WorldWideScience

Sample records for mega plasmid resident

  1. Sequence-based analysis of pQBR103; a representative of a unique, transfer-proficient mega plasmid resident in the microbial community of sugar beet.

    OpenAIRE

    Tett, A.; Spiers, Aj; Crossman, Lc; Ager, D.; Ciric, L.; Dow, Jm; Fry, Jc; Harris, D.; Lilley, A.; Oliver, A.; Parkhill, J.; Quail, Ma; Rainey, Pb; Saunders, Nj; Seeger, K.

    2007-01-01

    The plasmid pQBR103 was found within Pseudomonas populations colonizing the leaf and root surfaces of sugar beet plants growing at Wytham, Oxfordshire, UK. At 425 kb it is the largest self-transmissible plasmid yet sequenced from the phytosphere. It is known to enhance the competitive fitness of its host, and parts of the plasmid are known to be actively transcribed in the plant environment. Analysis of the complete sequence of this plasmid predicts a coding sequence (CDS)-rich genome contain...

  2. Cereulide synthetase gene cluster from emetic Bacillus cereus: Structure and location on a mega virulence plasmid related to Bacillus anthracis toxin plasmid pXO1

    Directory of Open Access Journals (Sweden)

    Wagner Martin

    2006-03-01

    Full Text Available Abstract Background Cereulide, a depsipeptide structurally related to valinomycin, is responsible for the emetic type of gastrointestinal disease caused by Bacillus cereus. Recently, it has been shown that this toxin is produced by a nonribosomal peptide synthetase (NRPS, but its exact genetic organization and biochemical synthesis is unknown. Results The complete sequence of the cereulide synthetase (ces gene cluster, which encodes the enzymatic machinery required for the biosynthesis of cereulide, was dissected. The 24 kb ces gene cluster comprises 7 CDSs and includes, besides the typical NRPS genes like a phosphopantetheinyl transferase and two CDSs encoding enzyme modules for the activation and incorporation of monomers in the growing peptide chain, a CDS encoding a putative hydrolase in the upstream region and an ABC transporter in the downstream part. The enzyme modules responsible for incorporation of the hydroxyl acids showed an unusual structure while the modules responsible for the activation of the amino acids Ala and Val showed the typical domain organization of NRPS. The ces gene locus is flanked by genetic regions with high homology to virulence plasmids of B. cereus, Bacillus thuringiensis and Bacillus anthracis. PFGE and Southern hybridization showed that the ces genes are restricted to emetic B. cereus and indeed located on a 208 kb megaplasmid, which has high similarities to pXO1-like plasmids. Conclusion The ces gene cluster that is located on a pXO1-like virulence plasmid represents, beside the insecticidal and the anthrax toxins, a third type of B. cereus group toxins encoded on megaplasmids. The ces genes are restricted to emetic toxin producers, but pXO1-like plasmids are also present in emetic-like strains. These data might indicate the presence of an ancient plasmid in B. cereus which has acquired different virulence genes over time. Due to the unusual structure of the hydroxyl acid incorporating enzyme modules of Ces, substantial biochemical efforts will be required to dissect the complete biochemical pathway of cereulide synthesis.

  3. Insertion element IS102 resides in plasmid pSC101.

    OpenAIRE

    Ohtsubo, H.; Zenilman, M; Ohtsubo, E

    1980-01-01

    In vivo recombination was found to occur between plasmid pHS1, a temperature-sensitive replication mutant of pSC101 carrying tetracycline resistance, and plasmid ColE1 after selection for tetracycline resistance at the restrictive temperature, 42 degrees C. Extensive analysis of the physical structures of three of these recombinant plasmids, using restriction endonucleases and the electron microscope heteroduplex method, revealed that the plasmid pHS1 was integrated into different sites on Co...

  4. Resident enhanced repair: novel repair process action on plasmid DNA transformed into Escherichia coli K-12

    International Nuclear Information System (INIS)

    The survival of UV-irradiated DNA of plasmid NTP16 was monitored after its transformation into recipient cells containing an essentially homologous undamaged plasmid, pLV9. The presence of pLV9 resulted in a substantial increase in the fraction of damaged NTP16 molecules which survived in the recipient cells. This enhanced survival requires the host uvrA+ and uvrB+ gene products, but not the host recA+ gene product. The requirement for both homologous DNA and the uvrA+ gene products suggests that a novel repair process may act on plasmid DNA. Possible mechanisms for this process are considered

  5. Resident enhanced repair: novel repair process action on plasmid DNA transformed into Escherichia coli K-12.

    OpenAIRE

    Strike, P; Roberts, R. J.

