Insight into Biochemical Characterization of Plant Sesquiterpene Synthases
DEFF Research Database (Denmark)
Manczak, Tom; Simonsen, Henrik Toft
2016-01-01
A fast and reproducible protocol was established for enzymatic characterization of plant sesquiterpene synthases that can incorporate radioactivity in their products. The method utilizes the 96-well format in conjunction with cluster tubes and enables processing of >200 samples a day. Along...... with reduced reagent usage, it allows further reduction in the use of radioactive isotopes and flammable organic solvents. The sesquiterpene synthases previously characterized were expressed in yeast, and the plant-derived Thapsia garganica kunzeaol synthase TgTPS2 was tested in this method. KM for TgTPS2...... was found to be 0.55 μM; the turnover number, kcat, was found to be 0.29 s-1, kcat for TgTPS2 is in agreement with that of terpene synthases of other plants, and kcat/KM was found to be 0.53 s-1 μM-1 for TgTPS2. The kinetic parameters were in agreement with previously published data....
ISOLATION AND CHARACTERIZATION OF CHITINASE GENE FROM THE UNTRADITIONAL PLANT SPECIES
Directory of Open Access Journals (Sweden)
Dominika Ďurechová
2013-02-01
Full Text Available Round-leaf sundew (Drosera rotundifolia L. from Droseraceae family belongs among a few plant species with strong antifungal potential. It was previously shown that chitinases of carnivorous plant species may play role during the insect prey digestion, when hard chitin skeleton is being decomposed. As many phytopathogenic fungi contain chitin in their cell wall our attention in this work was focused on isolation and in silico characterization of genomic DNA sequence of sundew chitinase gene. Subsequently this gene was fused to strong constitutive CaMV35S promoter and cloned into the plant binary vector pBinPlus and tested in A. tumefaciens LBA 4404 for its stability. Next, when transgenic tobacco plants are obtained, increasing of their antifungal potential will be tested.
Plant Phenotype Characterization System
Energy Technology Data Exchange (ETDEWEB)
Daniel W McDonald; Ronald B Michaels
2005-09-09
This report is the final scientific report for the DOE Inventions and Innovations Project: Plant Phenotype Characterization System, DE-FG36-04GO14334. The period of performance was September 30, 2004 through July 15, 2005. The project objective is to demonstrate the viability of a new scientific instrument concept for the study of plant root systems. The root systems of plants are thought to be important in plant yield and thus important to DOE goals in renewable energy sources. The scientific study and understanding of plant root systems is hampered by the difficulty in observing root activity and the inadequacy of existing root study instrumentation options. We have demonstrated a high throughput, non-invasive, high resolution technique for visualizing plant root systems in-situ. Our approach is based upon low-energy x-ray radiography and the use of containers and substrates (artificial soil) which are virtually transparent to x-rays. The system allows us to germinate and grow plant specimens in our containers and substrates and to generate x-ray images of the developing root system over time. The same plant can be imaged at different times in its development. The system can be used for root studies in plant physiology, plant morphology, plant breeding, plant functional genomics and plant genotype screening.
Medicinal plants: production and biochemical characterization
International Nuclear Information System (INIS)
Chunzhao Liu; Zobayed, S.M.A; Murch, S.J.; Saxena, P.K.
2002-01-01
Recent advances in the area of biotechnology offer some possibility for the development of new technologies for the conservation, characterization and mass production of medicinal plant species, (i.e. in vitro cell culture techniques for the mass production of sterile, consistent, standardized medicinal plant materials). This paper discussed the following subjects - plant tissue culture, de novo shoot organogenesis, de novo root organogenesis, somatic embryogenesis, large scale propagation in bioreactors and discovery of unique biomolecules
Characterization plan for the Hanford Generating Plant (HGP)
International Nuclear Information System (INIS)
Marske, S.G.
1996-09-01
This characterization plan describes the sample collection and sample analysis activities to characterize the Hanford Generating Plant and associated solid waste management units (SWMUs). The analytical data will be used to identify the radiological contamination in the Hanford Generating Plant as well as the presence of radiological and hazardous materials in the SWMUs to support further estimates of decontamination interpretation for demolition
Radiological characterization of nuclear plants under decommissioning
International Nuclear Information System (INIS)
Mincarini, M.
1989-01-01
In the present work a description of major problems encountered in qualitative and quantitative radiological characterization of nuclear plants for decommissioning and decontamination purpose is presented. Referring to several nuclear plant classes activation and contamination processes, direct and indirect radiological analysis and some italian significant experience are descripted
Peeters, Edwin T H M; Neefjes, Rozemarijn E M; Zuidam, Bastiaan G van
2016-01-01
Nutrients can determine the outcome of the competition between different floating plant species. The response of floating plants to current phosphorus levels may be affected by previously experienced phosphorus concentrations because some species have the ability to store excess phosphorus for later use. This might have an impact on their competition. Here, we investigate the effect of previous and actual phosphorus concentrations on the growth rate of free-floating plant species (Azolla filiculoides, Lemna minor/gibba and Ricciocarpus natans)and the effect of phosphorus history on the competition between L. minor/gibba and A. filiculoides and between L. minor/gibba and R. natans. As expected, plant growth was lower when previously kept at low instead of high phosphorus concentrations. Growth of L. minor/gibba and A. filiculoides with a phosphorus rich history was comparable for low and high actual phosphorus concentrations, however, internal phosphorus concentrations were significantly lower with low actual phosphorus concentration. This indicates that both species perform luxury phosphorus uptake. Furthermore, internal P concentration in Azolla and Lemna increased within two weeks after a period of P deficit without a strong increase in growth. A. filiculoides in a mixture with L. minor/gibba grew faster than its monoculture. Morphological differences may explain why A. filiculoides outcompeted L. minor/gibba and these differences may be induced by phosphorus concentrations in the past. Growth of L. minor/gibba was only reduced by the presence of A. filiculoides with a high phosphorus history. Growth of L. minor/gibba and R. natans in mixtures was positively affected only when they had a high phosphorus history themselves and their competitor a low phosphorus history. These observations clearly indicate that phosphorus history of competing plants is important for understanding the outcome of the competition. Therefore, actual and previously experienced phosphorus
Peeters, E.T.H.M.; Neefjes, Rozemarijn; Zuidam, van B.G.
2016-01-01
Nutrients can determine the outcome of the competition between different floating plant species. The response of floating plants to current phosphorus levels may be affected by previously experienced phosphorus concentrations because some species have the ability to store excess phosphorus for later
Directory of Open Access Journals (Sweden)
Edwin T H M Peeters
Full Text Available Nutrients can determine the outcome of the competition between different floating plant species. The response of floating plants to current phosphorus levels may be affected by previously experienced phosphorus concentrations because some species have the ability to store excess phosphorus for later use. This might have an impact on their competition. Here, we investigate the effect of previous and actual phosphorus concentrations on the growth rate of free-floating plant species (Azolla filiculoides, Lemna minor/gibba and Ricciocarpus natansand the effect of phosphorus history on the competition between L. minor/gibba and A. filiculoides and between L. minor/gibba and R. natans. As expected, plant growth was lower when previously kept at low instead of high phosphorus concentrations. Growth of L. minor/gibba and A. filiculoides with a phosphorus rich history was comparable for low and high actual phosphorus concentrations, however, internal phosphorus concentrations were significantly lower with low actual phosphorus concentration. This indicates that both species perform luxury phosphorus uptake. Furthermore, internal P concentration in Azolla and Lemna increased within two weeks after a period of P deficit without a strong increase in growth. A. filiculoides in a mixture with L. minor/gibba grew faster than its monoculture. Morphological differences may explain why A. filiculoides outcompeted L. minor/gibba and these differences may be induced by phosphorus concentrations in the past. Growth of L. minor/gibba was only reduced by the presence of A. filiculoides with a high phosphorus history. Growth of L. minor/gibba and R. natans in mixtures was positively affected only when they had a high phosphorus history themselves and their competitor a low phosphorus history. These observations clearly indicate that phosphorus history of competing plants is important for understanding the outcome of the competition. Therefore, actual and previously
Peeters, Edwin T. H. M.; Neefjes, Rozemarijn E. M.; van Zuidam, Bastiaan G.
2016-01-01
Nutrients can determine the outcome of the competition between different floating plant species. The response of floating plants to current phosphorus levels may be affected by previously experienced phosphorus concentrations because some species have the ability to store excess phosphorus for later use. This might have an impact on their competition. Here, we investigate the effect of previous and actual phosphorus concentrations on the growth rate of free-floating plant species (Azolla filiculoides, Lemna minor/gibba and Ricciocarpus natans)and the effect of phosphorus history on the competition between L. minor/gibba and A. filiculoides and between L. minor/gibba and R. natans. As expected, plant growth was lower when previously kept at low instead of high phosphorus concentrations. Growth of L. minor/gibba and A. filiculoides with a phosphorus rich history was comparable for low and high actual phosphorus concentrations, however, internal phosphorus concentrations were significantly lower with low actual phosphorus concentration. This indicates that both species perform luxury phosphorus uptake. Furthermore, internal P concentration in Azolla and Lemna increased within two weeks after a period of P deficit without a strong increase in growth. A. filiculoides in a mixture with L. minor/gibba grew faster than its monoculture. Morphological differences may explain why A. filiculoides outcompeted L. minor/gibba and these differences may be induced by phosphorus concentrations in the past. Growth of L. minor/gibba was only reduced by the presence of A. filiculoides with a high phosphorus history. Growth of L. minor/gibba and R. natans in mixtures was positively affected only when they had a high phosphorus history themselves and their competitor a low phosphorus history. These observations clearly indicate that phosphorus history of competing plants is important for understanding the outcome of the competition. Therefore, actual and previously experienced phosphorus
Resins characterization strategy at Kozloduy Nuclear Power Plant
International Nuclear Information System (INIS)
Fenoy, A.; González, R.; Molleda, P.; Sánchez, L.; Herrera, J.
2013-01-01
The Consortium ENSA- Gas Natural Fenosa Engineering has a contract with Kozloduy Nuclear Power Plant (KNPP) for the retrieval and conditioning of the resins. Before that, the project deals with resins characterization to verify the fulfillment the Bulgarian authorities’ requirements. The project includes all the resins generated during the operation of the BACKGROUND Resins characterization strategy at Kozloduy Nuclear Power Plant units 1, 2, 3 and 4, which were stored into six big dimensions tanks: four low tanks and two intermediate tanks. They only have a manhole above for tanks access. The methodology and the progress of the work are presented
Chromatography in characterization of polysaccharides from medicinal plants and fungi.
Hu, De-jun; Cheong, Kit-leong; Zhao, Jing; Li, Shao-ping
2013-01-01
Polysaccharides isolated from medicinal plants and fungi exhibit multiple pharmacological activities. The biological activities of polysaccharides depend on their chemical characteristics. However, characterization of polysaccahrides is a challenge because of their complicated structure and macromolecular mass. In this review, chromatography in characterization of polysaccharides, including physicochemical characterization (purity, molecular mass, and distribution), structural characterization (constituent monosaccharide composition and the ratio, the features of glycosidic linkages), and fingerprint of polysaccharides (acidic and enzymatic hydrolysates), from medicinal plants and fungi were reviewed and discussed according to the publications collected in Web of Science since 2007. The perspective for characterization of polysaccharides has also been described. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Characterization of leaf area of Agave fourcroydes Lem. plants obtained from asexual propagation
Directory of Open Access Journals (Sweden)
Maryla Sosa del Castillo
2014-01-01
Full Text Available The henequen (Agave fourcroydes Lem. is a crop of great economic importance. This study was aimed to characterize the leaf surface of henequen plants variety `Sac Ki' obtained by asexual propagation methods. In vitro plants, shoots of bulbils of in vitro plants, shoots of rhizomes of in vitro plants, shoots of bulbils of field plants and shoots of field rhizomes were used. At 7 and 15 months after planting in the nursery, the epidermis was characterized through the stomatal index and stomatal density. Moreover, the conductor vessels and fiber bundles in leaf mesophyll, were characterized. It was found that the leaf surface of henequen plants variety `Sac Ki' obtained by different methods of asexual propagation showed similar anatomical structures. However, it was observed that in vitro plants were different from the rest in terms of stomatal index and stomatal density in both time points. It was suggesting a accommodate response to environmental conditions. Key words: stomatic density, stomatic index, in vitro plants
Persky, Victoria; Piorkowski, Julie; Turyk, Mary; Freels, Sally; Chatterton, Robert; Dimos, John; Bradlow, H Leon; Chary, Lin Kaatz; Burse, Virlyn; Unterman, Terry; Sepkovic, Daniel W; McCann, Kenneth
2012-08-29
Studies have shown associations of diabetes and endogenous hormones with exposure to a wide variety of organochlorines. We have previously reported positive associations of polychlorinated biphenyls (PCBs) and inverse associations of selected steroid hormones with diabetes in postmenopausal women previously employed in a capacitor manufacturing plant. This paper examines associations of PCBs with diabetes and endogenous hormones in 63 men previously employed at the same plant who in 1996 underwent surveys of their exposure and medical history and collection of bloods and urine for measurements of PCBs, lipids, liver function, hematologic markers and endogenous hormones. PCB exposure was positively associated with diabetes and age and inversely associated with thyroid stimulating hormone and triiodothyronine-uptake. History of diabetes was significantly related to total PCBs and all PCB functional groupings, but not to quarters worked and job score, after control for potential confounders. None of the exposures were related to insulin resistance (HOMA-IR) in non-diabetic men. Associations of PCBs with specific endogenous hormones differ in some respects from previous findings in postmenopausal women employed at the capacitor plant. Results from this study, however, do confirm previous reports relating PCB exposure to diabetes and suggest that these associations are not mediated by measured endogenous hormones.
Koeck, Daniela E; Zverlov, Vladimir V; Liebl, Wolfgang; Schwarz, Wolfgang H
2014-07-01
Clostridium thermocellum is among the most prevalent of known anaerobic cellulolytic bacteria. In this study, genetic and phenotypic variations among C. thermocellum strains isolated from different biogas plants were determined and different genotyping methods were evaluated on these isolates. At least two C. thermocellum strains were isolated independently from each of nine different biogas plants via enrichment on cellulose. Various DNA-based genotyping methods such as ribotyping, RAPD (Random Amplified Polymorphic DNA) and VNTR (Variable Number of Tandem Repeats) were applied to these isolates. One novel approach - the amplification of unknown target sequences between copies of a previously discovered Random Inserted Mobile Element (RIME) - was also tested. The genotyping method with the highest discriminatory power was found to be the amplification of the sequences between the insertion elements, where isolates from each biogas plant yielded a different band pattern. Cellulolytic potentials, optimal growth conditions and substrate spectra of all isolates were characterized to help identify phenotypic variations. Irrespective of the genotyping method used, the isolates from each individual biogas plant always exhibited identical patterns. This is suggestive of a single C. thermocellum strain exhibiting dominance in each biogas plant. The genotypic groups reflect the results of the physiological characterization of the isolates like substrate diversity and cellulase activity. Conversely, strains isolated across a range of biogas plants differed in their genotyping results and physiological properties. Both strains isolated from one biogas plant had the best specific cellulose-degrading properties and might therefore achieve superior substrate utilization yields in biogas fermenters. Copyright © 2014 Elsevier GmbH. All rights reserved.
Synthesis and characterization of nanoparticles capped with medicinal plant extracts
Rekulapally, Sujith R.
In this study, synthesis, characterization and biological application of series nanometal (silver, Ag) and nanometal oxide (titania, TiO2) were carried out. These nanomaterials were prepared using wet-chemistry method and then coated using natural plant extract. Three medicinal plants, namely Zingiber officinale (Ginger), Allium sativum (Garlic) and Capsicum annuum (Chili) were chosen as grafting agent to decrease the side-effects and increase the efficiency of NPs towards living organism. Extraction conditions were controlled under 60-100 °C for 8 hrs. Ag and TiO2 NPs were fabricated using colloidal chemistry and variables were controlled at ambient condition. The band gap of TiO2 NPs used as disinfectant was also modified through coating the medicinal plant extracts. The medicinal plant extracts and coated NPs were measured using spectroscopic methods. Ultraviolet-visible spectra indicated the Ag NPs were formed. The peak at 410 nm resulted from the electrons transferred from their ground to the excited state. The broadened full width at half maximum (FWHM) suggested the ultrafine particles were obtained. The lipid soluble compounds, phenols, tri-terpenoids, flavanoids, capsaicinoids, flavonoids, carotenoids, steroids steroidal glycosides, and vitamins were determined from the high performance liquid chromatographical analyses. X-ray powder diffraction indicated that the face-centered cubic Ag (PDF: 00-004-0783, a = 4.0862A, a = 90°) and anatase TiO2 (PDF: 01-08-1285, a = 3.7845, c = 9.5143A, a = 90°) were obtained using colloidal chemistry. Bactericidal activity indicated that these core-shelled TiO 2 were effective (MBC=0.6 ppm, within 30 mins) at inactivating Gram-positive and Gram-negative bacteria. It is proposed that the medicinal extracts enhanced the potency of NPs against bacteria. From our previous study, the Ag NPs were highly effective at inactivating both bacteria.
Identification and primary characterization of a plant antimicrobial ...
African Journals Online (AJOL)
Then an agar-overlay method using fully separated proteins on sodium dodecyl sulphate-polyacryliamide gel electrophoresis (SDS-PAGE) gels was used for initial determination and primary characterization of active putative defensins in the plant seeds. Clear and remarkable zones of inhibition in a region corresponding to ...
Expression and characterization of plant aspartic protease nepenthesin-1 from Nepenthes gracilis.
Kadek, Alan; Tretyachenko, Vyacheslav; Mrazek, Hynek; Ivanova, Ljubina; Halada, Petr; Rey, Martial; Schriemer, David C; Man, Petr
2014-03-01
Carnivorous plants of the genus Nepenthes produce their own aspartic proteases, nepenthesins, to digest prey trapped in their pitchers. Nepenthesins differ significantly in sequence from other aspartic proteases in the animal or even plant kingdoms. This difference, which also brings more cysteine residues into the structure of these proteases, can be a cause of uniquely high temperature and pH stabilities of nepenthesins. Their detailed structure characterization, however, has not previously been possible due to low amounts of protease present in the pitcher fluid and also due to limited accessibility of Nepenthes plants. In the present study we describe a convenient way for obtaining high amounts of nepenthesin-1 from Nepenthes gracilis using heterologous production in Escherichia coli. The protein can be easily refolded in vitro and its characteristics are very close to those described for a natural enzyme isolated from the pitcher fluid. Similarly to the natural enzyme, recombinant nepenthesin-1 is sensitive to denaturing and reducing agents. It also has maximal activity around pH 2.5, shows unusual stability at high pH and its activity is not irreversibly inhibited even after prolonged incubation in the basic pH range. On the other hand, temperature stability of the recombinant enzyme is lower in comparison with the natural enzyme, which can be attributed to missing N-glycosylation in the recombinant protein. Copyright © 2013 Elsevier Inc. All rights reserved.
Characterizing radionuclides in the B Plant HEPA filters
International Nuclear Information System (INIS)
Roege, P.E.
1998-01-01
B Plant was built during World War II to separate plutonium for nuclear weapons from reactor fuel. Later, the plant was re-equipped and used to separate radioactive fission products from the Hanford Site's nuclear processing waste tanks. The facility is now being deactivated: eliminating, stabilizing, and documenting existing hazards to allow safe surveillance and maintenance pending a final disposition which is yet to be determined. The processing areas of the plant, including process cells and exhaust air system, are heavily contaminated with radioactive cesium and strontium from the tank waste separation process. However, detailed characterization is difficult because many of these areas are inaccessible because of physical barriers and high radiological dose rates. The five existing canyon high efficiency particulate air (HEPA) filters were thought to contain a significant fraction of the inventory, but estimates were highly uncertain. This paper describes the process used to inspect and characterize the radionuclide content in one of these filters. The investigation required a collaborative effort among field and technical personnel. Sophisticated computer modeling and detector technologies were employed in conjunction with sound radiological control and field work practices. The outcome of the effort was a considerable reduction in the filter inventory estimate, accompanied by a greatly improved level of confidence in the data. The information derived from this project will provide a sound basis for future decisions regarding filter disposition
Characterization of some plant extracts by GC-MS
International Nuclear Information System (INIS)
Iordache, A.; Culea, M.; Gherman, C.; Cozar, O.
2009-01-01
Different types of herbs often used in pharmaceutical, cosmetic and food industry were extracted and then analyzed by gas chromatography and gas chromatography-mass spectrometry. The method validation parameters showed good linearity, precision and recovery for a standard mixture. Herbs from different zones of Romania were studied: melissa (Melissa officinalis), nettle (Urtica dioica, Lamium album), camomile (Matricaria chamomilla). The study was applied for fingerprint chromatograms to characterize the flavors extracted from herb plants of different sources. The identity and quantity of the measured active compounds was correlated with the expected therapeutic effects. The active principles content was determined for the same herb, and different amounts of the active principles were determined for plants of different origin.
Characterization of some plant extracts by GC-MS
Energy Technology Data Exchange (ETDEWEB)
Iordache, A. [' Babes-Bolyai' University, Str. M. Kogalniceanu, Nr. 1, Cluj-Napoca 400084 (Romania)], E-mail: andres_iro2002@yahoo.com; Culea, M.; Gherman, C.; Cozar, O. [' Babes-Bolyai' University, Str. M. Kogalniceanu, Nr. 1, Cluj-Napoca 400084 (Romania)
2009-01-15
Different types of herbs often used in pharmaceutical, cosmetic and food industry were extracted and then analyzed by gas chromatography and gas chromatography-mass spectrometry. The method validation parameters showed good linearity, precision and recovery for a standard mixture. Herbs from different zones of Romania were studied: melissa (Melissa officinalis), nettle (Urtica dioica, Lamium album), camomile (Matricaria chamomilla). The study was applied for fingerprint chromatograms to characterize the flavors extracted from herb plants of different sources. The identity and quantity of the measured active compounds was correlated with the expected therapeutic effects. The active principles content was determined for the same herb, and different amounts of the active principles were determined for plants of different origin.
Pressurized water reactor nuclear power plant. Environmental characterization information report
International Nuclear Information System (INIS)
1981-01-01
The typical plant chosen for characterization is a 10000-MWe nameplate rating with wet-natural-draft cooling towers and modern radwaste control and processing equipment. The process, plant operating parameters, resources needed, and the environmental residuals and products associated with the power plant are presented. Annual resource usage and pollutant discharges are shown in English and metric units, assuming an annual plant capacity factor of 70%. In addition to annual quantities, the summary table gives quantities in terms of 10 12 Btu (about 293 million kWh) of electrical energy produced for comparison among energy processes. Supporting information and calculation procedures for the data are given. Thirteen environmental points of interest are discussed individually. Cost information, typical radioactive releases, and use of cooling ponds as an alternative cooling method are discussed in appendixes. A glossary and list of acronyms and abbreviations are provided
Characterization of livestock wastewater at various stages of wastewater treatment plant
International Nuclear Information System (INIS)
Ting Teo Ming; Kim, Tak Hyun; Lee, Myun Joo
2007-01-01
A characterization study has been conducted at Gongju Livestock Wastewater Treatment Plant, Gongju, South Korea. It is owned and operated by the government with treatment capacity of 250 tons per day. Livestock wastewater was collected from individual farmer and treated at the treatment plant. The centralized livestock wastewater treatment plant has various treatment processes namely pre-treatment, anaerobic digestion, nitrification, de-nitrification , chemical treatment, sand filtration and ozonization. The livestock wastewater was characterized by high COD, SS, T-N and T-P with concentration of 20600 mg/l, 6933 mg/l, 2820 mg/l and 700 mg/ l, respectively. After the wastewater has undergone various treatment processes it was discharged to waterways with concentration of COD, SS, T-N and T-P at 105 mg/l, 73 mg/l, 2.1 mg/l and 9 mg/l, respectively. This is part of the study to investigate the potential of irradiation to be applied at the centralized livestock wastewater treatment plant. Although livestock wastewater can be potentially applied to crop as source of nutrients it also affect the water quality due to runoff and leaching. When the wastewater applied at the rates in excess of crop uptake rates, the excess wastewater could potentially enter surface and groundwater and polluted them. (author)
DEFF Research Database (Denmark)
Stranne, Maria
The plant cell wall is a dynamic structure and it is involved in regulating a number of physiological features of plants such as physical strength, growth, cell differentiation, intercellular communication, water movement and defense responses. Pectins constitute a major class of plant cell wall...... polysaccharides and consist of backbones rich in galacturonic acids, which are decorated with a range of functional groups including acetyl esters and arabinan sidechains. Although much effort has been made to uncover biological functions of pectins in plants and remarkable progresses have taken place, many...... aspects remain elusive. Studies described in this thesis aimed at gaining new insights into the biological roles of pectin acetylation and arabinosylation in the model plant Arabidopsis thaliana. The thesis consists of four chapters: physiological characterization of cell wall mutants affected in cell...
Al-Younis, Inas M.
2018-05-01
Adenylyl Cyclases (ACs) catalyze the formation of the key universal second messenger adenosine 3’, 5’-cyclic monophosphate (cAMP) from adenosine 5’- triphosphate. Cyclic AMP participates in several signal transduction pathways and is present in bacteria and higher and lower eukaryotes including higher plants. Previous studies in plants have shown a role for cAMP in signal transduction during e.g. the cell cycle, elongation of the pollen tube and stimulation of protein kinase activity. More recently cAMP has been shown to play a role in stress responses. Interestingly, cAMP has also been shown to regulate ion transport in plant cells. Here we used a similar strategy that led to the discovery of the first guanylyl cyclase in plants that was based on the alignment of conserved and functionally assigned amino acids in the catalytic centre of annotated nucleotide cyclases from lower and higher eukaryotes, to identify a novel candidate ACs in Arabidopsis (Arabidopsis thaliana K+ Uptake 5 and 7). ATKUP5 and 7 are homologous to K+ uptake permeases (KUPs) from bacteria and high-affinity K+ transporters (HAKs) from fungi. The AC activity was investigated by recombinantly expressing the ATKUP5 and 7 AC domain in vitro and by complementation of an E. coli AC mutant (cyaA). Furthermore, ATKUP5 was tested for its ability to functionally complement a yeast mutant deficient in Trk1 and Trk2 high affinity potassium uptake transporters. Site-mutagenesis in the AC domain was used to test the effect of both functions in each other. Furthermore, ATKUP5 was characterized electrophysiologically in HEK-293 cells to characterize the nature of this transporter. The localization of the ATKUP5 in Arabidopsis was examined using a Green Fluorescent Protein (GFP) fusion with the ATKUP5 to determine whether ATKUP5 is expressed at the plasma or tonoplast membrane. Arabiodpsis thaliana of the wild type, overexpressing ATKUP5 and atkup5 mutant lines were used to examine phenotypic differences.
Biochemical and kinetic characterization of geranylgeraniol 18 ...
African Journals Online (AJOL)
Suchart
2015-07-22
Jul 22, 2015 ... biochemical characterization of GGOH 18-hydroxylase activity in the microsomal fraction from C. .... method as previously described (Chanama et al., 2009). Briefly, 30 g of frozen ..... Catalytic properties of the plant cytochrome.
Characterization of the head end cells at the West Valley Nuclear Fuel Reprocessing Plant
International Nuclear Information System (INIS)
Vance, R.F.
1986-11-01
The head-end cells at the West Valley Nuclear Fuel Reprocessing Plant are characterized in this report. These cells consist of the Process Mechanical Cell (PMC) where irradiated nuclear fuel was trimmed of excess hardware and sheared into short segments; and the General Purpose Cell (GPC) where the segments were collected and stored prior to dissolution, and leached hulls were packaged for disposal. Between 1966 and 1972, while Nuclear Fuels Services operated the plant, these cells became highly contaminated with radioactive materials. The purpose of this characterization work was to develop technical information as a basis of decontamination and decommissioning planning and engineering. It was accomplished by performing remote in-cell visual examinations, radiation surveys, and sampling. Supplementary information was obtained from available written records, out-of-cell inspections, and interviews with plant personnel
Berger, Andreas; Fasshuber, Hannes; Schinnerl, Johann; Robien, Wolfgang; Brecker, Lothar; Valant-Vetschera, Karin
2011-12-08
Several roots or rhizomes of rubiaceous species are reportedly used as the emetic and antiamoebic drug ipecac. True ipecac (Carapichea ipecacuanha) is chemically well characterized, in contrast to striated or false ipecac derived from the rhizomes of Ronabea emetica (syn. Psychotria emetica). Besides its previous use as substitute of ipecac, the latter species is applied in traditional medicine of Panama and fruits of its relative Ronabea latifolia are reported as curare additives from Colombia. Compounds of Ronabea emetica were isolated using standard chromatographic techniques, and structurally characterized by NMR spectroscopy and mass spectrometry. Organ specific distribution in Ronabea emetica as well as in Ronabea latifolia was further assessed by comparative HPLC analysis. Four iridoid-glucosides, asperuloside (1), 6α-hydroxygeniposide (2), deacetylasperulosidic acid (3) and asperulosidic acid (4) were extracted from leaves of Ronabea emetica. Rhizomes, used in traditional medicine, were dominated by 3. HPLC profiles of Ronabea latifolia were largely corresponding. These results contrast to the general tendency of producing emetine-type and indole alkaloids in species of Psychotria and closely related genera and merit chemotaxonomic significance, characterizing the newly delimited genus Ronabea. The aim of the work was to resolve the historic problem of adulteration of ipecac by establishing the chemical profile of Ronabea emetica, the false ipecac, as one of its less known sources. The paper demonstrates that different sources of ipecac can be distinguished by their phytochemistry, thus contributing to identifying adulterations of true ipecac. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.
International Nuclear Information System (INIS)
Molecke, M.A.
1978-11-01
A general overview of the Waste Isolation Pilot Plant transuranic wastes experimental characterization program is presented. Objectives and outstanding concerns of this program are discussed. Characteristics of transuranic wastes are also described. Concerns for the terminal isolation of such wastes in a deep bedded salt facility are divided into two phases, those during the short-term operational phase of the facility, and those potentially occurring in the long-term, after decommissioning of the repository. An inclusive summary covering individual studies, their importance to the Waste Isolation Pilot Plant, investigators, general milestones, and comments are presented
Physico-chemical characterization of slag waste coming from GICC thermal power plant
Energy Technology Data Exchange (ETDEWEB)
Acosta, A.; Aineto, M.; Iglesias, I. [Laboratory of Applied Mineralogy, Universidad de Castilla-La Mancha, Ciudad Real Madrid (Spain); Romero, M.; Rincon, J.Ma. [The Glass-Ceramics Laboratory, Insituto Eduardo Torroja de Ciencias de la Construccion, CSIC, c/Serrano Galvache s/n, 28033, Madrid (Spain)
2001-09-01
The new gas installations of combined cycle (GICC) thermal power plants for production of electricity are more efficient than conventional thermal power plants, but they produce a high quantity of wastes in the form of slags and fly ashes. Nowadays, these by-products are stored within the production plants with, until now, no applications of recycling in other industrial processes. In order to evaluate the capability of these products for recycling in glass and ceramics inductory, an investigation for the full characterization has been made by usual physico-chemical methods such as: chemical analysis, mineralogical analysis by XRD, granulometry, BET, DTA/TG, heating microscopy and SEM/EDX.
Materials characterization capabilities at DOE Nuclear Weapons Laboratories and Production Plants
International Nuclear Information System (INIS)
Pyper, J.W.
1984-06-01
The materials characterization and analytical chemistry capabilities at the 11 DOE Nuclear Weapons Laboratories or Production Plants have been surveyed and compared. In general, all laboratories have similar capabilities and equipment. Facilities or capabilities that are unique or that exist at only a few laboratories are described in detail
Process cells dismantling of EUREX pant: previous activities
International Nuclear Information System (INIS)
Gili, M.
1998-01-01
In the '98-'99 period some process cells of the EUREX pant will be dismantled, in order to place there the liquid wastes conditioning plant 'CORA'. This report resumes the previous activities (plant rinsing campaigns and inactive Cell 014 dismantling), run in the past three years and the drawn experience [it
Hegazi, Nabil A; Sarhan, Mohamed S; Fayez, Mohamed; Patz, Sascha; Murphy, Brian R; Ruppel, Silke
2017-01-01
In an effort to axenically culture the previously uncultivable populations of the rhizobacteria of Lucerne (Medicago sativa L.), we propose plant-only teabags culture media to mimic the nutritional matrix available in the rhizosphere. Here, we show that culture media prepared from Lucerne powder teabags substantially increased the cultivability of Lucerne rhizobacteria compared with a standard nutrient agar, where we found that the cultivable populations significantly increased by up to 60% of the total bacterial numbers as estimated by Quantitative Real-time Polymerase Chain Reaction (qRT-PCR). Cluster analysis of 16S rDNA Polymerase Chain Reaction-Denaturing Gradient Gel Electrophoresis (PCR-DGGE) of cultivable Colony-Forming Units (CFUs) revealed a more distinct composition and separation of bacterial populations recovered on the plant-only teabags culture media than those developed on a standard nutrient agar. Further, the new plant medium gave preference to the micro-symbiont Sinorhizobium meliloti, and succeeded in isolating a number of not-yet-cultured bacteria, most closely matched to Novosphingobium sp., Lysobacter sp. and Pedobacter sp. The present study may encourage other researchers to consider moving from the well-established standard culture media to the challenging new plant-only culture media. Such a move may reveal previously hidden members of rhizobacteria, and help to further explore their potential environmental impacts.
Characterization of in-containment cables for nuclear plant life extension
International Nuclear Information System (INIS)
DuCharme, A.R.; Bustard, L.D.
1988-01-01
Electrical cable is made by a large number of manufacturers and used for a variety of applications in nuclear plants. cables have been identified in the Monticello and Surry Pilot Plant life extension studies and the NRC Nuclear Plant Aging Research Program as components important to the economic and safety aspects of life extension. Currently, fitness for service is largely determined by preoperational testing. The US Department of Energy is supporting work at Sandia National Laboratories to assess the technical basis for the life extension of cables found inside containment at US nuclear plants. The work is being performed in coordination with the Nuclear Management and Resource Council's (NUMARC) NUPLEX Working Group. The initial task of this effort is to characterize the design attributes of in-containment cables. This has been completed via development of a data base depicting the manufacturer, type, material composition, use, qualification, and relative popularity of cables installed in containment. Other ongoing work is focused on a review of cable operational experience and assessment of the issues affecting cable life extension. In the long term, the work aims to identify the technical criteria and life extension strategies needed to support continued cable qualification by nuclear plant owner/operators. 7 refs., 4 tabs
RNA-Binding Proteins in Plant Immunity
Directory of Open Access Journals (Sweden)
Virginia Woloshen
2011-01-01
Full Text Available Plant defence responses against pathogen infection are crucial to plant survival. The high degree of regulation of plant immunity occurs both transcriptionally and posttranscriptionally. Once transcribed, target gene RNA must be processed prior to translation. This includes polyadenylation, 5′capping, editing, splicing, and mRNA export. RNA-binding proteins (RBPs have been implicated at each level of RNA processing. Previous research has primarily focused on structural RNA-binding proteins of yeast and mammals; however, more recent work has characterized a number of plant RBPs and revealed their roles in plant immune responses. This paper provides an update on the known functions of RBPs in plant immune response regulation. Future in-depth analysis of RBPs and other related players will unveil the sophisticated regulatory mechanisms of RNA processing during plant immune responses.
Directory of Open Access Journals (Sweden)
Manoj Kumar
2017-10-01
rhizosphere soil as well as the endosphere communities in the Mayrhofen region were all characterized by high relative abundances of nifH sequences related to Geobacter. In contrast, the endosphere and soil (bulk or rhizosphere soil communities in the High Arctic were highly divergent: endosphere communities in the arctic regions were shaped by Clostridium spp., while nifH sequences representing δ-Proteobacteria, β-Proteobacteria, Cyanobacteria (in Ny-Ålesund, and Verrucomicrobia (in Kilpisjärvi dominated the soil communities. Interestingly, the major PNFB genera identified in this study have been previously identified as members of conserved core microbiomes in the endospheres and seeds of these plants by 16S rRNA gene based analyses combined with bacterial isolation, suggesting a very tight interaction between diazotrophic bacteria and these arctic pioneer plants. Overall, anaerobic bacterial taxa dominated the PNFB communities of the endospheres and rhizospheres of the two plant species in all study sites. This could indicate anoxic conditions in and around plant roots at the time of sampling (early growth season, created by melting snow and underlying permafrost.
Kumar, Manoj; van Elsas, Jan Dirk; Nissinen, Riitta
2017-01-01
as well as the endosphere communities in the Mayrhofen region were all characterized by high relative abundances of nifH sequences related to Geobacter . In contrast, the endosphere and soil (bulk or rhizosphere soil) communities in the High Arctic were highly divergent: endosphere communities in the arctic regions were shaped by Clostridium spp., while nifH sequences representing δ- Proteobacteria , β- Proteobacteria, Cyanobacteria (in Ny-Ålesund), and Verrucomicrobia (in Kilpisjärvi) dominated the soil communities. Interestingly, the major PNFB genera identified in this study have been previously identified as members of conserved core microbiomes in the endospheres and seeds of these plants by 16S rRNA gene based analyses combined with bacterial isolation, suggesting a very tight interaction between diazotrophic bacteria and these arctic pioneer plants. Overall, anaerobic bacterial taxa dominated the PNFB communities of the endospheres and rhizospheres of the two plant species in all study sites. This could indicate anoxic conditions in and around plant roots at the time of sampling (early growth season), created by melting snow and underlying permafrost.
Biochemical and Molecular Characterization of Plant-Parasitic Nematodes
Directory of Open Access Journals (Sweden)
I.M. de O. Abrantes
2004-08-01
Full Text Available Nematologists need correct species identification to carry out research, teaching, extension and other activities. Therefore, nematode taxonomy must be pursued diligently at all levels. The identification of plant-parasitic nematodes is not always easy and that of some species is especially difficult. Most of the information that nematologists use when characterizing and identifying specimens is based on morphological and morphometrical characters. Although these characters are of primary importance, in the last three decades they have been supplemented by biochemical/ molecular characters. Biochemical approaches include the separation of proteins (general proteins and isozymes by one-dimensional gel electrophoresis, isoelectric focusing, two-dimensional gel electrophoresis, and sodium dodecyl sulphate-capillary gel electrophoresis. Serology has also been found effective in the identification and quantification of nematodes, monoclonal antibodies being a more useful immunological tool than polyclonal antibodies. Identification based on the direct examination of DNA is potentially a more powerful method to characterize inter- and intra-specific variability. The development of techniques such as the polymerase chain reaction, restriction fragment length polymorphism, randomly amplified polymorphic DNA, and amplified fragment length polymorphism has increased the accuracy and speed of nematode characterization/identification. Progress continues to be made and more and more nematologists are using molecular techniques for diagnostic purposes and to assess genetic variation.
Phytochemical evaluation and molecular characterization of some important medicinal plants
Directory of Open Access Journals (Sweden)
Varahalarao Vadlapudi
2012-05-01
Full Text Available Objective: Phytochemical evaluation and molecular characterization of plants is an important task in medicinal botany and drug discovery. In the current study, Ocimum species, Pimenta officinalis and Piper betel were considered as medicinal plants by evaluation of phytochemical composition like phenol content, Flavonoid content, antioxidant content and other activities like antibacterial, antifungal, lethal dosage (LD 50 of the plant extracts. Among the selected plants P. officinalis shown higher medicinal properties and is selected for molecular characterization. Methods: Antimicrobial activity by agar well diffusion method and also estimated Total phenols, flavonoids content, Total Antioxidants, Cytotoxic assay on Artemia salina for determining lethal dosage (LD50, matK gene was sequenced by using ABI Prism 3700. Leaf extract of P. officinalis plant is further selected for GC-chromatographic analysis to know its chemical composition. DNA was isolated by different protocols, optimized, and is used for the PCR amplification of trnL-gene which is a universal marker among plants in molecular taxonomy. The trnL-gene is amplified by using PCR. The product obtained from PCR is purified and the sample is used for sequencing so that it can be used for comparative studies. Results: P.offcinalis has shown good antimicrobial activity against all organisms . A. flavus is resistant against O. sanctum (B. Phenolic content (26.5 毺 g/g is found to be rich in P. betel where as flavonoid and Antioxidant content are significant in P. betel. The chromatogram revealed the presence of high concentration of Eugenol in the leaf sample. On submitting to BLASTN, the genetic sequence has found similarity with Pimenta dioica plastid partial matK gene and Ugni molinae trnK gene. MatK did not shown any interactions with trnK or trnL genes. MatK has shown interactions with various genes like ycf5, pclpp, psbh, atph, NDVI, rpoc1, ndha, ndhd, psai. Conclusions: we can
Mouri, Chika; Laursen, Richard
2011-10-14
Flavonoids in the grasses (Poaceae family), Arthraxon hispidus (Thunb.) Makino and Miscanthus tinctorius (Steudel) Hackel have long histories of use for producing yellow dyes in Japan and China, but up to now there have been no analytical procedures for characterizing the dye components in textiles dyed with these materials. LC-MS analysis of plant material and of silk dyed with extracts of these plants shows the presence, primarily, of flavonoid C-glycosides, three of which have been tentatively identified as luteolin 8-C-rhamnoside, apigenin 8-C-rhamnoside and luteolin 8-C-(4-ketorhamnoside). Two of these compounds, luteolin 8-C-rhamnoside (M=432), apigenin 8-C-rhamnoside (M=416), along with the previously known tricin (M=330) and several other flavonoids that appear in varying amounts, serve as unique markers for identifying A. hispidus and M. tinctorius as the source of yellow dyes in textiles. Using this information, we have been able to identify grass-derived dyes in Japanese textiles dated to the Nara and Heian periods. However, due to the high variability in the amounts of various flavonoid components, our goal of distinguishing between the two plant sources remains elusive. Copyright © 2011 Elsevier B.V. All rights reserved.
Massaquoi, Lamin Daddy; Ma, Hui; Liu, Xue Hui; Han, Peng Yu; Zuo, Shu-Mei; Hua, Zhong-Xian; Liu, Dian-Wu
2015-12-01
It is common knowledge that soils irrigated with wastewater accumulate heavy metals more than those irrigated with cleaner water sources. However, little is known on metal concentrations in soils and cultivars after the cessation of wastewater use. This study assessed the accumulation and health risk of heavy metals 3 years post-wastewater irrigation in soils, vegetables, and farmers' hair. Soils, vegetables, and hair samples were collected from villages previously irrigating with wastewater (experimental villages) and villages with no history of wastewater irrigation (control villages). Soil samples were digested in a mixture of HCL/HNO3/HCLO4/HF. Plants and hair samples were digested in HNO3/HCLO4 mixture. Inductive coupled plasma-optical emission spectrometer (ICP-OES) was used to determine metal concentrations of digested extracts. Study results indicate a persistence of heavy metal concentration in soils and plants from farms previously irrigated with wastewater. In addition, soils previously irrigated with wastewater were severely contaminated with cadmium. Hair metal concentrations of farmers previously irrigating with wastewater were significantly higher (P metal concentrations in hair samples of farmers previously irrigating with wastewater were not associated with current soil metal concentrations. The study concludes that there is a persistence of heavy metals in soils and plants previously irrigated with wastewater, but high metal concentrations in hair samples of farmers cannot be associated with current soil metal concentrations.
Stripping Away the Soil: Plant Growth Promoting Microbiology Opportunities in Aquaponics
Bartelme, Ryan P; Oyserman, Ben O; Blom, Jesse E; Sepulveda-Villet, Osvaldo J; Newton, Ryan J
2018-01-01
As the processes facilitated by plant growth promoting microorganisms (PGPMs) become better characterized, it is evident that PGPMs may be critical for successful sustainable agricultural practices. Microbes enrich plant growth through various mechanisms, such as enhancing resistance to disease and drought, producing beneficial molecules, and supplying nutrients and trace metals to the plant rhizosphere. Previous studies of PGPMs have focused primarily on soil-based crops. In contrast, aquapo...
Fuentes, Alejandro; Carlos, Natacha; Ruiz, Yoslaine; Callard, Danay; Sánchez, Yadira; Ochagavía, María Elena; Seguin, Jonathan; Malpica-López, Nachelli; Hohn, Thomas; Lecca, Maria Rita; Pérez, Rosabel; Doreste, Vivian; Rehrauer, Hubert; Farinelli, Laurent; Pujol, Merardo; Pooggin, Mikhail M
2016-03-01
RNA interference (RNAi) is a widely used approach to generate virus-resistant transgenic crops. However, issues of agricultural importance like the long-term durability of RNAi-mediated resistance under field conditions and the potential side effects provoked in the plant by the stable RNAi expression remain poorly investigated. Here, we performed field trials and molecular characterization studies of two homozygous transgenic tomato lines, with different selection markers, expressing an intron-hairpin RNA cognate to the Tomato yellow leaf curl virus (TYLCV) C1 gene. The tested F6 and F4 progenies of the respective kanamycin- and basta-resistant plants exhibited unchanged field resistance to TYLCV and stably expressed the transgene-derived short interfering RNA (siRNAs) to represent 6 to 8% of the total plant small RNAs. This value outnumbered the average percentage of viral siRNAs in the nontransformed plants exposed to TYLCV-infested whiteflies. As a result of the RNAi transgene expression, a common set of up- and downregulated genes was revealed in the transcriptome profile of the plants selected from either of the two transgenic events. A previously unidentified geminivirus causing no symptoms of viral disease was detected in some of the transgenic plants. The novel virus acquired V1 and V2 genes from TYLCV and C1, C2, C3, and C4 genes from a distantly related geminivirus and, thereby, it could evade the repressive sequence-specific action of transgene-derived siRNAs. Our findings shed light on the mechanisms of siRNA-directed antiviral silencing in transgenic plants and highlight the applicability limitations of this technology as it may alter the transcriptional pattern of nontarget genes.
Benjamin C. Bright; E. Louise Loudermilk; Scott M. Pokswinski; Andrew T. Hudak; Joseph J. O' Brien
2016-01-01
Methods characterizing fine-scale fuels and plant diversity can advance understanding of plant-fire interactions across scales and help in efforts to monitor important ecosystems such as longleaf pine (Pinus palustris Mill.) forests of the southeastern United States. Here, we evaluate the utility of close-range photogrammetry for measuring fuels and plant...
Chamindu Deepagoda, T. K. K.; Chen Lopez, Jose Choc; Møldrup, Per; de Jonge, Lis Wollesen; Tuller, Markus
2013-10-01
Over the last decade there has been a significant shift in global agricultural practice. Because the rapid increase of human population poses unprecedented challenges to production of an adequate and economically feasible food supply for undernourished populations, soilless greenhouse production systems are regaining increased worldwide attention. The optimal control of water availability and aeration is an essential prerequisite to successfully operate plant growth systems with soilless substrates such as aggregated foamed glass, perlite, rockwool, coconut coir, or mixtures thereof. While there are considerable empirical and theoretical efforts devoted to characterize water retention and aeration substrate properties, a holistic, physically-based approach considering water retention and aeration concurrently is lacking. In this study, the previously developed concept of integral water storage and energy was expanded to dual-porosity substrates and an analog integral oxygen diffusivity parameter was introduced to simultaneously characterize aeration properties of four common soilless greenhouse growth media. Integral parameters were derived for greenhouse crops in general, as well as for tomatoes. The integral approach provided important insights for irrigation management and for potential optimization of substrate properties. Furthermore, an observed relationship between the integral parameters for water availability and oxygen diffusivity can be potentially applied for the design of advanced irrigation and management strategies to ensure stress-free growth conditions, while conserving water resources.
International Nuclear Information System (INIS)
Lambright, J.A.; Nowlen, S.P.; Nicolette, V.F.; Bohn, M.P.
1989-01-01
An investigation of nuclear power plant fire risk issues raised as a result of the USNRC sponsored Fire Protection Research Program at Sandia National Laboratories has been performed. The specific objectives of this study were (1) to review and requantify fire risk scenarios from four fire probabilistic risk assessments (PRAs) in light of updated data bases made available as a result of USNRC sponsored Fire Protection Research Program and updated computer fire modeling capabilities, (2) to identify potentially significant fire risk issues that have not been previously addressed in a fire risk context and to quantify the potential impact of those identified fire risk issues where possible, and (3) to review current fire regulations and plant implementation practices for relevance to the identified unaddressed fire risk issues. In performance of the fire risk scenario requantifications several important insights were gained. It was found that utilization of a more extensive operational experience base resulted in both fire occurrence frequencies and fire duration times (i.e., time required for fire suppression) increasing significantly over those assumed in the original works. Additionally, some thermal damage threshold limits assumed in the original works were identified as being nonconservative based on more recent experimental data. Finally, application of the COMPBRN III fire growth model resulted in calculation of considerably longer fire damage times than those calculated in the original works using COMPBRN I. 14 refs., 2 figs., 16 tabs
Advances in methods for identification and characterization of plant transporter function
DEFF Research Database (Denmark)
Larsen, Bo; Xu, Deyang; Halkier, Barbara Ann
2017-01-01
Transport proteins are crucial for cellular function at all levels. Numerous importers and exporters facilitate transport of a diverse array of metabolites and ions intra- and intercellularly. Identification of transporter function is essential for understanding biological processes at both......-based approaches. In this review, we highlight examples that illustrate how new technology and tools have advanced identification and characterization of plant transporter functions....
Characterization of Savannah River Plant waste glass
International Nuclear Information System (INIS)
Plodinec, M.J.
1985-01-01
The objective of the glass characterization programs at the Savannah River Laboratory (SRL) is to ensure that glass containing Savannah River Plant high-level waste can be permanently stored in a federal repository, in an environmentally acceptable manner. To accomplish this objective, SRL is carrying out several experimental programs, including: fundamental studies of the reactions between waste glass and water, particularly repository groundwater; experiments in which candidate repository environments are simulated as accurately as possible; burial tests of simulated waste glass in candidate repository geologies; large-scale tests of glass durability; and determination of the effects of process conditions on glass quality. In this paper, the strategy and current status of each of these programs is discussed. The results indicate that waste packages containing SRP waste glass will satisfy emerging regulatory criteria
Towards development of new ornamental plants
DEFF Research Database (Denmark)
Kuligowska, Katarzyna; Lütken, Henrik Vlk; Müller, Renate
2016-01-01
is one of the oldest breeding techniques that contributed enormously to the development of modern plant cultivars. Within ornamental breeding, it represents the main source of genetic variation. During the long history of wide hybridization, a number of methods were implemented allowing the evolution...... from a conventional breeding tool into a modern methodology. Nowadays, the research on model plants and crop species increases our understanding of reproductive isolation among distant species and partly explains the background of the traditional approaches previously used for overcoming hybridization...... barriers. Characterization of parental plants and hybrids is performed using molecular and cytological techniques that strongly facilitate breeding processes. Molecular markers and sequencing technologies are used for the assessment of genetic relationships among plants, as the genetic distance...
Plant diversity and plant identity influence Fusarium communities in soil.
LeBlanc, Nicholas; Kinkel, Linda; Kistler, H Corby
2017-01-01
Fusarium communities play important functional roles in soil and in plants as pathogens, endophytes, and saprotrophs. This study tests how rhizosphere Fusarium communities may vary with plant species, changes in the diversity of the surrounding plant community, and soil physiochemical characteristics. Fusarium communities in soil associated with the roots of two perennial prairie plant species maintained as monocultures or growing within polyculture plant communities were characterized using targeted metagenomics. Amplicon libraries targeting the RPB2 locus were generated from rhizosphere soil DNAs and sequenced using pyrosequencing. Sequences were clustered into operational taxonomic units (OTUs) and assigned a taxonomy using the Evolutionary Placement Algorithm. Fusarium community composition was differentiated between monoculture and polyculture plant communities, and by plant species in monoculture, but not in polyculture. Taxonomic classification of the Fusarium OTUs showed a predominance of F. tricinctum and F. oxysporum as well of the presence of a clade previously only found in the Southern Hemisphere. Total Fusarium richness was not affected by changes in plant community richness or correlated with soil physiochemical characteristics. However, OTU richness within two predominant phylogenetic lineages within the genus was positively or negatively correlated with soil physiochemical characteristics among samples within each lineage. This work shows that plant species, plant community richness, and soil physiochemical characteristics may all influence the composition and richness of Fusarium communities in soil.
Expression and characterization of plant aspartic protease nepenthesin-1 from Nepenthes gracilis
Czech Academy of Sciences Publication Activity Database
Kádek, Alan; Tretyachenko, V.; Mrázek, Hynek; Ivanova, Ljubina; Halada, Petr; Rey, M.; Schriemer, D. C.; Man, Petr
2014-01-01
Roč. 95, MAR 2014 (2014), s. 121-128 ISSN 1046-5928 R&D Projects: GA ČR GAP206/12/0503; GA MŠk(CZ) EE2.3.30.0003 Institutional support: RVO:61388971 Keywords : Plant aspartic protease * Nepenthesin * Protease characterization Subject RIV: CE - Biochemistry Impact factor: 1.695, year: 2014
Characterization of ultrafine and fine particles from CHP Plants
Energy Technology Data Exchange (ETDEWEB)
2009-08-15
Samples of particles collected at CHP plants in the project 'Survey of emissions from CHP Plants' have been analysed in this project to give information on the morphology and chemical composition of individual particle size classes. The objective of this project was to characterize ultrafine and fine particles emitted to the atmosphere from Danish CHP plants. Nine CHP plants were selected in the Emission Survey Project as being representative for the different types of CHP plants operating in Denmark: 1) Three Waste-to Energy (WTE) plants. 2) Three biomass fired (BM) plants (two straw fired, one wood/saw dust fired). 3) Two gas fired (GF) plants (one natural gas, one landfill gas fired). 4) One gasoil (GO) fired plant. At the WTE and BM plants, various types of emission control systems implemented. The results from these plants represent the composition and size distribution of combustion particles that are emitted from the plants emission control systems. The measured emissions of particles from the waste-to-energy plants WTE1-3 are generally very low. The number and mass concentrations of ultrafine particles (PM{sub 0.1}) were particularly low in the flue gas from WTE2 and WTE3, where bag filters are used for the reduction of particle emissions. The EDX analysis of particles from the WTE plants indicates that the PM{sub 0.1} that penetrates the ECS at WTE can contain high fractions of metals such as Fe, Mn and Cu. The SEM analysis of particles from WTE1-3 showed that the particles were generally porous and irregular in shape. The concentrations of particles in the flue gas from the biomass plants were generally higher than found for the WTE plants. The time series results showed that periodical, high concentration peaks of PM emissions occur from BM1 and BM2. The chemical composition of the particles emitted from the three biomass plants is generally dominated by C, O and S, and to some extend also Fe and Si. A high amount of Cu was found in selected
Biochemical and histological characterization of Agave fourcroydes Lem. plants in vitro acclimatized
Directory of Open Access Journals (Sweden)
Yunel Pérez Hernández
2016-10-01
Full Text Available Henequen (Agave fourcroydes Lem. is a representative crop of the province of Matanzas, Cuba, which has been exploited extensively for the quality of its fibers. The present work aimed to characterize from the biochemical and histological point of view henequen plants cv. 'Sac Ki' in vitro acclimatized. The biochemical indicators analyzed were concentration of soluble phenols, total soluble carbohydrates, reducing sugars, soluble proteins and total chlorophylls, as well as the relative contents of flavonoids, terpins and anthocyanins. In addition, a histological analysis of the epidermis was performed and the results were compared with plants of one month in rooting culture medium. In vitro acclimatized plants were subsequently transferred to the ex vitro conditions. The contents of total soluble carbohydrates, reducing sugars and chlorophylls decreased, whereas the levels of soluble phenols, proteins and secondary metabolites were higher in relation to in vitro plants rooted for 30 days. The epidermis of the in vitro acclimatized plants showed a greater development of the stomatal apparatus that could positively affect the ex vitro acclimatization, where a survival rate of 87% and a reduction of the acclimatization time were obtained. Keywords: chlorophyll, henequen, phenol, reducing sugar
Characterization of process air emissions in automotive production plants.
D'Arcy, J B; Dasch, J M; Gundrum, A B; Rivera, J L; Johnson, J H; Carlson, D H; Sutherland, J W
2016-01-01
During manufacturing, particles produced from industrial processes become airborne. These airborne emissions represent a challenge from an industrial hygiene and environmental standpoint. A study was undertaken to characterize the particles associated with a variety of manufacturing processes found in the auto industry. Air particulates were collected in five automotive plants covering ten manufacturing processes in the areas of casting, machining, heat treatment and assembly. Collection procedures provided information on air concentration, size distribution, and chemical composition of the airborne particulate matter for each process and insight into the physical and chemical processes that created those particles.
Characterization of a defective interfering RNA that contains a mosaic of a plant viral genome
Energy Technology Data Exchange (ETDEWEB)
Morris, T.J.; Jackson, A.O.
1991-01-01
Our lab was the first to describe and characterize a defective interfering RNA (DI RNAs or DIs) in association with a small RNA plant virus. The features of the DIs that we discovered in infections of tomato bushy stunt virus were compatible with the properties of DIs identified in many animal virus infections. Animal virologists have generally recognized the importance of studying DIs because they are invaluable tools for identifying cis-acting sequences important in virus multiplication and because they offer the opportunity to elucidate mechanisms involved in viral persistence and disease attenuation. Hence our discovery offered a comparably valuable tool for use in plant virus studies for the first time. Since then, we have also discovered the second example of plant viral DI RNAs associated with turnip crinkle virus (TCV), a virus structurally related to TBSV. We proposed a thorough characterization of this unique class of symptom modulating RNAs with the overall objective of identifying viral RNA nucleotide, sequences involved in such fundamental processes as virus replication and encapsidation as well as the degree of symptom expression resulting from the viral-DI-host interaction. The proposed research focused on the molecular characterization of the DI RNAs and the helper virus. We had demonstrated that the DIs were collinear deletion mutants of the genome of a cherry strain of tomato bushy stunt virus (TBSV). We had also shown that these low molecular weight RNAs interfered with the helper plant virus and modulated disease expression by preventing the development of a lethal necrotic disease in susceptible host plants. We also suggested that by exploring the mechanisms associated with the symptom attenuation effect, we might be able to devise novel strategies useful for engineering viral disease resistance.
International Nuclear Information System (INIS)
Robertson, D.E.; Abel, K.H.; Thomas, C.W.; Lepel, E.A.; Evans, J.C.; Thomas, W.V.; Carrick, L.C.; Leale, M.W.
1985-07-01
To provide a statistically valid data base for the residual radionuclide inventories in nuclear power stations, Pacific Northwest Laboratory (PNL) was contracted to conduct an extensive sampling and measurements program at a number of nuclear power plants. This paper summarizes the results of the radionuclide characterization studies conducted at seven nuclear power stations from a decommissioning assessment viewpoint
Directory of Open Access Journals (Sweden)
Dody Priadi
2016-04-01
Full Text Available Indonesia as a rich biodiversity country has many superior fruit plant germplasms such as sweet star fruit or carambola (Averrhoa carambola L.. Some varieties of carambola which collected at the Germplasm Garden of Research Center for Biotechnology-LIPI have been used for parent trees of fruit plant production. Therefore, they have to be characterized both phenotypically and genetically. The objective of the study was to analyze the relationship between eight varieties of carambola i.e. Malaysia, Penang, Rawasari, Bangkok, Sembiring, Dewabaru, Demak and Dewimurni at the germplasm garden based on phenotypic and genetic characters. Phenotypic characters were observed directly in the field, whereas genetic characters were observed with RAPD markers using 10 primers. Phylogenetic analysis was done using NT-SYS software showed that there were three clusters of carambola varieties. Meanwhile, Malaysia and Penang varieties have closed relationships (96% compared with the other varieties. The result of the study would be dedicated to updating and completing the existing fruit plant collection database of Plants Germplasm Garden.
Reconstruction of prehistoric plant production and cooking practices by a new isotopic method
Energy Technology Data Exchange (ETDEWEB)
Hastorf, C A [California Univ., Los Angeles (USA). Dept. of Anthropology; DeNiro, M J [California Univ., Los Angeles (USA). Dept. of Earth and Space Sciences
1985-06-06
A new method is presented based on isotopic analysis of burnt organic matter, allowing the characterization of previously unidentifiable plant remains extracted from archaeological contexts. The method is used to reconstruct prehistoric production, preparation and consumption of plant foods, as well as the use of ceramic vessels, in the Upper Mantaro Valley region of the central Peruvian Andes.
Liu, Jun; Bai, Ruyu; Liu, Yunpeng; Zhang, Xin; Kan, Juan; Jin, Changhai
2018-02-01
In recent years, several medicinal plants have been demonstrated as valuable resources of naturally occurring polysaccharide-polyphenolic conjugates. For the first time, this article introduces recent advances of polysaccharide-polyphenolic conjugates isolated from different medicinal plants. The isolation, purification, structural characterization and biological activities of polysaccharide-polyphenolic conjugates are introduced in details. In general, polysaccharide-polyphenolic conjugates can be isolated by hot water or alkaline extraction followed by purification through anion exchange chromatography or gel filtration chromatography. The structures of conjugates are usually characterized by chemical composition analysis, UV-vis, Fourier-transform infrared and nuclear magnetic resonance spectroscopy. Moreover, polysaccharide-polyphenolic conjugates exhibit several biological activities including anticoagulant, antioxidant, radioprotective, anti-platelet, antitussive and bronchodilatory effects. Therefore, polysaccharide-polyphenolic conjugates isolated from medicinal plants are certain to have a bright prospect in the field of food and pharmaceutics. Copyright © 2017 Elsevier B.V. All rights reserved.
Characterization of past and present solid waste streams from the plutonium finishing plant
Energy Technology Data Exchange (ETDEWEB)
Duncan, D.R.; Mayancsik, B.A. [Westinghouse Hanford Co., Richland, WA (United States); Pottmeyer, J.A.; Vejvoda, E.J.; Reddick, J.A.; Sheldon, K.M.; Weyns, M.I. [Los Alamos Technical Associates, Kennewick, WA (United States)
1993-02-01
During the next two decades the transuranic (TRU) wastes now stored in the burial trenches and storage facilities at the Hanford Site are to be retrieved, processed at the Waste Receiving and Processing (WRAP) Facility, and shipped to the Waste Isolation Pilot Plant (WIPP) near Carlsbad, New Mexico for final disposal. Over 50% of the TRU waste to be retrieved for shipment to the WIPP has been generated at the Plutonium Finishing Plant (PFP), also known as the Plutonium Processing and Storage Facility and Z Plant. The purpose of this report is to characterize the radioactive solid wastes generated by the PFP since its construction in 1947 using process knowledge, existing records, and history-obtained from interviews. The PFP is currently operated by Westinghouse Hanford Company (WHC) for the US Department of Energy (DOE).
Characterization of past and present solid waste streams from the plutonium finishing plant
International Nuclear Information System (INIS)
Duncan, D.R.; Mayancsik, B.A.; Pottmeyer, J.A.; Vejvoda, E.J.; Reddick, J.A.; Sheldon, K.M.; Weyns, M.I.
1993-02-01
During the next two decades the transuranic (TRU) wastes now stored in the burial trenches and storage facilities at the Hanford Site are to be retrieved, processed at the Waste Receiving and Processing (WRAP) Facility, and shipped to the Waste Isolation Pilot Plant (WIPP) near Carlsbad, New Mexico for final disposal. Over 50% of the TRU waste to be retrieved for shipment to the WIPP has been generated at the Plutonium Finishing Plant (PFP), also known as the Plutonium Processing and Storage Facility and Z Plant. The purpose of this report is to characterize the radioactive solid wastes generated by the PFP since its construction in 1947 using process knowledge, existing records, and history-obtained from interviews. The PFP is currently operated by Westinghouse Hanford Company (WHC) for the US Department of Energy (DOE)
Identification and Characterization of Novel Biocontrol Bacterial
Directory of Open Access Journals (Sweden)
Young Cheol Kim
2014-09-01
Full Text Available Because bacterial isolates from only a few genera have been developed commercially as biopesticides, discovery and characterization of novel bacterial strains will be a key to market expansion. Our previous screen using plant bioassays identified 24 novel biocontrol isolates representing 12 different genera. In this study, we characterized the 3 isolates showing the best biocontrol activities. The isolates were Pantoea dispersa WCU35, Proteus myxofaciens WCU244, and Exiguobacterium acetylicum WCU292 based on 16S rRNA sequence analysis. The isolates showed differential production of extracellular enzymes, antimicrobial activity against various fungal or bacterial plant pathogens, and induced systemic resistance activity against tomato gray mold disease caused by Botrytis cinerea. E. acetylicum WCU292 lacked strong in vitro antimicrobial activity against plant pathogens, but induced systemic resistance against tomato gray mold disease. These results confirm that the trait of biological control is found in a wide variety of bacterial genera
Evolution, diversification and expression of KNOX proteins in plants
Directory of Open Access Journals (Sweden)
Jie eGao
2015-10-01
Full Text Available The KNOX (KNOTTED1-like homeobox transcription factors play a pivotal role in leaf and meristem development. The majority of these proteins are characterized by the KNOX1, KNOX2, ELK and homeobox domains whereas the proteins of the KNATM family contain only the KNOX domains. We carried out an extensive inventory of these proteins and here report on a total of 394 KNOX proteins from 48 species. The land plant proteins fall into two classes (I and II as previously shown where the class I family seems to be most closely related to the green algae homologs. The KNATM proteins are restricted to Eudicots and some species have multiple paralogs of this protein. Certain plants are characterized by a significant increase in the number of KNOX paralogs; one example is Glycine max. Through the analysis of public gene expression data we show that the class II proteins of this plant have a relatively broad expression specificity as compared to class I proteins, consistent with previous studies of other plants. In G. max, class I protein are mainly distributed in axis tissues and KNATM paralogs are overall poorly expressed; highest expression is in the early plumular axis. Overall, analysis of gene expression in G. max demonstrates clearly that the expansion in gene number is associated with functional diversification.
da Silva, J F; Barbosa, R R; de Souza, A N; da Motta, O V; Teixeira, G N; Carvalho, V S; de Souza, A L S R; de Souza Filho, G A
2015-11-30
Each year, approximately 170 million metric tons of chemical fertilizer are consumed by global agriculture. Furthermore, some chemical fertilizers contain toxic by-products and their long-term use may contaminate groundwater, lakes, and rivers. The use of plant growth-promoting bacteria may be a cost-effective strategy for partially replacing conventional chemical fertilizers, and may become an integrated plant nutrient solution for sustainable crop production. The main direct bacteria-activated mechanisms of plant growth promotion are based on improvement of nutrient acquisition, siderophore biosynthesis, nitrogen fixation, and hormonal stimulation. The aim of this study was to isolate and identify bacteria with growth-promoting activities from sugarcane. We extracted the bacterial isolate SCB4789F-1 from sugarcane leaves and characterized it with regard to its profile of growth-promoting activities, including its ability to colonize Arabidopsis thaliana. Based on its biochemical characteristics and 16S rDNA sequence analysis, this isolate was identified as Pantoea ananatis. The bacteria were efficient at phosphate and zinc solubilization, and production of siderophores and indole-3-acetic acid in vitro. The isolate was characterized by Gram staining, resistance to antibiotics, and use of carbon sources. This is the first report on zinc solubilization in vitro by this bacterium, and on plant growth promotion following its inoculation into A. thaliana. The beneficial effects to plants of this bacterium justify future analysis of inoculation of economically relevant crops.
International Nuclear Information System (INIS)
Ahmad, F.; Abbasi, T.; Farman, K.; Akrem, A.; Asif, M.; Mahmood, S.; Iqbal, M.U.
2018-01-01
The herbs are the natural resources for the infinite phenolic compounds that are used in pharmaceutical industry. These herbs are of significant importance due to their beneficial usage for the human health. Here, we studied a common herbs Cannabis sativa, an important member of the family Cannabaceae for phytochemical characterization. The methanol extract of whole Cannabis plant and seed was analyzed for the identification of non-cannabinoid compounds through High Performance Liquid Chromatography (HPLC) technique, because the non-cannabinoid compounds have not been much studied in C. sativa. These compounds are very useful in different diseases, used in cosmetics and as antioxidant agent. HPLC analysis revealed the presence of a variety of non-cannabinoid compounds including Quercetin, Gallic acid, p-Coumaric acid, m-Coumaric acid, Caffeic acid, Cinnamic acid, Ferulic acid, Benzoic acid and Kampferol. Furthermore, Quercetin was observed with high concentration in whole plant sample, whereas high Gallic acid and absence of m-coumaric acid was noted in the Cannabis seed. It was also observed that plant samples were with higher concentration of cinnamic acid as compared to seed. The Caffeic acid, Benzoic acid and Ferulic acid were in low concentration in both Cannabis plant and seed samples. Kampferol is another important non-cannabinoid compound that was also quantified in both samples. This research will be providing a foundation for further molecular characterization of Cannabis plant and seed for their beneficial usage. (author)
Characterizing effects of hydropower plants on sub-daily flow regimes
Bejarano, María Dolores; Sordo-Ward, Álvaro; Alonso, Carlos; Nilsson, Christer
2017-07-01
A characterization of short-term changes in river flow is essential for understanding the ecological effects of hydropower plants, which operate by turning the turbines on or off to generate electricity following variations in the market demand (i.e., hydropeaking). The goal of our study was to develop an approach for characterizing the effects of hydropower plant operations on within-day flow regimes across multiple dams and rivers. For this aim we first defined ecologically meaningful metrics that provide a full representation of the flow regime at short time scales from free-flowing rivers and rivers exposed to hydropeaking. We then defined metrics that enable quantification of the deviation of the altered short-term flow regime variables from those of the unaltered state. The approach was successfully tested in two rivers in northern Sweden, one free-flowing and another regulated by cascades of hydropower plants, which were additionally classified based on their impact on short-term flows in sites of similar management. The largest differences between study sites corresponded to metrics describing sub-daily flow magnitudes such as amplitude (i.e., difference between the highest and the lowest hourly flows) and rates (i.e., rise and fall rates of hourly flows). They were closely followed by frequency-related metrics accounting for the numbers of within-day hourly flow patterns (i.e., rises, falls and periods of stability of hourly flows). In comparison, between-site differences for the duration-related metrics were smallest. In general, hydropeaking resulted in higher within-day flow amplitudes and rates and more but shorter periods of a similar hourly flow patterns per day. The impacted flow feature and the characteristics of the impact (i.e., intensity and whether the impact increases or decreases whatever is being described by the metric) varied with season. Our approach is useful for catchment management planning, defining environmental flow targets
Kruijt, M.; Tran, H.; Raaijmakers, J.M.
