD aerial parts extracts on MCD level. Materials and Methods In this experimental study, two groups of rats were used: normal and hyperglycemic group. Then UD aerial parts extracts (5 mg /500 µL administrated to the hyperglycemic group of rats and finally, the MCD and insulin levels were measured in both groups. Results Interestingly, we observed that the UD aerial parts extracts powder caused a significant (P < 0.05 increase in insulin level during the experiment, from the base level of 0.36 ± 0.07 μg/L to the peak value of 0.52 ± 0.15 μg/L. Also, it caused a significant (P < 0.05 decrease in MCD level, from the base level of 29.68 ±1.29 pg/mL to the bottom value of 22.12 ± 2.41 pg/mL. Conclusions The results of the present study indicate that UD aerial part extracts would decrease MCD level in hyperglycemic rats.

Harmonization of Glutamic Acid Decarboxylase and Islet Antigen-2 Autoantibody Assays for National Institute of Diabetes and Digestive and Kidney Diseases Consortia

OpenAIRE

Bonifacio, Ezio; Yu, Liping; Williams, Alastair K.; Eisenbarth, George S.; Bingley, Polly J.; Marcovina, Santica M.; Adler, Kerstin; Ziegler, Anette G.; Mueller, Patricia W.; Schatz, Desmond A.; Krischer, Jeffrey P.; Steffes, Michael W.; Akolkar, Beena

2010-01-01

Background/Rationale: Autoantibodies to islet antigen-2 (IA-2A) and glutamic acid decarboxylase (GADA) are markers for diagnosis, screening, and measuring outcomes in National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK) consortia studies. A harmonization program was established to increase comparability of results within and among these studies.

cDNA cloning, mRNA distribution and heterogeneity, chromosomal location, and RFLP analysis of human osteopontin (OPN)

DEFF Research Database (Denmark)

Young, M F; Kerr, J M; Termine, J D

1990-01-01

A human osteopontin (OP) cDNA was isolated from a library made from primary cultures of human bone cells. The distribution of osteopontin mRNA in human tissues was investigated by Northern analysis and showed that the human message was predominant in cultures of bone cells and in decidua cells...... osteopontin cDNA indicated that the gene is a single copy with an approximate length of 5.4-8.2 kb....

Growth hormone and prolactin in Andrias davidianus: cDNA cloning, tissue distribution and phylogenetic analysis.

Science.gov (United States)

Yang, Liping; Meng, Zining; Liu, Yun; Zhang, Yong; Liu, Xiaochun; Lu, Danqi; Huang, Junhai; Lin, Haoran

2010-01-15

The Chinese giant salamander (Andrias davidianus) is one of the largest and 'living fossil' species of amphibian. To obtain genetic information for this species, the cDNAs encoding growth hormone (adGH) and prolactin (adPRL) were cloned from a pituitary cDNA library. The isolated adGH cDNA consisted of 864 bp and encoded a propeptide of 215 amino acids, while the cDNA of adPRL was 1106 bp in length and encoded a putative peptide of 229 amino acids. Expression of the GH and PRL mRNA was only detected in the pituitary. Phylogenetic analyses were performed based on the isolated pituitary hormone sequences using maximum parsimony and neighbor-joining algorithms. The clustering results are similar to that based on the morphological characteristics or the rRNA genes, which indicate that the two orders (Anura and Caudata) of amphibian were monophyletic, and that A. davidianus was diverged early in the Caudate clade. These results indicated that both the GH and PRL sequence might be useful to study the phylogenies of relatively moderate evolved groups.

Suppression of phytohemagglutinin-induction of thymidine uptake in guinea pig lymphocytes by methylglyoxal bis(guanylhydrazone) treatment.

Science.gov (United States)

Otani, S; Matsui, I; Morisawa, S

1977-10-18

Treatment with methylglyoxal bis(guanylhydrazone), a specific inhibitor of S-adenosylmethionine decarboxylase (EC 4.1.1.50), suppressed the phytohemagglutinin-induction of [3H]thymidine uptake by guinea pig lymphocytes. The kinetics of [3H]thymidine uptake revealed that the Km value for thymidine was not changed, but the V value was markedly lowered by the methylglyoxal bis(guanylhydrazone) treatment. The induction of ATP: thymidine 5'-phosphotransferase (EC 2.7.1.75) (thymidine kinase) activity by phytohemagglutinin was suppressed to about the same extent as the induction of thymidine uptake. These suppressions were dependent on the methylglyoxal bis(guanylhydrazone) doses and on duration of the methylglyoxal bis(guanylhydrazone) treatment. Analysis of [3H]thymidine labelled compounds of the acid-soluble fraction showed that conversion of thymidine to thymidine 5'-triphosphate was inhibited by the methylglyoxal bis(guanylhydrazone) treatment. DNA polymerase activity was less inhibited by the methylglyoxal bis(guanylhydrazone) treatment in comparison with the methylglyoxal bis(guanylhydrazone) inhibition of thymidine uptake by whole cells. These results strongly suggested that blocking of polyamine accumulation by the methylglyoxal bis(guanylhydrazone) treatment influenced phytohemagglutinin induction of thymidine phosphorylation, resulting in a decrease of thymidine incorporation into DNA.

Inhibition of HIV Expression and Integration in Macrophages by Methylglyoxal-Bis-Guanylhydrazone.

Science.gov (United States)

Jin, Xia; McGrath, Michael S; Xu, Hua

2015-11-01

Macrophages are a target for infection with HIV and represent one of the viral reservoirs that are relatively resistant to current antiretroviral drugs. Here we demonstrate that methylglyoxal-bis-guanylhydrazone (MGBG), a polyamine analog and potent S-adenosylmethionine decarboxylase inhibitor, decreases HIV expression in monocytes and macrophages. MGBG is selectively concentrated by these cells through a mechanism consistent with active transport by the polyamine transporter. Using a macrophage-tropic reporter virus tagged with the enhanced green fluorescent protein, we demonstrate that MGBG decreases the frequency of HIV-infected cells. The effect is dose dependent and correlates with the production of HIV p24 in culture supernatants. This anti-HIV effect was further confirmed using three macrophage-tropic primary HIV isolates. Viral life cycle mapping studies show that MGBG inhibits HIV DNA integration into the cellular DNA in both monocytes and macrophages. Our work demonstrates for the first time the selective concentration of MGBG by monocytes/macrophages, leading to the inhibition of HIV-1 expression and a reduction in proviral load within macrophage cultures. These results suggest that MGBG may be useful in adjunctive macrophage-targeted therapy for HIV infection. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Generation of Infectious Poliovirus with Altered Genetic Information from Cloned cDNA.

Science.gov (United States)

Bujaki, Erika

2016-01-01

The effect of specific genetic alterations on virus biology and phenotype can be studied by a great number of available assays. The following method describes the basic protocol to generate infectious poliovirus with altered genetic information from cloned cDNA in cultured cells.The example explained here involves generation of a recombinant poliovirus genome by simply replacing a portion of the 5' noncoding region with a synthetic gene by restriction cloning. The vector containing the full length poliovirus genome and the insert DNA with the known mutation(s) are cleaved for directional cloning, then ligated and transformed into competent bacteria. The recombinant plasmid DNA is then propagated in bacteria and transcribed to RNA in vitro before RNA transfection of cultured cells is performed. Finally, viral particles are recovered from the cell culture.

Dual mechanisms regulating glutamate decarboxylases and accumulation of gamma-aminobutyric acid in tea (Camellia sinensis) leaves exposed to multiple stresses.

Science.gov (United States)

Mei, Xin; Chen, Yiyong; Zhang, Lingyun; Fu, Xiumin; Wei, Qing; Grierson, Don; Zhou, Ying; Huang, Yahui; Dong, Fang; Yang, Ziyin

2016-03-29

γ-Aminobutyric acid (GABA) is one of the major inhibitory neurotransmitters in the central nervous system. It has multiple positive effects on mammalian physiology and is an important bioactive component of tea (Camellia sinensis). GABA generally occurs at a very low level in plants but GABA content increases substantially after exposure to a range of stresses, especially oxygen-deficiency. During processing of tea leaves, a combination of anoxic stress and mechanical damage are essential for the high accumulation of GABA. This is believed to be initiated by a change in glutamate decarboxylase activity, but the underlying mechanisms are unclear. In the present study we characterized factors regulating the expression and activity of three tea glutamate decarboxylase genes (CsGAD1, 2, and 3), and their encoded enzymes. The results suggests that, unlike the model plant Arabidopsis thaliana, there are dual mechanisms regulating the accumulation of GABA in tea leaves exposed to multiple stresses, including activation of CsGAD1 enzymatic activity by calmodulin upon the onset of the stress and accumulation of high levels of CsGAD2 mRNA induced by a combination of anoxic stress and mechanical damage.

A new approach for cloning hLIF cDNA from genomic DNA isolated from the oral mucous membrane.

Science.gov (United States)

Cui, Y H; Zhu, G Q; Chen, Q J; Wang, Y F; Yang, M M; Song, Y X; Wang, J G; Cao, B Y

2011-11-25

Complementary DNA (cDNA) is valuable for investigating protein structure and function in the study of life science, but it is difficult to obtain by traditional reverse transcription. We employed a novel strategy to clone human leukemia inhibitory factor (hLIF) gene cDNA from genomic DNA, which was directly isolated from the mucous membrane of mouth. The hLIF sequence, which is 609 bp long and is composed of three exons, can be acquired within a few hours by amplifying each exon and splicing all of them using overlap-PCR. This new approach developed is simple, time- and cost-effective, without RNA preparation or cDNA synthesis, and is not limited to the specific tissues for a particular gene and the expression level of the gene.

Role of ornithine decarboxylase in breast cancer

Institute of Scientific and Technical Information of China (English)

Wensheng Deng; Xian Jiang; Yu Mei; Jingzhong Sun; Rong Ma; Xianxi Liu; Hui Sun; Hui Tian; Xueying Sun

2008-01-01

Ornithine decarboxylase (ODC), the rate-limiting enzyme in polyamine biosynthesis that decarboxylates ornithine to putrescine, has become a promising target for cancer research. The aim of this study is to investigate the role of ODC in breast cancer. We detected expression of ODC in breast cancer tissues and four breast cancer cell lines, and transfected breast cancer cells with an adenoviral vector carrying antisense ODC (rAd-ODC/Ex3as) and examined their growth and migration.ODC was overexpressed in breast cancer tissues and cell lines compared with non-tumor tissues and normal breast epithelial celis,and there was a positive correlation between the level of ODC mRNA and the staging of tumors.The expression of ODC correlated with cyclin D1,a cell cycle protein,in synchronized breast cancer MDA-MB-231 cells.Gene transfection of rAd-ODC/Ex3as markedly down-regulated expression Of ODC and cyclin D1,resulting in suppression of proliferation and cell cycle arrest at G0-G1 phase,and the inhibifion of colony formation,an anchorage-independent growth pattern,and the migratory ability of MDA-MB-231 cells.rAd-ODC/Ex3as also markedly reduced the concentration of putrescine,but not spermidine or spermine,in MDA-MB-231 cells.The results suggested that the ODC gene might act as aprognostic factor for breast cancer and it could be a promising therapeutic target.

APPLICATION OF CDNA MICROARRAY TO THE STUDY OF ARSENIC TOXICOLOGY AND CARCINOGENESIS

Science.gov (United States)

Arsenic (As) is a common environmental toxicant and known human carcinogen. Epidemiological studies link As exposure to various disorders and cancers. However, the molecular mechanisms for As toxicity and carcinogenicity are not completely known. The cDNA microarray, a high-th...

Cloning and expression of a human kidney cDNA for an α2-adrenergic receptor subtype

International Nuclear Information System (INIS)

Regan, J.W.; Kobilka, T.S.; Yang-Feng, T.L.; Caron, M.G.; Lefkowitz, R.J.; Kobilka, B.K.

1988-01-01

An α 2 -adrenergic receptor subtype has been cloned from a human kidney cDNA library using the gene for the human platelet α 2 -adrenergic receptor as a probe. The deduced amino acid sequence resembles the human platelet α 2 -adrenergic receptor and is consistent with the structure of other members of he family of guanine nucleotide-binding protein-coupled receptors. The cDNA was expressed in a mammalian cell line (COS-7), and the α 2 -adrenergic ligand [ 3 H]rauwolscine was bound. Competition curve analysis with a variety of adrenergic ligands suggests that this cDNA clone represents the α 2 B-adrenergic receptor. The gene for this receptor is on human chromosome 4, whereas the gene for the human platelet α 2 -adrenergic receptor (α 2 A) lies on chromosome 10. This ability to express the receptor in mammalian cells, free of other adrenergic receptor subtypes, should help in developing more selective α-adrenergic ligands

Molecular cloning and sequence analysis of growth hormone cDNA of Neotropical freshwater fish Pacu (Piaractus mesopotamicus

Directory of Open Access Journals (Sweden)

Janeth Silva Pinheiro

2008-01-01

Full Text Available RT-PCR was used for amplifying Piaractus mesopotamicus growth hormone (GH cDNA obtained from mRNA extracted from pituitary cells. The amplified fragment was cloned and the complete cDNA sequence was determined. The cloned cDNA encompassed a sequence of 543 nucleotides that encoded a polypeptide of 178 amino acids corresponding to mature P. mesopotamicus GH. Comparison with other GH sequences showed a gap of 10 amino acids localized in the N terminus of the putative polypeptide of P. mesopotamicus. This same gap was also observed in other members of the family. Neighbor-joining tree analysis with GH sequences from fishes belonging to different taxonomic groups placed the P. mesopotamicus GH within the Otophysi group. To our knowledge, this is the first GH sequence of a Neotropical characiform fish deposited in GenBank.

Haplotype analysis indicates an association between the DOPA decarboxylase (DDC) gene and nicotine dependence.

Science.gov (United States)

Ma, Jennie Z; Beuten, Joke; Payne, Thomas J; Dupont, Randolph T; Elston, Robert C; Li, Ming D

2005-06-15

DOPA decarboxylase (DDC; also known as L-amino acid decarboxylase; AADC) is involved in the synthesis of dopamine, norepinephrine and serotonin. Because the mesolimbic dopaminergic system is implicated in the reinforcing effects of many drugs, including nicotine, the DDC gene is considered a plausible candidate for involvement in the development of vulnerability to nicotine dependence (ND). Further, this gene is located within the 7p11 region that showed a 'suggestive linkage' to ND in our previous genome-wide scan in the Framingham Heart Study population. In the present study, we tested eight single nucleotide polymorphisms (SNPs) within DDC for association with ND, which was assessed by smoking quantity (SQ), the heaviness of smoking index (HSI) and the Fagerstrom test for ND (FTND) score, in a total of 2037 smokers and non-smokers from 602 nuclear families of African- or European-American (AA or EA, respectively) ancestry. Association analysis for individual SNPs using the PBAT-GEE program indicated that SNP rs921451 was significantly associated with two of the three adjusted ND measures in the EA sample (P=0.01-0.04). Haplotype-based association analysis revealed a protective T-G-T-G haplotype for rs921451-rs3735273-rs1451371-rs2060762 in the AA sample, which was significantly associated with all three adjusted ND measures after correction for multiple testing (min Z=-2.78, P=0.006 for HSI). In contrast, we found a high-risk T-G-T-G haplotype for a different SNP combination in the EA sample, rs921451-rs3735273-rs1451371-rs3757472, which showed a significant association after Bonferroni correction with the SQ and FTND score (max Z=2.73, P=0.005 for FTND). In summary, our findings provide the first evidence for the involvement of DDC in the susceptibility to ND and, further, reveal the racial specificity of its impact.

Isolation and characterization of human cDNA clones encoding the α and the α' subunits of casein kinase II

International Nuclear Information System (INIS)

Lozeman, F.J.; Litchfield, D.W.; Piening, C.; Takio, Koji; Walsh, K.A.; Krebs, E.G.

