WorldWideScience

Sample records for mycobacterial hsp65 gene

  1. Ubiquitin-fusion degradation pathway: A new strategy for inducing CD8 cells specific for mycobacterial HSP65

    The ubiquitin-proteasome system (UPS) plays an indispensable role in inducing MHC class I-restricted CD8+ T cells. In this study, we exploited UPS to induce CD8+ T cells specific for mycobacterial HSP65 (mHSP65), one of the leading vaccine candidates against infection with Mycobacterium tuberculosis. A chimeric DNA termed pU-HSP65 encoding a fusion protein between murine ubiquitin and mHSP65 was constructed, and C57BL/6 (B6) mice were immunized with the DNA using gene gun bombardment. Mice immunized with the chimeric DNA acquired potent resistance against challenge with the syngeneic B16F1 melanoma cells transfected with the mHSP65 gene (HSP65/B16F1), compared with those immunized with DNA encoding only mHSP65. Splenocytes from the former group of mice showed a higher grade of cytotoxic activity against HSP65/B16F1 cells and contained a larger number of granzyme B- or IFN-γ-producing CD8+ T cells compared with those from the latter group of mice

  2. Matrix metalloproteinase proteolysis of the mycobacterial HSP65 protein as a potential source of immunogenic peptides in human tuberculosis.

    Shiryaev, Sergey A; Cieplak, Piotr; Aleshin, Alexander E; Sun, Qing; Zhu, Wenhong; Motamedchaboki, Khatereh; Sloutsky, Alexander; Strongin, Alex Y

    2011-09-01

    Mycobacterium tuberculosis is the causative agent of human tuberculosis (TB). Mycobacterial secretory protein ESAT-6 induces matrix metalloproteinase (MMP)-9 in epithelial cells neighboring infected macrophages. MMP-9 then enhances recruitment of uninfected macrophages, which contribute to nascent granuloma maturation and bacterial growth. Disruption of MMP-9 function attenuates granuloma formation and bacterial growth. The abundant mycobacterial 65 kDa heat shock protein (HSP65) chaperone is the major target for the immune response and a critical component in M. tuberculosis adhesion to macrophages. We hypothesized that HSP65 is susceptible to MMP-9 proteolysis and that the resulting HSP65 immunogenic peptides affect host adaptive immunity. To identify MMPs that cleave HSP65, we used MMP-2 and MMP-9 gelatinases, the simple hemopexin domain MMP-8, membrane-associated MMP-14, MMP-15, MMP-16 and MMP-24, and glycosylphosphatidylinositol-linked MMP-17 and MMP-25. We determined both the relative cleavage efficiency of MMPs against the HSP65 substrate and the peptide sequence of the cleavage sites. Cleavage of the unstructured PAGHG474L C-terminal region initiates the degradation of HSP65 by MMPs. This initial cleavage destroys the substrate-binding capacity of the HSP65 chaperone. Multiple additional cleavages of the unfolded HSP65 then follow. MMP-2, MMP-8, MMP-14, MMP-15 and MMP-16, in addition to MMP-9, generate the known highly immunogenic N-terminal peptide of HSP65. Based on our biochemical data, we now suspect that MMP proteolysis of HSP65 in vivo, including MMP-9 proteolysis, also results in the abundant generation of the N-terminal immunogenic peptide and that this peptide, in addition to intact HSP65, contributes to the complex immunomodulatory interplay in the course of TB infection. PMID:21752195

  3. Matrix metalloproteinase proteolysis of the mycobacterial HSP65 protein as a potential source of immunogenic peptides in human tuberculosis

    Sergey A Shiryaev; Cieplak, Piotr; Aleshin, Alexander E.; Sun, Qing; Zhu, Wenhong; Motamedchaboki, Khatereh; Sloutsky, Alexander; Strongin, Alex Y.

    2011-01-01

    Mycobacterium tuberculosis is the causative agent of human tuberculosis (TB). Mycobacterial secretory protein ESAT-6 induces MMP-9 in epithelial cells neighboring infected macrophages. MMP-9 then enhances recruitment of uninfected macrophages, which contribute to nascent granuloma maturation and bacterial growth. Disruption of MMP-9 function attenuates granuloma formation and bacterial growth. The abundant mycobacterial HSP65 chaperone is the major target for immune response and a critical co...

  4. Análise de restrição enzimática do gene hsp65 de isolados clínicos de pacientes com suspeita de tuberculose pulmonar em Teresina, Piauí Restriction enzyme analysis of the hsp65 gene in clinical isolates from patients suspected of having pulmonary tuberculosis in Teresina, Brazil

    Maria das Graças Motta e Bona

    2011-10-01

    Full Text Available OBJETIVO: Identificar as espécies de micobactérias encontradas no escarro de pacientes com suspeita de tuberculose pulmonar e analisar o impacto dessas identificações na abordagem terapêutica. MÉTODOS: Foram avaliados 106 pacientes com suspeita de tuberculose pulmonar encaminhados para o serviço de pneumologia de um hospital público em Teresina, Piauí. Espécimes de escarro matinal foram avaliados quanto à presença de micobactérias por baciloscopia e cultura. Foram utilizadas PCR e análise de restrição enzimática do gene hsp65 (PRA-hsp65 para a identificação das cepas de micobactérias isoladas em cultura. RESULTADOS: Foram analisadas 206 amostras de escarro. A idade dos pacientes variou de 15 a 87 anos, sendo 67% do gênero masculino. Tosse ocorreu em 100% dos casos. O padrão radiográfico predominante foi de lesão moderada, observada em 70%. A positividade no esfregaço foi de 76%, e isolamento em cultura ocorreu em 91% das culturas executadas. Testes tradicionais identificaram micobactérias não tuberculosas (MNT em 9% dos isolados. O método PRA-hsp65 confirmou esses dados, mostrando sete padrões de bandas capazes de identificar as espécies de MNT isoladas: Mycobacterium kansasii; M. abscessus 1; M. abscessus 2; M. smegmatis; M. flavescens 1; M. gordonae 5 e M. gordonae 7. Todos os pacientes com MNT tinham mais de 60 anos, e observaram-se bronquiectasias em 88% das radiografias. Houve dois casos de reinfecção, identificados inicialmente como infecção por M. abscessus e M. kansasii. CONCLUSÕES: As MNT causam infecção pulmonar em pacientes imunocompetentes, e a identificação das MNT é importante para estabelecer o diagnóstico correto e a decisão terapêutica mais adequada. O método PRA-hsp65 é útil para identificar espécies de MNT e pode ser implantado em laboratórios de biologia molecular não especializados em micobactérias.OBJECTIVE: To identify mycobacterial species in the sputum of patients

  5. Administration of Mycobacterium leprae rHsp65 aggravates experimental autoimmune uveitis in mice.

    Eliana B Marengo

    Full Text Available The 60 kDa heat shock protein family, Hsp60, constitutes an abundant and highly conserved class of molecules that are highly expressed in chronic-inflammatory and autoimmune processes. Experimental autoimmune uveitis [EAU] is a T cell mediated intraocular inflammatory disease that resembles human uveitis. Mycobacterial and homologous Hsp60 peptides induces uveitis in rats, however their participation in aggravating the disease is poorly known. We here evaluate the effects of the Mycobacterium leprae Hsp65 in the development/progression of EAU and the autoimmune response against the eye through the induction of the endogenous disequilibrium by enhancing the entropy of the immunobiological system with the addition of homologous Hsp. B10.RIII mice were immunized subcutaneously with interphotoreceptor retinoid-binding protein [IRBP], followed by intraperitoneally inoculation of M. leprae recombinant Hsp65 [rHsp65]. We evaluated the proliferative response, cytokine production and the percentage of CD4(+IL-17(+, CD4(+IFN-gamma(+ and CD4(+Foxp3(+ cells ex vivo, by flow cytometry. Disease severity was determined by eye histological examination and serum levels of anti-IRBP and anti-Hsp60/65 measured by ELISA. EAU scores increased in the Hsp65 group and were associated with an expansion of CD4(+IFN-gamma(+ and CD4(+IL-17(+ T cells, corroborating with higher levels of IFN-gamma. Our data indicate that rHsp65 is one of the managers with a significant impact over the immune response during autoimmunity, skewing it to a pathogenic state, promoting both Th1 and Th17 commitment. It seems comprehensible that the specificity and primary function of Hsp60 molecules can be considered as a potential pathogenic factor acting as a whistleblower announcing chronic-inflammatory diseases progression.

  6. Th1 polarized response induced by intramuscular DNA-HSP65 immunization is preserved in experimental atherosclerosis

    D.M. Fonseca

    2007-11-01

    Full Text Available We previously reported that a DNA vaccine constructed with the heat shock protein (HSP65 gene from Mycobacterium leprae (DNA-HSP65 was protective and also therapeutic in experimental tuberculosis. By the intramuscular route, this vaccine elicited a predominant Th1 response that was consistent with its protective efficacy against tuberculosis. It has been suggested that the immune response to Hsp60/65 may be the link between exposure to microorganisms and increased cardiovascular risk. Additionally, the high cholesterol levels found in atherosclerosis could modulate host immunity. In this context, we evaluated if an atherogenic diet could modulate the immune response induced by the DNA-HSP65 vaccine. C57BL/6 mice (4-6 animals per group were initially submitted to a protocol of atherosclerosis induction and then immunized by the intramuscular or intradermal route with 4 doses of 100 µg DNA-HSP65. On day 150 (15 days after the last immunization, the animals were sacrificed and antibodies and cytokines were determined. Vaccination by the intramuscular route induced high levels of anti-Hsp65 IgG2a antibodies, but not anti-Hsp65 IgG1 antibodies and a significant production of IL-6, IFN-g and IL-10, but not IL-5, indicating a Th1 profile. Immunization by the intradermal route triggered a mixed pattern (Th1/Th2 characterized by synthesis of anti-Hsp65 IgG2a and IgG1 antibodies and production of high levels of IL-5, IL-6, IL-10, and IFN-g. These results indicate that experimentally induced atherosclerosis did not affect the ability of DNA-HSP65 to induce a predominant Th1 response that is potentially protective against tuberculosis.

  7. Recurrent nontuberculous mycobacterial endophthalmitis: a diagnostic conundrum

    Venkateswaran N

    2014-05-01

    Full Text Available Nandini Venkateswaran,1 Gabrielle Yeaney,2 Mina Chung,3,4 Holly B Hindman3,41University of Rochester School of Medicine and Dentistry, University of Rochester, 2Department of Pathology and Laboratory Medicine, 3Flaum Eye Institute, 4Center for Visual Science, University of Rochester School of Medicine and Dentistry, Rochester, NY, USAObjective: To report a case of recurrent nontuberculous mycobacterial endophthalmitis in the context of neurotrophic keratopathy secondary to herpes zoster ophthalmicus that had an atypical presentation and complex course, and highlights the challenges of causative organism identification and therapeutic interventions in this condition.Methods: A retrospective chart review was conducted to determine the visual outcomes of the patient.Results: A 68-year-old pseudophakic male with long-standing neurotrophic keratopathy and perforated descemetocele managed with cyanoacrylate glue and a contact bandage lens in the left eye, began experiencing recurrent episodes of endophthalmitis after undergoing a penetrating keratoplasty. Several therapeutic procedures including an anterior chamber washout, two pars plana vitrectomies, explantation of the posterior chamber intraocular lens and capsular bag, and multiple intravitreal antimicrobial injections, were performed to which he has ultimately responded favorably, with no signs of infection to date and stable visual acuity. The causative organism of his recurrent infections was initially identified as Mycobacterium abscessus through biochemical testing and 16S ribosomal ribonucleic acid gene sequencing; however, repeat polymerase chain reaction (PCR and sequencing of the 65 kDa heat shock protein (hsp65 gene for experimental purposes confirmed the accurate identification of the organism to be Mycobacterium chelonae. Given the greater reliability of PCR and sequencing of the hsp65 gene over traditional biochemical tests and culture techniques, M. chelonae was likely the

  8. Antigen-presenting cells transfected with Hsp65 messenger RNA fail to treat experimental tuberculosis

    In the last several years, the use of dendritic cells has been studied as a therapeutic strategy against tumors. Dendritic cells can be pulsed with peptides or full-length protein, or they can be transfected with DNA or RNA. However, comparative studies suggest that transfecting dendritic cells with messenger RNA (mRNA) is superior to other antigen-loading techniques in generating immunocompetent dendritic cells. In the present study, we evaluated a new therapeutic strategy to fight tuberculosis using dendritic cells and macrophages transfected with Hsp65 mRNA. First, we demonstrated that antigen-presenting cells transfected with Hsp65 mRNA exhibit a higher level of expression of co-stimulatory molecules, suggesting that Hsp65 mRNA has immunostimulatory properties. We also demonstrated that spleen cells obtained from animals immunized with mock and Hsp65 mRNA-transfected dendritic cells were able to generate a mixed Th1/Th2 response with production not only of IFN-γ but also of IL-5 and IL-10. In contrast, cells recovered from mice immunized with Hsp65 mRNA-transfected macrophages were able to produce only IL-5. When mice were infected with Mycobacterium tuberculosis and treated with antigen-presenting cells transfected with Hsp65 mRNA (therapeutic immunization), we did not detect any decrease in the lung bacterial load or any preservation of the lung parenchyma, indicating the inability of transfected cells to confer curative effects against tuberculosis. In spite of the lack of therapeutic efficacy, this study reports for the first time the use of antigen-presenting cells transfected with mRNA in experimental tuberculosis

  9. Antigen-presenting cells transfected with Hsp65 messenger RNA fail to treat experimental tuberculosis

    Rocha, C.D.; Trombone, A.P.F.; Lorenzi, J.C.C.; Almeida, L.P.; Gembre, A.F.; Padilha, E. [Departamento de Bioquímica e Imunologia, Faculdade de Medicina de Ribeirão Preto, Universidade de São Paulo, Ribeirão Preto, SP (Brazil); Ramos, S.G. [Departamento de Patologia, Faculdade de Medicina de Ribeirão Preto, Universidade de São Paulo, Ribeirão Preto, SP (Brazil); Silva, C.L.; Coelho-Castelo, A.A.M. [Departamento de Bioquímica e Imunologia, Faculdade de Medicina de Ribeirão Preto, Universidade de São Paulo, Ribeirão Preto, SP (Brazil)

    2012-09-21

    In the last several years, the use of dendritic cells has been studied as a therapeutic strategy against tumors. Dendritic cells can be pulsed with peptides or full-length protein, or they can be transfected with DNA or RNA. However, comparative studies suggest that transfecting dendritic cells with messenger RNA (mRNA) is superior to other antigen-loading techniques in generating immunocompetent dendritic cells. In the present study, we evaluated a new therapeutic strategy to fight tuberculosis using dendritic cells and macrophages transfected with Hsp65 mRNA. First, we demonstrated that antigen-presenting cells transfected with Hsp65 mRNA exhibit a higher level of expression of co-stimulatory molecules, suggesting that Hsp65 mRNA has immunostimulatory properties. We also demonstrated that spleen cells obtained from animals immunized with mock and Hsp65 mRNA-transfected dendritic cells were able to generate a mixed Th1/Th2 response with production not only of IFN-γ but also of IL-5 and IL-10. In contrast, cells recovered from mice immunized with Hsp65 mRNA-transfected macrophages were able to produce only IL-5. When mice were infected with Mycobacterium tuberculosis and treated with antigen-presenting cells transfected with Hsp65 mRNA (therapeutic immunization), we did not detect any decrease in the lung bacterial load or any preservation of the lung parenchyma, indicating the inability of transfected cells to confer curative effects against tuberculosis. In spite of the lack of therapeutic efficacy, this study reports for the first time the use of antigen-presenting cells transfected with mRNA in experimental tuberculosis.

  10. Web-Accessible Database of hsp65 Sequences from Mycobacterium Reference Strains▿†

    Dai, Jianli; Chen, Yuansha; Lauzardo, Michael

    2011-01-01

    Mycobacteria include a large number of pathogens. Identification to species level is important for diagnoses and treatments. Here, we report the development of a Web-accessible database of the hsp65 locus sequences (http://msis.mycobacteria.info) from 149 out of 150 Mycobacterium species/subspecies. This database can serve as a reference for identifying Mycobacterium species.

  11. Administration of M. leprae Hsp65 interferes with the murine lupus progression.

    Eliana B Marengo

    Full Text Available The heat shock protein [Hsp] family guides several steps during protein synthesis, are abundant in prokaryotic and eukaryotic cells, and are highly conserved during evolution. The Hsp60 family is involved in assembly and transport of proteins, and is expressed at very high levels during autoimmunity or autoinflammatory phenomena. Here, the pathophysiological role of the wild type [WT] and the point mutated K(409A recombinant Hsp65 of M. leprae in an animal model of Systemic Lupus Erythematosus [SLE] was evaluated in vivo using the genetically homogeneous [NZBxNZW]F(1 mice. Anti-DNA and anti-Hsp65 antibodies responsiveness was individually measured during the animal's life span, and the mean survival time [MST] was determined. The treatment with WT abbreviates the MST in 46%, when compared to non-treated mice [p<0.001]. An increase in the IgG2a/IgG1 anti-DNA antibodies ratio was also observed in animals injected with the WT Hsp65. Incubation of BALB/c macrophages with F(1 serum from WT treated mice resulted in acute cell necrosis; treatment of these cells with serum from K(409A treated mice did not cause any toxic effect. Moreover, the involvement of WT correlates with age and is dose-dependent. Our data suggest that Hsp65 may be a central molecule intervening in the progression of the SLE, and that the point mutated K(409A recombinant immunogenic molecule, that counteracts the deleterious effect of WT, may act mitigating and delaying the development of SLE in treated mice. This study gives new insights into the general biological role of Hsp and the significant impact of environmental factors during the pathogenesis of this autoimmune process.

  12. Comparative Study on the Immunogenicity between Hsp70 DNA Vaccine and Hsp65 DNA Vaccine in Human Mycobacterium Tuberculosis

    DAI; Wuxing; HUANG; Hailang; YUAN; Ye; HU; Jiajie; HUANGFU; Yongmu

    2001-01-01

    The BALB/c mice were immunized with Hsp70 DNA and Hsp65 DNA vaccines in human Mycobacterium tuberculosis. Eight weeks after immunization, the eyeballs were removed, blood and spleen taken, and intraperitoneal macrophages were harvested. The lymphocytic stimulating index(SI) was used to measure the cellular proliferating ability and NO release to measure the phagocytic activity of the macrophages. With ELISA kit, the levels of interleukin-2 (IL-2) and interferon-γ(IFN-γ) in serum and the splenic lymphocytic cultured supernatant were detected. The results showed that after the mice were immunized with 100 μg/mouse of Hsp70 DNA vaccine intramuscularly, the splenic lymphocytic proliferating ability in the mice was significantly increased as compared with that in the control group, vector group and Hsp65 DNA vaccine group (P<0. 01); The contents of NO in the intraperitoneal macrophages of the mice were significantly lower than in the control group and Hsp65 DNA vaccine group (P<0. 01); The levels of serum IL-2 in the mice were significantly higher than in the control group, but there was no statistical difference between Hsp65 DNA group and vector group (P>0. 05); The contents of serum IFN-γ in the mice were significantly higher than in the control group, but significantly lower than in the Hsp65 DNA vaccine group (P<0. 05). It was indicated that immunization with Hsp70 DNA vaccine could obviously enhance the immune response, but its intensity seemed inferior to Hsp65 DNA vaccine. The anti-infection mechanisms and clinical use in the future of the vaccines of Hsp70 DNA and Hsp65 DNA are worth further studying.

  13. A potential target gene for the host-directed therapy of mycobacterial infection in murine macrophages.

    Bao, Zhang; Chen, Ran; Zhang, Pei; Lu, Shan; Chen, Xing; Yao, Yake; Jin, Xiaozheng; Sun, Yilan; Zhou, Jianying

    2016-09-01

    Mycobacterium tuberculosis (MTB), one of the major bacterial pathogens for lethal infectious diseases, is capable of surviving within the phagosomes of host alveolar macrophages; therefore, host genetic variations may alter the susceptibility to MTB. In this study, to identify host genes exploited by MTB during infection, genes were non-selectively inactivated using lentivirus-based antisense RNA methods in Raw264.7 macrophages, and the cells that survived virulent MTB infection were then screened. Following DNA sequencing of the surviving cell clones, 26 host genes affecting susceptibility to MTB were identified and their pathways were analyzed by bioinformatics analysis. In total, 9 of these genes were confirmed as positive regulators of collagen α-5(IV) chain (Col4a5) expression, a gene encoding a type IV collagen subunit present on the cell surface. The knockdown of Col4a5 consistently suppressed intracellular mycobacterial viability, promoting the survival of Raw264.7 macrophages following mycobacterial infection. Furthermore, Col4a5 deficiency lowered the pH levels of intracellular vesicles, including endosomes, lysosomes and phagosomes in the Raw264.7 cells. Finally, the knockdown of Col4a5 post-translationally increased microsomal vacuolar-type H+-ATPase activity in macrophages, leading to the acidification of intracellular vesicles. Our findings reveal a novel role for Col4a5 in the regulation of macrophage responses to mycobacterial infection and identify Col4a5 as a potential target for the host-directed anti-mycobacterial therapy. PMID:27432120

  14. Novel mutation in the interferon-gamma-receptor gene and susceptibility to mycobacterial infections

    Storgaard, M; Varming, K; Herlin, Troels;

    2006-01-01

    In 1981 we presented a patient with Mycobacterium intracellulare osteomyelitis and depressed monocyte cytotoxicity. It is now demonstrated that the molecular defect was a never-before-described nucleotide deletion at position 794 (794delT) in the interferon-gamma-receptor alpha-1 gene. The genetic...... defect was passed on to his daughter who was diagnosed with non-tuberculous mycobacterial osteomyelitis at the age of 7 years....

  15. Hsp65-producing Lactococcus lactis prevents experimental autoimmune encephalomyelitis in mice by inducing CD4+LAP+ regulatory T cells.

    Rezende, Rafael M; Oliveira, Rafael P; Medeiros, Samara R; Gomes-Santos, Ana C; Alves, Andrea C; Loli, Flávia G; Guimarães, Mauro A F; Amaral, Sylvia S; da Cunha, André P; Weiner, Howard L; Azevedo, Vasco; Miyoshi, Anderson; Faria, Ana M C

    2013-02-01

    Heat shock proteins (Hsps) participate in the cellular response to stress and they are hiperexpressed in inflammatory conditions. They are also known to play a major role in immune modulation, controlling, for instance, autoimmune responses. In this study, we showed that oral administration of a recombinant Lactococcus lactis strain that produces and releases LPS-free Hsp65 prevented the development of experimental autoimmune encephalomyelitis (EAE) in C57BL/6 mice. This was confirmed by the reduced inflammatory cell infiltrate and absence of injury signs in the spinal cord. The effect was associated with reduced IL-17 and increased IL-10 production in mesenteric lymph node and spleen cell cultures. Hsp65-producing-L. lactis-fed mice had a remarkable increase in the number of natural and inducible CD4+Foxp3+ regulatory T (Treg) cells and CD4+LAP+ (Latency-associated peptide) Tregs - which express the membrane-bound TGF-β - in spleen, inguinal and mesenteric lymph nodes as well as in spinal cord. Moreover, many Tregs co-expressed Foxp3 and LAP. In vivo depletion of LAP+ cells abrogated the effect of Hsp65-producing L. lactis in EAE prevention and worsened disease in medium-fed mice. Thus, Hsp65-L.lactis seems to boost this critical regulatory circuit involved in controlling EAE development in mice. PMID:22939403

  16. Non mycobacterial virulence genes in the genome of the emerging pathogen Mycobacterium abscessus.

    Fabienne Ripoll

    Full Text Available Mycobacterium abscessus is an emerging rapidly growing mycobacterium (RGM causing a pseudotuberculous lung disease to which patients with cystic fibrosis (CF are particularly susceptible. We report here its complete genome sequence. The genome of M. abscessus (CIP 104536T consists of a 5,067,172-bp circular chromosome including 4920 predicted coding sequences (CDS, an 81-kb full-length prophage and 5 IS elements, and a 23-kb mercury resistance plasmid almost identical to pMM23 from Mycobacterium marinum. The chromosome encodes many virulence proteins and virulence protein families absent or present in only small numbers in the model RGM species Mycobacterium smegmatis. Many of these proteins are encoded by genes belonging to a "mycobacterial" gene pool (e.g. PE and PPE proteins, MCE and YrbE proteins, lipoprotein LpqH precursors. However, many others (e.g. phospholipase C, MgtC, MsrA, ABC Fe(3+ transporter appear to have been horizontally acquired from distantly related environmental bacteria with a high G+C content, mostly actinobacteria (e.g. Rhodococcus sp., Streptomyces sp. and pseudomonads. We also identified several metabolic regions acquired from actinobacteria and pseudomonads (relating to phenazine biosynthesis, homogentisate catabolism, phenylacetic acid degradation, DNA degradation not present in the M. smegmatis genome. Many of the "non mycobacterial" factors detected in M. abscessus are also present in two of the pathogens most frequently isolated from CF patients, Pseudomonas aeruginosa and Burkholderia cepacia. This study elucidates the genetic basis of the unique pathogenicity of M. abscessus among RGM, and raises the question of similar mechanisms of pathogenicity shared by unrelated organisms in CF patients.

  17. Gene Expression and Cytokine Profile Correlate With Mycobacterial Growth in a Human BCG Challenge Model

    Matsumiya, Magali; Satti, Iman; Chomka, Agnieszka; Harris, Stephanie A.; Stockdale, Lisa; Meyer, Joel; Helen A. Fletcher; McShane, Helen

    2014-01-01

    Background.  Bacillus Calmette-Guerin (BCG) vaccine is the most widely administered vaccine in the world, yet its mechanism of action remains unclear. We hypothesize that certain immune pathways are associated with reduced mycobacterial growth following BCG challenge in human volunteers. Methods.  We used samples from a mycobacterial challenge in which previously BCG-vaccinated or BCG-naive adults in the United Kingdom were challenged intradermally with a standard dose of BCG. Any remaining B...

  18. Zebrafish embryo screen for mycobacterial genes involved in the initiation of granuloma formation reveals a newly identified ESX-1 component

    Esther J. M. Stoop

    2011-07-01

    The hallmark of tuberculosis (TB is the formation of granulomas, which are clusters of infected macrophages surrounded by additional macrophages, neutrophils and lymphocytes. Although it has long been thought that granulomas are beneficial for the host, there is evidence that mycobacteria also promote the formation of these structures. In this study, we aimed to identify new mycobacterial factors involved in the initial stages of granuloma formation. We exploited the zebrafish embryo Mycobacterium marinum infection model to study initiation of granuloma formation and developed an in vivo screen to select for random M. marinum mutants that were unable to induce granuloma formation efficiently. Upon screening 200 mutants, three mutants repeatedly initiated reduced granuloma formation. One of the mutants was found to be defective in the espL gene, which is located in the ESX-1 cluster. The ESX-1 cluster is disrupted in the Mycobacterium bovis BCG vaccine strain and encodes a specialized secretion system known to be important for granuloma formation and virulence. Although espL has not been implicated in protein secretion before, we observed a strong effect on the secretion of the ESX-1 substrates ESAT-6 and EspE. We conclude that our zebrafish embryo M. marinum screen is a useful tool to identify mycobacterial genes involved in the initial stages of granuloma formation and that we have identified a new component of the ESX-1 secretion system. We are confident that our approach will contribute to the knowledge of mycobacterial virulence and could be helpful for the development of new TB vaccines.

  19. Dimerization of an Immunoactivating Peptide Derived from Mycobacterial hsp65 Using N-Hydroxysuccinimide Based Bifunctional Reagents Is Critical for Its Antitumor Properties

    Bezouška, Karel; Kubínková, Z.; Stříbrný, J.; Volfová, B.; Pompach, Petr; Kuzma, Marek; Šírová, Milada; Říhová, Blanka

    2012-01-01

    Roč. 23, č. 10 (2012), s. 2032-2041. ISSN 1043-1802 R&D Projects: GA MŠk 1M0505; GA ČR GA303/09/0477; GA ČR GD305/09/H008 Institutional research plan: CEZ:AV0Z50200510 Keywords : HUMAN EOSINOPHILS * KILLER-CELLS * CD69 Subject RIV: CE - Biochemistry Impact factor: 4.580, year: 2012

  20. Insights into horizontal acquisition patterns of dormancy and reactivation regulon genes in mycobacterial species using a partitioning-based framework

    VARUN MEHRA; TARINI SHANKAR GHOSH; SHARMILA S MANDE

    2016-09-01

    Horizontal Gene Transfer (HGT) events, initially thought to be rare in Mycobacterium tuberculosis, have recentlybeen shown to be involved in the acquisition of virulence operons in M. tuberculosis. We have developed a newpartitioning framework based HGT prediction algorithm, called Grid3M, and applied the same for the prediction ofHGTs in Mycobacteria. Validation and testing using simulated and real microbial genomes indicated better performanceof Grid3M as compared with other widely used HGT prediction methods. Specific analysis of the genesbelonging to dormancy/reactivation regulons across 14 mycobacterial genomes indicated that horizontal acquisition isspecifically restricted to important accessory proteins. The results also revealed Burkholderia species to be a probablesource of HGT genes belonging to these regulons. The current study provides a basis for similar analyses investigatingthe functional/evolutionary aspects of HGT genes in other pathogens. A database of Grid3M predicted HGTs incompletely sequenced genomes is available at https://metagenomics.atc.tcs.com/Grid3M/.

  1. Insights into horizontal acquisition patterns of dormancy and reactivation regulon genes in mycobacterial species using a partitioning-based framework.

    Mehra, Varun; Ghosh, Tarini Shankar; Mande, Sharmila S

    2016-09-01

    Horizontal Gene Transfer (HGT) events, initially thought to be rare in Mycobacterium tuberculosis, have recently been shown to be involved in the acquisition of virulence operons in M. tuberculosis. We have developed a new partitioning framework based HGT prediction algorithm, called Grid3M, and applied the same for the prediction of HGTs in Mycobacteria. Validation and testing using simulated and real microbial genomes indicated better performance of Grid3M as compared with other widely used HGT prediction methods. Specific analysis of the genes belonging to dormancy/reactivation regulons across 14 mycobacterial genomes indicated that horizontal acquisition is specifically restricted to important accessory proteins. The results also revealed Burkholderia species to be a probable source of HGT genes belonging to these regulons. The current study provides a basis for similar analyses investigating the functional/evolutionary aspects of HGT genes in other pathogens. A database of Grid3M predicted HGTs in completely sequenced genomes is available at https://metagenomics.atc.tcs.com/Grid3M/. PMID:27581938

  2. Molecular Characterization of Heterologous HIV-1gp120 Gene Expression Disruption in Mycobacterium bovis BCG Host Strain: A Critical Issue for Engineering Mycobacterial Based-Vaccine Vectors

    Joan Joseph

    2010-01-01

    Full Text Available Mycobacterium bovis Bacillus Calmette-Guérin (BCG as a live vector of recombinant bacterial vaccine is a promising system to be used. In this study, we evaluate the disrupted expression of heterologous HIV-1gp120 gene in BCG Pasteur host strain using replicative vectors pMV261 and pJH222. pJH222 carries a lysine complementing gene in BCG lysine auxotrophs. The HIV-1 gp120 gene expression was regulated by BCG hsp60 promoter (in plasmid pMV261 and Mycobacteria spp. α-antigen promoter (in plasmid pJH222. Among 14 rBCG:HIV-1gp120 (pMV261 colonies screened, 12 showed a partial deletion and two showed a complete deletion. However, deletion was not observed in all 10 rBCG:HIV-1gp120 (pJH222 colonies screened. In this study, we demonstrated that E. coli/Mycobacterial expression vectors bearing a weak promoter and lysine complementing gene in a recombinant lysine auxotroph of BCG could prevent genetic rearrangements and disruption of HIV 1gp120 gene expression, a key issue for engineering Mycobacterial based vaccine vectors.

  3. The mycobacterial LysR-type regulator OxyS responds to oxidative stress and negatively regulates expression of the catalase-peroxidase gene.

    Yuqing Li

    Full Text Available Protection against oxidative stress is one of the primary defense mechanisms contributing to the survival of Mycobacterium tuberculosis in the host. In this study, we provide evidence that OxyS, a LysR-type transcriptional regulator functions as an oxidative stress response regulator in mycobacteria. Overexpression of OxyS lowers expression of the catalase-peroxidase (KatG gene in M. smegmatis. OxyS binds directly with the katG promoter region and a conserved, GC-rich T-N(11-A motif for OxyS binding was successfully characterized in the core binding site. Interestingly, the DNA-binding activity of OxyS was inhibited by H(2O(2, but not by dithiothreitol. Cys25, which is situated at the DNA-binding domain of OxyS, was found to have a regulatory role for the DNA-binding ability of OxyS in response to oxidative stress. In contrast, the other three cysteine residues in OxyS do not appear to have this function. Furthermore, the mycobacterial strain over-expressing OxyS had a higher sensitivity to H(2O(2. Thus, OxyS responds to oxidative stress through a unique cysteine residue situated in its DNA-binding domain and negatively regulates expression of the katG gene. These findings uncover a specific regulatory mechanism for mycobacterial adaptation to oxidative stress.

  4. Monstrous Mycobacterial Lipids.

    Seeliger, Jessica; Moody, D Branch

    2016-02-18

    When it comes to lipid diversity, no bacterial genus approaches Mycobacterium. In this issue of Cell Chemical Biology, Burbaud et al. (2016) provide a multi-genic working model for the biosynthesis of trehalose polyphleate (TPP), one of the largest known lipids in mycobacteria. They demonstrate that this lipid is made by diverse mycobacterial species, including those of medical importance. PMID:26971870

  5. Novel Selection for Isoniazid (INH) Resistance Genes Supports a Role for NAD+-Binding Proteins in Mycobacterial INH Resistance

    CHEN, PING; Bishai, William R.

    1998-01-01

    The genetic basis of isoniazid (INH) resistance remains unknown for a significant proportion of clinical isolates. To identify genes which might confer resistance by detoxifying or sequestering INH, we transformed the Escherichia coli oxyR mutant, which is relatively sensitive to INH, with a Mycobacterium tuberculosis plasmid library and selected for INH-resistant clones. Three genes were identified and called ceo for their ability to complement the Escherichia coli oxyR mutant. ceoA was the ...

  6. [Biologics and mycobacterial diseases].

    Tsuyuguchi, Kazunari; Matsumoto, Tomoshige

    2013-03-01

    Various biologics such as TNF-alpha inhibitor or IL-6 inhibitor are now widely used for treatment of rheumatoid arthritis. Many reports suggested that one of the major issues is high risk of developing tuberculosis (TB) associated with using these agents, which is especially important in Japan where tuberculosis still remains endemic. Another concern is the risk of development of nontuberculous mycobacterial (NTM) diseases and we have only scanty information about it. The purpose of this symposium is to elucidate the role of biologics in the development of mycobacterial diseases and to establish the strategy to control them. First, Dr. Tohma showed the epidemiologic data of TB risks associated with using biologics calculated from the clinical database on National Database of Rheumatic Diseases by iR-net in Japan. He estimated TB risks in rheumatoid arthritis (RA) patients to be about four times higher compared with general populations and to become even higher by using biologics. He also pointed out a low rate of implementation of QuantiFERON test (QFT) as screening test for TB infection. Next, Dr. Tokuda discussed the issue of NTM disease associated with using biologics. He suggested the airway disease in RA patients might play some role in the development of NTM disease, which may conversely lead to overdiagnosis of NTM disease in RA patients. He suggested that NTM disease should not be uniformly considered a contraindication to treatment with biologics, considering from the results of recent multicenter study showing relatively favorable outcome of NTM patients receiving biologics. Patients with latent tuberculosis infection (LTBI) should receive LTBI treatment before starting biologics. Dr. Kato, a chairperson of the Prevention Committee of the Japanese Society for Tuberculosis, proposed a new LTBI guideline including active implementation of LTBI treatment, introducing interferon gamma release assay, and appropriate selection of persons at high risk for

  7. Mycobacterial species as case-study of comparative genome analysis

    Zakham, F.; Belayachi, L.; Ussery, David; Akrim, M.; Benjouad, A.; El Aouad, R.; Ennaji, M. M.

    2011-01-01

    evolutionary events of these species and improving drugs, vaccines, and diagnostics tools for controlling Mycobacterial diseases. In this present study we aim to outline a comparative genome analysis of fourteen Mycobacterial genomes: M. avium subsp. paratuberculosis K—10, M. bovis AF2122/97, M. bovis BCG str...... genomes, GC content, number of genes in different data bases (Genbank, Refseq, and Prodigal). The BLAST matrix of these genomes has been figured to give a lot of information about the similarity between species in a simple scheme. As a result of multiple genome analysis, the pan and core genome have been...

  8. Murine T-lymphocyte activation by mycobacterial antigens

    There has been renewed interest in the diagnosis of tuberculosis and other mycobacterial infections in the United States. Effective immunity to mycobacterial infections, as well as diagnosis by the skin test, involves T-cells rather than antibodies. Studies currently underway use the new technologies of monoclonal antibodies and recombinant DNA to define better mycobacterial antigens for T-cell activation, in the hope of identifying species specific antigens. Lymph node cells from mice sensitized to Mycobacterium intracellulare and Mycobacterium avium were assayed for activation by mycobacterial fractions, and cell lines and clones were generated. Comparing BALB/c and B10 mice indicated better responses to M. avium sonicate by B10 mice. A recombinant gene product containing a M. intracellulare peptide was assayed with lymph node cells and indicated excellent T-cell stimulation in BALB/c lymph node cells and cell lines. However, assays using B10 T-cell clones have yet to detect responders to the recombinant protein. Future studies using synthetic epitopes produced by recombinant DNA techniques and defined by monoclonal antibodies are necessary for the identification of reactive T-cell epitopes that are potentially species specific. 4 refs, 7 figs, 1 tab

  9. Mycobacterial mutants with defective control of phagosomal acidification.

    2005-11-01

    Full Text Available The pathogenesis of mycobacterial infection is associated with an ability to interfere with maturation of the phagosomal compartment after ingestion by macrophages. Identification of the mycobacterial components that contribute to this phenomenon will allow rational design of novel approaches to the treatment and prevention of tuberculosis. Microarray-based screening of a transposon library was used to identify mutations that influence the fate of Mycobacterium bovis bacille Calmette-Guérin (BCG following uptake by macrophages. A screen based on bacterial survival during a 3-d infection highlighted genes previously implicated in growth of Mycobacterium tuberculosis in macrophages and in mice, together with a number of other virulence genes including a locus encoding virulence-associated membrane proteins and a series of transporter molecules. A second screen based on separation of acidified and non-acidified phagosomes by flow cytometry identified genes involved in mycobacterial control of early acidification. This included the KefB potassium/proton antiport. Mutants unable to control early acidification were significantly attenuated for growth during 6-d infections of macrophages. Early acidification of the phagosome is associated with reduced survival of BCG in macrophages. A strong correlation exists between genes required for intracellular survival of BCG and those required for growth of M. tuberculosis in mice. In contrast, very little correlation exists between genes required for intracellular survival of BCG and those that are up-regulated during intracellular adaptation of M. tuberculosis. This study has identified targets for interventions to promote immune clearance of tuberculosis infection. The screening technologies demonstrated in this study will be useful to the study of pathogenesis in many other intracellular microorganisms.

  10. Characterization of the Mycobacterial NER System Reveals Novel Functions of the uvrD1 Helicase

    Guthlein, C.; Wanner, R M; Sander, P; Davis, E O; Bosshard, M.; Jiricny, J; Bottger, E. C.; Springer, B.

    2008-01-01

    In this study, we investigated the role of the nucleotide excision repair (NER) pathway in mycobacterial DNA repair. Mycobacterium smegmatis lacking the NER excinuclease component uvrB or the helicase uvrD1 gene and a double knockout lacking both genes were constructed, and their sensitivities to a series of DNA-damaging agents were analyzed. As anticipated, the mycobacterial NER system was shown to be involved in the processing of bulky DNA adducts and interstrand cross-links. In addition, i...

  11. [Hydrocarbon-Oxidizing potential and the genes for n-alkane biodegradation in a new acidophilic mycobacterial association from sulfur blocks].

    Ivanova, I E; Sukhacheva, M V; Kanat'eva, A Yu; Kravchenko, I K; Kurganov, A A

    2014-01-01

    Capacity of AG(S10), a new aerobic acidophilic (growing within the pH range from 1.3 to 4.5 with the optimum at 2.0-2.5) bacterial association from sulfur blocks of the Astrakhan gas-processing complex (AGC), for oxidation of hydrocarbons of various chemical structure was investigated. A broad spectrum of normal (C10-C21) and iso-alkanes, toluene, naphthalene, andphenanthrene, as well as isoprenoids resistant to microbial degradation, pristane and phytane (components of paraffin oil), and 2,2,4,4,6,8,8,-heptamethylnonane, a branched hydrocarbon, were biodegraded under acidic conditions. Microbiological investigation revealed the dominance of mycobacteria in the AGS10 association, which was confirmed by analysis of the 16S rRNA gene clone library. In the phylogenetic tree, the 16S rRNA sequences formed a branch within the cluster of slow-growing mycobacteria, with 98% homology to the closest species Mycobacterium florentinum. Genomic DNA of AG(S10) culture grown on C14-C17 n-alkanes at pH 2.5 was found to contain the genes of two hydroxylase families, alkB and Cyp 153, indicating their combined involvement in hydrocarbon biodegradation. The high hydrocarbon-oxidizing potential of the AGS10 bacterial association, indicated that further search for the genes responsible for degradation of various hydrocarbons in acidophilic mycobacteria could be promising. PMID:25941716

  12. The Mycobacterial LysR-Type Regulator OxyS Responds to Oxidative Stress and Negatively Regulates Expression of the Catalase-Peroxidase Gene

    Li, Yuqing; He, Zheng-Guo

    2012-01-01

    Protection against oxidative stress is one of the primary defense mechanisms contributing to the survival of Mycobacterium tuberculosis in the host. In this study, we provide evidence that OxyS, a LysR-type transcriptional regulator functions as an oxidative stress response regulator in mycobacteria. Overexpression of OxyS lowers expression of the catalase-peroxidase (KatG) gene in M. smegmatis. OxyS binds directly with the katG promoter region and a conserved, GC-rich T-N11-A motif for OxyS ...

  13. Mycobacterial species as case-study of comparative genome analysis.

    Zakham, F; Belayachi, L; Ussery, D; Akrim, M; Benjouad, A; El Aouad, R; Ennaji, M M

    2011-01-01

    The genus Mycobacterium represents more than 120 species including important pathogens of human and cause major public health problems and illnesses. Further, with more than 100 genome sequences from this genus, comparative genome analysis can provide new insights for better understanding the evolutionary events of these species and improving drugs, vaccines, and diagnostics tools for controlling Mycobacterial diseases. In this present study we aim to outline a comparative genome analysis of fourteen Mycobacterial genomes: M. avium subsp. paratuberculosis K—10, M. bovis AF2122/97, M. bovis BCG str. Pasteur 1173P2, M. leprae Br4923, M. marinum M, M. sp. KMS, M. sp. MCS, M. tuberculosis CDC1551, M. tuberculosis F11, M. tuberculosis H37Ra, M. tuberculosis H37Rv, M. tuberculosis KZN 1435 , M. ulcerans Agy99,and M. vanbaalenii PYR—1, For this purpose a comparison has been done based on their length of genomes, GC content, number of genes in different data bases (Genbank, Refseq, and Prodigal). The BLAST matrix of these genomes has been figured to give a lot of information about the similarity between species in a simple scheme. As a result of multiple genome analysis, the pan and core genome have been defined for twelve Mycobacterial species. We have also introduced the genome atlas of the reference strain M. tuberculosis H37Rv which can give a good overview of this genome. And for examining the phylogenetic relationships among these bacteria, a phylogenic tree has been constructed from 16S rRNA gene for tuberculosis and non tuberculosis Mycobacteria to understand the evolutionary events of these species. PMID:21396338

  14. Nontuberculous mycobacterial ocular infections--comparing the clinical and microbiological characteristics between Mycobacterium abscessus and Mycobacterium massiliense.

    Hsiao-Sang Chu

    Full Text Available To analyze the clinical characteristics of nontuberculous mycobacterial (NTM ocular infections and the species-specific in vitro antimicrobial susceptibility.In 2000 to 2011 at the National Taiwan University Hospital, multilocus sequencing of rpoB, hsp65 and secA was used to identify NTM isolates from ocular infections. The clinical presentation and treatment outcomes were retrospectively compared between species. Broth microdilution method was used to determine the minimum inhibitory concentrations of amikacin (AMK, clarithromycin (CLA, ciprofloxacin (CPF, levofloxacin (LVF, moxifloxacin (MXF and gatifloxacin (GAF against all strains. The activities of antimicrobial combinations were assessed by the checkerboard titration method.A total of 24 NTM strains (13 Mycobacterium abscessus and 11 Mycobacterium massiliense were isolated from 13 keratitis, 10 buckle infections, and 1 canaliculitis cases. Clinically, manifestations and outcomes caused by these two species were similar and surgical intervention was necessary for medically unresponsive NTM infection. Microbiologically, 100% of M. abscessus and 90.9% of M. massiliense ocular isolates were susceptible to amikacin but all were resistant to fluoroquinolones. Inducible clarithromycin resistance existed in 69.3% of M. abscessus but not in M. massiliense isolates. None of the AMK-CLA, AMK-MXF, AMK-GAF, CLA-MXF and CLA-GAF combinations showed synergistic or antagonistic effect against both species in vitro.M. abscessus and M. massiliense are the most commonly identified species for NTM ocular infections in Taiwan. Both species were resistant to fluoroquinolones, susceptible to amikacin, and differ in clarithromycin resistance. Combined antimicrobial treatments showed no interaction in vitro but could be considered in combination with surgical interventions for eradication of this devastating ocular infection.

  15. Simple sequence repeats in mycobacterial genomes

    Vattipally B Sreenu; Pankaj Kumar; Javaregowda Nagaraju; Hampapathalu A Nagarajaram

    2007-01-01

    Simple sequence repeats (SSRs) or microsatellites are the repetitive nucleotide sequences of motifs of length 1–6 bp. They are scattered throughout the genomes of all the known organisms ranging from viruses to eukaryotes. Microsatellites undergo mutations in the form of insertions and deletions (INDELS) of their repeat units with some bias towards insertions that lead to microsatellite tract expansion. Although prokaryotic genomes derive some plasticity due to microsatellite mutations they have in-built mechanisms to arrest undue expansions of microsatellites and one such mechanism is constituted by post-replicative DNA repair enzymes MutL, MutH and MutS. The mycobacterial genomes lack these enzymes and as a null hypothesis one could expect these genomes to harbour many long tracts. It is therefore interesting to analyse the mycobacterial genomes for distribution and abundance of microsatellites tracts and to look for potentially polymorphic microsatellites. Available mycobacterial genomes, Mycobacterium avium, M. leprae, M. bovis and the two strains of M. tuberculosis (CDC1551 and H37Rv) were analysed for frequencies and abundance of SSRs. Our analysis revealed that the SSRs are distributed throughout the mycobacterial genomes at an average of 220–230 SSR tracts per kb. All the mycobacterial genomes contain few regions that are conspicuously denser or poorer in microsatellites compared to their expected genome averages. The genomes distinctly show scarcity of long microsatellites despite the absence of a post-replicative DNA repair system. Such severe scarcity of long microsatellites could arise as a result of strong selection pressures operating against long and unstable sequences although influence of GC-content and role of point mutations in arresting microsatellite expansions can not be ruled out. Nonetheless, the long tracts occasionally found in coding as well as non-coding regions may account for limited genome plasticity in these genomes.

  16. Mycobacterial infections in solid organ transplant recipients.

    Meije, Y; Piersimoni, C; Torre-Cisneros, J; Dilektasli, A G; Aguado, J M

    2014-09-01

    Mycobacterial infections represent a growing challenge for solid organ transplant recipients (SOT). The adverse effects of tuberculosis (TB) therapy present a major difficulty, due to the interactions with immunosuppressive drugs and direct drug toxicity. While TB may be donor-transmitted or community-acquired, it usually develops at a latent infection site in the recipient. Pre-transplant prevention efforts will improve transplant outcomes and avoid the complications associated with post-transplant diagnosis and treatment. The present review and consensus manuscript is based on the updated published information and expert recommendations. The current data about epidemiology, diagnosis, new regimens for the treatment of latent TB infection (LTBI), the experience with rifamycins for the treatment of active TB in the post-transplant period and the experience with isoniazid for LTBI in the liver transplant population, are also reviewed. We attempt to provide useful recommendations for each transplant period and problem concerning mycobacterial infections in SOT recipients. PMID:24707957

  17. Computed Tomographic Findings in Cats with Mycobacterial Infection

    Major, Alison; Holmes, Andrea; Warren-Smith, Christopher; Lalor, Stephanie; Littler, Rebecca; Schwarz, Tobias; Gunn-Moore, Danielle

    2016-01-01

    Objectives: The objective of this study was to describe the CT imaging findings associated with confirmed mycobacterial infection in cats.Methods: CT images from 20 cats with confirmed mycobacterial disease were retrospectively reviewed. Five cats underwent conscious full-body CT in a VetMouseTrapTM device. All other cats had thoracic CT performed under general anaesthesia, with the addition of CT investigation of the head/neck, abdomen and limbs in some cases.Results: Mycobacterial infection...

  18. Detection of Mycobacterial Antigens in Leprosy Serum Immune Complex

    1986-01-01

    The antigens from immune complexes of sera from patients with mycobacterial diseases were released by sodium dodecyl sulfate. The antigenic activity of the released proteins was tested by agar gel diffusion and immunoelectrophoresis. This simple method provided direct evidence for the presence of mycobacterial antigens in the immune complexes of sera from patients with leprosy and tuberculosis.

  19. Boromycin Kills Mycobacterial Persisters without Detectable Resistance

    Moreira, Wilfried; Aziz, Dinah B.; Dick, Thomas

    2016-01-01

    Boromycin is a boron-containing polyether macrolide antibiotic isolated from Streptomyces antibioticus. It was shown to be active against Gram positive bacteria and to act as an ionophore for potassium ions. The antibiotic is ineffective against Gram negative bacteria where the outer membrane appears to block access of the molecule to the cytoplasmic membrane. Here we asked whether boromycin is active against Mycobacterium tuberculosis which, similar to Gram negative bacteria, possesses an outer membrane. The results show that boromycin is a potent inhibitor of mycobacterial growth (MIC50 = 80 nM) with strong bactericidal activity against growing and non-growing drug tolerant persister bacilli. Exposure to boromycin resulted in a rapid loss of membrane potential, reduction of the intracellular ATP level and leakage of cytoplasmic protein. Consistent with boromycin acting as a potassium ionophore, addition of KCl to the medium blocked its antimycobacterial activity. In contrast to the potent antimycobacterial activities of the polyether macrolide, its cytotoxicity and haemolytic activity were low (CC50 = 30 μM, HC50 = 40 μM) with a selectivity index of more than 300. Spontaneous resistant mutants could not be isolated suggesting a mutation frequency of less than 10-9/CFU. Taken together, the results suggests that targeting mycobacterial transmembrane ion gradients may be an attractive chemotherapeutic intervention level to kill otherwise drug tolerant persister bacilli, and to slow down the development of genetic antibiotic resistance. PMID:26941723

  20. Mycobacterial Lung Disease Complicating HIV Infection.

    Haas, Michelle K; Daley, Charles L

    2016-04-01

    Mycobacterial infections have caused enormous morbidity and mortality in people living with human immunodeficiency virus (HIV) infection. Of these, the most devastating has been tuberculosis (TB), the leading cause of death among HIV-positive persons globally. TB has killed more people living with HIV than any other infection. Diagnosis of latent TB infection (LTBI) is critical as treatment can prevent emergence of TB disease. Bacteriologic confirmation of TB disease should be sought whenever possible as well as drug susceptibility testing. When detected early, drug susceptible TB is curable. Similar to TB, nontuberculous mycobacteria (NTM) can also produce pulmonary and extrapulmonary infections including disseminated disease that can be fatal. Diagnosis through accurate identification of the pathogenic organism will greatly inform treatment. Depending on the NTM identified, treatment may not be curable. Ultimately, preventive strategies such as initiation of antiretroviral drugs and treatment of LTBI are interventions expected to have significant impacts on control of TB and NTM in the setting of HIV. This chapter will review the impact of pulmonary mycobacterial infections on HIV-positive individuals. PMID:26974300

  1. Nontuberculous mycobacterial otomastoiditis: a case report.

    Tsai, Li-Tai; Wang, Ching-Yuan; Lin, Chia-Der; Tsai, Ming-Hsui

    2013-01-01

    Nontuberculous mycobacterial otomastoiditis is rare and can be easily confused with various different forms of otitis media. We describe the case of a 50-year-old woman who presented with left-sided chronic otitis media that had persisted for more than 1 year. It was not eradicated by standard antimicrobial therapy and surgical debridement. After appropriate antibiotic therapy for nontuberculous mycobacteria was added to the therapeutic regimen, the patient improved significantly and the lesion had healed by 6 months. Based on our experience with this case, we conclude that early bacterial culture and staining for acid-fast bacilli in ear drainage material or granulation tissue should be performed when standard antimicrobial therapy fails to eradicate chronic otitis media of an undetermined origin that is accompanied by granulation tissue over the external auditory canal or middle ear. Polymerase chain reaction testing is also effective for rapid diagnosis. Surgical debridement and removal of the foreign body can successfully treat nontuberculous mycobacterial otomastoiditis only when effective antimicrobial therapy is also administered. PMID:23354889

  2. Control of Mycobacterial Infections in Mice Expressing Human Tumor Necrosis Factor (TNF) but Not Mouse TNF.

    Olleros, Maria L; Chavez-Galan, Leslie; Segueni, Noria; Bourigault, Marie L; Vesin, Dominique; Kruglov, Andrey A; Drutskaya, Marina S; Bisig, Ruth; Ehlers, Stefan; Aly, Sahar; Walter, Kerstin; Kuprash, Dmitry V; Chouchkova, Miliana; Kozlov, Sergei V; Erard, François; Ryffel, Bernard; Quesniaux, Valérie F J; Nedospasov, Sergei A; Garcia, Irene

    2015-09-01

    Tumor necrosis factor (TNF) is an important cytokine for host defense against pathogens but is also associated with the development of human immunopathologies. TNF blockade effectively ameliorates many chronic inflammatory conditions but compromises host immunity to tuberculosis. The search for novel, more specific human TNF blockers requires the development of a reliable animal model. We used a novel mouse model with complete replacement of the mouse TNF gene by its human ortholog (human TNF [huTNF] knock-in [KI] mice) to determine resistance to Mycobacterium bovis BCG and M. tuberculosis infections and to investigate whether TNF inhibitors in clinical use reduce host immunity. Our results show that macrophages from huTNF KI mice responded to BCG and lipopolysaccharide similarly to wild-type macrophages by NF-κB activation and cytokine production. While TNF-deficient mice rapidly succumbed to mycobacterial infection, huTNF KI mice survived, controlling the bacterial burden and activating bactericidal mechanisms. Administration of TNF-neutralizing biologics disrupted the control of mycobacterial infection in huTNF KI mice, leading to an increased bacterial burden and hyperinflammation. Thus, our findings demonstrate that human TNF can functionally replace murine TNF in vivo, providing mycobacterial resistance that could be compromised by TNF neutralization. This new animal model will be helpful for the testing of specific biologics neutralizing human TNF. PMID:26123801

  3. Tetrahydrolipstatin Inhibition, Functional Analyses, and Three-dimensional Structure of a Lipase Essential for Mycobacterial Viability

    Crellin, Paul K.; Vivian, Julian P.; Scoble, Judith; Chow, Frances M.; West, Nicholas P.; Brammananth, Rajini; Proellocks, Nicholas I.; Shahine, Adam; Le Nours, Jerome; Wilce, Matthew C.J.; Britton, Warwick J.; Coppel, Ross L.; Rossjohn, Jamie; Beddoe, Travis (Monash); (Centenary)

    2010-09-17

    The highly complex and unique mycobacterial cell wall is critical to the survival of Mycobacteria in host cells. However, the biosynthetic pathways responsible for its synthesis are, in general, incompletely characterized. Rv3802c from Mycobacterium tuberculosis is a partially characterized phospholipase/thioesterase encoded within a genetic cluster dedicated to the synthesis of core structures of the mycobacterial cell wall, including mycolic acids and arabinogalactan. Enzymatic assays performed with purified recombinant proteins Rv3802c and its close homologs from Mycobacterium smegmatis (MSMEG{_}6394) and Corynebacterium glutamicum (NCgl2775) show that they all have significant lipase activities that are inhibited by tetrahydrolipstatin, an anti-obesity drug that coincidently inhibits mycobacterial cell wall biosynthesis. The crystal structure of MSMEG{_}6394, solved to 2.9 {angstrom} resolution, revealed an {alpha}/{beta} hydrolase fold and a catalytic triad typically present in esterases and lipases. Furthermore, we demonstrate direct evidence of gene essentiality in M. smegmatis and show the structural consequences of loss of MSMEG{_}6394 function on the cellular integrity of the organism. These findings, combined with the predicted essentiality of Rv3802c in M. tuberculosis, indicate that the Rv3802c family performs a fundamental and indispensable lipase-associated function in mycobacteria.

  4. Mycobacterial infections: Still a millennium bug - the imaging features of mycobacterial infections

    Koh, D.M.; Bell, J.R.G.; Burkill, G.J.C.; Padley, S.P.G.; Healy, J.C

    2001-07-01

    Mycobacterial infection is re-emerging as a major health care concern. Although Mycobacterium tuberculosis (MTB) is still the most important pathogen, atypical mycobacterium (AMB) infections are becoming increasingly common. We present a pictorial review of the imaging features of these infections in the chest, abdomen, brain and musculoskeletal system. Imaging similarities and differences between the normal and the immunocompromised host will be highlighted. Koh, D. M. et al. Clinical Radiology (2001)

  5. High mycobacterial diversity in recreational lakes.

    Roguet, A; Therial, C; Saad, M; Boudahmane, L; Moulin, L; Lucas, F S

    2016-05-01

    Although nontuberculous mycobacteria (NTM) are natural inhabitants of freshwater ecosystems, few studies have focused on their distribution in these habitats. Thus, the knowledge about the abundance as well as the composition of NTM remains limited and patchy in these environments. In this context, a prospective study was performed to identify favourable habitats for mycobacteria in two recreational lakes. Mycobacterial density and diversity were measured using quantitative real-time PCR and the MiSeq Illumina platform. For both lakes, five compartments were investigated, i.e. water column, air-water interface, sediment, epilithon and epiphyton biofilms. Nontuberculous mycobacteria were detected in all compartments in large densities and displayed a remarkable diversity. NTM were dominated by fast-growing species. Lakes and compartments appeared to shape mycobacteria assemblage composition as well as their densities. In both lakes, some OTUs assigned to the species level were identified as related to known opportunistic pathogens. PMID:26873594

  6. Biosynthetic origin of mycobacterial cell wall arabinosyl residues.

    Scherman, M.; Weston, A; Duncan, K; Whittington, A; Upton, R; Deng, L.; Comber, R; Friedrich, J D; McNeil, M

    1995-01-01

    Designing new drugs that inhibit the biosynthesis of the D-arabinan moiety of the mycobacterial cell wall arabinogalactan is one important basic approach for treatment of mycobacterial diseases. However, the biosynthetic origin of the D-arabinosyl monosaccharide residues themselves is not known. To obtain information on this issue, mycobacteria growing in culture were fed glucose labeled with 14C or 3H in specific positions. The resulting radiolabeled cell walls were isolated and hydrolyzed, ...

  7. Evaluation of the GenoType Mycobacterium Assay for Identification of Mycobacterial Species from Cultures

    Richter, Elvira; Rüsch-Gerdes, Sabine; Hillemann, Doris

    2006-01-01

    A new commercially available DNA strip assay (GenoType Mycobacterium CM/AS; Hain Lifescience, Nehren, Germany) was evaluated for the ability to differentiate mycobacterial species. The test is based on a PCR technique targeting a 23S rRNA gene region, followed by reverse hybridization and line probe technology. The GenoType CM is capable of identifying 23, the GenoType AS a further 14, species either alone or in combination with one or more species. Both tests were evaluated with 156 mycobact...

  8. Mycobacterial infections in a large Virginia hospital, 2001-2009

    Scully Kenneth W

    2011-05-01

    Full Text Available Abstract Background In areas where both tuberculosis (TB and nontuberculous mycobacteria (NTM are prevalent, descriptive studies of the clinical features of individual mycobacteria are needed to inform clinical triage. Methods We queried the University of Virginia Clinical Data Repository for all mycobacterial infections from 2001-2009. Results Of 494 mycobacterial infections in 467 patients there were 22 species. Patients with pulmonary Tb were more likely to be reported as immigrants (p M. kansasii, M. xenopi, and M. fortuitum were more likely than MAC to have cavities. There were at least 83 patients that met criteria for NTM lung disease and these were caused by 9 species. M. abscessus infection was associated with cystic fibrosis and M. xenopi infection was associated with male gender. Conclusions In our center mycobacterial infections were common and of diverse species. Immigrant status, cavities, and effusion were associated with TB vs. NTM.

  9. Prevalence of Nontuberculous Mycobacterial Pulmonary Disease, Germany, 2009–2014

    Wagner, Dirk; de Roux, Andrés; Diel, Roland; Hohmann, David; Hickstein, Lennart; Welte, Tobias; Rademacher, Jessica

    2016-01-01

    We analyzed routine statutory health insurance claim data to determine prevalence of nontuberculous mycobacterial pulmonary disease in Germany. Documented prevalence rates of this nonnotifiable disease increased from 2.3 to 3.3 cases/100,000 population from 2009 to 2014. Prevalence showed a strong association with advanced age and chronic obstructive pulmonary disease. PMID:27191473

  10. DNA encoding individual mycobacterial antigens protects mice against tuberculosis

    C.L. Silva

    1999-02-01

    Full Text Available Over the last few years, some of our experiments in which mycobacterial antigens were presented to the immune system as if they were viral antigens have had a significant impact on our understanding of protective immunity against tuberculosis. They have also markedly enhanced the prospects for new vaccines. We now know that individual mycobacterial protein antigens can confer protection equal to that from live BCG vaccine in mice. A critical determinant of the outcome of immunization appears to be the degree to which antigen-specific cytotoxic T cells are generated by the immune response. Our most recent studies indicate that DNA vaccination is an effective way to establish long-lasting cytotoxic T cell memory and protection against tuberculosis.

  11. Inhibition of human lymphoproliferative responses by mycobacterial phenolic glycolipids.

    Fournie, J J; Adams, E; Mullins, R J; Basten, A

    1989-01-01

    The effect of mycobacterial phenolic glycolipids from Mycobacterium leprae, M. bovis BCG, and M. kansasii on in vitro proliferative responses by human blood mononuclear cells from healthy BCG vaccinees was investigated. All three phenolic glycolipids inhibited proliferation in a concentration-dependent manner. Inhibition was independent of the stimulus used and involved neither antigen-presenting cells nor antigen-specific CD8+ suppressor T cells. It was concluded that the phenomenon may be a...

  12. Production of Matrix Metalloproteinases in Response to Mycobacterial Infection

    Quiding-Järbrink, Marianne; Smith, Debbie A.; Bancroft, Gregory J.

    2001-01-01

    Matrix metalloproteinases (MMPs) constitute a large family of enzymes with specificity for the various proteins of the extracellular matrix which are implicated in tissue remodeling processes and chronic inflammatory conditions. To investigate the role of MMPs in immunity to mycobacterial infections, we incubated murine peritoneal macrophages with viable Mycobacterium bovis BCG or Mycobacterium tuberculosis H37Rv and assayed MMP activity in the supernatants by zymography. Resting macrophages ...

  13. Vaccination Against Tuberculosis With Whole-Cell Mycobacterial Vaccines.

    Scriba, Thomas J; Kaufmann, Stefan H E; Henri Lambert, Paul; Sanicas, Melvin; Martin, Carlos; Neyrolles, Olivier

    2016-09-01

    Live attenuated and killed whole-cell vaccines (WCVs) offer promising vaccination strategies against tuberculosis. A number of WCV candidates, based on recombinant bacillus Calmette-Guerin (BCG), attenuated Mycobacterium tuberculosis, or related mycobacterial species are in various stages of preclinical or clinical development. In this review, we discuss the vaccine candidates and key factors shaping the development pathway for live and killed WCVs and provide an update on progress. PMID:27247343

  14. Mendelian Susceptibility to Mycobacterial Disease due to IL-12Rβ1 Deficiency in Three Iranian Children

    Shokouh azam SARRAFZADEH

    2016-02-01

    Full Text Available Mendelian susceptibility to mycobacterial diseases (MSMD is a rare inheritance syndrome, characterized by a disseminated infection with mycobacterium in children following BCG vaccination at birth. Regarding the vaccination program in Iran, it may consider as a public health problem. The pathogenesis of MSMD is dependent on either insufficient production of IFN-gamma (γ or inadequate response to it. Here, we want to introduce three cases including two siblings and one girl from two unrelated families with severe mycobacterial infections referred to Immunology, Asthma and Allergy Research Institute (IAARI, from 2013 to 2015; their MSMD was confirmed by both cytokine assessment and genetic analysis. Regarding the clinical features of the patients, cell proliferation against a mitogen and BCG antigen was ordered in a lymphocyte transformation test (LTT setting. ELISA was performed for the measurement of IL-12p70 and IFN- γ in whole blood samples activated by BCG + recombinant human IFN-γ and BCG + recombinant human IL-12, respectively. In contrast to mitogen, the antigen-dependent proliferation activity of the patients’ leukocytes was significantly lower than that in normal range. We identified a homozygous mutation in IL12RB1 gene for two kindred who had a homozygous mutation affecting an essential splice site. For the third patient, a novel frameshift deletion in IL12RB1 gene was found. The genetic study results confirmed the impaired function of stimulated lymphocytes to release IFN-γ following stimulation with BCG+IL-12 while the response to rhIFN-γ for IL-12p70 production was relatively intact. Our findings show that cellular and molecular assessments are needed for precise identification of immunodeficiency disorders especially those without clear-cut diagnostic criteria. Keywords: Mendelian, IL-12Rβ1 Deficiency, Interfron-gamma, Interleukin 12, Mycobacterium

  15. Polyphenolic acetates : A newer anti-Mycobacterial therapeutic option

    Santram

    2014-01-01

    Full Text Available The objective of our research project was screening of various highly specific substrates of Acetoxy Drug: Protein Transacytylase (M.TAase for antimycobacterial activity. Mycobacterial culture was done in Middlebrook’s 7H9 media. Protein purification (Mycobacterial Tranacetylase, M.TAase was done by ion exchange chromatography and its demonstration was done on SDS- polyacrylamide gel electrophoresis (SDS-PAGE and western blot. Middlebrook’s 7H9 broth was procured from Becton Dickinson. CM-Sepharose, DEAE-Sepharose and Q-Sephharose were purchased from Amersham Pharmacia. Anti acetyl lysine polyclonal antibody was purchased from Cell Signaling. The Middlebrook 7H9 medium was used for M. smegmatis culture. The media was prepared according to the manufacturer’s instructions. The various Polyphenol acetate compounds were tested for their antimycobacterial activities. Minimal inhibitory concentrations (MIC were calculated by Alamar blue dye assay method. The GST protein was used as a receptor protein and purified Mycobacterial Glutamine Synthetase (GS as TAase for acetylation by DAMC. To demonstrate the TAase catalyzed acetylation of GST by DAMC, purified M.TAase (GS was preincubated with GST and DAMC followed by western blot using anti acetyl lysine antibody, which avidly react with the acetylated proteins. The growth pattern of M. smegmatis was diminished under the influence of various polyphenolic acetates (PA tested for their anti-mycobacterial activity. DAMC and DAMC-5-carboxylic acid was found to have MIC of 40μg/ml whereas DAMC-6-carboxylic acid was reported to have MIC value of 35μg/ml and for ellagic acid tetra acetate (EATA it was 60μg/ml. Previous work in our lab has led to discovery of a novel enzyme acetoxy drug: protein transacetylase (TAase, catalyzing transfer of acetyl group from various polyphenolic peracetate (PA to certain receptor proteins such as cytochromes P-450, NADPH cytochrome reductase, nitric oxide synthase (NOS

  16. Assembly and proteolytic processing of mycobacterial ClpP1 and ClpP2

    Benaroudj Nadia

    2011-12-01

    Full Text Available Abstract Background Caseinolytic proteases (ClpPs are barrel-shaped self-compartmentalized peptidases involved in eliminating damaged or short-lived regulatory proteins. The Mycobacterium tuberculosis (MTB genome contains two genes coding for putative ClpPs, ClpP1 and ClpP2 respectively, that are likely to play a role in the virulence of the bacterium. Results We report the first biochemical characterization of ClpP1 and ClpP2 peptidases from MTB. Both proteins were produced and purified in Escherichia coli. Use of fluorogenic model peptides of diverse specificities failed to show peptidase activity with recombinant mycobacterial ClpP1 or ClpP2. However, we found that ClpP1 had a proteolytic activity responsible for its own cleavage after the Arg8 residue and cleavage of ClpP2 after the Ala12 residue. In addition, we showed that the absence of any peptidase activity toward model peptides was not due to an obstruction of the entry pore by the N-terminal flexible extremity of the proteins, nor to an absolute requirement for the ClpX or ClpC ATPase complex. Finally, we also found that removing the putative propeptides of ClpP1 and ClpP2 did not result in cleavage of model peptides. We have also shown that recombinant ClpP1 and ClpP2 do not assemble in the conventional functional tetradecameric form but in lower order oligomeric species ranging from monomers to heptamers. The concomitant presence of both ClpP1 and ClpP2 did not result in tetradecameric assembly. Deleting the amino-terminal extremity of ClpP1 and ClpP2 (the putative propeptide or entry gate promoted the assembly in higher order oligomeric species, suggesting that the flexible N-terminal extremity of mycobacterial ClpPs participated in the destabilization of interaction between heptamers. Conclusion Despite the conservation of a Ser protease catalytic triad in their primary sequences, mycobacterial ClpP1 and ClpP2 do not have conventional peptidase activity toward peptide models and

  17. Comparison of different delivery systems of vaccination for the induction of protection against tuberculosis in mice.