    1982-01-01

    The survival of UV-irradiated DNA of plasmid NTP16 was monitored after its transformation into recipient cells containing an essentially homologous undamaged plasmid, pLV9. The presence of pLV9 resulted in a substantial increase in the fraction of damaged NTP16 molecules which survived in the recipient cells. This enhanced survival requires the host uvrA+ and uvrB+ gene products, but not the host recA+ gene product. The requirement for both homologous DNA and the uvrA+ and uvrB+ gene products...

  6. Examination of residence time and its relevance to water quality within a coastal mega-structure: The Palm Jumeirah Lagoon

    Science.gov (United States)

    Cavalcante, Geórgenes H.; Kjerfve, Björn; Feary, David A.

    2012-10-01

    SummaryA numerical modeling study was carried out to compute average residence time in the semi-enclosed lagoon formed by the man-made island Palm Jumeirah (Dubai, United Arab Emirates), termed Palm Jumeirah Lagoon (PJL). The PJL encompasses a main island axis with 17 'fronds' radiating from this axis, all encapsulated within a semi-circular breakwater system. A coupled hydrodynamic and solute transport model was developed for the waters of the PJL, based on depth-integrated conservation equations. Numerical model predictions were then verified against a set of field-measured hydrodynamic data. Model-predicted water elevations and velocities were in good agreement with field measurements. Residence times for this tidal dominated system were investigated through numerical experiments using a conservative tracer as a surrogate. The results indicated that average residence time varied spatially throughout the PJL depending on tidal flushing. Average residence time was unequally distributed throughout the PJL, with the eastern side showing higher flushing times than the western side. In addition, there were also differences between sections of the PJL in average residence time of a tracer: between frond tips and the surrounding breakwater the tracer was reduced to 30-40% of its original value after approximately 1 week, while a tracer placed between the fronds was reduced to 30-40% of its value after 20 days. The findings of this research provide vital information for understanding the water transport process in this man-made lagoon, and will be important in assessing the potential impact on coastal water quality conditions in coastal developments within the Middle East.

  7. Transporting Mega-Events to Sustainability: Assessing behaviors and attitudes of tourists and residents to promote sustainable mobility for 2014 Fifa World Cup

    OpenAIRE

    Mendes Malhado, Acácia Cristina

    2012-01-01

    Die Chance, eine Sport Mega-Veranstaltung wie die FIFA Weltmeisterschaft (WM) durchzuführen, bietet für Brasilien, besonders für die Stadt Manaus, drei mögliche Wege, zu wachsen. Erstens gibt es die Planungsphase, die vorbereitende Aktivitäten einschließt, wie z.B. infrastrukturelle Verbesserungen, um die FIFA WM durchführen zu können; zweitens die Phase nach der Veranstaltung, die von Langzeit Vorteilen begleitet ist; wie bei einer schnellen Entwicklung und Verbesserung eines effizie...

  8. Conduction of pEC22, a plasmid coding for MR.EcoT22I, mediated by a resident Tn3-like transposon, Tn5396.

    OpenAIRE

    Elhai, J.; Cai, Y.; Wolk, C. P.

    1994-01-01

    pEC22 is a small plasmid that encodes the restriction-modification system MR.EcoT22I. Restriction and functional analysis of the plasmid identified the positions of genes encoding that system. The plasmid is able to be conducted by conjugal plasmids, a process mediated by a transposon contained within pEC22. This cryptic transposon, called Tn5396, was isolated from pEC22 and partially sequenced. The sequence of Tn5396 is for the most part typical of transposons of the Tn3 family and is most s...