1990-01-01

Casein kinase II is a widely distributed protein serine/threonine kinase. The holoenzyme appears to be a tetramer, containing two α or α' subunits (or one of each) and two β subunits. Complementary DNA clones encoding the subunits of casein kinase II were isolated from a human T-cell λgt 10 library using cDNA clones isolated from Drosophila melanogasten. One of the human cDNA clones (hT4.1) was 2.2 kb long, including a coding region of 1176 bp preceded by 156 bp (5' untranslated region) and followed by 871 bp (3' untranslated region). The hT4.1 close was nearly identical in size and sequence with a cDNA clone from HepG2 human hepatoma cultured cells. Another of the human T-cell cDNA clones (hT9.1) was 1.8 kb long, containing a coding region of 1053 bp preceded by 171 by (5' untranslated region) and followed by 550 bp (3' untranslated region). Amino acid sequences deduced from these two cDNA clones were about 85% identical. Most of the difference between the two encoded polypeptides was in the carboxy-terminal region, but heterogeneity was distributed throughout the molecules. Partial amino acid sequence was determined in a mixture of α and α' subunits from bovine lung casein kinase II. The bovine sequences aligned with the 2 human cDNA-encoded polypeptides with only 2 discrepancies out of 535 amino acid positions. This confirmed that the two human T-cell cDNA clones encoded the α and α' subunits of casein kinase II. These studies show that there are two distinct catalytic subunits for casein II (α and α') and that the sequence of these subunits is largely conserved between the bovine and the human

Construction and characterization of a full-length cDNA library for the wheat stripe rust pathogen (Puccinia striiformis f. sp. tritici

Directory of Open Access Journals (Sweden)

Chen Xianming

2007-06-01

Full Text Available Abstract Background Puccinia striiformis is a plant pathogenic fungus causing stripe rust, one of the most important diseases on cereal crops and grasses worldwide. However, little is know about its genome and genes involved in the biology and pathogenicity of the pathogen. We initiated the functional genomic research of the fungus by constructing a full-length cDNA and determined functions of the first group of genes by sequence comparison of cDNA clones to genes reported in other fungi. Results A full-length cDNA library, consisting of 42,240 clones with an average cDNA insert of 1.9 kb, was constructed using urediniospores of race PST-78 of P. striiformis f. sp. tritici. From 196 sequenced cDNA clones, we determined functions of 73 clones (37.2%. In addition, 36 clones (18.4% had significant homology to hypothetical proteins, 37 clones (18.9% had some homology to genes in other fungi, and the remaining 50 clones (25.5% did not produce any hits. From the 73 clones with functions, we identified 51 different genes encoding protein products that are involved in amino acid metabolism, cell defense, cell cycle, cell signaling, cell structure and growth, energy cycle, lipid and nucleotide metabolism, protein modification, ribosomal protein complex, sugar metabolism, transcription factor, transport metabolism, and virulence/infection. Conclusion The full-length cDNA library is useful in identifying functional genes of P. striiformis.

Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine.

Directory of Open Access Journals (Sweden)

Utut Widyastuti Suharsono

2008-11-01

Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.

Diagnostic accuracy of the anti-glutamic acid decarboxylase antibody in type 1 diabetes mellitus: Comparison between radioimmunoassay and enzyme-linked immunosorbent assay.

Science.gov (United States)

Murata, Takashi; Tsuzaki, Kokoro; Nirengi, Shinsuke; Watanabe, Tomokazu; Mizutani, Yukako; Okada, Hayami; Tsukamoto, Masami; Odori, Shinji; Nakagawachi, Reiko; Kawaguchi, Yaeko; Yoshioka, Fumi; Yamada, Kazunori; Shimatsu, Akira; Kotani, Kazuhiko; Satoh-Asahara, Noriko; Sakane, Naoki

2017-07-01

The distributer of the anti-glutamic acid decarboxylase antibody assay kit using radioimmunoassay (RIA) recently announced its discontinuation, and proposed an alternative kit using enzyme-linked immunosorbent assay (ELISA). The aim of the present study was to investigate the diagnostic values of the anti-glutamic acid decarboxylase antibody by RIA and ELISA among type 1 diabetes mellitus patients and control participants. A total of 79 type 1 diabetes mellitus patients and 79 age-matched controls were enrolled and assessed using RIA and ELISA. Sensitivity, specificity, positive predictive values and negative predictive values were calculated for cut-off values (RIA = 1.5 U/mL and ELISA = 5.0 U/mL, respectively). Kappa coefficients were used to test for agreements between the RIA and ELISA methods regarding the diagnosis of type 1 diabetes mellitus. The sensitivity, specificity, positive predictive values, and negative predictive values for diagnosing type 1 diabetes mellitus were 57.0, 97.5, 95.7, and 69.4% by RIA, and 60.8, 100.0, 100.0 and 71.8% by ELISA, respectively. The diagnosis of type 1 diabetes mellitus using the RIA and ELISA methods showed substantial agreement with the kappa values of 0.74 for all participants, and of 0.64 for the acute type; however, there was moderate agreement with the kappa value of 0.56 for the slowly progressive type. The present study suggests that both anti-glutamic acid decarboxylase antibody by RIA and ELISA was useful for diagnosing type 1 diabetes mellitus. However, in the slowly progressive type, the degree of agreement of these two kits was poorer compared with those in all participants or in the acute type. © 2016 The Authors. Journal of Diabetes Investigation published by Asian Association for the Study of Diabetes (AASD) and John Wiley & Sons Australia, Ltd.

Construction and characterization of the alpha form of a cardiac myosin heavy chain cDNA clone and its developmental expression in the Syrian hamster.

OpenAIRE

Liew, C C; Jandreski, M A

1986-01-01

A cDNA clone, pVHC1, was isolated from a Syrian hamster heart cDNA library and was compared to the rat alpha (pCMHC21) and beta (pCMHC5) ventricular myosin heavy chain cDNA clones. The DNA sequence and amino acid sequence deducted from the DNA show more homology with pCMHC21 than pCMHC5. This indicates that pVHC1 is an alpha ventricular myosin heavy chain cDNA clone. However, even though pVHC1 shows a high degree of nucleotide and amino acid conservation with the rat myosin heavy chain sequen...

Purification, cDNA cloning and modification of a defensin from the coconut rhinoceros beetle, Oryctes rhinoceros.

Science.gov (United States)

Ishibashi, J; Saido-Sakanaka, H; Yang, J; Sagisaka, A; Yamakawa, M

1999-12-01

A novel member of the insect defensins, a family of antibacterial peptides, was purified from larvae of the coconut rhinoceros beetle, Oryctes rhinoceros, immunized with Escherichia coli. A full-size cDNA was cloned by combining reverse-transcription PCR (RT-PCR), and 5'- and 3'-rapid amplification of cDNA ends (RACE). Analysis of the O. rhinoceros defensin gene expression showed it to be expressed in the fat body and hemocyte, midgut and Malpighian tubules. O. rhinoceros defensin showed strong antibacterial activity against Staphylococcus aureus. A 9-mer peptide amidated at its C-terminus, AHCLAICRK-NH2 (Ala22-Lys30-NH2), was synthesized based on the deduced amino-acid sequence, assumed to be an active site sequence by analogy with the sequence of a defensin isolated from larvae of the beetle Allomyrina dichotoma. This peptide showed antibacterial activity against S. aureus, methicillin-resistant S. aureus, E. coli and Pseudomonas aeruginosa. We further modified this oligopeptide and synthesized five 9-mer peptides, ALRLAIRKR-NH2, ALLLAIRKR-NH2, AWLLAIRKR-NH2, ALYLAIRKR-NH2 and ALWLAIRKR-NH2. These oligopeptides showed strong antibacterial activity against Gram-negative and Gram-positive bacteria. The antibacterial effect of Ala22-Lys30-NH2 analogues was due to its interaction with bacterial membranes, judging from the leakage of liposome-entrapped glucose. These Ala22-Lys30-NH2 analogues did not show haemolytic activity and did not inhibit the growth of murine fibroblast cells or macrophages, except for AWLLAIRKR-NH2.

Purification, cDNA Cloning, and Developmental Expression of the Nodule-Specific Uricase from Phaseolus vulgaris L. 1

Science.gov (United States)

Sánchez, Federico; Campos, Francisco; Padilla, Jaime; Bonneville, Jean-Marc; Enríquez, Consuelo; Caput, Daniel

1987-01-01

Nodule-specific uricase (uricase II) from Phaseolus vulgaris L. was purified to homogeneity by chromatographic methods. Purification data indicated that uricase II is approximately 2% of the total soluble protein from mature nodules. Specific antiserum was raised and used to determine the developmental expression and for immunoselection of polysomes. Uricase II was antigenically detected early in nodule development, 2 to 3 days before nitrogen fixation. Uricase-encoding cDNA clones were isolated by hybridizing a nodule-specific pUC9 cDNA library with labeled mRNA from immunoselected polysomes and a 35,000 molecular weight uricase II-encoding cDNA from soybean. An homologous clone (pNF-UR07) was used to assess the expression pattern of the specific transcript during development. Northern-blot analysis indicated that uricase II mRNA is exclusively expressed in nodule tissue. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 PMID:16665575

Redox Cycling, pH Dependence, and Ligand Effects of Mn(III) in Oxalate Decarboxylase from Bacillus subtilis.

Science.gov (United States)

Twahir, Umar T; Ozarowski, Andrew; Angerhofer, Alexander

2016-11-29

This contribution describes electron paramagnetic resonance (EPR) experiments on Mn(III) in oxalate decarboxylase of Bacillus subtilis, an interesting enzyme that catalyzes the redox-neutral dissociation of oxalate into formate and carbon dioxide. Chemical redox cycling provides strong evidence that both Mn centers can be oxidized, although the N-terminal Mn(II) appears to have the lower reduction potential and is most likely the carrier of the +3 oxidation state under moderate oxidative conditions, in agreement with the general view that it represents the active site. Significantly, Mn(III) was observed in untreated OxDC in succinate and acetate buffers, while it could not be directly observed in citrate buffer. Quantitative analysis showed that up to 16% of the EPR-visible Mn is in the +3 oxidation state at low pH in the presence of succinate buffer. The fine structure and hyperfine structure parameters of Mn(III) are affected by small carboxylate ligands that can enter the active site and have been recorded for formate, acetate, and succinate. The results from a previous report [Zhu, W., et al. (2016) Biochemistry 55, 429-434] could therefore be reinterpreted as evidence of formate-bound Mn(III) after the enzyme is allowed to turn over oxalate. The pH dependence of the Mn(III) EPR signal compares very well with that of enzymatic activity, providing strong evidence that the catalytic reaction of oxalate decarboxylase is driven by Mn(III), which is generated in the presence of dioxygen.

Radioactive cDNA microarrys for gene expression profiles in antidepressant therapy

International Nuclear Information System (INIS)

Lee, M. S.; Han, B. J.; Cha, J. H.; Ryu, Y. M.; Shin, E. K.; Park, J. H.; Park, Y. H.; Kim, M. K.

2002-01-01

Using radioactive cDNA microarray, we investigated a pattern of gene regulation under treatment of antidepressant on patients of depressive disoder. Basic microarray technology was performed as previously described in our research. The bioinformatic selection of human cDNAs, which is specifically designed for psychiatry, neurology, and signal transduction, were arrayed on nylon membranes. Using with 33P-labeled probes, this method provided highly sensitive gene expression profiles of our interest including brain receptors, drug metabolism, and cellular signalings. Gene expression profiles were also classified into several categories in accordance with the gene-regulation of antidepressant. The gene profiles of our interest were significantly up- (16 genes, >2.0 of Z-ratio) or down- (24 genes, <-2.0 of Z ratio) regulated when compared the good responsed group with the bad-responsed one. Consequently, we demonstrated that radioactive human cDNA microarray is highly likely to be an efficient technology for evaluating the gene regulation of antidepressants, such as selective serotonin-reuptake inhibitors (SSRIs), by using high-throughput biotechnology

Structural Basis for Nucleotide Binding and Reaction Catalysis in Mevalonate Diphosphate Decarboxylase

Energy Technology Data Exchange (ETDEWEB)

Barta, Michael L.; McWhorter, William J.; Miziorko, Henry M.; Geisbrecht, Brian V. (UMKC)

2012-09-17

Mevalonate diphosphate decarboxylase (MDD) catalyzes the final step of the mevalonate pathway, the Mg{sup 2+}-ATP dependent decarboxylation of mevalonate 5-diphosphate (MVAPP), producing isopentenyl diphosphate (IPP). Synthesis of IPP, an isoprenoid precursor molecule that is a critical intermediate in peptidoglycan and polyisoprenoid biosynthesis, is essential in Gram-positive bacteria (e.g., Staphylococcus, Streptococcus, and Enterococcus spp.), and thus the enzymes of the mevalonate pathway are ideal antimicrobial targets. MDD belongs to the GHMP superfamily of metabolite kinases that have been extensively studied for the past 50 years, yet the crystallization of GHMP kinase ternary complexes has proven to be difficult. To further our understanding of the catalytic mechanism of GHMP kinases with the purpose of developing broad spectrum antimicrobial agents that target the substrate and nucleotide binding sites, we report the crystal structures of wild-type and mutant (S192A and D283A) ternary complexes of Staphylococcus epidermidis MDD. Comparison of apo, MVAPP-bound, and ternary complex wild-type MDD provides structural information about the mode of substrate binding and the catalytic mechanism. Structural characterization of ternary complexes of catalytically deficient MDD S192A and D283A (k{sub cat} decreased 10{sup 3}- and 10{sup 5}-fold, respectively) provides insight into MDD function. The carboxylate side chain of invariant Asp{sup 283} functions as a catalytic base and is essential for the proper orientation of the MVAPP C3-hydroxyl group within the active site funnel. Several MDD amino acids within the conserved phosphate binding loop ('P-loop') provide key interactions, stabilizing the nucleotide triphosphoryl moiety. The crystal structures presented here provide a useful foundation for structure-based drug design.

Construction of high-quality Caco-2 three-frame cDNA library and its application to yeast two-hybrid for the human astrovirus protein-protein interaction.

Science.gov (United States)

Zhao, Wei; Li, Xin; Liu, Wen-Hui; Zhao, Jian; Jin, Yi-Ming; Sui, Ting-Ting

2014-09-01

Human epithelial colorectal adenocarcinoma (Caco-2) cells are widely used as an in vitro model of the human small intestinal mucosa. Caco-2 cells are host cells of the human astrovirus (HAstV) and other enteroviruses. High quality cDNA libraries are pertinent resources and critical tools for protein-protein interaction research, but are currently unavailable for Caco-2 cells. To construct a three-open reading frame, full length-expression cDNA library from the Caco-2 cell line for application to HAstV protein-protein interaction screening, total RNA was extracted from Caco-2 cells. The switching mechanism at the 5' end of the RNA transcript technique was used for cDNA synthesis. Double-stranded cDNA was digested by Sfi I and ligated to reconstruct a pGADT7-Sfi I three-frame vector. The ligation mixture was transformed into Escherichia coli HST08 premium electro cells by electroporation to construct the primary cDNA library. The library capacity was 1.0×10(6)clones. Gel electrophoresis results indicated that the fragments ranged from 0.5kb to 4.2kb. Randomly picked clones show that the recombination rate was 100%. The three-frame primary cDNA library plasmid mixture (5×10(5)cfu) was also transformed into E. coli HST08 premium electro cells, and all clones were harvested to amplify the cDNA library. To detect the sufficiency of the cDNA library, HAstV capsid protein as bait was screened and tested against the Caco-2 cDNA library by a yeast two-hybrid (Y2H) system. A total of 20 proteins were found to interact with the capsid protein. These results showed that a high-quality three-frame cDNA library from Caco-2 cells was successfully constructed. This library was efficient for the application to the Y2H system, and could be used for future research. Copyright © 2014 Elsevier B.V. All rights reserved.

Construction of a cDNA library from human retinal pigment epithelial cells challenged with rod outer segments.

Science.gov (United States)

Cavaney, D M; Rakoczy, P E; Constable, I J

1995-05-01

To study genes expressed by retinal pigment epithelial (RPE) cells during phagocytosis and digestion of rod outer segments (ROS), a complementary (c)DNA library was produced using an in-vitro model. The cDNA library can be used to study molecular changes which contribute to the development of diseases due to a failure in outer segment phagocytosis and digestion by RPE cells. Here we demonstrate a way to study genes and their functions using a molecular biological approach and describing the first step involved in this process, the construction of a cDNA library. Human RPE cells obtained from the eyes of a seven-year-old donor were cultured and challenged with bovine ROS. The culture was harvested and total RNA was extracted. Complementary DNA was transcribed from the messenger (m)RNA and was directionally cloned into the LambdaGEM-4 bacteriophage vector successfully. Some clones were picked and the DNA extracted, to determine the size of the inserts as a measure of the quality of the library. Molecular biology and cell culture are important tools to be used in eye research, especially in areas where tissue is limiting and animal models are not available. We now have a ROS challenged RPE cDNA library which will be used to identify genes responsible for degrading phagocytosed debris within the retinal pigment epithelium.

Characterization of cDNA for human tripeptidyl peptidase II: The N-terminal part of the enzyme is similar to subtilisin

International Nuclear Information System (INIS)

Tomkinson, B.; Jonsson, A-K

1991-01-01

Tripeptidyl peptidase II is a high molecular weight serine exopeptidase, which has been purified from rat liver and human erythrocytes. Four clones, representing 4453 bp, or 90% of the mRNA of the human enzyme, have been isolated from two different cDNA libraries. One clone, designated A2, was obtained after screening a human B-lymphocyte cDNA library with a degenerated oligonucleotide mixture. The B-lymphocyte cDNA library, obtained from human fibroblasts, were rescreened with a 147 bp fragment from the 5' part of the A2 clone, whereby three different overlapping cDNA clones could be isolated. The deduced amino acid sequence, 1196 amino acid residues, corresponding to the longest open rading frame of the assembled nucleotide sequence, was compared to sequences of current databases. This revealed a 56% similarity between the bacterial enzyme subtilisin and the N-terminal part of tripeptidyl peptidase II. The enzyme was found to be represented by two different mRNAs of 4.2 and 5.0 kilobases, respectively, which probably result from the utilziation of two different polyadenylation sites. Futhermore, cDNA corresponding to both the N-terminal and C-terminal part of tripeptidyl peptidase II hybridized with genomic DNA from mouse, horse, calf, and hen, even under fairly high stringency conditions, indicating that tripeptidyl peptidase II is highly conserved

Enhancement of the catalytic activity of ferulic acid decarboxylase from Enterobacter sp. Px6-4 through random and site-directed mutagenesis.