2009-01-01
Aims: Plant growth-promoting Pseudomonas putida strain 267, originally isolated from the rhizosphere of black pepper, produces biosurfactants that cause lysis of zoospores of the oomycete pathogen Phytophthora capsici. The biosurfactants were characterized, the biosynthesis gene(s) partially
CHARACTERIZATION OF MERCURY EMISSIONS AT A CHLOR-ALKALI PLANT, VOLUME II. APPENDICES F-J
The report gives results of a characterization of mercury (Hg) emissions at a chlor-alkali plant. Up to 160 short tons (146 Mg) of Hg is consumed by the chlor-alkali industry each year. Very little quantitative information is currently available however, on the actual Hg losses f...
Characterization recommendations for waste sites at the Savannah River Plant
International Nuclear Information System (INIS)
Carlton, W.H.; Gordon, D.E.; Johnson, W.F.; Kaback, D.S.; Looney, B.B.; Nichols, R.L.; Shedrow, C.B.
1987-11-01
One hundred and sixty six disposal facilities that received or may have received waste materials resulting from operations at the Savannah River Plant (SRP) have been identified. These waste range from innocuous solid and liquid materials (e.g., wood piles) to process effluents that contain hazardous and/or radioactive constituents. The waste sites have been grouped into 45 categories according the the type of waste materials they received. Waste sites are located with SRP coordinates, a local Department of Energy (DOE) grid system whose grid north is 36 degrees 22 minutes west of true north. DOE policy is to close all waste sites at SRP in a manner consistent with protecting human health and environment and complying with applicable environmental regulations (DOE 1984). A uniform, explicit characterization program for SRP waste sites will provide a sound technical basis for developing closure plans. Several elements are summarized in the following individual sections including (1) a review of the history, geohydrology, and available characterization data for each waste site and (2) recommendations for additional characterization necessary to prepare a reasonable closure plan. Many waste sites have been fully characterized, while others have not been investigated at all. The approach used in this report is to evaluate available groundwater quality and site history data. For example, groundwater data are compared to review criteria to help determine what additional information is required. The review criteria are based on regulatory and DOE guidelines for acceptable concentrations of constituents in groundwater and soil
Ji, Sang Hye; Gururani, Mayank Anand; Chun, Se-Chul
2014-01-20
We have isolated 576 endophytic bacteria from the leaves, stems, and roots of 10 rice cultivars and identified 12 of them as diazotrophic bacteria using a specific primer set of nif gene. Through 16S rDNA sequence analysis, nifH genes were confirmed in the two species of Penibacillus, three species of Microbacterium, three Bacillus species, and four species of Klebsiella. Rice seeds treated with these plant growth-promoting bacteria (PGPB) showed improved plant growth, increased height and dry weight and antagonistic effects against fungal pathogens. In addition, auxin and siderophore producing ability, and phosphate solubilizing activity were studied for the possible mechanisms of plant growth promotion. Among 12 isolates tested, 10 strains have shown higher auxin producing activity, 6 isolates were confirmed as strains with high siderophore producing activity while 4 isolates turned out to have high phosphate-solubilizing activity. These results strongly suggest that the endophytic diazotrophic bacteria characterized in this study could be successfully used to promote plant growth and inducing fungal resistance in plants. Copyright © 2013 Elsevier GmbH. All rights reserved.
Directory of Open Access Journals (Sweden)
akanksha esingh
2016-05-01
Full Text Available Genomic attempts were undertaken to elucidate the plant developmental responses to heat stress, and to characterize the roles of B2 protein in mediating those responses. A wheat EST for B2 protein was identified which was cloned and characterized to assess its functional relevance causing plant growth and development during stress adaptation. Here, we show that wheat B2 protein is highly expressed in root and shoot tissues as well as in developing seed tissues under high temperature stress conditions. Morphological studies of transgenic Arabidopsis overexpressing gene encoding wheat B2 protein and Δb2 mutant plants were studied at major developmental stages. The stunted growth phenotype of mutant plants, together with hypocotyl and root elongation analysis of transgenic plants showed that B2 protein exhibits a crucial role in plant growth and development. Additional physiological analyses highlights the role of B2 protein in increased tolerance to heat and cold stresses by maintaining high chlorophyll content, strong activity of photosystem II and less membrane damage of overexpression transgenics as compared with the wild-type. Furthermore, the constitutive overexpression of TaB2 in Arabidopsis resulted in ABA hypersensitivity. Taken together, these studies suggest a novel perspectives of B2 protein in plant development and in mediating the thermal stress tolerance.
Gruener, J. E.; Ming, Doug; Galindo, C., Jr.; Henderson, K. E.
2006-01-01
The National Aeronautics and Space Administration (NASA) has developed advanced life support (ALS) systems for long duration space missions that incorporate plants to regenerate the atmosphere (CO2 to O2), recycle water (via evapotranspiration), and produce food. NASA has also developed a zeolite-based synthetic substrate consisting of clinoptilolite and synthetic apatite to support plant growth for ALS systems (Ming et al., 1995). The substrate is called zeoponics and has been designed to slowly release all plant essential elements into "soil" solution. The substrate consists of K- and NH4-exchanged clinoptilolite and a synthetic hydroxyapatite that has Mg, S, and the plant-essential micronutrients incorporated into its structure in addition to Ca and P. Plant performance in zeoponic substrates has been improved by the addition of dolomite pH buffers, nitrifying bacteria, and other calcium-bearing minerals (Henderson et al., 2000; Gruener et al., 2003). Wheat was used as the test crop for all of these studies. The objectives of this study were to expand upon the previous studies to determine the growth and nutrient uptake of radish in zeoponic substrates and to determine the nutrient availability of the zeoponic substrate after three successive radish crops.
Analytical characterization of contaminated soils from former manufactured gas plants
International Nuclear Information System (INIS)
Haeseler, F.; Blanchet, D.; Vandecasteele, J.P.; Druelle, V.; Werner, P.; Technische Univ., Dresden,
1999-01-01
Detailed analytical characterization of the organic matter (OM) of aged polluted soils from five former manufactured gas plants (MGP) and of two coal tars was completed. It was aimed at obtaining information relevant to the physicochemical state of the polycyclic aromatic hydrocarbon (PAH) pollutants and to their in-situ evolution in time. Overall characterization of total OM (essentially polluting OM) was carried out directly on soil samples with or without prior extraction with solvent. It involved a technique of pyrolysis/oxidation coupled to flame ionization/thermal conductivity detection. Extracts in solvent were fractionated by liquid chromatography into saturated hydrocarbons, PAH, and resins, the first two fractions being further characterized by gas chromatography and mass spectrometry. The compositions of OM of soils were found to be very similar. A total of 28% of organic carbon, including all PAH, was extractable by solvent. The compositions of coal tars were qualitatively similar to those of OM of MGP soils but with a higher proportion (48%) of total extractable OM and of PAH, in particular lower PAH. Contamination of MGP soils appeared essentially as coal tar having undergone natural attenuation. The constant association of PAH with heavy OM in MGP soils is important with respect to the mobility and bioaccessibility of these pollutants
NOM characterization and removal at six Southern African water treatment plants
Directory of Open Access Journals (Sweden)
J. Haarhoff
2010-04-01
Full Text Available Organic pollution is a major concern during drinking water treatment. Major challenges attributed to organic pollution include the proliferation of pathogenic micro-organisms, prevalence of toxic and physiologically disruptive organic micro-pollutants, and quality deterioration in water distribution systems. A major component of organic pollution is natural organic matter (NOM. The operational mechanisms of most unit processes are well understood. However, their interaction with NOM is still the subject of scientific research. This paper takes the form of a meta-study to capture some of the experiences with NOM monitoring and analysis at a number of Southern African Water Treatment Plants. It is written from the perspective of practical process selection, to try and coax some pointers from the available data for the design of more detailed pilot work. NOM was tracked at six water treatment plants using dissolved organic carbon (DOC measurements. Fractionation of the DOC based on biodegradability and molecular weight distribution was done at a water treatment plant in Namibia. A third fractionation technique using ion exchange resins was used to assess the impact of ozonation on DOC. DOC measurements alone did not give much insight into NOM evolution through the treatment train. The more detailed characterization techniques showed that different unit processes preferentially remove different NOM fractions. Therefore these techniques provide better information for process design and optimisation than the DOC measurement which is routinely done during full scale operation at these water treatment plants.
Socioeconomic baseline characterization for the Savannah River Plant area
International Nuclear Information System (INIS)
1981-09-01
This report presents the social and economic characteristics of the environs of the Savannah River Plant (SRP). The characterization is keyed to those areas of the social and economic environment that could be impacted by the construction and operation of major facilities at SRP. The data consists of past trends and existing characteristics of the area's land use; its demographic, social, and economic profile; regional government; community services; housing, transportation; and historical, scenic, and archeological resources. Published documents, reports, and brochures were the primary sources of all the data presented in this document. When current published data was unavailable, representatives of federal, state, and local agencies were contacted by telephone. Conversations were followed by letters of verification, which were reviewed and verified by the agency representative
Energy Technology Data Exchange (ETDEWEB)
Morris, T.J.; Jackson, A.O.
1991-12-31
Our lab was the first to describe and characterize a defective interfering RNA (DI RNAs or DIs) in association with a small RNA plant virus. The features of the DIs that we discovered in infections of tomato bushy stunt virus were compatible with the properties of DIs identified in many animal virus infections. Animal virologists have generally recognized the importance of studying DIs because they are invaluable tools for identifying cis-acting sequences important in virus multiplication and because they offer the opportunity to elucidate mechanisms involved in viral persistence and disease attenuation. Hence our discovery offered a comparably valuable tool for use in plant virus studies for the first time. Since then, we have also discovered the second example of plant viral DI RNAs associated with turnip crinkle virus (TCV), a virus structurally related to TBSV. We proposed a thorough characterization of this unique class of symptom modulating RNAs with the overall objective of identifying viral RNA nucleotide, sequences involved in such fundamental processes as virus replication and encapsidation as well as the degree of symptom expression resulting from the viral-DI-host interaction. The proposed research focused on the molecular characterization of the DI RNAs and the helper virus. We had demonstrated that the DIs were collinear deletion mutants of the genome of a cherry strain of tomato bushy stunt virus (TBSV). We had also shown that these low molecular weight RNAs interfered with the helper plant virus and modulated disease expression by preventing the development of a lethal necrotic disease in susceptible host plants. We also suggested that by exploring the mechanisms associated with the symptom attenuation effect, we might be able to devise novel strategies useful for engineering viral disease resistance.
Directory of Open Access Journals (Sweden)
Wang Haiyang
2002-12-01
Full Text Available Abstract Background Constitutive photomorphogenic 1 (COP1 has been defined as a central regulator of photomorphogenic development in plants, which targets key transcription factors for proteasome-dependent degradation. Although COP1 mammalian homologue has been previously reported, its function and distribution in animal kingdom are not known. Results Here we report the characterization of full-length human and mouse COP1 cDNAs and the genomic structures of the COP1 genes from several different species. Mammalian COP1 protein binds to ubiquitinated proteins in vivo and is itself ubiquitinated. Furthermore, mammalian COP1 is predominately nuclear localized and exists primarily as a complex of over 700 kDa. Through mutagenesis studies, we have defined a leucine-rich nuclear export signal (NES within the coiled-coil domain of mammalian COP1 and a nuclear localization signal (NLS, which is composed of two clusters of positive-charged amino acids, bridged by the RING finger. Disruption of the RING finger structure abolishes the nuclear import, while deletion of the entire RING finger restores the nuclear import. Conclusions Our data suggest that mammalian COP1, similar to its plant homologue, may play a role in ubiquitination. Mammalian COP1 contains a classic leucine-rich NES and a novel bipartite NLS bridged by a RING finger domain. We propose a working model in which the COP1 RING finger functions as a structural scaffold to bring two clusters of positive-charged residues within spatial proximity to mimic a bipartite NLS. Therefore, in addition to its well-characterized role in ubiquitination, the RING finger domain may also play a structural role in nuclear import.
Barancelli, Giovana V; Camargo, Tarsila M; Gagliardi, Natália G; Porto, Ernani; Souza, Roberto A; Campioni, Fabio; Falcão, Juliana P; Hofer, Ernesto; Cruz, Adriano G; Oliveira, Carlos A F
2014-03-03
This study aimed to evaluate the occurrence of Listeria monocytogenes in cheese and in the environment of three small-scale dairy plants (A, B, C) located in the Northern region state of São Paulo, Brazil, and to characterize the isolates using conventional serotyping and PFGE. A total of 393 samples were collected and analyzed from October 2008 to September 2009. From these, 136 came from dairy plant A, where only L. seeligeri was isolated. In dairy plant B, 136 samples were analyzed, and L. innocua, L. seeligeri and L. welshimeri were isolated together with L. monocytogenes. In dairy plant C, 121 samples were analyzed, and L. monocytogenes and L. innocua were isolated. Cheese from dairy plants B and C were contaminated with Listeria spp, with L. innocua being found in Minas frescal cheese from both dairy plants, and L. innocua and L. monocytogenes in Prato cheese from dairy plant C. A total of 85 L. monocytogenes isolates were classified in 3 serotypes: 1/2b, 1/2c, and 4b, with predominance of serotype 4b in both dairy plants. The 85 isolates found in the dairy plants were characterized by genomic macrorestriction using ApaI and AscI with Pulsed Field Gel Electrophoresis (PFGE). Macrorestriction yielded 30 different pulsotypes. The presence of indistinguishable profiles repeatedly isolated during a 12-month period indicated the persistence of L. monocytogenes in dairy plants B and C, which were more than 100 km away from each other. Brine used in dairy plant C contained more than one L. monocytogenes lineage. The routes of contamination were identified in plants B and C, and highlighted the importance of using molecular techniques and serotyping to track L. monocytogenes sources of contamination, distribution, and routes of contamination in dairy plants, and to develop improved control strategies for L. monocytogenes in dairy plants and dairy products. Copyright © 2013 Elsevier B.V. All rights reserved.
CHARACTERIZATION OF CADMIUM UPTAKE BY ROOTS OF DURUM WHEAT PLANTS
Directory of Open Access Journals (Sweden)
Lyubka Koleva
2009-03-01
Full Text Available Root Cd uptake of durum wheat plants (cv. Beloslava was characterized in hydroponics conditions. The uptake experiments have been performed in Cd concentration range of 0 – 2 μM adjusted by both stable Cd and radiolabeled (109Cd tracer. Cd removal from the solution over duration of 1 hour reached 50%. The part of loosely adsorbed Cd ions on root surface accounted for about 20%. Over 30% of absorbed Cd at 0.5 μM Cd treatment was retained in root cell walls. The apparent root Cd accumulation showed concentration-dependant tendency with the highest accumulation value of 7.45 nmol Cd g FW-1.
Santos, Karen B dos; Meneguim, Ana M; Santos, Walter J dos; Neves, Pedro M O J; Santos, Rachel B dos
2010-01-01
The cotton plant, Gossypium hirsutum, hosts various pests that damage different structures. Among these pests, Spodoptera cosmioides (Walker) and Spodoptera eridania (Cramer) (Lepidoptera: Noctuidae) are considered important. The objectives of this study were to characterize and to quantify the potential damage of S. eridania and S. cosmioides feeding on different structures of cotton plants. For this purpose, newly-hatched larvae were reared on the following plant parts: leaf and flower bud;...
Chingandu, Nomatter; Zia-Ur-Rehman, Muhammad; Sreenivasan, Thyail N; Surujdeo-Maharaj, Surendra; Umaharan, Pathmanathan; Gutierrez, Osman A; Brown, Judith K
2017-05-01
Suspected virus-like symptoms were observed in cacao plants in Trinidad during 1943, and the viruses associated with these symptoms were designated as strains A and B of cacao Trinidad virus (CTV). However, viral etiology has not been demonstrated for either phenotype. Total DNA was isolated from symptomatic cacao leaves exhibiting the CTV A and B phenotypes and subjected to Illumina HiSeq and Sanger DNA sequencing. Based on de novo assembly, two apparently full-length badnavirus genomes of 7,533 and 7,454 nucleotides (nt) were associated with CTV strain A and B, respectively. The Trinidad badnaviral genomes contained four open reading frames, three of which are characteristic of other known badnaviruses, and a fourth that is present in only some badnaviruses. Both badnaviral genomes harbored hallmark caulimovirus-like features, including a tRNA Met priming site, a TATA box, and a polyadenylation-like signal. Pairwise comparisons of the RT-RNase H region indicated that the Trinidad isolates share 57-71% nt sequence identity with other known badnaviruses. Based on the system for badnavirus species demarcation in which viruses with less than 80% nt sequence identity in the RT-RNase gene are considered members of separate species, these isolates represent two previously unidentified badnaviruses, herein named cacao mild mosaic virus and cacao yellow vein banding virus, making them the first cacao-infecting badnaviruses identified thus far in the Western Hemisphere.
Research Note Effects of previous cultivation on regeneration of ...
African Journals Online (AJOL)
We investigated the effects of previous cultivation on regeneration potential under miombo woodlands in a resettlement area, a spatial product of Zimbabwe's land reforms. We predicted that cultivation would affect population structure, regeneration, recruitment and potential grazing capacity of rangelands. Plant attributes ...
DEFF Research Database (Denmark)
Xu, Deyang; Veres, Dorottya; Belew, Zeinu Mussa
2016-01-01
the question whether the oocytes system is suitable to express and characterize ABC transporters. Thus we have selected AtABCG25, previously characterized in insect cells as the exporter of commercially valuable abscisic acid—as case study for optimizing of characterization in Xenopus oocytes. The tools...
Zdunek-Zastocka, Edyta; Grabowska, Agnieszka; Branicki, Tomasz; Michniewska, Beata
2017-07-01
Proline aminopeptidase (PAP, EC 3.4.11.5) is the only enzyme that effectively releases proline from the N-termini of peptides. The amino acid sequence of the PAP from Triticosecale, TsPAP1, comprises conserved regions, characteristic of the monomeric forms of PAP found in bacteria but not yet identified in plants. Therefore, we aimed to obtain and biochemically characterize the TsPAP1 protein. The recombinant TsPAP1 protein was received through heterologous expression of the TsPAP1 coding sequence in a bacterial expression system and purified with affinity chromatography. Gel filtration chromatography and SDS electrophoresis revealed that TsPAP1 is a monomer with a molecular mass of 37.5 kDa. TsPAP1 prefers substrates with proline at the N-terminus but is also capable of hydrolyzing β-naphthylamides of hydroxyproline and alanine. Among the peptides tested, the most preferred were di- and tripeptides, especially those with glycine in the Y position. The use of diagnostic inhibitors indicated that TsPAP1 is a serine peptidase; however, further characterization revealed that the SH residues are also important for maintaining its activity. To examine the role of TsPAP1 under physiological conditions, we developed transgenic Arabidopsis plants overexpressing TsPAP1. Compared with wild-type plants, the transgenic lines accumulated more proline, flowered an average of 3.5 days earlier, and developed more siliques than did untransformed controls. Our paper is the first to describe the biochemical properties of a novel monomeric plant PAP and contributes to the functional characterization of PAP proteins in plants. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Animal pigment bilirubin discovered in plants.
Pirone, Cary; Quirke, J Martin E; Priestap, Horacio A; Lee, David W
2009-03-04
The bile pigment bilirubin-IXalpha is the degradative product of heme, distributed among mammals and some other vertebrates. It can be recognized as the pigment responsible for the yellow color of jaundice and healing bruises. In this paper we present the first example of the isolation of bilirubin in plants. The compound was isolated from the brilliant orange-colored arils of Strelitzia nicolai, the white bird of paradise tree, and characterized by HPLC-ESMS, UV-visible, (1)H NMR, and (13)C NMR spectroscopy, as well as comparison with an authentic standard. This discovery indicates that plant cyclic tetrapyrroles may undergo degradation by a previously unknown pathway. Preliminary analyses of related plants, including S. reginae, the bird of paradise, also revealed bilirubin in the arils and flowers, indicating that the occurrence of bilirubin is not limited to a single species or tissue type.
Socioeconomic baseline characterization for the Savannah River Plant area
Energy Technology Data Exchange (ETDEWEB)
1981-09-01
This report presents the social and economic characteristics of the environs of the Savannah River Plant (SRP). The characterization is keyed to those areas of the social and economic environment that could be impacted by the construction and operation of major facilities at SRP. The data consists of past trends and existing characteristics of the area's land use; its demographic, social, and economic profile; regional government; community services; housing, transportation; and historical, scenic, and archeological resources. Published documents, reports, and brochures were the primary sources of all the data presented in this document. When current published data was unavailable, representatives of federal, state, and local agencies were contacted by telephone. Conversations were followed by letters of verification, which were reviewed and verified by the agency representative.
Cloning and functional characterization of MusaVND1 using transgenic banana plants.
Negi, Sanjana; Tak, Himanshu; Ganapathi, T R
2015-06-01
Vascular related NAC (NAM, ATAF and CUC) domain-containing genes regulate secondary wall deposition and differentiation of xylem vessel elements. MusaVND1 is an ortholog of Arabidopsis VND1 and contains the highly conserved NAC domain. The expression of MusaVND1 is highest in developing corm and during lignification conditions, the increase in expression of MusaVND1 coincides with the expression of PAL, COMT and C4H genes. MusaVND1 encodes a nuclear localized protein as MusaVND1-GFP fusion protein gets localized to nucleus. Transient overexpression of MusaVND1 converts banana embryogenic cells to xylem vessel elements, with a final differentiation frequency of 33.54% at the end of tenth day. Transgenic banana plants overexpressing MusaVND1 showed stunted growth and were characterized by PCR and Southern blot analysis. Transgenic banana plants showed transdifferentiation of various types of cells into xylem vessel elements and ectopic deposition of lignin in cells of various plant organs such as leaf and corm. Tracheary element formation was seen in the cortical region of transgenic corm as well as in epidermal cells of leaves. Biochemical analysis indicates significantly higher levels of lignin and cellulose content in transgenic banana lines than control plants. MusaVND1 overexpressing transgenic banana plants showed elevated expression levels of genes involved in lignin and cellulose biosynthesis pathway. Further expression of different MYB transcription factors positively regulating secondary wall deposition was also up regulated in MusaVND1 transgenic lines.
How To Produce and Characterize Transgenic Plants.
Savka, Michael A.; Wang, Shu-Yi; Wilson, Mark
2002-01-01
Explains the process of establishing transgenic plants which is a very important tool in plant biology and modern agriculture. Produces transgenic plants with the ability to synthesize opines. (Contains 17 references.) (YDS)
DEFF Research Database (Denmark)
Mortensen, R.J.; Shen, Xinyi; Reid, Alex
2010-01-01
, as were 29 Scottish mainland isolates of the same four potato virus species, and these 58 isolates were compared to previously published sequence data. This has allowed the characterization of viruses from a relatively isolated location, where there is little production of ware potatoes and no seed potato...... production. Phylogenetic homogeneity of the Shetland isolates of PVS and PVV was apparent. PVX was more heterogeneous, and Shetland isolates cluster with the Scottish isolates in a group which includes Asian and European isolates. For PVA, the majority of the Shetland and Scottish mainland isolates formed...... a predominantly Scottish grouping, with the remaining Shetland and Scottish mainland isolates clustering with a previously characterized Scottish isolate. There were three main groups of PVA, of which the Scottish grouping was the only one which did not have a fully characterized representative. To extend...
On the phase characterization of the residues of the plant Comandante Pedro Soto Alba
International Nuclear Information System (INIS)
Diaz Ruano, A.; Fernandez Miranda, J.
1980-04-01
It has been studied of the phases present in the solid industrial residues of the plant Comandante Pedro Soto Alba (Moas's tails). It is done a preliminary qualitative characterization by X ray diffraction. It is done a characterization by differential and gravimetric thermal analysis and a quantitative valuation of SO 3 and H 2 O present in the samples. A complex of S and Al is detected. The results of SO 3 are compared with those obtained by the gravimetric method to verify those of Al, an elemental analysis by neutron activation was solicitated. A formula for the complex of S and Al is proposed. (author)
Pastor, Victoria; Vicent, Cristian; Cerezo, Miguel; Mauch-Mani, Brigitte; Dean, John; Flors, Victor
2012-04-01
An approach for the detection and characterization of SA derivatives in plant samples is presented based on liquid chromatography coupled to electrospray ionization (ESI) tandem mass spectrometric techniques. Precursor ion scan methods using an ESI triple quadrupole spectrometer for samples from plants challenged with the virulent Pseudomonas syringae pv tomato DC3000 allowed us to detect two potential SA derivatives. The criterion used to consider a potential SA derivative is based on the detection of analytes in the precursor ion scan chromatogram upon selecting m/z 137 and m/z 93 that correspond to the salicylate and its main product ion, respectively. Product ion spectra of the newly-detected analytes as well as accurate m/z determinations using an ESI Q-time-of-flight instrument were registered as means of characterization and strongly suggest that glucosylated forms of SA at the carboxylic and at the phenol functional groups are present in plant samples. The specific synthesis and subsequent chromatography of salicylic glucosyl ester (SGE) and glucosyl salicylate (SAG) standards confirmed the chemical identity of both peaks that were obtained applying different tandem mass spectrometric techniques and accurate m/z determinations. A multiple reaction monitoring method has been developed and applied to plant samples. The advantages of this LC-ESI-MS/MS methods with respect to the traditional analysis of glucosyl conjugates are also discussed. Preliminary results revealed that SA and the glucosyl conjugates are accumulated in Arabidopsis thaliana in a time dependent manner, accordingly to the up-regulation of SA-dependent defenses following P. syringae infection. This technique applied to plant hormones or fragment ions may be useful to obtain chemical family members of plant metabolites and help identify their contribution in the signaling of plant defenses. Copyright © 2012 Elsevier Masson SAS. All rights reserved.
Milus, Eugene A; Moon, David E; Lee, Kevin D; Mason, R Esten
2015-08-01
Stripe rust, caused by Puccinia striiformis f. sp. tritici, is an important disease of wheat in the Great Plains and southeastern United States. Growing resistant cultivars is the preferred means for managing stripe rust, but new virulence in the pathogen population overcomes some of the resistance. The objectives of this study were to characterize the stripe rust resistance in contemporary soft and hard red winter wheat cultivars, to characterize the virulence of P. striiformis f. sp. tritici isolates based on the resistances found in the cultivars, and to determine wheat breeders' perceptions on the importance and methods for achieving stripe rust resistance. Seedlings of cultivars were susceptible to recent isolates, indicating they lacked effective all-stage resistance. However, adult-plants were resistant or susceptible depending on the isolate, indicating they had race-specific adult-plant resistance. Using isolates collected from 1990 to 2013, six major virulence patterns were identified on adult plants of twelve cultivars that were selected as adult-plant differentials. Race-specific adult-plant resistance appears to be the only effective type of resistance protecting wheat from stripe rust in eastern United States. Among wheat breeders, the importance of incorporating stripe rust resistance into cultivars ranged from high to low depending on the frequency of epidemics in their region, and most sources of stripe rust resistance were either unknown or already overcome by virulence in the pathogen population. Breeders with a high priority for stripe rust resistance made most of their selections based on adult-plant reactions in the field, whereas breeders with a low priority for resistance based selections on molecular markers for major all-stage resistance genes.
Holder, J.; Riches, M.; Abeleira, A.; Farmer, D.
2017-12-01
Accurate prediction of both climate and air quality under a changing earth system requires a full understanding of the sources, feedbacks, and ultimate fate of all atmospherically relevant chemical species, including volatile organic compounds (VOCs). Biogenic VOCs (BVOC) from plant emissions are the main source of VOCs to the atmosphere. However, the impact of global change on BVOC emissions is poorly understood. For example, while short-term increases in temperature are typically associated with increased BVOC emissions, the impact of long-term temperature increases are less clear. Our study aims to investigate the effects of long-term, singular and combined environmental perturbations on plant BVOC emissions through the use of whole plant chambers in order to better understand the effects of global change on BVOC-climate-air quality feedbacks. To fill this knowledge gap and provide a fundamental understanding of how BVOC emissions respond to environmental perturbations, specifically elevated temperature, CO2, and drought, whole citrus trees were placed in home-built chambers and monitored for monoterpene and other BVOC emissions utilizing thermal desorption gas chromatography mass spectrometry (TD-GC-MS). Designing and building a robust whole plant chamber to study atmospherically relevant chemical species while accommodating the needs of live plants over timescales of days to weeks is not a trivial task. The environmental conditions within the chamber must be carefully controlled and monitored. The inter-plant and chamber variability must be characterized. Finally, target BVOCs need to be sampled and detected from the chamber. Thus, the chamber design, control and characterization considerations along with preliminary BVOC results will be presented and discussed.
International Nuclear Information System (INIS)
Ahring, B.K.
1994-12-01
The present report contains the results of a project concerning behaviour of acetate-utilizing methanogenic bacteria in mesophilic and thermophilic biogas plants, collected in 1992 - 1994 period. Labelled acetates (2-C 14 -CH 3 COOH) have been used to characterize the types of methane bacteria populations in the Danish biogas plants, the optimum acetate concentration for these bacteria and acetate metabolism in mesophilic and thermophilic biogas reactors with low acetate concentrations. 2 publications are included. (EG)
Enhancement of iron content in spinach plants stimulated by magnetic nano particles
Energy Technology Data Exchange (ETDEWEB)
Yulianto, Agus; Astuti, Budi; Amalia, Saptaria Rosa [Physics Department, Faculty of Mathematics and Natural Science, Universitas Negeri Semarang (Indonesia)
2016-04-19
In our previous study, the iron content in spinach plants could be detected by magnetic susceptibility values. In the present work, magnetic nano particles were found from the iron sand. The magnetic nano particles are synthesis by using co-precipitation process and sol-gel technique. The stimulation of magnetic nano particles in the plant has been done by the provision of magnetic nano particles in growing media. After certain time, plant samples was characterized using susceptibility-meter MS2B and atomic absorption spectroscopy to measure the magnetic susceptibility and the amount of iron content that absorbed of the plant, respectively. The iron content in the spinach plants was increased when the magnetic nano particles was injected in the growing media.
Characterization of past and present solid waste streams from the Plutonium-Uranium Extraction Plant
International Nuclear Information System (INIS)
Pottmeyer, J.A.; Weyns, M.I.; Lorenzo, D.S.; Vejvoda, E.J.; Duncan, D.R.
1993-04-01
During the next two decades the transuranic wastes, now stored in the burial trenches and storage facilities at the Hanford Site, are to be retrieved, processed at the Waste Receiving and Processing Facility, and shipped to the Waste Isolation Pilot Plant near Carlsbad, New Mexico for final disposal. Over 7% of the transuranic waste to be retrieved for shipment to the Waste Isolation Pilot Plant has been generated at the Plutonium-Uranium Extraction (PUREX) Plant. The purpose of this report is to characterize the radioactive solid wastes generated by PUREX using process knowledge, existing records, and oral history interviews. The PUREX Plant is currently operated by the Westinghouse Hanford Company for the US Department of Energy and is now in standby status while being prepared for permanent shutdown. The PUREX Plant is a collection of facilities that has been used primarily to separate plutonium for nuclear weapons from spent fuel that had been irradiated in the Hanford Site's defense reactors. Originally designed to reprocess aluminum-clad uranium fuel, the plant was modified to reprocess zirconium alloy clad fuel elements from the Hanford Site's N Reactor. PUREX has provided plutonium for research reactor development, safety programs, and defense. In addition, the PUREX was used to recover slightly enriched uranium for recycling into fuel for use in reactors that generate electricity and plutonium. Section 2.0 provides further details of the PUREX's physical plant and its operations. The PUREX Plant functions that generate solid waste are as follows: processing operations, laboratory analyses and supporting activities. The types and estimated quantities of waste resulting from these activities are discussed in detail
Pedentchouk, N.; Wagner, T.; Jones, M.
2009-04-01
Forensic science is an integrative discipline that requires material evidence from diverse sources. Geochemical evidence derived from inorganic and organic substances is becoming increasingly popular among law enforcement agencies in industrialized countries. Previous investigations indicate that the relative distributions of individual plant-derived biomarkers found in soils are linked to the biomarker patterns found in the overlying vegetation. However, identification of soil provenance based on the distribution of plant-derived biomarkers for forensic purposes is inhibited by the fact that a significant number of terrestrial plant species have overlapping biomarker distributions. In order to enhance the resolving power of plant-derived biomarker signal, we propose to enhance the molecular approach by adding a stable isotope component, i.e. the delta13C/deltaD values of individual biomarkers. The first objective of this project is to determine the delta13C/deltaD signatures of n-alkanes derived from various higher plant types commonly growing in the UK. The second objective is to investigate whether the same species/plant types differ isotopically between two locations affected by different weather patterns in the UK: a relatively warmer and drier Norwich, Norfolk and a cooler and wetter Newcastle-upon-Tyne in NE England. The n-C29 alkane data from 14 tree species sampled during July 2007 and August 2008 in Newcastle show a clear negative trend between delta13C and deltaD values. When these data are plotted against each other, the six deciduous angiosperms (delta13C: c. -39 to -35 per mil; deltaD: c. -155 to -130 per mil) are completely separated from four evergreen angiosperms (delta13C: c. -33 to -28 per mil; deltaD: c. -195 to -165 per mil). The four gymnosperm species data plot between those of the deciduous and evergreen angiosperms. Because all 14 species in Newcastle experience the same environmental conditions, we suggest that the observed isotopic
Feasibility of landmine detection using transgenic plants
Deyholos, Michael; Faust, Anthony A.; Miao, Minmin; Montoya, Rebecca; Donahue, D. Aaron
2006-05-01
Genetically modified plants that detect TNT and its degradation products are potentially powerful aids in humanitarian demining and detection of unexploded ordnance. Although the feasibility of TNT detection by plants and microorganisms has been demonstrated by several research teams world wide, thus far, none of these previously demonstrated systems has the sensitivity and specificity to be effective under field conditions. We are using two approaches to increase the potential effectiveness of these and related biological detection systems. First, we are expanding the repertoire of explosive-responsive promoters by conducting DNA microarray experiments with plants treated with TNT-degradation products, and characterizing the inducibility of reporter gene expression by these promoters. Second, we are evaluating the dynamics and limiting factors in the transmission of artificial signals from roots to shoots. This will increase the ability of soil-based TNT perception strategies to effect human-readable changes in shoot morphology as part of a practical plant-based explosives detection system.
Directory of Open Access Journals (Sweden)
Mai Mohammed Farid
2016-10-01
Full Text Available Scientists continue to search for and conserve plants whose medicinal properties have become crucial in the fight against diseases. Moreover, lessons from folk medicine, indigenous knowledge and Chinese medicine on crude extracts points to possible findings of novel promising and strong pharmaceutically bioactive constituents. Arum palaestinum, commonly known as black calla lily, is one of the most important medicinal plants belonging to the family Araceae, which has not been well studied. Little is known about its pharmaceutically bioactive constituents and the effective conservation through the use of biotechnology. Thus, Arum Palaestinum is selected and reviewed for its phytochemical analysis and biological activities. Besides, the tissue culture and genetic characterization developed for effective conservation of the plant were also summarized.
International Nuclear Information System (INIS)
1989-03-01
The Quarry Construction Staging Area and Water Treatment Plant (QCSA) will be used in the support of the bulk waste removal of the Weldon Spring Quarry. Radiological and chemical characterization was performed on a 12 acre site where the QCSA will be constructed. The characterization revealed approximately .5 acres of radiologically contaminated land. No chemical contamination was found. 8 refs., 5 figs., 7 tabs
International Nuclear Information System (INIS)
Pessin, L.R.; Destefani, A.Z.; Holanda, J.N.F.
2011-01-01
The water treatment plants (WTP) for human consumption generate huge amounts of waste in the form of sludge (sludge) that have been over the years mostly inadequately prepared in water resources and the environment. Moreover, traditional methods of disposal of waste water treatment plants commonly used are generally costly activities. An alternative method for disposal of this waste abundant is its incorporation in ceramic products. This work is focused on the physical-chemical and mineralogical composition of a sample of waste water treatment plants from the region of Campos dos Goytacazes-RJ to their use in the manufacture of soil-cement brick. Several characterization techniques were used including X-ray diffraction, X-ray fluorescence, scanning electron microscopy, picnometry, particle size analysis and plasticity. The experimental results indicate that the waste water treatment plants have the potential to be used in the manufacture of ecologic soil-cement bricks. (author)
Directory of Open Access Journals (Sweden)
Janiffe Peres de Oliveira
2016-04-01
Full Text Available The objective of this work was to characterize the biochemically systemic bacterial isolated from banana plants, to evaluate the bacterial sensitivity to antibiotics, and to determine the phytotoxicity of banana shoots during in vitro proliferation. Systemic bacteria belonging to the Klebsiella and Aeromonas genera were isolated from the “Maravilha” (FHIA 01 AAAB, “Preciosa” (PV 4285 AAAB and “Thap Maeo” (AAB varieties and were then characterized. Tests of shoot sensitivity to antibiotics were performed, and the minimum inhibitory concentration (MIC and phytotoxic effects of selected antibiotics to plants were determined. Among the 20 antibiotics evaluated, the strains showed sensitivity to cefaclor, cefalexin, cefalotin, nalidixic acid, chloramphenicol, and vancomycin. However, during MIC determination, the best results were obtained with cefaclor, vancomycin or nalidixic acid alone in concentrations ranging from 512 to 1,024 mg L-1. In culture medium, cefaclor at 1,024 mg L-1 was the only antibiotic to affect the multiplication and the shoot survival in culture.
Tercé-Laforgue, Thérèse; Bedu, Magali; Dargel-Grafin, Céline; Dubois, Frédéric; Gibon, Yves; Restivo, Francesco M; Hirel, Bertrand
2013-10-01
Glutamate dehydrogenase (GDH; EC 1.4.1.2) is able to carry out the deamination of glutamate in higher plants. In order to obtain a better understanding of the physiological function of GDH in leaves, transgenic tobacco (Nicotiana tabacum L.) plants were constructed that overexpress two genes from Nicotiana plumbaginifolia (GDHA and GDHB under the control of the Cauliflower mosiac virus 35S promoter), which encode the α- and β-subunits of GDH individually or simultaneously. In the transgenic plants, the GDH protein accumulated in the mitochondria of mesophyll cells and in the mitochondria of the phloem companion cells (CCs), where the native enzyme is normally expressed. Such a shift in the cellular location of the GDH enzyme induced major changes in carbon and nitrogen metabolite accumulation and a reduction in growth. These changes were mainly characterized by a decrease in the amount of sucrose, starch and glutamine in the leaves, which was accompanied by an increase in the amount of nitrate and Chl. In addition, there was an increase in the content of asparagine and a decrease in proline. Such changes may explain the lower plant biomass determined in the GDH-overexpressing lines. Overexpressing the two genes GDHA and GDHB individually or simultaneously induced a differential accumulation of glutamate and glutamine and a modification of the glutamate to glutamine ratio. The impact of the metabolic changes occurring in the different types of GDH-overexpressing plants is discussed in relation to the possible physiological function of each subunit when present in the form of homohexamers or heterohexamers.
International Nuclear Information System (INIS)
Campo Blanco, X.
2015-01-01
The Neutron Standards Laboratory of CIEMAT, in collaboration with the Trillo Nuclear Power Plant, has conducted a detailed dosimetric and spectrometric characterization of the neutron fields at the Intermediate Temporary Storage of the Trillo Nuclear Power Plant, as well as the neutron fields of ENSA-DPT spent fuel casks. For neutron measurements, neutron monitors and a Bonner spheres spectrometry system have been used. In addition, a Monte Carlo model of the installation and the cask has been developed and validated.
CHARACTERIZATION OF MERCURY EMISSIONS AT A CHLOR-ALKALI PLANT, VOLUME I. REPORT AND APPENDICES A-E
The report gives results of a characterization of mercury (Hg) emissions at a chlor-alkali plant. Up to 160 short tons (146 Mg) of Hg is consumed by the chlor-alkali industry each year. Very little quantitative information is currently available however, on the actual Hg losses f...
Arif, I A; Bakir, M A; Khan, H A; Al Farhan, A H; Al Homaidan, A A; Bahkali, A H; Al Sadoon, M; Shobrak, M
2010-11-09
The use of highly discriminatory methods for the identification and characterization of genotypes is essential for plant protection and appropriate use. We utilized the RAPD method for the genetic fingerprinting of 11 plant species of desert origin (seven with known medicinal value). Andrachne telephioides, Zilla spinosa, Caylusea hexagyna, Achillea fragrantissima, Lycium shawii, Moricandia sinaica, Rumex vesicarius, Bassia eriophora, Zygophyllum propinquum subsp migahidii, Withania somnifera, and Sonchus oleraceus were collected from various areas of Saudi Arabia. The five primers used were able to amplify the DNA from all the plant species. The amplified products of the RAPD profiles ranged from 307 to 1772 bp. A total of 164 bands were observed for 11 plant species, using five primers. The number of well-defined and major bands for a single plant species for a single primer ranged from 1 to 10. The highest pair-wise similarities (0.32) were observed between A. fragrantissima and L. shawii, when five primers were combined. The lowest similarities (0) were observed between A. telephioides and Z. spinosa; Z. spinosa and B. eriophora; B. eriophora and Z. propinquum. In conclusion, the RAPD method successfully discriminates among all the plant species, therefore providing an easy and rapid tool for identification, conservation and sustainable use of these plants.
Directory of Open Access Journals (Sweden)
Tola Omolayo Olasunkanmi
2016-01-01
Full Text Available Proper fertilizer nutrient management through adequate utilization of the residual value coupled with healthy crop rotation contributes significantly to sustainable crop production. This study was conducted to evaluate the direct and residual effects of two rock phosphate (RP materials on two contrasting soils previously planted with either the cereal crop or the leguminous crop. The effectiveness of the RP materials as substitute for the conventional P fertilizers was evaluated using single superphosphate as reference at the Department of Agronomy, University of Ibadan, Ibadan, Nigeria. The experiments were 2 × 2 × 4 factorial in completely randomized design. The test crops in the first cropping performed better on the slightly acidic loamy sand than on the strongly acidic sandy clay loam. Performance of each crop was improved by P supply in the first and second cropping. Single superphosphate proved to be more efficient than the RPs in the first cropping but not as effective as MRP in the second cropping. In the second cropping, sorghum performed better on the soil previously cropped to cowpea while Morocco RP had the highest residual effect among the P-fertilizer sources. It is evident that rock phosphates are better substitutes to the conventional phosphorus fertilizers due to their long term residual effect in soils. The positive effects of healthy rotation of crops as well as the negative effects of low soil pH are also quite obvious.
Identification, characterization, and palynology of high-valued medicinal plants.
Fazal, Hina; Ahmad, Nisar; Haider Abbasi, Bilal
2013-01-01
High-valued medicinal plants Achillea millefolium, Acorus calamus, Arnebia nobilis, Fumaria indica, Gymnema sylvestre, Origanum vulgare, Paeonia emodi, Peganum harmala, Psoralea corylifolia, Rauwolfia serpentina, and Vetiveria zizanioides were identified with the help of taxonomical markers and investigated for characterization and palynological studies. These parameters are used to analyze their quality, safety, and standardization for their safe use. Botanical description and crude drug description is intended for their quality assurance at the time of collection, commerce stages, manufacturing, and production. For this purpose the detailed morphology was studied and compared with the Flora of Pakistan and other available literatures. Here we reported the pollen grain morphology of Origanum vulgare, Paeonia emodi, Psoralea corylifolia, and Rauwolfia serpentina for the first time. Similarly the crude drug study of Gymnema sylvestre (leaf), Origanum vulgare (aerial parts), Paeonia emodi (tubers), and Peganum harmala (seeds) was also carried out for the first time.
Identification, Characterization, and Palynology of High-Valued Medicinal Plants
Directory of Open Access Journals (Sweden)
Hina Fazal
2013-01-01
Full Text Available High-valued medicinal plants Achillea millefolium, Acorus calamus, Arnebia nobilis, Fumaria indica, Gymnema sylvestre, Origanum vulgare, Paeonia emodi, Peganum harmala, Psoralea corylifolia, Rauwolfia serpentina, and Vetiveria zizanioides were identified with the help of taxonomical markers and investigated for characterization and palynological studies. These parameters are used to analyze their quality, safety, and standardization for their safe use. Botanical description and crude drug description is intended for their quality assurance at the time of collection, commerce stages, manufacturing, and production. For this purpose the detailed morphology was studied and compared with the Flora of Pakistan and other available literatures. Here we reported the pollen grain morphology of Origanum vulgare, Paeonia emodi, Psoralea corylifolia, and Rauwolfia serpentina for the first time. Similarly the crude drug study of Gymnema sylvestre (leaf, Origanum vulgare (aerial parts, Paeonia emodi (tubers, and Peganum harmala (seeds was also carried out for the first time.
Energy Technology Data Exchange (ETDEWEB)
Liu, Shasha [College of Water Sciences, Beijing Normal University, Beijing 100875 (China); State Key Laboratory of Environment Criteria and Risk Assessment, Chinese Research Academy of Environmental Sciences, Beijing 100012 (China); Zhu, Yuanrong, E-mail: zhuyuanrong07@mails.ucas.ac.cn [State Key Laboratory of Environment Criteria and Risk Assessment, Chinese Research Academy of Environmental Sciences, Beijing 100012 (China); Wu, Fengchang, E-mail: wufengchang@vip.skleg.cn [State Key Laboratory of Environment Criteria and Risk Assessment, Chinese Research Academy of Environmental Sciences, Beijing 100012 (China); Meng, Wei [State Key Laboratory of Environment Criteria and Risk Assessment, Chinese Research Academy of Environmental Sciences, Beijing 100012 (China); He, Zhongqi [USDA-ARS Southern Regional Research Center, 1100 Robert E Lee Blvd, New Orleans, LA 70124 (United States); Giesy, John P. [State Key Laboratory of Environment Criteria and Risk Assessment, Chinese Research Academy of Environmental Sciences, Beijing 100012 (China); Department of Biomedical and Veterinary Biosciences and Toxicology Centre, University of Saskatchewan, Saskatoon, Saskatchewan (Canada)
2016-10-01
Although debris from aquatic macrophytes is one of the most important endogenous sources of organic matter (OM) and nutrients in lakes, its biogeochemical cycling and contribution to internal load of nutrients in eutrophic lakes are still poorly understood. In this study, sequential fractionation by H{sub 2}O, 0.1 M NaOH and 1.0 M HCl, combined with {sup 13}C and {sup 31}P NMR spectroscopy, was developed and used to characterize organic carbon (C) and phosphorus (P) in six aquatic plants collected from Tai Lake (Ch: Taihu), China. Organic matter, determined by total organic carbon (TOC), was unequally distributed in H{sub 2}O (21.2%), NaOH (29.9%), HCl (3.5%) and residual (45.3%) fractions. For P in debris of aquatic plants, 53.3% was extracted by H{sub 2}O, 31.9% by NaOH, and 11% by HCl, with 3.8% in residual fractions. Predominant OM components extracted by H{sub 2}O and NaOH were carbohydrates, proteins and aliphatic acids. Inorganic P (P{sub i}) was the primary form of P in H{sub 2}O fractions, whereas organic P (P{sub o}) was the primary form of P in NaOH fractions. The subsequent HCl fractions extracted fewer species of C and P. Some non-extractable carbohydrates, aromatics and metal phytate compounds remained in residual fractions. Based on sequential extraction and NMR analysis, it was proposed that those forms of C (54.7% of TOC) and P (96.2% of TP) in H{sub 2}O, NaOH and HCl fractions are potentially released to overlying water as labile components, while those in residues are stable and likely preserved in sediments of lakes. These results will be helpful in understanding internal loading of nutrients from debris of aquatic macrophytes and their recycling in lakes. - Highlights: • Sequential fractionation combined with NMR analysis was applied on aquatic plants. • Labile and stable C and P forms in aquatic plants were characterized. • 54.7% of OM and 96.2% of P in aquatic plants are potentially available. • 45.3% of OM and 3.8% of P in aquatic
Directory of Open Access Journals (Sweden)
DIANA ELIZABETH WATURANGI
2009-06-01
Full Text Available Ice nucleation active (INA bacteria is a group of bacteria with the ability to catalyze the ice formation at temperature above -10 °C and causing frost injury in plants. Since, most of the literature on INA bacteria were from subtropical area, studies of INA bacteria from tropical area are needed. We sampled eight fruits and 36 leaves of 21 plant species, and then identified through biochemical and genetic analysis. INA bacteria were characterized for INA protein classification, pH stability, and optimization of heat endurance. We discovered 15 INA bacteria from seven plants species. Most of bacteria are oxidase and H2S negative, catalase and citrate positive, gram negative, and cocoid formed. These INA bacteria were classified in to three classes based on their freezing temperature. Most of the isolates were active in heat and pH stability assay. Some isolates were analysed for 16S rRNA gene. We observed that isolates from Morinda citrifolia shared 97% similiarity with Pseudomonas sp. Isolate from Piper betle shared 93% similarity with P. pseudoalcaligenes. Isolate from Carica papaya shared 94% similarity with Pseudomonas sp. While isolate from Fragaria vesca shared 90% similarity with Sphingomonas sp.
Directory of Open Access Journals (Sweden)
DIANA ELIZABETH WATURANGI
2009-06-01
Full Text Available Ice nucleation active (INA bacteria is a group of bacteria with the ability to catalyze the ice formation at temperature above -10 oC and causing frost injury in plants. Since, most of the literature on INA bacteria were from subtropical area, studies of INA bacteria from tropical area are needed. We sampled eight fruits and 36 leaves of 21 plant species, and then identified through biochemical and genetic analysis. INA bacteria were characterized for INA protein classification, pH stability, and optimization of heat endurance. We discovered 15 INA bacteria from seven plants species. Most of bacteria are oxidase and H2S negative, catalase and citrate positive, gram negative, and cocoid formed. These INA bacteria were classified in to three classes based on their freezing temperature. Most of the isolates were active in heat and pH stability assay. Some isolates were analysed for 16S rRNA gene. We observed that isolates from Morinda citrifolia shared 97% similiarity with Pseudomonas sp. Isolate from Piper betle shared 93% similarity with P. pseudoalcaligenes. Isolate from Carica papaya shared 94% similarity with Pseudomonas sp. While isolate from Fragaria vesca shared 90% similarity with Sphingomonas sp.
Ma, Huiying; Zhang, Keke; Jiang, Qing; Dai, Diya; Li, Hongli; Bi, Wentao; Chen, David Da Yong
2018-04-27
Plant polysaccharides have numerous medicinal functions. Due to the differences in their origins, regions of production, and cultivation conditions, the quality and the functions of polysaccharides can vary significantly. They are macromolecules with large molecular weight (MW) and complex structure, and pose great challenge for the analytical technology used. Taking Dendrobium officinale (DO) from various origins and locations as model samples. In this investigation, mechanochemical extraction method was used to successfully extract polysaccharides from DO using water as solvent, the process is simple, fast (40 s) and with high yield. The MWs of the intact saccharides from calibration curve and light scattering measurement were determined and compared after separation with size exclusion chromatography (SEC). The large polysaccharide was acid hydrolyzed to oligosaccharides and the products were efficiently separated and identified using liquid chromatography coupled to a high resolution tandem mass spectrometry (LC-MS 2 ). Obvious differences were observed among LC-MS 2 chromatograms of digested products, and the chemical structures for the products were proposed based on accurate mass values. More importantly, isomeric digested carbohydrate compounds were explored and characterized. All the chromatographic and mass spectrometric results in this study provided a multi-dimensional characterization, fingerprint analysis, and molecular structure level assessment of plant polysaccharides. Copyright © 2018 Elsevier B.V. All rights reserved.
Falco, N.; Wainwright, H. M.; Dafflon, B.; Leger, E.; Peterson, J.; Steltzer, H.; Wilmer, C.; Williams, K. H.; Hubbard, S. S.
2017-12-01
Mountainous watershed systems are characterized by extreme heterogeneity in hydrological and pedological properties that influence biotic activities, plant communities and their dynamics. To gain predictive understanding of how ecosystem and watershed system evolve under climate change, it is critical to capture such heterogeneity and to quantify the effect of key environmental variables such as topography, and soil properties. In this study, we exploit advanced geophysical and remote sensing techniques - coupled with machine learning - to better characterize and quantify the interactions between plant communities' distribution and subsurface properties. First, we have developed a remote sensing data fusion framework based on the random forest (RF) classification algorithm to estimate the spatial distribution of plant communities. The framework allows the integration of both plant spectral and structural information, which are derived from multispectral satellite images and airborne LiDAR data. We then use the RF method to evaluate the estimated plant community map, exploiting the subsurface properties (such as bedrock depth, soil moisture and other properties) and geomorphological parameters (such as slope, curvature) as predictors. Datasets include high-resolution geophysical data (electrical resistivity tomography) and LiDAR digital elevation maps. We demonstrate our approach on a mountain hillslope and meadow within the East River watershed in Colorado, which is considered to be a representative headwater catchment in the Upper Colorado Basin. The obtained results show the existence of co-evolution between above and below-ground processes; in particular, dominant shrub communities in wet and flat areas. We show that successful integration of remote sensing data with geophysical measurements allows identifying and quantifying the key environmental controls on plant communities' distribution, and provides insights into their potential changes in the future
International Nuclear Information System (INIS)
Sibello Hernandez, R.Y.; Alonso Hernandez, C.M.; Diaz Asencio, M.; Cartas Aguila, H. A.
1999-01-01
In this work the results are exposed obtained by the Laboratory of Environmental Surveillance in the radioactive characterization of the existent terrestrial ecosystem in the area of location of the Juragua Nuclear Power Plants in Cienfuegos, Cuba, starting from 1986 and up to 1993
Molecular characterization of a novel cryptic virus infecting pigeonpea plants.
Directory of Open Access Journals (Sweden)
Surender Kumar
Full Text Available A new member of the genus Deltapartitivirus was identified containing three dsRNAs with an estimated size of 1.71, 1.49 and 1.43 kb. The dsRNAs were extracted from symptomless pigeonpea [Cajanus cajan (L. Millspaugh] plants cv. Erra Kandulu. This new virus with 4.64 kb genome was tentatively named Arhar cryptic virus-1 (ArCV-1. The genomic RNAs were amplified and characterized by sequence independent single primer amplification. The dsRNAs shared a highly conserved 16 nt 5' non-coding region (5'-GATAATGATCCAAGGA-3'. The largest dsRNA (dsRNA-1 was identified as the viral RNA dependent RNA polymerase (replicase, predicted to encode a putative 55.34 kDa protein (P1. The two other smaller dsRNAs (dsRNA-2 and dsRNA-3 predicted to encode for putative capsid proteins of 38.50kDa (P2 and 38.51kDa (P3, respectively. Phylogenetic analysis indicated that ArCV-1 formed a clade together with Fragaria chiloensis cryptic virus, Rosa multiflora cryptic virus and Rose cryptic virus-1, indicating that ArCV-1 could be a new member of the genus Deltapartitivirus. ArCV-1 3Dpol structure revealed several interesting features. The 3Dpol in its full-length shares structural similarities with members of the family Caliciviridaeand family Picornaviridae. In addition, fourth dsRNA molecule (dsRNA-2A, not related to ArCV-1 genome, was found in the same plant tissue. The dsRNA-2A (1.6 kb encodes a protein (P4, with a predicted size of 44.5 kDa. P4 shares similarity with coat protein genes of several cryptic viruses, in particular the bipartite cryptic viruses including Raphanus sativus cryptic virus-3. This is the first report of occurrence of a cryptic virus in pigeonpea plants.
Modeling adaptation of wetland plants under changing environments
Muneepeerakul, R.; Muneepeerakul, C. P.
2010-12-01
An evolutionary-game-theoretic approach is used to study the changes in traits of wetland plants in response to environmental changes, e.g., altered patterns of rainfall and nutrients. Here, a wetland is considered as a complex adaptive system where plants can adapt their strategies and influence one another. The system is subject to stochastic rainfall, which controls the dynamics of water level, soil moisture, and alternation between aerobic and anaerobic conditions in soil. Based on our previous work, a plant unit is characterized by three traits, namely biomass nitrogen content, specific leaf area, and allocation to rhizome. These traits control the basic functions of plants such as assimilation, respiration, and nutrient uptake, while affecting their environment through litter chemistry, root oxygenation, and thus soil microbial dynamics. The outcome of this evolutionary game, i.e., the best-performing plant traits against the backdrop of these interactions and feedbacks, is analyzed and its implications on important roles of wetlands in supporting our sustainability such as carbon sequestration in biosphere, nutrient cycling, and repository of biodiversity are discussed.
Poly-epiphyseal overgrowth: description of a previously unreported skeletal dysplasia
Energy Technology Data Exchange (ETDEWEB)
Pazzaglia, Ugo E.; Bonaspetti, Giovanni [University of Brescia, Orthopaedic Clinic, Brescia (Italy); Beluffi, Giampiero [Fondazione IRCCS Policlinico San Matteo, Department of Paediatric Radiology, Pavia (Italy); Marchi, Antonietta; Bozzola, Mauro; Savasta, Salvatore [Fondazione IRCCS Policlinico San Matteo, Paediatric Clinic, University of Pavia, Pavia (Italy)
2007-10-15
A skeletal dysplasia with previously unreported features is presented. Its evolution was characterized by growth abnormalities of bones without involvement of other organs. Advanced bone age, increased stature and irregular epiphyseal ossification with stippling of the main long bones were documented. Physeal overgrowth was massive in the left proximal humerus and femur. Furthermore, the hip joint appeared fused with an abundant mass of pathological calcific tissue extending from the femur to the ilium. Pathological epiphyses were characterized by anarchic cartilaginous proliferation with multiple ossification centres, while lamellar bone apposition and remodelling were normal. The observed bone changes were different from those in any previously reported syndrome, metabolic defect or bone dysplasia. However, they clearly indicated a defect of endochondral ossification with some resemblance to phenotypes observed in dysplasia epiphysealis hemimelica. (orig.)
Poly-epiphyseal overgrowth: description of a previously unreported skeletal dysplasia
International Nuclear Information System (INIS)
Pazzaglia, Ugo E.; Bonaspetti, Giovanni; Beluffi, Giampiero; Marchi, Antonietta; Bozzola, Mauro; Savasta, Salvatore
2007-01-01
A skeletal dysplasia with previously unreported features is presented. Its evolution was characterized by growth abnormalities of bones without involvement of other organs. Advanced bone age, increased stature and irregular epiphyseal ossification with stippling of the main long bones were documented. Physeal overgrowth was massive in the left proximal humerus and femur. Furthermore, the hip joint appeared fused with an abundant mass of pathological calcific tissue extending from the femur to the ilium. Pathological epiphyses were characterized by anarchic cartilaginous proliferation with multiple ossification centres, while lamellar bone apposition and remodelling were normal. The observed bone changes were different from those in any previously reported syndrome, metabolic defect or bone dysplasia. However, they clearly indicated a defect of endochondral ossification with some resemblance to phenotypes observed in dysplasia epiphysealis hemimelica. (orig.)
International Nuclear Information System (INIS)
Ideker, V.L.
1994-01-01
The Waste Stream and Residue Identification and Characterization (WSRIC) Program, as described in the WSRIC Program Description delineates the process knowledge used to identify and characterize currently-generated waste from approximately 5404 waste streams originating from 576 processes in 288 buildings at Rocky Flats Plant (RFP). Annual updates to the WSRIC documents are required by the Federal Facilities Compliance Agreement between the US Department of Energy, the Colorado Department of Health and the Environmental Protection Agency. Accurate determination and characterization of waste is a crucial component in RFP's waste management strategy to assure compliance with Resource Conservation and Recovery Act (RCRA) storage and treatment requirements, as well as disposal acceptance criteria. The WSRIC Program was rebaselined in September 1992, and serves as the linchpin for documenting process knowledge in RFP's RCRA operating record. Enhancements to the WSRIC include strengthening the waste characterization rationale, expanding WSRIC training for waste generators, and incorporating analytical information into the WSRIC building books. These enhancements will improve credibility with the regulators and increase waste generators' understanding of the basis for credible waste characterizations
A Brief Review of Molecular Techniques to Assess Plant Diversity
Directory of Open Access Journals (Sweden)
Ibrahim A. Arif
2010-05-01
Full Text Available Massive loss of valuable plant species in the past centuries and its adverse impact on environmental and socioeconomic values has triggered the conservation of plant resources. Appropriate identification and characterization of plant materials is essential for the successful conservation of plant resources and to ensure their sustainable use. Molecular tools developed in the past few years provide easy, less laborious means for assigning known and unknown plant taxa. These techniques answer many new evolutionary and taxonomic questions, which were not previously possible with only phenotypic methods. Molecular techniques such as DNA barcoding, random amplified polymorphic DNA (RAPD, amplified fragment length polymorphism (AFLP, microsatellites and single nucleotide polymorphisms (SNP have recently been used for plant diversity studies. Each technique has its own advantages and limitations. These techniques differ in their resolving power to detect genetic differences, type of data they generate and their applicability to particular taxonomic levels. This review presents a basic description of different molecular techniques that can be utilized for DNA fingerprinting and molecular diversity analysis of plant species.
A Brief Review of Molecular Techniques to Assess Plant Diversity
Arif, Ibrahim A.; Bakir, Mohammad A.; Khan, Haseeb A.; Al Farhan, Ahmad H.; Al Homaidan, Ali A.; Bahkali, Ali H.; Sadoon, Mohammad Al; Shobrak, Mohammad
2010-01-01
Massive loss of valuable plant species in the past centuries and its adverse impact on environmental and socioeconomic values has triggered the conservation of plant resources. Appropriate identification and characterization of plant materials is essential for the successful conservation of plant resources and to ensure their sustainable use. Molecular tools developed in the past few years provide easy, less laborious means for assigning known and unknown plant taxa. These techniques answer many new evolutionary and taxonomic questions, which were not previously possible with only phenotypic methods. Molecular techniques such as DNA barcoding, random amplified polymorphic DNA (RAPD), amplified fragment length polymorphism (AFLP), microsatellites and single nucleotide polymorphisms (SNP) have recently been used for plant diversity studies. Each technique has its own advantages and limitations. These techniques differ in their resolving power to detect genetic differences, type of data they generate and their applicability to particular taxonomic levels. This review presents a basic description of different molecular techniques that can be utilized for DNA fingerprinting and molecular diversity analysis of plant species. PMID:20559503
Li, Chaoqiong; Luo, Li; Fu, Qiantang; Niu, Longjian; Xu, Zeng-Fu
2014-05-08
Physic nut (Jatropha curcas L.) is a potential feedstock for biofuel production because Jatropha oil is highly suitable for the production of the biodiesel and bio-jet fuels. However, Jatropha exhibits low seed yield as a result of unreliable and poor flowering. FLOWERING LOCUS T (FT) -like genes are important flowering regulators in higher plants. To date, the flowering genes in Jatropha have not yet been identified or characterized. To better understand the genetic control of flowering in Jatropha, an FT homolog was isolated from Jatropha and designated as JcFT. Sequence analysis and phylogenetic relationship of JcFT revealed a high sequence similarity with the FT genes of Litchi chinensis, Populus nigra and other perennial plants. JcFT was expressed in all tissues of adult plants except young leaves, with the highest expression level in female flowers. Overexpression of JcFT in Arabidopsis and Jatropha using the constitutive promoter cauliflower mosaic virus 35S or the phloem-specific promoter Arabidopsis SUCROSE TRANSPORTER 2 promoter resulted in an extremely early flowering phenotype. Furthermore, several flowering genes downstream of JcFT were up-regulated in the JcFT-overexpression transgenic plant lines. JcFT may encode a florigen that acts as a key regulator in flowering pathway. This study is the first to functionally characterize a flowering gene, namely, JcFT, in the biofuel plant Jatropha.
International Nuclear Information System (INIS)
Guridi-Izquierdo, Fernando; Martínez-Balmori, Dariellys; Rosquete-Bassó, Mayelín; Calderín-García, Andrés; Louro-Berbara, Ricardo L.
2017-01-01
The humic acids (HA) from two different vermicompost were extracted, isolated, purified and partially characterized, to evaluate their possible protection in rice (Oryza sativa L.) plants against an hydric stress. Differences in elemental composition, as the coagulation threshold value and E4/E6 relation in their UV-Vis spectra were found. Two concentrations (40 and 60 mg L-1) of both HA were included in the nutritive solutions for rice plants in controlled conditions. It was verified that the previous treatment with the HA during six days stimulated the root biomass production. Later the HA were excluded and was an hydric deficit induced by adding polietilenglicol (PEG-6000) in the initially treated plants and in a group of those used as control. After 96 hours of this final condition the net radical biomass, the photosynthetic pigments content and the root membrane permeability were evaluated. In the plants previously treated with HA (at the concentration 60 mg HA L-1), the root membrane permeability, the net radical biomass production and the “a” chlorophyll content had no differences when compared with those without stress. It was concluded that the previous treatment with the HA protected the rice plants against a posterior hydric stress that was induced. (author)
Tartaglione, Luciana; Gambuti, Angelita; De Cicco, Paola; Ercolano, Giuseppe; Ianaro, Angela; Taglialatela-Scafati, Orazio; Moio, Luigi; Forino, Martino
2018-03-01
Vitis vinifera cv Falanghina is an ancient grape variety of Southern Italy. A thorough phytochemical analysis of the Falanghina leaves was conducted to investigate its specialised metabolite content. Along with already known molecules, such as caftaric acid, quercetin-3-O-β-d-glucopyranoside, quercetin-3-O-β-d-glucuronide, kaempferol-3-O-β-d-glucopyranoside and kaempferol-3-O-β-d-glucuronide, a previously undescribed biflavonoid was identified. For this last compound, a moderate bioactivity against metastatic melanoma cells proliferation was discovered. This datum can be of some interest to researchers studying human melanoma. The high content in antioxidant glycosylated flavonoids supports the exploitation of grape vine leaves as an inexpensive source of natural products for the food industry and for both pharmaceutical and nutraceutical companies. Additionally, this study offers important insights into the plant physiology, thus prompting possible technological researches of genetic selection based on the vine adaptation to specific pedo-climatic environments. Copyright © 2017 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Bevolo, A.J.; Kjartanson, B.H.; Wonder, J.D.
1996-03-01
The goal of the Ames Expedited Site Characterization (ESC) project is to evaluate and promote both innovative technologies (IT) and state-of-the-practice technologies (SOPT) for site characterization and monitoring. In April and May 1994, the ESC project conducted site characterization, technology comparison, and stakeholder demonstration activities at a former manufactured gas plant (FMGP) owned by Iowa Electric Services (IES) Utilities, Inc., in Marshalltown, Iowa. Three areas of technology were fielded at the Marshalltown FMGP site: geophysical, analytical and data integration. The geophysical technologies are designed to assess the subsurface geological conditions so that the location, fate and transport of the target contaminants may be assessed and forecasted. The analytical technologies/methods are designed to detect and quantify the target contaminants. The data integration technology area consists of hardware and software systems designed to integrate all the site information compiled and collected into a conceptual site model on a daily basis at the site; this conceptual model then becomes the decision-support tool. Simultaneous fielding of different methods within each of the three areas of technology provided data for direct comparison of the technologies fielded, both SOPT and IT. This document reports the results of the site characterization, technology comparison, and ESC demonstration activities associated with the Marshalltown FMGP site. 124 figs., 27 tabs
Di Salvo, Luciana P; Silva, Esdras; Teixeira, Kátia R S; Cote, Rosalba Esquivel; Pereyra, M Alejandra; García de Salamone, Inés E
2014-12-01
Azospirillum is a plant growth-promoting rhizobacteria (PGPR) genus vastly studied and utilized as agriculture inoculants. Isolation of new strains under different environmental conditions allows the access to the genetic diversity and improves the success of inoculation procedures. Historically, the isolation of this genus has been performed by the use of some traditional culture media. In this work we characterized the physiology and biochemistry of five different A. brasilense strains, commonly used as cereal inoculants. The aim of this work is to contribute to pose into revision some concepts concerning the most used protocols to isolate and characterize this bacterium. We characterized their growth in different traditional and non-traditional culture media, evaluated some PGPR mechanisms and characterized their profiles of fatty acid methyl esters and carbon-source utilization. This work shows, for the first time, differences in both profiles, and ACC deaminase activity of A. brasilense strains. Also, we show unexpected results obtained in some of the evaluated culture media. Results obtained here and an exhaustive knowledge revision revealed that it is not appropriate to conclude about bacterial species without analyzing several strains. Also, it is necessary to continue developing studies and laboratory techniques to improve the isolation and characterization protocols. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
PHYSIOLOGICAL AND AGROECOLOGICAL ASPECTS OF CADMIUM INTERACTIONS WITH BARLEY PLANTS: AN OVERVIEW
Directory of Open Access Journals (Sweden)
A VASSILEV
2003-07-01
Full Text Available This work is a review of author’s previous publications, unpublished results as well as available literature on barley responses to Cd contamination. The physiological backgrounds of the acute Cd toxicity in barley plants are briefly described. Some data characterizing the chronic Cd toxicity in barley have been also provided in relation to its possible use for seed production and Cd phytoextraction on Cd-contaminated agricultural soils. Information about the main physiological factors limiting growth of Cd-exposed barley plants and grain yield, seedling quality as well as Cd phytoextraction capacity of barley grown in Cd-contaminated soils is presented.