    Lima, K M; Bonato, V L; Faccioli, L H; Brandão, I T; dos Santos, S A; Coelho-Castelo, A A; Leão, S C; Silva, C L

    2001-05-14

    The way to deliver antigens and cellular requirements for long-lasting protection against tuberculosis are not known. Immunizations with mycobacterial 65 kDa heat shock protein (hsp65) expressed from J774-hsp65 cells (antigen-presenting cells that endogenously produce hsp65 antigen) or from plasmid DNA, or with the protein entrapped in cationic liposomes, can each give protective immunity similar to that obtained from live Bacillus Calmette Guérin (BCG), whereas injecting the protein in Freund's incomplete adjuvant (FIA) has minimal effect. Protective procedures elicited high frequencies of antigen-reactive alphabeta T cells with CD4+/CD8- and CD8+/CD4- phenotypes. Protection correlated with the abundance of hsp65-dependent cytotoxic CD8+/CD4-/CD44hi cells. The frequency of these cells and the level of protection declined during 8 months after J774-hsp65 or liposome-mediated immunization with hsp65 protein but were sustained or steadily increased over this period after hsp65-DNA or BCG immunizations. IFN-gamma predominated over IL-4 among the hsp65-reactive CD8+/CD4- and CD4+/CD8- populations after J774-hsp65-, hsp65-liposome-, and hsp65-DNA-mediated immunizations, but similar levels of these cytokines prevailed after BCG vaccination. PMID:11348719

  18. Multiple-genome comparison reveals new loci for Mycobacterium species identification.

    Dai, Jianli; Chen, Yuansha; Dean, Susan; Morris, J Glenn; Salfinger, Max; Johnson, Judith A

    2011-01-01

    To identify loci useful for species identification and to enhance our understanding of the population structure and genetic variability of the genus Mycobacterium, we conducted a multiple-genome comparison of a total of 27 sequenced genomes in the suborder of Corynebacterineae (18 from the Mycobacterium genus, 7 from the Corynebacterium genus, 1 each from the Nocardia and Rhodococcus genera). Our study revealed 26 informative loci for species identification in Mycobacterium. The sequences from these loci were used in a phylogenetic analysis to infer the evolutionary relations of the 18 mycobacterial genomes. Among the loci that we identified, rpoBC, dnaK, and hsp65 were amplified from 29 ATCC reference strains and 17 clinical isolates and sequenced. The phylogenetic trees generated from these loci show similar topologies. The newly identified dnaK locus is more discriminatory and more robust than the widely used hsp65 locus. The length-variable rpoBC locus is the first intergenic locus between two protein-encoding genes being used for mycobacterial species identification. A multilocus sequence analysis system including the rpoBC, dnaK, and hsp65 loci is a robust tool for accurate identification of Mycobacterium species. PMID:21048007

  19. Nontuberculous Mycobacterial Tenosynovitis in the Hand: Two Case Reports with the MR Imaging Findings

    Nontuberculous mycobacterial infections can cause destructive tenosynovitis of the hand. We report on and discuss the clinical course and distinctive radiologic findings of two patients with hand tenosynovitis secondary to M. marinum and intracellulare infection, which are different from those of the nontuberculous mycobacterial infections reported in the previous literature.

  20. Production of matrix metalloproteinases in response to mycobacterial infection.

    Quiding-Järbrink, M; Smith, D A; Bancroft, G J

    2001-09-01

    Matrix metalloproteinases (MMPs) constitute a large family of enzymes with specificity for the various proteins of the extracellular matrix which are implicated in tissue remodeling processes and chronic inflammatory conditions. To investigate the role of MMPs in immunity to mycobacterial infections, we incubated murine peritoneal macrophages with viable Mycobacterium bovis BCG or Mycobacterium tuberculosis H37Rv and assayed MMP activity in the supernatants by zymography. Resting macrophages secreted only small amounts of MMP-9 (gelatinase B), but secretion increased dramatically in a dose-dependent manner in response to either BCG or M. tuberculosis in vitro. Incubation with mycobacteria also induced increased MMP-2 (gelatinase A) activity. Neutralization of tumor necrosis alpha (TNF-alpha), and to a lesser extent interleukin 18 (IL-18), substantially reduced MMP production in response to mycobacteria. Exogenous addition of TNF-alpha or IL-18 induced macrophages to express MMPs, even in the absence of bacteria. The immunoregulatory cytokines gamma interferon (IFN-gamma), IL-4, and IL-10 all suppressed BCG-induced MMP production, but through different mechanisms. IFN-gamma treatment increased macrophage secretion of TNF-alpha but still reduced their MMP activity. Conversely, IL-4 and IL-10 seemed to act by reducing the amount of TNF-alpha available to the macrophages. Finally, infection of BALB/c or severe combined immunodeficiency (SCID) mice with either BCG or M. tuberculosis induced substantial increases in MMP-9 activity in infected tissues. In conclusion, we show that mycobacterial infection induces MMP-9 activity both in vitro and in vivo and that this is regulated by TNF-alpha, IL-18, and IFN-gamma. These findings indicate a possible contribution of MMPs to tissue remodeling processes that occur in mycobacterial infections. PMID:11500442

  1. microRNAs in mycobacterial disease: friend or foe?

    Mehta, Manali D.; Liu, Philip T.

    2014-01-01

    As the role of microRNA in all aspects of biology continues to be unraveled, the interplay between microRNAs and human disease is becoming clearer. It should come of no surprise that microRNAs play a major part in the outcome of infectious diseases, since early work has implicated microRNAs as regulators of the immune response. Here, we provide a review on how microRNAs influence the course of mycobacterial infections, which cause two of humanity’s most ancient infectious diseases: tuberculos...

  2. The mycobacterial DNA-binding protein 1 (MDP1 from Mycobacterium bovis BCG influences various growth characteristics

    Maurischat Sven

    2008-06-01

    Full Text Available Abstract Background Pathogenic mycobacteria such as M. tuberculosis, M. bovis or M. leprae are characterised by their extremely slow growth rate which plays an important role in mycobacterial virulence and eradication of the bacteria. Various limiting factors influence the generation time of mycobacteria, and the mycobacterial DNA-binding protein 1 (MDP1 has also been implicated in growth regulation. Our strategy to investigate the role of MDP1 in mycobacterial growth consisted in the generation and characterisation of a M. bovis BCG derivative expressing a MDP1-antisense gene. Results The expression rate of the MDP1 protein in the recombinant M. bovis BCG containing the MDP1-antisense plasmid was reduced by about 50% compared to the reference strain M. bovis BCG containing the empty vector. In comparison to this reference strain, the recombinant M. bovis BCG grew faster in broth culture and reached higher cell masses in stationary phase. Likewise its intracellular growth in mouse and human macrophages was ameliorated. Bacterial clumping in broth culture was reduced by the antisense plasmid. The antisense plasmid increased the susceptibility of the bacteria towards Ampicillin. 2-D protein gels of bacteria maintained under oxygen-poor conditions demonstrated a reduction in the number and the intensity of many protein spots in the antisense strain compared to the reference strain. Conclusion The MDP1 protein has a major impact on various growth characteristics of M. bovis BCG. It plays an important role in virulence-related traits such as aggregate formation and intracellular multiplication. Its impact on the protein expression in a low-oxygen atmosphere indicates a role in the adaptation to the hypoxic conditions present in the granuloma.

  3. microRNAs in mycobacterial disease: friend or foe?

    Manali D Mehta

    2014-07-01

    Full Text Available As the role of microRNA in all aspects of biology continues to be unraveled, the interplay between microRNAs and human disease is becoming clearer. It should come of no surprise that microRNAs play a major part in the outcome of infectious diseases, since early work has implicated microRNAs as regulators of the immune response. Here, we provide a review on how microRNAs influence the course of mycobacterial infections, which cause two of humanity’s most ancient infectious diseases: tuberculosis and leprosy. Evidence derived from profiling and functional experiments suggests that regulation of specific microRNAs during infection can either enhance the immune response or facilitate pathogen immune evasion. Now, it remains to be seen if the manipulation of host cell microRNA profiles can be an opportunity for therapeutic intervention for these difficult-to-treat diseases.

  4. Platensimycin activity against mycobacterial beta-ketoacyl-ACP synthases.

    Alistair K Brown

    Full Text Available BACKGROUND: There is an urgent need for the discovery and development of new drugs against Mycobacterium tuberculosis, the causative agent of tuberculosis, especially due to the recent emergence of multi-drug and extensively-drug resistant strains. Herein, we have examined the susceptibility of mycobacteria to the natural product platensimycin. METHODS AND FINDINGS: We have demonstrated that platensimycin has bacteriostatic activity against the fast growing Mycobacterium smegmatis (MIC = 14 microg/ml and against Mycobacterium tuberculosis (MIC = 12 microg/ml. Growth in the presence of paltensimycin specifically inhibited the biosynthesis of mycolic acids suggesting that the antibiotic targeted the components of the mycolate biosynthesis complex. Given the inhibitory activity of platensimycin against beta-ketoacyl-ACP synthases from Staphylococcus aureus, M. tuberculosis KasA, KasB or FabH were overexpressed in M. smegmatis to establish whether these mycobacterial KAS enzymes were targets of platensimycin. In M. smegmatis overexpression of kasA or kasB increased the MIC of the strains from 14 microg/ml, to 30 and 124 microg/ml respectively. However, overexpression of fabH on did not affect the MIC. Additionally, consistent with the overexpression data, in vitro assays using purified proteins demonstrated that platensimycin inhibited Mt-KasA and Mt-KasB, but not Mt-FabH. SIGNIFICANCE: Our results have shown that platensimycin is active against mycobacterial KasA and KasB and is thus an exciting lead compound against M. tuberculosis and the development of new synthetic analogues.

  5. Mycobacterial Infection of the Gallbladder Masquerading as Gallbladder Cancer with a False Positive Pet Scan

    Adeeb Majid; Ravish Sanghi Raju; Markus Trochsler; Kanhere, Harsh A.; Maddern, Guy J

    2013-01-01

    Isolated mycobacterial infection of gall bladder is an extremely rare entity. Only anecdotal reports are evident in the literature. A preoperative diagnosis of mycobacterial infection of gallbladder is therefore very difficult. The case of a 72-year-old male who underwent surgery for suspected gallbladder cancer is presented. The diagnosis of cancer was based on radiological findings and an abnormal uptake of fluorine-18-fluoro-2-deoxy-D-glucose (FDG) on positron emission tomography (PET) sca...

  6. Molecular-based mycobacterial identification in a clinical laboratory setting: a comparison of two methods.

    O'Donnell, N

    2012-01-01

    Many mycobacterial species are pathogenic to humans, with infection occurring worldwide. Infection with Mycobacterium tuberculosis is a well-described global phenomenon, but other mycobacterial species are increasingly shown to be the cause of both pulmonary and extrapulmonary infection and are managed differently from M. tuberculosis infection. Rapid and accurate differentiation of mycobacterial species is, therefore, critical to guide timely and appropriate therapeutic and public health management. This study evaluates two commercially available DNA strip assays, the Genotype Common Mycobacteria (CM) assay (Hain Lifescience, Nehren, Germany) and the Speed-oligo Mycobacteria assay (Vircell, Spain) for their usefulness in a clinical laboratory setting. Both assays were evaluated on 71 clinical mycobacterial isolates, previously identified using Gen-Probe AccuProbe and through a UK mycobacteriology reference laboratory, as well as 29 non-mycobacterial isolates. Concordant results were obtained for 98% of isolates using both assays. The sensitivity was 97% (95% confidence interval [CI]: 93.3-100%) for the CM assay and 98.6% (95% CI: 95.9-100%) for the Speed-oligo assay. Overall, both assays proved to be useful tools for rapid and sensitive mycobacterial species identification, although interpretation of results was easier with the CM assay. Finally, results were available within one day, compared to current identification times which range between seven days and four weeks.

  7. microRNA-146a promotes mycobacterial survival in macrophages through suppressing nitric oxide production.

    Li, Miao; Wang, Jinli; Fang, Yimin; Gong, Sitang; Li, Meiyu; Wu, Minhao; Lai, Xiaomin; Zeng, Gucheng; Wang, Yi; Yang, Kun; Huang, Xi

    2016-01-01

    Macrophages play a crucial role in host innate anti-mycobacterial defense, which is tightly regulated by multiple factors, including microRNAs. Our previous study showed that a panel of microRNAs was markedly up-regulated in macrophages upon mycobacterial infection. Here, we investigated the biological function of miR-146a during mycobacterial infection. miR-146a expression was induced both in vitro and in vivo after Mycobacterium bovis BCG infection. The inducible miR-146a could suppress the inducible nitric oxide (NO) synthase (iNOS) expression and NO generation, thus promoting mycobacterial survival in macrophages. Inhibition of endogenous miR-146a increased NO production and mycobacterial clearance. Moreover, miR-146a attenuated the activation of nuclear factor κB and mitogen-activated protein kinases signaling pathways during BCG infection, which in turn repressed iNOS expression. Mechanistically, miR-146a directly targeted tumor necrosis factor (TNF) receptor-associated factor 6 (TRAF6) at post-transcriptional level. Silencing TRAF6 decreased iNOS expression and NO production in BCG-infected macrophages, while overexpression of TRAF6 reversed miR-146a-mediated inhibition of NO production and clearance of mycobacteria. Therefore, we demonstrated a novel role of miR-146a in the modulation of host defense against mycobacterial infection by repressing NO production via targeting TRAF6, which may provide a promising therapeutic target for tuberculosis. PMID:27025258

  8. The essential mycobacterial amidotransferase GatCAB is a modulator of specific translational fidelity.

    Su, Hong-Wei; Zhu, Jun-Hao; Li, Hao; Cai, Rong-Jun; Ealand, Christopher; Wang, Xun; Chen, Yu-Xiang; Kayani, Masood Ur Rehman; Zhu, Ting F; Moradigaravand, Danesh; Huang, Hairong; Kana, Bavesh D; Javid, Babak

    2016-01-01

    Although regulation of translation fidelity is an essential process(1-7), diverse organisms and organelles have differing requirements of translational accuracy(8-15), and errors in gene translation serve an adaptive function under certain conditions(16-20). Therefore, optimal levels of fidelity may vary according to context. Most bacteria utilize a two-step pathway for the specific synthesis of aminoacylated glutamine and/or asparagine tRNAs, involving the glutamine amidotransferase GatCAB(21-25), but it had not been appreciated that GatCAB may play a role in modulating mistranslation rates. Here, by using a forward genetic screen, we show that the mycobacterial GatCAB enzyme complex mediates the translational fidelity of glutamine and asparagine codons. We identify mutations in gatA that cause partial loss of function in the holoenzyme, with a consequent increase in rates of mistranslation. By monitoring single-cell transcription dynamics, we demonstrate that reduced gatCAB expression leads to increased mistranslation rates, which result in enhanced rifampicin-specific phenotypic resistance. Consistent with this, strains with mutations in gatA from clinical isolates of Mycobacterium tuberculosis show increased mistranslation, with associated antibiotic tolerance, suggesting a role for mistranslation as an adaptive strategy in tuberculosis. Together, our findings demonstrate a potential role for the indirect tRNA aminoacylation pathway in regulating translational fidelity and adaptive mistranslation. PMID:27564922

  9. Phagocyte NADPH oxidase, chronic granulomatous disease and mycobacterial infections.

    Deffert, Christine; Cachat, Julien; Krause, Karl-Heinz

    2014-08-01

    Infection of humans with Mycobacterium tuberculosis remains frequent and may still lead to death. After primary infection, the immune system is often able to control M. tuberculosis infection over a prolonged latency period, but a decrease in immune function (from HIV to immunosenescence) leads to active disease. Available vaccines against tuberculosis are restricted to BCG, a live vaccine with an attenuated strain of M. bovis. Immunodeficiency may not only be associated with an increased risk of tuberculosis, but also with local or disseminated BCG infection. Genetic deficiency in the reactive oxygen species (ROS)-producing phagocyte NADPH oxidase NOX2 is called chronic granulomatous disease (CGD). CGD is among the most common primary immune deficiencies. Here we review our knowledge on the importance of NOX2-derived ROS in mycobacterial infection. A literature review suggests that human CGD patient frequently have an increased susceptibility to BCG and to M. tuberculosis. In vitro studies and experiments with CGD mice are incomplete and yielded - at least in part - contradictory results. Thus, although observations in human CGD patients leave little doubt about the role of NOX2 in the control of mycobacteria, further studies will be necessary to unequivocally define and understand the role of ROS. PMID:24916152

  10. The galactosamine residue in mycobacterial arabinogalactan is α-linked.

    Peng, Wenjie; Zou, Lu; Bhamidi, Suresh; McNeil, Michael R; Lowary, Todd L

    2012-11-01

    Previous studies have demonstrated that cell wall arabinogalactan from mycobacteria possesses a single galactosamine (GalN) residue. This moiety, which is one of the rare natural occurrences of galactosamine lacking an acetyl group on the nitrogen, has been identified as a pendant substituent attached to a highly branched arabinofuranose residue in the arabinan core. However, the stereochemistry by which the GalN residue is linked to the polysaccharide remains unknown. We report here the synthesis of two tetrasaccharides, 1 and 2, consisting of GalN attached through either an α- or β-linkage to a trisaccharide fragment of mycobacterial arabinan. These molecules represent the first synthetic GalN-containing oligosaccharides, and the preparation of both targets was achieved from a single donor species by modulation of the reaction solvent. Comparison of the NMR spectra of 1 and 2 with those obtained from a sample derived from the natural glycan revealed that the GalN residue in the polysaccharide is attached via an α-linkage. PMID:23043372

  11. Species distribution in human immunodeficiency virus-related mycobacterial infections: implications for selection of initial treatment.

    Montessori, V; Phillips, P; Montaner, J; Haley, L; Craib, K; Bessuille, E; Black, W

    1996-06-01

    Management of mycobacterial infection is species specific; however, treatment is prompted by positive smears or cultures, often several weeks before species identification. The objective of this study was to determine the species distribution of mycobacterial isolates from various body sites in patients infected with human immunodeficiency virus (HIV). All mycobacterial isolates recovered at St. Paul's Hospital (Vancouver, British Columbia, Canada) from April 1989 to March 1993 were reviewed. Among 357 HIV-positive patients with mycobacterial infections, 64% (96) of the sputum isolates were Mycobacterium avium complex (MAC), 18% were Mycobacterium tuberculosis, and 17% were Mycobacterium kansasii. Lymph node involvement (25 patients) was due to either MAC (72%) or M. tuberculosis (24%). Two hundred ninety-eight episodes of mycobacteremia were due to MAC (98%), M. tuberculosis (1%), and M. kansasii (1%). Similarly, cultures of 84 bone marrow biopsy specimens (99%), 19 intestinal biopsy specimens (100%), and 30 stool specimens (97%) yielded predominantly MAC. These results have implications for initial therapy, particularly in areas where rapid methods for species identification are not readily available. Because of considerable geographic variation, development of guidelines for selection of initial therapy depends on regional determination of species distribution in HIV-related mycobacterial infections. PMID:8783698

  12. PPARγ Expression and Function in Mycobacterial Infection: Roles in Lipid Metabolism, Immunity, and Bacterial Killing

    Patricia E. Almeida

    2012-01-01

    Full Text Available Tuberculosis continues to be a global health threat, with drug resistance and HIV coinfection presenting challenges for its control. Mycobacterium tuberculosis, the etiological agent of tuberculosis, is a highly adapted pathogen that has evolved different strategies to subvert the immune and metabolic responses of host cells. Although the significance of peroxisome proliferator-activated receptor gamma (PPARγ activation by mycobacteria is not fully understood, recent findings are beginning to uncover a critical role for PPARγ during mycobacterial infection. Here, we will review the molecular mechanisms that regulate PPARγ expression and function during mycobacterial infection. Current evidence indicates that mycobacterial infection causes a time-dependent increase in PPARγ expression through mechanisms that involve pattern recognition receptor activation. Mycobacterial triggered increased PPARγ expression and activation lead to increased lipid droplet formation and downmodulation of macrophage response, suggesting that PPARγ expression might aid the mycobacteria in circumventing the host response acting as an escape mechanism. Indeed, inhibition of PPARγ enhances mycobacterial killing capacity of macrophages, suggesting a role of PPARγ in favoring the establishment of chronic infection. Collectively, PPARγ is emerging as a regulator of tuberculosis pathogenesis and an attractive target for the development of adjunctive tuberculosis therapies.

  13. Tumor necrosis factor alpha is a determinant of pathogenesis and disease progression in mycobacterial infection in the central nervous system.

    Tsenova, L; Bergtold, A; Freedman, V H; Young, R A; Kaplan, G

    1999-05-11

    The pathogenesis of tuberculous meningitis, a devastating complication of tuberculosis in man, is poorly understood. We previously reported that rabbits with experimental tuberculous meningitis were protected from death by a combination of antibiotics and thalidomide therapy. Survival was associated with inhibition of tumor necrosis factor alpha (TNF-alpha) production by thalidomide. To test whether cerebrospinal fluid (CSF) levels of TNF-alpha correlated with pathogenesis, the response of rabbits infected in the central nervous system (CNS) with various mycobacterial strains was studied. CNS infection with Mycobacterium bovis Ravenel, M. bovis bacillus Calmette-Guérin (BCG) Pasteur, and M. bovis BCG Montreal were compared. M. bovis Ravenel induced the highest levels of TNF-alpha in the CSF in association with high leukocytosis, protein accumulation, and severe meningeal inflammation. BCG Pasteur had intermediate effects, and BCG Montreal was the least virulent. In addition, M. bovis Ravenel numbers were highest in the brain and CSF and the bacilli also disseminated more efficiently to distant organs, compared with BCG Pasteur and BCG Montreal. In subsequent experiments, rabbits were infected with either recombinant M. bovis BCG Montreal (vector), or BCG Montreal expressing the murine gene for TNF-alpha (BCG mTNF-alpha). BCG Montreal was rendered virulent by the expression of murine TNF-alpha, as demonstrated by high CSF leukocytosis, high protein accumulation, severe meningeal inflammation, persistent bacillary load, and progressive clinical deterioration. Taken together, these results demonstrate that the level of TNF-alpha produced during mycobacterial CNS infection determines, at least in part, the extent of pathogenesis. PMID:10318940

  14. A Mycobacterial Perspective on Tuberculosis in West Africa: Significant Geographical Variation of M. africanum and Other M. tuberculosis Complex Lineages

    Florian Gehre; Samrat Kumar; Lindsay Kendall; Mebrat Ejo; Oumie Secka; Boatema Ofori-Anyinam; Emmanuel Abatih; Martin Antonio; Dirk Berkvens; Bouke C de Jong

    2016-01-01

    Background Phylogenetically distinct Mycobacterium tuberculosis lineages differ in their phenotypes and pathogenicity. Consequently, understanding mycobacterial population structures phylogeographically is essential for design, interpretation and generalizability of clinical trials. Comprehensive efforts are lacking to date to establish the West African mycobacterial population structure on a sub-continental scale, which has diagnostic implications and can inform the design of clinical TB tri...

  15. Specific detection of the cleavage activity of mycobacterial enzymes using a quantum dot based DNA nanosensor

    Jepsen, Morten Leth; Harmsen, Charlotte; Godbole, Adwait Anand; Nagaraja, Valakunja; Knudsen, Birgitta R.; Ho, Yi-Ping

    2015-12-01

    We present a quantum dot based DNA nanosensor specifically targeting the cleavage step in the reaction cycle of the essential DNA-modifying enzyme, mycobacterial topoisomerase I. The design takes advantages of the unique photophysical properties of quantum dots to generate visible fluorescence recovery upon specific cleavage by mycobacterial topoisomerase I. This report, for the first time, demonstrates the possibility to quantify the cleavage activity of the mycobacterial enzyme without the pre-processing sample purification or post-processing signal amplification. The cleavage induced signal response has also proven reliable in biological matrices, such as whole cell extracts prepared from Escherichia coli and human Caco-2 cells. It is expected that the assay may contribute to the clinical diagnostics of bacterial diseases, as well as the evaluation of treatment outcomes.We present a quantum dot based DNA nanosensor specifically targeting the cleavage step in the reaction cycle of the essential DNA-modifying enzyme, mycobacterial topoisomerase I. The design takes advantages of the unique photophysical properties of quantum dots to generate visible fluorescence recovery upon specific cleavage by mycobacterial topoisomerase I. This report, for the first time, demonstrates the possibility to quantify the cleavage activity of the mycobacterial enzyme without the pre-processing sample purification or post-processing signal amplification. The cleavage induced signal response has also proven reliable in biological matrices, such as whole cell extracts prepared from Escherichia coli and human Caco-2 cells. It is expected that the assay may contribute to the clinical diagnostics of bacterial diseases, as well as the evaluation of treatment outcomes. Electronic supplementary information (ESI) available: Characterization of the QD-based DNA Nanosensor. See DOI: 10.1039/c5nr06326d

  16. Who Has Mycobacterial Disease? A Cross Sectional Study in Agropastoral Communities in Tanzania.

    Andrew Martin Kilale

    Full Text Available To determine and describe clinical symptoms, demographic characteristics and environmental exposures as determinants of pulmonary mycobacterial diseases among patients examined for tuberculosis in agropastoral communities in Northern Tanzania.This was a cross sectional study. Sputum samples were collected from patients attending three hospitals in Tanzania, and were investigated for pulmonary tuberculosis by microscopy between November 2010 and June 2012. The patients were interviewed about background information, and potential exposure to mycobacteria.We examined 1,711 presumptive tuberculosis cases where 936 (54.2% were males and 775 (45.3% females. Of all the study participants, 277 (16% were found to have sputum samples positive for mycobacteria; 228 (13% were smear positive, 123 (7% were culture positive and 74 (4% were positive by both smear microscopy and culture. Of the 123 mycobacterial culture positive, 15 (12.2% had non-tuberculous mycobacteria. Males were more likely than females to be positive for mycobacteria. Factors associated with mycobacterial disease were loss of appetite, age groups below 41 years, and being a male. Among HIV negative patients, loss of appetite, age below 20 years and being a male were associated with being mycobacterial positive. Among HIV positive patients, males and those patients with a persistently coughing family member were more likely to harbor mycobacteria.The findings in this study show that both M. tuberculosis and non-tuberculous mycobacterial strains were prevalent in the study community. Some risk factors were identified. Although the reported predictors may improve screening for mycobacterial diseases, their use requires some precaution.

  17. Mycobacterial DNA Extraction for Whole-Genome Sequencing from Early Positive Liquid (MGIT) Cultures

    Votintseva, Antonina A.; Pankhurst, Louise J.; Anson, Luke W.; Morgan, Marcus R.; Gascoyne-Binzi, Deborah; Walker, Timothy M; Quan, T. Phuong; Wyllie, David H; Del Ojo Elias, Carlos; Wilcox, Mark; Walker, A. Sarah; Peto, Tim E A; Crook, Derrick W.

    2015-01-01

    We developed a low-cost and reliable method of DNA extraction from as little as 1 ml of early positive mycobacterial growth indicator tube (MGIT) cultures that is suitable for whole-genome sequencing to identify mycobacterial species and predict antibiotic resistance in clinical samples. The DNA extraction method is based on ethanol precipitation supplemented by pretreatment steps with a MolYsis kit or saline wash for the removal of human DNA and a final DNA cleanup step with solid-phase reve...

  18. Mycobacterial DNA extraction for whole-genome sequencing from early positive liquid (MGIT) cultures

    Votintseva, AA; Pankhurst, LJ; Anson, LW; Morgan, *; Gascoyne-Binzi, D.; Walker, TM; quan, TP; Wyllie, DH; Del Ojo Elias, C; Wilcox, M; Walker, AS; Peto, TE; Crook, DW

    2015-01-01

    We developed a low-cost and reliable method of DNA extraction from as little as 1 ml of early positive mycobacterial growth indicator tube (MGIT) cultures that is suitable for whole-genome sequencing to identify mycobacterial species and predict antibiotic resistance in clinical samples. The DNA extraction method is based on ethanol precipitation supplemented by pretreatment steps with a MolYsis kit or saline wash for the removal of human DNA and a final DNA cleanup step with solid-phase reve...

  19. Characterisation of the mycobacterial NER system reveals novel functions of uvrD1 helicase

    Güthlein, C; Wanner, R M; Sander, P; Davis, E O; Bosshard, M.; Jiricny, J; Böttger, E C; Springer, B.

    2009-01-01

    In this study, we investigated the role of the nucleotide excision repair (NER) pathway in mycobacterial DNA repair. Mycobacterium smegmatis lacking the NER excinuclease component uvrB, the helicase uvrD1 and a double knock-out lacking both proteins were constructed and their sensitivity to a series of DNA damaging agents wa analysed. As anticipated, the mycobacterial NER system was shown to be involved in the processing of bulky DNA adducts and inter-strand cross-links. In addition, it coul...

  20. Non-major histocompatibility complex-restricted cytotoxic activity of blood mononuclear cells stimulated with secreted mycobacterial proteins and other mycobacterial antigens

    Ravn, P; Pedersen, B K

    1994-01-01

    Several observations indicate that non-major histocompatibility complex (MHC)-restricted cytotoxicity, mediated for example by natural killer cells and lymphokine-activated killer cells, may serve as an important antimicrobial defense mechanism. The purpose of the present study was to investigate...... the influences of different mycobacterial antigens on non-MHC-restricted cytotoxicity and further to investigate the ways by which various lymphocyte subpopulations contribute to the development of this cytotoxicity. Non-MHC-restricted cytotoxicity was induced following stimulation of mononuclear...... interferon. The CD4+ cells proliferated and expressed interleukin-2 receptors following stimulation with mycobacterial antigens.Depletion studies after antigen stimulation showed that the cytotoxic effector cells were CD16+ CD56+ and CD4-; the CD4+ cells alone did not mediate non-MHC-restricted cytotoxicity...

  1. Nontuberculous Mycobacterial Disease Is Not a Contraindication to Lung Transplantation in Patients With Cystic Fibrosis

    Qvist, Tavs; Pressler, Tanja; Thomsen, V O;

    2013-01-01

    Whether nontuberculous mycobacterial (NTM) disease is a contraindication to lung transplantation remains controversial. We conducted a nationwide study to evaluate the clinical importance of NTM infection among lung transplant patients with cystic fibrosis (CF) in Denmark and to determine if NTM...

  2. Differential Immune Responses and Protective Effects in Avirulent Mycobacterial Strains Vaccinated BALB/c Mice.

    Liu, Laicheng; Fu, Ruiling; Yuan, Xuefeng; Shi, Chunwei; Wang, Shuling; Lu, Xianyu; Ma, Zhao; Zhang, Xiaoming; Qin, Weiyan; Fan, Xionglin

    2015-07-01

    Screening live mycobacterial vaccine candidates is the important strategy to develop new vaccines against adult tuberculosis (TB). In this study, the immunogenicity and protective efficacy of several avirulent mycobacterial strains including Mycobacterium smegmatis, M. vaccae, M. terrae, M. phlei, M. trivial, and M. tuberculosis H37Ra were compared with M. bovis BCG in BALB/c mice. Our results demonstrated that differential immune responses were induced in different mycobacterial species vaccinated mice. As BCG-vaccinated mice did, M. terrae immunization resulted in Th1-type responses in the lung, as well as splenocytes secreting IFN-γ against a highly conserved mycobacterial antigen Ag85A. M. smegmatis also induced the same splenocytes secreting IFN-γ as BCG and M. terrae did. In addition, M. terrae and M. smegmatis-immunized mice predominantly increased expression of IL-10 and TGF-β in the lung. Most importantly, mice vaccinated with H37Ra and M. vaccae could provide the same protection in the lung against virulent M. tuberculosis challenge as BCG. The result may have important implications in developing adult TB vaccine. PMID:25995039

  3. Nontuberculous Mycobacterial Tenosynovitis: A Case Report and Review of the Literature

    Liang-De Jiang

    2015-12-01

    Full Text Available Nontuberculous mycobacteria tenosynovitis is a rare clinical condition that commonly affects the hand and wrist. It is also a condition that is difficult to diagnose through clinical and roentgenological methods. In this study, a case of nontuberculous mycobacterial tenosynovitis infected by Mycobacterium marinum, which can be easily misdiagnosed, was reported and its imaging findings discussed.

  4. Mycobacterial antigen 85 complex (Ag85) as a target for ficolins and mannose-binding lectin.

    Świerzko, Anna S; Bartłomiejczyk, Marcin A; Brzostek, Anna; Łukasiewicz, Jolanta; Michalski, Mateusz; Dziadek, Jarosław; Cedzyński, Maciej

    2016-06-01

    The pattern recognition molecules (PRMs) able to activate complement via the lectin pathway are suspected to be involved in the interaction between pathogenic Mycobacteria and the host immune response. Recently, we have found strong interactions between 25 and 35kDa mycobacterial cell fractions and mannose-binding lectin (MBL) and ficolins. Here we demonstrate that two biologically important mycobacterial structures, mannosylated lipoarabinomannan (ManLAM) and the antigen 85 (Ag85) complex, induce activation of the lectin pathway of complement. The strong interaction of recombinant MBL with purified ManLAM was confirmed, but no binding of recombinant ficolins (ficolin-1, -2, -3) with this structure was observed. Interestingly, all PRMs tested reacted with the mycobacterial antigen 85 (Ag85) complex. Based on the use of specific inhibitors (mannan for MBL, acetylated bovine serum albumin for ficolin-1 and -2, Hafnia alvei PCM 1200 lipopolysaccharide for ficolin-3), we concluded that carbohydrate-recognition (MBL) and fibrinogen-like domains (ficolins) were involved in these interactions. Our results indicate that the mycobacterial antigen 85 complex is a target for ficolins and MBL. Furthermore, those PRMs also bound to fibronectin and therefore might influence the Ag85 complex-dependent interaction of Mycobacterium with the extracellular matrix. PMID:27141819

  5. Missense splice variant (g.20746A>G, p.Ile183Val) of interferon gamma receptor 1 (IFNGR1) coincidental with mycobacterial osteomyelitis - a screen of osteoarticular lesions.

    Bińczak-Kuleta, Agnieszka; Szwed, Aleksander; Walter, Mark R; Kołban, Maciej; Ciechanowicz, Andrzej; Clark, Jeremy S C

    2016-08-01

    Previously, dominant partial interferon-gamma receptor 1 (IFN-g-R1) susceptibility to environmental mycobacteria was found with IFNGR1 deletions or premature stop. Our aim was to search for IFNGR1 variants in patients with mycobacterial osteoarticular lesions. Biopsies from the patients were examined for acid-fast bacilli, inflammatory cell infiltration, and mycobacterial niacin. Mycobacterial rRNA was analyzed using a target-amplified rRNA probe test. Peripheral-blood-leukocyte genomic DNA was isolated from 19 patients using the QIAamp DNA Mini Kit, and all IFNGR1 exons were sequenced using an ABIPRISM 3130 device. After the discovery of an exon 5 variant, a Polish newborn population sample (n = 100) was assayed for the discovered variant. Splice sites and putative amino acid interactions were analyzed. All patients tested were positive for mycobacteria; one was heterozygous for the IFNGR1 exon 5 single-nucleotide-missense substitution (g.20746A>G, p.Ile183Val). No other variant was found. The splice analysis indicated the creation of an exonic splicing silencer, and alternatively, molecular graphics indicated that the p.Ile183Val might alter beta-strand packing (loss of van der Waals contacts; Val183/Pro205), possibly altering the IFN-g-R1/IFN-g-R2 interaction. The probability of non-deleterious variant was estimated as genes affecting Type 1 T-helper-cell-mediated immunity. PMID:27483180

  6. Multiplex PCR assay for immediate identification of the infecting species in patients with mycobacterial disease.

    Kox, L F; Jansen, H M; Kuijper, S; Kolk, A H

    1997-01-01

    Rapid identification of infecting mycobacterial species enables appropriate medical care decisions to be made. Our aim was to demonstrate the clinical usefulness of the multiplex PCR assay, a test based on PCR, which permits direct identification of 12 mycobacterial species in clinical specimens. A total of 259 specimens from 177 patients who had clinical symptoms of mycobacterial disease but for whom there were difficulties in diagnosis were tested. Specimens were analyzed within 48 h of receipt of the sample. Mycobacteria were identified in 102 specimens; 66 specimens contained nontuberculous mycobacteria, and 36 specimens contained Mycobacterium tuberculosis complex mycobacteria. The PCR assay identified the mycobacterial species in 43 (97.7%) of 44 microscopy- and culture-positive specimens and in 15 (93.8%) of 16 culture-positive, microscopy-negative specimens. It also permitted species identification in infections caused by more than one mycobacterial species. For 56 (96.5%) of the 58 specimens from patients with infections caused by opportunistic mycobacteria, the organisms were identified with the PCR assay. The test was useful also for the identification of fastidious mycobacteria, e.g., M. genavense, and those that cannot be cultured, e.g., M. leprae. After resolution of discrepant results, the sensitivity of the PCR assay was 97.9%, the specificity was 96.9%, the positive predictive value was 95.0%, and the negative predictive value was 98.7%. For culture these values were 60.8, 100, 100, and 81.0%, respectively. Thus, the multiplex PCR assay enables prompt diagnosis when rapid identification of infecting mycobacteria is necessary. PMID:9163468

  7. A SHORT INTERFERING RNA MOLECULAR BEACON FOR THE ATTENUATION OF MYCOBACTERIAL INFECTION

    Remo George

    2014-01-01

    Full Text Available The ability of the pathogen Mycobacterium Tuberculosis (MTB to invade and survive within macrophages of granulomas is attributed to the product of the Mammalian Cell Entry (MCE operon whose gene, mce4A, encodes a cholesterol transporter that transports host lipids into the bacterium that allows the bacterium to survive during chronic infection. Here, we proposed and tested the hypothesis that a mce4A siRNA molecular beacon can be used to attenuate mycobacterial infection in macrophages. Mce4A gene was cloned and expressed in E. coli (E. coli-4A and differentiated U937 cells were transduced with piLenti-siRNA-GFP phage expressing the mce4A siRNA for 24 h. This was followed by infection with either E. coli-4A or M. smegmatis for 3 h followed by incubation for 0, 3, 6, 24 and 48 h. The cells were lysed and the lysates were plated on LB agar plates containing ampicillin (100 µg mL-1 or on 7H11 media and incubated at 37°C overnight. Our results showed that the siRNA treatment attenuated E.coli-4A infection in macrophages at 3, 6, 24 and 48 h by 0, 77, 59.6 and 99.7%, respectively. Our results also showed that the siRNA treatment attenuated M. smegmatis infection in macrophages at 3, 6, 24 and 48 h. by 94.8, 70.3, 98.9 and 93.4%, respectively. In conclusion, a mce4A siRNA molecular beacon was successfully delivered and stably expressed in macrophages which attenuated E. coli expressing mce4A (E. coli-4A and M. smegmatis infection in macrophages.

  8. Isolation of Mycobacterium fortuitum from fish tanks in Alborz, Iran.

    Shirin Akbari

    2014-08-01

    Full Text Available Fish mycobacteriosis is caused by the non-tuberculous mycobacteria. Infected fish are normally the primary source of infection, although non-tuberculous Mycobacteria can be found in the environment. The present study was designed to investigate the few recently found suspected cases of mycobacteriosis in Iranian ornamental fish tanks.Pathological specimens including granolumas from autopsied fish were used to inoculate Lowenstein-Jensen medium. Genomic material was extracted from all acid-fast positive cultures. The mycobacterial identity of bacterial isolates was authenticated using a PCR assessment targeting a 543 bp-long stretch of 16Sr RNA gene. Further more, a PCR assessment targeting a 294 bp-long stretch of heat shock protein hsp65 was performed and the amplicons were sequenced to identify the isolates.Characteristic mycobacterial bacilli were identified both in light and fluorescent microscopy of bacterial culture from all the suspected specimens. PCR-amplification of DNA templates from all isolates successfully resulted in production of the expected products. Existence of Mycobacterium fortuitum was confirmed by comparison analysis of nucleotide sequencing at hsp65 gene.The present work clearly shows mycobacteria are important in pathology of ornamental fish diseases. People who are keeping fish as pet in their homes should be cantioned about the bacterial contamination risks arise from close contact with exotic ornamental species of fish.

  9. Molecular and Physiological Effects of Mycobacterial oxyR Inactivation

    Pagán-Ramos, Eileen; Master, Sharon S.; Pritchett, Christopher L.; Reimschuessel, Renate; Trucksis, Michele; Timmins, Graham S.; Deretic, Vojo

    2006-01-01

    The majority of slow-growing mycobacteria have a functional oxyR, the central regulator of the bacterial oxidative stress response. In contrast, this gene has been inactivated during the evolution of Mycobacterium tuberculosis. Here we inactivated the oxyR gene in Mycobacterium marinum, an organism used to model M. tuberculosis pathogenesis. Inactivation of oxyR abrogated induction of ahpC, a gene encoding alkylhydroperoxide reductase, normally activated upon peroxide challenge. The absence o...

  10. Transcriptome Analysis Reveals Novel Entry Mechanisms and a Central Role of SRC in Host Defense during High Multiplicity Mycobacterial Infection.

    Jay Zhang

    Full Text Available Mycobacterium tuberculosis (MTB infects an estimated one-third of the global population and is one of the main causes of mortality from an infectious agent. The characteristics of macrophages challenged by MTB with a high multiplicity of infection (MOI, which mimics both clinical disseminated infection and granuloma formation, are distinct from macrophages challenged with a low MOI. To better understand the cross talk between macrophage host cells and mycobacteria, we compared the transcription patterns of mouse macrophages infected with bacille Calmette-Guérin, H37Ra and M. smegmatis. Attention was focused on the changes in the abundance of transcripts related to immune system function. From the results of a transcriptome profiling study with a high mycobacterial MOI, we defined a pathogen-specific host gene expression pattern. The present study suggests that two integrins, ITGA5 and ITGAV, are novel cell surface receptors mediating mycobacterium entry into macrophages challenged with high MOI. Our results indicate that SRC likely plays a central role in regulating multiple unique signaling pathways activated by MTB infection. The integrated results increase our understanding of the molecular networks behind the host innate immune response and identify important targets that might be useful for the development of tuberculosis therapy.

  11. Bacillus Calmette-Guerin Infection in NADPH Oxidase Deficiency: Defective Mycobacterial Sequestration and Granuloma Formation

    Deffert, Christine; Schäppi, Michela G.; Pache, Jean-Claude; Cachat, Julien; Vesin, Dominique; Bisig, Ruth; Ma Mulone, Xiaojuan; Kelkka, Tiina; Holmdahl, Rikard; Garcia, Irène; Olleros, Maria-Luisa; Krause, Karl-Heinz

    2014-01-01

    Patients with chronic granulomatous disease (CGD) lack generation of reactive oxygen species (ROS) through the phagocyte NADPH oxidase NOX2. CGD is an immune deficiency that leads to frequent infections with certain pathogens; this is well documented for S. aureus and A. fumigatus, but less clear for mycobacteria. We therefore performed an extensive literature search which yielded 297 cases of CGD patients with mycobacterial infections; M. bovis BCG was most commonly described (74%). The rela...

  12. Six recommendations for improving monitoring of diseases shared with wildlife: examples regarding mycobacterial infections in Spain

    Boadella, Mariana; Gortazar, Christian; Acevedo, Pelayo; Carta, Tania; Martín-Hernando, María Paz; Fuente, José; Vicente, Joaquín

    2011-01-01

    Abstract Monitoring is needed to identify changes in disease occurrence and to measure the impact of intervention. Using mycobacterial diseases as an example, we discuss herein the pros and cons of the current Spanish Wildlife Disease Surveillance Scheme providing suggestions for monitoring relevant diseases shared with wildlife in other regions facing similar challenges. Six points should be considered. This includes: (1) making sure the disease is properly monitored in the releva...

  13. Development of a Murine Mycobacterial Growth Inhibition Assay for Evaluating Vaccines against Mycobacterium tuberculosis▿ †

    Parra, Marcela; Yang, Amy L.; Lim, Jaehyun; Kolibab, Kristopher; Derrick, Steven; Cadieux, Nathalie; Perera, Liyanage P.; Jacobs, William R.; Brennan, Michael; Morris, Sheldon L.

    2009-01-01

    The development and characterization of new tuberculosis (TB) vaccines has been impeded by the lack of reproducible and reliable in vitro assays for measuring vaccine activity. In this study, we developed a murine in vitro mycobacterial growth inhibition assay for evaluating TB vaccines that directly assesses the capacity of immune splenocytes to control the growth of Mycobacterium tuberculosis within infected macrophages. Using this in vitro assay, protective immune responses induced by immu...

  14. Biochip System for Rapid and Accurate Identification of Mycobacterial Species from Isolates and Sputum▿

    Zhu, Lingxiang; Jiang, Guanglu; Wang, Shengfen; Wang, Can; Li, Qiang; Yu, Hao; Zhou, Yang; Zhao, Bing; Huang, Hairong; Xing, Wanli; Mitchelson, Keith; Cheng, Jing; Zhao, Yanlin; Guo, Yong

    2010-01-01

    The accurate detection of mycobacterial species from isolates and clinical samples is important for pathogenic diagnosis and treatment and for disease control. There is an urgent need for the development of a rapid, simple, and accurate detection method. We established a biochip assay system, including a biochip, sample preparation apparatus, hybridization instrument, chip washing machine, and laser confocal scanner equipped with interpretation software for automatic diagnosis. The biochip si...

  15. Optimizing Mycobacterial Culture in Smear-Negative, Human Immunodeficiency Virus-Infected Tuberculosis Cases

    Ismail, N. A.; Said, H. M.; Pinini, Z.; S.V. Omar; Beyers, N; Naidoo, P

    2015-01-01

    Introduction Tuberculosis (TB) is a significant public health problem and the diagnosis in human immunodeficiency virus (HIV)—infected individuals is challenging. The use of mycobacterial culture remains an important complementary tool and optimizing it has important benefits. We sought to determine the effect of an increase in the number of specimens evaluated, addition of nutritional supplementation to the culture medium, sputum appearance and volume on diagnostic yield and time to detectio...

  16. Osteopontin Expression Correlates with Clinical Outcome in Patients with Mycobacterial Infection

    Nau, Gerard J.; Chupp, Geoffrey L.; Emile, Jean-François; Jouanguy, Emmanuelle; Berman, Jeffrey S.; Casanova, Jean-Laurent; Young, Richard A.

    2000-01-01

    Osteopontin (OPN) is a protein that is expressed in chronic inflammatory diseases including tuberculosis, and its deficiency predisposes to more severe mycobacterial infections in mice. However, no reports have identified altered OPN expression in, or correlated these alterations to, infections in humans. The data presented herein identify alterations in the tissue expression of OPN protein and describe an inverse correlation between these levels and disease progression after inoculation of M...

  17. Relationships between Mycobacterium Isolates from Patients with Pulmonary Mycobacterial Infection and Potting Soils▿ †

    De Groote, Mary Ann; Pace, Norman R.; Fulton, Kayte; Joseph O. Falkinham

    2006-01-01

    High numbers of mycobacteria, including known pathogenic species such as Mycobacterium avium, Mycobacterium intracellulare, and Mycobacterium chelonae, were recovered from aerosols produced by pouring commercial potting soil products and potting soil samples provided by patients with pulmonary mycobacterial infections. The dominant mycobacteria in the soil samples corresponded to the dominant species implicated clinically. Profiles of large restriction fragments obtained by pulsed-field gel e...

  18. Recognition of the mycobacterial cord factor by Mincle: relevance for granuloma formation and resistance to tuberculosis

    Roland eLang

    2013-01-01

    The world’s most successful intracellular bacterial pathogen, Mycobacterium tuberculosis (MTB), survives inside macrophages by blocking phagosome maturation and establishes chronic infection characterized by the formation of granulomas. Trehalose-6,6-dimycolate (TDM), the mycobacterial cord factor, is the most abundant cell wall lipid of virulent mycobacteria, is sufficient to cause granuloma formation, and has long been known to be a major virulence factor of MTB. Recently, TDM has been show...

  19. Recognition of the mycobacterial cord factor by Mincle: relevance for granuloma formation and resistance to tuberculosis

    Lang, Roland

    2013-01-01

    The world's most successful intracellular bacterial pathogen, Mycobacterium tuberculosis (MTB), survives inside macrophages by blocking phagosome maturation and establishes chronic infection characterized by the formation of granulomas. Trehalose-6,6-dimycolate (TDM), the mycobacterial cord factor, is the most abundant cell wall lipid of virulent mycobacteria, is sufficient to cause granuloma formation, and has long been known to be a major virulence factor of MTB. Recently, TDM has been show...

  20. Acid-Fast Staining and Petroff Hausser Chamber Counting of Mycobacterial Cells in Liquid Suspension

    Treuer, Robin; Haydel, Shelley E.

    2011-01-01

    Accurate and rapid cell counts of mycobacterial species in culture are difficult to obtain. Here, a method using modified Kinyoun acid-fast staining was adapted for use with a Petroff-Hausser sperm and bacteria cell counting chamber by using a liquid suspension staining technique. Cell counts obtained by this method were compared to viable cell counts by agar plate counting, revealing accurate correlation.

  1. Searching for proteins of subspecies with diagnostic potential by comparative qualitative proteomic analysis of mycobacterial tuberculins

    Santema, Wiebren; Overdijk, Marije; Barends, Judith; Krijgsveld, Jeroen; Rutten, Victor; Koets, Ad

    2009-01-01

    Abstract Accurate immunodiagnosis of bovine paratuberculosis is among others hampered by the lack of specific antigens. One of the most frequently used antigen preparations is purified protein derivative (PPD), also known as tuberculin. This crude extract has limitations when used in diagnostic assays due to the presence of cross-reactive antigens. The aim of the current study was to systematically analyze the qualitative protein composition of PPD of the major mycobacterial pathog...

  2. Mycobacterial DNA extraction for whole-genome sequencing from early positive liquid (MGIT) cultures.

    Votintseva, Antonina A; Pankhurst, Louise J; Anson, Luke W; Morgan, Marcus R; Gascoyne-Binzi, Deborah; Walker, Timothy M; Quan, T Phuong; Wyllie, David H; Del Ojo Elias, Carlos; Wilcox, Mark; Walker, A Sarah; Peto, Tim E A; Crook, Derrick W

    2015-04-01

    We developed a low-cost and reliable method of DNA extraction from as little as 1 ml of early positive mycobacterial growth indicator tube (MGIT) cultures that is suitable for whole-genome sequencing to identify mycobacterial species and predict antibiotic resistance in clinical samples. The DNA extraction method is based on ethanol precipitation supplemented by pretreatment steps with a MolYsis kit or saline wash for the removal of human DNA and a final DNA cleanup step with solid-phase reversible immobilization beads. The protocol yielded ≥0.2 ng/μl of DNA for 90% (MolYsis kit) and 83% (saline wash) of positive MGIT cultures. A total of 144 (94%) of the 154 samples sequenced on the MiSeq platform (Illumina) achieved the target of 1 million reads, with 90% coverage achieved. The DNA extraction protocol, therefore, will facilitate fast and accurate identification of mycobacterial species and resistance using a range of bioinformatics tools. PMID:25631807

  3. Rapid detection and differentiation of mycobacterial species using a multiplex PCR system

    Andrea Santos Lima

    2013-07-01

    Full Text Available Introduction The early diagnosis of mycobacterial infections is a critical step for initiating treatment and curing the patient. Molecular analytical methods have led to considerable improvements in the speed and accuracy of mycobacteria detection. Methods The purpose of this study was to evaluate a multiplex polymerase chain reaction system using mycobacterial strains as an auxiliary tool in the differential diagnosis of tuberculosis and diseases caused by nontuberculous mycobacteria (NTM Results Forty mycobacterial strains isolated from pulmonary and extrapulmonary origin specimens from 37 patients diagnosed with tuberculosis were processed. Using phenotypic and biochemical characteristics of the 40 mycobacteria isolated in LJ medium, 57.5% (n=23 were characterized as the Mycobacterium tuberculosis complex (MTBC and 20% (n=8 as nontuberculous mycobacteria (NTM, with 22.5% (n=9 of the results being inconclusive. When the results of the phenotypic and biochemical tests in 30 strains of mycobacteria were compared with the results of the multiplex PCR, there was 100% concordance in the identification of the MTBC and NTM species, respectively. A total of 32.5% (n=13 of the samples in multiplex PCR exhibited a molecular pattern consistent with NTM, thus disagreeing with the final diagnosis from the attending physician. Conclusions Multiplex PCR can be used as a differential method for determining TB infections caused by NTM a valuable tool in reducing the time necessary to make clinical diagnoses and begin treatment. It is also useful for identifying species that were previously not identifiable using conventional biochemical and phenotypic techniques.

  4. Mycobacterial laminin-binding histone-like protein mediates collagen-dependent cytoadherence

    André Alves Dias

    2012-12-01

    Full Text Available When grown in the presence of exogenous collagen I, Mycobacterium bovis BCG was shown to form clumps. Scanning electron microscopy examination of these clumps revealed the presence of collagen fibres cross-linking the bacilli. Since collagen is a major constituent of the eukaryotic extracellular matrices, we assayed BCG cytoadherence in the presence of exogenous collagen I. Collagen increased the interaction of the bacilli with A549 type II pneumocytes or U937 macrophages, suggesting that BCG is able to recruit collagen to facilitate its attachment to host cells. Using an affinity chromatography approach, we have isolated a BCG collagen-binding protein corresponding to the previously described mycobacterial laminin-binding histone-like protein (LBP/Hlp, a highly conserved protein associated with the mycobacterial cell wall. Moreover, Mycobacterium leprae LBP/Hlp, a well-characterized adhesin, was also able to bind collagen I. Finally, using recombinant fragments of M. leprae LBP/Hlp, we mapped the collagen-binding activity within the C-terminal domain of the adhesin. Since this protein was already shown to be involved in the recognition of laminin and heparan sulphate-containing proteoglycans, the present observations reinforce the adhesive activities of LBP/Hlp, which can be therefore considered as a multifaceted mycobacterial adhesin, playing an important role in both leprosy and tuberculosis pathogenesis.

  5. Recombinant gamma interferon for the treatment of pulmonary and mycobacterial diseases

    An increased antibiotic resistance is described for Mycobacterium tuberculosis and atypical mycobacterial species; therefore, new treatments are required. Immunocompromised patients have increased risk, as demonstrated by complications after BCG vaccination. On the other hand, idiopathic pulmonary fibrosis is a fatal disease, with no therapy available to modify course of the disease. Gamma interferon (IFN-γ) plays an essential role as main activator of cytokine secretion in macrophages, also showing a potent anti-fibrotic effects. To evaluate the adjuvant effect of IFN-γ on these three clinical scenarios, five clinical trials were carried out. Patients treated with IFN gamma had satisfactory response according to clinical, imaging and functional criteria since their first evaluations, significantly improving when compared to the control group receiving placebo in a study of pulmonary atypical mycobacteriosis. Fast sputum conversion was obtained in mycobacterial infections, including tuberculosis. In the idiopathic pulmonary fibrosis study, 75% of treated patients were considered as responders (improvement + stable). Here we report the cases of two nursing babies with suppurative regional lymphadenitis caused by BCG, who were successfully treated with recombinant human IFN-γ. Treatment was well tolerated, with most of the adverse reactions corresponding to classical flu-like symptoms produced by the cytokine. We can conclude that IFN-γ is useful and well tolerated as adjuvant therapy in patients with pulmonary mycobacterial diseases or idiopathic pulmonary fibrosis. (author)

  6. Use of Molecular Methods To Identify the Mycobacterium tuberculosis Complex (MTBC) and Other Mycobacterial Species and To Detect Rifampin Resistance in MTBC Isolates following Growth Detection with the BACTEC MGIT 960 System

    Somoskovi, Akos; Song, Qunfeng; Mester, Judit; Tanner, Charise; Hale, Yvonne M.; Linda M. Parsons; Salfinger, Max

    2003-01-01

    A prospective study was organized by using a total of 1,585 consecutive clinical specimens to determine whether biomass obtained from positive growth in the MGIT 960 system could be used directly in AccuProbe DNA hybridization tests, the PCR-based Inno-LiPA Rif.TB (LiPA) assay, and a PCR-based DNA sequencing of the rpoB gene for the rapid identification of the Mycobacterium tuberculosis complex (MTBC) and other mycobacterial species and for the determination of rifampin (RIF) resistance in MT...

  7. Identification of drug susceptibility pattern and mycobacterial species in sputum smear positive pulmonary tuberculosis patients with and without HIV co-infection in north west Ethiopia

    Mekonen, Mekdem; Abate, Ebba; Aseffa, Abraham;

    2010-01-01

    Ethiopia is among the high-burden countries of tuberculosis (TB) in the world Since mycobacterial culture and susceptibility testing are not routinely performed in Ethiopia, recent data on susceptibility patterns and the mycobacterial species cultured from sputum smear positive patients are limited....

  8. Solar disinfection of MODS mycobacterial cultures in resource-poor settings.

    Ruvandhi Nathavitharana

    Full Text Available INTRODUCTION: Safe disposal of TB culture material in which the infectious burden of clinical samples has been greatly amplified is an important challenge in resource-limited settings. The bactericidal capacity of solar cookers has been demonstrated previously for conventional bacteria and contaminated clinical waste. We investigated the use of a simple solar cooker for the sterilization of mycobacterial broth cultures from the microscopic observation drug susceptibility assay (MODS. METHODS: Simulated TB culture materials were prepared by inoculating 24-well MODS plates with 500 microL of a known concentration of Mycobacterium bovis BCG. In a series of experiments, samples were simultaneously placed inside a box-type solar cooker and control box and removed at timepoints between 15 minutes and 6 hours. Quantitative cultures were performed using retrieved samples to determine sterilization effect. RESULTS: All cultures from the control box were positive at or within 1-4 logs of inoculation concentration. Simulated culture plates at concentrations from 10(3 colony-forming-units (CFU/ml to 10(7 CFU/ml were completely sterilized after only one hour of cooker exposure, at temperatures between 50-102 degrees C. At 10(9 CFU/ml (far in excess of diagnostic cultures, it was only possible to recover mycobacterial growth in plates removed after 15 minutes. By 30 minutes all plates were effectively sterilized. DISCUSSION: Solar disinfection provides a very effective, safe and low-cost alternative to conventional equipment used for disposal of mycobacterial culture material. Effect of climatic conditions and optimal operating procedure remain to be defined.

  9. Characterization and comparison of mycobacterial antigens by two-dimensional immunoelectrophoresis.

    Roberts, D B; Wright, G L; Affronti, L F; Reich, M

    1972-10-01

    Two-dimensional immunoelectrophoresis (2D-IEP), in which a complex of antigens is subjected to electrophoresis first through an agarose matrix in one direction and secondly through an antiserum-agarose matrix at right angles to the first direction, was evaluated as a tool for analysis of mycobacterial antigens. Cell extracts from four species of mycobacteria, Mycobacterium tuberculosis (four strains), M. bovis strain BCG, M. scrofulaceum, and M. phlei, were assayed by 2D-IEP with four anti-mycobacterial antisera. Besides displaying the precipitin curves in a more easily interpreted format than did conventional immunoelectrophoresis (IEP), 2D-IEP offered greater sensitivity in terms of numbers of precipitin curves when like reactions were compared with IEP patterns. As many as 60 immunoprecipitates were observed on 2D-IEP slides compared to 18 on comparable IEP plates. Technical reproducibility of patterns from run to run was excellent. Other parameters, such as the influence of using different batches of antigen on the pattern, are discussed. Each of the cell extract antigens gave a unique pattern of precipitin peaks which could be easily differentiated from the patterns given by the other mycobacterial cell extracts when reacted with any of the antisera in 2D-IEP. Since both the species and strains of mycobacteria could be easily and reproducibly differentiated solely on the basis of two-dimensional immunoelectrophoretic patterns obtained with any of the antisera employed in this study, it may be possible, by using IEP, to differentiate and identify all species and strains of mycobacteria with one standard, highly sensitive antiserum, rather than a battery of antisera. PMID:4628899

  10. Human TYK2 deficiency: Mycobacterial and viral infections without hyper-IgE syndrome.

    Kreins, Alexandra Y; Ciancanelli, Michael J; Okada, Satoshi; Kong, Xiao-Fei; Ramírez-Alejo, Noé; Kilic, Sara Sebnem; El Baghdadi, Jamila; Nonoyama, Shigeaki; Mahdaviani, Seyed Alireza; Ailal, Fatima; Bousfiha, Aziz; Mansouri, Davood; Nievas, Elma; Ma, Cindy S; Rao, Geetha; Bernasconi, Andrea; Sun Kuehn, Hye; Niemela, Julie; Stoddard, Jennifer; Deveau, Paul; Cobat, Aurelie; El Azbaoui, Safa; Sabri, Ayoub; Lim, Che Kang; Sundin, Mikael; Avery, Danielle T; Halwani, Rabih; Grant, Audrey V; Boisson, Bertrand; Bogunovic, Dusan; Itan, Yuval; Moncada-Velez, Marcela; Martinez-Barricarte, Ruben; Migaud, Melanie; Deswarte, Caroline; Alsina, Laia; Kotlarz, Daniel; Klein, Christoph; Muller-Fleckenstein, Ingrid; Fleckenstein, Bernhard; Cormier-Daire, Valerie; Rose-John, Stefan; Picard, Capucine; Hammarstrom, Lennart; Puel, Anne; Al-Muhsen, Saleh; Abel, Laurent; Chaussabel, Damien; Rosenzweig, Sergio D; Minegishi, Yoshiyuki; Tangye, Stuart G; Bustamante, Jacinta; Casanova, Jean-Laurent; Boisson-Dupuis, Stéphanie

    2015-09-21

    Autosomal recessive, complete TYK2 deficiency was previously described in a patient (P1) with intracellular bacterial and viral infections and features of hyper-IgE syndrome (HIES), including atopic dermatitis, high serum IgE levels, and staphylococcal abscesses. We identified seven other TYK2-deficient patients from five families and four different ethnic groups. These patients were homozygous for one of five null mutations, different from that seen in P1. They displayed mycobacterial and/or viral infections, but no HIES. All eight TYK2-deficient patients displayed impaired but not abolished cellular responses to (a) IL-12 and IFN-α/β, accounting for mycobacterial and viral infections, respectively; (b) IL-23, with normal proportions of circulating IL-17(+) T cells, accounting for their apparent lack of mucocutaneous candidiasis; and (c) IL-10, with no overt clinical consequences, including a lack of inflammatory bowel disease. Cellular responses to IL-21, IL-27, IFN-γ, IL-28/29 (IFN-λ), and leukemia inhibitory factor (LIF) were normal. The leukocytes and fibroblasts of all seven newly identified TYK2-deficient patients, unlike those of P1, responded normally to IL-6, possibly accounting for the lack of HIES in these patients. The expression of exogenous wild-type TYK2 or the silencing of endogenous TYK2 did not rescue IL-6 hyporesponsiveness, suggesting that this phenotype was not a consequence of the TYK2 genotype. The core clinical phenotype of TYK2 deficiency is mycobacterial and/or viral infections, caused by impaired responses to IL-12 and IFN-α/β. Moreover, impaired IL-6 responses and HIES do not appear to be intrinsic features of TYK2 deficiency in humans. PMID:26304966

  11. The common mycobacterial antigens and their importance in the treatment of disease.

    Stanford, John; Stanford, Cynthia; Stansby, Gerard; Bottasso, Oscar; Bahr, Georges; Grange, John

    2009-01-01

    The mycobacteria are one of a number of genera making up the aerobic Actinomycetales. Their antigens demonstrable by immuno-precipitation methods can be divided into four groups. The group i antigens, common to all mycobacterial species, cross-react with their counterparts in animal cells, largely derived from mitochondria. Notable amongst these antigens are the heat-shock, or stress, proteins and possibly bacterial sugars. Tests of cell-mediated immunity show that people can be separated by their responsiveness in skin-test, or lymphocyte proliferation techniques, into four categories of responders. Category 1 individuals respond to all mycobacterial reagents through recognition of the group i antigens. Many chronic diseases are associated with a lack of cell-mediated responsiveness to the group i antigens, and have a raised antibody titre to them. This reflects a predominance of T helper 2 activity and reduced T helper 1 responsiveness as part of the pathogenesis of their diseases, which include chronic bacterial, viral and parasitic infections, allergies, auto-immunities and neoplasms. Packaged together, the group i antigens and the cell-wall adjuvants of selected aerobic Actinomycetales make potent immuno-modulatory reagents. An example is heat-killed Mycobacterium vaccae, useful in both prevention and treatment of disease. Treatment with such reagents results in alleviation of disease, restoration of cellular responsiveness to the common mycobacterial antigens and a decrease in antibody titres to them. This new approach to treatment for such a wide range of diseases has few disadvantageous side effects and can accompany other non-immunosuppressive therapies. PMID:19355964

  12. Human TYK2 deficiency: Mycobacterial and viral infections without hyper-IgE syndrome

    Kreins, Alexandra Y.; Ciancanelli, Michael J.; Okada, Satoshi; Kong, Xiao-Fei; Ramírez-Alejo, Noé; Kilic, Sara Sebnem; El Baghdadi, Jamila; Nonoyama, Shigeaki; Mahdaviani, Seyed Alireza; Ailal, Fatima; Bousfiha, Aziz; Mansouri, Davood; Nievas, Elma; Ma, Cindy S.; Rao, Geetha; Bernasconi, Andrea; Sun Kuehn, Hye; Niemela, Julie; Stoddard, Jennifer; Deveau, Paul; Cobat, Aurelie; El Azbaoui, Safa; Sabri, Ayoub; Lim, Che Kang; Sundin, Mikael; Avery, Danielle T.; Halwani, Rabih; Grant, Audrey V.; Boisson, Bertrand; Bogunovic, Dusan; Itan, Yuval; Moncada-Velez, Marcela; Martinez-Barricarte, Ruben; Migaud, Melanie; Deswarte, Caroline; Alsina, Laia; Kotlarz, Daniel; Klein, Christoph; Muller-Fleckenstein, Ingrid; Fleckenstein, Bernhard; Cormier-Daire, Valerie; Rose-John, Stefan; Picard, Capucine; Hammarstrom, Lennart; Puel, Anne; Al-Muhsen, Saleh; Abel, Laurent; Chaussabel, Damien; Rosenzweig, Sergio D.; Minegishi, Yoshiyuki; Tangye, Stuart G.; Bustamante, Jacinta; Casanova, Jean-Laurent

    2015-01-01

    Autosomal recessive, complete TYK2 deficiency was previously described in a patient (P1) with intracellular bacterial and viral infections and features of hyper-IgE syndrome (HIES), including atopic dermatitis, high serum IgE levels, and staphylococcal abscesses. We identified seven other TYK2-deficient patients from five families and four different ethnic groups. These patients were homozygous for one of five null mutations, different from that seen in P1. They displayed mycobacterial and/or viral infections, but no HIES. All eight TYK2-deficient patients displayed impaired but not abolished cellular responses to (a) IL-12 and IFN-α/β, accounting for mycobacterial and viral infections, respectively; (b) IL-23, with normal proportions of circulating IL-17+ T cells, accounting for their apparent lack of mucocutaneous candidiasis; and (c) IL-10, with no overt clinical consequences, including a lack of inflammatory bowel disease. Cellular responses to IL-21, IL-27, IFN-γ, IL-28/29 (IFN-λ), and leukemia inhibitory factor (LIF) were normal. The leukocytes and fibroblasts of all seven newly identified TYK2-deficient patients, unlike those of P1, responded normally to IL-6, possibly accounting for the lack of HIES in these patients. The expression of exogenous wild-type TYK2 or the silencing of endogenous TYK2 did not rescue IL-6 hyporesponsiveness, suggesting that this phenotype was not a consequence of the TYK2 genotype. The core clinical phenotype of TYK2 deficiency is mycobacterial and/or viral infections, caused by impaired responses to IL-12 and IFN-α/β. Moreover, impaired IL-6 responses and HIES do not appear to be intrinsic features of TYK2 deficiency in humans. PMID:26304966

  13. Antibodies against Mycobacterial Proteins as Biomarkers for HIV-Associated Smear-Negative Tuberculosis

    Siev, Michael; Wilson, Douglas; Kainth, Supreet; Kasprowicz, Victoria O.; Feintuch, Catherine M.; Jenny-Avital, Elizabeth R.; Achkar, Jacqueline M.