Science.gov (United States)

Lee, Hyunji; Park, Jiyoung; Jung, Chaewon; Han, Dongfei; Seo, Jiyoung; Ahn, Joong-Hoon; Chong, Youhoon; Hur, Hor-Gil

2015-11-01

The enzyme ferulic acid decarboxylase (FADase) from Enterobacter sp. Px6-4 catalyzes the decarboxylation reaction of lignin monomers and phenolic compounds such as p-coumaric acid, caffeic acid, and ferulic acid into their corresponding 4-vinyl derivatives, that is, 4-vinylphenol, 4-vinylcatechol, and 4-vinylguaiacol, respectively. Among various ferulic acid decarboxylase enzymes, we chose the FADase from Enterobacter sp. Px6-4, whose crystal structure is known, and produced mutants to enhance its catalytic activity by random and site-directed mutagenesis. After three rounds of sequential mutations, FADase(F95L/D112N/V151I) showed approximately 34-fold higher catalytic activity than wild-type for the production of 4-vinylguaiacol from ferulic acid. Docking analyses suggested that the increased activity of FADase(F95L/D112N/V151I) could be due to formation of compact active site compared with that of the wild-type FADase. Considering the amount of phenolic compounds such as lignin monomers in the biomass components, successfully bioengineered FADase(F95L/D112N/V151I) from Enterobacter sp. Px6-4 could provide an ecofriendly biocatalytic tool for producing diverse styrene derivatives from biomass.

Triazole-linked DNA as a primer surrogate in the synthesis of first-strand cDNA.

Science.gov (United States)

Fujino, Tomoko; Yasumoto, Ken-ichi; Yamazaki, Naomi; Hasome, Ai; Sogawa, Kazuhiro; Isobe, Hiroyuki

2011-11-04

A phosphate-eliminated nonnatural oligonucleotide serves as a primer surrogate in reverse transcription reaction of mRNA. Despite of the nonnatural triazole linkages in the surrogate, the reverse transcriptase effectively elongated cDNA sequences on the 3'-downstream of the primer by transcription of the complementary sequence of mRNA. A structure-activity comparison with the reference natural oligonucleotides shows the superior priming activity of the surrogate containing triazole-linkages. The nonnatural linkages also protect the transcribed cDNA from digestion reactions with 5'-exonuclease and enable us to remove noise transcripts of unknown origins. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Data on internal cDNA amplification and color changes of the proteins derived from Pacific white leg shrimp shell.

Science.gov (United States)

Chuang, Pan; Shoichiro, Ishizaki; Yuji, Nagashima; Jialong, Gao; Shugo, Watabe

2018-02-01

In this article, we report original data on the designation of the primers for full-length cDNA amplification and the internal cDNA amplification of red color-related pigment-binding protein derived from shrimp shell. Data on the color shifts of different soluble proteins under 100 °C 10 min heat treatment and the effects of heating temperatures (from 30 to 100 °C) on the color changes of crude water-soluble proteins are also included in this report. For further details and experimental findings please refer to the article "Isolation and cDNA cloning of a novel red color-related pigment-binding protein derived from the shell of shrimp, Litopenaeus vannamei " (Chuang et al., 2017) [1].

Data on internal cDNA amplification and color changes of the proteins derived from Pacific white leg shrimp shell

Directory of Open Access Journals (Sweden)

Pan Chuang

2018-02-01

Full Text Available In this article, we report original data on the designation of the primers for full-length cDNA amplification and the internal cDNA amplification of red color-related pigment-binding protein derived from shrimp shell. Data on the color shifts of different soluble proteins under 100 °C 10 min heat treatment and the effects of heating temperatures (from 30 to 100 °C on the color changes of crude water-soluble proteins are also included in this report. For further details and experimental findings please refer to the article “Isolation and cDNA cloning of a novel red color-related pigment-binding protein derived from the shell of shrimp, Litopenaeus vannamei” (Chuang et al., 2017 [1].

Biochemical and chemical characterization of trifluoromethylglyoxal bis(guanylhydrazone), a close analog of the antileukemic drug mitoguazone.

Science.gov (United States)

Elo, H; Mutikainen, I

1988-01-01

In order to study the structure-activity relationships of bis(guanylhydrazone) type polyamine antimetabolites, trifluoromethylglyoxal bis(guanylhydrazone) (CF3-GBG), a close analog of the antileukemic drug methylglyoxal bis(guanylhydrazone) (mitoguazone, MGBG) was synthesized according to a novel modification of previous methods, yielding single crystals. Single-crystal X-ray crystallography revealed the presence of an isomer different from the one detected in the case of MGBG and all other bis(guanylhydrazones) so far studied. In contrast to MGBG, CF3-GBG was shown to be a very weak inhibitor of yeast adenosylmethionine decarboxylase, being thus devoid of value as a polyamine antimetabolite. In addition, the compound did not have antiproliferative activity against mouse L1210 leukemia cells in vitro. As long as analogous isomers of the two compounds are not available, no conclusions can be drawn about the reasons lying behind the drastical differences between their biological properties.

Consistent errors in first strand cDNA due to random hexamer mispriming.

Directory of Open Access Journals (Sweden)

Thomas P van Gurp

Full Text Available Priming of random hexamers in cDNA synthesis is known to show sequence bias, but in addition it has been suggested recently that mismatches in random hexamer priming could be a cause of mismatches between the original RNA fragment and observed sequence reads. To explore random hexamer mispriming as a potential source of these errors, we analyzed two independently generated RNA-seq datasets of synthetic ERCC spikes for which the reference is known. First strand cDNA synthesized by random hexamer priming on RNA showed consistent position and nucleotide-specific mismatch errors in the first seven nucleotides. The mismatch errors found in both datasets are consistent in distribution and thermodynamically stable mismatches are more common. This strongly indicates that RNA-DNA mispriming of specific random hexamers causes these errors. Due to their consistency and specificity, mispriming errors can have profound implications for downstream applications if not dealt with properly.

An improved method for RNA isolation and cDNA library construction from immature seeds of Jatropha curcas L

Directory of Open Access Journals (Sweden)

Kaur Jatinder

2010-05-01

Full Text Available Abstract Background RNA quality and quantity is sometimes unsuitable for cDNA library construction, from plant seeds rich in oil, polysaccharides and other secondary metabolites. Seeds of jatropha (Jatropha curcas L. are rich in fatty acids/lipids, storage proteins, polysaccharides, and a number of other secondary metabolites that could either bind and/or co-precipitate with RNA, making it unsuitable for downstream applications. Existing RNA isolation methods and commercial kits often fail to deliver high-quality total RNA from immature jatropha seeds for poly(A+ RNA purification and cDNA synthesis. Findings A protocol has been developed for isolating good quality total RNA from immature jatropha seeds, whereby a combination of the CTAB based RNA extraction method and a silica column of a commercial plant RNA extraction kit is used. The extraction time was reduced from two days to about 3 hours and the RNA was suitable for poly(A+ RNA purification, cDNA synthesis, cDNA library construction, RT-PCR, and Northern hybridization. Based on sequence information from selected clones and amplified PCR product, the cDNA library seems to be a good source of full-length jatropha genes. The method was equally effective for isolating RNA from mustard and rice seeds. Conclusions This is a simple CTAB + silica column method to extract high quality RNA from oil rich immature jatropha seeds that is suitable for several downstream applications. This method takes less time for RNA extraction and is equally effective for other tissues where the quality and quantity of RNA is highly interfered by the presence of fatty acids, polysaccharides and polyphenols.

Crystal Structures of Apo and Liganded 4-Oxalocrotonate Decarboxylase Uncover a Structural Basis for the Metal-Assisted Decarboxylation of a Vinylogous β-Keto Acid.

Science.gov (United States)

Guimarães, Samuel L; Coitinho, Juliana B; Costa, Débora M A; Araújo, Simara S; Whitman, Christian P; Nagem, Ronaldo A P

2016-05-10

The enzymes in the catechol meta-fission pathway have been studied for more than 50 years in several species of bacteria capable of degrading a number of aromatic compounds. In a related pathway, naphthalene, a toxic polycyclic aromatic hydrocarbon, is fully degraded to intermediates of the tricarboxylic acid cycle by the soil bacteria Pseudomonas putida G7. In this organism, the 83 kb NAH7 plasmid carries several genes involved in this biotransformation process. One enzyme in this route, NahK, a 4-oxalocrotonate decarboxylase (4-OD), converts 2-oxo-3-hexenedioate to 2-hydroxy-2,4-pentadienoate using Mg(2+) as a cofactor. Efforts to study how 4-OD catalyzes this decarboxylation have been hampered because 4-OD is present in a complex with vinylpyruvate hydratase (VPH), which is the next enzyme in the same pathway. For the first time, a monomeric, stable, and active 4-OD has been expressed and purified in the absence of VPH. Crystal structures for NahK in the apo form and bonded with five substrate analogues were obtained using two distinct crystallization conditions. Analysis of the crystal structures implicates a lid domain in substrate binding and suggests roles for specific residues in a proposed reaction mechanism. In addition, we assign a possible function for the NahK N-terminal domain, which differs from most of the other members of the fumarylacetoacetate hydrolase superfamily. Although the structural basis for metal-dependent β-keto acid decarboxylases has been reported, this is the first structural report for that of a vinylogous β-keto acid decarboxylase and the first crystal structure of a 4-OD.

Cloning and chromosomal assignment of a human cDNA encoding a T cell- and natural killer cell-specific trypsin-like serine protease

International Nuclear Information System (INIS)

Gershenfeld, H.K.; Hershberger, R.J.; Shows, T.B.; Weissman, I.L.

1988-01-01

A cDNA clone encoding a human T cell- and natural killer cell-specific serine protease was obtained by screening a phage λgt10 cDNA library from phytohemagglutinin-stimulated human peripheral blood lymphocytes with the mouse Hanukah factor cDNA clone. In an RNA blot-hybridization analysis, this human Hanukah factor cDNA hybridized with a 1.3-kilobase band in allogeneic-stimulated cytotoxic T cells and the Jurkat cell line, but this transcript was not detectable in normal muscle, liver, tonsil, or thymus. By dot-blot hybridization, this cDNA hybridized with RNA from three cytolytic T-cell clones and three noncytolytic T-cell clones grown in vitro as well as with purified CD16 + natural killer cells and CD3 + , CD16 - T-cell large granular lymphocytes from peripheral blood lymphocytes (CD = cluster designation). The nucleotide sequence of this cDNA clone encodes a predicted serine protease of 262 amino acids. The active enzyme is 71% and 77% similar to the mouse sequence at the amino acid and DNA level, respectively. The human and mouse sequences conserve the active site residues of serine proteases--the trypsin-specific Asp-189 and all 10 cysteine residues. The gene for the human Hanukah factor serine protease is located on human chromosome 5. The authors propose that this trypsin-like serine protease may function as a common component necessary for lysis of target cells by cytotoxic T lymphocytes and natural killer cells

Cloning the human lysozyme cDNA: Inverted Alu repeat in the mRNA and in situ hybridization for macrophages and Paneth cells

International Nuclear Information System (INIS)

Chung, L.P.; Keshav, S.; Gordon, S.

1988-01-01

Lysozyme is a major secretory product of human and rodent macrophages and a useful marker for myelomonocytic cells. Based on the known human lysozyme amino acid sequence, oligonucleotides were synthesized and used as probes to screen a phorbol 12-myristate 13-acetate-treated U937 cDNA library. A full-length human lysozyme cDNA clone, pHL-2, was obtained and characterized. Sequence analysis shows that human lysozyme, like chicken lysozyme, has in 18-amino-acid-long signal peptide, but unlike the chicken lysozyme cDNA, the human lysozyme cDNA has a >1-kilobase-long 3' nontranslated sequence. Interestingly, within this 3' region, an inverted repeat of the Alu family of repetitive sequences was discovered. In RNA blot analyses, DNA probes prepared from pHL-2 can be used to detect lysozyme mRNA not only from human but also from mouse and rat. Moreover, by in situ hybridization, complementary RNA transcripts have been used as probes to detect lysozyme mRNA in mouse macrophages and Paneth cells. This human lysozyme cDNA clone is therefore likely to be a useful molecular probe for studying macrophage distribution and gene expression

cDNA cloning and expression of a human platelet-derived growth factor (PDGF) receptor specific for B-chain-containing PDGF molecules

International Nuclear Information System (INIS)

Claesson-Welsh, L.; Eriksson, A.; Moren, A.; Severinsson, L.; Ek, B.; Ostman, A.; Betsholtz, C.; Heldin, C.H.

1988-01-01

The structure of the human receptor for platelet-derived growth factor (PDGF) has been deduced through cDNA cloning. A 5.45-kilobase-pair cDNA clone predicts a 1,106-amino-acid polypeptide, including the cleavable signal sequence. The overall amino acid sequence similarity with the murine PDGFR receptor is 85%. After transcription of the cDNA and translation in vitro, a PDGR receptor antiserum was used to immunoprecipitate a product of predicted size, which also could be phosphorylated in vitro. Stable introduction of the cDNA into Chinese hamster ovary (CHO) cells led to the expression of a 190-kilodalton component, which was immunoprecipitated by the PDGF receptor antiserum; this most probably represents the mature PDGF receptor. Binding assays with different /sup 125/I-labeled dimeric forms of PDGF A and B chains showed that the PDGFR receptor expressed in CHO cells bound PDGF-BB and, to a lesser extent, PDGF-AB, but not PDGF-AA

Isolation and characterisation of the cDNA encoding a glycosylated accessory protein of pea chloroplast DNA polymerase.

OpenAIRE

Gaikwad, A; Tewari, K K; Kumar, D; Chen, W; Mukherjee, S K

1999-01-01

The cDNA encoding p43, a DNA binding protein from pea chloroplasts (ct) that binds to cognate DNA polymerase and stimulates the polymerase activity, has been cloned and characterised. The characteristic sequence motifs of hydroxyproline-rich glyco-proteins (HRGP) are present in the cDNA corres-ponding to the N-terminal domain of the mature p43. The protein was found to be highly O-arabinosylated. Chemically deglycosylated p43 (i.e. p29) retains its binding to both DNA and pea ct-DNA polymeras...

Cloning and sequencing of Indian Water buffalo (Bubalus bubalis) interleukin-3 cDNA

KAUST Repository

Sugumar, Thennarasu; Harishankar, M.; Dhinakar Raj, G.

2011-01-01

Full-length cDNA (435 bp) of the interleukin-3(IL-3) gene of the Indian water buffalo was amplified by reverse transcriptase-polymerase chain reaction and sequenced. This sequence had 96% nucleotide identity and 92% amino acid identity with bovine

Histidine Decarboxylase Deficiency Prevents Autoimmune Diabetes in NOD Mice

Directory of Open Access Journals (Sweden)

Manal Alkan

2015-01-01

Full Text Available Recent evidence has highlighted the role of histamine in inflammation. Since this monoamine has also been strongly implicated in the pathogenesis of type-1 diabetes, we assessed its effect in the nonobese diabetic (NOD mouse model. To this end, we used mice (inactivated knocked out for the gene encoding histidine decarboxylase, the unique histamine-forming enzyme, backcrossed on a NOD genetic background. We found that the lack of endogenous histamine in NOD HDC−/− mice decreased the incidence of diabetes in relation to their wild-type counterpart. Whereas the proportion of regulatory T and myeloid-derived suppressive cells was similar in both strains, histamine deficiency was associated with increased levels of immature macrophages, as compared with wild-type NOD mice. Concerning the cytokine pattern, we found a decrease in circulating IL-12 and IFN-γ in HDC−/− mice, while IL-6 or leptin remained unchanged, suggesting that histamine primarily modulates the inflammatory environment. Paradoxically, exogenous histamine given to NOD HDC−/− mice provided also protection against T1D. Our study supports the notion that histamine is involved in the pathogenesis of diabetes, thus providing additional evidence for its role in the regulation of the immune response.

L-Dopa decarboxylase expression profile in human cancer cells.