Kamnev, A. A.; Antonyuk, L. P.; Matora, L. Yu.; Serebrennikova, O. B.; Sumaroka, M. V.; Colina, M.; Renou-Gonnord, M.-F.; Ignatov, V. V.
1999-05-01
Structural and compositional features of bacterial membranes and some of their isolated constituents (cell surface lipopolysaccharide, phospholipids) of the plant-growth-promoting diazotrophic rhizobacterium Azospirillum brasilense (wild-type strain Sp245) were characterized using Fourier transform infrared (FTIR) spectroscopy and some other techniques. FTIR spectra of the cell membranes were shown to comprise the main vibration modes of the relevant lipopolysaccharide and protein components which are believed to be involved in associative plant-bacterium interactions, as well as of phospholipid constituents. The role and functions of metal cations in the structural organization and physicochemical properties of bacterial cell membranes are also discussed considering their accumulation in the membranes from the culture medium.
Dal Santo, Silvia; Fasoli, Marianna; Cavallini, Erika; Tornielli, Giovanni Battista; Pezzotti, Mario; Zenoni, Sara
2011-12-01
Expansins are wall-loosening proteins that induce wall stress relaxation and irreversible wall extension in a pH-dependent manner. Despite a substantial body of work has been performed on the characterization of many expansins genes in different plant species, the knowledge about their precise biological roles during plant development remains scarce. To yield insights into the expansion process in Petunia hybrida, PhEXPA1, an expansin gene preferentially expressed in petal limb, has been characterized. The constitutive overexpression of PhEXPA1 significantly increased expansin activity, cells size and organ dimensions. Moreover, 35S::PhEXPA1 transgenic plants exhibited an altered cell wall polymer composition and a precocious timing of axillary meristem development compared with wild-type plants. These findings supported a previous hypothesis that expansins are not merely structural proteins involved in plant cell wall metabolism but they also take part in many plant development processes. Here, to support this expansins dual role, we discuss about differential cell wall-related genes expressed in PhEXPA1 expression mutants and gradients of altered petunia branching pattern. © 2011 Landes Bioscience
International Nuclear Information System (INIS)
HELTON, JON CRAIG; MARTELL, MARY-ALENA; TIERNEY, MARTIN S.
2000-01-01
The 1996 performance assessment (PA) for the Waste Isolation Pilot Plant (WIPP) maintains a separation between stochastic (i.e., aleatory) and subjective (i.e., epistemic) uncertainty, with stochastic uncertainty arising from the possible disruptions that could occur at the WIPP over the 10,000 yr regulatory period specified by the US Environmental Protection Agency (40 CFR 191,40 CFR 194) and subjective uncertainty arising from an inability to uniquely characterize many of the inputs required in the 1996 WIPP PA. The characterization of subjective uncertainty is discussed, including assignment of distributions, uncertain variables selected for inclusion in analysis, correlation control, sample size, statistical confidence on mean complementary cumulative distribution functions, generation of Latin hypercube samples, sensitivity analysis techniques, and scenarios involving stochastic and subjective uncertainty
Energy Technology Data Exchange (ETDEWEB)
HELTON,JON CRAIG; MARTELL,MARY-ALENA; TIERNEY,MARTIN S.
2000-05-18
The 1996 performance assessment (PA) for the Waste Isolation Pilot Plant (WIPP) maintains a separation between stochastic (i.e., aleatory) and subjective (i.e., epistemic) uncertainty, with stochastic uncertainty arising from the possible disruptions that could occur at the WIPP over the 10,000 yr regulatory period specified by the US Environmental Protection Agency (40 CFR 191,40 CFR 194) and subjective uncertainty arising from an inability to uniquely characterize many of the inputs required in the 1996 WIPP PA. The characterization of subjective uncertainty is discussed, including assignment of distributions, uncertain variables selected for inclusion in analysis, correlation control, sample size, statistical confidence on mean complementary cumulative distribution functions, generation of Latin hypercube samples, sensitivity analysis techniques, and scenarios involving stochastic and subjective uncertainty.
International Nuclear Information System (INIS)
1991-01-01
This Quality Assurance Program Plan (QAPP) identifies the quality of data necessary to meet the specific objectives associated with the Department of Energy (DOE) Waste Isolation Pilot Plant (WIPP) Experimental-Waste Characterization Program (the Program). This experimental-waste characterization program is only one part of the WIPP Test Phase, both in the short- and long-term, to quantify and evaluate the characteristics and behavior of transuranic (TRU) wastes in the repository environment. Other parts include the bin-scale and alcove tests, drum-scale tests, and laboratory experiments. In simplified terms, the purpose of the Program is to provide chemical, physical, and radiochemical data describing the characteristics of the wastes that will be emplaced in the WIPP, while the remaining WIPP Test Phase is directed at examining the behavior of these wastes in the repository environment. 50 refs., 35 figs., 33 tabs
Characterization of Foliage Mutants for Plant Variety Registration
International Nuclear Information System (INIS)
Affrida Abu Hassan; Shuhaimi Shamsuddin; Zaiton Ahmad
2011-01-01
Breeding for new plant varieties requires a substantial investment in terms of skill, labour, material resources and financing. Thus, registration of new plant variety is important to ensure return of revenue and protection of the breeder's right. Before a new variety is registered, it has to comply certain requirements under Plant Variety Protection Act. One of the most important requirements is, the new species/variety must be morphologically distinguishable from existing plant varieties. This paper discusses detailed leaf characteristics of 4 foliage mutants produced by Malaysian Nuclear Agency as part of the requirement for new variety registration. (author)
Biological conversion assay using Clostridium phytofermentans to estimate plant feedstock quality.
Lee, Scott J; Warnick, Thomas A; Pattathil, Sivakumar; Alvelo-Maurosa, Jesús G; Serapiglia, Michelle J; McCormick, Heather; Brown, Virginia; Young, Naomi F; Schnell, Danny J; Smart, Lawrence B; Hahn, Michael G; Pedersen, Jeffrey F; Leschine, Susan B; Hazen, Samuel P
2012-02-08
There is currently considerable interest in developing renewable sources of energy. One strategy is the biological conversion of plant biomass to liquid transportation fuel. Several technical hurdles impinge upon the economic feasibility of this strategy, including the development of energy crops amenable to facile deconstruction. Reliable assays to characterize feedstock quality are needed to measure the effects of pre-treatment and processing and of the plant and microbial genetic diversity that influence bioconversion efficiency. We used the anaerobic bacterium Clostridium phytofermentans to develop a robust assay for biomass digestibility and conversion to biofuels. The assay utilizes the ability of the microbe to convert biomass directly into ethanol with little or no pre-treatment. Plant samples were added to an anaerobic minimal medium and inoculated with C. phytofermentans, incubated for 3 days, after which the culture supernatant was analyzed for ethanol concentration. The assay detected significant differences in the supernatant ethanol from wild-type sorghum compared with brown midrib sorghum mutants previously shown to be highly digestible. Compositional analysis of the biomass before and after inoculation suggested that differences in xylan metabolism were partly responsible for the differences in ethanol yields. Additionally, we characterized the natural genetic variation for conversion efficiency in Brachypodium distachyon and shrub willow (Salix spp.). Our results agree with those from previous studies of lignin mutants using enzymatic saccharification-based approaches. However, the use of C. phytofermentans takes into consideration specific organismal interactions, which will be crucial for simultaneous saccharification fermentation or consolidated bioprocessing. The ability to detect such phenotypic variation facilitates the genetic analysis of mechanisms underlying plant feedstock quality.
Biological conversion assay using Clostridium phytofermentans to estimate plant feedstock quality
Directory of Open Access Journals (Sweden)
Lee Scott J
2012-02-01
Full Text Available Abstract Background There is currently considerable interest in developing renewable sources of energy. One strategy is the biological conversion of plant biomass to liquid transportation fuel. Several technical hurdles impinge upon the economic feasibility of this strategy, including the development of energy crops amenable to facile deconstruction. Reliable assays to characterize feedstock quality are needed to measure the effects of pre-treatment and processing and of the plant and microbial genetic diversity that influence bioconversion efficiency. Results We used the anaerobic bacterium Clostridium phytofermentans to develop a robust assay for biomass digestibility and conversion to biofuels. The assay utilizes the ability of the microbe to convert biomass directly into ethanol with little or no pre-treatment. Plant samples were added to an anaerobic minimal medium and inoculated with C. phytofermentans, incubated for 3 days, after which the culture supernatant was analyzed for ethanol concentration. The assay detected significant differences in the supernatant ethanol from wild-type sorghum compared with brown midrib sorghum mutants previously shown to be highly digestible. Compositional analysis of the biomass before and after inoculation suggested that differences in xylan metabolism were partly responsible for the differences in ethanol yields. Additionally, we characterized the natural genetic variation for conversion efficiency in Brachypodium distachyon and shrub willow (Salix spp.. Conclusion Our results agree with those from previous studies of lignin mutants using enzymatic saccharification-based approaches. However, the use of C. phytofermentans takes into consideration specific organismal interactions, which will be crucial for simultaneous saccharification fermentation or consolidated bioprocessing. The ability to detect such phenotypic variation facilitates the genetic analysis of mechanisms underlying plant feedstock quality.
Characterization and structural properties of iron in plants.
Dewanamuni, Udya; Dehipawala, Sunil; Gafney, Harry
Iron is one of the most abundant metals in the soil and occurs in a wide range of chemical forms. Humans receive iron through either meat products or plants. Non meat eaters depend on plant product for their daily iron requirement. The iron absorption by plants depends on other minerals present in the soil and soil pH value. The amount of iron present in plants grown with different soil compositions were investigated using X-ray absorption spectroscopy (XAS) and Mossbauer spectroscopy. Based on the X-ray absorption data, the amount of iron in plants vary significantly with soil pH value. The Mossbauer spectroscopy reveals that iron present in the samples has the form Fe3+ or electron density at the site of the iron nucleus similar to that of Fe3+. CUNY Research Scholar Program, MSEIP.
Yang, Qingjie; Yuan, Dawei; Shi, Lianxuan; Capell, Teresa; Bai, Chao; Wen, Nuan; Lu, Xiaodan; Sandmann, Gerhard; Christou, Paul; Zhu, Changfu
2012-10-01
The accumulation of carotenoids in plants depends critically on the spatiotemporal expression profiles of the genes encoding enzymes in the carotenogenic pathway. We cloned and characterized the Gentiana lutea zeaxanthin epoxidase (GlZEP) promoter to determine its role in the regulation of carotenogenesis, because the native gene is expressed at high levels in petals, which contain abundant chromoplasts. We transformed tomato (Solanum lycopersicum cv. Micro-Tom) plants with the gusA gene encoding the reporter enzyme β-glucuronidase (GUS) under the control of the GlZEP promoter, and investigated the reporter expression profile at the mRNA and protein levels. We detected high levels of gusA expression and GUS activity in chromoplast-containing flowers and fruits, but minimal levels in immature fruits containing green chloroplasts, in sepals, leaves, stems and roots. GlZEP-gusA expression was strictly associated with fruit development and chromoplast differentiation, suggesting an evolutionarily-conserved link between ZEP and the differentiation of organelles that store carotenoid pigments. The impact of our results on current models for the regulation of carotenogenesis in plants is discussed.
Directory of Open Access Journals (Sweden)
Shan Lu
2017-08-01
Full Text Available Phosphate (Pi deficiency is a common nutritional stress of plants in both agricultural and natural ecosystems. Plants respond to Pi starvation in the environment by triggering a suite of biochemical, physiological, and developmental changes that increase survival and growth. The key factors that determine plant sensitivity to Pi starvation, however, are unclear. In this research, we identified an Arabidopsis mutant, dps1, with greatly reduced sensitivity to Pi starvation. The dps1 phenotypes are caused by a mutation in the previously characterized SVR1 (SUPPRESSION OF VARIAGATION 1 gene, which encodes a chloroplast-localized pseudouridine synthase. The mutation of SVR1 results in defects in chloroplast rRNA biogenesis, which subsequently reduces chloroplast translation. Another mutant, rps5, which contains a mutation in the chloroplast ribosomal protein RPS5 and has reduced chloroplast translation, also displayed decreased sensitivity to Pi starvation. Furthermore, wild type plants treated with lincomycin, a chemical inhibitor of chloroplast translation, showed similar growth phenotypes and Pi starvation responses as dps1 and rps5. These results suggest that impaired chloroplast translation desensitizes plants to Pi starvation. Combined with previously published results showing that enhanced leaf photosynthesis augments plant responses to Pi starvation, we propose that the decrease in responses to Pi starvation in dps1, rps5, and lincomycin-treated plants is due to their reduced demand for Pi input from the environment.
Ecosystem-scale plant hydraulic strategies inferred from remotely-sensed soil moisture
Bassiouni, M.; Good, S. P.; Higgins, C. W.
2017-12-01
Characterizing plant hydraulic strategies at the ecosystem scale is important to improve estimates of evapotranspiration and to understand ecosystem productivity and resilience. However, quantifying plant hydraulic traits beyond the species level is a challenge. The probability density function of soil moisture observations provides key information about the soil moisture states at which evapotranspiration is reduced by water stress. Here, an inverse Bayesian approach is applied to a standard bucket model of soil column hydrology forced with stochastic precipitation inputs. Through this approach, we are able to determine the soil moisture thresholds at which stomata are open or closed that are most consistent with observed soil moisture probability density functions. This research utilizes remotely-sensed soil moisture data to explore global patterns of ecosystem-scale plant hydraulic strategies. Results are complementary to literature values of measured hydraulic traits of various species in different climates and previous estimates of ecosystem-scale plant isohydricity. The presented approach provides a novel relation between plant physiological behavior and soil-water dynamics.
Characterization of process holdup material at the Portsmouth Gaseous Diffusion Plant
International Nuclear Information System (INIS)
Boyd, D.E.; Miller, R.R.
1986-01-01
The cascade material balance area at the Portsmouth Gaseous Diffusion Plant is characterized by continuous, large, in-process inventories of gaseous uranium hexafluoride (UF 6 ) and very large inputs and outputs of UF 6 over a complete range of 235 U enrichments. Monthly inventories are conducted to quantify the in-place material, but the inventory techniques are blind to material not in the gas phase. Material is removed from the gas phase by any one of four mechanisms: (1) freeze-outs which are the solidification of UF 6 , (2) inleakage of wet air which produces solid uranium oxyfluorides, (3) consumption of uranium through UF 6 reaction with internal metal surfaces, and (4) adsorption of UF 6 on internal surfaces. This presentation describes efforts to better characterize and, where possible, to eliminate or reduce the effects of these mechanisms on material accountability. Freeze-outs and wet air deposits occur under absormal operating conditions, and techniques are available to prevent, detect and reverse them. Consumption and adsorption occur under normal operating conditions and are more complex to manage, however, computer models have been developed to quantify monthly the net effects due to consumption and adsorption. These models have shown that consumption and adsorption effects on inventory differences are significant
International Nuclear Information System (INIS)
Fromm, J.M.
1995-01-01
A conceptual model of the Eastern Snake River Plain aquifer in the vicinity of monitoring well USGS-44, downgradient of the Idaho Chemical Processing Plant (ICPP) on the Idaho National Engineering Laboratory (INEL), was developed by synthesis and comparison of previous work (40 years) and new investigations into local natural hydrogeological conditions and anthropogenic influences. Quantitative tests of the model, and other recommendations are suggested. The ICPP recovered fissionable uranium from spent nuclear fuel rods and disposed of waste fluids by release to the regional aquifer and lithosphere. Environmental impacts were assessed by a monitoring well network. The conceptual model identifies multiple, highly variable, interacting, and transient components, including INEL facilities multiple operations and liquid waste handling, systems; the anisotropic, in homogeneous aquifer; the network of monitoring and production wells, and the intermittent flow of the Big Lost River. Pre anthropogenic natural conditions and early records of anthropogenic activities were sparsely or unreliably documented making reconstruction of natural conditions or early hydrologic impacts impossible or very broad characterizations
International Nuclear Information System (INIS)
Sackschewsky, M.R.
1992-04-01
Environmental characterization in support of hazardous, radioactive, and mixed waste cleanup (in accordance with the Comprehensive Environmental Response, Compensation, and Liability Act of 1980) can involve a large number of both nonintrusive and intrusive activities. Many of these activities could have a detrimental impact on listed plant species. These impacts can be minimized by following simple conservation policies while conducting the various field activities. For instance, frequent off-road vehicular traffic and have a severe impact on native habitats and, therefore, should be kept to a minimum. Personnel performing the field activities should be trained to preserve, respect, and minimize their impact on native habitat while performing work in the field. In addition, areas where sampling is planned should be surveyed for the presence of listed plant species before the initiation of the field activities. Extremely distributed areas could be exempted from this requirement provided adequate habitat assessments have been performed by qualified personnel. Twelve special status plant species are known to survive on or very near the Hanford Site. None of these species currently are listed as Federal Threatened or Endangered Species. However, four local species currently are candidates for federal protection. These species are the Northern Wormwood (Artemisia campestris ssp. borealis var. wormskioldii), Persistantsepal Yellowcress (Rorippa columbiae), Hoover's Desert Parsley (Lomatium tuberosum), and Columbia Milkvetch (Astragalus columbianus)
International Nuclear Information System (INIS)
Cesari, F.G.; Terzi, L.A.; Giostri, A.; Bernini, C.; Sirito, E.; Sirito, M.
2005-01-01
The Caorso's Nuclear Power Plant (BWR, 870 MWe) has just started the decommissioning process, with the intent to reach, by almost ten years, the 'green field' conditions for the site. The plant has fully worked for a very short period of time, by 1981 to 1986, being shut down after 1987 Italy's poll that abrogated nuclear power use. The dismantling of the components and of the structural materials has already begun in the Turbine Building. The University of Bologna, on indication of the NPP's management, has started an experimental campaign to test the cutting processes and its filtering plant. The starting phase is the qualification of the cutting methods chosen by Caorso's management, oxyfuel and plasma cuttings. This campaign is set over no contaminated material, or, better, material with a contamination under the level of free release, and is now running in the University Labs. Next phase are filtering tests. This part of the qualifying campaign is set to highlight the kind of trouble that can emerge in the cutting processes, not yet taking into account radioactivity. Caorso's BWR is a plant designed and built in the 70s. Possible decommissioning problems weren't considered during the design phase so the cutting processes will be quite difficult, even on the conventional side. The final phase is settled in the plant. Cutting tests, following indications made by previous campaigns, will be conducted in the Turbine Building, where tests can be conducted on a low level of radioactivity (only some little part of it has a contamination level over the free release limit of 1 Bq/cm 2 ). The intent is to develop an extensive cutting procedure, with the obvious option of remote control, able to face difficulties connected with cutting processes in a nuclear plant like Caorso. This means handling with radioactivity and with not airy narrow rooms, fulfilled with pipes. (authors)
Engineered Plants as Biosensors
National Research Council Canada - National Science Library
Stewart, C
2003-01-01
The aim of the research was the creation of a model biosensing plant that could detect plant diseases and to characterize the utility of laser induced fluorescence imaging for detecting the inducible (LIFI) plant signal...
Characterization of Cellulose Synthesis in Plant Cells
Maleki, Samaneh Sadat; Mohammadi, Kourosh; Ji, Kong-shu
2016-01-01
Cellulose is the most significant structural component of plant cell wall. Cellulose, polysaccharide containing repeated unbranched β (1-4) D-glucose units, is synthesized at the plasma membrane by the cellulose synthase complex (CSC) from bacteria to plants. The CSC is involved in biosynthesis of cellulose microfibrils containing 18 cellulose synthase (CesA) proteins. Macrofibrils can be formed with side by side arrangement of microfibrils. In addition, beside CesA, various proteins like the KORRIGAN, sucrose synthase, cytoskeletal components, and COBRA-like proteins have been involved in cellulose biosynthesis. Understanding the mechanisms of cellulose biosynthesis is of great importance not only for improving wood production in economically important forest trees to mankind but also for plant development. This review article covers the current knowledge about the cellulose biosynthesis-related gene family. PMID:27314060
Characterization of Cellulose Synthesis in Plant Cells
Directory of Open Access Journals (Sweden)
Samaneh Sadat Maleki
2016-01-01
Full Text Available Cellulose is the most significant structural component of plant cell wall. Cellulose, polysaccharide containing repeated unbranched β (1-4 D-glucose units, is synthesized at the plasma membrane by the cellulose synthase complex (CSC from bacteria to plants. The CSC is involved in biosynthesis of cellulose microfibrils containing 18 cellulose synthase (CesA proteins. Macrofibrils can be formed with side by side arrangement of microfibrils. In addition, beside CesA, various proteins like the KORRIGAN, sucrose synthase, cytoskeletal components, and COBRA-like proteins have been involved in cellulose biosynthesis. Understanding the mechanisms of cellulose biosynthesis is of great importance not only for improving wood production in economically important forest trees to mankind but also for plant development. This review article covers the current knowledge about the cellulose biosynthesis-related gene family.
ACCUMULATION OF PERCHLORATE IN TOBACCO PLANTS: DEVELOPMENT OF A PLANT KINETIC MODEL
Previous studies have shown that tobacco plants are tolerant of perchlorate and will accumulate perchlorate in plant tissues. This research determined the uptake, translocation, and accumulation of perchlorate in tobacco plants. Three hydroponics growth studies were completed u...
Energy Technology Data Exchange (ETDEWEB)
Davis, M.S. [Univ. of Sunderland (United Kingdom). Ecology Centre
1996-05-01
In an attempt to replicate the findings of Smith et al., seeds of Raphanus sativus L. (radish), Sinapsis alba L. (mustard), and Hordeum vulgare L. (barley) were grown for between 9 and 21 days in continuous electromagnetic fields (EMFs) at ion-cyclotron resonance conditions for stimulation of Ca{sup 2+} (B{sub H} = 78.3 {micro}T, B{sub HAC} = 40 {micro}T peak-peak at 60 Hz, B{sub v} = 0). On harvesting, radish showed results similar to those of Smith et al. Dry stem weight and plant height were both significantly greater (Mann-Whitney tests, Ps < 0.05) in EMF-exposed plants than in control plants in each EMF experiment. Wet root weight was significantly greater in EMF-exposed plants in two out of three experiments, as were dry leaf weight, dry whole weight, and stem diameter. Dry root weight, wet leaf weight, and wet whole weight were significantly greater in EMF-exposed plants in one of three experiments. All significant differences indicated an increase in weight or size in the EMF-exposed plants. In each of the sham experiments, no differences between exposed and control plants were evident. Mustard plants failed to respond to the EMFs in any of the plant parameters measured. In one experiment, barley similarly failed to respond; but in another showed significantly greater wet root weight and significantly smaller stem diameter and dry seed weight at the end of the experiment in exposed plants compared to control plants. Although these results give no clue about the underlying bioelectromagnetic mechanism, they demonstrate that, at least for one EMF-sensitive biosystem, results can be independently replicated in another laboratory. Such replication is crucial in establishing the validity of bioelectromagnetic science.
Purdy, A. J.; Fisher, J.; Goulden, M.; Randerson, J. T.; Famiglietti, J. S.
2017-12-01
Plants link the carbon and water cycles through photosynthesis and evapotranspiration (ET). When plants take in CO2 for photosynthesis, water evaporates to the atmosphere. This exchange of carbon and water is sensitive to a number of environmental variables including: soil water availability, temperature, atmospheric water vapor, and radiation. When the atmospheric demand for water is high, plants avoid hydraulic failure by regulating the amount of water exiting leaves at the expense of inhibiting carbon uptake. Over time, stress caused by this response limits plant growth and can even result in death by carbon starvation. With increasing atmospheric demand for water, impending expansion of arid regions, and more frequent droughts, understanding how vegetation responds to regulate photosynthesis and ET is important to quantify potential feedbacks between the carbon and water cycles. Despite its importance, to what extent plants respond to stressful conditions is an open science question. An important step forward is to characterize the dominant controls in these stress events and identify geographic areas that are vulnerable to climate change. The 2015-2016 El Nino and subsequent 2016-2017 La Nina transition provides an opportunity to quantify the extent and magnitude of vegetation regulation of these carbon and water variables in response to changes in environmental conditions. We present results from a space-based analysis using global observations of solar induced fluorescence (SIF) from the Orbiting Carbon Observatory-2 (OCO-2), soil moisture from Soil Moisture Active Passive (SMAP), and two widely used ET models (PT-JPL and MOD-16) to characterize the dominant controls on gross primary production and ET.
CHARACTERIZATION AND MODELING OF THE FORMS OF MERCURY FROM COAL-FIRED POWER PLANTS
Energy Technology Data Exchange (ETDEWEB)
Dennis L. Laudal
2001-08-01
The 1990 Clean Air Act Amendments (CAAAs) required the U.S. Environmental Protection Agency (EPA) to determine whether the presence of mercury in the stack emissions from fossil fuel-fired electric utility power plants poses an unacceptable public health risk. EPA's conclusions and recommendations were presented in the Mercury Study Report to Congress (1) and the Utility Air Toxics Report to Congress (1). The first report addressed both the human health and environmental effects of anthropogenic mercury emissions, while the second addressed the risk to public health posed by the emission of mercury and other hazardous air pollutants from steam-electric generating units. Given the current state of the art, these reports did not state that mercury controls on coal-fired electric power stations would be required. However, they did indicate that EPA views mercury as a potential threat to human health. In fact, in December 2000, the EPA issued an intent to regulate for mercury from coal-fired boilers. However, it is clear that additional research needs to be done in order to develop economical and effective mercury control strategies. To accomplish this objective, it is necessary to understand mercury behavior in coal-fired power plants. The markedly different chemical and physical properties of the different mercury forms generated during coal combustion appear to impact the effectiveness of various mercury control strategies. The original Characterization and Modeling of the Forms of Mercury from Coal-Fired Power Plants project had two tasks. The first was to collect enough data such that mercury speciation could be predicted based on relatively simple inputs such as coal analyses and plant configuration. The second was to field-validate the Ontario Hydro mercury speciation method (at the time, it had only been validated at the pilot-scale level). However, after sampling at two power plants (the Ontario Hydro method was validated at one of them), the EPA issued
Advances on Bioactive Polysaccharides from Medicinal Plants.
Xie, Jian-Hua; Jin, Ming-Liang; Morris, Gordon A; Zha, Xue-Qiang; Chen, Han-Qing; Yi, Yang; Li, Jing-En; Wang, Zhi-Jun; Gao, Jie; Nie, Shao-Ping; Shang, Peng; Xie, Ming-Yong
2016-07-29
In recent decades, the polysaccharides from the medicinal plants have attracted a lot of attention due to their significant bioactivities, such as anti-tumor activity, antioxidant activity, anticoagulant activity, antidiabetic activity, radioprotection effect, anti-viral activity, hypolipidemic and immunomodulatory activities, which make them suitable for medicinal applications. Previous studies have also shown that medicinal plant polysaccharides are non-toxic and show no side effects. Based on these encouraging observations, most researches have been focusing on the isolation and identification of polysaccharides, as well as their bioactivities. A large number of bioactive polysaccharides with different structural features and biological effects from medicinal plants have been purified and characterized. This review provides a comprehensive summary of the most recent developments in physiochemical, structural features and biological activities of bioactive polysaccharides from a number of important medicinal plants, such as polysaccharides from Astragalus membranaceus, Dendrobium plants, Bupleurum, Cactus fruits, Acanthopanax senticosus, Angelica sinensis (Oliv.) Diels, Aloe barbadensis Miller, and Dimocarpus longan Lour. Moreover, the paper has also been focused on the applications of bioactive polysaccharides for medicinal applications. Recent studies have provided evidence that polysaccharides from medicinal plants can play a vital role in bioactivities. The contents and data will serve as a useful reference material for further investigation, production, and application of these polysaccharides in functional foods and therapeutic agents.
International Nuclear Information System (INIS)
Hatheway, A.W.; Anderson, D.R.
1993-01-01
Missouri's first gas works began operation in 1845 (St. Louis). By 1900, gas works operated in many northern-Missouri coal belt towns, major cities, and Hannibal and Cape Girardeau (Mississippi River supply). Today's 40-odd former manufactured gas plant (FMPGs) sites are fiscal nightmares for parent utility companies; all hazardous waste groups are prevalent to the plants. Tar residuals may migrate along/through geologic anomalies. Tar-water emulsions typically were disposed in tar wells or nearby drainages or many times plumbed directly into sewers, which typically leaked into the environment at unpredictable down gradient locations. Just as well site geologic characteristics and current groundwater usage may render FMPGs relatively harmless from the human exposure standpoint. Geologic deduction, photo interpretation, careful subsurface exploration and engineering geophysics can locate hot spots and delimit contaminant migration. Many types of historic documents chronicle changes in plant character and equipment, as well as mode of operation. Without such details, mistakes in characterization are likely and errors in risk assessment and selection of remedial technologies are possible
Stripping Away the Soil: Plant Growth Promoting Microbiology Opportunities in Aquaponics
Directory of Open Access Journals (Sweden)
Ryan P. Bartelme
2018-01-01
Full Text Available As the processes facilitated by plant growth promoting microorganisms (PGPMs become better characterized, it is evident that PGPMs may be critical for successful sustainable agricultural practices. Microbes enrich plant growth through various mechanisms, such as enhancing resistance to disease and drought, producing beneficial molecules, and supplying nutrients and trace metals to the plant rhizosphere. Previous studies of PGPMs have focused primarily on soil-based crops. In contrast, aquaponics is a water-based agricultural system, in which production relies upon internal nutrient recycling to co-cultivate plants with fish. This arrangement has management benefits compared to soil-based agriculture, as system components may be designed to directly harness microbial processes that make nutrients bioavailable to plants in downstream components. However, aquaponic systems also present unique management challenges. Microbes may compete with plants for certain micronutrients, such as iron, which makes exogenous supplementation necessary, adding production cost and process complexity, and limiting profitability and system sustainability. Research on PGPMs in aquaponic systems currently lags behind traditional agricultural systems, however, it is clear that certain parallels in nutrient use and plant-microbe interactions are retained from soil-based agricultural systems.
Stripping Away the Soil: Plant Growth Promoting Microbiology Opportunities in Aquaponics.
Bartelme, Ryan P; Oyserman, Ben O; Blom, Jesse E; Sepulveda-Villet, Osvaldo J; Newton, Ryan J
2018-01-01
As the processes facilitated by plant growth promoting microorganisms (PGPMs) become better characterized, it is evident that PGPMs may be critical for successful sustainable agricultural practices. Microbes enrich plant growth through various mechanisms, such as enhancing resistance to disease and drought, producing beneficial molecules, and supplying nutrients and trace metals to the plant rhizosphere. Previous studies of PGPMs have focused primarily on soil-based crops. In contrast, aquaponics is a water-based agricultural system, in which production relies upon internal nutrient recycling to co-cultivate plants with fish. This arrangement has management benefits compared to soil-based agriculture, as system components may be designed to directly harness microbial processes that make nutrients bioavailable to plants in downstream components. However, aquaponic systems also present unique management challenges. Microbes may compete with plants for certain micronutrients, such as iron, which makes exogenous supplementation necessary, adding production cost and process complexity, and limiting profitability and system sustainability. Research on PGPMs in aquaponic systems currently lags behind traditional agricultural systems, however, it is clear that certain parallels in nutrient use and plant-microbe interactions are retained from soil-based agricultural systems.
Plant stress signalling: understanding and exploiting plant-plant interactions.
Pickett, J A; Rasmussen, H B; Woodcock, C M; Matthes, M; Napier, J A
2003-02-01
When plants are attacked by insects, volatile chemical signals can be released, not only from the damaged parts, but also systemically from other parts of the plant and this continues after cessation of feeding by the insect. These signals are perceived by olfactory sensory mechanisms in both the herbivorous insects and their parasites. Molecular structures involved can be characterized by means of electrophysiological assays, using the insect sensory system linked to chemical analysis. Evidence is mounting that such signals can also affect neighbouring intact plants, which initiate defence by the induction of further signalling systems, such as those that increase parasitoid foraging. Furthermore, insect electrophysiology can be used in the identification of plant compounds having effects on the plants themselves. It has been found recently that certain plants can release stress signals even when undamaged, and that these can cause defence responses in intact plants. These discoveries provide the basis for new crop protection strategies, that are either delivered by genetic modification of plants or by conventionally produced plants to which the signal is externally applied. Delivery can also be made by means of mixed seed strategies in which the provoking and recipient plants are grown together. Related signalling discoveries within the rhizosphere seem set to extend these approaches into new ways of controlling weeds, by exploiting the elusive potential of allelopathy, but through signalling rather than by direct physiological effects.
Toussaint, Frédéric; Pierman, Baptiste; Bertin, Aurélie; Lévy, Daniel; Boutry, Marc
2017-05-04
Pleiotropic drug resistance (PDR) transporters belong to the ABCG subfamily of ATP-binding cassette (ABC) transporters and are involved in the transport of various molecules across plasma membranes. During evolution, PDR genes appeared independently in fungi and in plants from a duplication of a half-size ABC gene. The enzymatic properties of purified PDR transporters from yeast have been characterized. This is not the case for any plant PDR transporter, or, incidentally, for any purified plant ABC transporter. Yet, plant PDR transporters play important roles in plant physiology such as hormone signaling or resistance to pathogens or herbivores. Here, we describe the expression, purification, enzymatic characterization and 2D analysis by electron microscopy of NpABCG5/NpPDR5 from Nicotiana plumbaginifolia , which has been shown to be involved in the plant defense against herbivores. We constitutively expressed NpABCG5/NpPDR5, provided with a His-tag in a homologous system: suspension cells from Nicotiana tabacum (Bright Yellow 2 line). NpABCG5/NpPDR5 was targeted to the plasma membrane and was solubilized by dodecyl maltoside and purified by Ni-affinity chromatography. The ATP-hydrolyzing specific activity (27 nmol min -1 mg -1 ) was stimulated seven-fold in the presence of 0.1% asolectin. Electron microscopy analysis indicated that NpABCG5/NpPDR5 is monomeric and with dimensions shorter than those of known ABC transporters. Enzymatic data (optimal pH and sensitivity to inhibitors) confirmed that plant and fungal PDR transporters have different properties. These data also show that N. tabacum suspension cells are a convenient host for the purification and biochemical characterization of ABC transporters. © 2017 The Author(s); published by Portland Press Limited on behalf of the Biochemical Society.
Characterization and mass balance of trace elements in an iron ore sinter plant
Directory of Open Access Journals (Sweden)
Lucas Ladeira Lau
2016-04-01
Full Text Available Environmental legislation is becoming more restrictive in several industrial sectors, especially in the steel industry, which is well known for its large pollution potential. With the recent growth of interest in effects of trace elements on the environment and health, the inclusion of emission limits on these elements in this legislation has become increasingly popular. This article aims to describe the partitioning of trace elements between the products (sinter and plant emissions in an iron ore sinter plant, aiming to better understand the behavior of these elements in the sintering process to eventually support interventions to modify these partitions. Chemical characterization of several sintering inputs was initially performed, revealing that the steel-making residues contained large concentrations of trace elements, whereas low concentrations were observed in the flux. Based on the trace element concentrations, we analyzed the injection of trace elements in a sintering pilot using a sintering mixture. Mass balance was then used to determine the theoretical partitioning of trace elements in the sinter and emissions; cadmium, nickel, lead, mercury, and copper exhibited greater tendencies to concentrate in atmospheric emissions.
Characterization of NORM material produced in a water treatment plant
Energy Technology Data Exchange (ETDEWEB)
Suursoo, S.; Kiisk, M.; Jantsikene, A.; Koch, R.; Isakar, K.; Realo, E. [University of Tartu, Institute of Physics (Estonia); Lumiste, L. [Tallinn University of Technology (Estonia)
2014-07-01
In February 2012 a water treatment plant was opened in Viimsi, Estonia. The plant is designed for removal of iron, manganese, and radium from groundwater. The first 2 years of operation have shown that the purification process generates significant amounts of materials with elevated radium levels. The treatment plant is fed by nine wells, which open to radium-rich aquifers. Purification is achieved by aeration and filtration processes. Aerated water is led through two successive filter columns, first of them is filled with MnO{sub 2} coated material FMH and filtration sand, the second one with zeolite. The plant has five parallel treatment lines with a total of 95 tons of FMH + filtration sand, and 45 tons of zeolite. The average capacity of the facility has been 2400 m{sup 3}/day. Yearly input of radium to the plant is estimated to be 325 MBq for Ra-226, and 420 MBq for Ra-228. Most of the radium (about 90%) accumulates in the filter columns. Some 8-9% of it is removed by backwash water during regular filter backwash cycles. To characterize radium accumulation and its removal by backwash in detail, treatment line no. 5 is sampled monthly for filter materials and backwash water. A steady growth of radium activity concentrations is apparent in both filter materials. In the top layer of the first stage filter (FMH+sand), Ra-226 and Ra-228 activity concentrations (per unit dry weight) reached (1540 ± 60) Bq/kg and (2510 ± 50) Bq/kg (k=2), respectively, by April 2013. At the same time, radium content in the top layer of the second stage filter (zeolite) was an order of magnitude higher: (19 600 ± 130) Bq/kg for Ra-226, and (22 260 ± 170) Bq/kg for Ra-228 (k=2). Radium is not evenly distributed throughout the filter columns. A rough estimate can be given that after 1.25 years of operation (by April 2013) the accumulated activities in treatment line no. 5 reached 1000 MBq for Ra-226 and 1200 MBq for Ra-228. Although filters are the most important type of NORM
Improved method for HPLC analysis of polyamines, agmatine and aromatic monoamines in plant tissue
Slocum, R. D.; Flores, H. E.; Galston, A. W.; Weinstein, L. H.
1989-01-01
The high performance liquid chromatographic (HPLC) method of Flores and Galston (1982 Plant Physiol 69: 701) for the separation and quantitation of benzoylated polyamines in plant tissues has been widely adopted by other workers. However, due to previously unrecognized problems associated with the derivatization of agmatine, this important intermediate in plant polyamine metabolism cannot be quantitated using this method. Also, two polyamines, putrescine and diaminopropane, also are not well resolved using this method. A simple modification of the original HPLC procedure greatly improves the separation and quantitation of these amines, and further allows the simulation analysis of phenethylamine and tyramine, which are major monoamine constituents of tobacco and other plant tissues. We have used this modified HPLC method to characterize amine titers in suspension cultured carrot (Daucas carota L.) cells and tobacco (Nicotiana tabacum L.) leaf tissues.
Overholt, Will A; Diaz, Rodrigo; Rosskopf, Erin; Green, Stefan J; Overholt, William A
2015-01-01
Bacteria associated with sap-feeding insect herbivores include not only symbionts that may increase their hosts' fitness but also harmful plant pathogens. Calophya spp. gall-inducing psyllids (Hemiptera: Calophyidae) are being investigated for their potential as biological control agents of the noxious weed, Brazilian peppertree (Schinus terebinthifolia), in Florida. Although there are no examples of plant pathogen transmission by members of the family Calophyidae, several insects in the superfamily Psylloidea are known to transmit pathogenic bacteria in the genera Candidatus Liberibacter and Candidatus Phytoplasma. To determine whether Calophya spp. harbor potentially harmful plant pathogenic bacteria, we sequenced small subunit (SSU) ribosomal RNA (rRNA) gene amplicons generated from individuals from four Calophya spp. populations: All microbial SSU gene sequences fell into the bacterial domain, with 98-99% belonging to the Proteobacteria. The Calophya microbiomes contained a relatively simple community, with 49-79 operational taxonomic units (OTUs; 97%) detected, and only 5-8 OTUs with greater than 1% abundance. Candidatus Carsonella showed the highest relative abundance, with OTUs from this candidate genus representing between 51-65% of all recovered sequences. The next most abundant clade observed was an unclassified Enterobacteriacae group closely related to bacteria from the genera Buchnera and Blochmannia that ranged from 20-31% in relative abundance. Wolbachia populations were the third most abundant group and represented 7-27% of the diversity in microbial OTUs. No SSU rRNA gene sequences from putative pathogenic bacteria from the genera Ca. Liberibacter or Ca. Phytoplasma were detected in the microbiomes of the four Calophya populations. The probability that infected psyllids were present in our colonies, but were not sampled, was extremley low (1.39 x 10(-10)). As far as we are aware, our study is the first to characterize the microbiome of a candidate
Directory of Open Access Journals (Sweden)
Will A Overholt
Full Text Available Bacteria associated with sap-feeding insect herbivores include not only symbionts that may increase their hosts' fitness but also harmful plant pathogens. Calophya spp. gall-inducing psyllids (Hemiptera: Calophyidae are being investigated for their potential as biological control agents of the noxious weed, Brazilian peppertree (Schinus terebinthifolia, in Florida. Although there are no examples of plant pathogen transmission by members of the family Calophyidae, several insects in the superfamily Psylloidea are known to transmit pathogenic bacteria in the genera Candidatus Liberibacter and Candidatus Phytoplasma. To determine whether Calophya spp. harbor potentially harmful plant pathogenic bacteria, we sequenced small subunit (SSU ribosomal RNA (rRNA gene amplicons generated from individuals from four Calophya spp. populations: All microbial SSU gene sequences fell into the bacterial domain, with 98-99% belonging to the Proteobacteria. The Calophya microbiomes contained a relatively simple community, with 49-79 operational taxonomic units (OTUs; 97% detected, and only 5-8 OTUs with greater than 1% abundance. Candidatus Carsonella showed the highest relative abundance, with OTUs from this candidate genus representing between 51-65% of all recovered sequences. The next most abundant clade observed was an unclassified Enterobacteriacae group closely related to bacteria from the genera Buchnera and Blochmannia that ranged from 20-31% in relative abundance. Wolbachia populations were the third most abundant group and represented 7-27% of the diversity in microbial OTUs. No SSU rRNA gene sequences from putative pathogenic bacteria from the genera Ca. Liberibacter or Ca. Phytoplasma were detected in the microbiomes of the four Calophya populations. The probability that infected psyllids were present in our colonies, but were not sampled, was extremley low (1.39 x 10(-10. As far as we are aware, our study is the first to characterize the microbiome of
García-Fernández, Alfredo; Lázaro-Nogal, Ana; Traveset, Anna; Valladares, Fernando
2012-08-01
The main aim of this study was to isolate and characterize microsatellite loci in Cneorum tricoccon (Cneoraceae), a Mediterranean shrub relict of the early Tertiary, which inhabits western Mediterranean islands and coasts. Microsatellites will be useful for investigating biogeography and landscape genetics across the species distribution range, including current or past gene flow. Seventeen microsatellite loci were characterized, of which 10 were polymorphic and amplified for a total of 56 alleles in three populations of C. tricoccon. The markers revealed average coefficients of expected heterozygosity (H(e) = 0.425), observed heterozygosity (H(o) = 0.282), and inbreeding coefficient value per population (F(IS) = 0.408). These microsatellite primers will potentially be useful in the study of population and landscape genetics, conservation status of isolated populations, island-continental distribution, current or historical movements between populations, and in the investigation of the consequences of dispersal mechanisms of these plants.
International Nuclear Information System (INIS)
Cline, J.F.; Uresk, D.W.; Rickard, W.H.
1975-01-01
The plant communities at the Hanford B-C Cribs controlled area and REDOX study areas are characterized. It is concluded that they are probably very much like the communities that existed prior to 1943 when the Hanford Reservation was established. (CH)
Characterization of Minnesota lunar simulant for plant growth
Oglesby, James P.; Lindsay, Willard L.; Sadeh, Willy Z.
1993-01-01
Processing of lunar regolith into a plant growth medium is crucial in the development of a regenerative life support system for a lunar base. Plants, which are the core of such a system, produce food and oxygen for humans and, at the same time, consume carbon dioxide. Because of the scarcity of lunar regolith, simulants must be used to infer its properties and to develop procedures for weathering and chemical analyses. The Minnesota Lunar Simulant (MLS) has been identified to date as the best available simulant for lunar regolith. Results of the dissolution studies reveal that appropriately fertilized MLS can be a suitable medium for plant growth. The techniques used in conducting these studies can be extended to investigate the suitability of actual lunar regolith as a plant growth medium. Dissolution experiments were conducted using the MLS to determine its nutritional and toxicity characteristics for plant growth and to develop weathering and chemical analysis techniques. Two weathering regimes, one with water and one with dilute organic acids simulating the root rhizosphere microenvironment, were investigated. Elemental concentrations were measured using inductively-coupled-plasma (ICP) emission spectrometry and ion chromatography (IC). The geochemical speciation model, MINTEQA2, was used to determine the major solution species and the minerals controlling them. Acidification was found to be a useful method for increasing cation concentrations to meaningful levels. Initial results indicate that MLS weathers to give neutral to slightly basic solutions which contain acceptable amounts of the essential elements required for plant nutrition (i.e., potassium, calcium, magnesium, sulfur, zinc, sodium, silicon, manganese, copper, chlorine, boron, molybdenum, and cobalt). Elements that need to be supplemented include carbon, nitrogen, and perhaps phosphorus and iron. Trace metals in solution were present at nontoxic levels.
Christensen, Anne Munch; Markussen, Bo; Baun, Anders; Halling-Sørensen, Bent
2009-10-01
The occurrence of pharmaceuticals in different water bodies and the findings of effects on aquatic organisms in ecotoxicity tests have raised concerns about environmental risks of pharmaceuticals in receiving waters. Due to the fact that the amount of ecotoxicological studies has increased significantly during the last decade, probabilistic approaches for risk characterization of these compounds may be feasible. This approach was evaluated by applying it to 22 human-used pharmaceuticals covering both pharmaceuticals with a high volume and high ecotoxicity, using ecotoxicological effect data from laboratory studies and comparing these to monitoring data on the effluents from sewage treatment plants in Europe and pharmaceutical sales quantities. We found that for 19 of the 22 selected pharmaceuticals the existing data were sufficient for probabilistic risk characterizations. The subsequently modeled ratios between monitored concentrations and low-effect concentrations were mostly above a factor of 100. Compared to the current paradigm for EU environmental risk assessment where a safety factor of 10 or 100 might have been used it seems that for the modeled compounds there's a low environmental risk. However, similarly calculated ratios for five pharmaceuticals (propranolol, ibuprofen, furosemide, ofloxacin, and ciprofloxacin) were below 100, while ibuprofen and ciprofloxacin are considered to be of high concern due to lack of ecotoxicity studies. This paper shows that by applying probabilistic approaches, existing data can be used to execute a comprehensive study on probability of impacts, thereby contributing to a more comprehensive environmental risk assessment of pharmaceuticals.
Radiation-related impacts for nuclear plant physical modifications
International Nuclear Information System (INIS)
Sciacca, F.; Knudson, R.; Simion, G.; Baca, G.; Behling, H.; Behling, K.; Britz, W.; Cohen, S.
1989-10-01
The radiation fields in nuclear power plants present significant obstacles to accomplishing repairs and modifications to many systems and components in these plants. The NRC's generic cost estimating methodology attempts to account for radiation-related impacts by assigning values to the radiation labor productivity factor. This radiation labor productivity factor is then used as a multiplier on the greenfield or new nuclear plant construction labor to adjust for the actual operating plant conditions. The value assigned to the productivity factor is based on the work-site radiation levels. The relationship among ALARA practices, work-place radiation levels, and radiation-related cost impacts previously had not been adequately characterized or verified. The assumptions made concerning the use and application of radiation-reduction measures such as system decontamination and/or the use of temporary shielding can significantly impact estimates of both labor requirements and radiation exposure associated with a particular activity. Overall guidance was needed for analysts as to typical ALARA practices at nuclear power plants and the effects of these practices in reducing work-site dose rates and overall labor requirements. This effort was undertaken to better characterize the physical modification cost and radiological exposure impacts related to the radiation environment of the work place. More specifically, this work sought to define and clarify the quantitative relationships between or among: radiation levels and ALARA practices, such as the use of temporary shielding, decontamination efforts, or the use of robots and remote tools; radiation levels and labor productivity factors; radiation levels, in-field labor hours, and worker radiation exposure; radiation levels and health physics services costs; and radiation levels, labor hours, and anti-contamination clothing and equipment. 48 refs., 4 figs., 4 tabs
Directory of Open Access Journals (Sweden)
Anne M. Charrier
2018-03-01
Full Text Available Ethanol production using extracted cellulose from plant cell walls (PCW is a very promising approach to biofuel production. However, efficient throughput has been hindered by the phenomenon of recalcitrance, leading to high costs for the lignocellulosic conversion. To overcome recalcitrance, it is necessary to understand the chemical and structural properties of the plant biological materials, which have evolved to generate the strong and cohesive features observed in plants. Therefore, tools and methods that allow the investigation of how the different molecular components of PCW are organized and distributed and how this impacts the mechanical properties of the plants are needed but challenging due to the molecular and morphological complexity of PCW. Atomic force microscopy (AFM, capitalizing on the interfacial nanomechanical forces, encompasses a suite of measurement modalities for nondestructive material characterization. Here, we present a review focused on the utilization of AFM for imaging and determination of physical properties of plant-based specimens. The presented review encompasses the AFM derived techniques for topography imaging (AM-AFM, mechanical properties (QFM, and surface/subsurface (MSAFM, HPFM chemical composition imaging. In particular, the motivation and utility of force microscopy of plant cell walls from the early fundamental investigations to achieve a better understanding of the cell wall architecture, to the recent studies for the sake of advancing the biofuel research are discussed. An example of delignification protocol is described and the changes in morphology, chemical composition and mechanical properties and their correlation at the nanometer scale along the process are illustrated.
Santos, Karen B Dos; Meneguim, Ana M; Santos, Walter J Dos; Neves, Pedro M O J; Santos, Rachel B Dos
2010-01-01
The cotton plant, Gossypium hirsutum, hosts various pests that damage different structures. Among these pests, Spodoptera cosmioides (Walker) and Spodoptera eridania (Cramer) (Lepidoptera: Noctuidae) are considered important. The objectives of this study were to characterize and to quantify the potential damage of S. eridania and S. cosmioides feeding on different structures of cotton plants. For this purpose, newly-hatched larvae were reared on the following plant parts: leaf and flower bud; leaf and boll; flower bud or boll; and leaf, flower bud and boll. The survival of S. cosmioides and S. eridania was greater than 80% and 70% for larvae fed on cotton plant parts offered separately or together, respectively. One larva of S. eridania damaged 1.7 flower buds, but did not damage bolls, while one larva of S. cosmioides damaged 5.2 flower buds and 3.0 cotton bolls. Spodoptera eridania and S. cosmioides can be considered species with potential to cause economic damage to cotton plants because they can occur throughout cotton developmental stages causing defoliation and losses of reproductive structures. Therefore, the results validate field observations that these two species of Spodoptera are potential pests for cotton.
International Nuclear Information System (INIS)
Helton, Jon Craig; Davis, Freddie J.; Johnson, J.D.
2000-01-01
The 1996 performance assessment (PA) for the Waste Isolation Pilot Plant (WIPP) maintains a separation between stochastic (i.e., aleatory) and subjective (i.e., epistemic) uncertainty, with stochastic uncertainty arising from the possible disruptions that could occur at the WIPP over the 10,000 yr regulatory period specified by the US Environmental Protection Agency (40 CFR 191, 40 CFR 194) and subjective uncertainty arising from an inability to uniquely characterize many of the inputs required in the 1996 WIPP PA. The characterization of stochastic uncertainty is discussed including drilling intrusion time, drilling location penetration of excavated/nonexcavated areas of the repository, penetration of pressurized brine beneath the repository, borehole plugging patterns, activity level of waste, and occurrence of potash mining. Additional topics discussed include sampling procedures, generation of individual 10,000 yr futures for the WIPP, construction of complementary cumulative distribution functions (CCDFs), mechanistic calculations carried out to support CCDF construction the Kaplan/Garrick ordered triple representation for risk and determination of scenarios and scenario probabilities
Hoyerová, Klára; Perry, Lucie; Hand, Paul; Laňková, Martina; Kocábek, Tomáš; May, Sean; Kottová, Jana; Pačes, Jan; Napier, Richard; Zažímalová, Eva
2008-01-01
We have isolated the cDNA of the gene PaLAX1 from a wild cherry tree (Prunus avium). The gene and its product are highly similar in sequences to both the cDNAs and the corresponding protein products of AUX/LAX-type genes, coding for putative auxin influx carriers. We have prepared and characterized transformed Nicotiana tabacum and Arabidopsis thaliana plants carrying the gene PaLAX1. We have proved that constitutive overexpression of PaLAX1 is accompanied by changes in the content and distribution of free indole-3-acetic acid, the major endogenous auxin. The increase in free indole-3-acetic acid content in transgenic plants resulted in various phenotype changes, typical for the auxin-overproducing plants. The uptake of synthetic auxin, 2,4-dichlorophenoxyacetic acid, was 3 times higher in transgenic lines compared to the wild-type lines and the treatment with the auxin uptake inhibitor 1-naphthoxyacetic acid reverted the changes caused by the expression of PaLAX1. Moreover, the agravitropic response could be restored by expression of PaLAX1 in the mutant aux1 plants, which are deficient in auxin influx carrier activity. Based on our data, we have concluded that the product of the gene PaLAX1 promotes the uptake of auxin into cells, and, as a putative auxin influx carrier, it affects the content and distribution of free endogenous auxin in transgenic plants. PMID:18184737
Visual Characterization of VX Droplets on Plant Foliage
2016-07-01
droplets were dispensed onto plant leaves using a high-precision syringe. Digital photographs of the droplets were taken at intervals, saved, and...purposes of advertisement . Approved for public release; distribution is unlimited Acknowledgments The authors would like to thank Dr...alcohol (CAS no. 67-63-0) was used as an extractant. Miracle-Gro Water Soluble All Purpose Plant Food (Scotts Company; Marysville, OH) fertilizer
Role and structural characterization of plant aldehyde dehydrogenases from family 2 and family 7.
Končitíková, Radka; Vigouroux, Armelle; Kopečná, Martina; Andree, Tomáš; Bartoš, Jan; Šebela, Marek; Moréra, Solange; Kopečný, David
2015-05-15
Aldehyde dehydrogenases (ALDHs) are responsible for oxidation of biogenic aldehyde intermediates as well as for cell detoxification of aldehydes generated during lipid peroxidation. So far, 13 ALDH families have been described in plants. In the present study, we provide a detailed biochemical characterization of plant ALDH2 and ALDH7 families by analysing maize and pea ALDH7 (ZmALDH7 and PsALDH7) and four maize cytosolic ALDH(cALDH)2 isoforms RF2C, RF2D, RF2E and RF2F [the first maize ALDH2 was discovered as a fertility restorer (RF2A)]. We report the crystal structures of ZmALDH7, RF2C and RF2F at high resolution. The ZmALDH7 structure shows that the three conserved residues Glu(120), Arg(300) and Thr(302) in the ALDH7 family are located in the substrate-binding site and are specific to this family. Our kinetic analysis demonstrates that α-aminoadipic semialdehyde, a lysine catabolism intermediate, is the preferred substrate for plant ALDH7. In contrast, aromatic aldehydes including benzaldehyde, anisaldehyde, cinnamaldehyde, coniferaldehyde and sinapaldehyde are the best substrates for cALDH2. In line with these results, the crystal structures of RF2C and RF2F reveal that their substrate-binding sites are similar and are formed by an aromatic cluster mainly composed of phenylalanine residues and several nonpolar residues. Gene expression studies indicate that the RF2C gene, which is strongly expressed in all organs, appears essential, suggesting that the crucial role of the enzyme would certainly be linked to the cell wall formation using aldehydes from phenylpropanoid pathway as substrates. Finally, plant ALDH7 may significantly contribute to osmoprotection because it oxidizes several aminoaldehydes leading to products known as osmolytes.
Persky, Victoria; Piorkowski, Julie; Turyk, Mary; Freels, Sally; Chatterton, Robert; Dimos, John; Bradlow, H Leon; Chary, Lin Kaatz; Burse, Virlyn; Unterman, Terry; Sepkovic, Daniel; McCann, Kenneth
2011-08-01
There is an increasing body of literature showing associations of organochlorine exposure with risk of diabetes and insulin resistance. Some studies suggest that associations differ by gender and that diabetes risk, in turn, may be affected by endogenous steroid hormones. This report examines the relationships of serum PCBs and endogenous hormones with history of diabetes in a cohort of persons previously employed at a capacitor manufacturing plant. A total of 118 women were post-menopausal with complete data, of whom 93 were not using steroid hormones in 1996, at the time of examination, which included a survey of exposure and medical history, height, weight and collection of blood and urine for measurements of lipids, liver function, hematologic markers and endogenous hormones. This analysis examines relationships of serum polychlorinated biphenyls (PCBs), work exposure and endogenous hormones with self-reported history of diabetes after control for potential confounders. All PCB exposure groups were significantly related to history of diabetes, but not to insulin resistance as measured by the homeostatic model assessment of insulin resistance (HOMA-IR) in non-diabetics. Diabetes was also independently and inversely associated with follicle stimulating hormone (FSH), dehydroepiandrosterone sulfate (DHEAS) and triiodothyronine (T3) uptake. HOMA-IR was positively associated with body mass index (BMI) and C-reactive protein (CRP) and inversely associated with sex hormone binding globulin (SHBG) and T3 uptake after control for PCB exposure. Possible biologic mechanisms are discussed. This study confirms previous reports relating PCB exposure to diabetes and suggests possible hormonal pathways deserving further exploration. Copyright © 2011 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Tri Joko Raharjo
2011-12-01
Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene
Mitochondria as a Possible Place for Initial Stages of Steroid Biosynthesis in Plants
Directory of Open Access Journals (Sweden)
Elena K. Shematorova
2014-12-01
Full Text Available With the aim of thorough comparison of steroidogenic systems of plants and animals, transgenic plants of Solanaceae family expressing CYP11A1 cDNA encoding cytochrome P450SCC of mammalian mitochondria were further analysed. Positive effect of CYP11A1 on resistance of the transgenic tobacco plants to the infection by fungal phytopathogene Botrytis cinerea was for the first time detected. Subtle changes in mitochondria of the transgenic Nicotiana tabacum plants expressing mammalian CYP11A1 cDNA were demonstrated by transmissive electron microscopy. The main components of the electron transfer chain of plant mitochondria were for the first time cloned and characterized. It was established that plants from the Solanacea family (tomato, tobacco and potato contain two different genes with similar exon-intron structures (all contain 8 exons encoding mitochondrial type ferredoxins (MFDX, and one gene for mitochondrial ferredoxin reductase (MFDXR. The results obtained point out on profound relatedness of electron transfer chains of P450-dependent monooxygenases in mammalian and plant mitochondria and support our previous findings about functional compatability of steroidogenic systems of Plantae and Animalia.
PHYTOREMEDIATION OF PERCHLORATE BY TOBACCO PLANTS
Previous studies have shown that tobacco plants are tolerant of perchlorate and will accumulate perchlorate in the plant tissues. The objective of this research was to determine the effectiveness of tobacco plants in phytoremediation, a technology that employs plants to degrade,...
Energy Technology Data Exchange (ETDEWEB)
NONE
1994-09-01
The Y-12 Plant Decontamination and Decommissioning Technology Logic Diagram for Building 9201-4 (TLD) was developed to provide a decision-support tool that relates decontamination and decommissioning (D and D) problems at Bldg. 9201-4 to potential technologies that can remediate these problems. The TLD uses information from the Strategic Roadmap for the Oak Ridge Reservation, the Oak Ridge K-25 Site Technology Logic Diagram, the Oak Ridge National Laboratory Technology Logic Diagram, and a previous Hanford logic diagram. This TLD identifies the research, development, demonstration, testing, and evaluation needed for sufficient development of these technologies to allow for technology transfer and application to D and D and waste management (WM) activities. It is essential that follow-on engineering studies be conducted to build on the output of this project. These studies will begin by selecting the most promising technologies identified in the TLD and by finding an optimum mix of technologies that will provide a socially acceptable balance between cost and risk. This report consists of the characterization and dismantlement data sheets.
International Nuclear Information System (INIS)
1994-09-01
The Y-12 Plant Decontamination and Decommissioning Technology Logic Diagram for Building 9201-4 (TLD) was developed to provide a decision-support tool that relates decontamination and decommissioning (D and D) problems at Bldg. 9201-4 to potential technologies that can remediate these problems. The TLD uses information from the Strategic Roadmap for the Oak Ridge Reservation, the Oak Ridge K-25 Site Technology Logic Diagram, the Oak Ridge National Laboratory Technology Logic Diagram, and a previous Hanford logic diagram. This TLD identifies the research, development, demonstration, testing, and evaluation needed for sufficient development of these technologies to allow for technology transfer and application to D and D and waste management (WM) activities. It is essential that follow-on engineering studies be conducted to build on the output of this project. These studies will begin by selecting the most promising technologies identified in the TLD and by finding an optimum mix of technologies that will provide a socially acceptable balance between cost and risk. This report consists of the characterization and dismantlement data sheets
International Nuclear Information System (INIS)
1991-01-01
This Quality Assurance Program Plan (QAPP) identifies the quality of data necessary to meet the specific objectives associated with the Department of Energy (DOE) Waste Isolation Pilot Plant (WIPP) Experimental-Waste Characterization Program (the Program). DOE plans to conduct experiments in the WIPP during a Test Phase of approximately 5 years. These experiments will be conducted to reduce the uncertainties associated with the prediction of several processes (e.g., gas generation) that may influence repository performance. The results of the experiments will be used to assess the ability of the WIPP to meet regulatory requirements for the long-term protection of human health and the environment from the disposal of TRU wastes. 37 refs., 25 figs., 18 tabs
Tauanov, Z.; Abylgazina, L.; Spitas, C.; Itskos, G.; Inglezakis, V.
2017-09-01
Coal fly ash (CFA) is a waste by-product of coal combustion. Kazakhstan has vast coal deposits and is major consumer of coal and hence produces huge amounts of CFA annually. The government aims to recycle and effectively utilize this waste by-product. Thus, a detailed study of the physical and chemical properties of material is required as the data available in literature is either outdated or not applicable for recently produced CFA samples. The full mineralogical, microstructural and thermal characterization of three types of coal fly ash (CFA) produced in two large Kazakhstani power plants is reported in this work. The properties of CFAs were compared between samples as well as with published values.
International Nuclear Information System (INIS)
Briese, Dirk; Hoemske, Tom
2010-01-01
The power plant scene in Europe is characterized by new power plant projects and retrofitting projects everywhere. This is due to the ageing of existing power plants and to increasing energy demand. Currently, there are projects for 48 power plant units with an installed capacity of 70 GW. According to a study of the nuclear power plant sector, about 16 GW will probably be constructed prior to 2030. The reference scenario presented in this article assumes a dynamic increase of 15 thousand million Euros per annum through 2016/2018. (orig.)
Characterization of the recombinant copper chaperone (CCS) from the plant Glycine (G.) max.
Sagasti, Sara; Yruela, Inmaculada; Bernal, Maria; Lujan, Maria A; Frago, Susana; Medina, Milagros; Picorel, Rafael
2011-02-01
The goal of the present work was to characterize the recombinant copper chaperone (CCS) from soybean. Very little is known about plant copper chaperones, which makes this study of current interest, and allows for a comparison with the better known homologues from yeast and humans. To obtain sizeable amounts of pure protein suitable for spectroscopic characterization, we cloned and overexpressed the G. max CCS chaperone in E. coli in the presence of 0.5 mM CuSO(4) and 0.5 mM ZnSO(4) in the broth. A pure protein preparation was obtained by using two IMAC steps and pH gradient chromatography. Most of the proteins were obtained as apo-form, devoid of copper atoms. The chaperone showed a high content (i.e., over 40%) of loops, turns and random coil as determined both by circular dichroism and homology modelling. The homology 3-D structural model suggests the protein might fold in three structural protein domains. The 3-D model along with the primary structure and spectroscopic data may suggest that copper atoms occupy the two metal binding sites, MKCEGC and CTC, within the N-terminal domain I and C-terminal domain III, respectively. But only one Zn-binding site was obtained spectroscopically.
Characterization of ash pond ashes from 3rd thermal power plant by SEM/EDX and XRD methods
A Minjigmaa; Ts Zolzaya; E Bayanjargal; B Davaabal; J Temuujin
2014-01-01
Coal combustion by products from ash pond of 3rdthermal power plant of Ulaanbaatar city have been collected in 2010 and 2013 years. The ash samples have been characterized by XRD, XRF and SEM-EDX methods in order to evaluate their chemical and mineralogical composition changes with disposed times. The mineralogical composition of ash varies with time though the chemical composition of the ashes were close each other. Possibly, inefficient operating condition of the TPS shows influence on th...
Energy Technology Data Exchange (ETDEWEB)
Chiban, Mohamed; Soudani, Amina; Sinan, Fouad [Department of Chemistry, Faculty of Sciences, Agadir (Morocco); Tahrouch, Saida [Department of Biology, Faculty of Sciences, Agadir (Morocco); Persin, Michel [European Membrane Institute, CRNS, Montpellier (France)
2011-04-15
Low cost adsorbents were prepared from dried plants for the removal of heavy metals, nitrate, and phosphate ions from industrial wastewaters. The efficiency of these adsorbents was investigated using batch adsorption technique at room temperature. The dried plant particles were characterized by N{sub 2} at 77 K adsorption, scanning electron microscopy, energy dispersive X-ray spectroscopy, Fourier transform infrared spectroscopy, and phytochemical screening. The adsorption experiments showed that the microparticles of the dried plants presented a good adsorption of heavy metals, phosphate, and nitrate ions from real wastewaters. This adsorption increased with increasing contact time. The equilibrium time was found to be 30 min for heavy metals and nitrate ions and 240 min for phosphate ions. After the adsorption process, the Pb(II) concentrations, as well as those of Cd(II), Cu(II), and Zn(II) were below the European drinking water norms concentrations. The percentage removal of heavy metals, nitrates, and phosphates from industrial wastewaters by dried plants was {proportional_to}94% for Cd{sup 2+}, {proportional_to}92% for Cu{sup 2+}, {proportional_to}99% for Pb{sup 2+}, {proportional_to}97% for Zn{sup 2+}, {proportional_to}100% for NO{sub 3}{sup -} and {proportional_to}77% for PO{sub 4}{sup 3-} ions. It is proved that dried plants can be one alternative source for low cost absorbents to remove heavy metals, nitrate, and phosphate ions from municipal and industrial wastewaters. (Copyright copyright 2011 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)
International Nuclear Information System (INIS)
Donato, A.; Ricci, G.; Pace, A.
1985-01-01
The cement solidification of the Montalto di Castro BWR plant radwastes has been studied both from the point of view of the mixtures of formulation and of the product characterization. Five radwaste types and mixtures of them have been taken into consideration, determining the best chemical formulations starting from the compressive strenght as leading parameter. The solidified products have been characterized from the point of view of the freeze and thawing resistance, the water immersion resistance, the leachability, the dimensional changes and the free standing water. All the tests have been performed taking into account the real site conditions, so the leaching tests and the water immersion tests have been carried out using sea water and table water as leachant
Trakulnaleamsai, Chitra; Okazawa, Atsushi; An, Chung-Il; Kajiyama, Shin'ichiro; Fukusaki, Ei'ichiro; Yoneyama, Koichi; Takeuchi, Yasutomo; Kobayashi, Akio
2005-01-01
In this study, the isolation and characterization of a phytochrome A (PHYA) homologous cDNA (OmPHYA) in the non-photosynthetic holoparasitic plant Orobanche minor are described. The present findings provide the first report of the presence of a PHYA homolog in the holoparasite. This study found that OmPHYA is of similar size to the other PHYAs of green plants and shows 72, 77, and 77% amino acid sequence identity with PHYA in Arabidopsis, potato, and tobacco respectively. The OmPHYA contains a conserved chromophore attachment cysteine at position 323. Although OmPHYA shows high sequence identity with other PHYAs in green plants, 13 amino acid substitutions located in both the N and C-terminal domains are observed (a total of 26 amino acids). OmPHYA is encoded by a single gene within the O. minor genome. The abundance of the OmPHYA transcript as well as nuclear translocation of OmphyA occurs in a light-dependent manner.