    2014-01-01

    Serology data are limited for patients with sputum smear-negative HIV-associated active tuberculosis (TB). We evaluated the serum antibody responses against the mycobacterial proteins MPT51, MS, and echA1 and the 38-kDa protein via enzyme-linked immunosorbent assay (ELISA) in South African (S.A.) HIV-positive (HIV+) smear-negative TB patients (n = 56), U.S. HIV+ controls with a positive tuberculin skin test (TST+; n = 21), and S.A. HIV-negative (HIV−) (n = 18) and HIV+ (n = 24) controls. TB p...

  14. A method to investigate protein association with intact sealed mycobacterial membrane vesicles.

    D'Lima, Nadia G; Teschke, Carolyn M

    2015-09-15

    In mycobacteria, probing the association of cytoplasmic proteins with the membrane itself, as well as with integral or peripheral membrane proteins, is limited by the difficulty in extracting intact sealed membrane vesicles due to the complex cell wall structure. Here we tested the association of Mycobacterium tuberculosis SecA1 and SecA2 proteins with intact membrane vesicles by a flotation assay using iodixanol density gradients. These protocols have wide applications for studying the association of other mycobacterial cytoplasmic proteins with the membrane and membrane-associated proteins. PMID:26099936

  15. Prevalence of non-tuberculous mycobacterial infections among tuberculosis suspects in Nigeria.

    Gambo Aliyu

    Full Text Available BACKGROUND: Nigeria is ranked in the top five countries for tuberculosis deaths worldwide. This study investigated the mycobacterial agents associated with presumptive clinical pulmonary tuberculosis (TB in Nigeria and evaluated the pattern and frequency of mycobacterial infections over twelve calendar months period. METHODS: Sputum samples from 1,603 consecutive new cases with presumptive diagnosis of TB were collected from August 2010 to July 2011. All sputum samples were incubated for detection of mycobacterial growth and those with positive acid fast bacilli (AFB growth were tested to detect mycobacterium tuberculosis (MTB complex and characterized to differentiate between MTB complex species. Cultures suggestive of Non-tuberculous mycobacterial infections (NTM were sub-cultured and characterized. RESULTS: Of the 1,603 patients screened, 444 (28% culture-positive cases of pulmonary tuberculosis were identified. Of these, 375 (85% were due to strains of MTB complex (354 cases of M. tuberculosis, 20 M. africanum and one case of M. bovis and 69 (15% were due to infection with NTM. In contrast to the MTB complex cases, the NTM cases were more likely to have been diagnosed during the calendar months of the Harmattan dust season (OR = 2.34, 1.28-4.29; p = 0.01, and aged older than 35 years (OR = 2.77, 1.52-5.02, p = 0.0007, but less likely to have AFB identified on their sputum smear (OR = 0.06, 0.02-0.14, p<0.0001. Among those with NTM infection, cases 35 years or younger were more likely to have co-infection with HIV (3.76, 1.72-8.22; p = 0.0009 compared to those older than 35 years. INTERPRETATION: The high proportion of younger patients with clinical pulmonary TB due to NTM and co-infection with HIV and the likely role of the seasonal dust exposure in the occurrence of the disease, present novel public health challenges for prevention and treatment.

  16. A chemically synthesized peptide which elicits humoral and cellular immune responses to mycobacterial antigens.

    Minden, P; Houghten, R A; Spear, J R; Shinnick, T M

    1986-01-01

    Monoclonal antibodies directed to Mycobacterium bovis BCG (BCG) and to M. tuberculosis H37Rv (H37Rv) were used in conjunction with affinity chromatography to prepare a mycobacterial component which was designated BCG-a. A synthetic peptide antigen was prepared based on the amino acid sequence of BCG-a and was designated BCG-a-P. Significant immunological similarities were found between BCG-a-P and antigens in extracts of BCG and H37Rv but not between BCG-a-P and antigens of nontuberculous myc...

  17. Domain Requirements for DNA Unwinding by Mycobacterial UvrD2, an Essential DNA Helicase†

    Sinha, Krishna Murari; Stephanou, Nicolas C.; Unciuleac, Mihaela-Carmen; Glickman, Michael S.; Shuman, Stewart

    2008-01-01

    Mycobacterial UvrD2 is a DNA-dependent ATPase with 3′ to 5′ helicase activity. UvrD2 is an atypical helicase, insofar as its N-terminal ATPase domain resembles the superfamily I helicases UvrD/PcrA, yet it has a C-terminal HRDC domain, which is a feature of RecQ-type superfamily II helicases. The ATPase and HRDC domains are connected by a CxxC-(14)-CxxC tetracysteine module that defines a new clade of UvrD2-like bacterial helicases found only in Actinomycetales. By characterizing truncated ve...

  18. Lipase Activity of Guinea Pig Peritoneal Macrophages and Mycobacterial Lipase Inhibitor

    Kiyotani, Katsuhiro; Tasaka, Hiromichi; Tsukiyama, Fumiaki; Matsuo, Yoshiyasu

    1983-01-01

    The interaction of mycobacterial lipase inhibitor (MLI), isolated from culture supernatant fluid of Mycobacterium tuberculosis strain H37Rv, and lipase from guinea pig peritoneal macrophages (GP-PMφs) was investigated fluorimetrically by the modified lipase assay system which had previously been proposed. Two peaks of lipase activity were observed in the enzyme preparation from GPPMφs. The activity of MLI against lipase from GP-PMφs was significantly high at acidic pH less than 5.0, and t...

  19. Novel TetR family transcriptional factor regulates expression of multiple transport-related genes and affects rifampicin resistance in Mycobacterium smegmatis.

    Liu, Huicong; Yang, Min; He, Zheng-Guo

    2016-01-01

    Transport-related genes significantly affect bacterial antibiotic resistance. However, the effects of these genes and their regulation of bacterial drug resistance in several mycobacterial species, including the fast-growing Mycobacterium smegmatis, the pathogen M. tuberculosis and M. avium have not been clearly characterized. We identified Ms4022 (MSMEG_4022) as a novel TetR family regulator that activates the expression of seven transport-related genes and affects drug resistance in M. smegmatis. Overexpression of Ms4022 inhibited M. smegmatis growth and enhanced mycobacterial resistance to the anti-tuberculosis drug rifampicin (RIF). By contrast, the Ms4022-deleted mycobacterial strain has shown sensitive to RIF. Ms4022 recognized three 19 bp non-palindromic motifs containing a 9 bp conserved region at their 5' end and it directly regulated seven transport-related genes, which affects mycobacterial resistance to RIF. Overexpression of three of seven transport-related genes (Ms1448, Ms1613, and Ms5278) inhibited the growth of M. smegmatis. This study improves our understanding of the function of mycobacterial transport-related genes and their regulation of bacterial drug resistance. PMID:27271013

  20. Characterization of two heparan sulphate-binding sites in the mycobacterial adhesin Hlp

    Previato Jose O

    2008-05-01

    Full Text Available Abstract Background The histone-like Hlp protein is emerging as a key component in mycobacterial pathogenesis, being involved in the initial events of host colonization by interacting with laminin and glycosaminoglycans (GAGs. In the present study, nuclear magnetic resonance (NMR was used to map the binding site(s of Hlp to heparan sulfate and identify the nature of the amino acid residues directly involved in this interaction. Results The capacity of a panel of 30 mer synthetic peptides covering the full length of Hlp to bind to heparin/heparan sulfate was analyzed by solid phase assays, NMR, and affinity chromatography. An additional active region between the residues Gly46 and Ala60 was defined at the N-terminal domain of Hlp, expanding the previously defined heparin-binding site between Thr31 and Phe50. Additionally, the C-terminus, rich in Lys residues, was confirmed as another heparan sulfate binding region. The amino acids in Hlp identified as mediators in the interaction with heparan sulfate were Arg, Val, Ile, Lys, Phe, and Thr. Conclusion Our data indicate that Hlp interacts with heparan sulfate through two distinct regions of the protein. Both heparan sulfate-binding regions here defined are preserved in all mycobacterial Hlp homologues that have been sequenced, suggesting important but possibly divergent roles for this surface-exposed protein in both pathogenic and saprophic species.

  1. Mycobacterial spindle cell pseudotumor of the appendix vermiformis in a patient with AIDS

    Basílio-de-Oliveira Carlos Alberto

    2001-01-01

    Full Text Available Mycobacterial pseudotumor (MP is a rare pathologic presentation of both Mycobacterium tuberculosis and non-tuberculous mycobacterial disease, hitherto reported to occur only in immunosuppressed patients with or without human immunodeficiency virus infection. This lesion shares close pathologic resemblance to certain mesenchymal neoplasms, particularly Kaposi's sarcoma (KS, from which it must be properly differentiated due to distinct prognosis and therapy. We report a case of MP obliterating the lumen of the appendix vermiformis in a 34-year-old patient who died of complications of AIDS at our hospital in Rio de Janeiro. A total of 24 cases of MP (including our patient have been described in the literature. MP has been found especially in lymph nodes, but extranodal lesions have been described in the skin, spleen, lung, bone marrow, brain and, in our patient, the appendix vermiformis. We offer a review of the other 23 published case reports of MP in both HIV-infected and uninfected patients and discuss the pathologic features that differentiate MP from KS.

  2. Development of a murine mycobacterial growth inhibition assay for evaluating vaccines against Mycobacterium tuberculosis.

    Parra, Marcela; Yang, Amy L; Lim, JaeHyun; Kolibab, Kristopher; Derrick, Steven; Cadieux, Nathalie; Perera, Liyanage P; Jacobs, William R; Brennan, Michael; Morris, Sheldon L

    2009-07-01

    The development and characterization of new tuberculosis (TB) vaccines has been impeded by the lack of reproducible and reliable in vitro assays for measuring vaccine activity. In this study, we developed a murine in vitro mycobacterial growth inhibition assay for evaluating TB vaccines that directly assesses the capacity of immune splenocytes to control the growth of Mycobacterium tuberculosis within infected macrophages. Using this in vitro assay, protective immune responses induced by immunization with five different types of TB vaccine preparations (Mycobacterium bovis BCG, an attenuated M. tuberculosis mutant strain, a DNA vaccine, a modified vaccinia virus strain Ankara [MVA] construct expressing four TB antigens, and a TB fusion protein formulated in adjuvant) can be detected. Importantly, the levels of vaccine-induced mycobacterial growth-inhibitory responses seen in vitro after 1 week of coculture correlated with the protective immune responses detected in vivo at 28 days postchallenge in a mouse model of pulmonary tuberculosis. In addition, similar patterns of cytokine expression were evoked at day 7 of the in vitro culture by immune splenocytes taken from animals immunized with the different TB vaccines. Among the consistently upregulated cytokines detected in the immune cocultures are gamma interferon, growth differentiation factor 15, interleukin-21 (IL-21), IL-27, and tumor necrosis factor alpha. Overall, we have developed an in vitro functional assay that may be useful for screening and comparing new TB vaccine preparations, investigating vaccine-induced protective mechanisms, and assessing manufacturing issues, including product potency and stability. PMID:19458207

  3. Macrophage and T cell dynamics during the development and disintegration of mycobacterial granulomas.

    Egen, Jackson G; Rothfuchs, Antonio Gigliotti; Feng, Carl G; Winter, Nathalie; Sher, Alan; Germain, Ronald N

    2008-02-01

    Granulomas play a key role in host protection against mycobacterial pathogens, with their breakdown contributing to exacerbated disease. To better understand the initiation and maintenance of these structures, we employed both high-resolution multiplex static imaging and intravital multiphoton microscopy of Mycobacterium bovis BCG-induced liver granulomas. We found that Kupffer cells directly capture blood-borne bacteria and subsequently nucleate formation of a nascent granuloma by recruiting both uninfected liver-resident macrophages and blood-derived monocytes. Within the mature granuloma, these myeloid cell populations formed a relatively immobile cellular matrix that interacted with a highly dynamic effector T cell population. The efficient recruitment of these T cells was highly dependent on TNF-alpha-derived signals, which also maintained the granuloma structure through preferential effects on uninfected macrophage populations. By characterizing the migration of both innate and adaptive immune cells throughout the process of granuloma development, these studies provide a new perspective on the cellular events involved in mycobacterial containment and escape. PMID:18261937

  4. Rapid susceptibility testing of Mycobacterium tuberculosis by bioluminescence assay of mycobacterial ATP

    Mycobacterial growth was monitored by bioluminescence assay of mycobacterial ATP. Cultures of Mycobacterium tuberculosis H37Rv and of 25 clinical isolates of the same species were exposed to serial dilutions of ethambutol, isoniazid, rifampin, and streptomycin. A suppression of ATP, indicating growth inhibition, occurred for susceptible but not resistant strains within 5 to 7 days of incubation. Breakpoint concentrations between susceptibility and resistance were determined by comparing these results with those obtained by reference techniques. Full agreement was found in 99% of the assays with the resistance ratio method on Lowenstein-Jensen medium, and 98% of the assays were in full agreement with the radiometric system (BACTEC). A main advantage of the bioluminescence method is its rapidity, with results available as fast as with the radiometric system but at a lower cost and without the need for radioactive culture medium. The method provides kinetic data concerning drug effects within available in vivo drug concentrations and has great potential for both rapid routine susceptibility testing and research applications in studies of drug effects on mycobacteria

  5. Recognition of the mycobacterial cord factor by Mincle: relevance for granuloma formation and resistance to tuberculosis

    Roland eLang

    2013-01-01

    Full Text Available The world’s most successful intracellular bacterial pathogen, Mycobacterium tuberculosis (MTB, survives inside macrophages by blocking phagosome maturation and establishes chronic infection characterized by the formation of granulomas. Trehalose-6,6-dimycolate (TDM, the mycobacterial cord factor, is the most abundant cell wall lipid of virulent mycobacteria, is sufficient to cause granuloma formation, and has long been known to be a major virulence factor of MTB. Recently, TDM has been shown to activate the Syk-Card9 signaling pathway in macrophages through binding to the C-type lectin receptor Mincle. The Mincle-Card9 pathway is required for activation of macrophages by TDM in vitro and for granuloma formation in vivo following injection of TDM. Whether this pathway is also exploited by MTB to reprogram the macrophage into a comfortable niche has not been explored yet. Several recent studies have investigated the phenotype of Mincle-deficient mice in mycobacterial infection, yielding divergent results in terms of a role for Mincle in host resistance. Here, we review these studies, discuss possible reasons for discrepant results and highlight open questions in the role of Mincle and other C-type lectin receptors in the infection biology of MTB.

  6. Complications after video-assisted thoracic surgery in patients with pulmonary nontuberculous mycobacterial lung disease who underwent preoperative pulmonary rehabilitation

    Morino, Akira; Murase, Kazuma; Yamada, Katsuo

    2015-01-01

    [Purpose] Video-assisted thoracic surgery and preoperative pulmonary rehabilitation are effective in preventing postoperative complications in patients with cardiopulmonary disease. The present study aims to elucidate the presence of postoperative pneumonia and atelectasis in patients with nontuberculous mycobacterial lung disease who underwent lung resection with video-assisted thoracic surgery and preoperative pulmonary rehabilitation. [Subjects and Methods] Nineteen patients with nontuberc...

  7. “Mycobacterium tilburgii” Infection in Two Immunocompromised Children: Importance of Molecular Tools in Culture-Negative Mycobacterial Disease Diagnosis▿

    2011-01-01

    “Mycobacterium tilburgii” is a nontuberculous mycobacterium that cannot be cultured by current techniques. It is described as causing disseminated disease in adults. We present the first cases of disseminated disease in 2 immunocompromised children. This paper stresses the importance of molecular techniques for correct mycobacterial identification and guidance to immunological diagnosis.

  8. Immune reconstitution inflammatory syndrome in HIV-infected patients with mycobacterial infections starting highly active anti-retroviral therapy

    AIM: To describe the radiological appearances of immune reconstitution inflammatory syndrome (IRIS) in human immunodeficiency virus (HIV)-infected patients with mycobacterial infections starting highly active anti-retroviral therapy (HAART). MATERIALS AND METHODS: Five consecutive HIV infected patients with IRIS due to mycobacterial infection were studied. Intercurrent infection and poor drug compliance were excluded as causes of presentation. The chest radiological appearances at the time of starting HAART and at the time of diagnosis of IRIS were compared. RESULTS: In these five patients there was clinical and radiological deterioration, occurring between 10 days and 7 months after starting HAART, leading to unmasking of previously undiagnosed mycobacterial infection or to worsening of mycobacterial disease. All five patients had HAART-induced increases in CD4+ T lymphocyte counts and reductions in peripheral blood HIV 'viral load'. Chest radiographic abnormalities due to IRIS included marked mediastinal lymphadenopathy in three patients--severe enough to produce tracheal compression in two patients (one of whom had stridor)--and was associated with new pulmonary infiltrates in two patients. The other two patients had new infiltrates, which in one patient was associated with a pleural effusion. CONCLUSION: These cases illustrate the diverse chest radiographic appearances of IRIS occurring after HAART in patients with mycobacterial and HIV co-infection. Marked mediastinal lymphadenopathy occurred in three of these five patients (with associated tracheal narrowing in two patients); four patients developed pulmonary infiltrates and one had an effusion. The cases further highlight that the onset of IRIS may be delayed for several months after HAART is started

  9. Immune reconstitution inflammatory syndrome in HIV-infected patients with mycobacterial infections starting highly active anti-retroviral therapy

    Buckingham, S.J.; Haddow, L.J.; Shaw, P.J.; Miller, R.F. E-mail: rmiller@gum.ucl.ac.uk

    2004-06-01

    AIM: To describe the radiological appearances of immune reconstitution inflammatory syndrome (IRIS) in human immunodeficiency virus (HIV)-infected patients with mycobacterial infections starting highly active anti-retroviral therapy (HAART). MATERIALS AND METHODS: Five consecutive HIV infected patients with IRIS due to mycobacterial infection were studied. Intercurrent infection and poor drug compliance were excluded as causes of presentation. The chest radiological appearances at the time of starting HAART and at the time of diagnosis of IRIS were compared. RESULTS: In these five patients there was clinical and radiological deterioration, occurring between 10 days and 7 months after starting HAART, leading to unmasking of previously undiagnosed mycobacterial infection or to worsening of mycobacterial disease. All five patients had HAART-induced increases in CD4+ T lymphocyte counts and reductions in peripheral blood HIV 'viral load'. Chest radiographic abnormalities due to IRIS included marked mediastinal lymphadenopathy in three patients--severe enough to produce tracheal compression in two patients (one of whom had stridor)--and was associated with new pulmonary infiltrates in two patients. The other two patients had new infiltrates, which in one patient was associated with a pleural effusion. CONCLUSION: These cases illustrate the diverse chest radiographic appearances of IRIS occurring after HAART in patients with mycobacterial and HIV co-infection. Marked mediastinal lymphadenopathy occurred in three of these five patients (with associated tracheal narrowing in two patients); four patients developed pulmonary infiltrates and one had an effusion. The cases further highlight that the onset of IRIS may be delayed for several months after HAART is started.

  10. The Host Response to a Clinical MDR Mycobacterial Strain Cultured in a Detergent-Free Environment: A Global Transcriptomics Approach

    Leisching, Gina; Pietersen, Ray-Dean; Mpongoshe, Vuyiseka; van Heerden, Carel; van Helden, Paul; Wiid, Ian; Baker, Bienyameen

    2016-01-01

    During Mycobacterium tuberculosis (M.tb) infection, the initial interactions between the pathogen and the host cell determines internalization and innate immune response events. It is established that detergents such as Tween alter the mycobacterial cell wall and solubilize various lipids and proteins. The implication of this is significant since induced changes on the cell wall affect macrophage uptake and the immune response to M.tb. Importantly, during transmission between hosts, aerosolized M.tb enters the host in its native form, i.e. in a detergent-free environment, thus in vitro and in vivo studies should mimic this as closely as possible. To this end, we have optimized a procedure for growing and processing detergent-free M.tb and assessed the response of murine macrophages (BMDM) infected with multi drug-resistant M.tb (R179 Beijing 220 clinical isolate) using RNAseq. We compared the effects of the host response to M.tb cultured under standard laboratory conditions (Tween 80 containing medium -R179T), or in detergent-free medium (R179NT). RNAseq comparisons reveal 2651 differentially expressed genes in BMDMs infected with R179T M.tb vs. BMDMs infected with R179NT M.tb. A range of differentially expressed genes involved in BMDM receptor interaction with M.tb (Mrc1, Ifngr1, Tlr9, Fpr1 and Itgax) and pro-inflammatory cytokines/chemokines (Il6, Il1b, Tnf, Ccl5 and Cxcl14) were selected for analysis through qPCR. BMDMs infected with R179NT stimulate a robust inflammatory response. Interestingly, R179NT M.tb induce transcription of Fpr1, a receptor which detects bacterial formyl peptides and initiates a myriad of immune responses. Additionally we show that the host components Cxcl14, with an unknown role in M.tb infection, and Tlr9, an emerging role player, are only stimulated by infection with R179NT M.tb. Taken together, our results suggest that the host response differs significantly in response to Tween 80 cultured M.tb and should therefore not be used in

  11. Lung surfactant dysfunction in tuberculosis: effect of mycobacterial tubercular lipids on dipalmitoylphosphatidylcholine surface activity.

    Chimote, G; Banerjee, R

    2005-11-10

    In pulmonary tuberculosis, Mycobacterium tuberculosis bacteria reside in the alveoli and are in close proximity with the alveolar surfactant. Mycolic acid in its free form and as cord factor, constitute the major lipids of the mycobacterial cell wall. They can detach from the bacteria easily and are known to be moderately surface active. We hypothesize that these surface-active mycobacterial cell wall lipids could interact with the pulmonary surfactant and result in lung surfactant dysfunction. In this study, the major phospholipid of the lung surfactant, dipalmitoylphosphatidylcholine (DPPC) and binary mixtures of DPPC:phosphatidylglycerol (PG) in 9:1 and 7:3 ratios were modelled as lung surfactant monolayers and the inhibitory potential of mycolic acid and cord factor on the surface activity of DPPC and DPPC:PG mixtures was evaluated using Langmuir monolayers. The mycobacterial lipids caused common profile changes in all the isotherms: increase in minimum surface tension, compressibility and percentage area change required for change in surface tension from 30 to 10 mN/m. Higher minimum surface tension values were achieved in the presence of mycolic acid (18.2+/-0.7 mN/m) and cord factor (13.28+/-1.2 mN/m) as compared to 0 mN/m, achieved by pure DPPC film. Similarly higher values of compressibility (0.375+/-0.005 m/mN for mycolic acid:DPPC and 0.197+/-0.003 m/mN for cord factor:DPPC monolayers) were obtained in presence of mycolic acid and cord factor. Thus, mycolic acid and cord factor were said to be inhibitory towards lung surfactant phospholipids. Higher surface tension and compressibility values in presence of tubercular lipids are suggestive of an unstable and fluid surfactant film, which will fail to achieve low surface tensions and can contribute to alveolar collapse in patients suffering from pulmonary tuberculosis. In conclusion a biophysical inhibition of lung surfactant may play a role in the pathogenesis of tuberculosis and may serve as a target for

  12. Gene

    U.S. Department of Health & Human Services — Gene integrates information from a wide range of species. A record may include nomenclature, Reference Sequences (RefSeqs), maps, pathways, variations, phenotypes,...

  13. Leveraging Advances in Tuberculosis Diagnosis and Treatment to Address Nontuberculous Mycobacterial Disease.

    Raju, Ravikiran M; Raju, Sagar M; Zhao, Yanlin; Rubin, Eric J

    2016-03-01

    The nontuberculous mycobacteria (NTM), defined as any mycobacterial pathogen other than Mycobacterium tuberculosis or Mycobacterium leprae, are a diverse group of pathogens that collectively cause a substantive but often unappreciated worldwide burden of illness. Although NTMs may cause illness similar to M. tuberculosis, these pathogens generally do not respond to classic tuberculosis (TB) drug regimens, resulting in misdiagnosis and poor treatment, particularly in resource-poor settings. Although a few high-quality epidemiologic surveys have been made on the topic, existing evidence suggests that NTM-associated disease is much more common than previously thought: more common than TB in the industrialized world and likely increasing in prevalence globally. Despite this evidence, these organisms remain markedly understudied, and few international grants support basic science and clinical research. Here we suggest that the considerable efforts in developing new treatments and diagnostics for TB can be harnessed in the fight against NTM-associated illnesses. PMID:26886068

  14. Coupling of Petri Net Models of the Mycobacterial Infection Process and Innate Immune Response

    Rafael V. Carvalho

    2015-04-01

    Full Text Available Computational and mathematical modeling is important in support of a better understanding of complex behavior in biology. For the investigation of biological systems, researchers have used computers to construct, verify, and validate models that describe the mechanisms behind biological processes in multi-scale representations. In this paper we combine Petri net models that represent the mycobacterial infection process and innate immune response at various levels of organization, from molecular interaction to granuloma dissemination. In addition to the conventional graphical representation of the Petri net, the outcome of the model is projected onto a 3D model representing the zebrafish embryo. In this manner we provide a visualization of the process in a simulation framework that portrays the infection in the living system.

  15. CT features of pulmonary nontuberculous mycobacterial infection. Effects of underlying pulmonary disease

    The CT findings of 50 cases of pulmonary nontuberculous mycobacterial infection (NMI) were evaluated by dividing patients into two clinical groups: group 1, with no history of pulmonary disease (n=34), and group 2, with underlying pulmonary disease (n=16), and observing serial CT images. Bronchiectasis, irregular opacity, and small nodule were common findings and were concomitantly seen in 80% of cases in both groups. In group 1, small nodule, peripheral bronchiectasis, and irregular opacity with bronchiectasis in the middle lobes were common findings. On the other hand, irregular opacity with cavity in the upper lobes was a common CT finding in group 2. Irregular opacity was a more frequent finding of NMI than previously reported and might be seen as the sole manifestation of NMI, especially in group 2 patients. Serial CT studies showed frequent changes in small nodule and irregular opacity. Irregular opacity with cavity tended to progress, whereas irregular opacity without bronchiectasis or cavity may or may not improve. (author)

  16. Two episodes of cutaneous non-tuberculous mycobacterial infection in a patient with psoriasis

    Wai Sze Agnes Chan

    2015-06-01

    Full Text Available Non-tuberculous mycobacteria (NTM are a group of environmental pathogens, which cause a broad spectrum of disease. The incidence of NTM infection is increasing, especially in immunocompromized patients. The past three decades also saw a rapid increase in the incidence of NTM infection involving otherwise healthy subjects. We report a case of cutaneous NTM infection in a 79-year-old Chinese woman, who was receiving methotrexate for psoriasis. Mycobacterial culture grew Mycobacterium abscessus, and the lesions cleared with a combination of oral clarithromycin, ciprofloxacin and doxycycline. Interestingly, she then developed a second episode of cutaneous NTM infection with Mycobacterium haemophilum over the same body region, five years after stoppage of methotrexate. Both episodes were separated in time and involved different species, indicating that they were independent from each other. We further discuss the risk factors for cutaneous NTM infection, treatment, and highlight the need for diagnostic vigilance.

  17. Mycobacterium tuberculosis phosphoribosylpyrophosphate synthetase: biochemical features of a crucial enzyme for mycobacterial cell wall biosynthesis.

    Anna P Lucarelli

    Full Text Available The selection and soaring spread of Mycobacterium tuberculosis multidrug-resistant (MDR-TB and extensively drug-resistant strains (XDR-TB is a severe public health problem. Currently, there is an urgent need for new drugs for tuberculosis treatment, with novel mechanisms of action and, moreover, the necessity to identify new drug targets. Mycobacterial phosphoribosylpyrophosphate synthetase (MtbPRPPase is a crucial enzyme involved in the biosynthesis of decaprenylphosphoryl-arabinose, an essential precursor for the mycobacterial cell wall biosynthesis. Moreover, phosphoribosylpyrophosphate, which is the product of the PRPPase catalyzed reaction, is the precursor for the biosynthesis of nucleotides and of some amino acids such as histidine and tryptophan. In this context, the elucidation of the molecular and functional features of MtbPRPPase is mandatory. MtbPRPPase was obtained as a recombinant form, purified to homogeneity and characterized. According to its hexameric form, substrate specificity and requirement of phosphate for activity, the enzyme proved to belong to the class I of PRPPases. Although the sulfate mimicked the phosphate, it was less effective and required higher concentrations for the enzyme activation. MtbPRPPase showed hyperbolic response to ribose 5-phosphate, but sigmoidal behaviour towards Mg-ATP. The enzyme resulted to be allosterically activated by Mg(2+ or Mn(2+ and inhibited by Ca(2+ and Cu(2+ but, differently from other characterized PRPPases, it showed a better affinity for the Mn(2+ and Cu(2+ ions, indicating a different cation binding site geometry. Moreover, the enzyme from M. tuberculosis was allosterically inhibited by ADP, but less sensitive to inhibition by GDP. The characterization of M. tuberculosis PRPPase provides the starting point for the development of inhibitors for antitubercular drug design.

  18. Drug resistance pattern of mycobacterial isolates in HIV and non-HIV population in South India

    Umamaheshwari Shivaswamy

    2016-01-01

    Full Text Available Background: Emergence of drug resistance has complicated the treatment of tuberculosis (TB. WHO reports India to be one among 27 “high burden” multidrug-resistant (MDR TB countries. Objective: To diagnose TB and detect drug resistance of mycobacterial isolates in acid-fast bacilli (AFB smear negative HIV reactive patients (Group A and compare them with HIV seropositive AFB smear positive (Group B and HIV-seronegative AFB positive cases (Group C. Materials and Methods: Clinical specimens collected in all groups were processed as per the standard protocol except blood, which was processed by lysis centrifugation technique. They were then inoculated with Lowenstein-Jensen media and the isolates obtained were subjected to drug susceptibility test (DST by proportion method and genotype MTBDR plus assay. Results: In Group A, 162 patients were included. Of the 443 clinical samples collected, 76 mycobacterial strains were obtained from 67 (41% patients. Of these, 50 (65.8% were sensitive to all drugs and 26 (34.2% resistant to one or more anti-tubercular drugs. Antibiogram of Group A when compared with Group B and C showed that the MDR rate 6.6%, 6.7% and 8% respectively did not differ much; but resistance to at least single drug was (26 [34.2%], 3 [10%], and 8 [16%], respectively. Conclusion: Our study suggests that HIV has no influence on the anti-tubercular resistance pattern, but increased MDR rate along with HIV in high TB burden setting stresses the need for early diagnosis and DST in providing proper regimens and improve prognosis.

  19. Rapid radiometric methods to detect and differentiate Mycobacterium tuberculosis/M. bovis from other mycobacterial species

    Rapid methods for the differentiation of Mycobacterium tuberculosis/M. bovis (TB complex) from other mycobacteria (MOTT bacilli) were developed and evaluated in a three-phase study. In the first phase, techniques for identification of Mycobacterium species were developed by using radiometric technology and BACTEC Middlebrook 7H12 liquid medium. Based on 14CO2 evolution, characteristic growth patterns were established for 13 commonly encountered mycobacterial species. Mycobacteria belonging to the TB complex were differentiated from other mycobacteria by cellular morphology and rate of 14CO2 evolution. For further differentiation, radiometric tests for niacin production and inhibition by Q-nitro-alpha-acetyl amino-beta-hydroxy-propiophenone (NAP) were developed. In the second phase, 100 coded specimens on Lowenstein-Jensen medium were identified as members of the TB complex, MOTT bacilli, bacteria other than mycobacteria, or ''no viable organisms'' within 3 to 12 (average 6.4) days of receipt from the Centers for Disease Control. Isolation and identification of mycobacteria from 20 simulated sputum specimens were carried out in phase III. Out of 20 sputum specimens, 16 contained culturable mycobacteria, and all of the positives were detected by the BACTEC method in an average of 7.3 days. The positive mycobacterial cultures were isolated and identified as TB complex or MOTT bacilli in an average of 12.8 days. The radiometric NAP test was found to be highly sensitive and specific for a rapid identification of TB complex, whereas the radiometric niacin test was found to have some inherent problems. Radiometric BACTEC and conventional methodologies were in complete agreement in Phase II as well as in Phase III

  20. Presence of mycobacterial L-forms in human blood: Challenge of BCG vaccination.

    Markova, Nadya; Slavchev, Georgi; Michailova, Lilia

    2015-01-01

    Possible persistence of bacteria in human blood as cell wall deficient forms (L-forms) represents a top research priority for microbiologists. Application of live BCG vaccine and L-form transformation of vaccine strain may display a new intriguing aspect concerning the opportunity for occurrence of unpredictable colonization inside the human body by unusual microbial life forms. L-form cultures were isolated from 141 blood samples of people previously vaccinated with BCG, none with a history of exposure to tuberculosis. Innovative methodology to access the unusual L-form elements derived from human blood was developed. The methodology outlines the path of transformation of non- cultivable L-form element to cultivable bacteria and their adaptation for growth in vitro. All isolates showed typical L-forms growth features ("fried eggs" colonies and biofilm). Electron microscopy revealed morphology evidencing peculiar characteristics of bacterial L-form population (cell wall deficient polymorphic elements of variable shape and size). Regular detection of acid fast bacteria in smears of isolated blood L-form cultures, led us to start their identification by using specific Mycobactrium spp. genetic tests. Forty five of 97 genetically tested blood cultures provided specific positive signals for mycobacteria, confirmed by at least one of the 3 specific assays (16S rRNA PCR; IS6110 Real Time PCR and spoligotyping). In conclusion, the obtained genetic evidence suggests that these L-forms are of mycobacterial origin. As the investigated people had been vaccinated with BCG, we can assume that the identified mycobacterial L-forms may be produced by persisting live BCG vaccine. PMID:25874947

  1. Attenuation of Mycobacterium tuberculosis by Disruption of a mas-Like Gene or a Chalcone Synthase-Like Gene, Which Causes Deficiency in Dimycocerosyl Phthiocerol Synthesis

    Sirakova, Tatiana D.; Dubey, Vinod S.; Cynamon, Michael H.; Kolattukudy, Pappachan E.

    2003-01-01

    Tuberculosis is one of the leading preventable causes of death. Emergence of drug-resistant tuberculosis makes the discovery of new targets for antimycobacterial drugs critical. The unique mycobacterial cell wall lipids are known to play an important role in pathogenesis, and therefore the genes responsible for their biosynthesis offer potential new targets. To assess the possible role of some of the genes potentially involved in cell wall lipid synthesis, we disrupted a mas-like gene, msl7, ...

  2. Monosodium Urate Crystals Promote Innate Anti-Mycobacterial Immunity and Improve BCG Efficacy as a Vaccine against Tuberculosis.

    Taus, Francesco; Santucci, Marilina B; Greco, Emanuela; Morandi, Matteo; Palucci, Ivana; Mariotti, Sabrina; Poerio, Noemi; Nisini, Roberto; Delogu, Giovanni; Fraziano, Maurizio

    2015-01-01

    A safer and more effective anti-Tuberculosis vaccine is still an urgent need. We probed the effects of monosodium urate crystals (MSU) on innate immunity to improve the Bacille Calmette-Guerin (BCG) vaccination. Results showed that in vitro MSU cause an enduring macrophage stimulation of the anti-mycobacterial response, measured as intracellular killing, ROS production and phagolysosome maturation. The contribution of MSU to anti-mycobacterial activity was also shown in vivo. Mice vaccinated in the presence of MSU showed a lower number of BCG in lymph nodes draining the vaccine inoculation site, in comparison to mice vaccinated without MSU. Lastly, we showed that MSU improved the efficacy of BCG vaccination in mice infected with Mycobacterium tuberculosis (MTB), measured in terms of lung and spleen MTB burden. These results demonstrate that the use of MSU as adjuvant may represent a novel strategy to enhance the efficacy of BCG vaccination. PMID:26023779

  3. Detection of Mycobacterium bovis and Mycobacterium tuberculosis from Cattle: Possible Public Health Relevance

    Thakur, Aneesh; Sharma, Mandeep; Katoch, Vipin C.;

    2012-01-01

    Mycobacterium bovis and Mycobacterium tuberculosis infect both animals and humans. The disease epidemiology by these agents differs in developed and developing countries due to the differences in the implementation of the prevention and control strategies. The present study describes the detection...... of M. bovis and M. tuberculosis from specimens of lungs and pulmonary lymph nodes of four cattle died in an organized herd of 183 cattle in the state of Himachal Pradesh, India, with inconclusive skin test results. Identification and distinction of these closely related mycobacterial species was done...... by PCR-RFLP targeting hsp65 gene followed by spacer oligonucleotide typing. Mixed infection of M. bovis and M. tuberculosis was detected in one cattle....

  4. Detection of 2-eicosanol by gas chromatography-mass spectrometry in sputa from patients with pulmonary mycobacterial infections.

    Alugupalli, S; Olsson, B; Larsson, L.

    1993-01-01

    A total of 96 sputum specimens from patients with suspected or known mycobacterial and nonmycobacterial pulmonary infections were analyzed by gas chromatography-mass spectrometry for the presence of 2-eicosanol. This secondary alcohol was detected in all of the 25 sputum specimens culture positive for Mycobacterium tuberculosis, in 7 of the 9 sputum specimens culture positive for M. avium complex, and in all 3 of the studied sputum specimens associated with M. malmoense. The alcohol was not d...

  5. In vivo repackaging of recombinant cosmid molecules for analyses of Salmonella typhimurium, Streptococcus mutans, and mycobacterial genomic libraries.

    Jacobs, W R; Barrett, J.F.; Clark-Curtiss, J E; Curtiss, R

    1986-01-01

    Strains of Escherichia coli K-12 were constructed that permitted the amplification of in vitro-packaged recombinant cosmid-transducing particles by in vivo repackaging of recombinant cosmid molecules. Thermal induction of these thermoinducible, excision-defective lysogens containing recombinant cosmid molecules yielded high titers of packaged recombinant cosmids and low levels of PFU. These strains were used to amplify packaged recombinant cosmid libraries of Mycobacterium leprae, Mycobacteri...

  6. Direct Comparison of Xpert MTB/RIF Assay with Liquid and Solid Mycobacterial Culture for Quantification of Early Bactericidal Activity

    Kayigire, Xavier A.; Friedrich, Sven O.; Venter, Amour; Dawson, Rodney; Gillespie, Stephen Henry; Boeree, Martin J.; Heinrich, Norbert; Hoelscher, Michael; Diacon, Andreas H.

    2013-01-01

    The early bactericidal activity of antituberculosis agents is usually determined by measuring the reduction of the sputum mycobacterial load over time on solid agar medium or in liquid culture. This study investigated the value of a quantitative PCR assay for early bactericidal activity determination. Groups of 15 patients were treated with 6 different antituberculosis agents or regimens. Patients collected sputum for 16 h overnight at baseline and at days 7 and 14 after treatment initiation....

  7. Functional capacity of Mycobacterium tuberculosis-specific T cell responses in humans is associated with mycobacterial load1

    Day, Cheryl L.; Abrahams, Deborah A.; Lerumo, Lesedi; van Rensburg, Esme Janse; Stone, Lynnett; O’rie, Terrence; Pienaar, Bernadette; de Kock, Marwou; Kaplan, Gilla; Mahomed, Hassan; Dheda, Keertan; Hanekom, Willem A.

    2011-01-01

    High antigen load in chronic viral infections has been associated with impairment of antigen-specific T cell responses; however, the relationship between antigen load in chronic Mycobacterium tuberculosis (Mtb) infection and functional capacity of Mtb-specific T cells in humans is not clear. We compared Mtb-specific T cell-associated cytokine production and proliferative capacity in peripheral blood from adults with progressively higher mycobacterial loads, i.e., persons with latent Mtb infec...

  8. A Mycobacterial Perspective on Tuberculosis in West Africa: Significant Geographical Variation of M. africanum and Other M. tuberculosis Complex Lineages.

    Florian Gehre

    2016-03-01

    Full Text Available Phylogenetically distinct Mycobacterium tuberculosis lineages differ in their phenotypes and pathogenicity. Consequently, understanding mycobacterial population structures phylogeographically is essential for design, interpretation and generalizability of clinical trials. Comprehensive efforts are lacking to date to establish the West African mycobacterial population structure on a sub-continental scale, which has diagnostic implications and can inform the design of clinical TB trials.We collated novel and published genotyping (spoligotyping data and classified spoligotypes into mycobacterial lineages/families using TBLineage and Spotclust, followed by phylogeographic analyses using statistics (logistic regression and lineage axis plot analysis in GenGIS, in which a phylogenetic tree constructed in MIRU-VNTRplus was analysed. Combining spoligotyping data from 16 previously published studies with novel data from The Gambia, we obtained a total of 3580 isolates from 12 countries and identified 6 lineages comprising 32 families. By using stringent analytical tools we demonstrate for the first time a significant phylogeographic separation between western and eastern West Africa not only of the two M. africanum (West Africa 1 and 2 but also of several major M. tuberculosis sensu stricto families, such as LAM10 and Haarlem 3. Moreover, in a longitudinal logistic regression analysis for grouped data we showed that M. africanum West Africa 2 remains a persistent health concern.Because of the geographical divide of the mycobacterial populations in West Africa, individual research findings from one country cannot be generalized across the whole region. The unequal geographical family distribution should be considered in placement and design of future clinical trials in West Africa.

  9. Relationship Between Blood Concentrations of Hepcidin and Anemia Severity, Mycobacterial Burden, and Mortality Among Patients With HIV-Associated Tuberculosis

    Kerkhoff, AD; Meintjes, G.; Burton, R; Vogt, M.; Wood, R.; Lawn, SD

    2015-01-01

    Background Anemia is very common in patients with human immunodeficiency virus (HIV)–associated tuberculosis, and hepcidin may be key in mediating this. We explored the relationship between blood hepcidin concentrations and anemia severity, mycobacterial burden and mortality in patients with HIV-associated tuberculosis. Methods Consecutive unselected HIV-infected adults in South Africa were systematically investigated for tuberculosis. Three groups were studied: 116 hospitalized inpatients wi...

  10. Etiology of Crohn's disease: Do certain food additives cause intestinal inflammation by molecular mimicry of mycobacterial lipids?

    Traunmüller, F

    2005-01-01

    Crohn's disease is a chronic granulomatous inflammation of the gastrointestinal tract which was first described in the beginning of the 20th century. The histological similarity with intestinal tuberculosis has led to the assumption of an involvement of mycobacteria and mycobacterial antigens, respectively, in the etiology. A major defense mechanism against mycobacterial lipid antigens is the CD1 system which includes CD1 molecules for antigen presentation and natural killer T cells for recognition and subsequent production of cytokines like interferon-gamma and tumour necrosis factor-alpha. These cytokines promote granulomatous transformation. Various food additives, especially emulsifiants, thickeners, surface-finishing agents and contaminants like plasticizers share structural domains with mycobacterial lipids. It is therefore hypothesized, that these compounds are able to stimulate by molecular mimicry the CD1 system in the gastrointestinal mucosa and to trigger the pro-inflammatory cytokine cascade. The understanding of Crohn's disease as a CD1-mediated delayed-type hypersensitivity to certain food additives would lead to strong emphasis on a dietary treatment. Related aspects of pathology, physiology and epidemiology of Crohn's disease are presented. PMID:16043304

  11. Increased serum anti-mycobacterial antibody titers in rheumatoid arthritis patients: Is there any specific antigenic target?

    Objective was to investigate the presence of immunoreactivity against mycobacterial antigens in the sera of patients with rheumatoid arthritis (Ra) and to detect the target of the immune reaction. This study was carried out on 60 patients with RA, and 25 patients with no joint diseases in the laboratory of Clinical Microbiology Department of Ankara University Medical Faculty, Ankara, Turkey between July 2003 to January 2004. Secreted and cellular antigens of Mycobacterium tuberculosis (M. tuberculosis) H37Rv and Mycobacterium bovis (M. bovis) were isolated and purified by high performance liquid chromatography to antigenic fractions. The immunoreactivity of patient and control sera against these antigens were determined by enzyme-linked immunosorbent assay (ELISA). Immunoreactivity against mycobacterial antigens in RA patients were significantly higher than controls. Significant difference between patients and controls has been determined with M. bovis Bacillus Calmette Guerin (BCG) culture fluid and sonicate antigens, but not with M. tuberculosis H37Rv. This suggests that the antigen triggering immune response in patients with RA may belong to or mainly expressed on M. bovis BCG. The ELISA results showed significant difference between RA patients and controls with all antigenic fractions. Presence of increased immunoreactivity against mycobacterial antigens in the sera of patients with RA was detected. When statistical analysis was considered, we cannot put forward any antigenic fraction alone as the one responsible for the increased reactivity. (author)

  12. Structure of the mycobacterial ATP synthase Fo rotor ring in complex with the anti-TB drug bedaquiline.

    Preiss, Laura; Langer, Julian D; Yildiz, Özkan; Eckhardt-Strelau, Luise; Guillemont, Jérôme E G; Koul, Anil; Meier, Thomas

    2015-05-01

    Multidrug-resistant tuberculosis (MDR-TB) is more prevalent today than at any other time in human history. Bedaquiline (BDQ), a novel Mycobacterium-specific adenosine triphosphate (ATP) synthase inhibitor, is the first drug in the last 40 years to be approved for the treatment of MDR-TB. This bactericidal compound targets the membrane-embedded rotor (c-ring) of the mycobacterial ATP synthase, a key metabolic enzyme required for ATP generation. We report the x-ray crystal structures of a mycobacterial c9 ring without and with BDQ bound at 1.55- and 1.7-Å resolution, respectively. The structures and supporting functional assays reveal how BDQ specifically interacts with the rotor ring via numerous interactions and thereby completely covers the c-ring's ion-binding sites. This prevents the rotor ring from acting as an ion shuttle and stalls ATP synthase operation. The structures explain how diarylquinoline chemicals specifically inhibit the mycobacterial ATP synthase and thus enable structure-based drug design of next-generation ATP synthase inhibitors against Mycobacterium tuberculosis and other bacterial pathogens. PMID:26601184

  13. Identification of critical residues of the mycobacterial dephosphocoenzyme a kinase by site-directed mutagenesis.

    Guneet Walia

    Full Text Available Dephosphocoenzyme A kinase performs the transfer of the γ-phosphate of ATP to dephosphocoenzyme A, catalyzing the last step of coenzyme A biosynthesis. This enzyme belongs to the P-loop-containing NTP hydrolase superfamily, all members of which posses a three domain topology consisting of a CoA domain that binds the acceptor substrate, the nucleotide binding domain and the lid domain. Differences in the enzymatic organization and regulation between the human and mycobacterial counterparts, have pointed out the tubercular CoaE as a high confidence drug target (HAMAP database. Unfortunately the absence of a three-dimensional crystal structure of the enzyme, either alone or complexed with either of its substrates/regulators, leaves both the reaction mechanism unidentified and the chief players involved in substrate binding, stabilization and catalysis unknown. Based on homology modeling and sequence analysis, we chose residues in the three functional domains of the enzyme to assess their contributions to ligand binding and catalysis using site-directed mutagenesis. Systematically mutating the residues from the P-loop and the nucleotide-binding site identified Lys14 and Arg140 in ATP binding and the stabilization of the phosphoryl intermediate during the phosphotransfer reaction. Mutagenesis of Asp32 and Arg140 showed catalytic efficiencies less than 5-10% of the wild type, indicating the pivotal roles played by these residues in catalysis. Non-conservative substitution of the Leu114 residue identifies this leucine as the critical residue from the hydrophobic cleft involved in leading substrate, DCoA binding. We show that the mycobacterial enzyme requires the Mg(2+ for its catalytic activity. The binding energetics of the interactions of the mutant enzymes with the substrates were characterized in terms of their enthalpic and entropic contributions by ITC, providing a complete picture of the effects of the mutations on activity. The properties of

  14. Nosocomial rapidly growing mycobacterial infections following laparoscopic surgery: CT imaging findings

    Volpato, Richard [Cassiano Antonio de Moraes University Hospital, Department of Diagnostic Radiology, Vitoria, ES (Brazil); Campi de Castro, Claudio [University of Sao Paulo Medical School, Department of Radiology, Cerqueira Cesar, Sao Paulo (Brazil); Hadad, David Jamil [Cassiano Antonio de Moraes University Hospital, Nucleo de Doencas Infecciosas, Department of Internal Medicine, Vitoria, ES (Brazil); Silva Souza Ribeiro, Flavya da [Laboratorio de Patologia PAT, Department of Diagnostic Radiology, Unit 1473, Vitoria, ES (Brazil); Filho, Ezequiel Leal [UNIMED Diagnostico, Department of Diagnostic Radiology, Unit 1473, Vitoria, ES (Brazil); Marcal, Leonardo P. [The University of Texas M D Anderson Cancer Center, Department of Diagnostic Radiology, Unit 1473, Houston, TX (United States)

    2015-09-15

    To identify the distribution and frequency of computed tomography (CT) findings in patients with nosocomial rapidly growing mycobacterial (RGM) infection after laparoscopic surgery. A descriptive retrospective study in patients with RGM infection after laparoscopic surgery who underwent CT imaging prior to initiation of therapy. The images were analyzed by two radiologists in consensus, who evaluated the skin/subcutaneous tissues, the abdominal wall, and intraperitoneal region separately. The patterns of involvement were tabulated as: densification, collections, nodules (≥1.0 cm), small nodules (<1.0 cm), pseudocavitated nodules, and small pseudocavitated nodules. Twenty-six patients met the established criteria. The subcutaneous findings were: densification (88.5 %), small nodules (61.5 %), small pseudocavitated nodules (23.1 %), nodules (38.5 %), pseudocavitated nodules (15.4 %), and collections (26.9 %). The findings in the abdominal wall were: densification (61.5 %), pseudocavitated nodules (3.8 %), and collections (15.4 %). The intraperitoneal findings were: densification (46.1 %), small nodules (42.3 %), nodules (15.4 %), and collections (11.5 %). Subcutaneous CT findings in descending order of frequency were: densification, small nodules, nodules, small pseudocavitated nodules, pseudocavitated nodules, and collections. The musculo-fascial plane CT findings were: densification, collections, and pseudocavitated nodules. The intraperitoneal CT findings were: densification, small nodules, nodules, and collections. (orig.)

  15. Identification, function and structure of the mycobacterial sulfotransferase that initiates sulfolipid-1 biosynthesis.

    Mougous, Joseph D; Petzold, Christopher J; Senaratne, Ryan H; Lee, Dong H; Akey, David L; Lin, Fiona L; Munchel, Sarah E; Pratt, Matthew R; Riley, Lee W; Leary, Julie A; Berger, James M; Bertozzi, Carolyn R

    2004-08-01

    Sulfolipid-1 (SL-1) is an abundant sulfated glycolipid and potential virulence factor found in Mycobacterium tuberculosis. SL-1 consists of a trehalose-2-sulfate (T2S) disaccharide elaborated with four lipids. We identified and characterized a conserved mycobacterial sulfotransferase, Stf0, which generates the T2S moiety of SL-1. Biochemical studies demonstrated that the enzyme requires unmodified trehalose as substrate and is sensitive to small structural perturbations of the disaccharide. Disruption of stf0 in Mycobacterium smegmatis and M. tuberculosis resulted in the loss of T2S and SL-1 formation, respectively. The structure of Stf0 at a resolution of 2.6 A reveals the molecular basis of trehalose recognition and a unique dimer configuration that encloses the substrate into a bipartite active site. These data provide strong evidence that Stf0 carries out the first committed step in the biosynthesis of SL-1 and establish a system for probing the role of SL-1 in M. tuberculosis infection. PMID:15258569

  16. Antimicrobial peptides and proteins in mycobacterial therapy: current status and future prospects.

    Padhi, Avinash; Sengupta, Mitali; Sengupta, Srabasti; Roehm, Klaus H; Sonawane, Avinash

    2014-07-01

    Tuberculosis (TB), an infectious disease caused by the pathogen Mycobacterium tuberculosis (Mtb), kills about 1.5 million people every year worldwide. An increase in the prevalence of drug-resistant strains of Mtb in the last few decades now necessitates the development of novel drugs that combat infections by both drug-sensitive and resistant Mtb. Moreover, as Mtb can persist in host cells by modulating their immune responses, it is essential that anti-TB agents be able to penetrate macrophages and kill the pathogen intracellularly without harming the host cells. In this context, antimicrobial peptides (AMPs) and proteins are being harnessed as anti-infective agents for the treatment of various diseases. Due to their direct and rapid bactericidal activity it is unlikely that pathogens acquire resistance against AMPs. Several short and potent AMP derivatives have been prepared by peptide engineering, and several of them are currently evaluated in clinical trials. The present review summarizes the role of endogenously expressed AMPs and proteins in the treatment of tuberculosis infections. In addition, mechanisms of direct anti-mycobacterial activity, manipulation of host immune responses, and future prospects of AMPs as therapeutic agents are discussed. PMID:24813349

  17. Efflux pump inhibitors: targeting mycobacterial efflux systems to enhance TB therapy.

    Pule, Caroline M; Sampson, Samantha L; Warren, Robin M; Black, Philippa A; van Helden, Paul D; Victor, Tommie C; Louw, Gail E

    2016-01-01

    The emergence of drug resistance continues to plague TB control, with a global increase in the prevalence of MDR-TB. This acts as a gateway to XDR-TB and thus emphasizes the urgency for drug development and optimal treatment options. Bedaquiline is the first new anti-TB drug approved by the FDA in 40 years and has been shown to be an effective treatment option for MDR Mycobacterium tuberculosis infection. Bedaquiline has also recently been included in clinical trials for new regimens with the aim of improving and shortening treatment periods. Alarmingly, efflux-mediated bedaquiline resistance, as well as efflux-mediated cross-resistance to clofazimine, has been identified in treatment failures. This mechanism of resistance results in efflux of a variety of anti-TB drugs from the bacterial cell, thereby decreasing the intracellular drug concentration. In doing so, the bacillus is able to render the antibiotic treatment ineffective. Recent studies have explored strategies to reverse the resistance phenotype conferred by efflux pump activation. It was observed that the addition of efflux pump inhibitors partially restored drug susceptibility in vitro and in vivo. This has significant clinical implications, especially in MDR-TB management where treatment options are extremely limited. This review aims to highlight the current efflux pump inhibitors effective against M. tuberculosis, the effect of efflux pump inhibitors on mycobacterial growth and the clinical promise of treatment with efflux pump inhibitors and standard anti-TB therapy. PMID:26472768

  18. Mycobacterial Osteomyelitis of the Spine Following Intravesical BCG Therapy for Bladder Cancer.

    Mackel, Charles E; Burke, Shane M; Huhta, Taylor; Riesenburger, Ron; Weller, Simcha J

    2016-01-01

    Osteomyelitis is an infection of the bone that can involve the vertebral column. A rare cause of vertebral osteomyelitis is Mycobacterium bovis after intravesical Bacillus Calmette-Guerin (BCG) therapy for transitional cell carcinoma of the bladder. In this report, we describe the case of a 64-year-old male presenting with constitutional symptoms, progressive thoracic kyphosis, and intractable T11 and T12 radiculopathies over the proceeding six months. A CT scan revealed erosive, lytic changes of the T12 and L1 vertebrae with compression of the T12 vertebra. An MRI demonstrated T11-12 osteomyelitis with intervening discitis and extensive paraspinal enhancement with a corresponding hyperintensity on a short tau inversion recovery (STIR) sequence. A needle aspiration grew out Mycobacterial tuberculosis complex that was pansensitive to all antimicrobial agent therapies, except pyrazinamide on culture, a finding consistent with an M. bovis infection. The patient's infection and neurologic compromise resolved after transthoracic T11-12 vertebrectomies with decompression of the spinal cord and nerve roots as well as T10-L1 instrumented fusion and protracted antimicrobial therapy. The epidemiology and natural history of M. bovis osteomyelitis are reviewed and the authors emphasize a mechanism of vertebral inoculation to explain the predilection of M. bovis osteomyelitis in males after intravesical BCG therapy. PMID:27158574

  19. Nosocomial rapidly growing mycobacterial infections following laparoscopic surgery: CT imaging findings

    To identify the distribution and frequency of computed tomography (CT) findings in patients with nosocomial rapidly growing mycobacterial (RGM) infection after laparoscopic surgery. A descriptive retrospective study in patients with RGM infection after laparoscopic surgery who underwent CT imaging prior to initiation of therapy. The images were analyzed by two radiologists in consensus, who evaluated the skin/subcutaneous tissues, the abdominal wall, and intraperitoneal region separately. The patterns of involvement were tabulated as: densification, collections, nodules (≥1.0 cm), small nodules (<1.0 cm), pseudocavitated nodules, and small pseudocavitated nodules. Twenty-six patients met the established criteria. The subcutaneous findings were: densification (88.5 %), small nodules (61.5 %), small pseudocavitated nodules (23.1 %), nodules (38.5 %), pseudocavitated nodules (15.4 %), and collections (26.9 %). The findings in the abdominal wall were: densification (61.5 %), pseudocavitated nodules (3.8 %), and collections (15.4 %). The intraperitoneal findings were: densification (46.1 %), small nodules (42.3 %), nodules (15.4 %), and collections (11.5 %). Subcutaneous CT findings in descending order of frequency were: densification, small nodules, nodules, small pseudocavitated nodules, pseudocavitated nodules, and collections. The musculo-fascial plane CT findings were: densification, collections, and pseudocavitated nodules. The intraperitoneal CT findings were: densification, small nodules, nodules, and collections. (orig.)

  20. Thioridazine in PLGA nanoparticles reduces toxicity and improves rifampicin therapy against mycobacterial infection in zebrafish.

    Vibe, Carina Beatrice; Fenaroli, Federico; Pires, David; Wilson, Steven Ray; Bogoeva, Vanya; Kalluru, Raja; Speth, Martin; Anes, Elsa; Griffiths, Gareth; Hildahl, Jon

    2016-08-01

    Encapsulating antibiotics such as rifampicin in biodegradable nanoparticles provides several advantages compared to free drug administration, including reduced dosing due to localized targeting and sustained release. Consequently, these characteristics reduce systemic drug toxicity. However, new nanoformulations need to be tested in complex biological systems to fully characterize their potential for improved drug therapy. Tuberculosis, caused by infection with the bacterium Mycobacterium tuberculosis, requires lengthy and expensive treatment, and incomplete therapy contributes to an increasing incidence of drug resistance. Recent evidence suggests that standard therapy may be improved by combining antibiotics with bacterial efflux pump inhibitors, such as thioridazine. However, this drug is difficult to use clinically due to its toxicity. Here, we encapsulated thioridazine in poly(lactic-co-glycolic) acid nanoparticles and tested them alone and in combination with rifampicin nanoparticles, or free rifampicin in macrophages and in a zebrafish model of tuberculosis. Whereas free thioridazine was highly toxic in both cells and zebrafish embryos, after encapsulation in nanoparticles no toxicity was detected. When combined with rifampicin nanoparticles, the nanoparticles loaded with thioridazine gave a modest increase in killing of both Mycobacterium bovis BCG and M. tuberculosis in macrophages. In the zebrafish, the thioridazine nanoparticles showed a significant therapeutic effect in combination with rifampicin by enhancing embryo survival and reducing mycobacterial infection. Our results show that the zebrafish embryo is a highly sensitive indicator of drug toxicity and that thioridazine nanoparticle therapy can improve the antibacterial effect of rifampicin in vivo. PMID:26573343

  1. Expression and Immunogenicity of the Mycobacterial Ag85B/ESAT-6 Antigens Produced in Transgenic Plants by Elastin-Like Peptide Fusion Strategy

    Doreen Manuela Floss

    2010-01-01

    Full Text Available This study explored a novel system combining plant-based production and the elastin-like peptide (ELP fusion strategy to produce vaccinal antigens against tuberculosis. Transgenic tobacco plants expressing the mycobacterial antigens Ag85B and ESAT-6 fused to ELP (TBAg-ELP were generated. Purified TBAg-ELP was obtained by the highly efficient, cost-effective, inverse transition cycling (ICT method and tested in mice. Furthermore, safety and immunogenicity of the crude tobacco leaf extracts were assessed in piglets. Antibodies recognizing mycobacterial antigens were produced in mice and piglets. A T-cell immune response able to recognize the native mycobacterial antigens was detected in mice. These findings showed that the native Ag85B and ESAT-6 mycobacterial B- and T-cell epitopes were conserved in the plant-expressed TBAg-ELP. This study presents the first results of an efficient plant-expression system, relying on the elastin-like peptide fusion strategy, to produce a safe and immunogenic mycobacterial Ag85B-ESAT-6 fusion protein as a potential vaccine candidate against tuberculosis.

  2. Bacillus calmette-guerin infection in NADPH oxidase deficiency: defective mycobacterial sequestration and granuloma formation.

    Deffert, Christine; Schäppi, Michela G; Pache, Jean-Claude; Cachat, Julien; Vesin, Dominique; Bisig, Ruth; Ma Mulone, Xiaojuan; Kelkka, Tiina; Holmdahl, Rikard; Garcia, Irene; Olleros, Maria L; Krause, Karl-Heinz

    2014-09-01

    Patients with chronic granulomatous disease (CGD) lack generation of reactive oxygen species (ROS) through the phagocyte NADPH oxidase NOX2. CGD is an immune deficiency that leads to frequent infections with certain pathogens; this is well documented for S. aureus and A. fumigatus, but less clear for mycobacteria. We therefore performed an extensive literature search which yielded 297 cases of CGD patients with mycobacterial infections; M. bovis BCG was most commonly described (74%). The relationship between NOX2 deficiency and BCG infection however has never been studied in a mouse model. We therefore investigated BCG infection in three different mouse models of CGD: Ncf1 mutants in two different genetic backgrounds and Cybb knock-out mice. In addition, we investigated a macrophage-specific rescue (transgenic expression of Ncf1 under the control of the CD68 promoter). Wild-type mice did not develop severe disease upon BCG injection. In contrast, all three types of CGD mice were highly susceptible to BCG, as witnessed by a severe weight loss, development of hemorrhagic pneumonia, and a high mortality (∼ 50%). Rescue of NOX2 activity in macrophages restored BCG resistance, similar as seen in wild-type mice. Granulomas from mycobacteria-infected wild-type mice generated ROS, while granulomas from CGD mice did not. Bacterial load in CGD mice was only moderately increased, suggesting that it was not crucial for the observed phenotype. CGD mice responded with massively enhanced cytokine release (TNF-α, IFN-γ, IL-17 and IL-12) early after BCG infection, which might account for severity of the disease. Finally, in wild-type mice, macrophages formed clusters and restricted mycobacteria to granulomas, while macrophages and mycobacteria were diffusely distributed in lung tissue from CGD mice. Our results demonstrate that lack of the NADPH oxidase leads to a markedly increased severity of BCG infection through mechanisms including increased cytokine production and

  3. Optimizing Mycobacterial Culture in Smear-Negative, Human Immunodeficiency Virus-Infected Tuberculosis Cases.

    N A Ismail

    Full Text Available Tuberculosis (TB is a significant public health problem and the diagnosis in human immunodeficiency virus (HIV-infected individuals is challenging. The use of mycobacterial culture remains an important complementary tool and optimizing it has important benefits. We sought to determine the effect of an increase in the number of specimens evaluated, addition of nutritional supplementation to the culture medium, sputum appearance and volume on diagnostic yield and time to detection of pulmonary TB among smear-negative, HIV-infected adults.In this prospective study conducted at the Tshwane District Hospital and Academic TB Laboratory, Pretoria, South Africa we collected three sputum specimens an hour apart from presumptive TB cases at an antiretroviral treatment site. We analysed specimens from 236 patients. Specimen appearance and volume were recorded. All specimens were processed for culture using both standard and supplemented media.A single specimen identified 79% of PTB cases using standard media; the second and third specimens added 12.5% and 8.3% respectively. Media supplementation, sputum appearance and specimen volume had no effect on culture yield or contamination rates. The mean time to detection was reduced from 19.8 days in standard cultures to 11.8 days in nutrient supplemented cultures (p = 0.002. For every 1 ml increase in sputum volume, time to detection was decreased by a factor of 0.797 (p = 0.011.Use of an inexpensive culture supplement substantially reduced time to detection and could contribute to reducing treatment delay among HIV-infected cases.