Science.gov (United States)

Chalatsa, Ioanna; Nikolouzou, Eleftheria; Fragoulis, Emmanuel G; Vassilacopoulou, Dido

2011-02-01

L-Dopa decarboxylase (DDC) catalyses the decarboxylation of L-Dopa. It has been shown that the DDC gene undergoes alternative splicing within its 5'-untranslated region (UTR), in a tissue-specific manner, generating identical protein products. The employment of two alternative 5'UTRs is thought to be responsible for tissue-specific expression of the human DDC mRNA. In this study, we focused on the investigation of the nature of the mRNA expression in human cell lines of neural and non-neural origin. Our results show the expression of a neural-type DDC mRNA splice variant, lacking exon 3 in all cell lines studied. Co-expression of the full length non-neural DDC mRNA and the neural-type DDC splice variant lacking exon 3 was detected in all cell lines. The alternative DDC protein isoform, Alt-DDC, was detected in SH-SY5Y and HeLa cells. Our findings suggest that the human DDC gene undergoes complex processing, leading to the formation of multiple mRNA isoforms. The study of the significance of this phenomenon of multiple DDC mRNA isoforms could provide us with new information leading to the elucidation of the complex biological pathways that the human enzyme is involved in.

Pattern analysis approach reveals restriction enzyme cutting abnormalities and other cDNA library construction artifacts using raw EST data

Directory of Open Access Journals (Sweden)

Zhou Sun

2012-05-01

Full Text Available Abstract Background Expressed Sequence Tag (EST sequences are widely used in applications such as genome annotation, gene discovery and gene expression studies. However, some of GenBank dbEST sequences have proven to be “unclean”. Identification of cDNA termini/ends and their structures in raw ESTs not only facilitates data quality control and accurate delineation of transcription ends, but also furthers our understanding of the potential sources of data abnormalities/errors present in the wet-lab procedures for cDNA library construction. Results After analyzing a total of 309,976 raw Pinus taeda ESTs, we uncovered many distinct variations of cDNA termini, some of which prove to be good indicators of wet-lab artifacts, and characterized each raw EST by its cDNA terminus structure patterns. In contrast to the expected patterns, many ESTs displayed complex and/or abnormal patterns that represent potential wet-lab errors such as: a failure of one or both of the restriction enzymes to cut the plasmid vector; a failure of the restriction enzymes to cut the vector at the correct positions; the insertion of two cDNA inserts into a single vector; the insertion of multiple and/or concatenated adapters/linkers; the presence of 3′-end terminal structures in designated 5′-end sequences or vice versa; and so on. With a close examination of these artifacts, many problematic ESTs that have been deposited into public databases by conventional bioinformatics pipelines or tools could be cleaned or filtered by our methodology. We developed a software tool for Abnormality Filtering and Sequence Trimming for ESTs (AFST, http://code.google.com/p/afst/ using a pattern analysis approach. To compare AFST with other pipelines that submitted ESTs into dbEST, we reprocessed 230,783 Pinus taeda and 38,709 Arachis hypogaea GenBank ESTs. We found 7.4% of Pinus taeda and 29.2% of Arachis hypogaea GenBank ESTs are “unclean” or abnormal, all of which could be cleaned

Cloning, sequencing and expression of a novel xylanase cDNA from ...

African Journals Online (AJOL)

STORAGESEVER

2008-12-03

Dec 3, 2008 ... First strand cDNA was synthesized by RT-PCR with Oligo(dT)15 using mRNA isolated ... 4°C. Single colonies were picked into 5 mL BMGY medium for preculture, and incubated ... to fold properly into a native conformation. Without the .... polymorphism is often used in taxonomy, but now, it is being well ...

Differential representation of sunflower ESTs in enriched organ-specific cDNA libraries in a small scale sequencing project

Directory of Open Access Journals (Sweden)

Heinz Ruth A

2003-09-01

Full Text Available Abstract Background Subtractive hybridization methods are valuable tools for identifying differentially regulated genes in a given tissue avoiding redundant sequencing of clones representing the same expressed genes, maximizing detection of low abundant transcripts and thus, affecting the efficiency and cost effectiveness of small scale cDNA sequencing projects aimed to the specific identification of useful genes for breeding purposes. The objective of this work is to evaluate alternative strategies to high-throughput sequencing projects for the identification of novel genes differentially expressed in sunflower as a source of organ-specific genetic markers that can be functionally associated to important traits. Results Differential organ-specific ESTs were generated from leaf, stem, root and flower bud at two developmental stages (R1 and R4. The use of different sources of RNA as tester and driver cDNA for the construction of differential libraries was evaluated as a tool for detection of rare or low abundant transcripts. Organ-specificity ranged from 75 to 100% of non-redundant sequences in the different cDNA libraries. Sequence redundancy varied according to the target and driver cDNA used in each case. The R4 flower cDNA library was the less redundant library with 62% of unique sequences. Out of a total of 919 sequences that were edited and annotated, 318 were non-redundant sequences. Comparison against sequences in public databases showed that 60% of non-redundant sequences showed significant similarity to known sequences. The number of predicted novel genes varied among the different cDNA libraries, ranging from 56% in the R4 flower to 16 % in the R1 flower bud library. Comparison with sunflower ESTs on public databases showed that 197 of non-redundant sequences (60% did not exhibit significant similarity to previously reported sunflower ESTs. This approach helped to successfully isolate a significant number of new reported sequences

Development of Gene Expression Fingerprints for Identification of Environmental Contaminants Using cDNA Arrays

National Research Council Canada - National Science Library

Inouye, L

2004-01-01

...) to develop cDNA array-based assays that map gene expression from contaminant exposures. Results substantiate that distinct gene expression profiles exist for major contaminant classes such as PARs, PCBs, and PCDD/Fs...

Reactions of Ferrous Coproheme Decarboxylase (HemQ) with O2 and H2O2 Yield Ferric Heme b.

Science.gov (United States)

Streit, Bennett R; Celis, Arianna I; Shisler, Krista; Rodgers, Kenton R; Lukat-Rodgers, Gudrun S; DuBois, Jennifer L

2017-01-10

A recently discovered pathway for the biosynthesis of heme b ends in an unusual reaction catalyzed by coproheme decarboxylase (HemQ), where the Fe(II)-containing coproheme acts as both substrate and cofactor. Because both O 2 and H 2 O 2 are available as cellular oxidants, pathways for the reaction involving either can be proposed. Analysis of reaction kinetics and products showed that, under aerobic conditions, the ferrous coproheme-decarboxylase complex is rapidly and selectively oxidized by O 2 to the ferric state. The subsequent second-order reaction between the ferric complex and H 2 O 2 is slow, pH-dependent, and further decelerated by D 2 O 2 (average kinetic isotope effect of 2.2). The observation of rapid reactivity with peracetic acid suggested the possible involvement of Compound I (ferryl porphyrin cation radical), consistent with coproheme and harderoheme reduction potentials in the range of heme proteins that heterolytically cleave H 2 O 2 . Resonance Raman spectroscopy nonetheless indicated a remarkably weak Fe-His interaction; how the active site structure may support heterolytic H 2 O 2 cleavage is therefore unclear. From a cellular perspective, the use of H 2 O 2 as an oxidant in a catalase-positive organism is intriguing, as is the unusual generation of heme b in the Fe(III) rather than Fe(II) state as the end product of heme synthesis.

Autoantibodies against voltage-gated potassium channel and glutamic acid decarboxylase in psychosis: A systematic review, meta-analysis, and case series.

OpenAIRE

Grain, Rosemary; Lally, John; Stubbs, Brendon; Malik, Steffi; LeMince, Anne; Nicholson, Timothy R; Murray, Robin M; Gaughran, Fiona

2017-01-01

Antibodies to the voltage-gated potassium channel (VGKC) complex and glutamic acid decarboxylase (GAD) have been reported in some cases of psychosis. We conducted the first systematic review and meta-analysis to investigate their prevalence in people with psychosis and report a case series of VGKC-complex antibodies in refractory psychosis. Only five studies presenting prevalence rates of VGKC seropositivity in psychosis were identified, in addition to our case series, with an overall prevale...

Lack of Association Between Polymorphisms in Dopa Decarboxylase and Dopamine Receptor-1 Genes With Childhood Autism in Chinese Han Population.

Science.gov (United States)

Yu, Hong; Liu, Jun; Yang, Aiping; Yang, Guohui; Yang, Wenjun; Lei, Heyue; Quan, Jianjun; Zhang, Zengyu

2016-04-01

Genetic factors play an important role in childhood autism. This study is to determine the association of single-nucleotide polymorphisms in dopa decarboxylase (DDC) and dopamine receptor-1 (DRD1) genes with childhood autism, in a Chinese Han population. A total of 211 autistic children and 250 age- and gender-matched healthy controls were recruited. The severity of disease was determined by Children Autism Rating Scale scores. TaqMan Probe by real-time polymerase chain reaction was used to determine genotypes and allele frequencies of single-nucleotide polymorphism rs6592961 in DDC and rs251937 in DRD1. Case-control and case-only studies were respectively performed, to determine the contribution of both single-nucleotide polymorphisms to the predisposition of disease and its severity. Our results showed that there was no significant association of the genotypes and allele frequencies of both single-nucleotide polymorphisms concerning childhood autism and its severity. More studies with larger samples are needed to corroborate their predicting roles. © The Author(s) 2015.

Interaction of Polyamines, Abscisic Acid, Nitric Oxide, and Hydrogen Peroxide under Chilling Stress in Tomato (Lycopersicon esculentum Mill.) Seedlings.

Science.gov (United States)

Diao, Qiannan; Song, Yongjun; Shi, Dongmei; Qi, Hongyan

2017-01-01

Polyamines (PAs) play a vital role in the responses of higher plants to abiotic stresses. However, only a limited number of studies have examined the interplay between PAs and signal molecules. The aim of this study was to elucidate the cross-talk among PAs, abscisic acid (ABA), nitric oxide (NO), and hydrogen peroxide (H 2 O 2 ) under chilling stress conditions using tomato seedlings [( Lycopersicon esculentum Mill.) cv. Moneymaker]. The study showed that during chilling stress (4°C; 0, 12, and 24 h), the application of spermidine (Spd) and spermine (Spm) elevated NO and H 2 O 2 levels, enhanced nitrite reductase (NR), nitric oxide synthase (NOS)-like, and polyamine oxidase activities, and upregulated LeNR relative expression, but did not influence LeNOS1 expression. In contrast, putrescine (Put) treatment had no obvious impact. During the recovery period (25/15°C, 10 h), the above-mentioned parameters induced by the application of PAs were restored to their control levels. Seedlings pretreated with sodium nitroprusside (SNP, an NO donor) showed elevated Put and Spd levels throughout the treatment period, consistent with increased expression in leaves of genes encoding arginine decarboxylase ( LeADC. LeADC1 ), ornithine decarboxylase ( LeODC ), and Spd synthase ( LeSPDS ) expressions in tomato leaves throughout the treatment period. Under chilling stress, the Put content increased first, followed by a rise in the Spd content. Exogenously applied SNP did not increase the expression of genes encoding S -adenosylmethionine decarboxylase ( LeSAMDC ) and Spm synthase ( LeSPMS ), consistent with the observation that Spm levels remained constant under chilling stress and during the recovery period. In contrast, exogenous Put significantly increased the ABA content and the 9- cis -epoxycarotenoid dioxygenase ( LeNCED1 ) transcript level. Treatment with ABA could alleviate the electrolyte leakage (EL) induced by D-Arg (an inhibitor of Put). Taken together, it is

Evaluation of the performance of different plastics used to seal nylon cDNA arrays Avaliação da performance de diferentes plásticos usados para selar arranjos de cDNA em náilon

Directory of Open Access Journals (Sweden)

Antônio Paulino da Costa Netto

2009-01-01

Full Text Available cDNA arrays are a powerful tool for discovering gene expression patterns. Nylon arrays have the advantage that they can be re-used several times. A key issue in high throughput gene expression analysis is sensitivity. In the case of nylon arrays, signal detection can be affected by the plastic bags used to keep membranes humid. In this study, we evaluated the effect of five types of plastics on the radioactive transmittance, number of genes with a signal above the background, and data variability. A polyethylene plastic bag 69 μm thick had a strong shielding effect that blocked 68.7% of the radioactive signal. The shielding effect on transmittance decreased the number of detected genes and increased the data variability. Other plastics which were thinner gave better results. Although plastics made from polyvinylidene chloride, polyvinyl chloride (both 13 μm thick and polyethylene (29 and 7 μm thick showed different levels of transmittance, they all gave similarly good performances. Polyvinylidene chloride and polyethylene 29 mm thick were the plastics of choice because of their easy handling. For other types of plastics, it is advisable to run a simple check on their performance in order to obtain the maximum information from nylon cDNA arrays.Os arranjos de cDNA são uma poderosa ferramenta para o estudo de padrões de expressão gênica. Os arranjos em membranas de náilon apresentam ainda a vantagem de poderem ser reutilizados diversas vezes. Porém, um ponto bastante delicado em estudos de expressão gênica em larga escala é a sensibilidade. No caso de arranjos em membranas de náilon, a detecção dos sinais pode ser afetada pelo envoltório plástico utilizado para manter as membranas úmidas. Nesse estudo, nós avaliamos os efeitos de cinco tipos de plásticos na transmissão radioativa detectada, no número de genes com sinal acima da emissão de fundo e na variabilidade dos dados. O plástico produzido com polietileno com 69 μm de

Discovery and characterization of gut microbiota decarboxylases that can produce the neurotransmitter tryptamine.

Science.gov (United States)

Williams, Brianna B; Van Benschoten, Andrew H; Cimermancic, Peter; Donia, Mohamed S; Zimmermann, Michael; Taketani, Mao; Ishihara, Atsushi; Kashyap, Purna C; Fraser, James S; Fischbach, Michael A

2014-10-08

Several recent studies describe the influence of the gut microbiota on host brain and behavior. However, the mechanisms responsible for microbiota-nervous system interactions are largely unknown. Using a combination of genetics, biochemistry, and crystallography, we identify and characterize two phylogenetically distinct enzymes found in the human microbiome that decarboxylate tryptophan to form the β-arylamine neurotransmitter tryptamine. Although this enzymatic activity is exceedingly rare among bacteria more broadly, analysis of the Human Microbiome Project data demonstrate that at least 10% of the human population harbors at least one bacterium encoding a tryptophan decarboxylase in their gut community. Our results uncover a previously unrecognized enzymatic activity that can give rise to host-modulatory compounds and suggests a potential direct mechanism by which gut microbiota can influence host physiology, including behavior. Copyright © 2014 Elsevier Inc. All rights reserved.

Microarray and cDNA sequence analysis of transcription during nerve-dependent limb regeneration

Directory of Open Access Journals (Sweden)

Bryant Susan V

2009-01-01

Full Text Available Abstract Background Microarray analysis and 454 cDNA sequencing were used to investigate a centuries-old problem in regenerative biology: the basis of nerve-dependent limb regeneration in salamanders. Innervated (NR and denervated (DL forelimbs of Mexican axolotls were amputated and transcripts were sampled after 0, 5, and 14 days of regeneration. Results Considerable similarity was observed between NR and DL transcriptional programs at 5 and 14 days post amputation (dpa. Genes with extracellular functions that are critical to wound healing were upregulated while muscle-specific genes were downregulated. Thus, many processes that are regulated during early limb regeneration do not depend upon nerve-derived factors. The majority of the transcriptional differences between NR and DL limbs were correlated with blastema formation; cell numbers increased in NR limbs after 5 dpa and this yielded distinct transcriptional signatures of cell proliferation in NR limbs at 14 dpa. These transcriptional signatures were not observed in DL limbs. Instead, gene expression changes within DL limbs suggest more diverse and protracted wound-healing responses. 454 cDNA sequencing complemented the microarray analysis by providing deeper sampling of transcriptional programs and associated biological processes. Assembly of new 454 cDNA sequences with existing expressed sequence tag (EST contigs from the Ambystoma EST database more than doubled (3935 to 9411 the number of non-redundant human-A. mexicanum orthologous sequences. Conclusion Many new candidate gene sequences were discovered for the first time and these will greatly enable future studies of wound healing, epigenetics, genome stability, and nerve-dependent blastema formation and outgrowth using the axolotl model.

A jojoba beta-Ketoacyl-CoA synthase cDNA complements the canola fatty acid elongation mutation in transgenic plants.

Science.gov (United States)

Lassner, M W; Lardizabal, K; Metz, J G

1996-02-01

beta-Ketoacyl-coenzyme A (CoA) synthase (KCS) catalyzes the condensation of malonyl-CoA with long-chain acyl-CoA. This reaction is the initial step of the microsomal fatty acyl-CoA elongation pathway responsible for formation of very long chain fatty acids (VLCFAs, or fatty acids with chain lengths > 18 carbons). Manipulation of this pathway is significant for agriculture, because it is the basis of conversion of high erucic acid rapeseed into canola. High erucic acid rapeseed oil, used as an industrial feedstock, is rich in VLCFAs, whereas the edible oil extracted from canola is essentially devoid of VLCFAs. Here, we report the cloning of a cDNA from developing jojoba embryos involved in microsomal fatty acid elongation. The jojoba cDNA is homologous to the recently cloned Arabidopsis FATTY ACID ELONGATION1 (FAE1) gene that has been suggested to encode KCS. We characterize the jojoba enzyme and present biochemical data indicating that the jojoba cDNA does indeed encode KCS. Transformation of low erucic acid rapeseed with the jojoba cDNA restored KCS activity to developing embryos and altered the transgenic seed oil composition to contain high levels of VLCFAs. The data reveal the key role KCS plays in determining the chain lengths of fatty acids found in seed oils.

