
Electroporation of Alcaligenes eutrophus with (mega) plasmids and genomic DNA fragments. (United States)

Electroporation was used as a tool to explore the genetics of the heavy-metal-resistant strain Alcaligenes eutrophus CH34. A 12.9-kb A. eutrophus-Escherichia coli shuttle vector, pMOL850, was constructed to optimize electroporation conditions. This vector is derived from the E. coli plasmid pSUP202 and contains the replication region of the A. eutrophus megaplasmid pMOL28. Electroporation was used to transform A. eutrophus CH34 derivatives with megaplasmids (sizes up to 240 kb), and transformants were selected for resistance to heavy metals. Electroporation was also performed with endonuclease-digested genomic DNA. Transformation of markers affecting lysine biosynthesis (lysA194) and biosynthesis of the siderophore alcaligin E were observed. Transfer of the nonselected markers pheB332 and aro-333, linked to lysA194, confirmed the intervention of homologous recombination. However, during transformation of ale::Tn5-Tc, illegitimate recombination and transposition were also observed as an alternative for the inheritance of the Tn5-Tc markers. PMID:7986037

Taghavi, S; van der Lelie, D; Mergeay, M



Cereulide synthetase gene cluster from emetic Bacillus cereus: Structure and location on a mega virulence plasmid related to Bacillus anthracis toxin plasmid pXO1  

Directory of Open Access Journals (Sweden)

Full Text Available Abstract Background Cereulide, a depsipeptide structurally related to valinomycin, is responsible for the emetic type of gastrointestinal disease caused by Bacillus cereus. Recently, it has been shown that this toxin is produced by a nonribosomal peptide synthetase (NRPS, but its exact genetic organization and biochemical synthesis is unknown. Results The complete sequence of the cereulide synthetase (ces gene cluster, which encodes the enzymatic machinery required for the biosynthesis of cereulide, was dissected. The 24 kb ces gene cluster comprises 7 CDSs and includes, besides the typical NRPS genes like a phosphopantetheinyl transferase and two CDSs encoding enzyme modules for the activation and incorporation of monomers in the growing peptide chain, a CDS encoding a putative hydrolase in the upstream region and an ABC transporter in the downstream part. The enzyme modules responsible for incorporation of the hydroxyl acids showed an unusual structure while the modules responsible for the activation of the amino acids Ala and Val showed the typical domain organization of NRPS. The ces gene locus is flanked by genetic regions with high homology to virulence plasmids of B. cereus, Bacillus thuringiensis and Bacillus anthracis. PFGE and Southern hybridization showed that the ces genes are restricted to emetic B. cereus and indeed located on a 208 kb megaplasmid, which has high similarities to pXO1-like plasmids. Conclusion The ces gene cluster that is located on a pXO1-like virulence plasmid represents, beside the insecticidal and the anthrax toxins, a third type of B. cereus group toxins encoded on megaplasmids. The ces genes are restricted to emetic toxin producers, but pXO1-like plasmids are also present in emetic-like strains. These data might indicate the presence of an ancient plasmid in B. cereus which has acquired different virulence genes over time. Due to the unusual structure of the hydroxyl acid incorporating enzyme modules of Ces, substantial biochemical efforts will be required to dissect the complete biochemical pathway of cereulide synthesis.

Wagner Martin



Correlative Association between Resident Plasmids and the Host Chromosome in a Diverse Agrobacterium Soil Population (United States)

Soil samples collected from a fallow field which had not been cultivated for 5 years harbored a population of Agrobacterium spp. estimated at 3 × 107 CFU/g. Characterization of 72 strains selected from four different isolation media showed the presence of biovar 1 (56%) and bv. 2 (44%) strains. Pathogenicity assays on five different test plants revealed a high proportion (33%) of tumorigenic strains in the resident population. All tumorigenic strains belonged to bv. 1. Differentiation of the strains by restriction fragment length polymorphism analysis, sodium dodecyl sulfate-polyacrylamide gel electrophoresis of cellular proteins, and utilization patterns of 95 carbon substrates (Biolog GN microplate) revealed a diversified bv. 1 population, composed of five distinct chromosomal backgrounds (chr A, C, D, E, and F), and a homogeneous bv. 2 population (chr B). chr A, B, C, and D were detected at similar levels throughout the study site. According to opine metabolism, pathogenicity, and agrocin sensitivity, chr A strains carried a nopaline Ti plasmid (pTi), whereas chr C strains had an octopine pTi. In addition, four of six nontumorigenic bv. 1 strains (two chr D, one chr E, and one chr F) had distinct and unusual opine catabolism patterns. chr B (bv. 2) strains were nonpathogenic and catabolized nopaline. Although agrocin sensitivity is a pTi-borne trait, 14 chr B strains were sensitive to agrocin 84, apparently harboring a defective nopaline pTi similar to pAtK84b. The other two chr B strains were agrocin resistant. The present analysis of chromosomal and plasmid phenotypes suggests that in this Agrobacterium soil population, there is a preferential association between the resident plasmids and their bacterial host. Images PMID:16348927

Bouzar, Hacène; Ouadah, Djaouida; Krimi, Zoulikha; Jones, Jeffrey B.; Trovato, Maurizio; Petit, Annik; Dessaux, Yves



Resident enhanced repair: novel repair process action on plasmid DNA transformed into Escherichia coli K-12  

International Nuclear Information System (INIS)

The survival of UV-irradiated DNA of plasmid NTP16 was monitored after its transformation into recipient cells containing an essentially homologous undamaged plasmid, pLV9. The presence of pLV9 resulted in a substantial increase in the fraction of damaged NTP16 molecules which survived in the recipient cells. This enhanced survival requires the host uvrA+ and uvrB+ gene products, but not the host recA+ gene product. The requirement for both homologous DNA and the uvrA+ gene products suggests that a novel repair process may act on plasmid DNA. Possible mechanisms for this process are considered


Correlative Association between Resident Plasmids and the Host Chromosome in a Diverse Agrobacterium Soil Population  


Soil samples collected from a fallow field which had not been cultivated for 5 years harbored a population of Agrobacterium spp. estimated at 3 × 107 CFU/g. Characterization of 72 strains selected from four different isolation media showed the presence of biovar 1 (56%) and bv. 2 (44%) strains. Pathogenicity assays on five different test plants revealed a high proportion (33%) of tumorigenic strains in the resident population. All tumorigenic strains belonged to bv. 1. Differentiation of the...

Bouzar, Hace?ne; Ouadah, Djaouida; Krimi, Zoulikha; Jones, Jeffrey B.; Trovato, Maurizio; Petit, Annik; Dessaux, Yves



Transfer of Herb-Resistance Plasmid From Escherichia coli to Staphylococcus aureus Residing in the Human Urinary Tract  

Directory of Open Access Journals (Sweden)

Full Text Available Background:: Plasmid transfer among bacteria provides a means for dissemination of resistance. Plasmid Analysis has made it possible to track plasmids that induce resistance in bacterial population. Objectives:: To screen the presence of herb-resistance plasmid in Escherichia coli strains and determine the transferability of this resistance plasmid directly from E. coli to the Gram-positive, Staphylococcus aureus. Materials and Methods:: The donor strain E. coli CP9 and recipient strain S. aureus RN450RF were isolated from UTI patients. E. coli CP9 was highly resistant to herbal concoction. Isolates of S. aureus RN450RF were fully susceptible. Total plasmid DNA was prepared and transferred into E. coli DH5?. Transconjugants were selected on agar plates containing serial dilutions of herbal concoction. Resistance plasmid was transferred to susceptible S. aureus RN450RFin triple replicas. The mating experiments were repeated twice. Results:: The identified 45 kb herb-resistance plasmid could be transferred from E. coli CP9 isolates to E. coli DH5?. As a consequence E. coli DH5? transconjugant MIC increased from 0.0125 g/mL to 0.25 g/mL. The plasmid was easily transferred from E. coli CP9 strain to S. aureus RN450RF with a mean transfer rate of 1×10-2 transconjugants/recipient. The E. coli donor and the S. aureus RN450RF transconjugant contained a plasmid of the same size, which was absent in the recipient before mating. Susceptibility testing showed that the S. aureus RN450RF transconjugant was resistant to herbal concoction. Conclusions:: E. coli herb-resistance plasmid can replicate and be expressed in S. aureus. Keywords: Escherichia coli; Resistance; Plasmid

Yan Qing Tong



Interactions between octopine and nopaline plasmids in Agrobacterium tumefaciens.  


Transfer of octopine Ti plasmids to strains already carrying an octopine Ti plasmid was found to occur at the same (high) frequency as transfer to Ti plasmid lacking recipients, showing that resident Ti plasmids do not exhibit entry exclusion towards incoming Ti plasmids. The resident octopine Ti plasmid was lost by the recipient after the entrance of the incoming Ti plasmid, which is indicative of the incompatibility between the Ti plasmids. Octopine Ti plasmids were found to become establis...

Hooykaas, P. J.; Den Dulk-ras, H.; Ooms, G.; Schilperoort, R. A.



The genetic organization and evolution of the broad host range mercury resistance plasmid pSB102 isolated from a microbial population residing in the rhizosphere of alfalfa  


Employing the biparental exogenous plasmid isolation method, conjugative plasmids conferring mercury resistance were isolated from the microbial community of the rhizosphere of field grown alfalfa plants. Five different plasmids were identified, designated pSB101–pSB105. One of the plasmids, pSB102, displayed broad host range (bhr) properties for plasmid replication and transfer unrelated to the known incompatibility (Inc) groups of bhr plasmids IncP-1, IncW, IncN and IncA/C. Nucleotide seq...

Schneiker, Susanne; Keller, Mathias; Dro?ge, Marcus; Lanka, Erich; Pu?hler, Alfred; Selbitschka, Werner



The mega cisterna magna. (United States)

Eleven cases of enlarged cisterna magna were found in a series of 3000 computerized tomography scans. We believe mega cisterna magna by itself is not related to any specific symptoms and may not require further study or treatment. PMID:624967

Adam, R; Greenberg, J O



Dr. MegaVolt (United States)

This website contains information about Tesla coil demonstrations by particle physicist Austin Richards--Dr. MegaVolt--who performs wearing a metal suit that protects him from the multi-kilovolt electrostatic potentials. The gallery provides videos and images from Dr. MegaVolt demonstrations. An explanation of the physics of the Tesla coil is supplied along with information about the development of the suit.



Muonium and MEGA  

International Nuclear Information System (INIS)

Two types of experiments on muonium are described. The first measures the hyperfine structure interval in muonium, and the second measures the Lamb shift. Another type of experiment is described which searches for the transition (?+e-)?(?-e+). The MEGA experiment is then discussed which searches for the reaction ? ? e + ?. 13 figs., 3 refs


Mega cisterna magna  

Energy Technology Data Exchange (ETDEWEB)

Computerized tomography (CT) has made it possible to discover various uncommon intracranial structures and to elucidate the morbidity of these pathophysiological conditions. The mega cisterna magna is an example of such a structure being widely known, but the incidence and morbidity being uncertain. Since the mega cisterna magna has shown no special symptoms and signs and does not require any surgical treatment, it was not necessary to diagnose it property before the establishment of routine examination by CT. From April 1979 to June 1980; a total of 2089 patients were examined by CT; of these, 9 cases (0.43%) of mega cisterna magna were identified. The symptoms and signs of those 9 patients were headache, vertigo, nausea, right hemiparesis, convulsive seizure, hyperventilation syndrome, and tremor. One patient was examined for head injury. A plain craniogram revealed a thinness of the occipital bone in 2 cases. The sizes of the mega cisterna magna appearing on CT were from 1.0 x 1.5 cm to 3.5 x 4.0 cm at the level of +40 -60 mm from the plane of the 0/sup 0/ OM line. The craniotomy was performed on one patient who was suspected of having arachnoiditis in the posterior fossa.

Kumagai, Y.; Yamakawa, K.; Tsujita, Y.; Sugiyama, H.; Nawata, H. (Ebara Metropolitan Hospital, Tokyo (Japan))



Aircushion Supported Mega-Floaters:  


The increase of the global population and expanding coastal mega-cities will necessitate an innovative pursuit of the utilization of the ocean space in which mega-floaters will play an important role in the future. These types of structures are very large floating artificial islands that can be used for various facilities and purposes similar to those on land. Compared to landfill methods mega-floaters generally have a smaller environmental impact than traditional land reclamation projects. T...

Kessel, J. L. F.



The mega cisterna magna  

International Nuclear Information System (INIS)

Reported here are 5 cases of large cisterna magna (mega cisterna magna MCM), MCM has been known commonly to be of radiological interest; a consideration of the literature and of our clinical results has shown that: (1) CT reveals an omega-shaped low-density area in the posterior part of the posterior fossa, without any effect of contrast enhancement. (2) Usually MCM has no mass effect except when it shows the valve phenomenon. (3) MCM by itself has no relation with any specific symptoms and may not require further examination or treatment. CT is a non-invasive method, available for the screening examination of out-patients; the opportunity to locate MCM with exactitude increases with the use of CT. (author)


Mega cisterna magna  

Energy Technology Data Exchange (ETDEWEB)

Reported here are 5 cases of large cisterna magna (mega cisterna magna MCM), MCM has been known commonly to be of radiological interest; a consideration of the literature and of our clinical results has shown that: (1) CT reveals an omega-shaped low-density area in the posterior part of the posterior fossa, without any effect of contrast enhancement. (2) Usually MCM has no mass effect except when it shows the valve phenomenon. (3) MCM by itself has no relation with any specific symptoms and may not require further examination or treatment. CT is a non-invasive method, available for the screening examination of out-patients; the opportunity to locate MCM with exactitude increases with the use of CT.

Suzuki, M.; Ebina, K. (Hirosaki Univ., Aomori (Japan). School of Medicine); Harata, N.



Photon detector for MEGA  

International Nuclear Information System (INIS)

During the past year, we have continued work on the photon detector for the MEGA experiment at Los Alamos, a search for the rare decay ? ? e? to a sensitivity of a few parts in 1013. The MEGA photon detector is designed to observe the 52.38 MeV photon produced in a ? ? e? decay with an energy resolution of 1.25 MeV, a position resolution of 2 x 5 mm2, a directional resolution of 10 degrees, a time resolution of 500 ps, and an efficiency of 7%. It will consists of four independent concentric cylindrical pair spectrometers mounted within a 1.5 T magnetic field produced by a superconducting solenoid magnet. Each pair spectrometer includes two thin Pb foils to convert photons into e+e- pairs, and thereby, determine both their locations and their vector momenta. The inner drift chamber layer includes a delay line cathode to determine the z coordinates needed for track reconstruction. An MWPC located between two Pb layers identifies the conversion layer so that energy loss corrections may be applied, while plastic scintillators provide timing information. Our, group together with a group from the University of Houston, is responsible for the design and construction of the photon detector, as well as developing the computer codes necessary for Monte Carlo simulations and data analysis. During the past year, our efforts have focused primarily on two tasks, delay line cathode read-out and software development. This report describes our recent work on delay lines and data analysis along with a discussion of the new plans for multiplexing in the photon arm


Photon detector for MEGA  

International Nuclear Information System (INIS)

The MEGA photon detector is designed to observe the 52.83-MeV photon produced in a ? ? e? decay with an energy resolution of 1.25 MeV, a position resolution of 2 x 5 mm2, a directional resolution of 10 degree, a time resolution of 500 ps, and an efficiency of about 5.4%. It will consist of three independent concentric cylindrical pair spectrometers mounted within a 1.5 T magnetic field produced by a superconducting solenoid magnet. Each pair spectrometer includes two thin Pb foils to convert photons into e+e- pairs. The two smaller pair spectrometers will have three drift chamber layers to track the e+e- pairs and thereby determine both their locations and their vector momenta. The third pair spectrometer will have four layers of drift chamber, together with a larger turning region, to provide better tracking information for high energy photons. The inner drift chamber layer in each of the spectrometers includes a delay line cathode to determine the z coordinates needed for track reconstruction. An MWPC located between the two Pb layers identifies the conversion layer so that energy loss corrections may be applied, while plastic scintillators provide timing information. During the past year, efforts have focused primarily on software development, completion of the delay line tests, and development of electronics for the scintillators and delay line read-out. Optical windows were glued onto the light guides required for the third pair spectrometer. In addition, major contributions were made to the development of a proposal to measure the Michel parameter, ?, using the MEGA positron detectors


Photon detector for MEGA  

International Nuclear Information System (INIS)

During this past August and September, we had beam time at LAMPF for an engineering study of the second prototype cylindrical photon pair spectrometer for MEGA. All of the scintillators in the detector, a total of 40, and 40% of the drift chamber cells were instrumented for this run. The main photon arm activities during the run were to compare event patterns in the chamber to our Monte Carlo generated events, to study the trigger rate and to determine the background rates in the various detector elements. At low beam intensity, the event patterns from the chamber closely resembled those generated from the Monte Carlo. The background rates in the scintillators and the innermost drift chamber layer were close to those anticipated from previous studies. However the background rates in the outer two drift chamber layers were substantially higher than we had expected. This high rate was traced to low energy photons interacting with field and sense wires. The trigger studies during the run have led us to consider alternative strategies including two different first stage triggers and a second stage trigger. The combination of the second stage trigger with either of the two first stage triggers is expected to provide good detection efficiency while keeping the raw trigger rate below that required by the data acquisition system. Detailed discussions of both the background and trigger studies are discussed in this report. Since the run, our work on methods to obtain the z-position in the photon arm drift chambers has continued. Our goal is to obtain the z coordinate to 5 mm FWHM. At this level, the z uncertainty makes a negligible contribution to the overall photon energy resolution and only a small contribution to the angular resolution. We have been studying an option which uses delay lines to provide a direct z determination. The results of our study are discussed in this report


The MEGA data acquisition system  

Energy Technology Data Exchange (ETDEWEB)

The MEGA experiment will acquire 3 MB/sec of data into a 9-crate Fastbus system controlled by a single Fastbus master. A second-level trigger will be implemented in a Fermilab Advanced Computer Program (ACP) farm of 32 Motorola 68020 microprocessors. Output from the ACP farm at a rate of 24 KB/sec will be sent to a MicroVAX II for taping. 16 refs.

Oothoudt, M.A.; Amann, J.F.; Bolton, R.D.; Hughes, E.B.; Jui, C.C.H.; Cooper, P.S.; Hahn, K.; Lauer, R.B.; Markey, J.K.



FACT, Mega-ROSA, SOLAROSA (United States)

The Flexible Array Concentrator Technology (FACT) is a lightweight, high-performance reflective concentrator blanket assembly that can be used on flexible solar array blankets. The FACT concentrator replaces every other row of solar cells on a solar array blanket, significantly reducing the cost of the array. The modular design is highly scalable for the array system designer, and exhibits compact stowage, good off-pointing acceptance, and mass/cost savings. The assembly s relatively low concentration ratio, accompanied by a large radiative area, provides for a low cell operating temperature, and eliminates many of the thermal problems inherent in high-concentration-ratio designs. Unlike other reflector technologies, the FACT concentrator modules function on both z-fold and rolled flexible solar array blankets, as well as rigid array systems. Mega-ROSA (Mega Roll-Out Solar Array) is a new, highly modularized and extremely scalable version of ROSA that provides immense power level range capability from 100 kW to several MW in size. Mega-ROSA will enable extremely high-power spacecraft and SEP-powered missions, including space-tug and largescale planetary science and lunar/asteroid exploration missions. Mega-ROSA's inherent broad power scalability is achieved while retaining ROSA s solar array performance metrics and missionenabling features for lightweight, compact stowage volume and affordability. This innovation will enable future ultra-high-power missions through lowcost (25 to 50% cost savings, depending on PV and blanket technology), lightweight, high specific power (greater than 200 to 400 Watts per kilogram BOL (beginning-of-life) at the wing level depending on PV and blanket technology), compact stowage volume (greater than 50 kilowatts per cubic meter for very large arrays), high reliability, platform simplicity (low failure modes), high deployed strength/stiffness when scaled to huge sizes, and high-voltage operation capability. Mega-ROSA is adaptable to all photovoltaic and concentrator flexible blanket technologies, and can readily accommodate standard multijunction and emerging ultra-lightweight IMM (inverted metamorphic) photovoltaic flexible blanket assemblies, as well as ENTECHs Stretched Lens Array (SLA) and DSSs (Deployable Space Systems) FACT, which allows for cost reduction at the array level.

Spence, Brian; White, Steve; Schmid, Kevin; Douglas Mark



MEGA - A search for ? ? e?  

International Nuclear Information System (INIS)

The MEGA experiment is a search for the decay ? ? e?. Even though there is no fundamental reason to expect lepton number to be a conserved quantity, processes such as ? ? e? have not been observed. (The present upper limit for the branching ratio for ? ? e? is 4.9 x 10-11.) The minimal standard model of electroweak interactions, which is enormously successful, builds in lepton number conservation. However, the decay ? ? e? is expected in many extensions to the standard model, in particular in supersymmetry models. The experimental signature for ? ? e? from decays at rest is the observation of a positron and photon, each of 52.8 MeV , that are back-to-back, in time coincidence, and originate from a common spatial point. The MEGA detector consists of two spectrometers designed to measure the kinematic characteristics of positrons and photons to search for events with this signature. The primary difficulty in the analysis of these data has been the development of reconstruction algorithms that balance efficiency and resolution. Also, many calibrations and corrections are needed to get optimum resolutions. Most surviving candidate events are accidentals. Results of analysis are given


Manic episode associated with mega cisterna magna. (United States)

Mega cisterna magna is a part of "Dandy-Walker Complex" and it is characterized by the enlargement of the cisterna magna, morphologically intact vermis and cerebellar hemispheres. We report a case of manic attack in a 23-year-old man with mega cisterna magna. The patient was treated with quetiapine 1,000 mg/day and sodium valproate 1,500 mg/day and the symptoms were ameliorated within 2.5 months. In this case, mega cisterna magna and manic symptoms may be found together coincidentally or any cerebellar dysfunction due to mega cisterna magna may cause or contribute to the appearance of affective symptoms. To our knowledge, this is the first case reporting manic attack with psychotic symptoms associated with mega cisterna magna. This report suggests that any lesion in the cerebellum might contribute to the occurrences of some affective and psychotic symptoms seen in bipolar disorder. PMID:21253417

Turan, Tayfun; Be?irli, Asl?; Asdemir, Akif; Ozsoy, Saliha; E?el, Ertu?rul



Plasmids in Yersinia pestis.  


Pesticinogenic and Ca2+-dependent strains of Yersinia pestis harbored plasmids of about 6 and 45 megadaltons, respectively. In addition, most isolates examined possessed a cryptic 65-megadalton plasmid.

Ferber, D. M.; Brubaker, R. R.



Characterization of Propionibacterium plasmids. (United States)

Plasmid DNAs from 15 Propionibacterium strains were characterized by using restriction endonuclease analyses, DNA-DNA hybridizations, and curing experiments. Restriction endonuclease analysis identified seven distinct plasmids (pRGO1 through pRGO7). Detailed restriction maps were constructed for four of these plasmids. DNA-DNA hybridization analysis revealed that plasmids pRGO1 and pRGO2 had extensive sequence homology and that both were homologous to pRGO7 and to similar sequences of pRGO5. Plasmids pRGO4 and pRGO6 did not have any significant sequence homology with any of the other plasmids. Plasmid pRGO3 had partial sequence homology only with pRGO7. Curing of plasmids pRGO1, pRGO2, and pRGO5 was achieved by treatment with acriflavin, but we failed to identify any plasmid-encoded bacteriocin production, carbohydrate fermentation, or antibiotic resistance. However, physical evidence was obtained that tentatively linked the clumping phenotype of Propionibacterium jensenii P38 with plasmid pRGO5. PMID:2339876

Rehberger, T G; Glatz, B A



Degradative plasmids from sphingomonads. (United States)

Large plasmids ('megaplasmids') are commonly found in members of the Alphaproteobacterial family Sphingomonadaceae ('sphingomonads'). These plasmids contribute to the extraordinary catabolic flexibility of this group of organisms, which degrade a broad range of recalcitrant xenobiotic compounds. The genomes of several sphingomonads have been sequenced during the last years. In the course of these studies, also the sequences of several plasmids have been determined. The analysis of the published information and the sequences deposited in the public databases allowed a first classification of these plasmids into a restricted number of groups according to the proteins involved in the initiation of replication, plasmid partition and conjugation. The sequence comparisons demonstrated that the plasmids from sphingomonads encode for four main groups of replication initiation (Rep) proteins. These Rep proteins belong to the protein superfamilies RepA_C (Pfam 04796), Rep_3 (Pfam 01051), RPA (Pfam 10134) and HTH-36 (Pfam 13730). The 'degradative megaplasmids' pNL2, pCAR3, pSWIT02, pCHQ1, pISP0, and pISP1, which code for genes involved in the degradation of aromatic hydrocarbons, carbazole, dibenzo-p-dioxin and ?-hexachlorocyclohexane, carry Rep proteins which either belong to the RepA_C- (plasmids pNL2, pCAR3, pSWIT02), Rep-3- (plasmids pCHQ1, pISP0) or RPA-superfamily (pISP1). The classification of these 'degradative megaplasmids' into three groups is also supported by sequence comparisons of the proteins involved in plasmid partition (ParAB) and the organization of the three genes on the respective plasmids. All analysed 'degradative megaplasmids' carry genes, which might allow a conjugative transfer of the plasmids. Sequence comparisons of these genes suggest the presence of at least two types of transfer functions, which either are closer related to the tra- or vir-genes previously described for plasmids from other sources. PMID:24111699

Stolz, Andreas



Characterization of Boolean Valued Star and Mega Lattice Functions  

Directory of Open Access Journals (Sweden)

Full Text Available This paper is a study on Boolean valued star and mega lattice functions. It establishes a positive lattice measure, complex lattice measure, star lattice function and founds that every star lattice function is a positive lattice measure on s(L and every star lattice function is a s-additive on X. Also, it classifies mega lattice function, mega lattice and demonstrates that in a mega lattice the limit of the integral is equal to the integral of the limit and every mega lattice is a s-additive. Finally, it confirms that every mega lattice preserves Fatous lemma.

D.V.S.R. Anil Kumar



Plasmid segregation mechanisms  

DEFF Research Database (Denmark)

Bacterial plasmids encode partitioning (par) loci that ensure ordered plasmid segregation prior to cell division. par loci come in two types: those that encode actin-like ATPases and those that encode deviant Walker-type ATPases. ParM, the actin-like ATPase of plasmid R1, forms dynamic filaments that segregate plasmids paired at mid-cell to daughter cells. Like microtubules, ParM filaments exhibit dynamic instability (i.e., catastrophic decay) whose regulation is an important component of the DNA segregation process. The Walker box ParA ATPases are related to MinD and form highly dynamic, oscillating filaments that are required for the subcellular movement and positioning of plasmids. The role of the observed ATPase oscillation is not yet understood. However, we propose a simple model that couples plasmid segregation to ParA oscillation. The model is consistent with the observed movement and localization patterns of plasmid foci and does not require the involvement of plasmid-specific host-encoded factors.

Ebersbach, Gitte; Gerdes, Kenn



Plasmids in Lactobacillus. (United States)

This review describes Lactobacillus plasmids on distribution, structure, function, vector construction, vector stability, application, and prospective. About 38% of species of the genus Lactobacillus were found to contain plasmids with different sizes (from 1.2 to 150 kb) and varied numbers (1 or more). Some Lactobacillus plasmids with small sizes were highly similar to those of single strand plasmids from other Gram-positive bacteria. The extensive sequence homologies of plus origins, replication initiation proteins, minus origins, cointegration sites, and the presence of single strand intermediates supported the fact that these small Lactobacillus plasmids replicate with a rolling-circle replication mechanism. Some Lactobacillus plasmid replicons were of broad host range that could function in other Gram-positive bacteria, and even in Escherichia coli, while replicons of other Gram-positive bacteria also function in Lactobacillus. Although most Lactobacillus plasmids are cryptic, some plasmid-encoded functions have been discovered and applied to vector construction and Lactobacillus identification, detection, and modification. PMID:9306650

Wang, T T; Lee, B H



UNITY OF MICRO- AND MEGA WORLD ???????? ?????- ? ????????  

Directory of Open Access Journals (Sweden)

Full Text Available This article, based on the arguments of mod-ern physicists, substantiates the position of the proof of the unity of micro and mega world, is the co-evolution of self-organizing dissipative structures, tak-ing into account the impact of micro and mega factors. The author points out on the features of synergy, which using the linearity and nonlinearity in the the-ory expresses the aspects of material unity of the world, linked to the general properties of self-development of complex systems. The universe is seen as a dissipative system with periodically removable elements (elementary dissipative systems

Gafiatullina O. A.



Indian manpower for mega nuclear project  

CERN Multimedia

"India is supplying critical scientific manpower and high-tech components needed for building a Large Hadron Collider (LHC) - an accelerator used in particle physics research - a mega scientific project of the European Organisation for Nuclear Research (CERN) worth billions of dollars" (1/2 page).



Natural plasmids of filamentous fungi.  


Among eukaryotes, plasmids have been found in fungi and plants but not in animals. Most plasmids are mitochondrial. In filamentous fungi, plasmids are commonly encountered in isolates from natural populations. Individual populations may show a predominance of one type, but some plasmids have a global distribution, often crossing species boundaries. Surveys have shown that strains can contain more than one type of plasmid and that different types appear to be distributed independently. In cros...

Griffiths, A. J.



Using Mahalanobis distance to compare genomic signatures between bacterial plasmids and chromosomes  


Plasmids are ubiquitous mobile elements that serve as a pool of many host beneficial traits such as antibiotic resistance in bacterial communities. To understand the importance of plasmids in horizontal gene transfer, we need to gain insight into the ‘evolutionary history’ of these plasmids, i.e. the range of hosts in which they have evolved. Since extensive data support the proposal that foreign DNA acquires the host's nucleotide composition during long-term residence, comparison of nucl...

Suzuki, Haruo; Sota, Masahiro; Brown, Celeste J.; Top, Eva M.



Plasmid-chromosome recombination of irradiated shuttle vector DNA in African Green Monkey kidney cells  

International Nuclear Information System (INIS)

An autonomously replicating shuttle vector was used to investigate the enhancement of plasmid-chromosome recombination in mammalian host cells by ultraviolet light and gamma radiation. Sequences homologous to the shuttle vector were stably inserted into the genome of African Green Monkey kidney cells to act as the target substrate for these recombination events. The SV40- and pBR322-derived plasmid DNA was irradiated with various doses of radiation before transfection into the transformed mammalian host cells. Ultraviolet light (UV) was found not to induce homologous plasmid-chromosome recombination, while gamma radiation increased the frequency of recombinant plasmids detected. The introduction of specific double-strand breaks in the plasmid or prolonging the time of plasmid residence in the mammalian host cells also enhanced plasmid-chromosome recombination. In contrast, plasmid mutagenesis was found to be increased by plasmid UV irradiation, but not to change with time. Plasmid survival, recombination, and mutagenesis were not affected by treating the mammalian host cells with UV light prior to plasmid transfection. The amp/sup r/ recombinant plasmid molecules analyzed were found to be mostly the result of nonconservative exchanges which appeared to involve both homologous and possibly nonhomologous interactions with the host chromosome


Plasmid-chromosome recombination of irradiated shuttle vector DNA in African Green Monkey kidney cells  

Energy Technology Data Exchange (ETDEWEB)

An autonomously replicating shuttle vector was used to investigate the enhancement of plasmid-chromosome recombination in mammalian host cells by ultraviolet light and gamma radiation. Sequences homologous to the shuttle vector were stably inserted into the genome of African Green Monkey kidney cells to act as the target substrate for these recombination events. The SV40- and pBR322-derived plasmid DNA was irradiated with various doses of radiation before transfection into the transformed mammalian host cells. Ultraviolet light (UV) was found not to induce homologous plasmid-chromosome recombination, while gamma radiation increased the frequency of recombinant plasmids detected. The introduction of specific double-strand breaks in the plasmid or prolonging the time of plasmid residence in the mammalian host cells also enhanced plasmid-chromosome recombination. In contrast, plasmid mutagenesis was found to be increased by plasmid UV irradiation, but not to change with time. Plasmid survival, recombination, and mutagenesis were not affected by treating the mammalian host cells with UV light prior to plasmid transfection. The amp/sup r/ recombinant plasmid molecules analyzed were found to be mostly the result of nonconservative exchanges which appeared to involve both homologous and possibly nonhomologous interactions with the host chromosome.

Mudgett, J.S.



Plasmids encoding therapeutic agents  

Energy Technology Data Exchange (ETDEWEB)

Plasmids encoding anti-HIV and anti-anthrax therapeutic agents are disclosed. Plasmid pWKK-500 encodes a fusion protein containing DP178 as a targeting moiety, the ricin A chain, an HIV protease cleavable linker, and a truncated ricin B chain. N-terminal extensions of the fusion protein include the maltose binding protein and a Factor Xa protease site. C-terminal extensions include a hydrophobic linker, an L domain motif peptide, a KDEL ER retention signal, another Factor Xa protease site, an out-of-frame buforin II coding sequence, the lacZ.alpha. peptide, and a polyhistidine tag. More than twenty derivatives of plasmid pWKK-500 are described. Plasmids pWKK-700 and pWKK-800 are similar to pWKK-500 wherein the DP178-encoding sequence is substituted by RANTES- and SDF-1-encoding sequences, respectively. Plasmid pWKK-900 is similar to pWKK-500 wherein the HIV protease cleavable linker is substituted by a lethal factor (LF) peptide-cleavable linker.

Keener, William K. (Idaho Falls, ID)



The mosaicism of plasmids revealed by atypical genes detection and analysis  

Directory of Open Access Journals (Sweden)

Full Text Available Abstract Background From an evolutionary viewpoint, prokaryotic genomes are extremely plastic and dynamic, since large amounts of genetic material are continuously added and/or lost through promiscuous gene exchange. In this picture, plasmids play a key role, since they can be transferred between different cells and, through genetic rearrangement(s, undergo gene(s load, leading, in turn, to the appearance of important metabolic innovations that might be relevant for cell life. Despite their central position in bacterial evolution, a massive analysis of newly acquired functional blocks [likely the result of horizontal gene transfer (HGT events] residing on plasmids is still missing. Results We have developed a computational, composition-based, pipeline to scan almost 2000 plasmids for genes that differ significantly from their hosting molecule. Plasmids atypical genes (PAGs were about 6% of the total plasmids ORFs and, on average, each plasmid possessed 4.4 atypical genes. Nevertheless, conjugative plasmids were shown to possess an amount of atypical genes than that found in not mobilizable plasmids, providing strong support for the central role suggested for conjugative plasmids in the context of HGT. Part of the retrieved PAGs are organized into (mainly short clusters and are involved in important biological processes (detoxification, antibiotic resistance, virulence, revealing the importance of HGT in the spreading of metabolic pathways within the whole microbial community. Lastly, our analysis revealed that PAGs mainly derive from other plasmid (rather than coming from phages and/or chromosomes, suggesting that plasmid-plasmid DNA exchange might be the primary source of metabolic innovations in this class of mobile genetic elements. Conclusions In this work we have performed the first large scale analysis of atypical genes that reside on plasmid molecules to date. Our findings on PAGs function, organization, distribution and spreading reveal the importance of plasmids-mediated HGT within the complex bacterial evolutionary network and in the dissemination of important biological traits.

Bosi Emanuele



Megacinogenic plasmids of Bacillus megaterium.  


Megacins A-216 and A-19213 in Bacillus megaterium are plasmid encoded, as shown by analysis of cured, non-megacinogenic (Meg-) derivatives of strains 216 and ATCC 19213 and by polyethylene glycol-mediated protoplast transformation of Meg- bacteria with plasmid DNA. The results of both techniques implicated a 31-megadalton plasmid, pBM309, in megacin A-216 production and a 29-megadalton plasmid, pBM113, in megacin A-19213 production.

Von Tersch, M. A.; Carlton, B. C.



Mega cisterna magna: diagnosis using metrizamide computed tomographic cisternography. (United States)

The mega cisterna magna is one cause of a midline, extra-axial, posterior fossa cyst. The computed tomographic features and differential diagnosis of midline posterior fossa cystic structures are reviewed, and the clinical features of the mega cisterna magna are discussed. We describe a method of metrizamide cisternography and report a case of mega cisterna magna that was diagnosed by this technique. PMID:7121784

Hough, D R; Mengel, M B; Malik, A H



Plasmid-Chromosome Recombination of Irradiated Shuttle Vector DNA in African Green Monkey Kidney Cells. (United States)

An autonomously replicating shuttle vector was used to investigate the enhancement of plasmid-chromosome recombination in mammalian host cells by ultraviolet light and gamma radiation. Sequences homologous to the shuttle vector were stably inserted into the genome of African Green Monkey kidney cells to act as the target substrate for these recombination events. The SV40- and pBR322-derived plasmid DNA was irradiated with various doses of radiation before transfection into the transformed mammalian host cells. The successful homologous transfer of the bacterial ampicillin resistance (amp^{rm r}) gene from the inserted sequences to replace a mutant amp^->=ne on the shuttle vector was identified by plasmid extraction and transformation into E. coli host cells. Ultraviolet light (UV) was found not to induce homologous plasmid-chromosome recombination, while gamma radiation increased the frequency of recombinant plasmids detected. The introduction of specific double -strand breaks in the plasmid or prolonging the time of plasmid residence in the mammalian host cells also enhanced plasmid-chromosome recombination. In contrast, plasmid mutagenesis was found to be increased by plasmid UV irradiation, but not to change with time. Plasmid survival, recombination, and mutagenesis were not affected by treating the mammalian host cells with UV light prior to plasmid transfection. The amp^{rm r} recombinant plasmid molecules analyzed were found to be mostly the result of nonconservative exchanges which appeared to involve both homologous and possibly nonhomologous interactions with the host chromosome. The observation that these recombinant structures were obtained from all of the plasmid alterations investigated suggests a common mechanistic origin for plasmid -chromosome recombination in these mammalian cells.

Mudgett, John Stuart



Discharge behaviour of MicroMegas detectors  

Energy Technology Data Exchange (ETDEWEB)

The discharge behaviour of MicroMegas detectors with conventional copper strip anode has been investigated. Alpha particles from a mixed nuclide source produce high enough primary ionization that the charge density during gas amplification exceeds the Raether limit. The detector has been adapted such that the pass length of the alphas inside the detector can be varied. The discharges were counted using a discriminator and NIM scaler capacitively coupled to the mesh. We report on the dependence on drift and amplification voltage for a range of operating temperatures and compare with Garfield++ simulations.

Moll, Samuel; Bortfeldt, Jonathan; Hertenberger, Ralf; Loesel, Philipp; Biebel, Otmar [Ludwig-Maximilians-Universitaet, Muenchen (Germany)



Discharge behaviour of MicroMegas detectors  

International Nuclear Information System (INIS)

The discharge behaviour of MicroMegas detectors with conventional copper strip anode has been investigated. Alpha particles from a mixed nuclide source produce high enough primary ionization that the charge density during gas amplification exceeds the Raether limit. The detector has been adapted such that the pass length of the alphas inside the detector can be varied. The discharges were counted using a discriminator and NIM scaler capacitively coupled to the mesh. We report on the dependence on drift and amplification voltage for a range of operating temperatures and compare with Garfield++ simulations.


An improved method for including upper size range plasmids in metamobilomes  

DEFF Research Database (Denmark)

Two recently developed isolation methods have shown promise when recovering pure community plasmid DNA (metamobilomes/plasmidomes), which is useful in conducting culture-independent investigations into plasmid ecology. However, both methods employ multiple displacement amplification (MDA) to ensure suitable quantities of plasmid DNA for high-throughput sequencing. This study demonstrates that MDA greatly favors smaller circular DNA elements (10 Kbp). Throughout the study, we used two model plasmids, a 4.4 Kbp cloning vector (pBR322), and a 56 Kbp conjugative plasmid (pKJK10), to represent lower- and upper plasmid size ranges, respectively. Subjecting a mixture of these plasmids to the overall isolation protocol revealed a 34-fold over-amplification of pBR322 after MDA. To address this bias, we propose the addition of an electroelution step that separates different plasmid size ranges prior to MDA in order to reduce size-dependent competition during incubation. Subsequent analyses of metamobilome data from wastewater spiked with the model plasmids showed in silica recovery of pKJK10 to be very poor with the established method and a 1,300-fold overrepresentation of pBR322. Conversely, complete recovery of pKJK10 was enabled with the new modified protocol although considerable care must be taken during electroelution to minimize cross-contamination between samples. For further validation, non-spiked wastewater metamobilomes were mapped to more than 2,500 known plasmid genomes. This displayed an overall recovery of plasmids well into the upper size range (median size: 30 kilobases) with the modified protocol. Analysis of de novo assembled metamobilome data also suggested distinctly better recovery of larger plasmids, as gene functions associated with these plasmids, such as conjugation, was exclusively encoded in the data output generated through the modified protocol. Thus, with the suggested modification, access to a large uncharacterized pool of accessory elements that reside on medium-to-large plasmids has been improved. © 2014 Norman et al.

Norman, Anders; Riber, Leise



Development of MicroMegas for a Digital Hadronic Calorimeter  


Recent developments on the MicroMegas prototypes built by use of the bulk technology with analog and digital readout electronics are presented. The main test beam results of a stack of several MicroMegas prototypes fully comply with the needs of a hadronic calorimeter for future particle physics experiments. A technical solution for a large scale prototype is also introduced.

Adloff, Catherine; Blaha, Jan; Espargiliere, Ambroise; Karyotakis, Yannis



Population Growth and Policies in Mega-Cities. Sao Paulo. (United States)

This document is one in a series of studies that focus on the population policies and plans of a number of mega-cities in developing countries. The object of the series is to examine the formulation, implementation, and evaluation of the population policies of mega-cities from a broad perspective, emphasizing the reciprocal links between…

United Nations New York, NY. Dept. of Economic and Social Information and Policy Analysis.


In Silico Detection and Typing of Plasmids using PlasmidFinder and Plasmid Multilocus Sequence Typing  

DEFF Research Database (Denmark)

In the work presented here, we designed and developed two easy-to-use Web tools for in silico detection and characterization of whole-genome sequence (WGS) and whole-plasmid sequence data from members of the family Enterobacteriaceae. These tools will facilitate bacterial typing based on draft genomes of multidrug-resistant Enterobacteriaceae species by the rapid detection of known plasmid types. Replicon sequences from 559 fully sequenced plasmids associated with the family Enterobacteriaceae in the NCBI nucleotide database were collected to build a consensus database for integration into a Web tool called PlasmidFinder that can be used for replicon sequence analysis of raw, contig group, or completely assembled and closed plasmid sequencing data. The PlasmidFinder database currently consists of 116 replicon sequences that match with at least at 80% nucleotide identity all replicon sequences identified in the 559 fully sequenced plasmids. For plasmid multilocus sequence typing (pMLST) analysis, a database that is updated weekly was generated from and integrated into a Web tool called pMLST. Both databases were evaluated using draft genomes from a collection of Salmonella enterica serovar Typhimurium isolates. PlasmidFinder identified a total of 103 replicons and between zero and five different plasmid replicons within each of 49 S. Typhimurium draft genomes tested. The pMLST Web tool was able to subtype genomic sequencing data of plasmids, revealing both known plasmid sequence types (STs) and new alleles and ST variants. In conclusion, testing of the two Web tools using both fully assembled plasmid sequences and WGS-generated draft genomes showed them to be able to detect a broad variety of plasmids that are often associated with antimicrobial resistance in clinically relevant bacterial pathogens.

Carattoli, Alessandra; Zankari, Ea



In Silico Detection and Typing of Plasmids using PlasmidFinder and Plasmid Multilocus Sequence Typing (United States)

In the work presented here, we designed and developed two easy-to-use Web tools for in silico detection and characterization of whole-genome sequence (WGS) and whole-plasmid sequence data from members of the family Enterobacteriaceae. These tools will facilitate bacterial typing based on draft genomes of multidrug-resistant Enterobacteriaceae species by the rapid detection of known plasmid types. Replicon sequences from 559 fully sequenced plasmids associated with the family Enterobacteriaceae in the NCBI nucleotide database were collected to build a consensus database for integration into a Web tool called PlasmidFinder that can be used for replicon sequence analysis of raw, contig group, or completely assembled and closed plasmid sequencing data. The PlasmidFinder database currently consists of 116 replicon sequences that match with at least at 80% nucleotide identity all replicon sequences identified in the 559 fully sequenced plasmids. For plasmid multilocus sequence typing (pMLST) analysis, a database that is updated weekly was generated from and integrated into a Web tool called pMLST. Both databases were evaluated using draft genomes from a collection of Salmonella enterica serovar Typhimurium isolates. PlasmidFinder identified a total of 103 replicons and between zero and five different plasmid replicons within each of 49 S. Typhimurium draft genomes tested. The pMLST Web tool was able to subtype genomic sequencing data of plasmids, revealing both known plasmid sequence types (STs) and new alleles and ST variants. In conclusion, testing of the two Web tools using both fully assembled plasmid sequences and WGS-generated draft genomes showed them to be able to detect a broad variety of plasmids that are often associated with antimicrobial resistance in clinically relevant bacterial pathogens. PMID:24777092

Carattoli, Alessandra; Zankari, Ea; García-Fernández, Aurora; Voldby Larsen, Mette; Lund, Ole; Villa, Laura; Møller Aarestrup, Frank



Vishal Mega-Mart- An Overview  

Directory of Open Access Journals (Sweden)

Full Text Available In the background of high consumerism and income of the urban consumers, in recent year, a number of companies have expressed their interest towards retail sector outlets. As a result, numbers of shopping malls have started their operations in metro and urban areas. Pantaloon, big bazaar, Vishal Mega Mart, Reliance Fresh are the best known examples of retail sector outlets in India.Retailing is the interface between the producer and the individual consumer buying for personal consumption. This excludes direct interface between the manufacturer and institutional buyers such as the government and other bulk customers. A retailer is one who stocks the producer’s goods and is involved in the act of selling it to the individual consumer, at a margin of profit. As such, retailing is the last link that connects the individual consumer with the manufacturing and distribution chain. Some of the key features of retailing include: -Selling directly to customers without having any intermediaries-Selling in smaller units / quantities, breaking the bulk-Present in neighborhood or in the location which is quite convenient to the customers.-Very high in numbers-Recognized by their service levels-Fitting any size and or locationThe objective of this article is to study the Marketing Mix and Shareholding pattern of Vishal Mega-Mart, a renowned name in Retail Industry of India.

Shikha Gupta



First Microlensing Events From The MEGA Survey  

CERN Document Server

We present the first M31 microlensing events from the Microlensing Exploration of the Galaxy and Andromeda (MEGA) survey. MEGA uses several telescopes to detect microlensing towards the nearby Andromeda galaxy, M31, in order to establish whether massive compact objects are a significant contribution to the mass budget of the dark halo of M31. The results presented here are based on observations with the Isaac Newton Telescope on La Palma, during the 1999/00 and 2000/01 observing seasons. In this data set, 14 microlensing events have been detected, 2 of which have been reported previously by the POINT-AGAPE group, and 12 are new events. The timescale distribution of the events is consistent with halo lensing dominating in the outer parts of M31; from the spatial distribution of the events there is some evidence for a far/near side asymmetry. Although the number of events is still quite small, our results are consistent with a significant population of compact objects in the M31 halo.

De Jong, J T A; Crotts, A P S; Sackett, P D; Sutherland, W J; Uglesich, R R; Baltz, E A; Cseresnjes, P; Gyuk, G; Widrow, L M; Jong, Jelte T.A. de; Kuijken, Konrad H.; Crotts, Arlin P.S.; Sackett, Penny D.; Sutherland, Will J.; Uglesich, Robert R.; Baltz, Edward A.; Cseresnjes, Patrick; Gyuk, Geza; Widrow, Lawrence M.



Characterization of circular plasmid dimers in Borrelia burgdorferi. (United States)

We have inactivated the ospC, oppAIV, and guaB genes on the 26-kb circular plasmid of Borrelia burgdorferi (cp26) by allelic exchange. On several occasions following such transformations, the cp26 of transformants had an aberrant mobility through agarose gels. Characterization of these cp26 molecules showed that the plasmid had dimerized. These dimers were quite stable during either selective or nonselective passage. Subsequent transformations with dimer DNA supported the hypothesis that in B. burgdorferi, transforming cp26 DNA most likely does not displace the resident homologous plasmid but rather must recombine in order to donate sequences that it carries. These serendipitous findings provide a mechanism for obtaining heterozygous complemented control strains when mutant phenotypes are characterized. PMID:9791118

Tilly, K; Lubke, L; Rosa, P



Prevalence and Significance of Plasmid Maintenance Functions in the Virulence Plasmids of Pathogenic Bacteria ?  


Virulence functions of pathogenic bacteria are often encoded on large extrachromosomal plasmids. These plasmids are maintained at low copy number to reduce the metabolic burden on their host. Low-copy-number plasmids risk loss during cell division. This is countered by plasmid-encoded systems that ensure that each cell receives at least one plasmid copy. Plasmid replication and recombination can produce plasmid multimers that hinder plasmid segregation. These are removed by multimer resolutio...

Sengupta, Manjistha; Austin, Stuart



Mini-MegaTORTORA status update (United States)

Here we give a status report on the next generation, multi-objective and transforming monitoring system, MiniMegaTORTORA, with two variants (MMT-6 based on image intensifiers with fast CCDs and MMT-9 equipped with Andor Neo sCMOSes) now under construction and commissioning at SAO RAS. This system combines a wide field of view with subsecond temporal resolution in monitoring regime, and is able to reconfigure itself, in a fractions of second, to follow-up mode which has better sensitifity and provides us with multi-color and polarimetric information on detected transients simultaneously. Hardware and software solutions used for the systems, as well as perspectives of its operation, are also discussed.

Beskin, G.; Karpov, S.; Bondar, S.; Perkov, A.; Ivanov, E.; Katkova, E.; Sasyuk, V.; Biryukov, A.; Shearer, A.



Atlas Test Beam And MicroMegas Detectors  

CERN Document Server

MicroMegas is one of the detector technologies (along with the small Thin Gap Chambers) that has been chosen for precision tracking and triggering purposes of the ATLAS muon forward detectors in the view of LHC luminosity increase. To fulfill the requirements of such upgrade, several prototype MicroMegas detectors were tested in recent test beam campaigns with high energy hadron beams at CERN. The following report describes the way that the MicroMegas detectors work and the procedure of the test beam at Atlas experiment at Cern .

Koutsoupi, Soultana



Growth dependence of conjugation explains limited plasmid invasion in biofilms: an individual?based modelling study  

DEFF Research Database (Denmark)

Plasmid invasion in biofilms is often surprisingly limited in spite of the close contact of cells in a biofilm. We hypothesized that this poor plasmid spread into deeper biofilm layers is caused by a dependence of conjugation on the growth rate (relative to the maximum growth rate) of the donor. By extending an individual?based model of microbial growth and interactions to include the dynamics of plasmid carriage and transfer by individual cells, we were able to conduct in silico tests of this and other hypotheses on the dynamics of conjugal plasmid transfer in biofilms. For a generic model plasmid, we find that invasion of a resident biofilm is indeed limited when plasmid transfer depends on growth, but not so in the absence of growth dependence. Using sensitivity analysis we also find that parameters related to timing (i.e. a lag before the transconjugant can transfer, transfer proficiency and scan speed) and spatial reach (EPS yield, conjugal pilus length) are more important for successful plasmid invasionthan the recipients' growth rate or the probability of segregational loss. While this study identifies one factor that can limit plasmid invasion in biofilms, the new individual?based framework introduced in this work is a powerful tool that enables one to test additional hypotheses on the spread and role of plasmids in microbial biofilms.

Merkey, Brian; Lardon, Laurent



Thermal analysis of MegaDiscaP semiconductor devices  

CERN Document Server

This technical report presents a thermal analysis of MegaDiscaP semiconductor devices. This analysis evaluates the thermal cycling of representative devices in order to estimate the expected lifetime. Simulation results based on manufacturer specifications are presented.

Cravero, Jean-Marc; Garcia Retegui, Rogelio; Maestri, Sebastian; Wassinger, Nicolas



Global Analysis and Structural Performance of the Tubed Mega Frame  


The Tubed Mega Frame is a new structure concept for high-rise buildings which is developed by Tyréns. In order to study the structural performance as well as the efficiency of this new concept, a global analysis of the Tubed Mega Frame structure is performed using finite element analysis software ETABS. Besides, the lateral loads that should be applied on the structure according to different codes are also studied. From the design code study for wind loads and seismic design response spectru...