  4. Bacillus calmette-guerin infection in NADPH oxidase deficiency: defective mycobacterial sequestration and granuloma formation.

    Christine Deffert

    2014-09-01

    Full Text Available Patients with chronic granulomatous disease (CGD lack generation of reactive oxygen species (ROS through the phagocyte NADPH oxidase NOX2. CGD is an immune deficiency that leads to frequent infections with certain pathogens; this is well documented for S. aureus and A. fumigatus, but less clear for mycobacteria. We therefore performed an extensive literature search which yielded 297 cases of CGD patients with mycobacterial infections; M. bovis BCG was most commonly described (74%. The relationship between NOX2 deficiency and BCG infection however has never been studied in a mouse model. We therefore investigated BCG infection in three different mouse models of CGD: Ncf1 mutants in two different genetic backgrounds and Cybb knock-out mice. In addition, we investigated a macrophage-specific rescue (transgenic expression of Ncf1 under the control of the CD68 promoter. Wild-type mice did not develop severe disease upon BCG injection. In contrast, all three types of CGD mice were highly susceptible to BCG, as witnessed by a severe weight loss, development of hemorrhagic pneumonia, and a high mortality (∼ 50%. Rescue of NOX2 activity in macrophages restored BCG resistance, similar as seen in wild-type mice. Granulomas from mycobacteria-infected wild-type mice generated ROS, while granulomas from CGD mice did not. Bacterial load in CGD mice was only moderately increased, suggesting that it was not crucial for the observed phenotype. CGD mice responded with massively enhanced cytokine release (TNF-α, IFN-γ, IL-17 and IL-12 early after BCG infection, which might account for severity of the disease. Finally, in wild-type mice, macrophages formed clusters and restricted mycobacteria to granulomas, while macrophages and mycobacteria were diffusely distributed in lung tissue from CGD mice. Our results demonstrate that lack of the NADPH oxidase leads to a markedly increased severity of BCG infection through mechanisms including increased cytokine

  5. Mycobacterial Interspersed Repetitive Unit Can Predict Drug Resistance of Mycobacterium tuberculosis in China

    Cheng, Xian-feng; Jiang, Chao; Zhang, Min; Xia, Dan; Chu, Li-li; Wen, Yu-feng; Zhu, Ming; Jiang, Yue-gen

    2016-01-01

    Background: Recently, Mycobacterial Interspersed Repetitive Unit (MIRU) was supposed to be associated with drug resistance in Mycobacterium tuberculosis (M. tuberculosis), but whether the association exists actually in local strains in China was still unknown. This research was conducted to explore that association and the predictability of MIRU to drug resistance of Tuberculosis (TB). Methods: The clinical isolates were collected and the susceptibility test were conducted with Lowenstein–Jensen (LJ) medium for five anti-TB drug. Based on PCR of MIRU-VNTR (Variable Number of Tandem Repeat) genotyping, we tested the number of the repeat unite of MIRU. Then, we used logistic regression to evaluate the association between 15 MIRU and drug resistance. In addition, we explored the most suitable MIRU locus of identified MIRU loci for drug resistance by multivariate logistic regression. Results: Of the 102 strains, one isolate was resistant to rifampicin and one isolate was resistant to streptomycin. Among these fifteen MIRU, there was a association between MIRU loci polymorphism and anti-tuberculosis drug resistance, ETRB (P = 0.03, OR = 0.19, 95% CI 0.05–0.81) and ETRC (P = 0.01, OR = 0.14, 95% CI 0.03–0.64) were negatively related to isoniazid resistance; MIRU20 (P = 0.05, OR = 2.87, 95% CI 1.01–8.12) was positively associated with ethambutol resistance; and QUB11a (P = 0.02, OR = 0.79, 95% CI 0.65–0.96) was a negative association factor of p-aminosalicylic acid resistance. Conclusion: Our research showed that MIRU loci may predict drug resistance of tuberculosis in China. However, the mechanism still needs further exploration. PMID:27047485

  6. CT findings of mycobacterial infection other than tuberculosis : comparison with tuberculosis

    Yoon, Chang Jin; Goo, Jin Mo; Seo, Joon Beom; Kim, Se Hyung; Im, Jung Gi [College of Medicine and the Institute of Radiation Medicine, Seoul National University, Seoul (Korea, Republic of)

    2000-03-01

    To compare the CT findings of mycobacterial infection other than tuberculosis (MOTT) with those of tuberculosis (TB). The chest CT scans of 30 immunocompetent patients with culture-proven pulmonary MOTT (M:F =3D 11:19; mean age, 51.2 yrs.) and of 24 patients with active tuberculosis (M:F 12:12; mean age, 42.5 yrs.) were analyzed by two radiologists; decisions were reached by consensus. Common findings for both MOTT and TB included brochogenically-spread bronchogenic spread nodular lesion (93.3% for MOTT, 100% for TB), bronchiectasis (90%, 83.3%), bronchial wall thickening (66.7%, 54.2%), granuloma (63.3%, 75%), parenchymal scarring (53.3%, 54.2%), and mediastinal lymphadenopathy (50%, 37.5%). Less commonly observed findings were emphysema (46.7%, 29.7%), atelectasis (36.7%, 29.2%), narrowing of a major airway (23.3%, 25%), consolidation (23.3%, 29.2%)and pleural disease (16.7%, 29.2%). Except for cavity (30%, 53.3%; P less than 0.05), the frequencies of each finding were not different between the two groups. A lobe-matched frequency comparison showed that only bronchiectasis in the right middle lobe (40%, 16.7%), right lower lobe (63.3%, 33.3%) and lingula division (53.3%, 25%) was significantly more common in MOTT than in TB (p less than 0.05). The number of lobes in which bronchiectasis and bronchial wall thickening were involved was greater in MOTT (3.20) than in TB (2.04) (p=3D 0.011). Although the CT findings of MOTT and TB overlap considerably, cavities are more common in TB, while in MOTT, bronchiectasis in the lower lung zone is more common and bronchiectasis tends to be more extensive. (author)

  7. Towards new antituberculotic targets: biochemical characterisation of mycobacterial RNase E/G

    Agnes Csanadi

    2008-06-01

    Full Text Available The World Health Organization estimates that each year 3 million people die from tuberculosis (TB and 8 million people become infected. No new anti-TB drugs have been introduced in the past 30 years, even though their development becomes increasingly important to face new challenges posed by multidrug-resistant and extensively drug-resistant strains and by acute infection with M. tuberculosis of HIV positive patients. Owing to its apparently important role in RNA metabolism, the RNase E/G family of endoribonucleases can be considered as a promising target for antimicrobial drugs. This consideration promted us to characterise biochemical properties of the M. tuberculosis RNase E/G homologue. To learn more about specific properties of RNase E/G homologues a M. tuberculosis RNase E/G (MycRne was overexpressed in E. coli and purified as a 6His-tagged polypeptide. To characterise MycRne, we used in vitro cleavage assays and primer extension analysis of total RNA extracted from mycobacteria. We show that affinity purified MycRne has an endoribonucleolytic activity, which is dependent on the 5'-phosphorylation status of RNA. We could also show that RNase E/G has Mg2+ dependent activity and similar to E. coli RNase E, MycRne was able to cleave in an intercistronic region of the putative 9S precursor of 5S rRNA. Although, similar to E. coli RNase E, the mycobacterial RNase E/G homologue plays a role in rRNA processing, the substrate specificities of these enzymes show differences. This suggests that RNase E/G can be used as a promising target for antimicrobial drugs that can be optimized to specifically target pathogenic species.

  8. Chronic Gastrointestinal Nematode Infection Mutes Immune Responses to Mycobacterial Infection Distal to the Gut.

    Obieglo, Katja; Feng, Xiaogang; Bollampalli, Vishnu Priya; Dellacasa-Lindberg, Isabel; Classon, Cajsa; Österblad, Markus; Helmby, Helena; Hewitson, James P; Maizels, Rick M; Gigliotti Rothfuchs, Antonio; Nylén, Susanne

    2016-03-01

    Helminth infections have been suggested to impair the development and outcome of Th1 responses to vaccines and intracellular microorganisms. However, there are limited data regarding the ability of intestinal nematodes to modulate Th1 responses at sites distal to the gut. In this study, we have investigated the effect of the intestinal nematode Heligmosomoides polygyrus bakeri on Th1 responses to Mycobacterium bovis bacillus Calmette-Guérin (BCG). We found that H. polygyrus infection localized to the gut can mute BCG-specific CD4(+) T cell priming in both the spleen and skin-draining lymph nodes. Furthermore, H. polygyrus infection reduced the magnitude of delayed-type hypersensitivity (DTH) to PPD in the skin. Consequently, H. polygyrus-infected mice challenged with BCG had a higher mycobacterial load in the liver compared with worm-free mice. The excretory-secretory product from H. polygyrus (HES) was found to dampen IFN-γ production by mycobacteria-specific CD4(+) T cells. This inhibition was dependent on the TGF-βR signaling activity of HES, suggesting that TGF-β signaling plays a role in the impaired Th1 responses observed coinfection with worms. Similar to results with mycobacteria, H. polygyrus-infected mice displayed an increase in skin parasite load upon secondary infection with Leishmania major as well as a reduction in DTH responses to Leishmania Ag. We show that a nematode confined to the gut can mute T cell responses to mycobacteria and impair control of secondary infections distal to the gut. The ability of intestinal helminths to reduce DTH responses may have clinical implications for the use of skin test-based diagnosis of microbial infections. PMID:26819205

  9. Dynamic ligand-based pharmacophore modeling and virtual screening to identify mycobacterial cyclopropane synthase inhibitors

    CHINMAYEE CHOUDHURY; U DEVA PRIYAKUMAR; G NARAHARI SASTRY

    2016-05-01

    Multidrug resistance in Mycobacterium tuberculosis (M. Tb) and its coexistence with HIV arethe biggest therapeutic challenges in anti-M. Tb drug discovery. The current study reports a Virtual Screening(VS) strategy to identify potential inhibitors of Mycobacterial cyclopropane synthase (CmaA1), an importantM. Tb target considering the above challenges. Five ligand-based pharmacophore models were generatedfrom 40 different conformations of the cofactors of CmaA1 taken from molecular dynamics (MD) simulationstrajectories of CmaA1. The screening abilities of these models were validated by screening 23 inhibitors and1398 non-inhibitors of CmaA1. A VS protocol was designed with four levels of screening i.e., ligand-basedpharmacophore screening, structure-based pharmacophore screening, docking and absorption, distribution,metabolism, excretion and the toxicity (ADMET) filters. In an attempt towards repurposing the existing drugsto inhibit CmaA1, 6,429 drugs reported in DrugBank were considered for screening. To find compounds thatinhibit multiple targets of M. Tb as well as HIV, we also chose 701 and 11,109 compounds showing activitybelow 1 μM range on M. Tb and HIV cell lines, respectively, collected from ChEMBL database. Thus, a totalof 18,239 compounds were screened against CmaA1, and 12 compounds were identified as potential hits forCmaA1 at the end of the fourth step. Detailed analysis of the structures revealed these compounds to interactwith key active site residues of CmaA1.

  10. CT findings of mycobacterial infection other than tuberculosis : comparison with tuberculosis

    To compare the CT findings of mycobacterial infection other than tuberculosis (MOTT) with those of tuberculosis (TB). The chest CT scans of 30 immunocompetent patients with culture-proven pulmonary MOTT (M:F =3D 11:19); mean age, 51.2 yrs.) and of 24 patients with active tuberculosis (M:F 12:12; mean age, 42.5 yrs.) were analyzed by two radiologists; decisions were reached by consensus. Common findings for both MOTT and TB included brochogenically-spread bronchogenic spread nodular lesion (93.3% for MOTT, 100% for TB), bronchiectasis (90%, 83.3%), bronchial wall thickening (66.7%, 54.2%), granuloma (63.3%, 75%), parenchymal scarring (53.3%, 54.2%), and mediastinal lymphadenopathy (50%, 37.5%). Less commonly observed findings were emphysema (46.7%, 29.7%), atelectasis (36.7%, 29.2%), narrowing of a major airway (23.3%, 25%), consolidation (23.3%, 29.2%)and pleural disease (16.7%, 29.2%). Except for cavity (30%, 53.3%; P less than 0.05), the frequencies of each finding were not different between the two groups. A lobe-matched frequency comparison showed that only bronchiectasis in the right middle lobe (40%, 16.7%), right lower lobe (63.3%, 33.3%) and lingula division (53.3%, 25%) was significantly more common in MOTT than in TB (p less than 0.05). The number of lobes in which bronchiectasis and bronchial wall thickening were involved was greater in MOTT (3.20) than in TB (2.04) (p=3D 0.011). Although the CT findings of MOTT and TB overlap considerably, cavities are more common in TB, while in MOTT, bronchiectasis in the lower lung zone is more common and bronchiectasis tends to be more extensive. (author)

  11. Anti-mycobacterial screening of five Indian medicinal plants and partial purification of active extracts of Cassia sophera and Urtica dioica

    Rambir Singh; Shariq Hussain; Rajesh Verma; Poonam Sharma

    2013-01-01

    Objective: To find out the anti-mycobacterial potential of Cassia sophera (C. sophera), Urticadioica (U. dioica), Momordica dioica, Tribulus terrestris and Coccinia indica plants against multi-drug resistant (MDR) strain of Mycobacterium tuberculosis (M. tuberculosis). Methods: Plant materials were extracted successively with solvents of increasing polarity. Solvent extracts were screened for anti-mycobacterial activity against fast growing, non-pathogenic mycobacterium strain, Mycobacterium semegmatis, by disk diffusion method. The active extracts were tested against MDR and clinical isolates of M. tuberculosis by absolute concentration and proportion methods. The active extracts were subjected to bio-autoassay on TLC followed by silica column chromatography for isolation of potential drug leads. Results: Hexane extract of U. dioica (HEUD) and methanol extract of C. sophera (MECS) produced inhibition zone of 20 mm in disc diffusion assay and MIC of 250 and 125 μg/mL respectively in broth dilution assay against Mycobacteriumsemegmatis. Semipurified fraction F2 from MECS produced 86% inhibition against clinical isolate and 60% inhibition against MDR strain of M. tuberculosis. F18 from HEUD produced 81% inhibition against clinical isolate and 60% inhibition against MDR strain of M. tuberculosis. Phytochemical analysis indicated that anti-mycobacterial activity of MECS may be due to presence of alkaloids or flavonoids and that of HEUD due to terpenoids. Conclusions: C. sophera and U. dioica plant extracts exhibited promising anti-mycobacterial activity against MDR strain of M. tuberculosis. This is the first report of anti-mycobacterial activity form C. sophera. This study showed possibility of purifying novel anti-mycobacterial compound(s) from C. sophera and U. dioica.

  12. Characterization of the Mycobacterial AdnAB DNA Motor Provides Insights into the Evolution of Bacterial Motor-Nuclease Machines*

    Unciuleac, Mihaela-Carmen; Shuman, Stewart

    2009-01-01

    Mycobacterial AdnAB exemplifies a family of heterodimeric motor-nucleases involved in processing DNA double strand breaks (DSBs). The AdnA and AdnB subunits are each composed of an N-terminal UvrD-like motor domain and a C-terminal RecB-like nuclease module. Here we conducted a biochemical characterization of the AdnAB motor, using a nuclease-inactivated heterodimer. AdnAB is a vigorous single strand DNA (ssDNA)-dependent ATPase (kcat 415 s−1), and the affinity of the motor for the ssDNA cofa...

  13. Diffuse Pulmonary Uptake of Tc-99m Methylene Diphosphonate in a Patient with Non-tuberculosis Mycobacterial Infection

    Kwon, Hyun Woo; Chung, June Key; Lee, Dong Soo [Seoul National University College of Medicine, Seoul (Korea, Republic of); Ab-Aziz, Aini [University Kebangsaan Malaysia Medical Centre, Kuala Lumpur, (Morocco)

    2010-06-15

    Extra-osseous uptake of bone-seeking radiopharmaceuticals has been reported at various sites and it is known to be induced by various causes. Diffuse pulmonary infection, such as tuberculosis, can be a cause of lung uptake of bone-scan agent. Here we report on a patient with non-tuberculosis mycobacterial infection (NTM) who demonstrated diffuse pulmonary uptake on Tc-99m MDP bone scan. After medical treatment for NTM, the patient's lung lesions improved. Estra skeletal lung Tc-99m MDP uptake on bone scan may suggest lung parenchymal damage associated with disease activity.

  14. Diffuse Pulmonary Uptake of Tc-99m Methylene Diphosphonate in a Patient with Non-tuberculosis Mycobacterial Infection

    Extra-osseous uptake of bone-seeking radiopharmaceuticals has been reported at various sites and it is known to be induced by various causes. Diffuse pulmonary infection, such as tuberculosis, can be a cause of lung uptake of bone-scan agent. Here we report on a patient with non-tuberculosis mycobacterial infection (NTM) who demonstrated diffuse pulmonary uptake on Tc-99m MDP bone scan. After medical treatment for NTM, the patient's lung lesions improved. Estra skeletal lung Tc-99m MDP uptake on bone scan may suggest lung parenchymal damage associated with disease activity.

  15. Mechanism of the adjuvant activity of the synthetic mycobacterial cord factor analog Trehalose-6,6-dibehenate (TDB)

    Althaus, Kerstin

    2010-01-01

    The mechanism behind the adjuvant activity of the mycobacterial cord factor TDM and its synthetic analog TDB as a component of the new adjuvant system CAF01 was investigated and compared to the TLR9 ligand CpG. In vitro, TDB and TDM potently activate antigen-presenting cells via a Myd88 and TLR independent, but FcRg-Syk-Card9 dependent signaling pathway. Microarray analysis indicated that in macrophages, TDB induced genome-wide transcriptional responses similar to the Dectin-1 ligand Curdlan ...

  16. Mincle is essential for recognition and adjuvanticity of the mycobacterial cord factor and its synthetic analogue trehalose-dibehenate1

    Schoenen, Hanne; Bodendorfer, Barbara; Hitchens, Kelly; Manzanero, Silvia; Werninghaus, Kerstin; Nimmerjahn, Falk; Agger, Else Marie; Stenger, Steffen; Andersen, Peter; Ruland, Jürgen; Brown, Gordon D.; Wells, Christine; Lang, Roland

    2010-01-01

    The mycobacterial cord factor trehalose-6,6-dimycolate (TDM) and its synthetic analogue trehalose-6,6-dibehenate (TDB) are potent adjuvants for Th1/Th17 vaccination that activate Syk-Card9 signaling in antigen presenting cells. Here, we have further investigated the molecular mechanism of innate immune activation by TDM and TDB. The Syk-coupling adapter protein Fc receptor gamma chain (FcRγ) was essential for macrophage activation and Th17 adjuvanticity. The FcRγ-associated C-type lectin rece...

  17. DNA-Launched Alphavirus Replicons Encoding a Fusion of Mycobacterial Antigens Acr and Ag85B Are Immunogenic and Protective in a Murine Model of TB Infection.

    Dalmia, Neha; Klimstra, William B; Mason, Carol; Ramsay, Alistair J

    2015-01-01

    There is an urgent need for effective prophylactic measures against Mycobacterium tuberculosis (Mtb) infection, particularly given the highly variable efficacy of Bacille Calmette-Guerin (BCG), the only licensed vaccine against tuberculosis (TB). Most studies indicate that cell-mediated immune responses involving both CD4+ and CD8+ T cells are necessary for effective immunity against Mtb. Genetic vaccination induces humoral and cellular immune responses, including CD4+ and CD8+ T-cell responses, against a variety of bacterial, viral, parasitic and tumor antigens, and this strategy may therefore hold promise for the development of more effective TB vaccines. Novel formulations and delivery strategies to improve the immunogenicity of DNA-based vaccines have recently been evaluated, and have shown varying degrees of success. In the present study, we evaluated DNA-launched Venezuelan equine encephalitis replicons (Vrep) encoding a novel fusion of the mycobacterial antigens α-crystallin (Acr) and antigen 85B (Ag85B), termed Vrep-Acr/Ag85B, for their immunogenicity and protective efficacy in a murine model of pulmonary TB. Vrep-Acr/Ag85B generated antigen-specific CD4+ and CD8+ T cell responses that persisted for at least 10 wk post-immunization. Interestingly, parenterally administered Vrep-Acr/Ag85B also induced T cell responses in the lung tissues, the primary site of infection, and inhibited bacterial growth in both the lungs and spleens following aerosol challenge with Mtb. DNA-launched Vrep may, therefore, represent an effective approach to the development of gene-based vaccines against TB, particularly as components of heterologous prime-boost strategies or as BCG boosters. PMID:26317509

  18. DNA-Launched Alphavirus Replicons Encoding a Fusion of Mycobacterial Antigens Acr and Ag85B Are Immunogenic and Protective in a Murine Model of TB Infection.

    Neha Dalmia

    Full Text Available There is an urgent need for effective prophylactic measures against Mycobacterium tuberculosis (Mtb infection, particularly given the highly variable efficacy of Bacille Calmette-Guerin (BCG, the only licensed vaccine against tuberculosis (TB. Most studies indicate that cell-mediated immune responses involving both CD4+ and CD8+ T cells are necessary for effective immunity against Mtb. Genetic vaccination induces humoral and cellular immune responses, including CD4+ and CD8+ T-cell responses, against a variety of bacterial, viral, parasitic and tumor antigens, and this strategy may therefore hold promise for the development of more effective TB vaccines. Novel formulations and delivery strategies to improve the immunogenicity of DNA-based vaccines have recently been evaluated, and have shown varying degrees of success. In the present study, we evaluated DNA-launched Venezuelan equine encephalitis replicons (Vrep encoding a novel fusion of the mycobacterial antigens α-crystallin (Acr and antigen 85B (Ag85B, termed Vrep-Acr/Ag85B, for their immunogenicity and protective efficacy in a murine model of pulmonary TB. Vrep-Acr/Ag85B generated antigen-specific CD4+ and CD8+ T cell responses that persisted for at least 10 wk post-immunization. Interestingly, parenterally administered Vrep-Acr/Ag85B also induced T cell responses in the lung tissues, the primary site of infection, and inhibited bacterial growth in both the lungs and spleens following aerosol challenge with Mtb. DNA-launched Vrep may, therefore, represent an effective approach to the development of gene-based vaccines against TB, particularly as components of heterologous prime-boost strategies or as BCG boosters.

  19. Double Strand Break Unwinding and Resection by the Mycobacterial Helicase-Nuclease AdnAB in the Presence of Single Strand DNA-binding Protein (SSB)*

    Unciuleac, Mihaela-Carmen; Shuman, Stewart

    2010-01-01

    Mycobacterial AdnAB is a heterodimeric DNA helicase-nuclease and 3′ to 5′ DNA translocase implicated in the repair of double strand breaks (DSBs). The AdnA and AdnB subunits are each composed of an N-terminal motor domain and a C-terminal nuclease domain. Inclusion of mycobacterial single strand DNA-binding protein (SSB) in reactions containing linear plasmid dsDNA allowed us to study the AdnAB helicase under conditions in which the unwound single strands are coated by SSB and thereby prevent...

  20. Direct contacts between conserved motifs of different subunits provide major contribution to active site organization in human and mycobacterial dUTPases

    Takács, Enikő; Nagy, Gergely,; Leveles, Ibolya; Harmat, Veronika; Lopata, Anna; Tóth, Judit; Vértessy, Beáta G.

    2010-01-01

    dUTPases are essential for genome integrity. Recent results allowed characterization of the role of conserved residues. Here we analyzed the Asp/Asn mutation within conserved Motif I of human and mycobacterial dUTPases, wherein the Asp residue was previously implicated in Mg2+-coordination. Our results on transient/steady-state kinetics, ligand-binding and a 1.80 Å-resolution structure of the mutant mycobacterial enzyme, in comparison with wild type and C-terminally truncated structures, argu...

  1. Mycobacterial secretion systems ESX-1 and ESX-5 play distinct roles in host cell death and inflammasome activation

    Abdallah, Abdallah

    2011-09-28

    During infection of humans and animals, pathogenic mycobacteria manipulate the host cell causing severe diseases such as tuberculosis and leprosy. To understand the basis of mycobacterial pathogenicity, it is crucial to identify the molecular virulence mechanisms. In this study, we address the contribution of ESX-1 and ESX-5 - two homologous type VII secretion systems of mycobacteria that secrete distinct sets of immune modulators - during the macrophage infection cycle. Using wild-type, ESX-1- and ESX-5-deficient mycobacterial strains, we demonstrate that these secretion systems differentially affect subcellular localization and macrophage cell responses. We show that in contrast to ESX-1, the effector proteins secreted by ESX-5 are not required for the translocation of Mycobacterium tuberculosis or Mycobacterium marinum to the cytosol of host cells. However, the M. marinum ESX-5 mutant does not induce inflammasome activation and IL-1b activation. The ESX-5 system also induces a caspase-independent cell death after translocation has taken place. Importantly, by means of inhibitory agents and small interfering RNA experiments, we reveal that cathepsin B is involved in both the induction of cell death and inflammasome activation upon infection with wild-type mycobacteria. These results reveal distinct roles for two different type VII secretion systems during infection and shed light on how virulent mycobacteria manipulate the host cell in various ways to replicate and spread. Copyright © 2011 by The American Association of Immunologists, Inc.

  2. Tratamiento antirretroviral en pacientes con sida y micobacteriosis Anti-retroviral treatment in patients with AIDS and mycobacterial diseases

    Marcelo E. Corti

    2005-08-01

    Full Text Available La tuberculosis y otras micobacteriosis constituyen asociaciones o coinfecciones frecuentes en pacientes con sida y se asocian con una elevada mortalidad. En esta revisión se actualizan los tratamientos de las principales enfermedades micobacterianas asociadas al sida (tuberculosis y micobacteriosis por Mycobacterium avium, con especial énfasis en las interacciones farmacológicas entre antimicobacterianos, principalmente rifampicina y claritromicina, y fármacos antirretrovirales. Se analizan los esquemas de tratamiento, su duración, la quimioprofilaxis primaria y secundaria y el momento óptimo de iniciación del tratamiento antirretroviral. Finalmente se describe el síndrome inflamatorio de reconstitución inmune y su tratamiento.Tuberculosis and other mycobacterial diseases are frequent coinfections in AIDS patients with an increased related mortality. In this review we have updated the treatment of the main mycobacterial diseases (tuberculosis and Mycobacterium avium disease, under the scope of pharmacological interactions between antimycobacterial drugs, specially rifampicin and clarithromycin, and anti-retroviral drugs. Antimycobacterial treatment schemes, their duration, primary and secondary chemoprophylaxis and the optimal time to start the anti-retroviral therapy are analized. Finally, the immnune reconstitution inflammatory syndrome and its treatment are discussed.

  3. Mycobacterial secretion systems ESX-1 and ESX-5 play distinct roles in host cell death and inflammasome activation.

    Abdallah, Abdallah M; Bestebroer, Jovanka; Savage, Nigel D L; de Punder, Karin; van Zon, Maaike; Wilson, Louis; Korbee, Cees J; van der Sar, Astrid M; Ottenhoff, Tom H M; van der Wel, Nicole N; Bitter, Wilbert; Peters, Peter J

    2011-11-01

    During infection of humans and animals, pathogenic mycobacteria manipulate the host cell causing severe diseases such as tuberculosis and leprosy. To understand the basis of mycobacterial pathogenicity, it is crucial to identify the molecular virulence mechanisms. In this study, we address the contribution of ESX-1 and ESX-5--two homologous type VII secretion systems of mycobacteria that secrete distinct sets of immune modulators--during the macrophage infection cycle. Using wild-type, ESX-1- and ESX-5-deficient mycobacterial strains, we demonstrate that these secretion systems differentially affect subcellular localization and macrophage cell responses. We show that in contrast to ESX-1, the effector proteins secreted by ESX-5 are not required for the translocation of Mycobacterium tuberculosis or Mycobacterium marinum to the cytosol of host cells. However, the M. marinum ESX-5 mutant does not induce inflammasome activation and IL-1β activation. The ESX-5 system also induces a caspase-independent cell death after translocation has taken place. Importantly, by means of inhibitory agents and small interfering RNA experiments, we reveal that cathepsin B is involved in both the induction of cell death and inflammasome activation upon infection with wild-type mycobacteria. These results reveal distinct roles for two different type VII secretion systems during infection and shed light on how virulent mycobacteria manipulate the host cell in various ways to replicate and spread. PMID:21957139

  4. Fasciola hepatica infection reduces Mycobacterium bovis burden and mycobacterial uptake and suppresses the pro-inflammatory response.

    Garza-Cuartero, L; O'Sullivan, J; Blanco, A; McNair, J; Welsh, M; Flynn, R J; Williams, D; Diggle, P; Cassidy, J; Mulcahy, G

    2016-07-01

    Bovine tuberculosis (BTB), caused by Mycobacterium bovis, has an annual incidence in cattle of 0.5% in the Republic of Ireland and 4.7% in the UK, despite long-standing eradication programmes being in place. Failure to achieve complete eradication is multifactorial, but the limitations of diagnostic tests are significant complicating factors. Previously, we have demonstrated that Fasciola hepatica infection, highly prevalent in these areas, induced reduced sensitivity of the standard diagnostic tests for BTB in animals co-infected with F. hepatica and M. bovis. This was accompanied by a reduced M. bovis-specific Th1 immune response. We hypothesized that these changes in co-infected animals would be accompanied by enhanced growth of M. bovis. However, we show here that mycobacterial burden in cattle is reduced in animals co-infected with F. hepatica. Furthermore, we demonstrate a lower mycobacterial recovery and uptake in blood monocyte-derived macrophages (MDM) from F. hepatica-infected cattle which is associated with suppression of pro-inflammatory cytokines and a switch to alternative activation of macrophages. However, the cell surface expression of TLR2 and CD14 in MDM from F. hepatica-infected cattle is increased. These findings reflecting the bystander effect of helminth-induced downregulation of pro-inflammatory responses provide insights to understand host-pathogen interactions in co-infection. PMID:27108767

  5. Novel TetR family transcriptional factor regulates expression of multiple transport-related genes and affects rifampicin resistance in Mycobacterium smegmatis

    Huicong Liu; Min Yang; Zheng-Guo He

    2016-01-01

    Transport-related genes significantly affect bacterial antibiotic resistance. However, the effects of these genes and their regulation of bacterial drug resistance in several mycobacterial species, including the fast-growing Mycobacterium smegmatis, the pathogen M. tuberculosis and M. avium have not been clearly characterized. We identified Ms4022 (MSMEG_4022) as a novel TetR family regulator that activates the expression of seven transport-related genes and affects drug resistance in M. smeg...

  6. Predicting the subcellular localization of mycobacterial proteins by incorporating the optimal tripeptides into the general form of pseudo amino acid composition.

    Zhu, Pan-Pan; Li, Wen-Chao; Zhong, Zhe-Jin; Deng, En-Ze; Ding, Hui; Chen, Wei; Lin, Hao

    2015-02-01

    Mycobacterium tuberculosis is a bacterium that causes tuberculosis, one of the most prevalent infectious diseases. Predicting the subcellular localization of mycobacterial proteins in this bacterium may provide vital clues for the prediction of protein function as well as for drug discovery and design. Therefore, a computational method that can predict the subcellular localization of mycobacterial proteins with high precision is highly desirable. We propose a computational method to predict the subcellular localization of mycobacterial proteins. An objective and strict benchmark dataset was constructed after collecting 272 non-redundant proteins from the universal protein resource (the UniProt database). Subsequently, a novel feature selection strategy based on binomial distribution was used to optimize the feature vector. Finally, a subset containing 219 chosen tripeptide features was imported into a support vector machine-based method to estimate the performance of the dataset in accurately and sensitively identifying these proteins. We found that the proposed method gave a maximum overall accuracy of 89.71% with an average accuracy of 81.12% in the jackknife cross-validation. The results indicate that our prediction method gave an efficient and powerful performance when compared with other published methods. We made the proposed method available on a purpose built Web server called MycoSub that is freely accessible at . We anticipate that MycoSub will become a useful tool for studying the functions of mycobacterial proteins and for designing and developing anti-mycobacterium drugs. PMID:25437899

  7. Escherichia coli-mycobacteria shuttle vectors for operon and gene fusions to lacZ: the pJEM series.

    Timm, J; Lim, E.M.; Gicquel, B

    1994-01-01

    A series of Escherichia coli-mycobacteria shuttle plasmids for the isolation and study of gene regulatory sequences was constructed. These pJEM vectors contain an efficient transcription terminator and multiple cloning sites and allow either operon or gene fusions to lacZ. By constructing operon fusions with pJEM15, we assessed various previously characterized mycobacterial promoters in the fast-growing species Mycobacterium smegmatis and the slow-growing species M. bovis BCG. Our results sug...

  8. Comparative Ser/Thr/Tyr phosphoproteomics between two mycobacterial species: the fast growing Mycobacterium smegmatis and the slow growing Mycobacterium bovis BCG.

    Nakedi, Kehilwe C; Nel, Andrew J M; Garnett, Shaun; Blackburn, Jonathan M; Soares, Nelson C

    2015-01-01

    Ser/Thr/Tyr protein phosphorylation plays a critical role in regulating mycobacterial growth and development. Understanding the mechanistic link between protein phosphorylation signaling network and mycobacterial growth rate requires a global view of the phosphorylation events taking place at a given time under defined conditions. In the present study we employed a phosphopeptide enrichment and high throughput mass spectrometry-based strategy to investigate and qualitatively compare the phosphoproteome of two mycobacterial model organisms: the fast growing Mycobacterium smegmatis and the slow growing Mycobacterium bovis BCG. Cells were harvested during exponential phase and our analysis detected a total of 185 phospho-sites in M. smegmatis, of which 106 were confidently localized [localization probability (LP) = 0.75; PEP = 0.01]. By contrast, in M. bovis BCG the phosphoproteome comprised 442 phospho-sites, of which 289 were confidently localized. The percentage distribution of Ser/Thr/Tyr phosphorylation was 39.47, 57.02, and 3.51% for M. smegmatis and 35, 61.6, and 3.1% for M. bovis BCG. Moreover, our study identified a number of conserved Ser/Thr phosphorylated sites and conserved Tyr phosphorylated sites across different mycobacterial species. Overall a qualitative comparison of the fast and slow growing mycobacteria suggests that the phosphoproteome of M. smegmatis is a simpler version of that of M. bovis BCG. In particular, M. bovis BCG exponential cells exhibited a much more complex and sophisticated protein phosphorylation network regulating important cellular cycle events such as cell wall biosynthesis, elongation, cell division including immediately response to stress. The differences in the two phosphoproteomes are discussed in light of different mycobacterial growth rates. PMID:25904896

  9. Nitric oxide production inhibition and anti-mycobacterial activity of extracts and halogenated sesquiterpenes from the Brazilian red alga laurencia dendroidea J. Agardh

    Thatiana Lopes Biá Ventura

    2015-01-01

    Full Text Available Background: Red algae of the genus Laurencia J. V. Lamouroux are a rich source of secondary metabolites with important pharmacological activities such as anti-tumoral, anti-inflammatory, anti-fungal, anti-viral, anti-leishmanial, anti-helminthic, anti-malarial, anti-trypanosomal, anti-microbial as well as anti-bacterial against Mycobacterium tuberculosis. Objective: In the present study, we evaluated the inhibition of nitric oxide (NO and tumor necrosis factor-a production and the anti-mycobacterial activity of crude extracts from the red Alga Laurencia dendroidea (from the South-Eastern coast of Brazil. Halogenated sesquiterpenes elatol (1, obtusol (2 and cartilagineol (3, previously isolated from this Alga by our group, were also studied. Materials and Methods: The lipopolysaccharide-activated macrophage cells (RAW 264.7 were used as inflammation model. Cytotoxic effect was determined using a commercial  lactate dehydrogenase (LDH kit and 3-(4,5-dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide assay. The growing Mycobacterium inhibition was verified against Mycobacterium bovis Bacillus Calmette-Guιrin and M. tuberculosis H 37 Rv strains. Results: The crude extract from Alga collected at Angra dos Reis, RJ, Brazil, was the most active inhibitor of both mycobacterial growth (half maximal inhibitory concentration [IC 50 ] 8.7 ± 1.4 mg/mL and NO production by activated macrophages (IC 50 5.3 ± 1.3 mg/mL. The assays with isolated compounds revealed the anti-mycobacterial activity of obtusol (2, whereas (--elatol (1 inhibited the release of inflammatory mediators, especially NO. To our knowledge, this is the first report describing an anti-mycobacterial effect of L. dendroidea extract and demonstrating the association of this activity with obtusol (2. Conclusion: The described effects of active compounds from L. dendroidea are promising for the control of inflammation in infectious diseases and specifically, against mycobacterial

  10. Comparative Ser/Thr/Tyr phosphoproteomics between two Mycobacterial species: The fast growing Mycobacterium smegmatis and the slow growing Mycobacterium bovis BCG.

    Kehilwe Confidence Nakedi

    2015-04-01

    Full Text Available Ser/Thr/Tyr protein phosphorylation plays a critical role in regulating mycobacterial growth and development. Understanding the mechanistic link between protein phosphorylation signaling network and mycobacterial growth rate requires a global view of the phosphorylation events taking place at a given time under defined conditions. In the present study we employed a phosphopeptide enrichment and high throughput mass spectrometry-based strategy to investigate and qualitatively compare the phosphoproteome of two mycobacterial model organisms: the fast growing Mycobacterium smegmatis and the slow growing Mycobacterium bovis BCG. Cells were harvested during exponential phase and our analysis detected a total of 185 phospho-sites in M. smegmatis, of which 106 were confidently localized (localization probability (LP =0.75; PEP=0.01. By contrast, in M. bovis BCG the phosphoproteome comprised 442 phospho-sites, of which 289 were confidently localized. The percentage distribution of Ser/Thr/Tyr phosphorylation was 39.47, 57.02 and 3.51 % for M. smegmatis and 35, 61.6 and 3.1% for M. bovis BCG. Moreover, our study identified a number of conserved Ser/Thr phosphorylated sites and conserved Tyr phosphorylated sites across different mycobacterial species. Overall a qualitative comparison of the fast and slow growing mycobacteria suggests that the phosphoproteome of M. smegmatis is a simpler version of that of M. bovis BCG. In particular, M. bovis BCG exponential cells exhibited a much more complex and sophisticated protein phosphorylation network regulating important cellular cycle events such as cell wall biosynthesis, elongation, cell division including immediately response to stress. The differences in the two phosphoproteomes are discussed in light of different mycobacterial growth rates.

  11. First Canadian Reports of Cervical Adenitis due to Mycobacterium malmoense and a 10-Year Review of Nontuberculous Mycobacterial Adenitis

    Chris McCrossin

    2006-01-01

    Full Text Available The present report reviews a decade of experience with nontuberculous mycobacterial adenitis at a pediatric referral centre, noting that patients are often subjected to multiple ineffective antibiotic courses, and that delays in diagnosis and referral for appropriate therapy are common. Notable clinical features include a mean age of presentation of 3.4 years, a male-to-female ratio of 1:1.5 and a gradual onset of painless, unilateral cervical adenopathy. Fever was absent in most patients (77%, and the disease failed to respond to antistaphylococcal antibiotics. The mean time to correct diagnosis was longer than three months (15 weeks. The clinical features of the disease are highlighted and presented with a practical diagnostic approach to the child with subacute/chronic adenitis. New molecular diagnostic tools and emerging mycobacteria are discussed, including the first reports of Mycobacterium malmoense adenitis in Canada.

  12. A hybrid soft solar cell based on the mycobacterial porin MspA linked to a sensitizer-viologen Diad.

    Perera, Ayomi S; Subbaiyan, Navaneetha K; Kalita, Mausam; Wendel, Sebastian O; Samarakoon, Thilani N; D'Souza, Francis; Bossmann, Stefan H

    2013-05-01

    A prototype of a nano solar cell containing the mycobacterial channel protein MspA has been successfully designed. MspA, an octameric transmembrane channel protein from Mycobacterium smegmatis, is one of the most stable proteins known to date. Eight Ruthenium(II) aminophenanthroline-viologen maleimide Diads (Ru-Diads) have been successfully bound to the MspA mutant MspAA96C via cysteine-maleimide bonds. MspA is known to form double layers in which it acts as nanoscopic surfactant. The nanostructured layer that is formed by (Ru-Diad)8MspA at the TiO2 electrode is photochemically active. The resulting "protein nano solar cell" features an incident photon conversion efficiency of 1% at 400 nm. This can be regarded as a proof-of-principle that stable proteins can be successfully integrated into the design of solar cells. PMID:23611424

  13. Techniques of DNA hybridization detect small numbers of mycobacteria with no cross-hybridization with non-mycobacterial respiratory organisms

    The traditional methods used in identifying mycobacteria, such as acid-fast bacillus stains and culture, are often time-consuming, insensitive, and nonspecific. As part of an ongoing program to improve diagnosis and characterization of mycobacteria, the authors have found that deoxyribonucleic acid (DNA) hybridization techniques using isotopically labeled, single-stranded, total DNA can be used to detect as little as 10(-4) micrograms of Mycobacterium tuberculosis (MTb) DNA. This amount of DNA represents approximately 2 X 10(4) genomes. They have also shown the MTb DNA is sufficiently different from the DNA of non-mycobacterial microorganisms such that cross-hybridization with MTb DNA does not occur under the hybridization conditions employed. The authors speculate that DNA hybridization techniques may allow the rapid, sensitive, and specific identification of mycobacteria

  14. A novel inhibitor of gyrase B is a potent drug candidate for treatment of tuberculosis and nontuberculosis mycobacterial infections.

    Locher, Christopher P; Jones, Steven M; Hanzelka, Brian L; Perola, Emanuele; Shoen, Carolyn M; Cynamon, Michael H; Ngwane, Andile H; Wiid, Ian J; van Helden, Paul D; Betoudji, Fabrice; Nuermberger, Eric L; Thomson, John A

    2015-03-01

    New drugs to treat drug-resistant tuberculosis are urgently needed. Extensively drug-resistant and probably the totally drug-resistant tuberculosis strains are resistant to fluoroquinolones like moxifloxacin, which target gyrase A, and most people infected with these strains die within a year. In this study, we found that a novel aminobenzimidazole, VXc-486, which targets gyrase B, potently inhibits multiple drug-sensitive isolates and drug-resistant isolates of Mycobacterium tuberculosis in vitro (MICs of 0.03 to 0.30 μg/ml and 0.08 to 5.48 μg/ml, respectively) and reduces mycobacterial burdens in lungs of infected mice in vivo. VXc-486 is active against drug-resistant isolates, has bactericidal activity, and kills intracellular and dormant M. tuberculosis bacteria in a low-oxygen environment. Furthermore, we found that VXc-486 inhibits the growth of multiple strains of Mycobacterium abscessus, Mycobacterium avium complex, and Mycobacterium kansasii (MICs of 0.1 to 2.0 μg/ml), as well as that of several strains of Nocardia spp. (MICs of 0.1 to 1.0 μg/ml). We made a direct comparison of the parent compound VXc-486 and a phosphate prodrug of VXc-486 and showed that the prodrug of VXc-486 had more potent killing of M. tuberculosis than did VXc-486 in vivo. In combination with other antimycobacterial drugs, the prodrug of VXc-486 sterilized M. tuberculosis infection when combined with rifapentine-pyrazinamide and bedaquiline-pyrazinamide in a relapse infection study in mice. Furthermore, the prodrug of VXc-486 appeared to perform at least as well as the gyrase A inhibitor moxifloxacin. These findings warrant further development of the prodrug of VXc-486 for the treatment of tuberculosis and nontuberculosis mycobacterial infections. PMID:25534737

  15. Efficient Calculation of Enzyme Reaction Free Energy Profiles Using a Hybrid Differential Relaxation Algorithm: Application to Mycobacterial Zinc Hydrolases.

    Romero, Juan Manuel; Martin, Mariano; Ramirez, Claudia Lilián; Dumas, Victoria Gisel; Marti, Marcelo Adrián

    2015-01-01

    Determination of the free energy profile for an enzyme reaction mechanism is of primordial relevance, paving the way for our understanding of the enzyme's catalytic power at the molecular level. Although hybrid, mostly DFT-based, QM/MM methods have been extensively applied to this type of studies, achieving accurate and statistically converged results at a moderate computational cost is still an open challenge. Recently, we have shown that accurate results can be achieved in less computational time, combining Jarzynski's relationship with a hybrid differential relaxation algorithm (HyDRA), which allows partial relaxation of the solvent during the nonequilibrium steering of the reaction. In this work, we have applied this strategy to study two mycobacterial zinc hydrolases. Mycobacterium tuberculosis infections are still a worldwide problem and thus characterization and validation of new drug targets is an intense field of research. Among possible drug targets, recently two essential zinc hydrolases, MshB (Rv1170) and MA-amidase (Rv3717), have been proposed and structurally characterized. Although possible mechanisms have been proposed by analogy to the widely studied human Zn hydrolases, several key issues, particularly those related to Zn coordination sphere and its role in catalysis, remained unanswered. Our results show that mycobacterial Zn hydrolases share a basic two-step mechanism. First, the attacking water becomes deprotonated by the conserved base and establishes the new C-O bond leading to a tetrahedral intermediate. The intermediate requires moderate reorganization to allow for proton transfer to the amide N and C-N bond breaking to occur in the second step. Zn ion plays a key role in stabilizing the tetrahedral intermediate and balancing the negative charge of the substrate during hydroxide ion attack. Finally, comparative analysis of other Zn hydrolases points to a convergent mechanistic evolution. PMID:26415840

  16. Direct contacts between conserved motifs of different subunits provide major contribution to active site organization in human and mycobacterial dUTPases.

    Takács, Eniko; Nagy, Gergely; Leveles, Ibolya; Harmat, Veronika; Lopata, Anna; Tóth, Judit; Vértessy, Beáta G

    2010-07-16

    dUTP pyrophosphatases (dUTPases) are essential for genome integrity. Recent results allowed characterization of the role of conserved residues. Here we analyzed the Asp/Asn mutation within conserved Motif I of human and mycobacterial dUTPases, wherein the Asp residue was previously implicated in Mg(2+)-coordination. Our results on transient/steady-state kinetics, ligand binding and a 1.80 A resolution structure of the mutant mycobacterial enzyme, in comparison with wild type and C-terminally truncated structures, argue that this residue has a major role in providing intra- and intersubunit contacts, but is not essential for Mg(2+) accommodation. We conclude that in addition to the role of conserved motifs in substrate accommodation, direct subunit interaction between protein atoms of active site residues from different conserved motifs are crucial for enzyme function. PMID:20493855

  17. AADNMR: A Simple Method for Rapid Identification of Bacterial/Mycobacterial Infections in Antibiotic Treated Peritoneal Dialysis Effluent Samples for Diagnosis of Infectious Peritonitis

    Guleria, Anupam; Rawat, Atul; Khetrapal, C L; Prasad, Narayan; Kumar, Dinesh

    2014-01-01

    An efficient method is reported for rapid identification of bacterial or mycobacterial infection in a suspected clinical/biological sample. The method is based on the fact that the ring methylene protons of cyclic fatty acids (constituting the cell membrane of several species of bacteria and mycobacteria) resonate specifically between -0.40 and 0.68 ppm region of the 1H NMR spectrum. These cyclic fatty acids are rarely found in the eukaryotic cell membranes. Therefore, the signals from cyclic ring moiety of these fatty acids can be used as markers (a) for the identification of bacterial and mycobacterial infections and (b) for differential diagnosis of bacterial and fungal infections. However, these microbial fatty acids when present inside the membrane are not easily detectable by NMR owing to their fast T2 relaxation. Nonetheless, the problem can easily be circumvented if these fatty acids become suspended in solution. This has been achieved by abolishing the membrane integrity using broad spectrum antibiot...

  18. Implementation of a Consensus Set of Hypervariable Mycobacterial Interspersed Repetitive-Unit-Variable-Number Tandem-Repeat Loci in Mycobacterium tuberculosis Molecular Epidemiology.

    Trovato, Alberto; Tafaj, Silva; Battaglia, Simone; Alagna, Riccardo; Bardhi, Donika; Kapisyzi, Perlat; Bala, Silvana; Haldeda, Migena; Borroni, Emanuele; Hafizi, Hasan; Cirillo, Daniela Maria

    2016-02-01

    This study shows that the addition of a consensus 4-locus set of hypervariable mycobacterial interspersed repetitive-unit-variable-number tandem repeat (MIRU-VNTR) loci to the spoligotyping-24-locus MIRU-VNTR typing strategy is a well-standardized approach that can contribute to an improvement of the true cluster definition while retaining high typeability in non-Beijing strains. PMID:26659207

  19. Leprosy pathogenetic background: a review and lessons from other mycobacterial diseases.

    Goulart, Luiz Ricardo; Goulart, Isabela Maria Bernardes

    2009-02-01

    Leprosy is a disease caused by Mycobacterium leprae that initially affects the peripheral nervous system with patients exhibiting contrasting clinical, immunological, and pathological manifestations despite minimal genetic variation among bacilli isolates. Its clinical manifestations are related to M. leprae survival, innate and acquired immune responses, and interactions between host and bacterial proteins, preventing their invasion and infection, or promoting their development and pathogenesis. The complex molecular interactions in affected individuals influenced by the pathogenetic background will be explored in this review. However, the great genetic diversity imposes difficulty for understanding disease development, and it is likely that many factors and metabolic pathways regulating the immense and contrasting symptomatology will yet be revealed. Four pathways may play a central role in leprosy, including the TLR/LIR-7, VDR, TNF-alpha, and TGF-beta1 for which a large amount of gene polymorphisms have been described that could potentially affect the clinical outcome. Cross-talk pathways may significantly change the course of the disease, depending on the specific disequilibrium of genic homeostasis, which is highly dependent on the environment, antigens that are presented to the host cell, and specific polymorphisms that interact with other genes, external factors, and pathogen survival, culminating in leprosy occurrence. Currently, the microarray-based genomic survey of gene polymorphisms, multiple gene expression analyses, and proteomic technologies, such as mass spectrometry and phage display applied in the discovery of antigens, represent a great potential for evaluating individual responses of leprosy patients and contacts to predict the outcome and progression of the disease. At present, none of the genes is good prognostic marker; however, in the near future we may use multiple targets to predict infection and leprosy development. PMID:19043725

  20. Control of Mycobacterial Infections in Mice Expressing Human Tumor Necrosis Factor (TNF) but Not Mouse TNF

    Olleros, Maria L.; Chavez-Galan, Leslie; Segueni, Noria; Bourigault, Marie L.; Vesin, Dominique; Kruglov, Andrey A.; Drutskaya, Marina S.; Bisig, Ruth; Ehlers, Stefan; Aly, Sahar; Walter, Kerstin; Kuprash, Dmitry V.; Chouchkova, Miliana; Sergei V. Kozlov; Erard, François

    2015-01-01

    Tumor necrosis factor (TNF) is an important cytokine for host defense against pathogens but is also associated with the development of human immunopathologies. TNF blockade effectively ameliorates many chronic inflammatory conditions but compromises host immunity to tuberculosis. The search for novel, more specific human TNF blockers requires the development of a reliable animal model. We used a novel mouse model with complete replacement of the mouse TNF gene by its human ortholog (human TNF...

  1. CMRegNet-An interspecies reference database for corynebacterial and mycobacterial regulatory networks

    Abreu, Vinicius A C; Almeida, Sintia; Tiwari, Sandeep;

    2015-01-01

    BACKGROUND: Organisms utilize a multitude of mechanisms for responding to changing environmental conditions, maintaining their functional homeostasis and to overcome stress situations. One of the most important mechanisms is transcriptional gene regulation. In-depth study of the transcriptional g......Net to date the most comprehensive database of regulatory interactions of CMNR bacteria. The content of CMRegNet is publicly available online via a web interface found at http://lgcm.icb.ufmg.br/cmregnet ....

  2. The HyVac4 subunit vaccine efficiently boosts BCG-primed anti-mycobacterial protective immunity.

    Rolf Billeskov

    Full Text Available BACKGROUND: The current vaccine against tuberculosis (TB, BCG, has failed to control TB worldwide and the protective efficacy is moreover limited to 10-15 years. A vaccine that could efficiently boost a BCG-induced immune response and thus prolong protective immunity would therefore have a significant impact on the global TB-burden. METHODS/FINDINGS: In the present study we show that the fusion protein HyVac4 (H4, consisting of the mycobacterial antigens Ag85B and TB10.4, given in the adjuvant IC31® or DDA/MPL effectively boosted and prolonged immunity induced by BCG, leading to improved protection against infection with virulent M. tuberculosis (M.tb. Increased protection correlated with an increased percentage of TB10.4 specific IFNγ/TNFα/IL-2 or TNFα/IL-2 producing CD4 T cells at the site of infection. Moreover, this vaccine strategy did not compromise the use of ESAT-6 as an accurate correlate of disease development/vaccine efficacy. Indeed both CD4 and CD8 ESAT-6 specific T cells showed significant correlation with bacterial levels. CONCLUSIONS/SIGNIFICANCE: H4-IC31® can efficiently boost BCG-primed immunity leading to an increased protective anti-M.tb immune response dominated by IFNγ/TNFα/IL-2 or TNFα/IL2 producing CD4 T cells. H4 in the CD4 T cell inducing adjuvant IC31® is presently in clinical trials.

  3. The chest radiographic appearances of non-tuberculous mycobacterial pulmonary infection in patients with acquired immunodeficiency syndrome

    Objective: To study the chest radiographic appearances of the non-tuberculous mycobacterial (NTM) pulmonary infection in patients with acquired immune deficiency syndrome (AIDS). Methods: Ten patients with AIDS and NTM underwent chest X-ray radiography and 7 patients performed high-resolution CT (HRCT) scan. Chest radiographic features of' NTM in patients with AIDS were retrospectively analyzed. Results: The chest radiograph showed bilateral pulmonary involvement in 6 cases and single lung involvement in 4 cases (3 cases in the right, 1 case in the left). Patchy air space consolidation (6 cases), large consolidation (5 cases), cavitation (5 cases), small nodules (3 cases), military nodules (2 cases), linear opacity (1 cases) were demonstrated on radiography. On HRCT, air space consolidation (7 cases), small nodules (6 cases), large consolidation (5 cases) with cavitation and cylindric bronchiectasis after the absorption of consolidation, enlarged hilar and mediastinal lymph nodes (4 cases), ground-glass opacities (3 cases), military nodules and 'tree-in-bud' sign (2 case), pleural effusion (1 case), pericardial effusion (1 case) and fibrotic band (1 case) were found. Conclusion: The most common radiographic appearances of NTM in patients with AIDS are bilateral small nodules, large consolidation with cavitation and cylindric bronchiectasis, enlarged hilar and mediastinal lymph nodes. (authors)

  4. An In Silico Approach for Identification of Potential Anti-Mycobacterial Targets of Vasicine and Related Chemical Compounds.

    Chaliha, Amrita Kashyap; Gogoi, Dhrubajyoti; Chetia, Pankaj; Sarma, Diganta; Buragohain, Alak Kumar

    2016-01-01

    Tuberculosis (TB) is known to mankind as one of the most pervasive and persistent of diseases since the early days of civilization. The growing resistance of the causative pathogen Mycobacterium tuberculosis to the standard drug regimen for TB poses further difficulty in its treatment and control. Screening of novel plant-derived compounds with promising anti-tubercular activity has been cited as a prospective route for new anti-tubercular drug discovery and design. Justicia adhatoda L. is a perennial evergreen shrub which is widely mentioned in scientific literature on account of its potent anti-mycobacterial properties. In the present study, we have employed a series of computational methodologies to reveal the probable molecular interactions of vasicine, the principal alkaloid of Justicia adhatoda L., and two of its close natural derivatives- vasicinone and deoxyvasicine, with certain biological targets in M. tuberculosis. Targets were identified from literature and through a reverse Pharmacophore-based approach. Subsequent comparative molecular docking to identify the best ligand-target interactions revealed Antigen 85C of M. tuberculosis as the most potent biological target of vasicine on the basis of optimum molecular docking values. A chemogenomics approach was also employed to validate the molecular interactions between the same class of chemical compounds as vasicine and Antigen 85C. Further, a library of structural analogs of vasicine was created by bioiosterism-based drug design to identify structural analogs with better inhibitory potential against Antigen 85C. PMID:26632438

  5. The mycobacterial cord factor adjuvant analogue trehalose-6,6'-dibehenate (TDB) activates the Nlrp3 inflammasome.

    Schweneker, Katrin; Gorka, Oliver; Schweneker, Marc; Poeck, Hendrik; Tschopp, Jürg; Peschel, Christian; Ruland, Jürgen; Gross, Olaf

    2013-04-01

    The success of a vaccine consists in the induction of an innate immune response and subsequent activation of the adaptive immune system. Because antigens are usually not immunogenic, the addition of adjuvants that activate innate immunity is required. The mycobacterial cord factor trehalose-6,6'-dimycolate (TDM) and its synthetic adjuvant analogue trehalose-6,6'-dibehenate (TDB) rely on the C-type lectin Mincle and the signaling molecules Syk and Card9 to trigger innate immunity. In this study, we show that stimulation of bone marrow-derived dendritic cells (BMDCs) with TDB induces Nlrp3 inflammasome-dependent IL-1β secretion. While Card9 is required for NF-κB activation by TDB, it is dispensable for TDB-induced activation of the Nlrp3 inflammasome. Additionally, efflux of intracellular potassium, lysosomal rupture, and oxygen radical (ROS) production are crucial for caspase-1 processing and IL-1β secretion by TDB. In an in vivo inflammation model, we demonstrate that the recruitment of neutrophils by TDB is significantly reduced in the Nlrp3-deficient mice compared to the wild-type mice, while the production of chemokines in vitro is not influenced by the absence of Nlrp3. These results identify the Nlrp3 inflammasome as an essential mediator for the induction of an innate immune response triggered by TDB. PMID:22921586

  6. Specific interaction between Mycobacterium tuberculosis lipoprotein-derived peptides and target cells inhibits mycobacterial entry in vitro

    Ocampo, Marisol; Curtidor, Hernando; Vanegas, Magnolia; Patarroyo, Manuel Alfonso; Patarroyo, Manuel Elkin

    2014-01-01

    Summary Tuberculosis (TB) continues being one of the diseases having the greatest mortality rates around the world, 8.7 million cases having been reported in 2011. An efficient vaccine against TB having a great impact on public health is an urgent need. Usually, selecting antigens for vaccines has been based on proteins having immunogenic properties for patients suffering TB and having had promising results in mice and non-human primates. Our approach has been based on a functional approach involving the pathogen–host interaction in the search for antigens to be included in designing an efficient, minimal, subunit-based anti-tuberculosis vaccine. This means that Mycobacterium tuberculosis has mainly been involved in studies and that lipoproteins represent an important kind of protein on the cell envelope which can also contribute towards this pathogen's virulence. This study has assessed the expression of four lipoproteins from M. tuberculosis H37Rv, i.e. Rv1411c (LprG), Rv1911c (LppC), Rv2270 (LppN) and Rv3763 (LpqH), and the possible biological activity of peptides derived from these. Five peptides were found for these proteins which had high specific binding to both alveolar A549 epithelial cells and U937 monocyte-derived macrophages which were able to significantly inhibit mycobacterial entry to these cells in vitro. PMID:25041568

  7. Multiphasic strain differentiation of atypical mycobacteria from elephant trunk wash

    Chan, Kok-Gan; Loke, Mun Fai; Ong, Bee Lee; Wong, Yan Ling; Hong, Kar Wai; Tan, Kian Hin; Kaur, Sargit; Ng, Hien Fuh; Abdul Razak, MFA; Ngeow, Yun Fong

    2015-01-01

    Background. Two non-tuberculous mycobacterial strains, UM_3 and UM_11, were isolated from the trunk wash of captive elephants in Malaysia. As they appeared to be identical phenotypes, they were investigated further by conventional and whole genome sequence-based methods of strain differentiation. Methods. Multiphasic investigations on the isolates included species identification with hsp65 PCR-sequencing, conventional biochemical tests, rapid biochemical profiling using API strips and the Bio...

  8. The role of transcriptional regulation in maintaining the availability of mycobacterial adenylate cyclases

    Sarah J. Casey

    2014-03-01

    Full Text Available Mycobacterium species have a complex cAMP regulatory network indicated by the high number of adenylate cyclases annotated in their genomes. However the need for a high level of redundancy in adenylate cyclase genes remains unknown. We have used semiquantitiative RT-PCR to examine the expression of eight Mycobacterium smegmatis cyclases with orthologs in the human pathogen Mycobacterium tuberculosis, where cAMP has recently been shown to be important for virulence. All eight cyclases were transcribed in all environments tested, and only four demonstrated environmental-mediated changes in transcription. M. smegmatis genes MSMEG_0545 and MSMEG_4279 were upregulated during starvation conditions while MSMEG_0545 and MSMEG_4924 were downregulated in H2O2 and MSMEG_3780 was downregulated in low pH and starvation. Promoter fusion constructs containing M. tuberculosis H37Rv promoters showed consistent regulation compared to their M. smegmatis orthologs. Overall our findings indicate that while low levels of transcriptional regulation occur, regulation at the mRNA level does not play a major role in controlling cellular cyclase availability in a given environment.

  9. Construction, Expression and Identification of a Recombinant BCG Vaccine Encoding Human Mycobacterium Tuberculosis Heat Shock Protein 65

    戴五星; 梁靓; 高红; 黄海浪; 陈智浩; 程继忠; 皇甫永穆

    2004-01-01

    Heat shock protein 65 (HSP65) is one of the most important protective immunogens against the tuberculosis infection. The signal sequence of antigen 85B and the whole HSP65 DNA sequence of human Mycobacterium tuberculosis (M. tuberculosis) were amplified from BCG genome and plasmid pCMV-MTHSP65 respectively by polymerase chain reactions (PCR). These two sequences were cloned into the plasmid pBCG-2100 under the control of the promoter of heat shock protein 70 (HSP70) from human M. tuberculosis, yielding the prokaryotic shuttle expression plasmid pBCG-SP-HSP65. Results of restriction endonuclease analysis, PCR detection and DNA sequencing analysis showed that the two cloned DNA sequences were consistent with those previously reported, and the direction of their inserting into the recombinant was correct and the reading frame had been maintained. The recombinants were electroporated into BCG to construct the recombinant BCG vaccine and induced by heating. The induced expression detected by SDS-PAGE showed that the content of 65 kD protein expressed in recombinant BCG was 35.69 % in total bacterial protein and 74.09 % in the cell lysate supernatants, suggesting that the recombinant HSP65 gene could express in BCG with high efficiency and the expressed proteins were mainly soluble. Western-blot showed that the secretive recombinant proteins could specifically combine with antibody against M.tuberculosis HSP65, indicating that the recombinant proteins possess the biological activity of HSP65.

  10. New Recombinant Mycobacterium bovis BCG Expression Vectors: Improving Genetic Control over Mycobacterial Promoters.

    Kanno, Alex I; Goulart, Cibelly; Rofatto, Henrique K; Oliveira, Sergio C; Leite, Luciana C C; McFadden, Johnjoe

    2016-04-15

    The expression of many antigens, stimulatory molecules, or even metabolic pathways in mycobacteria such asMycobacterium bovisBCG orM. smegmatiswas made possible through the development of shuttle vectors, and several recombinant vaccines have been constructed. However, gene expression in any of these systems relied mostly on the selection of natural promoters expected to provide the required level of expression by trial and error. To establish a systematic selection of promoters with a range of strengths, we generated a library of mutagenized promoters through error-prone PCR of the strong PL5promoter, originally from mycobacteriophage L5. These promoters were cloned upstream of the enhanced green fluorescent protein reporter gene, and recombinantM. smegmatisbacteria exhibiting a wide range of fluorescence levels were identified. A set of promoters was selected and identified as having high (pJK-F8), intermediate (pJK-B7, pJK-E6, pJK-D6), or low (pJK-C1) promoter strengths in bothM. smegmatisandM. bovisBCG. The sequencing of the promoter region demonstrated that it was extensively modified (6 to 11%) in all of the plasmids selected. To test the functionality of the system, two different expression vectors were demonstrated to allow corresponding expression levels of theSchistosoma mansoniantigen Sm29 in BCG. The approach used here can be used to adjust expression levels for synthetic and/or systems biology studies or for vaccine development to maximize the immune response. PMID:26850295

  11. Systemic BCG immunization induces persistent lung mucosal multifunctional CD4 T(EM cells which expand following virulent mycobacterial challenge.

    Daryan A Kaveh

    Full Text Available To more closely understand the mechanisms of how BCG vaccination confers immunity would help to rationally design improved tuberculosis vaccines that are urgently required. Given the established central role of CD4 T cells in BCG induced immunity, we sought to characterise the generation of memory CD4 T cell responses to BCG vaccination and M. bovis infection in a murine challenge model. We demonstrate that a single systemic BCG vaccination induces distinct systemic and mucosal populations of T effector memory (T(EM cells in vaccinated mice. These CD4+CD44(hiCD62L(loCD27⁻ T cells concomitantly produce IFN-γ and TNF-α, or IFN-γ, IL-2 and TNF-α and have a higher cytokine median fluorescence intensity MFI or 'quality of response' than single cytokine producing cells. These cells are maintained for long periods (>16 months in BCG protected mice, maintaining a vaccine-specific functionality. Following virulent mycobacterial challenge, these cells underwent significant expansion in the lungs and are, therefore, strongly associated with protection against M. bovis challenge. Our data demonstrate that a persistent mucosal population of T(EM cells can be induced by parenteral immunization, a feature only previously associated with mucosal immunization routes; and that these multifunctional T(EM cells are strongly associated with protection. We propose that these cells mediate protective immunity, and that vaccines designed to increase the number of relevant antigen-specific T(EM in the lung may represent a new generation of TB vaccines.

  12. Tomography high Resolution CT findings of nontuberculous mycobacterial pulmonary disease: Comparison between the first treatment and the re treatment group

    Gwak, Soon Hyuk; Cho, Bum Sang; Jeon, Min Hee; Kim, Eun Young; Kang, Min Ho; Yi, Kyung Sik; Lee, Seung Young; Kim, Sung Jin; Lee, Ki Man [Chungbuk National Univ., Cheongju, (Korea, Republic of)

    2012-06-15

    To analyze and compare the thin section CT findings of first and re treatment nontuberculous mycobacterial (NTM) pulmonary disease. Between January 2005 and April 2010, 121 patients with positive sputum culture for NTM were recruited. We included only 32 patients underwent high resolution chest CT and were confirmed by American Thoracic Society criteria NTM pulmonary infection (first treatment 15, re treatment 17 patients). CT images of 32 patients were reviewed retrospectively. We evaluated the frequency and laterality of the followings; nodule, increased density, bronchial change, parenchymal change. The significantly frequent CT findings of the re treatment NTM group were well defined nodules (retreatment 82.4%, first treatment 33.3%, p = 0.00), consolidations (retreatment 88.2%, first treatment 53.3%, p = 0.03), bronchial changes (bronchiectasis; retreatment 100%, first treatment 66.6%, p = 0.01, bronchial narrowing; retreatment 23.5%, first treatment 0%, p = 0.04 and mucoid impaction; retreatment-58.8%, first treatment-20.0%, p = 0.03) and atelectasis with bronchiectasis (retreatment-88.2%, first treatment 26.7%, p = 0.00). However, most of the evaluated thin section CT findings, such as centrilobular and ill defined nodules, lobular, segmental and subpleural consolidations, ground glass attenuation, bronchial wall thickening, cavities, pleural lesions, fibrotic band, emphysema and laterality of lesions, have not shown significant differences between first treatment and the re treatment group. Thin section CT findings of well defined nodules, consolidations, bronchial changes (bronchiectasis, bronchial narrowing and mucoid impaction) and atelectasis with bronchiectasis are highly suggestive of re treatment NTM pulmonary disease.