Structure and characterization of a cDNA clone for phenylalanine ammonia-lyase from cut-injured roots of sweet potato

International Nuclear Information System (INIS)

Tanaka, Yoshiyuki; Matsuoka, Makoto; Yamanoto, Naoki; Ohashi, Yuko; Kano-Murakami, Yuriko; Ozeki, Yoshihiro

1989-01-01

A cDNA clone for phenylalanine ammonia-lyase (PAL) induced in wounded sweet potato (Ipomoea batatas Lam.) root was obtained by immunoscreening a cDNA library. The protein produced in Escherichia coli cells containing the plasmid pPAL02 was indistinguishable from sweet potato PAL as judged by Ouchterlony double diffusion assays. The M r of its subunit was 77,000. The cells converted [ 14 C]-L-phenylalanine into [ 14 C]-t-cinnamic acid and PAL activity was detected in the homogenate of the cells. The activity was dependent on the presence of the pPAL02 plasmid DNA. The nucleotide sequence of the cDNA contained a 2,121-base pair (bp) open-reading frame capable of coding for a polypeptide with 707 amino acids (M r 77,137), a 22-bp 5'-noncoding region and a 207-bp 3'-noncoding region. The results suggest that the insert DNA fully encoded the amino acid sequence for sweet potato PAL that is induced by wounding. Comparison of the deduced amino acid sequence with that of a PAL cDNA fragment from Phaseolus vulgaris revealed 78.9% homology. The sequence from amino acid residues 258 to 494 was highly conserved, showing 90.7% homology

Construcción de una genoteca de cDNA de fríjol (Phaseolus vulgaris L. para mapeo genético

Directory of Open Access Journals (Sweden)

Roca William M.

1995-06-01

Full Text Available

A small cDNA library from beans (Phaseolus vulgaris L. of about 1500 clones was constructed, to further saturate the bean RFLP linkage map. The primarily synthesized cDNAs were amplified by PCR using the adaptors as primers for amplification (Jepson et al., 1991. Inserts in the range of 500 bp were obtained. 93 clones were singled for further analysis. They showed a degree of repeatibility of around 61 %. Around 80% of the unique clones were single copy, and 20% were low copy sequences as expected from a cDNA library. Three pairs of parental bean lines were chosen for their agronomical traits, and evaluated for polymorphism, which was highest as revealed by digestion with EcoRV (77%, followed by DraI (73%, EcoRI (63% and HindIIl (60%. The highest polymorphism was observed between the pair DOR60 and APNI8, 71% for EcoRV and 57% for EcoRI, respectively. Two clones of the two groups with the most repeated clones were analyzed by slot blot hybridization against the other clones and ribosomal DNA, to understand the origin of the repetitions. Only one clone seemed to be of ribosomal origin, as confirmed by the patterns obtained by hybridization to bean genomic DNA digested with HaelIl, implying that the whole group to which it belonged was of ribosomal origin.  It can be explained by the combined utilization of the PCR amplification methodology and the multipleprimers for the synthesis of the first cDNA strand.

Se construyó una pequeña librería de cDNA de fríjol (phaseolus vulgaris L. de alrededor de 1500 clones, con el fin de incrementar la saturación del mapa de ligamiento de fríjol con marcadores de RFLPs. Para la generación de la librería se utilizó la técnica de amplificación por PCR (Jepson et al., 1991. En ella se utilizan como iniciadores para la reacción los mismos adaptadores empleados para generar los terminales cohesivos del cDNA. Se obtuvieron insertos con un promedio de 500 pares de bases. Se aislaron 93 clones, los

Cloning of human tumor necrosis factor (TNF) receptor cDNA and expression of recombinant soluble TNF-binding protein

International Nuclear Information System (INIS)

Gray, P.W.; Barrett, K.; Chantry, D.; Turner, M.; Feldmann, M.

1990-01-01

The cDNA for one of the receptors for human tumor necrosis factor (TNF) has been isolated. This cDNA encodes a protein of 455 amino acids that is divided into an extracellular domain of 171 residues and a cytoplasmic domain of 221 residues. The extracellular domain has been engineered for expression in mammalian cells, and this recombinant derivative binds TNFα with high affinity and inhibits its cytotoxic activity in vitro. The TNF receptor exhibits similarity with a family of cell surface proteins that includes the nerve growth factor receptor, the human B-cell surface antigen CD40, and the rat T-cell surface antigen OX40. The TNF receptor contains four cysteine-rich subdomains in the extracellular portion. Mammalian cells transfected with the entire TNF receptor cDNA bind radiolabeled TNFα with an affinity of 2.5 x 10 -9 M. This binding can be competitively inhibited with unlabeled TNFα or lymphotoxin (TNFβ)

Cloning of Human Tumor Necrosis Factor (TNF) Receptor cDNA and Expression of Recombinant Soluble TNF-Binding Protein

Science.gov (United States)

Gray, Patrick W.; Barrett, Kathy; Chantry, David; Turner, Martin; Feldmann, Marc

1990-10-01

The cDNA for one of the receptors for human tumor necrosis factor (TNF) has been isolated. This cDNA encodes a protein of 455 amino acids that is divided into an extracellular domain of 171 residues and a cytoplasmic domain of 221 residues. The extracellular domain has been engineered for expression in mammalian cells, and this recombinant derivative binds TNFα with high affinity and inhibits its cytotoxic activity in vitro. The TNF receptor exhibits similarity with a family of cell surface proteins that includes the nerve growth factor receptor, the human B-cell surface antigen CD40, and the rat T-cell surface antigen OX40. The TNF receptor contains four cysteine-rich subdomains in the extra-cellular portion. Mammalian cells transfected with the entire TNF receptor cDNA bind radiolabeled TNFα with an affinity of 2.5 x 10-9 M. This binding can be competitively inhibited with unlabeled TNFα or lymphotoxin (TNFβ).

Development of a porcine skeletal muscle cDNA microarray: analysis of differential transcript expression in phenotypically distinct muscles

Directory of Open Access Journals (Sweden)

Stear Michael

2003-03-01

Full Text Available Abstract Background Microarray profiling has the potential to illuminate the molecular processes that govern the phenotypic characteristics of porcine skeletal muscles, such as hypertrophy or atrophy, and the expression of specific fibre types. This information is not only important for understanding basic muscle biology but also provides underpinning knowledge for enhancing the efficiency of livestock production. Results We report on the de novo development of a composite skeletal muscle cDNA microarray, comprising 5500 clones from two developmentally distinct cDNA libraries (longissimus dorsi of a 50-day porcine foetus and the gastrocnemius of a 3-day-old pig. Clones selected for the microarray assembly were of low to moderate abundance, as indicated by colony hybridisation. We profiled the differential expression of genes between the psoas (red muscle and the longissimus dorsi (white muscle, by co-hybridisation of Cy3 and Cy5 labelled cDNA derived from these two muscles. Results from seven microarray slides (replicates correctly identified genes that were expected to be differentially expressed, as well as a number of novel candidate regulatory genes. Quantitative real-time RT-PCR on selected genes was used to confirm the results from the microarray. Conclusion We have developed a porcine skeletal muscle cDNA microarray and have identified a number of candidate genes that could be involved in muscle phenotype determination, including several members of the casein kinase 2 signalling pathway.

Characterization of proteins in soybean roots under flooding and drought stresses.

Science.gov (United States)

Oh, MyeongWon; Komatsu, Setsuko

2015-01-30

Flooding and drought affect soybean growth because soybean is a stress-sensitive crop. In 2-day-old plants exposed to 2-day flooding or drought, the fresh weight of roots was markedly suppressed, although the root morphology clearly differed between two conditions. To understand the response mechanisms of soybean to flooding and drought stresses, a gel-free proteomic technique was used. A total of 97 and 48 proteins were significantly changed in response to flooding and drought stresses, respectively. Proteins involved in protein synthesis were decreased by flooding stress and increased by drought. Glycolysis-related proteins were increased in roots by both flooding and drought stresses. Fermentation, stress, and cell wall-related proteins were increased in response to flooding stress, whereas cell organization and redox-related proteins were increased under drought stress. Among the identified proteins, three S-adenosylmethionine synthetases were commonly decreased and increased in response to flooding and drought stresses, respectively. The mRNA expression levels of S-adenosylmethionine synthetase genes displayed a similar tendency to the changes in protein abundance. These results suggest that S-adenosylmethionine synthetase is involved in the regulation of stress response because it was changed in response to flooding and drought stresses. This study reported on the response mechanisms of soybean to flooding and drought stresses using the gel-free proteomic technique. Proteins involved in protein synthesis were decreased by flooding stress and increased by drought. Glycolysis-related proteins were increased in roots by both flooding and drought stresses. Fermentation, stress, and cell wall-related proteins were increased in response to flooding stress, whereas cell organization and redox-related proteins were increased under drought stress. Among the identified proteins, three S-adenosylmethionine synthetases were commonly decreased and increased in response to

Construction of cDNA library and preliminary analysis of expressed sequence tags from Siberian tiger

Science.gov (United States)

Liu, Chang-Qing; Lu, Tao-Feng; Feng, Bao-Gang; Liu, Dan; Guan, Wei-Jun; Ma, Yue-Hui

2010-01-01

In this study we successfully constructed a full-length cDNA library from Siberian tiger, Panthera tigris altaica, the most well-known wild Animal. Total RNA was extracted from cultured Siberian tiger fibroblasts in vitro. The titers of primary and amplified libraries were 1.30×106 pfu/ml and 1.62×109 pfu/ml respectively. The proportion of recombinants from unamplified library was 90.5% and average length of exogenous inserts was 1.13 kb. A total of 282 individual ESTs with sizes ranging from 328 to 1,142bps were then analyzed the BLASTX score revealed that 53.9% of the sequences were classified as strong match, 38.6% as nominal and 7.4% as weak match. 28.0% of them were found to be related to enzyme/catalytic protein, 20.9% ESTs to metabolism, 13.1% ESTs to transport, 12.1% ESTs to signal transducer/cell communication, 9.9% ESTs to structure protein, 3.9% ESTs to immunity protein/defense metabolism, 3.2% ESTs to cell cycle, and 8.9 ESTs classified as novel genes. These results demonstrated that the reliability and representativeness of the cDNA library attained to the requirements of a standard cDNA library. This library provided a useful platform for the functional genomic research of Siberian tigers. PMID:20941376

Chromosomal Localization of DNA Amplifications in Neuroblastoma Tumors Using cDNA Microarray Comparative Genomic Hybridization

Directory of Open Access Journals (Sweden)

Ben Beheshti

2003-01-01

Full Text Available Conventional comparative genomic hybridization (CGH profiling of neuroblastomas has identified many genomic aberrations, although the limited resolution has precluded a precise localization of sequences of interest within amplicons. To map high copy number genomic gains in clinically matched stage IV neuroblastomas, CGH analysis using a 19,200-feature cDNA microarray was used. A dedicated (freely available algorithm was developed for rapid in silico determination of chromosomal localizations of microarray cDNA targets, and for generation of an ideogram-type profile of copy number changes. Using these methodologies, novel gene amplifications undetectable by chromosome CGH were identified, and larger MYCN amplicon sizes (in one tumor up to 6 Mb than those previously reported in neuroblastoma were identified. The genes HPCAL1, LPIN1/KIAA0188, NAG, and NSE1/LOC151354 were found to be coamplified with MYCN. To determine whether stage IV primary tumors could be further subclassified based on their genomic copy number profiles, hierarchical clustering was performed. Cluster analysis of microarray CGH data identified three groups: 1 no amplifications evident, 2 a small MYCN amplicon as the only detectable imbalance, and 3 a large MYCN amplicon with additional gene amplifications. Application of CGH to cDNA microarray targets will help to determine both the variation of amplicon size and help better define amplification-dependent and independent pathways of progression in neuroblastoma.

Screening and kinetics of glutaminase and glutamate decarboxylase producing lactic acid bacteria from fermented Thai foods

Directory of Open Access Journals (Sweden)

Sasimar Woraharn

2014-12-01

Full Text Available L-glutaminase and glutamic acid decarboxylase (GAD catalyzes the hydrolysis of L-glutamine and glutamate, respectively. L-glutaminase widely used in cancer therapy along with a combination of other enzymes and most importantly these enzymes were used in food industries, as a major catalyst of bioconversion. The current investigation was aimed to screen and select L-glutaminase, and GAD producing lactic acid bacteria (LAB. A total of 338 LAB were isolated from fermented meat, fermented fish, fermented soya bean, fermented vegetables and fruits. Among 338 isolates, 22 and 237 LAB has been found to be positive for L-glutaminase and GAD, respectively. We found that 30 days of incubation at 35 ºC and pH 6.0 was the optimum condition for glutaminase activity by G507/1. G254/2 was found to be the best for GAD activity with the optimum condition of pH 6.5, temperature 40 ºC and ten days of incubation. These LAB strains, G507/1 and G254/2, were identified as close relative of Lactobacillus brevis ATCC 14869 and Lactobacillus fermentum NBRC 3956, respectively by 16S rRNA sequencing. Further, improvements in up-stream of the fermentation process with these LAB strains are currently under development.

Mevalonate 5-diphosphate mediates ATP binding to the mevalonate diphosphate decarboxylase from the bacterial pathogen Enterococcus faecalis

Energy Technology Data Exchange (ETDEWEB)

Chen, Chun-Liang; Mermoud, James C.; Paul, Lake N.; Steussy, Calvin Nicklaus; Stauffacher, Cynthia V. (Purdue)

2017-10-12

The mevalonate pathway produces isopentenyl diphosphate (IPP), a building block for polyisoprenoid synthesis, and is a crucial pathway for growth of the human bacterial pathogen Enterococcus faecalis. The final enzyme in this pathway, mevalonate diphosphate decarboxylase (MDD), acts on mevalonate diphosphate (MVAPP) to produce IPP while consuming ATP. This essential enzyme has been suggested as a therapeutic target for the treatment of drug-resistant bacterial infections. Here, we report functional and structural studies on the mevalonate diphosphate decarboxylase from E. faecalis (MDDEF). The MDDEF crystal structure in complex with ATP (MDDEF–ATP) revealed that the phosphate-binding loop (amino acids 97–105) is not involved in ATP binding and that the phosphate tail of ATP in this structure is in an outward-facing position pointing away from the active site. This suggested that binding of MDDEF to MVAPP is necessary to guide ATP into a catalytically favorable position. Enzymology experiments show that the MDDEF performs a sequential ordered bi-substrate reaction with MVAPP as the first substrate, consistent with the isothermal titration calorimetry (ITC) experiments. On the basis of ITC results, we propose that this initial prerequisite binding of MVAPP enhances ATP binding. In summary, our findings reveal a substrate-induced substrate-binding event that occurs during the MDDEF-catalyzed reaction. The disengagement of the phosphate-binding loop concomitant with the alternative ATP-binding configuration may provide the structural basis for antimicrobial design against these pathogenic enterococci.

Ornithine decarboxylase activity in rat organs and tissues under artificial hypobiosis.

Science.gov (United States)

Aksyonova, G E; Logvinovich, O S; Fialkovskaya, L A; Afanasyev, V N; Ignat'ev, D A; Kolomiytseva, I K

2010-09-01

The influence of hypothermia-hypoxia-hypercapnia on ornithine decarboxylase (ODC, EC 4.1.1.17) activities in rat organs and tissues and also on the thymocyte distribution throughout the cell cycle stages was studied. The state of artificial hypobiosis in rats on decrease in the body temperature to 14.4-18.0°C during 3.0-3.5 h was accompanied by drops in the ODC activities in the neocortex and liver by 50-60% and in rapidly proliferating tissues (thymus, spleen, and small intestine mucosa) by 80% of the control value. In kidneys the ODC activity raised to 200% of the control level. Twenty-four hours after termination of the cooling and replacing the rats under the standard conditions, the ODC activities in the neocortex, liver, kidneys, spleen, and intestinal mucosa returned to the control values, but remained decreased in the thymus. Forty-eight hours later the ODC activities in the thymus and spleen exceeded the normal level. The distribution of thymocytes throughout the cell cycle stages did not change in rats in the state of hypothermia (hypobiosis); 24 and 48 h after termination of the cooling the fraction of thymocytes in the S stage was decreased and the fraction of the cells in the G(0)+G(1) stage was increased. The normal distribution of thymocytes throughout the cell cycle stages recovered in 72 h. Thus, in the thymus the diminution of the ODC activity preceded the suppression of the cell proliferation rate. The tissue-specific changes in the ODC activity are suggested to reflect adaptive changes in the functional and proliferative activities of organs and tissues during the development of hypobiosis under conditions of hypothermia-hypoxia-hypercapnia.

Nanoparticle-mediated rhodopsin cDNA but not intron-containing DNA delivery causes transgene silencing in a rhodopsin knockout model.