Zhang, Han



Rare case of dystrophia myotonica with mega cisterna magna. (United States)

Myotonic dystrophy is also known as dystrophia myotonica (DM). The condition is composed of at least two clinical disorders with overlapping phenotypes and distinct molecular genetic defects: myotonic dystrophy type 1, the classic disease originally described by Steinert, and myotonic dystrophy type 2, also called proximal myotonic myopathy (PROMM). Mega cisterna magna is thought to be an anatomic variant with no clinical significance. We report a rare case of type 1 dystrophia myotonica in combination with mega cisterna magna. PMID:22848312

Pandya, Hetal; Lakhani, Jitendra; Mehta, Jigar; Dodhania, Jimmy



Rare case of dystrophia myotonica with mega cisterna magna  

Directory of Open Access Journals (Sweden)

Full Text Available Myotonic dystrophy is also known as dystrophia myotonica (DM. The condition is composed of at least two clinical disorders with overlapping phenotypes and distinct molecular genetic defects: myotonic dystrophy type 1, the classic disease originally described by Steinert, and myotonic dystrophy type 2, also called proximal myotonic myopathy (PROMM. Mega cisterna magna is thought to be an anatomic variant with no clinical significance. We report a rare case of type 1 dystrophia myotonica in combination with mega cisterna magna.

Hetal Pandya



Ultrasonographic appearance of the mega cisterna magna in the newborn. (United States)

The mega cisterna magna is a congenital developmental malformation which in the majority of instances is symptomless and does not require further study or surgical treatment. However, differential diagnosis with other cerebellar diseases is often necessary especially in newborn infants. Ultrasonographic recognition of the mega cisterna magna in a newborn infant is reported. The reported case demonstrates the usefulness of the ultrasonographic technique in the study of the posterior cranial fossa abnormalities of newborn infants. PMID:3912472

Cerisoli, M; Sandri, F; Giulioni, M; Pilu, G; Cocchi, G; Bovicelli, L; Salvioli, G P; Alvisi, C



Plasmid-mediated transformation in Bacillus megaterium.  


A transformation system was developed for Bacillus megaterium by using antibiotic resistance plasmid deoxyribonucleic acid molecules derived from Staphylococcus aureus and Bacillus cereus. Lysozyme-generated protoplasts of B. megaterium allowed uptake of plasmid deoxyribonucleic acid in the presence of polyethylene glycol. Transformants expressed the antibiotic resistance determinants present on the plasmid deoxyribonucleic acid, and reisolated plasmid deoxyribonucleic acid yielded restrictio...

Brown, B. J.; Carlton, B. C.



[Intraspecies plasmid transformation of Bacillus thuringiensis]. (United States)

Bacillus thuringiensis strains 1009, 3004, 3029 of the natural isolates of var. dendrolimus harbouring two large plasmids were transformed by a mix of small plasmids DNA. One of transforming plasmids carried a gene for tetracyclinresistance. The natural isolates of var. dendrolimus strain 2002 and var. berliner strain 1035 were used as donors for plasmid DNA transformation. Three variants of plasmid spectra registered in tetracycliresistant transformants are discussed. PMID:2725537

Bessol'tsev, V V; Zhuchilin, L I



Homemade Site Directed Mutagenesis of Whole Plasmids  


Site directed mutagenesis of whole plasmids is a simple way to create slightly different variations of an original plasmid. With this method the cloned target gene can be altered by substitution, deletion or insertion of a few bases directly into a plasmid. It works by simply amplifying the whole plasmid, in a non PCR-based thermocycling reaction. During the reaction mutagenic primers, carrying the desired mutation, are integrated into the newly synthesized plasmid. In this video tutorial we ...

Laible, Mark; Boonrod, Kajohn



The partitioning and copy number control systems of the selfish yeast plasmid: an optimized molecular design for stable persistence in host cells  


The multi-copy 2 micron plasmid of Saccharomyces cerevisiae, a resident of the nucleus, is remarkable for its high chromosome-like stability. The plasmid does not appear to contribute to the fitness of the host, nor does it impose a significant metabolic burden on the host at its steady state copy number. The plasmid may be viewed as a highly optimized selfish DNA element whose genome design is devoted entirely towards efficient replication, equal segregation and copy number maintenance. A pa...

Yen-Ting-Liu,; Sau, Saumitra; Ma, Chien-hui; Kachroo, Aashiq H.; Rowley, Paul A.; Chang, Keng-ming; Fan, Hsiu-fang; Jayaram, Makkuni



Nursing Homes: Resident Rights (United States)

... on this website may not be available. Resident rights Nursing home residents have certain rights and protections under the law. The nursing home ... give all new residents a copy of these rights. These resident rights include, but are not limited ...


The Mega-Terrorism - The Challenge of the Third Millennium  

Directory of Open Access Journals (Sweden)

Full Text Available The aim of this article is to describe the "new face" of terrorism in the twenty-first centuryindicating the transition to mass destruction weapons (nuclear terrorism, chemical, biological, toethnic-religious terrorism, the occurrence of massive gray area phenomena of terrorism and how thisphenomenon became a strategic weapon. Mega-terrorism has been existing, at a conceptual level,ever since the 70’s, when the experts of this phenomenon tried to find a semantic cover for thesituations that certain organizations, groups or terrorist or extremist sections would get someWeapons of Mass Destruction Systems. Actually, the 11th of September tragedy proves that megaterrorismrepresents the premeditated destruction, the lack of negotiations, of a tactical goal that wasto be accomplished by means of a threat. The mega-terrorism actors do not intend to get themselvesknown to the public, do not require anything, do not see the threat as means or device to reach theirpurpose. The 21 st century mega-terrorism simple logic is materialized in the systemic destroying ofthe enemy, no longer representing a political power or a government, but an entire ‘disobeying’,‘corrupted’, ‘unfaithful’ population indifferent to the mega-terrorist actors’ desires. New dimensionagainst mega-terrorism determines not only a rethinking of how to combat it, but also the realizationof a conceptual legal framework and measures established to materialize the political decision.

Daniel Andri?an



Structure of mega-hemocyanin reveals protein origami in snails. (United States)

Mega-hemocyanin is a 13.5 MDa oxygen transporter found in the hemolymph of some snails. Similar to typical gastropod hemocyanins, it is composed of 400 kDa building blocks but has additional 550 kDa subunits. Together, they form a large, completely filled cylinder. The structural basis for this highly complex protein packing is not known so far. Here, we report the electron cryomicroscopy (cryo-EM) structure of mega-hemocyanin complexes from two different snail species. The structures reveal that mega-hemocyanin is composed of flexible building blocks that differ in their conformation, but not in their primary structure. Like a protein origami, these flexible blocks are optimally packed, implementing different local symmetries and pseudosymmetries. A comparison between the two structures suggests a surprisingly simple evolutionary mechanism leading to these large oxygen transporters. PMID:25482543

Gatsogiannis, Christos; Hofnagel, Oliver; Markl, Jürgen; Raunser, Stefan



Adjuvants for plasmid DNA vaccines. (United States)

In the late 1980s, Jon Wolff of the University of Wisconsin and Phil Felgner here at Vical were screening cationic lipids for their ability to encapsulate and deliver purified plasmid DNA into mouse tissues. They discovered that direct injection of lipid-DNA complexes into muscle resulted in measurable protein expression. A belated control experiment without lipid led to the serendipitous discovery that "naked" plasmid DNA was taken up and expressed in muscle to a greater extent than DNA-lipid complexes (1). This key observation led to the demonstration that i.m. injection in mice of a standard 50 ?g of plasmid DNA encoding a reporter gene becomes readily expressed exclusively in myofiber cells at 180 pg of gene product per muscle (2). More recently, plasmid DNA expression vectors were improved such that an average of 300 ng of gene product could be produced from single intramuscular (i.m.) injections of plasmid DNA, and up to 40 ?g of gene product could be produced after multiple injections (3 and J. Hartikka, unpublished observations). PMID:21374320

Norman, J; Hartikka, J; Strauch, P; Manthorpe, M



Reversible atrial fibrillation secondary to a mega-oesophagus  

Directory of Open Access Journals (Sweden)

Full Text Available Abstract Background Atrial fibrillation (AF is the most common cardiac arrhythmia, and it increases in prevalence with advancing age to about 5% in people older than 65 years. Case presentation We present a rare case of atrial fibrillation secondary to a mega-oesophagus occurring in an 84-years-old Caucasian woman. The patient had a history of progressive dysphagia and the accumulation of food debris lead to mega-oesophagus. Conclusion The diagnosis was made by barium swallow and electrocardiogram; evacuations of 300 ml of the food debris lead to complete resolution of the arrhythmia. The possible aetiology leading to this AF is discussed.

Hopper Colin



Repair in E. coli of transforming plasmid DNA damaged by psoralen plus near-ultraviolet irradiation  

International Nuclear Information System (INIS)

Treatment of DNA with psoralen plus near-ultraviolet irradiation gives rise to both monoadducts and cross-links. The authors have examined the repair of plasmid NTP16 DNA treated in this way in vitro and then used to transform E. coli. Monoadducts are found to be potentially lethal, and can be repaired by uvr-dependent and recA-dependent pathways. The presence of a related resident plasmid in the transformed cells can enhance the survival of the incoming damaged NTP16 DNA. This effect is not recA-dependent. Removal of unbound psoralen from the plasmid DNA and exposure to further NUV is known to increase the ratio of cross-links to monoadducts, and the authors demonstrate that such cross-linked plasmid DNA is not readily repaired following transformation. However in the presence of homologous DNA there is evidence for the repair, and hence uptake by the cell, of cross-linked DNA. (Auth.)


Novel Pseudomonas Plasmid Involved in Aniline Degradation  


A plasmid of ca. 100 kilobases was detected in a Pseudomonas species which was isolated from soil by growth on aniline as the sole carbon and energy source. The plasmid was shown to be involved in aniline metabolism.

Anson, John G.; Mackinnon, Graeme



Mega-city pollution over East Asia: Satellite Perspective (United States)

East Asian pollution is now one of the top growing environmental concerns with far-reaching impacts on the global tropospheric air quality and climate change. Satellite observations of tropospheric composition provide a unique opportunity to characterize mega-city pollution. Here we focuse on the air quality over major East Asian mega-cities: Beijing, Shanghai, Hongkong, Seoul and Tokyo in 2006. We analyzed time series of tropospheric O3, CO, and NO2 over those cites from TES, SCIAMACHY, and OMI. Results from GEOS-Chem global 3-D CTM simulations and corresponding meteorological variables including temperature and precipitation are used to understand and interpret the seasonal variations of those pollutants and controlling factors such as transport. Beijing is the most polluted among the five cities where ~200 ppbv of O3 and ~400 ppbv of CO in the lower troposphere were frequent. Those mega-cities' air quality is mostly affected by industrial/urban emissions and domestic biofuel burning from China, while the contribution from natural pollution (biomass burning and terrestrial biosphere) are fairly small. The difference in seasonal trends and photochemical O3 productivity among the cities partly reflects the different photochemical environment in the different latitudes. The strong summer monsoon over Asia causes seasonal mitigation of pollutions over those mega-cities.

Shim, C.; Li, Q.; Eldering, A.



Strategies simulation model for the gas business chain MEGAS  

International Nuclear Information System (INIS)

MEGAS is a simulation model representing fundamental parameters of Corpoven's natural gas and NGL production, handling, processing, transportation and distribution systems in the Venezuelan mid-east, as well as its financial implications. Various strategies regarding development, prices, costs, new business opportunities, production scenarios, demand and energy policies can be evaluated through this model in order to determine, after analyzing the economics results, a set of strategies to follow in the mid and long term. MEGAS could be also used to make risk analysis studies, considering that probabilistic parameters and variables like gas quality, production, demand, plant shutdowns and others are to be represented by their distinctive function. It is possible to set up a probabilistic function for each economic indicator or operating variables with an appropriate experiment design. MEGAS is based on a dynamic simulation language, which facilitates both the real system components representation and the main variables statistical data accumulation. It also allows graphical representation of results and the simulation animation. Demand and price forecasts, new projects, costs and capabilities of the systems are some of the model input data. MEGAS should be considered as a tool that eases the strategic planning of the business, making it possible for the Corporation to foresee changes, both in the domestic and international market, to predict how these changes could affet, to predict how these changes could affect its business affairs and to visualize different return scenarios


IncP-1? Plasmid pGNB1 Isolated from a Bacterial Community from a Wastewater Treatment Plant Mediates Decolorization of Triphenylmethane Dyes?  


Plasmid pGNB1 was isolated from bacteria residing in the activated sludge compartment of a wastewater treatment plant by using a transformation-based approach. This 60-kb plasmid confers resistance to the triphenylmethane dye crystal violet and enables its host bacterium to decolorize crystal violet. Partial sequencing of pGNB1 revealed that its backbone is very similar to that of previously sequenced IncP-1? plasmids. The two accessory regions of the plasmid, one located downstream of the r...

Schlu?ter, Andreas; Krahn, Irene; Kollin, Florian; Bo?nemann, Gabriele; Stiens, Michael; Szczepanowski, Rafael; Schneiker, Susanne; Pu?hler, Alfred



Characterization of plasmids in bacterial fish pathogen.  


Plasmid profiles of representative fish pathogens, Aeromonas salmonicida, Aeromonas hydrophila, Vibrio anguillarum, Pasteurella piscicida, Yersinia ruckeri, Edwardsiella tarda, and Renibacterium salmoninarum, were determined by agarose gel electrophoresis with four different plasmid detection methods. A combination of two methods was required to detect the plasmids present in these strains and to calculate precisely the molecular weights of the plasmids. Of 38 strains, 28 harbored one or more...

Toranzo, A. E.; Barja, J. L.; Colwell, R. R.; Hetrick, F. M.



Prevalence and Significance of Plasmid Maintenance Functions in the Virulence Plasmids of Pathogenic Bacteria ? (United States)

Virulence functions of pathogenic bacteria are often encoded on large extrachromosomal plasmids. These plasmids are maintained at low copy number to reduce the metabolic burden on their host. Low-copy-number plasmids risk loss during cell division. This is countered by plasmid-encoded systems that ensure that each cell receives at least one plasmid copy. Plasmid replication and recombination can produce plasmid multimers that hinder plasmid segregation. These are removed by multimer resolution systems. Equitable distribution of the resulting monomers to daughter cells is ensured by plasmid partition systems that actively segregate plasmid copies to daughter cells in a process akin to mitosis in higher organisms. Any plasmid-free cells that still arise due to occasional failures of replication, multimer resolution, or partition are eliminated by plasmid-encoded postsegregational killing systems. Here we argue that all of these three systems are essential for the stable maintenance of large low-copy-number plasmids. Thus, they should be found on all large virulence plasmids. Where available, well-annotated sequences of virulence plasmids confirm this. Indeed, virulence plasmids often appear to contain more than one example conforming to each of the three system classes. Since these systems are essential for virulence, they can be regarded as ubiquitous virulence factors. As such, they should be informative in the search for new antibacterial agents and drug targets. PMID:21555398

Sengupta, Manjistha; Austin, Stuart



Drug-resistant plasmids from fish pathogens. (United States)

The epidemiological surveillance of drug-resistant strains of the fish pathogenic bacteria Vibrio anguillarum and Pasteurella piscicida carrying transferable R plasmids in fish farms is described. The DNA structure of R plasmids, and the drug-resistant determinants of R plasmids from the fish pathogens Aeromonas hydrophila,aeromonas salmonicida, Edwardsiella tarda, V. anguillarum, and P. piscicida are discussed. PMID:3079184

Aoki, T



Elimination of plasmids by new 4-quinolones.  


Nalidixic acid and six of the new 4-quinolones eliminated F'lac and various native R plasmids from Escherichia coli at one half or one quarter the MIC. Four of eight plasmids tested were cured by all derivatives, with frequencies from 10 to 98%. Quinolones did not eliminate all plasmids that were cured by novobiocin, and vice versa.

Weisser, J.; Wiedemann, B.



Plasmid DNA in acidophilic, chemolithotrophic thiobacilli. (United States)

Plasmid patterns were determined in 15 strains of iron-oxidizing Thiobacillus ferrooxidans. In four of these strains plasmid DNA was not detected. In the other strains the molecular weights of plasmids ranged from 5 x 10(6) to 50 x 10(6) and each strain had a different plasmid composition. The change of growth substrate from ferrous iron to tetrathionate did not affect the plasmid pattern in T. ferrooxidans nor did it in T. acidophilus, which was adapted from glucose to grow on tetrathionate. PMID:7296416

Martin, P A; Dugan, P R; Tuovinen, O H



The mechanism of plasmid curing in bacteria. (United States)

Bacterial plasmids have a major impact on metabolic function. Lactose fermentation of E. coli or hemolysin B transporter expressed by the plasmids that carry these respective genes could be readily obviated by heterocyclic compounds that readily bind to plasmid DNA. These compounds could also reverse the resistance to antibiotics of E. coli, Enterobacter, Proteus, Staphylococcus and Yersinia strains by eliminating plasmids. However, the frequency and extent of this effect was significantly less than might have been expected based on a complex interaction with plasmid DNA. The effects of heterocyclic compounds on the plasmids responsible for the virulence of Yersinia and A. tumefaciens, or on nodulation, nitrogen fixation of Rhizobia accounted for the elimination of 0.1 to 1.0 % of plasmids present in the populations studied. Bacterial plasmids can be eliminated from bacterial species grown as pure or mixed bacterial cultures in the presence of sub-inhibitory concentrations of non-mutagenic heterocyclic compounds. The antiplasmid action of the compounds depends on the chemical structure of amphiphillic compounds having a planar ring system with substitution in the L-molecular region. A symmetrical pi-electron conjugation at the highest occupied molecular orbitals favours the antiplasmid effect. The antiplasmid effect of heterocyclic compounds is expressed differentially in accordance with the structural form of the DNA to which they bind. In this manner "extrachromosomal" plasmid DNA that exists in a superhelical state binds more compound than its linear or open-circular form; and least to the chromosomal DNA of the bacterium, that carries the plasmid. It can also be noted that these compounds are not mutagenic and their antiplasmid effects correlate with the energy of HOMO-orbitals. Plasmid elimination is considered also to take place in ecosystems containing numerous bacterial species. This opens up a new perspective in rational drug design against bacterial plasmids. The inhibition of conjugational transfer of antibiotic resistance plasmid can be exploited to reduce the spread of antibiotic resistance plasmid in the ecosystem. Inhibition of plasmid replication at various stages, as shown in the "rolling circle" model (replication, partition, conjugal transfer) may also be the theoretical basis for the elimination of bacterial virulence in the case of plasmid mediated pathogenicity and antibiotic resistance. The large number of compounds tested for antiplasmid effects provides opportunities for QSAR studies in order to find a correlation between the antiplasmid effect and the supramolecular chemistry of these plasmid curing compounds. Plasmid elimination in vitro provides a method of isolating plasmid free bacteria for biotechnology without any risk of inducing mutations. PMID:16842214

Spengler, Gabriella; Molnár, Annamária; Schelz, Zsuzsanna; Amaral, Leonard; Sharples, Derek; Molnár, Joseph



Species and Incompatibility Determination within the P1par Family of Plasmid Partition Elements  


The P1par family of active plasmid partition systems consists of at least six members, broadly distributed in a variety of plasmid types and bacterial genera. Each encodes two Par proteins and contains a cis-acting parS site. Individual par systems can show distinct species specificities; the proteins from one type cannot function with the parS site of another. P1par-versus-P7par specificity resides within two hexamer BoxB repeats encoded by parS that contact the ParB protein near the carboxy...

Dabrazhynetskaya, Alena; Sergueev, Kirill; Austin, Stuart



A study of the decay ? ? e? by the MEGA experiment  

International Nuclear Information System (INIS)

The MEGA experiment is designed to search for the lepton-flavor number non-conserving rare decay ? ? e?. Data- taking is complete, with 450 million events on tape taken over approximately 107 seconds. A small portion of the data sample has been processed through the complete event reconstruction codes to search for the ? ? e? process. No evidence for the ? ? e? decay is observed at a sensitivity of ?7 x 10-11 (90% confidence)


Sport mega-events and ‘terrorism’: A critical analysis  


The article explores critically the interplay between sport and terrorism, with particular reference to sport mega-events. Our discussion is divided into two main sections. First, we set out the main principles of a critical social theoretical approach, which enables satisfactory analysis of the ‘sport/terrorism’ couplet. We discuss the contribution of three types of critical perspective that are tied to different disciplines, namely sociology, human geography, and political science/inter...

Giulianotti, Richard; Klauser, Francisco





Sporting events to help make creating beautiful scenery and unique areas to tourism. Thepurpose of this study was investigated the role of holding sporting events on destinationsBranding with hosted of mega sports event (Traditional Sport ;hors riding) on branding sportstourism destinations in Golestan province. Data from a questionnaire (Cronbach's alpha = 91%)and interviews were collected. Statistical population of this study was 217 patients (53 expert(cultural heritage; physical education...

Abolfazl Farahani; Habib Honari; Hasan Asadi; Abdul Hamid Zeitoonly; Mohammad Pour Ranjbar



Mega borg oil spill: Fate and effect studies  

International Nuclear Information System (INIS)

The Mega Borg, a Norwegian tanker, released an estimated 5.1 million gallons (gal) of Palanca Angola crude oil into the Gulf of Mexico during a lightering accident and subsequent fire. The collection of reports was designed to provide a comprehensive overview of the spill chronology, the fate of the oil released, and subsequent studies that were conducted to assess the impacts of the oil spill on the environment and its biota


Microlensing in M31; Preliminary lightcurves from MEGA  


One of the possible astrophysical solutions to the galactic dark matter problem is the presence of a significant amount of ``dark'' compact objects (MACHOs) in galactic dark matter halos. MEGA (Microlensing Exploration of the Galaxy and Andromeda) tries to find proof for or against the presence of compact objects in the halo of the Andromeda galaxy (M31) by looking for the microlensing signature that would be induced by these objects. The lightcurves presented here are preli...

Jong, Jelte; Sackett, Penny D.; Kuijken, Konrad; Uglesich, Robert; Crotts, Arlin; Sutherland, Will



Assessment of MEGA BORG impacts on sea turtles  

International Nuclear Information System (INIS)

Studies were conducted to assess the impacts of the MEGA BORG oil spill on sea turtles in the path of the oil plume. Aerial surveys were performed to determine the presence of turtles and provide a gross visual assessment of potential impacts. Although extensive efforts were made to capture sea turtles around oil and gas platforms only one loggerhead sea turtle, Caretta caretta, was captured. Neither external visual inspection nor laboratory fecal analysis showed evidence of petroleum contamination



Directory of Open Access Journals (Sweden)

Full Text Available This paper describes the state of the art of a simplified model for integration of services in mega events. The project context, which was financed by the National Research Council – CNPq, is divided into six major areas or functional groups: Urban Mobility, Tourism, Airports, Security, Energy and Telecommunications. The proposal is described in layers, as an infrastructure model of integration and services evaluation, describing its main layers and interaction processes. The proposal described in this paper is restricted to the telecommunication subproject, however, in the modeling of the scenario for the study case, it was necessary to considerate requirements and variables that are common to all subprojects. In the specification process of these requirements, we noticed important processes that interact with some sectors in the city of São Paulo, however, in the mean time, we noticed some failures regarding the integration and collaboration performed by administrators elements of stadiums as main focus in the mega event and part of our case study. Currently, the proposal is in its first version as open software for the evaluation of the services quality and the mega event infrastructure through the use of performance indicators.

Jorge R. B. Garay



State of the art: integrating services for mega events  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in english This paper describes the state of the art of a simplified model for integration of services in mega events. The project context, which was financed by the National Research Council – CNPq, is divided into six major areas or functional groups: Urban Mobility, Tourism, Airports, Security, Energy and T [...] elecommunications. The proposal is described in layers, as an infrastructure model of integration and services evaluation, describing its main layers and interaction processes. The proposal described in this paper is restricted to the telecommunication subproject; however, in the modeling of the scenario for the study case, it was necessary to consider requirements and variables that are common to all subprojects. In the specification process of these requirements, we noticed important processes that interact with some sectors in the city of São Paulo; however, in the mean time, we noticed some failures regarding the integration and collaboration performed by administrative elements of stadiums as a main focus in the mega event and part of our case study. Currently, the proposal is in its first version as open software for the evaluation of the services quality and the mega event infrastructure through the use of performance indicators.

Jorge R. B., Garay; Gustavo M., Calixto; Alexandre M. De, Oliveira; Marcelo K., Zuffo.



Comparison of typical mega cities in China using emergy synthesis (United States)

An emergy-based comparison analysis is conducted for three typical mega cities in China, i.e., Beijing, Shanghai and Guangzhou, from 1990 to 2005 in four perspectives including emergy intensity, resource structure, environmental pressure and resource use efficiency. A new index of non-renewable emergy/money ratio is established to indicate the utilization efficiency of the non-renewable resources. The results show that for the three mega urban systems, Beijing, Shanghai and Guangzhou, the total emergy inputs were 3.76E+23, 3.54E+23, 2.52E+23 sej in 2005, of which 64.88%, 91.45% and 72.28% were imported from the outsides, respectively. As to the indicators of emergy intensity involving the total emergy use, emergy density and emergy use per cap, three cities exhibited similar overall increase trends with annual fluctuations from 1990 to 2005. Shanghai achieved the highest level of economic development and non-renewable resource use efficiency, and meanwhile, lower proportion of renewable resource use and higher environmental pressure compared to those of Beijing and Guangzhou. Guangzhou has long term sustainability considering an amount of local renewable resources used, per capita emergy used, energy consumption per unit GDP and the ratio of waste to renewable emergy. It can be concluded that different emergy-based evaluation results arise from different geographical locations, resources endowments, industrial structures and urban orientations of the concerned mega cities.

Zhang, L. X.; Chen, B.; Yang, Z. F.; Chen, G. Q.; Jiang, M. M.; Liu, G. Y.



Design of Hollow Reinforced Concrete Columns in the Tubed Mega Frame : Dimensionering av ihåliga armerade betongpelare i ”Tubed Mega Frame”  


A new concept for the structural system for tall buildings, called the “Tubed Mega Frame”, has been developed by Tyre?ns AB. The structure consists of several hollow reinforced concrete columns at the perimeter of the building and at certain levels, the columns are tied together with perimeter walls. Together they carry all the vertical and lateral loads. A purpose of the new concept is to eliminate the core in the center of the building which allows utilizing more floor spacing compared...

To?nseth, David; Welchermill, Kristian



Characterization of plasmids in bacterial fish pathogen. (United States)

Plasmid profiles of representative fish pathogens, Aeromonas salmonicida, Aeromonas hydrophila, Vibrio anguillarum, Pasteurella piscicida, Yersinia ruckeri, Edwardsiella tarda, and Renibacterium salmoninarum, were determined by agarose gel electrophoresis with four different plasmid detection methods. A combination of two methods was required to detect the plasmids present in these strains and to calculate precisely the molecular weights of the plasmids. Of 38 strains, 28 harbored one or more plasmids, with the majority of strains demonstrating multiplasmid banding. Similarity in plasmid banding between strains was noted and related to geographic source. Five strains of A. salmonicida possessed six plasmid bands having molecular weights of 8.6 X 10(6), 8.4 X 10(6), 8.1 X 10(6), 3.6 X 10(6), 3.5 X 10(6), and 3.4 X 10(6). Four P. piscicida isolates shared three plasmid bands having molecular weights of 37 X 10(6), 15 X 10(6), and 5 X 10(6), and five A. hydrophila strains harbored a common plasmid having a molecular weight of ca. 20 X 10(6) to 30 X 10(6). The highest-molecular-weight plasmids (145 X 10(6) and 130 X 10(6) were detected in V. anguillarum. From curing experiments, it was found that in A. hydrophila strain 79-62, a loss of resistance to tetracycline was associated with loss of plasmid content in all susceptible derivatives, suggesting plasmid-mediated tetracycline resistance. Cell surface characteristics and metabolic properties were also modified in cured derivatives of A. hydrophila strain 79-62. PMID:6822413

Toranzo, A E; Barja, J L; Colwell, R R; Hetrick, F M



Chromate resistance plasmid in Pseudomonas fluorescens.  


Chromate resistance of Pseudomonas fluorescens LB300, isolated from chromium-contaminated sediment in the upper Hudson River, was found to be plasmid specified. Loss of the plasmid (pLHB1) by spontaneous segregation or mitomycin C curing resulted in a simultaneous loss of chromate resistance. Subsequent transformation of such strains with purified pLHB1 plasmid DNA resulted in a simultaneous re-acquisition of the chromate resistance phenotype and the plasmid. When pLHB1 was transferred by con...

Bopp, L. H.; Chakrabarty, A. M.; Ehrlich, H. L.



Virulence-associated plasmids in Rhodococcus equi.  


Twenty-three strains of Rhodococcus equi from independent clinical cases were analyzed for the presence of virulence plasmid DNA. Of the clinical isolates, 19 contained an 85-kb plasmid and the remaining 4 contained a 90-kb plasmid. All of the isolates expressed 15- to 17-kDa antigens and were virulent in mice. Restriction enzyme and Southern blot analyses showed large regions of DNA homology between the 85- and 90-kb virulence plasmids. It was concluded tentatively that there are at least tw...

Takai, S.; Watanabe, Y.; Ikeda, T.; Ozawa, T.; Matsukura, S.; Tamada, Y.; Tsubaki, S.; Sekizaki, T.



The partitioning and copy number control systems of the selfish yeast plasmid: an optimized molecular design for stable persistence in host cells (United States)

Summary The multi-copy 2 micron plasmid of Saccharomyces cerevisiae, a resident of the nucleus, is remarkable for its high chromosome-like stability. The plasmid does not appear to contribute to the fitness of the host, nor does it impose a significant metabolic burden on the host at its steady state copy number. The plasmid may be viewed as a highly optimized selfish DNA element whose genome design is devoted entirely towards efficient replication, equal segregation and copy number maintenance. A partitioning system comprised of two plasmid coded proteins, Rep1 and Rep2, and a partitioning locus STB is responsible for equal or nearly equal segregation of plasmid molecules to mother and daughter cells. Current evidence supports a model in which the Rep-STB system promotes the physical association of the plasmid with chromosomes and thus plasmid segregation by a hitchhiking mechanism. The Flp site-specific recombination system housed by the plasmid plays a critical role in maintaining steady state plasmid copy number. A decrease in plasmid population due to rare missegregation events is rectified by plasmid amplification via a recombination induced rolling circle replication mechanism. Appropriate plasmid amplification, without runaway increase in copy number, is ensured by positive and negative regulation of FLP gene expression by plasmid coded proteins and by the control of Flp level/activity through host mediated post-translational modification(s) of Flp. The Flp system has been successfully utilized to understand mechanisms of site-specific recombination, to bring about directed genetic alterations for addressing fundamental problems in biology, and as a tool in biotechnological applications. PMID:25541598

Yen-Ting-Liu; Sau, Saumitra; Ma, Chien-Hui; Kachroo, Aashiq H; Rowley, Paul A; Chang, Keng-Ming; Fan, Hsiu-Fang; Jayaram, Makkuni



Residency training program: Perceptions of residents  

Directory of Open Access Journals (Sweden)

Full Text Available Background: There is a phobia among doctors for the residency training program, since the establishment of the program over 30 years ago. The reason for establishing the program was mainly to provide the much-needed specialists in medicine. Objectives: To ascertain the perception of the residency training program among residents. Materials and Methods: Structured questionnaires were administered to residents at 3 training institutions in Nigeria. Results: One hundred nineteen (85.5% questionnaires were returned out of 140. The ages of respondents ranged from 27 to 42 years, the median age being 30 years. There were 110 males and 9 females. One hundred six (89.1% were junior residents. Ninety (75.6% were sponsored by the training institutions. Seventy-four (62.25% felt their consultants were contributing just 50% or less to their training. Sixty-two (52.2% of the respondents had attended a revision course, conference or seminar within the last 6 months. Majority of the residents would want better remuneration, up-front payment of examination and revision fees, more teaching by the consultants and less emphasis on the provision of services as ways of improving the program. Conclusion: Majority of the residents are sponsored by the training institutions.

Yusufu L. M. D



Diversity and epidemiology of plasmids from Enterobacteriaceae from human and non-human reservoirs  

DEFF Research Database (Denmark)

The family of Enterobacteriaceae is comprised of Gram negative bacteria found in a variety of natural environments as well as in the gastrointestinal (GI) tracts of humans and many animals including diverse mammals, birds and reptiles. Three species of the enteric bacteria are largely responsible for causing infections both in humans and animals worldwide; these are Escherichia coli, Salmonella enterica and Klebsiella pneumoniae; ß-lactams are antimicrobials commonly prescribed to treat uncomplicated as well as severe infections caused by these Enterobacteriaceae and other Gram negative and also Gram positive bacteria. In particular, aminopenicillins, cephalosporins and carbapenems found broad application in treatment of infections caused by the aforementioned enteric species. Recently however, increasing levels of resistance to ß-lactams is observed in these key infectious agents as well as in many other previously susceptible species. This phenomenon has become a major public concern. Antimicrobials including ß-lactams have been often used in heavy amounts in farming, not only to treat the diagnosed infections in individual animals but also as prophylaxis, metaphylaxis and growth promotion. It is believed that these practices lead to the generation of reservoirs of antimicrobial resistance genes in the GI tracts of intensively reared food - production animals like pigs, poultry and cattle. Moreover, it has been previously shown that the bla genes (e.g. genes encoding resistance to ß-lactams) could be transmitted between different bacteria on mobile genetic elements (MGEs) like plasmids and variety of transposons. Evidences were also published indicating that zoonotic bacteria like E. coli or S. enterica resistant to diverse antimicrobials and harbouring plasmids might have been transmitted from farm animals to humans (farm workers, animal caretakers etc.). It has been therefore speculated whether the plasmids with the bla genes found in Enterobacteriaceae in humans could actually originate from the animal sources. The overall aim of this thesis was to verify if indeed related resistance plasmids can circulate between enteric bacteria from humans and food production animals; and if so, then which of these plasmid species are specifically associated with the epidemic types of blaTEM genes in Enterobacteriaceae. Furthermore, the association of the plasmid encoded blaTEM genes with transposable elements is also studied in order to get a broader perspective of which MGEs are involved in mobilization and spread of these bla genes in the diverse reservoirs. Finally, an attempt is made to encompass ecological aspects of plasmid driven transmission of resistance among the enteric bacteria. In the first study the relationship between plasmids harbouring blaTEM-52 genes isolated from humans, poultry and also meat products was examined. Twenty- two plasmids from a collection of E. coli and different serovars of S. enterica were characterized. The study delivered molecular evidences that epidemiologically related plasmids circulated in the diverse species of enteric bacteria and between humans and animals, and the possible transmission route could have been contaminated food products like meat. Two types of epidemic plasmids were detected in isolates of E. coli and S. enterica; namely undistinguishable IncI1 blaTEM-52 plasmids were found in human and poultry isolates of E. coli and S. enterica; also undistinguishable IncX1 plasmids were isolated from E. coli and S. enterica from human infections, poultry and meat products (from poultry, broiler and beef). The strains harbouring these plasmids were confirmed not to be clonally related, hence indicating the transmission of the plasmids between the different bacteria from humans and animals rather than isolation of the same bacterial clones from the different reservoirs. With relation to the study I, a range of other observations was made. On majority of the examined plasmids, the blaTEM-52 genes resided on the Tn3-related transposons. Further analysis of the genetic environment o

Bielak, Eliza Maria




The report describes a series of selftransmissible and nonselftransmissible (cloning vector) plasmids constructed to compare results from different laboratory tests and plasmid systems. Plasmids were designed to overcome problems of reproducibility, confusion due to use of differ...


MegaPipe astrometry for the New Horizons spacecraft  


The New Horizons spacecraft, launched by NASA in 2006, will arrive in the Pluto-Charon system on July 14, 2015. There, it will spend a few hours imaging Pluto and its moons. It will then have a small amount of reserve propellant which will be used to direct the probe on to a second, yet to be discovered object in the Kuiper Belt. Data from the MegaPrime camera on CFHT was used to build a precise, high density astrometric reference frame for both the final approach into the P...

Gwyn, Stephen D. J.



Development of Mega-Watt Gyrotrons for fusion research  


At the Plasma Research Center (PRC) in University of Tsukuba, development of Mega-Watt Gyrotrons is performed for fusion research. We are developing a new 28 GHz 1 MW and a 77 GHz 1.5 MW gyrotron for ECRH system of tandem mirror GAMMAlO and Large Helical Device (LHD), respectively. In the short pulse test of 77 GHz gyrotron, the maximum output power of 1.6 MW and the maximum total efficiency of 49.4% with CPD were obtained. In the long pulse test, the pulse length extended to 5 sec. with 1 MW...

Kariya, T.; Minami, R.; Imai, T.; Kubo, S.; Shimozuma, T.; Takahashi, H.; Yoshimura, Y.; Ito, S.; Mutoh, T.; Ota, M.; Endo, Y.; Sakamoto, K.



How to make mega-cities energy efficient?  

Energy Technology Data Exchange (ETDEWEB)

Tokyo is a Megalopolis with 40 million+ population. It has an energy efficient profile due to its uniqueness as extensive mass rail transit networks, high density and compact urban formation, compact space oriented life style. The other feature is extensive use of electric heat pumps (EHP), which entails low carbon city profile. Further possibility is prepared with water thermal energy utilization, which is widely available also through EHP particularly in Tokyo central districts, which could make Tokyo one of the lowest carbon cities in the world. Emerging mega-cities are expected to learn from Tokyo's success and not from western conventional models.

Aoki, Hitoshi; Aoki, Yoshitaka



The Uruguayan Per mic mega flora. A synthesis  

International Nuclear Information System (INIS)

The Permian mega floras of Uruguay. A synthesis. An analysis of the impression and fossil wood floras from the Permian of Uruguay is given through a series of Tables. These show : (1) the list of taxa, (2) anatomical characters of the woods, (3) data on the micro floral associations, (4) paleoenvironmental information and (5) comparisons with contemporaneous Gondwana floras. The evolutionary degree of the woods is briefly analyzed where they correspond to the so-called transition xilotaphofloras as they present typical Paleozoic anatomical characters but with secondary xylem of more advanced characteristics. (author)


Microlensing in M31; Preliminary lightcurves from MEGA  

CERN Document Server

One of the possible astrophysical solutions to the galactic dark matter problem is the presence of a significant amount of ``dark'' compact objects (MACHOs) in galactic dark matter halos. MEGA (Microlensing Exploration of the Galaxy and Andromeda) tries to find proof for or against the presence of compact objects in the halo of the Andromeda galaxy (M31) by looking for the microlensing signature that would be induced by these objects. The lightcurves presented here are preliminary and based on observations of M31 with the Isaac Newton Telescope (INT) on La Palma during the second half of 1999.

De Jong, J; Kuijken, K; Uglesich, R R; Crotts, A; Sutherland, W; Jong, Jelte de; Sackett, Penny D.; Kuijken, Konrad; Uglesich, Robert; Crotts, Arlin; Sutherland, Will



Surveillance system with mega-pixel scalable transcoder (United States)

This paper presents a video surveillance system that displays mega-pixel streams effectively, while transmitting and processing the streams efficiently with limited resources such as bandwidth, computing power and display resolution. The proposed system stores high-resolution and high-quality video data and associated object metadata, which includes ROI (Region-of-Interest) information. To satisfy such resource constraints and display important parts in detail without missing the overall scene context, the stored images are efficiently transcoded in the compressed-domain based on the ROI information, display resolution and available bandwidth. Simulation results confirm the effectiveness of the proposed system in terms of objective measures and subjective evaluation.

Hata, Toshihiko; Kuwahara, Naoki; Schwenke, Derek L.; Vetro, Anthony



Meta, mega e retroanálises correlacionais: comparando dados primários em Psicologia / Correlational meta, mega and retroanalyses: comparing primary data in Psychology / Meta, mega y retroanálisis correlacionales: comparando datos primarios en Psicología  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Na tentativa de promover a transformação de informações em conhecimento, este artigo compara as meta-análises com duas de suas variantes, as mega-análises e as retroanálises, técnicas desenvolvidas para a síntese e a equiparação de resultados pouco precisos ou contraditórios. Enquanto as meta-anális [...] es referem-se à síntese dos resultados de diferentes pesquisas primárias, as mega-análises referem-se à síntese dos dados coletados por pesquisas primárias e as retroanálises à recriação e posterior síntese desses mesmos dados. Por meio de uma simulação, o Estudo 1 pareia o viés médio de meta, mega e retroanálises em função de nove diferentes configurações que variam conforme a quantidade de estudos empregados e do tamanho da amostra individual de cada um desses estudos, nas modalidades de dados completos, leve e severa ausência de dados. No Estudo 2, os mesmos dados utilizados na simulação de ausência severa foram empregados para testar a precisão de mega e retroanálises quando se realiza a imputação de dados. Os resultados apontam para uma leve superioridade geral das mega-análises, diferença essa que diminui, até desaparecer, em situações ideais. Abstract in spanish En la tentativa de fomentar la transformación de informaciones en conocimiento, este artículo compara los meta-análisis con dos de sus variantes, los mega-análisis y los retro-análisis, técnicas desarrolladas para la síntesis y la equiparación de resultados poco precisos o contradictorios. Mientras [...] los meta-análisis se refieren a la síntesis de los resultados de distintas investigaciones primarias, los mega-análisis se refieren a la síntesis de los datos recolectados por investigaciones primarias, y los retro-análisis, a una nueva creación y posterior síntesis de esos mismos datos. Por medio de una simulación, el Estudio 01 parea el sesgo medio de meta-, mega- y retro-análisis en función de nueve distintas configuraciones que varían según la cantidad de estudios llevados a cabo y el tamaño de la muestra individual de cada uno de esos estudios, en las modalidades de datos completos, leve y severa ausencia de datos. En el estudio 02, los mismos datos utilizados en la simulación de ausencia severa han sido empleados para testar la precisión de mega- y retro-análisis cuando se lleva a cabo la imputación de datos. Los resultados señalan hacia una leve superioridad general de los mega-análisis. Esa diferencia disminuye, hasta desaparecer, en situaciones ideales Abstract in english In an attempt to promote the transformation of information into knowledge, this article compares meta-analyses with two of its variants, mega-analyses and retro-analyses, techniques developed to summarize and compare results that are not very accurate or contradictory. While meta-analyses refer to t [...] he synthesis of results of different primary researches. mega-analyses refer to the synthesis of results collected by primary researches and retroanalyses, to the recreation and posterior synthesis of that data. Using a simulation, Study 1 pairs the average trends from meta, mega and retroanalyses regarding nine different configurations that vary according to the number of studies used and the size of the individual sample of each of those studies, in the full data, light data and severe lack of data modes. In Study 2, the same data used in the simulation of severe lack of data were used to test the accuracy of mega and retroanalyses when performing data imputation. The results show a slight general superiority of mega-analyses, a difference that fades away in ideal situations.

Igor Reszka, Pinheiro; Roberto Moraes, Cruz.



Plasmid Mediated Salt Tolerance in Root Associated Bacteria from Erigerone linifolious  

Directory of Open Access Journals (Sweden)

Full Text Available Bacterial strains (which could tolerate 2-3M NaCl in the growth medium were isolated from the roots of Erigerone linifolious. They were El-1, El-2, El-3 (from histoplane of roots and REl-1, REl-2, REl-3, REl-4, REl-5 (from the rhizoplane. All bacterial strains were motile rods (except El-2 which were cocci, exhibiting either Gram-negative (El-1, El-2, El-3, REl-1 or Gram-variable (REl-2, REl-3, REl-4, REl-5 staining. These strains were affiliated with genus Delya (El-1, Vibrio (El-3, REl-1, while four Gram-variable strains shaired characters with Bacillus pumilus. They have wide temperature and pH ranges with different optima. These strains also exhibit multiple salts/osmolytes/heavy metals/antibiotics resistance. Curing of plasmids from four of these strains revealed that salt tolerance and most of the other resistances were plasmid encoded. Plasmids residing in these halo-tolerant strains were conjugative (except pSH1413. Hybridization experiments revealed that one of these plasmids (pSH1414 belonged to IncN group of plasmids.

Azra Yasmin



Mega cisterna magna: a constant variation of the cerebellomedullary cistern associated with cerebral atrophy. (United States)

Data relating to 31 cases of mega cisterna magna studied by computed tomography are presented. The incidence and the relation of this condition to cerebral atrophy are examined. Mega cisterna magna has a constant incidence in routine CT material and is closely associated with cerebral atrophy. PMID:3748263

Kars, Z; Kiliç, K; Ozgen, T; Bertan, V; Erbengi, A



Conjugative transfer of the naturally occurring plasmids of Acetobacter xylinum by IncP-plasmid-mediated mobilization.  


Broad-host-range plasmids and cloning vectors were conjugatively transferred to Acetobacter xylinum. One of the plasmids, RP4::Mu cts61, was used for the insertion of Tn1 into the 16-, 44-, and 64-kilobase-pair plasmids of A. xylinum. The Tn1-labeled plasmids could be mobilized by a helper plasmid. Many of the Tn1 insertions affected the copy number of the plasmids.

Valla, S.; Coucheron, D. H.; Kjosbakken, J.



Development of sewage system for mega-city Karachi  

International Nuclear Information System (INIS)

The growth of mega-cities in recent times has brought to the fore a large number of issues with respect environmental conditions such as development of slum areas, poor localities, solid waste disposal, management of sewage system, lack of open spaces and health facilities. One of the major issues effecting environment proper disposal of sewage and development of sewage system including recycling of sewage water and its use. The heavy pressure of population calls for adequate provision of sewage disposal in the new areas and remodeling of systems in the old areas of the cities to ensure a pollution-free environment. Recycling of sewage and prevention of sewage discharge into natural water channels and the sea has to be undertaken on urgent bases. The paper seeks to outline the present status of sewage system of the city of Karachi, the problems involved and the proposals for management and development of the system compatible with the need and requirement of mega-city population. (author)


MegaPipe astrometry for the New Horizons spacecraft  

CERN Document Server

The New Horizons spacecraft, launched by NASA in 2006, will arrive in the Pluto-Charon system on July 14, 2015. There, it will spend a few hours imaging Pluto and its moons. It will then have a small amount of reserve propellant which will be used to direct the probe on to a second, yet to be discovered object in the Kuiper Belt. Data from the MegaPrime camera on CFHT was used to build a precise, high density astrometric reference frame for both the final approach into the Pluto system and the search for the secondary target. Pluto currently lies in the galactic plane. This is a hindrance in that there are potential problems with confusion. However, it is also a benefit, since it allows the use of the UCAC4 astrometric reference catalog, which is normally too sparse for use with MegaCam images. The astrometric accuracy of the final catalogs, as measured by the residuals, is 0.02 arcseconds.

Gwyn, Stephen D J



MegaPipe astrometry for the New Horizons spacecraft (United States)

The New Horizons spacecraft, launched by NASA in 2006, will arrive in the Pluto-Charon system on July 14, 2015. There, it will spend a few hours imaging Pluto and its moons. It will then have a small amount of reserve propellant which will be used to direct the probe on to a second, yet to be discovered object in the Kuiper Belt. Data from the MegaPrime camera on CFHT was used to build a precise, high density astrometric reference frame for both the final approach into the Pluto system and the search for the secondary target. Pluto currently lies in the galactic plane. This is a hindrance in that there are potential problems with confusion. However, it is also a benefit, since it allows the use of the UCAC4 astrometric reference catalog, which is normally too sparse for use with MegaCam images. The astrometric accuracy of the final catalogs, as measured by the residuals, is 0.02 arcseconds.

Gwyn, S. D. J.



Performance studies of MicroMegas for the ATLAS experiment (United States)

The performance of MicroMegas (MM) has been extensively studied during several test beam campaigns with high energy particle beams at CERN up to the year 2012, and more recently (June 2013) with electron beams at DESY. Main objectives of the tests were to demonstrate that the requirements could be achieved for the upgrade of the ATLAS Muon Spectrometer, where the MicroMegas will be mounted (along with small-strip Thin Gap Chambers — sTGC) on the New Small Wheel for forward muon detection. The MM layout and operating settings have then been chosen to satisfy the ATLAS upgrade requirements and trigger timing constraints. Results for efficiencies, time resolution and spatial resolution for perpendicular and inclined tracks are presented. Moreover, in ATLAS the MM will operate in a non-uniform magnetic field up to 0.3 T. Dedicated test beam measurements have been carried out in a variable magnetic field between 0 and 1 T. The performance of MM in magnetic fields is also reported along with a comparison to simulations.

Iodice, M.



Variations of Plasmid Content in Rickettsia felis (United States)

Background Since its first detection, characterization of R. felis has been a matter of debate, mostly due to the contamination of an initial R. felis culture by R. typhi. However, the first stable culture of R. felis allowed its precise phenotypic and genotypic characterization, and demonstrated that this species belonged to the spotted fever group rickettsiae. Later, its genome sequence revealed the presence of two forms of the same plasmid, physically confirmed by biological data. In a recent article, Gillespie et al. (PLoS One. 2007;2(3):e266.) used a bioinformatic approach to refute the presence of the second plasmid form, and proposed the creation of a specific phylogenetic group for R. felis. Methodology/Principal Findings In the present report, we, and five independent international laboratories confirmed unambiguously by PCR the presence of two plasmid forms in R. felis strain URRWXCal2T, but observed that the plasmid content of this species, from none to 2 plasmid forms, may depend on the culture passage history of the studied strain. We also demonstrated that R. felis does not cultivate in Vero cells at 37°C but generates plaques at 30°C. Finally, using a phylogenetic study based on 667 concatenated core genes, we demonstrated the position of R. felis within the spotted fever group. Significance We demonstrated that R. felis, which unambiguously belongs to the spotted fever group rickettsiae, may contain up to two plasmid forms but this plasmid content is unstable. PMID:18509454

Fournier, Pierre-Edouard; Belghazi, Lokmane; Robert, Catherine; Elkarkouri, Khalid; Richards, Allen L.; Greub, Gilbert; Collyn, François; Ogawa, Motohiko; Portillo, Arantxa; Oteo, Jose A.; Psaroulaki, Anna; Bitam, Idir; Raoult, Didier



Regular segregation of composite plasmid Rms201.  


Copy number mutants Rms201ts15 and Rms201ts16 were isolated at 30 degrees C from a temperature-sensitive replication mutant (Rms201ts14) of the conjugative plasmid Rms201. The numbers of plasmids per chromosome of ML1410(Rms201ts14), ML1410(Rms201ts15), and ML1410(Rms201ts16) grown at 30 degrees C were 2.2, 7.4, and 20, respectively. The synthesis of covalently closed circular plasmid deoxyribonucleic acid stopped in Rms201ts14, Rms201ts15, and Rms201ts16 immediately after a "shift-up" in tem...

Ike, Y.; Hashimoto, H.; Mitsuhashi, S.



P1 Plasmid Segregation: Accurate Redistribution by Dynamic Plasmid Pairing and Separation? †  


Low-copy-number plasmids, such as P1 and F, encode a type Ia partition system (P1par or Fsop) for active segregation of copies to daughter cells. Typical descriptions show a single central plasmid focus dividing and the products moving to the cell quarter regions, ensuring segregation. However, using improved optical and analytical tools and large cell populations, we show that P1 plasmid foci are very broadly distributed. Moreover, under most growth conditions, more than two foci are frequen...

Sengupta, Manjistha; Nielsen, Henrik Jorck; Youngren, Brenda; Austin, Stuart



SiO and CH3OH mega-masers in NGC 1068 (United States)

Maser is an acronym for microwave amplification by stimulated emission of radiation; in astronomy mega-masers are masers in galaxies that are ?106 times more luminous than typical galactic maser sources. Observational studies of mega-masers can help us to understand their origins and characteristics. More importantly, mega-masers can be used as diagnostic tracers to probe the physical properties of their parent galaxies. Since the late 1970s, only three types of molecules have been found to form mega-masers: H2O, OH and H2CO. Here we report the detection of both SiO and CH3OH mega-masers near the centre of Seyfert 2 galaxy NGC 1068 at millimetre wavelengths, obtained using the IRAM 30-m telescope. We argue that the SiO mega-maser originated from the nuclear disk and the CH3OH mega-maser originated from shock fronts. High-resolution observations in the future will enable us to investigate AGN feedback and determine the masses of central supermassive black holes in such galaxies.