  13. Tomography high Resolution CT findings of nontuberculous mycobacterial pulmonary disease: Comparison between the first treatment and the re treatment group

    To analyze and compare the thin section CT findings of first and re treatment nontuberculous mycobacterial (NTM) pulmonary disease. Between January 2005 and April 2010, 121 patients with positive sputum culture for NTM were recruited. We included only 32 patients underwent high resolution chest CT and were confirmed by American Thoracic Society criteria NTM pulmonary infection (first treatment 15, re treatment 17 patients). CT images of 32 patients were reviewed retrospectively. We evaluated the frequency and laterality of the followings; nodule, increased density, bronchial change, parenchymal change. The significantly frequent CT findings of the re treatment NTM group were well defined nodules (retreatment 82.4%, first treatment 33.3%, p = 0.00), consolidations (retreatment 88.2%, first treatment 53.3%, p = 0.03), bronchial changes (bronchiectasis; retreatment 100%, first treatment 66.6%, p = 0.01, bronchial narrowing; retreatment 23.5%, first treatment 0%, p = 0.04 and mucoid impaction; retreatment-58.8%, first treatment-20.0%, p = 0.03) and atelectasis with bronchiectasis (retreatment-88.2%, first treatment 26.7%, p = 0.00). However, most of the evaluated thin section CT findings, such as centrilobular and ill defined nodules, lobular, segmental and subpleural consolidations, ground glass attenuation, bronchial wall thickening, cavities, pleural lesions, fibrotic band, emphysema and laterality of lesions, have not shown significant differences between first treatment and the re treatment group. Thin section CT findings of well defined nodules, consolidations, bronchial changes (bronchiectasis, bronchial narrowing and mucoid impaction) and atelectasis with bronchiectasis are highly suggestive of re treatment NTM pulmonary disease

  14. A Subset of Protective γ9δ2 T Cells Is Activated by Novel Mycobacterial Glycolipid Components.

    Xia, Mei; Hesser, Danny C; De, Prithwiraj; Sakala, Isaac G; Spencer, Charles T; Kirkwood, Jay S; Abate, Getahun; Chatterjee, Delphi; Dobos, Karen M; Hoft, Daniel F

    2016-09-01

    γ9δ2 T cells provide a natural bridge between innate and adaptive immunity, rapidly and potently respond to pathogen infection in mucosal tissues, and are prominently induced by both tuberculosis (TB) infection and bacillus Calmette Guérin (BCG) vaccination. Mycobacterium-expanded γ9δ2 T cells represent only a subset of the phosphoantigen {isopentenyl pyrophosphate [IPP] and (E)-4-hydroxy-3-methyl-but-2-enylpyrophosphate [HMBPP]}-responsive γ9δ2 T cells, expressing an oligoclonal set of T cell receptor (TCR) sequences which more efficiently recognize and inhibit intracellular Mycobacterium tuberculosis infection. Based on this premise, we have been searching for M. tuberculosis antigens specifically capable of inducing a unique subset of mycobacterium-protective γ9δ2 T cells. Our screening strategy includes the identification of M. tuberculosis fractions that expand γ9δ2 T cells with biological functions capable of inhibiting intracellular mycobacterial replication. Chemical treatments of M. tuberculosis whole-cell lysates (MtbWL) ruled out protein, nucleic acid, and nonpolar lipids as the M. tuberculosis antigens inducing protective γ9δ2 T cells. Mild acid hydrolysis, which transforms complex carbohydrate to monomeric residues, abrogated the specific activity of M. tuberculosis whole-cell lysates, suggesting that a polysaccharide was required for biological activity. Extraction of MtbWL with chloroform-methanol-water (10:10:3) resulted in a polar lipid fraction with highly enriched specific activity; this activity was further enriched by silica gel chromatography. A combination of mass spectrometry and nuclear magnetic resonance analysis of bioactive fractions indicated that 6-O-methylglucose-containing lipopolysaccharides (mGLP) are predominant components present in this active fraction. These results have important implications for the development of new immunotherapeutic approaches for prevention and treatment of TB. PMID:27297390

  15. Mycobacterium tuberculosis Zinc Metalloprotease-1 Elicits Tuberculosis-specific Humoral Immune Response Independent of Mycobacterial Load in Pulmonary and Extra-Pulmonary Tuberculosis Patients

    Mani Harika eVemula

    2016-03-01

    Full Text Available Conventionally, facultative intracellular pathogen, Mycobacterium tuberculosis (M.tb, the tuberculosis (TB causing bacilli in human is cleared by cell-mediated immunity (CMI with CD4+ T cells playing instrumental role in protective immunity, while antibody-mediated immunity (AMI is considered non-protective. This longstanding convention has been challenged with recent evidences of increased susceptibility of hosts with compromised AMI and monoclonal antibodies conferring passive protection against TB and other intracellular pathogens. Therefore, novel approaches towards vaccine development include strategies aiming at induction of humoral response along with CMI. This necessitates the identification of mycobacterial proteins with properties of immunomodulation and strong immunogenicity. In this study, we determined the immunogenic potential of M.tb Zinc metalloprotease-1 (Zmp1, a secretory protein essential for intracellular survival and pathogenesis of M.tb. We observed that Zmp1 was secreted by in vitro grown M.tb under granuloma-like stress conditions (acidic, oxidative, iron deficiency and nutrient deprivation and generated Th2 cytokine microenvironment upon exogenous treatment of Peripheral Blood Mononulear Cells (PBMCs with recombinant Zmp1 (rZmp1. This was supported by recording specific and robust humoral response in TB patients in a cohort of 295. The anti-Zmp1 titers were significantly higher in TB patients (n=121 as against healthy control (n=62, household contacts (n=89 and non-specific infection controls (n=23. A significant observation of the study is the presence of equally high titers of anti-Zmp1 antibodies in a range of patients with high bacilli load (sputum bacilli load of 300+ per mL to paucibacillary smear-negative pulmonary tuberculosis (PTB cases. This clearly indicated the potential of Zmp1 to evoke an effective humoral response independent of mycobacterial load. Such mycobacterial proteins can be explored as antigen

  16. Activation of human antigen-presenting cells by the mycobacterial cord factor and its glycolipid adjuvant analogue trehalose-6,6’-dibehenate

    Ostrop, Jenny

    2015-01-01

    The mycobacterial cord factor trehalose-6,6’-dimycolate (TDM) is an abundant cell wall glycolipid of Mycobacterium tuberculosis and other mycobacteria. It causes inflammation and adjuvanticity, but it is also a major virulence factor of M. tuberculosis. Its synthetic analogue trehalose-6,6’-dibehenate (TDB) has robust adjuvant activity and induces a Th1/Th17 T cell response in animal models. The TDB-containing liposomal adjuvant formulation Caf01 has entered phase I clinical studies in humans...

  17. Unravelling the Secrets of Mycobacterial Cidality through the Lens of Antisense

    Datta, Santanu; Shandil, Radha Krishan; Kumar, Naveen; Robert, Nanduri; Sokhi, Upneet K.; Guptha, Supreeth; Narayanan, Shridhar; Anbarasu, Anand; Ramaiah, Sudha

    2016-01-01

    One of the major impediments in anti-tubercular drug discovery is the lack of a robust grammar that governs the in-vitro to the in-vivo translation of efficacy. Mycobacterium tuberculosis (Mtb) is capable of growing both extracellular as well as intracellular; encountering various hostile conditions like acidic milieu, free radicals, starvation, oxygen deprivation, and immune effector mechanisms. Unique survival strategies of Mtb have prompted researchers to develop in-vitro equivalents to simulate in-vivo physiologies and exploited to find efficacious inhibitors against various phenotypes. Conventionally, the inhibitors are screened on Mtb under the conditions that are unrelated to the in-vivo disease environments. The present study was aimed to (1). Investigate cidality of Mtb targets using a non-chemical inhibitor antisense-RNA (AS-RNA) under in-vivo simulated in-vitro conditions.(2). Confirm the cidality of the targets under in-vivo in experimental tuberculosis. (3). Correlate in-vitro vs. in-vivo cidality data to identify the in-vitro condition that best predicts in-vivo cidality potential of the targets. Using cidality as a metric for efficacy, and AS-RNA as a target-specific inhibitor, we delineated the cidality potential of five target genes under six different physiological conditions (replicating, hypoxia, low pH, nutrient starvation, nitrogen depletion, and nitric oxide).In-vitro cidality confirmed in experimental tuberculosis in BALB/c mice using the AS-RNA allowed us to identify cidal targets in the rank order of rpoB>aroK>ppk>rpoC>ilvB. RpoB was used as the cidality control. In-vitro and in-vivo studies feature aroK (encoding shikimate kinase) as an in-vivo mycobactericidal target suitable for anti-TB drug discovery. In-vitro to in-vivo cidality correlations suggested the low pH (R = 0.9856) in-vitro model as best predictor of in-vivo cidality; however, similar correlation studies in pathologically relevant (Kramnik) mice are warranted. In the acute

  18. A High Throughput Screening Assay for Anti-Mycobacterial Small Molecules Based on Adenylate Kinase Release as a Reporter of Cell Lysis.

    Lauren Forbes

    Full Text Available Mycobacterium tuberculosis (Mtb is well-established to be one of the most important bacterial pathogens for which new antimicrobial therapies are needed. Herein, we describe the development of a high throughput screening assay for the identification of molecules that are bactericidal against Mycobacteria. The assay utilizes the release of the intracellular enzyme adenylate kinase into the culture medium as a reporter of mycobacterial cell death. We demonstrate that the assay is selective for mycobactericidal molecules and detects anti-mycobacterial activity at concentrations below the minimum inhibitory concentration of many molecules. Thus, the AK assay is more sensitive than traditional growth assays. We have validated the AK assay in the HTS setting using the Mtb surrogate organism M. smegmatis and libraries of FDA approved drugs as well as a commercially available Diversity set. The screen of the FDA-approved library demonstrated that the AK assay is able to identify the vast majority of drugs with known mycobactericidal activity. Importantly, our screen of the Diversity set revealed that the increased sensitivity of the AK assay increases the ability of M. smegmatis-based screens to detect molecules with relatively poor activity against M. smegmatis but good to excellent activity against Mtb.

  19. Purification, crystallization and preliminary X-ray analysis of SGR6054, a Streptomyces homologue of the mycobacterial integration host factor mIHF

    A Streptomyces homologue of the mycobacterial integration host factor mIHF was heterologously produced, purified and crystallized in the presence of a 16-mer duplex DNA by the sitting-drop vapour-diffusion method. The best crystal diffracted X-rays to 2.22 Å resolution and belonged to space group C2. The mycobacterial integration host factor (mIHF) is a small nonspecific DNA-binding protein that is essential for the growth of Mycobacterium smegmatis. mIHF homologues are widely distributed among Actinobacteria, and a Streptomyces homologue of mIHF is involved in control of sporulation and antibiotic production in S. coelicolor A3(2). Despite their important biological functions, a structure of mIHF or its homologues has not been elucidated to date. Here, the S. griseus mIHF homologue (SGR6054) was expressed and purified from Escherichia coli and crystallized in the presence of a 16-mer duplex DNA by the sitting-drop vapour-diffusion method. The plate-shaped crystal belonged to space group C2, with unit-cell parameters a = 88.53, b = 69.35, c = 77.71 Å, β = 96.63°, and diffracted X-rays to 2.22 Å resolution

  20. A Subgroup of Latently Mycobacterium tuberculosis Infected Individuals Is Characterized by Consistently Elevated IgA Responses to Several Mycobacterial Antigens

    Ralf Baumann

    2015-01-01

    Full Text Available Elevated antibody responses to Mycobacterium tuberculosis antigens in individuals with latent infection (LTBI have previously been linked to an increased risk for progression to active disease. Studies in the field focussed mainly on IgG antibodies. In the present study, IgA and/or IgG responses to the mycobacterial protein antigens AlaDH, NarL, 19 kDa, PstS3, and MPT83 were determined in a blinded fashion in sera from 53 LTBI controls, 14 healthy controls, and 42 active TB subjects. Among controls, we found that elevated IgA levels against all investigated antigens were not randomly distributed but concentrated on a subgroup of <30%—with particular high levels in a small subgroup of ~5% comprising one progressor to active TB. Based on a specificity of 100%, anti-NarL IgA antibodies achieved with 78.6% sensitivity the highest accuracy for the detection of active TB compared to healthy controls. In conclusion, the consistently elevated IgA levels in a subgroup of controls suggest higher mycobacterial load, a risk factor for progression to active TB, and together with high IgG levels may have prognostic potential and should be investigated in future large scale studies. The novel antigen NarL may also be promising for the antibody-based diagnosis of active TB cases.

  1. Drug-sensitive tuberculosis, multidrug-resistant tuberculosis, and nontuberculous mycobacterial pulmonary disease in nonAIDS adults: comparisons of thin-section CT findings

    The aim of this work was to compare thin-section CT (TSCT) findings of drug-sensitive (DS) tuberculosis (TB), multidrug-resistant (MDR) TB, and nontuberculous mycobacterial (NTM) pulmonary disease in nonAIDS adults. During 2003, 216 (113 DS TB, 35 MDR TB, and 68 NTM) patients with smear-positive sputum for acid-fast bacilli (AFB), and who were subsequently confirmed to have mycobacterial pulmonary disease, underwent thoracic TSCT. The frequency of lung lesion patterns on TSCT and patients' demographic data were compared. The commonest TSCT findings were tree-in-bud opacities and nodules. On a per-person basis, significant differences were found in the frequency of multiple cavities and bronchiectasis (P<0.001, chi-square test and multiple logistic regression analysis). Multiple cavities were more frequent in MDR TB than in the other two groups and extensive bronchiectasis in NTM disease (multiple logistic regression analysis). Patients with MDR TB were younger than those with DS TB or NTM disease (P<0.001, multiple logistic regression analysis). Previous tuberculosis treatment history was significantly more frequent in patients with MDR TB or NTM disease (P<0.001, chi-square test and multiple logistic regression analysis). In patients with positive sputum AFB, multiple cavities, young age, and previous tuberculosis treatment history imply MDR TB, whereas extensive bronchiectasis, old age, and previous tuberculosis treatment history NTM disease. (orig.)

  2. Benzoic Acid-Inducible Gene Expression in Mycobacteria.

    Marte S Dragset

    Full Text Available Conditional expression is a powerful tool to investigate the role of bacterial genes. Here, we adapt the Pseudomonas putida-derived positively regulated XylS/Pm expression system to control inducible gene expression in Mycobacterium smegmatis and Mycobacterium tuberculosis, the causative agent of human tuberculosis. By making simple changes to a Gram-negative broad-host-range XylS/Pm-regulated gene expression vector, we prove that it is possible to adapt this well-studied expression system to non-Gram-negative species. With the benzoic acid-derived inducer m-toluate, we achieve a robust, time- and dose-dependent reversible induction of Pm-mediated expression in mycobacteria, with low background expression levels. XylS/Pm is thus an important addition to existing mycobacterial expression tools, especially when low basal expression is of particular importance.

  3. Characterization of the mycobacterial AdnAB DNA motor provides insights into the evolution of bacterial motor-nuclease machines.

    Unciuleac, Mihaela-Carmen; Shuman, Stewart

    2010-01-22

    Mycobacterial AdnAB exemplifies a family of heterodimeric motor-nucleases involved in processing DNA double strand breaks (DSBs). The AdnA and AdnB subunits are each composed of an N-terminal UvrD-like motor domain and a C-terminal RecB-like nuclease module. Here we conducted a biochemical characterization of the AdnAB motor, using a nuclease-inactivated heterodimer. AdnAB is a vigorous single strand DNA (ssDNA)-dependent ATPase (k(cat) 415 s(-1)), and the affinity of the motor for the ssDNA cofactor increases 140-fold as DNA length is extended from 12 to 44 nucleotides. Using a streptavidin displacement assay, we demonstrate that AdnAB is a 3' --> 5' translocase on ssDNA. AdnAB binds stably to DSB ends. In the presence of ATP, the motor unwinds the DNA duplex without requiring an ssDNA loading strand. We integrate these findings into a model of DSB unwinding in which the "leading" AdnB and "lagging" AdnA motor domains track in tandem, 3' to 5', along the same DNA single strand. This contrasts with RecBCD, in which the RecB and RecD motors track in parallel along the two separated DNA single strands. The effects of 5' and 3' terminal obstacles on ssDNA cleavage by wild-type AdnAB suggest that the AdnA nuclease receives and processes the displaced 5' strand, while the AdnB nuclease cleaves the displaced 3' strand. We present evidence that the distinctive "molecular ruler" function of the ATP-dependent single strand DNase, whereby AdnAB measures the distance from the 5'-end to the sites of incision, reflects directional pumping of the ssDNA through the AdnAB motor into the AdnB nuclease. These and other findings suggest a scenario for the descent of the RecBCD- and AddAB-type DSB-processing machines from an ancestral AdnAB-like enzyme. PMID:19920138

  4. Genes and Gene Therapy

    ... correctly, a child can have a genetic disorder. Gene therapy is an experimental technique that uses genes to ... or prevent disease. The most common form of gene therapy involves inserting a normal gene to replace an ...

  5. Rapid Detection of Mutation in RRDR of rpo B Gene for Rifampicin Resistance in MDR-Pulmonary Tuberculosis by DNA Sequencing

    Patra, Surajeet Kumar; Jain, Anju; B L Sherwal; Khanna, Ashwani

    2010-01-01

    To detect the site of mutation in RRDR of rpo B gene for rifampicin resistance in MDR-TB by DNA sequencing. 50 MDR-TB patients were enrolled in our study after informed written consent. Mycobacterial DNA was extracted from sputum samples by Universal Sample Processing (USP) method and RRDR of rpo B gene was amplified by PCR using primers RP4T and RP8T and then sequenced by automated DNA sequencing. The nucleotide sequences of RRDR of rpo B gene were compared with the reference sequence. We ob...

  6. Factors associated with pastoral community knowledge and occurrence of mycobacterial infections in Human-Animal Interface areas of Nakasongola and Mubende districts, Uganda

    Biffa Demelash

    2010-08-01

    Full Text Available Abstract Background Nontuberculous mycobacteria (NTM are emerging opportunistic pathogens whose role in human and animal disease is increasingly being recognized. Major concerns are their role as opportunistic pathogens in HIV/AIDS infections. The role of open natural water sources as source and livestock/wildlife as reservoirs of infections to man are well documented. This presents a health challenge to the pastoral systems in Africa that rely mostly on open natural water sources to meet livestock and human needs. Recent study in the pastoral areas of Uganda showed infections with same genotypes of NTM in pastoralists and their livestock. The aim of this study was to determine the environmental, animal husbandry and socio-demographic factors associated with occurrence and the pastoral community knowledge of mycobacterial infections at the human-environment-livestock/wildlife interface (HELI areas in pastoral ecosystems of Uganda. Methods Two hundred and fifty three (253 individuals were subjected to a questionnaire survey across the study districts of Nakasongola and Mubende. Data were analyzed using descriptive statistics and multivariable logistic regression analysis. Results Humans sharing of the water sources with wild animals from the forest compared to savannah ecosystem (OR = 3.3, the tribe of herding pastoral community (OR = 7.9, number of rooms present in household (3-5 vs. 1-2 rooms (OR = 3.3 were the socio-demographic factors that influenced the level of knowledge on mycobacterial infections among the pastoral communities. Tribe (OR = 6.4, use of spring vs. stream water for domestic use (OR = 4.5, presence of sediments in household water receptacle (OR = 2.32, non separation of water containers for drinking and domestic use (OR = 2.46, sharing of drinking water sources with wild animals (OR = 2.1, duration of involvement of >5 yrs in cattle keeping (OR = 3.7 and distance of household to animal night shelters (>20 meters (OR = 3

  7. Disseminated Bacillus Calmette-Guérin and Susceptibility to Mycobacterial Infections-Implications on Bacillus Calmette-Guérin Vaccinations.

    Lee, Pamela Pw

    2015-08-01

    Bacillus Calmette-Guérin (BCG) is a live vaccine and has the potential to cause local disease and systemic dissemination in immunocompromised hosts, including infants who are infected with human immunodeficiency virus (HIV) through vertical transmission, and patients with primary immunodeficiencies (PID) such as severe combined immunodeficiency (SCID), chronic granulomatous disease (CGD), hyper-IgM syndrome, and defects of the IL12- IFNγ axis (Mendelian susceptibility to mycobacterial diseases, MSMD). Disseminated BCG is extremely difficult to treat. The chance of complete eradication is low unless functional immune response is restored by haematopoietic stem cell transplant. Prolonged use of anti-mycobacterial drugs often causes organ toxicities and drug resistance. Inflammatory complications which develop upon immunoreconstitution post-transplant may necessitate immunosuppressive treatment, which adversely affect immune recovery and increases risks of opportunistic infections. Multiple BCG reactivations can occur in patients with CGD and MSMD, and BCG can remain latent until reactivations take place in adulthood and manifest as disease. It is important for neonatologists, general practitioners, primary care clinicians and nurses working in maternal and child care centres to be aware of BCG-related complications, which may be the first sign of an underlying immunodeficiency. As neonatal BCG is included in standard vaccination schedule in many countries, it is a challenge to identify and avoid administration of BCG to infants who potentially have PIDs. Deferring BCG vaccination is recently advocated to protect highly vulnerable populations, but the appropriate strategy is yet to be determined. Newborn screening for SCID offers a potential to avoid this complication, if an integrated system of screening and vaccination can be organised. PMID:26477962

  8. Heterologous expression of mycobacterial Esx complexes in Escherichia coli for structural studies is facilitated by the use of maltose binding protein fusions.

    Mark A Arbing

    Full Text Available The expression of heteroligomeric protein complexes for structural studies often requires a special coexpression strategy. The reason is that the solubility and proper folding of each subunit of the complex requires physical association with other subunits of the complex. The genomes of pathogenic mycobacteria encode many small protein complexes, implicated in bacterial fitness and pathogenicity, whose characterization may be further complicated by insolubility upon expression in Escherichia coli, the most common heterologous protein expression host. As protein fusions have been shown to dramatically affect the solubility of the proteins to which they are fused, we evaluated the ability of maltose binding protein fusions to produce mycobacterial Esx protein complexes. A single plasmid expression strategy using an N-terminal maltose binding protein fusion to the CFP-10 homolog proved effective in producing soluble Esx protein complexes, as determined by a small-scale expression and affinity purification screen, and coupled with intracellular proteolytic cleavage of the maltose binding protein moiety produced protein complexes of sufficient purity for structural studies. In comparison, the expression of complexes with hexahistidine affinity tags alone on the CFP-10 subunits failed to express in amounts sufficient for biochemical characterization. Using this strategy, six mycobacterial Esx complexes were expressed, purified to homogeneity, and subjected to crystallization screening and the crystal structures of the Mycobacterium abscessus EsxEF, M. smegmatis EsxGH, and M. tuberculosis EsxOP complexes were determined. Maltose binding protein fusions are thus an effective method for production of Esx complexes and this strategy may be applicable for production of other protein complexes.

  9. Diagnostic Yield of Bronchoalveolar Lavage Gene Xpert in Smear-Negative and Sputum-Scarce Pulmonary Tuberculosis

    Objective: To measure the diagnostic yield of Bronchoalveolar Lavage (BAL) gene Xpert (Xpert MTB/RIF assay), to detect Mycobacterium tuberculosis (MTB) and rifampicin resistance and compare it with that of mycobacterial cultures in a suspected case of pulmonary tuberculosis. Study Design: An analytical study. Place and Duration of Study: Department of Pulmonology, Fauji Foundation Hospital (FFH), Rawalpindi, from December 2012 to August 2013. Methodology: BAL specimens of 93 patients with suspected pulmonary tuberculosis with smear-negative or sputumscarce disease, who presented to the Department of Pulmonology, FFH, Rawalpindi were inducted. A smear-negative case was one in whom three consecutive early morning sputum samples did not reveal acid fast bacilli when examined by microscopy with Zeihl Nelson (ZN) stain. Patients who had sputum amount less than 1 ml were defined to have sputumscarce disease. The same was evaluated with ZN stain, gene Xpert and mycobacterial cultures. Sensitivity analysis was carried out using culture as the gold standard. Results: The frequency of positive mycobacterial cultures was 85 (91.4%). The sensitivity, specificity, positive predictive value and negative predictive values of BAL gene Xpert to detect Mycobacterium tuberculosis were 91.86%, 71.42%, 97.53% and 41.66% respectively. Xpert MTB/RIF assay had a sensitivity and specificity of 83.33% and 100% to detect rifampicin resistance. Conclusion: Bronchoalveolar lavage gene Xpert had a superior diagnostic yield in patients with either smear-negative or sputum-scarce pulmonary tuberculosis. Hence a positive Xpert MTB/RIF assay may be a useful adjunct to diagnosis and detection of MDR-TB in bronchoalveolar lavage specimens. (author)

  10. Decreased C3 Activation by the devR Gene-Disrupted Mycobacterium tuberculosis Strain in Comparison to the Wild-Type Strain

    V. Narayan Rao

    2013-01-01

    Full Text Available Activation of the complement component C3 is an important step in the complement cascade, contributing to inflammatory mechanisms. Considerable research on gene-disrupted mycobacterial strains using animal models of tuberculosis infection has reported the roles of some of the mycobacterial genes during tuberculosis infection. The aim of the present study was to assess the pattern of complement activation by the devR gene-disrupted Mycobacterium tuberculosis H37Rv strain and compare with that by its wild-type strain. In vitro complement activation at the level of C3 by the gene-disrupted strain, its complemented strain, and wild-type strain was performed using solid-phase ELISA. It was observed that the ability of devR gene-disrupted M. tuberculosis H37Rv to activate C3 was significantly reduced in comparison to its wild-type strain (P<0.05. In addition, C3 activation by the complemented devR mutant strain was almost similar to that of the wild strain, which indicated that the reduced ability to activate C3 could potentially be due to the deletion of devR gene. These findings indicate that the gene devR probably aids in complement activation and contributes to the inflammatory processes during tuberculosis infection.

  11. Avian mycobacteriosis in psittacines: a retrospective study of 123 cases.

    Palmieri, C; Roy, P; Dhillon, A S; Shivaprasad, H L

    2013-02-01

    One hundred and twenty-three cases of mycobacterioses were diagnosed in psittacine birds from a total of 9,241 submissions for necropsy examination or histopathology made to the California Animal Health and Food Safety Laboratory System between 1990 and 2007. The species affected most commonly were Amazon parrots (Amazona spp.)(n = 32; 26%) and grey-cheeked parakeets Brotogeris pyrrophterus (n = 23; 18.7%). The main gross findings on necropsy examination were enlarged and mottled pale livers and spleens and thickening of the small intestinal wall with numerous pale miliary nodules on the mucosa. Microscopical examination revealed infiltration of foamy macrophages and giant cells containing acid-fast bacteria in various organs. The gene encoding mycobacterial 65 kDa heat shock protein (hsp65) was amplified by nested polymerase chain reaction (PCR) from DNA extracted from 22 cases. The species of Mycobacterium involved was determined by analysis of restriction endonuclease patterns of the PCR products. Mycobacterium genavense was detected in 19 cases and Mycobacterium avium in two cases. One parrotlet (Touit spp.) had a mixed infection of both species of mycobacteria. It is concluded that M. genavense is the primary cause of mycobacteriosis in psittacine birds and the potential for zoonotic disease should be considered, especially for immunocompromised owners. PMID:22884283

  12. Mutation in alkylhydroperoxidase D gene dramatically decreases persistence of Mycobacterium bovis bacillus calmette-guerin in infected macrophage

    Farivar Taghi

    2008-07-01

    Full Text Available Background and Objectives: Mycobacterium tuberculosis is the leading cause of death from a single bacterial species in the world and is subjected to a highly oxidative environment in its host macrophage and consequently has evolved protective mechanisms against reactive oxygen and nitrogen intermediates. Alkyl hydroperoxidase D (AhpD is a molecule from these mycobacterial defense systems that has a dual function. It not only works with Alkyl hydroperoxidase C (AhpC in mycobacterial defense system against oxidative stress but also has a role in oxidation/reduction of succinyltransferase B (SucB, dihydrolipoamide dehydrogenase (LPD and AhpC. The present study was undertaken to find out the effects of inactivation of ahpD gene in the intra-macrophage persistence of resulted BCG mutant. Materials and Methods: We did allelic exchange mutagenesis in Mycobacterium bovis BCG and evaluate the effects of this mutagenesis in intracellular persistence of wild type BCG strains and ahpD mutant ones by comparing colony forming units (CFU in infected macrophage. Results: Our findings showed that after producing allelic exchange mutagenesis in ahpD gene of M.bovis BCG a sever decrease in the CFU′s of ahpD mutant BCG strains has been observed and intracellular persistence of ahpD mutant BCG strains decreased significantly. Conclusion: Mutagenesis in ahpD gene will cause significant decrease in intracellular survival of ahpD mutant strains than wild type M.bovis BCG strains and could leads to an inefficiency in pyruvate dehydrogenase pathway and could also impair impairs mycobacterial defense system against oxidative and nitrosative stress.

  13. Cloning, protein expression and display of synthetic multi-epitope mycobacterial antigens on Salmonella typhi Ty21a cell surface.

    Sarhan, Mohammed A A; Musa, Mustaffa; Zainuddin, Zainul F

    2011-09-01

    Expressing proteins of interest as fusion to proteins of bacterial envelope is a powerful technique for biotechnological and medical applications. The synthetic gene (VacII) encoding for T-cell epitopes of selected genes of Mycobacterium tuberculosis namely, ESAT6, MTP40, 38 kDa, and MPT64 was fused with N- terminus of Pseudomonas syringae ice nucleation protein (INP) outer membrane protein. The fused genes were cloned into a bacterial expression vector pKK223-3. The recombinant protein was purified by Ni-NAT column. VacII gene was displayed on the cell surface of Salmonella typhi Ty21a using N-terminal region of ice nucleation proteins (INP) as an anchoring motif. Glycine method confirmed that VacII was anchored on the cell surface. Western blot analysis further identified the synthesis of INP derivatives containing the N-terminal domain INP- VacII fusion protein of the expected size (52 kDa). PMID:21941936

  14. Enhanced effect of BCG vaccine against pulmonary Mycobacterium tuberculosis infection in mice with lung Th17 response to mycobacterial heparin-binding hemagglutinin adhesin antigen.

    Fukui, Masayuki; Shinjo, Kikuko; Umemura, Masayuki; Shigeno, Satoko; Harakuni, Tetsuya; Arakawa, Takeshi; Matsuzaki, Goro

    2015-12-01

    Although the BCG vaccine can prevent tuberculosis (TB) in infants, its ability to prevent adult pulmonary TB is reportedly limited. Therefore, development of a novel effective vaccine against pulmonary TB has become an international research priority. We have previously reported that intranasal vaccination of mice with a mycobacterial heparin-binding hemagglutinin adhesin (HBHA) plus mucosal adjuvant cholera toxin (CT) enhances production of IFN-γ and anti-HBHA antibody and suppresses extrapulmonary bacterial dissemination after intranasal infection with BCG. In the present study, the effects of intranasal HBHA + CT vaccine on murine pulmonary Mycobacterium tuberculosis (Mtb) infection were examined. Intranasal HBHA + CT vaccination alone failed to reduce the bacterial burden in the infected lung. However, a combination vaccine consisting of s.c. BCG priming and an intranasal HBHA + CT booster significantly enhanced protective immunity against pulmonary Mtb infection on day 14 compared with BCG vaccine alone. Further, it was found that intranasal HBHA + CT vaccine enhanced not only IFN-γ but also IL-17A production by HBHA-specific T cells in the lung after pulmonary Mtb infection. Therefore, this combination vaccine may be a good candidate for a new vaccine strategy against pulmonary TB. PMID:26577130

  15. Cell wall lipids from Mycobacterium bovis BCG are inflammatory when inoculated within a gel matrix: characterization of a new model of the granulomatous response to mycobacterial components.

    Rhoades, Elizabeth R; Geisel, Rachel E; Butcher, Barbara A; McDonough, Sean; Russell, David G

    2005-05-01

    The chronic inflammatory response to Mycobacterium generates complex granulomatous lesions that balance containment with destruction of infected tissues. To study the contributing factors from host and pathogen, we developed a model wherein defined mycobacterial components and leukocytes are delivered in a gel, eliciting a localized response that can be retrieved and analysed. We validated the model by comparing responses to the cell wall lipids from Mycobacterium bovis bacillus Calmette-Guerin (BCG) to reported activities in other models. BCG lipid-coated beads and bone marrow-derived macrophages (input macrophages) were injected intraperitoneally into BALB/c mice. Input macrophages and recruited peritoneal exudate cells took up fluorescently tagged BCG lipids, and matrix-associated macrophages and neutrophils produced tumor necrosis factor, interleukin-1alpha, and interleukin-6. Leukocyte numbers and cytokine levels were greater in BCG lipid-bearing matrices than matrices containing non-coated or phosphatidylglycerol-coated beads. Leukocytes arrived in successive waves of neutrophils, macrophages and eosinophils, followed by NK and T cells (CD4(+), CD8(+), or gammadelta) at 7 days and B cells within 12 days. BCG lipids also predisposed matrices for adherence and vascularization, enhancing cellular recruitment. We submit that the matrix model presents pertinent features of the murine granulomatous response that will prove to be an adaptable method for study of this complex response. PMID:15850754

  16. Exposure to a Mycobacterial Antigen, ESAT-6, Exacerbates Granulomatous and Fibrotic Changes in a Multiwall Carbon Nanotube Model of Chronic Pulmonary Disease

    Malur, Anagha; Barna, Barbara P; Patel, Janki; McPeek, Matthew; Wingard, Christopher J; Dobbs, Larry; Thomassen, Mary Jane

    2016-01-01

    Recent studies suggest additive effects of environmental pollutants and microbial antigens on respiratory disease. We established a granuloma model in which instilled multiwall carbon nanotubes (MWCNT) elicit granulomatous pathology. We hypothesized that mycobacterial antigen ESAT-6, a T cell activator associated with tuberculosis and sarcoidosis, might alter pathology. Wild-type C57Bl/6 mice received MWCNT with or without ESAT-6 peptide. Controls received vehicle (surfactant-PBS) or ESAT-6 alone. Mice were evaluated 60 days later for granulomas, fibrosis, and bronchoalveolar lavage (BAL) cell expression of inflammatory mediators (CCL2, MMP-12, and Osteopontin). Results indicated increased granulomas, fibrosis, and inflammatory mediators in mice receiving the combination of MWCNT+ESAT-6 compared to MWCNT or vehicle alone. ESAT-6 alone showed no significant effect on these pathological endpoints. However, CD3 (+) lymphocyte infiltration of lung tissue increased with MWCNT+ESAT-6 versus MWCNT alone. Findings suggest that concurrent exposure to microbial antigen and MWCNT exacerbates chronic pulmonary disease. PMID:27019768

  17. Mycobacterial antigen driven activation of CD14++CD16- monocytes is a predictor of tuberculosis-associated immune reconstitution inflammatory syndrome.

    Bruno B Andrade

    2014-10-01

    Full Text Available Paradoxical tuberculosis-associated immune reconstitution inflammatory syndrome (TB-IRIS is an aberrant inflammatory response occurring in a subset of TB-HIV co-infected patients initiating anti-retroviral therapy (ART. Here, we examined monocyte activation by prospectively quantitating pro-inflammatory plasma markers and monocyte subsets in TB-HIV co-infected patients from a South Indian cohort at baseline and following ART initiation at the time of IRIS, or at equivalent time points in non-IRIS controls. Pro-inflammatory biomarkers of innate and myeloid cell activation were increased in plasma of IRIS patients pre-ART and at the time of IRIS; this association was confirmed in a second cohort in South Africa. Increased expression of these markers correlated with elevated antigen load as measured by higher sputum culture grade and shorter duration of anti-TB therapy. Phenotypic analysis revealed the frequency of CD14(++CD16(- monocytes was an independent predictor of TB-IRIS, and was closely associated with plasma levels of CRP, TNF, IL-6 and tissue factor during IRIS. In addition, production of inflammatory cytokines by monocytes was higher in IRIS patients compared to controls pre-ART. These data point to a major role of mycobacterial antigen load and myeloid cell hyperactivation in the pathogenesis of TB-IRIS, and implicate monocytes and monocyte-derived cytokines as potential targets for TB-IRIS prevention or treatment.

  18. Comparison of Mycobacterial Growth Indicator Tube with Culture on RGM Selective Agar for Detection of Mycobacteria in Sputum Samples from Patients with Cystic Fibrosis.

    Eltringham, Ian; Pickering, Julie; Gough, Helen; Preece, Clair L; Perry, John D

    2016-08-01

    Nontuberculous mycobacteria (NTM) are an important cause of pulmonary disease in patients with cystic fibrosis (CF). A new culture medium (RGM medium) for the isolation of rapidly growing mycobacteria from the sputum of cystic fibrosis patients has recently been reported. The aim of this study was to compare culture of sputum samples on RGM medium with culture using a standard automated liquid culture method. Sputum samples were obtained from 187 distinct patients with CF attending King's College Hospital, London, United Kingdom. Each sample was decontaminated with 3% oxalic acid and inoculated into a mycobacterial growth indicator tube (MGIT) that was monitored for 42 days using the Bactec MGIT 960 instrument. Each sample was also cultured, without decontamination, onto RGM medium, which was incubated for 10 days at 30°C. Mycobacteria were isolated from 28 patients (prevalence, 15%). Mycobacteria were detected in 24 samples (86%) using the MGIT and in 23 samples (82%) using RGM medium (P = 1.00). In this setting, RGM medium showed sensitivity equivalent to that of the MGIT for isolation of NTM from the sputum of patients with CF. RGM medium offers a simple, convenient tool that can be embedded into routine culture methods, allowing the culture of all sputum samples that are submitted from patients with CF. PMID:27225412

  19. T Cell Reactivity against Mycolyl Transferase Antigen 85 of M. tuberculosis in HIV-TB Coinfected Subjects and in AIDS Patients Suffering from Tuberculosis and Nontuberculous Mycobacterial Infections

    Pascal Launois

    2011-01-01

    Full Text Available The mycolyl transferase antigen 85 complex is a major secreted protein family from mycobacterial culture filtrate, demonstrating powerful T cell stimulatory properties in most HIV-negative, tuberculin-positive volunteers with latent M.tuberculosis infection and only weak responses in HIV-negative tuberculosis patients. Here, we have analyzed T cell reactivity against PPD and Ag85 in HIV-infected individuals, without or with clinical symptoms of tuberculosis, and in AIDS patients with disease caused by nontuberculous mycobacteria. Whereas responses to PPD were not significantly different in HIV-negative and HIV-positive tuberculin-positive volunteers, responses to Ag85 were significantly decreased in the HIV-positive (CDC-A and CDC-B group. Tuberculosis patients demonstrated low T cell reactivity against Ag85, irrespective of HIV infection, and finally AIDS patients suffering from NTM infections were completely nonreactive to Ag85. A one-year follow-up of twelve HIV-positive tuberculin-positive individuals indicated a decreased reactivity against Ag85 in patients developing clinical tuberculosis, highlighting the protective potential of this antigen.

  20. Serologic follow-up of IgG responses against recombinant mycobacterial proteins ML0405, ML2331 and LID-1 in a leprosy hyperendemic area in Venezuela

    Elsa Rada

    2012-12-01

    Full Text Available Leprosy is a slowly evolving disease that occurs mainly in adults. In this study, the Mamaría Village, state of Portuguesa was selected because it had one of the highest prevalence rates (13.25% of leprosy cases in 1997. Between 1998-2004, 20.2% of the 89 cases registered in this village were less than 15 years old and 61.8% were males. Pau-cibacillary (PB lesions were the predominant clinical forms identified, although also multibacillary (MB forms were found. Additionally, 76% of the patients were bacteriologically negative. At the time of diagnosis, 75% of the patients presented with grade 0 disabilities, 23% with grade 1 and 2% with grade 2. Serum samples were collected from 18 PB and 15 MB patients, in addition to 14 family contacts, at the beginning and end of treatment. All the groups were re-evaluated during a three-year period (2008-2011. The proteins used for evaluation were ML0405, ML2331 and LID-1. These mycobacterial proteins were highly specific for Mycobacterium leprae and the IgG responses decreased in both MB and PB patients during multidrug treatment. Our results suggest that these antigens could be used as markers for successful treatment of non-reactional lepromatous patients.

  1. Identification of a novel gene product that promotes survival of Mycobacterium smegmatis in macrophages.

    Assunta Pelosi

    Full Text Available BACKGROUND: Bacteria of the suborder Corynebacterineae include significant human pathogens such as Mycobacterium tuberculosis and M. leprae. Drug resistance in mycobacteria is increasingly common making identification of new antimicrobials a priority. Mycobacteria replicate intracellularly, most commonly within the phagosomes of macrophages, and bacterial proteins essential for intracellular survival and persistence are particularly attractive targets for intervention with new generations of anti-mycobacterial drugs. METHODOLOGY/PRINCIPAL FINDINGS: We have identified a novel gene that, when inactivated, leads to accelerated death of M. smegmatis within a macrophage cell line in the first eight hours following infection. Complementation of the mutant with an intact copy of the gene restored survival to near wild type levels. Gene disruption did not affect growth compared to wild type M. smegmatis in axenic culture or in the presence of low pH or reactive oxygen intermediates, suggesting the growth defect is not related to increased susceptibility to these stresses. The disrupted gene, MSMEG_5817, is conserved in all mycobacteria for which genome sequence information is available, and designated Rv0807 in M. tuberculosis. Although homology searches suggest that MSMEG_5817 is similar to the serine:pyruvate aminotransferase of Brevibacterium linens suggesting a possible role in glyoxylate metabolism, enzymatic assays comparing activity in wild type and mutant strains demonstrated no differences in the capacity to metabolize glyoxylate. CONCLUSIONS/SIGNIFICANCE: MSMEG_5817 is a previously uncharacterized gene that facilitates intracellular survival of mycobacteria. Interference with the function of MSMEG_5817 may provide a novel therapeutic approach for control of mycobacterial pathogens by assisting the host immune system in clearance of persistent intracellular bacteria.

  2. The radiology of IRIS (immune reconstitution inflammatory syndrome) in patients with mycobacterial tuberculosis and HIV co-infection: appearances in 11 patients

    Aim: To determine the radiological manifestations of IRIS (immune reconstitution inflammatory syndrome) in patients with HIV and mycobacterium tuberculosis co-infection, in the context of their demographic and clinical data. Materials and methods: The radiological imaging, demographic and clinical data of 11 patients diagnosed with IRIS associated with HIV and mycobacterial tuberculosis co-infection were studied retrospectively. Where available, follow-up imaging studies were also reviewed. Results: The most common radiological feature of IRIS was lymph node enlargement (73%), with central low attenuation centres, in keeping with necrosis, present in most of these cases (88%). Most commonly affected were intra-abdominal nodes (70%), followed by axillary (40%) and mediastinal lymph nodes (36%). Within the lung parenchyma, diffuse, bilateral pulmonary nodules were seen in 55% of cases. Unilateral small volume pleural effusions were seen in two cases with associated parenchymal changes seen in only one. Small volume ascites was seen in two cases. Thirty-six percent of cases presented with new or worsening abscesses despite treatment. In this context, image-guided radiological drainage proved a useful adjunct to the conventional medical therapy for IRIS. The most common clinical signs of IRIS included fever (64%), abdominal pain (36%) and cough (27%). Conclusion: We have described the radiological features that are characteristic in IRIS and the importance of putting these into context with the clinical and pathological findings as part of a multidisciplinary approach in making the diagnosis. The role of the radiologist is central in diagnosis, monitoring of disease progression and management of complications in patients with IRIS

  3. The radiology of IRIS (immune reconstitution inflammatory syndrome) in patients with mycobacterial tuberculosis and HIV co-infection: appearances in 11 patients

    Rajeswaran, G. [Department of Radiology and Department of HIV/GU Medicine, Chelsea and Westminster Hospital, London (United Kingdom)]. E-mail: grajeswaran@hotmail.com; Becker, J.L. [Department of Radiology and Department of HIV/GU Medicine, Chelsea and Westminster Hospital, London (United Kingdom); Michailidis, C. [Department of Radiology and Department of HIV/GU Medicine, Chelsea and Westminster Hospital, London (United Kingdom); Pozniak, A.L. [Department of Radiology and Department of HIV/GU Medicine, Chelsea and Westminster Hospital, London (United Kingdom); Padley, S.P.G. [Department of Radiology and Department of HIV/GU Medicine, Chelsea and Westminster Hospital, London (United Kingdom)

    2006-10-15

    Aim: To determine the radiological manifestations of IRIS (immune reconstitution inflammatory syndrome) in patients with HIV and mycobacterium tuberculosis co-infection, in the context of their demographic and clinical data. Materials and methods: The radiological imaging, demographic and clinical data of 11 patients diagnosed with IRIS associated with HIV and mycobacterial tuberculosis co-infection were studied retrospectively. Where available, follow-up imaging studies were also reviewed. Results: The most common radiological feature of IRIS was lymph node enlargement (73%), with central low attenuation centres, in keeping with necrosis, present in most of these cases (88%). Most commonly affected were intra-abdominal nodes (70%), followed by axillary (40%) and mediastinal lymph nodes (36%). Within the lung parenchyma, diffuse, bilateral pulmonary nodules were seen in 55% of cases. Unilateral small volume pleural effusions were seen in two cases with associated parenchymal changes seen in only one. Small volume ascites was seen in two cases. Thirty-six percent of cases presented with new or worsening abscesses despite treatment. In this context, image-guided radiological drainage proved a useful adjunct to the conventional medical therapy for IRIS. The most common clinical signs of IRIS included fever (64%), abdominal pain (36%) and cough (27%). Conclusion: We have described the radiological features that are characteristic in IRIS and the importance of putting these into context with the clinical and pathological findings as part of a multidisciplinary approach in making the diagnosis. The role of the radiologist is central in diagnosis, monitoring of disease progression and management of complications in patients with IRIS.

  4. In Vitro Evaluation of Linezolid and Meropenem Against Clinical Isolates of Multi Drug Resistant Tuberculosis By Mycobacterial Growth Indicator Tube (MGIT) 960

    Objective: To evaluate the in vitro effectiveness of multiple breakpoint concentrations of newer antituberculosis agents (Linezolid and Meropenem) against Multi Drug-Resistant Tuberculosis (MDR-TB) isolates. Study Design: Adescriptive cross-sectional study. Place and Duration of Study: Microbiology Department, Armed Forces Institute of Pathology (AFIP), Rawalpindi, from September 2011 to August 2013. Methodology: Atotal of 100 MDR-TB isolates recovered during the study period were subjected to susceptibility testing against multiple breakpoint concentrations of Linezolid (LZD) and Meropenem (MER). The breakpoint concentration used for LZD were 0.5, 1.0 and 2.0 micro g/ml, while for MER were 4.0, 8.0 and 16 micro g/ml. Mycobacterial Growth Indicator Tube (MGIT) 960 system was used to carry out drug susceptibility testing as per recommended protocol. Results: At break point concentration of 0.5 micro g/ml, 80 out of 100 (80%) MDR-TB isolates were susceptible to LZD while at breakpoint concentration of 1.0 micro g/ml and 2.0 micro g/ml, 96/100, (96%) of MDR-TB isolates were susceptible. For MER, at breakpoint concentrations of 4.0 micro g/ml no MDR-TB isolate was susceptible, while at 8.0 micro g/ml 3/100, (3%) and at 16.0 micro g/ml 11/100, (11%) of MDR-TB isolates were susceptible. Conclusion: LZD was found to have excellent in vitroefficacy as 96% of MDR-TB isolates were susceptible at breakpoint concentration of 1.0 micro g/ml or more. In case of MER it was found that in vitrosusceptibility improved as the break point concentrations were increased. (author)

  5. Contribution of MINCLE-SYK Signaling to Activation of Primary Human APCs by Mycobacterial Cord Factor and the Novel Adjuvant TDB.

    Ostrop, Jenny; Jozefowski, Katrin; Zimmermann, Stephanie; Hofmann, Katharina; Strasser, Erwin; Lepenies, Bernd; Lang, Roland

    2015-09-01

    Trehalose-6,6-dimycolate (TDM), the mycobacterial cord factor, is an abundant cell wall glycolipid and major virulence factor of Mycobacterium tuberculosis. Its synthetic analog trehalose-6,6-dibehenate (TDB) is a new adjuvant currently in phase I clinical trials. In rodents, the C-type lectin receptors Mincle and Mcl bind TDB/TDM and activate macrophages and dendritic cells (DC) through the Syk-Card9 pathway. However, it is unknown whether these glycolipids activate human innate immune cells through the same mechanism. We performed in vitro analysis of TDB/TDM-stimulated primary human monocytes, macrophages, and DC; determined C-type lectin receptor expression; and tested the contribution of SYK, MINCLE, and MCL by small interfering RNA knockdown and genetic complementation. We observed a robust chemokine and cytokine release in response to TDB or TDM. MCSF-driven macrophages secreted higher levels of IL-8, IL-6, CCL3, CCL4, and CCL2 after stimulation with TDM, whereas DC responded more strongly to TDB and GM-CSF-driven macrophages were equally responsive to TDB and TDM. SYK kinase and the adaptor protein CARD9 were essential for glycolipid-induced IL-8 production. mRNA expression of MINCLE and MCL was high in monocytes and macrophages, with MINCLE and MCL proteins localized intracellularly under resting conditions. Small interfering RNA-mediated MINCLE or MCL knockdown caused on average reduced TDB- or TDM-induced IL-8 production. Conversely, retroviral expression in murine Mincle-deficient DC revealed that human MINCLE, but not MCL, was sufficient to confer responsiveness to TDB/TDM. Our study demonstrates that SYK-CARD9 signaling plays a key role in TDB/TDM-induced activation of innate immune cells in man as in mouse, likely by engagement of MINCLE. PMID:26202982

  6. Mycobacterial RNA isolation optimized for non-coding RNA: high fidelity isolation of 5S rRNA from Mycobacterium bovis BCG reveals novel post-transcriptional processing and a complete spectrum of modified ribonucleosides

    Hia, Fabian; Chionh, Yok Hian; Pang, Yan Ling Joy; DeMott, Michael S.; McBee, Megan E.; Dedon, Peter C.

    2014-01-01

    A major challenge in the study of mycobacterial RNA biology is the lack of a comprehensive RNA isolation method that overcomes the unusual cell wall to faithfully yield the full spectrum of non-coding RNA (ncRNA) species. Here, we describe a simple and robust procedure optimized for the isolation of total ncRNA, including 5S, 16S and 23S ribosomal RNA (rRNA) and tRNA, from mycobacteria, using Mycobacterium bovis BCG to illustrate the method. Based on a combination of mechanical disruption and...

  7. Farmed deer: A veterinary model for chronic mycobacterial diseases that is accessible, appropriate and cost-effective

    Frank Griffin

    2014-01-01

    Full Text Available Although most studies in immunology have used inbred mice as the experimental model to study fundamental immune mechanisms they have been proven to be limited in their ability to chart complex functional immune pathways, such as are seen in outbred populations of humans or animals. Translation of the findings from inbred mouse studies into practical solutions in therapeutics or the clinic has been remarkably unproductive compared with many other areas of clinical practice in human and veterinary medicine. Access to an unlimited array of mouse strains and an increasing number of genetically modified strains continues to sustain their paramount position in immunology research. Since the mouse studies have provided little more than the dictionary and glossary of immunology, another approach will be required to write the classic exposition of functional immunity. Domestic animals such as ruminants and swine present worthwhile alternatives as models for immunological research into infectious diseases, which may be more informative and cost effective. The original constraint on large animal research through a lack of reagents has been superseded by new molecular technologies and robotics that allow research to progress from gene discovery to systems biology, seamlessly. The current review attempts to highlight how exotic animals such as deer can leverage off the knowledge of ruminant genomics to provide cost-effective models for research into complex, chronic infections. The unique opportunity they provide relates to their diversity and polymorphic genotypes and the integrity of their phenotype for a range of infectious diseases.

  8. Inositol monophosphate phosphatase genes of Mycobacterium tuberculosis

    Parish Tanya

    2010-02-01

    Full Text Available Abstract Background Mycobacteria use inositol in phosphatidylinositol, for anchoring lipoarabinomannan (LAM, lipomannan (LM and phosphatidylinosotol mannosides (PIMs in the cell envelope, and for the production of mycothiol, which maintains the redox balance of the cell. Inositol is synthesized by conversion of glucose-6-phosphate to inositol-1-phosphate, followed by dephosphorylation by inositol monophosphate phosphatases (IMPases to form myo-inositol. To gain insight into how Mycobacterium tuberculosis synthesises inositol we carried out genetic analysis of the four IMPase homologues that are present in the Mycobacterium tuberculosis genome. Results Mutants lacking either impA (Rv1604 or suhB (Rv2701c were isolated in the absence of exogenous inositol, and no differences in levels of PIMs, LM, LAM or mycothiol were observed. Mutagenesis of cysQ (Rv2131c was initially unsuccessful, but was possible when a porin-like gene of Mycobacterium smegmatis was expressed, and also by gene switching in the merodiploid strain. In contrast, we could only obtain mutations in impC (Rv3137 when a second functional copy was provided in trans, even when exogenous inositol was provided. Experiments to obtain a mutant in the presence of a second copy of impC containing an active-site mutation, in the presence of porin-like gene of M. smegmatis, or in the absence of inositol 1-phosphate synthase activity, were also unsuccessful. We showed that all four genes are expressed, although at different levels, and levels of inositol phosphatase activity did not fall significantly in any of the mutants obtained. Conclusions We have shown that neither impA, suhB nor cysQ is solely responsible for inositol synthesis. In contrast, we show that impC is essential for mycobacterial growth under the conditions we used, and suggest it may be required in the early stages of mycothiol synthesis.

  9. Evaluation of Matrix-Assisted Laser Desorption Ionization–Time of Flight Mass Spectrometry for Identification of Nontuberculous Mycobacteria from Clinical Isolates

    Rodríguez-Sánchez, Belén; Ruiz-Serrano, María Jesús; Marín, Mercedes; López Roa, Paula; Rodríguez-Créixems, Marta; Bouza, Emilio

    2015-01-01

    Matrix-assisted laser desorption ionization–time of flight mass spectrometry (MALDI-TOF MS) for the identification of nontuberculous mycobacterial (NTM) isolates was evaluated in this study. Overall, 125 NTM isolates were analyzed by MALDI-TOF and GenoType CM/AS. Identification by 16S rRNA/hsp65 sequencing was considered the gold standard. Agreements between MALDI-TOF and GenoType CM/AS with the reference method were, respectively, 94.4% and 84.0%. In 17 cases (13.6%), results provided by Gen...

  10. A randomised controlled trial of the effects of albendazole in pregnancy on maternal responses to mycobacterial antigens and infant responses to bacille Calmette-Guérin (BCG immunisation [ISRCTN32849447

    Nampijja Margaret

    2005-12-01

    Full Text Available Abstract Background Maternal schistosomiasis and filariasis have been shown to influence infant responses to neonatal bacille Calmette-Guérin (BCG immunisation but the effects of maternal hookworm, and of de-worming in pregnancy, are unknown. Methods In Entebbe, Uganda, we conducted a randomised, double-blind, placebo-controlled trial of a single dose of 400 mg of albendazole in the second trimester of pregnancy. Neonates received BCG. Interferon-gamma (IFN-γ and interleukin (IL-5 responses to a mycobacterial antigen (crude culture filtrate proteins (CFP of Mycobacterium tuberculosis were measured in a whole blood assay. We analysed results for binary variables using χ2 tests and logistic regression. We analysed continuous variables using Wilcoxon's tests. Results Maternal hookworm was associated with reduced maternal IFN-γ responses to CFP (adjusted odds ratio for IFN-γ > median response: 0.14 (95% confidence interval 0.02–0.83, p = 0.021. Conversely, maternal hookworm was associated with subsequent increased IFN-γ responses in their one-year-old infants (adjusted OR 17.65 (1.20–258.66; p = 0.013. Maternal albendazole tended to reduce these effects. Conclusion Untreated hookworm infection in pregnancy was associated with reduced maternal IFN-γ responses to mycobacterial antigens, but increased responses in their infants one year after BCG immunisation. The mechanisms of these effects, and their implications for protective immunity remain, to be determined.

  11. Analysis on Epidemiological and Clinical Characteristics of 63 Cases of Nontuberculous mycobacterial(NTM)Lung Disease%63例非结核分枝杆菌肺病的流行病学及临床特点分析

    梁冰; 黄瑞霞; 邓虹; 何庆秋

    2011-01-01

    目的 探讨非结核分枝杆菌肺病的临床特点及防治对策.方法 对2009-2011年7月广州市结核病防治所二分所经过实验室检查确诊的63例非结核分枝杆菌肺病患者进行分析.结果 非结核分枝杆菌肺病波及两肺叶为多(58%),双侧同时患病较多(51%),空洞仅占25%.涂阴培阳44%,涂阳培阳56%,菌型鉴定以龟分枝杆菌为多占44%.耐药以耐多药比例最大(占77%),耐药顺位为耐多药>耐二药>单药.仅有3例是对一二线抗结核药全敏感.其中47例为初治病例(75%),16例复治病例(25%).结论 由于生活环境的变迁可能导致了非结核分枝杆菌的习性发生了变化,以至于目前非结核分枝杆菌肺病的临床特点也发生了不同程度的改变.%Objective To investigate the nontuberculcxus mycobacterial(NTM) lung disease prevention and treatment of clinical features and treatment response. Methods Sixty - three cases of nontuberculous mycobacterial lung disease confirmed by the laboratory testing in the Second Clinic of Guangzhou Tuberculosis Dispensary from 2009 to July 2011 were analyzed. Results The case of both lung lobe were affected by nontuberculous mycobacterial accounted for 58%, while the case of both sides of lung were affected accounted for 51 %, and the cavityaccounted for only 25%. The bacteria - based . Identification of M. Chelonei accounted for more than 44% for the. Multiple drug resistance tuberculosis accounted for the largest proportion (77%) of drug - resistance. Conclusions As the environment changes may result in a nontuberculous mycobacteria habits change, so the current nontuberculous mycobacterial lung disease also occurred in the clinical features of varying degrees of change. In order to have a better control of multidrug- resistant tuberculosis, MDR-TB. And prevent the spread and infection of both multiple drug resistance tubercle bacillus and NTM with the property of MDR, therefore nontuberculous

  12. Mycobacterial and HIV infections up-regulated human zinc finger protein 134, a novel positive regulator of HIV-1 LTR activity and viral propagation.

    Ronald Benjamin

    Full Text Available BACKGROUND: Concurrent occurrence of HIV and Tuberculosis (TB infections influence the cellular environment of the host for synergistic existence. An elementary approach to understand such coalition at the molecular level is to understand the interactions of the host and the viral factors that subsequently effect viral replication. Long terminal repeats (LTR of HIV genome serve as a template for binding trans-acting viral and cellular factors that regulate its transcriptional activity, thereby, deciding the fate of HIV pathogenesis, making it an ideal system to explore the interplay between HIV and the host. METHODOLOGY/PRINCIPAL FINDINGS: In this study, using biotinylated full length HIV-1 LTR sequence as bait followed by MALDI analyses, we identified and further characterized human-Zinc-finger-protein-134 (hZNF-134 as a novel positive regulator of HIV-1 that promoted LTR-driven transcription and viral production. Over-expression of hZNF-134 promoted LTR driven luciferase activity and viral transcripts, resulting in increased virus production while siRNA mediated knockdown reduced both the viral transcripts and the viral titers, establishing hZNF-134 as a positive effector of HIV-1. HIV, Mycobacteria and HIV-TB co-infections increased hZNF-134 expressions in PBMCs, the impact being highest by mycobacteria. Corroborating these observations, primary TB patients (n = 22 recorded extraordinarily high transcript levels of hZNF-134 as compared to healthy controls (n = 16. CONCLUSIONS/SIGNIFICANCE: With these observations, it was concluded that hZNF-134, which promoted HIV-1 LTR activity acted as a positive regulator of HIV propagation in human host. High titers of hZNF-134 transcripts in TB patients suggest that up-regulation of such positive effectors of HIV-1 upon mycobacterial infection can be yet another mechanism by which mycobacteria assists HIV-1 propagation during HIV-TB co-infections. hZNF-134, an uncharacterized host protein, thus

  13. Relationship of bovine TNF-α gene polymorphisms with the risk of bovine tuberculosis in Holstein cattle

    CHENG, Yafen; HUANG, ChenShen; TSAI, Hsiang-Jung

    2016-01-01

    Many studies suggest significant genetic variation in the resistance of cattle and humans to infection with Mycobacterium bovis (M. bovis), the causative agent of zoonotic tuberculosis. TNF-α promotes inflammation and induces apoptosis in response to mycobacterial infection. The aim of the present study was to investigate the influence of single nucleotide polymorphisms of the TNF-α gene on bovine tuberculosis (bTB) susceptibility. We genotyped the TNF-α gene in 74 bTB-infected Holstein cows and 90 healthy control animals. The influence in the exon 3 region of TNF-α polymorphisms on bTB susceptibility was subsequently investigated by association analysis. Our finding demonstrated that the g.27534932A>C polymorphism of the TNF-α is associated with bTB in Holstein cattle. The susceptibility of cattle with the g.27534932A>C genotype compared with the CC genotype was 4.11-fold (95% CI, 1.27–13.36; P=0.02) higher. The g.27534932A>C polymorphism located in exon 3 of the TNF-α gene, and the functional consequence was missense. The deduced amino acid sequence for the protein product revealed an arginine to serine conversion at position 159, which may affect initiation of protein synthesis and disrupt normal TNF-α function that protects animals against mycobacterial infection. A significant association was observed with the A allele as a risk factor for bTB susceptibility (OR, 3.84; 95% CI, 1.21–12.17; P=0.02). In conclusion, this is the first report showing that the g.27534932A>C polymorphism may contribute to TNF-α-mediated bTB susceptibility. PMID:26876219

  14. Gene expression

    We prepared probes for isolating functional pieces of the metallothionein locus. The probes enabled a variety of experiments, eventually revealing two mechanisms for metallothionein gene expression, the order of the DNA coding units at the locus, and the location of the gene site in its chromosome. Once the switch regulating metallothionein synthesis was located, it could be joined by recombinant DNA methods to other, unrelated genes, then reintroduced into cells by gene-transfer techniques. The expression of these recombinant genes could then be induced by exposing the cells to Zn2+ or Cd2+. We would thus take advantage of the clearly defined switching properties of the metallothionein gene to manipulate the expression of other, perhaps normally constitutive, genes. Already, despite an incomplete understanding of how the regulatory switch of the metallothionein locus operates, such experiments have been performed successfully

  15. Structure of Mycobacterium tuberculosis Rv2714, a representative of a duplicated gene family in Actinobacteria

    The crystal structure of Rv2714, a protein of unknown function from M. tuberculosis, has been determined at 2.6 Å resolution using single-wavelength anomalous diffraction methods. The gene Rv2714 from Mycobacterium tuberculosis, which codes for a hypothetical protein of unknown function, is a representative member of a gene family that is largely confined to the order Actinomycetales of Actinobacteria. Sequence analysis indicates the presence of two paralogous genes in most mycobacterial genomes and suggests that gene duplication was an ancient event in bacterial evolution. The crystal structure of Rv2714 has been determined at 2.6 Å resolution, revealing a trimer in which the topology of the protomer core is similar to that observed in a functionally diverse set of enzymes, including purine nucleoside phosphorylases, some carboxypeptidases, bacterial peptidyl-tRNA hydrolases and even the plastidic form of an intron splicing factor. However, some structural elements, such as a β-hairpin insertion involved in protein oligomerization and a C-terminal α-helical domain that serves as a lid to the putative substrate-binding (or ligand-binding) site, are only found in Rv2714 bacterial homologues and represent specific signatures of this protein family

  16. Perspective on sequence evolution of microsatellite locus (CCGn in Rv0050 gene from Mycobacterium tuberculosis

    Jin Ruiliang

    2011-08-01

    Full Text Available Abstract Background The mycobacterial genome is inclined to polymerase slippage and a high mutation rate in microsatellite regions due to high GC content and absence of a mismatch repair system. However, the exact molecular mechanisms underlying microsatellite variation have not been fully elucidated. Here, we investigated mutation events in the hyper-variable trinucleotide microsatellite locus MML0050 located in the Rv0050 gene of W-Beijing and non-W-Beijing Mycobacterium tuberculosis strains in order to gain insight into the genomic structure and activity of repeated regions. Results Size analysis indicated the presence of five alleles that differed in length by three base pairs. Moreover, nucleotide gains occurred more frequently than loses in this trinucleotide microsatellite. Mutation frequency was not completely related with the total length, though the relative frequency in the longest allele was remarkably higher than that in the shortest. Sequence analysis was able to detect seven alleles and revealed that point mutations enhanced the level of locus variation. Introduction of an interruptive motif correlated with the total allele length and genetic lineage, rather than the length of the longest stretch of perfect repeats. Finally, the level of locus variation was drastically different between the two genetic lineages. Conclusion The Rv0050 locus encodes the bifunctional penicillin-binding protein ponA1 and is essential to mycobacterial survival. Our investigations of this particularly dynamic genomic region provide insights into the overall mode of microsatellite evolution. Specifically, replication slippage was implicated in the mutational process of this microsatellite and a sequence-based genetic analysis was necessary to determine that point mutation events acted to maintain microsatellite size integrity while providing genomic diversity.