Science.gov (United States)

Zheng, Min; Mitra, Rajendra N; Filonov, Nazar A; Han, Zongchao

2016-03-01

Previously, we compared the efficacy of nanoparticle (NP)-mediated intron-containing rhodopsin (sgRho) vs. intronless cDNA in ameliorating retinal disease phenotypes in a rhodopsin knockout (RKO) mouse model of retinitis pigmentosa. We showed that NP-mediated sgRho delivery achieved long-term expression and phenotypic improvement in RKO mice, but not NP housing cDNA. However, the protein level of the NP-sgRho construct was only 5-10% of wild-type at 8 mo postinjection. To have a better understanding of the reduced levels of long-term expression of the vectors, in the present study, we evaluated the epigenetic changes of subretinal delivering NP-cDNA vs. NP-sgRho in the RKO mouse eyes. Following the administration, DNA methylation and histone status of specific regions (bacteria plasmid backbone, promoter, rhodopsin gene, and scaffold/matrix attachment region) of the vectors were evaluated at various time points. We documented that epigenetic transgene silencing occurred in vector-mediated gene transfer, which were caused by the plasmid backbone and the cDNA of the transgene, but not the intron-containing transgene. No toxicity or inflammation was found in the treated eyes. Our results suggest that cDNA of the rhodopsin transgene and bacteria backbone interfered with the host defense mechanism of DNA methylation-mediated transgene silencing through heterochromatin-associated modifications. © FASEB.

Molecular cloning of chicken metallothionein. Deduction of the complete amino acid sequence and analysis of expression using cloned cDNA

Energy Technology Data Exchange (ETDEWEB)

Wei, D; Andrews, G K

1988-01-25

A cDNA library was constructed using RNA isolated from the livers of chickens which had been treated with zinc. This library was screened with a RNA probe complementary to mouse metallothionein-I (MT), and eight chicken MT cDNA clones were obtained. All of the cDNA clones contained nucleotide sequences homologous to regions of the longest (375 bp) cDNA clone. The latter contained an open reading frame of 189 bp, and the deduced amino acid sequence indicates a protein of 63 amino acids of which 20 are cysteine residues. Amino acid composition and partial amino acid sequence analyses of purified chicken MT protein agreed with the amino acid composition and sequence deduced from the cloned cDNA. Amino acid sequence comparison establish that chicken MT shares extensive homology with mammalian MTs. Southern blot analysis of chicken DNA indicates that the chicken MT gene is not a part of a large family of related sequences, but rather is likely to be a unique gene sequence. In the chicken liver, levels of chicken MT mRNA were rapidly induced by metals (Cd/sup 2 +/, Zn/sup 2 +/, Cu/sup 2 +/), glucocorticoids and lipopolysaccharide. MT mRNA was present in low levels in embryonic liver and increased to high levels during the first week after hatching before decreasing again to the basal levels found in adult liver. The results of this study establish that MT is highly conserved between birds and mammals and is regulated in the chicken by agents which also regulate expression of mammalian MT genes. However, in contrast to the mammals, the results suggest the existence of a single isoform of MT in the chicken.

Identification of immune protective genes of Eimeria maxima through cDNA expression library screening.

Science.gov (United States)

Yang, XinChao; Li, MengHui; Liu, JianHua; Ji, YiHong; Li, XiangRui; Xu, LiXin; Yan, RuoFeng; Song, XiaoKai

2017-02-16

Eimeria maxima is one of the most prevalent Eimeria species causing avian coccidiosis, and results in huge economic loss to the global poultry industry. Current control strategies, such as anti-coccidial medication and live vaccines have been limited because of their drawbacks. The third generation anticoccidial vaccines including the recombinant vaccines as well as DNA vaccines have been suggested as a promising alternative strategy. To date, only a few protective antigens of E. maxima have been reported. Hence, there is an urgent need to identify novel protective antigens of E. maxima for the development of neotype anticoccidial vaccines. With the aim of identifying novel protective genes of E. maxima, a cDNA expression library of E. maxima sporozoites was constructed using Gateway technology. Subsequently, the cDNA expression library was divided into 15 sub-libraries for cDNA expression library immunization (cDELI) using parasite challenged model in chickens. Protective sub-libraries were selected for the next round of screening until individual protective clones were obtained, which were further sequenced and analyzed. Adopting the Gateway technology, a high-quality entry library was constructed, containing 9.2 × 10 6 clones with an average inserted fragments length of 1.63 kb. The expression library capacity was 2.32 × 10 7 colony-forming units (cfu) with an average inserted fragments length of 1.64 Kb. The expression library was screened using parasite challenged model in chickens. The screening yielded 6 immune protective genes including four novel protective genes of EmJS-1, EmRP, EmHP-1 and EmHP-2, and two known protective genes of EmSAG and EmCKRS. EmJS-1 is the selR domain-containing protein of E. maxima whose function is unknown. EmHP-1 and EmHP-2 are the hypothetical proteins of E. maxima. EmRP and EmSAG are rhomboid-like protein and surface antigen glycoproteins of E. maxima respectively, and involved in invasion of the parasite. Our

Characterization of full-length sequenced cDNA inserts (FLIcs) from Atlantic salmon (Salmo salar)

Science.gov (United States)

Andreassen, Rune; Lunner, Sigbjørn; Høyheim, Bjørn

2009-01-01

Background Sequencing of the Atlantic salmon genome is now being planned by an international research consortium. Full-length sequenced inserts from cDNAs (FLIcs) are an important tool for correct annotation and clustering of the genomic sequence in any species. The large amount of highly similar duplicate sequences caused by the relatively recent genome duplication in the salmonid ancestor represents a particular challenge for the genome project. FLIcs will therefore be an extremely useful resource for the Atlantic salmon sequencing project. In addition to be helpful in order to distinguish between duplicate genome regions and in determining correct gene structures, FLIcs are an important resource for functional genomic studies and for investigation of regulatory elements controlling gene expression. In contrast to the large number of ESTs available, including the ESTs from 23 developmental and tissue specific cDNA libraries contributed by the Salmon Genome Project (SGP), the number of sequences where the full-length of the cDNA insert has been determined has been small. Results High quality full-length insert sequences from 560 pre-smolt white muscle tissue specific cDNAs were generated, accession numbers [GenBank: BT043497 - BT044056]. Five hundred and ten (91%) of the transcripts were annotated using Gene Ontology (GO) terms and 440 of the FLIcs are likely to contain a complete coding sequence (cCDS). The sequence information was used to identify putative paralogs, characterize salmon Kozak motifs, polyadenylation signal variation and to identify motifs likely to be involved in the regulation of particular genes. Finally, conserved 7-mers in the 3'UTRs were identified, of which some were identical to miRNA target sequences. Conclusion This paper describes the first Atlantic salmon FLIcs from a tissue and developmental stage specific cDNA library. We have demonstrated that many FLIcs contained a complete coding sequence (cCDS). This suggests that the remaining cDNA

Characterization of full-length sequenced cDNA inserts (FLIcs from Atlantic salmon (Salmo salar

Directory of Open Access Journals (Sweden)

Lunner Sigbjørn

2009-10-01

Full Text Available Abstract Background Sequencing of the Atlantic salmon genome is now being planned by an international research consortium. Full-length sequenced inserts from cDNAs (FLIcs are an important tool for correct annotation and clustering of the genomic sequence in any species. The large amount of highly similar duplicate sequences caused by the relatively recent genome duplication in the salmonid ancestor represents a particular challenge for the genome project. FLIcs will therefore be an extremely useful resource for the Atlantic salmon sequencing project. In addition to be helpful in order to distinguish between duplicate genome regions and in determining correct gene structures, FLIcs are an important resource for functional genomic studies and for investigation of regulatory elements controlling gene expression. In contrast to the large number of ESTs available, including the ESTs from 23 developmental and tissue specific cDNA libraries contributed by the Salmon Genome Project (SGP, the number of sequences where the full-length of the cDNA insert has been determined has been small. Results High quality full-length insert sequences from 560 pre-smolt white muscle tissue specific cDNAs were generated, accession numbers [GenBank: BT043497 - BT044056]. Five hundred and ten (91% of the transcripts were annotated using Gene Ontology (GO terms and 440 of the FLIcs are likely to contain a complete coding sequence (cCDS. The sequence information was used to identify putative paralogs, characterize salmon Kozak motifs, polyadenylation signal variation and to identify motifs likely to be involved in the regulation of particular genes. Finally, conserved 7-mers in the 3'UTRs were identified, of which some were identical to miRNA target sequences. Conclusion This paper describes the first Atlantic salmon FLIcs from a tissue and developmental stage specific cDNA library. We have demonstrated that many FLIcs contained a complete coding sequence (cCDS. This

Yoctomole electrochemical genosensing of Ebola virus cDNA by rolling circle and circle to circle amplification.

Science.gov (United States)

Carinelli, S; Kühnemund, M; Nilsson, M; Pividori, M I

2017-07-15

This work addresses the design of an Ebola diagnostic test involving a simple, rapid, specific and highly sensitive procedure based on isothermal amplification on magnetic particles with electrochemical readout. Ebola padlock probes were designed to detect a specific L-gene sequence present in the five most common Ebola species. Ebola cDNA was amplified by rolling circle amplification (RCA) on magnetic particles. Further re-amplification was performed by circle-to-circle amplification (C2CA) and the products were detected in a double-tagging approach using a biotinylated capture probe for immobilization on magnetic particles and a readout probe for electrochemical detection by square-wave voltammetry on commercial screen-printed electrodes. The electrochemical genosensor was able to detect as low as 200 ymol, corresponding to 120 cDNA molecules of L-gene Ebola virus with a limit of detection of 33 cDNA molecules. The isothermal double-amplification procedure by C2CA combined with the electrochemical readout and the magnetic actuation enables the high sensitivity, resulting in a rapid, inexpensive, robust and user-friendly sensing strategy that offers a promising approach for the primary care in low resource settings, especially in less developed countries. Copyright © 2016 Elsevier B.V. All rights reserved.

Human uroporphyrinogen III synthase: Molecular cloning, nucleotide sequence, and expression of a full-length cDNA

International Nuclear Information System (INIS)

Tsai, Shihfeng; Bishop, D.F.; Desnick, R.J.

1988-01-01

Uroporphyrinogen III synthase, the fourth enzyme in the heme biosynthetic pathway, is responsible for conversion of the linear tetrapyrrole, hydroxymethylbilane, to the cyclic tetrapyrrole, uroporphyrinogen III. The deficient activity of URO-synthase is the enzymatic defect in the autosomal recessive disorder congenital erythropoietic porphyria. To facilitate the isolation of a full-length cDNA for human URO-synthase, the human erythrocyte enzyme was purified to homogeneity and 81 nonoverlapping amino acids were determined by microsequencing the N terminus and four tryptic peptides. Two synthetic oligonucleotide mixtures were used to screen 1.2 x 10 6 recombinants from a human adult liver cDNA library. Eight clones were positive with both oligonucleotide mixtures. Of these, dideoxy sequencing of the 1.3 kilobase insert from clone pUROS-2 revealed 5' and 3' untranslated sequences of 196 and 284 base pairs, respectively, and an open reading frame of 798 base pairs encoding a protein of 265 amino acids with a predicted molecular mass of 28,607 Da. The isolation and expression of this full-length cDNA for human URO-synthase should facilitate studies of the structure, organization, and chromosomal localization of this heme biosynthetic gene as well as the characterization of the molecular lesions causing congenital erythropoietic porphyria

Characterization of a pollen-specific cDNA clone from Nicotiana tabacum expressed during microgametogenesis and germination.

Science.gov (United States)

Weterings, K; Reijnen, W; van Aarssen, R; Kortstee, A; Spijkers, J; van Herpen, M; Schrauwen, J; Wullems, G

1992-04-01

This report describes the isolation and characterization of a cDNA clone representing a gene specifically expressed in pollen. A cDNA library was constructed against mRNA from mature pollen of Nicotiana tabacum. It was screened differentially against cDNA from mRNA of leaf and of pollen. One clone, NTPc303, was further characterized. On northern blot this clone hybridizes to a transcript 2100 nucleotides in length. NTPc303 is abundant in pollen. Expression of the corresponding gene is restricted to pollen, because no other generative or vegetative tissue contains transcripts hybridizing to NTPc303. Expression of NTP303 is evolutionarily conserved: homologous transcripts are present in pollen from various plant species. The first NTP303 transcripts are detectable on northern blot at the early bi-nucleate stage and accumulate until the pollen has reached maturity. During germination and pollen tube growth in vitro new NTP303 transcripts appear. This transcription has been proved by northern blots as well as by pulse labelling experiments. Nucleotide sequence analysis revealed that NTPc303 has an open reading frame coding for a predicted protein of 62 kDa. This protein shares homology to ascorbate oxidase and other members of the blue copper oxidase family. A possible function for this clone during pollen germination is discussed.

Cloning of the γ-aminobutyric acid (GABA) ρ1 cDNA: A GABA receptor subunit highly expressed in the retina

International Nuclear Information System (INIS)

Cutting, G.R.; Lu, Luo; Kasch, L.M.; Montrose-Rafizadeh, C.; Antonarakis, S.E.; Guggino, W.B.; Kazazian, H.H. Jr.; O'Hara, B.F.; Donovan, D.M.; Shimada, Shoichi; Uhl, G.R.

1991-01-01

Type A γ-aminobutyric acid (GABA A ) receptors are a family of ligand-gated chloride channels that are the major inhibitory neurotransmitter receptors in the nervous system. Molecular cloning has revealed diversity in the subunits that compose this heterooligomeric receptor, but each previously elucidated subunit displays amino acid similarity in conserved structural elements. The authors have used these highly conserved regions to identify additional members of this family by using the polymerase chain reaction (PCR). One PCR product was used to isolate a full-length cDNA from a human retina cDNA library. The mature protein predicted from this cDNA sequence is 458 amino acids long and displays between 30 and 38% amino acid similarity to the previously identified GABA A subunits. This gene is expressed primarily in the retina but transcripts are also detected in the brain, lung, and thymus. Injection of Xenopus oocytes with RNA transcribed in vitro produces a GABA-responsive chloride conductance and expression of the cDNA in COS cells yields GABA-displaceable muscimol binding. These features are consistent with our identification of a GABA subunit, GABA ρ 1 , with prominent retinal expression that increases the diversity and tissue specificity of this ligand-gated ion-channel receptor family

Depletion of polycistronic transcripts using short interfering RNAs: cDNA synthesis method affects levels of non-targeted genes determined by quantitative PCR.

Science.gov (United States)

Hanning, Jennifer E; Groves, Ian J; Pett, Mark R; Coleman, Nicholas

2013-05-21

Short interfering RNAs (siRNAs) are often used to deplete viral polycistronic transcripts, such as those encoded by human papillomavirus (HPV). There are conflicting data in the literature concerning how siRNAs targeting one HPV gene can affect levels of other genes in the polycistronic transcripts. We hypothesised that the conflict might be partly explained by the method of cDNA synthesis used prior to transcript quantification. We treated HPV16-positive cervical keratinocytes with siRNAs targeting the HPV16 E7 gene and used quantitative PCR to compare transcript levels of E7 with those of E6 and E2, viral genes located upstream and downstream of the target site respectively. We compared our findings from cDNA generated using oligo-dT primers alone with those from cDNA generated using a combination of random hexamer and oligo-dT primers. Our data show that when polycistronic transcripts are targeted by siRNAs, there is a period when untranslatable cleaved mRNA upstream of the siRNA binding site remains detectable by PCR, if cDNA is generated using random hexamer primers. Such false indications of mRNA abundance are avoided using oligo-dT primers. The period corresponds to the time taken for siRNA activity and degradation of the cleaved transcripts. Genes downstream of the siRNA binding site are detectable during this interval, regardless of how the cDNA is generated. These data emphasise the importance of the cDNA synthesis method used when measuring transcript abundance following siRNA depletion of polycistronic transcripts. They provide a partial explanation for erroneous reports suggesting that siRNAs targeting HPV E7 can have gene-specific effects.

Sharpening spots: correcting for bleedover in cDNA array images.

Science.gov (United States)

Therneau, Terry; Tschumper, Renee C; Jelinek, Diane

2002-03-01

For cDNA array methods that depend on imaging of a radiolabel, we show that bleedover of one spot onto another, due to the gap between the array and the imaging media, can be a major problem. The images can be sharpened, however, using a blind convolution method based on the EM algorithm. The sharpened images look like a set of donuts, which concurs with our knowledge of the spotting process. Oversharpened images are actually useful as well, in locating the centers of each spot.

cDNA cloning and immunological characterization of the rye grass allergen Lol p I.