Wang, Junzhi; Zhang, Jiangshui; Gao, Yu; Zhang, Zhi-Yu; Li, Di; Fang, Min; Shi, Yong



Replication of the broad host range plasmid RSF1010: requirement for three plasmid-encoded proteins.  


Cloning of specific regions of plasmid RSF1010, in conjunction with in vitro replication studies, has revealed three novel genes: repA, repB, and repC. They are clustered in one region of the plasmid, separated from the origin of replication by regions that are not essential for plasmid viability in an Escherichia coli host. In vivo, a 2.1-kilobase segment of the plasmid, bearing the replication origin, can establish itself as an autonomous replicon if the DNA region carrying the three rep ge...

Scherzinger, E.; Bagdasarian, M. M.; Scholz, P.; Lurz, R.; Ru?ckert, B.; Bagdasarian, M.



HST imaging of MEGA Microlensing Candidates in M31  

Energy Technology Data Exchange (ETDEWEB)

We investigate HST/ACS and WFPC2 images at the positions of five candidate microlensing events from a large survey of variability in M31 (MEGA). Three closely match unresolved sources, and two produce only flux upper limits. All are confined to regions of the color-magnitude diagram where stellar variability is unlikely to be easily confused with microlensing. Red variable stars cannot explain these events (although background supernova are possible for two). If these lenses arise in M31's halo, they are due to masses 0.08 < m/M{sub {circle_dot}} < 0.85 (95% certainty, for a {delta}-function mass distribution), brown dwarfs for disk/disk, and stellar masses for disk/bulge ''self-lensing''.

Cseresnjes, Patrick; Crotts, Arlin P.S.; de Jong, Jelte T.A.; Bergier, Alex; Baltz, Edward A.; Gyuk, Geza; Kuijken, Konrad; Widrow, Lawrence M.; /Columbia U., Astron.; s U., Kingston



Clostridium perfringens type A-E toxin plasmids. (United States)

Clostridium perfringens relies upon plasmid-encoded toxin genes to cause intestinal infections. These toxin genes are associated with insertion sequences that may facilitate their mobilization and transfer, giving rise to new toxin plasmids with common backbones. Most toxin plasmids carry a transfer of clostridial plasmids locus mediating conjugation, which likely explains the presence of similar toxin plasmids in otherwise unrelated C. perfringens strains. The association of many toxin genes with insertion sequences and conjugative plasmids provides virulence flexibility when causing intestinal infections. However, incompatibility issues apparently limit the number of toxin plasmids maintained by a single cell. PMID:25283728

Freedman, John C; Theoret, James R; Wisniewski, Jessica A; Uzal, Francisco A; Rood, Julian I; McClane, Bruce A



Activation of spleen lymphocytes by plasmid DNA. (United States)

It was shown that plasmid pUC19 DNA stimulates in vitro proliferation of CBA mouse splenocytes in a dose-dependent manner. Stimulation effect of the plasmid DNA is additive with COn A or LPS, synergistic with PMA and is inhibited by nonimmunogenic phosphodiester oligonucleotides and Fab fragments of antimouse Ig antibodies. These data and the data of affinity labelling of ODN-binding proteins indicate that immunoglobulin receptors are involved in DNA-induced lymphocyte activation. PMID:10474248

Rykova, E; Laktionov, P; Vlassov, V



FCC resid processing  

International Nuclear Information System (INIS)

This paper narrows the definition of reside processor to those FCC's which run feedstocks containing 1 wt.% or more Conradson carbon residue. With this new definition, the resid survey is revisited to see if any new conclusions can be drawn from the data. The authors break down the numbers and geography of resid processors, feed types, operating variables, and yields. After examining the state of resid processing in the FCC, the paper focuses on the design of cracking catalysts for handling resid feeds. There are important considerations involved in processing resid including high levels of contaminants such as vanadium and nickel, the impact on heat balance, and diffusion effects. Catalysts can be designed to improve the profitability of a resid operation. A clear picture of the roles of zeolite and matrix is presented, along with a discussion of the different types of zeoliters which are commonly used. The paper demonstrates how zeolite and matrix are best combined to meet objectives within a given set of constraints while processing resid


Plasmid fermentation process for DNA immunization applications. (United States)

Plasmid DNA for immunization applications must be of the highest purity and quality. The ability of downstream purification to efficiently produce a pure final product is directly influenced by the performance of the upstream fermentation process. While several clinical manufacturing facilities already have validated fermentation processes in place to manufacture plasmid DNA for use in humans, a simple and inexpensive laboratory-scale fermentation process can be valuable for in-house production of plasmid DNA for use in animal efficacy studies. This chapter describes a simple fed-batch fermentation process for producing bacterial cell paste enriched with high-quality plasmid DNA. A constant feeding strategy results in a medium cell density culture with continuously increasing plasmid amplification towards the end of the process. Cell banking and seed culture preparation protocols, which can dramatically influence final product yield and quality, are also described. These protocols are suitable for production of research-grade plasmid DNA at the 100 mg-to-1.5 g scale from a typical 10 L laboratory benchtop fermentor. PMID:24715290

Carnes, Aaron E; Williams, James A



Plasmids of Pseudomonas cepacia strains of diverse origins.  


Thirty-seven strains of Pseudomonas cepacia from clinical, pharmaceutical-industrial, and environmental origins were analyzed for the presence of plasmid DNA by a modification of the rapid alkaline extraction method of Birnboim (H. C. Birnboim, Methods Enzymol. 100:243-255, 1983). Plasmids were present in 31 strains (84%) from all sources, with no one source showing less than 75% plasmid carriage among its strains. The plasmid profiles indicated that the presence of large plasmids (146 to 222...

Lennon, E.; Decicco, B. T.



Plasmids in Corynebacterium diphtheriae and diphtheroids mediating erythromycin resistance.  


Plasmids were isolated from erythromycin-resistant Corynebacterium diphtheriae and skin coryneforms. Six erythromycin-resistant C. diphtheriae strains, isolated from cutaneous lesions, all contained a 9.5-megadalton (Mdal) plasmid. Loss of resistance was associated with the deletion of a 1-Mdal segment from the plasmid or, less frequently, with loss of the plasmid. Two erythromycin-resistant diphtheroids were isolated from similar skin lesions. One contained a 38-Mdal plasmid that was lost in...

Schiller, J.; Groman, N.; Coyle, M.



Mega-cone blue LEDs based on ZnO/GaN direct wafer bonding  

Energy Technology Data Exchange (ETDEWEB)

We demonstrate the fabrication of hexagonal pyramid shaped light-emitting diodes (LEDs), ''mega-cone'' LEDs based on ZnO/GaN wafer bonding. Compared with a conventional type LEDs with thin Ni/Au p-type electrode, external quantum efficiency was 3.1 times higher at 20 mA of current injection condition. We also report on the structural, optical, and electrical characteristics of the mega-cone LED. The results here indicate the high potential of these mega-cone LEDs for light sources. (copyright 2007 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

Murai, A.; Thompson, D.B.; Masui, H.; Fellows, N.; Mishra, U.K.; Nakamura, S.; DenBaars, S.P. [Materials and ECE Departments, University of California, Santa Barbara, CA (United States)



Investigating fusion plasma instabilities in the Mega Amp Spherical Tokamak using mega electron volt proton emissions (invited)  

International Nuclear Information System (INIS)

The proton detector (PD) measures 3 MeV proton yield distributions from deuterium-deuterium fusion reactions within the Mega Amp Spherical Tokamak (MAST). The PD’s compact four-channel system of collimated and individually oriented silicon detectors probes different regions of the plasma, detecting protons (with gyro radii large enough to be unconfined) leaving the plasma on curved trajectories during neutral beam injection. From first PD data obtained during plasma operation in 2013, proton production rates (up to several hundred kHz and 1 ms time resolution) during sawtooth events were compared to the corresponding MAST neutron camera data. Fitted proton emission profiles in the poloidal plane demonstrate the capabilities of this new system


Bacteriophage selection against a plasmid-encoded sex apparatus leads to the loss of antibiotic-resistance plasmids  


Antibiotic-resistance genes are often carried by conjugative plasmids, which spread within and between bacterial species. It has long been recognized that some viruses of bacteria (bacteriophage; phage) have evolved to infect and kill plasmid-harbouring cells. This raises a question: can phages cause the loss of plasmid-associated antibiotic resistance by selecting for plasmid-free bacteria, or can bacteria or plasmids evolve resistance to phages in other ways? Here, we show that multiple ant...

Jalasvuori, Matti; Friman, Ville-petri; Nieminen, Anne; Bamford, Jaana K. H.; Buckling, Angus



Plasmid Flux in Escherichia coli ST131 Sublineages, Analyzed by Plasmid Constellation Network (PLACNET), a New Method for Plasmid Reconstruction from Whole Genome Sequences  


Bacterial whole genome sequence (WGS) methods are rapidly overtaking classical sequence analysis. Many bacterial sequencing projects focus on mobilome changes, since macroevolutionary events, such as the acquisition or loss of mobile genetic elements, mainly plasmids, play essential roles in adaptive evolution. Existing WGS analysis protocols do not assort contigs between plasmids and the main chromosome, thus hampering full analysis of plasmid sequences. We developed a method (called plasmid...

Lanza, Val F.; Toro, Mari?a; Garcilla?n-barcia, M. Pilar; Mora, Azucena; Blanco, Jorge; Coque, Teresa M.; La Cruz, Fernando



O'Mega & WHIZARD: Monte Carlo Event Generator Generation For Future Colliders  


I describe the optimizing matrix element generator O'Mega and Wolfgang Kilian's event generator generator WHIZARD. These tools cooperate in the automated production of efficient unweighted event generators for linear collider physics.

Ohl, Thorsten



Between Discourse and Reality: The Un-Sustainability of Mega-Event Planning  

Directory of Open Access Journals (Sweden)

Full Text Available The zero-sum nature of mega-event hosting encourages cities to escalate investment with an eye towards convincing event rights holders that a positive outcome will result. The discursive frameworks of “legacy” and “sustainability”, the global competition to attract events and the compressed event horizon make for mega-event preparation regimes that may seriously compromise long-term urban planning agendas in mega-event hosts. By examining the sustainable urban planning literature, the discursive frameworks of sustainability in the International Olympic Committee (IOC and the discursive framing of the Rio 2016 bid, this paper will examine the Olympic Golf project being implemented in Rio de Janeiro. Through this case study the paper argues that unless mega-event rights holders change their candidacy and selection processes, these events will inevitably be detrimental to their hosts.

Christopher Gaffney



A ECONOMIA DOS MEGAEVENTOS: impactos setoriais e regionais The economics of mega events: sectoral and regional impacts La economía de los mega-eventos: impactos sectoriales y regionales  

Directory of Open Access Journals (Sweden)

Full Text Available Português O objetivo deste artigo é avaliar a coerência da adoção dos megaeventos como estratégiade crescimento econômico. A revisão bibliográfica mostra que essa estratégia não estábaseada em sólida base teórica, pois resulta de modelos adotados em outros contextose escalas geográficas. A experiência internacional indica que os megaeventos são estratégiasde risco, principalmente nos países subdesenvolvidos. A análise econômica revela queos setores econômicos beneficiados não apresentam alto impacto para a economiabrasileira, e a concentração de investimentos no Sudeste do País não contribui para aredução das desigualdades regionais.EnglishThe aim of this study is to evaluate the coherence of mega-events as strategy for economicgrowth. The bibliographic review showed that this strategy is not based on solid theoreticalbasis, because results from models adopted in other contexts and geographical scales. Theinternational experience indicates that mega-events depend on high level risk strategies,particularly at developing countries. The economic analysis revealed that the benefitedeconomic sectors do not have a high impact on the Brazilian economy and the concentrationof investments in the country’s southeast does not contribute to reduce regional inequalities.EspañolEl objetivo de este estudio es evaluar la consistencia de la adopción de los mega-eventoscomo una estrategia para el crecimiento económico. La revisión de la literatura mostró queesta estrategia no se basa en sólidos fundamentos teóricos. Mega-eventos se inspiran enmodelos utilizados en otros contextos y escalas geográficas. La experiencia internacional hademostrado que los mega-eventos implican en alto riesgo para los países en desarrollo. Lossectores económicos estimulados por mega-eventos no generan gran impacto para la economíanacional y la concentración regional de la inversión no contribuye a la reducción de lasdesigualdades espaciales..

Alberto Oliveira



The Stabilization of High-rise Buildings : An Evaluation of the Tubed Mega Frame Concept  


Building tall has always been an expression of dreams, power and technical advancement. With the greatly increasing urbanization in recent years building tall has become a more viable option for office and residential housing. The Tubed mega frame concept tries to evolve the stabilizing systems of high-rise buildings with its mega frame around the buildings perimeter, created together with a new elevator system; the Articulated Funiculator. This thesis examines the effectiveness of the Tubed ...

Sandelin, Christian; Budajev, Evgenij



Mega events, tourism and local development: the case of Torino 2006  


This paper examines the impact of mega-events such as Olympic Games on tourism development in host territories. In the first part, we adopt a territorialization approach to understand the relationship between the event and the host region.A mega-event is conceived as a great chance to generate new territory as it produces both tangible and intangible legacies that remain after the event ends: renewal of facilities for hospitality and accommodation, better infrastructures, better training for ...

Dansero, Egidio; Puttilli, Matteo Girolamo



Plasmid and chromosome partitioning: surprises from phylogeny  

DEFF Research Database (Denmark)

Plasmids encode partitioning genes (par) that are required for faithful plasmid segregation at cell division. Initially, par loci were identified on plasmids, but more recently they were also found on bacterial chromosomes. We present here a phylogenetic analysis of par loci from plasmids and chromosomes from prokaryotic organisms. All known plasmid-encoded par loci specify three components: a cis-acting centromere-like site and two trans-acting proteins that form a nucleoprotein complex at the centromere (i.e. the partition complex). The proteins are encoded by two genes in an operon that is autoregulated by the par-encoded proteins. In all cases, the upstream gene encodes an ATPase that is essential for partitioning. Recent cytological analyses indicate that the ATPases function as adaptors between a host-encoded component and the partition complex and thereby tether plasmids and chromosomal origin regions to specific subcellular sites (i.e. the poles or quarter-cell positions). Two types of partitioning ATPases are known: the Walker-type ATPases encoded by the par/sop gene family (type I partitioning loci) and the actin-like ATPase encoded by the par locus of plasmid R1 (type II partitioning locus). A phylogenetic analysis of the large family of Walker type of partitioning ATPases yielded a surprising pattern: most of the plasmid-encoded ATPases clustered into distinct subgroups. Surprisingly, however, the par loci encoding these distinct subgroups have different genetic organizations and thus divide the type I loci into types Ia and Ib. A second surprise was that almost all chromosome-encoded ATPases, including members from both Gram-negative and Gram-positive Bacteria and Archaea, clustered into one distinct subgroup. The phylogenetic tree is consistent with lateral gene transfer between Bacteria and Archaea. Using database mining with the ParM ATPase of plasmid R1, we identified a new par gene family from enteric bacteria. These type II loci, which encode ATPases of the actin type, have a genetic organization similar to that of type Ib loci. Udgivelsesdato: Aug

Gerdes, Kenn; MØller-Jensen, Jakob



Distribution of small native plasmids in Streptococcus pyogenes in India. (United States)

Complete characterization of a Streptococcus pyogenes population from a defined geographic region comprises information on the plasmids that circulate in these bacteria. Therefore, we determined the distribution of small plasmids (isolates from India, where diversity of strains and incidence rates of S. pyogenes infections are high. The collection comprised 77 emm-types. For plasmid detection and discrimination, we developed PCRs for different plasmid replication initiation protein genes, the putative repressor gene copG and bacteriocin genes dysA and scnM57. Plasmid distribution was limited to 13 emm-types. Co-detection analysis using aforementioned PCRs revealed four distinct plasmid sub-types, two of which were previously unknown. Representative plasmids pA852 and pA996 of the two uncharacterized plasmid sub-types were sequenced. These two plasmids could be assigned to the pMV158 and the pC194/pUB110 family of rolling-circle plasmids, respectively. The majority of small plasmids found in India belonged to the two newly characterized sub-types, with pA852- and pA996-like plasmids amounting to 42% and 22% of all detected plasmids, respectively. None of the detected plasmids coded for a known antibiotic resistance gene. Instead, all of the four plasmid sub-types carried known or potential bacteriocin genes. These genes may have influence on the evolutionary success of certain S. pyogenes genotypes. Notably, pA852-like plasmids were found in all isolates of the most prevalent emm-type 11.0. Together, a priori fitness of this genotype and increased fitness due to the acquired plasmids may have rendered type emm11.0 successful and caused the prevalence of pA852-like plasmids in India. PMID:24444719

Bergmann, René; Nerlich, Andreas; Chhatwal, Gursharan S; Nitsche-Schmitz, D Patric



The Kalimantan Border Oil Palm Mega-project  

International Nuclear Information System (INIS)

A few years ago, the Indonesian government and sections of the palm oil industry united in the Indonesian Palm Oil Commission (IPOC) to undertake efforts to restore the atrocious public image that the palm oil industry had earned abroad for its role in the demise of Indonesia's tropical rainforests, the massive forest fires and haze in 1997-1998, and for the widespread conflicts between plantation companies and local communities. If IPOC succeeded in restoring the palm oil industry's image abroad, it was shattered again after June 2005 when the Indonesian Minister of Agriculture revealed details of a government plan to develop the world's largest oil palm plantation in a 5-10 kilometer band along the border of Kalimantan and Malaysia. To finance the USD 567 million plantation project, the Indonesian President and Chamber of Commerce and Industry (KADIN) had already met up with the Chinese government and private sector several times, resulting in Memoranda of Understanding between (among other) the Artha Graha and Sinar Mas groups from Indonesia and the Chinese CITIC group and Chinese Development Bank (CDB). The oil palm mega-project, launched in Indonesia under the banner of 'bringing prosperity, security and environmental protection to the Kalimantan border area', turned sour when a business plan developed by the Indonesian State Plantation Corporation (PTPN) began to circulate. This document contained a map that showed beyond doubt how the 1.8 million hectare oil pad doubt how the 1.8 million hectare oil palm project would trash the primary forests of three National Parks, cut through rugged slopes and mountains utterly unsuitable for oil palm cultivation and annihilate the customary rights land of the indigenous Dayak communities in the border area. This report describes what has come of the Kalimantan border oil palm mega-plan since it was announced, who is involved and what research, lobby and campaigning has led to so far. In particular, this study aims to inform civil society organizations, palm oil buyers, investors and government bodies outside Indonesia about the undiminished threats to the tropical rainforests and indigenous peoples related to Indonesia's oil palm expansion plans and the government's overall development agenda for Kalimantan


The Kalimantan Border Oil Palm Mega-project  

Energy Technology Data Exchange (ETDEWEB)

A few years ago, the Indonesian government and sections of the palm oil industry united in the Indonesian Palm Oil Commission (IPOC) to undertake efforts to restore the atrocious public image that the palm oil industry had earned abroad for its role in the demise of Indonesia's tropical rainforests, the massive forest fires and haze in 1997-1998, and for the widespread conflicts between plantation companies and local communities. If IPOC succeeded in restoring the palm oil industry's image abroad, it was shattered again after June 2005 when the Indonesian Minister of Agriculture revealed details of a government plan to develop the world's largest oil palm plantation in a 5-10 kilometer band along the border of Kalimantan and Malaysia. To finance the USD 567 million plantation project, the Indonesian President and Chamber of Commerce and Industry (KADIN) had already met up with the Chinese government and private sector several times, resulting in Memoranda of Understanding between (among other) the Artha Graha and Sinar Mas groups from Indonesia and the Chinese CITIC group and Chinese Development Bank (CDB). The oil palm mega-project, launched in Indonesia under the banner of 'bringing prosperity, security and environmental protection to the Kalimantan border area', turned sour when a business plan developed by the Indonesian State Plantation Corporation (PTPN) began to circulate. This document contained a map that showed beyond doubt how the 1.8 million hectare oil palm project would trash the primary forests of three National Parks, cut through rugged slopes and mountains utterly unsuitable for oil palm cultivation and annihilate the customary rights land of the indigenous Dayak communities in the border area. This report describes what has come of the Kalimantan border oil palm mega-plan since it was announced, who is involved and what research, lobby and campaigning has led to so far. In particular, this study aims to inform civil society organizations, palm oil buyers, investors and government bodies outside Indonesia about the undiminished threats to the tropical rainforests and indigenous peoples related to Indonesia's oil palm expansion plans and the government's overall development agenda for Kalimantan.

Wakker, E. [AIDEnvironment, Amsterdam (Netherlands)



BioShuttle-mediated Plasmid Transfer  

Directory of Open Access Journals (Sweden)

Full Text Available An efficient gene transfer into target tissues and cells is needed for safe and effective treatment of genetic diseases like cancer. In this paper, we describe the development of a transport system and show its ability for transporting plasmids. This non-viral peptide-based BioShuttle-mediated transfer system consists of a nuclear localization address sequence realizing the delivery of the plasmid phNIS-IRES-EGFP coding for two independent reporter genes into nuclei of HeLa cells. The quantification of the transfer efficiency was achieved by measurements of the sodium iodide symporter activity. EGFP gene expression was measured with Confocal Laser Scanning Microscopy and quantified with biostatistical methods by analysis of the frequency of the amplitude distribution in the CLSM images. The results demonstrate that the “BioShuttle”-Technology is an appropriate tool for an effective transfer of genetic material carried by a plasmid.

Klaus Braun, Leonie von Brasch, Ruediger Pipkorn, Volker Ehemann, Juergen Jenne, Herbert Spring, Juergen Debus, Bernd Didinger, Werner Rittgen, Waldemar Waldeck



The CFHT/MegaCam Stripe-82 Survey (United States)

The CFTH/MegaCam Stripe-82 Survey (CS82) is a joint Canada-France-Brazil project covering ˜ 170 sq. deg. in the SDSS Stripe-82 area down to magnitude 24.1 in the optical i-band with a mean 0.6" seeing (PIs: J.-P. Kneib, A. Leauthaud, M. Makler, L. Van Waerbeke). Its main focus is the study of weak and strong gravitational lensing, with additional applications in other fields such as galaxy evolution and galaxy cluster science. Furthermore, the multitude of existing and future projects in Stripe-82, covering from the radio to the UV and including a large set of spectroscopic data, offers the possibility of exploring applications in many fields of astronomy, thereby enhancing the scientific value of the survey. In this Short Talk, we will give an overview of the main published and ongoing CS82 scientific projects. They include the measurement of the largest contiguous lensing convergence map to date and its peak statistics, providing direct information on the large scale dark matter distribution; the first CMB-lensing × shear cross-correlation measurement, probing the dark matter distribution at redshifts of order 1; galaxy-galaxy lensing measurements around SDSS-III/BOSS galaxies, constraining halo occupation distribution (HOD) models and obtaining complementary mass measurements in combination with BOSS spectroscopic data; the discovery of several new gravitational arc systems and more.

Moraes, B.; Kneib, J.-P.; Leauthaud, A.; Makler, M.; Van Waerbeke, L.; Bundy, K.; Erben, T.; Heymans, C.; Hildebrandt, H.; Miller, L.; Shan, H. Y.; Woods, D.; Charbonnier, A.; Pereira, M. E.



The impact of (mega)-cities on the earth's gravity (United States)

The world population is constantly growing; today over 7 billion people populate the planet. This development has led to a strong urbanization and expanding cities. According to the United Nations, since 2007 more human beings have lived in urban areas than in rural areas, and by 2030 the urban share will be more than 60%. The challenges of fast growing cities lie in urban management, supply to inhabitants of resources (e.g. water, power, food), and strong environmental problems (e.g. pollution), i.e. their ecological footprint. In our study we address the question of another footprint, whether (mega)-cities have an impact on the earth's gravity field. Analyzing the possible triggers will help to understand the multiple footprints of big cities in various regions. We analyze several data sources. The main data sets are a) monthly solutions of the gravity satellite mission GRACE, detecting changes in the earth's gravity field over time, b) data of the hydrological model WGHM, estimating mass changes in terrestrial and ground water storage, c) urban population data of the United Nations, d) land cover information of the European Space Agency, e) different climate data sets and other auxiliary data. The results suggest a non-uniform pattern of gravity changes with variations in trends related to different clustering parameters.

Schnitzer, S.; Estrella, N.; Güntner, A.; Matiu, M.; Peterseim, N.; Menzel, A.



System modelling and identification of Mega-Amp Spherical Tokamak  

International Nuclear Information System (INIS)

A dynamic system response model for plasma in Mega-Amp Spherical Tokamak (MAST) has been developed using RZIP. This is a linearized tokamak model. It assumes a constant plasma current distribution and axisymmetry. The plasma and conducting structures are approximated by discrete toroidal current filaments. RZIP generates a state-space model of the system behaviour, with PF coil voltages as inputs and various predicted diagnostic measurements as outputs. A separate SIMULINK model has been developed to represent the MAST plant, power supplies and analogue feedback controller. The RZIP and SIMULINK models were combined to produce a complete system model. This combined model was used to simulate test shots under both vacuum and plasma conditions. The two sets of traces cohere reasonably well, with some difference in attenuation levels. System identification experiments were carried out on the PF coils, with particular attention paid to the vertical field coils, under vacuum conditions. The frequency response behaviour was found using an excitation signal comprising a number of sinusoids. The RZIP model was verified by comparing its predicted response with experimental data


Replication of the broad host range plasmid RSF1010: requirement for three plasmid-encoded proteins. (United States)

Cloning of specific regions of plasmid RSF1010, in conjunction with in vitro replication studies, has revealed three novel genes: repA, repB, and repC. They are clustered in one region of the plasmid, separated from the origin of replication by regions that are not essential for plasmid viability in an Escherichia coli host. In vivo, a 2.1-kilobase segment of the plasmid, bearing the replication origin, can establish itself as an autonomous replicon if the DNA region carrying the three rep genes is present in the same cell on an independent plasmid. In vitro, RSF1010 DNA is efficiently replicated by an ammonium sulfate fraction from the E. coli extract, provided the extracts are prepared from cells that can supply the required rep gene products. Using cells containing the cloned rep gene region as a source of elevated levels of the rep proteins, we have partially purified these proteins in functional form. When added to an enzyme fraction derived from plasmid-free cells, they specifically promote the replication of plasmid DNA bearing the RSF1010 origin. Images PMID:6322159

Scherzinger, E; Bagdasarian, M M; Scholz, P; Lurz, R; Rückert, B; Bagdasarian, M



BioShuttle-mediated Plasmid Transfer  


An efficient gene transfer into target tissues and cells is needed for safe and effective treatment of genetic diseases like cancer. In this paper, we describe the development of a transport system and show its ability for transporting plasmids. This non-viral peptide-based BioShuttle-mediated transfer system consists of a nuclear localization address sequence realizing the delivery of the plasmid phNIS-IRES-EGFP coding for two independent reporter genes into nuclei of HeLa cells. The quan...

Klaus Braun, Leonie Von Brasch



Dynamic plasmid populations in Halobacterium halobium.  


Deletion events occurring in the major 150-kilobase-pair (kb) plasmid pHH1 of the archaebacterium Halobacterium halobium were investigated. We found four deletion derivatives of pHH1 in gas-vacuole-negative mutants, two of which (pHH23) [65 kb] and pHH4 [36 kb]) we analyzed. Both plasmids incurred more than one deletion, leading to the fusion of noncontiguous pHH1 sequences. pHH23 and pHH4 overlapped by only 4 kb of DNA sequence. A DNA fragment derived from this region was used to monitor the...

Pfeifer, F.; Blaseio, U.; Ghahraman, P.



“Festivalisation” of Urban Governance in South African Cities: Framing the Urban Social Sustainability of Mega-Event Driven Development from Below  

Directory of Open Access Journals (Sweden)

Full Text Available This article is based on field research in two South African host cities of the Men’s Football World Cup 2010 (eThekwini and Johannesburg. The discussed work is part of the research project “Festivalisation” of Urban Governance: The Production of Socio-Spatial Control in the Context of the FIFA World Cup 2010 in South Africa. In the context of mega-events, impacts and changes on urban development can vary on a spectrum of festivalisation between opposing poles, either “driven by the event”, or on the other hand where existing configurations of actors and established policies are “driving the event”. By drawing on a theoretical framework which is inspired by an analytical understanding of urban governance, our assumptions are that (a different configurations of governance promote different ways of handling the challenges associated to the hosting and (b that different types of “festivalisation” have different consequences and effects for the lived realities of the residents at a local level. The latter is an arena in which urban governance policies are translated, adapted, renegotiated or rejected. We argue that the bringing together of both spheres (local and metropolitan provides a profound understanding of the process of mega-event implementation and its relation to urban social sustainability.

Matthias Fleischer



Short-lived tectonic switch mechanism for long-term pulses of volcanic activity after mega-thrust earthquakes  


Eruptive rates in volcanic arcs increase significantly after mega-thrust earthquakes in subduction zones. Over short to intermediate time periods the link between mega-thrust earthquakes and arc response can be attributed to dynamic triggering processes or static stress changes, but a fundamental mechanism that controls long-term pulses of volcanic activity after mega-thrust earthquakes has not been proposed yet. Using geomechanical, geological, and geophysical arguments, we pro...

Lupi, M.; Miller, S. A.



An Assigned Teaching Resident Rotation (United States)

Objective: The authors' adult psychiatry residency training program identified several educational needs for residents at their institution. Junior residents needed enhanced learning of clinical interviewing skills and learning connected to the inpatient psychiatry ward rotations, and senior residents needed opportunities to prepare for the…

Daniels-Brady, Catherine; Rieder, Ronald



Plasmid Replicon Typing of Commensal and Pathogenic Escherichia coli Isolates?  


Despite the critical role of plasmids in horizontal gene transfer, few studies have characterized plasmid relatedness among different bacterial populations. Recently, a multiplex PCR replicon typing protocol was developed for classification of plasmids occurring in members of the Enterobacteriaceae. Here, a simplified version of this replicon typing procedure which requires only three multiplex panels to identify 18 plasmid replicons is described. This method was used to screen 1,015 Escheric...

Johnson, Timothy J.; Wannemuehler, Yvonne M.; Johnson, Sara J.; Logue, Catherine M.; White, David G.; Doetkott, Curt; Nolan, Lisa K.



Simple method for extracting plasmid DNA from lactic acid bacteria. (United States)

Rapid screening and large-scale plasmid DNA isolation procedures are described for lactic acid bacteria, using glass beads to break cells. The rapid screening procedure allows one to obtain plasmid DNA pellets in less than 1 h. This method has been successfully tested on various bacteria from the genera Lactococcus, Leuconostoc, Lactobacillus, Pediococcus, Streptococcus, Enterococcus and Propionibacterium. This procedure yields plasmid DNA with minor chromosomal and plasmid DNA-degraded form contaminations. PMID:7764702

Frère, J



The influence of biofilms in the biology of plasmids  


The field of plasmid biology has historically focused on bacteria growing in liquid culture. Surface attached communities of bacterial biofilms have recently been understood to be the normal environment of bacteria in the natural world. Thus, studies examining plasmid replication, maintenance, and transfer in biofilms are essential for a true understanding of bacterial plasmid biology. This chapter reviews the current knowledge of the interplay between bacterial biofilms and plasmids, focusin...

Cook, Laura C. C.; Dunny, Gary M.



Presence of a virulence-associated plasmid in Yersinia pseudotuberculosis.  


We have shown that Yersinia pseudotuberculosis can possess plasmids which are similar in size and function to the previously described Vwa plasmids of Y. enterocolitica. These plasmids are associated with the production of V and W antigens (calcium dependency) and pathogenicity of the organism. Further investigation of these plasmids from Y. pseudotuberculosis and Y. enterocolitica with restriction endonucleases revealed significant differences in their fragmentation pattern.

Gemski, P.; Lazere, J. R.; Casey, T.; Wohlhieter, J. A.



Integrated bariatric surgery residency  

Directory of Open Access Journals (Sweden)

Full Text Available Adam EM Eltorai Warren Alpert Medical School of Brown University, RI, USA Abstract: Obesity is a major public health concern. Given its lasting efficacy for improving obesity and obesity-related diseases, bariatric surgery is an increasingly common treatment option. As the implementation of the Affordable Care Act progresses, the impending physician shortage will become more severe. Thus there will be an even greater need for doctors specialized in the management and treatment of obese patients. The development of integrated bariatric surgery residency programs could be considered and is discussed herein. Keywords: obesity, bariatric surgery, integrated residency, surgery education

Eltorai AE



Residence of the elderly  

Directory of Open Access Journals (Sweden)

Full Text Available Residence of the elderly is analyzed in this work. Experiences of the developed world in this field can be extremely beneficial to the housing policy in Serbia. The elderly are facing serious facility shortages for living compared to the actual demand. The subject-matter of this work is to carry out research into the institutional forms of taking up residence of the elderly in Serbia and France, since France is a welfare state. By analyzing French pattern, some useful recommendations can be found for the development of the Serbian pattern.

Stanimirovi? Mirko



Transfer of IncN plasmids to Pseudomonas aeruginosa.  


Three of four N plasmids tested were found to be conjugatively transferable from Escherichia coli to Pseudomonas aeruginosa. The plasmids in the Pseudomonas transconjugants differed from the plasmids in the donor E. coli with respect to molecular weight, transfer ability, phenotype conferred, and stability. In some cases, the antibiotic and UV resistance genes appeared to integrate into the P. aeruginosa chromosome.

Tardif, G.; Grant, R. B.



Quality Control of Mega Voltage Portal Imaging System  

International Nuclear Information System (INIS)

The Electronic Portal Imaging Device (EPID) is a system used to verify either the correct positioning of the patient during radiotherapy treatment or the linear accelerator beam parameters. The correct position of the patient corresponds to the position at which the patient was scanned at the CT simulator and according to which the therapy plan was made and optimized. Regarding this, besides the advanced treatment planning system and optimized treatment planning techniques, the day-to-day reproduction of simulated conditions is of great importance for the treatment outcome. Therefore, to verify the patient set-up portal imaging should be applied prior to the first treatment session and repeated according to treatment prescriptions during the treatment. In order to achieve full functionality and precision of the EPID, it must be included in radiotherapy Quality Control (QC) programme. The QC of the Mega Voltage portal imaging system was separated in two parts. In the first, the QC of the detector parameters should be performed. For this purpose, the FC2 and QC3 phantoms should be used, along with the Portal Image Processing System program (PIPSpro) package for data analysis. The second part of the QC of the linear accelerator's portal imaging system should include the QC of the CBCT. In this part a set of predefined manufacturer's tests using two different phantoms, one for the geometry calibration and the other for the image quality evaluation, should be performed. Also, the treatment conditions should be simulated using anthropomorphic phantoms and dose distributions for particular EPID protocols should be measured. Procedures for quality control of the portal imaging system developed and implemented at University Hospital Rijeka are presented in this paper.(author)


A mutant defective in partitioning of composite plasmid Rms201.  


Escherichia coli harboring mutant plasmids defective in maintenance stability (from the conjugative plasmid Rms201) showed a wide distribution of ampicillin resistance levels, as well as increased frequency of plasmid loss from the cell. The amounts of covalently closed circular deoxyribonucleic acid of mutant plasmid Rms268 and parental plasmid Rms201 per chromosome were 5.3 and 6.1%, respectively. The beta-lactamase activities of strains W3630(Rms268) and W3630(Rms201) were 0.56 and 0.44 U/...

Ike, Y.; Hashimoto, H.; Mitsuhashi, S.



Multilocus sequence typing of IncN plasmids  


OBJECTIVES: Incompatibility group N (IncN) plasmids have been associated with the dissemination of antimicrobial resistance and are a major vehicle for the spread of blaVIM-1 in humans and blaCTX-M-1 in animals. A plasmid multilocus sequence typing (pMLST) scheme was developed for rapid categorization of IncN plasmids. METHODS: Twelve fully sequenced IncN plasmids available at GenBank were analysed in silico for selecting the loci for the IncN-specific pMLST. A total of 58 plasmids originatin...

Garci?a-ferna?ndez, Aurora; Villa, Laura; Moodley, Arshnee; Hasman, Henrik; Miriagou, Vivi; Guardabassi, Luca; Carattoli, Alessandra



Plasmid Flux in Escherichia coli ST131 Sublineages, Analyzed by Plasmid Constellation Network (PLACNET), a New Method for Plasmid Reconstruction from Whole Genome Sequences. (United States)

Bacterial whole genome sequence (WGS) methods are rapidly overtaking classical sequence analysis. Many bacterial sequencing projects focus on mobilome changes, since macroevolutionary events, such as the acquisition or loss of mobile genetic elements, mainly plasmids, play essential roles in adaptive evolution. Existing WGS analysis protocols do not assort contigs between plasmids and the main chromosome, thus hampering full analysis of plasmid sequences. We developed a method (called plasmid constellation networks or PLACNET) that identifies, visualizes and analyzes plasmids in WGS projects by creating a network of contig interactions, thus allowing comprehensive plasmid analysis within WGS datasets. The workflow of the method is based on three types of data: assembly information (including scaffold links and coverage), comparison to reference sequences and plasmid-diagnostic sequence features. The resulting network is pruned by expert analysis, to eliminate confounding data, and implemented in a Cytoscape-based graphic representation. To demonstrate PLACNET sensitivity and efficacy, the plasmidome of the Escherichia coli lineage ST131 was analyzed. ST131 is a globally spread clonal group of extraintestinal pathogenic E. coli (ExPEC), comprising different sublineages with ability to acquire and spread antibiotic resistance and virulence genes via plasmids. Results show that plasmids flux in the evolution of this lineage, which is wide open for plasmid exchange. MOBF12/IncF plasmids were pervasive, adding just by themselves more than 350 protein families to the ST131 pangenome. Nearly 50% of the most frequent ?-proteobacterial plasmid groups were found to be present in our limited sample of ten analyzed ST131 genomes, which represent the main ST131 sublineages. PMID:25522143

Lanza, Val F; de Toro, María; Garcillán-Barcia, M Pilar; Mora, Azucena; Blanco, Jorge; Coque, Teresa M; de la Cruz, Fernando



A Practical Data Recovery Technique for Long-Term Strain Monitoring of Mega Columns during Construction  

Directory of Open Access Journals (Sweden)

Full Text Available A practical data recovery method is proposed for the strain data lost during the safety monitoring of mega columns. The analytical relations among the measured strains are derived to recover the data lost due to unexpected errors in long-term measurement during construction. The proposed technique is applied to recovery of axial strain data of a mega column in an irregular building structure during construction. The axial strain monitoring using the wireless strain sensing system was carried out for one year and five months between 23 July 2010 and 22 February 2012. During the long-term strain sensing, three different types of measurement errors occurred. Using the recovery technique, the strain data that could not be measured at different intervals in the measurement were successfully recovered. It is confirmed that the problems that may occur during long-term wireless strain sensing of mega columns during construction could be resolved through the proposed recovery method.

Hyo Seon Park



Refractory psychosis and prominent cognitive deficits in a patient with mega-cisterna magna. (United States)

We present a case of refractory psychosis with prominent cognitive deficits in a patient with 'mega-cisterna magna', a congenital defect within the 'Dandy-Walker Complex' continuum. The 21-year-old female had a 3-year history of refractory psychotic symptoms despite adequate antipsychotic treatment. CT and MRI scans disclosed 'mega-cisterna magna'. Thorough neuropsychological testing recorded extensive deficits. Treatment with amisulpride 1200 mg/day resulted in a 30% decrease in PANSS score within 2 months. Then galantamine 8 mg/day was added and PANSS score decreased further by 27% within 2 weeks. Cognitive and social functioning was overall much improved. The effect was sustained in a 24 months follow-up. It is postulated that even a less extended cerebellar lesion, such as mega-cisterna magna, can be associated with psychosis, and in some cases with treatment refractoriness or cognitive dysfunction. Adjuvant galantamine may improve cognitive and psychosocial functioning in these patients. PMID:17150294

Ferentinos, Panayotis P; Kontaxakis, Vassilis P; Havaki-Kontaxaki, Beata J; Paplos, Konstantinos G; Pappa, Dimitra A; Soldatos, Constantin R



Using a custom mega prosthesis to treat hydatidosis of bone: a report of 3 cases.  

Directory of Open Access Journals (Sweden)

Full Text Available Three cases of hydatidosis of bone with pathological fracture were treated by wide resection, custom mega prosthesis replacement, and chemotherapy. Two patients were females and one was male, with a mean age of 47 years (range, 38-55 years. Two of them had a pathological fracture of the proximal femur, and one had a pathological fracture of the distal femur. All patients were treated postoperatively with albendazole 400 mg, twice daily, for 12 weeks. During the mean follow-up period of 4.5 years, no recurrence of Echinococcal infection was noticed. The use of the custom mega prosthesis technique has not been reported elsewhere, and hydatid disease of the bone can now be considered an extended indication for custom mega prosthesis in addition to its application in surgery for tumours and massive trauma.

Natarajan MV



The influence of biofilms in the biology of plasmids. (United States)

The field of plasmid biology has historically focused on bacteria growing in liquid culture. Surface attached communities of bacterial biofilms have recently been understood to be the normal environment of bacteria in the natural world. Thus, studies examining plasmid replication, maintenance, and transfer in biofilms are essential for a true understanding of bacterial plasmid biology. This chapter reviews the current knowledge of the interplay between bacterial biofilms and plasmids, focusing on the role of plasmids in biofilm development and the role of biofilms in plasmid maintenance, copy number control, and transfer. The studies examined herein highlight the importance of biofilms as an important ecological niche in which bacterial plasmids play an essential role. PMID:25392747

Cook, Laura C C; Dunny, Gary M



Role of Plasmid in Production of Acetobacter Xylinum Biofilms  

Directory of Open Access Journals (Sweden)

Full Text Available Acetobacter xylinum has the ability to produce cellulotic biofilms. Bacterial cellulose is expected to be used in many industrial or biomedical materials for its unique characteristics. A. xylinum contains a complex system of plasmid DNA molecules. A 44 kilobases (kb plasmid was isolated in wild type of A. xylinum. To improve the cellulose producing ability of A. xylinum, role of the plasmid in production of cellulose was studied. The comparisons between wild type and cured cells of A. xylinum showed that there is considerably difference in cellulose production. In order to study the relationship between plasmid and the rate of cellulose production, bacteria were screened for plasmid profile by a modified method for preparation of plasmid. This method yields high levels of pure plasmid DNA that can be used for common molecular techniques, such as digestion and transformation, with high efficiency.

Abbas Rezaee



Thermosensitive plasmid replication, temperature-sensitive host growth, and chromosomal plasmid integration conferred by Lactococcus lactis subsp. cremoris lactose plasmids in Lactococcus lactis subsp. lactis.  


Evidence is presented that lactose-fermenting ability (Lac+) in Lactococcus lactis subsp. cremoris AM1, SK11, and ML1 is associated with plasmid DNA, even though these strains are difficult to cure of Lac plasmids. When the Lac plasmids from these strains were introduced into L. lactis subsp. lactis LM0230, they appeared to replicate in a thermosensitive manner; inheritance of the plasmid was less efficient at 32 to 40 degrees C than at 22 degrees C. The stability of the L. lactis subsp. crem...

Feirtag, J. M.; Petzel, J. P.; Pasalodos, E.; Baldwin, K. A.; Mckay, L. L.



P1 Plasmid Segregation: Accurate Redistribution by Dynamic Plasmid Pairing and Separation? † (United States)

Low-copy-number plasmids, such as P1 and F, encode a type Ia partition system (P1par or Fsop) for active segregation of copies to daughter cells. Typical descriptions show a single central plasmid focus dividing and the products moving to the cell quarter regions, ensuring segregation. However, using improved optical and analytical tools and large cell populations, we show that P1 plasmid foci are very broadly distributed. Moreover, under most growth conditions, more than two foci are frequently present. Each focus contains either one or two plasmid copies. Replication and focus splitting occur at almost any position in the cell. The products then move rapidly apart for approximately 40% of the cell length. They then tend to maintain their relative positions. The segregating foci often pass close to or come to rest close to other foci in the cell. Foci frequently appear to fuse during these encounters. Such events occur several times in each cell and cell generation on average. We argue that foci pair with their neighbors and then actively separate again. The net result is an approximately even distribution of foci along the long cell axis on average. We show mathematically that trans-pairing and active separation could greatly increase the accuracy of segregation and would produce the distributions of foci that we observe. Plasmid pairing and separation may constitute a novel fine-tuning mechanism that takes the basic pattern created when plasmids separate after replication and converts it to a roughly even pattern that greatly improves the fidelity of plasmid segregation. PMID:19897644

Sengupta, Manjistha; Nielsen, Henrik Jorck; Youngren, Brenda; Austin, Stuart



Analisis Pengaruh Corporate Social Responsibility (CSR) terhadap Kinerja Keuangan Perusahaan Pada PT. Bank Mega Tbk Cabang Makassar  


Tujuan dari penelitian ini adalah untuk melihat sejauh mana pengaruh penerapan Corporate Social Responsibility (CSR) pada PT. Bank Mega Tbk Cabang Makassar, dengan menganalisis seberapa besar pengaruh dan hubungan Corporate Social Responsibility terhadap kinerja keuangan PT. Bank Mega Tbk Cabang Makassar. Metode analisis yang digunakan dalam penelitian ini adalah analisis deskriptif, analisis regresi berganda, dan analisis korelasi berga...

Wahyuni Iskandar, Dian



Assembly and characterization of megaTALs for hyperspecific genome engineering applications. (United States)

Rare-cleaving nucleases have emerged as valuable tools for creating targeted genomic modification for both therapeutic and research applications. MegaTALs are novel monomeric nucleases composed of a site-specific meganuclease cleavage head with additional affinity and specificity provided by a TAL effector DNA binding domain. This fusion product facilitates the transformation of meganucleases into hyperspecific and highly active genome engineering tools that are amenable to multiplexing and compatible with multiple cellular delivery methods. In this chapter, we describe the process of assembling a megaTAL from a meganuclease, as well as a method for characterization of nuclease cleavage activity in vivo using a fluorescence reporter assay. PMID:25408406

Boissel, Sandrine; Scharenberg, Andrew M



Excess Clustering on Large Scales in the MegaZ DR7 Photometric Redshift Survey  


We observe a large excess of power in the statistical clustering of Luminous Red Galaxies in the photometric SDSS galaxy sample called MegaZ DR7. This is seen over the lowest multipoles in the angular power spectra C_{\\ell} in four equally spaced redshift bins between 0.45 < z < 0.65. However, it is most prominent in the highest redshift band at ~ 4 sigma and it emerges at an effective scale k ~ 0.01 h Mpc^{-1}. Given that MegaZ DR7 is the largest cosmic volume galaxy survey...

Thomas, S. A.; Abdalla, F. B.; Lahav, O.



Brussels blocks stock exchange mega-merger deal | EurActiv  


...Brussels blocks stock exchange mega-merger deal | EurActiv competition,euro-finance,Competition policy,Deutsche Börse,mergers,NYSE EU news & policy debates- ... VIDEOS Home › Euro & Finance › News Brussels blocks stock exchange mega-merger deal -A + A Published 02 February 2012 Tags Competition policy,...Deutsche Börse, mergers, NYSE Deutsche Börse and the NYSE's proposal to create the world's largest exchange operator was rejected by European anti-trust authorities ...yesterday (1 February), for fear that it would create 'a near-monopoly' on derivatives trading. 'The merger between Deutsche Börse and NYSE Euronext would ...


Finding ultracool brown dwarfs with MegaCam on CFHT: method and first results  


We present the first results of a wide field survey for cool brown dwarfs with the MegaCam camera on the CFHT telescope, the Canada-France Brown Dwarf Survey, hereafter CFBDS. Our objectives are to find ultracool brown dwarfs and to constrain the field-brown dwarf mass function thanks to a larger sample of L and T dwarfs. We identify candidates in CFHT/MegaCam i' and z' images using optimised psf-fitting within Source Extractor, and follow them up with pointed near-infrared ...

Delorme, Philippe; Willott, Chris; Forveille, Thierry; Delfosse, Xavier; Reyle?, Ce?line; Bertin, Emmanuel; Albert, Loic; Artigau, Etienne; Robin, Annie; Allard, France; Doyon, Rene; Hill, Gary



Mega sporting events: A poisoned chalice or a new dawn for low- and middle-income  

Directory of Open Access Journals (Sweden)

Full Text Available Mega sporting events in South Africa, which has the largest number of HIV-positive people in the world, and India, with 1.8 million deaths of children under 5 each year and 52 million stunted children, raise questions about the effective and, as importantly, the moral imperative of spending billions of dollars to host a sporting event. From a health perspective, selling alcohol and debt tarnishes further the notion of any intangible benefits of mega events to low- and middle-income countries.

Mark Tomlinson



Dynamic plasmid populations in Halobacterium halobium. (United States)

Deletion events occurring in the major 150-kilobase-pair (kb) plasmid pHH1 of the archaebacterium Halobacterium halobium were investigated. We found four deletion derivatives of pHH1 in gas-vacuole-negative mutants, two of which (pHH23) [65 kb] and pHH4 [36 kb]) we analyzed. Both plasmids incurred more than one deletion, leading to the fusion of noncontiguous pHH1 sequences. pHH23 and pHH4 overlapped by only 4 kb of DNA sequence. A DNA fragment derived from this region was used to monitor the production of further deletion variants of pHH4. A total of 25 single colonies were characterized, 23 of which contained various smaller pHH4 derivatives. Of the 25 colonies investigated, 2 had lost pHH4 entirely and contained only large (greater than or equal to 100-kb) minor covalently closed circular DNAs. One colony contained the 17-kb deletion derivative pHH6 without any residual pHH4. The sizes of the pHH4 deletion derivatives, produced during the development of a single colony, ranged from 5 to 20 kb. In five colonies, pHH4 was altered by the integration of an additional insertion element. These insertions, as well as copies of the various insertion elements already present in pHH4, presumably serve as hot spots for recombination events which result in deletions. A second enrichment procedure led to the identification of colonies containing either a 16-kb (pHH7) or a 5-kb (pHH8) deletion derivative of pHH4 as the major plasmid. pHH8, the smallest plasmid found, contained the 4 kb of unique DNA sequence shared by pHH23 and pHH4, as well as some flanking pHH4 sequences. This result indicates that the 4-kb region contains the necessary sequences for plasmid maintenance and replication. PMID:2841297

Pfeifer, F; Blaseio, U; Ghahraman, P



Plasmid transfer between bacteria in soil microcosms and the field  

Directory of Open Access Journals (Sweden)

Full Text Available In ibis review factors influencing conjugal plasmid transfer between bacteria and the possible role of naturally occurring selftransmissible plasmide for the dissemination of recombinant DNA in soil will be discussed. In microcosm studies, plasmid transfer between various species of introduced bacteria has been detected. Moreover, plamid transfer to indigenous soil micoorganisms was observed. Soil is an oligotrophic environment and plasmid transfer occurred mainly under conditions which were nutritionally favourable for bacteria, such as in the plant rhizosphere and in the presence of clay minerais or added nutrients. Mobilizable plasmids, lacking the ability to transfer themselves, have been reported to be transferred in the presence of selftransmissible plasmids. A study comparing conjugal transfer in microcosme with those in the field revealed that the transfer rates found in microcosme and in the field were similar. Transfer of chromosomal DNA by plasmid RP4 could only be shown on filters and was not observed in soil. Transfer of plasmids carrying biodegradative genes appeared to be favoured in the presence of the compound that can be degraded. Evidence was found for the presence of naturally-occurring selftransmissible plasmids in bacteria in the rhizosphere which could mobilize recombinant plasmids.

Eric Smit



Molecular characterization of "plasmid-free" antibiotic-resistant Haemophilus influenzae.  


We examined 14 multiresistant and 8 ampicillin- or tetracycline-resistant Haemophilus influenzae isolates and 4 ampicillin-resistant H. parainfluenzae isolates for plasmid deoxyribonucleic acid. Sixteen strains carried plasmids. Both "plasmid-free" and plasmid-carrying isolates transferred the antibiotic resistance by conjugation. All transconjugants carried plasmid deoxyribonucleic acid, suggesting that the apparent plasmid-free strains contained R plasmids encoding for antibiotic resistance.

Roberts, M. C.; Smith, A. L.



Definition of a minimal plasmid stabilization system from the broad-host-range plasmid RK2.  


The stable inheritance of the broad-host-range plasmid RK2 is due at least in part to functions within a region located at coordinates 32.8 to 35.9 kb, termed the RK2 par locus. This locus encodes four previously identified genes in two operons (parCBA and parD; M. Gerlitz, O. Hrabak, and H. Schwab, J. Bacteriol. 172:6194-6203, 1990, and R. C. Roberts, R. Burioni, and D. R. Helinski, J. Bacteriol. 172:6204-6216, 1990). The parCBA operon is functional in resolving plasmid multimers to monomers...