  17. Gene therapy

    2005-01-01

    2005147 CNHK200-hA-a gene-viral therapeutic system and its antitumor effect on lung cancer. WANG Wei-guo(王伟国),et al. Viral & Gene Ther Center, Eastern Hepatobilli Surg Instit 2nd Milit Univ, Shanghai 200438. Chin J Oncol,2005:27(2):69-72. Objective: To develop a novel vector system, which combines the advantages of the gene therapy,

  18. Enfermedades micobacterianas diseminadas en pacientes con VIH/SIDA. Evaluación de los hemocultivos por método rápido Disseminated mycobacterial infections in patients with HIV/AIDS. Evaluation of blood cultures

    C. Coitinho

    2005-12-01

    Full Text Available Mil cuarenta hemocultivos correspondientes a 451 enfermos uruguayos con SIDA y diagnóstico clínico de micobacteriosis diseminada fueron evaluados entre 1999 y 2003. Las muestras fueron procesadas en el Centro de Referencia Nacional para Micobacterias (Montevideo, Uruguay, utilizando el sistema de hemocultivos automatizado para micobacterias MB - BacT (BioMérieux. Se detectaron 45 muestras positivas (4,3% correspondientes a 26 enfermos (promedio 2,3 muestras por paciente. En 10/26 casos se identificó M. avium complex (MAC y en 13/26 el germen aislado fue M. tuberculosis. El tiempo medio de incubación fue de 12,4 días (intervalo 6-19 días para MAC y de 22,6 días (intervalo 7-35 días para M. tuberculosis. El hemocultivo ha demostrado ser la mejor muestra para la confirmación bacteriológica de las enfermedades micobacterianas diseminadas cuando se estudian por lo menos 2 muestras por paciente. La frecuencia de aislamientos de M. tuberculosis y MAC aislados en pacientes con SIDA en Uruguay, corresponde a la de un país con una moderada prevalencia de tuberculosis.One thousand-forty blood cultures corresponding to 451 Uruguayan patients with AIDS and clinic diagnosis of disseminated mycobacterial infection were evaluated between 1999 and 2003. Samples were processed in the NationalReferenceCenter for Mycobacteria (Montevideo, Uruguay, using the automated blood culture system for mycobacteria MB -BacT (BioMérieux. Forty-five positive samples were detected (4.3% corresponding to 26 patients with AIDS (average 2.3 samples per patient. In 10/26 patients M. avium complex (MAC was identified and in 13/26 the isolated germ was M. tuberculosis. The average time of incubation was of 12.4 days (range 6-19 days for MAC and of 22.6 days (range 7-35 days for M. tuberculosis. Blood culture has demonstrated to be the best sample for the bacteriological confirmation of the disseminated mycobacterial infections when at least 2 samples by patient are

  19. Gene therapy.

    Mota Biosca, Anna

    1992-01-01

    Applications of gene therapy have been evaluated in virtually every oral tissue, and many of these have proved successful at least in animal models. While gene therapy will not be used routinely in the next decade, practitioners of oral medicine should be aware of the potential of this novel type of treatment that doubtless will benefit many patients with oral diseases.

  20. Trichoderma genes

    Foreman, Pamela; Goedegebuur, Frits; Van Solingen, Pieter; Ward, Michael

    2012-06-19

    Described herein are novel gene sequences isolated from Trichoderma reesei. Two genes encoding proteins comprising a cellulose binding domain, one encoding an arabionfuranosidase and one encoding an acetylxylanesterase are described. The sequences, CIP1 and CIP2, contain a cellulose binding domain. These proteins are especially useful in the textile and detergent industry and in pulp and paper industry.

  1. [Language gene].

    Takahashi, Hiroshi

    2006-11-01

    The human capacity for acquiring speech and language must derive, at least in part, from the genome. Recent advance in the field of molecular genetics finally discovered 'Language Gene'. Disruption of FOXP2 gene, the firstly identified 'language gene' causes severe speech and language disorder. To elucidate the anatomical basis of language processing in the brain, we examined the expression pattern of FOXP2/Foxp2 genes in the monkey and rat brains through development. We found the preferential expression of FOXP2/Foxp2 in the striosomal compartment of the developing striatum. Thus, we suggest the striatum, particularly striosomal system may participate in neural information processing for language and speech. Our suggestion is consistent with the declarative/ procedural model of language proposed by Ullman (1997, 2001), which the procedural memory-dependent mental grammar is rooted in the basal ganglia and the frontal cortex, and the declarative memory-dependent mental lexicon is rooted in the temporal lobe. PMID:17432197

  2. Gene Silencing

    Kertbundit, Sunee; Juříček, Miloslav; Hall, T.C.

    Dordrecht : Springer, 2010 - (Jain, S.; Brar, D.), s. 631-652 ISBN 978-90-481-2966-9 Institutional research plan: CEZ:AV0Z50380511 Keywords : Gene Silencing * RISC complex Subject RIV: EB - Genetics ; Molecular Biology

  3. Characterization of the first report of Mycobacterium timonense infecting an HIV patient in an Ecuadorian hospital.

    Zurita, J; Ortega-Paredes, D; Mora, M; Espinel, N; Parra, H; Febres, L; Zurita-Salinas, C

    2014-12-01

    Mycobacterium timonense is a non-tuberculous mycobacteria (NTM) described in southern France in 2009, and to our knowledge, not reported again as a human pathogen in indexed literature. The aim of this work was to characterize the first clinical isolate of M. timonense in Ecuador. Time of growth, biochemical tests, thin layer growth test, PCR-RFLP analysis of the hsp65 gene and MALDI-TOF spectra analysis were not able to identify the species. The species identification was achieved through sequencing of rrs, hsp65 and rpoB genes. The results highlight the necessity to set up a sequencing method to identify emerging NTM in Ecuadorian clinical facilities. PMID:24813256

  4. The effect of Mycobacterium tuberculosis CRISPR-associated Cas2 (Rv2816c) on stress response genes expression, morphology and macrophage survival of Mycobacterium smegmatis.

    Huang, Qinqin; Luo, Hongping; Liu, Minqiang; Zeng, Jie; Abdalla, Abualgasim Elgaili; Duan, Xiangke; Li, Qiming; Xie, Jianping

    2016-06-01

    Clustered regularly interspaced short palindromic repeats (CRISPR) are present in the genome of 40% bacteria and 90% archaea. CRISPR and accompanying Cas proteins constitute an adaptive immune system against disruptive mobile genetic elements. Two CRISPRs and 9 genes encoding CRISPR-associated proteins have been found in the genome of Mycobacterium tuberculosis. The CRISPR-associated Cas2 is an endoribonuclease required for the acquisition of new spacers. In this study, Cas2 encoded by Rv2816c was expressed in Mycobacterium smegmatis lacking CRISPR-Cas system and its role in stress responses of M. smegmatis in vitro and within macrophages was studied. We found that Cas2 mediated M. smegmatis stress response changes were associated with the altered expression of sigma factors which involved in mycobacterial stress response and virulence. We also found that Cas2 decreased the survival of M. smegmatis within macrophages. This study provides new insights on the role of Cas2. PMID:26498723

  5. Use of sequence microdivergence in mycobacterial ortholog to analyze contributions of the water-activating loop histidine of Escherichia coli uracil-DNA glycosylase in reactant binding and catalysis

    Uracil-DNA glycosylase (Ung), a DNA repair enzyme, pioneers uracil excision repair pathway. Structural determinations and mutational analyses of the Ung class of proteins have greatly facilitated our understanding of the mechanism of uracil excision from DNA. More recently, a hybrid quantum-mechanical/molecular mechanical analysis revealed that while the histidine (H67 in EcoUng) of the GQDPYH motif (ω loop) in the active site pocket is important in positioning the reactants, it makes an unfavorable energetic contribution (penalty) in achieving the transition state intermediate. Mutational analysis of this histidine is unavailable from any of the Ung class of proteins. A complication in demonstrating negative role of a residue, especially when located within the active site pocket, is that the mutants with enhanced activity are rarely obtained. Interestingly, unlike the most Ung proteins, the H67 equivalent in the ω loop in mycobacterial Ung is represented by P67. Exploiting this natural diversity to maintain structural integrity of the active site, we transplanted an H67P mutation in EcoUng. Uracil inhibition assays and binding of a proteinaceous inhibitor, Ugi (a transition state substrate mimic), with the mutant (H67P) revealed that its active site pocket was not perturbed. The catalytic efficiency (Vmax/Km) of the mutant was similar to that of the wild type Ung. However, the mutant showed increased Km and Vmax. Together with the data from a double mutation H67P/G68T, these observations provide the first biochemical evidence for the proposed diverse roles of H67 in catalysis by Ung

  6. Determination of genotypic diversity of Mycobacterium avium subspecies from human and animal origins by mycobacterial interspersed repetitive-unit-variable-number tandem-repeat and IS1311 restriction fragment length polymorphism typing methods.

    Radomski, Nicolas; Thibault, Virginie C; Karoui, Claudine; de Cruz, Krystel; Cochard, Thierry; Gutiérrez, Cristina; Supply, Philip; Biet, Frank; Boschiroli, María Laura

    2010-04-01

    Members of the Mycobacterium avium complex (MAC) are ubiquitous bacteria that can be found in water, food, and other environmental samples and are considered opportunistic pathogens for numerous animal species, mainly birds and pigs, as well as for humans. We have recently demonstrated the usefulness of a PCR-based mycobacterial interspersed repetitive-unit-variable-number tandem-repeat (MIRU-VNTR) typing for the molecular characterization of M. avium subsp. paratuberculosis and M. avium strains exclusively isolated from AIDS patients. In the present study we extended our analysis, based on eight MIRU-VNTR markers, to a strain collection comprehensively comprising the other M. avium subspecies, including M. avium subsp. avium, M. avium subsp. hominissuis, and M. avium subsp. silvaticum, isolated from numerous animal species, HIV-positive and HIV-negative humans, and environmental sources. All strains were fully typeable, with the discriminatory index being 0.885, which is almost equal to that obtained by IS1311 restriction fragment length polymorphism (RFLP) typing as a reference. In contrast to IS1311 RFLP typing, MIRU-VNTR typing was able to further discriminate M. avium subsp. avium strains. MIRU-VNTR alleles strongly associated with or specific for M. avium subspecies were detected in several markers. Moreover, the MIRU-VNTR typing-based results were consistent with a scenario of the independent evolution of M. avium subsp. avium/M. avium subsp. silvaticum and M. avium subsp. paratuberculosis from M. avium subsp. hominissuis, previously proposed on the basis of multilocus sequence analysis. MIRU-VNTR typing therefore appears to be a convenient typing method capable of distinguishing the three main subspecies and strains of the complex and providing new epidemiological knowledge on MAC. PMID:20107094

  7. Genes and Psoriasis

    ... Diet Tips" to find out more! Email * Zipcode Genes and Psoriasis Genes hold the key to understanding ... is responsible for causing psoriatic disease. How do genes work? Genes control everything from height to eye ...

  8. Genes and Hearing Loss

    ... Meeting Calendar Find an ENT Doctor Near You Genes and Hearing Loss Genes and Hearing Loss Patient ... mutation may only have dystopia canthorum. How Do Genes Work? Genes are a road map for the ...

  9. A Founder Effect of c.257 + 2T > C Mutation in NCF2 Gene Underlies Severe Chronic Granulomatous Disease in Eleven Patients.

    Ben-Farhat, Khaoula; Ben-Mustapha, Imen; Ben-Ali, Meriem; Rouault, Karen; Hamami, Saber; Mekki, Najla; Ben-Chehida, Amel; Larguèche, Beya; Fitouri, Zohra; Abdelmoula, Selim; Khemiri, Monia; Guediche, Mohamed-Neji; Boukthir, Samir; Barsaoui, Sihem; Chemli, Jalel; Barbouche, Mohamed-Ridha

    2016-08-01

    Chronic granulomatous disease (CGD) is the prototypic functional neutrophil disorder caused by genetic defects in one of the five genes encoding the superoxide-generating nicotinamide adenine dinucleotide phosphate (NADPH)-oxidase subunits of phagocytes. Mutations causing the most prevalent form of CGD in western populations are located in the X-linked-CYBB gene. The four remaining autosomal recessive (AR) forms collectively account for one-third of CGD cases. We investigated the clinical and molecular features of eleven patients with CGD from 6 consanguineous families, originating from contiguous regions in the west of Tunisia. The patients' clinical phenotype is characterized by a high incidence of mycobacterial infections. Five out of the eleven patients died despite treatment arguing in favor of a severe clinical form of CGD. These findings correlated with the absence of functional p67phox protein as well as the absence of residual reactive oxygen intermediates (ROI) production. Genetic analysis showed the presence, in all patients, of a unique mutation (c.257 + 2T > C) in NCF2 gene predicted to affect RNA splicing. Segregating analysis using nine polymorphic markers overlapping the NCF2 gene revealed a common haplotype spanning 4.1 Mb. The founder event responsible for this mutation was estimated to have arisen approximately 175 years ago. These findings will facilitate the implementation of preventive approaches through genetic counseling in affected consanguineous families. PMID:27220316

  10. STRESS AND ATHEROSCLEROSIS: MAY HSP60 BE THE MOLECULAR LINK?

    Luana Lipari

    2009-01-01

    Full Text Available In last decades, incidence of cardiovascular diseases is increased. Among them, atherosclerosis is one of the most commons. It is a disorder of in- flammation and innate immunity following lipid accumulation. From a bio- logic perspective, the process of adhesion and transmigration of immune cells (monocytes and macrophages across the endothelium is a crucial step for atherogenesis and mature plaque rupture. Moreover, there is a relationship between inflammation, infection, autoimmunity and athero- sclerosis. Inflammation has received increasing attention in recent years as a cause of atherosclerosis and cardiovascular diseases. Autoimmune diseases are characterized by enhanced atherosclerosis. Humoral immune responses to mycobacterial Hsp65, as well as to human Hsp60 and oxLDL, have been established in a number of human autoimmune diseases and are considered to be significantly associated also with atherosclerosis.

  11. Antigen stimulation of peripheral blood mononuclear cells from Mycobacterium bovis infected cattle yields evidence for a novel gene expression program

    Zhao Yingdong

    2008-09-01

    Full Text Available Abstract Background Bovine tuberculosis (BTB caused by Mycobacterium bovis continues to cause substantial losses to global agriculture and has significant repercussions for human health. The advent of high throughput genomics has facilitated large scale gene expression analyses that present a novel opportunity for revealing the molecular mechanisms underlying mycobacterial infection. Using this approach, we have previously shown that innate immune genes in peripheral blood mononuclear cells (PBMC from BTB-infected animals are repressed in vivo in the absence of exogenous antigen stimulation. In the present study, we hypothesized that the PBMC from BTB-infected cattle would display a distinct gene expression program resulting from exposure to M. bovis. A functional genomics approach was used to examine the immune response of BTB-infected (n = 6 and healthy control (n = 6 cattle to stimulation with bovine tuberculin (purified protein derivative – PPD-b in vitro. PBMC were harvested before, and at 3 h and 12 h post in vitro stimulation with bovine tuberculin. Gene expression changes were catalogued within each group using a reference hybridization design and a targeted immunospecific cDNA microarray platform (BOTL-5 with 4,800 spot features representing 1,391 genes. Results 250 gene spot features were significantly differentially expressed in BTB-infected animals at 3 h post-stimulation contrasting with only 88 gene spot features in the non-infected control animals (P ≤ 0.05. At 12 h post-stimulation, 56 and 80 gene spot features were differentially expressed in both groups respectively. The results provided evidence of a proinflammatory gene expression profile in PBMC from BTB-infected animals in response to antigen stimulation. Furthermore, a common panel of eighteen genes, including transcription factors were significantly expressed in opposite directions in both groups. Real-time quantitative reverse transcription PCR (qRT-PCR demonstrated

  12. Mycobacterium tuberculosis nuoG is a virulence gene that inhibits apoptosis of infected host cells.

    Kamalakannan Velmurugan

    2007-07-01

    Full Text Available The survival and persistence of Mycobacterium tuberculosis depends on its capacity to manipulate multiple host defense pathways, including the ability to actively inhibit the death by apoptosis of infected host cells. The genetic basis for this anti-apoptotic activity and its implication for mycobacterial virulence have not been demonstrated or elucidated. Using a novel gain-of-function genetic screen, we demonstrated that inhibition of infection-induced apoptosis of macrophages is controlled by multiple genetic loci in M. tuberculosis. Characterization of one of these loci in detail revealed that the anti-apoptosis activity was attributable to the type I NADH-dehydrogenase of M. tuberculosis, and was mainly due to the subunit of this multicomponent complex encoded by the nuoG gene. Expression of M. tuberculosis nuoG in nonpathogenic mycobacteria endowed them with the ability to inhibit apoptosis of infected human or mouse macrophages, and increased their virulence in a SCID mouse model. Conversely, deletion of nuoG in M. tuberculosis ablated its ability to inhibit macrophage apoptosis and significantly reduced its virulence in mice. These results identify a key component of the genetic basis for an important virulence trait of M. tuberculosis and support a direct causal relationship between virulence of pathogenic mycobacteria and their ability to inhibit macrophage apoptosis.

  13. Gene gymnastics

    Vijayachandran, Lakshmi S; Thimiri Govinda Raj, Deepak B; Edelweiss, Evelina; Gupta, Kapil; Maier, Josef; Gordeliy, Valentin; Fitzgerald, Daniel J; Berger, Imre

    2013-01-01

    Most essential activities in eukaryotic cells are catalyzed by large multiprotein assemblies containing up to ten or more interlocking subunits. The vast majority of these protein complexes are not easily accessible for high resolution studies aimed at unlocking their mechanisms, due to their low cellular abundance and high heterogeneity. Recombinant overproduction can resolve this bottleneck and baculovirus expression vector systems (BEVS) have emerged as particularly powerful tools for the provision of eukaryotic multiprotein complexes in high quality and quantity. Recently, synthetic biology approaches have begun to make their mark in improving existing BEVS reagents by de novo design of streamlined transfer plasmids and by engineering the baculovirus genome. Here we present OmniBac, comprising new custom designed reagents that further facilitate the integration of heterologous genes into the baculovirus genome for multiprotein expression. Based on comparative genome analysis and data mining, we herein present a blueprint to custom design and engineer the entire baculovirus genome for optimized production properties using a bottom-up synthetic biology approach. PMID:23328086

  14. Biochemical characterization of three mycobacterial ribosomal fractions.

    Portelance, V; Beaudet, R

    1983-02-01

    The induction of antituberculous immunity by crude ribosomal fractions isolated from Mycobacterium tuberculosis strain H37Ra, M. bovis strain BCG, and M. smegmatis was studied in CF-1 mice. Levels of antituberculous immunity similar to that induced by live BCG were induced by the BCG and H37Ra ribosomal fractions whereas that isolated from M. smegmatis was found to be inactive. Electrophoresis of the three ribosomal fractions in sodium dodecyl sulfate - polyacylamide gels followed by differential staining showed the two active ribosomal fractions to be similar in their proteins, carbohydrate-containing substances, and lipid profiles. The inactive smegmatis ribosomal fraction differed mainly from the active ones on the basis of its carbohydrate-containing substances profile and by the absence of lipids. The polysaccharides and the ribosomes present in the H37Ra ribosomal fractions were purified by affinity chromatography on concanavalin A - Sepharose 4B. Each purified preparation showed no or only low antituberculous activity when injected separately, but when mixed together a high protection was observed. The formation of complexes between the ribosomes and the polysaccharide fraction was suggested and appears to be necessary for the induction of antituberculous immunity. PMID:6189570

  15. Mycobacterial factors relevant for transmission of tuberculosis

    Verhagen, L.M.; Hof, S. van den; Deutekom, H. van; Hermans, P.W.M.; Kremer, K.; Borgdorff, M.W.; Soolingen, D. van

    2011-01-01

    BACKGROUND: Tuberculosis (TB) transmission is associated with patient-related risk factors. However, DNA fingerprint analysis has provided anecdotal evidence suggesting a role for bacteriological factors. METHODS: To examine the importance of the bacteriological component in TB transmission, we inve

  16. Nontuberculous Mycobacterial Infections in Cystic Fibrosis.

    Martiniano, Stacey L; Nick, Jerry A; Daley, Charles L

    2016-03-01

    Nontuberculous mycobacteria (NTM) are important emerging cystic fibrosis (CF) pathogens, with estimates of prevalence ranging from 6% to 13%. Diagnosis of NTM disease in patients with CF is challenging, as the infection may remain indolent in some, without evidence of clinical consequence, whereas other patients suffer significant morbidity and mortality. Treatment requires prolonged periods of multiple drugs and varies depending on NTM species, resistance pattern, and extent of disease. The development of a disease-specific approach to the diagnosis and treatment of NTM infection in CF patients is a research priority, as a lifelong strategy is needed for this high-risk population. PMID:26857770

  17. Principles of gene therapy

    Mammen Biju; Ramakrishnan T; Sudhakar Uma; Vijayalakshmi

    2007-01-01

    Genes are specific sequences of bases that encode instructions to make proteins. When genes are altered so that encoded proteins are unable to carry out their normal functions, genetic disorders can result. Gene therapy is designed to introduce genetic material into cells to compensate for abnormal genes or to make a beneficial protein. This article reviews the fundamentals in gene therapy and its various modes of administration with an insight into the role of gene therapy in Periodontics an...

  18. Recombinant DNA repair genes

    We have developed a gene transfer system with Chinese hamster ovary (CHO) cells to identify, characterize, and potentially isolate functionally homologous human or CHO genes regulating repair initiation

  19. Imaging gene expression in gene therapy

    Wiebe, Leonard I. [Alberta Univ., Edmonton (Canada). Noujaim Institute for Pharmaceutical Oncology Research

    1997-12-31

    Full text. Gene therapy can be used to introduce new genes, or to supplement the function of indigenous genes. At the present time, however, there is non-invasive test to demonstrate efficacy of the gene transfer and expression processes. It has been postulated that scintigraphic imaging can offer unique information on both the site at which the transferred gene is expressed, and the degree of expression, both of which are critical issue for safety and clinical efficacy. Many current studies are based on `suicide gene therapy` of cancer. Cells modified to express these genes commit metabolic suicide in the presence of an enzyme encoded by the transferred gene and a specifically-convertible pro drug. Pro drug metabolism can lead to selective metabolic trapping, required for scintigraphy. Herpes simplex virus type-1 thymidine kinase (H S V-1 t k{sup +}) has been use for `suicide` in vivo tumor gene therapy. It has been proposed that radiolabelled nucleosides can be used as radiopharmaceuticals to detect H S V-1 t k{sup +} gene expression where the H S V-1 t k{sup +} gene serves a reporter or therapeutic function. Animal gene therapy models have been studied using purine-([{sup 18} F]F H P G; [{sup 18} F]-A C V), and pyrimidine- ([{sup 123}/{sup 131} I]I V R F U; [{sup 124}/{sup 131I}]) antiviral nucleosides. Principles of gene therapy and gene therapy imaging will be reviewed and experimental data for [{sup 123}/{sup 131I}]I V R F U imaging with the H S V-1 t k{sup +} reporter gene will be presented

  20. Imaging gene expression in gene therapy

    Full text. Gene therapy can be used to introduce new genes, or to supplement the function of indigenous genes. At the present time, however, there is non-invasive test to demonstrate efficacy of the gene transfer and expression processes. It has been postulated that scintigraphic imaging can offer unique information on both the site at which the transferred gene is expressed, and the degree of expression, both of which are critical issue for safety and clinical efficacy. Many current studies are based on 'suicide gene therapy' of cancer. Cells modified to express these genes commit metabolic suicide in the presence of an enzyme encoded by the transferred gene and a specifically-convertible pro drug. Pro drug metabolism can lead to selective metabolic trapping, required for scintigraphy. Herpes simplex virus type-1 thymidine kinase (H S V-1 t k+) has been use for 'suicide' in vivo tumor gene therapy. It has been proposed that radiolabelled nucleosides can be used as radiopharmaceuticals to detect H S V-1 t k+ gene expression where the H S V-1 t k+ gene serves a reporter or therapeutic function. Animal gene therapy models have been studied using purine-([18 F]F H P G; [18 F]-A C V), and pyrimidine- ([123/131 I]I V R F U; [124/131I]) antiviral nucleosides. Principles of gene therapy and gene therapy imaging will be reviewed and experimental data for [123/131I]I V R F U imaging with the H S V-1 t k+ reporter gene will be presented

  1. Identifying Gene Interaction Enrichment for Gene Expression Data

    Jigang Zhang; Jian Li; Hong-Wen Deng

    2009-01-01

    Gene set analysis allows the inclusion of knowledge from established gene sets, such as gene pathways, and potentially improves the power of detecting differentially expressed genes. However, conventional methods of gene set analysis focus on gene marginal effects in a gene set, and ignore gene interactions which may contribute to complex human diseases. In this study, we propose a method of gene interaction enrichment analysis, which incorporates knowledge of predefined gene sets (e.g. gene ...

  2. Autism and Genes

    National Institutes of Health, 2005

    2005-01-01

    This document defines and discusses autism and how genes play a role in the condition. Answers to the following questions are covered: (1) What are genes? (2) What is autism? (3) What causes autism? (4) Why study genes to learn about autism? (5) How do researchers look for the genes involved in autism? (screen the whole genome; conduct cytogenetic…

  3. Principles of gene therapy

    Mammen Biju

    2007-01-01

    Full Text Available Genes are specific sequences of bases that encode instructions to make proteins. When genes are altered so that encoded proteins are unable to carry out their normal functions, genetic disorders can result. Gene therapy is designed to introduce genetic material into cells to compensate for abnormal genes or to make a beneficial protein. This article reviews the fundamentals in gene therapy and its various modes of administration with an insight into the role of gene therapy in Periodontics and future percepts and the technical and ethical issues of using gene therapy.

  4. Flagellin Encoded in Gene-Based Vector Vaccines Is a Route-Dependent Immune Adjuvant.

    Rady, Hamada F; Dai, Guixiang; Huang, Weitao; Shellito, Judd E; Ramsay, Alistair J

    2016-01-01

    Flagellin has been tested as a protein-based vaccine adjuvant, with the majority of studies focused on antibody responses. Here, we evaluated the adjuvant activity of flagellin for both cellular and humoral immune responses in BALB/c mice in the setting of gene-based immunization, and have made several novel observations. DNA vaccines and adenovirus (Ad) vectors were engineered to encode mycobacterial protein Ag85B, with or without flagellin of Salmonella typhimurium (FliC). DNA-encoded flagellin given IM enhanced splenic CD4+ and CD8+ T cell responses to co-expressed vaccine antigen, including memory responses. Boosting either IM or intranasally with Ad vectors expressing Ag85B without flagellin led to durable enhancement of Ag85B-specific antibody and CD4+ and CD8+ T cell responses in both spleen and pulmonary tissues, correlating with significantly improved protection against challenge with pathogenic aerosolized M. tuberculosis. However, inclusion of flagellin in both DNA prime and Ad booster vaccines induced localized pulmonary inflammation and transient weight loss, with route-dependent effects on vaccine-induced T cell immunity. The latter included marked reductions in levels of mucosal CD4+ and CD8+ T cell responses following IM DNA/IN Ad mucosal prime-boosting, although antibody responses were not diminished. These findings indicate that flagellin has differential and route-dependent adjuvant activity when included as a component of systemic or mucosally-delivered gene-based prime-boost immunization. Clear adjuvant activity for both T and B cell responses was observed when flagellin was included in the DNA priming vaccine, but side effects occurred when given in an Ad boosting vector, particularly via the pulmonary route. PMID:26844553

  5. Flagellin Encoded in Gene-Based Vector Vaccines Is a Route-Dependent Immune Adjuvant.

    Hamada F Rady

    Full Text Available Flagellin has been tested as a protein-based vaccine adjuvant, with the majority of studies focused on antibody responses. Here, we evaluated the adjuvant activity of flagellin for both cellular and humoral immune responses in BALB/c mice in the setting of gene-based immunization, and have made several novel observations. DNA vaccines and adenovirus (Ad vectors were engineered to encode mycobacterial protein Ag85B, with or without flagellin of Salmonella typhimurium (FliC. DNA-encoded flagellin given IM enhanced splenic CD4+ and CD8+ T cell responses to co-expressed vaccine antigen, including memory responses. Boosting either IM or intranasally with Ad vectors expressing Ag85B without flagellin led to durable enhancement of Ag85B-specific antibody and CD4+ and CD8+ T cell responses in both spleen and pulmonary tissues, correlating with significantly improved protection against challenge with pathogenic aerosolized M. tuberculosis. However, inclusion of flagellin in both DNA prime and Ad booster vaccines induced localized pulmonary inflammation and transient weight loss, with route-dependent effects on vaccine-induced T cell immunity. The latter included marked reductions in levels of mucosal CD4+ and CD8+ T cell responses following IM DNA/IN Ad mucosal prime-boosting, although antibody responses were not diminished. These findings indicate that flagellin has differential and route-dependent adjuvant activity when included as a component of systemic or mucosally-delivered gene-based prime-boost immunization. Clear adjuvant activity for both T and B cell responses was observed when flagellin was included in the DNA priming vaccine, but side effects occurred when given in an Ad boosting vector, particularly via the pulmonary route.

  6. Gene therapy in periodontics

    Anirban Chatterjee; Nidhi Singh; Mini Saluja

    2013-01-01

    GENES are made of DNA - the code of life. They are made up of two types of base pair from different number of hydrogen bonds AT, GC which can be turned into instruction. Everyone inherits genes from their parents and passes them on in turn to their children. Every person′s genes are different, and the changes in sequence determine the inherited differences between each of us. Some changes, usually in a single gene, may cause serious diseases. Gene therapy is ′the use of genes as medicine′. It...

  7. Human Gene Therapy: Genes without Frontiers?

    Simon, Eric J.

    2002-01-01

    Describes the latest advancements and setbacks in human gene therapy to provide reference material for biology teachers to use in their science classes. Focuses on basic concepts such as recombinant DNA technology, and provides examples of human gene therapy such as severe combined immunodeficiency syndrome, familial hypercholesterolemia, and…

  8. Does Gene Translocation Accelerate the Evolution of Laterally Transferred Genes?

    Hao, Weilong; Golding, G. Brian

    2009-01-01

    Lateral gene transfer (LGT) and gene rearrangement are essential for shaping bacterial genomes during evolution. Separate attention has been focused on understanding the process of lateral gene transfer and the process of gene translocation. However, little is known about how gene translocation affects laterally transferred genes. Here we have examined gene translocations and lateral gene transfers in closely related genome pairs. The results reveal that translocated genes undergo elevated ra...

  9. Essential Bacillus subtilis genes

    Kobayashi, K.; Ehrlich, S.D.; Albertini, A.;

    2003-01-01

    To estimate the minimal gene set required to sustain bacterial life in nutritious conditions, we carried out a systematic inactivation of Bacillus subtilis genes. Among approximate to4,100 genes of the organism, only 192 were shown to be indispensable by this or previous work. Another 79 genes were...... predicted to be essential. The vast majority of essential genes were categorized in relatively few domains of cell metabolism, with about half involved in information processing, one-fifth involved in the synthesis of cell envelope and the determination of cell shape and division, and one-tenth related to...... cell energetics. Only 4% of essential genes encode unknown functions. Most essential genes are present throughout a wide range of Bacteria, and almost 70% can also be found in Archaea and Eucarya. However, essential genes related to cell envelope, shape, division, and respiration tend to be lost from...

  10. Genes underlying altruism

    Thompson, Graham J.; Hurd, Peter L.; Crespi, Bernard J.

    2013-01-01

    William D. Hamilton postulated the existence of ‘genes underlying altruism’, under the rubric of inclusive fitness theory, a half-century ago. Such genes are now poised for discovery. In this article, we develop a set of intuitive criteria for the recognition and analysis of genes for altruism and describe the first candidate genes affecting altruism from social insects and humans. We also provide evidence from a human population for genetically based trade-offs, underlain by oxytocin-system ...

  11. Cochlear Gene Therapy

    Lustig, Lawrence R.; Akil, Omar

    2012-01-01

    The purpose of this review is to highlight recent advances in cochlear gene therapy over the past several years. Cochlear gene therapy has undergone tremendous advances over the past decade. Beginning with some groundbreaking work in 2005 documenting hair cell regeneration using virallymediated delivery of the mouse atonal 1 gene, gene therapy is now being explored as a possible treatment for a variety of causes of hearing loss.

  12. Supervised clustering of genes

    Dettling, Marcel; Bühlmann, Peter

    2002-01-01

    Background We focus on microarray data where experiments monitor gene expression in different tissues and where each experiment is equipped with an additional response variable such as a cancer type. Although the number of measured genes is in the thousands, it is assumed that only a few marker components of gene subsets determine the type of a tissue. Here we present a new method for finding such groups of genes by directly incorporating the response variables into the grouping process, yiel...

  13. Discovering genes underlying QTL

    A map-based approach has allowed scientists to discover few genes at a time. In addition, the reproductive barrier between cultivated rice and wild relatives has prevented us from utilizing the germ plasm by a map-based approach. Most genetic traits important to agriculture or human diseases are manifested as observable, quantitative phenotypes called Quantitative Trait Loci (QTL). In many instances, the complexity of the phenotype/genotype interaction and the general lack of clearly identifiable gene products render the direct molecular cloning approach ineffective, thus additional strategies like genome mapping are required to identify the QTL in question. Genome mapping requires no prior knowledge of the gene function, but utilizes statistical methods to identify the most likely gene location. To completely characterize genes of interest, the initially mapped region of a gene location will have to be narrowed down to a size that is suitable for cloning and sequencing. Strategies for gene identification within the critical region have to be applied after the sequencing of a potentially large clone or set of clones that contains this gene(s). Tremendous success of positional cloning has been shown for cloning many genes responsible for human diseases, including cystic fibrosis and muscular dystrophy as well as plant disease resistance genes. Genome and QTL mapping, positional cloning: the pre-genomics era, comparative approaches to gene identification, and positional cloning: the genomics era are discussed in the report. (M. Suetake)

  14. Discovering genes underlying QTL

    Vanavichit, Apichart [Kasetsart University, Kamphaengsaen, Nakorn Pathom (Thailand)

    2002-02-01

    A map-based approach has allowed scientists to discover few genes at a time. In addition, the reproductive barrier between cultivated rice and wild relatives has prevented us from utilizing the germ plasm by a map-based approach. Most genetic traits important to agriculture or human diseases are manifested as observable, quantitative phenotypes called Quantitative Trait Loci (QTL). In many instances, the complexity of the phenotype/genotype interaction and the general lack of clearly identifiable gene products render the direct molecular cloning approach ineffective, thus additional strategies like genome mapping are required to identify the QTL in question. Genome mapping requires no prior knowledge of the gene function, but utilizes statistical methods to identify the most likely gene location. To completely characterize genes of interest, the initially mapped region of a gene location will have to be narrowed down to a size that is suitable for cloning and sequencing. Strategies for gene identification within the critical region have to be applied after the sequencing of a potentially large clone or set of clones that contains this gene(s). Tremendous success of positional cloning has been shown for cloning many genes responsible for human diseases, including cystic fibrosis and muscular dystrophy as well as plant disease resistance genes. Genome and QTL mapping, positional cloning: the pre-genomics era, comparative approaches to gene identification, and positional cloning: the genomics era are discussed in the report. (M. Suetake)

  15. A Pilot Study of Gene/Gene and Gene/Environment Interactions in Alzheimer Disease

    Ghebranious, Nader; Mukesh, Bickol; Giampietro, Philip F.; Glurich, Ingrid; Mickel, Susan F.; Waring, Stephen C.; Catherine A McCarty

    2011-01-01

    Background: Although some genes associated with increased risk of Alzheimer Disease (AD) have been identified, few data exist related to gene/gene and gene/environment risk of AD. The purpose of this pilot study was to explore gene/gene and gene/environment associations in AD and to obtain data for sample size estimates for larger, more definitive studies of AD.

  16. Modelling prokaryote gene content

    Edward Susko

    2006-01-01

    Full Text Available The patchy distribution of genes across the prokaryotes may be caused by multiple gene losses or lateral transfer. Probabilistic models of gene gain and loss are needed to distinguish between these possibilities. Existing models allow only single genes to be gained and lost, despite the empirical evidence for multi-gene events. We compare birth-death models (currently the only widely-used models, in which only one gene can be gained or lost at a time to blocks models (allowing gain and loss of multiple genes within a family. We analyze two pairs of genomes: two E. coli strains, and the distantly-related Archaeoglobus fulgidus (archaea and Bacillus subtilis (gram positive bacteria. Blocks models describe the data much better than birth-death models. Our models suggest that lateral transfers of multiple genes from the same family are rare (although transfers of single genes are probably common. For both pairs, the estimated median time that a gene will remain in the genome is not much greater than the time separating the common ancestors of the archaea and bacteria. Deep phylogenetic reconstruction from sequence data will therefore depend on choosing genes likely to remain in the genome for a long time. Phylogenies based on the blocks model are more biologically plausible than phylogenies based on the birth-death model.

  17. Gene therapy: An overview

    Sudip Indu

    2013-01-01

    Full Text Available Gene therapy "the use of genes as medicine" involves the transfer of a therapeutic or working copy of a gene into specific cells of an individual in order to repair a faulty gene copy. The technique may be used to replace a faulty gene, or to introduce a new gene whose function is to cure or to favorably modify the clinical course of a condition. The objective of gene therapy is to introduce new genetic material into target cells while causing no damage to the surrounding healthy cells and tissues, hence the treatment related morbidity is decreased. The delivery system includes a vector that delivers a therapeutic gene into the patient′s target cell. Functional proteins are created from the therapeutic gene causing the cell to return to a normal stage. The vectors used in gene therapy can be viral and non-viral. Gene therapy, an emerging field of biomedicine, is still at infancy and much research remains to be done before this approach to the treatment of condition will realize its full potential.

  18. Evaluating gene × gene and gene × smoking interaction in rheumatoid arthritis using candidate genes in GAW15

    Mei Ling; Li Xiaohui; Yang Kai; Cui Jinrui; Fang Belle; Guo Xiuqing; Rotter Jerome I

    2007-01-01

    Abstract We examined the potential gene × gene interactions and gene × smoking interactions in rheumatoid arthritis (RA) using the candidate gene data sets provided by Genetic Analysis Workshop 15 Problem 2. The multifactor dimensionality reduction (MDR) method was used to test gene × gene interactions among candidate genes. The case-only sample was used to test gene × smoking interactions. The best predictive model was the single-locus model with single-nucleotide polymorphism (SNP) rs247660...

  19. Cancer gene therapy

    Mitrović Tatjana; Radulović Siniša

    2005-01-01

    Cancer gene therapy can be defined as transfer of nucleic acids into tumor or normal cells with aim to eradicate or reduce tumor mass by direct killing of cells, immunomodulation or correction of genetic errors, and reversion of malignant status. Initially started with lots of optimism and enthusiasm, cancer gene therapy has shown limited success in treatment of patients. This review highlights current limitations and almost endless possibilities of cancer gene therapy. The major difficulty i...

  20. Regulation of gene expression

    In order to define in molecular terms the mechanisms controlling expression of specific genes in mammalian cells, how gene expression is activated, how tissue-specific expression is effected, how expression is modulated by hormones and other specific effectors, and how genetic control mechanisms are altered in the dysfunction of gene expression in cells transformed to malignancy were studied. Much of this work has focused on expression of the rat liver enzyme tyrosine aminotransferase

  1. [The gene or genes of allergic asthma?].

    Demoly, P; Bousquet, J; Godard, P; Michel, F B

    1993-05-15

    Asthma is a multifactorial disease in which the hereditary component has been demonstrated by familial and identical twin studies. Allergy is important in the aetiology of asthma and is characterized by a hyperreaction to allergens triggering predominantly the immunoglobulines E. The levels of these antibodies are found to be elevated even in non allergic asthmatics. The majority of genetic research in this area is focused on either the genes of the specific immune response or that of the non allergic response. These are the genes of the class II MHC, and the APY gene on chromosome 11q respectively. The modern techniques of molecular genetics and in particular those of inverse genetics have recently contributed to a more comprehensive understanding of this disease. PMID:8316547

  2. Delivery Systems in Gene Therapy

    Liu Hu; Anas El-Aneed; Cui Guohui

    2005-01-01

    1 Gene therapy Gene therapy includes the treatment of both genetically based and infectious diseases by introducing genetic materials which have therapeutic effects[1~3]. In its simplest terms, a wild type gene (which is non-functional in the cell leading to disease development) is introduced into the somatic cell lacking this gene to restore the normal gene function in this cell. Many gene therapy strategies, however, utilize genes to destroy specific cells.

  3. Gene Conversion and Evolution of Gene Families: An Overview

    Tomoko Ohta

    2010-01-01

    The importance of gene conversion for the evolution of gene families is reviewed. Four problems concerning gene conversion, i.e., concerted evolution, generation of useful variation, deleterious effects, and relation to neofunctionalization, are discussed by surveying reported examples of evolving gene families. Emphasis is given toward understanding interactive effects of gene conversion and natural selection.

  4. Your Genes, Your Choices

    Table of Contents Your Genes, Your Choices describes the Human Genome Project, the science behind it, and the ethical, legal, and social issues that are ... Nothing could be further from the truth. Your Genes, Your Choices points out how the progress of ...

  5. The GeneMANIA prediction server: biological network integration for gene prioritization and predicting gene function

    Warde-Farley, David; Sylva L. Donaldson; Comes, Ovi; Zuberi, Khalid; Badrawi, Rashad; Chao, Pauline; Franz, Max; Grouios, Chris; Kazi, Farzana; Lopes, Christian Tannus; Maitland, Anson; Mostafavi, Sara; Montojo, Jason; Shao, Quentin; Wright, George

    2010-01-01

    GeneMANIA (http://www.genemania.org) is a flexible, user-friendly web interface for generating hypotheses about gene function, analyzing gene lists and prioritizing genes for functional assays. Given a query list, GeneMANIA extends the list with functionally similar genes that it identifies using available genomics and proteomics data. GeneMANIA also reports weights that indicate the predictive value of each selected data set for the query. Six organisms are currently supported (Arabidopsis t...

  6. É possível uma vacina gênica auxiliar no controle da tuberculose? Could a DNA vaccine be useful in the control of tuberculosis?

    José Maciel Rodrigues Júnior

    2004-08-01

    vaccines currently under pre-clinical and clinical development may prove to be important tools in combating infectious diseases, such as tuberculosis, for which no safe and effective form of prevention has yet been developed. In recent years, several studies have aimed to develop a DNA vaccine encoding mycobacterial proteins such as antigen 85 (Ag85 and the 65-kDa mycobacterial heat shock protein (hsp65. The latter is protective against virulent infection with Mycobacterium tuberculosis (including multidrug-resistant strains. The hsp65 DNA vaccine, currently under clinical evaluation in Brazil for cancer therapy, is able to induce the secretion of Th1 cytokines, such as gamma-interferon, associated with disease control. Furthermore, this vaccine stimulates cytotoxic CD8 and CD4 T-cell clones that can be characterized as memory cells, which are responsible for effective and long-lasting immunity against tuberculosis. When used as a therapeutic agent in inoculated mice, the hsp65 DNA vaccine promotes changes in the immunity profile, triggering the secretion of Th1 cytokines and establishing a favorable environment for the elimination of bacilli. The results also demonstrate that the route of administration, as well as the formulation in which the vaccine is administered, fundamentally influence the pattern and duration of the immune response induced. Taking all currently available data into account, we can conclude that a DNA vaccine against tuberculosis could contribute significantly to the control of the disease.

  7. Adenovirus Vectors for Gene Therapy, Vaccination and Cancer Gene Therapy

    Wold, William S.M.; Toth, Karoly

    2013-01-01

    Adenovirus vectors are the most commonly employed vector for cancer gene therapy. They are also used for gene therapy and as vaccines to express foreign antigens. Adenovirus vectors can be replication-defective; certain essential viral genes are deleted and replaced by a cassette that expresses a foreign therapeutic gene. Such vectors are used for gene therapy, as vaccines, and for cancer therapy. Replication-competent (oncolytic) vectors are employed for cancer gene therapy. Oncolytic vector...

  8. Epidemic of Postsurgical Infections Caused by Mycobacterium massiliense▿

    Duarte, Rafael Silva; Lourenço, Maria Cristina Silva; Fonseca, Leila de Souza; Leão, Sylvia Cardoso; Amorim, Efigenia de Lourdes T.; Rocha, Ingrid L. L.; Coelho, Fabrice Santana; Viana-Niero, Cristina; Gomes, Karen Machado; da Silva, Marlei Gomes; de Oliveira Lorena, Nádia Suely; Pitombo, Marcos Bettini; Ferreira, Rosa M. C.; de Oliveira Garcia, Márcio Henrique; de Oliveira, Gisele Pinto; Lupi, Otilia; Vilaça, Bruno Rios; Serradas, Lúcia Rodrigues; Chebabo, Alberto; Marques, Elizabeth Andrade; Teixeira, Lúcia Martins; Dalcolmo, Margareth; Senna, Simone Gonçalves; Sampaio, Jorge Luiz Mello

    2009-01-01

    An epidemic of infections after video-assisted surgery (1,051 possible cases) caused by rapidly growing mycobacteria (RGM) and involving 63 hospitals in the state of Rio de Janeiro, Brazil, occurred between August 2006 and July 2007. One hundred ninety-seven cases were confirmed by positive acid-fast staining and/or culture techniques. Thirty-eight hospitals had cases confirmed by mycobacterial culture, with a total of 148 available isolates recovered from 146 patients. Most (n = 144; 97.2%) isolates presented a PRA-hsp65 restriction pattern suggestive of Mycobacterium bolletii or Mycobacterium massiliense. Seventy-four of these isolates were further identified by hsp65 or rpoB partial sequencing, confirming the species identification as M. massiliense. Epidemic isolates showed susceptibility to amikacin (MIC at which 90% of the tested isolates are inhibited [MIC90], 8 μg/ml) and clarithromycin (MIC90, 0.25 μg/ml) but resistance to ciprofloxacin (MIC90, ≥32 μg/ml), cefoxitin (MIC90, 128 μg/ml), and doxycycline (MIC90, ≥64 μg/ml). Representative epidemic M. massiliense isolates that were randomly selected, including at least one isolate from each hospital where confirmed cases were detected, belonged to a single clone, as indicated by the analysis of pulsed-field gel electrophoresis (PFGE) patterns. They also had the same PFGE pattern as that previously observed in two outbreaks that occurred in other Brazilian cities; we designated this clone BRA100. All five BRA100 M. massiliense isolates tested presented consistent tolerance to 2% glutaraldehyde. This is the largest epidemic of postsurgical infections caused by RGM reported in the literature to date in Brazil. PMID:19403765

  9. Methanogenesis and methane genes

    An overview of the pathways leading to methane biosynthesis is presented. The steps investigated to date by gene cloning and DNA sequencing procedures are identified and discussed. The primary structures of component C of methyl coenzyme M reductase encoded by mcr operons in different methanogens are compared. Experiments to detect the primary structure of the genes encoding F420 reducing hydrogenase (frhABG) and methyl hydrogen reducing hydrogenase (mvhDGA) in methanobacterium thermoautotrophicum strain H are compared with each other and with eubacterial hydrogenase encoding genes. A biotechnological use for hydrogenases from hypermorphillic archaebacteria is suggested. (author)

  10. Antisense gene silencing

    Nielsen, Troels T; Nielsen, Jørgen E

    2013-01-01

    Since the first reports that double-stranded RNAs can efficiently silence gene expression in C. elegans, the technology of RNA interference (RNAi) has been intensively exploited as an experimental tool to study gene function. With the subsequent discovery that RNAi could also be applied to...... mammalian cells, the technology of RNAi expanded from being a valuable experimental tool to being an applicable method for gene-specific therapeutic regulation, and much effort has been put into further refinement of the technique. This review will focus on how RNAi has developed over the years and how the...

  11. Development of a quantitative analysis method for mRNA from Mycobacterium leprae and slow-growing acid-fast bacteria

    This study aimed to develop a specific method for detection and quantitative determination of mRNA that allows estimation of viable counts of M. leprae and other mycobacteria. Of heart-shock protein of 65 kDa (hsp65), mRNA was used as an indicator to discriminate the living cells and died ones. To compare mRNA detections by RNase protection assay (RPA) and Northern blot hybridization (NBH), labelled anti-sense RNA for hsp65 gene of M. leprae was synthesized using plasmid pUC8/N5. The anti-sense RNA synthesized from the template DNA containing about 580 bp (194 to 762) of hsp65 gene. When compared with NBH method, the amount of probe required for the detection by RPA method was 1/30 or less and the detection sensitivity of RPA was also 10 times higher. In addition, complicated procedures were needed to eliminate non-specific reactions in NBH method. These results indicated that RPA method is more convenient and superior for the mRNA detection. However, isotope degradation in the probe used for RPA method might affect the results. Therefore, 33P of 35P, of which degradation energy is less that 32P should be used for labelling. Total RNA was effectively extracted from M. chelonae, M. marinum by AGPC method, but not from M. leprae. In conclusion, RPA is a very effective detection method for these mRNA, but it seems necessary to further improve the sensitivity of detection for a small amount of test materials. (M.N.)

  12. Novel Species Including Mycobacterium fukienense sp. Is Found from Tuberc-ulosis Patients in Fujian Province, China, Using Phylogenetic Analysis of Mycobacterium chelonae/abscessus Complex

    ZHANG Yuan Yuan; LI Yan Bing; HUANG Ming Xiang; ZHAO Xiu Qin; ZHANG Li Shui; LIU Wen En; WAN Kang Lin

    2013-01-01

    Objective To identify the novel species ‘Mycobacterium fukienense’ sp. nov of Mycobacterium chelonae/abscessus complex from tuberculosis patients in Fujian Province, China. Methods Five of 27 clinical Mycobacterium isolates (Cls) were previously identified as M. chelonae/abscessus complex by sequencing the hsp65, rpoB, 16S-23S rRNA internal transcribed spacer region (its), recA and sodA house-keeping genes commonly used to describe the molecular characteristics of Mycobacterium. Clinical Mycobacterium isolates were classified according to the gene sequence using a clustering analysis program. Sequence similarity within clusters and diversity between clusters were analyzed. Results The 5 isolates were identified with distinct sequences exhibiting 99.8% homology in the hsp65 gene. However, a complete lack of homology was observed among the sequences of the rpoB, 16S-23S rRNA internal transcribed spacer region (its), sodA, and recA genes as compared with the M. abscessus. Furthermore, no match for rpoB, sodA, and recA genes was identified among the published sequences. Conclusion The novel species, Mycobacterium fukienense, is identified from tuberculosis patients in Fujian Province, China, which does not belong to any existing subspecies of M. chelonea/abscessus complex.

  13. Endurance performance: genes or gene combinations?

    Gómez Gallego, Félix; Santiago Dorrego, Catalina; González-Freire, Marta; Muniesa Ferrero, Carlos Alberto; Fernández del Valle, María; Pérez Ruiz, Margarita; Foster, Carl; Lucía Mulas, Alejandro

    2009-01-01

    We assessed the possible association between variants of the genes encoding for the angiotensin-converting enzyme ( ACE) and alpha-actinin-3 ( ACTN3) (both individually and combined) and several endurance phenotypic traits, e.g., peak power output (PPO), ventilatory (VT) and respiratory compensation threshold (RCT), among others, in professional road cyclists and sedentary controls (n = 46 each). We applied an ANCOVA test using the aforementioned phenotype traits as dependent variables, ACE a...

  14. Gene Therapy of Cancerous Diseases

    Valenčáková, A.; Dziaková, A.; Hatalová, E.

    2015-01-01

    Gene therapy of cancerous diseases provides new means of curing patients with oncologic illnesses. There are several approaches in treating cancer by gene therapy. Most commonly used methods are: cancer immunogene therapy, suicide gene therapy, application of tumor-suppressor genes, antiangiogenic therapy, mesenchymal stem cells used as vectors, gene directed enzyme/prodrug therapy and bacteria used as anti-cancer agents. Cancer gene immunotherapy uses several immunologic agents for the purp...

  15. Genes underlying altruism.

    Thompson, Graham J; Hurd, Peter L; Crespi, Bernard J

    2013-01-01

    William D. Hamilton postulated the existence of 'genes underlying altruism', under the rubric of inclusive fitness theory, a half-century ago. Such genes are now poised for discovery. In this article, we develop a set of intuitive criteria for the recognition and analysis of genes for altruism and describe the first candidate genes affecting altruism from social insects and humans. We also provide evidence from a human population for genetically based trade-offs, underlain by oxytocin-system polymorphisms, between alleles for altruism and alleles for non-social cognition. Such trade-offs between self-oriented and altruistic behaviour may influence the evolution of phenotypic diversity across all social animals. PMID:24132092

  16. What Is a Gene?

    ... Quizzes Kids' Dictionary of Medical Words En Español What Other Kids Are Reading Back-to-School Butterflies? ... Got Homework? Here's Help White House Lunch Recipes What Is a Gene? KidsHealth > For Kids > What Is ...

  17. Terplex Gene Delivery System.

    Kim, Sung Wan

    2005-01-01

    Polymeric gene delivery systems have been developed to overcome problems caused by viral carriers. They are low cytotoxic, have no size limit, are convenient in handling, of low cost and reproducible. A Terplex gene delivery system consisting of plasmid DNA, low density lipoprotein and hydropholized poly-L-lysine was designed and characterized. The plasmid DNA, when formulated with stearyl PLL and LDL, forms a stable and hydrophobicity/charge-balanced Terplex system of optimal size for efficient cellular uptake. DNA is still intact after the Terplex formation. This information is expected to be utilized for the development of improved transfection vector for in vivo gene therapy. Terplex DNA complex showed significantly longer retention in the vascular space than naked DNA. This system was used in the augmentation of myocardial transfection at an infarction site with the VEGF gene. PMID:16243067

  18. Gene Expression Omnibus (GEO)

    U.S. Department of Health & Human Services — Gene Expression Omnibus is a public functional genomics data repository supporting MIAME-compliant submissions of array- and sequence-based data. Tools are provided...

  19. Metastasis Suppressor Genes

    Yan, Jinchun; Yang, Qin; Huang, Qihong

    2013-01-01

    Metastasis is a major cause of cancer mortality. Metastasis is a complex process that requires the regulation of both metastasis-promoting and metastasis suppressor genes. The discovery of metastasis suppressor genes contributes significantly to our understanding of metastasis mechanisms and provides prognostic markers and therapeutic targets in clinical cancer management. In this review, we summarize the methods that have been used to identify metastasis suppressors and the potential clinica...

  20. Genes and Vocal Learning

    White, Stephanie A.

    2009-01-01

    Could a mutation in a single gene be the evolutionary lynchpin supporting the development of human language? A rare mutation in the molecule known as FOXP2 discovered in a human family seemed to suggest so, and its sequence phylogeny reinforced a Chomskian view that language emerged wholesale in humans. Spurred by this discovery, research in primates, rodents and birds suggests that FoxP2 and other language-related genes are interactors in the neuromolecular networks that underlie subsystems ...

  1. Evidence for homosexuality gene

    Pool, R.

    1993-07-16

    A genetic analysis of 40 pairs of homosexual brothers has uncovered a region on the X chromosome that appears to contain a gene or genes for homosexuality. When analyzing the pedigrees of homosexual males, the researcheres found evidence that the trait has a higher likelihood of being passed through maternal genes. This led them to search the X chromosome for genes predisposing to homosexuality. The researchers examined the X chromosomes of pairs of homosexual brothers for regions of DNA that most or all had in common. Of the 40 sets of brothers, 33 shared a set of five markers in the q28 region of the long arm of the X chromosome. The linkage has a LOD score of 4.0, which translates into a 99.5% certainty that there is a gene or genes in this area that predispose males to homosexuality. The chief researcher warns, however, that this one site cannot explain all instances of homosexuality, since there were some cases where the trait seemed to be passed paternally. And even among those brothers where there was no evidence that the trait was passed paternally, seven sets of brothers did not share the Xq28 markers. It seems likely that homosexuality arises from a variety of causes.

  2. Gene-gene, gene-environment, gene-nutrient interactionsand single nucleotide polymorphisms of inflammatorycytokines

    2015-01-01

    Inflammation plays a significant role in the etiologyof type 2 diabetes mellitus (T2DM). The rise in thepro-inflammatory cytokines is the essential step inglucotoxicity and lipotoxicity induced mitochondrialinjury, oxidative stress and beta cell apoptosis inT2DM. Among the recognized markers are interleukin(IL)-6, IL-1, IL-10, IL-18, tissue necrosis factor-alpha(TNF-α), C-reactive protein, resistin, adiponectin, tissueplasminogen activator, fibrinogen and heptoglobins.Diabetes mellitus has firm genetic and very strongenvironmental influence; exhibiting a polygenic modeof inheritance. Many single nucleotide polymorphisms(SNPs) in various genes including those of pro and antiinflammatorycytokines have been reported as a riskfor T2DM. Not all the SNPs have been confirmed byunifying results in different studies and wide variationshave been reported in various ethnic groups. Theinter-ethnic variations can be explained by the factthat gene expression may be regulated by gene-gene,gene-environment and gene-nutrient interactions. Thisreview highlights the impact of these interactions ondetermining the role of single nucleotide polymorphismof IL-6, TNF-α, resistin and adiponectin in pathogenesisof T2DM.

  3. The Mycoplasma hominis vaa gene displays a mosaic gene structure

    Boesen, Thomas; Emmersen, Jeppe M. G.; Jensen, Lise T.;

    1998-01-01

    Mycoplasma hominis contains a variable adherence-associated (vaa) gene. To classify variants of the vaa genes, we examined 42 M. hominis isolated by PCR, DNA sequencing and immunoblotting. This uncovered the existence of five gene categories. Comparison of the gene types revealed a modular...

  4. Hox genes and study of Hox genes in crustacean

    HOU Lin; CHEN Zhijuan; XU Mingyu; LIN Shengguo; WANG Lu

    2004-01-01

    Homeobox genes have been discovered in many species. These genes are known to play a major role in specifying regional identity along the anterior-posterior axis of animals from a wide range of phyla.The products of the homeotic genes are a set of evolutionarily conserved transcription factors that control elaborate developmental processes and specify cell fates in metazoans. Crustacean, presenting a variety of body plans not encountered in any other class or phylum of the Metazoa, has been shown to possess a single set of homologous Hox genes like insect. The ancestral crustacean Hox gene complex comprised ten genes: eight homologous to the hometic Hox genes and two related to nonhomeotic genes presented within the insect Hox complexes. The crustacean in particular exhibits an abundant diversity segment specialization and tagmosis. This morphological diversity relates to the Hox genes. In crustacean body plan, different Hox genes control different segments and tagmosis.

  5. GeneCards Version 3: the human gene integrator.

    Safran, Marilyn; Dalah, Irina; Alexander, Justin; Rosen, Naomi; Iny Stein, Tsippi; Shmoish, Michael; Nativ, Noam; Bahir, Iris; Doniger, Tirza; Krug, Hagit; Sirota-Madi, Alexandra; Olender, Tsviya; Golan, Yaron; Stelzer, Gil; Harel, Arye; Lancet, Doron

    2010-01-01

    GeneCards (www.genecards.org) is a comprehensive, authoritative compendium of annotative information about human genes, widely used for nearly 15 years. Its gene-centric content is automatically mined and integrated from over 80 digital sources, resulting in a web-based deep-linked card for each of >73,000 human gene entries, encompassing the following categories: protein coding, pseudogene, RNA gene, genetic locus, cluster and uncategorized. We now introduce GeneCards Version 3, featuring a speedy and sophisticated search engine and a revamped, technologically enabling infrastructure, catering to the expanding needs of biomedical researchers. A key focus is on gene-set analyses, which leverage GeneCards' unique wealth of combinatorial annotations. These include the GeneALaCart batch query facility, which tabulates user-selected annotations for multiple genes and GeneDecks, which identifies similar genes with shared annotations, and finds set-shared annotations by descriptor enrichment analysis. Such set-centric features address a host of applications, including microarray data analysis, cross-database annotation mapping and gene-disorder associations for drug targeting. We highlight the new Version 3 database architecture, its multi-faceted search engine, and its semi-automated quality assurance system. Data enhancements include an expanded visualization of gene expression patterns in normal and cancer tissues, an integrated alternative splicing pattern display, and augmented multi-source SNPs and pathways sections. GeneCards now provides direct links to gene-related research reagents such as antibodies, recombinant proteins, DNA clones and inhibitory RNAs and features gene-related drugs and compounds lists. We also portray the GeneCards Inferred Functionality Score annotation landscape tool for scoring a gene's functional information status. Finally, we delineate examples of applications and collaborations that have benefited from the GeneCards suite. Database

  6. Introns in higher plant genes

    2002-01-01

    The intron is an important component of eukaryotic gene. Extensive studies have been conducted to get a better understanding of its structure and function. This paper presents a brief review of the structure and function of introns in higher plant genes. It is shown that higher plant introns possess structural properties shared by all eukaryotic introns, however, they also exhibit a striking degree of diversity. The process of intron splicing in higher plant genes involves interaction between multiple cis-acting elements and trans-acting factors, such as 5′ splicing site, 3′ splicing site and many protein factors. The process of intron splicing is an important level at which gene expression is regulated. Especially alternative splicing of intron can regulate time and space of gene expression. In addition, some introns in higher plant genes also regulate gene expression by affecting the pattern of gene expression, enhancing the level of gene expression and driving the gene expression.

  7. Radionuclide reporter gene imaging for cardiac gene therapy

    In the field of cardiac gene therapy, angiogenic gene therapy has been most extensively investigated. The first clinical trial of cardiac angiogenic gene therapy was reported in 1998, and at the peak, more than 20 clinical trial protocols were under evaluation. However, most trials have ceased owing to the lack of decisive proof of therapeutic effects and the potential risks of viral vectors. In order to further advance cardiac angiogenic gene therapy, remaining open issues need to be resolved: there needs to be improvement of gene transfer methods, regulation of gene expression, development of much safer vectors and optimisation of therapeutic genes. For these purposes, imaging of gene expression in living organisms is of great importance. In radionuclide reporter gene imaging, ''reporter genes'' transferred into cell nuclei encode for a protein that retains a complementary ''reporter probe'' of a positron or single-photon emitter; thus expression of the reporter genes can be imaged with positron emission tomography or single-photon emission computed tomography. Accordingly, in the setting of gene therapy, the location, magnitude and duration of the therapeutic gene co-expression with the reporter genes can be monitored non-invasively. In the near future, gene therapy may evolve into combination therapy with stem/progenitor cell transplantation, so-called cell-based gene therapy or gene-modified cell therapy. Radionuclide reporter gene imaging is now expected to contribute in providing evidence on the usefulness of this novel therapeutic approach, as well as in investigating the molecular mechanisms underlying neovascularisation and safety issues relevant to further progress in conventional gene therapy. (orig.)

  8. Radionuclide reporter gene imaging for cardiac gene therapy

    Inubushi, Masayuki [Hokkaido University Graduate School of Medicine, Department of Molecular Imaging, Sapporo (Japan); Tamaki, Nagara [Hokkaido University Graduate School of Medicine, Department of Nuclear Medicine, Sapporo (Japan)

    2007-06-15

    In the field of cardiac gene therapy, angiogenic gene therapy has been most extensively investigated. The first clinical trial of cardiac angiogenic gene therapy was reported in 1998, and at the peak, more than 20 clinical trial protocols were under evaluation. However, most trials have ceased owing to the lack of decisive proof of therapeutic effects and the potential risks of viral vectors. In order to further advance cardiac angiogenic gene therapy, remaining open issues need to be resolved: there needs to be improvement of gene transfer methods, regulation of gene expression, development of much safer vectors and optimisation of therapeutic genes. For these purposes, imaging of gene expression in living organisms is of great importance. In radionuclide reporter gene imaging, ''reporter genes'' transferred into cell nuclei encode for a protein that retains a complementary ''reporter probe'' of a positron or single-photon emitter; thus expression of the reporter genes can be imaged with positron emission tomography or single-photon emission computed tomography. Accordingly, in the setting of gene therapy, the location, magnitude and duration of the therapeutic gene co-expression with the reporter genes can be monitored non-invasively. In the near future, gene therapy may evolve into combination therapy with stem/progenitor cell transplantation, so-called cell-based gene therapy or gene-modified cell therapy. Radionuclide reporter gene imaging is now expected to contribute in providing evidence on the usefulness of this novel therapeutic approach, as well as in investigating the molecular mechanisms underlying neovascularisation and safety issues relevant to further progress in conventional gene therapy. (orig.)

  9. Polymorphism in the First Intron of Interferon-Gamma Gene (+874T/A in Patients with BCG Adenitis

    N Parvaneh

    2009-09-01

    Full Text Available "nBackground: Cytokines and specially interferon-gamma (IFN-g are largely responsible for the regulation of the protective im­mune response against mycobacterial infections. Several studies have clarified the importance of common variants of IFN-g gene regarding the susceptibility to tuberculosis. Bacille Calmette-Guérin (BCG vaccine that is used to prevent se­vere forms of tuberculosis could produce local and systemic side effects. In this study we hypothesized that the IFN-g (+874T/A polymorphism was associated with development of BCG adenitis."nMethods: Thirty patients with BCG adenitis (18 males and 12 females and 30 age and sex-matched healthy children, vacci­nated with BCG during the first two days of life were chosen. All the patients and controls were of Iranian Fars origin and the study was conducted from 2005 to 2007. DNA samples were obtained from 30 patients with BCG adenitis and 30 age and sex matched healthy vaccinees. Polymorphism at +874 was identified using allele specific polymerase chain reac­tion. Allele and genotype frequencies in cases and controls were compared using the χ2 test and odds ratios (OR and their 95% confidence intervals (CI were calculated."nResults: The minor allele (T frequency was significantly lower in patients with BCG adenitis compared to controls (35% vs. 55%, P= 0.02, OR= 0.441, 95% CI= 0.211-0.919. The Armitage trend test revealed a gradually increasing protection from the AA genotype through AT to TT (common odds ratio= 0.49; P= 0.037."nConclusion: Our data suggest that in an Iranian population, the IFN-g (+874T/A polymorphism is associated with develop­ment of BCG adenitis in the vaccinees.

  10. Gene therapy: progress and predictions

    Collins, Mary; Thrasher, Adrian

    2015-01-01

    The first clinical gene delivery, which involved insertion of a marker gene into lymphocytes from cancer patients, was published 25 years ago. In this review, we describe progress since then in gene therapy. Patients with some inherited single-gene defects can now be treated with their own bone marrow stem cells that have been engineered with a viral vector carrying the missing gene. Patients with inherited retinopathies and haemophilia B can also be treated by local or systemic injection of ...

  11. Correlating Expression Data with Gene Function Using Gene Ontology

    LIU,Qi; DENG,Yong; WANG,Chuan; SHI,Tie-Liu; LI,Yi-Xue

    2006-01-01

    Clustering is perhaps one of the most widely used tools for microarray data analysis. Proposed roles for genes of unknown function are inferred from clusters of genes similarity expressed across many biological conditions.However, whether function annotation by similarity metrics is reliable or not and to what extent the similarity in gene expression patterns is useful for annotation of gene functions, has not been evaluated. This paper made a comprehensive research on the correlation between the similarity of expression data and of gene functions using Gene Ontology. It has been found that although the similarity in expression patterns and the similarity in gene functions are significantly dependent on each other, this association is rather weak. In addition, among the three categories of Gene Ontology, the similarity of expression data is more useful for cellular component annotation than for biological process and molecular function. The results presented are interesting for the gene functions prediction research area.

  12. The gene tree delusion.

    Springer, Mark S; Gatesy, John

    2016-01-01

    Higher-level relationships among placental mammals are mostly resolved, but several polytomies remain contentious. Song et al. (2012) claimed to have resolved three of these using shortcut coalescence methods (MP-EST, STAR) and further concluded that these methods, which assume no within-locus recombination, are required to unravel deep-level phylogenetic problems that have stymied concatenation. Here, we reanalyze Song et al.'s (2012) data and leverage these re-analyses to explore key issues in systematics including the recombination ratchet, gene tree stoichiometry, the proportion of gene tree incongruence that results from deep coalescence versus other factors, and simulations that compare the performance of coalescence and concatenation methods in species tree estimation. Song et al. (2012) reported an average locus length of 3.1 kb for the 447 protein-coding genes in their phylogenomic dataset, but the true mean length of these loci (start codon to stop codon) is 139.6 kb. Empirical estimates of recombination breakpoints in primates, coupled with consideration of the recombination ratchet, suggest that individual coalescence genes (c-genes) approach ∼12 bp or less for Song et al.'s (2012) dataset, three to four orders of magnitude shorter than the c-genes reported by these authors. This result has general implications for the application of coalescence methods in species tree estimation. We contend that it is illogical to apply coalescence methods to complete protein-coding sequences. Such analyses amalgamate c-genes with different evolutionary histories (i.e., exons separated by >100,000 bp), distort true gene tree stoichiometry that is required for accurate species tree inference, and contradict the central rationale for applying coalescence methods to difficult phylogenetic problems. In addition, Song et al.'s (2012) dataset of 447 genes includes 21 loci with switched taxonomic names, eight duplicated loci, 26 loci with non-homologous sequences that are

  13. Interaction with extracellular matrix proteins influences Lsh/Ity/Bcg (candidate Nramp) gene regulation of macrophage priming/activation for tumour necrosis factor-alpha and nitrite release.