Ooi, Amanda
2016-12-01
Indoor horticulture offers a promising solution for sustainable food production and is becoming increasingly widespread. However, it incurs high energy and cost due to the use of artificial lighting such as high-pressure sodium lamps, fluorescent light or increasingly, the light-emitting diodes (LEDs). The energy efficiency and light quality of currently available lighting is suboptimal, therefore less than ideal for sustainable and cost-effective large-scale plant production. Here, we demonstrate the use of high-powered single-wavelength lasers for indoor horticulture. Lasers are highly energy-efficient and can be remotely guided to the site of plant growth, thus reducing on-site heat accumulation. Besides, laser beams can be tailored to match the absorption profiles of different plants. We have developed a prototype laser growth chamber and demonstrate that laser-grown plants can complete a full growth cycle from seed to seed with phenotypes resembling those of plants grown under LEDs. Importantly, the plants have lower expression of proteins diagnostic for light and radiation stress. The phenotypical, biochemical and proteomic data show that the singlewavelength laser light is suitable for plant growth and therefore, potentially able to unlock the advantages of this next generation lighting technology for highly energy-efficient horticulture. Furthermore, stomatal movement partly determines the plant productivity and stress management. Abscisic acid (ABA) induces stomatal closure by promoting net K+-efflux from guard cells through outwardrectifying K+ (K+ out) channels to regulate plant water homeostasis. Here, we show that the Arabidopsis thaliana guard cell outward-rectifying K+ (ATGORK) channel is a direct target for ABA in the regulation of stomatal aperture and hence gas exchange and transpiration. Addition of (±)-ABA, but not the biologically inactive (−)-isomer, increases K+ out channel activity in Vicia faba guard cell protoplast. A similar ABA
International Nuclear Information System (INIS)
Campos, R.; Barrios, I.; Gonzalez, A. M.; Pelayo, M.; Saldana, R.
2011-01-01
The geological storage program of Energy City Foundation is focusing its research effort in the Technological Development and Research Plant in Hontomin (Burgos) start off. The present report shows the petrophysical characterization of of the Arroyal antiform geological formations since they are representatives, surface like, of the storage and seal formations that will be found in the CO 2 injection plant in Hontomin. In this petrophysics characterization has taken place the study of matrix porosity, specific surface and density of the storage and seal formations. Mercury intrusion porosimetry, N 2 adsorption and He pycnometry techniques have been used for the characterization. Furthermore, it has carried out a mineralogical analysis of the seal materials by RX diffraction. (Author) 26 refs.
International Nuclear Information System (INIS)
Bertram-Howery, S.G.; Hunter, R.L.
1989-04-01
The US Department of Energy is planning to dispose of transuranic wastes at the Waste Isolation Pilot Plant (WIPP) near Carlsbad, New Mexico. Sandia National Laboratories is responsible for evaluating the compliance of the WIPP with the Environmental Protection Agency's Environmental Standards for the Management and Disposal of Spent Nuclear Fuel, High-Level and Transuranic Radioactive Wastes (40 CFR 191, Subpart B). This plan has been developed to present the issues that will be addressed before compliance can be evaluated. These issues examine the procedural nature of the Standard, and the technical requirements for further characterizing the behavior of the disposal system, including uncertainties, to support the compliance assessment. The plan briefly describes the activities that will be conducted prior to 1993 by Sandia to characterize the WIPP disposal system's behavior and predict its performance. 41 refs., 35 figs., 21 tabs
Plant toxicity, adaptive herbivory, and plant community dynamics
Feng, Z.; Liu, R.; DeAngelis, D.L.; Bryant, J.P.; Kielland, K.; Stuart, Chapin F.; Swihart, R.K.
2009-01-01
We model effects of interspecific plant competition, herbivory, and a plant's toxic defenses against herbivores on vegetation dynamics. The model predicts that, when a generalist herbivore feeds in the absence of plant toxins, adaptive foraging generally increases the probability of coexistence of plant species populations, because the herbivore switches more of its effort to whichever plant species is more common and accessible. In contrast, toxin-determined selective herbivory can drive plant succession toward dominance by the more toxic species, as previously documented in boreal forests and prairies. When the toxin concentrations in different plant species are similar, but species have different toxins with nonadditive effects, herbivores tend to diversify foraging efforts to avoid high intakes of any one toxin. This diversification leads the herbivore to focus more feeding on the less common plant species. Thus, uncommon plants may experience depensatory mortality from herbivory, reducing local species diversity. The depensatory effect of herbivory may inhibit the invasion of other plant species that are more palatable or have different toxins. These predictions were tested and confirmed in the Alaskan boreal forest. ?? 2009 Springer Science+Business Media, LLC.
Spent fuel characterization program in Jose Cabrera nuclear power plant
International Nuclear Information System (INIS)
Lloret, M.; Canencia, R.; Blanco, J.; POMAR, C.
2010-01-01
Jose Cabrera Nuclear Power Plant (NPP) is a 14x14 PWR reactor built in 1964 in Spain (160 MWe). The commercial operation started in 1969 and finished in 2006. During year 2009, 377 fuel assemblies from cycles 11 to 29 have been stored in 12 containers HI-STORM 100, and positioned in an Interim Spent Fuel Storage Installation built near the NPP. The spent fuel characterization and classification is a critical and complex activity that could impact all the storage process. As every container has a number of positions for damaged fuel, the loading plans and the quantity of containers depends on the total fuels classified as damaged. The classification of the spent fuel in Jose Cabrera has been performed on the basis of the Interim Staff Guidance ISG-1 from USNRC, 'Damaged Fuel'. As the storage system should assure thermal limitations, criticality control, retrievability, confinement and shielding for radioactive protection, the criteria analyzed for every spent fuel have been the existence/non existence of fuel leaks; damage that could affect the criticality analysis (as missing fuel pins) and any situation that could affect the future retrievability, as defects on the top nozzle. The first classification was performed based upon existing core records. If there were no indication of operating leakers during the concerned cycles and the structural integrity was adequate, the fuel was classified as intact or undamaged. When operating records indicated a fuel leaker, an additional inspection by ultrasonic testing of all the fuel in the concerned cycle was performed to determine the fuel leakers. If the examination results indicated that the fuel has cladding cracks, it was classified as damaged fuel without considering if it was a gross breach or a hairline crack. Additionally, it was confirmed that the water chemistry specifications for spent fuel pool has been fulfilled. Finally, a visual inspection before dry cask storage was performed and foreign particles were
Spent fuel characterization program in Jose Cabrera nuclear power plant
Energy Technology Data Exchange (ETDEWEB)
Lloret, M.; Canencia, R. [Product Engineering, Enusa Industrias Avanzadas S.A., Santiago Rusinol 12, 28040 Madrid (Spain); Blanco, J.; POMAR, C. [Direction of Nuclear Generation, Gas Natural SDG, Avda. San Luis 77, 28033 Madrid (Spain)
2010-07-01
Jose Cabrera Nuclear Power Plant (NPP) is a 14x14 PWR reactor built in 1964 in Spain (160 MWe). The commercial operation started in 1969 and finished in 2006. During year 2009, 377 fuel assemblies from cycles 11 to 29 have been stored in 12 containers HI-STORM 100, and positioned in an Interim Spent Fuel Storage Installation built near the NPP. The spent fuel characterization and classification is a critical and complex activity that could impact all the storage process. As every container has a number of positions for damaged fuel, the loading plans and the quantity of containers depends on the total fuels classified as damaged. The classification of the spent fuel in Jose Cabrera has been performed on the basis of the Interim Staff Guidance ISG-1 from USNRC, 'Damaged Fuel'. As the storage system should assure thermal limitations, criticality control, retrievability, confinement and shielding for radioactive protection, the criteria analyzed for every spent fuel have been the existence/non existence of fuel leaks; damage that could affect the criticality analysis (as missing fuel pins) and any situation that could affect the future retrievability, as defects on the top nozzle. The first classification was performed based upon existing core records. If there were no indication of operating leakers during the concerned cycles and the structural integrity was adequate, the fuel was classified as intact or undamaged. When operating records indicated a fuel leaker, an additional inspection by ultrasonic testing of all the fuel in the concerned cycle was performed to determine the fuel leakers. If the examination results indicated that the fuel has cladding cracks, it was classified as damaged fuel without considering if it was a gross breach or a hairline crack. Additionally, it was confirmed that the water chemistry specifications for spent fuel pool has been fulfilled. Finally, a visual inspection before dry cask storage was performed and foreign particles
Aboveground mechanical stimuli affect belowground plant-plant communication.
Elhakeem, Ali; Markovic, Dimitrije; Broberg, Anders; Anten, Niels P R; Ninkovic, Velemir
2018-01-01
Plants can detect the presence of their neighbours and modify their growth behaviour accordingly. But the extent to which this neighbour detection is mediated by abiotic stressors is not well known. In this study we tested the acclimation response of Zea mays L. seedlings through belowground interactions to the presence of their siblings exposed to brief mechano stimuli. Maize seedling simultaneously shared the growth solution of touched plants or they were transferred to the growth solution of previously touched plants. We tested the growth preferences of newly germinated seedlings toward the growth solution of touched (T_solution) or untouched plants (C_solution). The primary root of the newly germinated seedlings grew significantly less towards T_solution than to C_solution. Plants transferred to T_solution allocated more biomass to shoots and less to roots. While plants that simultaneously shared their growth solution with the touched plants produced more biomass. Results show that plant responses to neighbours can be modified by aboveground abiotic stress to those neighbours and suggest that these modifications are mediated by belowground interactions.
Aboveground mechanical stimuli affect belowground plant-plant communication.
Directory of Open Access Journals (Sweden)
Ali Elhakeem
Full Text Available Plants can detect the presence of their neighbours and modify their growth behaviour accordingly. But the extent to which this neighbour detection is mediated by abiotic stressors is not well known. In this study we tested the acclimation response of Zea mays L. seedlings through belowground interactions to the presence of their siblings exposed to brief mechano stimuli. Maize seedling simultaneously shared the growth solution of touched plants or they were transferred to the growth solution of previously touched plants. We tested the growth preferences of newly germinated seedlings toward the growth solution of touched (T_solution or untouched plants (C_solution. The primary root of the newly germinated seedlings grew significantly less towards T_solution than to C_solution. Plants transferred to T_solution allocated more biomass to shoots and less to roots. While plants that simultaneously shared their growth solution with the touched plants produced more biomass. Results show that plant responses to neighbours can be modified by aboveground abiotic stress to those neighbours and suggest that these modifications are mediated by belowground interactions.
Generation, characterization and reuse of solid wastes from a biodiesel production plant.
Oliveira, Fernando Jorge Santos; Santana, Daniele Dos Santos; Costa, Simone Soraya Brito; Oliveira, Lenise Diniz; Liduino, Vitor Silva; Servulo, Eliana Flávia Camporese
2017-03-01
The aim of this study was to identify and characterize industrial solid wastes generated by a biodiesel production plant in Brazil, as well as to present strategies for the management of these materials. This plant produces every year around 100,000tons of biodiesel from vegetable oils and animal fats. The methodology of the study included technical visits, interviews with the operational and environmental management staff as well as analysis of documents, reports and computerized data systems. An approach to reduce the generation of hazardous waste was investigated. It was take into account the amount of raw material that was processed, reduction of landfill disposal, and the maximization of the their recycling and reuse. The study also identified the sources of waste generation and accordingly prepared an evaluation matrix to determine the types of waste with the higher potential for minimization. The most important residue of the process was the filter material impregnated with oil and biodiesel, requiring, therefore, measures for its minimization. The use of these residues in the production of ceramic artefacts (light bricks) was considered to be very promising, since no significant effect on the physico-chemical and mechanical properties of the artefacts produced was observed. Phytotoxicity test using seeds of Lactuva sativa (lettuce), Brassica juncea (mustard), Abelmoschus esculentus (okra), Chrysanthemum leucanthemum (daisy), Dendranthema grandiflorum (chrysanthemum) and Allium porrum (leek) were carried out. The results clearly show incorporation of the waste material into bricks did not influence relative germination and relative root elongation in comparison to control tests. Copyright © 2016 Elsevier Ltd. All rights reserved.
Li, Mei Jia; Deng, Jian Xin; Paul, Narayan Chandra; Lee, Hyang Burm; Yu, Seung Hun
2014-12-01
Alternaria from different Allium plants was characterized by multilocus sequence analysis. Based on sequences of the β-tubulin (BT2b), the Alternaria allergen a1 (Alt a1), and the RNA polymerase II second largest subunit (RPB2) genes and phylogenetic data analysis, isolates were divided into two groups. The two groups were identical to representative isolates of A. porri (EGS48-147) and A. vanuatuensis (EGS45-018). The conidial characteristics and pathogenicity of A. vanuatuensis also well supported the molecular characteristics. This is the first record of A. vanuatuensis E. G. Simmons & C. F. Hill from Korea and China.
Directory of Open Access Journals (Sweden)
Zainul A Khan
Full Text Available Cotton leaf curl Burewala virus (CLCuBuV, belonging to the genus Begomovirus, possesses single-stranded monopartite DNA genome. The bidirectional promoters representing Rep and coat protein (CP genes of CLCuBuV were characterized and their efficacy was assayed. Rep and CP promoters of CLCuBuV and 35S promoter of Cauliflower mosaic virus (CaMV were fused with β-glucuronidase (GUS and green fluorescent protein (GFP reporter genes. GUS activity in individual plant cells driven by Rep, CP and 35S promoters was estimated using real-time PCR and fluorometric GUS assay. Histochemical staining of GUS in transformed tobacco (Nicotiana tabacum cv. Xanthi leaves showed highest expression driven by Rep promoter followed by 35S promoter and CP promoter. The expression level of GUS driven by Rep promoter in transformed tobacco plants was shown to be two to four-fold higher than that of 35S promoter, while the expression by CP promoter was slightly lower. Further, the expression of GFP was monitored in agroinfiltrated leaves of N. benthamiana, N. tabacum and cotton (Gossypium hirsutum plants using confocal laser scanning microscopy. Rep promoter showed strong consistent transient expression in tobacco and cotton leaves as compared to 35S promoter. The strong constitutive CLCuBuV Rep promoter developed in this study could be very useful for high level expression of transgenes in a wide variety of plant cells.
Chen, Dijun; Kaufmann, Kerstin
2017-01-01
Key transcription factors (TFs) controlling the morphogenesis of flowers and leaves have been identified in the model plant Arabidopsis thaliana. Recent genome-wide approaches based on chromatin immunoprecipitation (ChIP) followed by high-throughput DNA sequencing (ChIP-seq) enable systematic identification of genome-wide TF binding sites (TFBSs) of these regulators. Here, we describe a computational pipeline for analyzing ChIP-seq data to identify TFBSs and to characterize gene regulatory networks (GRNs) with applications to the regulatory studies of flower development. In particular, we provide step-by-step instructions on how to download, analyze, visualize, and integrate genome-wide data in order to construct GRNs for beginners of bioinformatics. The practical guide presented here is ready to apply to other similar ChIP-seq datasets to characterize GRNs of interest.
International Nuclear Information System (INIS)
Wyatt, M.S.; Hannon, T.F.
1998-01-01
A method was developed and successfully applied to characterize large uranyl fluoride (UO 2 F 21 ) deposits at the former Oak Ridge Gaseous Diffusion Plant. These deposits were formed by a wet air in-leakage into the UF 6 process gas lines over a period of years. The resulting UO 2 F 2 is hygroscopic, readily absorbing moisture from the air to form hydrates as UO 2 F 2 -nH 2 O. The ratio of hydrogen to uranium, denoted H/U, can vary from 0--16, and has significant nuclear criticality safety impacts for large deposits. In order to properly formulate the required course of action, a non-intrusive characterization of the distribution of the fissile material within the pipe, its total mass, and amount of hydration was needed. The Nuclear Weapons Identification System (NWIS) previously developed at the Oak Ridge Y-12 Plant for identification of uranium weapons components in storage containers was used to successfully characterize the distribution, hydration, and total mass of these deposits
Plants on the move: plant-soil interactions in poleward shifting plant species
Grunsven, van R.H.A.
2008-01-01
As a result of recent global climate change, areas that have previously been climatically unsuitable for species have now become suitable new habitats. Many plant-species are expanding their range polewards, colonizing these newly available areas. If these species are able to expand their range
Employing modern power plant simulators in nuclear power plants
International Nuclear Information System (INIS)
Niedorf, V.; Storm, J.
2005-01-01
At the present state of the art, modern power plant simulators are characterized by new qualitative features, thus enabling operators to use them far beyond the traditional field of training. In its first part, this contribution presents an overview of the requirements to be met by simulators for multivalent uses. In part two, a survey of the uses and perspectives of simulation technology in power plants is presented on the basis of experience accumulated by Rheinmetall Defence Electronics (RDE).Modern simulators are shown to have applications by far exceeding traditional training areas. Modular client - sever systems on standard computers allow inexpensive uses to be designed at several levels, thus minimizing maintenance cost. Complex development and running time environments, like the SEMS developed by RDE, have made power plant simulators the workhorses of power plant engineers in all power plant areas. (orig.)
Analysis of the stress-inducible transcription factor SsNAC23 in sugarcane plants
Directory of Open Access Journals (Sweden)
Renata Fava Ditt
2011-08-01
Full Text Available Stresses such as cold and drought can impair plant yield and induce a highly complex array of responses. Sugarcane (Saccharum spp. is cultivated in tropical and subtropical areas and is considered a cold-sensitive plant. We previously showed that cold stress induces the expression of several genes in in vitro sugarcane plantlets. Here we characterize one of those genes, SsNAC23, a member of the NAC family of plant-specific transcription factors, which are induced by low temperature and other stresses in several plant species. The expression of SsNAC23 was induced in sugarcane plants exposed to low temperatures (4ºC. With the aim of further understanding the regulatory network in response to stress, we used the yeast two-hybrid system to identify sugarcane proteins that interact with SsNAC23. Using SsNAC23 as bait, we screened a cDNA expression library of sugarcane plants submitted to 4ºC for 48 h. Several interacting partners were identified, including stress-related proteins, increasing our knowledge on how sugarcane plants respond to cold stress. One of these interacting partners, a thioredoxin h1, offers insights into the regulation of SsNAC23 activity.
Perspectives on plant vulnerabilities ampersand other plant and containment improvements
International Nuclear Information System (INIS)
LaChance, J.; Kolaczkowski, A.; Kahn, J.
1996-01-01
The primary goal of the Individual Plant Examination (IPE) Program was for licensees to identify plant-unique vulnerabilities and actions to address these vulnerabilities. A review of these vulnerabilities and plant improvements that were identified in the IPEs was performed as part of the IPE Insights Program sponsored by the U.S. Nuclear Regulatory Commission (NRC). The purpose of this effort was to characterize the identified vulnerabilities and the impact of suggested plant improvements. No specific definition for open-quotes vulnerabilityclose quotes was provided in NRC Generic Letter 88-20 or in the subsequent NRC IPE submittal guidance documented in NUREG-1335. Thus licensees were left to use their own definitions. Only 20% of the plants explicitly stated that they had vulnerabilities. However, most licensees identified other plant improvements to address issues not explicitly classified as vulnerabilities, but pertaining to areas in which overall plant safety could potentially be increased. The various definitions of open-quotes vulnerabilityclose quotes used by the licensees, explicitly identified vulnerabilities, proposed plant improvements to address these vulnerabilities, and other plant improvements are summarized and discussed
Directory of Open Access Journals (Sweden)
Simon Jon McIlroy
Full Text Available An in depth understanding of the ecology of activated sludge nutrient removal wastewater treatment systems requires detailed knowledge of the community composition and metabolic activities of individual members. Recent 16S rRNA gene amplicon surveys of activated sludge wastewater treatment plants with nutrient removal indicate the presence of a core set of bacterial genera. These organisms are likely responsible for the bulk of nutrient transformations underpinning the functions of these plants. While the basic activities of some of these genera in situ are known, there is little to no information for the majority. This study applied microautoradiography coupled with fluorescence in situ hybridization (MAR-FISH for the in situ characterization of selected genus-level-phylotypes for which limited physiological information is available. These included Sulfuritalea and A21b, both within the class Betaproteobacteria, as well as Kaga01, within sub-group 10 of the phylum Acidobacteria. While the Sulfuritalea spp. were observed to be metabolically versatile, the A21b and Kaga01 phylotypes appeared to be highly specialized.
International Nuclear Information System (INIS)
Silva Lobo, M.A. da; Kronemberger, B.M.E.
1989-01-01
Available as short communication only. The Environmental Safety Division of the Nuclear Safety and Fuel Department from FURNAS Electric Station S.A. joint with the National Oceanic and Atmospheric Administration (NOAA), achieved a field experiment for characterizing the atmospheric transport and diffusion in the site complex of Angra I Nuclear Power Plant. The complex topography with the thick vegetation and the neighbour building bring problems for the modelling of the effluent transport and the dispersion. The actual meteorological measure system is automatic and compound with four towers. An intensive atmospheric measure with captive balloon is included, and the collected data shows that the site flux is strongly influenced by the topography and insolation. (C.G.C.). 2 figs
A high resolution GC/MS with Selected Ion Monitor (SIM) method focusing on the characterization and quantitative analysis of ginkgolic acids (GAs) in Ginkgo biloba L. plant materials, extracts and commercial products was developed and validated. The method involved sample extraction with (1:1) meth...
Use of an In Vitro, Nuclear Receptor Assay Panel to Characterize the Endocrine-Disrupting Activity Load of Wastewater Treatment Plant Effluent Extracts Katie B. Paul 1.2, Ruth Marfil-Vega 1 Marc A. Mills3, Steve 0. Simmons2, Vickie S. Wilson4, Kevin M. Crofton2 10ak Rid...
International Nuclear Information System (INIS)
1994-09-01
A three-dimensional (3-D), high-resolution (HR) seismic reflection evaluation was conducted at the Rocky Flats Plant (RFP), near Golden, Colorado, to demonstrate the applicability of nonintrusive characterization techniques to detect buried objects, contamination, and geological/hydrological features at RFP. The evaluation was conducted as part of the U.S. Department of Energy's (DOE) request for demonstration, testing and evaluation (DT ampersand E) of nonintrusive techniques, under DOE Program Research and Development Announcement (PRDA) No. DE-RA05-09OR22000
Energy Technology Data Exchange (ETDEWEB)
NONE
1994-09-01
A three-dimensional (3-D), high-resolution (HR) seismic reflection evaluation was conducted at the Rocky Flats Plant (RFP), near Golden, Colorado, to demonstrate the applicability of nonintrusive characterization techniques to detect buried objects, contamination, and geological/hydrological features at RFP. The evaluation was conducted as part of the U.S. Department of Energy`s (DOE) request for demonstration, testing and evaluation (DT&E) of nonintrusive techniques, under DOE Program Research and Development Announcement (PRDA) No. DE-RA05-09OR22000.
Plant state display device after occurrence of earthquake
International Nuclear Information System (INIS)
Kitada, Yoshio; Yonekura, Kazuyoshi.
1992-01-01
If a nuclear power plant should encounter earthquakes, an earthquake response analysis value previously stored and the earthquakes observed are compared to judge the magnitude of the earthquakes. From the result of the judgement, a possibility that an abnormality is recognized in plant equipment systems after the earthquakes is evaluated, in comparison with a previously stored earthquake fragility data base of each of equipment/systems. The result of the evaluation is displayed in a central control chamber. The plant equipment system is judged such that abnormalities are recognized at a high probability is evaluated by a previously stored earthquake PSA method for the influence of the abnormality on plant safety, and the result is displayed in the central control chamber. (I.S.)
Gustafson, J. Olaf; Bell, James F.; Gaddis, Lisa R.R.; Hawke, B. Ray Ray; Giguere, Thomas A.
2012-01-01
We used a Lunar Reconnaissance Orbiter Camera (LROC) global monochrome Wide-angle Camera (WAC) mosaic to conduct a survey of the Moon to search for previously unidentified pyroclastic deposits. Promising locations were examined in detail using LROC multispectral WAC mosaics, high-resolution LROC Narrow Angle Camera (NAC) images, and Clementine multispectral (ultraviolet-visible or UVVIS) data. Out of 47 potential deposits chosen for closer examination, 12 were selected as probable newly identified pyroclastic deposits. Potential pyroclastic deposits were generally found in settings similar to previously identified deposits, including areas within or near mare deposits adjacent to highlands, within floor-fractured craters, and along fissures in mare deposits. However, a significant new finding is the discovery of localized pyroclastic deposits within floor-fractured craters Anderson E and F on the lunar farside, isolated from other known similar deposits. Our search confirms that most major regional and localized low-albedo pyroclastic deposits have been identified on the Moon down to ~100 m/pix resolution, and that additional newly identified deposits are likely to be either isolated small deposits or additional portions of discontinuous, patchy deposits.
Evolutionary diversification of plant shikimate kinase gene duplicates.
Directory of Open Access Journals (Sweden)
Geoffrey Fucile
2008-12-01
Full Text Available Shikimate kinase (SK; EC 2.7.1.71 catalyzes the fifth reaction of the shikimate pathway, which directs carbon from the central metabolism pool to a broad range of secondary metabolites involved in plant development, growth, and stress responses. In this study, we demonstrate the role of plant SK gene duplicate evolution in the diversification of metabolic regulation and the acquisition of novel and physiologically essential function. Phylogenetic analysis of plant SK homologs resolves an orthologous cluster of plant SKs and two functionally distinct orthologous clusters. These previously undescribed genes, shikimate kinase-like 1 (SKL1 and -2 (SKL2, do not encode SK activity, are present in all major plant lineages, and apparently evolved under positive selection following SK gene duplication over 400 MYA. This is supported by functional assays using recombinant SK, SKL1, and SKL2 from Arabidopsis thaliana (At and evolutionary analyses of the diversification of SK-catalytic and -substrate binding sites based on theoretical structure models. AtSKL1 mutants yield albino and novel variegated phenotypes, which indicate SKL1 is required for chloroplast biogenesis. Extant SKL2 sequences show a strong genetic signature of positive selection, which is enriched in a protein-protein interaction module not found in other SK homologs. We also report the first kinetic characterization of plant SKs and show that gene expression diversification among the AtSK inparalogs is correlated with developmental processes and stress responses. This study examines the functional diversification of ancient and recent plant SK gene duplicates and highlights the utility of SKs as scaffolds for functional innovation.
Mass spectrometry for characterizing plant cell wall polysaccharides
Directory of Open Access Journals (Sweden)
Stefan eBauer
2012-03-01
Full Text Available Mass spectrometry is a selective and powerful technique to obtain identification and structural information on compounds present in complex mixtures. Since it requires only small sample amount it is an excellent tool for researchers interested in detecting changes in composition of complex carbohydrates of plants. This mini-review gives an overview of common mass spectrometry techniques applied to the analysis of plant cell wall carbohydrates. It presents examples in which mass spectrometry has been used to elucidate the structure of oligosaccharides derived from hemicelluloses and pectins and illustrates how information on sequence, linkages, branching and modifications are obtained from characteristic fragmentation patterns.
2017-01-01
We characterize the diversity of nectar-living yeasts of a tropical host plant community at different hierarchical sampling levels, measure the associations between yeasts and nectariferous plants, and measure the effect of yeasts on nectar traits. Using a series of hierarchically nested sampling units, we extracted nectar from an assemblage of host plants that were representative of the diversity of life forms, flower shapes, and pollinator types in the tropical area of Yucatan, Mexico. Yeasts were isolated from single nectar samples; their DNA was identified, the yeast cell density was estimated, and the sugar composition and concentration of nectar were quantified using HPLC. In contrast to previous studies from temperate regions, the diversity of nectar-living yeasts in the plant community was characterized by a relatively high number of equally common species with low dominance. Analyses predict highly diverse nectar yeast communities in a relatively narrow range of tropical vegetation, suggesting that the diversity of yeasts will increase as the number of sampling units increases at the level of the species, genera, and botanical families of the hosts. Significant associations between specific yeast species and host plants were also detected; the interaction between yeasts and host plants impacted the effect of yeast cell density on nectar sugars. This study provides an overall picture of the diversity of nectar-living yeasts in tropical host plants and suggests that the key factor that affects the community-wide patterns of nectar traits is not nectar chemistry, but rather the type of yeasts interacting with host plants. PMID:28717591
Directory of Open Access Journals (Sweden)
Azucena Canto
2017-07-01
Full Text Available We characterize the diversity of nectar-living yeasts of a tropical host plant community at different hierarchical sampling levels, measure the associations between yeasts and nectariferous plants, and measure the effect of yeasts on nectar traits. Using a series of hierarchically nested sampling units, we extracted nectar from an assemblage of host plants that were representative of the diversity of life forms, flower shapes, and pollinator types in the tropical area of Yucatan, Mexico. Yeasts were isolated from single nectar samples; their DNA was identified, the yeast cell density was estimated, and the sugar composition and concentration of nectar were quantified using HPLC. In contrast to previous studies from temperate regions, the diversity of nectar-living yeasts in the plant community was characterized by a relatively high number of equally common species with low dominance. Analyses predict highly diverse nectar yeast communities in a relatively narrow range of tropical vegetation, suggesting that the diversity of yeasts will increase as the number of sampling units increases at the level of the species, genera, and botanical families of the hosts. Significant associations between specific yeast species and host plants were also detected; the interaction between yeasts and host plants impacted the effect of yeast cell density on nectar sugars. This study provides an overall picture of the diversity of nectar-living yeasts in tropical host plants and suggests that the key factor that affects the community-wide patterns of nectar traits is not nectar chemistry, but rather the type of yeasts interacting with host plants.
Energy Technology Data Exchange (ETDEWEB)
Young, S.C.; Julian, S.C.; Neton, M.J.
1993-01-01
Multi-well pumping tests have been concluded at wells MW79, MW108, and PW1 at the Paducah Gaseous Diffusion Plant (PGDP) to determine the hydraulic properties of the Regional Gravel Aquifer (RGA). Soil cores suggest that the RGA consists of a thin sandy facies (2 to 6 feet) at the top of a thicker (> 10 feet) gravelly facies. Previous analyses have not considered any permeability contrast between the two facies. To assess the accuracy of this assumption, TVA personnel conducted borehole flowmeter tests at wells MW108 and PW1. Well MW79 could not be tested. The high K sand unit is probably 10 times more permeable than comparable zone in the gravelly portion of the RGA. Previous analyses of the three multi-well aquifer tests do not use the same conceptual aquifer model. Data analysis for one pumping test assumed that leakance was significant. Data analysis for another pumping test assumed that a geologic boundary was significant. By collectively analyzing all three tests with the borehole flowmeter results, the inconsistency among the three pumping tests can be explained. Disparity exists because each pumping test had a different placement of observation wells relative to the high K zone delineating by flowmeter testing.
Directory of Open Access Journals (Sweden)
Puja Kumari
2017-10-01
Full Text Available Plant growth promoting rhizobacteria (PGPR are bioresources which may be viewed as a novel and potential tool for providing substantial benefits to the agriculture. Soil is the dynamic living matrix and the major source of food security providing various resources of plant growth and maintaining life processes. PGPR are originally defined as root- colonizing bacteria that cause either plant growth promotion or biological control of plant diseases. Chemical fertilizers are used for killing pathogens, increase crop yield but long term use of chemical fertilizers lead to adverse effect to the soil profile and is the reason for decrease in soil productivity, on the other hand PGPR promote plant growth directly by either facilitating resource acquisition (nitrogen, phosphorus and essential minerals or modulating plant hormone levels, or indirectly by decreasing the inhibitory effects of various pathogens on plant growth and development in the forms of biocontrol agents. PGPR is the indispensable part of rhizosphere biota that when grown in association with the host plants can stimulate the growth of the host. PGPR seemed as successful rhizobacteria in getting established in soil ecosystem due to their high adaptability in a wide variety of environments, faster growth rate and biochemical versatility to metabolize a wide range of natural and xenobiotic compounds. Isolated PGPRs from selective crop rizosphere soil were used for further growth promotion and biocontrol studies in the green house and field. Different studies have been carrying out to develop some new bioformulations and evaluate their efficacy in promoting crop seedlings growth characteristics. Field trials were performed to evaluate selective crops with formulations of several plants PGPR in a production system. The present review highlights the Plant growth promoting rhizobacteria as an alternative of chemical fertilizer for sustainable, environment friendly agriculture.
Directory of Open Access Journals (Sweden)
Mojtaba Sankian
2014-05-01
Full Text Available Background: Melon (Cucumis melo allergy is one of the most common food allergies, characterized by oral allergy syndrome. To date, two allergen molecules, Cuc m 1 and Cuc m 2, have been fully characterized in melon pulp, but there are few reports about the molecular characteristics of Cuc m 3. Methods:The Cuc m 3 cDNA has been characterized by rapid amplification of cDNA ends (RACE, which revealed a 456 base-pair (bp fragment encoding a 151-amino acid polypeptide with a predicted molecular mass of 16.97 kDa, and identified 79 and 178 bp untranslated sequences at the 5′ and 3´ ends, respectively. Results: In silico analysis showed strong similarities between Cuc m 3 and other plant pathogen-related protein 1s from cucumber, grape, bell pepper, and tomato. Conclusion: Here we report the identification and characterization of the Cuc m 3 cDNA, which will be utilized for further analyses of structural and allergenic features of this allergen
Martín, Mariana; Rius, Sebastián Pablo; Podestá, Florencio Esteban
2011-06-01
Two phosphoenolpyruvate carboxykinase (PEPCK, EC 4.1.1.49) isoforms of 74 and 65 kDa were found to coexist in vivo in pineapple leaves, a constitutive Crassulacean Acid Metabolism plant. The 65 kDa form was not the result of proteolytic cleavage of the larger form since extraction methods reported to prevent PEPCK proteolysis in other plant tissues failed to yield a single immunoreactive PEPCK polypeptide in leaf extracts. In this work, the smaller form of 65 kDa was purified to homogeneity and physically and kinetically characterized and showed parameters compatible with a fully active enzyme. The specific activity was nearly twice higher for decarboxylation of oxaloacetate when compared to carboxylation of phosphoenolpyruvate. Kinetic parameters fell within the range of those estimated for other plant PEPCKs. Its activity was affected by several metabolites, as shown by inhibition by 3-phosphoglycerate, citrate, malate, fructose-1,6-bisphosphate, l-asparagine and activation of the decarboxylating activity by succinate. A break in the Arrhenius plot at about 30°C indicates that PEPCK structure is responsive to changes in temperature. The results indicate that pineapple leaves contain two PEPCK forms. The biochemical characterization of the smaller isoform performed in this work suggests that it could participate in both carbon and nitrogen metabolism in vivo by acting as a decarboxylase. Copyright © 2011 Elsevier Masson SAS. All rights reserved.
Characterization of actinobacteria associated with three ant-plant mutualisms.
Hanshew, Alissa S; McDonald, Bradon R; Díaz Díaz, Carol; Djiéto-Lordon, Champlain; Blatrix, Rumsaïs; Currie, Cameron R
2015-01-01
Ant-plant mutualisms are conspicuous and ecologically important components of tropical ecosystems that remain largely unexplored in terms of insect-associated microbial communities. Recent work has revealed that ants in some ant-plant systems cultivate fungi (Chaetothyriales) within their domatia, which are fed to larvae. Using Pseudomyrmex penetrator/Tachigali sp. from French Guiana and Petalomyrmex phylax/Leonardoxa africana and Crematogaster margaritae/Keetia hispida, both from Cameroon, as models, we tested the hypothesis that ant-plant-fungus mutualisms co-occur with culturable Actinobacteria. Using selective media, we isolated 861 putative Actinobacteria from the three systems. All C. margaritae/K. hispida samples had culturable Actinobacteria with a mean of 10.0 colony forming units (CFUs) per sample, while 26 % of P. penetrator/Tachigali samples (mean CFUs 1.3) and 67 % of P. phylax/L. africana samples (mean CFUs 3.6) yielded Actinobacteria. The largest number of CFUs was obtained from P. penetrator workers, P. phylax alates, and C. margaritae pupae. 16S rRNA gene sequencing and phylogenetic analysis revealed the presence of four main clades of Streptomyces and one clade of Nocardioides within these three ant-plant mutualisms. Streptomyces with antifungal properties were isolated from all three systems, suggesting that they could serve as protective symbionts, as found in other insects. In addition, a number of isolates from a clade of Streptomyces associated with P. phylax/L. africana and C. margaritae/K. hispida were capable of degrading cellulose, suggesting that Streptomyces in these systems may serve a nutritional role. Repeated isolation of particular clades of Actinobacteria from two geographically distant locations supports these isolates as residents in ant-plant-fungi niches.
Sharp, Andrew J.; Hansen, Sierra; Selzer, Rebecca R.; Cheng, Ze; Regan, Regina; Hurst, Jane A.; Stewart, Helen; Price, Sue M.; Blair, Edward; Hennekam, Raoul C.; Fitzpatrick, Carrie A.; Segraves, Rick; Richmond, Todd A.; Guiver, Cheryl; Albertson, Donna G.; Pinkel, Daniel; Eis, Peggy S.; Schwartz, Stuart; Knight, Samantha J. L.; Eichler, Evan E.
2006-01-01
Genomic disorders are characterized by the presence of flanking segmental duplications that predispose these regions to recurrent rearrangement. Based on the duplication architecture of the genome, we investigated 130 regions that we hypothesized as candidates for previously undescribed genomic
The Mechanism Forming the Cell Surface of Tip-Growing Rooting Cells Is Conserved among Land Plants.
Honkanen, Suvi; Jones, Victor A S; Morieri, Giulia; Champion, Clement; Hetherington, Alexander J; Kelly, Steve; Proust, Hélène; Saint-Marcoux, Denis; Prescott, Helen; Dolan, Liam
2016-12-05
To discover mechanisms that controlled the growth of the rooting system in the earliest land plants, we identified genes that control the development of rhizoids in the liverwort Marchantia polymorpha. 336,000 T-DNA transformed lines were screened for mutants with defects in rhizoid growth, and a de novo genome assembly was generated to identify the mutant genes. We report the identification of 33 genes required for rhizoid growth, of which 6 had not previously been functionally characterized in green plants. We demonstrate that members of the same orthogroup are active in cell wall synthesis, cell wall integrity sensing, and vesicle trafficking during M. polymorpha rhizoid and Arabidopsis thaliana root hair growth. This indicates that the mechanism for constructing the cell surface of tip-growing rooting cells is conserved among land plants and was active in the earliest land plants that existed sometime more than 470 million years ago [1, 2]. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.
A NEPA follow-up study of DOE loan guarantee fuel ethanol plants
International Nuclear Information System (INIS)
Hunsaker, D.B. Jr.; Eddlemon, G.K.; Miller, R.L.; Webb, J.W.
1989-04-01
This study was implemented to examine and characterize the actual environmental impacts of three fuel ethanol plants constructed under the US Department of Energy, Office of Alcohol Fuels Loan Guarantee Program, and to compare actual impacts with those predicted about six years ago in environmental assessments (EAs) prepared for these facilities. The objective of the program, established under the Energy Security Act of 1980, was to conserve petroleum resources by promoting the use of fuel ethanol in motor vehicles. The plants were designed to produce fuel-grade ethanol for blending with gasoline and reflect differentfeedstocks, processes, fuel sources, and site locations. Although two of the facilities as constructed differed substantially from those assessed previously, actual environmental impacts generally occurred in the areas predicted by the EAs. Major impacts not anticipated include odor from air emissions, effects of wastewater discharge on operation of a municipal sewage treatment plant, possible classification of treated wastewater from a molasses-based process as a nuisance, and habitat losses from both vegetation removal and unforeseen construction of barge terminals. In all cases, impacts were judged to be not significantn the final outcome, either because plant management (or other involved parties) took corrective action or because the resources affected in these particular cases were not important. Mitigation measures reliedon in the EAs to limit adverse impacts to insignificant levels were implemented and were required by permit condition, law, or regulation. Future follow-up studies would benefit from the availability of ambientmonitoring data to more thoroughly characterize actual impacts
International Nuclear Information System (INIS)
Wyatt, M.S.; Hannon, T.F.
1998-01-01
A method was developed and successfully applied to characterize large uranyl fluoride (UO 2 F 2 ) deposits at the former Oak Ridge Gaseous Diffusion Plant. These deposits were formed by a wet air in-leakage into the UF 6 process gas lines over a period of years. The resulting UO 2 F 2 is hygroscopic, readily absorbing moisture from the air to form hydrates as UO 2 F 2 -nH 2 O. The ratio of hydrogen to uranium can vary from 0--16, and has significant nuclear criticality safety impacts for large deposits. In order to properly formulate the required course of action, a non-intrusive characterization of the distribution of the fissile material within the pipe, its total mass, and amount of hydration was necessary. The Nuclear Weapons Identification System (NWIS) previously developed at the Oak Ridge Y-12 Plant for identification of uranium weapons components in storage containers was used to successfully characterize these deposits
Guo, Yuqiong; Zhao, Shanshan; Zhu, Chen; Chang, Xiaojun; Yue, Chuan; Wang, Zhong; Lin, Yuling; Lai, Zhongxiong
2017-11-21
Drought stress is one of the major natural challenges in the main tea-producing regions of China. The tea plant (Camellia sinensis) is a traditional beverage plant whose growth status directly affects tea quality. Recent studies have revealed that microRNAs (miRNAs) play key functions in plant growth and development. Although some miRNAs have been identified in C. sinensis, little is known about their roles in the drought stress response of tea plants. Physiological characterization of Camellia sinensis 'Tieguanyin' under drought stress showed that the malondialdehyde concentration and electrical conductivity of leaves of drought-stressed plants increased when the chlorophyll concentration decreased under severe drought stress. We sequenced four small-RNA (sRNA) libraries constructed from leaves of plants subjected to four different treatments, normal water supply (CK); mild drought stress (T1); moderate drought stress (T2) and severe drought stress (T3). A total of 299 known mature miRNA sequences and 46 novel miRNAs were identified. Gene Ontology enrichment analysis revealed that most of the differentially expressed-miRNA target genes were related to regulation of transcription. Kyoto Encyclopedia of Genes and Genomes analysis revealed that the most highly enriched pathways under drought stress were D-alanine metabolism, sulfur metabolism, and mineral absorption pathways. Real-time quantitative PCR (qPCR) was used to validate the expression patterns of 21 miRNAs (2 up-regulated and 19 down-regulated under drought stress). The observed co-regulation of the miR166 family and their targets ATHB-14-like and ATHB-15-like indicate the presence of negative feedback regulation in miRNA pathways. Analyses of drought-responsive miRNAs in tea plants showed that most of differentially expressed-miRNA target genes were related to regulation of transcription. The results of study revealed that the expressions of phase-specific miRNAs vary with morphological, physiological, and
Gavazzi, Floriana; Pigna, Gaia; Braglia, Luca; Gianì, Silvia; Breviario, Diego; Morello, Laura
2017-12-08
Microtubules, polymerized from alpha and beta-tubulin monomers, play a fundamental role in plant morphogenesis, determining the cell division plane, the direction of cell expansion and the deposition of cell wall material. During polarized pollen tube elongation, microtubules serve as tracks for vesicular transport and deposition of proteins/lipids at the tip membrane. Such functions are controlled by cortical microtubule arrays. Aim of this study was to first characterize the flax β-tubulin family by sequence and phylogenetic analysis and to investigate differential expression of β-tubulin genes possibly related to fibre elongation and to flower development. We report the cloning and characterization of the complete flax β-tubulin gene family: exon-intron organization, duplicated gene comparison, phylogenetic analysis and expression pattern during stem and hypocotyl elongation and during flower development. Sequence analysis of the fourteen expressed β-tubulin genes revealed that the recent whole genome duplication of the flax genome was followed by massive retention of duplicated tubulin genes. Expression analysis showed that β-tubulin mRNA profiles gradually changed along with phloem fibre development in both the stem and hypocotyl. In flowers, changes in relative tubulin transcript levels took place at anthesis in anthers, but not in carpels. Phylogenetic analysis supports the origin of extant plant β-tubulin genes from four ancestral genes pre-dating angiosperm separation. Expression analysis suggests that particular tubulin subpopulations are more suitable to sustain different microtubule functions such as cell elongation, cell wall thickening or pollen tube growth. Tubulin genes possibly related to different microtubule functions were identified as candidate for more detailed studies.
Engineered plant biomass feedstock particles
Dooley, James H [Federal Way, WA; Lanning, David N [Federal Way, WA; Broderick, Thomas F [Lake Forest Park, WA
2012-04-17
A new class of plant biomass feedstock particles characterized by consistent piece size and shape uniformity, high skeletal surface area, and good flow properties. The particles of plant biomass material having fibers aligned in a grain are characterized by a length dimension (L) aligned substantially parallel to the grain and defining a substantially uniform distance along the grain, a width dimension (W) normal to L and aligned cross grain, and a height dimension (H) normal to W and L. In particular, the L.times.H dimensions define a pair of substantially parallel side surfaces characterized by substantially intact longitudinally arrayed fibers, the W.times.H dimensions define a pair of substantially parallel end surfaces characterized by crosscut fibers and end checking between fibers, and the L.times.W dimensions define a pair of substantially parallel top and bottom surfaces. The L.times.W surfaces of particles with L/H dimension ratios of 4:1 or less are further elaborated by surface checking between longitudinally arrayed fibers. The length dimension L is preferably aligned within 30.degree. parallel to the grain, and more preferably within 10.degree. parallel to the grain. The plant biomass material is preferably selected from among wood, agricultural crop residues, plantation grasses, hemp, bagasse, and bamboo.
Monitoring Biological Activity at Geothermal Power Plants
Energy Technology Data Exchange (ETDEWEB)
Peter Pryfogle
2005-09-01
The economic impact of microbial growth in geothermal power plants has been estimated to be as high as $500,000 annually for a 100 MWe plant. Many methods are available to monitor biological activity at these facilities; however, very few plants have any on-line monitoring program in place. Metal coupon, selective culturing (MPN), total organic carbon (TOC), adenosine triphosphate (ATP), respirometry, phospholipid fatty acid (PLFA), and denaturing gradient gel electrophoresis (DGGE) characterizations have been conducted using water samples collected from geothermal plants located in California and Utah. In addition, the on-line performance of a commercial electrochemical monitor, the BIoGEORGE?, has been evaluated during extended deployments at geothermal facilities. This report provides a review of these techniques, presents data on their application from laboratory and field studies, and discusses their value in characterizing and monitoring biological activities at geothermal power plants.
PlantCV v2: Image analysis software for high-throughput plant phenotyping
Directory of Open Access Journals (Sweden)
Malia A. Gehan
2017-12-01
Full Text Available Systems for collecting image data in conjunction with computer vision techniques are a powerful tool for increasing the temporal resolution at which plant phenotypes can be measured non-destructively. Computational tools that are flexible and extendable are needed to address the diversity of plant phenotyping problems. We previously described the Plant Computer Vision (PlantCV software package, which is an image processing toolkit for plant phenotyping analysis. The goal of the PlantCV project is to develop a set of modular, reusable, and repurposable tools for plant image analysis that are open-source and community-developed. Here we present the details and rationale for major developments in the second major release of PlantCV. In addition to overall improvements in the organization of the PlantCV project, new functionality includes a set of new image processing and normalization tools, support for analyzing images that include multiple plants, leaf segmentation, landmark identification tools for morphometrics, and modules for machine learning.
Dasch, Jean; D'Arcy, James
2008-07-01
Airborne particles were characterized from six welding operations in three automotive plants, including resistance spot welding, metal inert gas (MIG) welding and tungsten inert gas (TIG) welding of aluminum and resistance spot welding, MIG welding and weld-through sealer of galvanized steel. Particle levels were measured throughout the process area to select a sampling location, followed by intensive particle sampling over one working shift. Temporal trends were measured, and particles were collected on filters to characterize their size and chemistry. In all cases, the particles fell into a bimodal size distribution with very large particles >20 mum in diameter, possibly emitted as spatter or metal expulsions, and very small particles about 1 mum in diameter, possibly formed from condensation of vaporized metal. The mass median aerodynamic diameter was about 1 mum, with only about 7% of the particle mass present as ultrafine particles welding particles could be accounted for by chemical analysis, with the remainder possibly present as oxygen. Predominant species were organic carbon, elemental carbon, iron, and aluminum. More than 80% of the particle mass could be accounted for from steel welding, primarily present as iron, organic carbon, zinc, and copper. Particle concentrations and elemental concentrations were compared with allowable concentrations as recommended by the Occupational Safety and Health Administration and the American Conference of Governmental Industrial Hygienists. In all cases, workplace levels were at least 11 times lower than recommended levels.
Functional characterization of CLE peptides from a plant-parasitic nematode Globodera rostochiensis
Plant CLAVATA3/ESR (CLE) proteins are a large family of secreted peptide ligands that play important roles in plant growth and development. Recent evidence suggests that plant-parasitic cyst nematodes secrete ligand mimics of plant CLE peptides to modify selected host root cells into multinucleate f...
Physicochemical characterization of Baizhi particles by ultrafine pulverization
Yang, Lian-Wei; Sun, Peng; Gai, Guo-Sheng; Yang, Yu-Fen; Wang, Yu-Rong
2011-04-01
Baizhi, as a medicinal plant, has been demonstrated to be useful for the treatment of aches and pains in China. The physicochemical characterization of Baizhi particles is greatly influenced by ultrafine pulverization. To study the physicochemical characterization of Baizhi, the raw plant material of Baizhi was ground to 6 μm particles by a high speed centrifugal sheering (HSCS) pulverizer. The micron particles were characterized by optical microscopy and scanning electron microscopy (SEM). Imperatorin is one of the active ingredients of Baizhi, and its extraction yield is determined to evaluate the chemical characterization of Baizhi powder. Imperatorin was analyzed by high performance liquid chromatography (HPLC). The results show that after ultrafine pulverization, the plant cell walls are broken into pieces and the extraction yield of imperatorin is increased by 11.93% compared with the normal particles.
A new plant chamber facility PLUS coupled to the atmospheric simulation chamber SAPHIR
Hohaus, T.; Kuhn, U.; Andres, S.; Kaminski, M.; Rohrer, F.; Tillmann, R.; Wahner, A.; Wegener, R.; Yu, Z.; Kiendler-Scharr, A.
2015-11-01
A new PLant chamber Unit for Simulation (PLUS) for use with the atmosphere simulation chamber SAPHIR (Simulation of Atmospheric PHotochemistry In a large Reaction Chamber) has been build and characterized at the Forschungszentrum Jülich GmbH, Germany. The PLUS chamber is an environmentally controlled flow through plant chamber. Inside PLUS the natural blend of biogenic emissions of trees are mixed with synthetic air and are transferred to the SAPHIR chamber where the atmospheric chemistry and the impact of biogenic volatile organic compounds (BVOC) can be studied in detail. In PLUS all important enviromental parameters (e.g. temperature, PAR, soil RH etc.) are well-controlled. The gas exchange volume of 9.32 m3 which encloses the stem and the leafes of the plants is constructed such that gases are exposed to FEP Teflon film and other Teflon surfaces only to minimize any potential losses of BVOCs in the chamber. Solar radiation is simulated using 15 LED panels which have an emission strength up to 800 μmol m-2 s-1. Results of the initial characterization experiments are presented in detail. Background concentrations, mixing inside the gas exchange volume, and transfer rate of volatile organic compounds (VOC) through PLUS under different humidity conditions are explored. Typical plant characteristics such as light and temperature dependent BVOC emissions are studied using six Quercus Ilex trees and compared to previous studies. Results of an initial ozonolysis experiment of BVOC emissions from Quercus Ilex at typical atmospheric concentrations inside SAPHIR are presented to demonstrate a typical experimental set up and the utility of the newly added plant chamber.
A new plant chamber facility, PLUS, coupled to the atmosphere simulation chamber SAPHIR
Hohaus, T.; Kuhn, U.; Andres, S.; Kaminski, M.; Rohrer, F.; Tillmann, R.; Wahner, A.; Wegener, R.; Yu, Z.; Kiendler-Scharr, A.
2016-03-01
A new PLant chamber Unit for Simulation (PLUS) for use with the atmosphere simulation chamber SAPHIR (Simulation of Atmospheric PHotochemistry In a large Reaction Chamber) has been built and characterized at the Forschungszentrum Jülich GmbH, Germany. The PLUS chamber is an environmentally controlled flow-through plant chamber. Inside PLUS the natural blend of biogenic emissions of trees is mixed with synthetic air and transferred to the SAPHIR chamber, where the atmospheric chemistry and the impact of biogenic volatile organic compounds (BVOCs) can be studied in detail. In PLUS all important environmental parameters (e.g., temperature, photosynthetically active radiation (PAR), soil relative humidity (RH)) are well controlled. The gas exchange volume of 9.32 m3 which encloses the stem and the leaves of the plants is constructed such that gases are exposed to only fluorinated ethylene propylene (FEP) Teflon film and other Teflon surfaces to minimize any potential losses of BVOCs in the chamber. Solar radiation is simulated using 15 light-emitting diode (LED) panels, which have an emission strength up to 800 µmol m-2 s-1. Results of the initial characterization experiments are presented in detail. Background concentrations, mixing inside the gas exchange volume, and transfer rate of volatile organic compounds (VOCs) through PLUS under different humidity conditions are explored. Typical plant characteristics such as light- and temperature- dependent BVOC emissions are studied using six Quercus ilex trees and compared to previous studies. Results of an initial ozonolysis experiment of BVOC emissions from Quercus ilex at typical atmospheric concentrations inside SAPHIR are presented to demonstrate a typical experimental setup and the utility of the newly added plant chamber.
Directory of Open Access Journals (Sweden)
Nadège A. Agbodjato
2015-01-01
Full Text Available Our study aims to characterize Plant Growth Promoting Rhizobacteria (PGPR isolated from maize roots in five agroecological zones of central and northern Benin. Sixty samples were collected at the rate of four samples per village and three villages per agroecological zone. Rhizobacteria strains were isolated from these samples and biochemically characterized. These strains were analyzed for some of their PGPR traits like ammonia production and hydrogen cyanide following conventional methods. Microbiological investigation of these samples has shown that maize rhizospheres in central and northern Benin contain a high diversity of microorganisms. A total of nine species of maize Plant Growth Promoting Rhizobacteria were identified. Those PGPR include five Bacillus species (B. polymyxa, B. pantothenticus, B. anthracis, B. thuringiensis, and B. circulans, three Pseudomonas species (P. cichorii, P. putida, and P. syringae, and Serratia marcescens. The microbial diversity does not depend on the soil types. The microbial density, generally high, varies according to both soil types and agroecological zones. All Serratia strains (100% have produced ammonia, whereas 80% of Bacillus and 77.77% of Pseudomonas produced this metabolite. The hydrogen cyanide was produced by all isolates (100% independent of their genus. These results suggest the possibility to use these rhizobacteria as biological fertilizers to increase maize production.
Characterization of ethno-medicinal plant resources of karamar valley Swabi, Pakistan
Directory of Open Access Journals (Sweden)
Muhammad Khalid
2017-04-01
Industrial relevance: Medicinal plants are still widely used for the treatment of different ailments in the area of Swabi, therefore survey of medicinal flora should be carried out to explore and bring up-to-date the catalogue of existing natural plant resources of the area especially in agricultural country like Pakistan. Small scale government processing units of agroforestry should be implemented to reduce the overuse and motivate the cultivation of valuable medicinal plants. Majority of the people use various formulations of medicinal plants for different ailments treatment. The phytochemicals greatly varied in medicinal plants and cause a marvelous effect on human illnesses. The objective of the present study was to document the information of folk medicines, its identification, collection of samples, study of its chemical constituents and uses by the local people of District Swabi, Pakistan.
Doublet, Jeremy; Mamy, Laure; Barriuso Benito, Enrique
2009-01-01
Following application, pesticides can be intercepted and absorbed by weeds and/or crops. Plants containing pesticides residues may then reach the soil during the crop cycle or after harvest. However, the fate in soil of pesticides residues in plants is unknown. Two commonly used foliar herbicides, glyphosate and sulcotrione, 14C-labeled, were applied on leaves of oilseed rape and/or maize, translocation was studied, and then soil incubations of aerial parts of plants containing herbicides res...
Christinet, Laurent; Burdet, Frédéric X.; Zaiko, Maïa; Hinz, Ursula; Zrÿd, Jean-Pierre
2004-01-01
Betalains are pigments that replace anthocyanins in the majority of families of the plant order Caryophyllales. Betalamic acid is the common chromophore of betalains. The key enzyme of the betalain biosynthetic pathway is an extradiol dioxygenase that opens the cyclic ring of dihydroxy-phenylalanine (DOPA) between carbons 4 and 5, thus producing an unstable seco-DOPA that rearranges nonenzymatically to betalamic acid. A gene for a 4,5-DOPA-dioxygenase has already been isolated from the fungus Amanita muscaria, but no homolog was ever found in plants. To identify the plant gene, we constructed subtractive libraries between different colored phenotypes of isogenic lines of Portulaca grandiflora (Portulacaceae) and between different stages of flower bud formation. Using in silico analysis of differentially expressed cDNAs, we identified a candidate showing strong homology at the level of translated protein with the LigB domain present in several bacterial extradiol 4,5-dioxygenases. The gene was expressed only in colored flower petals. The function of this gene in the betalain biosynthetic pathway was confirmed by biolistic genetic complementation in white petals of P. grandiflora genotypes lacking the gene for color formation. This gene named DODA is the first characterized member of a novel family of plant dioxygenases phylogenetically distinct from Amanita sp. DOPA-dioxygenase. Homologs of DODA are present not only in betalain-producing plants but also, albeit with some changes near the catalytic site, in other angiosperms and in the bryophyte Physcomitrella patens. These homologs are part of a novel conserved plant gene family probably involved in aromatic compound metabolism. PMID:14730069
Functional architecture of higher plant photosystem II supercomplexes.
Caffarri, Stefano; Kouril, Roman; Kereïche, Sami; Boekema, Egbert J; Croce, Roberta
2009-10-07
Photosystem II (PSII) is a large multiprotein complex, which catalyses water splitting and plastoquinone reduction necessary to transform sunlight into chemical energy. Detailed functional and structural studies of the complex from higher plants have been hampered by the impossibility to purify it to homogeneity. In this work, homogeneous preparations ranging from a newly identified particle composed by a monomeric core and antenna proteins to the largest C(2)S(2)M(2) supercomplex were isolated. Characterization by biochemical methods and single particle electron microscopy allowed to relate for the first time the supramolecular organization to the protein content. A projection map of C(2)S(2)M(2) at 12 A resolution was obtained, which allowed determining the location and the orientation of the antenna proteins. Comparison of the supercomplexes obtained from WT and Lhcb-deficient plants reveals the importance of the individual subunits for the supramolecular organization. The functional implications of these findings are discussed and allow redefining previous suggestions on PSII energy transfer, assembly, photoinhibition, state transition and non-photochemical quenching.
Clostridium difficile in retail meat and processing plants in Texas.
Harvey, Roger B; Norman, Keri N; Andrews, Kathleen; Norby, Bo; Hume, Michael E; Scanlan, Charles M; Hardin, Margaret D; Scott, Harvey M
2011-07-01
The incidence and severity of disease associated with toxigenic Clostridium difficile have increased in hospitals in North America from the emergence of newer, more virulent strains. Toxigenic C. difficile has been isolated from food animals and retail meat with potential implications of transfer to human beings. The objective of the present study was to determine the prevalence of C. difficile in pork from sausage manufacturing plants and retail meat in Texas. Twenty-three C. difficile isolates were detected from 243 meat samples (9.5%) from 3 sausage-manufacturing plants and 5 retail meat outlets from 2004 to 2009. Twenty-two isolates were positive for toxins A, B, and binary toxin, and were characterized as toxinotype V, PFGE type-NAP7, or "NAP7-variant." Susceptibilities to 11 antimicrobial agents in the current study were similar to those reported previously for toxinotype V isolates, although the results suggested somewhat reduced resistance than reported for other meat, animal, or human clinical toxinotype V isolates.
Silvia eTavares; Silvia eTavares; Markus eWirtz; Marcel Pascal Beier; Jochen eBogs; Jochen eBogs; Jochen eBogs; Ruediger eHell; Sara eAmâncio
2015-01-01
In higher plants cysteine biosynthesis is catalyzed by O-acetylserine(thiol)lyase (OASTL) and represents the last step of the assimilatory sulfate reduction pathway. It is mainly regulated by provision of O-acetylserine (OAS), the nitrogen/carbon containing backbone for fixation of reduced sulfur. OAS is synthesized by Serine acetyltransferase (SERAT), which reversibly interacts with OASTL in the cysteine synthase complex (CSC). In this study we identify and characterize the SERAT protein fam...
Tavares, Sílvia; Wirtz, Markus; Beier, Marcel P.; Bogs, Jochen; Hell, Rüdiger; Amâncio, Sara
2015-01-01
In higher plants cysteine biosynthesis is catalyzed by O-acetylserine(thiol)lyase (OASTL) and represents the last step of the assimilatory sulfate reduction pathway. It is mainly regulated by provision of O-acetylserine (OAS), the nitrogen/carbon containing backbone for fixation of reduced sulfur. OAS is synthesized by Serine acetyltransferase (SERAT), which reversibly interacts with OASTL in the cysteine synthase complex (CSC). In this study we identify and characterize the SERAT gene family...
George, Suja; Usha, B; Parida, Ajay
2009-05-01
Plant growth and productivity are adversely affected by various abiotic and biotic stress factors. Despite the wealth of information on abiotic stress and stress tolerance in plants, many aspects still remain unclear. Prosopis juliflora is a hardy plant reported to be tolerant to drought, salinity, extremes of soil pH, and heavy metal stress. In this paper, we report the isolation and characterization of the complementary DNA clone for an atypical late embryogenesis abundant (LEA) protein (Pj LEA3) and its putative promoter sequence from P. juliflora. Unlike typical LEA proteins, rich in glycine, Pj LEA3 has alanine as the most abundant amino acid followed by serine and shows an average negative hydropathy. Pj LEA3 is significantly different from other LEA proteins in the NCBI database and shows high similarity to indole-3 acetic-acid-induced protein ARG2 from Vigna radiata. Northern analysis for Pj LEA3 in P. juliflora leaves under 90 mM H2O2 stress revealed up-regulation of transcript at 24 and 48 h. A 1.5-kb fragment upstream the 5' UTR of this gene (putative promoter) was isolated and analyzed in silico. The possible reasons for changes in gene expression during stress in relation to the host plant's stress tolerance mechanisms are discussed.
GenoCAD Plant Grammar to Design Plant Expression Vectors for Promoter Analysis.
Coll, Anna; Wilson, Mandy L; Gruden, Kristina; Peccoud, Jean
2016-01-01
With the rapid advances in prediction tools for discovery of new promoters and their cis-elements, there is a need to improve plant expression methodologies in order to facilitate a high-throughput functional validation of these promoters in planta. The promoter-reporter analysis is an indispensible approach for characterization of plant promoters. It requires the design of complex plant expression vectors, which can be challenging. Here, we describe the use of a plant grammar implemented in GenoCAD that will allow the users to quickly design constructs for promoter analysis experiments but also for other in planta functional studies. The GenoCAD plant grammar includes a library of plant biological parts organized in structural categories to facilitate their use and management and a set of rules that guides the process of assembling these biological parts into large constructs.
International Nuclear Information System (INIS)
Jabeen, N.; Rasool, S.A.; Naz, S.A.
2014-01-01
Erwinia carotovora is a common soil borne plant pathogen, which generally infects plants of family Solanacea. In the present study, bacteriocin (CrNA5), produced by an indigenously isolated E. carotovora NA5 has been characterized and its possible anti phytopathogenic potential was shown in the field studies. CrNA5 showed its antimicrobial activity against many gram-positive and gram-negative bacteria including those associated with the plant diseases. The bacteriocin showed substantial stability against wide range of temperatures and pH. Additionally, it was also found resistant to the treatment of metal ions, organic solvents and non-proteolytic enzymes. Conversely, its inactivation by proteinase K and protease suggested its protein nature. Mode of action studies revealed that CrNA5 is bactericidal, particularly against Xanthomonas oryzae oryzae. The electron micrograph of CrNA5 revealed spherical particle (empty head) like structures implicating the vestigial bacteriophage based origin of carotovoricin. In silico analyses were also conducted in order to deduce the plausible ratio of the amino acids present in the protein. The In vivo experiments showed the efficacy of CrNA5 against X. oryzae oryzae (Xoo), the causative agent of bacterial leaf blight (BLB) of rice, both in controlled conditions (green house) as well as in field trials. To the best of our knowledge, the present study is the first of its kind with the bacteriocin of Erwinia origin (tested against the BLB infected plants in the field). It is expected that the present study will help visit new insights of the bacteriocins produced by Erwinia carotovora and their potential (application) as anti phytopathogenic agent. (author)
Haro von Mogel, Karl J.
Carbohydrate metabolism is a biologically, economically, and culturally important process in crop plants. Humans have selected many crop species such as maize (Zea mays L.) in ways that have resulted in changes to carbohydrate metabolic pathways, and understanding the underlying genetics of this pathway is therefore exceedingly important. A previously uncharacterized starch metabolic pathway mutant, sugary enhancer1 (se1), is a recessive modifier of sugary1 (su1) sweet corn that increases the sugar content while maintaining an appealing creamy texture. This allele has been incorporated into many sweet corn varieties since its discovery in the 1970s, however, testing for the presence of this allele has been difficult. A genetic stock was developed that allowed the presence of se1 to be visually scored in segregating ears, which were used to genetically map se1 to the deletion of a single gene model located on the distal end of the long arm of chromosome 2. An analysis of homology found that this gene is specific to monocots, and the gene is expressed in the endosperm and developing leaf. The se1 allele increased water soluble polysaccharide (WSP) and decreased amylopectin in maize endosperm, but there was no overall effect on starch content in mature leaves due to se1. This discovery will lead to a greater understanding of starch metabolism, and the marker developed will assist in breeding. There is a present need for increased training for plant breeders to meet the growing needs of the human population. To raise the profile of plant breeding among young students, a series of videos called Fields of Study was developed. These feature interviews with plant breeders who talk about what they do as plant breeders and what they enjoy about their chosen profession. To help broaden the education of students in college biology courses, and assist with the training of plant breeders, a second video series, Pollination Methods was developed. Each video focuses on one or two
Extraction and characterization of anthocyanin colorants from plant sources
Directory of Open Access Journals (Sweden)
S. Dyankova
2016-03-01
Full Text Available Abstract. Natural pigments (and especially those of anthocyanins are a valuable source of bioactive compounds and may be used in the production of new functional food ingredients. Furthermore, their applications in the treatment and prevention of chronic disorders are becoming more and more widespread. In the last few years consumers have focused their attention on the natural biologically active compounds as functional food ingredients, and therefore, it may be assumed that natural colorants are an alternative source of synthetic additives. The aim of the study was to determine the quantitative content of monomeric anthocyanin pigments in extracts obtained from eight plants. The total content of monomeric anthocyanin pigments was measured by a pH-differential method. The TLC analysis of the pigment extracts from the different plants showed intensive rose, red and violet stripes corresponding to the anthocyanin content. The extracts from chicory and lavender petals were unstable and their color decreased in intensity in 1 month. The analysis of the experimental data shows that the yield of pigment substances depends on a few factors: the type of plant, the preliminary treatment of the plant and the solvent that is used. The largest quantity of extracted substances in the studied plants were isolated from chokeberry (2 195.9 cyd eq mg/l, followed by blackberry (1 466.2 and one variety of the grapes (1 199.3 . In the case of chokeberry, the pigment content included a large number of anthocyanins and the combination of these components was the reason for the deep red/violet color of the extract. Fresh or frozen materials are the most suitable for extraction of anthocyanin pigments. On the whole, fruit pulp yielded a larger quantity of pigments than juice. Anthocyanins are water-soluble compounds and for that reason their isolation requires water and other polar solvents. Better stabilization of color is obtained by a slight acidification of the
Plants having modified response to ethylene
Meyerowitz, E.M.; Chang, C.; Bleecker, A.B.
1997-11-18
The invention includes transformed plants having at least one cell transformed with a modified ETR nucleic acid. Such plants have a phenotype characterized by a decrease in the response of at least one transformed plant cell to ethylene as compared to a plant not containing the transformed plant cell. Tissue and/or temporal specificity for expression of the modified ETR nucleic acid is controlled by selecting appropriate expression regulation sequences to target the location and/or time of expression of the transformed nucleic acid. The plants are made by transforming at least one plant cell with an appropriate modified ETR nucleic acid, regenerating plants from one or more of the transformed plant cells and selecting at least one plant having the desired phenotype. 31 figs.
Exserohilum rostratum: characterization of a cross-kingdom pathogen of plants and humans.
Directory of Open Access Journals (Sweden)
Kalpana Sharma
Full Text Available Pathogen host shifts represent a major source of new infectious diseases. There are several examples of cross-genus host jumps that have caused catastrophic epidemics in animal and plant species worldwide. Cross-kingdom jumps are rare, and are often associated with nosocomial infections. Here we provide an example of human-mediated cross-kingdom jumping of Exserohilum rostratum isolated from a patient who had received a corticosteroid injection and died of fungal meningitis in a Florida hospital in 2012. The clinical isolate of E. rostratum was compared with two plant pathogenic isolates of E. rostratum and an isolate of the closely related genus Bipolaris in terms of morphology, phylogeny, and pathogenicity on one C3 grass, Gulf annual rye grass (Lolium multiflorum, and two C4 grasses, Japanese stilt grass (Microstegium vimineum and bahia grass (Paspalum notatum. Colony growth and color, as well as conidia shape and size were the same for the clinical and plant isolates of E. rostratum, while these characteristics differed slightly for the Bipolaris sp. isolate. The plant pathogenic and clinical isolates of E. rostratum were indistinguishable based on morphology and ITS and 28S rDNA sequence analysis. The clinical isolate was as pathogenic to all grass species tested as the plant pathogenic strains that were originally isolated from plant hosts. The clinical isolate induced more severe symptoms on stilt grass than on rye grass, while this was the reverse for the plant isolates of E. rostratum. The phylogenetic similarity between the clinical and plant-associated E. rostratum isolates and the ability of the clinical isolate to infect plants suggests that a plant pathogenic strain of E. rostratum contaminated the corticosteroid injection fluid and was able to cause systemic disease in the affected patient. This is the first proof that a clinical isolate of E. rostratum is also an effective plant pathogen.