Roberts, R. C.; Helinski, D. R.



Treasure Chase: Mega Gifts Are Down--But Are They out? (United States)

Just a few years ago, the University of Notre Dame averaged about six mega gifts--$10 million or more--a year. Last year, however, the Fighting Irish received only one such donation. "That multimillion donation has become more difficult to obtain," says Lou Nanni, vice president for university relations at the Indiana institution. "It's not just…

Mayer, Caroline E.



Facilitators and Inhibitors of Bidding and Hosting Mega Sporting Events in Iran  

Directory of Open Access Journals (Sweden)

Full Text Available Legacies of hosting mega sporting events have been attempting idea for both the developed and the developing nations to participate in "bidding" competitions. Through mega sporting events bid process, despite all defined essentials infrastructures, the viewpoint of local organizing committee play a significant role to propose a winning bid and delivery of successful games. This research aims to identify the facilitators and inhibitors of bidding and hosting mega sporting events in Iran from the viewpoints of the Iranian distinguished professors in the sport management and the sport executive managers. Researcher questionnaire and Semi-structure interviews were conducted to gain in depth data. The results indicated that Iran currently has limitations to have winning bid and successful host mega sporting events; even though, it possesses the potential to do so. Public interest and support for hosting the sport events, good security condition against terrorism and tourist attractions are known as the strong points and he challenges and inhibitors which Iran is faced with includes: the qualitative and quantitative weakness in the transportation infrastructures and sport venues, west countries economic boycott, unstable government support and the lack of long-run planning for the events.

Mohammad Koosha



Isolation of Clinical Strains of Pseudomonas aeruginosa Harboring Different Plasmids  

Directory of Open Access Journals (Sweden)

Full Text Available Aim of this study was to investigate the presence of plasmids among the strains of P. aeruginosa isolated from clinically diagnosed cases in Tehran in 2006. A total of 38 strains of P. aeruginosa were isolated. With the exception of one isolate, all P. aeruginosa strains harbored at least one plasmid band. The electrophoretic analysis of plasmid DNAs showed different number of plasmid bands among the strains tested. The DNA band of 1.4 kbp was evident in 84.2% of the strains. Approximately 71 and 21% of the isolates harbored concomitantly two and three plasmids, respectively. Isolation of strains with diverse types of plasmids suggests the different cluster of P. aeruginosa might be disseminated during the current study period.

R. Ranjbar



[Construction and expression of Runxl-shRNA expressiong plasmid]. (United States)

This study aims to construct the plasmid of human Runx1 and observe its possible effects on Runxl gene expression in human pulmonary adenocarcinoma cells (A549). The shRNA sequence targeting human Runx1 was designed and synthesized, then inserted into pSuper plasmid by DNA recombination technology. The recombinant plasmid was confirmed by bacterial colonies PCR, enzyme digestion analysis and DNA sequencing. A549 cells were transfected by Runx1 shRNA plasmid. The inhibition efficiency of pSuper-Runx1-shRNA plasmid on Runx1 at mRNA level and protein level were measured with real-time PCR and Western blot. The results of real-time PCR and Western blot indicated that the mRNA and protein levels of Runxl in A549 cells were inhibited by the pSuper-Runxl- shRNA expression plasmid, and the inhibition rate were 33% and 50%, respectively. PMID:25508429

Chen, Yifan; Tang, Xiaoju; Luo, Fengming



Mega-precovery and data mining of near-Earth asteroids and other Solar System objects (United States)

The vast collection of CCD images and photographic plate archives available from the world-wide archives and telescopes is still insufficiently exploited. Within the EURONEAR project we designed two data mining software with the purpose to search very large collections of archives for images which serendipitously include known asteroids or comets in their field, with the main aims to extend the arc and improve the orbits. In this sense, ''Precovery'' (published in 2008, aiming to search all known NEAs in few archives via IMCCE's SkyBoT server) and ''Mega-Precovery'' (published in 2010, querying the IMCCE's Miriade server) were made available to the community via the EURONEAR website ( Briefly, Mega-Precovery aims to search one or a few known asteroids or comets in a mega-collection including millions of images from some of the largest observatory archives: ESO (15 instruments served by ESO Archive including VLT), NVO (8 instruments served by U.S. NVO Archive), CADC (11 instruments, including HST and Gemini), plus other important instrument archives: SDSS, CFHTLS, INT-WFC, Subaru-SuprimeCam and AAT-WFI, adding together 39 instruments and 4.3 million images (Mar 2014), and our Mega-Archive is growing. Here we present some of the most important results obtained with our data-mining software and some new planned search options of Mega-Precovery. Particularly, the following capabilities will be added soon: the ING archive (all imaging cameras) will be included and new search options will be made available (such as query by orbital elements and by observations) to be able to target new Solar System objects such as Virtual Impactors, bolides, planetary satellites, TNOs (besides the comets added recently). In order to better characterize the archives, we introduce the ''AOmegaA'' factor (archival etendue) proportional to the AOmega (etendue) and the number of images in an archive. With the aim to enlarge the Mega-Archive database, we invite the observatories (particularly those storing their images online and also those that own plate archives which could be scanned on request) to contact us in order to add their instrument archives (consisting of an ASCII file with telescope pointings in a simple format) to our Mega-Precovery open project. We intend for the future to synchronise our service with the Virtual Observatory.

Popescu, M.; Vaduvescu, O.; Char, F.; Curelaru, L.; Euronear Team



3-D geometry and physical property of the Mega-Splay Fault in Nankai trough (United States)

The Nankai trough is a subduction zone, where the Philippine Sea plate is being subducted beneath southwest Japan at a rate of ~4-6.5 cm/y at an azimuth of ~300°-315°. A lot of operations have been done in Nankai, such as three-dimensional seismic reflection surveys and Deep Sea Drilling Project (DSDP), Ocean Drilling Program (ODP), Integrated Ocean Drilling Program (IODP). They revealed that there is a large splay fault, referred to as 'Mega-Splay'. The Mega-Splay Fault has caused a series of catastrophic earthquakes and submarine landslides, which may have led to TSUNAMI. Since fault development history may have affected the geometry of the Mega-Splay Fault and physical property within the fault zone, they need to be examined in detail. In this research, we used 3-D pre-stack depth migration (PSDM), 3-D pre-stack time migration (PSTM) and P-wave velocity in C0004B well (Logging data), in order to interpret 3-D structure of Mega-Splay Fault. The analysis in this research is basically divided into two parts. One is structural interpretation of Splay Fault, based on the high amplitude reflection surface on seismic profiles. The other part is acoustic impedance inversion (AI inversion), in which we inverted seismic waveform into physical property (in this study, acoustic impedance), with the P-wave velocity data at C0004B near Mega-Splay Fault. The 3-D PSDM (or PSTM) clearly images details of Splay Fault, with good continuity of reflections along the fault. It is possible on each seismic profile to trace the high amplitude lines, where rock-properties significantly change. Since Mega-Splay Fault has 45-59m width along the wells, we interpreted the upper limit and the lower limit of the Mega-Splay Fault, based on the high amplitude surfaces along 3-D PSDM. Our interpretation shows that the width of Mega-Splay Fault has variation along the fault, and the plan geometry of the fault toe has a salient at the middle of the 3D box area, suggesting the fault could be divided into two segments: the eastern part and western part. In AI inversion, the 3-D PSTM and P-wave velocity at C0004B were used to build a physical property model around Mega-Splay Fault. AI Inversion is a methodology to invert seismic waveforms with physical property data, into acoustic impedance. Acoustic Impedance governs the ability of a rock to allow the passage of an acoustic wave. In this analysis, we used Hampson-Russell STRATA to perform post-stack seismic inversion. Our results show that there is a low acoustic impedance layer in the upper zone of Splay Fault. 3-D distribution of the low acoustic impedance layer in the fault zone has a variation in the width, similar to the 3-D interpretation of the geometry. This suggests that there are a relationship between structural geometry and physical property along the Mega-Splay Fault.

Masui, R.; Tsuji, T.; Yamada, Y.; Environmental Resource; System Engineering laboratory



Analysis of the incompatibility determinants of I-complex plasmids.  


The isolation and characterization of minireplicons corresponding to group B and I-complex plasmids are reported. The molecular structures of the small RNAs that may play a major role in the replication control and incompatibility reactions of the plasmids are compared. A mutant plasmid with changed copy number and incompatibility specificity is described. This mutant had a single-base-pair substitution in the DNA region that codes for the small RNA.

Nikoletti, S.; Bird, P.; Praszkier, J.; Pittard, J.



Pathogenomics of the Virulence Plasmids of Escherichia coli  


Summary: Bacterial plasmids are self-replicating, extrachromosomal elements that are key agents of change in microbial populations. They promote the dissemination of a variety of traits, including virulence, enhanced fitness, resistance to antimicrobial agents, and metabolism of rare substances. Escherichia coli, perhaps the most studied of microorganisms, has been found to possess a variety of plasmid types. Included among these are plasmids associated with virulence. Several types of E. col...

Johnson, Timothy J.; Nolan, Lisa K.



Plasmid-Driven Formation of Influenza Virus-Like Particles  


We established a plasmid-based system for generating infectious influenza virus-like particles entirely from cloned cDNAs. Human embryonic kidney cells (293T) were transfected with plasmids encoding the influenza A virus structural proteins and with a plasmid encoding an influenza virus-like viral RNA (vRNA) which contained an antisense copy of the cDNA for green fluorescence protein (GFP) flanked by an RNA polymerase I promoter and terminator. Intracellular transcription of the latter constr...

Neumann, Gabriele; Watanabe, Tokiko; Kawaoka, Yoshihiro



Identification of plasmid partition function in coryneform bacteria.  


We have identified and characterized a partition function that is required for stable maintenance of plasmids in the coryneform bacteria Brevibacterium flavum MJ233 and Corynebacterium glutamicum ATCC 31831. This function is localized to a HindIII-NspV fragment (673 bp) adjacent to the replication region of the plasmid, named pBY503, from Brevibacterium stationis IFO 12144. The function was independent of copy number control and was not associated directly with plasmid replication functions. ...

Kurusu, Y.; Satoh, Y.; Inui, M.; Kohama, K.; Kobayashi, M.; Terasawa, M.; Yukawa, H.



Physical map of a plasmid from Caedibacter taeniospiralis 51.  


Caedibacter taeniospiralis 51 carries at least two plasmids, pKAP51 and pKAP52. The smaller plasmid, pKAP51, contains 43 kilobase pairs. The larger plasmid, pKAP52, contains more than 110 kilobase pairs. Relative positions of recognition sequences for seven different restriction endonucleases were determined, and a physical map of pKAP51, consisting of a total of 28 restriction sites, was constructed.

Quackenbush, R. L.; Dilts, J. A.; Maser, R. L.



Plasmids with a Chromosome-Like Role in Rhizobia ? †  


Replicon architecture in bacteria is commonly comprised of one indispensable chromosome and several dispensable plasmids. This view has been enriched by the discovery of additional chromosomes, identified mainly by localization of rRNA and/or tRNA genes, and also by experimental demonstration of their requirement for cell growth. The genome of Rhizobium etli CFN42 is constituted by one chromosome and six large plasmids, ranging in size from 184 to 642 kb. Five of the six plasmids are dispensa...

Landeta, Cristina; Da?valos, Araceli; Cevallos, Miguel A?ngel; Geiger, Otto; Brom, Susana; Romero, David



Viral/plasmid captures in Crenarchaea. (United States)

tRNA genes are the integration sites of viral/plasmid genomes into their hosts chromosomes by homologous recombination catalyzed by integrases. The crossover between viral/plasmid and host genomes leaves 3'-fractional tRNA motif as tell-tale marker of integration on host-chromosome. This 3'-fractional tRNA motif on host genome is our retrenched tRNA (rtRNA). To track integration in Crenarchaea, host rtRNAs, and conserved features in viral/plasmid tRNA motifs and in integrases were identified. The viral-integrase has a conserved 24-nucleotide long motif, GTATTATGTTTACTCAATAGAGAA in the N-terminal region. Upstream of the viral tRNA motif has a conserved poly-cytosine region and a hairpin secondary structure. Corresponding to a host tRNA, we observe up to two rtRNAs on crenarchaeal chromosome. The length of the rtRNA is not random. The fraction of tRNA excised off in rtRNA is either 61.8, or 50, or 38.2, or 23.6%. Thus, the integration fragments the tRNA nonrandomly dividing it approximately in ratios 3:2, or 1:1, or 2:3, or 1:3. More than 79% of rtRNAs have lengths that are excised 38.2% off tRNA. It turns out that 38.2% excision implies that the ratio of the length of tRNA to its rtRNA is just 1.618, the golden ratio. Hence, the vast majority of rtRNAs are at or near the golden ratio. Evidence emerges of new extremophile viral entities. PMID:23659319

Das, Smarajit; Mitra, Sanga; Sahoo, Satyabrata; Chakrabarti, Jayprokas



Correlation between plasmid content and infectivity in Borrelia burgdorferi  


Infectivity-associated plasmids were identified in Borrelia burgdorferi B31 by using PCR to detect each of the plasmids in a panel of 19 clonal isolates. The clones exhibited high-, low-, and intermediate-infectivity phenotypes based on their frequency of isolation from needle-inoculated C3H/HeN mice. Presence or absence of 21 of the 22 plasmids was determined in each of the clones by using PCR primers specific for regions unique to each plasmid, as identified in t...

Purser, Joye E.; Norris, Steven J.



Multiple Pathways of Plasmid DNA Transfer in Helicobacter pylori  


Many Helicobacter pylori (Hp) strains carry cryptic plasmids of different size and gene content, the function of which is not well understood. A subgroup of these plasmids (e.g. pHel4, pHel12), contain a mobilisation region, but no cognate type IV secretion system (T4SS) for conjugative transfer. Instead, certain H. pylori strains (e.g. strain P12 carrying plasmid pHel12) can harbour up to four T4SSs in their genome (cag-T4SS, comB, tfs3, tfs4). Here, we show that such indigenous plasmids can...

Rohrer, Stefanie; Holsten, Lea; Weiss, Evelyn; Benghezal, Mohammed; Fischer, Wolfgang; Haas, Rainer



Molecular analysis of transferable tetracycline resistance plasmids from Clostridium perfringens.  


Conjugative tetracycline resistance plasmids from 15 Clostridium perfringens isolates from piggeries were analyzed by restriction endonuclease digestion and agarose gel electrophoresis. Seven isolates from one farm were found to carry a 47-kilobase pair (kb) plasmid, pJIR5, which had EcoRI, XbaI, and ClaI profiles that were identical to those of a previously characterized plasmid, pCW3. An isolate from a second farm was found to carry a plasmid, pJIR6, which also was indistinguishable from pC...

Abraham, L. J.; Rood, J. I.



Identification, characterization and preliminary X-ray diffraction analysis of the rolling-circle replication initiator protein from plasmid pSTK1. (United States)

Antibiotic resistance in bacterial pathogens poses an ever-increasing risk to human health. In antibiotic-resistant strains of Staphylococcus aureus this resistance often resides in extra-chromosomal plasmids, such as those of the pT181 family, which replicate via a rolling-circle mechanism mediated by a plasmid-encoded replication initiation protein. Currently, there is no structural information available for the pT181-family Rep proteins. Here, the crystallization of a catalytically active fragment of a homologous replication initiation protein from the thermophile Geobacillus stearothermophilus responsible for the replication of plasmid pSTK1 is reported. Crystals of the RepSTK1 fragment diffracted to a resolution of 2.5?Å and belonged to space group P2?2?2?. PMID:24100563

Carr, Stephen B; Mecia, Lauren B; Phillips, Simon E V; Thomas, Christopher D



Photonic plasmid stability of transformed Salmonella Typhimurium: A comparison of three unique plasmids  

Directory of Open Access Journals (Sweden)

Full Text Available Abstract Background Acquiring a highly stable photonic plasmid in transformed Salmonella Typhimurium for use in biophotonic studies of bacterial tracking in vivo is critical to experimental paradigm development. The objective of this study was to determine stability of transformed Salmonella Typhimurium (S. typh-lux using three different plasmids and characterize their respective photonic properties. Results In presence of ampicillin (AMP, S. typh-lux with pCGLS-1, pAK1-lux and pXEN-1 plasmids exhibited 100% photon-emitting colonies over a 10-d study period. Photon emitters of S. typh-lux with pCGLS-1, pAK1-lux and pXEN-1 without AMP selection decreased over time (P 7 to 1 × 109 CFU, P 0.05; although photonic emissions across a range of bacterial concentrations were not different (1 × 104 to 1 × 106 CFU, P > 0.05. For very low density bacterial concentrations imaged in 96 well plates photonic emissions were positively correlated with bacterial concentration (P 3 to 1 × 105 CFU low to high were different in the 96-well plate format (P Conclusion These data characterize photon stability properties for S. typh-lux transformed with three different photon generating plasmids that may facilitate real-time Salmonella tracking using in vivo or in situ biophotonic paradigms.

Lay Donald



Dictyostelium giganteum plasmid Dgp1 is a member of the Ddp2 plasmid family. (United States)

Dgp1, a circular 4.4-kb plasmid found in the nuclei of Dictyostelium giganteum strain DG61, is a member of the same plasmid family as plasmids Ddp2 and pDG1. Dgp1 has sequence similarity to a conserved region of the Ddp2 and pDG1 open reading frames. As with Ddp2 and pDG1, a single large RNA is transcribed from Dgp1. This 3.3-kb transcript is present at about 350 copies per vegetative cell. The transcript abundance decreased about 10-fold in early aggregation and continued at this lower level until late culmination when it returned to the level seen in vegetative cells. Dgp1 has a repeat of several hundred base pairs in a location, relative to the transcribed region, similar to the inverted repeats found in Ddp2 and pDG1. Dgp1 cannot be maintained as a plasmid in Dictyostelium discoideum AX4 cells, suggesting that Dgp1 carries species-specific maintenance elements. PMID:1518911

Yin, Y; Welker, D L



Plasmid Partition System of the P1par Family from the pWR100 Virulence Plasmid of Shigella flexneri  


P1par family members promote the active segregation of a variety of plasmids and plasmid prophages in gram-negative bacteria. Each has genes for ParA and ParB proteins, followed by a parS partition site. The large virulence plasmid pWR100 of Shigella flexneri contains a new P1par family member: pWR100par. Although typical parA and parB genes are present, the putative pWR100parS site is atypical in sequence and organization. However, pWR100parS promoted accurate plasmid partition in Escherichi...

Sergueev, Kirill; Dabrazhynetskaya, Alena; Austin, Stuart



Green space management & residents’ benefits  


Management of green spaces in rental multi-family housing areas is discussed in a Swedish context and the benefits of maintenance for residents examined in this thesis. In Sweden, these green spaces are an important part of the urban green structure and the housing companies who manage these spaces are important green space providers. However, the management and maintenance of such green spaces and its benefits for residents seldom receive attention in research. The residents’ perspective i...

Lindgren, Therese



Measurement of residence times and residence-time distributions  

International Nuclear Information System (INIS)

In this chapter the use of radioisotopes for the measurement of residence-times with particular reference to vessel failure in the chemical industry is discussed. Ideal and non-ideal flow models and the more important parameters of models are discussed. Examples are given of the effect of process malfunction on residence times. (U.K.)


Resident training in pathology: From resident's point of view  

Directory of Open Access Journals (Sweden)

Full Text Available In many recent studies in the literature have described and commented on “competency based resident training” in pathology. According to this model, competencies are subclassified in 6 main categories: Patient care, medical knowledge, practice based learning and improvement, interpersonal and communication skills, professionalism, and systems based practice. Assessment of competency forms the main component of this model.Under the framework of Ankara Society of Pathology, a working group, composed of 11 residents, 6 of which representing the Training and Research Hospitals of Ministry of Health and the rest representing the university hospitals in Ankara, was established in order to participate in the think-tank about resident training in pathology. A questionnaire, composed of 12 questions, was prepared. According to this questionnaire, the number of trainers in the university hospitals is much higher than in the commercial hospitals. While the total number of cases and cases per resident do not differ between the university and commercial hospitals, microscopes used for the educational purposes are significantly less in the commercial hospitals, that is due to less number of binocular microscopes. The amount of resident training program, which consists of intra and intersectional meetings, are similar in the university and commercial hospitals, however, theoretic lectures are given only in 3 departments. Residents working in the university hospitals have obviously heavier burden than in the commercial hospitals. Lastly, residents generally exclaimed that the time dedicated to the macroscopy training is less sufficient than time used for the microscopy training.The factors affecting the training of resident in pathology are divided into two main groups: 1 Factors directly affecting training (quality of trainer, time dedicated for education, feed back, eg. and 2 Conditions which waste residents' time. For instant, workload which does need qualified staff and increases the burden on residents may be reassigned to medical secretary or pathology assistants; therefore energy of residents can be saved for educational activities. Optimization of physical working conditions, assortment of training programs, rotation in lacking subjects and consultations will enhance the quality of the education of the resident. Feedback assessment of trainer and trainee is an essential part of a training program.In conclusion, an ideal resident from the resident's point of view is the person who is endowed with medical and pathological knowledge, orderly interrelates with staff, professionally communicates with clinicians, manages a laboratory and is trained hard to achieve all the above mentioned competencies.




Replication and inheritance of Nocardia plasmid pC1. (United States)

Nocardia sp. C-14-1, isolated from acrylic fiber wastewater, can degrade long-chain alkanes and succinonitrile efficiently. Here we report the characterization of an indigenous plasmid pC1. The overall nucleotide sequence of pC1 consisted of 5841 bp. The five ORFs, encoding a DNA recombinase, replication protein (Rep(pC1)) and three proteins of unknown function, were predicted on pC1. The Rep(pC1) displayed its homology with the Rep of Rhodococcus large plasmid p33701, suggesting a theta type of replication. An Escherichia coli plasmid (containing the single rep(pC1) gene) propagated autonomously in low copy number in Nocardia or Rhodococcus, suggesting that rep(pC1) was an essential gene for plasmid replication. The plasmid (containing the single rep(pC1) gene) presented as inheritance unstable hints that other pC1 loci were required for the stable inheritance of plasmids. By comparison of the plasmid-borne Rep proteins, we classify Rhodococcus or Nocardia plasmids into four groups. PMID:16842357

Shen, Meijuan; Fang, Ping; Xu, Deqiang; Zhang, Yalei; Cao, Weihuan; Zhu, Yingmin; Zhao, Jianfu; Qin, Zhongjun



Purification of large plasmids with methacrylate monolithic columns. (United States)

The rapid evolution of gene therapy and DNA vaccines results in an increasing interest in producing large quantities of pharmaceutical grade plasmid DNA. Most current clinical trials involve plasmids of 10 kb or smaller in size, however, future requirements for multigene vectors including extensive control regions may require the production of larger plasmids, e. g., 20 kb and bigger. The objective of this study was to examine certain process conditions for purification of large plasmids with the size of up to 93 kb. Since there is a lack of knowledge about production and purification of bigger plasmid DNA, cell lysis and storage conditions were investigated. The impact of chromatographic system and methacrylate monolithic column on the degradation of plasmid molecules under nonbinding conditions at different flow rates was studied. Furthermore, capacity measurements varying salt concentration in loading buffer were performed and the capacities up to 13 mg of plasmid per mL of the monolithic column were obtained. The capacity flow independence in the range from 130 to 370 cm/h was observed. Using high resolution monolithic column the separation of linear and supercoiled isoforms of large plasmids was obtained. Last but not least, since the baseline separation of RNA and pDNA was achieved, the one step purification on larger CIM DEAE 8 mL tube monolithic column was performed and the fractions were analyzed by CIM analytical monolithic columns. PMID:19598166

Krajnc, Nika Lendero; Smrekar, Franci; Cerne, Jasmina; Raspor, Peter; Modic, Martina; Krgovic, Danijela; Strancar, Ales; Podgornik, Ales



Linear plasmids in plant mitochondria: peaceful coexistences or malicious invasions? (United States)

Plant mitochondria contain small extrachromosomal DNAs in addition to a large and complex main mitochondrial genome. These molecules can be regarded as extrachromosomal replicons or plasmids, of which there are two forms, circular and linear. Linear mitochondrial plasmids are present in many fungi and in some plants, but they seem to be absent from most animal cells. They usually have a common structural feature, called an invertron, that is characterized by the presence of terminal inverted repeats and proteins covalently attached to their 5 termini. Linear mitochondrial plasmids possess one to six ORFs that can encode unknown proteins but often code for the DNA and RNA polymerases. Although the functions of most linear plasmids in plant mitochondria are unknown, some plasmids may be associated with mitochondrial genome rearrangements and may have phenotypic effects due to their integration into mitochondrial genome. The Brassica 11.6-kb plasmid, one of the linear mitochondrial plasmids in plants, shows a non-maternal inheritance, in contrast to mitochondrial genomes. The origin of these plasmids is still a mystery, but indirect evidence indicates the possibility of horizontal transfer from fungal mitochondria. In this review, the main features of these unique DNAs present in plant mitochondria are described. PMID:18326073

Handa, Hirokazu



Examination of uropathogenic Escherichia coli strains conferring large plasmids  

Directory of Open Access Journals (Sweden)

Full Text Available Suhartono (2010 Examination of uropathogenic Escherichia coli strains conferring large plasmids. Biodiversitas 11: 59-64. Of major uropathogens, Escherichia coli has been widely known as a main pathogen of UTIs globally and has considerable medical and financial consequences. A strain of UPEC, namely E. coli ST131, confers a large plasmid encoding cephalosporinases (class C ?-lactamase or AmpC that may be disseminated through horizontal transfer among bacterial populations. Therefore, it is worth examining such large plasmids by isolating, purifying, and digesting the plasmid with restriction enzymes. The examination of the large plasmids was conducted by isolating plasmid DNA visualized by agarose gel electrophoresis as well as by PFGE. The relationship of plasmids among isolates was carried out by HpaI restriction enzyme digestion. Of 36 isolates of E. coli ST 131, eight isolates possessed large plasmids, namely isolates 3, 9, 10, 12, 17, 18, 26 and 30 with the largest molecular size confirmed by agarose gel electrophoresis and PFGE was ~42kb and ~118kb respectively. Restriction enzyme analysis revealed that isolates 9, 10, 12, 17 and 18 have the common restriction patterns and those isolates might be closely related.




Plasmid-encoded copper resistance and precipitation by Mycobacterium scrofulaceum.  


A copper-tolerant Mycobacterium scrofulaceum strain was able to remove copper from culture medium by sulfate-dependent precipitation as copper sulfide. Such precipitation of copper sulfide was not observed in a derivative that lacks a 173-kilobase plasmid. In addition, the plasmid-carrying strain has a sulfate-independent copper resistance mechanism.

Erardi, F. X.; Failla, M. L.; Falkinham, J. O.



Phage type conversion in Salmonella enterica serotype Enteritidis caused by the introduction of a resistance plasmid of incompatibility group X (IncX)  

DEFF Research Database (Denmark)

The plasmid pOG670, a 54 kb, conjugative plasmid that specifies resistance to ampicillin and kanamycin and belonging to the incompatibility group X (IncX), was transferred into 10 isolates of Salmonella enterica serotype Enteritidis belonging to 10 different phage types (PT1, 2, 3, 4, 8, 9, 9b, 10, 11 and 13). Acquisition of the plasmid by these strains did not result in the loss of any resident plasmids but resulted in phage type conversion in 8 of the 10 strains (PT1, 2, 4, 8, 9, 9b, 10 and 11). The observed changes in phage type were found to result from the loss of sensitivity to 3 of the 10 typing phages used (phages 3, 5 and 7). Where the conversion resulted in a change to a defined phage type, both the new and original PTs belonged to the same, previously described, evolutionary lines. Enteritidis PTs 1, 4 and 8, commonly associated with poultry world-wide, were converted to PTs 21, 6 and 13a respectively. The results indicate a different route for phage type conversion Enteritidis from others reportedin the literature and, although IncX plasmids are not normally present in PT8 or PT13a, may suggest a possible mechanism/link connecting these phage types.

Brown, D. J.; Baggesen, Dorte Lau



Parallels in portraits of leadership in mega churches of Gauteng (RSA) and Florida (USA) / Tsietsi John Maloma  


This thesis, Parallels in portraits of leadership in mega churches of Gauteng (RSA) and Florida (USA), the researcher, studied literature on church leadership with special reference to the leadership of mega churches. He researched issues relating to the nature of church leadership by exploring relevant Bible passages, the lives of certain Bible characters that the Bible presents as good but not perfect leaders, as well as relevant key theological conceptions of leadership. The study accordin...

Maloma, Tsietsi John



Multilocus sequence typing of IncN plasmids  

DEFF Research Database (Denmark)

OBJECTIVES: Incompatibility group N (IncN) plasmids have been associated with the dissemination of antimicrobial resistance and are a major vehicle for the spread of blaVIM-1 in humans and blaCTX-M-1 in animals. A plasmid multilocus sequence typing (pMLST) scheme was developed for rapid categorization of IncN plasmids. METHODS: Twelve fully sequenced IncN plasmids available at GenBank were analysed in silico for selecting the loci for the IncN-specific pMLST. A total of 58 plasmids originating from different reservoirs (human, pig, poultry, cattle and horses) and geographic regions (Italy, Greece, Denmark, UK and The Netherlands) were classified by DNA sequencing of the amplicons obtained for the repA, traJ and korA loci. RESULTS: Eleven sequence types (STs) were defined on the basis of allele sequences of the three selected loci. Most plasmids carrying blaCTX-M-1 (24/27) isolated in different countries from both animals and humans belonged to ST1, suggesting dissemination of an epidemic plasmid through the food chain. Fifteen of 17 plasmids carrying blaVIM-1 from Klebsiella pneumoniae and Escherichia coli, isolated during a 5year period in Greece were assigned to ST10, suggesting that spread and persistence of this particular IncN-carrying blaVIM-1 lineage in Greece. CONCLUSIONS: This study proposes the use of pMLST as a suitable and rapid method for identification of IncN epidemic plasmid lineages. The recent spread of blaCTX-M-1 among humans and animals seems to be associated with the dissemination of an epidemic IncN plasmid lineage.

García-Fernández, Aurora; Villa, Laura



Study of the performance of the MicroMegas chambers for the ATLAS muon spectrometer upgrade.  

CERN Document Server

MicroMegas (Micro MEsh Gaseous Structures) chambers and sTGC (small Thin Gap Chambers) have been chosen for the upgrade of the forward muon detectors of the ATLAS experiment to provide precision tracking and trigger capabilities. The MicroMegas chambers have been designed to allow operation in a high rate environment, to guarantee a resolution below 100 micron per point on a large area and to provide a fast trigger signal. In the last months several tests have been done on small area prototypes in order to verify that the requirements on resolution and rate capabilities are well matched. The results of the performance studies done on beams at CERN and of the ageing studies done at Saclay, are presented.

Bini, C; The ATLAS collaboration



Hereditary subependymal heterotopia associated with mega cisterna magna: antenatal diagnosis with magnetic resonance imaging. (United States)

Bilateral nodular subependymal heterotopia has recently been identified as a hereditary disease linked to the X-chromosome. The sonographic findings are very subtle and difficult to observe during the second trimester when the germinal matrix is at its largest. Fetal magnetic resonance imaging facilitates visualization of the periventricular area. We report a case of bilateral nodular heterotopia associated with mega cisterna magna diagnosed by ultrasound and magnetic resonance imaging at 29 weeks' gestation. Magnetic resonance imaging of the brain of the mother revealed similar findings to those observed in the fetus and neonate. This case confirms the association between mega cisterna magna and bilateral periventricular nodular heterotopia and demonstrates that neuroimaging studies of the mother can contribute to the fetal diagnosis. PMID:12100426

Bargalló, N; Puerto, B; De Juan, C; Martinez-Crespo, J M; Lourdes Olondo, M



Management of juxta articular giant cell tumors around the knee by custom mega prosthetic arthroplasty  


Background: Juxtaarticular giant cell tumors around the knee are common and pose a special problem of reconstruction after tumor excision. This article analyzes the functional outcome after resection of juxtaarticular giant cell tumors around the knee and replacement by custom mega prosthetic arthroplasty. Materials and Methods: One hundred and forty-three patients with juxtaarticular giant cell tumors around the knee with mean age of 30.8 years (range 15 to 64 years) underwe...

Natarajan Mayil; Prabhakar R; Mohamed Sameer M; Shashidhar R



Management of juxta articular giant cell tumors around the knee by custom mega prosthetic arthroplasty  

Directory of Open Access Journals (Sweden)

Full Text Available Background: Juxtaarticular giant cell tumors around the knee are common and pose a special problem of reconstruction after tumor excision. This article analyzes the functional outcome after resection of juxtaarticular giant cell tumors around the knee and replacement by custom mega prosthetic arthroplasty. Materials and Methods: One hundred and forty-three patients with juxtaarticular giant cell tumors around the knee with mean age of 30.8 years (range 15 to 64 years underwent resection and replacement by custom mega prosthetic arthroplasty during the period 1994 to 2005. Eighty-one patients were males and 62 were females. Fourteen patients were in Enneking Stage 2 while 129 patients were in Stage 3. Distal femur was involved in 87 patients and proximal tibia in 56 patients. Forty patients presented with pathological fracture at the time of diagnosis. The technique of sleeve resection of the quadriceps musculature was followed to achieve local clearance in distal femoral tumors, and for proximal tibial lesions resection of the tumor-bearing part and a medial gastronemius rotation flap was used routinely. The prosthesis used was a rotating hinge custom mega prosthesis manufactured locally. Results: The mean follow-up was 5.4 years (1.5 years to 11 years. Functional results were analyzed using Enneking criteria. Excellent results were obtained in 90 patients (62% and 39 patients had good (27% results. Periprosthetic fracture (8.3% and infection (6.9% were the most common complications followed by aseptic loosening (4.2%. Recurrence of lesion was found in only one patient (0.69% who was managed with wide local excision. Conclusion: Custom mega prosthetic arthroplasty is effective in achieving the desired goals of reconstruction with good functional results and least complications in selected patients.

Natarajan Mayil



Low-mass, high-rate cylindrical MWPC's for the MEGA experiment  

International Nuclear Information System (INIS)

The construction of MWPCs for the MEGA experiment at LAMPF are described. The chambers are cylindrical, low mass (3 x 10-4 radiation lengths), and are designed to operate at high rates (3 x 104 /mm2/s). Several novel construction techniques have been developed and custom electronics have been designed to help achieve the required performance, which corresponds to that needed at high luminosity colliders. 4 refs., 3 figs


Mitigation technique for use of CMOS image sensors in mega-joule class laser radiative environment  

International Nuclear Information System (INIS)

Presented is a new mitigation technique to improve the radiation tolerance of CMOS image sensors to the radiation constraints associated to the fusion by inertial confinement experiments at mega-joule class laser facilities. Using the global reset mode, results acquired at the OMEGA facility show the efficiency of this technique to reduce by more than 70% the number of white pixels induced by the mixed 14 MeV neutron and gamma-ray pulse. (authors)


Sustainable Science? Reducing the Carbon Impact of Scientific Mega-Meetings  


Scientists across the globe recognize the importance of reducing carbon emissions to combat climate change.  At the same time, we have increased our carbon footprint through air travel to the growing number of scientific society “mega-meetings” that host thousands of attendees.  Although alternative solutions have been proposed to reduce the environmental impact of annual conferences, these have yet to be evaluated against the business-as-usual scenario.  Here, we use 9 years of annual...

Ponette-gonza?lez, Alexandra G.; Byrnes, Jarrett E.



Cities in transcontinental context: A comparison of mega urban projects in Shanghai and Belgrade  


This study of urban developments in Belgrade and Shanghai is set in the context of comparative urban research. It presents two ostensibly contrasting cities and briefly examines urban development patterns in China and Serbia before focusing more specifically on mega urban projects in the two cities - Pudong and Hongqiao in Shanghai contrasted with New Belgrade. While the historical genesis of the Chinese and Serbian projects differs markedly, together they ...

Waley Paul



Mini-MegaTORTORA — multichannel system for wide-field optical monitoring with high temporal resolution (United States)

We report on a multi-objective and transforming 9-channel monitoring system, the Mini-MegaTORTORA (MMT-9). This system combines a wide field of view with a subsecond temporal resolution in the monitoring regime, and is able to reconfigure itself, in fractions of a second, to a follow-up mode which has better sensitivity and provides us with multi-color and polarimetric information on detected transients simultaneously.

Sasyuk, V.; Beskin, G.; Karpov, S.; Bondar, S.; Perkov, A.; Ivanov, E.; Katkova, E.; Shearer, A.



Strategic place marketing and place branding: 15 years of mega-events in Lisbon  


Urban tourism is a relatively recent phenomenon but is now being embraced by most European cities, which are using substantial funds to compete for visitors, thus generating new infrastructures for this process. Cities so as to differentiate themselves from their competitors, attempt to manage their image by strategic place marketing approach. This paper explores the implications and significance of being a host city of mega events. The purpose is to identify the perception of Lisbon’s iden...

Metaxas, Theodore; Bati, Aristea; Filippopoulos, Dimitris; Drakos, Kostas; Tzellou, Vagia



The magnitude 9.0 Sumatra (Indonesia) mega-earthquake of 26 December 2004  


The magnitude 9.0 of the Sumatra mega-earthquake occurred on December 26, 2004 is the strongest in the world since the 1964 Alaska earthquake and the fourth since 1900. The earthquake happened on the interface of the India and Burma plates and triggered a massive tsunami that affected several countries throughout South and Southeast Asia. The rupture, estimated by the aftershock distribution, start from central Suma- tra northward for about 1200 kilometres. The source time function and the ru...

Borges, Jf; Caldeira, B.; Bezzeghoud, M.



Wilms' tumor in a case with Möbius' syndrome associated with arthrogryposis and mega cisterna magna. (United States)

Möbius' syndrome is a rare congenital anomaly characterized by paralysis of the 7th and other cranial nerves and musculoskeletal abnormalities. We report a patient with Möbius' syndrome associated with arthrogryposis and mega cisterna magna in addition to the classic components of this syndrome. The case is interesting because she developed Wilms' tumor at 21 months of age. To our knowledge, this is the first case of this association reported in the literature. PMID:15032390

Yaris, Nilgun; Aynaci, F Müjgan; Kalyoncu, Mukaddes; Odemi?, Ender; Okten, Aysenur



Patch definition in metapopulation analysis: a graph theory approach to solve the mega-patch problem. (United States)

The manner in which patches are delineated in spatially realistic metapopulation models will influence the size, connectivity, and extinction and recolonization dynamics of those patches. Most commonly used patch-definition methods focus on identifying discrete, contiguous patches of habitat from a single temporal observation of species occurrence or from a model of habitat suitability. However, these approaches are not suitable for many metapopulation systems where entire patches may not be fully colonized at a given time. For these metapopulation systems, a single large patch of habitat may actually support multiple, interacting subpopulations. The interactions among these subpopulations will be ignored if the patch is treated as a single unit, a situation we term the "mega-patch problem." Mega-patches are characterized by variable intra-patch synchrony, artificially low inter-patch connectivity, and low extinction rates. One way to detect this problem is by using time series data to calculate demographic synchrony within mega-patches. We present a framework for identifying subpopulations in mega-patches using a combination of spatial autocorrelation and graph theory analyses. We apply our approach to southern California giant kelp (Macrocystis pyrifera) forests using a new, long-term (27 years), satellite-based data set of giant kelp canopy biomass. We define metapopulation patches using our method as well as several other commonly used patch delineation methodologies and examine the colonization and extinction dynamics of the metapopulation under each approach. We find that the relationships between patch characteristics such as area and connectivity and the demographic processes of colonizations and extinctions vary among the different patch-definition methods. Our spatial-analysis/graph-theoretic framework produces results that match theoretical expectations better than the other methods. This approach can be used to identify subpopulations in metapopulations where the distributions of organisms do not always reflect the distribution of suitable habitat. PMID:24669726

Cavanaugh, Kyle C; Siegel, David A; Raimondi, Peter T; Alberto, Filipe



Air pollution and its impact on human health in mega cities  

International Nuclear Information System (INIS)

One of the major problems faced by the over crowded mega-cities of the world in general and that in third world is the alarming levels of air pollution causing damage to the health of its inhabitants. In Cairo estimated lives lost annually due to air pollution varies between 4000 to 16000 while Delhi has been rated as the most polluted city in the world. Karachi now a mega-city typically represents pollution status of the third world. Major cause of pollution is more than 0.62 millions vehicles on the roads. The pollution due to industries is localized and mainly affects the health of the workers. Measurement carried out for the selected areas along the roads carrying high density traffic show a very high pollution level (CO, 3 to 10 ppm; CO/sub 2/,170 to 350 ppm; HC 0.274 to 0.360 vol. %; particulate matter 67.0 to 565.5 ug/m/sup 3/. A parallel hospital survey to correlate air borne disease with air pollution indicates that over 16600 to 22977 patients suffered from air borne diseases while 6377 from bacterial infection. Analysis showed that 70% of the patients suffering from airborne disease come from the surveyed areas with high level pollution. Cancer is shifting from old age to middle age group indicating deteriorating air environment. Ratio of male to female patients is 2:1, which is indicative of hazardous ambient air quality outside to which men are exposed more than women. The paper discusses in depth the air pollution and its impact on human health in mega cn and its impact on human health in mega cities with Karachi as a case study. (author)


Handling technology of mega-watt millimeter-waves for optimized heating of fusion plasmas  


Millimeter-wave components were re-examined for high power (Mega-Watt) and steady- state (greater than one hour) operation. Some millimeter-wave components, including waveguide joints, vacuum pumping sections, power monitors, sliding waveguides, and injection windows, have been improved for high power CW (Continuous Waves) transmission. To improve transmission efficiency, information about the wave phase and mode content of high power millimeter-waves propagating in corrugated waveguides, whi...

Shimozuma, T.; Kubo, S.; Yoshimura, Y.; Igami, H.; Takahashi, H.; Takita, Y.; Kobayashi, S.; Ito, S.; Mizuno, Y.; Idei, H.; Notake, T.; Shapiro, M. A.; Temkin, R. J.; Felici, F.; Goodman, T. P.



Sistem Informasi Akuntansi Penjualan dan Penerimaan Kas pada PT.(persero) Mega Eltra Cabang Medan  


Devi Sepriyanti. Sistem Informasi Akuntansi Penjualan dan Penerimaan Kas Pada PT. (Persero) Mega Eltra Cabang Medan. Zainul Bahri Torong selaku Dosen Pembimbing, Sri Mulyani selaku Ketua Departemen Akuntansi Universitas Sumatera Utara, Syamsul Bahri TRB dan Agusni Pasaribu selaku Dosen Penguji. Dalam membantu manajemen untuk melaksanakan kegiatan operasional guna pencapaian tujuan perusahaan, setiap perusahaan harus memiliki suatu sistem yang baik. Sistem yang baik dimaksud agar tujuan pe...

Devi Sepriyanti



Antibiotic resistance and R-plasmids in food chain Salmonella: evidence of plasmid relatedness.  


A large number of strains (1,783) belonging to 15 Salmonella serovars isolated, in Canada, from the three major links of the human food chain were screened for multiple antibiotic resistance and the presence of R-plasmids. Multiresistant strains occurred among animal feed, livestock, and human isolates at frequencies of 4, 22, and 14%, respectively. Conjugation analysis revealed that 58% of the isolates from feeds, 87% of those from livestock, and 89% of the human strains carried all or part ...

Bezanson, G. S.; Pauze?, M.; Lior, H.



Deletion and rearrangement of plasmid DNA during transformation of Escherichia coli with linear plasmid molecules.  


When E. coli was transformed with linearized pBR322 DNA, many transformants contained recircularized plasmids bearing deletions and other rearrangements. Most aberrant molecules were less than monomeric length and had lost the restriction site used for linearization, with the deleted region extending mono- (type Ia) or bi-directionally (type Ib). Type II deletants were greater than monomeric but less than dimeric and contained the pBR322 sequence in direct repeat with deletion at one or both ...

Conley, E. C.; Saunders, V. A.; Saunders, J. R.



MegaTevs: single-chain dual nucleases for efficient gene disruption. (United States)

Targeting gene disruptions in complex genomes relies on imprecise repair by the non-homologous end-joining DNA pathway, creating mutagenic insertions or deletions (indels) at the break point. DNA end-processing enzymes are often co-expressed with genome-editing nucleases to enhance the frequency of indels, as the compatible cohesive ends generated by the nucleases can be precisely repaired, leading to a cycle of cleavage and non-mutagenic repair. Here, we present an alternative strategy to bias repair toward gene disruption by fusing two different nuclease active sites from I-TevI (a GIY-YIG enzyme) and I-OnuI E2 (an engineered meganuclease) into a single polypeptide chain. In vitro, the MegaTev enzyme generates two double-strand breaks to excise an intervening 30-bp fragment. In HEK 293 cells, we observe a high frequency of gene disruption without co-expression of DNA end-processing enzymes. Deep sequencing of disrupted target sites revealed minimal processing, consistent with the MegaTev sequestering the double-strand breaks from the DNA repair machinery. Off-target profiling revealed no detectable cleavage at sites where the I-TevI CNNNG cleavage motif is not appropriately spaced from the I-OnuI binding site. The MegaTev enzyme represents a small, programmable nuclease platform for extremely specific genome-engineering applications. PMID:25013171

Wolfs, Jason M; DaSilva, Matthew; Meister, Sarah E; Wang, Xu; Schild-Poulter, Caroline; Edgell, David R



Ultra Mega Power Projects: Additional Re-Structural Capacity to Existing Indian Grid System  

Directory of Open Access Journals (Sweden)

Full Text Available The demand for power in India is ever increasing, as industrial sector is one of the largest consumers of electrical energy in India. More and more efforts are made by the Government every year to overcome this problem. Ultra Mega Power projects (UMPP are a series of ambitious power projects planned by the Government of India. With India being a country of chronic power deficit, the Government of India has planned to provide 'power for all' by the end of the eleventh plan. This would entail a creation of an additional capacity of at least 100,000 MW. The Ultra Mega Power projects, each with a capacity of 4000 megawatts or above, are being developed with an aim to bridge this gap. The UMPPs are seen as an expansion of the MPP (Mega Power Projects projects that the Government of India undertook in the nineties but met with limited success. The Ministry of Power in association with Central Electricity Authority and Power Finance Corporation Ltd. has launched an initiative for development of coal-based UMPP's in India. These projects will be awarded to developers on the basis of competitive bidding.




Wireless laser range finder system for vertical displacement monitoring of mega-trusses during construction. (United States)

As buildings become increasingly complex, construction monitoring using various sensors is urgently needed for both more systematic and accurate safety management and high-quality productivity in construction. In this study, a monitoring system that is composed of a laser displacement sensor (LDS) and a wireless sensor node was proposed and applied to an irregular building under construction. The subject building consists of large cross-sectional members, such as mega-columns, mega-trusses, and edge truss, which secured the large spaces. The mega-trusses and edge truss that support this large space are of the cantilever type. The vertical displacement occurring at the free end of these members was directly measured using an LDS. To validate the accuracy and reliability of the deflection data measured from the LDS, a total station was also employed as a sensor for comparison with the LDS. In addition, the numerical simulation result was compared with the deflection obtained from the LDS and total station. Based on these investigations, the proposed wireless displacement monitoring system was able to improve the construction quality by monitoring the real-time behavior of the structure, and the applicability of the proposed system to buildings under construction for the evaluation of structural safety was confirmed. PMID:23648650

Park, Hyo Seon; Son, Sewook; Choi, Se Woon; Kim, Yousok



Wireless Laser Range Finder System for Vertical Displacement Monitoring of Mega-Trusses during Construction  

Directory of Open Access Journals (Sweden)

Full Text Available As buildings become increasingly complex, construction monitoring using various sensors is urgently needed for both more systematic and accurate safety management and high-quality productivity in construction. In this study, a monitoring system that is composed of a laser displacement sensor (LDS and a wireless sensor node was proposed and applied to an irregular building under construction. The subject building consists of large cross-sectional members, such as mega-columns, mega-trusses, and edge truss, which secured the large spaces. The mega-trusses and edge truss that support this large space are of the cantilever type. The vertical displacement occurring at the free end of these members was directly measured using an LDS. To validate the accuracy and reliability of the deflection data measured from the LDS, a total station was also employed as a sensor for comparison with the LDS. In addition, the numerical simulation result was compared with the deflection obtained from the LDS and total station. Based on these investigations, the proposed wireless displacement monitoring system was able to improve the construction quality by monitoring the real-time behavior of the structure, and the applicability of the proposed system to buildings under construction for the evaluation of structural safety was confirmed.

Hyo Seon Park



A Generalized Component Modal Analysis for Space Mega Frames of Super Tall Buildings (United States)

A generalized component modal analytical method for space mega frames of super tall buildings is developed. The components used herein are not the actual components, but they are conceptual ones. They are actually the nodal lines employed to discretize the computational model of the structure, a three dimensional model with continuously distributed mass and stiffness. One-variable functions defined on the nodal lines selected by the analyst are unknown functions (eigenfunctions) employed to describe the behavior of the model. By a Hamiltonian principle, the governing equations of the modal analysis can be obtained, which are a set of Ordinary Differential Equations (ODE) of the eigenfunctions with their corresponding boundary conditions. The desired eigenvalues and corresponding eigenfunctions (eigenmode) can be obtained by numerically solving the system of ODEs with boundary conditions. The method is applied to the space-mega-frame system of super tall buildings. The results from the illustration example show that the method is rational and powerful for the modal analysis of space-mega-frame systems.

Gong, Yaoqing; Liu, Liping



The MEGA BORG: The value of cooperative damage assessment to trustees, PRPs, and the environment  

International Nuclear Information System (INIS)

The Natural Resource Damage Assessment (NRDA) process provides natural resource trustees with a method for restoring publicly owned or managed natural resources and their services that are injured as a result of an oil or chemical release. The NRDA process is simple in concept, but provides significant challenges for natural resource trustees. Although the impacts of marine pollution have been studied for many years, the quantification, economic evaluation, and restoration of these impacts brings up controversial scientific, legal, and economic issues. The 1990 MEGA BORG spill in the Gulf of Mexico is an example of a cooperative assessment. Within a few days of the spill, the Texas Water Commission and the National Oceanic and Atmospheric Administration (NOAA) reached and agreement with the owners of the MEGA BORG under which the owners would fund a preliminary assessment of the environmental impact of the spill. Five projects were funded to determine whether there was sufficient injury to justify the completion of a natural resource damage assessment. The MEGA BORG provides an example of a cooperative and scientifically balanced approach to the initiation of damage assessment activities and illustrates the benefits of a cooperative assessment


The effects of the MEGA BORG spill on Gulf of Mexico shrimp  

International Nuclear Information System (INIS)

A brown shrimp stock model was developed at the NMFS Galveston Laboratory to assess the effects of the MEGA BORG oil spill on the brown shrimp population along the Texas coast. Water and sediment samples from near the MEGA BORG spill area were collected and analyzed by the Geochemical and Environmental Research Group at Texas A ampersand M University. Hydrocarbon concentrations found at the sediment collection stations ranged from 1.38 ug/g to 7.42 ug/g, while concentrations at the water column sampling sites ranged from 0.69 ug/l to 27.39 ug/l. Evaluation of chromatograms and analytical data suggested that sediments from the area contained primarily biogenic hydrocarbons. Only one station had elevated hydrocarbon levels. However, these values were only three to five times higher than the concentrations measured at the other stations. Evaluation of the water samples from the area showed only very low concentration levels of hydrocarbons were present in the water column. A bioassay study was conducted by the US Environmental Protection Agency, Environmental Research Laboratory in Gulf Breeze, Florida. The main conclusion from the bioassay study was that the concentrations of hydrocarbons measured at the field sites where water samples were taken tended to be three orders of magnitude lower than the hydrocarbon concentrations causing toxic responses in mysid and white shrimp. There were no detected effects of the brown shrimp population along the Texas coast from the MEpulation along the Texas coast from the MEGA BORG oil spill


Identificación de mega?ambientes para potenciar el uso de genotipos superiores de arroz en Panamá / Identifying mega?environments to enhance the use of superior rice genotypes in Panama  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Spanish Abstract in spanish El objetivo de este trabajo fue evaluar tres métodos para identificar mega?ambientes, para optimizar el uso del potencial genético de los cultivares de arroz, durante el proceso de selección, y para hacer recomendaciones sobre siembras comerciales en Panamá. Los datos experimentales fueron obtenidos [...] de los ensayos de productividad de cultivares precoces realizados entre 2006 y 2008. Para lograr la estratificación de los ambientes y definir los mega?ambientes, se utilizaron los métodos del genotipo vencedor mediante el modelo AMMI1, el modelo biplot GGE y el de conglomerado por el método de Ward, complementado con el biplot GGE. Los tres métodos utilizados identificaron dos mega?ambientes, donde los cultivares sobresalientes fueron Fedearroz 473 e Idiap 145?05. Hubo una coincidencia de 100% en el agrupamiento del conglomerado x el biplot GGE, mientras que entre conglomerado x AMMI1 y biplot GGE x AMMI1 fue de 95,2%. El genotipo más estable, en ambos mega?ambientes, fue el cultivar Idiap 145?05, lo que indica capacidad de adaptación amplia y específica. La capacidad adaptativa de los genotipos superiores y no las condiciones agroclimáticas de las localidades evaluadas fue responsable de la definición de los mega?ambientes. Abstract in english The objective of this work was to evaluate three methods to identify mega?environments, in order to optimize the use of the genetic potential of rice cultivars during the selection process and to make recommendations for commercial plantations in Panama. Experimental data were obtained from the test [...] performance, between 2006 and 2008, for early maturing cultivars. To achieve the stratification of environments and define mega?environments, the winner genotype method by the AMMI1 model, GGE biplot model and cluster by Ward's method supplemented by GGE biplot were used. The three methods used identified two mega?environments, where the outstanding cultivars were Fedearroz 473 e Idiap 145?05. There was 100% coincidence in the grouping of the cluster x the GGE biplot, with 95.2% coincidence between the AMMI1 x cluster and GGE biplot x AMMI1. The most stable genotype, in both mega?environments, was the Idiap?145?05 cultivar, which indicates its broad and specific adaptive capacity. The adaptive capacity of the superior genotypes and not the agroclimatic conditions of the assessed localities was responsible for defining the mega?environments.