    Formica, S; Roach, T I; Blackwell, J M

    1994-05-01

    The murine resistance gene Lsh/Ity/Bcg regulates activation of macrophages for tumour necrosis factor-alpha (TNF-alpha)-dependent production of nitric oxide mediating antimicrobial activity against Leishmania, Salmonella and Mycobacterium. As Lsh is differentially expressed in macrophages from different tissue sites, experiments were performed to determine whether interaction with extracellular matrix (ECM) proteins would influence the macrophage TNF-alpha response. Plating of bone marrow-derived macrophages onto purified fibrinogen or fibronectin-rich L929 cell-derived matrices, but not onto mannan, was itself sufficient to stimulate TNF-alpha release, with significantly higher levels released from congenic B10.L-Lshr compared to C57BL/10ScSn (Lshs) macrophages. Only macrophages plated onto fibrinogen also released measurable levels of nitrites, again higher in Lshr compared to Lshs macrophages. Addition of interferon-gamma (IFN-gamma), but not bacterial lipopolysaccharide or mycobacterial lipoarabinomannan, as a second signal enhanced the TNF-alpha and nitrite responses of macrophages plated onto fibrinogen, particularly in the Lshr macrophages. Interaction with fibrinogen and fibronectin also primed macrophages for an enhanced TNF-alpha response to leishmanial parasites, but this was only translated into enhanced nitrite responses in the presence of IFN-gamma. In these experiments, Lshr macrophages remained superior in their TNF-alpha responses throughout, but to a degree which reflected the magnitude of the difference observed on ECM alone. Hence, the specificity for the enhanced TNF-alpha responses of Lshr macrophages lay in their interaction with fibrinogen and fibronectin ECM, while a differential nitrite response was only observed with fibrinogen and/or IFN-gamma. The results are discussed in relation to the possible function of the recently cloned candidate gene Nramp, which has structural identity to eukaryote transporters and an N-terminal cytoplasmic

  14. Vertebrate gene predictions and the problem of large genes

    Wang, Jun; Li, ShengTing; Zhang, Yong;

    2003-01-01

    To find unknown protein-coding genes, annotation pipelines use a combination of ab initio gene prediction and similarity to experimentally confirmed genes or proteins. Here, we show that although the ab initio predictions have an intrinsically high false-positive rate, they also have a consistently...... low false-negative rate. The incorporation of similarity information is meant to reduce the false-positive rate, but in doing so it increases the false-negative rate. The crucial variable is gene size (including introns)--genes of the most extreme sizes, especially very large genes, are most likely to...

  15. Suicide genes or p53 gene and p53 target genes as targets for cancer gene therapy by ionizing radiation

    Radiotherapy has some disadvantages due to the severe side-effect on the normal tissues at a curative dose of ionizing radiation (IR). Similarly, as a new developing approach, gene therapy also has some disadvantages, such as lack of specificity for tumors, limited expression of therapeutic gene, potential biological risk. To certain extent, above problems would be solved by the suicide genes or p53 gene and its target genes therapies targeted by ionizing radiation. This strategy not only makes up the disadvantage from radiotherapy or gene therapy alone, but also promotes success rate on the base of lower dose. By present, there have been several vectors measuring up to be reaching clinical trials. This review focused on the development of the cancer gene therapy through suicide genes or p53 and its target genes mediated by IR. (authors)

  16. Association Between a Prognostic Gene Signature and Functional Gene Sets

    Hummel, Manuela; Metzeler, Klaus H.; Buske, Christian; Bohlander, Stefan K.; Mansmann, Ulrich

    2008-01-01

    Background The development of expression-based gene signatures for predicting prognosis or class membership is a popular and challenging task. Besides their stringent validation, signatures need a functional interpretation and must be placed in a biological context. Popular tools such as Gene Set Enrichment have drawbacks because they are restricted to annotated genes and are unable to capture the information hidden in the signature’s non-annotated genes. Methodology We propose concepts to relate a signature with functional gene sets like pathways or Gene Ontology categories. The connection between single signature genes and a specific pathway is explored by hierarchical variable selection and gene association networks. The risk score derived from an individual patient’s signature is related to expression patterns of pathways and Gene Ontology categories. Global tests are useful for these tasks, and they adjust for other factors. GlobalAncova is used to explore the effect on gene expression in specific functional groups from the interaction of the score and selected mutations in the patient’s genome. Results We apply the proposed methods to an expression data set and a corresponding gene signature for predicting survival in Acute Myeloid Leukemia (AML). The example demonstrates strong relations between the signature and cancer-related pathways. The signature-based risk score was found to be associated with development-related biological processes. Conclusions Many authors interpret the functional aspects of a gene signature by linking signature genes to pathways or relevant functional gene groups. The method of gene set enrichment is preferred to annotating signature genes to specific Gene Ontology categories. The strategies proposed in this paper go beyond the restriction of annotation and deepen the insights into the biological mechanisms reflected in the information given by a signature. PMID:19812786

  17. Old genes experience stronger translational selection than young genes.

    Yin, Hongyan; Ma, Lina; Wang, Guangyu; Li, Mengwei; Zhang, Zhang

    2016-09-15

    Selection on synonymous codon usage for translation efficiency and/or accuracy has been identified as a widespread mechanism in many living organisms. However, it remains unknown whether translational selection associates closely with gene age and acts differentially on genes with different evolutionary ages. To address this issue, here we investigate the strength of translational selection acting on different aged genes in human. Our results show that old genes present stronger translational selection than young genes, demonstrating that translational selection correlates positively with gene age. We further explore the difference of translational selection in duplicates vs. singletons and in housekeeping vs. tissue-specific genes. We find that translational selection acts comparably in old singletons and old duplicates and stronger translational selection in old genes is contributed primarily by housekeeping genes. For young genes, contrastingly, singletons experience stronger translational selection than duplicates, presumably due to redundant function of duplicated genes during their early evolutionary stage. Taken together, our results indicate that translational selection acting on a gene would not be constant during all stages of evolution, associating closely with gene age. PMID:27259662

  18. Inferring horizontal gene transfer.

    Matt Ravenhall

    2015-05-01

    Full Text Available Horizontal or Lateral Gene Transfer (HGT or LGT is the transmission of portions of genomic DNA between organisms through a process decoupled from vertical inheritance. In the presence of HGT events, different fragments of the genome are the result of different evolutionary histories. This can therefore complicate the investigations of evolutionary relatedness of lineages and species. Also, as HGT can bring into genomes radically different genotypes from distant lineages, or even new genes bearing new functions, it is a major source of phenotypic innovation and a mechanism of niche adaptation. For example, of particular relevance to human health is the lateral transfer of antibiotic resistance and pathogenicity determinants, leading to the emergence of pathogenic lineages. Computational identification of HGT events relies upon the investigation of sequence composition or evolutionary history of genes. Sequence composition-based ("parametric" methods search for deviations from the genomic average, whereas evolutionary history-based ("phylogenetic" approaches identify genes whose evolutionary history significantly differs from that of the host species. The evaluation and benchmarking of HGT inference methods typically rely upon simulated genomes, for which the true history is known. On real data, different methods tend to infer different HGT events, and as a result it can be difficult to ascertain all but simple and clear-cut HGT events.

  19. GENES BEHIND SMOKE ACTION

    Vilmos Soós

    2008-09-01

    Full Text Available Smoke can break dormancy and promote seed germination of many plant species. We investigated changes in the gene expression changes after imbibition of light-sensitive Lactuca sativa L. cv. Grand Rapids achenes with dilute smoke water compared to water control samples kept in dark or continuous light. Although no difference was detected in the smoke water vs. water control samples germinated in light, smoke water treatment resulted in the differential display of several expressed sequence tags (ESTs when compared to water control samples kept in dark. The most pronounced fragments isolated correspond to known genes with functions related to cell wall expansion, abscisic acid regulation, regulation of translation, the cell division cycle, carbohydrate metabolism and desiccation tolerance. These data clearly indicate that the smoke water, which stimulates germination of light-sensitive Grand Rapids lettuce seeds in the dark, rapidly affects genes that are essential for cell division, cell wall expansion and mobilization and utilization of nutrients for the resumption of embryo growth. Although the master genes remained unknown, our hope is that the using of maize microarray will reveal the whole molecular background of smoke action.

  20. Ultrasound mediated gene transfection

    Williamson, Rene G.; Apfel, Robert E.; Brandsma, Janet L.

    2002-05-01

    Gene therapy is a promising modality for the treatment of a variety of human diseases both inherited and acquired, such as cystic fibrosis and cancer. The lack of an effective, safe method for the delivery of foreign genes into the cells, a process known as transfection, limits this effort. Ultrasound mediated gene transfection is an attractive method for gene delivery since it is a noninvasive technique, does not introduce any viral particles into the host and can offer very good temporal and spatial control. Previous investigators have shown that sonication increases transfection efficiency with and without ultrasound contrast agents. The mechanism is believed to be via a cavitation process where collapsing bubble nuclei permeabilize the cell membrane leading to increased DNA transfer. The research is focused on the use of pulsed wave high frequency focused ultrasound to transfect DNA into mammalian cells in vitro and in vivo. A better understanding of the mechanism behind the transfection process is also sought. A summary of some in vitro results to date will be presented, which includes the design of a sonication chamber that allows us to model the in vivo case more accurately.

  1. Searching for speciation genes

    Holt, Benjamin George; Côté, Isabelle M; Emerson, Brent C

    2011-01-01

    Closely related species that show clear phenotypic divergence, but without obvious geographic barriers, can provide opportunities to study how diversification can occur when opportunities for allopatric speciation are limited. We examined genetic divergence in the coral reef fish genus Hypoplectr...... evidence for genes that may be associated with colour morphotype in the genus Hypoplectrus....

  2. Genes contributing to prion pathogenesis

    Tamgüney, Gültekin; Giles, Kurt; Glidden, David V;

    2008-01-01

    incubation times, indicating that the conversion reaction may be influenced by other gene products. To identify genes that contribute to prion pathogenesis, we analysed incubation times of prions in mice in which the gene product was inactivated, knocked out or overexpressed. We tested 20 candidate genes...... show that many genes previously implicated in prion replication have no discernible effect on the pathogenesis of prion disease. While most genes tested did not significantly affect survival times, ablation of the amyloid beta (A4) precursor protein (App) or interleukin-1 receptor, type I (Il1r1), and...

  3. Entrez Gene: gene-centered information at NCBI.

    Maglott, Donna; Ostell, Jim; Pruitt, Kim D; Tatusova, Tatiana

    2007-01-01

    Entrez Gene (www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=gene) is NCBI's database for gene-specific information. Entrez Gene includes records from genomes that have been completely sequenced, that have an active research community to contribute gene-specific information or that are scheduled for intense sequence analysis. The content of Entrez Gene represents the result of both curation and automated integration of data from NCBI's Reference Sequence project (RefSeq), from collaborating model organism databases and from other databases within NCBI. Records in Entrez Gene are assigned unique, stable and tracked integers as identifiers. The content (nomenclature, map location, gene products and their attributes, markers, phenotypes and links to citations, sequences, variation details, maps, expression, homologs, protein domains and external databases) is provided via interactive browsing through NCBI's Entrez system, via NCBI's Entrez programing utilities (E-Utilities), and for bulk transfer by ftp. PMID:17148475

  4. Tumor-specific gene expression patterns with gene expression profiles

    RUAN; Xiaogang; LI; Yingxin; LI; Jiangeng; GONG; Daoxiong

    2006-01-01

    Gene expression profiles of 14 common tumors and their counterpart normal tissues were analyzed with machine learning methods to address the problem of selection of tumor-specific genes and analysis of their differential expressions in tumor tissues. First, a variation of the Relief algorithm, "RFE_Relief algorithm" was proposed to learn the relations between genes and tissue types. Then, a support vector machine was employed to find the gene subset with the best classification performance for distinguishing cancerous tissues and their counterparts. After tissue-specific genes were removed, cross validation experiments were employed to demonstrate the common deregulated expressions of the selected gene in tumor tissues. The results indicate the existence of a specific expression fingerprint of these genes that is shared in different tumor tissues, and the hallmarks of the expression patterns of these genes in cancerous tissues are summarized at the end of this paper.

  5. Novel targeting of PEGylated liposomes for codelivery of TGF-β1 siRNA and four antitubercular drugs to human macrophages for the treatment of mycobacterial infection: a quantitative proteomic study

    Niu NK

    2015-08-01

    Full Text Available Ning-Kui Niu,1–3 Juan-Juan Yin,3 Yin-Xue Yang,4 Zi-Li Wang,1 Zhi-Wei Zhou,3 Zhi-Xu He,5 Xiao-Wu Chen,6 Xueji Zhang,7 Wei Duan,8 Tianxin Yang,9 Shu-Feng Zhou3 1Department of Orthopedics, General Hospital of Tianjin Medical University, Tianjin, 2Department of Spinal Surgery, General Hospital of Ningxia Medical University, Yinchuan, Ningxia, People’s Republic of China; 3Department of Pharmaceutical Sciences, College of Pharmacy, University of South Florida, Tampa, FL, USA; 4Department of Colorectal Surgery, General Hospital of Ningxia Medical University, Yinchuan, Ningxia, 5Guizhou Provincial Key Laboratory for Regenerative Medicine, Stem Cell and Tissue Engineering Research Center and Sino-US Joint Laboratory for Medical Sciences, Guizhou Medical University, Guiyang, Guizhou, 6Department of General Surgery, The First People’s Hospital of Shunde Affiliated to Southern Medical University, Shunde, Foshan, Guangdong, 7Research Center for Bioengineering and Sensing Technology, University of Science and Technology Beijing, Beijing, People’s Republic of China; 8School of Medicine, Deakin University, Waurn Ponds, VIC, Australia; 9Department of Internal Medicine, University of Utah and Salt Lake Veterans Affairs Medical Center, Salt Lake City, UT, USA Abstract: Tuberculosis (TB is still a major public health issue in developing countries, and its chemotherapy is compromised by poor drug compliance and severe side effects. This study aimed to synthesize and characterize new multimodal PEGylated liposomes encapsulated with clinically commonly used anti-TB drugs with linkage to small interfering RNA (siRNA against transforming growth factor-β1 (TGF-β1. The novel NP-siRNA liposomes could target THP-1-derived human macrophages that were the host cells of mycobacterium infection. The biological effects of the NP-siRNA liposomes were evaluated on cell cycle distribution, apoptosis, autophagy, and the gene silencing efficiency of TGF-β1 siRNA in human

  6. Dominance from the perspective of gene-gene and gene-chemical interactions.

    Gladki, Arkadiusz; Zielenkiewicz, Piotr; Kaczanowski, Szymon

    2016-02-01

    In this study, we used genetic interaction (GI) and gene-chemical interaction (GCI) data to compare mutations with different dominance phenotypes. Our analysis focused primarily on Saccharomyces cerevisiae, where haploinsufficient genes (HI; genes with dominant loss-of-function mutations) were found to be participating in gene expression processes, namely, the translation and regulation of gene transcription. Non-ribosomal HI genes (mainly regulators of gene transcription) were found to have more GIs and GCIs than haplosufficient (HS) genes. Several properties seem to lead to the enrichment of interactions, most notably, the following: importance, pleiotropy, gene expression level and gene expression variation. Importantly, after these properties were appropriately considered in the analysis, the correlation between dominance and GI/GCI degrees was still observed. Strikingly, for the GCIs of heterozygous strains, haploinsufficiency was the only property significantly correlated with the number of GCIs. We found ribosomal HI genes to be depleted in GIs/GCIs. This finding can be explained by their high variation in gene expression under different genetic backgrounds and environmental conditions. We observed the same distributions of GIs among non-ribosomal HI, ribosomal HI and HS genes in three other species: Schizosaccharomyces pombe, Drosophila melanogaster and Homo sapiens. One potentially interesting exception was the lack of significant differences in the degree of GIs between non-ribosomal HI and HS genes in Schizosaccharomyces pombe. PMID:26613610

  7. Gene doping in modern sport.

    MAREK SAWCZUK

    2009-01-01

    Full Text Available Background: The subject of this paper is gene doping, which should be understood as "he non-therapeutic use of cells, genes, genetic elements, or of the modulation of gene expression, having the capacity to improve athletic performance". The authors of this work, based on the review of literature and previous research, make an attempt at wider characterization of gene doping and the discussion of related potential threats.Methods: This is a comprehensive survey of literature on the latest applications of molecular biology in medicine. The analysis involves a dozen scientific databases examined in order to find genes used in gene therapy and potentially useful in gene doping. Results: The obtained results enable better recognition of gene doping and indicate genes used in medicine that could be used in gene doping. This paper describes potential effects of their use and associated risk, and predicts the possible developments of gene doping in the future. Conclusion: Gene doping is undoubtedly a part of modern sport. Although WADA included gene doping on the list of banned methods as early as 2004, as previously stated above, it has not managed to develop efficient methods of detection.

  8. Eukaryotic gene prediction using GeneMark.hmm-E and GeneMark-ES.

    Borodovsky, Mark; Lomsadze, Alex

    2011-09-01

    This unit describes how to use the gene-finding programs GeneMark.hmm-E and GeneMark-ES for finding protein-coding genes in the genomic DNA of eukaryotic organisms. These bioinformatics tools have been demonstrated to have state-of-the-art accuracy for many fungal, plant, and animal genomes, and have frequently been used for gene annotation in novel genomic sequences. An additional advantage of GeneMark-ES is that the problem of algorithm parameterization is solved automatically, with parameters estimated by iterative self-training (unsupervised training). PMID:21901742

  9. Genes, stress, and depression.

    Wurtman, Richard J

    2005-05-01

    A relationship between genetic makeup and susceptibility to major depressive disorder (MDD) has long been suspected on the basis of family and twin studies. A metaanalysis of reports on the basis of twin studies has estimated MDD's degree of heritability to be 0.33 (confidence interval, 0.26-0.39). Among families exhibiting an increased prevalence of MDD, risk of developing the illness was enhanced in members exposed to a highly stressful environment. Aberrant genes can predispose to depression in a number of ways, for example, by diminishing production of growth factors that act during brain development. An aberrant gene could also increase or decrease a neurotransmitter's release into synapses, its actions, or its duration of activity. The gene products of greatest interest at present are those involved in the synthesis and actions of serotonin; among them, the serotonin-uptake protein localized within the terminals and dendrites of serotonin-releasing neurons. It has been found that the Vmax of platelet serotonin uptake is low in some patients with MDD; also, Vmax is highly correlated in twins. Antidepressant drugs such as the selective serotonin reuptake inhibitors act on this uptake protein. The specific genetic locus causing serotonin uptake to be lower in some patients with major depression involves a polymorphic region (5-HTTLPR) in the promoter region of the gene for the uptake protein. The gene itself exists as several alleles, the short "S" allele and the long "L" allele. The S variant is associated with less, and the L variant with more, of the uptake protein. The effect of stressful life events on depressive symptoms in young adults was found to be significantly stronger among SS or SL subjects than among LL subjects. Neuroimaging studies showed that people with the SS or SL alleles exhibited a greater activation of the amygdala in response to fearful stimuli than those with LL. It has been reported recently that mutations in the gene that controls

  10. On atavisms and atavistic genes.

    Cantú, J M; Ruiz, C

    1985-01-01

    The authors propose the term atavistic to designate a gene producing an ancestral phenotype (atavism). Several examples are presented, and the possible origin of atavistic genes, as well as their pathological implications discussed. PMID:3879145

  11. Gene Testing for Hereditary Ataxia

    FAQ NATIONAL ATAXIA FOUNDATION FREQUENTLY ASKED QUESTIONS ABOUT... Gene Testing for Hereditary Ataxia This fact sheet provides an overview of gene testing for ataxia. It also addresses commonly asked ...

  12. Genes and human brain evolution

    Geschwind, Daniel H.; Konopka, Genevieve

    2012-01-01

    Several genes were duplicated during human evolution. It seems that one such duplication gave rise to a gene that may have helped to make human brains bigger and more adaptable than those of our ancestors.

  13. Genes That Influence Blood Pressure

    ... Research Matters NIH Research Matters September 26, 2011 Genes that Influence Blood Pressure In one of the ... 16 previously unknown variations. Six were found in genes already suspected of regulating blood pressure. The remaining ...

  14. Gene therapy of liver cancer

    Hernandez-Alcoceba, R. (Rubén); B. Sangro; Prieto, J.

    2006-01-01

    The application of gene transfer technologies to the treatment of cancer has led to the development of new experimental approaches like gene directed enzyme/pro-drug therapy (GDEPT), inhibition of oncogenes and restoration of tumor-suppressor genes. In addition, gene therapy has a big impact on other fields like cancer immunotherapy, anti-angiogenic therapy and virotherapy. These strategies are being evaluated for the treatment of primary and metastatic liver cancer and some of them have reac...

  15. Gene doping in modern sport.

    MAREK SAWCZUK; AGNIESZKA MACIEJEWSKA; PAWEL CIESZCZYK,

    2009-01-01

    Background: The subject of this paper is gene doping, which should be understood as "he non-therapeutic use of cells, genes, genetic elements, or of the modulation of gene expression, having the capacity to improve athletic performance". The authors of this work, based on the review of literature and previous research, make an attempt at wider characterization of gene doping and the discussion of related potential threats.Methods: This is a comprehensive survey of literature on the latest app...

  16. Human housekeeping genes are compact

    Eisenberg, Eli; Erez Y. Levanon

    2003-01-01

    We identify a set of 575 human genes that are expressed in all conditions tested in a publicly available database of microarray results. Based on this common occurrence, the set is expected to be rich in "housekeeping" genes, showing constitutive expression in all tissues. We compare selected aspects of their genomic structure with a set of background genes. We find that the introns, untranslated regions and coding sequences of the housekeeping genes are shorter, indicating a selection for co...

  17. Gene therapy in gastric cancer

    Xu Chang-tai; Guo Xue-gang; Pan Bo-rong

    2003-01-01

    @@ 1 Introduction We have reviewed the gene therapy in gastrointestinal diseases[1]. Gastric cancer is common in China[2~20] ,and its early diagnosis andtreatment are still difficult up to now[13~36]. The expression of anexogenous gene introduced by gene therapy into patients with gliomascan be monitored non- invasively by positron- emission tomography[4]. In recent years, gene study in cancer is a hotspot, and great progress hasbeen achieved[33~41].

  18. Genes y especies

    A. G. Sáez

    2009-01-01

    Full Text Available La posibilidad de secuenciar y manipular los genes sigue abriendo fronteras en el estudio de las especies y la especiación. En tiempos recientes particularmente en dos direcciones. Por un lado, la secuenciación del gen COI (y otros en miles de muestras de forma sistemática y masiva, el llamado "DNA barcoding", está revelando una gran cantidad de biodiversidad, en buena medida previamente no sospechada y correspondiente a especies crípticas (morfológicamente irreconocibles. En segundo lugar, el estudio de los genes responsables de los cambios morfológicos nos está haciendo volver a dar una creciente importancia a la selección como motor de la especiación y de la evolución, incluso en presencia de dosis importantes de flujo génico.

  19. Gene and Aging

    DD Farhud

    2008-09-01

    Full Text Available "nCollection of multiple processes that increase the chronological age of an organism leading to death is defined as aging, and even though important, it is poorly understood. Recent research has shown that aging is due to biochemical and genetic changes, in interaction with environmental effects, including diet and nutrition. Most knowledge on aging is based on ge­netic model system, but its molecular mechanisms are still not very clear. Discoveries in molecular biology have made way to look for candidate genes influencing lifespan. Furthermore, new investigations have stressed on the roles of mitochondria as the major generators and direct targets of reactive oxygen species. This paper reviews some recent literature on genes and ag­ing in model system, then discusses the role of mitochondria and nutrients in human aging.

  20. Nocardia altamirensis sp. nov., isolated from Altamira cave, Cantabria, Spain.

    Jurado, Valme; Boiron, Patrick; Kroppenstedt, Reiner M; Laurent, Frédéric; Couble, Andrée; Laiz, Leonila; Klenk, Hans-Peter; González, Juan M; Saiz-Jimenez, Cesareo; Mouniée, Delphine; Bergeron, Emanuelle; Rodríguez-Nava, Verónica

    2008-09-01

    A novel actinomycete strain, OFN S17(T), was isolated from a sample collected from Altamira Cave, Cantabria, Spain. This strain was identified by using a polyphasic taxonomic approach. The 16S rRNA, hsp65 and sod gene sequences of the strain were determined and compared with those of representative Nocardia species. The results showed that strain OFN S17(T) should be assigned to the genus Nocardia. Phylogenetic analysis indicated that strain OFN S17(T) was most closely related to the type strain of Nocardia tenerifensis (98.6, 96.2 and 96% similarity, respectively, for the 16S rRNA, hsp65 and sod gene sequences). The DNA G+C content was 64.4 mol%. DNA-DNA hybridization analyses revealed 29% relative reassociation between the DNA of strain OFN S17(T) and N. tenerifensis DSM 44704(T). The phenotypic and genotypic data show that strain OFN S17(T) merits recognition as a representative of a novel species of the genus Nocardia, for which the name Nocardia altamirensis sp. nov. is proposed. The type strain is OFN S17(T) (=CIP 109606(T) =DSM 44997(T)). PMID:18768631

  1. Nontuberculous mycobacteria in respiratory samples from patients with pulmonary tuberculosis in the state of Rondonia, Brazil

    Cleoni Alves Mendes de Lima

    2013-06-01

    Full Text Available The main cause of pulmonary tuberculosis (TB is infection with Mycobacterium tuberculosis (MTB. We aimed to evaluate the contribution of nontuberculous mycobacteria (NTM to pulmonary disease in patients from the state of Rondônia using respiratory samples and epidemiological data from TB cases. Mycobacterium isolates were identified using a combination of conventional tests, polymerase chain reaction-based restriction enzyme analysis of hsp65 gene and hsp65 gene sequencing. Among the 1,812 cases suspected of having pulmonary TB, 444 yielded bacterial cultures, including 369 cases positive for MTB and 75 cases positive for NTM. Within the latter group, 14 species were identified as Mycobacterium abscessus, Mycobacterium avium, Mycobacterium fortuitum, Mycobacterium intracellulare, Mycobacterium gilvum, Mycobacterium gordonae, Mycobacterium asiaticum, Mycobacterium tusciae, Mycobacterium porcinum, Mycobacterium novocastrense, Mycobacterium simiae, Mycobacterium szulgai, Mycobacterium phlei and Mycobacterium holsaticum and 13 isolates could not be identified at the species level. The majority of NTM cases were observed in Porto Velho and the relative frequency of NTM compared with MTB was highest in Ji-Paraná. In approximately half of the TB subjects with NTM, a second sample containing NTM was obtained, confirming this as the disease-causing agent. The most frequently observed NTM species were M. abscessus and M. avium and because the former species is resistant to many antibiotics and displays unsatisfactory cure rates, the implementation of rapid identification of mycobacterium species is of considerable importance.

  2. Gene therapy of cancer and development of therapeutic target gene

    We applied HSV-tk/GCV strategy to orthotopic rat hepatoma model and showed anticancer effects of hepatoma. The increased expression of Lac Z gene after adenovirus-mediated gene delivery throughout hepatic artery was thought that is increased the possibility of gene therapy for curing hepatoma. With the construction of kGLP-laboratory, it is possible to produce a good quantity and quality of adenovirus in lage-scale production and purification of adenovirus vector. Also, the analysis of hepatoma related genes by PCR-LOH could be used for the diagnosis of patients and the development of therapeutic gene

  3. Gene therapy of cancer and development of therapeutic target gene

    Kim, Chang Min; Kwon, Hee Chung

    1998-04-01

    We applied HSV-tk/GCV strategy to orthotopic rat hepatoma model and showed anticancer effects of hepatoma. The increased expression of Lac Z gene after adenovirus-mediated gene delivery throughout hepatic artery was thought that is increased the possibility of gene therapy for curing hepatoma. With the construction of kGLP-laboratory, it is possible to produce a good quantity and quality of adenovirus in lage-scale production and purification of adenovirus vector. Also, the analysis of hepatoma related genes by PCR-LOH could be used for the diagnosis of patients and the development of therapeutic gene.

  4. The Perils of Gene Patents

    Salzberg, SL

    2012-01-01

    I argue here that gene patents, and patented genetic tests based on them, are a very bad idea. First, I discuss whether genes can reasonably be the subject of patents in the first place; I maintain that the answer is no. Second, I explain how gene patents interfere with scientific progress, slowing down the development of new cures and treatments for genetic diseases.

  5. Globin genes on the move

    Hardison, Ross C.

    2008-01-01

    Recent data published in BMC Biology from the globin gene clusters in platypus, together with data from other species, show that β-globin genes transposed from one chromosomal location to another. This resolves some controversies about vertebrate globin gene evolution but ignites new ones.

  6. Independent Gene Discovery and Testing

    Palsule, Vrushalee; Coric, Dijana; Delancy, Russell; Dunham, Heather; Melancon, Caleb; Thompson, Dennis; Toms, Jamie; White, Ashley; Shultz, Jeffry

    2010-01-01

    A clear understanding of basic gene structure is critical when teaching molecular genetics, the central dogma and the biological sciences. We sought to create a gene-based teaching project to improve students' understanding of gene structure and to integrate this into a research project that can be implemented by instructors at the secondary level…

  7. Ascidian gene-expression profiles

    William R Jeffery

    2002-01-01

    With the advent of gene-expression profiling, a large number of genes can now be investigated simultaneously during critical stages of development. This approach will be particularly informative in studies of ascidians, basal chordates whose genomes and embryology are uniquely suited for mapping developmental gene networks.

  8. Gene therapy for thyroid cancer

    Gene therapy for thyroid cancer include immunotherapy, suicide gene therapy, tumor suppressor replacement, 131I therapy by sodium/iodide symporter and antisense therapy and so on. Gene therapy has wide perspectives, but there are many problems need to be solved for clinical application

  9. Compositional gradients in Gramineae genes

    Wong, Gane Ka-Shu; Wang, Jun; Tao, Lin;

    2002-01-01

    In this study, we describe a property of Gramineae genes, and perhaps all monocot genes, that is not observed in eudicot genes. Along the direction of transcription, beginning at the junction of the 5'-UTR and the coding region, there are gradients in GC content, codon usage, and amino-acid usage...

  10. Gene therapy for mucopolysaccharidosis

    Ponder, Katherine P.; Haskins, Mark E.

    2007-01-01

    Mucopolysaccharidoses (MPS) are due to deficiencies in activities of lysosomal enzymes that degrade glycosaminoglycans. Some attempts at gene therapy for MPS in animal models have involved intravenous injection of vectors derived from an adeno-associated virus (AAV), adenovirus, retrovirus or a plasmid, which primarily results in expression in liver and secretion of the relevant enzyme into blood. Most vectors can correct disease in liver and spleen, although correction in other organs includ...

  11. Gene Porter Bridwell

    1994-01-01

    Gene Porter Bridwell served as the director of the Marshall Space Flight Center from January 6, 1994 until February 3, 1996, when he retired from NASA after thirty-four years service. Bridwell, a Marshall employee since 1962, had been Marshall's Space Shuttle Projects Office Director and Space Station Redesign Team deputy manager. Under Bridwell, Marshall worked to develop its role as a Center of Excellence for propulsion and for providing access to space.

  12. Engineering prokaryotic gene circuits

    Michalodimitrakis, Konstantinos; Isalan, Mark

    2009-01-01

    Engineering of synthetic gene circuits is a rapidly growing discipline, currently dominated by prokaryotic transcription networks, which can be easily rearranged or rewired to give different output behaviours. In this review, we examine both a rational and a combinatorial design of such networks and discuss progress on using in vitro evolution techniques to obtain functional systems. Moving beyond pure transcription networks, more and more networks are being implemented at the level of RNA, t...

  13. Hidden genes in birds

    Hron, Tomáš; Pajer, Petr; Pačes, Jan; Bartůněk, Petr; Elleder, Daniel

    2015-01-01

    Roč. 16, August 18 (2015). ISSN 1465-6906 R&D Projects: GA MŠk(CZ) LK11215; GA MŠk LO1419 Grant ostatní: GA MŠk(CZ) LM2010005 Institutional support: RVO:68378050 Keywords : REPETITIVE SEQUENCES * G/C stretches * avian genes Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 10.810, year: 2014

  14. The ank gene story

    Ryan, Lawrence M

    2000-01-01

    The underlying molecular defect resulting in the abnormal calcification observed in ank/ank mice has been identified. The responsible nonsense mutation affects the protein product of ank, resulting in diminished production of extracellular inorganic pyrophosphate, an important inhibitor of nucleation and of the growth of apatite crystals. The ank gene product is one of several cell membrane proteins, including ectonucleoside triphosphate pyrophosphohydrolase enzymes and alkaline phosphatase, ...

  15. nanosheets for gene therapy

    Kou, Zhongyang; Wang, Xin; Yuan, Renshun; Chen, Huabin; Zhi, Qiaoming; Gao, Ling; Wang, Bin; Guo, Zhaoji; Xue, Xiaofeng; Cao, Wei; Guo, Liang

    2014-10-01

    A new class of two-dimensional (2D) nanomaterial, transition metal dichalcogenides (TMDCs) such as MoS2, MoSe2, WS2, and WSe2 which have fantastic physical and chemical properties, has drawn tremendous attention in different fields recently. Herein, we for the first time take advantage of the great potential of MoS2 with well-engineered surface as a novel type of 2D nanocarriers for gene delivery and therapy of cancer. In our system, positively charged MoS2-PEG-PEI is synthesized with lipoic acid-modified polyethylene glycol (LA-PEG) and branched polyethylenimine (PEI). The amino end of positively charged nanomaterials can bind to the negatively charged small interfering RNA (siRNA). After detection of physical and chemical characteristics of the nanomaterial, cell toxicity was evaluated by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. Polo-like kinase 1 (PLK1) was investigated as a well-known oncogene, which was a critical regulator of cell cycle transmission at multiple levels. Through knockdown of PLK1 with siRNA carried by novel nanovector, qPCR and Western blot were used to measure the interfering efficiency; apoptosis assay was used to detect the transfection effect of PLK1. All results showed that the novel nanocarrier revealed good biocompatibility, reduced cytotoxicity, as well as high gene-carrying ability without serum interference, thus would have great potential for gene delivery and therapy.

  16. Extracting gene-gene interactions through curve fitting.

    Das, Ranajit; Mitra, Sushmita; Murthy, C A

    2012-12-01

    This paper presents a simple and novel curve fitting approach for generating simple gene regulatory subnetworks from time series gene expression data. Microarray experiments simultaneously generate massive data sets and help immensely in the large-scale study of gene expression patterns. Initial biclustering reduces the search space in the high-dimensional microarray data. The least-squares error between fitting of gene pairs is minimized to extract a set of gene-gene interactions, involving transcriptional regulation of genes. The higher error values are eliminated to retain only the strong interacting gene pairs in the resultant gene regulatory subnetwork. Next the algorithm is extended to a generalized framework to enhance its capability. The methodology takes care of the higher-order dependencies involving multiple genes co-regulating a single gene, while eliminating the need for user-defined parameters. It has been applied to the time-series Yeast data, and the experimental results biologically validated using standard databases and literature. PMID:22997274

  17. Identification of Significant Association and Gene-Gene Interaction of GABA Receptor Subunit Genes in Autism

    Ma, D Q; Whitehead, P. L.; Menold, M M; Martin, E. R.; Ashley-Koch, A. E.; Mei, H; Ritchie, M. D.; Delong, G R; Abramson, R.K.; Wright, H. H.; Cuccaro, M. L.; Hussman, J. P.; Gilbert, J.R.; Pericak-Vance, M A

    2005-01-01

    Autism is a common neurodevelopmental disorder with a significant genetic component. Existing research suggests that multiple genes contribute to autism and that epigenetic effects or gene-gene interactions are likely contributors to autism risk. However, these effects have not yet been identified. Gamma-aminobutyric acid (GABA), the primary inhibitory neurotransmitter in the adult brain, has been implicated in autism etiology. Fourteen known autosomal GABA receptor subunit genes were studied...

  18. Gene Network Biological Validity Based on Gene-Gene Interaction Relevance

    Francisco Gómez-Vela; Norberto Díaz-Díaz

    2014-01-01

    In recent years, gene networks have become one of the most useful tools for modeling biological processes. Many inference gene network algorithms have been developed as techniques for extracting knowledge from gene expression data. Ensuring the reliability of the inferred gene relationships is a crucial task in any study in order to prove that the algorithms used are precise. Usually, this validation process can be carried out using prior biological knowledge. The metabolic pathways stored in...

  19. Gene electrotransfer in clinical trials

    Gehl, Julie

    2014-01-01

    Electroporation is increasingly being used for delivery of chemotherapy to tumors. Likewise, gene delivery by electroporation is rapidly gaining momentum for both vaccination purposes and for delivery of genes coding for other therapeutic molecules, such as chronic diseases or cancer. This chapte...... describes how gene therapy may be performed using electric pulses to enhance uptake and expression.......Electroporation is increasingly being used for delivery of chemotherapy to tumors. Likewise, gene delivery by electroporation is rapidly gaining momentum for both vaccination purposes and for delivery of genes coding for other therapeutic molecules, such as chronic diseases or cancer. This chapter...

  20. Gene therapy of liver cancer

    Ruben Hernandez-Alcoceba; Bruno Sangro; Jesus Prieto

    2006-01-01

    The application of gene transfer technologies to the treatment of cancer has led to the development of new experimental approaches like gene directed enzyme/prodrug therapy (GDEPT), inhibition of oncogenes and restoration of tumor-suppressor genes. In addition,gene therapy has a big impact on other fields like cancer immunotherapy, anti-angiogenic therapy and virotherapy.These strategies are being evaluated for the treatment of primary and metastatic liver cancer and some of them have reached clinical phases. We present a review on the basis and the actual status of gene therapy approaches applied to liver cancer.

  1. Gene finding in novel genomes

    Korf Ian

    2004-05-01

    Full Text Available Abstract Background Computational gene prediction continues to be an important problem, especially for genomes with little experimental data. Results I introduce the SNAP gene finder which has been designed to be easily adaptable to a variety of genomes. In novel genomes without an appropriate gene finder, I demonstrate that employing a foreign gene finder can produce highly inaccurate results, and that the most compatible parameters may not come from the nearest phylogenetic neighbor. I find that foreign gene finders are more usefully employed to bootstrap parameter estimation and that the resulting parameters can be highly accurate. Conclusion Since gene prediction is sensitive to species-specific parameters, every genome needs a dedicated gene finder.

  2. American Society of Gene & Cell Therapy

    ... Resources Clinical Trials Information Gene Therapy and Cell Therapy Terminology Gene Therapy & Cell Therapy Breakthroughs FAQs Gene Therapy and Cell Therapy Defined Gene Therapy and Cell Therapy for Diseases Sites of ...

  3. Gene Therapy and Children (For Parents)

    ... Story" 5 Things to Know About Zika & Pregnancy Gene Therapy and Children KidsHealth > For Parents > Gene Therapy ... that don't respond to conventional therapies. About Genes Our genes help make us unique. Inherited from ...

  4. Genes and Disease: Prader-Willi Syndrome

    ... MD): National Center for Biotechnology Information (US); 1998-. Genes and Disease [Internet]. Show details National Center for ... Willi syndrome. PDF version of this page (220K) Gene sequence Genome view see gene locations Entrez Gene ...

  5. Our Blue Gene Experience

    Jakl, Ondřej; Starý, Jiří

    Ostrava : Ústav geoniky AV ČR, 2009 - (Blaheta, R.; Starý, J.), s. 50-54 ISBN 978-80-86407-60-9. [SNA '09 - Seminar on numerical analysis: modelling and simulation of challenging engineering problems. Ostrava (CZ), 02.02.2009-06.02.2009] R&D Projects: GA ČR(CZ) GA105/09/1830 Institutional research plan: CEZ:AV0Z30860518 Keywords : IBM Blue Gene/P * finite element solver * parallel scalability Subject RIV: BA - General Mathematics

  6. Computation in gene networks

    Ben-Hur, Asa; Siegelmann, Hava T.

    2004-03-01

    Genetic regulatory networks have the complex task of controlling all aspects of life. Using a model of gene expression by piecewise linear differential equations we show that this process can be considered as a process of computation. This is demonstrated by showing that this model can simulate memory bounded Turing machines. The simulation is robust with respect to perturbations of the system, an important property for both analog computers and biological systems. Robustness is achieved using a condition that ensures that the model equations, that are generally chaotic, follow a predictable dynamics.

  7. Genes and species

    Sáez, Alberto G.

    2009-01-01

    La posibilidad de secuenciar y manipular los genes sigue abriendo fronteras en el estudio de las especies y la especiación. En tiempos recientes particularmente en dos direcciones. Por un lado, la secuenciación del gen COI (y otros) en miles de muestras de forma sistemática y masiva, el llamado "DNA barcoding", está revelando una gran cantidad de biodiversidad, en buena medida previamente no sospechada y correspondiente a especies crípticas (morfológicamente irreconocibles). En segundo lug...

  8. MUTATIONS IN CALMODULIN GENES

    2013-01-01

    The present invention relates to an isolated polynucleotide encoding at least a part of calmodulin and an isolated polypeptide comprising at least a part of a calmodulin protein, wherein the polynucleotide and the polypeptide comprise at least one mutation associated with a cardiac disorder. The ...... binding of calmodulin to ryanodine receptor 2 and use of such compound in a treatment of an individual having a cardiac disorder. The invention further provides a kit that can be used to detect specific mutations in calmodulin encoding genes....

  9. The GeneMANIA prediction server: biological network integration for gene prioritization and predicting gene function.

    Warde-Farley, David; Donaldson, Sylva L; Comes, Ovi; Zuberi, Khalid; Badrawi, Rashad; Chao, Pauline; Franz, Max; Grouios, Chris; Kazi, Farzana; Lopes, Christian Tannus; Maitland, Anson; Mostafavi, Sara; Montojo, Jason; Shao, Quentin; Wright, George; Bader, Gary D; Morris, Quaid

    2010-07-01

    GeneMANIA (http://www.genemania.org) is a flexible, user-friendly web interface for generating hypotheses about gene function, analyzing gene lists and prioritizing genes for functional assays. Given a query list, GeneMANIA extends the list with functionally similar genes that it identifies using available genomics and proteomics data. GeneMANIA also reports weights that indicate the predictive value of each selected data set for the query. Six organisms are currently supported (Arabidopsis thaliana, Caenorhabditis elegans, Drosophila melanogaster, Mus musculus, Homo sapiens and Saccharomyces cerevisiae) and hundreds of data sets have been collected from GEO, BioGRID, Pathway Commons and I2D, as well as organism-specific functional genomics data sets. Users can select arbitrary subsets of the data sets associated with an organism to perform their analyses and can upload their own data sets to analyze. The GeneMANIA algorithm performs as well or better than other gene function prediction methods on yeast and mouse benchmarks. The high accuracy of the GeneMANIA prediction algorithm, an intuitive user interface and large database make GeneMANIA a useful tool for any biologist. PMID:20576703

  10. Gene Therapy of Cancerous Diseases

    Valenčáková, A.

    2015-11-01

    Full Text Available Gene therapy of cancerous diseases provides new means of curing patients with oncologic illnesses. There are several approaches in treating cancer by gene therapy. Most commonly used methods are: cancer immunogene therapy, suicide gene therapy, application of tumor-suppressor genes, antiangiogenic therapy, mesenchymal stem cells used as vectors, gene directed enzyme/prodrug therapy and bacteria used as anti-cancer agents. Cancer gene immunotherapy uses several immunologic agents for the purpose of explaining effective anti-tumor immune response. Another method is suicide gene therapy, based on introducing viral or bacterial agents to tumor cells, allowing the conversion of a non-toxic compound to a lethal medication. The application of intact suppressor genes to cancer cells will avert their neoplastic behavior and will induce tumor regression. Inhibition of angiogenesis is also a promising strategy for treating oncologic patients. Mesenchymal stem cells can also be used as vectors in targeted gene therapy. An increasing list of experimental evidence shows, that therapeutically modified mesenchymal stem cells in “gene directed enzyme/prodrug therapy” can attack cancer tissue can kill tumor cells, cancer stem cells included. Bacteria are used as anti-cancer agents independently of in combination with conventional therapeutic methods.

  11. PROAPOPTOTIC FUNCTION OF FHIT GENE

    QIU Zhe-fu; HAN De-min; ZHANG Luo; ZHANG Wei

    2006-01-01

    Tumor suppressor gene plays an important role in maintaining the homeostasis between cell loss and growth. Fragile in maintaining the homeostasis between cell loss and growth. Fragile histidine triad (FHIT) gene found recently was studied in a deep going way; it becomes the focus as a result of its roleof ep going way; it becomes the focus as a result of its roleof anti-tumor in human various type of tissue. Due to the high efficiency of FHIT gene benefiting the anti-tumor, it is proposed gh efficiency of FHIT gene benefiting the anti-tumor, it is proposed as a candidate of tumor suppressor gene though there are several opposite opinions.several opposite opinions. We stress the summary of some properties of FHIT gene on proapoptosis according to the published data which showed gene on proapoptosis according to the published data which showed the stronger proapoptotic function of FHIT gene; the apoptosis induced by FHIT depends on the expression level and status of ene; the apoptosis induced by FHIT depends on the expression level and status of FHIT; and FHIT gene can alternate the cell cycling properties and reduce the tumorigenic potential; the apoptotic process e can alternate the cell cycling properties and reduce the tumorigenic potential; the apoptotic process induced by FHIT has no relation to p53 gene. In a ward, in consideration of its multiple functions against malignancies, FHIT in consideration of its multiple functions against malignancies, FHIT gene deserves attention and exploration as a selective target for searching the mechanism of tumorigenesis and clinical et for searching the mechanism of tumorigenesis and clinical therapeutic applications in further.le histidine triad (FHIT) gene; Apoptosis; Tumorigenesis; Tumor suppressor gene deserves attention and exploration as a selective target for searching the mechanism of tumorigenesis and clinical therapeutic applications in further.

  12. Identifying Driver Genes in Cancer by Triangulating Gene Expression, Gene Location, and Survival Data

    Rouam, Sigrid; Miller, Lance D; Karuturi, R Krishna Murthy

    2014-01-01

    Driver genes are directly responsible for oncogenesis and identifying them is essential in order to fully understand the mechanisms of cancer. However, it is difficult to delineate them from the larger pool of genes that are deregulated in cancer (ie, passenger genes). In order to address this problem, we developed an approach called TRIAngulating Gene Expression (TRIAGE through clinico-genomic intersects). Here, we present a refinement of this approach incorporating a new scoring methodology to identify putative driver genes that are deregulated in cancer. TRIAGE triangulates – or integrates – three levels of information: gene expression, gene location, and patient survival. First, TRIAGE identifies regions of deregulated expression (ie, expression footprints) by deriving a newly established measure called the Local Singular Value Decomposition (LSVD) score for each locus. Driver genes are then distinguished from passenger genes using dual survival analyses. Incorporating measurements of gene expression and weighting them according to the LSVD weight of each tumor, these analyses are performed using the genes located in significant expression footprints. Here, we first use simulated data to characterize the newly established LSVD score. We then present the results of our application of this refined version of TRIAGE to gene expression data from five cancer types. This refined version of TRIAGE not only allowed us to identify known prominent driver genes, such as MMP1, IL8, and COL1A2, but it also led us to identify several novel ones. These results illustrate that TRIAGE complements existing tools, allows for the identification of genes that drive cancer and could perhaps elucidate potential future targets of novel anticancer therapeutics. PMID:25949096

  13. Immunity-related genes and gene families in Anopheles gambiae.

    Christophides, George K; Zdobnov, Evgeny; Barillas-Mury, Carolina; Birney, Ewan; Blandin, Stephanie; Blass, Claudia; Brey, Paul T; Collins, Frank H; Danielli, Alberto; Dimopoulos, George; Hetru, Charles; Hoa, Ngo T; Hoffmann, Jules A; Kanzok, Stefan M; Letunic, Ivica; Levashina, Elena A; Loukeris, Thanasis G; Lycett, Gareth; Meister, Stephan; Michel, Kristin; Moita, Luis F; Müller, Hans-Michael; Osta, Mike A; Paskewitz, Susan M; Reichhart, Jean-Marc; Rzhetsky, Andrey; Troxler, Laurent; Vernick, Kenneth D; Vlachou, Dina; Volz, Jennifer; von Mering, Christian; Xu, Jiannong; Zheng, Liangbiao; Bork, Peer; Kafatos, Fotis C

    2002-10-01

    We have identified 242 Anopheles gambiae genes from 18 gene families implicated in innate immunity and have detected marked diversification relative to Drosophila melanogaster. Immune-related gene families involved in recognition, signal modulation, and effector systems show a marked deficit of orthologs and excessive gene expansions, possibly reflecting selection pressures from different pathogens encountered in these insects' very different life-styles. In contrast, the multifunctional Toll signal transduction pathway is substantially conserved, presumably because of counterselection for developmental stability. Representative expression profiles confirm that sequence diversification is accompanied by specific responses to different immune challenges. Alternative RNA splicing may also contribute to expansion of the immune repertoire. PMID:12364793

  14. Characterization of the KstR-dependent promoter of the gene for the first step of the cholesterol degradative pathway in Mycobacterium smegmatis.

    Uhía, Iria; Galán, Beatriz; Medrano, Francisco Javier; García, José Luis

    2011-09-01

    The KstR-dependent promoter of the MSMEG_5228 gene of Mycobacterium smegmatis, which encodes the 3-β-hydroxysteroid dehydrogenase (3-β HSD(MS)) responsible for the first step in the cholesterol degradative pathway, has been characterized. Primer extension analysis of the P₅₂₂₈ promoter showed that the transcription starts at the ATG codon, thus generating a leaderless mRNA lacking a 5' untranslated region (5'UTR). Footprint analyses demonstrated experimentally that KstR specifically binds to an operator region of 31 nt containing the quasi-palindromic sequence AACTGGAACGTGTTTCAGTT, located between the -5 and -35 positions with respect to the transcription start site. This region overlaps with the -10 and -35 boxes of the P₅₂₂₈ promoter, suggesting that KstR represses MSMEG_5228 transcription by preventing the binding of RNA polymerase. Using a P₅₂₂₈-β-galactosidase fusion we have demonstrated that KstR is able to work as a repressor in a heterologous system like Escherichia coli. A 3D model of the KstR protein revealed folding typical of TetR-type regulators, with two domains, i.e. a DNA-binding N-terminal domain and a regulator-binding C-terminal domain composed of six helices with a long tunnel-shaped hydrophobic pocket that might interact with a putative highly hydrophobic inducer. The finding that similar P₅₂₂₈ promoter regions have been found in all mycobacterial strains examined, with the sole exception of Mycobacterium tuberculosis, provides new clues about the role of cholesterol in the pathogenicity of this micro-organism. PMID:21565928

  15. Horizontal gene transfer in fungi

    Fitzpatrick, David A.

    2011-01-01

    Horizontal gene transfer (HGT) is frequently observed in prokaryotes and until recently was assumed to be of limited importance to eukaryotes. However, there is an increasing body of evidence to suggest that HGT is an important mechanism in eukaryotic genome evolution, particularly in unicellular organisms. The transfer of individual genes, gene clusters or entire chromosomes can have significant impacts on niche specification, disease emergence or shift in metabolic capabil...

  16. Gene expression in colorectal cancer

    Birkenkamp-Demtroder, Karin; Christensen, Lise Lotte; Olesen, Sanne Harder;

    2002-01-01

    Understanding molecular alterations in colorectal cancer (CRC) is needed to define new biomarkers and treatment targets. We used oligonucleotide microarrays to monitor gene expression of about 6,800 known genes and 35,000 expressed sequence tags (ESTs) on five pools (four to six samples in each...... high frequency of loss of heterozygosity. The genes and ESTs presented in this study encode new potential tumor markers as well as potential novel therapeutic targets for prevention or therapy of CRC....

  17. Gene therapy in pancreatic cancer

    Liu, Si-Xue; Xia, Zhong-Sheng; Zhong, Ying-Qiang

    2014-01-01

    Pancreatic cancer (PC) is a highly lethal disease and notoriously difficult to treat. Only a small proportion of PC patients are eligible for surgical resection, whilst conventional chemoradiotherapy only has a modest effect with substantial toxicity. Gene therapy has become a new widely investigated therapeutic approach for PC. This article reviews the basic rationale, gene delivery methods, therapeutic targets and developments of laboratory research and clinical trials in gene therapy of PC...

  18. Hormones, genes, and behavior

    Pfaff, Donald W.

    1997-01-01

    With assays of hormone-sensitive behaviors, it is possible to demonstrate both direct and indirect actions of genes on mammalian social behaviors. Direct effects of estrogen receptor gene expression and progesterone receptor gene expression figure prominently in well analyzed neuroendocrine mechanisms for sex behavior, operating through a neural circuit that has been delineated. Indirect effects, notably the consequences of sexual differentiation, display complex d...

  19. Gene therapy for psychiatric disorders

    Thome, Johannes; HÄSSLER, FRANK; ZACHARIOU, VANNA

    2011-01-01

    There is no indication that gene therapy can be applied in psychiatric patients any time soon. However, there are several promising developments on the level of experimental neuroscience indicating that gene therapy approaches have an effect in animal models of several psychiatric disorders including drug addiction, affective disorders, psychoses and dementia, modifying behavioural parameters via interventions on the molecular and cellular level. However, before gene therapy in psychiatric di...

  20. Combinatorial approaches to gene recognition.

    Roytberg, M A; Astakhova, T V; Gelfand, M S

    1997-01-01

    Recognition of genes via exon assembly approaches leads naturally to the use of dynamic programming. We consider the general graph-theoretical formulation of the exon assembly problem and analyze in detail some specific variants: multicriterial optimization in the case of non-linear gene-scoring functions; context-dependent schemes for scoring exons and related procedures for exon filtering; and highly specific recognition of arbitrary gene segments, oligonucleotide probes and polymerase chain reaction (PCR) primers. PMID:9440930

  1. Gene set analysis for GWAS

    Debrabant, Birgit; Soerensen, Mette

    2014-01-01

    Abstract We discuss the use of modified Kolmogorov-Smirnov (KS) statistics in the context of gene set analysis and review corresponding null and alternative hypotheses. Especially, we show that, when enhancing the impact of highly significant genes in the calculation of the test statistic, the...... parameter and the genesis and distribution of the gene-level statistics, and illustrate the effects of differential weighting in a real-life example....

  2. Respiratory Review of 2014: Tuberculosis and Nontuberculous Mycobacterial Pulmonary Disease

    Park, Cheol Kyu; Kwon, Yong Soo

    2014-01-01

    Since tuberculosis (TB) remains a major global health concern and the incidence of multi-drug resistant (MDR)-TB is increasing globally, new modalities for the detection of TB and drug resistant TB are needed to improve TB control. The Xpert MTB/RIF test can be a valuable new tool for early detection of TB and rifampicin resistance, with a high sensitivity and specificity. Late-generation fluoroquinolones, levofloxacin, and moxifloxacin, which are the principal drugs for the treatment of MDR-...

  3. Macrophage Activation by Ursolic and Oleanolic Acids during Mycobacterial Infection

    Sonia López-García

    2015-08-01

    Full Text Available Oleanolic (OA and ursolic acids (UA are triterpenes that are abundant in vegetables, fruits and medicinal plants. They have been described as active moieties in medicinal plants used for the treatment of tuberculosis. In this study, we analyzed the effects of these triterpenes on macrophages infected in vitro with Mycobacterium tuberculosis (MTB. We evaluated production of nitric oxide (NO, reactive oxygen species (ROS, and cytokines (TNF-α and TGF-β as well as expression of cell membrane receptors (TGR5 and CD36 in MTB-infected macrophages following treatment with OA and UA. Triterpenes caused reduced MTB growth in macrophages, stimulated production of NO and ROS in the early phase, stimulated TNF-α, suppressed TGF-β and caused over-expression of CD36and TGR5 receptors. Thus, our data suggest immunomodulatory properties of OA and UA on MTB infected macrophages. In conclusion, antimycobacterial effects induced by these triterpenes may be attributable to the conversion of macrophages from stage M2 (alternatively activated to M1 (classically activated.

  4. Mycobacterial Pulmonary Infections in Patients with Idiopathic Pulmonary Fibrosis

    Park, Sung-Woo; Song, Jin Woo; Shim, Tae Sun; Park, Moo-Suk; Lee, Hong-Lyeol; Uh, Soo-taek; Park, Choon-Sik; Kim, Dong Soon

    2012-01-01

    Patients with idiopathic pulmonary fibrosis (IPF) have an increased risk for developing tuberculosis (TB). However, no studies have been reported regarding the development of nontuberculous mycobacterium (NTM) lung disease (NTMLD). We reviewed 795 patients with IPF from five university hospitals who were diagnosed by histological or radio-clinical criteria. In the 795 patients with IPF, pulmonary infections with mycobacterium tuberculosis (MTB) and NTM were found in 35 (4.4%) and 16 patients ...

  5. Triazaspirodimethoxybenzoyls as Selective Inhibitors of Mycobacterial Lipoamide Dehydrogenase

    Bryk, Ruslana; Arango, Nancy; Venugopal, Aditya; Warren, J. David; Park, Yun-Hee; Patel, Mulchand S.; Lima, Christopher D.; Nathan, Carl (Weill-Med); (SKI); (SUNYB)

    2010-06-25

    Mycobacterium tuberculosis (Mtb) remains the leading single cause of death from bacterial infection. Here we explored the possibility of species-selective inhibition of lipoamide dehydrogenase (Lpd), an enzyme central to Mtb's intermediary metabolism and antioxidant defense. High-throughput screening of combinatorial chemical libraries identified triazaspirodimethoxybenzoyls as high-nanomolar inhibitors of Mtb's Lpd that were noncompetitive versus NADH, NAD{sup +}, and lipoamide and >100-fold selective compared to human Lpd. Efficacy required the dimethoxy and dichlorophenyl groups. The structure of an Lpd-inhibitor complex was resolved to 2.42 {angstrom} by X-ray crystallography, revealing that the inhibitor occupied a pocket adjacent to the Lpd NADH/NAD{sup +} binding site. The inhibitor did not overlap with the adenosine moiety of NADH/NAD{sup +} but did overlap with positions predicted to bind the nicotinamide rings in NADH and NAD{sup +} complexes. The dimethoxy ring occupied a deep pocket adjacent to the FAD flavin ring where it would block coordination of the NADH nicotinamide ring, while the dichlorophenyl group occupied a more exposed pocket predicted to coordinate the NAD{sup +} nicotinamide. Several residues that are not conserved between the bacterial enzyme and its human homologue were predicted to contribute both to inhibitor binding and to species selectivity, as confirmed for three residues by analysis of the corresponding mutant Mtb Lpd proteins. Thus, nonconservation of residues lining the electron-transfer tunnel in Mtb Lpd can be exploited for development of species-selective Lpd inhibitors.

  6. Mycobacterial heat shock protein 65 and experimental autoimmune uveitis

    杨俊杰

    2010-01-01

    @@ Uveitis, common cause of human visual disability and blindness, is an inflammatory eye disease of unknown etiology. Human autoimmune uveiti, which characterizes inflammation of different tissues of the eyes, is diverse and complex. Approximately 50% of patients with uveitis were found to occur in families in which clustering of other underlying systemic autoimmune diseases has been observed (multiplex families) such as diabetes, sarcoidosis, rheumatoid arthritis (RA), Behcet disease, multiple sclerosis (MS), and others [1-3]. Animal models of experimental autoimmune uveitis (EAU), which represent different forms of clinical uveitis, have been widely used for studying the immunopathological mechanisms of uveitis to develop preventive or therapeutic strategies because of the difficulties in obtaining tissues from a patient's inflamed eye for experiments [4].

  7. Gene therapy for Parkinson's disease.

    Lawlor, Patricia A; During, Matthew J

    2004-03-01

    Parkinson's disease (PD) is a debilitating neurodegenerative disorder arising from loss of dopaminergic neurons in the substantia nigra pars compacta and subsequent depletion of striatal dopamine levels, which results in distressing motor symptoms. The current standard pharmacological treatment for PD is direct replacement of dopamine by treatment with its precursor, levodopa (L-dopa). However, this does not significantly alter disease progression and might contribute to the ongoing pathology. Several features of PD make this disease one of the most promising targets for clinical gene therapy of any neurological disease. The confinement of the major pathology to a compact, localised neuronal population and the anatomy of the basal ganglia circuitry mean that global gene transfer is not required and there are well-defined sites for gene transfer. The multifactorial aetiology of idiopathic PD means that it is unlikely any single gene will cure the disease, and as a result at least three separate gene-transfer strategies are currently being pursued: transfer of genes for enzymes involved in dopamine production; transfer of genes for growth factors involved in dopaminergic cell survival and regeneration; and transfer of genes to reset neuronal circuitry by switching cellular phenotype. The merits of these strategies are discussed here, along with remaining hurdles that might impede transfer of gene therapy technology to the clinic as a treatment for PD. PMID:15000692

  8. ERGDB: Estrogen Responsive Genes Database.

    Tang, Suisheng; Han, Hao; Bajic, Vladimir B

    2004-01-01

    ERGDB is an integrated knowledge database dedicated to genes responsive to estrogen. Genes included in ERGDB are those whose expression levels are experimentally proven to be either up-regulated or down-regulated by estrogen. Genes included are identified based on publications from the PubMed database and each record has been manually examined, evaluated and selected for inclusion by biologists. ERGDB aims to be a unified gateway to store, search, retrieve and update information about estrogen responsive genes. Each record contains links to relevant databases, such as GenBank, LocusLink, Refseq, PubMed and ATCC. The unique feature of ERGDB is that it contains information on the dependence of gene reactions on experimental conditions. In addition to basic information about the genes, information for each record includes gene functional description, experimental methods used, tissue or cell type, gene reaction, estrogen exposure time and the summary of putative estrogen response elements if the gene's promoter sequence was available. Through a web interface at http://sdmc.i2r.a-star.edu.sg/ergdb/ cgi-bin/explore.pl users can either browse or query ERGDB. Access is free for academic and non-profit users. PMID:14681475

  9. Gene expression analysis identifies global gene dosage sensitivity in cancer

    Fehrmann, Rudolf S. N.; Karjalainen, Juha M.; Krajewska, Malgorzata;

    2015-01-01

    expression. We reanalyzed 77,840 expression profiles and observed a limited set of 'transcriptional components' that describe well-known biology, explain the vast majority of variation in gene expression and enable us to predict the biological function of genes. On correcting expression profiles for these...

  10. LSL_(gene) - Wikipedia, the free encyclopedia [Gene Wiki

    Full Text Available LSL (gene) - Wikipedia, the free encyclopediaLSL (gene)From Wikipedia, the free encyclopediaJump ... n-bound leptin from subcutaneous adipose tissue of lean ... and obese women". J. Clin. Endocrinol. Metab. 87 ( ... et al. (2003). "Serum leptin activity in obese and lean ... patients". Regul. Pept. 111 (1–3): 77–82. doi:10.1 ...

  11. BBX_(gene) - Wikipedia, the free encyclopedia [Gene Wiki

    Full Text Available BBX (gene) - Wikipedia, the free encyclopediaBBX (gene)From Wikipedia, the free encyclopediaJump ... of disease to interested scientists.[12][13][14]Male an d female an imals underwent a standardized phenotyp ... while mutants of both sexes showed a reduction in lean ... body mass. Radiography found that males had abnorm ...

  12. Are TMEM genes potential candidate genes for panic disorder?

    Gregersen, Noomi O; Buttenschøn, Henriette Nørmølle; Hedemand, Anne;

    2014-01-01

    We analysed single nucleotide polymorphisms in two transmembrane genes (TMEM98 and TMEM132E) in panic disorder (PD) patients and control individuals from the Faroe Islands, Denmark and Germany. The genes encode single-pass membrane proteins and are located within chromosome 17q11.2-q12, a...

  13. STATE-OF-THE-ART HUMAN GENE THERAPY: PART I. GENE DELIVERY TECHNOLOGIES

    Wang, Dan; Gao, Guangping

    2014-01-01

    Safe and effective gene delivery is a prerequisite for successful gene therapy. In the early age of human gene therapy, setbacks due to problematic gene delivery vehicles plagued the exciting therapeutic outcome. However, gene delivery technologies rapidly evolved ever since. With the advancement of gene delivery techniques, gene therapy clinical trials surged during the past decade. As the first gene therapy product has obtained regulatory approval and reached clinic, human gene therapy fina...

  14. Classifying genes to the correct Gene Ontology Slim term in Saccharomyces cerevisiae using neighbouring genes with classification learning

    Tsatsoulis Costas

    2010-05-01

    Full Text Available Abstract Background There is increasing evidence that gene location and surrounding genes influence the functionality of genes in the eukaryotic genome. Knowing the Gene Ontology Slim terms associated with a gene gives us insight into a gene's functionality by informing us how its gene product behaves in a cellular context using three different ontologies: molecular function, biological process, and cellular component. In this study, we analyzed if we could classify a gene in Saccharomyces cerevisiae to its correct Gene Ontology Slim term using information about its location in the genome and information from its nearest-neighbouring genes using classification learning. Results We performed experiments to establish that the MultiBoostAB algorithm using the J48 classifier could correctly classify Gene Ontology Slim terms of a gene given information regarding the gene's location and information from its nearest-neighbouring genes for training. Different neighbourhood sizes were examined to determine how many nearest neighbours should be included around each gene to provide better classification rules. Our results show that by just incorporating neighbour information from each gene's two-nearest neighbours, the percentage of correctly classified genes to their correct Gene Ontology Slim term for each ontology reaches over 80% with high accuracy (reflected in F-measures over 0.80 of the classification rules produced. Conclusions We confirmed that in classifying genes to their correct Gene Ontology Slim term, the inclusion of neighbour information from those genes is beneficial. Knowing the location of a gene and the Gene Ontology Slim information from neighbouring genes gives us insight into that gene's functionality. This benefit is seen by just including information from a gene's two-nearest neighbouring genes.

  15. Advancement and prospects of tumor gene therapy

    Zhang, Chao; Wang, Qing-Tao; Liu, He; Zhang, Zhen-Zhu; Huang, Wen-Lin

    2011-01-01

    Gene therapy is one of the most attractive fields in tumor therapy. In past decades, significant progress has been achieved. Various approaches, such as viral and non-viral vectors and physical methods, have been developed to make gene delivery safer and more efficient. Several therapeutic strategies have evolved, including gene-based (tumor suppressor genes, suicide genes, antiangiogenic genes, cytokine and oxidative stress-based genes) and RNA-based (antisense oligonucleotides and RNA inter...

  16. Evidence Based Selection of Housekeeping Genes

    de Jonge, Hendrik J.M.; Fehrmann, Rudolf S. N.; Eveline S. J. M. de Bont; Hofstra, Robert M. W.; Gerbens, Frans; Kamps, Willem A.; Vries, Elisabeth G. E.; van der Zee, Ate G.J.; te Meerman, Gerard J.; ter Elst, Arja

    2007-01-01

    For accurate and reliable gene expression analysis, normalization of gene expression data against housekeeping genes (reference or internal control genes) is required. It is known that commonly used housekeeping genes (e.g. ACTB, GAPDH, HPRT1, and B2M) vary considerably under different experimental conditions and therefore their use for normalization is limited. We performed a meta-analysis of 13,629 human gene array samples in order to identify the most stable expressed genes. Here we show n...