Carbon use by microorganisms in the rhizosphere microbiome has been linked to plant pathogen suppression and increased mineralization of soil nutrients for plant uptake, however factors that influence carbon use traits are poorly understood for most microbial groups. This work characterized the rela...
International Nuclear Information System (INIS)
Kim, Jae Sung; Song, Hi Sup; Lee, Young Keun; Lee, Byung Hun; Shin, In Chul; Lim, Young Taek
2000-04-01
This research was performed to investigate the effects of low dose γ-ray radiation on the seed germination and the following physiological responses in vegetable crops. Special attention was focused on whether the resistance of vegetables against the unfavorable conditions of environment such as subsequent high doses of radiation or Phytophthora blight of pepper could be enhanced as an aspect of radiation hormesis. Analysis and characterization of antioxidant enzyme from plant culture cells and radiation tolerant of transformed plants from antioxidant (POD) were accomplished in the plant irradiated with different dose of γ-ray. (author)
Energy Technology Data Exchange (ETDEWEB)
Kim, Jae Sung; Song, Hi Sup; Lee, Young Keun; Lee, Byung Hun; Shin, In Chul; Lim, Young Taek
2000-04-01
This research was performed to investigate the effects of low dose {gamma}-ray radiation on the seed germination and the following physiological responses in vegetable crops. Special attention was focused on whether the resistance of vegetables against the unfavorable conditions of environment such as subsequent high doses of radiation or Phytophthora blight of pepper could be enhanced as an aspect of radiation hormesis. Analysis and characterization of antioxidant enzyme from plant culture cells and radiation tolerant of transformed plants from antioxidant (POD) were accomplished in the plant irradiated with different dose of {gamma}-ray. (author)
International Nuclear Information System (INIS)
Kim, Jae Sung; Song, Hi Sup; Lee, Young Keun; Cun, Ki Jung; Shin, In Chul; Lim, Young Taek
1999-04-01
This research was performed to investigate the effects of low dose γ-ray radiation on the seed germination and the following physiological responses in vegetable crops. Special attention was focused on whether the resistance of vegetables against the unfavorable conditions of environment such as acid rain or soil types could be enhanced as an aspect of radiation hormesis. Analysis and characterization of antioxidant enzyme from plant culture cells and radiation tolerant of transformed plants from antioxidant enzyme (POD) were accomplished in the plant irradiated with difference dosage of γ-ray
Energy Technology Data Exchange (ETDEWEB)
Kim, Jae Sung; Song, Hi Sup; Lee, Young Keun; Cun, Ki Jung; Shin, In Chul; Lim, Young Taek
1999-04-01
This research was performed to investigate the effects of low dose {gamma}-ray radiation on the seed germination and the following physiological responses in vegetable crops. Special attention was focused on whether the resistance of vegetables against the unfavorable conditions of environment such as acid rain or soil types could be enhanced as an aspect of radiation hormesis. Analysis and characterization of antioxidant enzyme from plant culture cells and radiation tolerant of transformed plants from antioxidant enzyme (POD) were accomplished in the plant irradiated with difference dosage of {gamma}-ray.
International Nuclear Information System (INIS)
1994-09-01
The Y-12 Plant Remedial Action Technology Logic Diagram (TLD) was developed to provide a decision-support tool that relates environmental restoration (ER) problems at the Y-12 Plant to potential technologies that can remediate theses problems. The TLD identifies the research, development, demonstration, testing, and evaluation needed for sufficient development of these technologies to allow for technology transfer and application to remedial action (RA) activities. The TLD consists of three volumes. Volume 1 contains an overview of the TLD, an explanation of the program-specific responsibilities, a review of identified technologies, and the rankings of remedial technologies. Volume 2 contains the logic linkages among environmental management goals, environmental problems, and the various technologies that have the potential to solve these problems. Volume 3 contains the TLD data sheets. This report is Part B of Volume 3 and contains the Characterization and Robotics/Automation sections
Ahmad, Tarique; Ahmad, Kafeel; Alam, Mehtab
2018-03-01
All water treatment plants produce waste/residue amid the treatment of raw water. This study selectively investigates the clariflocculator sludge for its physicochemical characteristics and potential reuse options. Sieve analysis, XRF, SEM, XRD, FTIR, and TG-DTA instrumental techniques have been used to characterize the sludge sample. Results show that clariflocculator sludge contains about 78% fine sand having grain size range 150-75 μm. SiO2, Al2O3, Fe2O3 and CaO constitute the maximum percentage of chemical compounds present in the sludge and quartz is the main crystalline phase of the sludge. Recycling and reuse of this sludge, especially, as fine sand in preparing mortar, concrete mix and other civil engineering products would pave the way for constructive utilization with safe and sustainable sludge management strategies.
Papa, Gabriella; Spagnol, Manuela; Tambone, Fulvia; Pilu, Roberto; Scaglia, Barbara; Adani, Fabrizio
2010-02-01
Previous studies suggested that micropore surface area (MSA) of alkali-soluble bio-macromolecules of aerial plant residues of maize constitutes an important factor that explains their humification in soil, that is, preservation against biological degradation. On the other hand, root plant residue contributes to the soil humus balance, as well. Following the experimental design used in a previous paper published in this journal, this study shows that the biochemical recalcitrance of the alkali-soluble acid-insoluble fraction of the root plant material, contributed to the root maize humification of both Wild-type maize plants and its corresponding mutant brown midrib (bm3), this latter characterized by reduced lignin content. Humic acids (HAs) existed in root (root-HAs) were less degraded in soil than corresponding HAs existed in shoot (shoot-HAs): shoot-HAs bm3 (48%)>shoot-HAs Wild-type (37%)>root-HAs Wild-type (33%)>root-HAs bm3 (22%) (degradability shown in parenthesis). These differences were related to the MSA of HAs, that is, root-HAs having a higher MSA than shoot-HAs: shoot-HAs bm3 (41.43+/-1.2m(2)g(-1))
Multinationals and plant survival
DEFF Research Database (Denmark)
Bandick, Roger
2010-01-01
The aim of this paper is twofold: first, to investigate how different ownership structures affect plant survival, and second, to analyze how the presence of foreign multinational enterprises (MNEs) affects domestic plants’ survival. Using a unique and detailed data set on the Swedish manufacturing...... sector, I am able to separate plants into those owned by foreign MNEs, domestic MNEs, exporting non-MNEs, and purely domestic firms. In line with previous findings, the result, when conditioned on other factors affecting survival, shows that foreign MNE plants have lower survival rates than non......-MNE plants. However, separating the non-MNEs into exporters and non-exporters, the result shows that foreign MNE plants have higher survival rates than non-exporting non-MNEs, while the survival rates of foreign MNE plants and exporting non-MNE plants do not seem to differ. Moreover, the simple non...
Characterization of ash pond ashes from 3rd thermal power plant by SEM/EDX and XRD methods
Directory of Open Access Journals (Sweden)
A Minjigmaa
2014-10-01
Full Text Available Coal combustion by products from ash pond of 3rdthermal power plant of Ulaanbaatar city have been collected in 2010 and 2013 years. The ash samples have been characterized by XRD, XRF and SEM-EDX methods in order to evaluate their chemical and mineralogical composition changes with disposed times. The mineralogical composition of ash varies with time though the chemical composition of the ashes were close each other. Possibly, inefficient operating condition of the TPS shows influence on the mineralogical composition.DOI: http://dx.doi.org/10.5564/mjc.v14i0.201Mongolian Journal of Chemistry 14 (40, 2013, p61-65
Rüping, Boris; Ernst, Antonia M; Jekat, Stephan B; Nordzieke, Steffen; Reineke, Anna R; Müller, Boje; Bornberg-Bauer, Erich; Prüfer, Dirk; Noll, Gundula A
2010-10-08
The phloem of dicotyledonous plants contains specialized P-proteins (phloem proteins) that accumulate during sieve element differentiation and remain parietally associated with the cisternae of the endoplasmic reticulum in mature sieve elements. Wounding causes P-protein filaments to accumulate at the sieve plates and block the translocation of photosynthate. Specialized, spindle-shaped P-proteins known as forisomes that undergo reversible calcium-dependent conformational changes have evolved exclusively in the Fabaceae. Recently, the molecular characterization of three genes encoding forisome components in the model legume Medicago truncatula (MtSEO1, MtSEO2 and MtSEO3; SEO = sieve element occlusion) was reported, but little is known about the molecular characteristics of P-proteins in non-Fabaceae. We performed a comprehensive genome-wide comparative analysis by screening the M. truncatula, Glycine max, Arabidopsis thaliana, Vitis vinifera and Solanum phureja genomes, and a Malus domestica EST library for homologs of MtSEO1, MtSEO2 and MtSEO3 and identified numerous novel SEO genes in Fabaceae and even non-Fabaceae plants, which do not possess forisomes. Even in Fabaceae some SEO genes appear to not encode forisome components. All SEO genes have a similar exon-intron structure and are expressed predominantly in the phloem. Phylogenetic analysis revealed the presence of several subgroups with Fabaceae-specific subgroups containing all of the known as well as newly identified forisome component proteins. We constructed Hidden Markov Models that identified three conserved protein domains, which characterize SEO proteins when present in combination. In addition, one common and three subgroup specific protein motifs were found in the amino acid sequences of SEO proteins. SEO genes are organized in genomic clusters and the conserved synteny allowed us to identify several M. truncatula vs G. max orthologs as well as paralogs within the G. max genome. The unexpected
PlantSize Offers an Affordable, Non-destructive Method to Measure Plant Size and Color in Vitro
Directory of Open Access Journals (Sweden)
Dóra Faragó
2018-02-01
Full Text Available Plant size, shape and color are important parameters of plants, which have traditionally been measured by destructive and time-consuming methods. Non-destructive image analysis is an increasingly popular technology to characterize plant development in time. High throughput automatic phenotyping platforms can simultaneously analyze multiple morphological and physiological parameters of hundreds or thousands of plants. Such platforms are, however, expensive and are not affordable for many laboratories. Moreover, determination of basic parameters is sufficient for most studies. Here we describe a non-invasive method, which simultaneously measures basic morphological and physiological parameters of in vitro cultured plants. Changes of plant size, shape and color is monitored by repeated photography with a commercial digital camera using neutral white background. Images are analyzed with the MatLab-based computer application PlantSize, which simultaneously calculates several parameters including rosette size, convex area, convex ratio, chlorophyll and anthocyanin contents of all plants identified on the image. Numerical data are exported in MS Excel-compatible format. Subsequent data processing provides information on growth rates, chlorophyll and anthocyanin contents. Proof-of-concept validation of the imaging technology was demonstrated by revealing small but significant differences between wild type and transgenic Arabidopsis plants overexpressing the HSFA4A transcription factor or the hsfa4a knockout mutant, subjected to different stress conditions. While HSFA4A overexpression was associated with better growth, higher chlorophyll and lower anthocyanin content in saline conditions, the knockout hsfa4a mutant showed hypersensitivity to various stresses. Morphological differences were revealed by comparing rosette size, shape and color of wild type plants with phytochrome B (phyB-9 mutant. While the technology was developed with Arabidopsis plants
Patterns of genetic diversity in three plant lineages endemic to the Cape Verde Islands.
Romeiras, Maria M; Monteiro, Filipa; Duarte, M Cristina; Schaefer, Hanno; Carine, Mark
2015-05-15
Conservation of plant diversity on islands relies on a good knowledge of the taxonomy, distribution and genetic diversity of species. In recent decades, a combination of morphology- and DNA-based approaches has become the standard for investigating island plant lineages and this has led, in some cases, to the discovery of previously overlooked diversity, including 'cryptic species'. The flora of the Cape Verde archipelago in the North Atlantic is currently thought to comprise ∼740 vascular plant species, 92 of them endemics. Despite the fact that it is considered relatively well known, there has been a 12 % increase in the number of endemics in the last two decades. Relatively few of the Cape Verde plant lineages have been included in genetic studies so far and little is known about the patterns of diversification in the archipelago. Here we present an updated list for the endemic Cape Verde flora and analyse diversity patterns for three endemic plant lineages (Cynanchum, Globularia and Umbilicus) based on one nuclear (ITS) and four plastid DNA regions. In all three lineages, we find genetic variation. In Cynanchum, we find two distinct haplotypes with no clear geographical pattern, possibly reflecting different ploidy levels. In Globularia and Umbilicus, differentiation is evident between populations from northern and southern islands. Isolation and drift resulting from the small and fragmented distributions, coupled with the significant distances separating the northern and southern islands, could explain this pattern. Overall, our study suggests that the diversity in the endemic vascular flora of Cape Verde is higher than previously thought and further work is necessary to characterize the flora. Published by Oxford University Press on behalf of the Annals of Botany Company.
Mousa, Walaa Kamel; Schwan, Adrian L; Raizada, Manish N
2016-09-03
Finger millet is an ancient African-Indian crop that is resistant to many pathogens including the fungus, Fusarium graminearum. We previously reported the first isolation of putative fungal endophytes from finger millet and showed that the crude extracts of four strains had anti-Fusarium activity. However, active compounds were isolated from only one strain. The objectives of this study were to confirm the endophytic lifestyle of the three remaining anti-Fusarium isolates, to identify the major underlying antifungal compounds, and to initially characterize the mode(s) of action of each compound. Results of confocal microscopy and a plant disease assay were consistent with the three fungal strains behaving as endophytes. Using bio-assay guided fractionation and spectroscopic structural elucidation, three anti-Fusarium secondary metabolites were purified and characterized. These molecules were not previously reported to derive from fungi nor have antifungal activity. The purified antifungal compounds were: 5-hydroxy 2(3H)-benzofuranone, dehydrocostus lactone (guaianolide sesquiterpene lactone), and harpagoside (an iridoide glycoside). Light microscopy and vitality staining were used to visualize the in vitro interactions between each compound and Fusarium; the results suggested a mixed fungicidal/fungistatic mode of action. We conclude that finger millet possesses fungal endophytes that can synthesize anti-fungal compounds not previously reported as bio-fungicides against F. graminearum.
Overexpression of the PtSOS2 gene improves tolerance to salt stress in transgenic poplar plants.
Yang, Yang; Tang, Ren-Jie; Jiang, Chun-Mei; Li, Bei; Kang, Tao; Liu, Hua; Zhao, Nan; Ma, Xu-Jun; Yang, Lei; Chen, Shao-Liang; Zhang, Hong-Xia
2015-09-01
In higher plants, the salt overly sensitive (SOS) signalling pathway plays a crucial role in maintaining ion homoeostasis and conferring salt tolerance under salinity condition. Previously, we functionally characterized the conserved SOS pathway in the woody plant Populus trichocarpa. In this study, we demonstrate that overexpression of the constitutively active form of PtSOS2 (PtSOS2TD), one of the key components of this pathway, significantly increased salt tolerance in aspen hybrid clone Shanxin Yang (Populus davidiana × Populus bolleana). Compared to the wild-type control, transgenic plants constitutively expressing PtSOS2TD exhibited more vigorous growth and produced greater biomass in the presence of high concentrations of NaCl. The improved salt tolerance was associated with a decreased Na(+) accumulation in the leaves of transgenic plants. Further analyses revealed that plasma membrane Na(+) /H(+) exchange activity and Na(+) efflux in transgenic plants were significantly higher than those in the wild-type plants. Moreover, transgenic plants showed improved capacity in scavenging reactive oxygen species (ROS) generated by salt stress. Taken together, our results suggest that PtSOS2 could serve as an ideal target gene to genetically engineer salt-tolerant trees. © 2015 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.
Pinellas Plant Environmental Baseline Report
Energy Technology Data Exchange (ETDEWEB)
1997-06-01
The Pinellas Plant has been part of the Department of Energy`s (DOE) nuclear weapons complex since the plant opened in 1957. In March 1995, the DOE sold the Pinellas Plant to the Pinellas County Industry Council (PCIC). DOE has leased back a large portion of the plant site to facilitate transition to alternate use and safe shutdown. The current mission is to achieve a safe transition of the facility from defense production and prepare the site for alternative uses as a community resource for economic development. Toward that effort, the Pinellas Plant Environmental Baseline Report (EBR) discusses the current and past environmental conditions of the plant site. Information for the EBR is obtained from plant records. Historical process and chemical usage information for each area is reviewed during area characterizations.
Cold flow model study of an oxyfuel combustion pilot plant
Energy Technology Data Exchange (ETDEWEB)
Guio-Perez, D.C.; Tondl, G.; Hoeltl, W.; Proell, T.; Hofbauer, H. [Vienna University of Technology, Institute of Chemical Engineering, Vienna (Austria)
2011-12-15
The fluid-dynamic behavior of a circulating fluidized bed pilot plant for oxyfuel combustion was studied in a cold flow model, down-scaled using Glicksman's criteria. Pressures along the unit and the global circulation rate were used for characterization. The analysis of five operating parameters and their influence on the system was carried out; namely, total solids inventory and the air velocity of primary, secondary, loop seal and support fluidizations. The cold flow model study shows that the reactor design allows stable operation at a wide range of fluidization rates, with results that agree well with previous observations described in the literature. (Copyright copyright 2011 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)
Phytozome Comparative Plant Genomics Portal
Energy Technology Data Exchange (ETDEWEB)
Goodstein, David; Batra, Sajeev; Carlson, Joseph; Hayes, Richard; Phillips, Jeremy; Shu, Shengqiang; Schmutz, Jeremy; Rokhsar, Daniel
2014-09-09
The Dept. of Energy Joint Genome Institute is a genomics user facility supporting DOE mission science in the areas of Bioenergy, Carbon Cycling, and Biogeochemistry. The Plant Program at the JGI applies genomic, analytical, computational and informatics platforms and methods to: 1. Understand and accelerate the improvement (domestication) of bioenergy crops 2. Characterize and moderate plant response to climate change 3. Use comparative genomics to identify constrained elements and infer gene function 4. Build high quality genomic resource platforms of JGI Plant Flagship genomes for functional and experimental work 5. Expand functional genomic resources for Plant Flagship genomes
Directory of Open Access Journals (Sweden)
Yoko Miyasaki
Full Text Available The number of fully active antibiotic options that treat nosocomial infections due to multidrug-resistant Acinetobacter baumannii (A. baumannii is extremely limited. Magnolia officinalis, Mahonia bealei, Rabdosia rubescens, Rosa rugosa, Rubus chingii, Scutellaria baicalensis, and Terminalia chebula plant extracts were previously shown to have growth inhibitory activity against a multidrug-resistant clinical strain of A. baumannii. In this study, the compounds responsible for their antimicrobial activity were identified by fractionating each plant extract using high performance liquid chromatography, and determining the antimicrobial activity of each fraction against A. baumannii. The chemical structures of the fractions inhibiting >40% of the bacterial growth were elucidated by liquid chromatography/mass spectrometry analysis and nuclear magnetic resonance spectroscopy. The six most active compounds were identified as: ellagic acid in Rosa rugosa; norwogonin in Scutellaria baicalensis; and chebulagic acid, chebulinic acid, corilagin, and terchebulin in Terminalia chebula. The most potent compound was identified as norwogonin with a minimum inhibitory concentration of 128 µg/mL, and minimum bactericidal concentration of 256 µg/mL against clinically relevant strains of A. baumannii. Combination studies of norwogonin with ten anti-Gram negative bacterial agents demonstrated that norwogonin did not enhance the antimicrobial activity of the synthetic antibiotics chosen for this study. In conclusion, of all identified antimicrobial compounds, norwogonin was the most potent against multidrug-resistant A. baumannii strains. Further studies are warranted to ascertain the prophylactic and therapeutic potential of norwogonin for infections due to multidrug-resistant A. baumannii.
Reassessing the Potential Activities of Plant CGI-58 Protein
Khatib, Abdallah; Arhab, Yani; Bentebibel, Assia; Abousalham, Abdelkarim; Noiriel, Alexandre
2016-01-01
Comparative Gene Identification-58 (CGI-58) is a widespread protein found in animals and plants. This protein has been shown to participate in lipolysis in mice and humans by activating Adipose triglyceride lipase (ATGL), the initial enzyme responsible for the triacylglycerol (TAG) catabolism cascade. Human mutation of CGI-58 is the cause of Chanarin-Dorfman syndrome, an orphan disease characterized by a systemic accumulation of TAG which engenders tissue disorders. The CGI-58 protein has also been shown to participate in neutral lipid metabolism in plants and, in this case, a mutation again provokes TAG accumulation. Although its roles as an ATGL coactivator and in lipid metabolism are quite clear, the catalytic activity of CGI-58 is still in question. The acyltransferase activities of CGI-58 have been speculated about, reported or even dismissed and experimental evidence that CGI-58 expressed in E. coli possesses an unambiguous catalytic activity is still lacking. To address this problem, we developed a new set of plasmids and site-directed mutants to elucidate the in vivo effects of CGI-58 expression on lipid metabolism in E. coli. By analyzing the lipid composition in selected E. coli strains expressing CGI-58 proteins, and by reinvestigating enzymatic tests with adequate controls, we show here that recombinant plant CGI-58 has none of the proposed activities previously described. Recombinant plant and mouse CGI-58 both lack acyltransferase activity towards either lysophosphatidylglycerol or lysophosphatidic acid to form phosphatidylglycerol or phosphatidic acid and recombinant plant CGI-58 does not catalyze TAG or phospholipid hydrolysis. However, expression of recombinant plant CGI-58, but not mouse CGI-58, led to a decrease in phosphatidylglycerol in all strains of E. coli tested, and a mutation of the putative catalytic residues restored a wild-type phenotype. The potential activities of plant CGI-58 are subsequently discussed. PMID:26745266
Reassessing the Potential Activities of Plant CGI-58 Protein.
Directory of Open Access Journals (Sweden)
Abdallah Khatib
Full Text Available Comparative Gene Identification-58 (CGI-58 is a widespread protein found in animals and plants. This protein has been shown to participate in lipolysis in mice and humans by activating Adipose triglyceride lipase (ATGL, the initial enzyme responsible for the triacylglycerol (TAG catabolism cascade. Human mutation of CGI-58 is the cause of Chanarin-Dorfman syndrome, an orphan disease characterized by a systemic accumulation of TAG which engenders tissue disorders. The CGI-58 protein has also been shown to participate in neutral lipid metabolism in plants and, in this case, a mutation again provokes TAG accumulation. Although its roles as an ATGL coactivator and in lipid metabolism are quite clear, the catalytic activity of CGI-58 is still in question. The acyltransferase activities of CGI-58 have been speculated about, reported or even dismissed and experimental evidence that CGI-58 expressed in E. coli possesses an unambiguous catalytic activity is still lacking. To address this problem, we developed a new set of plasmids and site-directed mutants to elucidate the in vivo effects of CGI-58 expression on lipid metabolism in E. coli. By analyzing the lipid composition in selected E. coli strains expressing CGI-58 proteins, and by reinvestigating enzymatic tests with adequate controls, we show here that recombinant plant CGI-58 has none of the proposed activities previously described. Recombinant plant and mouse CGI-58 both lack acyltransferase activity towards either lysophosphatidylglycerol or lysophosphatidic acid to form phosphatidylglycerol or phosphatidic acid and recombinant plant CGI-58 does not catalyze TAG or phospholipid hydrolysis. However, expression of recombinant plant CGI-58, but not mouse CGI-58, led to a decrease in phosphatidylglycerol in all strains of E. coli tested, and a mutation of the putative catalytic residues restored a wild-type phenotype. The potential activities of plant CGI-58 are subsequently discussed.
Stillwater Hybrid Geo-Solar Power Plant Optimization Analyses
Energy Technology Data Exchange (ETDEWEB)
Wendt, Daniel S.; Mines, Gregory L.; Turchi, Craig S.; Zhu, Guangdong; Cohan, Sander; Angelini, Lorenzo; Bizzarri, Fabrizio; Consoli, Daniele; De Marzo, Alessio
2015-09-02
The Stillwater Power Plant is the first hybrid plant in the world able to bring together a medium-enthalpy geothermal unit with solar thermal and solar photovoltaic systems. Solar field and power plant models have been developed to predict the performance of the Stillwater geothermal / solar-thermal hybrid power plant. The models have been validated using operational data from the Stillwater plant. A preliminary effort to optimize performance of the Stillwater hybrid plant using optical characterization of the solar field has been completed. The Stillwater solar field optical characterization involved measurement of mirror reflectance, mirror slope error, and receiver position error. The measurements indicate that the solar field may generate 9% less energy than the design value if an appropriate tracking offset is not employed. A perfect tracking offset algorithm may be able to boost the solar field performance by about 15%. The validated Stillwater hybrid plant models were used to evaluate hybrid plant operating strategies including turbine IGV position optimization, ACC fan speed and turbine IGV position optimization, turbine inlet entropy control using optimization of multiple process variables, and mixed working fluid substitution. The hybrid plant models predict that each of these operating strategies could increase net power generation relative to the baseline Stillwater hybrid plant operations.
Singh, Kanchan Lata; Singh, D K; Singh, Vinay Kumar
2012-01-01
The molluscicidal activity of Bauhinia variegata leaf and Mimusops elengi bark was studied against vector snail Lymnaea acuminata. The toxicity of both plants was time and concentration-dependent. Among organic extracts, ethanol extracts of both plants were more toxic. Toxicity of B. variegata leaf ethanolic extract (96h LC50- 14.4 mg/L) was more pronounced than M. elengi bark ethanolic extract (96h LC50-15.0 mg/L). The 24h LC50 of column purified fraction of B. variegata and M. elengi bark were 20.3 mg/L and 18.3 mg/L, respectively. Saponin and quercetin were characterized and identified as active molluscicidal component. Co-migration of saponin (Rf 0.48) and quercetin (Rf 0.52) with column purified bark of M. elengi and leaf of B. variegata on thin layer chromatography demonstrate same Rf value i.e. 0.48 and 0.52, respectively. The present study clearly indicates the possibility of using M. elengi and/or B. variegata as potent molluscicide.
International Nuclear Information System (INIS)
Anastos, G.J.; Johnson, G.M.; Schapot, R.M.; Velez, V.G.
1990-01-01
Town gas plant sites are receiving increasing attention from the utility industry and regulatory communities. This attention has been prompted by greater environmental awareness of impacts due to past disposal practices and the understanding that gas plant wastes contain a wide range of chemical constituents that have persisted in the environment. This paper discusses the history of the town gas plant industry, the various processes utilized and the resultant by-products and wastes. Potential problem areas relating to these sites as well as potential approaches to site characterization are addressed. Included are recommendations for the phasing of site investigations and the use of relatively inexpensive and rapid field screening techniques to identify contamination
PREDICTION MODELS OF GRAIN YIELD AND CHARACTERIZATION
Directory of Open Access Journals (Sweden)
Narciso Ysac Avila Serrano
2009-06-01
Full Text Available With the objective to characterize the grain yield of five cowpea cultivars and to find linear regression models to predict it, a study was developed in La Paz, Baja California Sur, Mexico. A complete randomized blocks design was used. Simple and multivariate analyses of variance were carried out using the canonical variables to characterize the cultivars. The variables cluster per plant, pods per plant, pods per cluster, seeds weight per plant, seeds hectoliter weight, 100-seed weight, seeds length, seeds wide, seeds thickness, pods length, pods wide, pods weight, seeds per pods, and seeds weight per pods, showed significant differences (P≤ 0.05 among cultivars. Paceño and IT90K-277-2 cultivars showed the higher seeds weight per plant. The linear regression models showed correlation coefficients ≥0.92. In these models, the seeds weight per plant, pods per cluster, pods per plant, cluster per plant and pods length showed significant correlations (P≤ 0.05. In conclusion, the results showed that grain yield differ among cultivars and for its estimation, the prediction models showed determination coefficients highly dependable.
Baier, Anne Kathrin
2016-01-01
The aim of this thesis was to evaluate the potential of high isostatic pressure and pulsed electric fields for the production of high quality plant proteins. Induced changes in protein solutions and plant tissue of potato and pea were analyzed by means of structural and techno-functional characterization as well as by investigation of diffusion and extractions procedures. The application of high isostatic pressure provides a gentle alternative to conventional heat preservation. Especially ...
Demers, Jill E.; Gugino, Beth K.
2014-01-01
The diversity and genetic differentiation of populations of Fusarium oxysporum associated with tomato fields, both endophytes obtained from tomato plants and isolates obtained from soil surrounding the sampled plants, were investigated. A total of 609 isolates of F. oxysporum were obtained, 295 isolates from a total of 32 asymptomatic tomato plants in two fields and 314 isolates from eight soil cores sampled from the area surrounding the plants. Included in this total were 112 isolates from the stems of all 32 plants, a niche that has not been previously included in F. oxysporum population genetics studies. Isolates were characterized using the DNA sequence of the translation elongation factor 1α gene. A diverse population of 26 sequence types was found, although two sequence types represented nearly two-thirds of the isolates studied. The sequence types were placed in different phylogenetic clades within F. oxysporum, and endophytic isolates were not monophyletic. Multiple sequence types were found in all plants, with an average of 4.2 per plant. The population compositions differed between the two fields but not between soil samples within each field. A certain degree of differentiation was observed between populations associated with different tomato cultivars, suggesting that the host genotype may affect the composition of plant-associated F. oxysporum populations. No clear patterns of genetic differentiation were observed between endophyte populations and soil populations, suggesting a lack of specialization of endophytic isolates. PMID:25304514
Evolution of allosteric regulation in chorismate mutases from early plants
Energy Technology Data Exchange (ETDEWEB)
Kroll, Kourtney; Holland, Cynthia K.; Starks, Courtney M.; Jez, Joseph M.
2017-09-28
Plants, fungi, and bacteria synthesize the aromatic amino acids: l-phenylalanine, l-tyrosine, and l-tryptophan. Chorismate mutase catalyzes the branch point reaction of phenylalanine and tyrosine biosynthesis to generate prephenate. In Arabidopsis thaliana, there are two plastid-localized chorismate mutases that are allosterically regulated (AtCM1 and AtCM3) and one cytosolic isoform (AtCM2) that is unregulated. Previous analysis of plant chorismate mutases suggested that the enzymes from early plants (i.e. bryophytes/moss, lycophytes, and basal angiosperms) formed a clade distinct from the isoforms found in flowering plants; however, no biochemical information on these enzymes is available. To understand the evolution of allosteric regulation in plant chorismate mutases, we analyzed a basal lineage of plant enzymes homologous to AtCM1 based on sequence similarity. The chorismate mutases from the moss/bryophyte Physcomitrella patens (PpCM1 and PpCM2), the lycophyte Selaginella moellendorffii (SmCM), and the basal angiosperm Amborella trichopoda (AmtCM1 and AmtCM2) were characterized biochemically. Tryptophan was a positive effector for each of the five enzymes examined. Histidine was a weak positive effector for PpCM1 and AmtCM1. Neither tyrosine nor phenylalanine altered the activity of SmCM; however, tyrosine was a negative regulator of the other four enzymes. Phenylalanine down-regulates both moss enzymes and AmtCM2. The 2.0 Å X-ray crystal structure of PpCM1 in complex with the tryptophan identified the allosteric effector site and reveals structural differences between the R- (more active) and T-state (less active) forms of plant chorismate mutases. Molecular insight into the basal plant chorismate mutases guides our understanding of the evolution of allosteric regulation in these enzymes.
ORNL process waste treatment plant modifications
International Nuclear Information System (INIS)
Bell, J.P.
1982-01-01
The ORNL Process Waste Treatment Plant removes low levels of radionuclides (primarily Cs-137 and Sr-90) from process waste water prior to discharge. The previous plant operation used a scavenging precipitaton - ion exchange process which produced a radioactive sludge. In order to eliminate the environmental problems associated with sludge disposal, the plant is being converted to a new ion exchange process without the precipitation process
Ishizawa, Hidehiro; Kuroda, Masashi; Morikawa, Masaaki; Ike, Michihiko
2017-09-01
Bacteria colonizing the plant rhizosphere are believed to positively or negatively affect the host plant productivity. This feature has inspired researchers to engineer such interactions to enhance crop production. However, it remains to be elucidated whether rhizobacteria influences plant oxidative stress vis-a-vis other environmental stressors, and whether such influence is associated with their growth promoting/inhibiting ability. In this study, two plant growth-promoting bacteria (PGPB) and two plant growth-inhibiting bacteria (PGIB) were separately inoculated into axenic duckweed (Lemna minor) culture under laboratory conditions for 4 and 8 days in order to investigate their effects on plant oxidative stress and antioxidant activities. As previously characterized, the inoculation of PGPB and PGIB strains accelerated and reduced the growth of L. minor, respectively. After 4 and 8 days of cultivation, compared to the PGPB strains, the PGIB strains induced larger amounts of O 2 •- , H 2 O 2 , and malondialdehyde (MDA) in duckweed, although all bacterial strains consistently increased O 2 •- content by two times more than that in the aseptic control plants. Activities of five antioxidant enzymes were also elevated by the inoculation of PGIB, confirming the severe oxidative stress condition in plants. These results suggest that the surface attached bacteria affect differently on host oxidative stress and its response, which degree correlates negatively to their effects on plant growth. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Directory of Open Access Journals (Sweden)
Longfei Zhao
2015-12-01
Full Text Available Abstract A total of 48 endophytic bacteria were isolated from surface-sterilized tissues of the medicinal plant Lonicera japonica, which is grown in eastern China; six strains were selected for further study based on their potential ability to promote plant growth in vitro (siderophore and indoleacetic acid production. The bacteria were characterized by phylogenetically analyzing their 16S rRNA gene similarity, by examining their effect on the mycelial development of pathogenic fungi, by testing their potential plant growth-promoting characteristics, and by measuring wheat growth parameters after inoculation. Results showed that the number of endophytic bacteria in L. japonica varied among different tissues, but it remained relatively stable in the same tissues from four different plantation locations. Among the three endophytic strains, strains 122 and 124 both had high siderophore production, with the latter showing the highest phosphate solubilization activity (45.6 mg/L and aminocyclopropane-1-carboxylic acid deaminase activity (47.3 nmol/mg/h. Strain 170 had the highest indoleacetic acid (IAA production (49.2 mg/L and cellulase and pectinase activities. After inoculation, most of the six selected isolates showed a strong capacity to promote wheat growth. Compared with the controls, the increase in the shoot length, root length, fresh weight, dry weight, and chlorophyll content was most remarkable in wheat seedlings inoculated with strain 130. The positive correlation between enzyme (cellulose and pectinase activity and inhibition rate on Fusarium oxysporum, the IAA production, and the root length of wheat seedlings inoculated with each tested endophytic strain was significant in regression analysis. Deformity of pathogenic fungal mycelia was observed under a microscope after the interaction with the endophytic isolates. Such deformity may be directly related to the production of hydrolytic bacterial enzymes (cellulose and pectinase. The six
TRU waste characterization chamber gloveboxes
International Nuclear Information System (INIS)
Duncan, D. S.
1998-01-01
Argonne National Laboratory-West (ANL-W) is participating in the Department of Energy's (DOE) National Transuranic Waste Program in support of the Waste Isolation Pilot Plant (WIPP). The Laboratory's support currently consists of intrusive characterization of a selected population of drums containing transuranic waste. This characterization is performed in a complex of alpha containment gloveboxes termed the Waste Characterization Gloveboxes. Made up of the Waste Characterization Chamber, Sample Preparation Glovebox, and the Equipment Repair Glovebox, they were designed as a small production characterization facility for support of the Idaho National Engineering and Environmental Laboratory (INEEL). This paper presents salient features of these gloveboxes
Mininno, Morgane; Brugière, Sabine; Pautre, Virginie; Gilgen, Annabelle; Ma, Sheng; Ferro, Myriam; Tardif, Marianne; Alban, Claude; Ravanel, Stéphane
2012-01-01
In pea (Pisum sativum), the protein-lysine methyltransferase (PsLSMT) catalyzes the trimethylation of Lys-14 in the large subunit (LS) of ribulose 1,5-bisphosphate carboxylase/oxygenase (Rubisco), the enzyme catalyzing the CO2 fixation step during photosynthesis. Homologs of PsLSMT, herein referred to as LSMT-like enzymes, are found in all plant genomes, but methylation of LS Rubisco is not universal in the plant kingdom, suggesting a species-specific protein substrate specificity of the methyltransferase. In this study, we report the biochemical characterization of the LSMT-like enzyme from Arabidopsis thaliana (AtLSMT-L), with a focus on its substrate specificity. We show that, in Arabidopsis, LS Rubisco is not naturally methylated and that the physiological substrates of AtLSMT-L are chloroplastic fructose 1,6-bisphosphate aldolase isoforms. These enzymes, which are involved in the assimilation of CO2 through the Calvin cycle and in chloroplastic glycolysis, are trimethylated at a conserved lysyl residue located close to the C terminus. Both AtLSMT-L and PsLSMT are able to methylate aldolases with similar kinetic parameters and product specificity. Thus, the divergent substrate specificity of LSMT-like enzymes from pea and Arabidopsis concerns only Rubisco. AtLSMT-L is able to interact with unmethylated Rubisco, but the complex is catalytically unproductive. Trimethylation does not modify the kinetic properties and tetrameric organization of aldolases in vitro. The identification of aldolases as methyl proteins in Arabidopsis and other species like pea suggests a role of protein lysine methylation in carbon metabolism in chloroplasts. PMID:22547063
Presta, Luana; Bosi, Emanuele; Fondi, Marco; Maida, Isabel; Perrin, Elena; Miceli, Elisangela; Maggini, Valentina; Bogani, Patrizia; Firenzuoli, Fabio; Di Pilato, Vincenzo; Rossolini, Gian Maria; Mengoni, Alessio; Fani, Renato
2017-04-01
In recent years, there has been increasing interest in plant microbiota; however, despite medicinal plant relevance, very little is known about their highly complex endophytic communities. In this work, we report on the genomic and phenotypic characterization of the antimicrobial compound producer Rheinheimera sp. EpRS3, a bacterial strain isolated from the rhizospheric soil of the medicinal plant Echinacea purpurea. In particular, EpRS3 is able to inhibit growth of different bacterial pathogens (Bcc, Acinetobacter baumannii, and Klebsiella pneumoniae) which might be related to the presence of gene clusters involved in the biosynthesis of different types of secondary metabolites. The outcomes presented in this work highlight the fact that the strain possesses huge biotechnological potential; indeed, it also shows antimicrobial effects upon well-described multidrug-resistant (MDR) human pathogens, and it affects plant root elongation and morphology, mimicking indole acetic acid (IAA) action. Copyright © 2016 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Yamagami, Mutsumi; Yanai, Masumi; Hisamatsu, Shunichi; Inaba, Jiro [Inst. for Environmental Sciences, Rokkasho, Aomori (Japan)
2002-07-01
We have investigated the effect of climate on the metabolic behavior of various elements in a specific plant. The following items have been examined: the effect of climate conditions including Yamase (prevailing windows from the Pacific Ocean side area of Aomori Prefecture) on the elemental transfer factor of rice, the effect of light conditions on metabolism of elements in a plant, the effect of environmental factors on elemental movements at a cell level, and establishment of a mutant plant strain to obtain elemental requirement. This paper describes the development of a method for screening and characterizing cesium resistance mutants from Arabidopsis thaliana. Arabidopsis is a small herbaceous plant which is used for experimental molecular botany. To isolate mutant in cesium uptake or accumulation, we have devised a screening method using energy-dispersive x-ray microanalysis (EDX) of mutagenized Arabidopsis leaves. The seeds for the selection were M{sub 2} seeds derived from ethyl methane sulfonate (EMS)-treated plants. A double screening method was used to isolate about 50 Cs-resistant mutants. In the first screening experiment, EMS-mutagenized seeds were grown in medium containing 3 mM Cs. The wild type Arabidopsis usually died, but Cs-resistant mutants survived. These were transferred into soil for harvest of first-screening-seeds. In the successive experiment, first-screening-seeds were grown in medium containing 1 mM Cs, and Cs of the leaves was analyzed by EDX. We identified about 50 mutants in Cs uptake or accumulation after screening over 100,000 seedlings. These mutants showed either excessive accumulation of Cs in leaves or an inability to accumulate Cs at a normal concentration. The uptake rates of Cs in those mutants were also examined by using {sup 134}Cs radioactive tracer. (author)
Directory of Open Access Journals (Sweden)
Ahmad-Faris Seman-Kamarulzaman
Full Text Available Juvenile Hormone III is of great concern due to negative effects on major developmental and reproductive maturation in insect pests. Thus, the elucidation of enzymes involved JH III biosynthetic pathway has become increasing important in recent years. One of the enzymes in the JH III biosynthetic pathway that remains to be isolated and characterized is farnesal dehydrogenase, an enzyme responsible to catalyze the oxidation of farnesal into farnesoic acid. A novel NAD+-farnesal dehydrogenase of Polygonum minus was purified (315-fold to apparent homogeneity in five chromatographic steps. The purification procedures included Gigacap S-Toyopearl 650M, Gigacap Q-Toyopearl 650M, and AF-Blue Toyopearl 650ML, followed by TSK Gel G3000SW chromatographies. The enzyme, with isoelectric point of 6.6 is a monomeric enzyme with a molecular mass of 70 kDa. The enzyme was relatively active at 40°C, but was rapidly inactivated above 45°C. The optimal temperature and pH of the enzyme were found to be 35°C and 9.5, respectively. The enzyme activity was inhibited by sulfhydryl agent, chelating agent, and metal ion. The enzyme was highly specific for farnesal and NAD+. Other terpene aldehydes such as trans- cinnamaldehyde, citral and α- methyl cinnamaldehyde were also oxidized but in lower activity. The Km values for farnesal, citral, trans- cinnamaldehyde, α- methyl cinnamaldehyde and NAD+ were 0.13, 0.69, 0.86, 1.28 and 0.31 mM, respectively. The putative P. minus farnesal dehydrogenase that's highly specific towards farnesal but not to aliphatic aldehydes substrates suggested that the enzyme is significantly different from other aldehyde dehydrogenases that have been reported. The MALDI-TOF/TOF-MS/MS spectrometry further identified two peptides that share similarity to those of previously reported aldehyde dehydrogenases. In conclusion, the P. minus farnesal dehydrogenase may represent a novel plant farnesal dehydrogenase that exhibits distinctive substrate
AtNEA1-identification and characterization of a novel plant nuclear ...
African Journals Online (AJOL)
In animal and yeast cells, a cross nuclear envelope structure linker of nucleoskeleton and cytoskeleton (LINC) is formed by outer nuclear membrane SUN proteins and inner nuclear membrane KASH proteins. However, little information was acquired about plant SUN-KASH structure until they were found in plant SUN ...
Chemical signaling involved in plant-microbe interactions.
Chagas, Fernanda Oliveira; Pessotti, Rita de Cassia; Caraballo-Rodríguez, Andrés Mauricio; Pupo, Mônica Tallarico
2018-03-05
Microorganisms are found everywhere, and they are closely associated with plants. Because the establishment of any plant-microbe association involves chemical communication, understanding crosstalk processes is fundamental to defining the type of relationship. Although several metabolites from plants and microbes have been fully characterized, their roles in the chemical interplay between these partners are not well understood in most cases, and they require further investigation. In this review, we describe different plant-microbe associations from colonization to microbial establishment processes in plants along with future prospects, including agricultural benefits.
Directory of Open Access Journals (Sweden)
Mattsson Roland
2007-09-01
Full Text Available Abstract Background During the past decade, Chorioptes mites occupying the outer ear canals have been a common finding at routine necropsies of moose (Alces alces in Sweden, but neither the taxonomy of the mites nor lesions from the infestation have been investigated. In this study, the mites are characterized by morphological and molecular techniques, and the histopathology of the skin of the outer ear canal is described. Methods External auditory meatuses from 53 necropsied moose were examined for the presence of Chorioptes, and samples from outer ear canals were taken for histopathological and microbiological examination. A proportion of the mites from each moose was identified to species. The DNA was extracted from mites from three moose, and their ITS-2 sequences were determined; these sequences were compared phylogenetically to sequences from other Chorioptes taxa. Results Chorioptes mites were found in 43 (81% of the 53 moose. The mites had morphological and genetic characteristics distinct from those of C. texanus and C. bovis, the two species generally accepted within the genus. Morphology also did not argue for a diagnosis as C. crewei, C. mydaus or C. panda. On histopathology, lesions were characterized by a hyperplastic perivascular to interstitial dermatitis with epidermal hyperkeratosis and crust formation. Dermal inflammatory infiltrates were composed of mixed T- and B-lymphocytes, plasma cells and macrophages, whereas eosinophils were notably uncommon. Staphylococcus aureus was grown from the infested epidermis of five of 14 examined moose. Conclusion Chorioptes mite infestation was frequently detected in the outer ear canals of moose in Sweden. The mites were evidently pathogenic, being associated with inflammatory lesions of the external auditory meatus. Our studies indicate infestations with a previously undescribed Chorioptes species.
Identification and characterization of mobile genetic elements LINEs from Brassica genome.
Nouroz, Faisal; Noreen, Shumaila; Khan, Muhammad Fiaz; Ahmed, Shehzad; Heslop-Harrison, J S Pat
2017-09-05
Among transposable elements (TEs), the LTR retrotransposons are abundant followed by non-LTR retrotransposons in plant genomes, the lateral being represented by LINEs and SINEs. Computational and molecular approaches were used for the characterization of Brassica LINEs, their diversity and phylogenetic relationships. Four autonomous and four non-autonomous LINE families were identified and characterized from Brassica. Most of the autonomous LINEs displayed two open reading frames, ORF1 and ORF2, where ORF1 is a gag protein domain, while ORF2 encodes endonuclease (EN) and a reverse transcriptase (RT). Three of four families encoded an additional RNase H (RH) domain in pol gene common to 'R' and 'I' type of LINEs. The PCR analyses based on LINEs RT fragments indicate their high diversity and widespread occurrence in tested 40 Brassica cultivars. Database searches revealed the homology in LINE sequences in closely related genera Arabidopsis indicating their origin from common ancestors predating their separation. The alignment of 58 LINEs RT sequences from Brassica, Arabidopsis and other plants depicted 4 conserved domains (domain II-V) showing similarity to previously detected domains. Based on RT alignment of Brassica and 3 known LINEs from monocots, Brassicaceae LINEs clustered in separate clade, further resolving 4 Brassica-Arabidopsis specific families in 2 sub-clades. High similarities were observed in RT sequences in the members of same family, while low homology was detected in members across the families. The investigation led to the characterization of Brassica specific LINE families and their diversity across Brassica species and their cultivars. Copyright © 2017 Elsevier B.V. All rights reserved.
do Carmo, Flavia Lima; dos Santos, Henrique Fragoso; Martins, Edir Ferreira; van Elsas, Jan Dirk; Rosado, Alexandre Soares; Peixoto, Raquel Silva
Most oil from oceanic spills converges on coastal ecosystems, such as mangrove forests, which are threatened with worldwide disappearance. Particular bacteria that inhabit the rhizosphere of local plant species can stimulate plant development through various mechanisms; it would be advantageous if
Directory of Open Access Journals (Sweden)
Youngjoo Oh
Full Text Available Jasmonic acid is an important regulator of plant growth, development and defense. The jasmonate-ZIM domain (JAZ proteins are key regulators in jasmonate signaling ubiquitously present in flowering plants but their functional annotation remains largely incomplete. Recently, we identified 12 putative JAZ proteins in native tobacco, Nicotiana attenuata, and initiated systematic functional characterization of these proteins by reverse genetic approaches. In this report, Nicotiana attenuata plants silenced in the expression of NaJAZd (irJAZd by RNA interference were used to characterize NaJAZd function. Although NaJAZd transcripts were strongly and transiently up-regulated in the rosette leaves by simulated herbivory treatment, we did not observe strong defense-related phenotypes, such as altered herbivore performance or the constitutive accumulation of defense-related secondary metabolites in irJAZd plants compared to wild type plants, both in the glasshouse and the native habitat of Nicotiana attenuata in the Great Basin Desert, Utah, USA. Interestingly, irJAZd plants produced fewer seed capsules than did wild type plants as a result of increased flower abscission in later stages of flower development. The early- and mid-developmental stages of irJAZd flowers had reduced levels of jasmonic acid and jasmonoyl-L-isoleucine, while fully open flowers had normal levels, but these were impaired in NaMYB305 transcript accumulations. Previously, NaMYB305-silenced plants were shown to have strong flower abscission phenotypes and contained lower NECTARIN 1 transcript levels, phenotypes which are copied in irJAZd plants. We propose that the NaJAZd protein is required to counteract flower abscission, possibly by regulating jasmonic acid and jasmonoyl-L-isoleucine levels and/or expression of NaMYB305 gene in Nicotiana attenuata flowers. This novel insight into the function of JAZ proteins in flower and seed development highlights the diversity of functions
CHARACTERIZATION QUALITATIVE OF SOEL FOR A ...
African Journals Online (AJOL)
15 janv. 2015 ... ABSTRACT. The main objective of this study was to qualitatively characterize biomass of Solanum elaeagnifolium Cav. (or SOEL) to highlight the essential alternatives its valorization. At first, we studied the potential of composting biomass of this plant. The physico-chemical characterization of biomass ...
This manual highlights the project constraints and concerns, and includes detailed design calculations and system schematics. The plant is based on engineering design principles and practices, previous pilot plant design experiences, and professional experiences and may serve as ...
Study of candu fuel elements irradiated in a nuclear power plant
International Nuclear Information System (INIS)
Ionescu, S.; Uta, O.; Mincu, M.; Anghel, D.; Prisecaru, I.
2015-01-01
The object of this work is the behaviour of CANDU fuel elements after service in nuclear power plant. The results are analysed and compared with previous result obtained on unirradiated samples and with the results obtained on samples irradiated in the TRIGA reactor of INR Pitesti. Zircaloy-4 is the material used for CANDU fuel sheath. The importance of studying its behaviour results from the fact that the mechanical properties of the CANDU fuel sheath suffer modifications during normal and abnormal operation. In the nuclear reactor, the fuel elements endure dimensional and structural changes as well as cladding oxidation, hydriding and corrosion. These changes can lead to defects and even to the loss of integrity of the cladding. This paper presents the results of examinations performed in the Post Irradiation Examination Laboratory (PIEL) of INR Pitesti on samples from fuel elements after they were removed out of the nuclear power plant: - dimensional and macrostructural characterization; - microstructural characterization by metallographic analyses; - determination of mechanical properties; - fracture surface analysis by scanning electron microscopy (SEM). A full set of non-destructive and destructive examinations concerning the integrity, dimensional changes, oxidation, hydriding and mechanical properties of the cladding was performed. The obtained results are typical for CANDU 6-type fuel. The obtained data could be used to evaluate the security, reliability and nuclear fuel performance, and for the improvement of the CANDU fuel. (authors)
On characterization of anisotropic plant protein structures
Krintiras, G.A.; Göbel, J.; Bouwman, W.G.; Goot, van der A.J.; Stefanidis, G.D.
2014-01-01
In this paper, a set of complementary techniques was used to characterize surface and bulk structures of an anisotropic Soy Protein Isolate (SPI)–vital wheat gluten blend after it was subjected to heat and simple shear flow in a Couette Cell. The structured biopolymer blend can form a basis for a
Wolff-Parkinson-White syndrome with cleft lip and palate: A rare, previously unreported association
Directory of Open Access Journals (Sweden)
K Kannan
2008-01-01
Full Text Available Wolff-Parkinson-White syndrome, also called Pre Excitation Syndrome, is characterized by an extra pathway that conducts the electrical impulses from the atria to the ventricles without the normal delay. We are reporting a case of WPW syndrome with a cleft lip and palate, which is a rare association and previously unreported in literature.
Kujawska, Monika; Klepacki, Piotr; Łuczaj, Łukasz
2017-03-23
Historical ethnobotanical studies are useful starting points for further diachronic analysis. The aim of this contribution is to present archival data from the Polish-Lithuanian-Belarusian borderland, which were collected by Adam Fischer, a Polish ethnographer from Lviv, in the 1930s. These data were originally gathered for publication in the first part of the Lexicon of Slavic beliefs and customs, dedicated to plant uses in traditional Slavonic culture. It was intended to be a joint international enterprise, but was never actually fulfilled. In this article we used information from historical Lithuania (the Great Duchy of Lithuania), nowadays a border region between Poland, Lithuania and Belarus. We applied cultural importance indices such as Use Value, Relative Importance value and Sørensen similarity coefficient, in order to compare our data with a western Ukraine data set from the same research framework. In total, 153 plant taxa were registered as used in peasant culture in the Polish-Lithuanian-Belarusian borderland in the 1930s. The species which achieved the highest Use Values were: Calendula officinalis, Cyanus segetum, Helichrysum arenarium, Betula sp., Prunella vulgaris, and Nuphar lutea or Lilium sp. The most salient use categories were medicinal, followed by food and home garden plants. The overall similarity to plants recorded in western Ukraine within the same project of Fischer's is quite low (46%), which may be explained by the partly different flora found in the regions, and a cultural discontinuity, revealed by the difference in species with the highest UV. Moreover, the field collaborators were different in the two regions and may have paid attention to different cultural spheres of use. The presented ethnobotanical data are a valuable contribution to the ethnobotany of Eastern Europe as a whole. In particular, the presented list of plants may be a rich source for future studies on the ethnobotany of the Polish diaspora in Lithuania, and
He, Jianbo; Meng, Shan; Zhao, Tuanjie; Xing, Guangnan; Yang, Shouping; Li, Yan; Guan, Rongzhan; Lu, Jiangjie; Wang, Yufeng; Xia, Qiuju; Yang, Bing; Gai, Junyi
2017-11-01
The innovative RTM-GWAS procedure provides a relatively thorough detection of QTL and their multiple alleles for germplasm population characterization, gene network identification, and genomic selection strategy innovation in plant breeding. The previous genome-wide association studies (GWAS) have been concentrated on finding a handful of major quantitative trait loci (QTL), but plant breeders are interested in revealing the whole-genome QTL-allele constitution in breeding materials/germplasm (in which tremendous historical allelic variation has been accumulated) for genome-wide improvement. To match this requirement, two innovations were suggested for GWAS: first grouping tightly linked sequential SNPs into linkage disequilibrium blocks (SNPLDBs) to form markers with multi-allelic haplotypes, and second utilizing two-stage association analysis for QTL identification, where the markers were preselected by single-locus model followed by multi-locus multi-allele model stepwise regression. Our proposed GWAS procedure is characterized as a novel restricted two-stage multi-locus multi-allele GWAS (RTM-GWAS, https://github.com/njau-sri/rtm-gwas ). The Chinese soybean germplasm population (CSGP) composed of 1024 accessions with 36,952 SNPLDBs (generated from 145,558 SNPs, with reduced linkage disequilibrium decay distance) was used to demonstrate the power and efficiency of RTM-GWAS. Using the CSGP marker information, simulation studies demonstrated that RTM-GWAS achieved the highest QTL detection power and efficiency compared with the previous procedures, especially under large sample size and high trait heritability conditions. A relatively thorough detection of QTL with their multiple alleles was achieved by RTM-GWAS compared with the linear mixed model method on 100-seed weight in CSGP. A QTL-allele matrix (402 alleles of 139 QTL × 1024 accessions) was established as a compact form of the population genetic constitution. The 100-seed weight QTL-allele matrix was
Effect of explant plant source and acetosyringone concentration on ...
African Journals Online (AJOL)
Jane
2011-08-15
Aug 15, 2011 ... a number of factors including tissue culture conditions, acetosyringone .... immature embryo culture, callus induction and in vitro salt stress. Plant Cell ... phenotypical characterization of transgenic tomato plants: Solanum.
Genetic and phenotypic characterization of Saccharomyces spp. strains isolated in distillery plants.
Úbeda, Juan F; Chacón-Ocaña, Maria; Díaz-Hellín, Patricia; Ramírez-Pérez, Hector; Briones, Ana
2016-06-01
In this study, the biodiversity and some interesting phenotypic properties of Saccharomyces wild yeasts isolated in distilleries, at least 100 years old, located in La Mancha (Spain), were determined. Strains were genetically characterized by RFLP-mtDNA, which confirmed a great genetic biodiversity with 73% of strains with different mtDNA profiles, highlighting the large variability found in sweet and fermented piquette substrata. The predominant species identified was S. cerevisiae, followed by S. paradoxus and S. bayanus Due to the residual sugar-alcohol extraction process using warm water, a great number of thermophilic Saccharomyces strains with a great cell vitality were found to have potential use as starters in distillery plants. Interesting technological properties such as cell vitality and growth rate at different temperatures were studied. The thermal washing process for the extraction of alcohol and reducing sugars of some raw materials contributes to the presence of Saccharomyces strains with technologically interesting properties, especially in terms of vitality and resistance to high temperatures. Due to the fact that fermentation is spontaneous, the yeast biota of these environments, Saccharomyces and non-Saccharomyces, is very varied so these ecological niches are microbial reserves of undoubted biotechnological interest. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Khan, Muhammad
2013-02-01
The complexity of Reverse Osmosis (RO) membrane fouling phenomenon has been widely studied and several factors influencing it have been reported by many researchers. This original study involves the investigation of two different fouling profiles produced at a seawater RO desalination plant installed on a floating mobile barge. The plant was moved along the coastline of the Red Sea in Saudi Arabia. The two locations where the barge was anchored showed different water quality. At the second location, two modules were harvested. One of the modules was pre-fouled by inorganics during plant operation at the previous site while the other was installed at the second site. Fouled membranes were subjected to a wide range of chemical and microbiological characterization procedures. Drastically different fouling patterns were observed in the two membranes which indicates the influence of source water quality on membrane surface modification and on fouling of RO membranes. © 2012 Elsevier Ltd.
The major importance of 'minor' resources: Women and plant biodiversity
Howard, P.L.
2003-01-01
Understanding women’s influence on plant biodiversity is essential to our ability to conserve plant genetic resources, especially those plants that are useful to humans. Contrary to previous thinking, it is becoming clear that women know most about these plants because, throughout history, women’s
Directory of Open Access Journals (Sweden)
Patricia Chavez Carvajal
2016-06-01
Full Text Available Myrcianthes hallii (O. Berg McVaugh (Myrtaceae is a plant native to Ecuador, traditionally used for its antiseptic properties. The composition of the hydro-methanolic extract of this plant was determined by submitting it to ultra-high performance liquid chromatography (UHPLC hyphenated to heated-electrospray ionization mass spectrometry and UV detection. The presence of antimicrobial components prompted us to test the extract against methicillin-resistant and methicillin-susceptible Staphylococcus aureus, multidrug-resistant and susceptible Escherichia coli, Pseudomonas aeruginosa, Enterococcus spp. and Streptococcus pyogenes strains. The chromatographic analysis led to the identification of 38 compounds, including polyphenols and organic acids, and represents the first chemical characterization of this plant. The extract showed modest antibacterial activity against all tested bacteria, with the exception of E. coli which was found to be less sensitive. Whilst methicillin-resistant strains usually display resistance to several drugs, no relevant differences were observed between methicillin-susceptible and resistant strains. Considering its long-standing use in folk medicine, which suggests the relative safety of the plant, and the presence of many known antibacterial polyphenolic compounds responsible for its antibacterial activity, the results show that M. hallii extract could be used as a potential new antiseptic agent. Moreover, new anti-infective biomaterials and nanomaterials could be designed through the incorporation of M. hallii polyphenols. This prospective biomedical application is also discussed.
Characterization of the temporary radiation workforce at US nuclear power plants
International Nuclear Information System (INIS)
Cehn, J.I.
1984-01-01
The temporary radiation worker is the subject of this recent study by the National Environmental Studies Project. ''Lenny'', an imaginary worker, is actually a composite of the estimated 22,000 radiation workers employed at various times at the 80 nuclear power plants in the U.S. Lenny reports to a trailer on the plant site to check in and spends the next day and a half in a training class that covers radiation safety, federal regulations and exposure limits and plant procedures. He must take and pass a written exam, then he fills out a medical history, indicating whether or not he has received any industrial radiation exposure. After three days of training and ''processing'' he dons a radiation measuring dosimeter and begins work. A key question to this study is whether the temporary employees are getting assigned the dirty work. It has been alleged that temps are used as ''glowboys'' or ''radiation sponges''. The new study finds no basis for this allegation. Data show that permanent plant staff received nearly the same average annual radiation dose as temporary employees
Blatrix, Rumsaïs; Debaud, Sarah; Salas-Lopez, Alex; Born, Céline; Benoit, Laure; McKey, Doyle B; Attéké, Christiane; Djiéto-Lordon, Champlain
2013-01-01
Some tropical plant species possess hollow structures (domatia) occupied by ants that protect the plant and in some cases also provide it with nutrients. Most plant-ants tend patches of chaetothyrialean fungi within domatia. In a few systems it has been shown that the ants manure the fungal patches and use them as a food source, indicating agricultural practices. However, the identity of these fungi has been investigated only in a few samples. To examine the specificity and constancy of ant-plant-fungus interactions we characterised the content of fungal patches in an extensive sampling of three ant-plant symbioses (Petalomyrmex phylax/Leonardoxa africana subsp. africana, Aphomomyrmex afer/Leonardoxa africana subsp. letouzeyi and Tetraponera aethiops/Barteria fistulosa) by sequencing the Internal Transcribed Spacers of ribosomal DNA. For each system the content of fungal patches was constant over individuals and populations. Each symbiosis was associated with a specific, dominant, primary fungal taxon, and to a lesser extent, with one or two specific secondary taxa, all of the order Chaetothyriales. A single fungal patch sometimes contained both a primary and a secondary taxon. In one system, two founding queens were found with the primary fungal taxon only, one that was shown in a previous study to be consumed preferentially. Because the different ant-plant symbioses studied have evolved independently, the high specificity and constancy we observed in the composition of the fungal patches have evolved repeatedly. Specificity and constancy also characterize other cases of agriculture by insects.
Habib, Cameron; Yu, Yiyang; Gozzi, Kevin; Ching, Carly; Shemesh, Moshe
2017-01-01
The soil bacterium Bacillus subtilis is often found in association with plants in the rhizosphere. Previously, plant polysaccharides have been shown to stimulate formation of root-associated multicellular communities, or biofilms, in this bacterium, yet the underlying mechanism is not fully understood. A five-gene gan operon (ganSPQAB) in B. subtilis has recently been shown to be involved in utilization of the plant-derived polysaccharide galactan. Despite these findings, molecular details about the regulation of the operon and the role of the operon in biofilm formation remain elusive. In this study, we performed comprehensive genetic analyses on the regulation of the gan operon. We show that this operon is regulated both by a LacI-like transcription repressor (GanR), which directly binds to pairs of inverted DNA repeats in the promoter region of the operon, and by the catabolite control protein A (CcpA). Derepression can be triggered by the presence of the inducer β-1,4-galactobiose, a hydrolysis product of galactan, or in situ when B. subtilis cells are associated with plant roots. In addition to the transcriptional regulation, the encoded ß-galactosidase GanA (by ganA), which hydrolyzes ß-1,4-galactobiose into galactose, is inhibited at the enzymatic level by the catalytic product galactose. Thus, the galactan utilization pathway is under complex regulation involving both positive and negative feedback mechanisms in B. subtilis. We discuss about the biological significance of such complex regulation as well as a hypothesis of biofilm induction by galactan via multiple mechanisms. PMID:28617843
Habib, Cameron; Yu, Yiyang; Gozzi, Kevin; Ching, Carly; Shemesh, Moshe; Chai, Yunrong
2017-01-01
The soil bacterium Bacillus subtilis is often found in association with plants in the rhizosphere. Previously, plant polysaccharides have been shown to stimulate formation of root-associated multicellular communities, or biofilms, in this bacterium, yet the underlying mechanism is not fully understood. A five-gene gan operon (ganSPQAB) in B. subtilis has recently been shown to be involved in utilization of the plant-derived polysaccharide galactan. Despite these findings, molecular details about the regulation of the operon and the role of the operon in biofilm formation remain elusive. In this study, we performed comprehensive genetic analyses on the regulation of the gan operon. We show that this operon is regulated both by a LacI-like transcription repressor (GanR), which directly binds to pairs of inverted DNA repeats in the promoter region of the operon, and by the catabolite control protein A (CcpA). Derepression can be triggered by the presence of the inducer β-1,4-galactobiose, a hydrolysis product of galactan, or in situ when B. subtilis cells are associated with plant roots. In addition to the transcriptional regulation, the encoded ß-galactosidase GanA (by ganA), which hydrolyzes ß-1,4-galactobiose into galactose, is inhibited at the enzymatic level by the catalytic product galactose. Thus, the galactan utilization pathway is under complex regulation involving both positive and negative feedback mechanisms in B. subtilis. We discuss about the biological significance of such complex regulation as well as a hypothesis of biofilm induction by galactan via multiple mechanisms.
International Nuclear Information System (INIS)
Murakishi, H.; Lesney, M.S.; Carlson, P.
1984-01-01
The use of protoplasts in the study of plant viruses has attracted considerable attention since its inception in the late 1960s. This article is an attempt to assess the current status of protoplasts (primarily) and all cell cultures (in some instances) in studies of virus infection, virus replication, cytopathology, cross-protection, virus resistance, and the use of in vitro methods and genetic engineering to recover virus-resistant plants. These areas of study proved difficult to do entirely with whole plants or plant parts. However, because protoplasts could be synchronously infected with virus, they provided a valuable alternative means of following biochemical and cytological events in relation to the virus growth cycle in a more precise manner than previously possible
Nuclear plant simulation using the Nuclear Plant Analyzer
International Nuclear Information System (INIS)
Beelman, R.J.; Laats, E.T.; Wagner, R.J.
1984-01-01
The Nuclear Plant Analyzer (NPA), a state-of-the-art computerized safety analysis and engineering tool, was employed to simulate nuclear plant response to an abnormal transient during a training exercise at the US Nuclear Regulatory Commission (USNRC) in Washington, DC. Information relative to plant status was taken from a computer animated color graphics display depicting the course of the transient and was transmitted to the NRC Operations Center in a manner identical to that employed during an actual event. Recommendations from the Operations Center were implemented during on-line, interactive execution of the RELAP5 reactor systems code through the NPA allowing a degree of flexibility in training exercises not realized previously. When the debriefing was conducted, the RELAP5 calculations were replayed by way of the color graphics display, adding a new dimension to the debriefing and greatly enhancing the critique of the exercise
Directory of Open Access Journals (Sweden)
Walaa Kamel Mousa
2016-09-01
Full Text Available Finger millet is an ancient African-Indian crop that is resistant to many pathogens including the fungus, Fusarium graminearum. We previously reported the first isolation of putative fungal endophytes from finger millet and showed that the crude extracts of four strains had anti-Fusarium activity. However, active compounds were isolated from only one strain. The objectives of this study were to confirm the endophytic lifestyle of the three remaining anti-Fusarium isolates, to identify the major underlying antifungal compounds, and to initially characterize the mode(s of action of each compound. Results of confocal microscopy and a plant disease assay were consistent with the three fungal strains behaving as endophytes. Using bio-assay guided fractionation and spectroscopic structural elucidation, three anti-Fusarium secondary metabolites were purified and characterized. These molecules were not previously reported to derive from fungi nor have antifungal activity. The purified antifungal compounds were: 5-hydroxy 2(3H-benzofuranone, dehydrocostus lactone (guaianolide sesquiterpene lactone, and harpagoside (an iridoide glycoside. Light microscopy and vitality staining were used to visualize the in vitro interactions between each compound and Fusarium; the results suggested a mixed fungicidal/fungistatic mode of action. We conclude that finger millet possesses fungal endophytes that can synthesize anti-fungal compounds not previously reported as bio-fungicides against F. graminearum.
Energy Technology Data Exchange (ETDEWEB)
Liu, Jang Ryol; Kwak, Sang Soo; Kwon, Seok Yoon [Korea Research Institute of Bioscience and Biotechnology, Taejon (Korea)
2000-04-01
- tSOD1, cytosolic CuZnSOD cDNA was cloned from tobacco cDNA library by PCR. To develop the under-producing the transgenic plants, the vectors were constructed using by antisense and co-supressing technology. The transgenic tobacco plants were confirmed that over 60% of kanamycin-resistant plants were introduced the foreign gene by PCR and transformed one copy through Southern blot analysis. - In an attempt to identify marker genes for gamma irradiation of plants, expression patterns of diverse genes upon gamma irradiation of young tobacco plants were investigated. With the knowledge of distinctive expression patterns of diverse genes, irradiation-indicating marker plants could be developed by engineering and monitoring multiple radiation-responsive genes. Additionally, a gamma irradiation-responsive NtTMK1 receptor-like kinase gene was molecular biologically characterized. -Uranium reductase gene (Cytochrome C3) and radiation resistance gene (recA) have been cloned from Desulfovibrio and Deinococcus radiodurans. -Two plant transformation vectors (pCYC3 and pDrecA) have been constructed. - Tobacco transgenic plants of have been obtained. 52 refs., 5 figs. (Author)
Characterization of haemoglobin from Actinorhizal plants – An in ...