Science.gov (United States)

Perez, M; Ishioka, G Y; Walker, L E; Chesnut, R W

1990-09-25

The complete amino acid sequence of two "isoallergenic" forms of Lol p I, the major rye grass (Lolium perenne) pollen allergen, was deduced from cDNA sequence analysis. cDNA clones isolated from a Lolium perenne pollen library contained an open reading frame coding for a 240-amino acid protein. Comparison of the nucleotide and deduced amino acid sequence of two of these clones revealed four changes at the amino acid level and numerous nucleotide differences. Both clones contained one possible asparagine-linked glycosylation site. Northern blot analysis shows one RNA species of 1.2 kilobases. Based on the complete amino acid sequence of Lol p I, overlapping peptides covering the entire molecule were synthesized. Utilizing these peptides we have identified a determinant within the Lol p I molecule that is recognized by human leukocyte antigen class II-restricted T cells obtained from persons allergic to rye grass pollen.

Nucleotide sequence of a cDNA coding for the amino-terminal region of human prepro. alpha. 1(III) collagen

Energy Technology Data Exchange (ETDEWEB)

Toman, P D; Ricca, G A [Rorer Biotechnology, Inc., Springfield, VA (USA); de Crombrugghe, B [National Institutes of Health, Bethesda, MD (USA)

1988-07-25

Type III Collagen is synthesized in a variety of tissues as a precursor macromolecule containing a leader sequence, a N-propeptide, a N-telopeptide, the triple helical region, a C-telopeptide, and C-propeptide. To further characterize the human type III collagen precursor, a human placental cDNA library was constructed in gt11 using an oligonucleotide derived from a partial cDNA sequence corresponding to the carboxy-terminal part of the 1(III) collagen. A cDNA was identified which contains the leader sequence, the N-propeptide and N-telopeptide regions. The DNA sequence of these regions are presented here. The triple helical, C-telopeptide and C-propeptide amino acid sequence for human type III collagen has been determined previously. A comparison of the human amino acid sequence with mouse, chicken, and calf sequence shows 81%, 81%, and 92% similarity, respectively. At the DNA level, the sequence similarity between human and mouse or chicken type III collagen sequences in this area is 82% and 77%, respectively.

Budding yeast cDNA sequencing project: S03052-01_K20 [Budding yeast cDNA sequencing project

Lifescience Database Archive (English)

Full Text Available GTCTTTGCTTCTAAA GCTTAACCATANAGTCACGGACTTAAGACTGTACGACCTGAAGGGCGCAAAAGGTGTATG CG Quality >S03052-01_K20.phd 4...C ATATACAATGTTGTCANGAGTAGCTAAACGTGCGTTTTCCTCTACANTTGCCAACCCTTA TAAAGTGACTGTCTTGGGTGCAGGCGGTGGTATTGGACAACCATT

Ethylglyoxal bis(guanylhydrazone) as an inhibitor of polyamine biosynthesis in L1210 leukemia cells.

Science.gov (United States)

Seppänen, P; Ruohola, H; Jänne, J

1984-04-16

Ethylglyoxal bis(guanylhydrazone), a close derivative of the known anti-cancer drug methylglyoxal bis(guanylhydrazone), is also a powerful inhibitor of S-adenosylmethionine decarboxylase (EC 4.1.1.50), the enzyme needed for the synthesis of spermidine and spermine. There were, however, marked differences between the ethyl and methyl derivatives of glyoxal bis(guanylhydrazone) when tested in cultured L1210 cells. The cellular accumulation of ethylglyoxal bis(guanylhydrazone) represented only a fraction (20-25%) of that of the methyl derivative. Moreover, polyamine depletion, which is known to strikingly stimulate the uptake of methylglyoxal bis(guanylhydrazone), decreased, if anything, the uptake of ethylglyoxal bis(guanylhydrazone) by L1210 cells. The compound produced spermidine and spermine depletion fully comparable to that achieved with methylglyoxal bis(guanylhydrazone) at micromolar concentrations. Ethylglyoxal bis(guanylhydrazone) was growth-inhibitory to L1210 cells and produced an additive antiproliferative action when used together with 2-difluoromethylornithine. Ethylglyoxal bis(guanylhydrazone) was distinctly less effective than methylglyoxal bis(guanylhydrazone) in releasing bound polyamines from isolated cell organelles in vitro. Ethylglyoxal bis(guanylhydrazone) was also devoid of the early and profound mitochondrial toxicity typical to methylglyoxal bis(guanylhydrazone). These findings may indicate that this compound is a more specific inhibitor of polyamine biosynthesis with less intracellular polyamine 'receptor-site' activity than methylglyoxal bis(guanylhydrazone).

Spermidine mediates degradation of ornithine decarboxylase by a non-lysosomal, ubiquitin-independent mechanism

International Nuclear Information System (INIS)

Glass, J.R.; Gerner, E.W.

1987-01-01

The mechanism of spermidine-induced ornithine decarboxylase (OCD, E.C. 4.1.1.17) inactivation was investigated using Chinese hamster ovary (CHO) cells, maintained in serum-free medium, which display a stabilization of ODC owing to the lack of accumulation of putrescine and spermidine. Treatment of cells with 10 μM exogenous spermidine leads to rapid decay of ODC activity accompanied by a parallel decrease in enzyme protein. Analysis of the decay of [ 35 S]methionine-labeled ODC and separation by two-dimensional electrophoresis revealed no detectable modification in ODC structure during enhanced degradation. Spermidine-mediated inactivation of ODC occurred in a temperature-dependent manner exhibiting pseudo-first-order kinetics over a temperature range of 22-37 0 C. In cultures treated continuously, an initial lag was observed after treatment with spermidine, followed by a rapid decline in activity as an apparent critical concentration of intracellular spermidine was achieved. Treating cells at 22 0 C for 3 hours with 10 μ M spermidine, followed by removal of exogenous polyamine, and then shifting to varying temperatures, resulted in rates of ODC inactivation identical with that determined with a continuous treatment. Arrhenius analysis showed that polyamine mediated inactivation of ODC occurred with an activation energy of approximately 16 kcal/mol. Treatment of cells with lysosomotrophic agents had no effect of ODC degradation. ODC turnover was not dependent on ubiquitin-dependent proteolysis. These data support the hypothesis that spermidine regulates ODC degradation via a mechanism requiring new protein synthesis, and that this occurs via a non-lysosomal, ubiquitin-independent pathway

Cloning and characterization of a cDNA encoding topoisomerase II in pea and analysis of its expression in relation to cell proliferation.

Science.gov (United States)

Reddy, M K; Nair, S; Tewari, K K; Mudgil, Y; Yadav, B S; Sopory, S K

1999-09-01

We have isolated and sequenced four overlapping cDNA clones to identify the full-length cDNA for topoisomerase II (PsTopII) from pea. Using degenerate primers, based on the conserved amino acid sequences of other eukaryotic type II topoisomerases, a 680 bp fragment was PCR-amplified with pea cDNA as template. This fragment was used as a probe to screen an oligo-dT-primed pea cDNA library. A partial cDNA clone was isolated that was truncated at the 3' end. RACE-PCR was employed to isolate the remaining portion of the gene. The total size of PsTopII is 4639 bp with an open reading frame of 4392 bp. The deduced amino acid sequence shows a strong homology to other eukaryotic topoisomerase II (topo II) at the N-terminus end. The topo II transcript was abundant in proliferative tissues. We also show that the level of topo II transcripts could be stimulated by exogenous application of growth factors that induced proliferation in vitro cultures. Light irradiation to etiolated tissue strongly stimulated the expression of topo II. These results suggest that topo II gene expression is up-regulated in response to light and hormones and correlates with cell proliferation. Besides, we have also isolated and analysed the 5'-flanking region of the pea TopII gene. This is first report on the isolation of a putative promoter for topoisomerase II from plants.

Budding yeast cDNA sequencing project: S03036-05_I15 [Budding yeast cDNA sequencing project

Lifescience Database Archive (English)

Full Text Available EST - Link to UCSC Genome Browser - Sequence >S03036-05_I15.phd NNNTNNTNNNNCNCTCACATANAAGACGGANNAGNNNGCTGGGC...CAATGCGTTCCATATGCG AAAATTCTTGGNCAATGTATTCTCTAGCAATCTNTNCTTTTGTACANTCGGAGGNTTNTC ATGNTCCTTTCATANATTATANAAANNG

Increased yield of PCR products by addition of T4 gene 32 protein to the SMART PCR cDNA synthesis system.

Science.gov (United States)

Villalva, C; Touriol, C; Seurat, P; Trempat, P; Delsol, G; Brousset, P

2001-07-01

Under certain conditions, T4 gene 32 protein is known to increase the efficiency of different enzymes, such as Taq DNA polymerase, reverse transcriptase, and telomerase. In this study, we compared the efficiency of the SMART PCR cDNA synthesis kit with and without the T4 gene 32 protein. The use of this cDNA synthesis procedure, in combination with T4 gene 32 protein, increases the yield of RT-PCR products from approximately 90% to 150%. This effect is even observed for long mRNA templates and low concentrations of total RNA (25 ng). Therefore, we suggest the addition of T4 gene 32 protein in the RT-PCR mixture to increase the efficiency of cDNA synthesis, particularly in cases when low amounts of tissue are used.

Autoantibodies against voltage-gated potassium channel (VGKC) and glutamic acid decarboxylase (GAD) in psychosis: A systematic review, meta-analysis and case series.

OpenAIRE

Lally*, John; Grain*, Rosemary; Stubbs, Brendon; Malik, Steffi; LeMince, Anne; Nicholson, Timothy RJ; Murray, Robin MacGregor; Gaughran, Fiona Patricia

2017-01-01

Antibodies to the voltage-gated potassium channel (VGKC) complex and glutamic acid decarboxylase (GAD) have been reported in some cases of psychosis. We conducted the first systematic review and meta-analysis to investigate their prevalence in people with psychosis and report a case series of VGKC-complex antibodies in refractory psychosis. Only five studies presenting prevalence rates of VGKC seropositivity in psychosis were identified, in addition to our case series, with an overall prevale...

Dissection of the inflammatory bowel disease transcriptome using genome-wide cDNA microarrays.

Directory of Open Access Journals (Sweden)

Christine M Costello

2005-08-01

Full Text Available BACKGROUND: The differential pathophysiologic mechanisms that trigger and maintain the two forms of inflammatory bowel disease (IBD, Crohn disease (CD, and ulcerative colitis (UC are only partially understood. cDNA microarrays can be used to decipher gene regulation events at a genome-wide level and to identify novel unknown genes that might be involved in perpetuating inflammatory disease progression. METHODS AND FINDINGS: High-density cDNA microarrays representing 33,792 UniGene clusters were prepared. Biopsies were taken from the sigmoid colon of normal controls (n = 11, CD patients (n = 10 and UC patients (n = 10. 33P-radiolabeled cDNA from purified poly(A+ RNA extracted from biopsies (unpooled was hybridized to the arrays. We identified 500 and 272 transcripts differentially regulated in CD and UC, respectively. Interesting hits were independently verified by real-time PCR in a second sample of 100 individuals, and immunohistochemistry was used for exemplary localization. The main findings point to novel molecules important in abnormal immune regulation and the highly disturbed cell biology of colonic epithelial cells in IBD pathogenesis, e.g., CYLD (cylindromatosis, turban tumor syndrome and CDH11 (cadherin 11, type 2. By the nature of the array setup, many of the genes identified were to our knowledge previously uncharacterized, and prediction of the putative function of a subsection of these genes indicate that some could be involved in early events in disease pathophysiology. CONCLUSION: A comprehensive set of candidate genes not previously associated with IBD was revealed, which underlines the polygenic and complex nature of the disease. It points out substantial differences in pathophysiology between CD and UC. The multiple unknown genes identified may stimulate new research in the fields of barrier mechanisms and cell signalling in the context of IBD, and ultimately new therapeutic approaches.

Human thyroid peroxidase: complete cDNA and protein sequence, chromosome mapping, and identification of two alternately spliced mRNAs

International Nuclear Information System (INIS)

Kimura, S.; Kotani, T.; McBride, O.W.; Umeki, K.; Hirai, K.; Nakayama, T.; Ohtaki, S.

1987-01-01

Two forms of human thyroid peroxidase cDNAs were isolated from a λgt11 cDNA library, prepared from Graves disease thyroid tissue mRNA, by use of oligonucleotides. The longest complete cDNA, designated phTPO-1, has 3048 nucleotides and an open reading frame consisting of 933 amino acids, which would encode a protein with a molecular weight of 103,026. Five potential asparagine-linked glycosylation sites are found in the deduced amino acid sequence. The second peroxidase cDNA, designated phTPO-2, is almost identical to phTPO-1 beginning 605 base pairs downstream except that it contains 1-base-pair difference and lacks 171 base pairs in the middle of the sequence. This results in a loss of 57 amino acids corresponding to a molecular weight of 6282. Interestingly, this 171-nucleotide sequence has GT and AG at its 5' and 3' boundaries, respectively, that are in good agreement with donor and acceptor splice site consensus sequences. Using specific oligonucleotide probes for the mRNAs derived from the cDNA sequences hTOP-1 and hTOP-2, the authors show that both are expressed in all thyroid tissues examined and the relative level of two mRNAs is different in each sample. The results suggest that two thyroid peroxidase proteins might be generated through alternate splicing of the same gene. By using somatic cell hybrid lines, the thyroid peroxidase gene was mapped to the short arm of human chromosome 2

Renal ornithine decarboxylase activity, polyamines, and compensatory renal hypertrophy in the rat

International Nuclear Information System (INIS)

Humphreys, M.H.; Etheredge, S.B.; Lin, Shanyan; Ribstein, J.; Marton, L.J.

1988-01-01

The authors determined the role of ornithine decarboxylase (ODC) in compensatory renal hypertrophy (CRH) by relating renal ODC activity and polyamine content to kidney size, expressed as a percent of body weight, 1 wk after unilateral nephrectomy (UN). In normal rats, renal ODC activity increased after UN; 1 wk later the remaining kidney weight had increased. Renal concentration of putrescine, the product of ODC's decarboxylation of ornithine, was increased 3, 8, and 48 h after UN, but concentrations of polyamines synthesized later in the pathway, spermidine and spermine, were not appreciably affected. Pretreatment with difluoromethylornithine (DFMO), an irreversible inhibitor of ODC inhibited both base-line renal ODC activity and putrescine concentration as well as increases stimulated by UN, although concentrations of spermidine and spermine were not decreased. In hypophysectomized rats, both increased renal ODC activity and CRH occurred as well, indicating that these two consequences of UN do not require intact pituitary function. Thus stimulation of renal ODC activity and putrescine content do not appear critical to the process of CRH after UN

Pyruvate decarboxylase provides growing pollen tubes with a competitive advantage in petunia.

Science.gov (United States)

Gass, Nathalie; Glagotskaia, Tatiana; Mellema, Stefan; Stuurman, Jeroen; Barone, Mario; Mandel, Therese; Roessner-Tunali, Ute; Kuhlemeier, Cris

2005-08-01

Rapid pollen tube growth places unique demands on energy production and biosynthetic capacity. The aim of this work is to understand how primary metabolism meets the demands of such rapid growth. Aerobically grown pollen produce ethanol in large quantities. The ethanolic fermentation pathway consists of two committed enzymes: pyruvate decarboxylase (PDC) and alcohol dehydrogenase (ADH). Because adh mutations do not affect male gametophyte function, the obvious question is why pollen synthesize an abundant enzyme if they could do just as well without. Using transposon tagging in Petunia hybrida, we isolated a null mutant in pollen-specific Pdc2. Growth of the mutant pollen tubes through the style is reduced, and the mutant allele shows reduced transmission through the male, when in competition with wild-type pollen. We propose that not ADH but rather PDC is the critical enzyme in a novel, pollen-specific pathway. This pathway serves to bypass pyruvate dehydrogenase enzymes and thereby maintain biosynthetic capacity and energy production under the unique conditions prevailing during pollen-pistil interaction.

Insights on ornithine decarboxylase silencing as a potential strategy for targeting retinoblastoma.

Science.gov (United States)

Muthukumaran, Sivashanmugam; Bhuvanasundar, Renganathan; Umashankar, Vetrivel; Sulochana, K N

2018-02-01

Ornithine Decarboxylase (ODC) is a key enzyme involved in polyamine synthesis and is reported to be up regulated in several cancers. However, the effect of ODC gene silencing in retinoblastoma is to be understood for utilization in therapeutic applications. Hence, in this study, a novel siRNA (small interference RNA) targeting ODC was designed and validated in Human Y79 retinoblastoma cells for its effects on intracellular polyamine levels, Matrix Metalloproteinase 2 & 9 activity and Cell cycle. The designed siRNA showed efficient silencing of ODC mRNA expression and protein levels in Y79 cells. It also showed significant reduction of intracellular polyamine levels and altered levels of oncogenic LIN28b expression. By this study, a regulatory loop is proposed, wherein, ODC silencing in Y79 cells to result in decreased polyamine levels, thereby, leading to altered protein levels of Lin28b, MMP-2 and MMP-9, which falls in line with earlier studies in neuroblastoma. Thus, by this study, we propose ODC silencing as a prospective strategy for targeting retinoblastoma. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

Construction of an Unstable Ring-X Chromosome Bearing the Autosomal Dopa Decarboxylase Gene in Drosophila melanogaster and Analysis of Ddc Mosaics

OpenAIRE

Gailey, Donald A.; Bordne, Deborah L.; Vallés, Ana Maria; Hall, Jeffrey C.; White, Kalpana

1987-01-01

An unstable Ring-X chromosome, Ddc+- Ring-X carrying a cloned Dopa decarboxylase (Ddc) encoding segment was constructed. The construction involved a double recombination event between the unstable Ring-X, R(1)wvC and a Rod-X chromosome which contained a P-element mediated Ddc + insert. The resulting Ddc+-Ring-X chromosome behaves similarly to the parent chromosome with respect to somatic instability. The Ddc+-Ring-X chromosome was used to generate Ddc mosaics. Analyses of Ddc mosaics reveal...