Ismael, Camargo& #8209; Buitrago; Evelyn, Quirós& #8209; Mc Intire; Román, Gordón& #8209; Mendoza.



Identificación de mega?ambientes para potenciar el uso de genotipos superiores de arroz en Panamá Identifying mega?environments to enhance the use of superior rice genotypes in Panama  

Directory of Open Access Journals (Sweden)

Full Text Available El objetivo de este trabajo fue evaluar tres métodos para identificar mega?ambientes, para optimizar el uso del potencial genético de los cultivares de arroz, durante el proceso de selección, y para hacer recomendaciones sobre siembras comerciales en Panamá. Los datos experimentales fueron obtenidos de los ensayos de productividad de cultivares precoces realizados entre 2006 y 2008. Para lograr la estratificación de los ambientes y definir los mega?ambientes, se utilizaron los métodos del genotipo vencedor mediante el modelo AMMI1, el modelo biplot GGE y el de conglomerado por el método de Ward, complementado con el biplot GGE. Los tres métodos utilizados identificaron dos mega?ambientes, donde los cultivares sobresalientes fueron Fedearroz 473 e Idiap 145?05. Hubo una coincidencia de 100% en el agrupamiento del conglomerado x el biplot GGE, mientras que entre conglomerado x AMMI1 y biplot GGE x AMMI1 fue de 95,2%. El genotipo más estable, en ambos mega?ambientes, fue el cultivar Idiap 145?05, lo que indica capacidad de adaptación amplia y específica. La capacidad adaptativa de los genotipos superiores y no las condiciones agroclimáticas de las localidades evaluadas fue responsable de la definición de los mega?ambientes.The objective of this work was to evaluate three methods to identify mega?environments, in order to optimize the use of the genetic potential of rice cultivars during the selection process and to make recommendations for commercial plantations in Panama. Experimental data were obtained from the test performance, between 2006 and 2008, for early maturing cultivars. To achieve the stratification of environments and define mega?environments, the winner genotype method by the AMMI1 model, GGE biplot model and cluster by Ward's method supplemented by GGE biplot were used. The three methods used identified two mega?environments, where the outstanding cultivars were Fedearroz 473 e Idiap 145?05. There was 100% coincidence in the grouping of the cluster x the GGE biplot, with 95.2% coincidence between the AMMI1 x cluster and GGE biplot x AMMI1. The most stable genotype, in both mega?environments, was the Idiap?145?05 cultivar, which indicates its broad and specific adaptive capacity. The adaptive capacity of the superior genotypes and not the agroclimatic conditions of the assessed localities was responsible for defining the mega?environments.

Ismael Camargo?Buitrago



Antibiotic resistance plasmids of Staphylococcus aureus and their clinical importance  

International Nuclear Information System (INIS)

A variety of plasmids were isolated physically, and most antibiotic resistance is thought to be plasmid mediated. A number of characters (e.g., resistance to erythromycin or methicillin, and production of pigment) are determined by genes that do not give clear indications of either plasmid or chromosomal location. Although the formation of a particular plasmid is probably, even in bacterial terms, a very rare event, once formed such an element can spread rapidly among the bacterial population. The spectacular increase in the incidence of penicillinase-producing hospital strains in the late 1940's could have been due in part to this process. Evidence is stronger, however, for the intercell transfer of recently isolated plasmids coding for resistance to fusidic acid (and penicillinase production), or for neomycin, or for tetracycline resistance. Study of bacterial plasmids can resolve fundamental biochemical problems, and give some insight into the life of the cell at the molecular level. But the immediate application of the study of staphylococcal plasmids may be directed towards improving the effectiveness of antibiotic therapy. The most important aspect of future anti-staphylococcal chemotherapy should thus be the limitation of the use of antibiotics, particularly for application to the skin and nose. (U.S.)


Plasmid requirements for infection of ticks by Borrelia burgdorferi. (United States)

Borrelia burgdorferi strain B31 MI commonly loses one or more of its complement of 21 extrachromosomal plasmids during normal handling procedures and during genetic manipulations. Certain plasmid losses cause an inability or reduction in the ability of spirochetes to infect mice. In the current study, nine strains of spirochetes with varying plasmid profiles were used to identify plasmids necessary for nymphal tick infection. Nymphal ticks were artificially fed the nine spirochete strains as well as the parental strain containing a full complement of plasmids. The capillary fed nymphs were allowed to feed on mice for at least 63 h and then examined for the presence of spirochetes in their guts and salivary glands. All spirochete strains tested were able to infect ticks guts, but to different degrees. We determined that the plasmids lp5, lp28-1, and cp9 were not required for infecting tick guts, whereas loss of lp25 and lp28-4 was associated with reduced gut infectivity. A reduction in the ability of spirochetes to invade salivary glands was seen in bacteria that did not have lp28-1, whereas cp9 was not required for salivary gland infection. This study has pinpointed specific plasmids whose absence is deleterious to infecting nymphal tick guts and salivary glands. PMID:16187892

Strother, Keith O; Broadwater, Anne; De Silva, Aravinda



Plasmid-associated sensitivity of Bacillus thuringiensis to UV light  

International Nuclear Information System (INIS)

Spores and vegetative cells of Bacillus thuringiensis were more sensitive to UV light than were spores or cells of plasmid-cured B. thuringiensis strains or of the closely related Bacillus cereus. Introduction of B. thuringiensis plasmids into B. cereus by cell mating increased the UV sensitivity of the cells and spores. Protoxins encoded by one or more B. thuringiensis plasmids were not involved in spore sensitivity, since a B. thuringiensis strain conditional for protoxin accumulation was equally sensitive at the permissive and nonpermissive temperatures. In addition, introduction of either a cloned protoxin gene, the cloning vector, or another plasmid not containing a protoxin gene into a plasmid-cured strain of B. thuringiensis all increased the UV sensitivity of the spores. Although the variety of small, acid-soluble proteins was the same in the spores of all strains examined, the quantity of dipicolinic acid was about twice as high in the plasmid-containing strains, and this may account for the differences in UV sensitivity of the spores. The cells of some strains harboring only B. thuringiensis plasmids were much more sensitive than cells of any of the other strains, and the differences were much greater than observed with spores


Wide-host-range plasmids function in the genus thiobacillus. (United States)

Plasmids S-a, RP4, R388, and several RP4 derivatives (pMD101, pDT387, and pDT566) were transmissible by conjugation to Thiobacillus novellus from Escherichia coli. Genetic markers were expressed in T. novellus, with the exception of chloramphenicol resistance and ampicillin resistance. Plasmids were not transmissible by conjugation from E. coli donors to Thiobacillus intermedius, T. perometabolis, T. neapolitanus, or T. acidophilus recipients, although they could be mated into these strains from T. novellus. All Thiobacillus species tested could transfer plasmids back to E. coli, with the exception of T. acidophilus. The donor-specific bacteriophages PRR1 and PRD1 were incapable of initiating the lytic cycle in RP4-bearing strains of T. novellus. The cosmid cloning vehicle pVK100 could be mobilized from E. coli to T. novellus with the aid of the "helper" plasmid pRK2013. pVK100 is stable in T. novellus, but pRK2013 is not maintained in this species. pRK2013 was also used to mobilize another cloning vector, R300B, to T. novellus. A previously unreported cryptic plasmid of approximately 24 megadaltons was observed in T. intermedius. No native plasmids were demonstrated in the other Thiobacillus species except in T. acidophilus, which contained cryptic plasmids ranging in size from 7.6 to 56 megadaltons (molecular mass). PMID:16346383

Davidson, M S; Summers, A O



Learning styles of orthodontic residents. (United States)

Significant challenges face many orthodontic residency programs, particularly a shortage of full-time experienced faculty members. Due to this shortage, it is critical that program directors design comprehensive curricula that incorporate the most effective and efficient teaching methods. It is theorized that teaching effectiveness and efficiency are optimized when the course design and content closely match students' learning preferences. This survey study was designed to distinguish the learning preferences of orthodontic residents utilizing Felder and Soloman's Index of Learning Styles, which assesses student learning preferences in four dimensions using dichotomous scales, thereby providing insight into how teaching strategies can best be structured. As a secondary focus, additional questions on the survey were asked to gain information about residents' access to the Internet and comfort level with online learning so as to address acceptance of web-based courses in response to the shortage of full-time faculty members. Orthodontic residents, contacted via email, were requested to complete an online survey; 261 responses were collected. The results indicate that orthodontic residents are highly visual learners and show a preference for sensing and sequential learning strategies. In terms of information technology, the residents are comfortable with and have adequate access to current technological assets; therefore, they may be well suited for inclusion of computer-based teaching modules and other multimedia devices in their residency curriculum. PMID:19289721

Hughes, Janeen M; Fallis, Drew W; Peel, Jennifer L; Murchison, David F



A socio-ecological adaptive approach to contaminated mega-site management: From 'control and correct' to 'coping with change' (United States)

Mega-sites have a notable impact on surrounding ecological systems. At such sites there are substantial risks associated with complex socio-ecological interactions that are hard to characterize, let alone model and predict. While the urge to control and clean-up mega-sites (control and correct) is understandable, rather than setting a goal of cleaning up such sites, we suggest a more realistic response strategy is to address these massive and persistent sources of contamination by acknowledging their position as new features of the socio-ecological landscapes within which they are located. As it seems nearly impossible to clean up such sites, we argue for consideration of a 'coping with change' rather than a 'control and correct' approach. This strategy recognizes that the current management option for a mega-site, in light of its physical complexities and due to changing societal preferences, geochemical transformations, hydrogeology knowledge and remedial technology options may not remain optimal in future, and therefore needs to be continuously adapted, as community, ecology, technology and understanding change over time. This approach creates an opportunity to consider the relationship between a mega-site and its human and ecological environments in a different and more dynamic way. Our proposed approach relies on iterative adaptive management to incorporate mega-site management into the overall socio-ecological systems of the site's context. This approach effectively embeds mega-site management planning in a triple bottom line and environmental sustainability structure, rather than simply using single measures of success, such as contaminant-based guidelines. Recognizing that there is probably no best solution for managing a mega-site, we present a starting point for engaging constructively with this seemingly intractable issue. Therefore, we aim to initiate discussion about a new approach to mega-site management, in which the complexity of the problems posed by mega-sites is reflected upon in its entirety. These complexities are associated with uncertainties and unknowns that have to be addressed, as they have an impact on the strategies being developed and applied. We contend that the best that can be hoped for in mega-site management is an acceptable solution for the current state of affairs, with good flexibility to modify strategies as new site conditions, remediation possibilities, community preferences and management objectives develop over time.

Schirmer, Mario; Lyon, Ken; Armstrong, James E.; Farrell, Katharine N.



New research project for the next Nankai trough mega thrust earthquakes -Integration of Observation, Simulation and Disaster Mitigation researches- (United States)

The Nankai trough located off Southwestern Japan is well known as mega thrust earthquake seismogenic zone, In the Nankai trough, there are three mega thrust earthquake rupture zones such as Tokai, Tonankai and Nankai earthquake rupture zones, around there mega thrust earthquakes are occurring with an interval of 100-200 years. In past three mega thrust earthquakes around the Nankai trough, 1944/1946(Showa earthquake), 1854(Ansei earthquake) and 1707(Hoei earthquake), these occurrence patterns are quite differences. In the1994/1946 Showa earthquakes, the first rupture started from the Tonankai earthquake rupture zone a head of the Nankai earthquake with a interval of 2 years, however, in the 1854 Ansei earthquakes, time difference between the Tonankai/Tokai earthquakes and the Nankai earthquake were about 32 hours, and in the 1707 Hoei earthquakes, time differences among these earthquakes are estimated as almost same. According to results of these historical earthquakes, we understand that there quite diversities in the mega thrust earthquake recurrences around the Nankai trough. To understand and estimate the diversities among ten next Nankai trough mega thrust earthquakes , we have to improve the structure model and the recurrence cycle simulation model with higher reliabilities. Especially, the estimation of recurrence cycle between the Tonankai and Nankai earthquake is very important for disaster preventions. The new research project for the next Nanaki trough mega thrust earthquakes is starting as the MEXT project which is a kind of Japanese government. In this project, we will propose research plans as follows, 1) Construct the detailed crustal medium around the Nankai trough using controlled sources and seismic tomography using dense seismic lines and OBS network arrays. 2) Observations of crustal activities around the Nankai trough using seismometers and pressure gauges. 3) Construct the database of long term plate coupling dynamics. And study the diversity of recurrence pattern and scale of next mega thrust earthquakes. 4) Develop the advanced simulation methods. 5) Improve the large scale recurrence cycle simulation model based on theoretical and experimental analyses. 6) Evaluate the precise strong motions and tsunamis for the disaster mitigation. 7) Develop the reliable risk management system for next mega thrust earthquake. 8) Develop and construct the real time monitoring system around the Tonankai earthquake rupture zone. This system is called as DONET(Dense Ocean floor Network for Earthquakes and Tsunamis). 9) Apply scientific results of Nankai seismogenic zone drilling to recurrence cycle simulation. Finally, we will progress these researches and integrate these results for the next Nankai trough mega thrust earthquakes. We will introduce these researches in the detail.

Kaneda, Y.; Hirahara, K.; Furumuea, T.



Structural Organization of Virulence-Associated Plasmids of Yersinia pestis  


The complete nucleotide sequence and gene organization of the three virulence plasmids from Yersinia pestis KIM5 were determined. Plasmid pPCP1 (9,610 bp) has a GC content of 45.3% and encodes two previously known virulence factors, an associated protein, and a single copy of IS100. Plasmid pCD1 (70,504 bp) has a GC content of 44.8%. It is known to encode a number of essential virulence determinants, regulatory functions, and a multiprotein secretory system comprising the low-calcium response...

Hu, Ping; Elliott, Jeffrey; Mccready, Paula; Skowronski, Evan; Garnes, Jeffrey; Kobayashi, Arthur; Brubaker, Robert R.; Garcia, Emilio



Bacterial Mitosis: ParM of Plasmid R1 Moves Plasmid DNA by an Actin-like Insertional Polymerization Mechanism  

DEFF Research Database (Denmark)

Bacterial DNA segregation takes place in an active and ordered fashion. In the case of Escherichia coli plasmid R1, the partitioning system (par) separates paired plasmid copies and moves them to opposite cell poles. Here we address the mechanism by which the three components of the R1 par system act together to generate the force required for plasmid movement during segregation. ParR protein binds cooperatively to the centromeric parC DNA region, thereby forming a complex that interacts with the filament-forming actin-like ParM protein in an ATP-dependent manner, suggesting that plasmid movement is powered by insertional polymerization of ParM. Consistently, we find that segregating plasmids are positioned at the ends of extending ParM filaments. Thus, the process of R1 plasmid segregation in E. coli appears to be mechanistically analogous to the actin-based motility operating in eukaryotic cells. In addition, we find evidence suggesting that plasmid pairing is required for ParM polymerization. Udgivelsesdato: Dec 2003

MØller-Jensen, Jakob; Borch, Jonas



42 CFR 483.10 - Resident rights. (United States)

42 Public Health 5 2010-10-01...false Resident rights. 483.10 Section 483.10 Public Health CENTERS...DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED...10 Resident rights. The resident...maintaining written policies and...



Mini-P1 plasmid partitioning: excess ParB protein destabilizes plasmids containing the centromere parS.  


The partition system of the unit-copy plasmid P1 consists of two proteins, the parA and parB gene products, and a cis-acting site, parS. Production of high levels of the P1 ParB protein, from an external promoter on a high-copy-number vector, inhibits the propagation of lambda-mini-P1 prophages and destabilizes other P1-derived plasmids. The interference by ParB protein depends on the parS site, or centromere, of the P1 partition region; plasmids lacking parS are unaffected. The defect is mor...

Funnell, B. E.



Exploitation of Plasmid pMRC01 To Direct Transfer of Mobilizable Plasmids into Commercial Lactococcal Starter Strains  


Genetic analysis of the 60.2-kb lactococcal plasmid pMRC01 revealed a 19.6-kb region which includes putative genes for conjugal transfer of the plasmid and a sequence resembling an origin of transfer (oriT). This oriT-like sequence was amplified and cloned on a 312-bp segment into pCI372, allowing the resultant plasmid, pRH001, to be mobilized at a frequency of 3.4 × 10?4 transconjugants/donor cell from an MG1363 (recA mutant) host containing pMRC01. All of the resultant chloramphenicol-re...

Hickey, Rita M.; Twomey, Denis P.; Ross, R. Paul; Hill, Colin



Comparative analysis of conjugative plasmids mediating gentamicin resistance in Staphylococcus aureus.  


Five gentamicin-resistant clinical isolates of Staphylococcus aureus were found to contain self-transmissible plasmids of 32 to 37 megadaltons in size. Restriction endonuclease digests of the plasmids were markedly similar to those of reference plasmids of unrelated geographical origin, thus suggesting the significant contribution of common conjugal plasmids to the emergence of gentamicin resistance in S. aureus populations.

Goering, R. V.; Ruff, E. A.



Construction of three new Gateway® expression plasmids for Trypanosoma cruzi  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in english We present here three expression plasmids for Trypanosoma cruzi adapted to the Gateway® recombination cloning system. Two of these plasmids were designed to express trypanosomal proteins fused to a double tag for tandem affinity purification (TAPtag). The TAPtag an [...] d Gateway® cassette were introduced into an episomal (pTEX) and an integrative (pTREX) plasmid. Both plasmids were assayed by introducing green fluorescent protein (GFP) by recombination and the integrity of the double-tagged protein was determined by western blotting and immunofluorescence microscopy. The third Gateway adapted vector assayed was the inducible pTcINDEX. When tested with GFP, pTcINDEX-GW showed a good response to tetracycline, being less leaky than its precursor (pTcINDEX).

Victoria L, Alonso; Carla, Ritagliati; Pamela, Cribb; Esteban C, Serra.



Construction of three new Gateway® expression plasmids for Trypanosoma cruzi  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in english We present here three expression plasmids for Trypanosoma cruzi adapted to the Gateway® recombination cloning system. Two of these plasmids were designed to express trypanosomal proteins fused to a double tag for tandem affinity purification (TAPtag). The TAPtag and Gateway® cassette were introduced [...] into an episomal (pTEX) and an integrative (pTREX) plasmid. Both plasmids were assayed by introducing green fluorescent protein (GFP) by recombination and the integrity of the double-tagged protein was determined by western blotting and immunofluorescence microscopy. The third Gateway adapted vector assayed was the inducible pTcINDEX. When tested with GFP, pTcINDEX-GW showed a good response to tetracycline, being less leaky than its precursor (pTcINDEX).

Victoria L, Alonso; Carla, Ritagliati; Pamela, Cribb; Esteban C, Serra.


Isolation and properties of plasmids from Deinococcus radiodurans Sark  

International Nuclear Information System (INIS)

Radioresistant bacterium, Deinococcus radiodurans, can repair completely almost all of DNA damages including double strand breaks induced by gamma-rays up to about 5 kGy. In order to reveal the repair mechanism, it is necessary to develop a cloning vector available for the genetic analysis. We tried to isolate plasmids from D.radiodurans Sark strain. In the present paper the isolation and properties of plasmids were described. (author)


Conjugative transfer of cadmium resistance plasmids in Rhodococcus fascians strains.  


The presence of a 138-kilobase plasmid (pD188) correlated with increased resistance to cadmium in Rhodococcus fascians D188. This plasmid could be transferred by a conjugation-like system in matings between R. fascians strains. Transconjugants expressed the cadmium resistance and could be used as donors in subsequent matings. Four other R. fascians strains (NCPPB 1488, NCPPB 1675, NCPPB 2551, and ATCC 12974) could also be used as donors for cadmium resistance in matings. Strain NCPPB 1675 sho...

Desomer, J.; Dhaese, P.; Montagu, M.



Characterization of Circular Plasmid Dimers in Borrelia burgdorferi  


We have inactivated the ospC, oppAIV, and guaB genes on the 26-kb circular plasmid of Borrelia burgdorferi (cp26) by allelic exchange. On several occasions following such transformations, the cp26 of transformants had an aberrant mobility through agarose gels. Characterization of these cp26 molecules showed that the plasmid had dimerized. These dimers were quite stable during either selective or nonselective passage. Subsequent transformations with dimer DNA supported the hypothesis that in B...

Tilly, Kit; Lubke, Lori; Rosa, Patricia



Thioredoxin-like proteins in F and other plasmid systems  


Bacterial conjugation is the process by which a conjugative plasmid transfers from donor to recipient bacterium. During this process, single-stranded plasmid DNA is actively and specifically transported from the cytoplasm of the donor, through a large membrane-spanning assembly known as the pore complex, and into the cytoplasm of the recipient. In Gram negative bacteria, construction of the pore requires localization of a subset of structural and catalytically active proteins to the bacterial...

Hemmis, Casey W.; Schildbach, Joel F.



Genetic transformation of Streptococcus pneumoniae by heterologous plasmid deoxyribonucleic acid.  


A number of heterologous plasmid deoxyribonucleic acids (DNAs) coding for erythromycin, tylosin, lincomycin, tetracycline, or chloramphenicol resistance have been introduced into Streptococcus pneumoniae via genetic transformation with frequencies that varied between 10(-5) to as high as 5 x 10(-1) per colony-forming unit. Transformation with plasmid DNA required pneumococcal competence, was competed by chromosomal DNA, and showed a saturation at about 0.5 micrograms/ml (with a recipient popu...

Barany, F.; Tomasz, A.



Wide-Host-Range Plasmids Function in the Genus Thiobacillus  


Plasmids S-a, RP4, R388, and several RP4 derivatives (pMD101, pDT387, and pDT566) were transmissible by conjugation to Thiobacillus novellus from Escherichia coli. Genetic markers were expressed in T. novellus, with the exception of chloramphenicol resistance and ampicillin resistance. Plasmids were not transmissible by conjugation from E. coli donors to Thiobacillus intermedius, T. perometabolis, T. neapolitanus, or T. acidophilus recipients, although they could be mated into these strains f...

Davidson, M. S.; Summers, Anne O.



Plasmid transfer and genetic recombination by protoplast fusion in staphylococci.  


The experimental conditions for plasmid transfer and genetic recombination in Staphylococcus aureus and some coagulase-negative staphylococci by protoplast fusion are described. Protoplasts were prepared by treatment with lysostaphin and lysozyme in a buffered medium with 0.7 to 0.8 M sucrose. Regeneration of cell walls was accomplished on a hypertonic agar medium containing succinate and bovine serum albumin. Transfer of plasmids occurred after treatment of the protoplast mixtures with polye...

Go?tz, F.; Ahrne?, S.; Lindberg, M.



Construction of a bioluminescence reporter plasmid for Francisella tularensis  


A Francisella tularensis shuttle vector that constitutively expresses the Photorhabdus luminescens lux operon in type A and type B strains of F. tularensis was constructed. The bioluminescence reporter plasmid was introduced into the live vaccine strain of F. tularensis and used to follow F. tularensis growth in a murine intranasal challenge model in real time by bioluminescence imaging. The results show that the new bioluminescence reporter plasmid represents a useful tool for tularemia rese...

Bina, Xiaowen R.; Miller, Mark A.; Bina, James E.



Mega-rings Surrounding Timber Mountain Nested Calderas, Geophysical Anomalies: Rethinking Structure and Volcanism Near Yucca Mountain (YM), Nevada (United States)

Observed regional mega-rings define a zone ˜80-100 km in diameter centered on Timber Mountain (TM). The mega-rings encompass known smaller rhyolitic nested Miocene calderas ( ˜11-15 my, seismicity patterns, and structural relationships. Mega-rings consist of arcuate faulted blocks with deformation (some remain active structures) patterns showing a genetic relationship to the TM volcanic system; they appear to be spatially associated and temporally correlated with Miocene volcanism and two geophysically identified crustal/upper mantle features. A 50+ km diameter pipe-like high velocity anomaly extends from crustal depth to over 200 km beneath TM (evidence for 400km depth to NE). The pipe is located between two ˜100 km sub-parallel N/S linear trends of small-magnitude earthquake activity, one extending through the central NV Test Site, and a second located near Beatty, NV. Neither the kinematics nor relational mechanism of 100km seismically active N/S linear zones, pipe, and mega-rings are understood. Interpreted mega-rings are: 1) Similar in size to larger terrestrial volcanic complexes (e.g., Yellowstone, Indonesia's Toba system); 2) Located in the region of structural transition from the Mohave block to the south, N/S Basin and Range features to the north, Walker Lane to the NW, and the Las Vegas Valley shear zone to the SE; 3) Associated with the two seismically active zones (similar to other caldera fault-bounded sags), the mantle high velocity feature, and possibly a regional bouguer gravity anomaly; 4) Nearly coincident with area hydrologic basins and sub-basins; 5) Similar to features described from terrestrial and planetary caldera-collapse studies, and as modeled in laboratory scaled investigations (ice melt, balloon/sand). Post Mid-Miocene basalts commonly occur within or adjacent to the older rhyolitic caldera moats; other basaltic material occurs marginal to both the outer rings of the interpreted mega-ring system and high velocity pipe. The YM repository may be situated in an isolated structural setting within the mega-ring system; basaltic materials are absent in the block for over 11my for geologic reasons. The mega-ring model may better explain YM area structures (Highway 95 fault), tectonism, and volcanism. Coincident physiographic, geologic, and geophysical features associated with the mega-rings feature, and temporal characteristics of regional seismicity and volcanism suggest the need to critically re-assess regional scale and YM tectonic, seismotectonic, and volcanic models.

Tynan, M. C.; Smith, K. D.; Savino, J. M.; Vogt, T. J.



Plasmid vector with temperature-controlled gene expression  

International Nuclear Information System (INIS)

In plasmid pBR327, a fragment 169 b.p. long including promotor p3 of the bla gene has been deleted. The deletional derivative so obtained (pSP2) has been used to construct a recombinant plasmid bearing a fragment of phage ? DNA with the p/sub R/ promotor and the gene of the temperature-sensitive repressor cI. It has been shown that the plasmid vector so constructed (pCE119) with promotor cR performs repressor-cI-controlled transcription of the bla gene, as a result of which induction for an hour at 420C leads to an almost 100-fold increase in the amount of product of the bla gene as compared with that at 320C. The possibility of the use of plasmid cPE119 for the expression of other genes has been demonstrated for the case of the semisynthetic ?-galactosidase gene of E. coli. In this case, on induction of the cells with recombinant plasmid pCEZ12 for 3 hours at 420C, a 300-fold increase in the amount of active ?-galactosidase, as compared with that at 320C, was observed. It is important to point out that under these conditions (at 420C), at least 99% of the cells containing the plasmid retain the phenotype lacZ+, which indicates the stability of the proposed vector system


Functional analysis of three plasmids from Lactobacillus plantarum. (United States)

Lactobacillus plantarum WCFS1 harbors three plasmids, pWCFS101, pWCFS102, and pWCFS103, with sizes of 1,917, 2,365, and 36,069 bp, respectively. The two smaller plasmids are of unknown function and contain replication genes that are likely to function via the rolling-circle replication mechanism. The host range of the pWCFS101 replicon includes Lactobacillus species and Lactococcus lactis, while that of the pWCFS102 replicon also includes Carnobacterium maltaromaticum and Bacillus subtilis. The larger plasmid is predicted to replicate via the theta-type mechanism. The host range of its replicon seems restricted to L. plantarum. Cloning vectors were constructed based on the replicons of all three plasmids. Plasmid pWCFS103 was demonstrated to be a conjugative plasmid, as it could be transferred to L. plantarum NC8. It confers arsenate and arsenite resistance, which can be used as selective markers. PMID:15746322

van Kranenburg, Richard; Golic, Natasa; Bongers, Roger; Leer, Rob J; de Vos, Willem M; Siezen, Roland J; Kleerebezem, Michiel



Quantification and modeling of plasmid mobilization on seeds and roots. (United States)

Mobilization frequencies of the nonconjugative plasmid pMON5003 were quantified using Escherichia coli TB1(pRK2013) as donor of a helper plasmid, E. coli M182 (pMON5003) as donor of the nonconjugative plasmid, and Pseudomonas fluorescens as recipient. Initial mating experiments were conducted in nutrient and minimal salts media and pea seed exudates. Mobilization rates were higher during early stationary growth of donors, helpers, and recipients. Numbers of transconjugants were higher in biparental matings when donors contained both conjugative and nonconjugative plasmids, versus tri-parental matings. A mathematical model was developed to predict a nonconjugative plasmid transfer rate parameter (delta), estimating the proportion of conjugative matings in which a plasmid is mobilized. Values of delta ranged from 8 x 10(-3) to 7.9 x 10(-1). Transfer frequencies for pMON5003 from E. coli to P. fluorescens on pea seeds and roots were determined. Transconjugants (P. fluorescens 2-79 (pMON5003)) were isolated from seeds, roots, and soil, but mobilization frequencies were lower than in liquid media. PMID:16732455

Sudarshana, Padma; Knudsen, Guy R



Sodium phosphate enhances plasmid DNA expression in vivo. (United States)

Intramuscular injection of plasmid DNA results in myofiber cell expression of proteins encoded by the DNA. The preferred vehicle for plasmid DNA injections has been saline (154 mM sodium chloride) or PBS (154 mM NaCl plus 10 mM sodium phosphate). Here, it is shown that injection of luciferase or beta-galactosidase encoding plasmid DNA in a 150 mM sodium phosphate vehicle into murine muscle resulted in a two- to seven-fold increase in transgene expression compared with DNA injected in saline or PBS. When the DNA encoded secreted alkaline phosphatase, preproinsulin or interferon, sodium phosphate vehicle increased their serum levels by two- to four-fold. When the DNA encoded mouse erythropoietin, sodium phosphate vehicle increased hematocrits by two-fold compared with DNA injected in saline. When the DNA encoded influenza nucleoprotein, sodium phosphate increased anti-nucleoprotein antibody titers by two-fold. The expression of luciferase from plasmid DNA instilled into lung was increased five-fold compared with that in vehicle without sodium phosphate. Incubation of plasmid DNA with muscle extract or serum showed that sodium phosphate protected the DNA from degradation. Thus, a change from sodium chloride to sodium phosphate vehicle can enhance the expression of plasmid DNA in a tissue, possibly by inhibiting DNA degradation. Gene Therapy (2000) 7, 1171-1182. PMID:10918485

Hartikka, J; Bozoukova, V; Jones, D; Mahajan, R; Wloch, M K; Sawdey, M; Buchner, C; Sukhu, L; Barnhart, K M; Abai, A M; Meek, J; Shen, N; Manthorpe, M



Plasmid-mediated resistance to protein biosynthesis inhibitors in staphylococci. (United States)

Protein biosynthesis inhibitors (PBIs) represent powerful antimicrobial agents for the control of bacterial infections. In staphylococci, numerous resistance genes are known to be involved in resistance to PBIs, most of which mediate resistance to a specific class/subclass of PBIs, though a few genes do confer a multidrug resistance phenotype-up to five classes/subclasses of PBIs. Plasmids play a key role in the dissemination of PBI resistance among staphylococci, as they primarily carry plasmid-borne PBI resistance genes; however, plasmids also can be vectors for transposon-borne PBI resistance genes. Small plasmids that carry single PBI resistance genes are widespread among staphylococci of human and animal origin. Various mechanisms exist by which they can recombine, form cointegrates, or integrate into chromosomal DNA or larger plasmids. We provide an overview of the current knowledge of plasmid-mediated PBI resistance in staphylococci, with particular reference to the currently known PBI resistance genes, their association with mobile genetic elements, and the recombination/integration processes that control their mobility. PMID:22191528

Schwarz, Stefan; Fessler, Andrea T; Hauschild, Tomasz; Kehrenberg, Corinna; Kadlec, Kristina



Plasmid RNA polymerase-like mitochondrial sequences in Agaricus bitorquis. (United States)

A linear mitochondrial plasmid, pEM, found in certain isolates of the basidiomycete Agaricus bitorquis, potentially encodes virus-like DNA and RNA polymerases. Mitochondrial DNA from Agaricus bisporus that hybridizes to an internal region of pEM contains a fragmented and potentially non-functional version of the carboxy terminal end of the plasmid RNA polymerase. In this study, we present the sequence of the corresponding region of mitochondrial DNA from A. bitorquis. This sequence contained the same region of the plasmid RNA polymerase gene as was reported for the mitochondrial DNA of A. bisporus, and the level of similarity between the A. bisporus and A. bitorquis mitochondrial sequences was much higher than the level of similarity between either mitochondrial sequence and the plasmid. We propose that this plasmid RNA polymerase-like sequence was present in the Agaricus mitochondrial genome before the divergence of A. bisporus and A. bitorquis, and thus is unlikely to be a recent derivative of the plasmid pEM. PMID:8598058

Robison, M M; Horgen, P A



Plasmid analysis of Shigella dysenteriae type 1 isolates obtained from widely scattered geographical locations.  


Plasmid profiles and antimicrobial susceptibility patterns of 343 strains of Shigella dysenteriae type 1, obtained from 18 different geographical locations, were analyzed. Three plasmids, with molecular sizes of 140, 6, and 2 megadaltons (MDa), were present in 94, 98, and 96%, respectively, of the 343 strains isolated during either epidemic or nonepidemic periods from 1965 to 1987. In addition to these plasmids, 83% of the strains harbored a 4-MDa plasmid and 25% harbored a 20-MDa plasmid. Va...

Haider, K.; Kay, B. A.; Talukder, K. A.; Huq, M. I.



The distribution of plasmids among a representative collection of Scottish strains of Salmonellae.  


The distribution of plasmids was studied in a representative collection of salmonella strains which comprised 98 Salmonella typhimurium and 96 other serotypes. Plasmids were detected in 72% of strains (mean 1.3 plasmids/strain) and individual strains harboured between 0 and 7 plasmids. They were more common among S. typhimurium than other serotypes (incidence 92 and 53%; mean 1.9 and 0.8 plasmids/strain respectively). Although a higher proportion of S. typhimurium (33%) were antibiotic-resist...

Platt, D. J.; Brown, D. J.; Munro, D. S.



Infectivity Acts as In Vivo Selection for Maintenance of the Chlamydial Cryptic Plasmid?  


Chlamydia trachomatis contains a conserved ?7.5-kb plasmid. Loss of the plasmid results in reduced glycogen accumulation, failure to activate TLR2, and reduced infectivity. We hypothesized that reduced infectivity functions as a means of selection for plasmid maintenance. We directly examined the biological significance of the reduced infectivity associated with plasmid deficiency by determining the relative fitness of plasmid-deficient CM972 versus that of wild-type C. muridarum Nigg in mi...

Russell, Marsha; Darville, Toni; Chandra-kuntal, Kumar; Smith, Bennett; Andrews, Charles W.; O Connell, Catherine M.



Hofmeister series salts enhance purification of plasmid DNA by non-ionic detergents  


Ion-exchange chromatography is the standard technique used for plasmid DNA purification, an essential molecular biology procedure. Non-ionic detergents (NIDs) have been used for plasmid DNA purification, but it is unclear whether Hofmeister series salts (HSS) change the solubility and phase separation properties of specific NIDs, enhancing plasmid DNA purification. After scaling-up NID-mediated plasmid DNA isolation, we established that NIDs in HSS solutions minimize plasmid DNA contamination...

Lezin, George; Kuehn, Michael R.; Brunelli, Luca



Scaling Relations of Source Parameters of Earthquakes Occurring on Inland Crustal Mega-Fault Systems (United States)

We examined a new scaling relation between source area S and seismic moment M 0 for large crustal earthquakes on "mega-fault" systems, including earthquakes with magnitudes larger than M w7.4. We focused on earthquakes that occurred on inland crustal mega-fault systems, such as the 2008 Wenchuan and 2002 Denali earthquakes, and compiled the source parameters using 11 inland crustal earthquakes which analyses of source rupture processes by waveform inversion as well as investigation of surface ruptures via geomorphological surveys. We found that the maximum surface rupture displacement is two to three times larger than the average slip on the source fault, and the length of the surface rupture is equivalent to the length of the source fault. Furthermore, our compiled data shows the displacement of the surface rupture D saturates around 10 m when the length of the surface rupture L reaches 100 km. Assuming that the average width of the source fault W = 18 km (for Japanese inland crustal earthquakes) and the saturated surface displacement D = 10 m, we found that the scaling relations between rupture area S and seismic moment M 0 have three stages. For the first stage, S is proportional to M {0/2/3} for earthquakes smaller than M 0 = 7.5 × 1018 Nm. For the second stage, S ranges from M {0/1/2} to M {0/2/3}, depending on the thickness of the seismogenic zone. For the third stage, S is proportional to M 0 because of the saturation of the slip on the fault. From our compiled data, we derived the third scaling relation between source area S and seismic moment M 0 for inland crustal mega-fault systems to be S (km2) = 1.0 × 10-17 M 0 (Nm), where M 0 > 1.8 × 1020 (Nm).

Murotani, Satoko; Matsushima, Shinichi; Azuma, Takashi; Irikura, Kojiro; Kitagawa, Sadayuki



Seismic Regime in the Vicinity of the 2011 Tohoku Mega Earthquake (Japan, M w = 9) (United States)

The 2011 Tohoku mega earthquake ( M w = 9) is unique due to a combination of its large magnitude and the high level of detail of regional seismic data. The authors analyzed the seismic regime in the vicinity of this event using data from the Japan Meteorological Agency catalog and world databases. It was shown that a regional decrease in b-value and of the number of main shocks took place in the 6-7 years prior to the Tohoku mega earthquake. The space-time area of such changes coincided with the development of precursor effects in this area, as revealed by Lyubushin (Geofiz Prots Biosfera 10:9-35, 2011) from the analysis of microseisms recorded by the broadband seismic network F-net in Japan. The combination of episodes of growth in the number of earthquakes, accompanied by a corresponding decrease in the b-value and average depth of the earthquakes, was observed for the foreshock and aftershock sequences of the 2011 Tohoku earthquake. Some of these anomalies were similar to those observed (also post factum) by Katsumata (Earth Planets Space 63:709-712, 2011), Nanjo et al. (Geophys Res Lett 39, 2012), and Huang and Ding (Bull Seismol Soc Am 102:1878-1883, 2012), whereas others were not described before. The correlation of the periods of growth in seismic activity with the decrease of the average depth of earthquakes can be explained by the growth of fluid activity and the tendency of a penetration of low density fluids into the upper horizons of the lithosphere. The unexpectedly strong Tohoku mega earthquake with a rather small rupture area caused an unexpectedly high tsunami wave. From here it seems plausible that M9+ earthquakes with a large tsunami could occur in other subduction zones where such cases were suggested before to be impossible.

Rodkin, M. V.; Tikhonov, I. N.



Topographic and road control of mega-gullies in Kinshasa (DR Congo) (United States)

Diachronic mapping (1957, 1967, 2007 and 2010) shows an exponentially growing mega-gully network since roads were constructed through in the forests and plantations which occupied the sandy soils of the high town of Kinshasa. We found that the spatial occurrence of the mega-gullies (width ? 5 m) in this newly urbanized environment is controlled by two factors. First, there is a topographic control, given by the relation S = 0.00008A- 1.459, with S being the slope gradient (m m- 1) of the soil surface at the gully head and A the drainage area (ha) above the head. There is also a ‘road’ control, expressed by S = 22.991Lc- 1.999, with Lc being the cumulated length of roads in the basin above the gully head. The co-existence of both controls reflects the fact that the local sands are highly permeable and hence roads are more important generators of continuous runoff. The S-A relation noted above should not be applied outside the town where the road network is less dense. In contrast, the S-Lc relation may be used in both the town and rural areas underlain by porous soils where roads are the only generators of continuous runoff. We further conclude that the high town of Kinshasa is one of the most vulnerable places for gullying, and gullying can potentially transform the town into a badland. ‘Artisanal’ gully treatment is more successful than generally believed and the S-Lc relation can be a tool for mega-gully prevention.

Makanzu Imwangana, Fils; Dewitte, Olivier; Ntombi, Médard; Moeyersons, Jan



Deletion and rearrangement of plasmid DNA during transformation of Escherichia coli with linear plasmid molecules. (United States)

When E. coli was transformed with linearized pBR322 DNA, many transformants contained recircularized plasmids bearing deletions and other rearrangements. Most aberrant molecules were less than monomeric length and had lost the restriction site used for linearization, with the deleted region extending mono- (type Ia) or bi-directionally (type Ib). Type II deletants were greater than monomeric but less than dimeric and contained the pBR322 sequence in direct repeat with deletion at one or both junctions (type IIa) or in inverted repeat with loss of sequence at both junctions (type IIb). Type III deletants were greater than dimeric but less than trimeric, consisting of pBR322 sequences in both direct and inverse repeat with deletions at two or more junctions. Transformation frequencies for linear DNA were drastically reduced in xth-1- bacteria with type IIb deletants predominating in transformants. This indicates that exonuclease III is important for perfect recyclization of plasmids and the generation of type I deletants. In vivo recyclization of in vitro ligation products explains many of the aberrant DNA molecules that are encountered during gene cloning. PMID:3024124

Conley, E C; Saunders, V A; Saunders, J R



Tunable Mega-Ampere Electron Current Propagation in Solids by Dynamic Control of Lattice Melt (United States)

The influence of lattice-melt-induced resistivity gradients on the transport of mega-ampere currents of fast electrons in solids is investigated numerically and experimentally using laser-accelerated protons to induce isochoric heating. Tailoring the heating profile enables the resistive magnetic fields which strongly influence the current propagation to be manipulated. This tunable laser-driven process enables important fast electron beam properties, including the beam divergence, profile, and symmetry to be actively tailored, and without recourse to complex target manufacture.

MacLellan, D. A.; Carroll, D. C.; Gray, R. J.; Booth, N.; Burza, M.; Desjarlais, M. P.; Du, F.; Neely, D.; Powell, H. W.; Robinson, A. P. L.; Scott, G. G.; Yuan, X. H.; Wahlström, C.-G.; McKenna, P.



Festifavelisation: mega-events, slums and strategic city-staging – the example of Rio de Janeiro  

Directory of Open Access Journals (Sweden)

Full Text Available Mega-events are increasingly often taking place in countries of the Global South. In the socio-spatially deeply fragmented host cities these spectacles encompass extremely transformative urban processes. This paper will consider the festivalisation of Rio de Janeiro in the preparatory phase of the 2014 FIFA World Cup and the 2016 Summer Olympics. It focuses on the urban policy in relation to how Rio deals with its favelas. The aim of the article is to critically assess current measures of ‘invisibilisation’, ‘pacification’, ‘beautification’ and ‘touristic staging’ of favelas against the backdrop of the upcoming events.

Steinbrink, Malte



Development of a hardened imaging system for the Laser MegaJoule  


The Laser MegaJoule (LMJ) facility will host inertial confinement fusion experiments in order to achieve ignition by imploding a Deuterium-Tritium microballoon. In this context an X-ray imager is necessary to diagnose the core size and shape of the DT-target in the 10–100?keV band in complement of neutron imaging system. Such a diagnostic will be composed of two parts: an X-ray optical system and a detection assembly. Each element will be affected by the harsh environment created by fusio...

Rousseau A.; Darbon S.; Troussel P.; Caillaud T.; Bourgade J.L.; Turk G.; Vigne E.; Hamel M.; Larour J.; Bradley D.; Smalyuk V.; Bell P.



Development of a hardened imaging system for the Laser MegaJoule  

Directory of Open Access Journals (Sweden)

Full Text Available The Laser MegaJoule (LMJ facility will host inertial confinement fusion experiments in order to achieve ignition by imploding a Deuterium-Tritium microballoon. In this context an X-ray imager is necessary to diagnose the core size and shape of the DT-target in the 10–100?keV band in complement of neutron imaging system. Such a diagnostic will be composed of two parts: an X-ray optical system and a detection assembly. Each element will be affected by the harsh environment created by fusion reactions.

Rousseau A.



Ultra Mega Power Projects: Additional Re-Structural Capacity to Existing Indian Grid System  


The demand for power in India is ever increasing, as industrial sector is one of the largest consumers of electrical energy in India. More and more efforts are made by the Government every year to overcome this problem. Ultra Mega Power projects (UMPP) are a series of ambitious power projects planned by the Government of India. With India being a country of chronic power deficit, the Government of India has planned to provide 'power for all' by the end of the eleventh plan. This would entail ...

Singh, M. K.; Shrama, Dr N. K.; Dr.Prabhakar Tiwari; Vikas Pandey; Tiwari, Dr A. N.



Establishment of a production line for the fabrication of mega-curie sealed 60Co sources  

International Nuclear Information System (INIS)

In order to change the status that highly radioactive 60Co sources in China are de- pendent on imports, the fabrication technology of sealed 60Co sources was successfully developed and a mega Curie production line was established. This paper describes the hot cell facilities for the 60Co source encapsulation and quality control, the model and main technical parameters of the sealed 60Co source, the fabrication process, some key techniques in the re- search and development of the sealed 60Co source, etc. (authors)


Tunable mega-ampere electron current propagation in solids by dynamic control of lattice melt. (United States)

The influence of lattice-melt-induced resistivity gradients on the transport of mega-ampere currents of fast electrons in solids is investigated numerically and experimentally using laser-accelerated protons to induce isochoric heating. Tailoring the heating profile enables the resistive magnetic fields which strongly influence the current propagation to be manipulated. This tunable laser-driven process enables important fast electron beam properties, including the beam divergence, profile, and symmetry to be actively tailored, and without recourse to complex target manufacture. PMID:25396375

MacLellan, D A; Carroll, D C; Gray, R J; Booth, N; Burza, M; Desjarlais, M P; Du, F; Neely, D; Powell, H W; Robinson, A P L; Scott, G G; Yuan, X H; Wahlström, C-G; McKenna, P



Development of a hardened imaging system for the Laser MegaJoule  

International Nuclear Information System (INIS)

The Laser MegaJoule (LMJ) facility will host inertial confinement fusion experiments in order to achieve ignition by imploding a Deuterium-Tritium micro-balloon. In this context an X-ray imager is necessary to diagnose the core size and shape of the DT-target in the 10-100 keV band in complement of neutron imaging system. Such a diagnostic will be composed of two parts: an X-ray optical system and a detection assembly. Each element will be affected by the harsh environment created by fusion reactions. (authors)


New horizons for extreme light physics with mega-science project XCELS  

International Nuclear Information System (INIS)

A short review of the Russian mega-science project XCELS and scientific problems to be solved are presented. We discuss the origin of multi-beam design to attain the highest field magnitude at optimal focusing. Then, we formulate particular physical problems of fundamental interest that can be solved within this project. They include new regimes of single particle motions mostly due to the radiation reaction force (RR) effects when efficient gamma ray generation occurs, new regimes of non-linear electrodynamics, as well as QED resulting in highly efficient plasma converter for gamma rays, and probing non-perturbative QED with dipole or superluminal atto-second pulses


Expansion of the IncX plasmid family for improved identification and typing of novel plasmids in drug-resistant Enterobacteriaceae  

DEFF Research Database (Denmark)

IncX plasmids are narrow host range plasmids of Enterobactericeae that have been isolated for over 50years. They are known to encode type IV fimbriae enabling their own conjugative transfer, and to provide accessory functions to their host bacteria such as resistance towards antimicrobial agents and biofilm formation. Previous plasmid-based replicon typing procedures have indicated that the prevalence of IncX plasmids is low among members of the Enterobacteriaceae. However, examination of a number of IncX-like plasmid sequences and their occurrence in various organisms suggests that IncX plasmid diversity and prevalence is underappreciated. To address these possible shortcomings, we generated additional plasmid sequences of IncX plasmids of interest and compared them to the genomes of all sequenced IncX-like plasmids. These comparisons revealed that IncX plasmids possess a highly syntenic plasmid backbone, but that they are quite divergent with respect to nucleotide and amino acid similarity. Based on phylogenetic comparisons of the sequenced IncX plasmids, the IncX plasmid group has been expanded to include at least four subtypes, IncX1-IncX4. A revised IncX plasmid replicon typing procedure, based upon these sequences and subtypes, was then developed. Use of this revised typing procedure revealed that IncX plasmid occurrence among bacterial populations is much more common than had previously been acknowledged. Thus, this revised procedure can be used to better discern the occurrence of IncX type plasmids among enterobacterial populations.

Johnson, Timothy J.; Bielak, Eliza Maria



Status and Perspectives of the Mini-MegaTORTORA Wide-field Monitoring System with High Temporal Resolution  

Directory of Open Access Journals (Sweden)

Full Text Available Here we briefly summarize our long-term experience of constructing and operating wide-field monitoring cameras with sub-second temporal resolution to look for optical components of GRBs, fast-moving satellites and meteors. The general hardware requirements for these systems are discussed, along with algorithms for real-time detection and classification of various kinds of short optical transients. We also give a status report on the next generation, the MegaTORTORA multi-objective and transforming monitoring system, whose 6-channel (Mini-MegaTORTORA-Spain and 9-channel prototypes (Mini-MegaTORTORA-Kazan we have been building at SAO RAS. This system combines a wide field of view with subsecond temporal resolution in monitoring regime, and is able, within fractions of a second, to reconfigure itself to follow-up mode, which has better sensitivity and simultaneously provides multi-color and polarimetric information on detected transients.

Sergey Karpov




The transduction of Pseudomonas aeruginosa plasmid Rms149 by the generalized transducing phage DS1 was shown to occur during a nine day incubation of environmental test chambers in a freshwater reservoir. Plasmid DNA was transferred from a nonlysogenic plasmid donor to a DS1 lyso...


Evaluation of in Ovo Delivery System for Plasmid DNA Vaccination  

Directory of Open Access Journals (Sweden)

Full Text Available In ovo vaccination against Marek`s Disease Virus (MDV is a common practice in more than 85% of broilers produced in the US. DNA vaccines represent a new tool to prevent infectious diseases in many species, including poultry. An in ovo delivery system for plasmid DNA vaccines is described in which we evaluate the route of delivery (air cell vs amniotic cavity, transfection reagent (IFA+DMSO vs polyethylenimine, dose of plasmid DNA (1 to 100 µg/egg and the nature of humoral immune responses. A plasmid DNA (CMV-EGFP-BGH construct expressing Enhanced Green Fluorescent Protein (EGFP under cytomegalovirus (CMV immediate early promoter was used to optimize the route of delivery and formulation for in ovo DNA vaccination. A plasmid expressing the hemmagglutinin-neuraminidase (HN gene of Newcastle disease virus (pIRES-HN-EGFP was used to evaluate five different dosages of DNA and the humoral immune responses after in ovo vaccination. Higher expression of EGFP and hatchability were obtained when 18-day-old embryos were inoculated through the amniotic cavity using a cationic lipid adjuvant containing polyethylenimine (PEI-ExGen®. Transgene expression was observed even when low amounts of plasmid DNA were used (1 µg/egg. A dose-dependent response was observed with plasmid DNA concentrations of 1, 10, 25, 60 and 100 µg/egg. Better responses were detected when embryos were inoculated with 60 µg of plasmid DNA. Detectable humoral responses were observed as measured by ELISA and isotope-ELISA assays.