  9. BACTERIAL PLASMIDS

    Directory of Open Access Journals (Sweden)

    Marina Dinic

    2007-12-01

    Full Text Available Plasmids, extrachromosomal DNA, were identified in bacteria pertaining to family of Enterobacteriacae for the very first time. After that, they were discovered in almost every single observed strain. The structure of plasmids is made of circular double chain DNA molecules which are replicated autonomously in a host cell. Their length may vary from few up to several hundred kilobase (kb. Among the bacteria, plasmids are mostly transferred horizontally by conjugation process. Plasmid replication process can be divided into three stages: initiation, elongation, and termination. The process involves DNA helicase I, DNA gyrase, DNA polymerase III, endonuclease, and ligase.Plasmids contain genes essential for plasmid function and their preservation in a host cell (the beginning and the control of replication. Some of them possess genes whichcontrol plasmid stability. There is a common opinion that plasmids are unnecessary fora growth of bacterial population and their vital functions; thus, in many cases they can be taken up or kicked out with no lethal effects to a plasmid host cell. However,there are numerous biological functions of bacteria related to plasmids. Plasmids identification and classification are based upon their genetic features which are presented permanently in all of them, and these are: abilities to preserve themselves in a host cell and to control a replication process. In this way, plasmids classification among incompatibility groups is performed. The method of replicon typing, which is based on genotype and not on phenotype characteristics, has the same results as in compatibility grouping.

  10. Muonium and MEGA

    International Nuclear Information System (INIS)

    Two types of experiments on muonium are described. The first measures the hyperfine structure interval in muonium, and the second measures the Lamb shift. Another type of experiment is described which searches for the transition (?+e-)?(?-e+). The MEGA experiment is then discussed which searches for the reaction ? ? e + ?. 13 figs., 3 refs

  11. Mega cisterna magna

    International Nuclear Information System (INIS)

    Computerized tomography (CT) has made it possible to discover various uncommon intracranial structures and to elucidate the morbidity of these pathophysiological conditions. The mega cisterna magna is an example of such a structure being widely known, but the incidence and morbidity being uncertain. Since the mega cisterna magna has shown no special symptoms and signs and does not require any surgical treatment, it was not necessary to diagnose it property before the establishment of routine examination by CT. From April 1979 to June 1980; a total of 2089 patients were examined by CT; of these, 9 cases (0.43%) of mega cisterna magna were identified. The symptoms and signs of those 9 patients were headache, vertigo, nausea, right hemiparesis, convulsive seizure, hyperventilation syndrome, and tremor. One patient was examined for head injury. A plain craniogram revealed a thinness of the occipital bone in 2 cases. The sizes of the mega cisterna magna appearing on CT were from 1.0 x 1.5 cm to 3.5 x 4.0 cm at the level of +40 -60 mm from the plane of the 00 OM line. The craniotomy was performed on one patient who was suspected of having arachnoiditis in the posterior fossa. (J.P.N.)

  12. Recurring Klebsiella pneumoniae Pyogenic Liver Abscesses in a Resident of San Diego, California, Due to a K1 Strain Carrying the Virulence Plasmid ?

    OpenAIRE

    Fierer, Joshua; Walls, Lorraine; Chu, Pauline

    2011-01-01

    We report a diabetic patient who had three episodes of cryptogenic liver abscess due to Klebsiella pneumoniae. He was a Caucasian who lived in California and had no epidemiological connection to East Asia. The isolate from his third episode was a hyperviscous K1 strain that carried the Klebsiella virulence plasmid.

  13. Photon detector for MEGA

    International Nuclear Information System (INIS)

    The MEGA photon detector is designed to observe the 52.83-MeV photon produced in a ? ? e? decay with an energy resolution of 1.25 MeV, a position resolution of 2 x 5 mm2, a directional resolution of 10 degree, a time resolution of 500 ps, and an efficiency of about 5.4%. It will consist of three independent concentric cylindrical pair spectrometers mounted within a 1.5 T magnetic field produced by a superconducting solenoid magnet. Each pair spectrometer includes two thin Pb foils to convert photons into e+e- pairs. The two smaller pair spectrometers will have three drift chamber layers to track the e+e- pairs and thereby determine both their locations and their vector momenta. The third pair spectrometer will have four layers of drift chamber, together with a larger turning region, to provide better tracking information for high energy photons. The inner drift chamber layer in each of the spectrometers includes a delay line cathode to determine the z coordinates needed for track reconstruction. An MWPC located between the two Pb layers identifies the conversion layer so that energy loss corrections may be applied, while plastic scintillators provide timing information. During the past year, efforts have focused primarily on software development, completion of the delay line tests, and development of electronics for the scintillators and delay line read-out. Optical windows were glued onto the light guides required for the third pair spectrometer. In addition, major contributions were made to the development of a proposal to measure the Michel parameter, ?, using the MEGA positron detectors