Purification of a jojoba embryo fatty acyl-coenzyme A reductase and expression of its cDNA in high erucic acid rapeseed.

Science.gov (United States)

Metz, J G; Pollard, M R; Anderson, L; Hayes, T R; Lassner, M W

2000-03-01

The jojoba (Simmondsia chinensis) plant produces esters of long-chain alcohols and fatty acids (waxes) as a seed lipid energy reserve. This is in contrast to the triglycerides found in seeds of other plants. We purified an alcohol-forming fatty acyl-coenzyme A reductase (FAR) from developing embryos and cloned the cDNA encoding the enzyme. Expression of a cDNA in Escherichia coli confers FAR activity upon those cells and results in the accumulation of fatty alcohols. The FAR sequence shows significant homology to an Arabidopsis protein of unknown function that is essential for pollen development. When the jojoba FAR cDNA is expressed in embryos of Brassica napus, long-chain alcohols can be detected in transmethylated seed oils. Resynthesis of the gene to reduce its A plus T content resulted in increased levels of alcohol production. In addition to free alcohols, novel wax esters were detected in the transgenic seed oils. In vitro assays revealed that B. napus embryos have an endogenous fatty acyl-coenzyme A: fatty alcohol acyl-transferase activity that could account for this wax synthesis. Thus, introduction of a single cDNA into B. napus results in a redirection of a portion of seed oil synthesis from triglycerides to waxes.

Isolation and characterization of full-length cDNA clones coding for cholinesterase from fetal human tissues

International Nuclear Information System (INIS)

Prody, C.A.; Zevin-Sonkin, D.; Gnatt, A.; Goldberg, O.; Soreq, H.

1987-01-01

To study the primary structure and regulation of human cholinesterases, oligodeoxynucleotide probes were prepared according to a consensus peptide sequence present in the active site of both human serum pseudocholinesterase and Torpedo electric organ true acetylcholinesterase. Using these probes, the authors isolated several cDNA clones from λgt10 libraries of fetal brain and liver origins. These include 2.4-kilobase cDNA clones that code for a polypeptide containing a putative signal peptide and the N-terminal, active site, and C-terminal peptides of human BtChoEase, suggesting that they code either for BtChoEase itself or for a very similar but distinct fetal form of cholinesterase. In RNA blots of poly(A) + RNA from the cholinesterase-producing fetal brain and liver, these cDNAs hybridized with a single 2.5-kilobase band. Blot hybridization to human genomic DNA revealed that these fetal BtChoEase cDNA clones hybridize with DNA fragments of the total length of 17.5 kilobases, and signal intensities indicated that these sequences are not present in many copies. Both the cDNA-encoded protein and its nucleotide sequence display striking homology to parallel sequences published for Torpedo AcChoEase. These finding demonstrate extensive homologies between the fetal BtChoEase encoded by these clones and other cholinesterases of various forms and species

Primary structure of bovine pituitary secretory protein I (chromogranin A) deduced from the cDNA sequence

International Nuclear Information System (INIS)

Ahn, T.G.; Cohn, D.V.; Gorr, S.U.; Ornstein, D.L.; Kashdan, M.A.; Levine, M.A.

1987-01-01

Secretory protein I (SP-I), also referred to as chromogranin A, is an acidic glycoprotein that has been found in every tissue of endocrine and neuroendocrine origin examined but never in exocrine or epithelial cells. Its co-storage and co-secretion with peptide hormones and neurotransmitters suggest that it has an important endocrine or secretory function. The authors have isolated cDNA clones from a bovine pituitary λgt11 expression library using an antiserum to parathyroid SP-I. The largest clone (SP4B) hybridized to a transcript of 2.1 kilobases in RNA from parathyroid, pituitary, and adrenal medulla. Immunoblots of bacterial lysates derived from SP4B lysognes demonstrated specific antibody binding to an SP4B/β-galactosidase fusion protein (160 kDa) with a cDNA-derived component of 46 kDa. Radioimmunoassay of the bacterial lystates with SP-I antiserum yielded parallel displacement curves of 125 I-labeled SP-I by the SP4B lysate and authentic SP-I. SP4B contains a cDNA of 1614 nucleotides that encodes a 449-amino acid protein (calculated mass, 50 kDa). The nucleotide sequences of the pituitary SP-I cDNA and adrenal medullary SP-I cDNAs are nearly identical. Analysis of genomic DNA suggests that pituitary, adrenal, and parathyroid SP-I are products of the same gene

Multiplex preamplification of specific cDNA targets prior to gene expression analysis by TaqMan Arrays

Directory of Open Access Journals (Sweden)

Ribal María

2008-06-01

Full Text Available Abstract Background An accurate gene expression quantification using TaqMan Arrays (TA could be limited by the low RNA quantity obtained from some clinical samples. The novel cDNA preamplification system, the TaqMan PreAmp Master Mix kit (TPAMMK, enables a multiplex preamplification of cDNA targets and therefore, could provide a sufficient amount of specific amplicons for their posterior analysis on TA. Findings A multiplex preamplification of 47 genes was performed in 22 samples prior to their analysis by TA, and relative gene expression levels of non-preamplified (NPA and preamplified (PA samples were compared. Overall, the mean cycle threshold (CT decrement in the PA genes was 3.85 (ranging from 2.07 to 5.01. A high correlation (r between the gene expression measurements of NPA and PA samples was found (mean r = 0.970, ranging from 0.937 to 0.994; p Conclusion We demonstrate that cDNA preamplification using the TPAMMK before TA analysis is a reliable approach to simultaneously measure gene expression of multiple targets in a single sample. Moreover, this procedure was validated in genes from degraded RNA samples and low abundance expressed genes. This combined methodology could have wide applications in clinical research, where scarce amounts of degraded RNA are usually obtained and several genes need to be quantified in each sample.

Primary structure of bovine pituitary secretory protein I (chromogranin A) deduced from the cDNA sequence

Energy Technology Data Exchange (ETDEWEB)

Ahn, T.G.; Cohn, D.V.; Gorr, S.U.; Ornstein, D.L.; Kashdan, M.A.; Levine, M.A.

1987-07-01

Secretory protein I (SP-I), also referred to as chromogranin A, is an acidic glycoprotein that has been found in every tissue of endocrine and neuroendocrine origin examined but never in exocrine or epithelial cells. Its co-storage and co-secretion with peptide hormones and neurotransmitters suggest that it has an important endocrine or secretory function. The authors have isolated cDNA clones from a bovine pituitary lambdagt11 expression library using an antiserum to parathyroid SP-I. The largest clone (SP4B) hybridized to a transcript of 2.1 kilobases in RNA from parathyroid, pituitary, and adrenal medulla. Immunoblots of bacterial lysates derived from SP4B lysognes demonstrated specific antibody binding to an SP4B/..beta..-galactosidase fusion protein (160 kDa) with a cDNA-derived component of 46 kDa. Radioimmunoassay of the bacterial lystates with SP-I antiserum yielded parallel displacement curves of /sup 125/I-labeled SP-I by the SP4B lysate and authentic SP-I. SP4B contains a cDNA of 1614 nucleotides that encodes a 449-amino acid protein (calculated mass, 50 kDa). The nucleotide sequences of the pituitary SP-I cDNA and adrenal medullary SP-I cDNAs are nearly identical. Analysis of genomic DNA suggests that pituitary, adrenal, and parathyroid SP-I are products of the same gene.

A tobacco cDNA reveals two different transcription patterns in vegetative and reproductive organs

Directory of Open Access Journals (Sweden)

I. da Silva

2002-08-01

Full Text Available In order to identify genes expressed in the pistil that may have a role in the reproduction process, we have established an expressed sequence tags project to randomly sequence clones from a Nicotiana tabacum stigma/style cDNA library. A cDNA clone (MTL-8 showing high sequence similarity to genes encoding glycine-rich RNA-binding proteins was chosen for further characterization. Based on the extensive identity of MTL-8 to the RGP-1a sequence of N. sylvestris, a primer was defined to extend the 5' sequence of MTL-8 by RT-PCR from stigma/style RNAs. The amplification product was sequenced and it was confirmed that MTL-8 corresponds to an mRNA encoding a glycine-rich RNA-binding protein. Two transcripts of different sizes and expression patterns were identified when the MTL-8 cDNA insert was used as a probe in RNA blots. The largest is 1,100 nucleotides (nt long and markedly predominant in ovaries. The smaller transcript, with 600 nt, is ubiquitous to the vegetative and reproductive organs analyzed (roots, stems, leaves, sepals, petals, stamens, stigmas/styles and ovaries. Plants submitted to stress (wounding, virus infection and ethylene treatment presented an increased level of the 600-nt transcript in leaves, especially after tobacco necrosis virus infection. In contrast, the level of the 1,100-nt transcript seems to be unaffected by the stress conditions tested. Results of Southern blot experiments have suggested that MTL-8 is present in one or two copies in the tobacco genome. Our results suggest that the shorter transcript is related to stress while the larger one is a flower predominant and nonstress-inducible messenger.

Cloning of the cDNA for U1 small nuclear ribonucleoprotein particle 70K protein from Arabidopsis thaliana

Science.gov (United States)

Reddy, A. S.; Czernik, A. J.; An, G.; Poovaiah, B. W.

1992-01-01

We cloned and sequenced a plant cDNA that encodes U1 small nuclear ribonucleoprotein (snRNP) 70K protein. The plant U1 snRNP 70K protein cDNA is not full length and lacks the coding region for 68 amino acids in the amino-terminal region as compared to human U1 snRNP 70K protein. Comparison of the deduced amino acid sequence of the plant U1 snRNP 70K protein with the amino acid sequence of animal and yeast U1 snRNP 70K protein showed a high degree of homology. The plant U1 snRNP 70K protein is more closely related to the human counter part than to the yeast 70K protein. The carboxy-terminal half is less well conserved but, like the vertebrate 70K proteins, is rich in charged amino acids. Northern analysis with the RNA isolated from different parts of the plant indicates that the snRNP 70K gene is expressed in all of the parts tested. Southern blotting of genomic DNA using the cDNA indicates that the U1 snRNP 70K protein is coded by a single gene.

Molecular cloning of a catalase cDNA from Nicotiana glutinosa L. and its repression by tobacco mosaic virus infection.

Science.gov (United States)

Yi, S Y; Yu, S H; Choi, D

1999-06-30

Recent reports revealed that catalase has a role in the plant defense mechanism against a broad range of pathogens through being inhibited by salicylic acid (SA). During an effort to clone disease resistance-responsive genes, a cDNA encoding catalase (Ngcat1; Nicotiana glutinosa cat1) was isolated from a tobacco cDNA library. In N. glutinosa, catalase is encoded by a small gene family. The deduced amino acid sequence of the Ngcat1 cDNA has 98% homology with the cat1 gene of N. plumbaginifolia. The Ngcat1 expression is controlled by the circadian clock, and its mRNA level is the most abundant in leaves. Both the expression of Ngcat1 mRNA and its enzyme activity in the tobacco plant undergoing a hypersensitive response (HR) to TMV infection were repressed. The repression of the mRNA level was also observed following treatment with SA. These results imply that SA may act as an inhibitor of catalase transcription during the HR of tobacco. Cloning and expression of the Ngcat1 in tobacco following pathogen infection and SA treatment are presented.

Molecular cloning of cDNA for rat brain metallothionein-2 and regulation of its gene expression

Energy Technology Data Exchange (ETDEWEB)

Saijoh, Kiyofumi; Sumino, Kimiaki [Department of Public Health, Kobe University School of Medicine (Japan); Kuno, Takayoshi; Shuntoh, Hisato; Tanaka, Chikako [Department of Pharmacology, Kobe University of Medicine (Japan)

1989-01-01

A rat brain metallothionein-II (MT-II) complementary DNA (cDNA) clone was isolated from a cDNA plasmid library, which was prepared from non-treated rat brain mRNA, by a colony screening procedure using /sup 32/P-labeled synthetic oligonucleotide probes. It is deduced that the clone encodes for a protein of 61 amino acids comprising 20 cysteines, which is highly homologous to MT-IIs in other species. Northern blot analysis demonstrated major mRNA species in the brain, liver and kidneys (approximately 350 b in size), which is induced in response to dexamethasone, zinc, cadmium and mercury but not to methyl mercury. These findings confirm that MT-II genes are expressed and regulated both by steroid and heavy metals in the brain as well as in peripheral organs. (author).

Molecular cloning of cDNA for rat brain metallothionein-2 and regulation of its gene expression

International Nuclear Information System (INIS)

Saijoh, Kiyofumi; Sumino, Kimiaki; Kuno, Takayoshi; Shuntoh, Hisato; Tanaka, Chikako

1989-01-01

A rat brain metallothionein-II (MT-II) complementary DNA (cDNA) clone was isolated from a cDNA plasmid library, which was prepared from non-treated rat brain mRNA, by a colony screening procedure using 32 P-labeled synthetic oligonucleotide probes. It is deduced that the clone encodes for a protein of 61 amino acids comprising 20 cysteines, which is highly homologous to MT-IIs in other species. Northern blot analysis demonstrated major mRNA species in the brain, liver and kidneys (approximately 350 b in size), which is induced in response to dexamethasone, zinc, cadmium and mercury but not to methyl mercury. These findings confirm that MT-II genes are expressed and regulated both by steroid and heavy metals in the brain as well as in peripheral organs. (author)

Cloning of oleosin, a putative new hazelnut allergen, using a hazelnut cDNA library

NARCIS (Netherlands)

Akkerdaas, Jaap H.; Schocker, Frauke; Vieths, Stefan; Versteeg, Serge; Zuidmeer, Laurian; Hefle, Sue L.; Aalberse, Rob C.; Richter, Klaus; Ferreira, Fatima; van Ree, Ronald

2006-01-01

The clinical presentation of non-pollen related allergy to hazelnut can be severe and systemic. So far, only a limited number of non-pollen related hazelnut allergens have been identified and characterized. The aim of this study was to identify and clone new hazelnut allergens. A lambda ZAP cDNA

Microaspiration of esophageal gland cells and cDNA library construction for identifying parasitism genes of plant-parasitic nematodes.

Science.gov (United States)

Hussey, Richard S; Huang, Guozhong; Allen, Rex

2011-01-01

Identifying parasitism genes encoding proteins secreted from a plant-parasitic nematode's esophageal gland cells and injected through its stylet into plant tissue is the key to understanding the molecular basis of nematode parasitism of plants. Parasitism genes have been cloned by directly microaspirating the cytoplasm from the esophageal gland cells of different parasitic stages of cyst or root-knot nematodes to provide mRNA to create a gland cell-specific cDNA library by long-distance reverse-transcriptase polymerase chain reaction. cDNA clones are sequenced and deduced protein sequences with a signal peptide for secretion are identified for high-throughput in situ hybridization to confirm gland-specific expression.

HosA, a MarR Family Transcriptional Regulator, Represses Nonoxidative Hydroxyarylic Acid Decarboxylase Operon and Is Modulated by 4-Hydroxybenzoic Acid.

Science.gov (United States)

Roy, Ajit; Ranjan, Akash

2016-02-23

Members of the Multiple antibiotic resistance Regulator (MarR) family of DNA binding proteins regulate transcription of a wide array of genes required for virulence and pathogenicity of bacteria. The present study reports the molecular characterization of HosA (Homologue of SlyA), a MarR protein, with respect to its target gene, DNA recognition motif, and nature of its ligand. Through a comparative genomics approach, we demonstrate that hosA is in synteny with nonoxidative hydroxyarylic acid decarboxylase (HAD) operon and is present exclusively within the mutS-rpoS polymorphic region in nine different genera of Enterobacteriaceae family. Using molecular biology and biochemical approach, we demonstrate that HosA binds to a palindromic sequence downstream to the transcription start site of divergently transcribed nonoxidative HAD operon and represses its expression. Furthermore, in silico analysis showed that the recognition motif for HosA is highly conserved in the upstream region of divergently transcribed operon in different genera of Enterobacteriaceae family. A systematic chemical search for the physiological ligand revealed that 4-hydroxybenzoic acid (4-HBA) interacts with HosA and derepresses HosA mediated repression of the nonoxidative HAD operon. Based on our study, we propose a model for molecular mechanism underlying the regulation of nonoxidative HAD operon by HosA in Enterobacteriaceae family.