L. Moura



Thioredoxin-like proteins in F and other plasmid systems. (United States)

Bacterial conjugation is the process by which a conjugative plasmid transfers from donor to recipient bacterium. During this process, single-stranded plasmid DNA is actively and specifically transported from the cytoplasm of the donor, through a large membrane-spanning assembly known as the pore complex, and into the cytoplasm of the recipient. In Gram negative bacteria, construction of the pore requires localization of a subset of structural and catalytically active proteins to the bacterial periplasm. Unlike the cytoplasm, the periplasm contains proteins that promote disulfide bond formation within or between cysteine-containing proteins. To ensure proper protein folding and assembly, bacteria employ periplasmic redox systems for thiol oxidation, disulfide bond/sulfenic acid reduction, and disulfide bond isomerization. Recent data suggest that plasmid-based proteins belonging to the disulfide bond formation family play an integral role in the conjugative process by serving as mediators in folding and/or assembly of pore complex proteins. Here we report the identification of 165 thioredoxin-like family members across 89 different plasmid systems. Using phylogenetic analysis, all but nine family members were categorized into thioredoxin-like subfamilies. In addition, we discuss the diversity, conservation, and putative roles of thioredoxin-like proteins in plasmid systems, which include homologs of DsbA, DsbB, DsbC, DsbD, DsbG, and CcmG from Escherichia coli, TlpA from Bradyrhizobium japonicum, Com1 from Coxiella burnetii, as well as TrbB and TraF from plasmid F, and the absolute conservation of a disulfide isomerase in plasmids containing homologs of the transfer proteins TraH, TraN, and TraU. PMID:23721857

Hemmis, Casey W; Schildbach, Joel F



The Emotional Intelligence of Resident Physicians  


Since academic literature indicates that emotional intelligence (EI) is tied to work performance, there is increasing interest in understanding physician EI. We studied the EI of resident physicians in surgery, pediatric, and pathology residency programs at three academic centers to describe the EI profiles of residents in different specialties and determine whether gender differences in resident physician EI profiles mirror those in the general population. 325 residents were electronically...

Mckinley, Sophia Kim



The mega-Gray-level glucose dosimeter using optical rotation change  

International Nuclear Information System (INIS)

Dosimetric characteristics of glucose dosimeter based on the radiation induced change in optical rotation of D-glucose solution was studied for the high-dose dosimetry at mega-Gray level. D-glucose solution of 20 wt% concentration was used for dosimeter solution. The optical rotation of solution is independent of the temperature of solution during measurement in the range of 5 to 30 deg C and stable for a long period at room temperature before and after irradiation. Radiation induced optical rotation change also does not depend on the temperature during irradiation in the range of 25 to 50 deg C. Glucose dosimeter was found to be very reproducible in mega-Gray level and covers high dose range from 0.01 to 4.30 MGy within the accuracy of ± 4 %. As to the radiation chemical mechanism, the optical rotation change of glucose solution is ascribed to radiation induced decomposition of D-glucose, and the G value for the decomposition, which is 4.1 to initial stage of irradiation, decreases with the increase of dose. (author)


Sustainable Science? Reducing the Carbon Impact of Scientific Mega-Meetings  

Directory of Open Access Journals (Sweden)

Full Text Available Scientists across the globe recognize the importance of reducing carbon emissions to combat climate change.  At the same time, we have increased our carbon footprint through air travel to the growing number of scientific society “mega-meetings” that host thousands of attendees.  Although alternative solutions have been proposed to reduce the environmental impact of annual conferences, these have yet to be evaluated against the business-as-usual scenario.  Here, we use 9 years of annual meeting attendance data from the Ecological Society of America and the Association of American Geographers to assess the efficacy of two additional solutions: 1 alternate large national meetings that require significant air travel with smaller regional meetings that do not; and 2 incorporate geography into the meeting location selection process.  The carbon footprint of annual mega-meetings ranged 3-fold, from 1196-4062 metric tons of CO2.  Results indicate that an alternating schedule of national and regional meetings can reduce conference-related CO2 emissions up to 73%, while improved spatial planning may result in further reductions.  We discuss the benefits and tradeoffs of proposals to green scientific meetings, with a view to spark further debate on how to increase the sustainability of scientific conferences.

Alexandra G. Ponette-González



Research on Mega-Math: Discrete mathematics and computer science for children. Final report  

Energy Technology Data Exchange (ETDEWEB)

The objective of the subcontract was to provide further research on the approach to mathematics education embodied in the workbook ``This is Mega-Mathematics!`` essentially produced under the subcontract and its preceding informal (alas!) cooperative arrangements. The workbook is now widely and freely distributed on the Internet under the copyright of the Los Alamos National Labs. This research was to consist of: (1) the development and dissemination of materials, (2) experimentation with use of the materials in classroom visits and other events, (3) communication of the ideas embodied in the materials to various forums concerned with mathematics education reform, (4) the development of connections to the computer games industry, (5) the development of new workbook-type materials, (6) publications, (7) the development of connections to Science Museums, (8) the development of uses of the Internet to make MegaMath materials and ideas available through that medium, (9) the stimulation of and coordination with other projects in mathematics education reform. All of these objectives have been accomplished in what should be regarded as one of the most interesting and cost-effective projects ever undertaken in mathematics education, a testimony to the vision and creative imagination of the Los Alamos Labs.

Fellows, M.R. [Victoria Univ., BC (Canada)



A case with mega cisterna magna renal and ear anomalies: is this a new syndrome? (United States)

Background. Extrarenal pathologies may be associated with renal position and fusion anomalies. According to the literature, our patient is the first horseshoe kidney case that had mega cisterna magna, arachnodactyly, and mild mental retardation. Case Report. A 9-year-old boy admitted because of the myoclonic jerks. He had a dysmorphic face, low-set and cup-shaped ears, arachnodactyly, and mild mental retardation. The patient's laboratory findings were normal except for a mild leucocytosis and hypochromic microcytic anemia. His cerebrospinal fluid was cytologically and biochemically normal. Cranial MRI revealed 1.5?cm diametered mega cisterna magna in the retrocerebellar region. Although there were no significant epileptical discharges in the electroencephalography, there were slow wave discharges arising from the anterior regions of both hemispheres. Because he had stomachache, abdominal ultrasonography was performed, and horseshoe kidney was determined. Abdominal CT did not reveal any abnormalities except the horseshoe kidney. There were not any cardiac pathologies in echocardiography. He had normal 46XY karyotype and there were no repeated chromosomal derangements, but we could not evaluate for molecular and submicroscopic somatic changes. He was treated with valproic acid and myoclonic jerks did not repeat. Conclusion. We suggest that the presence of these novel findings may represent a newly recognized, separate syndrome. PMID:23762068

Konca, Capan; Caliskan, Bahar; Tas, Mehmet Ali



Plasmid Profiles of Antibiotic Resistant Salmonella Species Isolated in Muscat, Oman  

Directory of Open Access Journals (Sweden)

Full Text Available Different Salmonella species (159 strains were isolated from human and non-human sources were exposed to eighteen different antibiotics. 48 strains showed resistance to one or more antibiotics. Resistant strains were examined for their R- plasmids contents by glass fines, boiling miniprep and agarose electrophoresis procedures. All but three of the tested strains from chicken contained a plasmid with similar molecular weight (m.w. even though the strains were resistant to different antibiotics. The remaining three strains contained an additional plasmid with a different electrophoretic migration pattern. Many of the plasmids when digested with endonucleases were found to have similar fragments. Out of four plasmids extracted from Salmonella strains isolated from sheep, three contained one type of a plasmid with similar m.w. and fragmentation. Broad diversity was noted in plasmids extracted from Salmonella strains isolated from humans. Endonuclease digestion of plasmids revealed that some plasmids have a common fingerprint pattern.

S. N. Al-Bahry



Plasmid DNA content of multiresistant Staphylococcus aureus strains. (United States)

Multiresistant S. aureus strains (also called methicillin-resistant in clinical laboratories) share many common properties. In addition to the commonly used epidemiological markers (pattern of resistance to antibiotics and metal ions, serotype and lysotype), we considered using the molecular and genetical properties of the plasmid DNA harboured by these strains. In this paper we report an epidemiological study of two groups of S. aureus strains sampled since 1975 and carrying new resistance characters which appeared with increasing frequency in France. The Tm-SgR strains (5 strains) carry, in addition to 13 resistance characters commonly observed, two new characters: the resistance to gramin components A and B (Sg). The two new characters were shown to be encoded by a single plasmid. Amongst the 5 strains studied, two harbour a similar plasmid DNA content while the three others were clearly distinct. Because of the variability of the plasmid DNA content observed in these strains, the similarity of this content observed between two of them suggest a close phylogenic relationship. These two strains are probably derivatives from a single clone. The spread of the two new characters amongst the distinct strains might be related to the spread of ancestrally related Tm-Sg plasmids. The Tob-GenR strains (16 strains) carry, in addition to 12 wide-spread resistance markers, the newly observed resistance to many aminoglycosides, mainly the resistance to tobramycin (Tob) and gentamicin (Gen). They all harbour a 22-kb plasmid DNA generating similar restriction cleavage patterns and conferring the resistance to penicillin G, arsenate, arsenite and cadmium. Some of them harbour one or two extra small plasmids (3.4 and 2.3 kb); the presence of these two plasmids was not associated with a modification of the resistance pattern of the strains. Most of the resistance characters--including the new ones--are probably encoded by chromosomal genes. In this epidemiological situation, the spread of the new aminoglycoside resistance characters carried by the 16 strains having the same phenotype and harbouring the same 22-kb plasmid is attributed to the spread of derivatives from a single clone. PMID:6275759

El Solh, N; Fouace, J M; Pillet, J; Chabbert, Y A



Mega-asperity model for the 2011 Tohoku-Oki earthquake, Japan (United States)

We performed moment tensor inversion of the 2011 Mw 9.0 Tohoku-Oki earthquake using regional seismic waveforms, which indicates that the earthquake can be approximated by a point source. We used strong-motion seismograms from a nationwide broadband seismic network of the F-net installed and operated by the National Research Institute for Earth Science and Disaster Prevention (NIED). At each F-net station, a velocity-type strong-motion seismometer is installed at the end of a 30-50 m long vault to record strong motions up to +-2 m/s. We selected five F-net stations with the hypocentral distances more than several hundred kilometers. We used a waveform inversion method that assumes a double-couple focal mechanism for a point source [Nakano et al., 2008, GJI]. Our inversion using the strong-motion seismograms band-pass filtered between 0.006 and 0.02 Hz indicates that the best-fit source location was obtained at 38.25 N, 143.25 E at a depth of 30 km, at which the normalized residual was 0.13. The estimated mechanism and moment magnitude (Mw = 9.0) are consistent with those estimated from global broadband seismographic network data by the global CMT project and the National Earthquake Information Center (NEIC) of the U.S. Geological Survey. We fitted the omega-square model to amplitude spectra of observed vertical displacement seismograms, which resulted in the corner frequency of around 0.017 Hz. This implies average slip of roughly 70 m over a circular fault with radius of 70 km. These results suggest that a strongly localized asperity (mega asperity) was ruptured during the earthquake. For the northeastern Japan subduction zone, where the old Pacific Sea plate subducts along the Japan Trench, the seismic coupling was believed to be very small. The occurrence of the mega earthquake is apparently not compatible with weak seismic coupling. However, as suggested by Scholz and Small [1997, Geology], the subduction of a large seamount increases the normal stress across the subduction interface, which produces local seismic coupling in decoupled plates. If we consider a subducted seamount as the mega asperity at the source of the Tohoku-Oki earthquake, the occurrence of the mega earthquake in the decoupled plates is reasonably explained. Asano et al. [2011, EPS] indicated that all the CMT solutions of aftershocks above the source region of the Tohoku-Oki earthquake were characterized by normal faulting. A similar aftershock pattern was observed during the 1994 Java earthquake (Mw7.6). This earthquake occurred in a weakly coupled plate interface and its large slip area was coincident with a well identified seamount in this region. We can find a velocity anomaly near the source region of the Tohoku-Oki earthquake in the velocity model of Miura et al. [2005, Tectonophyics], which was obtained from a seismic line experiment off-Miyagi perpendicular to the trench. This velocity anomaly may be related with the subduction process of a seamount at this region. Further extensive refraction and reflection seismic surveys along the Japan Trench would contribute to verify our mega-asperity model and to evaluate seismic and tsunami hazards along the Japan Trench.

Kumagai, H.; Pulido Hernandez, N. E.; Fukuyama, E.; Aoi, S.



Dcm methylation is detrimental to plasmid transformation in Clostridium thermocellum  

Directory of Open Access Journals (Sweden)

Full Text Available Abstract Background Industrial production of biofuels and other products by cellulolytic microorganisms is of interest but hindered by the nascent state of genetic tools. Although a genetic system for Clostridium thermocellum DSM1313 has recently been developed, available methods achieve relatively low efficiency and similar plasmids can transform C. thermocellum at dramatically different efficiencies. Results We report an increase in transformation efficiency of C. thermocellum for a variety of plasmids by using DNA that has been methylated by Escherichia coli Dam but not Dcm methylases. When isolated from a dam+dcm+E. coli strain, pAMG206 transforms C. thermocellum 100-fold better than the similar plasmid pAMG205, which contains an additional Dcm methylation site in the pyrF gene. Upon removal of Dcm methylation, transformation with pAMG206 showed a four- to seven-fold increase in efficiency; however, transformation efficiency of pAMG205 increased 500-fold. Removal of the Dcm methylation site from the pAMG205 pyrF gene via silent mutation resulted in increased transformation efficiencies equivalent to that of pAMG206. Upon proper methylation, transformation efficiency of plasmids bearing the pMK3 and pB6A origins of replication increased ca. three orders of magnitude. Conclusions E. coli Dcm methylation decreases transformation efficiency in C. thermocellum DSM1313. The use of properly methylated plasmid DNA should facilitate genetic manipulation of this industrially relevant bacterium.

Guss Adam M



Dcm methylation is detrimental to plasmid transformation in Clostridium thermocellum  

Energy Technology Data Exchange (ETDEWEB)

BACKGROUND: Industrial production of biofuels and other products by cellulolytic microorganisms is of interest but hindered by the nascent state of genetic tools. Although a genetic system for Clostridium thermocellum DSM1313 has recently been developed, available methods achieve relatively low efficiency and similar plasmids can transform C. thermocellum at dramatically different efficiencies. RESULTS: We report an increase in transformation efficiency of C. thermocellum for a variety of plasmids by using DNA that has been methylated by Escherichia coli Dam but not Dcm methylases. When isolated from a dam+ dcm+ E. coli strain, pAMG206 transforms C. thermocellum 100-fold better than the similar plasmid pAMG205, which contains an additional Dcm methylation site in the pyrF gene. Upon removal of Dcm methylation, transformation with pAMG206 showed a four- to seven-fold increase in efficiency; however, transformation efficiency of pAMG205 increased 500-fold. Removal of the Dcm methylation site from the pAM205 pyrF gene via silent mutation resulted in increased transformation efficiencies equivalent to that of pAMG206. Upon proper methylation, transformation efficiency of plasmids bearing the pMK3 and pB6A origins of replication increased ca. three orders of magnitude. CONCLUSION: E. coli Dcm methylation decreases transformation efficiency in C. thermocellum DSM1313. The use of properly methylated plasmid DNA should facilitate genetic manipulation of this industrially relevant bacterium.

Guss, Adam M [ORNL; Olson, Daniel G. [Thayer School of Engineering at Dartmouth; Caiazza, Nicky [Mascoma Corporation; Lynd, Lee R [Thayer School of Engineering at Dartmouth



High-performance membrane chromatography of supercoiled plasmid DNA. (United States)

Membrane adsorbers are well established in protein chromatography. The present paper investigated for the first time the behavior of polynucleotides on these stationary phases, taking a 7.2-kb predominantly supercoiled plasmid as example. Gradient and isocratic elution was studied. In contrast to protein high-performance membrane chromatography (HPMC), isocratic elution is possible in DNA chromatography. In the case of gradient elution, much higher salt concentrations can be used in the starting buffer. Under optimized conditions, both approaches led to a splitting of the single plasmid peak into three maximums, which corresponded to the three-albeit isolated-bands in the agarose gel. Presumably the three fractions were supercoiled, nicked, and open circular plasmid DNA. Linearization of the plasmid lowered the adsorption energy, and the linearized plasmid eluted earlier than the nonlinearized one. The HPMC experiments were compared to similar ones performed using a conventional packed-bed anion-exchange column (BioScale Q2, 7 x 52 mm, 10-micron porous particles) and a novel monolithic-type anion-exchange column (UNO Q1, 7 x 35 mm). The results and characteristic differences observed in these experiments were interpreted in the light of the newly developed theory of HPMC. PMID:9726161

Giovannini, R; Freitag, R; Tennikova, T B



Recovery of recombinant plasmids from Pleurotus ostreatus transformants. (United States)

A transformation system employing selectable resistance to hygromycin B has been developed for the mushroom-forming fungus, Pleurotus ostreatus. Vector pAN7-1, a commonly used non-replicative vector for integrative transformation in fungi, yielded 5-46 resistant colonies per micrograms of DNA per 10(7) viable protoplasts. Southern blot analysis of certain transformants revealed unexpected replicative plasmids containing pAN7-1 sequences, but modified for size, methylation and restriction enzyme pattern when compared to the initial transforming vector. Two such replicative derivatives of pAN7-1 have been rescued from P. ostreatus by cloning into Escherichia coli. Rescued plasmids have been used to probe DNA from untransformed P. ostreatus in an effort to identify fungal sequences that recombined in vivo with pAN7-1 to form replicative plasmids. Such replicative sequences have been localized in high molecular weight (chromosomal) DNA of wild-type P. ostreatus. Transformation has been obtained for P. ostreatus using a rescued plasmid, thereby confirming the role of this recombinant plasmid as a shuttle vector. PMID:1611668

Peng, M; Singh, N K; Lemke, P A



Plasmid location of Borrelia purine biosynthesis gene homologs. (United States)

The Lyme disease spirochete Borrelia burgdorferi must survive in both its tick vector and its mammalian host to be maintained in nature. We have identified the B. burgdorferi guaA gene encoding GMP synthetase, an enzyme involved in de novo purine biosynthesis that is important for the survival of bacteria in mammalian blood. This gene encodes a functional product that will complement an Escherichia coli GMP synthetase mutant. The gene is located on a 26-kb circular plasmid, adjacent to and divergent from the gene encoding the outer surface protein C (OspC). The guaB gene homolog encoding IMP dehydrogenase, another enzyme in the purine biosynthetic pathway, is adjacent to guaA. In Borrelia hermsii, a tick-borne relapsing fever spirochete, the guaA and guaB genes are located on a linear plasmid. These are the first genes encoding proteins of known function to be mapped to a borrelial plasmid and the only example of genes encoding enzymes involved in the de novo purine biosynthesis pathway to be mapped to a plasmid in any organism. The unique plasmid location of these and perhaps other housekeeping genes may be a consequence of the segmented genomes in borreliae and reflect the need to adapt to both the arthropod and mammalian environments. PMID:7961392

Margolis, N; Hogan, D; Tilly, K; Rosa, P A



Mega Virus (United States)

The study of science at the extremes of size often involves creating and testing models of science phenomena. Scientists and engineers often build models at different sizes and scales. These models can be physical, such as a Styrofoam ball model of the so

Amy R. Taylor



Mega Microforms. (United States)

Explores the trends and current status of library use of microforms for the preservation and dissemination of research materials. A sampling of topics available on microform is provided, and a directory of the publishers mentioned is included. (CLB)

Bourke, Thomas A.



[Plasmid P85 from Azospirillum brasilense SP245: study of the circle of possible hosts and incompatibility with plasmids from Azospirillum brasilense SP7]. (United States)

The possibility of the stable inheritance of the plasmid p85 mobilized derivatives from Azospirillum brasilense Sp245 in the cells of the bacterial genera Rizobiaceae (Agrobacterium tumfaciens) and Pseudomonadaceae (Pseudomonas putida) has been shown. The plasmid p85 participates in coding for the physiologically active products (the plant hormones). It is not inherited by the Escherichia coli strains. For the first time the incompatibility of azospirillium plasmids has been demonstrated on the example of the plasmid p85 from Azospirillum brasilense Sp245 and the plasmid p115 from Azospirillum brasilense Sp7. PMID:1298886

Katsy, E I



The conjugative plasmid of a bean-nodulating Sinorhizobium fredii strain is assembled from sequences of two Rhizobium plasmids and the chromosome of a Sinorhizobium strain  

Directory of Open Access Journals (Sweden)

Full Text Available Abstract Background Bean-nodulating Rhizobium etli originated in Mesoamerica, while soybean-nodulating Sinorhizobium fredii evolved in East Asia. S. fredii strains, such as GR64, have been isolated from bean nodules in Spain, suggesting the occurrence of conjugative transfer events between introduced and native strains. In R. etli CFN42, transfer of the symbiotic plasmid (pRet42d requires cointegration with the endogenous self-transmissible plasmid pRet42a. Aiming at further understanding the generation of diversity among bean nodulating strains, we analyzed the plasmids of S. fredii GR64: pSfr64a and pSfr64b (symbiotic plasmid. Results The conjugative transfer of the plasmids of strain GR64 was analyzed. Plasmid pSfr64a was self-transmissible, and required for transfer of the symbiotic plasmid. We sequenced pSfr64a, finding 166 ORFs. pSfr64a showed three large segments of different evolutionary origins; the first one presented 38 ORFs that were highly similar to genes located on the chromosome of Sinorhizobium strain NGR234; the second one harbored 51 ORFs with highest similarity to genes from pRet42d, including the replication, but not the symbiosis genes. Accordingly, pSfr64a was incompatible with the R. etli CFN42 symbiotic plasmid, but did not contribute to symbiosis. The third segment contained 36 ORFs with highest similarity to genes localized on pRet42a, 20 of them involved in conjugative transfer. Plasmid pRet42a was unable to substitute pSfr64a for induction of pSym transfer, and its own transfer was significantly diminished in GR64 background. The symbiotic plasmid pSfr64b was found to differ from typical R. etli symbiotic plasmids. Conclusions S. fredii GR64 contains a chimeric transmissible plasmid, with segments from two R. etli plasmids and a S. fredii chromosome, and a symbiotic plasmid different from the one usually found in R. etli bv phaseoli. We infer that these plasmids originated through the transfer of a symbiotic-conjugative-plasmid cointegrate from R. etli to a S. fredii strain, and at least two recombination events among the R. etli plasmids and the S. fredii genome. As in R. etli CFN42, the S. fredii GR64 transmissible plasmid is required for the conjugative transfer of the symbiotic plasmid. In spite of the similarity in the conjugation related genes, the transfer process of these plasmids shows a host-specific behaviour.

Brom Susana



Cleaner in Hall of Residence (United States)

This syllabus is intended for the use of training personnel in drawing up training programs for cleaners in halls of residence. Its main objective is to produce fully trained cleaners, thereby maintaining and raising standards. The syllabus is divided into three sections: Introduction to Housekeeping Employees, and Tasks Performed by the Majority…

Hotel and Catering Industry Training Board, Wembley (England).


Teaching Medical Ethics during Residency. (United States)

Three reasons for teaching medical ethics during residency are presented. Key ethical concepts to be addressed include moral aspects of medical practice, obtaining informed consent, dealing with incompetent patients and those who refuse treatment, knowing when to withhold or disclose clinical information, and using medical resources properly. (MSE)

Perkins, Henry S.



Plasmid Mediated Streptomycin and Sulfonamide Resistance in Haemophilus parasuis  

Directory of Open Access Journals (Sweden)

Full Text Available Streptomycin and sulfonamide resistance in Haemophilus parasuis is an emerging phenomenon that has not yet been characterized from a molecular perspective. The aim of the present research was to determine the molecular mechanism of Haemophilus parasuis resistant to streptomycin and sulfonamide. One high level streptomycin and sulfonamide-resistant isolate from China was submitted for MIC determination and plasmid extract, then sequencing and annotation. One plasmid extracted from the bacteria strain, designated pHPS-A67 (4.2 kb, contain fifteen open reading frames including streptomycin resistance gene StrA, sulfonamide resistance gene Sul 2 and mobilization protein genes Mob A, Mob B and Mob C. This is believed to be the first report of native Haemophilus parasuis contains plasmid which mediated streptomycin and sulfonamide resistance in this microorganism.

Qigai He



A novel plasmid pEA68 of Erwinia amylovora and the description of a new family of plasmids. (United States)

Recent genome analysis of Erwinia amylovora, the causal agent of fire blight disease on Rosaceae, has shown that the chromosome is highly conserved among strains and that plasmids are the principal source of genomic diversity. A new circular plasmid, pEA68, was found in E. amylovora strain 692 (LMG 28361), isolated in Poland from Sorbus (mountain ash) with fire blight symptoms. Annotation of the 68,763-bp IncFIIa-type plasmid revealed that it contains 79 predicted CDS, among which two operons (tra, pil) are associated with mobility. The plasmid is maintained stably in E. amylovora and does not possess genes associated with antibiotic resistance or known virulence genes. Curing E. amylovora strain 692 of pEA68 did not influence its virulence in apple shoots nor amylovoran synthesis. Of 488 strains of E. amylovora from seventeen countries, pEA68 was only found in two additional strains from Belgium. Although the spread of pEA68 is currently limited to Europe, pEA68 comprises, together with pEA72 and pEA78 both found in North America, a new plasmid family that spans two continents. PMID:25178659

Ismail, Emadeldeen; Blom, Jochen; Bultreys, Alain; Ivanovi?, Milan; Obradovi?, Aleksa; van Doorn, Joop; Bergsma-Vlami, Maria; Maes, Martine; Willems, Anne; Duffy, Brion; Stockwell, Virginia O; Smits, Theo H M; Pu?awska, Joanna



Genetic characterization of plasmid pRJ5 of Staphylococcus aureus compared to plasmid pE194  

International Nuclear Information System (INIS)

The pRJ5, a naturally occurring constitutive macrolide, lincosamide and streptogramin B (MLS) resistance plasmid of Staphylococcus aureus, was compared to pE194, a plasmid that confers the inducible phenotype. pRJ5 was stable in all strains of S. aureus tested, even under growth at 43O C, which distinguished it from pE194 which was shown to be thermo-sensitive for replication. pRJ5, like pE194, was highly unstable in Bacillus subtilis when the cells were grown in nonselective conditions. Multimeric forms of pRJ5 DNA were detected in the few cells of B. subtilis that retained this plasmid. pE194 was transduced by phages ? 11 and ? 443 at frequencies 400 and 20-fold higher, respectively, than pRJ5. Both plasmids were co-transduced with the plasmid pRJ4. pRJ5 was shown to be compatible with pE194. Therefore they belong to distinct Inc groups. Hybridization studies revealed that pRJ5 shares a 1.35 kb region of homology to pE194, which is limited to the erm gene, conferring MLS resistance. (author)


Electroporation-facilitated delivery of plasmid DNA in skeletal muscle: plasmid dependence of muscle damage and effect of poloxamer 188. (United States)

Electroporation has been reported to facilitate naked DNA gene transfer in skeletal muscle, but has also been implicated in the pathogenesis of electrical injuries. To assess the effects of electroporation on gene transfer, mouse quadriceps muscles were injected with the luciferase reporter plasmid VR1255 and electroporated with caliper electrodes. Intramuscular luciferase expression was increased 10- to 70-fold by electroporation, depending on the DNA dose and injection volume used. In the absence of plasmid DNA injection, electroporation of quadriceps muscles resulted in rapid elevations in serum creatine phosphokinase activity, but did not elicit visible muscle damage. However, in muscles injected with plasmid DNA and electroporated, visible lesions consistently developed in the areas proximal to electrode placement when field strengths optimal for gene transfer (300 volts/cm) were applied. The development of muscle lesions was independent of plasmid transgene expression and required the presence of plasmid in the muscle during electroporation. Co-injection of poloxamer 188 (pluronic F68) with VR1255 substantially reduced elevations in serum creatine phosphokinase activity following electroporation, but did not inhibit the development of muscle lesions. In non-electroporated muscles, co-injection of poloxamer 188 increased luciferase expression threefold. Poloxamer 188 may thus constitute a useful excipient for intramuscular delivery of naked DNA. PMID:11708877

Hartikka, J; Sukhu, L; Buchner, C; Hazard, D; Bozoukova, V; Margalith, M; Nishioka, W K; Wheeler, C J; Manthorp, M; Sawdey, M



Currents, Water Budget and Turn-Over Time Within A Man-Made Coastal Mega-Structure: Palm Jumeirah, Southern Arabian Gulf, United Arab Emirates (United States)

Large-scale land reclamation projects along the coastline of Dubai, United Arab Emirates (UAE), are set to expand from 45 km of natural shoreline to more than 1,500 km by 2010. The increasing scale of coastal development in Dubai has large-scale effects on water movement throughout the project area. Palm Jumeirah is the oldest, most well-developed of several man-made coastal mega-constructions in Dubai. This construction project started 6 years ago, has an overall surface area of 7.9 km2 and a footprint of 23 km2, and is connected to the coast via a 5-km long spine from the mainland to the crescent tip. We made time series observations of hydrographic properties and currents within the Palm Jumeirah Lagoon (PJL) during 29 days in April/May 2008 to examine the current flows, water budget, salt transport, and turn-over time. The currents and water flow within the PJL were quite variable, with stronger currents, greater material transports, lower water temperatures, and slightly lower salinities in areas close to the entrances where flushing is ample. Due to the shallow water depths, we found only weak vertical stratification during a tidal cycle. The lagoon system is comprised of 18 blind channels surrounded by a semi-circular open channel, which in turn is linked to the coastal waters by 4 gaps (one each on the East and West sides and two at the base of the development) in the rocky breakwater that surrounds the development. We found substantial differences in water discharge between the east and west gaps, with high discharge on average exiting the east gap and extremely low water discharge exiting the west gap. Our results indicate that the PJL is flushed unequally between the east and west sides with residence times of 1.2 and 42 days for the east and west sides of the development, respectively. Previous studies of water residence time using the DELFT3D hydrodynamics simulation modeling software did not capture this difference accurately, estimating residence times for the two sides of PJL to be 14 and 28 days, respectively. Stratification remains absent during the spring-neap tidal cycle with well mixed conditions throughout the lagoon system. PJL tides are mixed mainly semidiurnal, with the spring and neap tidal ranges measuring 116 and 56 cm, respectively, with no measureable change in either amplitude or phase within the man-made lagoon.

Cavalcante, G.; Kjerfve, B.



The complete genome sequences of four new IncN plasmids from wastewater treatment plant effluent provide new insights into IncN plasmid diversity and evolution. (United States)

The dissemination of antibiotic resistance genes among bacteria often occurs by means of plasmids. Wastewater treatment plants (WWTP) were previously recognized as hot spots for the horizontal transfer of genetic material. One of the plasmid groups that is often associated with drug resistance is the incompatibility group IncN. The aim of this study was to gain insights into the diversity and evolutionary history of IncN plasmids by determining and comparing the complete genome sequences of the four novel multi-drug resistance plasmids pRSB201, pRSB203, pRSB205 and pRSB206 that were exogenously isolated from the final effluent of a municipal WWTP. Their sizes range between 42,875 bp and 56,488 bp and they share a common set of backbone modules that encode plasmid replication initiation, conjugative transfer, and plasmid maintenance and control. All plasmids are transferable at high rates between Escherichia coli strains, but did not show a broad host range. Different genes conferring resistances to ampicillin, streptomycin, spectinomycin, sulfonamides, tetracycline and trimethoprim were identified in accessory modules inserted in these plasmids. Comparative analysis of the four WWTP IncN plasmids and IncN plasmids deposited in the NCBI database enabled the definition of a core set of backbone genes for this group. Moreover, this approach revealed a close phylogenetic relationship between the IncN plasmids isolated from environmental and clinical samples. Phylogenetic analysis also suggests the existence of host-specific IncN plasmid subgroups. In conclusion, IncN plasmids likely contribute to the dissemination of resistance determinants between environmental bacteria and clinical strains. This is of particular importance since multi-drug resistance IncN plasmids have been previously identified in members of the Enterobacteriaceae that cause severe infections in humans. PMID:22326849

Eikmeyer, Felix; Hadiati, Atika; Szczepanowski, Rafael; Wibberg, Daniel; Schneiker-Bekel, Susanne; Rogers, Linda M; Brown, Celeste J; Top, Eva M; Pühler, Alfred; Schlüter, Andreas



Incorporating resident research into the dermatology residency program  


Richard F Wagner Jr, Sharon S Raimer, Brent C Kelly Department of Dermatology, The University of Texas Medical Branch, Galveston, Texas, USA Abstract: Programmatic changes for the dermatology residency program at The University of Texas Medical Branch were first introduced in 2005, with the faculty goal incorporating formal dermatology research projects into the 3-year postgraduate training period. This curriculum initially developed as a recommendation for voluntary scholarly project activit...

Rf, Wagner Jr; Ss, Raimer; Bc, Kelly



Evaluation of in Ovo Delivery System for Plasmid DNA Vaccination  


In ovo vaccination against Marek`s Disease Virus (MDV) is a common practice in more than 85% of broilers produced in the US. DNA vaccines represent a new tool to prevent infectious diseases in many species, including poultry. An in ovo delivery system for plasmid DNA vaccines is described in which we evaluate the route of delivery (air cell vs amniotic cavity), transfection reagent (IFA+DMSO vs polyethylenimine), dose of plasmid DNA (1 to 100 µg/egg) and the nature of humoral i...

Moura, L.; Liu, M.; Vakharia, V. N.



Plasmid Encoded Neurotoxin Genes in Clostridium botulinum Serotype A Subtypes  


Clostridium botulinum, an important pathogen of humans and animals, produces botulinum neurotoxin (BoNT), the most poisonous toxin known. We have determined by pulsed-field gel electrophoresis (PFGE) and Southern hybridizations that the genes encoding BoNTs in strains Loch Maree (subtype A3) and 657Ba (type B and subtype A4) are located on large (~280 kb) plasmids. This is the first demonstration of plasmid-borne neurotoxin genes in Clostridium botulinum serotypes A and B. The finding of BoNT...

Marshall, Kristin M.; Bradshaw, Marite; Pellett, Sabine; Johnson, Eric A.



Conjugative transfer of cadmium resistance plasmids in Rhodococcus fascians strains. (United States)

The presence of a 138-kilobase plasmid (pD188) correlated with increased resistance to cadmium in Rhodococcus fascians D188. This plasmid could be transferred by a conjugation-like system in matings between R. fascians strains. Transconjugants expressed the cadmium resistance and could be used as donors in subsequent matings. Four other R. fascians strains (NCPPB 1488, NCPPB 1675, NCPPB 2551, and ATCC 12974) could also be used as donors for cadmium resistance in matings. Strain NCPPB 1675 showed a 100% cotransfer of cadmium and chloramphenicol resistance markers. PMID:3162908

Desomer, J; Dhaese, P; Van Montagu, M



Plasmid-Determined Copper Resistance in Pseudomonas syringae from Impatiens  


A strain of Pseudomonas syringae was recently identified as the cause of a new foliar blight of impatiens. The bacterium was resistant to copper compounds, which are used on a variety of crops for bacterial and fungal disease control. The bacterium contained a single 47-kilobase plasmid (pPSI1) that showed homology to a copper resistance operon previously cloned and characterized from P. syringae pv. tomato plasmid pPT23D (D. Cooksey, Appl. Environ. Microbiol. 53:454-456, 1987). pPSI1 was tra...

Cooksey, Donald A.



Functional analysis of three plasmids from Lactobacillus plantarum  


Lactobacillus plantarum WCFS1 harbors three plasmids, pWCFS101, pWCFS102, and pWCFS103, with sizes of 1,917, 2,365, and 36,069 bp, respectively. The two smaller plasmids are of unknown function and contain replication genes that are likely to function via the rolling-circle replication mechanism. The host range of the pWCFS101 replicon includes Lactobacillus species and Lactococcus lactis, while that of the pWCFS102 replicon also includes Carnobacterium maltaromaticum and Bacillus subtilis. T...

Kranenburg, R.; Golic, N.; Bongers, R.; Leer, R. J.; Vos, W. M.; Siezen, R. J.; Kleerebezem, M.



Stability of Integrated Plasmids in the Chromosome of Lactococcus lactis  


Derivatives of plasmids pBR322, pUB110, pSC101, and pTB19, all containing an identical fragment of lactococcal chromosomal DNA, were integrated via a Campbell-like mechanism into the same chromosomal site of Lactococcus lactis MG1363, and the transformants were analyzed for the stability of the integrated plasmids. In all cases the erythromycin resistance gene of pE194 was used as a selectable marker. Transformants obtained by integration of the pBR322 derivatives contained a head-to-tail arr...

Leenhouts, Kees J.; Kok, Jan; Venema, Gerard



Association of lupin mitochondrial plasmid DNA with mitochondrial protein  

International Nuclear Information System (INIS)

Lupinus albus mitochondrial plasmids and Lupinus mitochondrial and total proteins have been used for studying the formation of complexes by gel retardation and UV crosslinking assays. All the results suggest formation of a specific complex between mitochondrial plasmids and proteins. Lupinus albus mitochondrial proteins recovered from the complex and resolved by two-dimensional gel electrophoresis (2-D SDS-PAGE) displayed a pI of about 5.6 and 5.8 and a molecular weight of 30 and 31 kDa. (author)


Pathology Residency Training in Turkey from the Residents' Point of View: A Survey Study  


Objective: Recent insights that have emerged in local meetings with participation of pathology residents are promising as regards achieving progress in pathology residency training. Accordingly, in this study, overall pathology residency training in Turkey is discussed in detail from the pathology residents' point of view; current data and suggestions for the solutions of problems are presented.Material and Method: Two questionnaires were applied to resident representatives and overall reside...

Ko?semehmetog?lu, Kemal; Tan, Ayc?a; Esen, Tug?c?e; Eren Ates?, K?v?lc?m



Transcriptional Profiling of Human Epithelial Cells Infected with Plasmid-Bearing and Plasmid-Deficient Chlamydia trachomatis. (United States)

Chlamydia trachomatis is an obligate intracellular epitheliotropic bacterial pathogen of humans. Infection of the eye can result in trachoma, the leading cause of preventable blindness in the world. The pathophysiology of blinding trachoma is driven by multiple episodes of reinfection of conjunctival epithelial cells, producing an intense chronic inflammatory response resulting in submucosal tissue remodeling and scarring. Recent reports have shown that infection with trachoma organisms lacking the cryptic chlamydial plasmid is highly attenuated in macaque eyes, a relevant experimental model of human trachoma infection. To better understand the molecular basis of plasmid-mediated infection attenuation and the potential modulation of host immunity, we conducted transcriptional profiling of human epithelial cells infected with C. trachomatis plasmid-bearing (A2497) and plasmid-deficient (A2497P(-)) organisms. Infection of human epithelial cells with either strain increased the expression of host genes coding for proinflammatory (granulocyte-macrophage colony-stimulating factor [GM-CSF], macrophage colony-stimulating factor [MCSF], interleukin-6 [IL-6], IL-8, IL-1?, CXCL1, CXCL2, CXCL3, intercellular adhesion molecule 1 [ICAM1]), chemoattraction (CCL20, CCL5, CXCL10), immune suppression (PD-L1, NFKB1B, TNFAIP3, CGB), apoptosis (CASP9, FAS, IL-24), and cell growth and fibrosis (EGR1 and IL-20) proteins. Statistically significant increases in the levels of expression of many of these genes were found in A2497-infected cells compared to the levels of expression in A2497P(-)-infected cells. Our findings suggest that the chlamydial plasmid plays a focal role in the host cell inflammatory response to infection and immune avoidance. These results provide new insights into the role of the chlamydial plasmid as a chlamydial virulence factor and its contributions to trachoma pathogenesis. PMID:25404022

Porcella, Stephen F; Carlson, John H; Sturdevant, Daniel E; Sturdevant, Gail L; Kanakabandi, Kishore; Virtaneva, Kimmo; Wilder, Hannah; Whitmire, William M; Song, Lihua; Caldwell, Harlan D



Transient residence and exposure times  

Directory of Open Access Journals (Sweden)

Full Text Available The residence time measures the time spent by a water parcel or a pollutant in a given water body and is therefore widely used in environmental studies. The adjoint method introduced by Delhez et al. (Estuarine Coastal and Shelf Sciences, 2004 to compute this diagnostic is revised here to take into account the effect of the initialisation and of the boundary conditions. In addition to the equation for the mean residence time, it is suggested to solve a simple advection-diffusion problem to quantify the effect of the initialisation and clarify the interpretation of the results. Using the two same equations but with modified boundary conditions, the method can also be used to quantify the accumulated time spent by water/tracer parcels in a control domain. This diagnostic is called "exposure time".

E. J. M. Delhez



Possible involvement of a plasmid in arginine auxotrophic mutation of Streptomyces kasugaensis.  


Streptomyces kasugaensis gave arginine auxotrophic mutants at high frequency, The coupled loss and reappearance of plasmid deoxyribonucleic acid with arginine auxotrophy suggested that the insertion of the plasmid into chromosomal deoxyribonucleic acid caused the arginine auxotrophy.

Nakano, M. M.; Ozawa, K.; Ogawara, H.



Lack of Chemotactic Response to Tricarboxylic Acids by Escherichia coli Carrying a Plasmid Determining Citrate Utilization  


Salmonella typhimurium but not citrate-utilizing Escherichia coli carrying the Cit plasmid showed positive chemotaxis to tricarboxylic acids, indicating that the Cit plasmid encodes a transport system but not a chemoreceptor for citrate.

Ishigura, Naotaka; Sato, Gihei; Yoshikawa, Masanosuke



megaTALs: a rare-cleaving nuclease architecture for therapeutic genome engineering. (United States)

Rare-cleaving endonucleases have emerged as important tools for making targeted genome modifications. While multiple platforms are now available to generate reagents for research applications, each existing platform has significant limitations in one or more of three key properties necessary for therapeutic application: efficiency of cleavage at the desired target site, specificity of cleavage (i.e. rate of cleavage at 'off-target' sites), and efficient/facile means for delivery to desired target cells. Here, we describe the development of a single-chain rare-cleaving nuclease architecture, which we designate 'megaTAL', in which the DNA binding region of a transcription activator-like (TAL) effector is used to 'address' a site-specific meganuclease adjacent to a single desired genomic target site. This architecture allows the generation of extremely active and hyper-specific compact nucleases that are compatible with all current viral and nonviral cell delivery methods. PMID:24285304

Boissel, Sandrine; Jarjour, Jordan; Astrakhan, Alexander; Adey, Andrew; Gouble, Agnès; Duchateau, Philippe; Shendure, Jay; Stoddard, Barry L; Certo, Michael T; Baker, David; Scharenberg, Andrew M



Overview of the ARGOS X-ray framing camera for Laser MegaJoule. (United States)

Commissariat à l'Énergie Atomique et aux Énergies Alternatives has developed the ARGOS X-ray framing camera to perform two-dimensional, high-timing resolution imaging of an imploding target on the French high-power laser facility Laser MegaJoule. The main features of this camera are: a microchannel plate gated X-ray detector, a spring-loaded CCD camera that maintains proximity focus in any orientation, and electronics packages that provide remotely-selectable high-voltages to modify the exposure-time of the camera. These components are integrated into an "air-box" that protects them from the harsh environmental conditions. A miniaturized X-ray generator is also part of the device for in situ self-testing purposes. PMID:25430196

Trosseille, C; Aubert, D; Auger, L; Bazzoli, S; Beck, T; Brunel, P; Burillo, M; Chollet, C; Gazave, J; Jasmin, S; Maruenda, P; Moreau, I; Oudot, G; Raimbourg, J; Soullié, G; Stemmler, P; Zuber, C



Direct-drive shock-ignition for the Laser MegaJoule  

International Nuclear Information System (INIS)

We present a review of direct-drive shock ignition studies done as an alternative for the Laser MegaJoule (LMJ). One and two dimensional systematic analyses of HiPER-like shock-ignited target designs are performed for the fuel assembly irradiation uniformity using the whole LMJ configuration or a part of the facility, and for the uniformity of the ignitor spike. High-gain shock-ignition is shown to be possible with intensity of each quad less than 1015 W/cm2 but low modes asymmetries displace the power required in the ignitor spike towards higher powers. Shock-ignition of Direct-Drive Double-Shell non-cryogenic targets is also addressed. (authors)


MEGA: An experiment to search for ? ? e? at the level of 10-13  

International Nuclear Information System (INIS)

This report describes the status of the MEGA experiment, which is a search for the decay ? ? e? with a branching ratio sensitivity of approximately 10-13. The observation of this decay would contradict the empirically established rule of lepton family number conservation and would indicate the existence of physics outside the standard model of electroweak interactions. The experimental design employs highly modular, fast detectors, state-of-the-art electronics, and a staged trigger with online filters. The detectors are contained in a 15 kG solenoidal field produced by a superconducting magnet. Positrons are confined to the central region and are measured by a set of thin MWPCs. Photons are measured by one of four layers of pair spectrometers in the outer region. Most aspects of the detector design have been validated in engineering runs; data taking will begin in 1990 with the electron arm and one pair spectrometer layer installed. 9 refs., 1 fig


Calculation of prompt doses induced by fusion experiments in Laser MegaJoule facility  

International Nuclear Information System (INIS)

The Laser MegaJoule (LMJ), built at CEA/CESTA near Bordeaux, France, will conduct research in the field of plasma physics and inertial confinement fusion. Some of these experiments are designed to produce during less than one nanosecond up to 1019 neutrons at 14 MeV in indirect drive mode. The 300 m long building that hosts both laser sources and target chamber was designed to confine neutron and gamma fluxes in the experiment hall during a shot. Monte Carlo simulations were performed using a TRIPOLI 4 modelling of the facility to ensure that prompt doses in occupied areas inside the facility that host employees during a shot will be sufficiently low. Although significant radiation levels inside the experiment hall, prompt doses in occupied rooms are limited to a few ?Sv per shot which is fully compatible with radiation level limits.


High-power optical coatings for a mega-joule class ICF laser  

International Nuclear Information System (INIS)

As a consequence of advancements in Inertial Confinement Fusion research, LLNL is developing plans for a new 1.5 to 2 mega-joule solid-state Nd:glass laser designed to achieve fusion ignition. The new design is possible in part due to advances in optical coatings suitable for high power laser systems. High damage threshold mirrors and polarizers are comprised of electron beam deposited dielectric multilayers. Subthreshold illumination, or laser conditioning, of the multilayer coatings results in an increase in the damage thresholds by factors of 2 to 3 at 1.06?m, thus meeting the fluence requirements of the advanced architecture. For anti-reflective coatings, protective organic coatings for non-linear crystals and phase plates for beam smoothing, sol-gel films provide high damage thresholds coatings at low cost


Overview of the ARGOS X-ray framing camera for Laser MegaJoule  

Energy Technology Data Exchange (ETDEWEB)

Commissariat à l’Énergie Atomique et aux Énergies Alternatives has developed the ARGOS X-ray framing camera to perform two-dimensional, high-timing resolution imaging of an imploding target on the French high-power laser facility Laser MegaJoule. The main features of this camera are: a microchannel plate gated X-ray detector, a spring-loaded CCD camera that maintains proximity focus in any orientation, and electronics packages that provide remotely-selectable high-voltages to modify the exposure-time of the camera. These components are integrated into an “air-box” that protects them from the harsh environmental conditions. A miniaturized X-ray generator is also part of the device for in situ self-testing purposes.

Trosseille, C., E-mail:; Aubert, D.; Auger, L.; Bazzoli, S.; Brunel, P.; Burillo, M.; Chollet, C.; Jasmin, S.; Maruenda, P.; Moreau, I.; Oudot, G.; Raimbourg, J.; Soullié, G.; Stemmler, P.; Zuber, C. [CEA, DAM, DIF, F-91297 Arpajon (France); Beck, T. [CEA, DEN, CADARACHE, F-13108 St Paul lez Durance (France); Gazave, J. [CEA, DAM, CESTA, F-33116 Le Barp (France)



Narrow linewidth picosecond pulsed laser with mega-watt peak power at UV wavelength  

Energy Technology Data Exchange (ETDEWEB)

We demonstrate a master oscillator power amplifier (MOPA) burst mode laser system to generate 66 ps/402.5 MHz pulses with mega-watt peak power at 355 nm. The seed laser is based on a direct electro-optic modulation of a fiber laser output. A very high extinction ratio (45 dB) has been achieved by using an adaptive bias control. The multi-stage Nd:YAG amplifier system allows a uniformly temporal shaping of macropulses with tunable pulse duration. The light output form the amplifier is converted to 355 nm and over 1 MW UV peak power is obtained when the laser is operating in a 5- s/10-Hz macropulse mode. The laser output has a transform limited spectrum bandwidth with a very narrow linewidth of individual laser mode. The immediate application of the laser system is the laser assisted hydrogen ion beam stripping for the Spallation Neutron Source (SNS).

Liu, Yun [ORNL; Huang, Chunning [ORNL; Deibele, Craig Edmond [ORNL



X-ray calibration facility for plasma diagnostics of the MegaJoule laser  

International Nuclear Information System (INIS)

The Laser MegaJoule (LMJ) located at CEA-CESTA will be equipped with x-ray plasma diagnostics using different kinds of x-ray components such as filters, mirrors, crystals, detectors and cameras. To guarantee LMJ measurements, detectors such as x-ray cameras need to be regularly calibrated. An x-ray laboratory is devoted to this task and performs absolute x-ray calibrations for similar x-ray cameras running on Laser Integration Line (LIL). This paper presents the x-ray calibration bench with its x-ray tube based High Energy x-ray Source (HEXS) and some calibration results. By mean of an ingenious transposition system under vacuum absolute x-ray calibration of x-ray cameras, like streak and stripline ones, can be carried out. Coupled to a new collimation system with micrometric accuracy on aperture sensitivity quantum efficiency measurements can be achieved with reduced uncertainties. (authors)


The first light of Mini-MegaTORTORA wide-field monitoring system  

CERN Document Server

Here we describe the first light of the novel 9-channel wide-field optical monitoring system with sub-second temporal resolution, Mini-MegaTORTORA, which is being tested now at Special Astrophysical Observatory on Russian Caucasus. The system is able to observe the sky simultaneously in either wide (~900 square degrees) or narrow (~100 square degrees) fields of view, either in clear light or with any combination of color (Johnson B, V or R) polarimetric filters installed, with exposure times ranging from 100 ms to 100 s. The primary goal of the system is the detection of rapid -- with sub-second characteristic time-scales -- optical transients, but it may be also used for studying the variability of the sky objects on longer time scales.

Biryukov, A; Karpov, S; Bondar, S; Ivanov, E; Katkova, E; Perkov, A; Sasyuk, V



Leading by Metaphors –A Case Study of a Mega IT Project in a Danish Bank  

DEFF Research Database (Denmark)

Contrary to the existing literature and studies of large-scale IT projects, empirical data from a mega IT project in mid-sized Danish Bank, Jyske Bank, demonstrates a successful implementation of a highly complex IT platform transition. Linguistic representations and especially extensive use of metaphors by executive management to form and shape the megaproject appeared to have significant impact on guidance of individual and collective action, and thereby presumably one of the important factors for the successful implementation. To learn from this case study, we investigate the use of metaphors in the megaproject and discuss how leading by metaphors are enacted. Our findings are that (1) storytelling with metaphors can act as backbone for communication, (2) metaphors can set direction for technical capabilities, and finally (3) metaphors can be used to emphasize emotional intelligence.

Svejvig, Per; Fladkjær Nielsen, Anne-Dorte



La Organización Mundial de Comercio, los acuerdos mega-regionales y los usos estratégicos del regionalismo  

Directory of Open Access Journals (Sweden)

Full Text Available La parálisis de la Ronda Doha, el desarrollo de grandes negociaciones “mega-regionales” y la proliferación de acuerdos preferenciales han avivado los debates sobre la gobernanza del comercio internacional. Mientras que una interpretación benévola sobre estos acuerdos parece estar ganando lugar, en este artículo sostenemos que los atributos del “regionalismo del siglo XXI” son menos novedosos que lo que se insinúa; y que existe una notable continuidad en los incentivos y las características del “nuevo regionalismo” de los noventa y el llamado “regionalismo del siglo XXI”. Afirmamos que aun cuando los componentes discriminatorios de estos regionalismos hayan sido atenuados por el contenido y naturaleza de la agenda regulatoria, el conflicto básico entre las dos modalidades de gobernanza del régimen de comercio internacional sigue vigente.