  14. Photon detector for MEGA

    International Nuclear Information System (INIS)

    During the past year, we have continued work on the photon detector for the MEGA experiment at Los Alamos, a search for the rare decay ? ? e? to a sensitivity of a few parts in 1013. The MEGA photon detector is designed to observe the 52.38 MeV photon produced in a ? ? e? decay with an energy resolution of 1.25 MeV, a position resolution of 2 x 5 mm2, a directional resolution of 10 degrees, a time resolution of 500 ps, and an efficiency of 7%. It will consists of four independent concentric cylindrical pair spectrometers mounted within a 1.5 T magnetic field produced by a superconducting solenoid magnet. Each pair spectrometer includes two thin Pb foils to convert photons into e+e- pairs, and thereby, determine both their locations and their vector momenta. The inner drift chamber layer includes a delay line cathode to determine the z coordinates needed for track reconstruction. An MWPC located between two Pb layers identifies the conversion layer so that energy loss corrections may be applied, while plastic scintillators provide timing information. Our, group together with a group from the University of Houston, is responsible for the design and construction of the photon detector, as well as developing the computer codes necessary for Monte Carlo simulations and data analysis. During the past year, our efforts have focused primarily on two tasks, delay line cathode read-out and software development. This report describes our recent work on delay lines and data analysis along with a discussion of the new plans for multiplexing in the photon arm

  15. Photon detector for MEGA

    International Nuclear Information System (INIS)

    During this past August and September, we had beam time at LAMPF for an engineering study of the second prototype cylindrical photon pair spectrometer for MEGA. All of the scintillators in the detector, a total of 40, and 40% of the drift chamber cells were instrumented for this run. The main photon arm activities during the run were to compare event patterns in the chamber to our Monte Carlo generated events, to study the trigger rate and to determine the background rates in the various detector elements. At low beam intensity, the event patterns from the chamber closely resembled those generated from the Monte Carlo. The background rates in the scintillators and the innermost drift chamber layer were close to those anticipated from previous studies. However the background rates in the outer two drift chamber layers were substantially higher than we had expected. This high rate was traced to low energy photons interacting with field and sense wires. The trigger studies during the run have led us to consider alternative strategies including two different first stage triggers and a second stage trigger. The combination of the second stage trigger with either of the two first stage triggers is expected to provide good detection efficiency while keeping the raw trigger rate below that required by the data acquisition system. Detailed discussions of both the background and trigger studies are discussed in this report. Since the run, our work on methods to obtain the z-position in the photon arm drift chambers has continued. Our goal is to obtain the z coordinate to 5 mm FWHM. At this level, the z uncertainty makes a negligible contribution to the overall photon energy resolution and only a small contribution to the angular resolution. We have been studying an option which uses delay lines to provide a direct z determination. The results of our study are discussed in this report

  16. Groundwater sustainability in Asian Mega city

    Science.gov (United States)

    Taniguchi, M.

    2009-12-01

    Population increased in many Asian coastal cities, and increased demand of groundwater as water resources caused many subsurface environments. Subsurface environmental problems such as land subsidence due to excessive pumping, groundwater contamination and subsurface thermal anomaly, have occurred repeatedly in Asian mega cities with a time lag depending on the development stage of urbanization. This study focus on four subjects; urban, water, heat, and material in subsurface environment, and intensive field observations and data collections had been made in the basins including Tokyo, Osaka, Bangkok, Jakarta, Manila, Seoul, and Taipei. The new methods for evaluating the changes in groundwater storage by gravimeter measurements in situ and Satellite GRACE, and residence time evaluation by 85Kr and CFCs, have been developed in this study. The combined effects of heat island and global warming from subsurface temperature in Asian mega cities evaluated the magnitude and timing of the urbanization which were preserved in subsurface thermal environment. The effects of law/institution on change in reliable water resources between groundwater and surface water, have been also investigated. The groundwater is “private water”, on the other hand, the surface water is “public water”. Regulation of groundwater pumping due to serious land subsidence did not work without alternative water resources, and the price of water is another major factor for the change in reliable water resources between groundwater and surface water. Land use/cover changes at three ages (1940’s, 1970’s and 2000’s) have been analyzed based on GIS with 0.5 km grid at seven targeted cities. The development of integrated indicators based on GIS for understanding the relationship between human activities and subsurface environment have been made in this study. Finally, we address the sustainable use of groundwater and subsurface environments for better future development and human well-being.