Indian Academy of Sciences (India)
2013-10-01
Oct 1, 2013 ... Actinorhizal plant; haemoglobin (Hb); homology modelling; vesicle ..... specifies the overall quality of the models and determines the extent to which .... service for the recognition of errors in three-dimensional struc- tures of ...
Directory of Open Access Journals (Sweden)
Gianluca BLEVE
2016-05-01
Full Text Available DNA-based approaches were used to characterize a strain (Salento-1 of Xylella fastidiosa obtained from an olive plant suffering from the syndrome of quick decline in Apulia (South Italy. Salento-1 was indistinguishable from strain CoDiRO previously isolated from olive in Apulia and assigned to X. fastidiosa subsp. pauca. Based on our results and comparative analysis with reported data, the subspecies pauca, multiplex, and fastidiosa may invade olive throughout the world (California, Italy, Argentina and Brazil. The strain Salento-1 has been deposited in the National Collection of Plant Pathogenic Bacteria (NCPPB, England, and in the Belgian Coordinated Collections of Microorganisms (BCCM, Belgium.
Education, training and work experience among nuclear power plant workers
International Nuclear Information System (INIS)
Blair, L.M.; Doggette, J.
1980-01-01
This paper uses a unique data set to examine the prior work experience, training, and education of skilled and technical workers in United States nuclear power plants. The data were collected in the latter half of 1977 by the International Brotherhood of Electrical Workers (IBEW) in a survey of union locals in nuclear power plants. The survey results provided substantial evidence that workers in United States nuclear power plants have a relatively high level of education, training, and skill development. Analysis of average education by age did not reveal any significant differences in years of schooling between younger and older workers. Very high rates of participation in formal training programmes were reported by all types of workers. The most common type of training programme was held on-site at the power plant and was provided by utility personnel. The majority of workers reported previous work experience related to nuclear power plant activities. Almost one-third of the workers had been directly involved in nuclear energy in a previous job, the majority of these through the United States Navy nuclear programme. However, the newer plants are hiring relatively fewer persons with previous nuclear experience. (author)
Biodenitrification of gaseous diffusion plant aqueous wastes: stirred bed reactor
International Nuclear Information System (INIS)
Holland, M.E.
1980-01-01
Approximately 30 kilograms of nitrates per day are discarded in the raffinates (acid wastes) of the Portsmouth Gaseous Diffusion Plant's X-705 Uranium Recovery and Decontamination Facility. A biodenitrification process employing continuous-flow, stirred-bed reactors has been successfully used to remove nitrates from similar acid wastes at the Oak Ridge Y-12 Plant. Laboratory studies have been made at Portsmouth to characterize the X-705 raffinates and to test the stirred-bed biodenitrification process on such raffinates. Raffinates which had been previously characterized were pumped through continuous-flow, stirred-bed, laboratory-scale reactors. Tests were conducted over a period of 146 days and involved variations in composition, mixing requirements, and the fate of several metal ions in the raffinates. Tests results show that 20 weight percent nitrates were reduced to a target nitrate effluent concentration of 100 μg/ml with a 99.64 percent efficiency. However, the average denitrification rate achieved was only 33% of that demonstrated with the Y-12 stirred-bed system. These low rates were probably due to the toxic effects of heavy metal ions on the denitrifying bacteria. Also, most of the uranium in the raffinate feed remained in the biomass and calcite, which collected in the reactor. This could cause criticality problems. For these reasons, it was decided not to make use of the stirred-bed bioreactor at Portsmouth. Instead, the biodenitrification installation now planned will use fluidized bed columns whose performance will be the subject of a subsequent report
Characterization of Momordica charantia Ussing FT-IR Spectroscopy
Directory of Open Access Journals (Sweden)
Attila Keseru
2016-11-01
In this paper, because earlier claim shows that the plant used as stomachic, carminative, tonic, antipyretic, antidiabetic, in rheumatoid arthritis and gout, the present investigation was carried to characterized a principal components of plant using FT-IR technique
Energy Technology Data Exchange (ETDEWEB)
NONE
1996-08-01
This report describes activities associated with conducting dry weather surface water sampling of Upper East Fork Poplar Creek (UEFPC) at the Oak Ridge Y-12 Plant, Oak Ridge, Tennessee. This activity is a portion of the work to be performed at UEFPC Operable Unit (OU) 1 [now known as the UEFPC Characterization Area (CA)], as described in the RCRA Facility Investigation Plan for Group 4 at the Oak- Ridge Y-12 Plant, Oak Ridge, Tennessee and in the Response to Comments and Recommendations on RCRA Facility Investigation Plan for Group 4 at the Oak Ridge Y-12 Plant, Oak Ridge, Tennessee, Volume 1, Operable Unit 1. Because these documents contained sensitive information, they were labeled as unclassified controlled nuclear information and as such are not readily available for public review. To address this issue the U.S. Department of Energy (DOE) published an unclassified, nonsensitive version of the initial plan, text and appendixes, of this Resource Conservation and Recovery Act (RCRA) Facility Investigation (RFI) Plan in early 1994. These documents describe a program for collecting four rounds of wet weather and dry weather surface water samples and one round of sediment samples from UEFPC. They provide the strategy for the overall sample collection program including dry weather sampling, wet weather sampling, and sediment sampling. Figure 1.1 is a schematic flowchart of the overall sampling strategy and other associated activities. A Quality Assurance Project Plan (QAPJP) was prepared to specifically address four rounds of dry weather surface water sampling and one round of sediment sampling. For a variety of reasons, sediment sampling has not been conducted and has been deferred to the UEFPC CA Remedial Investigation (RI), as has wet weather sampling.
Deposition of radionuclides by fogwater on plants at Houdelaincourt, France
Tav, Jackie; Masson, Olivier; Burnet, Frédéric; De Visme, Anne; Paulat, Pascal; Bourrianne, Thierrry; Conil, Sébastien; Simon, Maxime
2015-04-01
After a nuclear accident like Fukushima, large quantities of radionuclides attached to particles are released in the atmosphere. Those particles can act as condensation nuclei to form fog droplets. To determine the radiological impact of fog droplets deposition on plants, an analysis of the fogwater radioactivity levels and a quantification of the fogwater deposition have been performed. To collect fogwater samples, a replica of the Caltech Active Strand Cloudwater Collector (Demoz et al. 1996) is implemented at the atmospheric research platform in Houdelaincourt (North-East region of France). This instrument allows air containing fog drops to be drawn through a cylinder by a fan. In this tube, rows of Teflon strands are collecting the drops by impaction. Other active collectors have been developed on the same principle with a tube and a mesh grid as the impaction surface. Passive collectors are also used; they consist of vertical strings surrounding a container where the drops are collected. Once the fogwater is collected, it is analyzed to determine the activity levels of gamma emitter radionuclides. In previous studies (Bourcier 2009) the mean level activity for cesium 137, beryllium 7 and lead 210 in rainwater at the Puy de DÙme have been previously estimated. A comparison between activity levels found in rainwater and in fogwater highlights the fact that fog deposition of radionuclides is far from negligible. At the same time a fog monitor FM-120 from DMT provides the size distribution of droplets from 1 to 30 microns. A visibility meter and a PVM from Gerber Scientific Inc. provide respectively the visibility and the liquid water content (LWC) to identify and characterize fog events. In order to quantify the deposition of water on plants, plastics plants were exposed to fog droplet deposition and weighed at the end of the event to measure the amount of water deposited. A second experiment was conducted, during which plastics plants were implemented on a
Plant regeneration in wheat mature embryo culture
African Journals Online (AJOL)
Kamil Haliloğlu
2011-11-09
Nov 9, 2011 ... Success in genetic engineering of cereals depends on the callus formation and efficient plant regeneration system. Callus formation and plant regeneration of wheat mature embryos ... compiled by modification of methods previously mentioned in ..... of more and readily available nutrition than artificial cul-.
Concretes characterization for spent radioactive sources
International Nuclear Information System (INIS)
Martinez B, J.; Monroy G, F. P.
2013-10-01
The present work includes the preparation and characterization of the concrete used as conditioning matrix of spent radioactive sources in the Treatment Plant of Radioactive Wastes of the Instituto Nacional de Investigaciones Nucleares (ININ). The concrete tests tubes were subjected to resistance assays to the compression, leaching, resistance to the radiation and porosity, and later on characterized by means of X rays diffraction, scanning electron microscopy and infrared spectrometry, with the purpose of evaluating if this concrete accredits the established tests by the NOM-019-Nucl-1995. The results show that the concrete use in the Treatment Plant fulfills the requirements established by the NOM-019-Nucl-1995. (author)
Structural breakdown of specialized plant-herbivore interaction networks in tropical forest edges
Directory of Open Access Journals (Sweden)
Bruno Ximenes Pinho
2017-10-01
Full Text Available Plant-herbivore relationships are essential for ecosystem functioning, typically forming an ecological network with a compartmentalized (i.e. modular structure characterized by highly specialized interactions. Human disturbances can favor habitat generalist species and thus cause the collapse of this modular structure, but its effects are rarely assessed using a network-based approach. We investigate how edge proximity alters plant-insect herbivore networks by comparing forest edge and interior in a large remnant (3.500 ha of the Brazilian Atlantic forest. Given the typical dominance of pioneer plants and generalist herbivores in edge-affected habitats, we test the hypothesis that the specialized structure of plant-herbivore networks collapse in forest edges, resulting in lower modularity and herbivore specialization. Despite no differences in the number of species and interactions, the network structure presented marked differences between forest edges and interior. Herbivore specialization, modularity and number of modules were significantly higher in forest interior than edge-affected habitats. When compared to a random null model, two (22.2% and eight (88.8% networks were significantly modular in forest edge and interior, respectively. The loss of specificity and modularity in plant-herbivore networks in forest edges may be related to the loss of important functions, such as density-dependent control of superior plant competitors, which is ultimately responsible for the maintenance of biodiversity and ecosystem functions. Our results support previous warnings that focusing on traditional community measures only (e.g. species diversity may overlook important modifications in species interactions and ecosystem functioning.
Hg transfer from contaminated soils to plants and animals
Rodrigues, S.M.; Henriques, B.; Reis, A.T.; Duarte, A.C.; Pereira, E.; Romkens, P.F.A.M.
2012-01-01
Understanding the transfer of mercury (Hg) from soil to crops is crucial due to Hg toxicity and Hg occurrence in terrestrial systems. Previous research has shown that available Hg in soils contributes to plant Hg levels. Plant Hg concentrations are related to soil conditions and plant
Cost and performance of fossil fuel power plants with CO2 capture and storage
International Nuclear Information System (INIS)
Rubin, Edward S.; Chen, Chao; Rao, Anand B.
2007-01-01
CO 2 capture and storage (CCS) is receiving considerable attention as a potential greenhouse gas (GHG) mitigation option for fossil fuel power plants. Cost and performance estimates for CCS are critical factors in energy and policy analysis. CCS cost studies necessarily employ a host of technical and economic assumptions that can dramatically affect results. Thus, particular studies often are of limited value to analysts, researchers, and industry personnel seeking results for alternative cases. In this paper, we use a generalized modeling tool to estimate and compare the emissions, efficiency, resource requirements and current costs of fossil fuel power plants with CCS on a systematic basis. This plant-level analysis explores a broader range of key assumptions than found in recent studies we reviewed for three major plant types: pulverized coal (PC) plants, natural gas combined cycle (NGCC) plants, and integrated gasification combined cycle (IGCC) systems using coal. In particular, we examine the effects of recent increases in capital costs and natural gas prices, as well as effects of differential plant utilization rates, IGCC financing and operating assumptions, variations in plant size, and differences in fuel quality, including bituminous, sub-bituminous and lignite coals. Our results show higher power plant and CCS costs than prior studies as a consequence of recent escalations in capital and operating costs. The broader range of cases also reveals differences not previously reported in the relative costs of PC, NGCC and IGCC plants with and without CCS. While CCS can significantly reduce power plant emissions of CO 2 (typically by 85-90%), the impacts of CCS energy requirements on plant-level resource requirements and multi-media environmental emissions also are found to be significant, with increases of approximately 15-30% for current CCS systems. To characterize such impacts, an alternative definition of the 'energy penalty' is proposed in lieu of the
Investigation of plant latices of Asteraceae and Campanulaceae regarding proteolytic activity.
Sytwala, Sonja; Domsalla, André; Melzig, Matthias F
2015-12-01
Occurrence of plant latices is widespread, there are more than 40 families of plants characterized to establish lactiferous structures. The appearance of hydrolytic active proteins, incorporated in latices is already characterized, and hydrolytic active proteins are considerable, and for several plant families, the occurrence of hydrolytic active proteins is already specified e.g. Apocynaceae Juss., Caricaceae Dumort, Euphorbiaceae Juss., Moraceae Gaudich and Papaveraceae Juss. In our investigation, focused on latex bearing plants of order Asterales, Asteraceae and Campanulaceae in particular. The present outcomes represent a comprehensive study, relating to the occurrence of proteolytic active enzymes of order Asterales for the first time. 131 different species of Asteraceae and Campanulaceae were tested, and the appearance of plant latex proteases were determined in different quantities. Proteolytic activity was investigated by inhibitory studies and determination of residual activity in the following, enable us to characterize the proteases. Most of the considered species exhibit a serine protease activity and a multiplicity of species exhibited two or more subclasses of proteases. Copyright © 2015 Elsevier Masson SAS. All rights reserved.
Char characterization and DTF assays as tools to predict burnout of coal blends in power plants
Energy Technology Data Exchange (ETDEWEB)
C. Ulloa; A.G. Borrego; S. Helle; A.L. Gordon; X. Garcia [Universidad de Concepcion, Concepcion (Chile). Departamento de Ingenieria Quimica
2005-02-01
The aim of this study is to predict efficiency deviations in the combustion of coal blends in power plants. Combustion of blends, as compared to its single coals, shows that for some blends the behavior is non-additive in nature. Samples of coal feed and fly ashes from combustion of blends at two power plants, plus chars of the parent coals generated in a drop-tube furnace (DTF) at temperatures and heating rates similar to those found in the industrial boilers were used. Intrinsic kinetic parameters, burning profiles and petrographic characteristics of these chars correlated well with the burnout in power plants and DTF experiments. The blend combustion in a DTF reproduces both positive and negative burnout deviations from the expected weighted average. These burnout deviations have been previously attributed to parallel or parallel-series pathways of competition for oxygen. No deviations were found for blends of low rank coals of similar characteristics yielding chars close in morphology, optical texture and reactivity. Negative deviations were found for blends of coals differing moderately in rank and were interpreted as associated with long periods of competition. In this case, fly-ashes were enriched in material derived from the least reactive char, but also unburnt material attributed to the most reactive char was identified. Improved burnout compared to the weighted average was observed for blends of coals very different in rank, and interpreted as the result of a short interaction period, followed by a period where the less reactive char burns under conditions that are more favorable to its combustion. In this case, only unburned material from the least reactive char was identified in the fly-ashes. 20 refs., 9 figs., 5 tabs.
Fluvial particle characterization using artificial neural network and spectral image processing
Shrestha, Bim Prasad; Gautam, Bijaya; Nagata, Masateru
2008-03-01
Sand, chemical waste, microbes and other solid materials flowing with the water bodies are of great significance to us as they cause substantial impact to different sectors including drinking water management, hydropower generation, irrigation, aquatic life preservation and various other socio-ecological factors. Such particles can't completely be avoided due to the high cost of construction and maintenance of the waste-treatment methods. A detailed understanding of solid particles in surface water system can have benefit in effective, economic, environmental and social management of water resources. This paper describes an automated system of fluvial particle characterization based on spectral image processing that lead to the development of devices for monitoring flowing particles in river. Previous research in coherent field has shown that it is possible to automatically classify shapes and sizes of solid particles ranging from 300-400 μm using artificial neural networks (ANN) and image processing. Computer facilitated with hyper spectral and multi spectral images using ANN can further classify fluvial materials into organic, inorganic, biodegradable, bio non degradable and microbes. This makes the method attractive for real time monitoring of particles, sand and microorganism in water bodies at strategic locations. Continuous monitoring can be used to determine the effect of socio-economic activities in upstream rivers, or to monitor solid waste disposal from treatment plants and industries or to monitor erosive characteristic of sand and its contribution to degradation of efficiency of hydropower plant or to identify microorganism, calculate their population and study the impact of their presence. Such system can also be used to characterize fluvial particles for planning effective utilization of water resources in micro-mega hydropower plant, irrigation, aquatic life preservation etc.
Nuclear plant aging research program
International Nuclear Information System (INIS)
Eissenberg, D.M.
1987-01-01
The U.S. Nuclear Regulatory Commission, Office of Nuclear Regulatory Research, has established the Nuclear Plant Aging Research (NPAR) program in its Division of Engineering Technology. Principal contractors for this program include Oak Ridge National Laboratory, Brookhaven National Laboratory, Idaho National Engineering Laboratory, and Pacific Northwest Laboratory. The program goals are: to identify and characterize time-dependent degradation (aging) of nuclear plant safety-related electrical and mechanical components which could lead to loss of safety function; to identify and recommend methods for detecting and trending aging effects prior to loss of safety function so that timely maintenance can be implemented; and to recommend maintenance practices for mitigating the effects of aging. Research activities include prioritization of system and component aging in nuclear plants, characterization of aging degradation of specific components including identification of functional indicators useful for trending degradation, and testing of practical methods and devices for measuring the functional indicators. Aging assessments have been completed on electric motors, snubbers, motor-operated valves, and check valves. Testing of trending methods and devices for motor-operated valves and check valves is in progress
Genetic engineering of syringyl-enriched lignin in plants
Chiang, Vincent Lee; Li, Laigeng
2004-11-02
The present invention relates to a novel DNA sequence, which encodes a previously unidentified lignin biosynthetic pathway enzyme, sinapyl alcohol dehydrogenase (SAD) that regulates the biosynthesis of syringyl lignin in plants. Also provided are methods for incorporating this novel SAD gene sequence or substantially similar sequences into a plant genome for genetic engineering of syringyl-enriched lignin in plants.
Energy Technology Data Exchange (ETDEWEB)
NONE
1995-02-01
With an objective of developing the coal gasification composite power generation technology, surveys and researches have been carried out on a demonstration plant. This paper summarizes the achievements in fiscal 1993. Based on the achievements having been obtained by the previous fiscal year, the current fiscal year has discussed the method for evaluating the up-scaling, and performed a conceptual design of the demonstration plant. In discussing the demonstration plant in the current fiscal year, identification was made on the basic performance characteristics as the IGCC (atmospheric temperature characteristics, coal type change characteristics, partial load characteristics, methods for plant actuation and shutdown, and utility use amount), and selections were conducted on different systems to be adopted in the demonstration plant, both based on the approximate thermal material balance having been derived in the previous fiscal year. The results of the discussions were summarized as the steam cycle discussion, performance discussion by coal types, partial load characteristics, atmospheric temperature characteristics, secondary air temperature characteristics, discussions to enhance efficiency and reliability in association with the up-scaling, discussions on the utility facilities, discussions on the protection interlock, and forecast on the entire performance according to the approximate thermal material balance. (NEDO)
Losfeld, Guillaume; L'Huillier, Laurent; Fogliani, Bruno; Mc Coy, Stéphane; Grison, Claude; Jaffré, Tanguy
2015-04-01
Relationships between the trace-elements (TE) content of plants and associated soil have been widely investigated especially to understand the ecology of TE hyperaccumulating species to develop applications using TE phytoextraction. Many studies have focused on the possibility of quantifying the soil TE fraction available to plants, and used bioconcentration (BC) as a measure of the plants ability to absorb TE. However, BC only offers a static view of the dynamic phenomenon of TE accumulation. Accumulation kinetics are required to fully account for TE distributions in plants. They are also crucial to design applications where maximum TE concentrations in plant leaves are needed. This paper provides a review of studies of BC (i.e. soil-plant relationships) and leaf-age in relation to TE hyperaccumulation. The paper focuses of Ni and Mn accumulators and hyperaccumulators from New Caledonia who were previously overlooked until recent Ecocatalysis applications emerged for such species. Updated data on Mn hyperaccumulators and accumulators from New Caledonia are also presented and advocate further investigation of the hyperaccumulation of this element. Results show that leaf-age should be considered in the design of sample collection and allowed the reclassification of Grevillea meisneri known previously as a Mn accumulator to a Mn hyperaccumulator.
Comparison of the Light-Harvesting Networks of Plant and Cyanobacterial Photosystem I
Şener, Melih K.; Jolley, Craig; Ben-Shem, Adam; Fromme, Petra; Nelson, Nathan; Croce, Roberta; Schulten, Klaus
2005-01-01
With the availability of structural models for photosystem I (PSI) in cyanobacteria and plants it is possible to compare the excitation transfer networks in this ubiquitous photosystem from two domains of life separated by over one billion years of divergent evolution, thus providing an insight into the physical constraints that shape the networks' evolution. Structure-based modeling methods are used to examine the excitation transfer kinetics of the plant PSI-LHCI supercomplex. For this purpose an effective Hamiltonian is constructed that combines an existing cyanobacterial model for structurally conserved chlorophylls with spectral information for chlorophylls in the Lhca subunits. The plant PSI excitation migration network thus characterized is compared to its cyanobacterial counterpart investigated earlier. In agreement with observations, an average excitation transfer lifetime of ∼49 ps is computed for the plant PSI-LHCI supercomplex with a corresponding quantum yield of 95%. The sensitivity of the results to chlorophyll site energy assignments is discussed. Lhca subunits are efficiently coupled to the PSI core via gap chlorophylls. In contrast to the chlorophylls in the vicinity of the reaction center, previously shown to optimize the quantum yield of the excitation transfer process, the orientational ordering of peripheral chlorophylls does not show such optimality. The finding suggests that after close packing of chlorophylls was achieved, constraints other than efficiency of the overall excitation transfer process precluded further evolution of pigment ordering. PMID:15994896
Saltmarsh plant responses to eutrophication.
Johnson, David Samuel; Warren, R Scott; Deegan, Linda A; Mozdzer, Thomas J
2016-12-01
In saltmarsh plant communities, bottom-up pressure from nutrient enrichment is predicted to increase productivity, alter community structure, decrease biodiversity, and alter ecosystem functioning. Previous work supporting these predictions has been based largely on short-term, plot-level (e.g., 1-300 m 2 ) studies, which may miss landscape-level phenomena that drive ecosystem-level responses. We implemented an ecosystem-scale, nine-year nutrient experiment to examine how saltmarsh plants respond to simulated conditions of coastal eutrophication. Our study differed from previous saltmarsh enrichment studies in that we applied realistic concentrations of nitrate (70-100 μM NO 3 - ), the most common form of coastal nutrient enrichment, via tidal water at the ecosystem scale (~60,000 m 2 creeksheds). Our enrichments added a total of 1,700 kg N·creek -1 ·yr -1 , which increased N loading 10-fold vs. reference creeks (low-marsh, 171 g N·m -2 ·yr -1 ; high-marsh, 19 g N·m -2 ·yr -1 ). Nutrients increased the shoot mass and height of low marsh, tall Spartina alterniflora; however, declines in stem density resulted in no consistent increase in aboveground biomass. High-marsh plants S. patens and stunted S. alterniflora did not respond consistently to enrichment. Nutrient enrichment did not shift community structure, contrary to the prediction of nutrient-driven dominance of S. alterniflora and Distichlis spicata over S. patens. Our mild responses may differ from the results of previous studies for a number of reasons. First, the limited response of the high marsh may be explained by loading rates orders of magnitude lower than previous work. Low loading rates in the high marsh reflect infrequent inundation, arguing that inundation patterns must be considered when predicting responses to estuarine eutrophication. Additionally, we applied nitrate instead of the typically used ammonium, which is energetically favored over nitrate for plant uptake. Thus, the
Plant sphingolipids: decoding the enigma of the Sphinx.
Pata, Mickael O; Hannun, Yusuf A; Ng, Carl K-Y
2010-02-01
Sphingolipids are a ubiquitous class of lipids present in a variety of organisms including eukaryotes and bacteria. In the last two decades, research has focused on characterizing the individual species of this complex family of lipids, which has led to a new field of research called 'sphingolipidomics'. There are at least 500 (and perhaps thousands of) different molecular species of sphingolipids in cells, and in Arabidopsis alone it has been reported that there are at least 168 different sphingolipids. Plant sphingolipids can be divided into four classes: glycosyl inositol phosphoceramides (GIPCs), glycosylceramides, ceramides, and free long-chain bases (LCBs). Numerous enzymes involved in plant sphingolipid metabolism have now been cloned and characterized, and, in general, there is broad conservation in the way in which sphingolipids are metabolized in animals, yeast and plants. Here, we review the diversity of sphingolipids reported in the literature, some of the recent advances in our understanding of sphingolipid metabolism in plants, and the physiological roles that sphingolipids and sphingolipid metabolites play in plant physiology.
Individual plant examination and future PRA applications
International Nuclear Information System (INIS)
Monty, B.S.; Sursock, J.P.; Thierry, R.J.
1992-01-01
PRA is being used in many areas of plant operation as has been demonstrated in previous studies. With the U.S. NRC's emphasis on the use of risk to identify plant vulnerabilities and the development of plant specific PRA models for all plants, it is expected that the use of PRA will be expanded. Key areas where this is expected to occur include the development of risk-based Technical Specifications, risk management, and risk-centered maintenance programs. This paper focuses on the Individual Plant Examination requirement and the possible uses of risk-based methods in controlling plant operation to enhance plant safety and availability, and how the IPE requirement will potentially further this area of development. (orig./DG)
Planning and evaluation of plant under safety aspects
International Nuclear Information System (INIS)
Strnad, H.
1985-01-01
Plant denotes a technical product characterized as being structured, complex, comprising the use of energy, and that of measuring, automatic control and monitoring systems to keep track of present, control and monitor processes. Particular attention is paid to methods of developing plant concepts, measures to exclude or detect risks, integration of safety engineering into the course of planning, safety concept and ergonomics in plant design. (DG) [de
Graça, V C; Barros, Lillian; Calhelha, Ricardo C; Dias, Maria Inês; Carvalho, Ana Maria; Santos-Buelga, Celestino; Ferreira, Isabel C F R; Santos, P F
2016-05-18
After a period of indifference, in which synthetic compounds were favored, there is an increasing interest in the study of the biological properties of plants and the active principles responsible for their therapeutic properties. Geranium molle L. has been used in the Portuguese folk medicine for the treatment of various ailments including cancer but, unlike many of the species from the Geranium genus, its phytochemical characterization and biological activity are virtually unexplored. In this study a G. molle sample from Trás-os-Montes, north-eastern Portugal, was chemically characterized regarding nutritional value, free sugars, organic acids, fatty acids and tocopherols, and several aqueous (decoction, infusion) and organic (n-hexane, dichloromethane, ethyl acetate, acetone, methanol) extracts of the plant were assessed for their bioactive properties. The antioxidant activity was evaluated by means of the free radicals scavenging activity, reducing power and inhibition of lipid peroxidation. The cytotoxicity of the different extracts was assessed in vitro against several human cancer cell lines (breast, lung, cervical and hepatocellular carcinomas) and, additionally, their hepatotoxicity was evaluated using a porcine liver primary cell culture. G. molle was shown to be rich in carbohydrates and proteins, providing tocopherols and essential fatty acids. Amongst the various extracts, the acetone extract was found to have the highest content of phenolic compounds (mainly ellagitannins, but also some flavone and flavonol glycosides) as well as the highest antioxidant and cytotoxic activities. To the best of our knowledge, this is the first report on the chemical composition and bioactive properties of G. molle.
Characterization of a novel tymovirus on tomato plants in Brazil.
de Oliveira, Virgínia Carla; Nagata, Tatsuya; Guimarães, Felipe C; Ferreira, Fernanda A; Kitajima, Elliot Watanabe; Nicolini, Cícero; de Oliveira Resende, Renato; Inoue-Nagata, Alice Kazuko
2013-02-01
A tymovirus was isolated in Brazil from tomato plants with severe symptoms of leaf mosaic and blistering. The virus was mechanically transmissible to solanaceous indicator host species. The infected plants contained icosahedral particles and chloroplasts with membrane deformations which are typical cytopathic effects caused by tymoviruses. Its coat protein amino acid sequence shares the maximum of 64 % identity with the tymovirus Chiltepin yellow mosaic virus, which suggested that it can be considered as a distinct member of the genus Tymovirus. In a phylogenetic tree, this tymovirus was clustered with other solanaceous-infecting tymoviruses. It was tentatively named as Tomato blistering mosaic virus (ToBMV).
Plant-integrated measurement of greenhouse gas emissions from a municipal wastewater treatment plant
DEFF Research Database (Denmark)
Yoshida, Hiroko; Mønster, Jacob; Scheutz, Charlotte
2014-01-01
experiencing operational problems, such as during foaming events in anaerobic digesters and during sub-optimal operation of biological nitrogen removal in the secondary treatment of wastewater. Methane emissions detected during measurement campaigns corresponded to 2.07-32.7% of the methane generated......Wastewater treatment plants (WWTPs) contribute to anthropogenic greenhouse gas (GHG) emissions. Due to its spatial and temporal variation in emissions, whole plant characterization of GHG emissions from WWTPs face a number of obstacles. In this study, a tracer dispersion method was applied...... in the plant. As high as 4.27% of nitrogen entering the WWTP was emitted as nitrous oxide under the sub-optimal operation of biological treatment processes. The study shows that the unit process configuration, as well as the operation of the WWTP, determines the rate of GHG emission. The applied plant...
Double tracks test site characterization report
International Nuclear Information System (INIS)
1996-05-01
This report presents the results of site characterization activities performed at the Double Tracks Test Site, located on Range 71 North, of the Nellis Air Force Range (NAFR) in southern Nevada. Site characterization activities included reviewing historical data from the Double Tracks experiment, previous site investigation efforts, and recent site characterization data. The most recent site characterization activities were conducted in support of an interim corrective action to remediate the Double Tracks Test Site to an acceptable risk to human health and the environment. Site characterization was performed using a phased approach. First, previously collected data and historical records sere compiled and reviewed. Generalized scopes of work were then prepared to fill known data gaps. Field activities were conducted and the collected data were then reviewed to determine whether data gaps were filled and whether other areas needed to be investigated. Additional field efforts were then conducted, as required, to adequately characterize the site. Characterization of the Double Tracks Test Site was conducted in accordance with the US Department of Energy's (DOE) Streamlined Approach for Environmental Restoration (SAFER)
Inorganic soil and groundwater chemistry near Paducah Gaseous Diffusion Plant, Paducah, Kentucky
Energy Technology Data Exchange (ETDEWEB)
Moore, G.K. [Tennessee Univ., Knoxville, TN (United States)
1995-03-01
Near-surface soils, boreholes, and sediments near the Paducah Gaseous Diffusion Plant (PGDP) were sampled in 1989-91 as were monitoring wells, TVA wells, and privately-owned wells. Most wells were sampled two or three times. The resulting chemical analyses have been published in previous reports and have been previously described (CH2M HILL 1991, 1992; Clausen et al. 1992). The two reports by CH2M HILL are controversial, however, because, the concentrations of some constituents were reported to exceed background levels or drinking water standards and because both on-site (within the perimeter fence at PGDP) and off-site pollution was reported to have occurred. The groundwater samples upon which these interpretations were based may not be representative, however. The CH2M HILL findings are discussed in the report. The purpose of this report is to characterize the inorganic chemistry of groundwater and soils near PGDP, using data from the CH2M HILL reports (1991, 1992), and to determine whether or not any contamination has occurred. The scope is limited to analysis and interpretation of data in the CH2M HILL reports because previous interpretations of these data may not be valid, because samples were collected in a relatively short period of time at several hundred locations, and because the chemical analyses are nearly complete. Recent water samples from the same wells were not considered because the characterization of inorganic chemistry for groundwater and soil requirements only one representative sample and an accurate analysis from each location.
Inorganic soil and groundwater chemistry near Paducah Gaseous Diffusion Plant, Paducah, Kentucky
International Nuclear Information System (INIS)
Moore, G.K.
1995-03-01
Near-surface soils, boreholes, and sediments near the Paducah Gaseous Diffusion Plant (PGDP) were sampled in 1989-91 as were monitoring wells, TVA wells, and privately-owned wells. Most wells were sampled two or three times. The resulting chemical analyses have been published in previous reports and have been previously described (CH2M HILL 1991, 1992; Clausen et al. 1992). The two reports by CH2M HILL are controversial, however, because, the concentrations of some constituents were reported to exceed background levels or drinking water standards and because both on-site (within the perimeter fence at PGDP) and off-site pollution was reported to have occurred. The groundwater samples upon which these interpretations were based may not be representative, however. The CH2M HILL findings are discussed in the report. The purpose of this report is to characterize the inorganic chemistry of groundwater and soils near PGDP, using data from the CH2M HILL reports (1991, 1992), and to determine whether or not any contamination has occurred. The scope is limited to analysis and interpretation of data in the CH2M HILL reports because previous interpretations of these data may not be valid, because samples were collected in a relatively short period of time at several hundred locations, and because the chemical analyses are nearly complete. Recent water samples from the same wells were not considered because the characterization of inorganic chemistry for groundwater and soil requirements only one representative sample and an accurate analysis from each location
Characterizing pathways of invasion using Sternorryhncha on imported plant material in cargo
Timothy T. Work
2011-01-01
Non-indigenous Homoptera, mainly scales, aphids, and mealy bugs, intercepted on plants destined for cultivation represent an elevated risk for the establishment of invasive insects in North America. These insects [grouped as the suborder Sternorrhyncha] are often parthenogenic and are imported on viable host plants.
International Nuclear Information System (INIS)
Mabrouk, A.
2012-01-01
In pressurized water reactor, ion exchange resins (IER) are used in systems purification. In this thesis, a qualitative study has been performed to predict the behavior of IER while used in nuclear plants conditions. Then, we searched to characterize the IER behavior in column through a quantitative study using analytical solutions. But these solutions worked only for particular cases. In order to find a general solution, we used a new numerical solution: OPTIPUR. To validate this general solution and get a better understanding of the kinetic in column, we performed an experimental study to characterize the resistance to mass transfer in column and to study the sensibility on the parameters influencing this phenomenon. This study is based on the characterization of the initial leakage (initial pollutant concentration at the column outlet). We tested numerous parameters on the initial leakage. We understood the importance of the superficial velocity and indeed of the hydrodynamic conditions on the initial leakage. These numerous results about initial leakage were modeled with an empirical correlation of Dwivedi and Upadhyay in order to validate it. Then, we modeled our results with the two options of OPTIPUR software: option Mass Transfer Coefficient (MTC) and Nernst-Planck (NP). These options encircle experimental results. The MTC option of OPTIPUR gives lower results while those obtained with the NP option are higher than the experimental results. We observed also that only the NP option was valid for a ternary exchange. We proposed solutions to get a better fit with the results obtained with OPTIPUR. We performed other simulations to check the prediction abilities of the software for longer experiments (until the IER saturation). The tendencies were those expected. The OPTIPUR software showed is accuracy and robustness to study column kinetic. (author)
Osmolyte cooperation affects turgor dynamics in plants
Argiolas, Alfredo; Puleo, Gian Luigi; Sinibaldi, Edoardo; Mazzolai, Barbara
2016-07-01
Scientists have identified turgor-based actuation as a fundamental mechanism in plant movements. Plant cell turgor is generated by water influx due to the osmolyte concentration gradient through the cell wall and the plasma membrane behaving as an osmotic barrier. Previous studies have focused on turgor modulation with respect to potassium chloride (KCl) concentration changes, although KCl is not efficiently retained in the cell, and many other compounds, including L-glutamine (L-Gln) and D-glucose (D-Glc), are present in the cytosol. In fact, the contributions of other osmolytes to turgor dynamics remain to be elucidated. Here, we show the association of osmolytes and their consequent cooperative effects on the time-dependent turgor profile generated in a model cytosol consisting of KCl, D-Glc and L-Gln at experimentally measured plant motor/generic cell concentrations and at modified concentrations. We demonstrate the influence and association of the osmolytes using osmometry and NMR measurements. We also show, using a plant cell-inspired device we previously developed, that osmolyte complexes, rather than single osmolytes, permit to obtain higher turgor required by plant movements. We provide quantitative cues for deeper investigations of osmolyte transport for plant movement, and reveal the possibility of developing osmotic actuators exploiting a dynamically varying concentration of osmolytes.
Effect Of Bird Manure On Cotton Plants Grown On Soils Sampled ...
African Journals Online (AJOL)
Cotton plant had a better development and growth when bird manure was only applied to soil or combined with mineral fertilizer and when cotton was grown on a soil where the previous crops were cereals (maize or sorghum). Planting cotton on a soil where the previous crop grown was maize or sorghum had no significant ...
MELiSSA Food Characterization general approach and current status
Weihreter, Martin; Chaerle, Laury; Secco, Benjamin; Molders, Katrien; van der Straeten, Dominique; Duliere, Eric; Pieters, Serge; Maclean, Heather; Dochain, Denis; Quinet, Muriel; Lutts, Stanley; Graham, Thomas; Stasiak, Michael; Rondeau Vuk, Theresa; Zheng, Youbin; Dixon, Mike; Laniau, Martine; Larreture, Alain; Timsit, Michel; Aronne, Giovanna; Barbieri, Giancarlo; Buonomo, Roberta; Veronica; Paradiso, Roberta; de Pascale, Stafania; Galbiati, Massimo; Troia, A. R.; Nobili, Matteo; Bucchieri, Lorenzo; Page, Valérie; Feller, Urs; Lasseur, Christophe
Higher plants play an important role in closed ecological life support systems as oxygen pro-ducers, carbon dioxide and water recyclers, and as a food source. For an integration of higher plant chambers into the MELiSSA (Micro Ecological Life Support System Alternative) loop, a detailed characterization and optimization of the full food production and preparation chain is needed. This implies the prediction and control of the nutritional quality of the final products consumed by the crew, the prediction of the wastes quality and quantity produced along the chain for further waste treatment (MELiSSA waste treatment) and the optimization of overall efficiencies. To reach this goal several issues have to be studied in an integrated manner: the physiological responses of crops to a range of environmental parameters, crop yield efficiencies and respective ratio and composition of edible and inedible biomass, the processability and storability of the produced food and last but not least composition of wastes in view of further degradation (fiber content). Within the Food Characterization (FC) project several compar-ative plant growth bench tests were carried out to obtain preliminary data regarding these aspects. Four pre-selected cultivars of each of the four energy-rich crops with worldwide usage -wheat, durum wheat, potato and soybean -were grown under well-characterized environmental conditions. The different cultivars of each species are screened for their performance in view of a closed loop application by parameter ranking. This comprises the characterization of edi-ble/inedible biomass ratio, nutritional quality, processability and overall performance under the specific conditions of hydroponic cultivation and artificial illumination. A second closely linked goal of the FC project is to develop a mechanistic physiological plant model, which will ease the integration of higher plants compartments in the MELiSSA concept by virtue of its predictive abilities
Nuclear power plant operating experience. Annual report, 1978
International Nuclear Information System (INIS)
Beebe, M.R.
1979-12-01
This report is the fifth in a series of reports issued annually that summarizes the operating experience of US nuclear power plants in commercial operation. Power generation statistics, plant outages, reportable occurrences, fuel element performance, occupational radiation exposure for each plant are presented. Summary highlights of these areas are discussed. The report includes 1978 data from 65 plants - 25 boiling water reactor plants and 40 pressurized water reactor plants. Discussion of radioactive effluents which has been a part of this report in previous years, has not been included in this issue because of late acquisition of data
-pumping pyrophosphatase in pepper plants
Vigani, Gianpiero; Rolli, Eleonora; Marasco, Ramona; Dell'Orto, Marta; Michoud, Gregoire; Soussi, Asma; Raddadi, Noura; Borin, Sara; Sorlini, Claudia; Zocchi, Graziano; Daffonchio, Daniele
2018-01-01
It has been previously shown that the transgenic overexpression of the plant root vacuolar proton pumps H+ -ATPase (V-ATPase) and H+ -PPase (V-PPase) confer tolerance to drought. Since plant-root endophytic bacteria can also promote drought tolerance, we hypothesize that such promotion can be associated to the enhancement of the host vacuolar proton pumps expression and activity. To test this hypothesis, we selected two endophytic bacteria endowed with an array of in vitro plant growth promoting traits. Their genome sequences confirmed the presence of traits previously shown to confer drought resistance to plants, such as the synthesis of nitric oxide and of organic volatile organic compounds. We used the two strains on pepper (Capsicuum annuum L.) because of its high sensitivity to drought. Under drought conditions, both strains stimulated a larger root system and enhanced the leaves' photosynthetic activity. By testing the expression and activity of the vacuolar proton pumps, H+ -ATPase (V-ATPase) and H+ -PPase (V-PPase), we found that bacterial colonization enhanced V-PPase only. We conclude that the enhanced expression and activity of V-PPase can be favoured by the colonization of drought-tolerance-inducing bacterial endophytes. This article is protected by copyright. All rights reserved.
-pumping pyrophosphatase in pepper plants
Vigani, Gianpiero
2018-05-22
It has been previously shown that the transgenic overexpression of the plant root vacuolar proton pumps H+ -ATPase (V-ATPase) and H+ -PPase (V-PPase) confer tolerance to drought. Since plant-root endophytic bacteria can also promote drought tolerance, we hypothesize that such promotion can be associated to the enhancement of the host vacuolar proton pumps expression and activity. To test this hypothesis, we selected two endophytic bacteria endowed with an array of in vitro plant growth promoting traits. Their genome sequences confirmed the presence of traits previously shown to confer drought resistance to plants, such as the synthesis of nitric oxide and of organic volatile organic compounds. We used the two strains on pepper (Capsicuum annuum L.) because of its high sensitivity to drought. Under drought conditions, both strains stimulated a larger root system and enhanced the leaves\\' photosynthetic activity. By testing the expression and activity of the vacuolar proton pumps, H+ -ATPase (V-ATPase) and H+ -PPase (V-PPase), we found that bacterial colonization enhanced V-PPase only. We conclude that the enhanced expression and activity of V-PPase can be favoured by the colonization of drought-tolerance-inducing bacterial endophytes. This article is protected by copyright. All rights reserved.
Diversity and Plant Growth Promoting Proerties of Rhizobacteria ...
African Journals Online (AJOL)
The purpose of this study was to evaluate and assess the plant growth promoting characteristics and diversity of major tef rhizosphere isolates from central Ethiopia. A total of 162 bacteria were isolated from rhizosphere of tef [Eragrostis tef (Zucc.) Trotter] and characterized. While screening using some plant growth ...
Directory of Open Access Journals (Sweden)
Rumsaïs Blatrix
Full Text Available Some tropical plant species possess hollow structures (domatia occupied by ants that protect the plant and in some cases also provide it with nutrients. Most plant-ants tend patches of chaetothyrialean fungi within domatia. In a few systems it has been shown that the ants manure the fungal patches and use them as a food source, indicating agricultural practices. However, the identity of these fungi has been investigated only in a few samples. To examine the specificity and constancy of ant-plant-fungus interactions we characterised the content of fungal patches in an extensive sampling of three ant-plant symbioses (Petalomyrmex phylax/Leonardoxa africana subsp. africana, Aphomomyrmex afer/Leonardoxa africana subsp. letouzeyi and Tetraponera aethiops/Barteria fistulosa by sequencing the Internal Transcribed Spacers of ribosomal DNA. For each system the content of fungal patches was constant over individuals and populations. Each symbiosis was associated with a specific, dominant, primary fungal taxon, and to a lesser extent, with one or two specific secondary taxa, all of the order Chaetothyriales. A single fungal patch sometimes contained both a primary and a secondary taxon. In one system, two founding queens were found with the primary fungal taxon only, one that was shown in a previous study to be consumed preferentially. Because the different ant-plant symbioses studied have evolved independently, the high specificity and constancy we observed in the composition of the fungal patches have evolved repeatedly. Specificity and constancy also characterize other cases of agriculture by insects.
Foreign acquisition, plant survival, and employment growth
DEFF Research Database (Denmark)
Bandick, Roger; Görg, Holger
This paper analyses the effect of foreign acquisition on survival probability and employment growth of target plant using data on Swedish manufacturing plants during the period 1993-2002. An improvement over previous studies is that we take into account firm level heterogeneity by separating...... the lifetime of the acquired plants only if the plant was an exporter. The effect differs depending on whether the acquisition is horizontal or vertical. We also find robust positive employment growth effects only for exporters, and only if the takeover is vertical, not horizontal....
Papenbrock, J; Riemenschneider, A; Kamp, A; Schulz-Vogt, H N; Schmidt, A
2007-09-01
Due to the clean air acts and subsequent reduction of emission of gaseous sulfur compounds sulfur deficiency became one of the major nutrient disorders in Northern Europe. Typical sulfur deficiency symptoms can be diagnosed. Especially plants of the Cruciferae family are more susceptible against pathogen attack. Sulfur fertilization can in part recover or even increase resistance against pathogens in comparison to sulfur-deficient plants. The term sulfur-induced resistance (SIR) was introduced, however, the molecular basis for SIR is largely unknown. There are several sulfur-containing compounds in plants which might be involved in SIR, such as high levels of thiols, glucosinolates, cysteine-rich proteins, phytoalexins, elemental sulfur, or H2S. Probably more than one strategy is used by plants. Species- or even variety-dependent differences in the development of SIR are probably used. Our research focussed mainly on the release of H2S as defence strategy. In field experiments using different BRASSICA NAPUS genotypes it was shown that the genetic differences among BRASSICA genotypes lead to differences in sulfur content and L-cysteine desulfhydrase activity. Another field experiment demonstrated that sulfur supply and infection with PYRENOPEZIZA BRASSICA influenced L-cysteine desulfhydrase activity in BRASSICA NAPUS. Cysteine-degrading enzymes such as cysteine desulfhydrases are hypothesized to be involved in H2S release. Several L- and D-cysteine-specific desulfhydrase candidates have been isolated and partially analyzed from the model plant ARABIDOPSIS THALIANA. However, it cannot be excluded that H2S is also released in a partial back reaction of O-acetyl-L-serine(thiol)lyase or enzymes not yet characterized. For the exact determination of the H2S concentration in the cell a H2S-specific microsensor was used the first time for plant cells. The transfer of the results obtained for application back on BRASSICA was initiated.
El-Sayed, Wael S.; Akhkha, Abdellah; El-Naggar, Moustafa Y.; Elbadry, Medhat
2014-01-01
The role of plant growth-promoting rhizobacteria (PGPR) in adaptation of plants in extreme environments is not yet completely understood. For this study native bacteria were isolated from rhizospeheric arid soils and evaluated for both growth-promoting abilities and antagonistic potential against phytopathogenic fungi and nematodes. The phylogentic affiliation of these representative isolates was also characterized. Rhizobacteria associated with 11 wild plant species from the arid soil of Alm...
Energy Technology Data Exchange (ETDEWEB)
Francini, A. [Dipartimento di Coltivazione e Difesa delle Specie Legnose ' Giovanni Scaramuzzi' , University of Pisa, Via del Borghetto 80, 56124 Pisa (Italy); Nali, C. [Dipartimento di Coltivazione e Difesa delle Specie Legnose ' Giovanni Scaramuzzi' , University of Pisa, Via del Borghetto 80, 56124 Pisa (Italy)], E-mail: cristina.nali@agr.unipi.it; Pellegrini, E.; Lorenzini, G. [Dipartimento di Coltivazione e Difesa delle Specie Legnose ' Giovanni Scaramuzzi' , University of Pisa, Via del Borghetto 80, 56124 Pisa (Italy)
2008-01-15
Centaurea jacea has been suggested as a potential bioindicator for ozone, but little is known about its intraspecific variation in sensitivity, especially at molecular level. The effects of ozone (200 ppb, 5 h) on sensitive and resistant lines of Centaurea have been investigated at the end of fumigation. Sensitive plants showed characteristic symptoms of injury in the form of diffuse discoloration stipples on leaves. A PCR-based approach was used to identify and isolate a partial-length cDNA coding for PAL and CHS genes. The northern analysis of PAL showed accumulation of transcript in both lines correlated with a typical increase of PAL activity (+41 and +91% in resistant and sensitive material, respectively, compared to controls). On the contrary, the transcripts of CHS, in resistant and sensitive plants, did not change after treatment. Total phenols were not affected by ozone, while anthocyanins were quickly utilised by resistant clone as antioxidant compounds. - Characterization and isolation of PAL and CHS genes in Centaurea jacea exposed to O{sub 3}.
Characterization of indole acetic acid endophyte producers in ...
African Journals Online (AJOL)
This work contributes to the knowledge of the phytobacteria diversity in aquatic plants, particularly in Lemnaceae species; here the majority of the isolates have been characterized as higher indole acetic acid producers, recommended as candidates for their use as biofertilizers. Key words: Plant growth-promoting bacteria, ...
New technologies accelerate the exploration of non-coding RNAs in horticultural plants
Energy Technology Data Exchange (ETDEWEB)
Liu, Degao; Mewalal, Ritesh; Hu, Rongbin; Tuskan, Gerald A.; Yang, Xiaohan
2017-07-05
Non-coding RNAs (ncRNAs), that is, RNAs not translated into proteins, are crucial regulators of a variety of biological processes in plants. While protein-encoding genes have been relatively well-annotated in sequenced genomes, accounting for a small portion of the genome space in plants, the universe of plant ncRNAs is rapidly expanding. Recent advances in experimental and computational technologies have generated a great momentum for discovery and functional characterization of ncRNAs. Here we summarize the classification and known biological functions of plant ncRNAs, review the application of next-generation sequencing (NGS) technology and ribosome profiling technology to ncRNA discovery in horticultural plants and discuss the application of new technologies, especially the new genome-editing tool clustered regularly interspaced short palindromic repeat (CRISPR)/CRISPR-associated protein 9 (Cas9) systems, to functional characterization of plant ncRNAs.
Lipavská, Helena; Žárský, Viktor
2009-01-01
The concept of plant intelligence, as proposed by Anthony Trewavas, has raised considerable discussion. However, plant intelligence remains loosely defined; often it is either perceived as practically synonymous to Darwinian fitness, or reduced to a mere decorative metaphor. A more strict view can be taken, emphasizing necessary prerequisites such as memory and learning, which requires clarifying the definition of memory itself. To qualify as memories, traces of past events have to be not only stored, but also actively accessed. We propose a criterion for eliminating false candidates of possible plant intelligence phenomena in this stricter sense: an “intelligent” behavior must involve a component that can be approximated by a plausible algorithmic model involving recourse to stored information about past states of the individual or its environment. Re-evaluation of previously presented examples of plant intelligence shows that only some of them pass our test. “You were hurt?” Kumiko said, looking at the scar. Sally looked down. “Yeah.” “Why didn't you have it removed?” “Sometimes it's good to remember.” “Being hurt?” “Being stupid.”—(W. Gibson: Mona Lisa Overdrive) PMID:19816094
Synthesis of plant cell wall oligosaccharides
DEFF Research Database (Denmark)
Clausen, Mads Hartvig
Plant cell walls are structurally complex and contain a large number of diverse carbohydrate polymers. These plant fibers are a highly valuable bio-resource and the focus of food, energy and health research. We are interested in studying the interplay of plant cell wall carbohydrates with proteins...... for characterizing protein-carbohydrate binding. The presentation will highlight chemical syntheses of plant cell wall oligosaccharides from the group and provide examples from studies of their interactions with proteins....... such as enzymes, cell surface lectins, and antibodies. However, detailed molecular level investigations of such interactions are hampered by the heterogeneity and diversity of the polymers of interest. To circumvent this, we target well-defined oligosaccharides with representative structures that can be used...
Plant-made vaccine antigens and biopharmaceuticals.
Daniell, Henry; Singh, Nameirakpam D; Mason, Hugh; Streatfield, Stephen J
2009-12-01
Plant cells are ideal bioreactors for the production and oral delivery of vaccines and biopharmaceuticals, eliminating the need for expensive fermentation, purification, cold storage, transportation and sterile delivery. Plant-made vaccines have been developed for two decades but none has advanced beyond Phase I. However, two plant-made biopharmaceuticals are now advancing through Phase II and Phase III human clinical trials. In this review, we evaluate the advantages and disadvantages of different plant expression systems (stable nuclear and chloroplast or transient viral) and their current limitations or challenges. We provide suggestions for advancing this valuable concept for clinical applications and conclude that greater research emphasis is needed on large-scale production, purification, functional characterization, oral delivery and preclinical evaluation.
Martínez-Aguilar, Juan Fco; Peña-Alvarez, Araceli
2009-03-11
Five agave plants typically used in Mexico for making mezcal in places included in the Denomination of Origin (Mexican federal law that establishes the territory within which mezcal can be produced) of this spirit were analyzed: Agave salmiana ssp. crassispina, A. salmiana var. salmiana, Agave angustifolia, Agave cupreata, and Agave karwinskii. Fatty acid and total simple lipid profiles of the mature heads of each plant were determined by means of a modified Bligh-Dyer extraction and gas chromatography. Sixteen fatty acids were identified, from capric to lignoceric, ranging from 0.40 to 459 microg/g of agave. Identified lipids include free fatty acids, beta-sitosterol, and groups of mono-, di-, and triacylglycerols, their total concentration ranging from 459 to 992 microg/g of agave. Multivariate analyses performed on the fatty acid profiles showed a close similarity between A. cupreata and A. angustifolia. This fact can be ascribed to the taxa themselves or differences in growing conditions, an issue that is still to be explored. These results help to characterize the agaves chemically and can serve to relate the composition of mezcals from various states of Mexico with the corresponding raw material.
Idris, Rughia; Kuffner, Melanie; Bodrossy, Levente; Puschenreiter, Markus; Monchy, Sebastien; Wenzel, Walter W; Sessitsch, Angela
2006-12-01
Various pink-pigmented facultative methylotrophic (PPFM) bacteria (strains iEII3, iEIV1, iEI6, iEII1, iEIII3 iEIII4, iEIII5, iRII1, iRII2, iRIII1, iRIV1 and iRIV2) were obtained from the rhizosphere and endosphere of hyperaccumulating plant Thlaspi goesingense grown in Redschlag, Austria [R. Idris, R. Trifonova, M. Puschenreiter, W.W. Wenzel, A. Sessitsch, Bacterial communities associated with flowering plants of the Ni hyperaccumulator Thlaspi goesingense, Appl. Environ. Microbiol. 70 (2004) 2667-2677]. Due to their unexpected diversity, abundance and nickel tolerance they were further characterized by detailed 16S rRNA gene analysis, DNA-DNA hybridization, fatty acid analysis, heavy metal tolerance, screening for known Ni resistance genes and phenotypic analysis. These strains were found to exhibit different multiple heavy metal resistance characteristics to Ni, Cd, Co, Zn and Cr. On the basis of their physiological and genotypic properties, strains could be grouped with Methylobacterium extorquens and M. mesophilicum. One endophyte, strain iEII3, was found to belong to a novel species for which the name M. goesingense is proposed.
Knapp, Sonja
2010-01-01
Urbanization is one of the main drivers of global change. It often takes place in areas with high biodiversity, threatening species worldwide. To protect biodiversity not only outside but also right within urban areas, knowledge about the effects of urban land use on species assemblages is essential. Sonja Knapp compares several aspects of plant biodiversity between urban and rural areas in Germany. Using extensive databases and modern statistical methods, she goes beyond species richness: Urban areas are rich in species but plant species in urban areas are closer related to each other than plant species in rural areas, respectively. The urban environment, characterized by high temperatures and frequent disturbances, changes the functional composition of the flora. It promotes e.g. short-lived species with leaves adapted to drought but threatens insect-pollinated or wind-dispersed species. The author claims that the protection of biodiversity should not only focus on species richness but also on functional an...
Directory of Open Access Journals (Sweden)
Leila ePazouki
2015-03-01
Full Text Available Terpenoid synthases constitute a highly diverse gene family producing a wide range of cyclic and acyclic molecules consisting of isoprene (C5 residues. Often a single terpene synthase produces a spectrum of molecules of given chain length, but some terpene synthases can use multiple substrates, producing products of different chain length. Only a few such enzymes has been characterized, but the capacity for multiple-substrate use can be more widespread than previously thought. Here we focused on germacrene A synthase (GAS that is a key cytosolic enzyme in the sesquiterpene lactone biosynthesis pathway in the important medicinal plant Achillea millefolium (AmGAS. The full length encoding gene was heterologously expressed in Escherichia coli BL21 (DE3, functionally characterized, and its in vivo expression was analyzed. The recombinant protein catalyzed formation of germacrene A with the C15 substrate farnesyl diphosphate (FDP, while acyclic monoterpenes were formed with the C10 substrate geranyl diphosphate (GDP and cyclic monoterpenes with the C10 substrate neryl diphosphate (NDP. Although monoterpene synthesis has been assumed to be confined exclusively to plastids, AmGAS can potentially synthesize monoterpenes in cytosol when GDP or NDP become available. AmGAS enzyme had high homology with GAS sequences from other Asteraceae species, suggesting that multi-substrate use can be more widespread among germacrene A synthases than previously thought. Expression studies indicated that AmGAS was expressed in both autotrophic and heterotrophic plant compartments with the highest expression levels in leaves and flowers. To our knowledge, this is the first report on the cloning and characterization of germacrene A synthase coding gene in A. millefolium, and multi-substrate use of GAS enzymes.
The function of the Mediator complex in plant immunity.
An, Chuanfu; Mou, Zhonglin
2013-03-01
Upon pathogen infection, plants undergo dramatic transcriptome reprogramming to shift from normal growth and development to immune response. During this rapid process, the multiprotein Mediator complex has been recognized as an important player to fine-tune gene-specific and pathway-specific transcriptional reprogramming by acting as an adaptor/coregulator between sequence-specific transcription factor and RNA polymerase II (RNAPII). Here, we review current understanding of the role of five functionally characterized Mediator subunits (MED8, MED15, MED16, MED21 and MED25) in plant immunity. All these Mediator subunits positively regulate resistance against leaf-infecting biotrophic bacteria or necrotrophic fungi. While MED21 appears to regulate defense against fungal pathogens via relaying signals from upstream regulators and chromatin modification to RNAPII, the other four Mediator subunits locate at different positions of the defense network to convey phytohormone signal(s). Fully understanding the role of Mediator in plant immunity needs to characterize more Mediator subunits in both Arabidopsis and other plant species. Identification of interacting proteins of Mediator subunits will further help to reveal their specific regulatory mechanisms in plant immunity.
Directory of Open Access Journals (Sweden)
Wenjun Huang
2017-07-01
Full Text Available Epimedium species have been widely used both as traditional Chinese medicinal plants and ornamental perennials. Both flavonols, acting as the major bioactive components (BCs and anthocyanins, predominantly contributing to the color diversity of Epimedium flowers belong to different classes of flavonoids. It is well-acknowledged that flavonoid biosynthetic pathway is predominantly regulated by R2R3-MYB transcription factor (TF as well as bHLH TF and WD40 protein at the transcriptional level. MYB TFs specifically regulating anthocyanin or flavonol biosynthetic pathway have been already isolated and functionally characterized from Epimedium sagittatum, but a R2R3-MYB TF involved in regulating both these two pathways has not been functionally characterized to date in Epimedium plants. In this study, we report the functional characterization of EsMYB9, a R2R3-MYB TF previously isolated from E. sagittatum. The previous study indicated that EsMYB9 belongs to a small subfamily of R2R3-MYB TFs containing grape VvMYB5a and VvMYB5b TFs, which regulate flavonoid biosynthetic pathway. The present studies show that overexpression of EsMYB9 in tobacco leads to increased transcript levels of flavonoid pathway genes and increased contents of anthocyanins and flavonols. Yeast two-hybrid assay indicates that the C-terminal region of EsMYB9 contributes to the autoactivation activity, and EsMYB9 interacts with EsTT8 or AtTT8 bHLH regulator. Transient reporter assay shows that EsMYB9 slightly activates the expression of EsCHS (chalcone synthase promoter in transiently transformed leaves of Nicotiana benthamiana, but the addition of AtTT8 or EsTT8 bHLH regulator strongly enhances the transcriptional activation of EsMYB9 against five promoters of the flavonoid pathway genes except EsFLS (flavonol synthase. In addition, co-transformation of EsMYB9 and EsTT8 in transiently transfected tobacco leaves strongly induces the expressions of flavonoid biosynthetic genes. The
Dynamics of an ant-plant-pollinator model
Wang, Yuanshi; DeAngelis, Donald L.; Nathaniel Holland, J.
2015-03-01
In this paper, we consider plant-pollinator-ant systems in which plant-pollinator interaction and plant-ant interaction are both mutualistic, but there also exists interference of pollinators by ants. The plant-pollinator interaction can be described by a Beddington-DeAngelis formula, so we extend the formula to characterize plant-pollinator mutualisms, including the interference by ants, and form a plant-pollinator-ant model. Using dynamical systems theory, we show uniform persistence of the model. Moreover, we demonstrate conditions under which boundary equilibria are globally asymptotically stable. The dynamics exhibit mechanisms by which the three species could coexist when ants interfere with pollinators. We define a threshold in ant interference. When ant interference is strong, it can drive plant-pollinator mutualisms to extinction. Furthermore, if the ants depend on pollination mutualism for their persistence, then sufficiently strong ant interference could lead to their own extinction as well. Yet, when ant interference is weak, plant-ant and plant-pollinator mutualisms can promote the persistence of one another.
Early vascular plants in the Czech Republic
Uhlířová, Monika
2017-01-01
Vascular plants are characterized as a group of plants, which are already fully adapted to live on the land. Their evolution is a result of a set of adaptations that have required the necessary changes at anatomical and morphological level. Some evidences about the rise of vascular plants appear in the fossil record from the Middle Ordovician in the form of spores and later also from the Early Silurian in the form of megafossils. The aim of the thesis is to briefly describe and discuss the mo...
Sahin, Nurettin
2004-10-01
The present work was aimed at the isolation of additional new pure cultures of oxalate-degrading Streptomyces and its preliminary characterization for further work in the field of oxalate metabolism and taxonomic studies. Mesophilic, oxalate-degrading Streptomyces were enriched and isolated from plant rhizosphere and forest soil samples. Strains were examined for cultural, morphological (spore chain morphology, spore mass colour, diffusible and melanin pigment production), physiological (antibiosis, growth in the presence of inhibitory compounds, assimilation of organic acids and enzyme substrates) and chemotaxonomic characters (cellular lipid components and diagnostic cell-wall diamino acid). The taxonomic data obtained were analysed by using the simple matching (SSM) and Jaccard (SJ) coefficients, clustering was achieved using the UPGMA algorithm. All strains were able to utilize sodium-, potassium-, calcium- and ammonium-oxalate salts. Based on the results of numerical taxonomy, isolates were grouped into five cluster groups with a ≥70% SSM similarity level. Streptomyces rochei was the most common of the cluster groups, with a Willcox probability of P>0.8. Streptomyces antibioticus, S. anulatus, S. fulvissimus, S. halstedii and S. violaceusniger are newly reported as oxalate-utilizing Streptomyces.
International Nuclear Information System (INIS)
Saleem, A. R.; Mahmood, T.; Batool, A.; Khalid, A.
2016-01-01
Rhizobacteria with plant growth promoting ability exist in association with plant roots and ameliorate over all plant development and yield. Numerous species of rhizobacteria have been identified with plant growth promoting ability, which can be attributed to multiple microbial characteristics. In the current study rhizobacterial isolates with best plant growth promotion traits were subjected to screening for plant growth promotion under axenic condition. The results of lab assays revealed that out of five rhizobacterial isolates three of bacterial isolate were Gram -ve and two of them were Gram +ve bacterial group. All isolates found positive for the auxin production and ACC-demainase activity. The isolate HS9 showed highest ACC activity (331 ketobutyrate nmol mg-1 biomass hr-1) and auxin production (3.85 without L-TRP). PGPR increase plant growth by reducing the ethylene release and its inhibitory effects, the role of isolates to decrease ethylene effects was affirmed via classical triple response assay on velvet bean. Furthermore, isolate were assessed for resistance test, three efficient strains (G9, HS9 and H38) exhibited antibiotic resistance for streptomycin, kanamycin and rifampicin at 100 mg L-1in TSB medium. For the purpose of co-inoculation, all three isolates showed positive relation to grow together. The results concluded that rhizobacteria selected from rain fed areas were found effective to improve plant growth with their multiple growth enhancing traits. Therefore, PGPR with various characteristics could be a better option for inoculation and co-inoculation to improve plant growth in well watered and water stressed environment. (author)
Characterization of Natural Dyes and Traditional Korean Silk Fabric by Surface Analytical Techniques
Directory of Open Access Journals (Sweden)
Yeonhee Lee
2013-05-01
Full Text Available Time-of-flight secondary ion mass spectrometry (TOF-SIMS and X-ray photoelectron spectroscopy (XPS are well established surface techniques that provide both elemental and organic information from several monolayers of a sample surface, while also allowing depth profiling or image mapping to be carried out. The static TOF-SIMS with improved performances has expanded the application of TOF-SIMS to the study of a variety of organic, polymeric and biological materials. In this work, TOF-SIMS, XPS and Fourier Transform Infrared (FTIR measurements were used to characterize commercial natural dyes and traditional silk fabric dyed with plant extracts dyes avoiding the time-consuming and destructive extraction procedures necessary for the spectrophotometric and chromatographic methods previously used. Silk textiles dyed with plant extracts were then analyzed for chemical and functional group identification of their dye components and mordants. TOF-SIMS spectra for the dyed silk fabric showed element ions from metallic mordants, specific fragment ions and molecular ions from plant-extracted dyes. The results of TOF-SIMS, XPS and FTIR are very useful as a reference database for comparison with data about traditional Korean silk fabric and to provide an understanding of traditional dyeing materials. Therefore, this study shows that surface techniques are useful for micro-destructive analysis of plant-extracted dyes and Korean dyed silk fabric.
Characterization of Natural Dyes and Traditional Korean Silk Fabric by Surface Analytical Techniques
Lee, Jihye; Kang, Min Hwa; Lee, Kang-Bong; Lee, Yeonhee
2013-01-01
Time-of-flight secondary ion mass spectrometry (TOF-SIMS) and X-ray photoelectron spectroscopy (XPS) are well established surface techniques that provide both elemental and organic information from several monolayers of a sample surface, while also allowing depth profiling or image mapping to be carried out. The static TOF-SIMS with improved performances has expanded the application of TOF-SIMS to the study of a variety of organic, polymeric and biological materials. In this work, TOF-SIMS, XPS and Fourier Transform Infrared (FTIR) measurements were used to characterize commercial natural dyes and traditional silk fabric dyed with plant extracts dyes avoiding the time-consuming and destructive extraction procedures necessary for the spectrophotometric and chromatographic methods previously used. Silk textiles dyed with plant extracts were then analyzed for chemical and functional group identification of their dye components and mordants. TOF-SIMS spectra for the dyed silk fabric showed element ions from metallic mordants, specific fragment ions and molecular ions from plant-extracted dyes. The results of TOF-SIMS, XPS and FTIR are very useful as a reference database for comparison with data about traditional Korean silk fabric and to provide an understanding of traditional dyeing materials. Therefore, this study shows that surface techniques are useful for micro-destructive analysis of plant-extracted dyes and Korean dyed silk fabric. PMID:28809257
Directory of Open Access Journals (Sweden)
Cindy Bongard
2012-08-01
Full Text Available Plant-fungal interactions are essential for understanding the distribution and abundance of plants species. Recently, arbuscular mycorrhizal fungal (AMF partners of non-indigenous invasive plants have been hypothesized to be a critical factor influencing the invasion processes. AMF are known to improve nutrient and moisture uptake, as well as disrupt parasitic and pathogenic microbes in the host plant. Such benefits may enable invaders to establish significant and persistent populations in environments previously dominated by natives. Coupling these findings with studies on invader pathogen-disrupting root exudates is not well documented in the literature describing plant invasion strategies. The interaction effects of altered AMF associations and the impact of invader root exudates would be more relevant than understanding the AMF dynamics or the phytochemistry of successful invaders in isolation, particularly given that AMF and root exudates can have a similar role in pathogen control but function quite differently. One means to achieve this goal is to assess these strategies concurrently by characterizing both the general (mostly pathogens or commensals and AM-specific fungal colonization patterns found in field collected root samples of successful invaders, native plants growing within dense patches of invaders, and native plants growing separately from invaders. In this review I examine the emerging evidence of the ways in which AMF-plant interactions and the production of defensive root exudates provide pathways to invasive plant establishment and expansion, and conclude that interaction studies must be pursued to achieve a more comprehensive understanding of successful plant invasion.
Energy Technology Data Exchange (ETDEWEB)
Orth, J. [ABB AG, Mannheim (Germany). Bereich Energietechnik
2005-10-31
Today's power generation markets are largely characterized by a small number of new thermal power plants, but a large number of highly aged plants. Plant owners are primarily interested in extending the service life of their existing facilities. In the current competitive scenario, they prefer modular and scalable I and C solutions that will allow them to keep the current equipment to a large extend. (orig.)
Characterization of wastes from fission 99 Mo production
International Nuclear Information System (INIS)
Endo, L.S.; Dellamano, J.C.