Roberto Bouzas



[Cavum vergae, cyst of cavum septi pellucidi, mega cisterna magna, and general fibrosis syndrome]. (United States)

One family of 17 cases of general fibrosis syndrome was reported. Four out of five patients examined with CT and/or MRI revealed cavum vergae or cyst of the cavum septi pellucidi or mega cisterna magna, which were characterized by existing on the midline of the brain. The patient with cavum vergae had also platybasia. In one patient, surgical correction of vertical deviation and blepharoptosis of both eyes was performed. There was abnormal insertion of the superior and inferior rectus muscles in posterior and nasal direction, and adhesion of the superior oblique muscle to the superior rectus muscle at the point of it's insertion was found in both eyes. Histopathological findings of the extraocular muscles of two patients showed mixture of relatively normal muscle tissues and vast amounts of collagen fibers. Electron microscopically many glycogen granules were found in muscle fibers. From these findings, this syndrome may be based on failure in development and differentiation. PMID:2220498

Nakajima, T; Namishima, S; Takahashi, K; Aonuma, H; Nitta, C; Abe, Y



Modeling gas migration experiments in repository host rocks for the MEGAS project  

International Nuclear Information System (INIS)

In response to concerns over the possibility of hydrogen gas generation within an underground repository for high-level radioactive waste, and its implications for repository safety, a joint European research study (MEGAS) is underway. Its aims are to understand and characterize the behavior of gas migration within an argillacious, host-rock. Laboratory experiments are being carried out by SCK/CEN, BGS and ISMES. SCK/CEN are also conducting in situ experiments at the underground laboratory at Mol, Belgium. Modeling of gas migration is being done in parallel with the experiments, by Intera Information Technologies. A two-phase flow code, TOPAZ, has been developed specifically for this work. In this paper the authors report on the results of some preliminary calculations performed with TOPAZ, in advance of the in situ experiments


Mega Borg oil spill of the Texas coast: An open-water bioremediation test  

International Nuclear Information System (INIS)

Nature has developed hydrocarbons as a part of life. Since the origin of life, more than 60,000 organic molecules have evolved that make up protoplasm; a given percentage of these molecules are hydrocarbons. Commercial hydrocarbon deposits are a by-product of this natural process and a continual source of oil in the aquatic environment through seeps. As a result, nature has also evolved a recycling system for the hydrocarbons. This cycle is the basis for a program of bioremediation using microorganisms. Effort has been made to develop mixed cultures capable of a wide range of hydrocarbon metabolism and co-metabolism. The cultures are economically produced in high concentrations as a dry powder with a shelf life of one year. The result is an economical process for the application of bacteria to hydrocarbon pollutants on water and soils. The process of bioremediation to the recent Mega Borg accident will be discussed


Mega debris flow deposits on the western Wilkes Land margin, East Antarctica (United States)

Multichannel seismic data collected off Western Wilkes Land (East Antarctica) reveal the occurrence of mega debris flow deposits on the lower slope and rise that were formed throughout the Miocene. Commonly, debris flow units are separated by thin deposits of well-stratified facies, interpreted as predominantly glaciomarine mixed contouritic and distal turbidite deposits. These units could act as weak layers and could have played a major role in the slope instability. High sedimentation rates, due to large amounts of sediment delivered from a temperate, wet-based ice sheet, constituted a key factor in the sediment failures. The main trigger mechanism would probably have been earthquakes enhanced by isostatic rebound following major ice sheet retreats.

Donda, F.; O'Brien, P.E.; De Santis, L.; Rebesco, M.; Brancolini, Giuliano



42 CFR 483.10 - Resident rights. (United States)

...moisturizing lotion, tissues, cotton balls, cotton swabs, deodorant, incontinence...advocates, and be afforded the opportunity to contact these agencies. (h) Work. The resident...resident's legal representative, and consistent with State law. (k)...



Aerosol chemical characteristics of a mega-city in Southeast Asia (Dhaka-Bangladesh) (United States)

Elemental carbon (EC), organic carbon (OC), organic acids, major inorganic ions and trace elements were determined in aerosol samples collected under pre-monsoon conditions (March-April 2001) in Dhaka (Bangladesh). Using the Fe content of the aerosol to reconstruct the aerosol mass from soil-type mineralic material, a mass balance of the Dhaka aerosol was achieved. From this follows that on the average around 76% of the aerosol is from soil-type material, around 18% of carbonaceous material, and around 6% soluble ions and trace elements (without iron) Dhaka aerosol, while As appears to be of geogenic origin. Organic acids contributed only 0.72% C to OC and were much less abundant relative to OC than at European sites. The trace elements levels in Dhaka were much lower than at comparable Southeast Asian mega-cities (e.g. Lahore, Pakistan), but considerably higher than reported for European and US cities under present day conditions. The correlation between EC and OC was quite high ( R2=0.81) indicating a potential joint source of emission for carbonaceous aerosols. The EC/total carbon (TC) and K/EC ratios indicated that biomass combustion was not a main contributor to EC in Dhaka, which implicates that fossil fuel combustion is the major contributor to EC levels in the Dhaka aerosol. The differences in the EC/TC and K/EC ratios in the three mega-cities in Southeast Asia (data available from Dhaka, Bangladesh; Lahore, Pakistan; and Mumbai, India) indicate that the aerosol source mix in Southeast Asian cities varies considerably at a national or even regional scale.

Salam, Abdus; Bauer, Heidi; Kassin, Karin; Mohammad Ullah, Shah; Puxbaum, Hans


Sustainable Housing, Population Growth and Poverty: The Implications on Lagos Mega City  

Directory of Open Access Journals (Sweden)

Full Text Available When people affected by poverty are unable to lead a decent life, there is no doubt that there will be a decay of the city. And when there are inadequate and unfit housing, the condition of the environment often result to slums and ghettos, there will be the disaster of homelessness, unplanned and sprawl nature of city growth. The magic year had the consolation slogan of “housing for all by the year 2000” but this has since changed to the hard fact of “ what Nigerians failed to realize is that housing is a thing that every family would need to provide for itself.” The era of subsidy is gone and this reality has raised a lot of pertinent questions especially on where lies the hope for the poor in a mega city? The phenomenal growth of our towns and cities has given rise to conurbation and metropolitan areas, with various planning problems such as traffic congestion, slum, shanty towns, waste management, housing, pollution, poverty and several others. There is no doubt that the impact of rapid population growth on housing development in a developing economy is usually a consequence of the push of the rural areas and the pull of the town. There is always an upsurge and conglomeration of people in city centres with the resultant effects on housing growth arising from acute unemployment. This growth and physical expansion of cities have been accompanied by unplanned urban sprawl, environmental pollution, deterioration, deficiencies in modern basic facilities, and general urban decay. As increased poverty and urbanization exert more pressures on urban facilities, most Nigerian cities tend to have lost their original dignity, social cohesion and administrative efficiency.This paper therefore revealed the consequences of the problems of urbanization in Lagos, it focuses on the spatial growth and the rapid rate of development in Metropolitan Lagos in order to show the significance and the role of public-private-partnership in the Mega City. 

Ola E. Aluko



Interspecies transduction of plasmids among Bacillus anthracis, B. cereus, and B. thuringiensis.  


Bacteriophage CP-51, a generalized transducing phage for Bacillus anthracis, B. cereus, and B. thuringiensis, mediates transduction of plasmid DNA. B. cereus GP7 harbors the 2.8-megadalton multicopy tetracycline resistance plasmid, pBC16. B. thuringiensis 4D11A carries pC194, the 1.8-megadalton multicopy chloramphenicol resistance plasmid. When phage CP-51 was propagated on these strains, it transferred the plasmid-encoded antibiotic resistances to the nonvirulent Weybridge (Sterne) strain of...

Ruhfel, R. E.; Robillard, N. J.; Thorne, C. B.



Stability in Escherichia coli of an antibiotic resistance plasmid from Bacteroides fragilis.  


A Bacteroides fragilis strain resistant to penicillin G, tetracycline, and clindamycin was screened for the presence of plasmid deoxyribonucleic acid (DNA). Agarose gel electrophoresis of ethanol-precipitated DNA from cleared lysates of this strain revealed two plasmid DNA bands. The molecular weights of the plasmids were estimated by their relative mobility in agarose gel and compared with standard plasmids with known molecular weights. The molecular weights were 3.40 +/- 0.20 x 10(6) and 1....

Rashtchian, A.; Booth, S. J.



Survey of plasmids and resistance factors in Campylobacter jejuni and Campylobacter coli.  


A total of 688 isolates of Campylobacter jejuni and Campylobacter coli were screened for the presence of plasmid DNA by agarose gel electrophoresis and were tested for susceptibility to ampicillin, chloramphenicol, erythromycin, streptomycin, and tetracycline. Of the isolates examined, 32% were noted to harbor plasmid DNA, ranging in size from 2.0 to 162 kilobases. Only tetracycline resistance was noted to correlate with the presence of plasmids. Plasmids capable of transferring tetracycline ...

Tenover, F. C.; Williams, S.; Gordon, K. P.; Nolan, C.; Plorde, J. J.



Attempts to find phenotypic markers of the virulence plasmid of Rhodococcus equi.  


Four isolates of Rhodococcus equi, from pneumonic foals, and containing the 85 kb virulence plasmid, a porcine isolate containing an 80 kb plasmid, and their plasmid cured derivatives, were examined for 239 phenotypic properties in an attempt to find characters other than the virulence-associated protein (VapA) which might be encoded by the virulence plasmid in organisms grown at 37 degrees C. Tests chosen included those which have previously given variable results for R. equi isolates, since...

La Pen?a-moctezuma, A.; Prescott, J. F.; Goodfellow, M.



The Salmonella virulence plasmid enhances Salmonella-induced lysis of macrophages and influences inflammatory responses.  


The Salmonella dublin virulence plasmid mediates systemic infection in mice and cattle. Here, we analyze the interaction between wild-type and plasmid-cured Salmonella strains with phagocytes in vitro and in vivo. The intracellular recovery of S. dublin from murine peritoneal and bovine alveolar macrophages cultured in the presence of gentamicin in vitro was not related to virulence plasmid carriage. However, the virulence plasmid increased the lytic activity of S. dublin, Salmonella typhimur...

Guilloteau, L. A.; Wallis, T. S.; Gautier, A. V.; Macintyre, S.; Platt, D. J.; Lax, A. J.



Identification of multiple plasmids released from recombinant genomes of Hansenula polymorpha by transformation of Escherichia coli.  


Total DNAs isolated from two Hansenula polymorpha (Pichia angusta) strains having chromosomal single or tandem multiple integrations of a pUC18-derived expression plasmid produced Escherichia coli transformants which contained plasmids of different size and/or organization than that of the expression plasmid. Evidence that plasmid-like structures are formed in H. polymorpha and that their formation is stimulated by DNA damage is presented in this study.

Graupner, S.; Wackernagel, W.



Plasmid instability in regenerating protoplasts of Staphylococcus aureus is caused by aberrant cell division.  


Elimination of plasmids from regenerating S. aureus protoplasts occurred when the regeneration medium contained sucrose but not when it contained sodium succinate. This difference was caused by the occurrence of cell division prior to regeneration of the cell wall on sucrose but not on succinate. Coexisting compatible plasmids were cured independently; coexisting incompatible plasmids were cured jointly. These results support the hypothesis that plasmid pools exist as physically sequestered u...

Gruss, A.; Novick, R.



Presence of Lactose Genes and Insertion Sequences in Plasmids of Minor Species of the Genus Lactococcus  


The type strains of all known species and biovars of the Lactococcus genus were tested for the presence of plasmids, lactose genes, and insertion sequences cloned from the lactose plasmid of Lactococcus lactis subsp. lactis. Only the biovar xylosus of this subspecies is plasmid free. The lactose plasmid is present only in lactose-positive strains except in Lactococcus plantarum. The distribution of insertion sequences varies within the type strains of the Lactococcus genus.

Bounaix, S.; Benachour, A.; Novel, G.



Predicting residents' performance: A prospective study  


Abstract Background Objective criteria for predicting residents' performance do not exist. The purpose of this study was to test the hypothesis that global assessment by an intern selection committee (ISC) would correlate with the future performance of residents. Methods A prospective study of 277 residents between 1992 and 1999. Global assessment at the time of interview was compared to subsequent clinical (assessed by chief residents) and cognitive performance...

Ozuah Philip O



Plasmid-determined copper resistance in Pseudomonas syringae from impatiens  

Energy Technology Data Exchange (ETDEWEB)

A strain of Pseudomonas syringae was recently identified as the cause of a new foliar blight of impatiens. The bacterium was resistant to copper compounds, which are used on a variety of crops for bacterial and fungal disease control. The bacterium contained a single 47-kilobase plasmid (pPSI1) that showed homology to a copper resistance operon previously cloned and characterized from P. syringae pv. tomato plasmid pPT23D (D. Cooksey, Appl. Environ. Microbiol. 53:454-456, 1987). pPSI1 was transformed by electroporation into a copper-sensitive P. syringae strain, and the resulting transformants were copper resistant. A physical map of pPSI1 was constructed, and the extent of homology to pPT23D outside the copper resistance operon was determined in Southern hybridizations. The two plasmids shared approximately 20 kilobases of homologous DNA, with the remainder of each plasmid showing no detectable homology. The homologous regions hybridized strongly, but there was little or no conservation of restriction enzyme recognition sites.

Cooksey, D.A. (Univ. of California, Riverside (USA))



R-plasmid transfer in a wastewater treatment plant.  


Enteric bacteria have been examined for their ability to transfer antibiotic resistance in a wastewater treatment plant. Resistant Salmonella enteritidis, Proteus mirabilis, and Escherichia coli were isolated from clinical specimens and primary sewage effluent. Resistance to ampicillin, chloramphenicol, streptomycin, sulfadiazine, and tetracycline was demonstrated by spread plate and tube dilution techniques. Plasmid mediation of resistance was shown by ethidium bromide curing, agarose gel el...

Mach, P. A.; Grimes, D. J.



Magnetic Nanoparticles for Plasmid DNA Adsorption via Hydrophobic Interaction  


This study aims the preparation of magnetic poly(2-hydroxyethylmethacrylate-N-methacryloyl-Lphenylalanine), [poly(HEMA-MAPA)] nanoparticles for plasmid DNA separation on the basis of hydrophobic interactions. Magnetic nanoparticles will be produced emulsion polymerization of 2- hydroxyethylmethacrylate (HEMA) and N-methacryloyl-L-phenylalanine (MAPA) monomers. Nanosized particles including hydrophobic groups stemmed from polymerizable derivative of phenylalanine aminoacid were ...

Gungunes H.; Uzek R.; Uzun L.; Ozkara S.; ?enel S.; Denizli A.



Plasmid transformation of Weissella paramesenteroides DX by electroporation. (United States)

The present investigation sought to provide a reliable and highly efficient electrotransformation method for the lactic acid bacterium Weissella paramesenteroides DX. Experiments were carried out with the shuttle vectors pVS44 (2910 bps), pTRKH3 (7766 bps) and its derivative pTRKH3-1 (4855 bps). Several parameters, including the concentration of transforming plasmid DNA, plasmid size, electric field strength, age of the culture, cell density, and the pretreatment of cells with dl-threonine, lysozyme, and combined treatment with lithium acetate and dithiothreitol, were investigated and proved to influence the efficiency of transformation. Electrocompetence was found to peak in the early stationary phase (OD600 1.2). Other optimized conditions included: the concentration of 10 ?g/ml transforming DNA, the cell density of 10(10) cells/ml, a high-density electric field pulse of 2.5 kV, 25 ?F and 200 ?, pretreatment of cells with 40 mM dl-threonine and 2000 U/ml lysozyme, and yielded 3.5×10(4) transformants/?g DNA for pVS44 while 1.2×10(4) transformants/?g DNA for the large plasmid TRKH3. Compared to previously reported data, the obtained transformation efficiencies provided an 8.75-fold increase for pVS44 and ensured plasmid stability for 120 generations in non-selective medium. PMID:25199701

Papagianni, Maria; Papamichael, Emmanuel M



Plasmid Transfer via Transduction from Streptococcus thermophilus to Lactococcus lactis?  


Using Streptococcus thermophilus phages, plasmid transduction in Lactococcus lactis was demonstrated. The transduction frequencies were 4 orders of magnitude lower in L. lactis than in S. thermophilus. These results are the first evidence that there is phage-mediated direct transfer of DNA from S. thermophilus to L. lactis. The implications of these results for phage evolution are discussed.

Ammann, Andreas; Neve, Horst; Geis, Arnold; Heller, Knut J.



Structural Organization of Virulence-Associated Plasmids of Yersinia pestis (United States)

The complete nucleotide sequence and gene organization of the three virulence plasmids from Yersinia pestis KIM5 were determined. Plasmid pPCP1 (9,610 bp) has a GC content of 45.3% and encodes two previously known virulence factors, an associated protein, and a single copy of IS100. Plasmid pCD1 (70,504 bp) has a GC content of 44.8%. It is known to encode a number of essential virulence determinants, regulatory functions, and a multiprotein secretory system comprising the low-calcium response stimulation that is shared with the other two Yersinia species pathogenic for humans (Y. pseudotuberculosis and Y. enterocolitica). A new pseudogene, which occurs as an intact gene in the Y. enterocolitica and Y. pseudotuberculosis-derived analogues, was found in pCD1. It corresponds to that encoding the lipoprotein YlpA. Several intact and partial insertion sequences and/or transposons were also found in pCD1, as well as six putative structural genes with high homology to proteins of unknown function in other yersiniae. The sequences of the genes involved in the replication of pCD1 are highly homologous to those of the cognate plasmids in Y. pseudotuberculosis and Y. enterocolitica, but their localization within the plasmid differs markedly from those of the latter. Plasmid pMT1 (100,984 bp) has a GC content of 50.2%. It possesses two copies of IS100, which are located 25 kb apart and in opposite orientations. Adjacent to one of these IS100 inserts is a partial copy of IS285. A single copy of an IS200-like element (recently named IS1541) was also located in pMT1. In addition to 5 previously described genes, such as murine toxin, capsule antigen, capsule anchoring protein, etc., 30 homologues to genes of several bacterial species were found in this plasmid, and another 44 open reading frames without homology to any known or hypothetical protein in the databases were predicted. PMID:9748454

Hu, Ping; Elliott, Jeffrey; McCready, Paula; Skowronski, Evan; Garnes, Jeffrey; Kobayashi, Arthur; Brubaker, Robert R.; Garcia, Emilio



42 CFR 483.10 - Resident rights. (United States)

...c) which determines the extent of a couple's non-exempt resources at the time...F) Personal reading matter. (G) Gifts purchased on behalf of a resident. of other residents. (m) Married couples. The resident has the right to...



Complete Genome Sequences of IncI1 Plasmids Carrying Extended-Spectrum ?-Lactamase Genes. (United States)

Extended spectrum beta-lactamases (ESBLs) confer resistance to clinically relevant antibiotics. Often, the resistance genes are carried by conjugative plasmids which are responsible for dissemination. Five IncI1 plasmids carrying ESBLs from commensal and clinical Escherichia coli isolates were completely sequenced and annotated along with a non-ESBL carrying IncI1 plasmid. PMID:25169863

Brouwer, Michael S M; Bossers, Alex; Harders, Frank; van Essen-Zandbergen, Alieda; Mevius, Dik J; Smith, Hilde E



Plasmid Copy Number and Disease Severity in Naturally Occurring Ocular Chlamydia trachomatis Infection (United States)

The Chlamydia trachomatis plasmid is a virulence factor. Plasmid copy number, C. trachomatis load and disease severity were assessed in a treatment-naive population where trachoma is hyperendemic. By using droplet digital PCR, plasmid copy number was found to be stable (median, 5.34 [range, 1 to 18]) and there were no associations with C. trachomatis load or disease severity. PMID:24197878

Roberts, Chrissy h.; Cassama, Eunice; Nabicassa, Meno; Molina-Gonzalez, Sandra; Burr, Sarah E.; Mabey, David C. W.; Bailey, Robin L.; Holland, Martin J.



Impact of Flavophospholipol and Vancomycin on Conjugational Transfer of Vancomycin Resistance Plasmids  


The influence of vancomycin and flavophospholipol (FPL) on the transfer rate of conjugative plasmids harboring the vancomycin resistance operon vanA was determined in several clinical and animal isolates of Enterococcus faecium. FPL significantly inhibited the frequency of transfer of conjugative VanA plasmids up to 70-fold. Vancomycin had no significant effect on the transfer rate of VanA plasmids.

Riedl, Sabine; Ohlsen, Knut; Werner, Guido; Witte, Wolfgang; Hacker, Jo?rg



Plasmid-determined silver resistance in Pseudomonas stutzeri isolated from a silver mine.  


A silver-resistant strain of Pseudomonas stutzeri was isolated from a silver mine. It harbored three plasmids, the largest of which (pKK1; molecular weight, 49.4 X 10(6)) specified silver resistance. Plasmid pKK1 was apparently nonconjugative but could be transferred to Pseudomonas putida by mobilization with plasmid R68.45.

Haefeli, C.; Franklin, C.; Hardy, K.



Expanding drug resistance through integron acquisition by IncFI plasmids of Salmonella enterica Typhimurium.  


We conducted a 30-year retrospective analysis of IncFI plasmids from Salmonella enterica serotype Typhimurium. These plasmids have been associated with the emergence of epidemic clones of multidrug-resistant Salmonella. Molecular and genetic evidence indicates that IncFI plasmids are evolving through sequential acquisition of integrons carrying different arrays of antibiotic- resistance genes.

Carattoli, A.; Villa, L.; Pezzella, C.; Bordi, E.; Visca, P.



Mix and match of KPC-2 encoding plasmids in Enterobacteriaceae-comparative genomics. (United States)

We performed comparative sequence analysis of 3 blaKPC-2 encoding plasmids to examine evolution of these plasmids and their dissemination. We found that all of them have an IncN replicon with a newly determined IncN plasmid sequence type (ST), ST15. The 2 Klebsiella pneumoniae (KPN) plasmids also harbor an IncF2A1-B1- replicon. The blaKPC-2 is located in the Tn4401c transposon with a newly discovered mutation in the P2 promoter. Screening of the 27 additional blaKPC-2 carrying plasmids from Enterobacter cloacae, Escherichia coli (EC), and K. pneumoniae showed that: all KPN and EC plasmids are IncN plasmids belonging to ST15; 4/7 KPN and 1/6 EC plasmids contain an additional IncF2A1-B1- replicon; all Enterobacter plasmids belong to neither IncN nor IncF2A1-B1- replicon plasmids; 6/7 KPN and 2/5 EC plasmids carry the mutated P2 promoter. Study of the blaKPC-2 environment, transposon, pMLST, and Inc group suggests transposon and plasmid inter- and intra-species dissemination and evolution. PMID:24743043

Chmelnitsky, Inna; Shklyar, Maya; Leavitt, Azita; Sadovsky, Evgeniya; Navon-Venezia, Shiri; Ben Dalak, Maayan; Edgar, Rotem; Carmeli, Yehuda



Air-quality measurements in mega-cities: Focus on gaseous organic and particulate pollutants and comparison between two contrasted cities, Paris and Beijing  

International Nuclear Information System (INIS)

The rapid and important development of large urban areas ('mega-cities'), especially in developing countries, causes and will cause serious air-quality problems. Pollutant measurements in these cities help to characterize the chemical nature and the quantity of these pollutants and to constrain air-quality models. This paper focuses on measurements of volatile organic compounds and aerosols that have an important impact on air quality. We present a brief review on existing measurements and experimental strategies in mega-cities and then we show results from recent measurement campaigns that took place in two contrasted mega-cities: Paris and Beijing. (authors)


Plasmid-borne macrolide resistance in Micrococcus luteus. (United States)

A plasmid designated pMEC2 which confers resistance to erythromycin, other macrolides, and lincomycin was detected in Micrococcus luteus strain MAW843 isolated from human skin. Curing of this approximately 4.2 kb plasmid from the host organism resulted in erythromycin sensitivity of the strain. Introduction of pMEC2 into a different M. luteus strain conferred erythromycin resistance upon this strain. Macrolide resistance in M. luteus MAW843 was an inducible trait. Induction occurred at subinhibitory erythromycin concentrations of about 0.02-0.05 micro g ml(-1). Erythromycin and oleandomycin were inducers, while spiramycin and tylosin exerted no significant inducer properties. With heterologous expression experiments in Corynebacterium glutamicum, using hybrid plasmid constructs and deletion derivatives thereof, it was possible to narrow down the location of the plasmid-borne erythromycin-resistance determinant to a region of about 1.8 kb of pMEC2. Sequence analysis of the genetic determinant, designated erm(36), identified an ORF putatively encoding a 281-residue protein with similarity to 23S rRNA adenine N(6)-methyltransferases. erm(36) was most related (about 52-54% identity) to erythromycin-resistance proteins found in high-G+C Gram-positive bacteria, including the (opportunistic) pathogenic corynebacteria Corynebacterium jeikeium, C. striatum, C. diphtheriae and Propionibacterium acnes. This is believed to be the first report of a plasmid-borne, inducible antibiotic resistance in micrococci. The possible role of non-pathogenic, saprophytic micrococci bearing antibiotic-resistance genes in the spreading of these determinants is discussed. PMID:12177341

Liebl, Wolfgang; Kloos, Wesley E; Ludwig, Wolfgang



Behavior of Sister Copies of Mini-F Plasmid after Synchronized Plasmid Replication in Escherichia coli Cells  


To clarify whether sister copies of mini-F plasmid are immediately separated from each other after replication, we analyzed the behavior of sister mini-F copies after synchronized replication of mini-F. Sister copies of mini-F were separated immediately or shortly after replication, in contrast to sister oriC copies of the Escherichia coli chromosome.

Onogi, Toshinari; Miki, Takeyoshi; Hiraga, Sota



Bronchoscopy Simulation in Anesthesia Resident Education  

Directory of Open Access Journals (Sweden)

Full Text Available Simulation in residency training is becoming more popular but there is limited evidence showing that it can improve a resident’s fund of knowledge, particularly in anesthesiology. We looked at whether a bronchoscopy simulation could improve performance on a thoracic anesthesia knowledge test administered both before and after using the simulator. Fourteen first-year anesthesiology residents completed the study with an average improvement on the test of 28% (p 0.05. We conclude that bronchoscopy simulation is an effective method of educating anesthesiology residents.

John Pawlowski



Expansion of a Plasmid Classification System for Gram-Positive Bacteria and Determination of the Diversity of Plasmids in Staphylococcus aureus Strains of Human, Animal, and Food Origins  


An expansion of a previously described plasmid classification was performed and used to reveal the plasmid content of a collection of 92 Staphylococcus aureus strains of different origins. rep genes of other genera were detected in Staphylococcus. S1 pulsed-field gel electrophoresis (PFGE) hybridizations were performed with 18 representative S. aureus strains, and a high number of plasmids of different sizes and organizations were detected.

Lozano, Carmen; Garci?a-migura, Lourdes; Aspiroz, Carmen; Zarazaga, Myriam; Torres, Carmen; Aarestrup, Frank Møller



The visitors and the residents  

Directory of Open Access Journals (Sweden)

Full Text Available Robert Normandeau discusses the relationship with the technologies developed by the generation of pioneers in comparison to that of the current generation. Through an analysis of the exclusive characteristics of digital media – such as, for example, the acousmatic approach, the different options for managing sound timbre, the procedures of semantic saturation attained by repetition of the sound fragment, the new social context, the spatial paradigm – the author defines those ones which are likely to generate a new approach to composition, approach proper to the ‘residents’ of the ‘digital generation’, now far from the demands, needs and contingencies of the pioneers.

Robert Normandeau



Neurocritical Care Training for the Neurosurgery Resident  

Directory of Open Access Journals (Sweden)

Full Text Available Introduction: Recent data has associated favorable outcomes in patients who were treated in a “semi-closed” intensive care unit and attended to by a devoted team of neurointensivists as opposed to the neurosurgeons. This has led many to question the need for dedicated critical care education in the neurosurgical residency training program. Our aim was to determine what current neurosurgery residents and program directors/chairman thoughts were on NCC education in neurosurgical resident training, and to discuss possible methods to allow for collaboration between the NCC team and the neurosurgeons. Methods: Surveys were sent out electronically to all residency programs. Thirty-nine responses from junior residents, 36 responses from senior/chief residents, and eight responses from program directors/chairman were obtained. Results: No statistical difference between the majority responses of the different level residents, and between program directors/chairman and combined resident responses. Conclusions: Clearly, neurosurgery residents of all levels and program directors/chairman value NCC education and see a valuable role for this knowledge in their future. Most residents however do not want to spend an additional year of fellowship training to become certified neurointensivists. We discuss the role of NCC education in residency training and possible solutions to allow collaboration between the NCC team and the neurosurgical team.

Paul EKaloostian



Perspective: Resident physician wellness: a new hope. (United States)

Residency training is a challenging period in a physician's career owing to a multitude of stressors perhaps not previously encountered. In some cases, these stressors may culminate in a state of burnout. In response, much has been written about the issues of personal wellness during residency training. Recently, duty hours reform has been the major focus of addressing resident wellness; however, this intervention has established little benefit and has created unintended negative consequences. Alternatively, an emerging solution may be the implementation of resident wellness programs into residency training. Such programs are defined by a combination of active and passive initiatives targeting the various domains of physical, mental, social, and intellectual wellness. In contrast to duty hours reform, resident wellness programs are generally free from controversy and have been shown to improve resident wellness and enhance empathy.This article highlights the salient causes of burnout as it applies to present-day resident physicians and the patient care they provide. Moreover, in the wake of the controversy surrounding duty hours reform, a novel approach to resident wellness involving structured resident wellness programs is discussed. Specifically included are the fundamental components of a wellness program, the advantages held over duty hours reform, methods to evaluate program efficacy, and the current evidence to support these initiatives. Formal wellness curricula, including an evaluative process, should be an integral component of physician training. These programs represent a new hope in the solution to the long-debated issue of burnout and wellness during residency training. PMID:22450179

Lefebvre, Dennis C



Short-lived tectonic switch mechanism for long-term pulses of volcanic activity after mega-thrust earthquakes  

Directory of Open Access Journals (Sweden)

Full Text Available Eruptive rates in volcanic arcs increase significantly after mega-thrust earthquakes in subduction zones. Over short to intermediate time periods the link between mega-thrust earthquakes and arc response can be attributed to dynamic triggering processes or static stress changes, but a fundamental mechanism that controls long-term pulses of volcanic activity after mega-thrust earthquakes has not been proposed yet. Using geomechanical, geological, and geophysical arguments, we propose that increased eruption rates over longer timescales are due to the relaxation of the compressional regime that accompanies mega-thrust subduction zone earthquakes. More specifically, the reduction of the horizontal stress ?h promotes the occurrence of short-lived strike-slip kinematics rather than reverse faulting in the volcanic arc. The relaxation of the pre-earthquake compressional regime facilitates magma mobilization by providing a short-circuit pathway to shallow depths by significantly increasing the hydraulic properties of the system. The timescale for the onset of strike-slip faulting depends on the degree of shear stress accumulated in the arc during inter-seismic periods, which in turn is connected to the degree of strain-partitioning at convergent margins. We performed Coulomb stress transfer analysis to determine the order of magnitude of the stress perturbations in present-day volcanic arcs in response to five actual mega-thrust earthquakes; the 2005 M8.6, 2007 M8.5, and 2007 M7.9 Sumatra earthquakes; the 2010 M8.8 Maule, Chile earthquake; and the 2011 M9.0 Tohoku, Japan earthquake. We find that all, but one, the shallow earthquakes that occurred in the arcs of Sumatra, Chile and Japan show a marked lateral component. Our hypothesis suggests that the long-term response of volcanic arcs to subduction zone mega-thrust earthquakes will be manifested as predominantly strike-slip seismic events, and that these future earthquakes will be followed closely by seismic swarms, inflation, and other indications of a rising magma source.

M. Lupi



Isolation of a novel plasmid from Couchioplanes caeruleus and construction of two plasmid vectors for gene expression in Actinoplanes missouriensis. (United States)

To date, no plasmid vector has been developed for the rare actinomycete Actinoplanes missouriensis. Moreover, no small circular plasmid has been reported to exist in the genus Actinoplanes. Here, a novel plasmid, designated pCAZ1, was isolated from Couchioplanes caeruleus subsp. azureus via screening for small circular plasmids in Actinoplanes (57 strains) and Couchioplanes (2 strains). Nucleotide sequencing revealed that pCAZ1 is a 5845-bp circular molecule with a G?+?C content of 67.5%. The pCAZ1 copy number was estimated at 30 per chromosome. pCAZ1 contains seven putative open reading frames, one of which encodes a protein containing three motifs conserved among plasmid-encoded replication proteins that are involved in the rolling-circle mechanism of replication. Detection of single-stranded DNA intermediates in C. caeruleus confirmed that pCAZ1 replicates by this mechanism. The ColE1 origin from pBluescript SK(+) and the oriT sequence with the apramycin resistance gene aac(3)IV from pIJ773 were inserted together into pCAZ1, to construct the Escherichia coli-A. missouriensis shuttle vectors, pCAM1 and pCAM2, in which the foreign DNA fragment was inserted into pCAZ1 in opposite directions. pCAM1 and pCAM2 were successfully transferred to A. missouriensis through the E. coli-mediated conjugative transfer system. The copy numbers of pCAM1 and pCAM2 in A. missouriensis were estimated to be one and four per chromosome, respectively. Thus, these vectors can be used as effective genetic tools for homologous and heterologous gene expression studies in A. missouriensis. PMID:25500016

Jang, Moon-Sun; Fujita, Azusa; Ikawa, Satomi; Hanawa, Keitaro; Yamamura, Hideki; Tamura, Tomohiko; Hayakawa, Masayuki; Tezuka, Takeaki; Ohnishi, Yasuo



Plasmid DNA Profilling of Pasteurella multocida Serotype A, B, D and Untypable (U) Isolates From Animals  


A total of two-hudred (200) P. multocida isolates obtained from Veterinary Diagnostic Laboratory, Petaling Jaya were screened for their presence of plasmid via alkaline lysis method (Sambrook, et al. 1989). The size, number and profile of plasmids for each isolate were estimated by agarose gel electrophoresis. 37% were noted to harbor small plasmid DNA, ranging in size from 1.5 to 3.6 Mda and there was no presence of large plasmids in all isolates. No plasmids could be detected for s...

Salmah Ismail



Long-term manure exposure increases soil bacterial community potential for plasmid uptake  

DEFF Research Database (Denmark)

Microbial communities derived from soils subject to different agronomic treatments were challenged with three broad host range plasmids, RP4, pIPO2tet and pRO101, via solid surface filter matings to assess their permissiveness. Approximately 1 in 10000 soil bacterial cells could receive and maintain the plasmids. The community permissiveness increased up to 100% in communities derived from manured soil. While the plasmid transfer frequency was significantly influenced by both the type of plasmid and the agronomic treatment, the diversity of the transconjugal pools was purely plasmid dependent and was dominated by ?- and ?-Proteobacteria. © 2013 Society for Applied Microbiology and John Wiley & Sons Ltd.

Musovic, Sanin; Klümper, Uli



Construction of a hybrid plasmid capable of replication in Amycolatopsis mediterranei.  


A new plasmid, pA387, has been isolated from "Amycolatopsis sp." (DSM 43387). This plasmid could be isolated from liquid culture as well as mycelium from agar plates by a modified procedure. Plasmid pA387 is about 29.6 kb and can be cured at low frequency by protoplasting and ethidium bromide and heat treatment. Hybridization experiments showed that this plasmid is present in free form and does not integrate into the chromosome. A hybrid plasmid was constructed by cloning a 5.1-kb fragment of...

Lal, R.; Lal, S.; Grund, E.; Eichenlaub, R.



[Conjugation transfer of the bireplicon plasmid pSPA044 into Rhizobiaceae bacteria]. (United States)

We have demonstrated the possibility of hybrid plasmid pSPA044 conjugative transfer from E. coli cells into different Rhizobium species. The bireplicon plasmid, constructed earlier in our laboratory, consisting of pBR325 and HindIII fragment 13 of the nopaline plasmid pTiC58 was mobilized for transfer by the helper plasmid pRK2013 with the frequency about 10(-4). We conclude the hybrid plasmid pSPA044 to be able to replicate stably in Rhizobiaceae cells. PMID:3540635

Stekhin, I N; Andrianov, V M; Piruzian, E S



Long- term manure exposure increases soil bacterial community potential for plasmid uptake  

DEFF Research Database (Denmark)

Microbial communities derived from soils subject to different agronomic treatments were challenged with three broad host range plasmids, RP4, pIPO2tet and pRO101, via solid surface filter matings to assess their permissiveness. Approximately 1 in 10 000 soil bacterial cells could receive and maintain the plasmids. The community permissiveness increased up to 100% in communities derived from manured soil. While the plasmid transfer frequency was significantly influenced by both the type of plasmid and the agronomic treatment, the diversity of the transconjugal pools was purely plasmid dependent and was dominated by ?- and ?-Proteobacteria.

Musovic, Sanin; Klümper, Uli



Streptococcal plasmid pIP501 has a functional oriT site.  


DNA sequence analysis suggested the presence of a plasmid transfer origin-like site (oriT) in the gram-positive conjugative plasmid pIP501. To test the hypothesis that the putative oriT site in pIP501 played a role in conjugal transfer, we conducted plasmid mobilization studies in Enterococcus faecalis. Two fragments, 49 and 309 bp, which encompassed the oriT region of pIP501, were cloned into pDL277, a nonconjugative plasmid of gram-positive origin. These recombinant plasmids were mobilized ...

Wang, A.; Macrina, F. L.



Presence and analysis of plasmids in human and animal associated Arcobacter species  

DEFF Research Database (Denmark)

In this study, we report the screening of four Arcobacter species for the presence of small and large plasmids. Plasmids were present in 9.9% of the 273 examined strains. One Arcobacter cryaerophilus and four Arcobacter butzleri plasmids were selected for further sequencing. The size of three small plasmids isolated from A. butzleri and the one from A. cryaerophilus strains ranged between 4.8 and 5.1 kb, and the size of the large plasmid, isolated from A. butzleri, was 27.4 kbp. The G+C content of all plasmids ranged between 25.4% and 26.2%. A total of 95% of the large plasmid sequence represents coding information, which contrasts to the 20 to 30% for the small plasmids. Some of the open reading frames showed a high homology to putative conserved domains found in other related organisms, such as replication, mobilization and genes involved in type IV secretion system. The large plasmid carried 35 coding sequences, including seven genes in a contiguous region of 11.6 kbp that encodes an orthologous type IV secretion system found in the Wolinella succinogenes genome, Helicobacter pylori and Campylobacter jejuni plasmids, which makes this plasmid interesting for further exploration.

Douidah, Laid; De Zutter, Lieven



Plasmid analysis and epidemiology of Salmonella enteritidis infection in three commercial layer flocks. (United States)

Ninety-six S. enteritidis isolates obtained from three commercial layer flocks in 1988-90 were examined following DNA extraction, restriction enzyme digestion, and gel electrophoresis for plasmid size profiles and restriction fragment length polymorphisms (RFLPs). The S. enteritidis isolates from the three flocks had three, eight, and two different plasmid profiles, respectively. Only four isolates from one flock lacked plasmids. A 36-megadalton (mDa) (54-kilobase) plasmid was present in 73% of the isolates, either alone or in combination with other plasmids. Isolates with only the 36-mDa plasmid had identical RFLPs. The diversity of plasmid profiles was greater than that of phage-types among isolates from the three flocks: 12 unique plasmid profiles vs. four phage-types. Mixed infections with S. enteritidis strains having distinct plasmid profiles occurred in all three flocks. Reinfection of these flocks in 1990 with one or more of the strains obtained earlier was evident, because some of the original isolates and the 1990 isolates had matching plasmid profiles and were of the same phage-types. Isolates from both environmental and tissue samples, examined from one flock, were found to share the same plasmid profile and phage-type. PMID:1362492

Dorn, C R; Silapanuntakul, R; Angrick, E J; Shipman, L D



Characterization of two novel plasmids from Geobacillus sp. 610 and 1121 strains. (United States)

We describe two cryptic low molecular weight plasmids, pGTD7 (3279bp) and pGTG5 (1540bp), isolated from Geobacillus sp. 610 and 1121 strains, respectively. Homology analysis of the replication protein (Rep) sequences and detection of ssDNA indicate that both of them replicate via rolling circle mechanism. As revealed by sequence similarities of dso region and Rep protein, plasmid pGTD7 belongs to pC194/pUB110 plasmid family. The replicon of pGTD7 was proved to be functional in another Geobacillus host. For this purpose, a construct pUCK7, containing a replicon of the analyzed plasmid, was created and transferred to G. stearothermophilus NUB3621R strain by electroporation. Plasmid pGTG5, based on Rep protein sequence similarity, was found to be related mostly to some poorly characterized bacterial plasmids. Rep proteins encoded by these plasmids contain conservative motifs that are most similar to those of Microviridae phages. This feature suggests that pGTG5, together with other plasmids containing the same motifs, could constitute a new family of bacterial plasmids. To date, pGTG5 is the smallest plasmid identified in bacteria belonging to the genus Geobacillus. The two plasmids described in this study can be used for the construction of new vectors suitable for biotechnologically important bacteria of the genus Geobacillus. PMID:24177015

Kananavi?i?t?, R?ta; Butait?, Elena; Citavi?ius, Donaldas



Content of Plasmids and Biogenic Amines Identification of Streptococcus thermophilus of Fermented Milk  

Directory of Open Access Journals (Sweden)

Full Text Available The plasmids content of nine different S. thermophilus strains of KLDS were identified. The strains KLDS3.0201, KLDS3.0203 and KLDS3.0208 isolated from the commercial yoghurt were free of plasmid. The strains S9, S11, S14 and S16 which were isolated from the traditional fermented milk of china that all contained different plasmids and the strains S10 and S15 were free of plasmid. The plasmids of the S14 were analyzing, plasmid rolling circle replication initiator protein has been sequenced. This part has the same sequence with the LMD-9 plasmid 2. Biogenic Amines were determined by multiplex PCR the related partial genes which were histidine decarboxylase (hdc gene, ornithine decarboxylase (odc gene and tyramine decarboxylase (tdc gene. There was no relative amplification gene in these nine strains. They were safe for the production of the yoghurt.

Wei Ye



Origin, duplication and reshuffling of plasmid genes: Insights from Burkholderia vietnamiensis G4 genome. (United States)

Using a computational pipeline based on similarity networks reconstruction we analysed the 1133 genes of the Burkholderia vietnamiensis (Bv) G4 five plasmids, showing that gene and operon duplication played an important role in shaping the plasmid architecture. Several single/multiple duplications occurring at intra- and/or interplasmids level involving 253 paralogous genes (stand-alone, clustered or operons) were detected. An extensive gene/operon exchange between plasmids and chromosomes was also disclosed. The larger the plasmid, the higher the number and size of paralogous fragments. Many paralogs encoded mobile genetic elements and duplicated very recently, suggesting that the rearrangement of the Bv plastic genome is ongoing. Concerning the "molecular habitat" and the "taxonomical status" (the Preferential Organismal Sharing) of Bv plasmid genes, most of them have been exchanged with other plasmids of bacteria belonging (or phylogenetically very close) to Burkholderia, suggesting that taxonomical proximity of bacterial strains is a crucial issue in plasmid-mediated gene exchange. PMID:24576463

Maida, Isabel; Fondi, Marco; Orlandini, Valerio; Emiliani, Giovanni; Papaleo, Maria Cristiana; Perrin, Elena; Fani, Renato



Cloning and characterization of a linear 2.3 kb mitochondrial plasmid of maize. (United States)

A linear 2.3 kb DNA molecule found in maize mitochondria was cloned into pUC8. A natural deletion of this plasmid, found in cmsT and some N (fertile) types of maize plants, was mapped to one end of the plasmid. A minor sequence homology to S-2, another linear mitochondrial plasmid, was detected, as well as more significant sequence homology with chloroplast and maize nuclear DNA. Hybridization to teosinte mitochondrial DNA (mtDNA) revealed the presence of part of the maize plasmid in the high molecular weight mtDNA of the maize relatives. RNA dot hybridization indicates that the plasmid is transcribed in mitochondria. The termini of the 2.3 kb linear plasmid contain inverted repeated sequences; of the first 17 nucleotides of the termini, 16 are identical to the terminal inverted repeats of the linear S plasmids found in the mitochondria of cmsS maize plants. PMID:3027500

Bedinger, P; de Hostos, E L; Leon, P; Walbot, V



Comparative analysis of staphylococcal plasmids carrying three streptogramin-resistance genes: vat-vgb-vga. (United States)

Several staphylococcal plasmids (26-45 kb) carry all three streptogramin-resistance (Sg(R)) genes, vat, vgb, and vga. Seven such plasmids harbored by independent strains belonging to three taxa (Staphylococcus aureus, S. simulans, and S. cohnii subsp. urealyticum) were compared and the deleted derivative of one of them, pIP680 (11.3 kb), carrying the three streptogramin-resistance genes was sequenced. The seven native plasmids had in common a 12.1-kb part cocarrying the three Sg(R) genes. Sequence analysis of pIP680 revealed that the simultaneous presence of these three genes has probably resulted from cointegration of two plasmids: (i) a pAMbeta1-like plasmid harboring vat-vgb and whose replication gene has been inactivated by an IS257 insertion and (ii) a functional vga plasmid whose replication is similar to that of two staphylococcal plasmids, pSX267 and pSK41. PMID:10489330

Allignet, J; El Solh, N



Differences in the stability of the plasmids of Yersinia pestis cultures in vitro: impact on virulence  

Directory of Open Access Journals (Sweden)

Full Text Available Plasmid and chromosomal genes encode determinants of virulence for Yersinia pestis, the causative agent of plague. However, in vitro, Y. pestis genome is very plastic and several changes have been described. To evaluate the alterations in the plasmid content of the cultures in vitro and the impact of the alterations to their pathogenicity, three Y. pestis isolates were submitted to serial subculture, analysis of the plasmid content, and testing for the presence of characteristic genes in each plasmid of colonies selected after subculture. Different results were obtained with each strain. The plasmid content of one of them was shown to be stable; no apparent alteration was produced through 32 subcultures. In the other two strains, several alterations were observed. LD50 in mice of the parental strains and the derived cultures with different plasmid content were compared. No changes in the virulence plasmid content could be specifically correlated with changes in the LD50.

TC Leal-Balbino



Mega jardines infantiles: heterotopías para el gobierno de la población infantil en Medellín / Mega-kindergartens: heterotopias for governing the infant population in Medellin / Mega jardins de infância: heterotopias para o governo da população infantil em Medellin  

Scientific Electronic Library Online (English)

Full Text Available SciELO Colombia | Language: Spanish Abstract in portuguese No marco de uma política integral de atenção para a infância, durante as últimas administrações a cidade de Medellín realizou um grande investimento em infraestrutura, especificamente para a construção, em lugares estratégicos da cidade, de grandes jardins de infância. Este texto tem como propósito [...] pensar em chave foucaultiana esses espaços como heterotopias, isto é, como espaços para o governo (governamentalidade) da população infantil. No texto se considera que a reestruturação e ressignificação do espaço educativo escolar e das práticas desenvolvidas na sua interioridade não obedecem, principalmente, a uma preocupação pedagógica ou filantrópica que poderia ser interpretada de maneira independente de um contexto histórico e social, nas margens de determinados interesses e relações de poder. Numa primeira parte, seguindo Foucault, se revisa o conceito de heterotopia e se propõe que esses espaços educativos outros -além da sua função educativa e formativa- cumprem um papel governamental em quanto permitem o governo da população infantil ao constituírem-se em lugares estratégicos para a implantação de tecnologias sociais como a prevenção. Abstract in spanish En el marco de una nueva política de atención integral a la infancia, durante las últimas administraciones la ciudad de Medellín ha venido realizando una considerable inversión en infraestructura urbana, específicamente con la creación, en lugares estratégicos de la ciudad, de grandes jardines infan [...] tiles. Este escrito tiene como propósito pensar en clave foucaultiana esos espacios como heterotopías, es decir, como espacios otros para el gobierno (gubernamentalidad) de la población infantil. Partimos así, del presupuesto según el cual la reestructuración y resignificación del espacio educativo escolar y de las prácticas en su interior no obedece a una suerte de preocupación pedagógica y filantrópica que sin más se pueda considerar desligada de un contexto histórico y social y al margen de ciertos intereses y de ciertas relaciones de poder. Para ello, y de la mano de Foucault, en una primera parte se le pasa revista al concepto de heterotopía y a sus particularidades; en la segunda parte, se profundiza en la caracterización de los mega jardines infantiles como heterotopías y se plantea que estos espacios educativos otros -además de su función educativa y formativa- cumplen con un papel gubernamental en el sentido que permiten el gobierno de la población infantil gracias a que se convierten en lugares estratégicos para la implementación de tecnologías sociales como la prevención. Abstract in english Under a new policy of comprehensive child care during the past administrations Medellin has been making a considerable investment in urban infrastructure, specifically the creation in strategic locations in the city, large kindergartens. This paper aims to reflect upon these spaces as key Foucauldia [...] n heterotopias, ie, as other spaces for the government (governmentality) of children. So, we start from the estimation that restructuring and redefining educational space and practices therein are not due to a kind of educational and philanthropic concern that no more can be considered detached from a historical and social context and outside certain interests and certain power relations.

Andrés Klaus, Runge Peña; Sara Carolina, Carrillo David.



Familial communicating hydrocephalus, posterior cerebellar agenesis, mega cisterna magna, and port-wine nevi. Report on five members of one family. (United States)

This report deals with a family in which the maternal grandmother, the mother, and all three male children have port-wine nevi and mega cisterna magna. Two of the three male children have, in addition, congenital communicating hydrocephalus associated with agenesis of the posterior cerebellar vermis. This case of familial communicating hydrocephalus, posterior cerebellar vermis agenesis, port-wine nevus, and mega cisterna magna represents a new neurocutaneous syndrome, possibly transmitted as an autosomal dominant. PMID:501430

Nova, H R



Stakeholder participation to improve societal acceptance for mega projects. : A case study of the forum for the coal-power plant “Datteln 4” project  


The aim of this thesis is to evaluate how stakeholder participation should be implemented to improve societal acceptance for mega projects. Thereby societal acceptance is seen as a major contributor to project success in this context and involving society in decision-making and two-way dialogue is recognized as the most  effective to achieve this. Based on this research area, a theoretical framework was proposed for the mega project context including prerequisite, process and outcome criteri...

Ja?ger, Tassilo; Zakharova, Anna



Competing ParA Structures Space Bacterial Plasmids Equally over the Nucleoid. (United States)

Low copy number plasmids in bacteria require segregation for stable inheritance through cell division. This is often achieved by a parABC locus, comprising an ATPase ParA, DNA-binding protein ParB and a parC region, encoding ParB-binding sites. These minimal components space plasmids equally over the nucleoid, yet the underlying mechanism is not understood. Here we investigate a model where ParA-ATP can dynamically associate to the nucleoid and is hydrolyzed by plasmid-associated ParB, thereby creating nucleoid-bound, self-organizing ParA concentration gradients. We show mathematically that differences between competing ParA concentrations on either side of a plasmid can specify regular plasmid positioning. Such positioning can be achieved regardless of the exact mechanism of plasmid movement, including plasmid diffusion with ParA-mediated immobilization or directed plasmid motion induced by ParB/parC-stimulated ParA structure disassembly. However, we find experimentally that parABC from Escherichia coli plasmid pB171 increases plasmid mobility, inconsistent with diffusion/immobilization. Instead our observations favor directed plasmid motion. Our model predicts less oscillatory ParA dynamics than previously believed, a prediction we verify experimentally. We also show that ParA localization and plasmid positioning depend on the underlying nucleoid morphology, indicating that the chromosomal architecture constrains ParA structure formation. Our directed motion model unifies previously contradictory models for plasmid segregation and provides a robust mechanistic basis for self-organized plasmid spacing that may be widely applicable. PMID:25521716

Ietswaart, Robert; Szardenings, Florian; Gerdes, Kenn; Howard, Martin



Conjugative transfer of cadmium resistance plasmids in Rhodococcus fascians strains  

Energy Technology Data Exchange (ETDEWEB)

The presence of a 138-kilobase plasmid (pD188) correlated with increased resistance to cadmium in Rhodococcus fascians D188. This plasmid could be transferred by a conjugation-like system in matings between R. fascians strains. To examine this correlation we used large /sup 32/P-labeled pD188 subclones as probes in hybridization analyses with Southern blots of restricted total DNAs of D188 and its derivative mutants. Transconjugants expressed the cadmium resistance and could be used as donors in subsequent matings. Four other R. fascians strains (NCPPB 1488, NCPPB 1675, NCPPB 2551, and ATCC 12974) could also be used as donors for cadmium resistance in matings. Strain NCPPB 1675 showed a 100% cotransfer of cadmium and chloramphenicol resistance markers.