  17. Plasmid Mediated Chromate Resistance in Bacteria Isolated from Industrial Waste

    Directory of Open Access Journals (Sweden)

    Sikander Sultan

    2005-01-01

    Full Text Available In order to study the genetic basis and mechanism of chromate resistance in chromate resistant bacteria, conjugal transfer as well as curing of plasmids in these bacteria and its effect on chromium uptake are being investigated. From the effluent of Shafiq Tannery, Kasur, Pakistan, four bacterial strains STCr-1, STCr-2, STCr-3 and STCr-4 which could endure 40 mg mL-1 of potassium chromate in nutrient agar medium were isolated. All of them were gram negative, aerobic and motile rods. One strain STCr-1 was identified as Ochrobactrum species by 16S rRNA gene sequence homology. Each strain harboured a single conjugative plasmid, which conferred resistance to chromate. Maximum plasmid transfer was recorded after 24 h of mating except for plasmid residing in STCr-3 (pSH1322, which transferred maximally after 16 h of mating. The plasmids harboring STCr-1 (pSH1320, STCr-3 (pSH1322 and STCr-4 (pSH1323 manifested highest transfer frequency at donor:recipient ratio 1, while plasmid resident of STCr-2 (pSH1321 preferred donor:recipient ratio 5. Transfer frequency of plasmids pSH1320 and pSH1322 was maximal at 28°C and that of pSH1321 and pSH1323 at 37°C. Optimum pH for plasmid transfer was 8 for these plasmids except pSH1320, which opted for pH 6 or 7. Curing of chromate resistant plasmids from these strains was achieved with SDS at high temperature and curing of plasmid was associated with the loss of chromate resistance phenotype. A comparison of Cr uptake by the parental strains and their cured derivatives revealed that plasmids in these strains express high level resistance to chromate by exerting stringent control on the accumulation/uptake of Cr.

  18. Plasmid segregation mechanisms

    DEFF Research Database (Denmark)

    Ebersbach, Gitte; Gerdes, Kenn

    2005-01-01

    Bacterial plasmids encode partitioning (par) loci that ensure ordered plasmid segregation prior to cell division. par loci come in two types: those that encode actin-like ATPases and those that encode deviant Walker-type ATPases. ParM, the actin-like ATPase of plasmid R1, forms dynamic filaments that segregate plasmids paired at mid-cell to daughter cells. Like microtubules, ParM filaments exhibit dynamic instability (i.e., catastrophic decay) whose regulation is an important component of the DNA segregation process. The Walker box ParA ATPases are related to MinD and form highly dynamic, oscillating filaments that are required for the subcellular movement and positioning of plasmids. The role of the observed ATPase oscillation is not yet understood. However, we propose a simple model that couples plasmid segregation to ParA oscillation. The model is consistent with the observed movement and localization patterns of plasmid foci and does not require the involvement of plasmid-specific host-encoded factors.

  19. Construction and Use of Flow Cytometry Optimized Plasmid-Sensor Strains : Genomes in Flux

    DEFF Research Database (Denmark)

    Bahl, Martin Iain; Oregaard, Gunnar

    2009-01-01

    Determining the stability of plasmids in bacterial populations is traditionally performed by isolating a large number of clones followed by screening for the presence of plasmids by replica transfer to plasmid-selective agar plates. This is often a laborious task, especially when the intrinsic stability of the plasmid is high. The method presented here relies on a phenotypic (green fluorescence protein) marker, which is switched on if the host bacteria loses the residing plasmid. The incorporation of flow cytometry for single-cell detection and discrimination between plasmid-free and plasmid-harboring cells in a bacterial population facilitates a very high throughput of cells and thus provides excellent sensitivity and statistics toward detecting even very low levels of plasmid instability.