1992-07-01
This work is a preliminary study on waste-streams generated in a fission 99 Mo production plant, their characterization and quantification. The study is based on a plant whose 99 Mo production process is the alkaline dissolution of U-target. The target is made of 1 g of enriched 235 U, therefore most of radionuclides present in the waste-streams are fission products. All the radionuclides inventories were estimated based on ORIGEN-2 Code. The characterization was done as a primary stage for the establishment of waste management plan, which should be subject for further study. (author)
Nuclear Plant Aging Research (NPAR) program plan
International Nuclear Information System (INIS)
1985-07-01
The nuclear plant aging research described in this plan is intended to resolve issues related to the aging and service wear of equipment and systems at commercial reactor facilities and their possible impact on plant safety. Emphasis has been placed on identification and characterization of the mechansims of material and component degradation during service and evaluation of methods of inspection, surveillance, condition monitoring and maintenance as means of mitigating such effects. Specifically the goals of the program are as follows: (1) to identify and characterize aging and service wear effects which, if unchecked, could cause degradation of structures, components, and systems and thereby impair plant safety; (2) to identify methods of inspection, surveillance and monitoring, or of evaluating residual life of structures, components, and systems, which will assure timely detection of significant aging effects prior to loss of safety function; and (3) to evaluate the effectiveness of storage, maintenance, repair and replacement practices in mitigating the rate and extent of degradation caused by aging and service wear
Eight previously unidentified mutations found in the OA1 ocular albinism gene
Directory of Open Access Journals (Sweden)
Dufier Jean-Louis
2006-04-01
Full Text Available Abstract Background Ocular albinism type 1 (OA1 is an X-linked ocular disorder characterized by a severe reduction in visual acuity, nystagmus, hypopigmentation of the retinal pigmented epithelium, foveal hypoplasia, macromelanosomes in pigmented skin and eye cells, and misrouting of the optical tracts. This disease is primarily caused by mutations in the OA1 gene. Methods The ophthalmologic phenotype of the patients and their family members was characterized. We screened for mutations in the OA1 gene by direct sequencing of the nine PCR-amplified exons, and for genomic deletions by PCR-amplification of large DNA fragments. Results We sequenced the nine exons of the OA1 gene in 72 individuals and found ten different mutations in seven unrelated families and three sporadic cases. The ten mutations include an amino acid substitution and a premature stop codon previously reported by our team, and eight previously unidentified mutations: three amino acid substitutions, a duplication, a deletion, an insertion and two splice-site mutations. The use of a novel Taq polymerase enabled us to amplify large genomic fragments covering the OA1 gene. and to detect very likely six distinct large deletions. Furthermore, we were able to confirm that there was no deletion in twenty one patients where no mutation had been found. Conclusion The identified mutations affect highly conserved amino acids, cause frameshifts or alternative splicing, thus affecting folding of the OA1 G protein coupled receptor, interactions of OA1 with its G protein and/or binding with its ligand.
Insect-resistant transgenic plants in a multi-trophic context
Groot, A.T.; Dicke, M.
2002-01-01
So far, genetic engineering of plants in the context of insect pest control has involved insertion of genes that code for toxins, and may be characterized as the incorporation of biopesticides into classical plant breeding. In the context of pesticide usage in pest control, natural enemies of
Development of sensors for monitoring oxygen and free radicals in plant physiology
Chaturvedi, Prachee
Oxygen plays a critical role in the physiology of photosynthetic organisms, including bioenergetics, metabolism, development, and stress response. Oxygen levels affect photosynthesis, respiration, and alternative oxidase pathways. Likewise, the metabolic rate of spatially distinct plant cells (and therefore oxygen flux) is known to be affected by biotic stress (e.g., herbivory) and environmental stress (e.g., salt/nutrient stress). During aerobic metabolism, cells produce reactive oxygen species (ROS) as a by product. Plants also produce ROS during adaptation to stress (e.g., abscisic acid (ABA) mediated stress responses). If stress conditions are prolonged, ROS levels surpass the capacity of detoxifying mechanisms within the cell, resulting in oxidative damage. While stress response pathways such as ABA-mediated mechanisms have been well characterized (e.g., water stress, inhibited shoot growth, synthesis of storage proteins in seeds), the connection between ROS production, oxygen metabolism and stress response remains unknown. In part, this is because details of oxygen transport at the interface of cell(s) and the surrounding microenvironment remains nebulous. The overall goal of this research was to develop oxygen and Free radical sensors for studying stress signaling in plants. Recent developments in nanomaterials and data acquisition systems were integrated to develop real-time, non-invasive oxygen and Free radical sensors. The availability of these sensors for plant physiologists is an exciting opportunity to probe the functional realm of cells and tissues in ways that were not previously possible.
High temperature reactor module power plant. Plant and safety concept June 1986 - 38.07126.2
International Nuclear Information System (INIS)
1986-06-01
The modular HTR power plant is a universally applicable energy source for the co-generation of electricity, process steam or district heating. The modular HTR concept is characterized by the fact that standardized reactor units with power ratings of 200 MJ/s (so-called modules) can be combined to form power plants with a higher power rating. Consequently the special safety features of small high-temperature reactors (HTR) are also available at higher power plant ratings. The safety features, the technical design and the mode of operation are briefly described in the following, taking a power plant with two HTR-Modules for the co-generation of electricity and process steam as an example. Due to its universal applicability and excellent safety features, the modular HTR power plant is suitable for erection on any site, but particularly on sites near other industrial plants or in densely populated areas. The co-generation of electricity and process steam or district heating with a modular HTR power plant as described here is primarily tailored to the requirements of industrial and communal consumers. The site for such a plant is a typical industrial one. The anticipated features of such sites were taken into consideration in the design of the modular HTR power plant
High temperature reactor module power plant. Plant and safety concept June 1986 - 38.07126.2
Energy Technology Data Exchange (ETDEWEB)
NONE
1986-06-15
The modular HTR power plant is a universally applicable energy source for the co-generation of electricity, process steam or district heating. The modular HTR concept is characterized by the fact that standardized reactor units with power ratings of 200 MJ/s (so-called modules) can be combined to form power plants with a higher power rating. Consequently the special safety features of small high-temperature reactors (HTR) are also available at higher power plant ratings. The safety features, the technical design and the mode of operation are briefly described in the following, taking a power plant with two HTR-Modules for the co-generation of electricity and process steam as an example. Due to its universal applicability and excellent safety features, the modular HTR power plant is suitable for erection on any site, but particularly on sites near other industrial plants or in densely populated areas. The co-generation of electricity and process steam or district heating with a modular HTR power plant as described here is primarily tailored to the requirements of industrial and communal consumers. The site for such a plant is a typical industrial one. The anticipated features of such sites were taken into consideration in the design of the modular HTR power plant.
Characterizing Sorghum Panicles using 3D Point Clouds
Lonesome, M.; Popescu, S. C.; Horne, D. W.; Pugh, N. A.; Rooney, W.
2017-12-01
To address demands of population growth and impacts of global climate change, plant breeders must increase crop yield through genetic improvement. However, plant phenotyping, the characterization of a plant's physical attributes, remains a primary bottleneck in modern crop improvement programs. 3D point clouds generated from terrestrial laser scanning (TLS) and unmanned aerial systems (UAS) based structure from motion (SfM) are a promising data source to increase the efficiency of screening plant material in breeding programs. This study develops and evaluates methods for characterizing sorghum (Sorghum bicolor) panicles (heads) in field plots from both TLS and UAS-based SfM point clouds. The TLS point cloud over experimental sorghum field at Texas A&M farm in Burleston County TX were collected using a FARO Focus X330 3D laser scanner. SfM point cloud was generated from UAS imagery captured using a Phantom 3 Professional UAS at 10m altitude and 85% image overlap. The panicle detection method applies point cloud reflectance, height and point density attributes characteristic of sorghum panicles to detect them and estimate their dimensions (panicle length and width) through image classification and clustering procedures. We compare the derived panicle counts and panicle sizes with field-based and manually digitized measurements in selected plots and study the strengths and limitations of each data source for sorghum panicle characterization.
Kang, Le; Ji, Chang Yoon; Kim, Sun Ha; Ke, Qingbo; Park, Sung-Chul; Kim, Ho Soo; Lee, Hyeong-Un; Lee, Joon Seol; Park, Woo Sung; Ahn, Mi-Jeong; Lee, Haeng-Soon; Deng, Xiping; Kwak, Sang-Soo
2017-08-01
β-carotene, a carotenoid that plays a key photo-protective role in plants is converted into zeaxanthin by β-carotene hydroxylase (CHY-β). Previous work showed that down-regulation of IbCHY-β by RNA interference (RNAi) results in higher levels of β-carotene and total carotenoids, as well as salt stress tolerance, in cultured transgenic sweetpotato cells. In this study, we introduced the RNAi-IbCHY-β construct into a white-fleshed sweetpotato cultivar (cv. Yulmi) by Agrobacterium-mediated transformation. Among the 13 resultant transgenic sweetpotato plants (referred to as RC plants), three lines were selected for further characterization on the basis of IbCHY-β transcript levels. The RC plants had orange flesh, total carotenoid and β-carotene contents in storage roots were 2-fold and 16-fold higher, respectively, than those of non-transgenic (NT) plants. Unlike storage roots, total carotenoid and β-carotene levels in the leaves of RC plants were slightly increased compared to NT plants. The leaves of RC plants also exhibited tolerance to methyl viologen (MV)-mediated oxidative stress, which was associated with higher 2,2-diphenyl-1- picrylhydrazyl (DPPH) radical-scavenging activity. In addition, RC plants maintained higher levels of chlorophyll and higher photosystem II efficiency than NT plants after 250 mM NaCl stress. Yield of storage roots did not differ significantly between RC and NT plants. These observations suggest that RC plants might be useful as a nutritious and environmental stress-tolerant crop on marginal lands around the world. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Plant breeding and genetics newsletter. No. 3
International Nuclear Information System (INIS)
1999-06-01
This third issue of the Plant Breeding and Genetics Newsletter highlights forthcoming events including regional (Afra) training course on 'molecular characterization of genetic biodiversity in traditional and neglected crops selected for improvement through mutation techniques' and seminar on 'mutation techniques and biotechnology for tropical and subtropical plant improvement in Asia and Pacific regions'. Status of existing co-ordinated and technical co-operation research projects is also summarized
Laparoscopy After Previous Laparotomy
Directory of Open Access Journals (Sweden)
Zulfo Godinjak
2006-11-01
Full Text Available Following the abdominal surgery, extensive adhesions often occur and they can cause difficulties during laparoscopic operations. However, previous laparotomy is not considered to be a contraindication for laparoscopy. The aim of this study is to present that an insertion of Veres needle in the region of umbilicus is a safe method for creating a pneumoperitoneum for laparoscopic operations after previous laparotomy. In the last three years, we have performed 144 laparoscopic operations in patients that previously underwent one or two laparotomies. Pathology of digestive system, genital organs, Cesarean Section or abdominal war injuries were the most common causes of previouslaparotomy. During those operations or during entering into abdominal cavity we have not experienced any complications, while in 7 patients we performed conversion to laparotomy following the diagnostic laparoscopy. In all patients an insertion of Veres needle and trocar insertion in the umbilical region was performed, namely a technique of closed laparoscopy. Not even in one patient adhesions in the region of umbilicus were found, and no abdominal organs were injured.
Crossfit analysis: a novel method to characterize the dynamics of induced plant responses
Jansen, J.J.; Van Dam, N.M.; Hoefsloot, H.C.J.; Smilde, A.K.
2009-01-01
Background Many plant species show induced responses that protect them against exogenous attacks. These responses involve the production of many different bioactive compounds. Plant species belonging to the Brassicaceae family produce defensive glucosinolates, which may greatly influence their
Crossfit analysis: a novel method to characterize the dynamics of induced plant responses
Jansen, J.J.; van Dam, N.M.; Hoefsloot, H.C.J.; Smilde, A.K.
2009-01-01
Background: Many plant species show induced responses that protect them against exogenous attacks. These responses involve the production of many different bioactive compounds. Plant species belonging to the Brassicaceae family produce defensive glucosinolates, which may greatly influence their
CHARACTERIZATION QUALITATIVE OF SOEL FOR A VALORIZATION BEST OF THE BIOMASS PRODUCED
Directory of Open Access Journals (Sweden)
Y. M’Sadak
2015-03-01
Full Text Available The main objective of this study was to qualitatively characterize biomass of Solanum elaeagnifolium Cav. (or SOEL to highlight the essential alternatives its valorization. At first, we studied the potential of composting biomass of this plant. The physico-chemical characterization of biomass silverleaf nightshade has detected a wealth in organic carbon, which highlighted the potential value of this plant in the Co-composting with other biodegradable waste. In a second step, we assessed the possibility to develop this plant in the area of treatment in textile effluents by biosorption of dyes on fibers from the biomass of this plant, especially after the discovery of high levels of cellulose in its different organs.
CHARACTERIZATION QUALITATIVE OF SOEL FOR A VALORIZATION BEST OF THE BIOMASS PRODUCED
Directory of Open Access Journals (Sweden)
Y. M’Sadak
2015-01-01
Full Text Available The main objective of this study was to qualitatively characterize biomass of Solanum elaeagnifolium Cav. (or SOEL to highlight the essential alternatives its valorization. At first, we studied the potential of composting biomass of this plant. The physico-chemical characterization of biomass silverleaf nightshade has detected a wealth in organic carbon, which highlighted the potential value of this plant in the Co-composting with other biodegradable waste. In a second step, we assessed the possibility to develop this plant in the area of treatment in textile effluents by biosorption of dyes on fibers from the biomass of this plant, especially after the discovery of high levels of cellulose in its different organs.
Omnivore-herbivore interactions: thrips and whiteflies compete via the shared host plant.
Pappas, Maria L; Tavlaki, Georgia; Triantafyllou, Anneta; Broufas, George
2018-03-05
Phytophagy is a common feature among pure herbivorous insects and omnivores that utilise both plant and prey as food resources; nevertheless, experimental evidence for factors affecting their interactions is restricted to intraguild predation and predator-mediated competition. We herein focused on plant-mediated effects that could result from plant defence activation or quality alteration and compared the performance of an omnivore, the western flower thrips Frankliniella occidentalis, and a pure herbivore, the greenhouse whitefly Trialeurodes vaporariorum, on cucumber plants previously infested with either species. Furthermore, we recorded their behavioural responses when given a choice among infested and clean plants. Whiteflies laid less eggs on plants previously exposed to thrips but more on whitefly-infested plants. Thrips survival was negatively affected on whitefly-infested than on thrips-infested or clean plants. Notably, whiteflies developed significantly faster on plants infested with conspecifics. In accordance, whiteflies avoided thrips-infested plants and preferred whitefly-infested over clean plants. Thrips showed no preference for either infested or clean plants. Our study is a first report on the role of plant-mediated effects in shaping omnivore-herbivore interactions. Considering the factors driving such interactions we will likely better understand the ecology of the more complex relationships among plants and pest organisms.
Transport proteins of the plant plasma membrane
Assmann, S. M.; Haubrick, L. L.; Evans, M. L. (Principal Investigator)
1996-01-01
Recently developed molecular and genetic approaches have enabled the identification and functional characterization of novel genes encoding ion channels, ion carriers, and water channels of the plant plasma membrane.
Letter Report for Characterization of Biochar
Energy Technology Data Exchange (ETDEWEB)
Amonette, James E.
2013-04-09
On 27 November 2012, a bulk biochar sample was received for characterization of selected physical and chemical properties. The main purpose of the characterization was to help determine the degree to which biochar would be suitable as a soil amendment to aid in growth of plants. Towards this end, analyses to determine specific surface, pH, cation-exchange capacity, water retention, and wettability (i.e. surface tension) were conducted. A second objective was to determine how uniform these properties were in the sample. Towards this end, the sample was separated into fractions based on initial particle size and on whether the material was from the external surface or the internal portion of the particle. Based on the results, the biochar has significant liming potentials, significant cation-retention capacities, and highly variable plant-available moisture retention properties that, under the most favorable circumstances, could be helpful to plants. As a consequence, it would be quite suitable for addition to acidic soils and should enhance the fertility of those soils.
Characterization of coal blends for effective utilization in thermal power plants
International Nuclear Information System (INIS)
Santhosh Raaj, S.; Arumugam, S.; Muthukrishnan, M.; Krishnamoorthy, S.; Anantharaman, N.
2016-01-01
Highlights: • This work will assist utilities to decide on the choice of coals for blending. • Conventional and advanced analytical techniques were used for characterization. • Fuel ratio, burnout profile, ash chemistry and carbon burnout are key factors. • Basic properties were additive while carbon burnout was non additive for the blends. - Abstract: This paper deals with the characterization of coal blends using various conventional and advanced analytical techniques. There has been an increasing trend in utilizing imported coals for power generation in India and utilities are resorting to blended coal firing for various reasons, both financially as well as technically. Characterization studies were carried out on 2 combinations of Indian and imported coal blends. Conventional characterization such as proximate and ultimate analysis and determination of calorific value were carried out for the raw coals and blends as per ASTM standards. Following this thermal and mineral analysis of the samples were carried out using thermo gravimetric analyzer (TGA), X-ray fluorescence spectrometer (XRF) and computer controlled scanning electron microscope (CCSEM). Combustion experiments were also conducted using drop tube furnace (DTF) to determine the burnout of the raw coals and blends. The selection of technically suitable coal combination for blending, based on these characterization studies, has been detailed.
Directory of Open Access Journals (Sweden)
Suvarna Punalekar
2016-02-01
Full Text Available We assessed the potential for using optical functional types as effective markers to monitor changes in vegetation in floodplain meadows associated with changes in their local environment. Floodplain meadows are challenging ecosystems for monitoring and conservation because of their highly biodiverse nature. Our aim was to understand and explain spectral differences among key members of floodplain meadows and also characterize differences with respect to functional traits. The study was conducted on a typical floodplain meadow in UK (MG4-type, mesotrophic grassland type 4, according to British National Vegetation Classification. We compared two approaches to characterize floodplain communities using field spectroscopy. The first approach was sub-community based, in which we collected spectral signatures for species groupings indicating two distinct eco-hydrological conditions (dry and wet soil indicator species. The other approach was “species-specific”, in which we focused on the spectral reflectance of three key species found on the meadow. One herb species is a typical member of the MG4 floodplain meadow community, while the other two species, sedge and rush, represent wetland vegetation. We also monitored vegetation biophysical and functional properties as well as soil nutrients and ground water levels. We found that the vegetation classes representing meadow sub-communities could not be spectrally distinguished from each other, whereas the individual herb species was found to have a distinctly different spectral signature from the sedge and rush species. The spectral differences between these three species could be explained by their observed differences in plant biophysical parameters, as corroborated through radiative transfer model simulations. These parameters, such as leaf area index, leaf dry matter content, leaf water content, and specific leaf area, along with other functional parameters, such as maximum carboxylation capacity
Whitebark pine planting guidelines
Ward McCaughey; Glenda L. Scott; Kay L. Izlar
2009-01-01
This article incorporates new information into previous whitebark pine guidelines for planting prescriptions. Earlier 2006 guidelines were developed based on review of general literature, research studies, field observations, and standard US Forest Service survival surveys of high-elevation whitebark pine plantations. A recent study of biotic and abiotic factors...
Energy Technology Data Exchange (ETDEWEB)
Camacho, A.; Montana, M.; Serrano, I.; Blazquez, S.; Duch, M.A. [Institut de Tecniques Energetiques. Universitat Politecnica de Catalunya, ETSEIB. Diagonal 647. 08028 Barcelona (Spain); Montes, S.; Ganzer, M.; Devesa, R. [Aigues de Barcelona, AGBAR. Laboratory, General Batet, 5-7, 08028 Barcelona (Spain)
2014-07-01
Conventional Drinking Water Treatment Plants (DWTP) have a fairly standard sequence of processes which essentially consist in solids separation using physical processes such as settling and filtration, and chemical processes such as coagulation and disinfection. Consequently large quantities of solid wastes or sludge are generated every year by DWTP. These solid wastes may contain all kind of pollutants, including significant levels of radioactivity and may cause a radiological impact on the operating personnel, but also on the public if the waste is recycled, e.g. the use of sludge as fertilizer or cement manufacturing. In this work it has been studied the radioactivity content of waste products of one DWTP. The selected DWTP treats water mainly taken from the Llobregat River and also ground water. The treatment plant has a maximum treatment capacity of 5.5 m{sup 3}/s, and provides almost 50% of the annual drinking water in Barcelona metropolitan area (population equivalent of the plant: 4,856,579). This plant has been selected taking into account both variations in water source and the treatment applied. During the period July 2007 - March 2009 a temporal study of radio-nuclides present in sludge produced by the decanter cleaning process was conducted. The temporal study was made taking into account the particular weather conditions in Spain, at least one sampling campaign per season. In these samples naturally gamma emitters from the {sup 238}U and {sup 232}Th series were detected with activities similar to the arithmetic mean found in Spanish soils so no increase in natural radiation are produced by the uses of these sludge. Furthermore, no seasonal tendency could be observed in the studied period for both series within the uncertainties associated with the results. Radiological hazard effects were also evaluated by the external hazard index because one of the end-uses of this sludge is the cement manufacturing. In 2009 the treatment plant was modified and
Maruthamuthu, Mukil; van Elsas, Jan Dirk
2017-01-01
Enzyme discovery is a promising approach to aid in the deconstruction of recalcitrant plant biomass in an industrial process. Novel enzymes can be readily discovered by applying metagenomics on whole microbiomes. Our goal was to select, examine, and characterize eight novel glycoside hydrolases that were previously detected in metagenomic libraries, to serve biotechnological applications with high performance. Here, eight glycosyl hydrolase family candidate genes were selected from metagenomes of wheat straw-degrading microbial consortia using molecular cloning and subsequent gene expression studies in Escherichia coli. Four of the eight enzymes had significant activities on either p NP-β-d-galactopyranoside, p NP-β-d-xylopyranoside, p NP-α-l-arabinopyranoside or p NP-α-d-glucopyranoside. These proteins, denoted as proteins 1, 2, 5 and 6, were his-tag purified and their nature and activities further characterized using molecular and activity screens with the p NP-labeled substrates. Proteins 1 and 2 showed high homologies with (1) a β-galactosidase (74%) and (2) a β-xylosidase (84%), whereas the remaining two (5 and 6) were homologous with proteins reported as a diguanylate cyclase and an aquaporin, respectively. The β-galactosidase- and β-xylosidase-like proteins 1 and 2 were confirmed as being responsible for previously found thermo-alkaliphilic glycosidase activities of extracts of E. coli carrying the respective source fosmids. Remarkably, the β-xylosidase-like protein 2 showed activities with both p NP-Xyl and p NP-Ara in the temperature range 40-50 °C and pH range 8.0-10.0. Moreover, proteins 5 and 6 showed thermotolerant α-glucosidase activity at pH 10.0. In silico structure prediction of protein 5 revealed the presence of a potential "GGDEF" catalytic site, encoding α-glucosidase activity, whereas that of protein 6 showed a "GDSL" site, encoding a 'new family' α-glucosidase activity. Using a rational screening approach, we identified and
Algal ancestor of land plants was preadapted for symbiosis.
Delaux, Pierre-Marc; Radhakrishnan, Guru V; Jayaraman, Dhileepkumar; Cheema, Jitender; Malbreil, Mathilde; Volkening, Jeremy D; Sekimoto, Hiroyuki; Nishiyama, Tomoaki; Melkonian, Michael; Pokorny, Lisa; Rothfels, Carl J; Sederoff, Heike Winter; Stevenson, Dennis W; Surek, Barbara; Zhang, Yong; Sussman, Michael R; Dunand, Christophe; Morris, Richard J; Roux, Christophe; Wong, Gane Ka-Shu; Oldroyd, Giles E D; Ané, Jean-Michel
2015-10-27
Colonization of land by plants was a major transition on Earth, but the developmental and genetic innovations required for this transition remain unknown. Physiological studies and the fossil record strongly suggest that the ability of the first land plants to form symbiotic associations with beneficial fungi was one of these critical innovations. In angiosperms, genes required for the perception and transduction of diffusible fungal signals for root colonization and for nutrient exchange have been characterized. However, the origin of these genes and their potential correlation with land colonization remain elusive. A comprehensive phylogenetic analysis of 259 transcriptomes and 10 green algal and basal land plant genomes, coupled with the characterization of the evolutionary path leading to the appearance of a key regulator, a calcium- and calmodulin-dependent protein kinase, showed that the symbiotic signaling pathway predated the first land plants. In contrast, downstream genes required for root colonization and their specific expression pattern probably appeared subsequent to the colonization of land. We conclude that the most recent common ancestor of extant land plants and green algae was preadapted for symbiotic associations. Subsequent improvement of this precursor stage in early land plants through rounds of gene duplication led to the acquisition of additional pathways and the ability to form a fully functional arbuscular mycorrhizal symbiosis.
Opto-nanomechanical spectroscopic material characterization
Tetard, L.; Passian, A.; Farahi, R. H.; Thundat, T.; Davison, B. H.
2015-10-01
The non-destructive, simultaneous chemical and physical characterization of materials at the nanoscale is an essential and highly sought-after capability. However, a combination of limitations imposed by Abbe diffraction, diffuse scattering, unknown subsurface, electromagnetic fluctuations and Brownian noise, for example, have made achieving this goal challenging. Here, we report a hybrid approach for nanoscale material characterization based on generalized nanomechanical force microscopy in conjunction with infrared photoacoustic spectroscopy. As an application, we tackle the outstanding problem of spatially and spectrally resolving plant cell walls. Nanoscale characterization of plant cell walls and the effect of complex phenotype treatments on biomass are challenging but necessary in the search for sustainable and renewable bioenergy. We present results that reveal both the morphological and compositional substructures of the cell walls. The measured biomolecular traits are in agreement with the lower-resolution chemical maps obtained with infrared and confocal Raman micro-spectroscopies of the same samples. These results should prove relevant in other fields such as cancer research, nanotoxicity, and energy storage and production, where morphological, chemical and subsurface studies of nanocomposites, nanoparticle uptake by cells and nanoscale quality control are in demand.
Heavy metal concentrations in plants and different harvestable parts: A soil-plant equilibrium model
International Nuclear Information System (INIS)
Guala, Sebastian D.; Vega, Flora A.; Covelo, Emma F.
2010-01-01
A mathematical interaction model, validated by experimental results, was developed to modeling the metal uptake by plants and induced growth decrease, by knowing metal in soils. The model relates the dynamics of the uptake of metals from soil to plants. Also, two types of relationships are tested: total and available metal content. The model successfully fitted the experimental data and made it possible to predict the threshold values of total mortality with a satisfactory approach. Data are taken from soils treated with Cd and Ni for ryegrass (Lolium perenne, L.) and oats (Avena sativa L.), respectively. Concentrations are measured in the aboveground biomass of plants. In the latter case, the concentration of metals in different parts of the plants (tillering, shooting and earing) is also modeled. At low concentrations, the effects of metals are moderate, and the dynamics appear to be linear. However, increasing concentrations show nonlinear behaviors. - The model proposed in this study makes possible to characterize the nonlinear behavior of the soil-plant interaction with metal pollution.
Heavy metal concentrations in plants and different harvestable parts: A soil-plant equilibrium model
Energy Technology Data Exchange (ETDEWEB)
Guala, Sebastian D. [Instituto de Ciencias, Universidad Nacional de General Sarmiento, Gutierrez 1150, Los Polvorines, Buenos Aires (Argentina); Vega, Flora A. [Departamento de Bioloxia Vexetal e Ciencia do Solo, Facultade de Bioloxia, Universidade de Vigo, Lagoas, Marcosende, 36310 Vigo, Pontevedra (Spain); Covelo, Emma F., E-mail: emmaf@uvigo.e [Departamento de Bioloxia Vexetal e Ciencia do Solo, Facultade de Bioloxia, Universidade de Vigo, Lagoas, Marcosende, 36310 Vigo, Pontevedra (Spain)
2010-08-15
A mathematical interaction model, validated by experimental results, was developed to modeling the metal uptake by plants and induced growth decrease, by knowing metal in soils. The model relates the dynamics of the uptake of metals from soil to plants. Also, two types of relationships are tested: total and available metal content. The model successfully fitted the experimental data and made it possible to predict the threshold values of total mortality with a satisfactory approach. Data are taken from soils treated with Cd and Ni for ryegrass (Lolium perenne, L.) and oats (Avena sativa L.), respectively. Concentrations are measured in the aboveground biomass of plants. In the latter case, the concentration of metals in different parts of the plants (tillering, shooting and earing) is also modeled. At low concentrations, the effects of metals are moderate, and the dynamics appear to be linear. However, increasing concentrations show nonlinear behaviors. - The model proposed in this study makes possible to characterize the nonlinear behavior of the soil-plant interaction with metal pollution.
Chemical and pharmacognostical characterization of two Malaysian plants both known as Ajisamat
Directory of Open Access Journals (Sweden)
Tengku Azlan S. Tengku Mohamad
Full Text Available Ajisamat, an herb commonly used as an aphrodisiac in the Malaysian traditional medicine, corresponds to two different species from different families - Salacia macrophylla Blume, Celastraceae, and Prismatomeris glabra (Korth. Valeton, Rubiaceae. Macromorphological inspection of the vegetative parts both plants reveals only a slight difference in the arrangement of the petioles. Microscopic investigation of the plants roots used as crude drugs revealed however distinctive anatomical features. Prismatic calcium oxalate crystals and banded paratracheal parenchyma are characteristics of S. macrophylla while P. glabradisplays an abundance as crystals. Other features such as vessels diameters and arrangements are also of diagnostic importance. Some of these characters were also identified in the powder of thes e plant materials and proposed for diagnostic purpose. The values for extraction of ethanol and water as well as total ash, acid-insoluble ash, water-soluble ash and sulfated ash were determined for both plants. Phytochemical studies were carried out on hexane and chloroform extracts of S. macrophylla and methanolic extract of P. glabra. S. macrophylla was shown to contain highly oxidized pentacyclic triterpenes while P. glabra contains anthraquinones. The pharmacognostical and hytochemical information can be utilised as the identification tools for Salacia macrophylla and Prismatomeris glabra
Bhagwat, Basdeo; Dickison, Virginia; Ding, Xinlun; Walker, Melanie; Bernardy, Michael; Bouthillier, Michel; Creelman, Alexa; DeYoung, Robyn; Li, Yinzi; Nie, Xianzhou; Wang, Aiming; Xiang, Yu; Sanfaçon, Hélène
2016-06-01
In this study, we report the genome sequence of five isolates of strawberry mottle virus (family Secoviridae, order Picornavirales) from strawberry field samples with decline symptoms collected in Eastern Canada. The Canadian isolates differed from the previously characterized European isolate 1134 in that they had a longer RNA2, resulting in a 239-amino-acid extension of the C-terminal region of the polyprotein. Sequence analysis suggests that reassortment and recombination occurred among the isolates. Phylogenetic analysis revealed that the Canadian isolates are diverse, grouping in two separate branches along with isolates from Europe and the Americas.
Giron, David; Huguet, Elisabeth; Stone, Graham N; Body, Mélanie
2016-01-01
Gall-inducing insects are iconic examples in the manipulation and reprogramming of plant development, inducing spectacular morphological and physiological changes of host-plant tissues within which the insect feeds and grows. Despite decades of research, effectors involved in gall induction and basic mechanisms of gall formation remain unknown. Recent research suggests that some aspects of the plant manipulation shown by gall-inducers may be shared with other insect herbivorous life histories. Here, we illustrate similarities and contrasts by reviewing current knowledge of metabolic and morphological effects induced on plants by gall-inducing and leaf-mining insects, and ask whether leaf-miners can also be considered to be plant reprogrammers. We review key plant functions targeted by various plant reprogrammers, including plant-manipulating insects and nematodes, and functionally characterize insect herbivore-derived effectors to provide a broader understanding of possible mechanisms used in host-plant manipulation. Consequences of plant reprogramming in terms of ecology, coevolution and diversification of plant-manipulating insects are also discussed. Copyright © 2015 Elsevier Ltd. All rights reserved.
Thermal and sintering characterization of IGCC slag
Energy Technology Data Exchange (ETDEWEB)
Acosta, A.; Iglesias, I.; Aineto, M.; Romero, M.; Rincon, J.M. [University of Castilla La Mancha, Ciudad Real (Spain)
2002-07-01
IGCC slag is a vitreous residual product from the new induction gasification combined cycle gasification thermal power plants. In order to characterize this waste as secondary raw material for the production of glasses and glass-ceramics as construction materials, slag from the Puertollano, Ciudad Real, Spain power plants was thermally investigated. After controlled heating this waste gives rise to hematite, anorthite, and cristobalite crystallized materials.
Directory of Open Access Journals (Sweden)
Stacie Tardif
2016-09-01
Full Text Available The interaction between plants and microorganisms, which is the driving force behind the decontamination of petroleum hydrocarbon (PHC contamination in phytoremediation technology, is poorly understood. Here, we aimed at characterizing the variations between plant compartments in the microbiome of two willow cultivars growing in contaminated soils. A field experiment was set-up at a former petrochemical plant in Canada and, after two growing seasons, bulk soil, rhizosphere soil, roots and stems samples of two willow cultivars (Salix purpurea cv. FishCreek and Salix miyabeana cv. SX67 growing at three PHC contamination concentrations were taken. DNA was extracted and bacterial 16S rRNA gene and fungal internal transcribed spacer (ITS regions were amplified and sequenced using an Ion Torrent Personal Genome Machine. Following multivariate statistical analyses, the level of PHC-contamination appeared as the primary factor influencing the willow microbiome with compartment-specific effects, with significant differences between the responses of bacterial and fungal communities. Increasing PHC contamination levels resulted in shifts in the microbiome composition, favoring putative hydrocarbon degraders and microorganisms previously reported as associated with plant health. These shifts were less drastic in the rhizosphere, root and stem tissues as compared to bulk soil, probably because the willows provided a more controlled environment and thus protected microbial communities against increasing contamination levels. Insights from this study will help to devise optimal plant microbiomes for increasing the efficiency of phytoremediation technology.
Overview of plant life management for long term operation in nuclear power plants
International Nuclear Information System (INIS)
Kang, K.S.; Vincze, P.; Bychkov, A.
2014-01-01
Many IAEA member states have given high priority to licensing their nuclear power plants to operate for terms longer than the time frame originally anticipated (generally 40 years). The task of managing plant ageing is assigned in most member states to an engineering specialty called 'plant life management' (PLiM) applying a systematic analysis methodology to System Structure Components (SSCs) ageing. In many countries, the safety performance of nuclear power plants is periodically assessed and characterized via the periodic safety review (PSR) process. Regulatory review and acceptance of PSRs constitutes for these countries the licensing requirement for continued operation of the plant to the following PSR cycle (usually 10 years). In the USA and in other countries operating US designed plants, instead of PSR process, a license renewal application (LRA) process is followed, which requires certain prerequisites such as ageing management programs, particularly for passive irreplaceable SSCs. Active components are normally addressed via the maintenance rule (MR) requirements and other established regulatory processes. A third group of member states have adopted a combined approach that incorporates elements of both the PSR process and selected LRA specific requirements, such as time limited ageing analysis. The article ends with some IAEA recommendations for the implementation of national PLiM programs
Qin, Liang; Zhang, Yawen; Liu, Yaqin; He, Huixin; Han, Manman; Li, Yanyan; Zeng, Maomao; Wang, Xiaodong
2018-04-17
Mass spectrometry imaging (MSI) as a label-free and powerful imaging technique enables in situ evaluation of a tissue metabolome and/or proteome, becoming increasingly popular in the detection of plant endogenous molecules. The characterization of structure and spatial information of endogenous molecules in plants are both very important aspects to better understand the physiological mechanism of plant organism. Matrix-assisted laser desorption/ionization mass spectrometry imaging (MALDI-MSI) is a commonly-used tissue imaging technique, which requires matrix to assist in situ detection of a variety of molecules on the surface of a tissue section. In previous studies, MALDI-MSI was mostly used for the detection of molecules from animal tissue sections, compared to plant samples due to cell structural limitations, such as plant cuticles, epicuticular waxes, and cell walls. Despite the enormous progress that has been made in tissue imaging, there is still a challenge for MALDI-MSI suitable for the imaging of endogenous compounds in plants. This review summarises the recent advances in MALDI-MSI, focusing on the application of in situ detection of endogenous molecules in different plant organs, i.e. root, stem, leaf, flower, fruit, and seed. Further improvements on instrumentation sensitivity, matrix selection, image processing and sample preparation will expand the application of MALDI-MSI in plant research. Copyright © 2018 John Wiley & Sons, Ltd.
Synthesis and characterization of ammonium phosphate fertilizers with boron
Directory of Open Access Journals (Sweden)
ANGELA MAGDA
2010-07-01
Full Text Available The concentration of boron, an essential micronutrient for plants, presents a narrow range between deficiency and toxicity. In order to provide the boron requirement for plants, and to avoid toxicity problems, boron compounds are mixed with basic fertilizers. Sodium borate pentahydrate was used as a boron source. Ammonium orthophosphates fertilizers with boron were prepared by neutralizing phosphoric acid with ammonia and addition of variable amounts of sodium tetraborate pentahydrate to the reaction mixture at a NH3:H3PO4 molar ratio of 1.5. The fertilizers obtained with boron contents ranging from 0.05 to 1 % (w/w were fully characterized by chemical analysis, thermal analysis, X-ray diffraction and infrared spectrophotometry. The studies showed that up to 500 °C, regardless of the boron content, no significant changes concerning thermal stability and nutritional properties occurred. Above 500 °C, an increase of thermal stability with an increase of the boron content was observed. X-Ray diffraction of a heat-treated sample containing 5 % (w/w boron indicated the appearance of boron orthophosphate, BPO4, as a new crystalline phase, and the disappearance of the previous structures above 500 °C, which explains the increase in thermal stability.
Ahmad, Faheem; Babalola, Olubukola O; Tak, Hamid I
2012-09-01
Plant diseases caused by plant pathogens substantially reduce crop production every year, resulting in massive economic losses throughout the world. Accurate detection and identification of plant pathogens is fundamental to plant pathogen diagnostics and, thus, plant disease management. Diagnostics and disease-management strategies require techniques to enable simultaneous detection and quantification of a wide range of pathogenic and non-pathogenic microorganisms. Over the past decade, rapid development of matrix-assisted laser-desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) techniques for characterization of microorganisms has enabled substantially improved detection and identification of microorganisms. In the biological sciences, MALDI-TOF MS is used to analyze specific peptides or proteins directly desorbed from intact bacteria, fungal spores, nematodes, and other microorganisms. The ability to record biomarker ions, in a broad m/z range, which are unique to and representative of individual microorganisms, forms the basis of taxonomic identification of microorganisms by MALDI-TOF MS. Recent advances in mass spectrometry have initiated new research, i.e. analysis of more complex microbial communities. Such studies are just beginning but have great potential for elucidation not only of the interactions between microorganisms and their host plants but also those among different microbial taxa living in association with plants. There has been a recent effort by the mass spectrometry community to make data from large scale mass spectrometry experiments publicly available in the form of a centralized repository. Such a resource could enable the use of MALDI-TOF MS as a universal technique for detection of plant pathogens and non-pathogens. The effects of experimental conditions are sufficiently understood, reproducible spectra can be obtained from computational database search, and microorganisms can be rapidly characterized by genus, species
Preoperative screening: value of previous tests.
Macpherson, D S; Snow, R; Lofgren, R P
1990-12-15
To determine the frequency of tests done in the year before elective surgery that might substitute for preoperative screening tests and to determine the frequency of test results that change from a normal value to a value likely to alter perioperative management. Retrospective cohort analysis of computerized laboratory data (complete blood count, sodium, potassium, and creatinine levels, prothrombin time, and partial thromboplastin time). Urban tertiary care Veterans Affairs Hospital. Consecutive sample of 1109 patients who had elective surgery in 1988. At admission, 7549 preoperative tests were done, 47% of which duplicated tests performed in the previous year. Of 3096 previous results that were normal as defined by hospital reference range and done closest to the time of but before admission (median interval, 2 months), 13 (0.4%; 95% CI, 0.2% to 0.7%), repeat values were outside a range considered acceptable for surgery. Most of the abnormalities were predictable from the patient's history, and most were not noted in the medical record. Of 461 previous tests that were abnormal, 78 (17%; CI, 13% to 20%) repeat values at admission were outside a range considered acceptable for surgery (P less than 0.001, frequency of clinically important abnormalities of patients with normal previous results with those with abnormal previous results). Physicians evaluating patients preoperatively could safely substitute the previous test results analyzed in this study for preoperative screening tests if the previous tests are normal and no obvious indication for retesting is present.
Technical Overview of Ecological Risk Assessment - Analysis Phase: Exposure Characterization
Exposure Characterization is the second major component of the analysis phase of a risk assessment. For a pesticide risk assessment, the exposure characterization describes the potential or actual contact of a pesticide with a plant, animal, or media.
β-characterization by irreversibility analysis: A thermoeconomic diagnosis method
International Nuclear Information System (INIS)
Zaleta-Aguilar, Alejandro; Olivares-Arriaga, Abraham; Cano-Andrade, Sergio; Rodriguez-Alejandro, David A.
2016-01-01
This paper presents a reconciliation methodology for the diagnosis of energy systems. The methodology is based on the characterization of irreversibilities in the components of an energy system. These irreversibilities can be attributed to malfunctions or dysfunctions. The characterization of irreversibilities as presented here makes possible to reconcile the Actual Operating Condition (AOC) versus the Reference Operating Condition (ROC) of the energy system in a real-time manner. The diagnosis methodology introduces a parameter β, which represents the total exergy or useful work of a component in terms of its inlet and output streams at either design (full-load) or off-design (partial-load) conditions. The methodology is applied to the diagnosis of an actual Natural Gas Combined Cycle (NGCC) power plant. Data for the model is obtained directly from the plant by monitoring its performance at every time; thus, a real-time thermodynamic diagnosis for the system is obtained. Results show that the methodology presented here is able to detect and quantify the deviations on the performance of the NGCC power plant during its real-time operation. Based on the detection and quantification of these deviations, the user is able to make recommendations to schedule maintenance on the components where the irreversibilities are present. - Highlights: • A new methodology for thermoeconomic diagnosis of energy systems is presented. • A parameter β is defined for characterization of the components of an energy system. • The β characterization methodology is tested in a real 420 MW NGCC power plant. • Results show that the complexity of a diagnosis analysis is reduced substantially.
Liposome-Based Delivery Systems in Plant Polysaccharides
International Nuclear Information System (INIS)
Meiwan, C.; Yitao, W.; Yanfang, Z.; Xinsheng, P.; Jingjing, H.; Ping, Z.
2012-01-01
Plant polysaccharides consist of many monosaccharide by α or β glycosidic bond which can be extracted by the water, alcohol, lipophile liquid from a variety of plants including Cordyceps sinensis, astragalus, and mushrooms. Recently, many evidences illustrate that natural plant polysaccharides possess various biological activities including strengthening immunity, lowering blood sugar, regulating lipid metabolism, anti oxidation, anti aging, and antitumour. Plant polysaccharides have been widely used in the medical field due to their special features and low toxicity. As an important drug delivery system, liposomes can not only encapsulate small-molecule compound but also big-molecule drug; therefore, they present great promise for the application of plant polysaccharides with unique physical and chemical properties and make remarkable successes. This paper summarized the current progress in plant polysaccharides liposomes, gave an overview on their experiment design method, preparation, and formulation, characterization and quality control, as well as in vivo and in vitro studies. Moreover, the potential application of plant polysaccharides liposomes was prospected as well.
Protection of melon plants against Cucumber mosaic virus infection ...
African Journals Online (AJOL)
This study was carried out to characterize a virus causing severe mosaic, yellowing, stunting and leaf deformation on melon (Cucumis melo L.), and evaluate the capacity of Pseudomonas fluorescens as biofertilizer to improve plant growth and restrict the accumulation of the virus in the plant. The virus was identified as an ...
Knief, Claudia; Ramette, Alban; Frances, Lisa; Alonso-Blanco, Carlos; Vorholt, Julia A
2010-06-01
The plant phyllosphere constitutes a habitat for numerous microorganisms; among them are members of the genus Methylobacterium. Owing to the ubiquitous occurrence of methylobacteria on plant leaves, they represent a suitable target for studying plant colonization patterns. The influence of the factor site, host plant species, time and the presence of other phyllosphere bacteria on Methylobacterium community composition and population size were evaluated in this study. Leaf samples were collected from Arabidopsis thaliana or Medicago truncatula plants and from the surrounding plant species at several sites. The abundance of cultivable Methylobacterium clearly correlated with the abundance of other phyllosphere bacteria, suggesting that methylobacteria constitute a considerable and rather stable fraction of the phyllosphere microbiota under varying environmental conditions. Automated ribosomal intergenic spacer analysis (ARISA) was applied to characterize the Methylobacterium community composition and showed the presence of similar communities on A. thaliana plants at most sites in 2 consecutive years of sampling. A substantial part of the observed variation in the community composition was explained by site and plant species, especially in the case of the plants collected at the Arabidopsis sites (50%). The dominating ARISA peaks that were detected on A. thaliana plants were found on other plant species grown at the same site, whereas some different peaks were detected on A. thaliana plants from other sites. This indicates that site-specific factors had a stronger impact on the Methylobacterium community composition than did plant-specific factors and that the Methylobacterium-plant association is not highly host plant species specific.
International Nuclear Information System (INIS)
Kovalenko, V.I.; Shevchenko, Yu.V.; Shikhajlov, N.A.; Kokhanevich, V.P.; Tanan, G.L.
1993-01-01
Design peculiarities, as well as the prospects of development and introduction of the low-power (from 0.5 up to 4 kW) wind power plants (WPP) are considered. The variants of WPP with vertical and horizontal rotation axis are described. The data characterizing cost and structure of expenditures on WPP manufacture and operation are given
Predicting coexistence of plants subject to a tolerance-competition trade-off.
Haegeman, Bart; Sari, Tewfik; Etienne, Rampal S
2014-06-01
Ecological trade-offs between species are often invoked to explain species coexistence in ecological communities. However, few mathematical models have been proposed for which coexistence conditions can be characterized explicitly in terms of a trade-off. Here we present a model of a plant community which allows such a characterization. In the model plant species compete for sites where each site has a fixed stress condition. Species differ both in stress tolerance and competitive ability. Stress tolerance is quantified as the fraction of sites with stress conditions low enough to allow establishment. Competitive ability is quantified as the propensity to win the competition for empty sites. We derive the deterministic, discrete-time dynamical system for the species abundances. We prove the conditions under which plant species can coexist in a stable equilibrium. We show that the coexistence conditions can be characterized graphically, clearly illustrating the trade-off between stress tolerance and competitive ability. We compare our model with a recently proposed, continuous-time dynamical system for a tolerance-fecundity trade-off in plant communities, and we show that this model is a special case of the continuous-time version of our model.
Isolation, characterization and Molecular weight Determination of ...
African Journals Online (AJOL)
Salwee
2013-07-10
Jul 10, 2013 ... Cellulose hydrolyzing enzyme from fungus Trichoderma viride was purified and characterized. The cellulase ... the most abundant component of plant biomass, found ... could efficiently and economically convert celluloytic.
International Nuclear Information System (INIS)
Pinheiro, H.S.; Nogueira, R.E.F.Q.; Lobo, C.J.S.; Nobre, A.I.S.; Sales, J.C.; Silva, C.J.M.
2012-01-01
Bottom ashes generated during combustion of a mineral coal from Colombia were characterized by X-ray fluorescence spectrometry and X-ray diffraction. The interest in this particular coal is due to the fact that it will be used by a thermal power plant in Ceara, Northeastern Brazil, where it could produce over 900 tons of different residues/combustion products every day. Results from Xray fluorescence allowed identification and quantification of elements present in the sample: silicon (59,17%), aluminum (13,17%), iron (10,74%), potassium (6,11%), titanium (2,91%), calcium (4,97%), sulphur (0,84%) and others (2,09%). The X-ray diffraction revealed patterns from silica, mullite, calcium sulphate and hydrated sodium. Results obtained so far indicate that the material is a potential raw-material for use in the formulation of ceramic components (author)
Nanosensors for pH measurements in plants
DEFF Research Database (Denmark)
Ytting, Cecilie Karkov; Fuglsang, Anja Thoe
Traditionally in vivo pH measurements in plants are carried out using different fluorescent probes such as BCECF and SNARFs by injecting plant cells or incubating tissues with the probes. This approach, however, carries several problems, the most important one being the handling of the plant cells...... or tissues. Stress and wounding of the plant can possibly influence the outcome of the pH measurements. Other problems are the difficulties of getting the probes more than a few cell layers into the plant tissue and to get an even distribution of the probe. Increasing numbers of different variants...... of the green fluorescent protein, GFP, have become available, some of which are pH sensitive. This offers the opportunity to simply express the pH sensitive protein in different plant tissues, making it possible to conduct in vivo pH measurements in a non-invasive manner. One sensor being characterized...
Endophytic actinobacteria of medicinal plants: diversity and bioactivity.
Golinska, Patrycja; Wypij, Magdalena; Agarkar, Gauravi; Rathod, Dnyaneshwar; Dahm, Hanna; Rai, Mahendra
2015-08-01
Endophytes are the microorganisms that exist inside the plant tissues without having any negative impact on the host plant. Medicinal plants constitute the huge diversity of endophytic actinobacteria of economical importance. These microbes have huge potential to synthesis of numerous novel compounds that can be exploited in pharmaceutical, agricultural and other industries. It is of prime importance to focus the present research on practical utilization of this microbial group in order to find out the solutions to the problems related to health, environment and agriculture. An extensive characterization of diverse population of endophytic actinobacteria associated with medicinal plants can provide a greater insight into the plant-endophyte interactions and evolution of mutualism. In the present review, we have discussed the diversity of endophytic actinobacteria of from medicinal plants their multiple bioactivities.
Extracellular nucleotide signaling in plants
Energy Technology Data Exchange (ETDEWEB)
Stacey, Gary [Univ. of Missouri, Columbia, MO (United States)
2016-09-08
Over the life of this funded project, our research group identified and characterized two key receptor proteins in plants; one mediating the innate immunity response to chitin and the other elucidating the key receptor for extracellular ATP. In the case of chitin recognition, we recently described the quaternary structure of this receptor, shedding light on how the receptor functions. Perhaps more importantly, we demonstrated that all plants have the ability to recognize both chitin oligomers and lipochitooligosacchardes, fundamentally changing how the community views the evolution of these systems and strategies that might be used, for example, to extend symbiotic nitrogen fixation to non-legumes. Our discovery of DORN1 opens a new chapter in plant physiology documenting conclusively that eATP is an important extracellular signal in plants, as it is in animals. At this point, we cannot predict just how far reaching this discovery may prove to be but we are convinced that eATP signaling is fundamental to plant growth and development and, hence, we believe that the future will be very exciting for the study of DORN1 and its overall function in plants.
Henry, Candise L; Pratson, Lincoln F
2016-09-06
Modeling studies predict that droughts and hotter water and air temperatures caused by climate warming will reduce the efficiency (η) of thermoelectric plants by 0.12-0.45% for each 1 °C of warming. We evaluate these predictions using historical performance data for 39 open- and closed-loop coal and natural gas plants from across the U.S., which operated under daily and seasonal temperature fluctuations multiples greater than future average warming projections. Seven to 14 years of hourly water (Tw), dry-bulb air (Ta), and wet-bulb air (Twb) temperature recordings collected near each plant are regressed against efficiency to attain estimates of Δη per 1 °C increase. We find reductions in η with increased Tw (for open-loop plants) up to 1 order of magnitude less than previous estimates. We also find that changes in η associated with changes in Ta (open-loop plants) or Twb (closed-loop plants) are not only smaller than previous estimates but also variable; i.e., η rises with Ta or Twb for some plants and falls for others. Our findings suggest that thermoelectric plants, particularly closed-loop plants, should be more resilient to climate warming than previously expected.
Prevention of type 2 diabetes mellitus in women with previous gestational diabetes mellitus.
Moon, Joon Ho; Kwak, Soo Heon; Jang, Hak C
2017-01-01
Gestational diabetes mellitus (GDM), defined as any degree of glucose intolerance with onset or first recognition during pregnancy, is characterized by underlying maternal defects in the β-cell response to insulin during pregnancy. Women with a previous history of GDM have a greater than 7-fold higher risk of developing postpartum diabetes compared with women without GDM. Various risk factors for postpartum diabetes have been identified, including maternal age, glucose levels in pregnancy, family history of diabetes, pre-pregnancy and postpartum body mass index, dietary patterns, physical activity, and breastfeeding. Genetic studies revealed that GDM shares common genetic variants with type 2 diabetes. A number of lifestyle interventional trials that aimed to ameliorate modifiable risk factors, including diet, exercise, and breastfeeding, succeeded in reducing the incidence of postpartum diabetes, weight retention, and other obesity-related morbidities. The present review summarizes the findings of previous studies on the incidence and risk factors of postpartum diabetes and discusses recent lifestyle interventional trials that attempted to prevent postpartum diabetes.
International Nuclear Information System (INIS)
Dunnette, M.D.
1982-01-01
The Plant Operator Selection System is a battery of tests and questionnaires that can be administered to job candidates in less than three hours. Various components of the battery measure what a job candidate has accomplished in previous educational and work situations, how well a candidate compares with others on a number of important aptitudes or abilities, and whether or not a candidate possesses the kind of personal stability required in power plant operations positions. A job candidate's answers to the tests and questionnaires of the Plant Operator Selection System are scored and converted to an OVERALL POTENTIAL INDEX. Values of the OVERALL POTENTIAL INDEX [OPI] range between 0 and 15. Candidates with high OPI values are much more likely to become effective and successful plant operators than candidates with low OPI values. It is possible to estimate the financial advantages to a company of using the Plant Operator Selection System in evaluating candidates for plant operations jobs
Stripping Away the Soil : Plant Growth Promoting Microbiology Opportunities in Aquaponics
Bartelme, Ryan P; Oyserman, Ben O; Blom, Jesse E; Sepulveda-Villet, Osvaldo J; Newton, Ryan J
2018-01-01
As the processes facilitated by plant growth promoting microorganisms (PGPMs) become better characterized, it is evident that PGPMs may be critical for successful sustainable agricultural practices. Microbes enrich plant growth through various mechanisms, such as enhancing resistance to disease and
Large-Scale Evolutionary Patterns of Host Plant Associations in the Lepidoptera
DEFF Research Database (Denmark)
Menken, S.B.J.; Boomsma, J.J.; van Nieukerken, E.J.
2010-01-01
We characterized evolutionary patterns of host plant use across about 2500 species of British Lepidoptera, using character optimization and independent phylogenetic contrasts among 95 operational taxa, and evaluated the extent to which caterpillars are monophagous, use woody host plants, and feed...
Runyon, Justin B; Mescher, Mark C
2010-01-01
Herbivores and pathogens come quickly to mind when one thinks of the biotic challenges faced by plants. Important but less appreciated enemies are parasitic plants, which can have important consequences for the fitness and survival of their hosts. Our knowledge of plant perception, signaling and response to herbivores and pathogens has expanded rapidly in recent years, but information is generally lacking for parasitic species. In a recent paper we reported that some of the same defense responses induced by herbivores and pathogens—notably increases in jasmonic acid (JA), salicylic acid (SA), and a hypersensitive-like response (HLR)—also occur in tomato plants upon attack by the parasitic plant Cuscuta pentagona (field dodder). Parasitism induced a distinct pattern of JA and SA accumulation, and growth trials using genetically-altered tomato hosts suggested that both JA and SA govern effective defenses against the parasite, though the extent of the response varied with host plant age. Here we discuss similarities between the induced responses we observed in response to Cuscuta parasitism to those previously described for herbivores and pathogens and present new data showing that trichomes should be added to the list of plant defenses that act against multiple enemies and across kingdoms. PMID:20495380
Plant-ants feed their host plant, but above all a fungal symbiont to recycle nitrogen.
Defossez, Emmanuel; Djiéto-Lordon, Champlain; McKey, Doyle; Selosse, Marc-André; Blatrix, Rumsaïs
2011-05-07
In ant-plant symbioses, plants provide symbiotic ants with food and specialized nesting cavities (called domatia). In many ant-plant symbioses, a fungal patch grows within each domatium. The symbiotic nature of the fungal association has been shown in the ant-plant Leonardoxa africana and its protective mutualist ant Petalomyrmex phylax. To decipher trophic fluxes among the three partners, food enriched in (13)C and (15)N was given to the ants and tracked in the different parts of the symbiosis up to 660 days later. The plant received a small, but significant, amount of nitrogen from the ants. However, the ants fed more intensively the fungus. The pattern of isotope enrichment in the system indicated an ant behaviour that functions specifically to feed the fungus. After 660 days, the introduced nitrogen was still present in the system and homogeneously distributed among ant, plant and fungal compartments, indicating efficient recycling within the symbiosis. Another experiment showed that the plant surface absorbed nutrients (in the form of simple molecules) whether or not it is coated by fungus. Our study provides arguments for a mutualistic status of the fungal associate and a framework for investigating the previously unsuspected complexity of food webs in ant-plant mutualisms.
Directory of Open Access Journals (Sweden)
D. Silhavy
2008-09-01
Full Text Available In eukaryotic cell, various quality control mechanisms have evolved to ensure that only perfect mRNAs could be translated. Nonsense-mediated mRNA decay (NMD is a quality control system that identifies and eliminates mRNAs containing premature termination codons, thereby preventing the accumulation of potentially harmful truncated proteins. While NMD is well-characterized in yeast, in invertebrates and in mammals, plant NMD is poorly understood. In yeast and in invertebrates unusually long 3'untranslated regions (3'UTRs render an mRNA subject to NMD, while in mammals' 3'UTR located introns trigger NMD. UPF1, 2 and 3 are the key trans-acting NMD factors in yeast as well as in animals. However, in mammals, the core components of the Exon Junction Complex (Mago, Y14, eIF4A3 and MLN51 are also required for NMD. It was proposed that long 3’UTR-induced NMD is the ancient type and that it was changed to a more complex intron-based NMD in mammals. To better understand the evolution of eukaryotic NMD systems, we have studied the NMD machinery of plants, as plants are outgroup relative to fungi and animals. We have elaborated various transient assays to analyze plant NMD. Using these assays we defined the cis elements of plant NMD and characterized several trans-acting plant NMD factors. We demonstrated that two plant NMD pathways co-exist, one pathway, as yeast or invertebrate NMD systems, eliminates mRNAs with long 3'UTRs, while a distinct pathway, like mammalian NMD, degrades mRNAs harbouring 3'UTR-located introns. We showed that UPF1, UPF2, and SMG-7 are involved in both plant NMD pathways, whereas Mago and Y14 are required only for intron-based NMD. We also provide evidence that the molecular mechanism of long 3'UTR-based plant NMD resembles yeast NMD, while the intron-based NMD is similar to mammalian NMD. Moreover we have found that the SMG-7 component of plant NMD is targeted by NMD suggesting that plant NMD is autoregulated. We propose that in
Volatilization of iodine from soils and plants
International Nuclear Information System (INIS)
Wildung, R.E.; Cataldo, D.A.; Garland, T.R.
1985-04-01
Elevated levels of 129 I, a long-lived fission product, are present in the environment as a result of nuclear weapons testing and fuel reprocessing. To aid in understanding the anomalous behavior of this element, relative to natural I ( 127 I), in the vicinity of nuclear fuel reprocessing plants, preliminary laboratory-growth chamber studies were undertaken to examine the possible formation of volatile inorganic and organic I species in soil and plant systems. Inorganic 129 I added to soil was volatilized from both the soil and plant during plant growth, at average ratios of 2 x 10 -3 %/day soil and 9 x 10 -3 %/day foliage, respectively. Volatilization rates from soil were an order of magnitude less in the absence of growing roots. Less than 2% of soil or plant volatiles was subsequently retained by plant canopies. Volatile I, chemically characterized by selective sorption methods, consisted principally of alkyl iodides formed by both soil and plant processes. However, plants and soils containing actively growing roots produced a larger fraction of volatile inorganic I than soil alone. 14 refs., 1 fig., 3 tabs
Ashton, A R; Polya, G M
1977-01-01
1.3':5'-Cyclic AMP was extensively purified from Kalanchoe daigremontiana and Agave americana by neutral alumina and anion- and cation-exchange column chromatography. Inclusion of 3':5'-cyclic [8-3H]AMP from the point of tissue extraction permitted calculation of yields. The purification procedure removed contaminating material that was shown to interfere with the 3':5'-cyclic AMP estimation and characterization procedures. 2. The partially purified 3':5'-cyclic AMP was quantified by means of a radiochemical saturation assay using an ox heart 3':5'-cyclic AMP-binding protein and by an assay involving activation of a mammalian protein kinase. 3. The plant 3':5'-cyclic AMP co-migrated with 3':5'-cyclic [8-3H]AMP on cellulose chromatography, poly(ethyleneimine)-cellulose chromatography and silica-gel t.l.c. developed with several solvent systems. 4. The plant 3':5'-cyclic AMP was degraded by ox heart 3':5'-cyclic nucleotide phosphodiesterase at the same rates as authentic 3':5'-cyclic AMP. 1-Methyl-3-isobutylxanthine (1 mM), a specific inhibitor of the 3':5'-cyclic nucleotide phosphodieterase, completely inhibited such degradation. 5. The concentrations of 3':5'-cyclic AMP satisfying the above criteria in Kalanchoe and Agave were 2-6 and 1 pmol/g fresh wt. respectively. Possible bacterial contribution to these analyses was estimated to be less than 0.002pmol/g fresh wt. Evidence for the occurrence of 3':5'-cyclic AMP in plants is discussed. PMID:196595
Kruijt, Marco; Tran, Ha; Raaijmakers, Jos M
2009-08-01
Plant growth-promoting Pseudomonas putida strain 267, originally isolated from the rhizosphere of black pepper, produces biosurfactants that cause lysis of zoospores of the oomycete pathogen Phytophthora capsici. The biosurfactants were characterized, the biosynthesis gene(s) partially identified, and their role in control of Phytophthora damping-off of cucumber evaluated. The biosurfactants were shown to lyse zoospores of Phy. capsici and inhibit growth of the fungal pathogens Botrytis cinerea and Rhizoctonia solani. In vitro assays further showed that the biosurfactants of strain 267 are essential in swarming motility and biofilm formation. In spite of the zoosporicidal activity, the biosurfactants did not play a significant role in control of Phytophthora damping-off of cucumber, since both wild type strain 267 and its biosurfactant-deficient mutant were equally effective, and addition of the biosurfactants did not provide control. Genetic characterization revealed that surfactant biosynthesis in strain 267 is governed by homologues of PsoA and PsoB, two nonribosomal peptide synthetases involved in production of the cyclic lipopeptides (CLPs) putisolvin I and II. The structural relatedness of the biosurfactants of strain 267 to putisolvins I and II was supported by LC-MS and MS-MS analyses. The biosurfactants produced by Ps. putida 267 were identified as putisolvin-like CLPs; they are essential in swarming motility and biofilm formation, and have zoosporicidal and antifungal activities. Strain 267 provides excellent biocontrol activity against Phytophthora damping-off of cucumber, but the lipopeptide surfactants are not involved in disease suppression. Pseudomonas putida 267 suppresses Phy. capsici damping-off of cucumber and provides a potential supplementary strategy to control this economically important oomycete pathogen. The putisolvin-like biosurfactants exhibit zoosporicidal and antifungal activities, yet they do not contribute to biocontrol of Phy
Pregnancy in a Previously Conjoined Thoracopagus Twin with a Crisscross Heart
Directory of Open Access Journals (Sweden)
Bassam H. Rimawi
2015-01-01
Full Text Available Background. Crisscross heart (CCH is a complex, rare, congenital, rotational, cardiac abnormality that accounts for <0.1% of congenital heart defects (CHD. CCH is characterized by the crossing of the inflow streams of the two ventricles due to an abnormal twisting of the heart. A case of maternal CCH has not been previously reported. Case. We report a case of a primigravida with a CCH, who was separated at birth from her thoracopagus conjoined twin. Pregnancy was managed by congenital cardiology, maternal-fetal medicine, anesthesiology, and obstetrics. She underwent a 39-week vaginal delivery without maternal or neonatal complication. Conclusion. A successful term pregnancy outcome was achieved in a patient with CCH using a multidisciplinary approach to address her cardiac condition.
Temporal dynamics of soil nematode communities in a grassland plant diversity experiment.
Viketoft, M.; Sohlenius, B.; Bostrom, S.; Palmborg, C.; Bengtsson, J.; Berg, M.P.; Kuss-Danell, K.
2011-01-01
We report here on an 8-year study examining links between plant and nematode communities in a grassland plant diversity experiment, located in the north of Sweden on previous agricultural soil. The examined plots contained 1, 4 and 12 common grassland plant species from three functional groups;
Plant breeding and genetics newsletter. No. 4
International Nuclear Information System (INIS)
1999-12-01
The Newsletter reports development of new Coordinated Research Projects (CRPs) and on efficient implementation of Technical Coperaton Projects related to regional activities. Following the organization of the CRP on 'Molecular characterization of mutated genes controlling important traits for seed crop improvement' the CRP on 'Mutational analysis of root characters in annual food plants related to plant performance' was also established with the participation of 21 institutes. It also presents recent training activities and meetings undertaken
Directory of Open Access Journals (Sweden)
Baldwin Ian T
2008-10-01
Full Text Available Abstract Background The adage from Shakespeare, "troubles, not as single spies, but in battalions come," holds true for Nicotiana attenuata, which is commonly attacked by both pathogens (Pseudomonas spp. and herbivores (Manduca sexta in its native habitats. Defense responses targeted against the pathogens can directly or indirectly influence the responses against the herbivores. Nadefensin is an effective induced defense gene against the bacterial pathogen Pseudomonas syringae pv tomato (PST DC3000, which is also elicited by attack from M. sexta larvae, but whether this defense protein influences M. sexta's growth and whether M. sexta-induced Nadefensin directly or indirectly influences PST DC3000 resistance are unknown. Results M. sexta larvae consumed less on WT and on Nadefensin-silenced N. attenuata plants that had previously been infected with PST DC3000 than on uninfected plants. WT plants infected with PST DC3000 showed enhanced resistance to PST DC3000 and decreased leaf consumption by M. sexta larvae, but larval mass gain was unaffected. PST DC3000-infected Nadefensin-silenced plants were less resistant to subsequent PST DC3000 challenge, and on these plants, M. sexta larvae consumed less and gained less mass. WT and Nadefensin-silenced plants previously damaged by M. sexta larvae were better able to resist subsequent PST DC3000 challenges than were undamaged plants. Conclusion These results demonstrate that Na-defensin directly mediates defense against PST DC3000 and indirectly against M. sexta in N. attenuata. In plants that were previously infected with PST DC3000, the altered leaf chemistry in PST DC3000-resistant WT plants and PST DC3000-susceptible Nadefensin-silenced plants differentially reduced M. sexta's leaf consumption and mass gain. In plants that were previously damaged by M. sexta, the combined effect of the altered host plant chemistry and a broad spectrum of anti-herbivore induced metabolomic responses was more
International Nuclear Information System (INIS)
Lappin, A.R.
1988-01-01
The Waste Isolation Pilot Plant (WIPP) is being excavated at a depth of approximately 655 m in bedded halites. Site-characterization activities at the WIPP site began in 1976. Characterization activities since 1983 have had the objective of updating the conceptual model for the geologic and hydrologic behavior of the WIPP site and vicinity. This paper discusses aspects of the general conceptual model significant to both site characterization and performance assessment. The geological and hydrologic behavior of the WIPP site and vicinity is transient, and has been transient since at least deposition of the Permian Salado Formation containing the underground workings of the WIPP facility. The Salado Formation deforms regionally in response to gravity, but is very low in permeability, except within approximately two meters of the WIPP facility. The Culebra Dolomite Member of the Rustler Formation dominates the hydrology at the WIPP site. Hydrologic measurements, geologic studies, major-element and minor-element distributions in Culebra fluids, and the results of isotopic studies (stable-isotope, radiocarbon, uranium-disequilibrium, and 87 Sr/ 86 Sr) are consistent with the interpretations that, although the Culebra dominates flow within the Rustler at the WIPP site and Rustler karst is not present, there has been limited vertical fluid movement within the Rustler and between the Rustler and the overlying Dewey Lake Red Beds
Proteomics Analysis Reveals Previously Uncharacterized Virulence Factors in Vibrio proteolyticus
Directory of Open Access Journals (Sweden)
Ann Ray
2016-07-01
Full Text Available Members of the genus Vibrio include many pathogens of humans and marine animals that share genetic information via horizontal gene transfer. Hence, the Vibrio pan-genome carries the potential to establish new pathogenic strains by sharing virulence determinants, many of which have yet to be characterized. Here, we investigated the virulence properties of Vibrio proteolyticus, a Gram-negative marine bacterium previously identified as part of the Vibrio consortium isolated from diseased corals. We found that V. proteolyticus causes actin cytoskeleton rearrangements followed by cell lysis in HeLa cells in a contact-independent manner. In search of the responsible virulence factor involved, we determined the V. proteolyticus secretome. This proteomics approach revealed various putative virulence factors, including active type VI secretion systems and effectors with virulence toxin domains; however, these type VI secretion systems were not responsible for the observed cytotoxic effects. Further examination of the V. proteolyticus secretome led us to hypothesize and subsequently demonstrate that a secreted hemolysin, belonging to a previously uncharacterized clan of the leukocidin superfamily, was the toxin responsible for the V. proteolyticus-mediated cytotoxicity in both HeLa cells and macrophages. Clearly, there remains an armory of yet-to-be-discovered virulence factors in the Vibrio pan-genome that will undoubtedly provide a wealth of knowledge on how a pathogen can manipulate host cells.