Desomer, J.; Dhaese, P.; Montagu, M.V.



Transfer of the lambdadv plasmid to new bacterial hosts  

International Nuclear Information System (INIS)

Lambda dv, which was derived from bacteriophage lambda, replicates autonomously as a plasmid in Escherichia coli and consists of only the immunity region (imm/sup lambda/) and DNA replication genes (O, P) of the ancestral phage. Addition phages (lambda imm21--lambda dv) carry the lambda dv fragment inserted as a tandem duplication in their genome (sequence A imm21 O P imm/sup lambda/ O P R) are formed as recombinants after lambda imm21 infection of strains carrying lambda dv. Addition phages were used to transfer lambda dv to new bacterial hosts. Lambda dv transfer by excision of the lambda dv segment from the addition phage genome requires a bacterial Rec or a phage Red recombination system. Successful transfer is stimulated by uv irradiation of the addition phage before infection. Some properties of the newly transferred lambda dv plasmids are described. (U.S.)


Plasmid DNA damage induced by helium atmospheric pressure plasma jet (United States)

A helium atmospheric pressure plasma jet (APPJ) is applied to induce damage to aqueous plasmid DNA. The resulting fractions of the DNA conformers, which indicate intact molecules or DNA with single- or double-strand breaks, are determined using agarose gel electrophoresis. The DNA strand breaks increase with a decrease in the distance between the APPJ and DNA samples under two working conditions of the plasma source with different parameters of applied electric pulses. The damage level induced in the plasmid DNA is also enhanced with increased plasma irradiation time. The reactive species generated in the APPJ are characterized by optical emission spectra, and their roles in possible DNA damage processes occurring in an aqueous environment are also discussed.

Han, Xu; Cantrell, William A.; Escobar, Erika E.; Ptasinska, Sylwia



The Effects of Herbivory by a Mega- and Mesoherbivore on Tree Recruitment in Sand Forest, South Africa  


Herbivory by megaherbivores on woody vegetation in general is well documented; however studies focusing on the individual browsing effects of both mega- and mesoherbivore species on recruitment are scarce. We determined these effects for elephant Loxodonta africana and nyala Tragelaphus angasii in the critically endangered Sand Forest, which is restricted to east southern Africa, and is conserved mainly in small reserves with high herbivore densities. Replicated experimental treatments (400 m...

Lagendijk, D. D. Georgette; Mackey, Robin L.; Page, Bruce R.; Slotow, Rob



Galaxy And Mass Assembly (GAMA): the wavelength-dependent sizes and profiles of galaxies revealed by MegaMorph  


We investigate the relationship between colour and structure within galaxies using a large, volume-limited sample of bright, low-redshift galaxies with optical-near-infrared imaging from the Galaxy AndMass Assembly survey.We fit single-component,wavelength-dependent, elliptical Sérsic models to all passbands simultaneously, using software developed by the MegaMorph project. Dividing our sample by n and colour, the recovered wavelength variations in effective radius (Re) and Sérsic index (n)...

Vulcani, B.; Bamford, Sp; Haeussler, B.; Vika, M.; Rojas, A.; Agius, Nk; Baldry, I.; Bauer, Ae; Brown, Mji; Driver, S.; Graham, Aw; Kelvin, Ls; Liske, J.; Loveday, J.; Popescu, Cc



The Role of Mega-events in Country Branding : Case Study on Brand of Ukraine before European Football Championship 2012  


Successful presentation of a country as a brand and positioning its unique image on the global level can give significant opportunities for development and progress of the state in the different areas. This research applies theories on the country branding to estimate impact of mega sport events on the image of state. To accomplish these goal I used case study – formation of brand Ukraine before hosting European Football Championship 2012 (EURO 2012). To investigate  brand strategy of Ukra...

Klonova, Anastasiia



Formation of mega-scale glacial lineations on the Dubawnt Lake Ice Stream bed : 2. Sedimentology and stratigaphy.  


Mega-scale glacial lineations (MSGLs) are highly elongate, subglacial landforms produced beneath zones of fast-flowing ice. While qualitative data on their morphology have existed for several decades, studies of their composition and sedimentology are comparatively rare. Sediment exposures along the course of the Finnie River in Nunavut, northern Canada, provide a window into the internal stratigraphy and sedimentology of MSGLs formed by the Dubawnt Lake Palaeo-Ice Stream during regional degl...

O Cofaigh, C.; Stokes, C. R.; Lian, O. B.; Clark, C. D.; Tulaczyk, S.





The Colombia/Ecuador subduction zone is a region where high seismic stress is presently accumulating. Statistical probability studies and GPS measurements of crustal deformation indicate that the region has an increased potential to generate in the near future a major or great tsunamigenic earthquake similar to the 1979 or 1906. Although most of the major earthquakes along this margin usually generate local tsunamis, the recurrence of a great mega-thrust, inter-plate earthquake, similar in ma...

George Pararas-Carayannis



Along came a mega-event : prospects of competitiveness for a 2010 FIFA World Cup™ host city  


South Africa’s hosting of the 2010 FIFA World Cup™ came at a time when countries and cities worldwide were increasingly competing for this sought-after status. The benefits and challenges of such an event have received significant attention from researchers and practitioners alike. No tourism destination is guaranteed long-term competitiveness by being offered the once-off opportunity to host a major international event. This study aimed to determine whether a mega-event would make a grea...

Kruger, Elizabeth Ann; Heath, Ernest Thomas



Efficient transformation of Bacillus thuringiensis requires nonmethylated plasmid DNA.  


The transformation efficiency of Bacillus thuringiensis depends upon the source of plasmid DNA. DNA isolated from B. thuringiensis, Bacillus megaterium, or a Dam- Dcm- Escherichia coli strain efficiently transformed several B. thuringiensis strains, B. thuringiensis strains were grouped according to which B. thuringiensis backgrounds were suitable sources of DNA for transformation of other B. thuringiensis strains, suggesting that B. thuringiensis strains differ in DNA modification and restri...

Macaluso, A.; Mettus, A. M.



Plasmid location of Borrelia purine biosynthesis gene homologs.  


The Lyme disease spirochete Borrelia burgdorferi must survive in both its tick vector and its mammalian host to be maintained in nature. We have identified the B. burgdorferi guaA gene encoding GMP synthetase, an enzyme involved in de novo purine biosynthesis that is important for the survival of bacteria in mammalian blood. This gene encodes a functional product that will complement an Escherichia coli GMP synthetase mutant. The gene is located on a 26-kb circular plasmid, adjacent to and di...

Margolis, N.; Hogan, D.; Tilly, K.; Rosa, P. A.



Expression plasmids and production of EGFP in stably transfected Acanthamoeba  


New plasmids containing the TATA-Binding Protein (TBP), TBP Promoter Binding Factor (TPBF) or Glyceraldehyde Phosphate Dehydrogenase (GAPDH) gene promoters from Acanthamoeba castellanii are described. The promoters for Acanthamoeba TPBF and GAPDH genes were used to drive constitutive expression of enhanced green fluorescent protein (EGFP) in stably transfected Acanthamoeba. Based initially on fluorescence microscopy and SDS PAGE analysis of EGFP, both promoters produce robust expression of EG...

Bateman, Erik



Construction and Characterization of a Highly Efficient Francisella Shuttle Plasmid  


Francisella tularensis is a facultative intracellular pathogen that infects a wide variety of mammals and causes tularemia in humans. It is recognized as a potential agent of bioterrorism due to its low infectious dose and multiple routes of transmission. To date, genetic manipulation in Francisella spp. has been limited due to the inefficiency of DNA transformation, the relative lack of useful selective markers, and the lack of stably replicating plasmids. Therefore, the goal of this study w...

Maier, Tamara M.; Havig, Andrea; Casey, Monika; Nano, Francis E.; Frank, Dara W.; Zahrt, Thomas C.



Generation of Recombinant Influenza Virus from Plasmid DNA  


Efforts by a number of influenza research groups have been pivotal in the development and improvement of influenza A virus reverse genetics. Originally established in 1999 1,2 plasmid-based reverse genetic techniques to generate recombinant viruses have revolutionized the influenza research field because specific questions have been answered by genetically engineered, infectious, recombinant influenza viruses. Such studies include virus replication, function of viral proteins, the contributio...

Marti?nez-sobrido, Luis; Garci?a-sastre, Adolfo



Silica nanoparticles modified with aminosilanes as carriers for plasmid DNA  


We synthesised silica nanoparticles (SiNP) with covalently linked cationic surface modifications and demonstrated their ability to electrostatically bind, condense and protect plasmid DNA. These particles might be utilised as DNA carriers for gene delivery. All nanoparticles were sized between 10 and 100 nm and displayed surface charge potentials from +7 to +31mV at pH 7.4. They were produced by modification of commercially available (IPAST) or in-house synthesised silica particles with eithe...

Lehr, Claus-michael; Kneuer, Carsten; Sameti, Mohammad; Haltner, Eleonore G.; Schiestel, Thomas; Schirra, Hermann; Schmidt, Helmut K.



Stable transformation of tobacco by electroporation: evidence for plasmid concatenation.  


Electroporation (electric field-mediated DNA transfer) of tobacco protoplasts in the presence of the linearized plasmid pMON200 has led to the formation of transgenic plants. Defined electric shocks were delivered by capacitive discharges with readily available, low-cost electrical components. This transformation procedure is simple and efficient and may suggest a quick method for determining the appropriate electric fields for new cell systems. An optimal transformation frequency of 2.2 X 10...

Riggs, C. D.; Bates, G. W.



Energetics of plasmid-mediated arsenate resistance in Escherichia coli.  


Plasmid R773, which codes for resistances to arsenate, arsenite, and antimony, was introduced into Escherichia coli strain AN120, a mutant deficient in the H+-translocating ATPase of oxidative phosphorylation. Cultures depleted of endogenous energy reserves were loaded with 74AsO3-4, and arsenate efflux was measured after dilution into medium containing various energy sources and inhibitors. Rapid extrusion of arsenate occurred when glucose was added. Arsenate was extruded both against and do...

Mobley, H. L.; Rosen, B. P.



The obstetrics and gynaecology resident as teacher. (United States)

In this article we discuss the role residents play in the clinical training and evaluation of medical students. A literature search was performed to identify articles dealing with research, curriculum, and the evaluation of residents as teachers. We summarize the importance of resident educators and the need to provide appropriate resources for house staff in this role, and we review evidence-based literature in the area of residents as teachers. Specific attention is given to the unique circumstances of the obstetrics and gynaecology resident, who is often faced with teaching in an emotionally charged and stress-filled environment. We present examples of curricula for residents as teachers and describe barriers to their implementation and evaluation. PMID:21176331

Cullimore, Amie J; Dalrymple, John L; Dugoff, Lorraine; Hueppchen, Nancy A; Casey, Petra M; Chuang, Alice W; Espey, Eve L; Hammoud, Maya M; Kaczmarczyk, Joseph M; Katz, Nadine T; Nuthalapaty, Francis S; Peskin, Edward G



Small Plasmids Harboring qnrB19: a Model for Plasmid Evolution Mediated by Site-Specific Recombination at oriT and Xer Sites (United States)

Plasmids pPAB19-1, pPAB19-2, pPAB19-3, and pPAB19-4, isolated from Salmonella and Escherichia coli clinical strains from hospitals in Argentina, were completely sequenced. These plasmids include the qnrB19 gene and are 2,699, 3,082, 2,989, and 2,702 nucleotides long, respectively, and they share extensive homology among themselves and with other previously described small qnrB19-harboring plasmids. The genetic environment of qnrB19 in all four plasmids is identical to that in these other plasmids and in transposons such as Tn2012, Tn5387, and Tn5387-like. Nucleotide sequence comparisons among these and previously described plasmids showed a variable region characterized by being flanked by an oriT locus and a Xer recombination site. We propose that this arrangement could play a role in the evolution of plasmids and present a model for DNA swapping between plasmid molecules mediated by site-specific recombination events at oriT and a Xer target site. PMID:22290975

Tran, Tung; Andres, Patricia; Petroni, Alejandro; Soler-Bistué, Alfonso; Albornoz, Ezequiel; Zorreguieta, Angeles; Reyes-Lamothe, Rodrigo; Sherratt, David J.; Corso, Alejandra



Mulberry strains of Xylella fastidiosa contain a 25 kilobase pair plasmid with extensive sequence identity to a plasmid from Verminephrobacter eiseniae (United States)

A 25 kbp plasmid was present in each of four Californian strains of Xylella fastidiosa from mulberry affected with leaf scorch disease. Fragments of each plasmid were cloned into E. coli, sequenced, and assembled into circular contigs of 25,105 bp (pXF-RIV11 and pXF-RIV16) or 24,372 bp (pXF-RIV19 an...


Stress and burnout among Swiss dental residents  


Stress and burnout have been well-documented in graduate medical and undergraduate dental education, but studies among dental graduate students and residents are sparse. The purpose of this investigation was to examine perceived stressors and three dimensions of burnout among dental residents enrolled in the University of Bern, Switzerland. Thirty-six residents enrolled in five specialty programmes were administered the Graduate Dental Environment Stress (GDES30) questionnaire and the Maslach...

Divaris, Kimon; Lai, Caroline S.; Polychronopoulou, Argy; Eliades, Theodore; Katsaros, Christos



Flippige Online-PDFs - Webpublikationen mit Umblätter-Effekt durch das MegaZine3-Tool  

Directory of Open Access Journals (Sweden)

Full Text Available Webdokumente werden in letzter Zeit immer häufiger mit einem Umblätter–Effekt präsentiert. Beliebt ist dies vor allem für Onlineversionen von Printmagazinen, Produktkatalogen und die Postwurfflyer von Super- und Baumärkten. Diese Funktion des Umblätterns wird mit diversen Begriffen Flip Book, Pageflip, … bezeichnet – einige davon sind markenrechtlich geschützt – was es echt schwierig macht, sich googelnder Weise einen raschen Überblick zu solchen Tools zu verschaffen. Wer es dennoch schafft, findet schnell heraus, dass diese Funktion eher im professionellen, hochpreisigen Desktop- und Online-Publishing Bereich angesiedelt ist. Für medienpädagogisch motivierte Projektergebnisse gibt’s wenig Optionen[FN1], die die Eigenverantwortung bei der Onlinepublikation und Onlineverbreitung unterstützen. Daher war ich sehr erfreut, als ich mit MegaZine3 (MZ3 ein Tool gefunden hab, dass einerseits als Basisversion für alle NutzerInnen kostenlos ist (nichteinmal registrierungspflichtig, für Schulen und Unis eine kostenlose EDU–Lizenz ermöglicht (unbegrenzte Seitenanzahl bei Registrierung der Schule und es MZ3 auch als deutschsprachige Version gibt, weil die Entwicklungsfirma in München zu hause ist.

Klaudia Mattern



Sustainable urban transport indicators: tool for evaluating transport sustainability in the mega cities of Pakistan  

International Nuclear Information System (INIS)

Urban Transport is an important sector to accomplish the goal of sustainable development in Pakistan. This is important because of the high growth of the transport sector's energy consumption, road crashes and greenhouse gas emissions. This becomes significant in the Pakistani cities where motor vehicle fleet is growing at two to three times the rate of population. Transport Policies has resulted high growth of urban road traffic, increasing air and noise pollution throughout the country. This situation raised the question how to achieve sustainable urban transport in the mega cities of Pakistan? Development of sustainable urban transport indicators will provide an opportunity to analyze current transport policies to assess Pakistan progress towards or away from sustainability. Medium Term Development Framework (2005-10) has selected to analyze against establish sustainable urban transport indicators for Pakistan. On the basis of analysis, it has found that MWF has tried to address transport problem in a piecemeal manner, rather than adopting a holistic approach. Implementing MTDF policies on transport is not fully matched with a long term commitment to achieving sustainable development in Pakistan. (author)


Caribou, individual-based modeling and mega-industry in central West Greenland  

DEFF Research Database (Denmark)

Spatial distribution of caribou (Rangifer tarandus groenlandicus) in West Greenland is a result of both short and long term changes in the Arctic landscape. To understand present distribution 40 satellite collars were deployed on 40 female caribou in the Akia-Maniitsoq herd, central West Greenland in 2008. The collars provided GPS-positions with 1-3-hours intervals hence giving detailed information on the spatial distribution of the animals. The detailed information prompt opportunities to introduce statistical models to enhance the understanding of causal effects on the distribution of the caribou in West Greenland. In a newly started PhD-project the focus will be the implementation of spatially explicit individual based modeling (IBM). The project relies on existing knowledge on caribou behavior and feeding ecology along with data on variations in the vegetation. By relating vegetation, snow distribution and caribou in a realistic but manipulable “virtual world” of an IBM it is possible to examine the plausible effects of different environmental impacts on the population dynamics of caribou in West Greenland. The simulations will include introduction of mega-industry, roads, and transmission lines in an area. Further, enhanced or lowered hunting pressure, and changed weather conditions can be studied using IBM. Thus, both short and long term changes in the landscape will be studied and provide insights in how the specific spatial changes impact caribou in West Greenland.

Raundrup, Katrine; Nymand, Josephine


Numerical analysis of the direct drive illumination uniformity for the Laser MegaJoule facility  

Energy Technology Data Exchange (ETDEWEB)

The illumination uniformity provided during the initial imprinting phase of the laser foot pulse in a direct drive scenario at the Laser MegaJoule facility has been analyzed. This study analyzes the quality of the illumination of a spherical capsule and concerns the uniformity of the first shock generate in the absorber of an Inertial Confinement Fusion capsule. Four configurations making use of all or some of the 80 laser beams organized in the 20 quads of the cones at 49° and 131° with respect to the polar axis have been considered in order to assemble the foot pulse. Elliptical and circular super-gaussian laser intensity profiles taking into account beam-to-beam power imbalance (10%), pointing error (50??m), and target positioning (20??m) have been considered. It has been found that the use of the Polar Direct Drive technique can in some cases reduce the irradiation non-uniformity by a factor as high as 50%. In all cases, elliptical profile provides better results in comparison with the circular one and it is shown that the minimum of the non-uniformity is also a function of the capsule radius.

Temporal, M., E-mail: [Centre de Mathématiques et de Leurs Applications, ENS Cachan and CNRS, 61 Av. du President Wilson, F-94235 Cachan Cedex (France); Canaud, B. [CEA, DIF, F-91297 Arpajon Cedex (France); Garbett, W. J. [AWE plc, Aldermaston, Reading, Berkshire RG7 4PR (United Kingdom); Ramis, R. [ETSI Aeronáuticos, Universidad Politécnica de Madrid, 28040 Madrid (Spain)



Experimental studies in a gas embedded Z-pinch operating at mega amperes currents  

International Nuclear Information System (INIS)

A gas embedded Z-pinch has been implemented using the SPEED2 generator (4.1 ?F equivalent Marx generator capacity, 300 kV, 4 MA in short circuit, 187 kJ, 400 ns rise time, dI/dt ? 1013 A/s). Initial conditions to produce a gas embedded Z-pinch suitable to be driven by the SPEED2 and with enhanced stability by means of resistive effects and by finite Larmor radius effects were obtained using a 0-D model. Thus, electrodes were constructed in order to obtain a double column Z-pinch and a hollow discharge. Experiments were carried out in deuterium at mega amperes currents. The diagnostics used are: current derivative and voltage signals, neutron detections using silver activation counters, and He3 detectors; scintillators with photomultilier; and interferograms using a pulse Nd-YAG laser (8 ns FWMH at 532 nm). A plasma column apparently stable is obtained and neutrons have been detected. (author)


Cities in transcontinental context: A comparison of mega urban projects in Shanghai and Belgrade  

Directory of Open Access Journals (Sweden)

Full Text Available This study of urban developments in Belgrade and Shanghai is set in the context of comparative urban research. It presents two ostensibly contrasting cities and briefly examines urban development patterns in China and Serbia before focusing more specifically on mega urban projects in the two cities - Pudong and Hongqiao in Shanghai contrasted with New Belgrade. While the historical genesis of the Chinese and Serbian projects differs markedly, together they provide complementary examples of contemporary entrepreneurial urban development in divergent settings. China and Serbia share a heritage of state ownership of urban land, and this characteristic is still very much a feature underpinning development in Shanghai and other Chinese cities, as well as in New Belgrade. In both territories, state ownership of land has contributed to a form of urban development which - it is argued in this paper - can best be seen as state-based but market-led. The comparative study that this work initiates will, it is hoped, contribute to an understanding of contextual change in the two worlds regions of East Europe and East Asia.

Waley Paul



How soon would the next mega-earthquake occur in Japan?  

Directory of Open Access Journals (Sweden)

Full Text Available The problem of seismic danger estimate in Japan after Tohoku mega-earthquake 11 March of 2011 is considered. The estimates are based on processing low-frequency seismic noise wave-forms from broadband network F-net. A new method of dynamic estimate of seismic danger is used for this problem. The method is based on calculating multi-fractal properties and minimum entropy of squared orthogonal wavelet coefficients for seismic noise. The analysis of the data using notion of “spots of seismic danger” shows that the seismic danger in Japan remains at high level after 2011. 03. 11 within north-east part of Philippine plate—at the region of Nankai Though which traditionally is regarded as the place of strongest earthquakes. It is well known that estimate of time moment of future shock is the most difficult problem in earthquake prediction. In this paper we try to find some peculiarities of the seismic noise data which could extract future danger time interval by analogy with the behavior before Tohoku earthquake. Two possible precursors of this type were found. They are the results of estimates within 1-year moving time window: based on correlation between 2 mean multi-fractal parameters of the noise and based on cluster analysis of annual clouds of 4 mean noise parameters. Both peculiarities of the noise data extract time interval 2013-2014 as the danger.

Alexey Lyubushin



Self-localizing stabilized mega-pixel picoliter arrays with size-exclusion sorting capabilities. (United States)

We report on a liquid self-localizing process capable of producing Mega-pixel arrays of picoliter volumes on a 1 cm(2) area, within seconds, for high throughput sampling. The chip is based on principles of spatially varying wetting and stabilization. The key is to develop differential surface contact regions, which lead to both localization of the solution and increasing the surface adsorption energy to further pin the liquid to the surface, as highlighted by other studies. By exploiting surface roughness for enhanced wettability, we demonstrate wetting of wells with the aspect ratio of 100. The high precision of reactive ion etching (RIE) of silicon substrates allows for an extremely reproducible method of preparing the array of identical well structures and increased contact area to increase surface adsorption in the wells. "Dynamic wetting" is then readily achieved through inducing contact line instability by simply moving a drop of liquid on the top surface of the array. Liquid samples self-localize into the array pattern with the associated liquid flow leading to self-localization of suspended particles or analyte. The resulting picoliter volumes are both spatially ordered and stable for long periods of time, even for such small volumes, to permit selective measurements of the contents. This development will be particularly important in the assembly of the massive amounts of crystalline particles needed for atomically resolved structural dynamics using the latest advances in high number density electron and X-ray sources. PMID:21174439

Zarrine-Afsar, Arash; Müller, Christina; Talbot, Francis O; Miller, R J Dwayne



Dolicomegarterias ilíacas.: Presentación de un caso. Iliac mega-dolicho arteries: Presentation of a case  

Directory of Open Access Journals (Sweden)

Full Text Available Las anomalías del árbol vascular son comunes. Los aneurismas aislados de las arterias ilíacas son de observación bastante rara. Representan un porcentaje escaso de las distintas estadísticas y a menudo se resalta su aislamiento, precisamente para recordar su rareza. Reportamos un caso masculino, de 74 años de edad, que asistió a consulta por presentar síntomas urinarios. Se le realizó un ultrasonido de abdomen, observándose hidronefrosis renal bilateral moderada, además masas complejas una en cada fosa ilíaca. Se le indicó Tomografía Axial Computarizada de abdomen, donde se confirmó la hidronefrosis renal bilateral y aneurismas de ambas arterias ilíacas. Se completó el estudio con un Angiotac, y se demostró que ambas ilíacas estaban tortuosas y dilatadas (DOLICOMEGARTERIAS.Vascular tree anomalies are common. Iliac arteries isolated aneurisms are very unusual. They represent an scarce percent of the different statistics and their isolation is frequently highlighted, precisely to recollect their rareness.We report the case of a male, 74-years-old patient, assisting the consultation with urinary symptoms. An abdominal ultrasound was made, showing moderated bilateral renal hydronephrosis and also complex masses in each iliac fosse. An abdomen computed axial tomography was indicated, confirming the bilateral renal hydronephrosis and aneurisms in both iliac arteries. The study was completed with an Angiotac and it was demonstrated that both iliac arteries were tortuous and dilated ( Mega-dolicho arteries .

Yariana Martínez Sánchez



Assessment of injury from the MEGA BORG oil spill: A case of cooperative damage assessment  

International Nuclear Information System (INIS)

The tanker MEGA BORG exploded while lightering about 60 miles offshore of Galveston, Texas on 8 June 1990. The explosion was followed by a spectacular fire and major release of Angolan crude. Up to 5.1 million gallons of the 41 million gallon cargo was lost to the sea or burning over a period of seven days. Vessel interests took responsibility for the spill and employed skimming and dispersive cleanup techniques. It is estimated that approximately 126 gallons ultimately reached shore in western Louisiana. Within a day of the explosion, the Norwegian vessel owner, French cargo owner and the Norwegian vessel insurer entered into discussion with the Texas Water Commission and the National Oceanic and Atmospheric Administration regarding damage assessment options. Within the next two days the owners agreed to fund and participate in a cooperative preliminary assessment of environmental injury. Five projects were funded to determine whether there was sufficient injury to justify the completion of a full natural resource damage assessment: (1) Fate of spilled oil; (2) Effects on shrimp fishery; (3) Effects on marine mammals and turtles; (4) Effects of beach oiling and (5) Effects on recreation. Funds were also provided for report preparation and project management. Several issues of major concern were considered by vessel interests prior to agreement. Many of these issues are common to consideration of cooperative assessments and may be critical importance to future incideny be critical importance to future incidents particularly if the damage assessment regulations developed pursuant to the Oil Pollution Act encourage cooperative responses


Computed tomography of the cisterna magna and mega cisterna magna in normal children  

Energy Technology Data Exchange (ETDEWEB)

We studied the cisterna magna (CM) on the computed tomography of children under 15 years of age. The scanners were GE-8800RTX and Hitachi CTH, and scanning was carried out parallel to the orbitomeatal line. Those with artifacts were excluded. 5 slices were needed to cover all the posterior fossa in children, but 4 slices were enough in infants, especially those under 6 months of age. 698 cases were included in the former group, and 69, in the latter. The authors estimated the size of the CM on the basis of the position of its tip. 7.1% of the children and 4% of the infants, especially under 6 months of age, had a CM of the full extent (from the foramen magnum to the 5th slice in children and to the 4th one in infants). If we may define a mega cisterna magna (MCM) as a CM more than 2 SD bigger than the mean, then the MCM are included in the groups described above. The MCM had no relationship with age or underlying disorders. The size of the 4th ventricle was, however, rather bigger in the MCM group than the normal CM group, suggesting that the pathogenesis of MCM might be a physiological hypoplasia of the cerebellar vermis. Therefore, no therapy was indicated for this abnormality.

Enomoto, Takao; Nakada, Yoshitaka; Maki, Yutaka (Tsukuba Univ., Sakura, Ibaraki (Japan))



Scandinavian Links: Mega Bridges/Tunnels Linking the Scandinavian Peninsula to the European Continent  

DEFF Research Database (Denmark)

The European Round Table of Industrialists identified in the 1980ies 14 missing links in the transportation network of the continent. Three of them were found around the Danish island of Zealand. One link is within the nation, the other two are between nations. One link connects heavy economic centres, one joins more thinly populated regions, and the last one links peripheral areas. Two of them (The Great Belt Link and the Oresund Link) have been constructed and are in full operation. The third (the Fehmarnbelt Link) has been decided 2008 on bilateral government level. The three links are impressive mega structures spanning international waterways. These waterways between the Baltic Sea and the North Sea have played major roles in history. The length of each of the crossings are around 20 km. The fixed links closes gaps between the Scandinavian and European motorway and rail networks. They concentrate traffic flows and create strong transport corridors. They are the basis of new regional development regimes.“Ferries connect systems, fixed links unite systems”.

Matthiessen, Christian Wichmann; Knowles, Richard D.



Microlensing in M31 - The MEGA Survey's Prospects and Initial Results  

CERN Document Server

January 2000 completes the first season of intensive, wide-field observations of microlensing and stellar variability in M31 by MEGA (Microlensing Exploration of the Galaxy and Andromeda) at the Isaac Newton 2.5m Telescope, the KPNO 4m, and the 1.3m and 2.5m telescopes of MDM Observatory. In preliminary analysis, we detect ~50000 variable objects, including some consistent with microlensing events. We present the level of sensitivity to be reached in our planned three-year program to test for the presence of a significant halo microlensing population in M31, as well as its spatial distribution and mass-function. We also discuss our application of image subtraction to these wide fields and HST WFPC2 Snapshot followup observations to confirm candidates identified from previous years' surveys. We present intermediate results from our smaller-field survey, on the MDM 1.3m and Vatican Advanced Technology 1.8m Telescope, from 1994-1998, wherein we have discovered 8 additional probable microlensing events, over abou...

Crotts, A; Gould, A; Gyuk, G; Sackett, P D; Kuijken, K; Sutherland, W; Widrow, L M



Observational study of aerosol hygroscopic growth factors over rural area near Beijing mega-city  

Directory of Open Access Journals (Sweden)

Full Text Available We investigated aerosol hygroscopic growth property and its influence on scattering coefficient using M9003 nephelometers in coupling with a relative humidity controlled inlet system at a rural site near Beijing mega-city (Jingjintang from 24th April to15th May 2006. Inlet relative humidity was controlled in an increasing range of 40%–90% while the aerosol hygroscopic growth factor, f(RH=80%, varied in a range of 1.07–2.35 during the measurement. Estimated periodic mean values of aerosol hygroscopic growth factors are 1.27–1.34, 1.17–1.23, 1.55–1.59 and 2.33–2.48 for clean, dust, urban pollution and mixed pollution periods respectively. An examination of chemical composition of daily filter samples highlighted that aerosol hygroscopicity was generally enhanced with the increasing ratio of ammonium sulfate (AS to organic matter (OMC. Furthermore, strong hygroscopic organic aerosols were observed on 11th (f(RH=80%=2.23 and 15th (f(RH=80%=2.21 of May with organic carbon proportions of PM2.1 reaching 42.3% and 43.0% respectively. Back-trajectory analysis indicated that solar radiation and vertical convective movement along the air mass pathway might strongly influence the hygroscopic properties of organic matter.

X. L. Pan



Liquid Metal Angiography for Mega Contrast X-ray Visualization of Vascular Network  

CERN Document Server

Visualizing the anatomical vessel networks plays a vital role in physiological or pathological investigations. However, identifying the fine structures of the smallest capillary vessels via conventional imaging ways remains a big challenge. Here, the room temperature liquid metal angiography was proposed for the first time to produce mega contrast X-ray images for multi-scale vasculature mapping. Gallium was used as the room temperature liquid metal contrast agent and perfused into the vessels of in vitro pig hearts and kidneys. We scanned the samples under X-ray and compared the angiograms with those obtained via conventional contrast agent--the iohexol. As quantitatively proved by the gray scale histograms, the contrast of the vessels to the surrounding tissues in the liquid metal angiograms is orders higher than that of the iohexol enhanced images. And the resolution of the angiograms has reached 100{\\mu}m, which means the capillaries can be clearly distinguished in the liquid metal enhanced images. With t...

Wang, Qian; Pan, Keqin; Liu, Jing



IncHI1 plasmids, a dynamic link between resistance and pathogenicity  

Directory of Open Access Journals (Sweden)

Full Text Available Plasmids of incompatibility group (Inc HI1 are important vectors of antibiotic resistance in both of the major causal agents of enteric fever: Salmonella enterica subspecies enterica serovar Typhi and S. Paratyphi A. In S. Typhi, IncHI1 plasmids appeared in the 1970s and spread globally. In some circumstances they are maintained within the bacterial population even in the absence of selection from antibiotics. The low cost associated with IncH plasmids in Salmonella is due, in part, to the presence of a plasmid gene encoding an H-NS-like global regulator which acts co-operatively with chromosomally encoded H-NS. Very recently, IncHI1 plasmids have crossed from S. Typhi into S. Paratyphi A; the acquisition of drug resistance and possibly other phenotypic traits encoded by IncHI1 plasmids has increased the virulence potential of this neglected pathogen. There is no vaccine for S. Paratyphi A and resistance to the current drugs of choice, the fluoroquinolones, is also spreading rapidly. There is a conserved backbone to all IncH plasmids but variation occurs in regions of the plasmids associated with antibiotic resistance. These IncHI1 plasmids are allowing major human pathogens to sample genes available in their environment, the human gut, and will be maintained by enhancing the competitive advantage of the bacterial host. Therefore competition between closely related resistance plasmids will probably increase the transmission of enteric fever by enhancing the fitness of their bacterial hosts.

Minh-Duy Phan, John Wain



Functional analysis of the finO distal region of plasmid R1. (United States)

The intergenic region linking conjugative transfer and replication copy control modules of IncF plasmids shows conservation of gene homology and organization. Genes distal to finO are coordinately expressed with the upstream transfer operon encoding the majority of conjugation genes in related plasmids. Here we investigate potential functions for these genes in copy number control and in processes related to conjugation: gene transfer, pilus specific phage infection and plasmid-promoted biofilm formation by an Escherichia coli host. We find that insertional inactivation of genes in the finO distal region reduced transcriptional read through into the downstream copB gene of plasmid R1. The mutant plasmid derivatives exhibited a reduced copy number compared to the wild type. Moreover all insertion mutant derivatives of plasmid R1-16 with aberrantly low copy numbers conferred poor biofilm forming ability to their hosts. The general mutagenesis thus identified plasmid stability genes as the only plasmid functions besides conjugation genes linked to plasmid-promoted biofilm production under these laboratory conditions. Our findings imply that a novel component of cis- or trans-regulation on the transcriptional level is important to normal R1 plasmid copy number regulation. PMID:21145347

Nuk, Monika R; Reisner, Andreas; Neuwirth, Martina; Schilcher, Katrin; Arnold, Roland; Jehl, Andre; Rattei, Thomas; Zechner, Ellen L



IS257-mediated cointegration in the evolution of a family of staphylococcal trimethoprim resistance plasmids. (United States)

Analyses of the Staphylococcus epidermidis multiresistance plasmids pSK697 and pSK818 have revealed them to be closely related to the trimethoprim resistance plasmid pSK639, also isolated from S. epidermidis. pSK697 and pSK818 were found to contain a cointegrated copy of a second plasmid related to the S. epidermidis multidrug antiseptic and disinfectant resistance plasmid pSK108 and the S. aureus tetracycline resistance plasmid pT181, respectively. In contrast to pSK639, both plasmids were found to contain a third copy of IS257, such that the integrated plasmids in both cases are flanked by a copy of this element. This organization and the presence of duplicated sequences at the extremities of the integrated plasmids implicate IS257 in the formation of these cointegrate plasmids. Sequence analysis of the IS257 elements from these plasmids has provided insights into the probable mechanism of cointegration, viz., nonresolved replicative transposition of IS257. PMID:8830710

Leelaporn, A; Firth, N; Paulsen, I T; Skurray, R A



Investigation of diversity of plasmids carrying the blaTEM-52 gene  

DEFF Research Database (Denmark)

OBJECTIVES: To investigate the diversity of plasmids that carry blaTEM-52 genes among Escherichia coli and Salmonella enterica originating from animals, meat products and humans. METHODS: A collection of 22 blaTEM-52-encoding plasmids was characterized by restriction fragment length polymorphism (RFLP), replicon typing (by PCR or replicon sequencing), susceptibility testing, assessment of plasmid ability to self-transfer by conjugation and typing of the genetic environment of the blaTEM-52 gene. Detected IncI1 plasmids underwent further plasmid multilocus sequence typing. RESULTS: RFLP profiles demonstrated dissemination of blaTEM-52 in Denmark (imported meat from Germany), France, Belgium and the Netherlands from 2000 to 2006 by mainly two different plasmids, one encoding blaTEM-52b (IncX1A, 45 kb) and the other blaTEM-52c (IncI1, 80 kb). In addition, blaTEM-52b was also found to be located on various other plasmids belonging to IncA/C and IncL/M, while blaTEM-52c was found on IncN-like as well as on IncR plasmids. In the majority of cases (n = 21) the blaTEM-52 gene was located on a Tn3 transposon. Seven out of 10 blaTEM-52 plasmids tested in conjugation experiments were shown to be capable of self-transfer to a plasmid-free E. coli recipient. CONCLUSIONS: The blaTEM-52 gene found in humans could have been transmitted on transferable plasmids originating from animal sources. Some of the blaTEM-52 plasmids carry replicons that differ from the classical ones. Two novel replicons were detected, IncX1A and IncN-like. Unlike its predecessor blaTEM-1, the blaTEM-52 gene was not detected on F-type replicons suggesting that this gene evolved on other types of plasmid scaffolds.

Bielak, Eliza Maria; Bergenholtz, Rikke D.



Investigation of diversity of plasmids carrying the blaTEM-52 gene  

DEFF Research Database (Denmark)

Objectives: To investigate the diversity of plasmids that carry blaTEM-52 genes among Escherichia coli and Salmonella enterica originating from animals, meat products and humans. Methods: A collection of 22 blaTEM-52-encoding plasmids was characterized by restriction fragment length polymorphism (RFLP), replicon typing (by PCR or replicon sequencing), susceptibility testing, assessment of plasmid ability to self-transfer by conjugation and typing of the genetic environment of the blaTEM-52 gene. Detected IncI1 plasmids underwent further plasmid multilocus sequence typing. Results: RFLP profiles demonstrated dissemination of blaTEM-52 in Denmark (imported meat from Germany), France, Belgium and the Netherlands from 2000 to 2006 by mainly two different plasmids, one encoding blaTEM-52b (IncX1A, 45 kb) and the other blaTEM-52c (IncI1, 80 kb). In addition, blaTEM-52b was also found to be located on various other plasmids belonging to IncA/C and IncL/M, while blaTEM-52c was found on IncN-like as well as on IncR plasmids. In the majority of cases (n¼21) the blaTEM-52 gene was located on a Tn3 transposon. Seven out of 10 blaTEM-52 plasmids tested in conjugation experiments were shown to be capable of self-transfer to a plasmid-free E. coli recipient. Conclusions: The blaTEM-52 gene found in humans could have been transmitted on transferable plasmids originating from animal sources. Some of the blaTEM-52 plasmids carry replicons that differ from the classical ones. Two novel replicons were detected, IncX1A and IncN-like. Unlike its predecessor blaTEM-1, the blaTEM-52 gene was not detected on F-type replicons suggesting that this gene evolved on other types of plasmid scaffolds.

Bielak, Eliza Maria; Bergenholtz, Rikke D



Role of Plasmid of Pseudomonas putida S3A in Nylon 6 Degradation  

Directory of Open Access Journals (Sweden)

Full Text Available Pseudomonas putida S3A was isolated in previous study and selected for its good ability to degrade nylon 6, nylon 66 and nylon 6 film as a sole source of carbon and nitrogen. Thus, plasmid profile of this bacterium was studied. Results showed that this isolate harbored small plasmid DNA bands. In order to study the role of its plasmid in degradation of nylon 6 film, curing experiment was performed using Sodium Dodecyl Sulfate (SDS and showed that two colonies had lost their ability to degrade nylon 6 film as a sole source of carbon and nitrogen. Plasmid DNA extraction from one of these colonies indicated the loss of plasmid DNA bands and this referred that the plasmid DNA bands could be responsible for degrading of nylon 6 film in P. putida S3A.

Riyam B. Al-Baldawi



Characterization of atypical Aeromonas salmonicida isolates by ribotyping and plasmid profiling  

DEFF Research Database (Denmark)

A total of 38 strains of atypical Aeromonas salmonicida, three oxidase-negative but otherwise typical Aer. salmonicida, three typical Aer. salmonicida, and two reference strains, isolated from several countries and fish species were examined with respect to rRNA gene restriction patterns (ribotypes) and plasmid profiles. Most epidemiologically unrelated strains had different ribotypes, whereas isolates from the same outbreak were identical. All strains, except one, carried one or more large plasmids (>55 kbp) and all strains, except two, additionally carried one or more smaller plasmids. Many strains isolated from the same outbreak showed different plasmid profiles although some plasmids were identical. The results suggest the existence of several atypical Aer, salmonicida. It also seems that ribotypes are stable properties for these bacteria while the plasmids are more labile.

Pedersen, Karl; Dalsgaard, Inger



Plasmid modifications in a tick-borne pathogen, Borrelia burgdorferi, cocultured with tick cells. (United States)

We describe an in vitro system that will facilitate molecular analysis of the association between Lyme disease spirochetes and vector cells. We cocultured Borrelia burgdorferi continuously with two tick cell lines, RAE25 (from Rhipicephalus appendiculatus) and IDE8 (from Ixodes scapularis). A clone isolated after twenty-two passages with RAE25 cells had lost the largest (49 kb) plasmid, and probes containing information normally encoded on it, including genes for two surface proteins, hybridized to smaller plasmids. Spirochetes maintained with IDE 8 cells showed a new 43 kb plasmid that hybridized to a probe made from the 49 kb plasmid. After reisolation from hamsters, these spirochetes carried a large plasmid (100 kb) that hybridized with the 49 kb plasmid. These changes may illustrate a plasticity that enables B. burgdorferi to adapt to different environments. PMID:8269098

Munderloh, U G; Park, Y J; Dioh, J M; Fallon, A M; Kurtti, T J



Occurrence of small Hsd plasmids in Salmonella typhi, Shigella boydii, and Escherichia coli. (United States)

The natural occurrence of small Hsd (host specificity for DNA) plasmids was demonstrated in restriction endonuclease-producing strains of Salmonella typhi, Shigella boydii, and Escherichia coli. The five Hsd plasmids isolated were between 5.0 and 12.2 kilobases long. The copy number of all the Hsd plasmids was high (more than 10 copies per cell). Introduction of these small plasmids into E. coli strain 0 drastically lowered the efficiency of plating of the lambda.0 phages (the efficiency of plating was less than 5 X 10(-5) PFU-1). High restriction endonuclease activities were detected in the Hsd plasmid-positive strains because of the elevated copy numbers of the hsdR+ gene. The advantages of using E. coli strains containing the small Hsd plasmids for purification of type II restriction endonucleases are discussed. PMID:3003023

Yoshida, Y; Mise, K



Brazilian purpuric fever caused by Haemophilus influenzae biogroup aegyptius strains lacking the 3031 plasmid. (United States)

Brazilian purpuric fever (BPF) is a life-threatening pediatric infection caused by Haemophilus influenzae biogroup aegyptius (Hae), an organism formerly associated with only self-limited purulent conjunctivitis. Strains of Hae causing BPF have a 24-MDa plasmid with a specific AccI restriction pattern designated 3031. This plasmid was thought to code for a virulence factor because it had been detected only among Hae strains isolated from BPF cases or their contacts. From 3 typical BPF cases recently identified in São Paulo State, sterile-site Hae isolates were obtained; these isolates were similar to earlier BPF-associated Hae except they did not possess a 3031 plasmid. HindIII restricted chromosomal DNA from these strains was probed with purified 3031 plasmid DNA under high-stringency conditions. There was no evidence that 3031 plasmid DNA had become chromosomally integrated. It appears that the 3031 plasmid does not code for BPF-specific virulence factors. PMID:7798665

Tondella, M L; Quinn, F D; Perkins, B A



Novel, high expressing and antibiotic-controlled plasmid vectors designed for use in gene therapy. (United States)

The promise of effective gene therapy can only be accomplished by high-level expression and regulatable delivery of gene products. To achieve this end, a eukaryotic expression plasmid was modified to make transcription dependent on a tetracycline(Tc)-regulated chimeric transactivator. Mouse muscle injected with this two plasmid cis/trans control system expressed reporter proteins at levels five- to 10-fold greater than the cytomegalovirus immediate-early promoter-controlled parental plasmid. Tetracycline could be useful to either repress or activate transactivator-controlled expression based on the position of the tetO control sequences within the reporter plasmid. Finally, a prototype single plasmid construct was made and shown to express a self-regulating bicistronic transcript containing both the reporter and the transactivator. These Tc-controlled plasmids, termed maximum expression and regulated vectors (MERVs), have the potential to target a variety of gene therapy applications. PMID:8732167

Liang, X; Hartikka, J; Sukhu, L; Manthorpe, M; Hobart, P



Environmental Assessment of Purdue Residence Halls. (United States)

Students (N=1,767) responded to questionnaires examining their perceptions of the living environment in university residence halls in relation to their perceptions of the social climate. General results were positive, with student perceptions of the residence hall environment being favorable in most instances. Compared 1980 and 1981 students'…

Null, Roberta; And Others



20th Annual Residence Hall Construction Report (United States)

Even in difficult economic times, colleges and universities continue to invest in residence hall construction projects as a way to attract new students and keep existing ones on campus. According to data from "American School & University"'s 20th annual Residence Hall Construction Report, the median new project completed in 2008 was less expensive…

Agron, Joe



19th Annual Residence Hall Construction Report (United States)

The construction of residence hall facilities at colleges and universities continues to be strong, as institutions scramble to meet the housing needs and varied demands of a growing student population. This article presents data collected from 39 new residence hall projects completed in 2007. According to American School & University's 19th annual…

Agron, Joe



Selecting Residents in Podiatric Medicine and Surgery. (United States)

Limited information exists to guide students of podiatric medicine and residency directors through the resident selection process. The present study aimed to evaluate the podiatric medicine and surgery resident selection process using an online survey. Residency directors of podiatric medicine and surgery programs across the United States and fourth-year students across all 9 colleges of podiatric medicine were contacted for participation. Two separate surveys were created, one for the directors and one for the students. The directors and students were asked the relative importance of 21 items considered in resident selection on a 7-point importance scale. Subsequent questions covered an array of related topics. The directors, compared with the students, identified the following items as more important (p student, number of classes failed during school, undergraduate experiences and activities, number of Part I board attempts, class rank, involvement in research, and grade point average during podiatric medical school. The manual dexterity portion of the residency interview was considered significantly more important by the students than the directors. The directors more satisfied with their residents placed greater importance on the following items (p attending physicians, and letters of recommendation. Additional trends and differences were also discovered. The results of the present study provide baseline data on the selection of podiatric medicine and surgery residents. PMID:25459090

Shofler, David



Arthroscopic training resources in orthopedic resident education. (United States)

The purpose of this study was to determine the frequency of use, perceived effectiveness, and preference for arthroscopic surgical skill training resources. An electronic survey was sent to orthopedics residents, residency program directors, and orthopedic sports medicine attending physicians in the United States. The frequency and perceived effectiveness of 10 types of adjunctive arthroscopic skills training was assessed. Residents and faculty members were asked to rate their confidence in resident ability to perform common arthroscopic procedures. Surveys were completed by 40 of 152 (26.3%) orthopedic residency program directors, 70 of 426 (16.4%) sports medicine faculty, and 235 of 3,170 (7.4%) orthopedic residents. The use of adjunctive methods of training varied from only 9.8% of programs with virtual reality training to 80.5% of programs that used reading of published materials to develop arthroscopic skill. Practice on cadaveric specimens was viewed as the most effective and preferred adjunctive method of training. Residents trained on cadaveric specimens reported increased confidence in their ability to perform arthroscopic procedures. The resources for developing arthroscopic surgical skill vary considerably across orthopedic residency programs in the United States. Adjunctive training methods were perceived to be effective at supplementing traditional training in the operating room. PMID:24510522

Koehler, Ryan; John, Tamara; Lawler, Jeffrey; Moorman, Claude; Nicandri, Gregg



Suicide Intervention Skills among Japanese Medical Residents (United States)

Objectives: Patient suicide is a tragic occurrence, and it can be a demoralizing experience for medical residents. Few studies, however, have assessed suicide management skills among these front-line healthcare professionals. This study evaluated the self-assessed competence and confidence of medical residents with regard to the management of…

Fujisawa, Daisuke; Suzuki, Yuriko; Kato, Takahiro A.; Hashimoto, Naoki; Sato, Ryoko; Aoyama-Uehara, Kumi; Fukasawa, Maiko; Tomita, Masayuki; Watanabe, Koichiro; Kashima, Haruo; Otsuka, Kotaro



Current Perspectives on Chief Residents in Psychiatry (United States)

Objective: The authors examine qualitative data from outgoing chief residents in psychiatry from the 2004-2005 academic year to 1) determine common characteristics between programs, 2) examine the residents' perspectives on their experiences, and 3) determine their common leadership qualities. Method: The authors sent out self-report surveys via…

Warner, Christopher H.; Rachal, James; Breitbach, Jill; Higgins, Michael; Warner, Carolynn; Bobo, William



Displacing Media: LCD LAB Artistic Residency  


This review refers to an artistic residency which took place at LCD LAB -  CAAA at Guimarães, in March, exploring a strategy for media art called Media Displacement. The text introduces the strategy very briefly and describes the residency's organization, structure, processses and the results produced.

Filipe Pais



Displacing Media: LCD LAB Artistic Residency  

Directory of Open Access Journals (Sweden)

Full Text Available This review refers to an artistic residency which took place at LCD LAB -  CAAA at Guimarães, in March, exploring a strategy for media art called Media Displacement. The text introduces the strategy very briefly and describes the residency's organization, structure, processses and the results produced.

Filipe Pais



Psychiatry Residency Training around the World (United States)

Objective: The authors compare and contrast psychiatry residency training in the United States to that in Canada and selected countries in South America, Europe, and Asia. Method: Nine individuals who are intimately familiar with psychiatry residency training in the United States (primarily chairs, training directors, associate training directors,…

Zisook, Sidney; Balon, Richard; Bjorksten, Karin S.; Everall, Ian; Dunn, Laura; Ganadjian, Krauz; Jin, Hua; Parikh, Sagar; Sciolla, Andres; Sidhartha, Tanuj; Yoo, Tai



Optometric Residency Education: Past, Present and Future. (United States)

Discusses the status of optometric residency education, looking briefly at its history, accreditation, growth, comparison with other professions, program content and enrollment, use of residency as a qualification, entry-level competence, potential for program expansion, and financial resources and pressures. Concludes that much development of…

Haffner, Alden N.



Emotional intelligence in orthopedic surgery residents (United States)

Background Emotional intelligence (EI) is the ability to understand and manage emotions in oneself and others. It was originally popularized in the business literature as a key attribute for success that was distinct from cognitive intelligence. Increasing focus is being placed on EI in medicine to improve clinical and academic performance. Despite the proposed benefits, to our knowledge, there have been no previous studies on the role of EI in orthopedic surgery. We evaluated baseline data on EI in a cohort of orthopedic surgery residents. Methods We asked all orthopedic surgery residents at a single institution to complete an electronic version of the Mayer–Salovey–Caruso Emotional Intelligence Test (MSCEIT). We used completed questionnaires to calculate total EI scores and 4 branch scores. Data were analyzed according to a priori cutoff values to determine the proportion of residents who were considered competent on the test. Data were also analyzed for possible associations with age, sex, race and level of training. Results Thirty-nine residents (100%) completed the MSCEIT. The mean total EI score was 86 (maximum score 145). Only 4 (10%) respondents demonstrated competence in EI. Junior residents (p = 0.026), Caucasian residents (p = 0.009) and those younger than 30 years (p = 0.008) had significantly higher EI scores. Conclusion Our findings suggest that orthopedic residents score low on EI based on the MSCEIT. Optimizing resident competency in noncognitive skills may be enhanced by dedicated EI education, training and testing. PMID:24666445

Chan, Kevin; Petrisor, Brad; Bhandari, Mohit