  20. Structuring a mega-project

    Energy Technology Data Exchange (ETDEWEB)

    Kutryk, T. [Husky Oil Operations Ltd., Calgary, AB (Canada)

    2004-07-01

    This paper presented an overview of mega-project management. Issues concerning scope, cost and schedule were discussed, with reference to the idea that a choice must be made from the outset as to which of the 3 is a main priority. The importance of preparation and the development of a fully resourced plan was emphasized. The use of the parametric 4-D model was discussed. Lessons that the construction industry may learn from manufacturers were presented along with issues of contract development and the role and importance of the project manager. Issues concerning performance measurement were reviewed, including lagging indicators. Project division factors were also discussed, with reference to data lags, naturally concurrent processes and over the fence units. A case study of Walmart was presented. Project design packages and long lead time items were discussed, as were issues concerning human resources. Functional units were examined in relation to zones of influence and unit integration. Various combinations of zones of influence were presented. Issues concerning span of control and varying relationships within a project were discussed. It was emphasized that great deeds can be accomplished by attracting the best people. tabs., figs.

  1. Chlamydial plasmids and bacteriophages.

    Science.gov (United States)

    Pawlikowska-Warych, Ma?gorzata; ?liwa-Dominiak, Joanna; Deptu?a, Wies?aw

    2015-01-01

    Chlamydia are absolute pathogens of humans and animals; despite being rather well recognised, they are still open for discovery. One such discovery is the occurrence of extrachromosomal carriers of genetic information. In prokaryotes, such carriers include plasmids and bacteriophages, which are present only among some Chlamydia species. Plasmids were found exclusively in Chlamydia (C.) trachomatis, C. psittaci, C. pneumoniae, C. suis, C. felis, C. muridarum and C. caviae. In prokaryotic organisms, plasmids usually code for genes that facilitate survival of the bacteria in the environment (although they are not essential). In chlamydia, their role has not been definitely recognised, apart from the fact that they participate in the synthesis of glycogen and encode proteins responsible for their virulence. Furthermore, in C. suis it was evidenced that the plasmid is integrated in a genomic island and contains the tetracycline-resistance gene. Bacteriophages specific for chlamydia (chlamydiaphages) were detected only in six species: C. psittaci, C. abortus, C. felis, C. caviae C. pecorum and C. pneumoniae. These chlamydiaphages cause inhibition of the developmental cycle, and delay transformation of reticulate bodies (RBs) into elementary bodies (EBs), thus reducing the possibility of infecting other cells in time. Plasmids and bacteriophages can be used in the diagnostics of chlamydioses; although especially in the case of plasmids, they are already used for detection of chlamydial infections. In addition, bacteriophages could be used as therapeutic agents to replace antibiotics, potentially addressing the problem of increasing antibiotic-resistance among chlamydia. PMID:25654356

  2. Innovative European Solutions in Managing the Mega-Crisis

    Science.gov (United States)

    Steinhäusler, Friedrich

    2014-07-01

    The following sections are included: * INTRODUCTION * PREPAREDNESS LEVEL IN EU MEMBER STATES * OPERATIONAL CHALLENGES DUE TO MEGA-CRISIS * REQUIREMENTS FOR MANAGING A MEGA-CRISIS * INNOVATIVE ENDUSER FRIENDLY SOLUTIONS * CONCLUSIONS

  3. Plasmids encoding therapeutic agents

    Energy Technology Data Exchange (ETDEWEB)

    Keener, William K. (Idaho Falls, ID)

    2007-08-07

    Plasmids encoding anti-HIV and anti-anthrax therapeutic agents are disclosed. Plasmid pWKK-500 encodes a fusion protein containing DP178 as a targeting moiety, the ricin A chain, an HIV protease cleavable linker, and a truncated ricin B chain. N-terminal extensions of the fusion protein include the maltose binding protein and a Factor Xa protease site. C-terminal extensions include a hydrophobic linker, an L domain motif peptide, a KDEL ER retention signal, another Factor Xa protease site, an out-of-frame buforin II coding sequence, the lacZ.alpha. peptide, and a polyhistidine tag. More than twenty derivatives of plasmid pWKK-500 are described. Plasmids pWKK-700 and pWKK-800 are similar to pWKK-500 wherein the DP178-encoding sequence is substituted by RANTES- and SDF-1-encoding sequences, respectively. Plasmid pWKK-900 is similar to pWKK-500 wherein the HIV protease cleavable linker is substituted by a lethal factor (LF) peptide-cleavable linker.

  4. Persistence Mechanisms of Conjugative Plasmids

    DEFF Research Database (Denmark)

    Bahl, Martin Iain; Hansen, Lars H.