Towards aspect-oriented functional–structural plant modelling
Cieslak, Mikolaj; Seleznyova, Alla N.; Prusinkiewicz, Przemyslaw; Hanan, Jim
2011-01-01
Background and Aims Functional–structural plant models (FSPMs) are used to integrate knowledge and test hypotheses of plant behaviour, and to aid in the development of decision support systems. A significant amount of effort is being put into providing a sound methodology for building them. Standard techniques, such as procedural or object-oriented programming, are not suited for clearly separating aspects of plant function that criss-cross between different components of plant structure, which makes it difficult to reuse and share their implementations. The aim of this paper is to present an aspect-oriented programming approach that helps to overcome this difficulty. Methods The L-system-based plant modelling language L+C was used to develop an aspect-oriented approach to plant modelling based on multi-modules. Each element of the plant structure was represented by a sequence of L-system modules (rather than a single module), with each module representing an aspect of the element's function. Separate sets of productions were used for modelling each aspect, with context-sensitive rules facilitated by local lists of modules to consider/ignore. Aspect weaving or communication between aspects was made possible through the use of pseudo-L-systems, where the strict-predecessor of a production rule was specified as a multi-module. Key Results The new approach was used to integrate previously modelled aspects of carbon dynamics, apical dominance and biomechanics with a model of a developing kiwifruit shoot. These aspects were specified independently and their implementation was based on source code provided by the original authors without major changes. Conclusions This new aspect-oriented approach to plant modelling is well suited for studying complex phenomena in plant science, because it can be used to integrate separate models of individual aspects of plant development and function, both previously constructed and new, into clearly organized, comprehensive FSPMs. In
Towards aspect-oriented functional--structural plant modelling.
Cieslak, Mikolaj; Seleznyova, Alla N; Prusinkiewicz, Przemyslaw; Hanan, Jim
2011-10-01
Functional-structural plant models (FSPMs) are used to integrate knowledge and test hypotheses of plant behaviour, and to aid in the development of decision support systems. A significant amount of effort is being put into providing a sound methodology for building them. Standard techniques, such as procedural or object-oriented programming, are not suited for clearly separating aspects of plant function that criss-cross between different components of plant structure, which makes it difficult to reuse and share their implementations. The aim of this paper is to present an aspect-oriented programming approach that helps to overcome this difficulty. The L-system-based plant modelling language L+C was used to develop an aspect-oriented approach to plant modelling based on multi-modules. Each element of the plant structure was represented by a sequence of L-system modules (rather than a single module), with each module representing an aspect of the element's function. Separate sets of productions were used for modelling each aspect, with context-sensitive rules facilitated by local lists of modules to consider/ignore. Aspect weaving or communication between aspects was made possible through the use of pseudo-L-systems, where the strict-predecessor of a production rule was specified as a multi-module. The new approach was used to integrate previously modelled aspects of carbon dynamics, apical dominance and biomechanics with a model of a developing kiwifruit shoot. These aspects were specified independently and their implementation was based on source code provided by the original authors without major changes. This new aspect-oriented approach to plant modelling is well suited for studying complex phenomena in plant science, because it can be used to integrate separate models of individual aspects of plant development and function, both previously constructed and new, into clearly organized, comprehensive FSPMs. In a future work, this approach could be further
Arunachalam Palaniyandi, Sasikumar; Yang, Seung Hwan; Damodharan, Karthiyaini; Suh, Joo-Won
2013-12-01
Actinobacteria were isolated from the rhizosphere of yam plants from agricultural fields from Yeoju, South Korea and analyzed for their genetic and plant-beneficial functional diversity. A total of 29 highly occurring actinobacterial isolates from the yam rhizosphere were screened for various plant-beneficial traits such as antimicrobial activity on fungi and bacteria; biocontrol traits such as production of siderophore, protease, chitinase, endo-cellulase, and β-glucanase. The isolates were also screened for plant growth-promoting (PGP) traits such as auxin production, phosphate solubilization, 1-aminocyclopropane-1-carboxylic acid (ACC) deaminase activity, and in vitro Arabidopsis growth promotion. 16S rDNA sequence-based phylogenetic analysis was carried out on the actinobacterial isolates to determine their genetic relatedness to known actinobacteria. BOX-PCR analysis revealed high genetic diversity among the isolates. Several isolates were identified to belong to the genus Streptomyces and a few to Kitasatospora. The actinobacterial strains exhibited high diversity in their functionality and were identified as novel and promising candidates for future development into biocontrol and PGP agents. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Phytochromes in photosynthetically competent plants
Energy Technology Data Exchange (ETDEWEB)
Pratt, L.H.
1990-07-01
Plants utilize light as a source of information in photomorphogenesis and of free energy in photosynthesis, two processes that are interrelated in that the former serves to increase the efficiency with which plants can perform the latter. Only one pigment involved in photomorphogenesis has been identified unequivocally, namely phytochrome. The thrust of this proposal is to investigate this pigment and its mode(s) of action in photosynthetically competent plants. Our long term objective is to characterize phytochrome and its functions in photosynthetically competent plants from molecular, biochemical and cellular perspectives. It is anticipated that others will continue to contribute indirectly to these efforts at the physiological level. The ultimate goal will be to develop this information from a comparative perspective in order to learn whether the different phytochromes have significantly different physicochemical properties, whether they fulfill independent functions and if so what these different functions are, and how each of the different phytochromes acts at primary molecular and cellular levels.
Cardiac Glycoside Plants Self-Poisoning
Directory of Open Access Journals (Sweden)
Radenkova-Saeva J.
2014-06-01
Full Text Available Cardiac glycosides are found in a diverse group of plants including Digitalis purpurea and Digitalis lanata (foxgloves, Nerium oleander, Convallaria majalis (lily of the valley, Strophanthus gratus, etc. Nerium Oleander is an indoor and ornamental plant of an evergreen shrub. It’s widespread in countries with a Mediterranean climate. Oleander is one of the most poisonous plants known to humans. All parts of the nerium oleander are poisonous, primarily due to the contained cardiac glycosides - oleandrin, nerin, digitoxigenin, and olinerin of which oleandrin is the principal toxin. The bark contains the toxic substances of rosagenin which causes strychnine-like effects. Signs of poisoning appear a few hours after the adoption of the parts of the plant. Two cases of Nerium Oleander poisoning were presented. Clinical picture included gastrointestinal, cardiovascular and central nervous system effects. The clinical symptoms were characterized by nausea, vomiting, salivation, colic, diarrhoea, ventricular tachycardia, dysrhythmia, heart block, ataxia, drowsiness, muscular tremor. Treatment included administration of activated charcoal, symptomatic and supportive care.
Zhang, Xinjian; Harvey, Paul R; Stummer, Belinda E; Warren, Rosemary A; Zhang, Guangzhi; Guo, Kai; Li, Jishun; Yang, Hetong
2015-09-01
Trichoderma afroharzianum is one of the best characterized Trichoderma species, and strains have been utilized as plant disease suppressive inoculants. In contrast, Trichoderma gamsii has only recently been described, and there is limited knowledge of its disease suppressive efficacies. Comparative studies of changes in gene expression during interactions of these species with their target plant pathogens will provide fundamental information on pathogen antibiosis functions. In the present study, we used complementary DNA amplified fragment length polymorphism (cDNA-AFLP) analysis to investigate changes in transcript profiling of T. afroharzianum strain LTR-2 and T. gamsii strain Tk7a during in vitro interactions with plant pathogenic Rhizoctonia solani and Pythium irregulare. Considerable differences were resolved in the overall expression profiles of strains LTR-2 and Tk7a when challenged with either plant pathogen. In strain LTR-2, previously reported mycoparasitism-related genes such as chitinase, polyketide synthase, and non-ribosomal peptide synthetase were found to be differentially expressed. This was not so for strain Tk7a, with the only previously reported antibiosis-associated genes being small secreted cysteine-rich proteins. Although only one differentially expressed gene was common to both strains LTR-2 and Tk7a, numerous genes reportedly associated with pathogen antibiosis processes were differentially expressed in both strains, including degradative enzymes and membrane transport proteins. A number of novel potential antibiosis-related transcripts were found from strains LTR-2 and Tk7a and remain to be identified. The expression kinetics of 20 Trichoderma (10 from strain LTR-2, 10 from strain Tk7a) transcript-derived fragments (TDFs) were quantified by quantitative reverse transcription PCR (RT-qPCR) at pre- and post-mycelia contact stages of Trichoderma-prey interactions, thereby confirming differential gene expression. Collectively, this research
Directory of Open Access Journals (Sweden)
Felix Carlos
2002-01-01
Full Text Available Abstract Background Several Trichoderma strains have been reported to be effective in controlling plant diseases, and the action of fungal hydrolytic enzymes has been considered as the main mechanism involved in the antagonistic process. However, although Trichoderma strains were found to impair development of Crinipellis perniciosa, the causal agent of cocoa plant witches' broom disease, no fungal strain is available for effective control of this disease. We have then undertaken a program of construction of hydrolytic enzyme-overproducing Trichoderma strains aiming improvement of the fungal antagonistic capacity. The protease of an indian Trichoderma isolate showing antagonistic activity against C. perniciosa was purified to homogeneity and characterized for its kinetic properties and action on the phytopathogen cell wall. Results A protease produced by the Trichoderma harzianum isolate 1051 was purified to homogeneity by precipitation with ammonium sulfate followed by hydrophobic chromatography. The molecular mass of this protease as determined by SDS-polyacrylamide gel electrophoresis was about 18.8 kDa. Its N-terminal amino acid sequence shares no homology with any other protease. The purified enzyme substantially affected the cell wall of the phytopathogen C. perniciosa. Western-blotting analysis showed that the enzyme was present in the culture supernatant 24 h after the Trichoderma started to grow in casein-containing liquid medium. Conclusions The capacity of the Trichoderma harzianum protease to hydrolyze the cell wall of C. perniciosa indicates that this enzyme may be actually involved in the antagonistic process between the two fungi. This fact strongly suggest that hydrolytic enzyme over-producing transgenic fungi may show superior biocontrol capacity.
Effect of cadmium on plants of oilseed rape
International Nuclear Information System (INIS)
Pesko, M.
2010-01-01
The aim of this work was to study the influence of some production parameters of hydroponically grown plants of new Czech species of oilseed rape Opponent by cadmium and determine the amount of cadmium accumulated in plant organs. Studying the effect of cadmium on plants of new Czech species of oilseed rape Opponent confirmed that application of metal reduced the length and also fresh and dry weight of plant organs, while the inhibitory effect of Cd with increasing concentration of metal in solution increased. Plant roots responded to toxic effect of Cd more responsive. As a result of Cd applications occurred a significant decrease of content of assimilation pigments (chlorophyll a, chlorophyll b, carotenoids) in plant leaves. Species of rape Opponent is a significant Cd battery, and for these plants is characterized by a high rate of translocation of this metal into the shoots.
Characterization and Clearance of m/s Sigyn
International Nuclear Information System (INIS)
Jiselmark, Jonatan; Vreede, Patrick
2016-01-01
M/s Sigyn was a 2044 ton ship that transported contaminated material between 1982 and 2013. Most of the transports were with spent nuclear fuel between Swedish nuclear power plants and the Swedish fuel repository, Clab. In addition to spent fuel, m/s Sigyn also transported big contaminated components, from nuclear power plants in Europe, to Studsvik for analysis or decontamination and melting. She also transported components from Swedish nuclear power plants to final disposal of short lived waste, SFR. Even though all transported items have been cleaned, checked and wrapped with plastics, some activity ended up as contamination onboard. In December 2013 it was decided that m/s Sigyn was subject for decommissioning due to her age. This Paper describes the method in which the activity onboard m/s Sigyn was characterized and clearance levels were calculated. This method for radiological characterization and clearance has recently been developed in Sweden, the method is efficient in that it does not need a big pre characterization survey. Only the nuclide distribution and history of the object, is needed to start the final survey. In the future there will be further development of the method, making it possible to reduce the number of measurements even more. This will further optimize the method and reduce the cost for final surveys and clearance. (authors)
Heavy Metals in Crop Plants: Transport and Redistribution Processes on the Whole Plant Level
Directory of Open Access Journals (Sweden)
Valérie Page
2015-09-01
Full Text Available Copper, zinc, manganese, iron, nickel and molybdenum are essential micronutrients for plants. However, when present in excess they may damage the plant or decrease the quality of harvested plant products. Some other heavy metals such as cadmium, lead or mercury are not needed by plants and represent pollutants. The uptake into the roots, the loading into the xylem, the acropetal transport to the shoot with the transpiration stream and the further redistribution in the phloem are crucial for the distribution in aerial plant parts. This review is focused on long-distance transport of heavy metals via xylem and phloem and on interactions between the two transport systems. Phloem transport is the basis for the redistribution within the shoot and for the accumulation in fruits and seeds. Solutes may be transferred from the xylem to the phloem (e.g., in the small bundles in stems of cereals, in minor leaf veins. Nickel is highly phloem-mobile and directed to expanding plant parts. Zinc and to a lesser degree also cadmium are also mobile in the phloem and accumulate in meristems (root tips, shoot apex, axillary buds. Iron and manganese are characterized by poor phloem mobility and are retained in older leaves.
Host Plant Species Differentiation in a Polyphagous Moth: Olfaction is Enough.
Conchou, Lucie; Anderson, Peter; Birgersson, Göran
2017-08-01
Polyphagous herbivorous insects need to discriminate suitable from unsuitable host plants in complex plant communities. While studies on the olfactory system of monophagous herbivores have revealed close adaptations to their host plant's characteristic volatiles, such adaptive fine-tuning is not possible when a large diversity of plants is suitable. Instead, the available literature on polyphagous herbivore preferences suggests a higher level of plasticity, and a bias towards previously experienced plant species. It is therefore necessary to take into account the diversity of plant odors that polyphagous herbivores encounter in the wild in order to unravel the olfactory basis of their host plant choice behaviour. In this study we show that a polyphagous moth, Spodoptera littoralis, has the sensory ability to distinguish five host plant species using olfaction alone, this being a prerequisite to the ability to make a choice. We have used gas chromatography mass spectrometry (GC-MS) and gas chromatography electroantennographic detection (GC-EAD) in order to describe host plant odor profiles as perceived by S. littoralis. We find that each plant emits specific combinations and proportions of GC-EAD active volatiles, leading to statistically distinct profiles. In addition, at least four of these plants show GC-EAD active compound proportions that are conserved across individual plants, a characteristic that enables insects to act upon previous olfactory experiences during host plant choice. By identifying the volatiles involved in olfactory differentiation of alternative host plants by Spodoptera littoralis, we set the groundwork for deeper investigations of how olfactory perceptions translate into behaviour in polyphagous herbivores.
Method for plant operation guidance by knowledge engineering technique
International Nuclear Information System (INIS)
Kiguchi, Takashi; Yoshida, Kenichi; Motoda, Hiroshi; Kobayashi, Setsuo
1983-01-01
A method for plant operation guidance has been developed by using the Knowledge Engineering technique. The method is characterized by its capability of handling plant dynamics. The knowledge-base includes plant simulation programs as tools to evaluate dynamic behaviors as well as production rules of ''if..., then...'' type. The inference engine is thus capable of predicting plant dynamics and making decisions in accordance with time progress. The performance of the guidance method was evaluated by simulation tests assuming various abnormal situations of a BWR power plant. It was shown that the method can detect each of the abnormal events along the course of their occurrence, and provide the guidance for corrective actions. The operation guidance method proposed in this paper is general and is applicable not only to nuclear power plants but also to other plants such as chemical production plants and fossile power plants. (author)
Novák, Petr; Ávila Robledillo, Laura; Koblížková, Andrea; Vrbová, Iva; Neumann, Pavel; Macas, Jirí
2017-07-07
Satellite DNA is one of the major classes of repetitive DNA, characterized by tandemly arranged repeat copies that form contiguous arrays up to megabases in length. This type of genomic organization makes satellite DNA difficult to assemble, which hampers characterization of satellite sequences by computational analysis of genomic contigs. Here, we present tandem repeat analyzer (TAREAN), a novel computational pipeline that circumvents this problem by detecting satellite repeats directly from unassembled short reads. The pipeline first employs graph-based sequence clustering to identify groups of reads that represent repetitive elements. Putative satellite repeats are subsequently detected by the presence of circular structures in their cluster graphs. Consensus sequences of repeat monomers are then reconstructed from the most frequent k-mers obtained by decomposing read sequences from corresponding clusters. The pipeline performance was successfully validated by analyzing low-pass genome sequencing data from five plant species where satellite DNA was previously experimentally characterized. Moreover, novel satellite repeats were predicted for the genome of Vicia faba and three of these repeats were verified by detecting their sequences on metaphase chromosomes using fluorescence in situ hybridization. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Mitochondrial Electron Transport and Plant Stress
DEFF Research Database (Denmark)
Rasmusson, Allan G; Møller, Ian Max
2011-01-01
Due to the sessile nature of plants, it is crucial for their survival and growth that they can handle a constantly changing, and thus stressful, ambient environment by modifying their structure and metabolism. The central metabolism of plants is characterized by many alternative options...... for metabolic pathways, which allow a wide range of adjustments of metabolic processes in response to environmental variations. Many of the metabolic pathways in plants involve the processing of redox compounds and the use of adenylates. They converge at the mitochondrial electron transport chain (ETC) where...... redox compounds from carbon degradation are used for powering ATP synthesis. The standard ETC contains three sites of energy conservation in complexes I, III, and IV, which are in common with most other eukaryotes. However, the complexity of the plant metabolic system is mirrored in the ETC. In addition...
Measuring Asymmetry in Insect-Plant Networks
Energy Technology Data Exchange (ETDEWEB)
Cruz, Claudia P T [Programa de Pos-Graduacao em Fisica, Universidade Federal do Rio Grande do Norte, UFRN - Campus Universitario, Lagoa Nova, CEP 59078 972, Natal, RN (Brazil); De Almeida, Adriana M [Departamento de Botanica, Ecologia e Zoologia, Centro de Biociencias, Universidade Federal do Rio Grande do Norte, UFRN - Campus Universitario, Lagoa Nova, CEP 59078 972, Natal, RN (Brazil); Corso, Gilberto, E-mail: claudia@dfte.ufrn.br, E-mail: adrianam@ufrn.br, E-mail: corso@cb.ufrn.br [Departamento de Biofisica e Farmacologia, Centro de Biociencias, Universidade Federal do Rio Grande do Norte, UFRN - Campus Universitario, Lagoa Nova, CEP 59078 972, Natal, RN (Brazil)
2011-03-01
In this work we focus on interaction networks between insects and plants and in the characterization of insect plant asymmetry, an important issue in coevolution and evolutionary biology. We analyze in particular the asymmetry in the interaction matrix of animals (herbivorous insects) and plants (food resource for the insects). Instead of driving our attention to the interaction matrix itself we derive two networks associated to the bipartite network: the animal network, D{sub 1}, and the plant network, D{sub 2}. These networks are constructed according to the following recipe: two animal species are linked once if they interact with the same plant. In a similar way, in the plant network, two plants are linked if they interact with the same animal. To explore the asymmetry between D{sub 2} and D{sub 1} we test for a set of 23 networks from the ecologic literature networks: the difference in size, {Delta}L, clustering coefficient difference, {Delta}C, and mean connectivity difference, {Delta}
Cassina, L; Tassi, E; Pedron, F; Petruzzelli, G; Ambrosini, P; Barbafieri, M
2012-09-15
Mercury-contaminated soils from a petrochemical plant in southern Italy were investigated to assess the phytoextraction efficiency of crop plants treated with the phytohormone, cytokinine (CK foliar treatment), and with the thioligand, ammonium thiosulfate (TS, soil application). Plant biomass, evapotranspiration, Hg uptake and distribution in plant tissues following treatment were compared. Results indicate the effectiveness of CK in increasing plant biomass and the evapotranspiration rate while TS treatment promoted soil Hg solubility and availability. The simultaneous addition of CK and TS treatments increased Hg uptake and translocation in both tested plants with up to 248 and 232% in Brassica juncea (Indian mustard) and Helianthus annuus (sunflower) respectively. B. juncea was more effective in Hg uptake, whereas H. annuus gave better response regarding plant biomass production. The effectiveness of the treatments was confirmed by the calculation of Hg phytoextraction and evaluation of labile-Hg residue in the soil after plant growth. In one growing cycle the plants subject to simultaneous CK and TS treatment significantly reduced labile-Hg pools that were characterized by the soil sequential extraction, but did not significantly affect the pseudototal metal content in the soil. Results support the use of plant growth regulators in the assisted phytoextraction process for Hg-contaminated soils. Copyright © 2012 Elsevier B.V. All rights reserved.
Occhialini, Alessandro; Lin, Myat T; Andralojc, P John; Hanson, Maureen R; Parry, Martin A J
2016-01-01
Introducing a carbon-concentrating mechanism and a faster Rubisco enzyme from cyanobacteria into higher plant chloroplasts may improve photosynthetic performance by increasing the rate of CO2 fixation while decreasing losses caused by photorespiration. We previously demonstrated that tobacco plants grow photoautotrophically using Rubisco from Synechococcus elongatus, although the plants exhibited considerably slower growth than wild-type and required supplementary CO2 . Because of concerns that vascular plant assembly factors may not be adequate for assembly of a cyanobacterial Rubisco, prior transgenic plants included the cyanobacterial chaperone RbcX or the carboxysomal protein CcmM35. Here we show that neither RbcX nor CcmM35 is needed for assembly of active cyanobacterial Rubisco. Furthermore, by altering the gene regulatory sequences on the Rubisco transgenes, cyanobacterial Rubisco expression was enhanced and the transgenic plants grew at near wild-type growth rates, although still requiring elevated CO2 . We performed detailed kinetic characterization of the enzymes produced with and without the RbcX and CcmM35 cyanobacterial proteins. These transgenic plants exhibit photosynthetic characteristics that confirm the predicted benefits of introduction of non-native forms of Rubisco with higher carboxylation rate constants in vascular plants and the potential nitrogen-use efficiency that may be achieved provided that adequate CO2 is available near the enzyme. © 2015 The Authors The Plant Journal © 2015 John Wiley & Sons Ltd.
Performance analysis of US coal-fired power plants by measuring three DEA efficiencies
International Nuclear Information System (INIS)
Sueyoshi, Toshiyuki; Goto, Mika; Ueno, Takahiro
2010-01-01
Data Envelopment Analysis (DEA) has been widely used for performance evaluation of many organizations in private and public sectors. This study proposes a new DEA approach to evaluate the operational, environmental and both-unified performance of coal-fired power plants that are currently operating under the US Clean Air Act (CAA). The economic activities of power plants examined by this study are characterized by four inputs, a desirable (good) output and three undesirable (bad) outputs. This study uses Range-Adjusted Measure (RAM) because it can easily incorporate both desirable and undesirable outputs in the unified analytical structure. The output unification proposed in this study has been never investigated in the previous DEA studies even though such a unified measure is essential in guiding policy makers and corporate leaders. Using the proposed DEA approach, this study finds three important policy implications. First, the CAA has been increasingly effective on their environmental protection. The increased environmental performance leads to the enhancement of the unified efficiency. Second, the market liberalization/deregulation was an important business trend in the electric power industry. Such a business trend was legally prepared by US Energy Policy Act (EPAct). According to the level of the market liberalization, the United States is classified into regulated and deregulated states. This study finds that the operational and unified performance of coal-fired power plants in the regulated states outperforms those of the deregulated states because the investment on coal-fired power plants in the regulated states can be utilized as a financial tool under the rate-of-return criterion of regulation. The power plants in the deregulated states do not have such a regulation premium. Finally, plant managers need to balance between their environmental performance and operational efficiency.
Preliminary Study of Late Pleistocene to Early Holocene Plant Food Strategies in China
Hayashi Tang, M.; Liu, X.; Fritz, G.; Zhao, Z.
2017-12-01
In recent decades, studies on the domestication and early cultivation of seed crops have contributed significantly to how we understand human-plant interactions, and their impact on human social organisation and the environment. It is becoming clear, however, that plants have been critical to the human diet for much longer and in more diverse ways than previously assumed. This paper is a preliminary attempt at identifying and addressing early prehistoric plant food strategies in China. In particular, very little is known about the use of vegetatively propagated plants, despite their significant representation in modern crops. Many ingredients of Chinese medicine are also roots and tubers (or vegetative storage organs, VSOs). Unlike seed crops, however, we lack a systematic criterion for examining diagnostic characters of different VSO taxa in the archaeological record. To address this issue, we characterized commonly consumed and historically significant VSOs in China, by studying experimentally charred modern samples under the optical microscope and scanning electron microscope. We then compared the characteristics of these modern VSO samples against plant remains from Late Pleistocene to early Holocene archaeological sites in China, such as Zengpiyan (Guangxi), Zhaoguodong (Guizhou), and Jiahu (Henan) sites. We found that different taxa of VSOs can be differentiated by using multiple lines of evidence, including: shape and size of various cells, texture and arrangement of cell walls, as well as anatomical arrangements of organs, especially the vascular bundles. Though identification can be difficult when fragile cell structures have collapsed or deteriorated, more robust features are often preserved for diagnosis. Our results suggest that the potential for studying the role of vegetatively propagated plants in early human-environmental interactions is overlooked, and can be expanded significantly with further investment in their systematic identification.
Bioelectric potentials in the soil-plant system
Pozdnyakov, A. I.
2013-07-01
A detailed study of the electric potentials in the soil-plant system was performed. It was found that the electric potential depends on the plant species and the soil properties. A theoretical interpretation of the obtained data was given. All the plants, independently from their species and their state, always had a negative electric potential relative to the soil. The electric potential of the herbaceous plants largely depended on the leaf area. In some plants, such as burdock ( Arctium lappa) and hogweed ( Heracleum sosnowskyi), the absolute values of the negative electric potential exceeded 100 mV. The electric potential was clearly differentiated by the plant organs: in the flowers, it was lower than in the leaves; in the leaves, it was usually lower than in the leaf rosettes and stems. The electric potentials displayed seasonal dynamics. As a rule, the higher the soil water content, the lower the electric potential of the plants. However, an inverse relationship was observed for dandelions ( Taraxacum officinale). It can be supposed that the electric potential between the soil and the plant characterizes the vital energy of the plant.
Chemical Analysis of Plants that Poison Livestock: Successes, Challenges, and Opportunities.
Welch, Kevin D; Lee, Stephen T; Cook, Daniel; Gardner, Dale R; Pfister, James A
2018-04-04
Poisonous plants have a devastating impact on the livestock industry as well as human health. To fully understand the effects of poisonous plants, multiple scientific disciplines are required. Chemical analysis of plant secondary compounds is key to identifying the responsible toxins, characterizing their metabolism, and understanding their effects on animals and humans. In this review, we highlight some of the successes in studying poisonous plants and mitigating their toxic effects. We also highlight some of the remaining challenges and opportunities with regards to the chemical analysis of poisonous plants.
Mourad, Elhussein F; Sarhan, Mohamed S; Daanaa, Hassan-Sibroe A; Abdou, Mennatullah; Morsi, Ahmed T; Abdelfadeel, Mohamed R; Elsawey, Hend; Nemr, Rahma; El-Tahan, Mahmoud; Hamza, Mervat A; Abbas, Mohamed; Youssef, Hanan H; Abdelhadi, Abdelhadi A; Amer, Wafaa M; Fayez, Mohamed; Ruppel, Silke; Hegazi, Nabil A
2018-03-29
In order to improve the culturability and biomass production of rhizobacteria, we previously introduced plant-only-based culture media. We herein attempted to widen the scope of plant materials suitable for the preparation of plant-only-based culture media. We chemically analyzed the refuse of turfgrass, cactus, and clover. They were sufficiently rich to support good in vitro growth by rhizobacteria isolates representing Proteobacteria and Firmicutes. They were also adequate and efficient to produce a cell biomass in liquid batch cultures. These culture media were as sufficient as artificial culture media for the cultivation and recovery of the in situ rhizobacteria of barley (Hordeum murinum L.). Based on culture-dependent (CFU plate counting) and culture-independent analyses (qPCR), mowed turfgrass, in particular, supported the highest culturable population of barley endophytes, representing >16% of the total bacterial number quantified with qPCR. This accurately reflected the endophytic community composition, in terms of diversity indices (S', H', and D') based on PCR-DGGE, and clustered the plant culture media together with the qPCR root populations away from the artificial culture media. Despite the promiscuous nature of the plant materials tested to culture the plant microbiome, our results indicated that plant materials of a homologous nature to the tested host plant, at least at the family level, and/or of the same environment were more likely to be selected. Plant-only-based culture media require further refinements in order to provide selectivity for the in vitro growth of members of the plant microbiome, particularly difficult-to-culture bacteria. This will provide insights into their hidden roles in the environment and support future culturomic studies.
Selective absorption pilot plant for decontamination of fuel reprocessing plant off-gas
Energy Technology Data Exchange (ETDEWEB)
Stephenson, M.J.; Eby, R.S.; Huffstetler, V.C.
1977-10-01
A fluorocarbon-based selective absorption process for removing krypton-85, carbon-14, and radon-222 from the off-gas of conventional light water and advanced reactor fuel reprocessing plants is being developed at the Oak Ridge Gaseous Diffusion Plant in conjunction with fuel recycle work at the Oak Ridge National Laboratory and at the Savannah River Laboratory. The process is characterized by an especially high tolerance for many other reprocessing plant off-gas components. This report presents detailed drawings and descriptions of the second generation development pilot plant as it has evolved after three years of operation. The test facility is designed on the basis of removing 99% of the feed gas krypton and 99.9% of the carbon and radon, and can handle a nominal 15 scfm (425 slm) of contaminated gas at pressures from 100 to 600 psig (7.0 to 42.2 kg/cm/sup 2/) and temperatures from minus 45 to plus 25/sup 0/F (-43 to -4/sup 0/C). Part of the development program is devoted to identifying flowsheet options and simplifications that lead to an even more economical and reliable process. Two of these applicative flowsheets are discussed.
Mixed waste characterization reference document
International Nuclear Information System (INIS)
1997-09-01
Waste characterization and monitoring are major activities in the management of waste from generation through storage and treatment to disposal. Adequate waste characterization is necessary to ensure safe storage, selection of appropriate and effective treatment, and adherence to disposal standards. For some wastes characterization objectives can be difficult and costly to achieve. The purpose of this document is to evaluate costs of characterizing one such waste type, mixed (hazardous and radioactive) waste. For the purpose of this document, waste characterization includes treatment system monitoring, where monitoring is a supplement or substitute for waste characterization. This document establishes a cost baseline for mixed waste characterization and treatment system monitoring requirements from which to evaluate alternatives. The cost baseline established as part of this work includes costs for a thermal treatment technology (i.e., a rotary kiln incinerator), a nonthermal treatment process (i.e., waste sorting, macronencapsulation, and catalytic wet oxidation), and no treatment (i.e., disposal of waste at the Waste Isolation Pilot Plant (WIPP)). The analysis of improvement over the baseline includes assessment of promising areas for technology development in front-end waste characterization, process equipment, off gas controls, and monitoring. Based on this assessment, an ideal characterization and monitoring configuration is described that minimizes costs and optimizes resources required for waste characterization
Albrecht, Verónica; Ingenfeld, Anke; Apel, Klaus
2006-03-01
During seedling development chloroplast formation marks the transition from heterotrophic to autotrophic growth. The development and activity of chloroplasts may differ in cotyledons that initially serve as a storage organ and true leaves whose primary function is photosynthesis. A genetic screen was used for the identification of genes that affect selectively chloroplast function in cotyledons of Arabidopsis thaliana. Several mutants exhibiting pale cotyledons and green true leaves were isolated and dubbed snowy cotyledon (sco). One of the mutants, sco1, was characterized in more detail. The mutated gene was identified using map-based cloning. The mutant contains a point mutation in a gene encoding the chloroplast elongation factor G, leading to an amino acid exchange within the predicted 70S ribosome-binding domain. The mutation results in a delay in the onset of germination. At this early developmental stage embryos still contain undifferentiated proplastids, whose proper function seems necessary for seed germination. In light-grown sco1 seedlings the greening of cotyledons is severely impaired, whereas the following true leaves develop normally as in wild-type plants. Despite this apparent similarity of chloroplast development in true leaves of mutant and wild-type plants various aspects of mature plant development are also affected by the sco1 mutation such as the onset of flowering, the growth rate, and seed production. The onset of senescence in the mutant and the wild-type plants occurs, however, at the same time, suggesting that in the mutant this particular developmental step does not seem to suffer from reduced protein translation efficiency in chloroplasts.
Unique phytochrome responses of the holoparasitic plant Orobanche minor.
Takagi, Kazuteru; Okazawa, Atsushi; Wada, Yu; Mongkolchaiyaphruek, Anchaya; Fukusaki, Eiichiro; Yoneyama, Koichi; Takeuchi, Yasutomo; Kobayashi, Akio
2009-06-01
Holoparasitic plants such as Orobanche spp. have lost their photosynthetic ability, so photoresponses to optimize photosynthesis are not necessary in these plants. Photoresponses are also involved in the regulation of plant development but the photoresponses of holoparasites have not been characterized in detail. In this study, the phytochrome (phy)-related photoresponse of Orobanche minor was investigated. Its photoreceptor, phytochrome A (OmphyA), was also characterized. Light effects on germination, shoot elongation, anthocyanin biosynthesis, and OmphyA expression and subcellular localization were analyzed. Red light (R):far-red light (FR) reversible inhibition of O. minor seed germination demonstrated that phy-mediated responses are retained in this holoparasite. Shoot elongation was inhibited by FR but not by R. This pattern is unique among known patterns of plant photoresponses. Additionally, molecular analysis showed that OmphyA is able to respond to the light signals. Interestingly, the unique pattern of photoresponses in O. minor seems to have been modified for adaptation to its parasitic life cycle. We hypothesize that this alteration has resulted from the loss or alteration of some phy-signaling components. Elucidation of altered components in phy signaling in this parasite will provide useful information not only about its physiological characteristics but also about general plant photoreception systems.
Jayakumar, Aswathy; Krishna, Arathy; Mohan, Mahesh; Nair, Indu C; Radhakrishnan, E K
2018-04-13
Endophytic bacteria have already been studied for their beneficial support to plants to manage both biotic and abiotic stress through an array of well-established mechanisms. They have either direct or indirect impact on mobilizing diverse nutrients and elements from soil to plants. However, detailed insight into the fine-tuning of plant elemental composition by associated microorganism is very limited. In this study, endophytic Bacillus Fcl1 characterized from the rhizome of Curcuma longa was found to have broad range of plant growth-promoting and biocontrol mechanisms. The organism was found to have indole acetic acid and 1-aminocyclopropane-1-carboxylate deaminase production properties along with nitrogen fixation. The Bacillus Fcl1 could also inhibit diverse phytopathogens as confirmed by dual culture and well diffusion. By LC-MS/MS analysis, chemical basis of its antifungal activity has been proved to be due to the production of iturin A and a blend of surfactin compounds. Moreover, the organism was found to induce both plant growth and disease resistance in vivo in model plant system. Because of these experimentally demonstrated multiple plant probiotic features, Bacillus Fcl1 was selected as a candidate organism to study its role in modulation of plant elemental composition. ICP-MS analysis of Bacillus Fcl1-treated plants provided insight into relation of bacterial interaction with elemental composition of plants.
Directory of Open Access Journals (Sweden)
Wang Liuqiang
2012-07-01
Full Text Available Abstract Background The eukaryotic translation initiation factor 5A (eIF5A promotes formation of the first peptide bond at the onset of protein synthesis. However, the function of eIF5A in plants is not well understood. Results In this study, we characterized the function of eIF5A (TaeIF5A1 from Tamarix androssowii. The promoter of TaeIF5A1 with 1,486 bp in length was isolated, and the cis-elements in the promoter were identified. A WRKY (TaWRKY and RAV (TaRAV protein can specifically bind to a W-box motif in the promoter of TaeIF5A1 and activate the expression of TaeIF5A1. Furthermore, TaeIF5A1, TaWRKY and TaRAV share very similar expression pattern and are all stress-responsive gene that functions in the abscisic acid (ABA signaling pathway, indicating that they are components of a single regulatory pathway. Transgenic yeast and poplar expressing TaeIF5A1 showed elevated protein levels combined with improved abiotic stresses tolerance. Furthermore, TaeIF5A1-transformed plants exhibited enhanced superoxide dismutase (SOD and peroxidase (POD activities, lower electrolyte leakage and higher chlorophyll content under salt stress. Conclusions These results suggested that TaeIF5A1 is involved in abiotic stress tolerance, and is likely regulated by transcription factors TaWRKY and TaRAV both of which can bind to the W-box motif. In addition, TaeIF5A1 may mediate stress tolerance by increasing protein synthesis, enhancing ROS scavenging by improving SOD and POD activities, and preventing chlorophyll loss and membrane damage. Therefore, eIF5A may play an important role in plant adaptation to changing environmental conditions.
Wang, Liuqiang; Xu, Chenxi; Wang, Chao; Wang, Yucheng
2012-07-26
The eukaryotic translation initiation factor 5A (eIF5A) promotes formation of the first peptide bond at the onset of protein synthesis. However, the function of eIF5A in plants is not well understood. In this study, we characterized the function of eIF5A (TaeIF5A1) from Tamarix androssowii. The promoter of TaeIF5A1 with 1,486 bp in length was isolated, and the cis-elements in the promoter were identified. A WRKY (TaWRKY) and RAV (TaRAV) protein can specifically bind to a W-box motif in the promoter of TaeIF5A1 and activate the expression of TaeIF5A1. Furthermore, TaeIF5A1, TaWRKY and TaRAV share very similar expression pattern and are all stress-responsive gene that functions in the abscisic acid (ABA) signaling pathway, indicating that they are components of a single regulatory pathway. Transgenic yeast and poplar expressing TaeIF5A1 showed elevated protein levels combined with improved abiotic stresses tolerance. Furthermore, TaeIF5A1-transformed plants exhibited enhanced superoxide dismutase (SOD) and peroxidase (POD) activities, lower electrolyte leakage and higher chlorophyll content under salt stress. These results suggested that TaeIF5A1 is involved in abiotic stress tolerance, and is likely regulated by transcription factors TaWRKY and TaRAV both of which can bind to the W-box motif. In addition, TaeIF5A1 may mediate stress tolerance by increasing protein synthesis, enhancing ROS scavenging by improving SOD and POD activities, and preventing chlorophyll loss and membrane damage. Therefore, eIF5A may play an important role in plant adaptation to changing environmental conditions.
Prospere, Kurt; McLaren, Kurt P; Wilson, Byron
2016-10-01
The last remaining Amazonian-type swamp forest fragments in Black River Lower Morass, Jamaica, have been subjected to a myriad of anthropogenic disturbances, compounded by the establishment and spread of several invasive plant species. We established 44 permanent sample plots (covering 3.92 ha) across 10 of these swamp forest fragments and sampled all non-woody plants and all trees ≥2 cm DBH found in the plots. These data were used to (1) identify thresholds of hybridity and novelty, (2) derive several diversity and structural descriptors used to characterize the swamp forest fragments and (3) identify possible indicators of anthropogenic degradation. These were incorporated into a framework and used to determine the status of the swamp forest fragments so that appropriate management and conservation measures can be implemented. We recorded 43 woody plant species (9 endemic, 28 native and 4 non-native) and 21 non-tree species. The composition and structure of all the patches differed significantly due to the impact of the herbaceous invasive plant Alpinia allughas, the presence and diversity of other non-native plants, and differing intensities of anthropogenic disturbance (e.g., burning, cutting and harvesting of non-timber forest products). We ranked forest patches along a continuum representing deviations from a historical proxy (least disturbed) swamp forest to those with dramatically altered structural and floristic attributes (=novel swamp forests). Only one fragment overrun with A. allughas was classified as novel. If effective conservation and management does not come to the BRLM, the remaining swamp forest fragments appear doomed to further degradation and will soon disappear altogether.
Characterization of a pepper collection (Capsicum frutescens L.) from Brazil.
Lima, M F; Carvalho, S I C; Ragassi, C F; Bianchetti, L B; Faleiro, F G; Reifschneider, F J B
2017-08-31
Germplasm banks are essential as sources of genetic variability for plant breeding programs. To characterize a Brazilian Capsicum frutescens collection, 21 malagueta and 5 Tabasco hot pepper accessions were evaluated under field and greenhouse conditions regarding morphological and molecular traits, as well as resistance to viruses. Morphological characterization was performed using 53 IPGRI (International Plant Genetic Resources Institute) descriptors, 15 vegetative, 13 inflorescence, 22 fruit, and 3 seed. Molecular characterization was carried out with 60 polymorphic markers from 29 RAPD primers. The incidence of major viruses infecting Capsicum spp, Tomato spotted wilt virus (TSWV), Groundnut ringspot virus (GRSV), Potato virus Y (PVY), Pepper yellow mosaic virus (PepYMV), Pepper mild mottle virus (PMMoV), and Cucumber mosaic virus (CMV) was evaluated by ELISA. Based on the average genetic distance among genotypes, six groups were defined for the 53 IPGRI descriptors. When considering only 11 quantitative traits (five vegetative and six fruit), six groups were also determined, and the traits plant canopy width (56.05%) and days to fruiting (25.07%) most explained the genetic diversity among genotypes. Molecular analysis defined five groups of accessions with partial correspondence to the morphological characterization data. The incidence of viruses in field-grown plants varied among genotypes and according to virus species, from 5.6% (GRSV; CNPH 3286) to 100% (PMMoV; CNPH2871), and indicated some accessions as potential sources of virus resistance. These results demonstrate the genetic variability within the group of 26 hot pepper accessions, as well as virus-resistant genotypes that can be used in breeding programs.
Cicatelli, Angela; Guarino, Francesco; Baldan, Enrico; Castiglione, Stefano
2017-03-01
Copper and zinc are essential micronutrients in plants but, at high concentrations, they are toxic. Assisted phytoremediation is an emerging "green" technology that aims to improve the efficiency of tolerant species to remove metals from soils through the use of chelants or microorganisms. Rhizobacteria can promote plant growth and tolerance and also affect the mobility, bioavailability, and complexation of metals. A pot experiment was conducted to evaluate the phytoremediation effectiveness of sunflowers cultivated in a Cu- and Zn-spiked soil, in the presence or absence of bacterial consortium and/or chelants. The consortium was constituted of two Stenotrophomonas maltophilia strains and one of Agrobacterium sp. These strains were previously isolated from the rhizosphere of maize plants cultivated on a metal-polluted soil and here molecularly and biochemically characterized. Results showed that the consortium improved sunflower growth and biomass production on the spiked soils. Sunflowers accumulated large amounts of metals in their roots and leaves; however, neither the bacterial consortium nor the chelants, singularly added to pots, influenced significantly Cu and Zn plant uptake. Furthermore, the consecutive soil amendment with the EDTA and bacterial consortium determined a consistent accumulation of metals in sunflowers, and it might be an alternative strategy to limit the use of EDTA and its associated environmental risks in phytoremediation.
Wild vascular plants gathered for consumption in the Polish countryside: a review.
Łuczaj, Łukasz; Szymański, Wojciech M
2007-04-15
This paper is an ethnobotanical review of wild edible plants gathered for consumption from the end of the 18th century to the present day, within the present borders of Poland. 42 ethnographic and botanical sources documenting the culinary use of wild plants were analyzed. The use of 112 species (3.7% of the flora) has been recorded. Only half of them have been used since the 1960s. Three species: Cirsium rivulare, Euphorbia peplus and Scirpus sylvaticus have never before been reported as edible by ethnobotanical literature. The list of wild edible plants which are still commonly gathered includes only two green vegetables (Rumex acetosa leaves for soups and Oxalis acetosella as children's snack), 15 folk species of fruits and seeds (Crataegus spp., Corylus avellana, Fagus sylvatica, Fragaria vesca, Malus domestica, Prunus spinosa, Pyrus spp., Rosa canina, Rubus idaeus, Rubus sect. Rubus, Sambucus nigra, Vaccinium myrtillus, V. oxycoccos, V. uliginosum, V. vitis-idaea) and four taxa used for seasoning or as preservatives (Armoracia rusticana root and leaves, Carum carvi seeds, Juniperus communis pseudo-fruits and Quercus spp. leaves). The use of other species is either forgotten or very rare. In the past, several species were used for food in times of scarcity, most commonly Chenopodium album, Urtica dioica, U. urens, Elymus repens, Oxalis acetosella and Cirsium spp., but now the use of wild plants is mainly restricted to raw consumption or making juices, jams, wines and other preserves. The history of the gradual disappearance of the original barszcz, Heracleum sphondylium soup, from Polish cuisine has been researched in detail and two, previously unpublished, instances of its use in the 20th century have been found in the Carpathians. An increase in the culinary use of some wild plants due to media publications can be observed. Poland can be characterized as a country where the traditions of culinary use of wild plants became impoverished very early, compared to
Two mini-preparation protocols to DNA extraction from plants with ...
African Journals Online (AJOL)
Were standardized two previously reported standard plant DNA extraction methods, but improved them on mini preparations to use the samples for population genetic analysis. The combination of CTAB lysis procedure-solvent extraction and DNA column purification (DNeasy plant mini kit modification) enables a faster and ...
Tavares, Sílvia; Wirtz, Markus; Beier, Marcel P.; Bogs, Jochen; Hell, Rüdiger; Amâncio, Sara
2015-01-01
In higher plants cysteine biosynthesis is catalyzed by O-acetylserine(thiol)lyase (OASTL) and represents the last step of the assimilatory sulfate reduction pathway. It is mainly regulated by provision of O-acetylserine (OAS), the nitrogen/carbon containing backbone for fixation of reduced sulfur. OAS is synthesized by Serine acetyltransferase (SERAT), which reversibly interacts with OASTL in the cysteine synthase complex (CSC). In this study we identify and characterize the SERAT gene family of the crop plant Vitis vinifera. The identified four members of the VvSERAT protein family are assigned to three distinct groups upon their sequence similarities to Arabidopsis SERATs. Expression of fluorescently labeled VvSERAT proteins uncover that the sub-cellular localization of VvSERAT1;1 and VvSERAT3;1 is the cytosol and that VvSERAT2;1 and VvSERAT2;2 localize in addition in plastids and mitochondria, respectively. The purified VvSERATs of group 1 and 2 have higher enzymatic activity than VvSERAT3;1, which display a characteristic C-terminal extension also present in AtSERAT3;1. VvSERAT1;1 and VvSERAT2;2 are evidenced to form the CSC. CSC formation activates VvSERAT2;2, by releasing CSC-associated VvSERAT2;2 from cysteine inhibition. Thus, subcellular distribution of SERAT isoforms and CSC formation in cytosol and mitochondria is conserved between Arabidopsis and grapevine. Surprisingly, VvSERAT2;1 lack the canonical C-terminal tail of plant SERATs, does not form the CSC and is almost insensitive to cysteine inhibition (IC50 = 1.9 mM cysteine). Upon sulfate depletion VvSERAT2;1 is strongly induced at the transcriptional level, while transcription of other VvSERATs is almost unaffected in sulfate deprived grapevine cell suspension cultures. Application of abiotic stresses to soil grown grapevine plants revealed isoform-specific induction of VvSERAT2;1 in leaves upon drought, whereas high light- or temperature- stress hardly trigger VvSERAT2;1 transcription. PMID:25741355
Isolation and characterization of yuremamine, a new phytoindole.
Vepsäläinen, Jouko J; Auriola, Seppo; Tukiainen, Mikko; Ropponen, Nina; Callaway, J C
2005-11-01
Yuremamine was isolated and characterized from the stem bark of Mimosa tenuiflora. This plant is still used by indigenous peoples in North-eastern Brazil to make yurema, a psychoactive beverage that is used for medico-religious purpose ( jurema preta or vinho da jurema, in Portuguese). The characterization of this novel compound by NMR and mass spectrometry introduces a new class of phytoindoles.
Directory of Open Access Journals (Sweden)
J. M. Rey Benayas
2008-06-01
Full Text Available Living organisms respond both to current and previous environments, which can have important consequences on population dynamics. However, there is little experimental evidence based on long-term field studies of the effects of previous environments on the performance of individuals. We tested the hypothesis that trees that establish under different environmental conditions perform differently under similar post-establishment conditions. We used the slow-growing, evergreen Mediterranean oak Quercus ilex subsp. rotundifolia as target species. We analyzed the effects of previous environments, competition effects and tradeoffs among life-history traits (survival, growth, and reproduction. We enhanced seedling establishment for three years by reducing abiotic environmental harshness by means of summer irrigation and artificial shading in 12 experimental plots, while four plots remained as controls. Then these treatments were interrupted for ten years. Seedlings under ameliorated environmental conditions survived and grew faster during early establishment. During the post-management period, previous treatments 1 did not have any effect on survival, 2 experienced a slower above-ground growth, 3 decreased root biomass as indicated from reflectivity of Ground Penetration Radar, 4 increased acorn production mostly through a greater canopy volume and 5 increased acorn production effort. The trees exhibited a combination of effects related to acclimation for coping with abiotic stress and effects of intra-specific competition. In accordance with our hypothesis, tree performance overall depended on previous environmental conditions, and the response was different for different life-history traits. We recommend early management because it increased plot cover, shortened the time to attain sexual maturity and increased the amount of acorn production. Plots such as those assessed in this study may act as sources of propagules in deforested
Using heterologous expression systems to characterize potassium and sodium transport activities.
Rodríguez, Alonso; Benito, Begoña; Cagnac, Olivier
2012-01-01
The expression of plant transporters in simple well-characterized cell systems is an irreplaceable technique for gaining insights into the kinetic and energetic features of plant transporters. Among all the available expression systems, yeast cells offer the highest simplicity and have the capacity to mimic the in vivo properties of plant transporters. Here, we describe the use of yeast mutants to express K(+) and Na(+) plant transporters and discuss some experimental problems that can produce misleading results.
Strykstra, RJ; Bekker, RM; Van Andel, J
Dispersal and life span of individual plant species within five plant communities were assessed to obtain a characterization of these communities in this respect. Such a characterization is important in the context of restoration and maintenance. The most frequent species of five communities were
Isolation and characterization of engine oil degrading indigenous ...
African Journals Online (AJOL)
AJB SERVER
2007-01-04
Jan 4, 2007 ... School of Biochemistry, Genetics, Microbiology and Plant Pathology, University of .... growth patterns were obtained by measuring the optical density at ..... genotypic characterization of phenanthrene–degrading fluorescent.
Lectin binders. A new group of plant proteins
Energy Technology Data Exchange (ETDEWEB)
Rudiger, H; Gebauer, G; Gansera, R; Schurz, H; Schimpl, A [Wuerzburg Univ. (Germany, F.R.)
1982-09-01
Lectins are widely distributed in the plant kingdom, many of them being well characterized in their chemical structure and the effects they have on alien biological systems such as erythrocytes or lymphocytes. The biological function of plant lectins remains speculative. We therefore inspected plant extracts from components which might bind specifically to the lectin from the respective plant. Single proteins (lectin binders) could be isolated from each plant extract. The interaction of these proteins with lectins was demonstrated and qualified by several methods. Similar to the lectins, the lectin binders are localized in the cytoplasm in contrast to them, however, they persist during germination and plant growth. Their precise role in the plant is not known, but they are likely to be associated with lectins not only in vitro but also in vivo. They also interact with alien cells, and are able to stimulate mitosis in murine lymphocytes. Some lectin binders act specifically on B lymphocytes, leaving T cells uninfluenced.
Deciphering composition and function of the root microbiome of a legume plant
Hartman, Kyle; van der Heijden, Marcel G A|info:eu-repo/dai/nl/240923901; Roussely-Provent, Valexia; Walser, Jean-Claude; Schlaeppi, Klaus
2017-01-01
BACKGROUND: Diverse assemblages of microbes colonize plant roots and collectively function as a microbiome. Earlier work has characterized the root microbiomes of numerous plant species, but little information is available for legumes despite their key role in numerous ecosystems including
Functional Characterization of Sesquiterpene Synthase from Polygonum minus
Directory of Open Access Journals (Sweden)
Su-Fang Ee
2014-01-01
Full Text Available Polygonum minus is an aromatic plant, which contains high abundance of terpenoids, especially the sesquiterpenes C15H24. Sesquiterpenes were believed to contribute to the many useful biological properties in plants. This study aimed to functionally characterize a full length sesquiterpene synthase gene from P. minus. P. minus sesquiterpene synthase (PmSTS has a complete open reading frame (ORF of 1689 base pairs encoding a 562 amino acid protein. Similar to other sesquiterpene synthases, PmSTS has two large domains: the N-terminal domain and the C-terminal metal-binding domain. It also consists of three conserved motifs: the DDXXD, NSE/DTE, and RXR. A three-dimensional protein model for PmSTS built clearly distinguished the two main domains, where conserved motifs were highlighted. We also constructed a phylogenetic tree, which showed that PmSTS belongs to the angiosperm sesquiterpene synthase subfamily Tps-a. To examine the function of PmSTS, we expressed this gene in Arabidopsis thaliana. Two transgenic lines, designated as OE3 and OE7, were further characterized, both molecularly and functionally. The transgenic plants demonstrated smaller basal rosette leaves, shorter and fewer flowering stems, and fewer seeds compared to wild type plants. Gas chromatography-mass spectrometry analysis of the transgenic plants showed that PmSTS was responsible for the production of β-sesquiphellandrene.
Characterization qualitative of SOEL for a valorization best of the ...
African Journals Online (AJOL)
The physico-chemical characterization of biomass silverleaf nightshade has detected a wealth in organic carbon, which highlighted the potential value of this plant in the Co-composting with other biodegradable waste. In a second step, we assessed the possibility to develop this plant in the area of treatment in textile ...
Phytoliths as Emerging Taxonomic Tools for Identification of Plants: An Overview
Directory of Open Access Journals (Sweden)
Sheikh Abdul Shakoor
2014-01-01
Full Text Available In the recent advancements in identification of plant species, phytoliths have found an immense role in the identification of plants at different levels of taxonomic hierarchy. Many plant groups are known to accumulate silica in solid form in and between the cells and tissues and hence create the structures commonly known as phytoliths. These phytoliths create replicas of the structures where they are deposited. The shapes of phytolith replicas, their size dimensions (morphometric parameters, surface features (ornamentation, distribution, and orientation pattern in epidermal layers of vegetative and reproductive structures as well as their frequency are highly important for characterization of species. Monocotyledonous families particularly the family Poaceae (Gramineae are known to produce diverse phytolith types that can serve as diagnostic markers for characterization of different taxa at different levels of taxonomic hierarchy. The present paper highlights the importance of phytoliths in taxonomic analysis of plants particularly in the family Poaceae.
Directory of Open Access Journals (Sweden)
Renata Aparecida de Andrade
2009-10-01
Full Text Available Em certas espécies vegetais, a distinção entre variedades pode ser realizada com base em aspectos morfológicos das plantas, o que permite a identificação mesmo quando não apresentam flores e/ou frutos. Diante disso, realizou-se o presente trabalho cujo objetivo foi a caracterização morfológica e o agrupamento de plantas de rambutan. Foram avaliados: altura da planta (cm, diâmetro e geometria da copa (entre linhas e entre plantas,em cm, diâmetro do tronco (cm e disposição dos ramos no tronco, tamanho de folhas efolíolos (comprimento e largura, em cm, número de folíolos,comprimento da ráquis (cm,comprimento do pecíolo (cm, área foliar (cm2, vigor das plantas, sensibilidade ao frio,formato dos folíolos, pilosidade, coloração dos folíolos (faces superior e inferior, tipo de nervação e disposição dos folíolos na ráquis. Os dados foram submetidos à análise de agrupamento pelo método UPGMA, a partir da distância de Mahalanobis. Com base nos resultados obtidos, pode-se concluir que o uso de descritores morfológicos é eficiente nadeterminação de divergência genética entre os materiais de rambutan estudados, não sendo,porém, possível sua distinção visual, por não existir uma característica discriminatória satisfatória.In some vegetable species, the distinction between varieties can be made based on morphological aspects of the leaves, permitting the differentiation even when these ones do not display flowers and/or fruits. Consequently, the present research was conducted, aiming at the morphological characterization and grouping of rambutan plants. Were evaluated: plant height (cm, cup diameter and geometry (between lines and plants, in cm, trunk diameter (cm, leaves and leaflet size (length and width, in cm, leaflet number, stem length (cm,length of the petiolate (cm, left area (cm², plant vigor, cold sensibility, leaflet format,pilosity, coloration of the leaflet (inferior and superior sides, veining
Priming of antiherbivore defensive responses in plants
Institute of Scientific and Technical Information of China (English)
Jinwon Kim; Gary W.Felton
2013-01-01
Defense priming is defined as increased readiness of defense induction.A growing body of literature indicates that plants (or intact parts of a plant) are primed in anticipation of impending environmental stresses,both biotic and abiotic,and upon the following stimulus,induce defenses more quickly and strongly.For instance,some plants previously exposed to herbivore-inducible plant volatiles (HIPVs) from neighboring plants under herbivore attack show faster or stronger defense activation and enhanced insect resistance when challenged with secondary insect feeding.Research on priming of antiherbivore defense has been limited to the HIPV-mediated mechanism until recently,but significant advances were made in the past three years,including non-HIPV-mediated defense priming,epigenetic modifications as the molecular mechanism of priming,and others.It is timely to consider the advances in research on defense priming in the plantinsect interactions.
Janitza, Philipp; Ullrich, Kristian Karsten; Quint, Marcel
2012-01-01
The mitogen-activated protein kinase (MAPK) pathway is a three-tier signaling cascade that transmits cellular information from the plasma membrane to the cytoplasm where it triggers downstream responses. The MAPKs represent the last step in this cascade and are activated when both tyrosine and threonine residues in a conserved TxY motif are phosphorylated by MAPK kinases, which in turn are themselves activated by phosphorylation by MAPK kinase kinases. To understand the molecular evolution of MAPKs in the plant kingdom, we systematically conducted a Hidden-Markov-Model based screen to identify MAPKs in 13 completely sequenced plant genomes. In this analysis, we included green algae, bryophytes, lycophytes, and several mono- and eudicotyledonous species covering >800 million years of evolution. The phylogenetic relationships of the 204 identified MAPKs based on Bayesian inference facilitated the retraction of the sequence of emergence of the four major clades that are characterized by the presence of a TDY or TEY-A/TEY-B/TEY-C type kinase activation loop. We present evidence that after the split of TDY- and TEY-type MAPKs, initially the TEY-C clade emerged. This was followed by the TEY-B clade in early land plants until the TEY-A clade finally emerged in flowering plants. In addition to these well characterized clades, we identified another highly conserved clade of 45 MAPK-likes, members of which were previously described as Mak-homologous kinases. In agreement with their essential functions, molecular population genetic analysis of MAPK genes in Arabidopsis thaliana accessions reveal that purifying selection drove the evolution of the MAPK family, implying strong functional constraints on MAPK genes. Closely related MAPKs most likely subfunctionalized, a process in which differential transcriptional regulation of duplicates may be involved.
Directory of Open Access Journals (Sweden)
Philipp eJanitza
2012-12-01
Full Text Available The mitogen-activated protein kinase (MAPK pathway is a three-tier signaling cascade that transmits cellular information from the plasma membrane to the cytoplasm where it triggers downstream responses. The MAPKs represent the last step in this cascade and are activated when both tyrosine and threonine residues in a conserved TxY motif are phosphorylated by MAPK kinases, which in turn are themselves activated by phosphorylation by MAPK kinase kinases. To understand the molecular evolution of MAPKs in the plant kingdom, we systematically conducted a Hidden-Markov-Model based screen to identify MAPKs in 13 completely sequenced plant genomes. In this analysis, we included green algae, bryophytes, lycophytes, and several mono- and dicotyledonous species covering >800 million years of evolution. The phylogenetic relationships of the 204 identified MAPKs based on Bayesian inference facilitated the retraction of the sequence of emergence of the four major clades that are characterized by the presence of a TDY or TEY-A/TEY-B/TEY-C type kinase activation loop. We present evidence that after the split of TDY- and TEY-type MAPKs, initially the TEY-C clade emerged. This was followed by the TEY-B clade in early land plants until the TEY-A clade finally emerged in flowering plants. In addition to these well characterized clades, we identified another highly conserved clade of 45 MAPK-likes, members of which were previously described as MHKs. In agreement with their essential functions, molecular population genetic analysis of MAPK genes in Arabidopsis thaliana accessions reveal that purifying selection drove the evolution of the MAPK family, implying strong functional constraints on MAPK genes. Closely related MAPKs most likely subfunctionalized, a process in which differential transcriptional regulation of duplicates may be involved.
Characterization of calcium oxalate biominerals in some (non-Cactaceae) succulent plant species.
Monje, Paula V; Baran, Enrique J
2010-01-01
The water-accumulating leaves of crassulacean acid metabolism plants belonging to five different families were investigated for the presence of biominerals by infrared spectroscopic and microscopic analyses. Spectroscopic results revealed that the mineral present in succulent species of Agavaceae, Aizoaceae, and Asphodelaceae was calcium oxalate monohydrate (whewellite, CaC2O4 x H2O). Crystals were predominantly found as raphides or solitary crystals of various morphologies. However, representative Crassulaceae members and a succulent species of Asteraceae did not show the presence of biominerals. Overall, these results suggest no correlation between calcium oxalate generation and crassulacean acid metabolism in succulent plants.
Scognamiglio, Monica; Fiumano, Vittorio; D'Abrosca, Brigida; Esposito, Assunta; Choi, Young Hae; Verpoorte, Robert; Fiorentino, Antonio
2014-10-01
Allelopathy is the chemical mediated communication among plants. While on one hand there is growing interest in the field, on the other hand it is still debated as doubts exist at different levels. A number of compounds have been reported for their ability to influence plant growth, but the existence of this phenomenon in the field has rarely been demonstrated. Furthermore, only few studies have reported the uptake and the effects at molecular level of the allelochemicals. Allelopathy has been reported on some plants of Mediterranean vegetation and could contribute to structuring this ecosystem. Sixteen plants of Mediterranean vegetation have been selected and studied by an NMR-based metabolomics approach. The extracts of these donor plants have been characterized in terms of chemical composition and the effects on a selected receiving plant, Aegilops geniculata, have been studied both at the morphological and at the metabolic level. Most of the plant extracts employed in this study were found to have an activity, which could be correlated with the presence of flavonoids and hydroxycinnamate derivatives. These plant extracts affected the receiving plant in different ways, with different rates of growth inhibition at morphological level. The results of metabolomic analysis of treated plants suggested the induction of oxidative stress in all the receiving plants treated with active donor plant extracts, although differences were observed among the responses. Finally, the uptake and transport into receiving plant leaves of different metabolites present in the extracts added to the culture medium were observed. Copyright © 2014 Elsevier Ltd. All rights reserved.
DEFF Research Database (Denmark)
Montgomery, Melanie; Larsen, OH
2001-01-01
A program has been initiated in Denmark to investigate the aggressive environment in various waste incineration plants. The results described are the preliminary results from one waste incineration plant. Deposits and corrosion products have been removed from various locations in the boiler...
PWR plant construction in Japan
International Nuclear Information System (INIS)
Tamura, Toshifumi
2002-01-01
The construction methods based on the experiences on the Nuclear Island, which is a critical path in the total construction schedule, have been studied and reconsidered in order to construct by more reliable and economical method. So various improved construction method are being applied and the duration of construction is being reduced continuously. So various improved construction method are being applied and the duration of construction is being reduced continuously. In this paper, the history of construction of twenty-three (23) PWR Plant, the actual construction methods and schedule of Ohi-3/4, to which the many improved methods were applied during their construction, are introduced mainly with the improved points for previously constructed plants. And also the situation of construction method for the next PWR Plant is simply explained
Emerging use of gene expression microarrays in plant physiology.
Wullschleger, Stan D; Difazio, Stephen P
2003-01-01
Microarrays have become an important technology for the global analysis of gene expression in humans, animals, plants, and microbes. Implemented in the context of a well-designed experiment, cDNA and oligonucleotide arrays can provide highthroughput, simultaneous analysis of transcript abundance for hundreds, if not thousands, of genes. However, despite widespread acceptance, the use of microarrays as a tool to better understand processes of interest to the plant physiologist is still being explored. To help illustrate current uses of microarrays in the plant sciences, several case studies that we believe demonstrate the emerging application of gene expression arrays in plant physiology were selected from among the many posters and presentations at the 2003 Plant and Animal Genome XI Conference. Based on this survey, microarrays are being used to assess gene expression in plants exposed to the experimental manipulation of air temperature, soil water content and aluminium concentration in the root zone. Analysis often includes characterizing transcript profiles for multiple post-treatment sampling periods and categorizing genes with common patterns of response using hierarchical clustering techniques. In addition, microarrays are also providing insights into developmental changes in gene expression associated with fibre and root elongation in cotton and maize, respectively. Technical and analytical limitations of microarrays are discussed and projects attempting to advance areas of microarray design and data analysis are highlighted. Finally, although much work remains, we conclude that microarrays are a valuable tool for the plant physiologist interested in the characterization and identification of individual genes and gene families with potential application in the fields of agriculture, horticulture and forestry.
Origin and radiation of the earliest vascular land plants.
Steemans, Philippe; Hérissé, Alain Le; Melvin, John; Miller, Merrell A; Paris, Florentin; Verniers, Jacques; Wellman, Charles H
2009-04-17
Colonization of the land by plants most likely occurred in a stepwise fashion starting in the Mid-Ordovician. The earliest flora of bryophyte-like plants appears to have been cosmopolitan and dominated the planet, relatively unchanged, for some 30 million years. It is represented by fossilized dispersed cryptospores and fragmentary plant remains. In the Early Silurian, cryptospore abundance and diversity diminished abruptly as trilete spores appeared, became abundant, and underwent rapid diversification. This change coincides approximately with the appearance of vascular plant megafossils and probably represents the origin and adaptive radiation of vascular plants. We have obtained a diverse trilete spore occurrence from the Late Ordovician that suggests that vascular plants originated and diversified earlier than previously hypothesized, in Gondwana, before migrating elsewhere and secondarily diversifying.
Radioisotopes in plant mineral nutrition
International Nuclear Information System (INIS)
Singh, Bhupinder
2016-01-01
Extensive investigations on mineral composition of different plant species growing on various soils, helped in realizing that neither the presence nor the concentration of a mineral element in a plant can be regarded as a criterion for essentially. Plants have a limited capability for selective uptake of those mineral elements which are essential for their growth. They also take up mineral element which are not necessary for growth and may even be toxic. The mineral composition of plants growing in soils cannot, therefore, be used to establish essentially of a mineral element. Once this fact was appreciated, both water and sand culture experiments were carried out in which particular mineral elements were omitted. Von Sach and Knop are credited with reintroduction of the solution culture method using which they demonstrated the absolute requirement of ten macronutrients. As evident, these techniques made possible a more precise characterization of essentially of mineral elements and led to a better understanding of their role in plant metabolism. By the beginning of 20"t"h century importance of micronutrients like B, Mn, Cu, Mo and CI was also established
A Radiological Characterization of the KIWI-I Vehicle
International Nuclear Information System (INIS)
Riedhauser, S.R.
1999-01-01
A review was conducted of the previous Kiwi characterization to understand apparent differences in measured contamination levels observed during recent field work between Kiwi-reported activities and values from another system. The review assessed how the data were processed as well as the assumptions behind the measurement techniques employed. The review included a reassessment of how calculations of conversion factors were preformed. The review also checked for errors in the measurements or calculations of the data collected at these sites. In addition, new characterization measurements were made and new characterization techniques investigated for the Kiwi detector array. These measurements and techniques led to new calculations of conversion factions for the array, which are compared to the previous conversion factors. The new measurements confirmed that the Kiwi detectors are very reproducible in measuring the photopeak count rate from a surface distribution of activity (±3%). Finally, a review was conducted of the various parameters which describe the exponential distribution of activity with depth in the soil. New values have been assigned to the relaxation length and the averaging depth. When combined with the new characterization measurements, they produce a 75% increase over the previous conversion factor
Energy Technology Data Exchange (ETDEWEB)
Nashold, B.; Rosenblatt, D.; Hau, J. [and others
1995-08-01
This summary describes a Supplemental Site Inspection (SSI) conducted by Argonne National Laboratory (ANL) at Air Force Plant 59 (AFP 59) in Johnson City, New York. All required data pertaining to this project were entered by ANL into the Air Force-wide Installation Restoration Program Information System (IRPIMS) computer format and submitted to an appropriate authority. The work was sponsored by the United States Air Force as part of its Installation Restoration Program (IRP). Previous studies had revealed the presence of contaminants at the site and identified several potential contaminant sources. Argonne`s study was conducted to answer questions raised by earlier investigations. This volume consists of appendices F-Q, which contain the analytical data from the site characterization.
Development of a coppice planting machine to commercial standards
Energy Technology Data Exchange (ETDEWEB)
Turton, J.S.
2000-07-01
This report gives details of the development work carried out on the Turton Engineering Coppice Planting machine in order to commercially market it. The background to the machine which plants single rows of cuttings from rods is traced,, and previous development work, design work, production of sub-assemblies and the assembly of modules, inspection and assembly, static trials, and commercial planting are examined. Further machine developments, proving trials, and recommendations for further work are discussed. Appendices address relationships applicable to vertical planting, the Turton short rotation cultivation machine rod format, estimated prices and charges, and a list of main suppliers. (UK)