  17. A Combinatorial Approach to Detecting Gene-Gene and Gene-Environment Interactions in Family Studies

    Lou, Xiang-Yang; Chen, Guo-Bo; Yan, Lei; Ma, Jennie Z.; Mangold, Jamie E.; Zhu, Jun; Elston, Robert C.; Li, Ming D.

    2008-01-01

    Widespread multifactor interactions present a significant challenge in determining risk factors of complex diseases. Several combinatorial approaches, such as the multifactor dimensionality reduction (MDR) method, have emerged as a promising tool for better detecting gene-gene (G × G) and gene-environment (G × E) interactions. We recently developed a general combinatorial approach, namely the generalized multifactor dimensionality reduction (GMDR) method, which can entertain both qualitative ...

  18. Gene-Gene and Gene-Environment Interactions in Ulcerative Colitis

    Wang, Ming-Hsi; FIOCCHI, CLAUDIO; Zhu, Xiaofeng; Ripke, Stephan; Kamboh, M. Ilyas; Rebert, Nancy; Duerr, Richard H.; Achkar, Jean-Paul

    2013-01-01

    Genome-wide association studies (GWAS) have identified at least 133 ulcerative colitis (UC) associated loci. The role of genetic factors in clinical practice is not clearly defined. The relevance of genetic variants to disease pathogenesis is still uncertain because of not characterized gene-gene and gene-environment interactions. We examined the predictive value of combining the 133 UC risk loci with genetic interactions in an ongoing inflammatory bowel disease (IBD) GWAS. The Wellcome Trust...

  19. Validation of qPCR Methods for the Detection of Mycobacterium in New World Animal Reservoirs.

    Housman, Genevieve; Malukiewicz, Joanna; Boere, Vanner; Grativol, Adriana D; Pereira, Luiz Cezar M; Silva, Ita de Oliveira; Ruiz-Miranda, Carlos R; Truman, Richard; Stone, Anne C

    2015-11-01

    Zoonotic pathogens that cause leprosy (Mycobacterium leprae) and tuberculosis (Mycobacterium tuberculosis complex, MTBC) continue to impact modern human populations. Therefore, methods able to survey mycobacterial infection in potential animal hosts are necessary for proper evaluation of human exposure threats. Here we tested for mycobacterial-specific single- and multi-copy loci using qPCR. In a trial study in which armadillos were artificially infected with M. leprae, these techniques were specific and sensitive to pathogen detection, while more traditional ELISAs were only specific. These assays were then employed in a case study to detect M. leprae as well as MTBC in wild marmosets. All marmosets were negative for M. leprae DNA, but 14 were positive for the mycobacterial rpoB gene assay. Targeted capture and sequencing of rpoB and other MTBC genes validated the presence of mycobacterial DNA in these samples and revealed that qPCR is useful for identifying mycobacterial-infected animal hosts. PMID:26571269

  20. Candidate genes for behavioural ecology

    Fitzpatrick, M.J.; Ben-Sahar, Y.; Smid, H.M.; Vet, L.E.M.; Robinson, G.E.; Sokolowski, M.B.

    2005-01-01

    In spite of millions of years of evolutionary divergence, the conservation of gene function is common across distant lineages. As such, genes that are known to influence behaviour in one organism are likely to influence similar behaviours in other organisms. Recent studies of the evolution of behavi

  1. HOX genes in ovarian cancer

    Kelly Zoë L

    2011-09-01

    Full Text Available Abstract The HOX genes are a family of homeodomain-containing transcription factors that determine cellular identity during development. Here we review a number of recent studies showing that HOX genes are strongly expressed in ovarian cancer, and that in some cases the expression of specific HOX genes is sufficient to confer a particular identity and phenotype upon cancer cells. We also review the recent advances in elucidating the different functions of HOX genes in ovarian cancer. A literature search was performed using the search terms HOX genes (including specific HOX genes, ovarian cancer and oncogenesis. Articles were accessed through searches performed in ISI Web of Knowledge, PubMed and ScienceDirect. Taken together, these studies have shown that HOX genes play a role in the oncogenesis of ovarian cancer and function in the inhibition of apoptosis, DNA repair and enhanced cell motility. The function of HOX genes in ovarian cancer oncogenesis supports their potential role as prognostic and diagnostic markers, and as therapeutic targets in this disease.

  2. Candidate gene prioritization with Endeavour.

    Tranchevent, Léon-Charles; Ardeshirdavani, Amin; ElShal, Sarah; Alcaide, Daniel; Aerts, Jan; Auboeuf, Didier; Moreau, Yves

    2016-07-01

    Genomic studies and high-throughput experiments often produce large lists of candidate genes among which only a small fraction are truly relevant to the disease, phenotype or biological process of interest. Gene prioritization tackles this problem by ranking candidate genes by profiling candidates across multiple genomic data sources and integrating this heterogeneous information into a global ranking. We describe an extended version of our gene prioritization method, Endeavour, now available for six species and integrating 75 data sources. The performance (Area Under the Curve) of Endeavour on cross-validation benchmarks using 'gold standard' gene sets varies from 88% (for human phenotypes) to 95% (for worm gene function). In addition, we have also validated our approach using a time-stamped benchmark derived from the Human Phenotype Ontology, which provides a setting close to prospective validation. With this benchmark, using 3854 novel gene-phenotype associations, we observe a performance of 82%. Altogether, our results indicate that this extended version of Endeavour efficiently prioritizes candidate genes. The Endeavour web server is freely available at https://endeavour.esat.kuleuven.be/. PMID:27131783

  3. On meme--gene coevolution.

    Bull, L; Holland, O; Blackmore, S

    2000-01-01

    In this article we examine the effects of the emergence of a new replicator, memes, on the evolution of a pre-existing replicator, genes. Using a version of the NKCS model we examine the effects of increasing the rate of meme evolution in relation to the rate of gene evolution, for various degrees of interdependence between the two replicators. That is, the effects of memes' (suggested) more rapid rate of evolution in comparison to that of genes is investigated using a tunable model of coevolution. It is found that, for almost any degree of interdependence between the two replicators, as the rate of meme evolution increases, a phase transition-like dynamic occurs under which memes have a significantly detrimental effect on the evolution of genes, quickly resulting in the cessation of effective gene evolution. Conversely, the memes experience a sharp increase in benefit from increasing their rate of evolution. We then examine the effects of enabling genes to reduce the percentage of gene-detrimental evolutionary steps taken by memes. Here a critical region emerges as the comparative rate of meme evolution increases, such that if genes cannot effectively select memes a high percentage of the time, they suffer from meme evolution as if they had almost no selective capability. PMID:11224917

  4. Phytochrome-regulated Gene Expression

    Peter H. Quail

    2007-01-01

    Identification of all genes involved in the phytochrome (phy)-mediated responses of plants to their light environment is an important goal in providing an overall understanding of light-regulated growth and development. This article highlights and integrates the central findings of two recent comprehensive studies in Arabidopsis that have identified the genome-wide set of phy-regulated genes that respond rapidly to red-light signals upon first exposure of dark-grown seedlings, and have tested the functional relevance to normal seedling photomorphogenesis of an initial subset of these genes. The data: (a) reveal considerable complexity in the channeling of the light signals through the different phy-family members (phyA to phyE) to responsive genes; (b) identify a diversity of transcription-factor-encoding genes as major early, if not primary, targets of phy signaling, and, therefore, as potentially important regulators in the transcriptional-network hierarchy; and (c) identify auxin-related genes as the dominant class among rapidly-regulated, hormone-related genes. However, reverse-genetic functional profiling of a selected subset of these genes reveals that only a limited fraction are necessary for optimal phy-induced seedling deetiolation.

  5. Multifunctional nanorods for gene delivery

    Salem, Aliasger K.; Searson, Peter C.; Leong, Kam W.

    2003-10-01

    The goal of gene therapy is to introduce foreign genes into somatic cells to supplement defective genes or provide additional biological functions, and can be achieved using either viral or synthetic non-viral delivery systems. Compared with viral vectors, synthetic gene-delivery systems, such as liposomes and polymers, offer several advantages including ease of production and reduced risk of cytotoxicity and immunogenicity, but their use has been limited by the relatively low transfection efficiency. This problem mainly stems from the difficulty in controlling their properties at the nanoscale. Synthetic inorganic gene carriers have received limited attention in the gene-therapy community, the only notable example being gold nanoparticles with surface-immobilized DNA applied to intradermal genetic immunization by particle bombardment. Here we present a non-viral gene-delivery system based on multisegment bimetallic nanorods that can simultaneously bind compacted DNA plasmids and targeting ligands in a spatially defined manner. This approach allows precise control of composition, size and multifunctionality of the gene-delivery system. Transfection experiments performed in vitro and in vivo provide promising results that suggest potential in genetic vaccination applications.

  6. FunGeneClusterS

    Vesth, Tammi Camilla; Brandl, Julian; Andersen, Mikael Rørdam

    2016-01-01

    Secondary metabolites of fungi are receiving an increasing amount of interest due to their prolific bioactivities and the fact that fungal biosynthesis of secondary metabolites often occurs from co-regulated and co-located gene clusters. This makes the gene clusters attractive for synthetic biology...

  7. 散发性皮肤非结核分枝杆菌感染37例回顾研究%Sporadic cutaneous infections due to nontuberculous mycobacteria: a retrospective study of 37 cases

    金江; 贾军; 丁晓岚; 陈雪; 孙青苗; 徐健楠; 薛晨红; 杜娟; 蔡林

    2015-01-01

    Objective:To study the clinical and pathological characteristics of sporadic cutaneous in-fections due to nontuberculous mycobacteria ( NTM) , and investigate the diagnostic criteria and therapeu-tic principal. Methods:Totally 37 cases of sporadic cutaneous infections due to NTM were confirmed in the Department of Dermatology, Peking University People's Hospital from January 2000 to March 2014. The microbiologic and clinical data were reviewed, and their skin biopsy specimens were reassessed. Re-sults:Of all the 37 patients, 30 cases were Mycobacterium marinum infection, 6 were Mycobacterium ab-scessus infection, and one was Mycobacterium chelonea and Mycobacterium fortuitum infection. Identifica-tion of mycobacterial species by analysis of hsp65 gene in tissue DNA was more sensitive than traditional bacterial culture. The most common risk factors were traumatic injuries ( 21 of 37 ) and aquarium or fish-related job (21 of 37). One case of Mycobacterium abscessus infection occurred after autologous fat filling. Nodule and plaque were most common lesions in Mycobacterium marinum infection. Twenty-four of the 30 cases of Mycobacterium marinum infection presented with multiple lesions or sporotrichoid spread lesions. Ulceration, papules, abscess, and purulent discharge were observed in cases of Mycobac-terium abscessus infection. Infective granuloma was most common histopathological appearance. For the treatment of Mycobacterium marinum infection, rifampin, ethambutol, and clarithromycin were commonly used (combination of two antibiotics, or three antibiotics), with the cure rate 90. 00%. Four of the six Mycobacterium abscessus infections cases were cured, and one patient died. Conclusion:The most com-mon species of sporadic cutaneous infections due to NTM is Mycobacterium marinum. Traumatic injuries, aquarium or fish-related job, and cosmetic surgeries are common risk factors. Mycobacterium marinum in-fection often presents with nodules, plaques, and sometimes

  8. Delivery systems for gene therapy

    Shrikant Mali

    2013-01-01

    Full Text Available The structure of DNA was unraveled by Watson and Crick in 1953, and two decades later Arber, Nathans and Smith discovered DNA restriction enzymes, which led to the rapid growth in the field of recombinant DNA technology. From expressing cloned genes in bacteria to expressing foreign DNA in transgenic animals, DNA is now slated to be used as a therapeutic agent to replace defective genes in patients suffering from genetic disorders or to kill tumor cells in cancer patients. Gene therapy provides modern medicine with new perspectives that were unthinkable two decades ago. Progress in molecular biology and especially, molecular medicine is now changing the basics of clinical medicine. A variety of viral and non-viral possibilities are available for basic and clinical research. This review summarizes the delivery routes and methods for gene transfer used in gene therapy.

  9. CNS Genes Implicated in Relapse

    Willard M. Freeman

    2008-01-01

    Full Text Available Drug abuse is a condition that impacts not only the individual drug user, but society as a whole. Although prevention of initial drug use is the most effective way to prevent addiction, avoiding relapse is a crucial component of drug addiction recovery. Recent studies suggest that there is a set of genes whose expression is robustly and stably altered following drug use and ensuing abstinence. Such stable changes in gene expression correlate with ultrastructural changes in brain as well as alterations in behavior. As persistent molecular changes, these genes may provide targets for the development of therapeutics. Developing a list of well-characterized candidate genes and examining the effect of manipulating these genes will contribute to the ultimate goal of developing effective treatments to prevent relapse to drug use.

  10. Function analysis of unknown genes

    Rogowska-Wrzesinska, A.

    2002-01-01

      This thesis entitled "Function analysis of unknown genes" presents the use of proteome analysis for the characterisation of yeast (Saccharomyces cerevisiae) genes and their products (proteins especially those of unknown function). This study illustrates that proteome analysis can be used to...... describe different aspects of molecular biology of the cell, to study changes that occur in the cell due to overexpression or deletion of a gene and to identify various protein modifications. The biological questions and the results of the described studies show the diversity of the information that can be...... characterising yeast genes and proteins. It reports the first global proteome database collecting 36 yeast single gene deletion mutants and selecting over 650 differences between analysed mutants and the wild type strain. The obtained results show that two-dimensional gel electrophoresis and mass spectrometry...

  11. GeneMANIA Prediction Server 2013 Update

    Zuberi, Khalid; Franz, Max; Rodriguez, Harold; Montojo, Jason; Lopes, Christian Tannus; Bader, Gary D.; Morris, Quaid

    2013-01-01

    GeneMANIA (http://www.genemania.org) is a flexible user-friendly web interface for generating hypotheses about gene function, analyzing gene lists and prioritizing genes for functional assays. Given a query gene list, GeneMANIA extends the list with functionally similar genes that it identifies using available genomics and proteomics data. GeneMANIA also reports weights that indicate the predictive value of each selected data set for the query. GeneMANIA can also be used in a function predict...

  12. Gene expression profiling: can we identify the right target genes?

    J. E. Loyd

    2008-12-01

    Full Text Available Gene expression profiling allows the simultaneous monitoring of the transcriptional behaviour of thousands of genes, which may potentially be involved in disease development. Several studies have been performed in idiopathic pulmonary fibrosis (IPF, which aim to define genetic links to the disease in an attempt to improve the current understanding of the underlying pathogenesis of the disease and target pathways for intervention. Expression profiling has shown a clear difference in gene expression between IPF and normal lung tissue, and has identified a wide range of candidate genes, including those known to encode for proteins involved in extracellular matrix formation and degradation, growth factors and chemokines. Recently, familial pulmonary fibrosis cohorts have been examined in an attempt to detect specific genetic mutations associated with IPF. To date, these studies have identified families in which IPF is associated with mutations in the gene encoding surfactant protein C, or with mutations in genes encoding components of telomerase. Although rare and clearly not responsible for the disease in all individuals, the nature of these mutations highlight the importance of the alveolar epithelium in disease pathogenesis and demonstrate the potential for gene expression profiling in helping to advance the current understanding of idiopathic pulmonary fibrosis.

  13. Genes and gene networks implicated in aggression related behaviour.

    Malki, Karim; Pain, Oliver; Du Rietz, Ebba; Tosto, Maria Grazia; Paya-Cano, Jose; Sandnabba, Kenneth N; de Boer, Sietse; Schalkwyk, Leonard C; Sluyter, Frans

    2014-10-01

    Aggressive behaviour is a major cause of mortality and morbidity. Despite of moderate heritability estimates, progress in identifying the genetic factors underlying aggressive behaviour has been limited. There are currently three genetic mouse models of high and low aggression created using selective breeding. This is the first study to offer a global transcriptomic characterization of the prefrontal cortex across all three genetic mouse models of aggression. A systems biology approach has been applied to transcriptomic data across the three pairs of selected inbred mouse strains (Turku Aggressive (TA) and Turku Non-Aggressive (TNA), Short Attack Latency (SAL) and Long Attack Latency (LAL) mice and North Carolina Aggressive (NC900) and North Carolina Non-Aggressive (NC100)), providing novel insight into the neurobiological mechanisms and genetics underlying aggression. First, weighted gene co-expression network analysis (WGCNA) was performed to identify modules of highly correlated genes associated with aggression. Probe sets belonging to gene modules uncovered by WGCNA were carried forward for network analysis using ingenuity pathway analysis (IPA). The RankProd non-parametric algorithm was then used to statistically evaluate expression differences across the genes belonging to modules significantly associated with aggression. IPA uncovered two pathways, involving NF-kB and MAPKs. The secondary RankProd analysis yielded 14 differentially expressed genes, some of which have previously been implicated in pathways associated with aggressive behaviour, such as Adrbk2. The results highlighted plausible candidate genes and gene networks implicated in aggression-related behaviour. PMID:25142712

  14. Progress of gene targeting in mouse

    2001-01-01

    Gene targeting is a powerful approach of study- ing the genefunction in vivo. Specific genetic modifications, including simple gene disruption, point mutations, large chromosomal deletions and rearrangements, targeted incor- poration of foreign genes, could be introduced into the mouse genome by gene targeting. Recent studies make it possible to do the gene targeting with temporal and spatial control.

  15. Genes and equality.

    Farrelly, C

    2004-12-01

    The way people think about equality as a value will influence how they think genetic interventions should be regulated. In this paper the author uses the taxonomy of equality put forth by Derek Parfit and applies this to the issue of genetic interventions. It is argued that telic egalitarianism is untenable and that deontic egalitarianism collapses into prioritarianism. The priority view maintains that it is morally more important to benefit the people who are worse off. Once this precision has been given to the concerns egalitarians have, a number of diverse issues must be considered before determining what the just regulation of genetic interventions would be. Consideration must be given to the current situation of the least advantaged, the fiscal realities behind genetic interventions, the budget constraints on other social programmes egalitarians believe should receive scarce public funds, and the interconnected nature of genetic information. These considerations might lead egalitarians to abandon what they take to be the obvious policy recommendations for them to endorse regarding the regulation of gene therapies and enhancements. PMID:15574450

  16. Visual gene developer: a fully programmable bioinformatics software for synthetic gene optimization

    McDonald Karen; Jung Sang-Kyu

    2011-01-01

    Abstract Background Direct gene synthesis is becoming more popular owing to decreases in gene synthesis pricing. Compared with using natural genes, gene synthesis provides a good opportunity to optimize gene sequence for specific applications. In order to facilitate gene optimization, we have developed a stand-alone software called Visual Gene Developer. Results The software not only provides general functions for gene analysis and optimization along with an interactive user-friendly interfac...

  17. GeneNet: a database on structure and functional organisation of gene networks

    Ananko, E A; Podkolodny, N. L.; Stepanenko, I. L.; Ignatieva, E. V.; Podkolodnaya, O. A.; Kolchanov, N. A.

    2002-01-01

    The GeneNet database is designed for accumulation of information on gene networks. Original technology applied in GeneNet enables description of not only a gene network structure and functional relationships between components, but also metabolic and signal transduction pathways. Specialised software, GeneNet Viewer, automatically displays the graphical diagram of gene networks described in the database. Current release 3.0 of GeneNet database contains descriptions of 25 gene networks, 945 pr...

  18. Genes: an Open Access Journal

    J. Peter W. Young

    2009-11-01

    Full Text Available Genes have been in the scientific vocabulary for a hundred years. The term "gene" was proposed by the Danish plant scientist Wilhelm Johannsen in the first decade of the 20th century. For Johannsen, the gene remained an abstract concept, "free of any hypothesis" [1], but others were already pointing to chromosomes as the likely location of genes. The science of genetics was born at that time, and genes were rapidly connected with mutations, with patterns of inheritance, with development, with quantitative traits, with evolution and with biochemical pathways. All this was achieved without knowledge of the physical nature of genes, but this changed in mid-century with the discoveries of molecular biology. DNA was revealed as the genetic material, and the mechanisms were elucidated by which the information was encoded, and propagated, and linked to the phenotype. However, the concept of a "gene" did not become clearer. Quite the reverse, as the units of mutation, of recombination, of inheritance, of expression, of regulation, etc. did not necessarily coincide. [...

  19. Gene Electrotransfer: A Mechanistic Perspective.

    Rosazza, Christelle; Meglic, Sasa Haberl; Zumbusch, Andreas; Rols, Marie-Pierre; Miklavcic, Damijan

    2016-01-01

    Gene electrotransfer is a powerful method of DNA delivery offering several medical applications, among the most promising of which are DNA vaccination and gene therapy for cancer treatment. Electroporation entails the application of electric fields to cells which then experience a local and transient change of membrane permeability. Although gene electrotransfer has been extensively studied in in vitro and in vivo environments, the mechanisms by which DNA enters and navigates through cells are not fully understood. Here we present a comprehensive review of the body of knowledge concerning gene electrotransfer that has been accumulated over the last three decades. For that purpose, after briefly reviewing the medical applications that gene electrotransfer can provide, we outline membrane electropermeabilization, a key process for the delivery of DNA and smaller molecules. Since gene electrotransfer is a multipart process, we proceed our review in describing step by step our current understanding, with particular emphasis on DNA internalization and intracellular trafficking. Finally, we turn our attention to in vivo testing and methodology for gene electrotransfer. PMID:27029943

  20. Multiphasic strain differentiation of atypical mycobacteria from elephant trunk wash.

    Chan, Kok-Gan; Loke, Mun Fai; Ong, Bee Lee; Wong, Yan Ling; Hong, Kar Wai; Tan, Kian Hin; Kaur, Sargit; Ng, Hien Fuh; Abdul Razak, Mfa; Ngeow, Yun Fong

    2015-01-01

    Background. Two non-tuberculous mycobacterial strains, UM_3 and UM_11, were isolated from the trunk wash of captive elephants in Malaysia. As they appeared to be identical phenotypes, they were investigated further by conventional and whole genome sequence-based methods of strain differentiation. Methods. Multiphasic investigations on the isolates included species identification with hsp65 PCR-sequencing, conventional biochemical tests, rapid biochemical profiling using API strips and the Biolog Phenotype Microarray analysis, protein profiling with liquid chromatography-mass spectrometry, repetitive sequence-based PCR typing and whole genome sequencing followed by phylogenomic analyses. Results. The isolates were shown to be possibly novel slow-growing schotochromogens with highly similar biological and genotypic characteristics. Both strains have a genome size of 5.2 Mbp, G+C content of 68.8%, one rRNA operon and 52 tRNAs each. They qualified for classification into the same species with their average nucleotide identity of 99.98% and tetranucleotide correlation coefficient of 0.99999. At the subspecies level, both strains showed 98.8% band similarity in the Diversilab automated repetitive sequence-based PCR typing system, 96.2% similarity in protein profiles obtained by liquid chromatography mass spectrometry, and a genomic distance that is close to zero in the phylogenomic tree constructed with conserved orthologs. Detailed epidemiological tracking revealed that the elephants shared a common habitat eight years apart, thus, strengthening the possibility of a clonal relationship between the two strains. PMID:26587340

  1. Gene expression profiles in skeletal muscle after gene electrotransfer

    Hojman, Pernille; Zibert, John R; Gissel, Hanne;

    2007-01-01

    BACKGROUND: Gene transfer by electroporation (DNA electrotransfer) to muscle results in high level long term transgenic expression, showing great promise for treatment of e.g. protein deficiency syndromes. However little is known about the effects of DNA electrotransfer on muscle fibres. We have...... therefore investigated transcriptional changes through gene expression profile analyses, morphological changes by histological analysis, and physiological changes by force generation measurements. DNA electrotransfer was obtained using a combination of a short high voltage pulse (HV, 1000 V/cm, 100 mus......) followed by a long low voltage pulse (LV, 100 V/cm, 400 ms); a pulse combination optimised for efficient and safe gene transfer. Muscles were transfected with green fluorescent protein (GFP) and excised at 4 hours, 48 hours or 3 weeks after treatment. RESULTS: Differentially expressed genes were...

  2. BRCA1 and BRCA2 gene testing

    The BRCA1 and BRCA2 gene test is a blood test that can tell you if you have a higher ... BRCA1 and BRCA2 are genes that suppress malignant tumors (cancer) in humans. When these genes change (become ...

  3. Gene Therapy for Diseases and Genetic Disorders

    ... Mentor Submit Your Press Release Donate Home ASGCT Gene Therapy for Diseases Gene Therapy has made important ... Among the most notable advancements are the following: Gene Therapy for Genetic Disorders Severe Combined Immune Deficiency ( ...

  4. Genes Might Explain Hispanics' Added Longevity

    ... page: https://medlineplus.gov/news/fullstory_160528.html Genes Might Explain Hispanics' Added Longevity Differences in 'genetic ... Services, or federal policy. More Health News on: Genes and Gene Therapy Hispanic American Health Recent Health ...

  5. Personalized Medicine: Matching Treatments to Your Genes

    ... disclaimer . Subscribe Personalized Medicine Matching Treatments to Your Genes You’re one of a kind. It’s not ... personalized medicine begins with the unique set of genes you inherited from your parents. Genes are stretches ...

  6. Basics on Genes and Genetic Disorders

    ... Help a Friend Who Cuts? The Basics on Genes and Genetic Disorders KidsHealth > For Teens > The Basics ... such as treating health problems. What Is a Gene? To understand how genes work, let's review some ...

  7. Correction of gene expression data

    Darbani Shirvanehdeh, Behrooz; Stewart, C. Neal, Jr.; Noeparvar, Shahin;

    2014-01-01

    This report investigates for the first time the potential inter-treatment bias source of cell number for gene expression studies. Cell-number bias can affect gene expression analysis when comparing samples with unequal total cellular RNA content or with different RNA extraction efficiencies. For...... maximal reliability of analysis, therefore, comparisons should be performed at the cellular level. This could be accomplished using an appropriate correction method that can detect and remove the inter-treatment bias for cell-number. Based on inter-treatment variations of reference genes, we introduce an...

  8. Gene networks controlling petal organogenesis.

    Huang, Tengbo; Irish, Vivian F

    2016-01-01

    One of the biggest unanswered questions in developmental biology is how growth is controlled. Petals are an excellent organ system for investigating growth control in plants: petals are dispensable, have a simple structure, and are largely refractory to environmental perturbations that can alter their size and shape. In recent studies, a number of genes controlling petal growth have been identified. The overall picture of how such genes function in petal organogenesis is beginning to be elucidated. This review will focus on studies using petals as a model system to explore the underlying gene networks that control organ initiation, growth, and final organ morphology. PMID:26428062

  9. The Ensembl gene annotation system.

    Aken, Bronwen L; Ayling, Sarah; Barrell, Daniel; Clarke, Laura; Curwen, Valery; Fairley, Susan; Fernandez Banet, Julio; Billis, Konstantinos; García Girón, Carlos; Hourlier, Thibaut; Howe, Kevin; Kähäri, Andreas; Kokocinski, Felix; Martin, Fergal J; Murphy, Daniel N; Nag, Rishi; Ruffier, Magali; Schuster, Michael; Tang, Y Amy; Vogel, Jan-Hinnerk; White, Simon; Zadissa, Amonida; Flicek, Paul; Searle, Stephen M J

    2016-01-01

    The Ensembl gene annotation system has been used to annotate over 70 different vertebrate species across a wide range of genome projects. Furthermore, it generates the automatic alignment-based annotation for the human and mouse GENCODE gene sets. The system is based on the alignment of biological sequences, including cDNAs, proteins and RNA-seq reads, to the target genome in order to construct candidate transcript models. Careful assessment and filtering of these candidate transcripts ultimately leads to the final gene set, which is made available on the Ensembl website. Here, we describe the annotation process in detail.Database URL: http://www.ensembl.org/index.html. PMID:27337980

  10. A Gene Score Test for Disease Association with Multiple Genes

    Changchun Xie

    2011-01-01

    The traditional method for creating a gene score to predict a given outcome is to use the most statistically significant single nucleotide polymorphisms (SNPs) from all SNPs which were tested. There are several disadvantages of this approach such as excluding SNPs that do not have strong single effects when tested on their own but do have strong joint effects when tested together with other SNPs. The interpretation of results from the traditional gene score may lack biological insight since t...

  11. Gene therapy of cancer by vaccines carrying inserted immunostimulatory genes

    Bubeník, Jan

    2007-01-01

    Roč. 53, č. 3 (2007), s. 71-73. ISSN 0015-5500 Grant ostatní: EU-FP6 NoE Clinigene(XE) 018933; Liga proti rakovině, Praha(CZ) XX Institutional research plan: CEZ:AV0Z50520514 Keywords : gene therapy * immunostimulatory genes * vaccine Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.596, year: 2007

  12. Parsimonious selection of useful genes in microarray gene expression data

    González Navarro, Félix Fernando; Belanche Muñoz, Luis Antonio

    2011-01-01

    Machine Learning methods have of late made significant efforts to solving multidisciplinary problems in the field of cancer classification in microarray gene expression data. These tasks are characterized by a large number of features and a few observations, making the modeling a non-trivial undertaking. In this work we apply entropic filter methods for gene selection, in combination with several off-the-shelf classifiers. The introduction of bootstrap resampling techniques permits the achiev...

  13. Viral vectors for vascular gene therapy

    Fischer, Lukas; Preis, Meir; Weisz, Anat; Koren, Belly; Lewis, Basil S; Flugelman, Moshe Y

    2002-01-01

    Vascular gene therapy is the focus of multiple experimental and clinical research efforts. While several genes with therapeutic potential have been identified, the best method of gene delivery is unknown. Viral vectors have the capacity to transfer genes at high efficiency rates. Several viral-based vectors have been used in experimental vascular gene therapy for in vivo and ex vivo gene transfer. Adenoviral-based vectors are being used for the induction of angiogenesis in phase 1 and 2 clini...

  14. Vector development for suicide gene therapy

    Aints, Alar

    2002-01-01

    Gene therapy is used to treat conditions that arise from errors in the genetic makeup of cells either congenital diseases resulting from a deletion or mutation in a gene or malignant diseases where genetic regulation mechanisms have been deranged. Suicide gene therapy is one of several gene therapeutic approaches to treat cancer. A suicide gene is a gene encoding a protein, frequently an enzyme, that in itself is non-toxic to the genetically modified cell. However, when ...

  15. Evolution of the nuclear receptor gene superfamily.

    Laudet, V; Hänni, C; Coll, J.; F. Catzeflis; Stéhelin, D

    1992-01-01

    Nuclear receptor genes represent a large family of genes encoding receptors for various hydrophobic ligands such as steroids, vitamin D, retinoic acid and thyroid hormones. This family also contains genes encoding putative receptors for unknown ligands. Nuclear receptor gene products are composed of several domains important for transcriptional activation, DNA binding (C domain), hormone binding and dimerization (E domain). It is not known whether these genes have evolved through gene duplica...

  16. Evolution of alternative splicing after gene duplication

    Su, Zhixi; Wang, Jianmin; Yu, Jun; Huang, Xiaoqiu; Gu, Xun

    2006-01-01

    Alternative splicing and gene duplication are two major sources of proteomic function diversity. Here, we study the evolutionary trend of alternative splicing after gene duplication by analyzing the alternative splicing differences between duplicate genes. We observed that duplicate genes have fewer alternative splice (AS) forms than single-copy genes, and that a negative correlation exists between the mean number of AS forms and the gene family size. Interestingly, we found that the loss of ...

  17. The evolution of resistance gene in plants

    BEN Haiyan; LIU Xuemin; LI Lijun; LIU Li

    2007-01-01

    Resistance genes enable plants to fight against plant pathogens. Plant resistance genes (R gene) are organized complexly in genome. Some resistance gene sequence data enable an insight into R gene structure and gene evolution. Some sites like Leucine-Rich Repeat (LRR) are of specific interest since homologous recombination can happen. Crossing over, transposon insertion and excision and mutation can produce new specificity. Three models explaining R gene evolution were discussed. More information needed for dissection of R gene evolution though some step can be inferred from genetic and sequence analysis.

  18. Gene discovery in Triatoma infestans

    de Burgos Nelia

    2011-03-01

    Full Text Available Abstract Background Triatoma infestans is the most relevant vector of Chagas disease in the southern cone of South America. Since its genome has not yet been studied, sequencing of Expressed Sequence Tags (ESTs is one of the most powerful tools for efficiently identifying large numbers of expressed genes in this insect vector. Results In this work, we generated 826 ESTs, resulting in an increase of 47% in the number of ESTs available for T. infestans. These ESTs were assembled in 471 unique sequences, 151 of which represent 136 new genes for the Reduviidae family. Conclusions Among the putative new genes for the Reduviidae family, we identified and described an interesting subset of genes involved in development and reproduction, which constitute potential targets for insecticide development.

  19. Gene Therapy for Parkinson's Disease

    Rachel Denyer

    2012-01-01

    Full Text Available Current pharmacological and surgical treatments for Parkinson's disease offer symptomatic improvements to those suffering from this incurable degenerative neurological disorder, but none of these has convincingly shown effects on disease progression. Novel approaches based on gene therapy have several potential advantages over conventional treatment modalities. These could be used to provide more consistent dopamine supplementation, potentially providing superior symptomatic relief with fewer side effects. More radically, gene therapy could be used to correct the imbalances in basal ganglia circuitry associated with the symptoms of Parkinson's disease, or to preserve or restore dopaminergic neurons lost during the disease process itself. The latter neuroprotective approach is the most exciting, as it could theoretically be disease modifying rather than simply symptom alleviating. Gene therapy agents using these approaches are currently making the transition from the laboratory to the bedside. This paper summarises the theoretical approaches to gene therapy for Parkinson's disease and the findings of clinical trials in this rapidly changing field.

  20. Homeobox gene expression in Brachiopoda

    Altenburger, Andreas; Martinez, Pedro; Wanninger, Andreas

    2011-01-01

    . Not is a homeobox containing gene that regulates the formation of the notochord in chordates, while Cdx (caudal) is a ParaHox gene involved in the formation of posterior tissues of various animal phyla. The T. transversa homolog, TtrNot, is expressed in the ectoderm from the beginning of gastrulation until...... (ectoderm) specification with co-opted functions in notochord formation in chordates and left/right determination in ambulacrarians and vertebrates. The caudal ortholog, TtrCdx, is first expressed in the ectoderm of the gastrulating embryo in the posterior region of the blastopore. Its expression stays...... metazoans, where genes belonging to the Cdx/caudal family are predominantly localized in posterior domains during gastrulation. Later in development this gene will play a fundamental role in the formation of posterior tissues....

  1. EGAN: exploratory gene association networks

    Paquette, Jesse; Tokuyasu, Taku

    2009-01-01

    Summary: Exploratory Gene Association Networks (EGAN) is a Java desktop application that provides a point-and-click environment for contextual graph visualization of high-throughput assay results. By loading the entire network of genes, pathways, interactions, annotation terms and literature references directly into memory, EGAN allows a biologist to repeatedly query and interpret multiple experimental results without incurring additional delays for data download/integration. Other compelling...

  2. Shuffling Yeast Gene Expression Data

    Bilke, Sven

    2000-01-01

    A new method to sort gene expression patterns into functional groups is presented. The method is based on a sorting algorithm using a non-local similarity score, which takes all other patterns in the dataset into account. The method is therefore very robust with respect to noise. Using the expression data for yeast, we extract information about functional groups. Without prior knowledge of parameters the cell cycle regulated genes in yeast can be identified. Furthermore a second, independent ...

  3. Gemini surfactants as gene carriers

    Teresa Piskorska

    2010-03-01

    Full Text Available Gemini surfactants are a new class of amphiphilic compounds built from two classic surfactant moieties bound together by a special spacer group. These compounds appear to be excellent for creating complexes with DNA and are effective in mediating transfection. Thanks to their construction, DNA carrier molecules built from gemini surfactants are able to deliver genes to cells of almost any DNA molecule size, unattainable when using viral gene delivery systems. Moreover, they are much safer for living organisms.

  4. CNS Genes Implicated in Relapse

    Freeman, Willard M; Kuntz-Melcavage, Kara L; Vrana, Kent E.

    2008-01-01

    Drug abuse is a condition that impacts not only the individual drug user, but society as a whole. Although prevention of initial drug use is the most effective way to prevent addiction, avoiding relapse is a crucial component of drug addiction recovery. Recent studies suggest that there is a set of genes whose expression is robustly and stably altered following drug use and ensuing abstinence. Such stable changes in gene expression correlate with ultrastructural changes in brain as well as al...

  5. Rice's Salt Tolerance Gene Cloned

    2005-01-01

    @@ In cooperation with US colleagues, CAS researchers have made significant progress in their studies into functional genes for key agronomic traits by cloning SKC1, a salt-tolerant functional gene of rice and making clear its biological functions and mechanisms. This pioneering work,which was reported in the Oct. issue of Nature Genetics (37:1141-1146), is believed to hold promise to increase the output of the crop plant in this country.

  6. Gene therapy in lung transplantation.

    Sato, Masaaki; Keshavjee, Shaf

    2006-08-01

    Lung transplantation is effective life-saving therapy for the treatment of a variety of end-stage lung diseases. However, the application of lung transplantation is hindered by multiple factors such as the shortage of organ donors, early graft failure and chronic graft dysfunction. These problems are related to various lung injuries before and after transplantation including donor brain-death-related lung injury, ischemia, reperfusion and immune-mediated injuries. Gene transfection presents a potential molecular therapeutic solution to modify the transplanted organ such that it is better able to deal with these obstacles. In fact, in many ways lung transplantation is an ideal situation for gene therapy in that: 1) the targeted injuries are predictable (e.g. IR injury), 2) only transient gene expression is needed in many instances, 3) the immunosuppressive regimen necessary to prevent rejection of the transplanted organ attenuates vector-induced inflammation and the immune response to the vectors or the transgene products, and thus effectively augments and prolongs gene expression; 4) the anatomical structure of the lung enables trans-airway access and local gene delivery - as well as re-transfection. A number of issues need to be considered to develop a strategy of gene delivery in lung transplantation: administration route (intra-airway, trans-vascular, intravenous, intramuscular), timing (donor in-vivo, ex-vivo organ transfection or recipient), vector selection and gene selection. Based on our work and the work of others, over the last decade, we present the state of art of in gene therapy in lung transplantation and exciting future directions in the field. PMID:16918334

  7. Vascular gene expression: a hypothesis

    Martínez-Navarro, Angélica C.; Galván-Gordillo, Santiago V.; Xoconostle-Cázares, Beatriz; Ruiz-Medrano, Roberto

    2013-01-01

    The phloem is the conduit through which photoassimilates are distributed from autotrophic to heterotrophic tissues and is involved in the distribution of signaling molecules that coordinate plant growth and responses to the environment. Phloem function depends on the coordinate expression of a large array of genes. We have previously identified conserved motifs in upstream regions of the Arabidopsis genes, encoding the homologs of pumpkin phloem sap mRNAs, displaying expression in vascular ti...

  8. Zipf's Law in Gene Expression

    Furusawa, Chikara; Kaneko, Kunihiko

    2002-01-01

    Using data from gene expression databases on various organisms and tissues, including yeast, nematodes, human normal and cancer tissues, and embryonic stem cells, we found that the abundances of expressed genes exhibit a power-law distribution with an exponent close to -1, i.e., they obey Zipf's law. Furthermore, by simulations of a simple model with an intra-cellular reaction network, we found that Zipf's law of chemical abundance is a universal feature of cells where such a network optimize...

  9. Gene therapy in clinical medicine

    Selkirk, S

    2004-01-01

    Although the field of gene therapy has experienced significant setbacks and limited success, it is one of the most promising and active research fields in medicine. Interest in this therapeutic modality is based on the potential for treatment and cure of some of the most malignant and devastating diseases affecting humans. Over the next decade, the relevance of gene therapy to medical practices will increase and it will become important for physicians to understand the basic principles and st...

  10. Transgenic Arabidopsis Gene Expression System

    Ferl, Robert; Paul, Anna-Lisa

    2009-01-01

    The Transgenic Arabidopsis Gene Expression System (TAGES) investigation is one in a pair of investigations that use the Advanced Biological Research System (ABRS) facility. TAGES uses Arabidopsis thaliana, thale cress, with sensor promoter-reporter gene constructs that render the plants as biomonitors (an organism used to determine the quality of the surrounding environment) of their environment using real-time nondestructive Green Fluorescent Protein (GFP) imagery and traditional postflight analyses.

  11. Information-processing genes

    There are an estimated 100,000 genes in the human genome of which 97% is non-coding. On the other hand, bacteria have little or no non-coding DNA. Non-coding region includes introns, ALU sequences, satellite DNA, and other segments not expressed as proteins. Why it exists? Why nature has kept non-coding during the long evolutionary period if it has no role in the development of complex life forms? Does complexity of a species somehow correlated to the existence of apparently useless sequences? What kind of capability is encoded within such nucleotide sequences that is a necessary, but not a sufficient condition for the evolution of complex life forms, keeping in mind the C-value paradox and the omnipresence of non-coding segments in higher eurkaryotes and also in many archea and prokaryotes. The physico-chemical description of biological processes is hardware oriented and does not highlight algorithmic or information processing aspect. However, an algorithm without its hardware implementation is useless as much as hardware without its capability to run an algorithm. The nature and type of computation an information-processing hardware can perform depends only on its algorithm and the architecture that reflects the algorithm. Given that enormously difficult tasks such as high fidelity replication, transcription, editing and regulation are all achieved within a long linear sequence, it is natural to think that some parts of a genome are involved is these tasks. If some complex algorithms are encoded with these parts, then it is natural to think that non-coding regions contain processing-information algorithms. A comparison between well-known automatic sequences and sequences constructed out of motifs is found in all species proves the point: noncoding regions are a sort of ''hardwired'' programs, i.e., they are linear representations of information-processing machines. Thus in our model, a noncoding region, e.g., an intron contains a program (or equivalently, it is

  12. Gene-gene, gene-environment, gene-nutrient interactions and single nucleotide polymorphisms of inflammatory cytokines

    Nadeem, Amina; Mumtaz, Sadaf; Naveed, Abdul Khaliq; Aslam, Muhammad; Siddiqui, Arif; Lodhi, Ghulam Mustafa; Ahmad, Tausif

    2015-01-01

    Inflammation plays a significant role in the etiology of type 2 diabetes mellitus (T2DM). The rise in the pro-inflammatory cytokines is the essential step in glucotoxicity and lipotoxicity induced mitochondrial injury, oxidative stress and beta cell apoptosis in T2DM. Among the recognized markers are interleukin (IL)-6, IL-1, IL-10, IL-18, tissue necrosis factor-alpha (TNF-α), C-reactive protein, resistin, adiponectin, tissue plasminogen activator, fibrinogen and heptoglobins. Diabetes mellitus has firm genetic and very strong environmental influence; exhibiting a polygenic mode of inheritance. Many single nucleotide polymorphisms (SNPs) in various genes including those of pro and anti-inflammatory cytokines have been reported as a risk for T2DM. Not all the SNPs have been confirmed by unifying results in different studies and wide variations have been reported in various ethnic groups. The inter-ethnic variations can be explained by the fact that gene expression may be regulated by gene-gene, gene-environment and gene-nutrient interactions. This review highlights the impact of these interactions on determining the role of single nucleotide polymorphism of IL-6, TNF-α, resistin and adiponectin in pathogenesis of T2DM. PMID:25987962

  13. Cationic Bolaamphiphiles for Gene Delivery

    Tan, Amelia Li Min; Lim, Alisa Xue Ling; Zhu, Yiting; Yang, Yi Yan; Khan, Majad

    2014-05-01

    Advances in medical research have shed light on the genetic cause of many human diseases. Gene therapy is a promising approach which can be used to deliver therapeutic genes to treat genetic diseases at its most fundamental level. In general, nonviral vectors are preferred due to reduced risk of immune response, but they are also commonly associated with low transfection efficiency and high cytotoxicity. In contrast to viral vectors, nonviral vectors do not have a natural mechanism to overcome extra- and intracellular barriers when delivering the therapeutic gene into cell. Hence, its design has been increasingly complex to meet challenges faced in targeting of, penetration of and expression in a specific host cell in achieving more satisfactory transfection efficiency. Flexibility in design of the vector is desirable, to enable a careful and controlled manipulation of its properties and functions. This can be met by the use of bolaamphiphile, a special class of lipid. Unlike conventional lipids, bolaamphiphiles can form asymmetric complexes with the therapeutic gene. The advantage of having an asymmetric complex lies in the different purposes served by the interior and exterior of the complex. More effective gene encapsulation within the interior of the complex can be achieved without triggering greater aggregation of serum proteins with the exterior, potentially overcoming one of the great hurdles faced by conventional single-head cationic lipids. In this review, we will look into the physiochemical considerations as well as the biological aspects of a bolaamphiphile-based gene delivery system.

  14. Origin and evolution of new genes

    LI Xin; YANG Shuang; PENG Lixin; CHEN Hong; WANG Wen

    2004-01-01

    Organisms have variable genome sizes andcontain different numbers of genes. This difference demonstrates that new gene origination is a fundamental process in evolutionary biology. Though the study of the origination of new genes dated back more than half a century ago, it is not until the 1990s when the first young genejingwei was found that empirical investigation of the molecular mechanisms of origination of new genes became possible. In the recent years,several young genes were identified and the studies on these genes have greatly enriched the knowledge of this field. Yet more details in a general picture of new genes origination are to be clarified. We have developed a systematic approach to searching for young genes at the genomic level, in the hope to summarize a general pattern of the origination and evolution of new genes, such as the rate of new gene appearance, impact of new genes on their host genomes, etc.

  15. Newer Gene Editing Technologies toward HIV Gene Therapy

    Premlata Shankar

    2013-11-01

    Full Text Available Despite the great success of highly active antiretroviral therapy (HAART in ameliorating the course of HIV infection, alternative therapeutic approaches are being pursued because of practical problems associated with life-long therapy. The eradication of HIV in the so-called “Berlin patient” who received a bone marrow transplant from a CCR5-negative donor has rekindled interest in genome engineering strategies to achieve the same effect. Precise gene editing within the cells is now a realistic possibility with recent advances in understanding the DNA repair mechanisms, DNA interaction with transcription factors and bacterial defense mechanisms. Within the past few years, four novel technologies have emerged that can be engineered for recognition of specific DNA target sequences to enable site-specific gene editing: Homing Endonuclease, ZFN, TALEN, and CRISPR/Cas9 system. The most recent CRISPR/Cas9 system uses a short stretch of complementary RNA bound to Cas9 nuclease to recognize and cleave target DNA, as opposed to the previous technologies that use DNA binding motifs of either zinc finger proteins or transcription activator-like effector molecules fused to an endonuclease to mediate sequence-specific DNA cleavage. Unlike RNA interference, which requires the continued presence of effector moieties to maintain gene silencing, the newer technologies allow permanent disruption of the targeted gene after a single treatment. Here, we review the applications, limitations and future prospects of novel gene-editing strategies for use as HIV therapy.

  16. Sequencing and Gene Expression Analysis of Leishmania tropica LACK Gene.

    Nour Hammoudeh

    2014-12-01

    Full Text Available Leishmania Homologue of receptors for Activated C Kinase (LACK antigen is a 36-kDa protein, which provokes a very early immune response against Leishmania infection. There are several reports on the expression of LACK through different life-cycle stages of genus Leishmania, but only a few of them have focused on L.tropica.The present study provides details of the cloning, DNA sequencing and gene expression of LACK in this parasite species. First, several local isolates of Leishmania parasites were typed in our laboratory using PCR technique to verify of Leishmania parasite species. After that, LACK gene was amplified and cloned into a vector for sequencing. Finally, the expression of this molecule in logarithmic and stationary growth phase promastigotes, as well as in amastigotes, was evaluated by Reverse Transcription-PCR (RT-PCR technique.The typing result confirmed that all our local isolates belong to L.tropica. LACK gene sequence was determined and high similarity was observed with the sequences of other Leishmania species. Furthermore, the expression of LACK gene in both promastigotes and amastigotes forms was confirmed.Overall, the data set the stage for future studies of the properties and immune role of LACK gene products.

  17. The biology of novel animal genes: Mouse APEX gene knockout

    MacInnes, M.; Altherr, M.R.; Ludwig, D. [Los Alamos National Lab., NM (United States); Pedersen, R.; Mold, C. [Univ. of California, San Francisco, CA (United States)

    1997-07-01

    This is the final report of a one-year, Laboratory Directed Research and Development (LDRD) project at the Los Alamos National Laboratory (LANL). The controlled breeding of novel genes into mice, including the gene knockout (KO), or conversely by adding back transgenes provide powerful genetic technologies that together suffice to determine in large part the biological role(s) of novel genes. Inbred mouse remains the best understood and most useful mammalian experimental system available for tackling the biology of novel genes. The major mammalian apurinic/apyrimidinic (AP) endonuclease (APE), is involved in a key step in the repair of spontaneous and induced AP sites in DNA. Efficient repair of these lesions is imperative to prevent the stable incorporation of mutations into the cellular genome which may lead to cell death or transformation. Loss or modulation of base excison repair activity in vivo may elevate the spontaneous mutation rate in cells, and may lead to a substantial increase in the incidence of cancer. Despite extensive biochemical analysis, however, the significance of these individual APE functions in vivo has not been elucidated. Mouse embryonic stem (ES) cells heterozygous for a deletion mutation in APE have been generated and whole animals containing the APE mutation have been derived from these ES cells. Animals homozygous for the APE null mutation die early in gestation, underscoring the biological significance of this DNA repair gene.

  18. Noninvasive tracking of gene transcript and neuroprotection after gene therapy.

    Ren, J; Chen, Y I; Liu, C H; Chen, P-C; Prentice, H; Wu, J-Y; Liu, P K

    2016-01-01

    Gene therapy holds exceptional potential for translational medicine by improving the products of defective genes in diseases and/or providing necessary biologics from endogenous sources during recovery processes. However, validating methods for the delivery, distribution and expression of the exogenous genes from such therapy can generally not be applicable to monitor effects over the long term because they are invasive. We report here that human granulocyte colony-stimulating factor (hG-CSF) complimentary DNA (cDNA) encoded in self-complementary adeno-associated virus-type 2 adeno-associated virus, as delivered through eye drops at multiple time points after cerebral ischemia using bilateral carotid occlusion for 60 min (BCAO-60) led to significant reduction in mortality rates, cerebral atrophy and neurological deficits in C57black6 mice. Most importantly, we validated hG-CSF cDNA expression using translatable magnetic resonance imaging (MRI) in living brains. This noninvasive approach for monitoring exogenous gene expression in the brains has potential for great impact in the area of experimental gene therapy in animal models of heart attack, stroke, Alzheimer's dementia, Parkinson's disorder and amyotrophic lateral sclerosis, and the translation of such techniques to emergency medicine. PMID:26207935

  19. Divergence of Gene Body DNA Methylation and Evolution of Plant Duplicate Genes

    Wang, Jun; Marowsky, Nicholas C.; Fan, Chuanzhu

    2014-01-01

    It has been shown that gene body DNA methylation is associated with gene expression. However, whether and how deviation of gene body DNA methylation between duplicate genes can influence their divergence remains largely unexplored. Here, we aim to elucidate the potential role of gene body DNA methylation in the fate of duplicate genes. We identified paralogous gene pairs from Arabidopsis and rice (Oryza sativa ssp. japonica) genomes and reprocessed their single-base resolution methylome data....

  20. A gene sets approach for identifying prognostic gene signatures for outcome prediction

    Kim Yong Sung; Kim Seon-Young

    2008-01-01

    Abstract Background Gene expression profiling is a promising approach to better estimate patient prognosis; however, there are still unresolved problems, including little overlap among similarly developed gene sets and poor performance of a developed gene set in other datasets. Results We applied a gene sets approach to develop a prognostic gene set from multiple gene expression datasets. By analyzing 12 independent breast cancer gene expression datasets comprising 1,756 tissues with 2,411 pr...

  1. Virus-induced gene silencing of Arabidopsis thaliana gene homologues in wheat identifies genes conferring improved drought tolerance

    Manmathan, Harish; Shaner, Dale; Snelling, Jacob; Tisserat, Ned; Lapitan, Nora

    2013-01-01

    In a non-model staple crop like wheat (Triticum aestivumI L.), functional validation of potential drought stress responsive genes identified in Arabidopsis could provide gene targets for breeding. Virus-induced gene silencing (VIGS) of genes of interest can overcome the inherent problems of polyploidy and limited transformation potential that hamper functional validation studies in wheat. In this study, three potential candidate genes shown to be involved in abiotic stress response pathways i...

  2. Integrating heterogeneous gene expression data for gene regulatory network modelling.

    Sîrbu, Alina; Ruskin, Heather J; Crane, Martin

    2012-06-01

    Gene regulatory networks (GRNs) are complex biological systems that have a large impact on protein levels, so that discovering network interactions is a major objective of systems biology. Quantitative GRN models have been inferred, to date, from time series measurements of gene expression, but at small scale, and with limited application to real data. Time series experiments are typically short (number of time points of the order of ten), whereas regulatory networks can be very large (containing hundreds of genes). This creates an under-determination problem, which negatively influences the results of any inferential algorithm. Presented here is an integrative approach to model inference, which has not been previously discussed to the authors' knowledge. Multiple heterogeneous expression time series are used to infer the same model, and results are shown to be more robust to noise and parameter perturbation. Additionally, a wavelet analysis shows that these models display limited noise over-fitting within the individual datasets. PMID:21948152

  3. How Gene Patents May Inhibit Scientific Research

    Campo-Engelstein, Lisa; Chan, Tiffany

    2015-01-01

    In this paper, we point out three possible ways gene patents could impede scientific research. First, gene patent laws might exacerbate the culture of secrecy ubiquitous in science. Second, gene patents may limit researchers’ ability to study poly or multigenic diseases without access to all genetic etiologies. Third, gene patents could result in a “patent thicket”.

  4. How Gene Patents May Inhibit Scientific Research

    Campo-Engelstein, Lisa

    2015-02-01

    Full Text Available In this paper, we point out three possible ways gene patents could impede scientific research. First, gene patent laws might exacerbate the culture of secrecy ubiquitous in science. Second, gene patents may limit researchers’ ability to study poly or multigenic diseases without access to all genetic etiologies. Third, gene patents could result in a “patent thicket”.

  5. Deregulated genes in sporadic vestibular schwannomas

    Cayé-Thomasen, Per; Helweg-Larsen, Rehannah Holga Andrea; Stangerup, Sven-Eric;

    2010-01-01

    In search of genes associated with vestibular schwannoma tumorigenesis, this study examines the gene expression in human vestibular nerve versus vestibular schwannoma tissue samples using microarray technology.......In search of genes associated with vestibular schwannoma tumorigenesis, this study examines the gene expression in human vestibular nerve versus vestibular schwannoma tissue samples using microarray technology....

  6. Gene therapy and radiotherapy in malignant tumor

    Tumor treatment is one of the most important fields in medical research. Nowadays, a novel method which is combined gene therapy with radiotherapy plays an important role in the field of cancer research, and mainly includes immune gene therapy combined with radiotherapy, suicide gene therapy or tumor suppressor gene therapy combined with radiotherapy, antiangiogenesis gene therapy combined with radiotherapy and protective gene therapy combined with radiotherapy based on the technical features. This review summarized the current status of combined therapies of gene therapy and radiotherapy and possible mechanism. (authors)

  7. The early stages of duplicate gene evolution

    Moore, Richard C; Purugganan, Michael D.

    2003-01-01

    Gene duplications are one of the primary driving forces in the evolution of genomes and genetic systems. Gene duplicates account for 8–20% of the genes in eukaryotic genomes, and the rates of gene duplication are estimated at between 0.2% and 2% per gene per million years. Duplicate genes are believed to be a major mechanism for the establishment of new gene functions and the generation of evolutionary novelty, yet very little is known about the early stages of the evolution of duplicated gen...

  8. FINDING GENERIFS VIA GENE ONTOLOGY ANNOTATIONS

    Lu, Zhiyong; Cohen, K Bretonnel; Hunter, Lawrence

    2006-01-01

    A Gene Reference Into Function (GeneRIF) is a concise phrase describing a function of a gene in the Entrez Gene database. Applying techniques from the area of natural language processing known as automatic summarization, it is possible to link the Entrez Gene database, the Gene Ontology, and the biomedical literature. A system was implemented that automatically suggests a sentence from a PubMed/MEDLINE abstract as a candidate GeneRIF by exploiting a gene’s GO annotations along with location f...

  9. Integrones: los coleccionistas de genes Integrons: gene collectors

    J. A. Di Conza; Gutkind, G. O.

    2010-01-01

    Los integrones son estructuras genéticas que han despertado gran interés, debido a que algunos de ellos vehiculizan genes de resistencia a los antimicrobianos. Están formados por un fragmento que codifica una integrasa (intI) y, a continuación, una secuencia attI a la que se unen los genes en casetes que codifican diferentes mecanismos de resistencia. Dentro de intI, en su extremo 3´, hay una secuencia promotora Pc a partir de la cual se transcriben los casetes de resistencia integrados, ya q...

  10. The KCNE genes in hypertrophic cardiomyopathy: a candidate gene study

    Hedley, Paula L; Haundrup, Ole; Andersen, Paal S;

    2011-01-01

    The gene family KCNE1-5, which encode modulating β-subunits of several repolarising K+-ion channels, has been associated with genetic cardiac diseases such as long QT syndrome, atrial fibrillation and Brugada syndrome. The minK peptide, encoded by KCNE1, is attached to the Z-disc of the sarcomere...... as well as the T-tubules of the sarcolemma. It has been suggested that minK forms part of an "electro-mechanical feed-back" which links cardiomyocyte stretching to changes in ion channel function. We examined whether mutations in KCNE genes were associated with hypertrophic cardiomyopathy (HCM), a...

  11. Advancement and prospects of tumor gene therapy

    Chao Zhang; Qing-Tao Wang; He Liu; Zhen-Zhu Zhang; Wen-Lin Huang

    2011-01-01

    Gene therapy is one of the most attractive fields in tumor therapy. In past decades, significant progress has been achieved. Various approaches, such as viral and non-viral vectors and physical methods, have been developed to make gene delivery safer and more efficient. Several therapeutic strategies have evolved, including gene-based (tumor suppressor genes, suicide genes, antiangiogenic genes, cytokine and oxidative stress-based genes) and RNA-based (antisense oligonucieotides and RNA interference) approaches. In addition, immune response-based strategies (dendritic cell- and T cell-based therapy) are also under investigation in tumor gene therapy. This review highlights the progress and recent developments in gene delivery systems, therapeutic strategies, and possible clinical directions for gene therapy.

  12. Transcriptional stochasticity in gene expression.

    Lipniacki, Tomasz; Paszek, Pawel; Marciniak-Czochra, Anna; Brasier, Allan R; Kimmel, Marek

    2006-01-21

    Due to the small number of copies of molecular species involved, such as DNA, mRNA and regulatory proteins, gene expression is a stochastic phenomenon. In eukaryotic cells, the stochastic effects primarily originate in regulation of gene activity. Transcription can be initiated by a single transcription factor binding to a specific regulatory site in the target gene. Stochasticity of transcription factor binding and dissociation is then amplified by transcription and translation, since target gene activation results in a burst of mRNA molecules, and each mRNA copy serves as a template for translating numerous protein molecules. In the present paper, we explore a mathematical approach to stochastic modeling. In this approach, the ordinary differential equations with a stochastic component for mRNA and protein levels in a single cells yield a system of first-order partial differential equations (PDEs) for two-dimensional probability density functions (pdf). We consider the following examples: Regulation of a single auto-repressing gene, and regulation of a system of two mutual repressors and of an activator-repressor system. The resulting PDEs are approximated by a system of many ordinary equations, which are then numerically solved. PMID:16039671

  13. Molecular Studies on Preproinsulin Gene

    Sabir Sarah

    2016-01-01

    Full Text Available Insulin plays an important role in maintaining the blood glucose level of the body. The β-cells of pancreas produce insulin in the form of precursor that is preproinsulin. The gene of preproinsulin provides an interesting system for addressing question related to molecular evolution. Recombinant DNA technology has made it possible to isolate and sequence the chromosomal genes coding for unique protein products. Although preproinsulin of various organism has been isolated and cloned, but there is no report from buffalo (Bubalus bubalis that is our major livestock. The genomic DNA of buffalo was isolated using Laura-Lee-Boodram method. The part of preproinsulin gene (596bp and 520bp using BPPI-UPS and bpiful_F as forward and BC1-C as reverse primer was amplified. Cloning of amplified fragments of gene were performed in pCR 2.1 vector. Positive clones were screened on the basis of blue white selection. The band obtained on 596bp and 520bp after colony PCR confirmed the successful cloning of preproinsulin gene in pCR 2.1 vector.

  14. Melatonin Receptor Genes in Vertebrates

    Hua Dong Yin

    2013-05-01

    Full Text Available Melatonin receptors are members of the G protein-coupled receptor (GPCR family. Three genes for melatonin receptors have been cloned. The MT1 (or Mel1a or MTNR1A and MT2 (or Mel1b or MTNR1B receptor subtypes are present in humans and other mammals, while an additional melatonin receptor subtype, Mel1c (or MTNR1C, has been identified in fish, amphibians and birds. Another melatonin related orphan receptor, GPR50, which does not bind melatonin, is found exclusively in mammals. The hormone melatonin is secreted primarily by the pineal gland, with highest levels occurring during the dark period of a circadian cycle. This hormone acts systemically in numerous organs. In the brain, it is involved in the regulation of various neural and endocrine processes, and it readjusts the circadian pacemaker, the suprachiasmatic nucleus. This article reviews recent studies of gene organization, expression, evolution and mutations of melatonin receptor genes of vertebrates. Gene polymorphisms reveal that numerous mutations are associated with diseases and disorders. The phylogenetic analysis of receptor genes indicates that GPR50 is an outgroup to all other melatonin receptor sequences. GPR50 may have separated from a melatonin receptor ancestor before the split between MTNR1C and the MTNR1A/B ancestor.

  15. Gene amplification during myogenic differentiation

    Fischer, Ulrike; Ludwig, Nicole; Raslan, Abdulrahman; Meier, Carola; Meese, Eckart

    2016-01-01

    Gene amplifications are mostly an attribute of tumor cells and drug resistant cells. Recently, we provided evidence for gene amplifications during differentiation of human and mouse neural progenitor cells. Here, we report gene amplifications in differentiating mouse myoblasts (C2C12 cells) covering a period of 7 days including pre-fusion, fusion and post-fusion stages. After differentiation induction we found an increase in copy numbers of CDK4 gene at day 3, of NUP133 at days 4 and 7, and of MYO18B at day 4. The amplification process was accompanied by gamma-H2AX foci that are indicative of double stand breaks. Amplifications during the differentiating process were also found in primary human myoblasts with the gene CDK4 and NUP133 amplified both in human and mouse myoblasts. Amplifications of NUP133 and CDK4 were also identified in vivo on mouse transversal cryosections at stage E11.5. In the course of myoblast differentiation, we found amplifications in cytoplasm indicative of removal of amplified sequences from the nucleus. The data provide further evidence that amplification is a fundamental mechanism contributing to the differentiation process in mammalians. PMID:26760505

  16. Species-specific engagement of human nucleotide oligomerization domain 2 (NOD)2 and Toll-like receptor (TLR) signalling upon intracellular bacterial infection: role of Crohn's associated NOD2 gene variants.

    Salem, M; Seidelin, J B; Eickhardt, S; Alhede, M; Rogler, G; Nielsen, O H

    2015-03-01

    Recognition of bacterial peptidoglycan-derived muramyl-dipeptide (MDP) by nucleotide oligomerization domain 2 (NOD2) induces crucial innate immune responses. Most bacteria carry the N-acetylated form of MDP (A-MDP) in their cell membranes, whereas N-glycolyl MDP (G-MDP) is typical for mycobacteria. Experimental murine studies have reported G-MDP to have a greater NOD2-stimulating capacity than A-MDP. As NOD2 polymorphisms are associated with Crohn's disease (CD), a link has been suggested between mycobacterial infections and CD. Thus, the aim was to investigate if NOD2 responses are dependent upon type of MDP and further to determine the role of NOD2 gene variants for the bacterial recognition in CD. The response pattern to A-MDP, G-MDP, Mycobacterium segmatis (expressing mainly G-MDP) and M. segmatisΔnamH (expressing A-MDP), Listeria monocytogenes (LM) (an A-MDP-containing bacteria) and M. avium paratuberculosis (MAP) (a G-MDP-containing bacteria associated with CD) was investigated in human peripheral blood mononuclear cells (PBMCs). A-MDP and M. segmatisΔnamH induced significantly higher tumour necrosis factor (TNF)-α protein levels in healthy wild-type NOD2 PBMCs compared with G-MDP and M. segmatis. NOD2 mutations resulted in a low tumour necrosis factor (TNF)-α protein secretion following stimulation with LM. Contrary to this, TNF-α levels were unchanged upon MAP stimulation regardless of NOD2 genotype and MAP solely activated NOD2- and Toll-like receptor (TLRs)-pathway with an enhanced production of interleukin (IL)-1β and IL-10. In conclusion, the results indicate that CD-associated NOD2 deficiencies might affect the response towards a broader array of commensal and pathogenic bacteria expressing A-MDP, whereas they attenuate the role of mycobacteria in the pathogenesis of CD. PMID:25335775

  17. Genes Contributing to the Development of Alcoholism

    Edenberg, Howard J

    2012-01-01

    Genetic factors (i.e., variations in specific genes) account for a substantial portion of the risk for alcoholism. However, identifying those genes and the specific variations involved is challenging. Researchers have used both case–control and family studies to identify genes related to alcoholism risk. In addition, different strategies such as candidate gene analyses and genome-wide association studies have been used. The strongest effects have been found for specific variants of genes that...

  18. Microarray Data Analysis of Gene Expression Evolution

    Honghuang Lin

    2009-01-01

    Microarrays are becoming a widely used tool to study gene expression evolution. A recent paper by Wang and Rekaya describes a comprehensive study of gene expression evolution by microarray.1 The work provides a perspective to study gene expression evolution in terms of functional enrichment and promoter conservation. It was found that gene expression patterns are highly conserved in some biological processes, but the correlation between promoter and gene expression is insignificant. This scop...

  19. Concerted evolution of human amylase genes.

    Gumucio, D L; Wiebauer, K; Caldwell, R M; Samuelson, L C; Meisler, M H

    1988-01-01

    Cosmid clones containing 250 kilobases of genomic DNA from the human amylase gene cluster have been isolated. These clones contain seven distinct amylase genes which appear to comprise the complete multigene family. By sequence comparison with the cDNAs, we have identified two pancreatic amylase genes and three salivary amylase genes. Two truncated pseudogenes were also recovered. Intergenic distances of 17 to 22 kilobases separate the amylase gene copies. Within the past 10 million years, du...

  20. GENE THERAPY AND ITS IMPLICATIONS IN SPORTS

    Biljana Vitošević

    2011-01-01

    Thanks to the very successful Human Genome Project and the identification of genes involved in genetic disease, we now have the ability to treat many conditions. However, the identification of the genes which code certain phenotype characteristics has opened the way for abuse in the fields of sport and physical exercise. The principles of gene therapy and the ways in which genes are transferred have completely been copied from gene therapy and are now being used to increase the physical abili...