    2009-01-01

    Are plasmids selfish parasitic DNA molecules or an integrated part of the bacterial genome? This chapter reviews the current understanding of the persistence mechanisms of conjugative plasmids harbored by bacterial cells and populations. The diversity and intricacy of mechanisms affecting the successful propagation and long-term continued existence of these extra-chromosomal elements is extensive. Apart from the accessory genetic elements that may provide plasmid-harboring cells a selective advantage, special focus is placed on the mechanisms conjugative plasmids employ to ensure their stable maintenance in the host cell. These importantly include the ability to self-mobilize in a process termed conjugative transfer, which may occur across species barriers. Other plasmid stabilizing mechanisms include the multimer resolution system, active partitioning, and post-segregational-killing of plasmid-free cells. Finally, various molecular adaptations of plasmids to better match the genetic background of their bacterial host cell will be described.

  5. An improved method for including upper size range plasmids in metamobilomes

    DEFF Research Database (Denmark)

    Norman, Anders; Riber, Leise

    2014-01-01

    Two recently developed isolation methods have shown promise when recovering pure community plasmid DNA (metamobilomes/plasmidomes), which is useful in conducting culture-independent investigations into plasmid ecology. However, both methods employ multiple displacement amplification (MDA) to ensure suitable quantities of plasmid DNA for high-throughput sequencing. This study demonstrates that MDA greatly favors smaller circular DNA elements (10 Kbp). Throughout the study, we used two model plasmids, a 4.4 Kbp cloning vector (pBR322), and a 56 Kbp conjugative plasmid (pKJK10), to represent lower- and upper plasmid size ranges, respectively. Subjecting a mixture of these plasmids to the overall isolation protocol revealed a 34-fold over-amplification of pBR322 after MDA. To address this bias, we propose the addition of an electroelution step that separates different plasmid size ranges prior to MDA in order to reduce size-dependent competition during incubation. Subsequent analyses of metamobilome data from wastewater spiked with the model plasmids showed in silica recovery of pKJK10 to be very poor with the established method and a 1,300-fold overrepresentation of pBR322. Conversely, complete recovery of pKJK10 was enabled with the new modified protocol although considerable care must be taken during electroelution to minimize cross-contamination between samples. For further validation, non-spiked wastewater metamobilomes were mapped to more than 2,500 known plasmid genomes. This displayed an overall recovery of plasmids well into the upper size range (median size: 30 kilobases) with the modified protocol. Analysis of de novo assembled metamobilome data also suggested distinctly better recovery of larger plasmids, as gene functions associated with these plasmids, such as conjugation, was exclusively encoded in the data output generated through the modified protocol. Thus, with the suggested modification, access to a large uncharacterized pool of accessory elements that reside on medium-to-large plasmids has been improved. © 2014 Norman et al.

  6. Vishal Mega-Mart- An Overview

    OpenAIRE

    Shikha Gupta; Preeti Khatri; Kapil Gulati; Santosh Chauhan

    2010-01-01

    In the background of high consumerism and income of the urban consumers, in recent year, a number of companies have expressed their interest towards retail sector outlets. As a result, numbers of shopping malls have started their operations in metro and urban areas. Pantaloon, big bazaar, Vishal Mega Mart, Reliance Fresh are the best known examples of retail sector outlets in India.Retailing is the interface between the producer and the individual consumer buying for personal consumption. Thi...

  7. MEGA: A search for the decay ??e?

    International Nuclear Information System (INIS)

    The MEGA experiment is designed to search for the rare decay ??e? with a branching ratio sensitivity of ?5x10-13. Production data have been taken during 1992 and 1993, and the detector is working as expected. Following a complete analysis, the present data set should represent an improvement of 12--15 in sensitivity over the previous limit of ??e?. copyright 1995 American Institute of Physics

  8. Construction of the MEGA photon detector

    International Nuclear Information System (INIS)

    The construction techniques used in the development of a set of large pair spectrometers for the MEGA detector are discussed. These spectrometers consist of carbon-fiber-composit cylinders on which the conversion foils are mounted, and appropriately spaced wire chambers in each layer which track the conversion leptons. Close tolerances on all dimensions are maintained. The detector has been operating well in the stopped muon beam line at LAMPF. ((orig.))

  9. Plasmid mapping computer program.

    OpenAIRE

    Nolan, G P; Maina, C V; Szalay, A A

    1984-01-01

    Three new computer algorithms are described which rapidly order the restriction fragments of a plasmid DNA which has been cleaved with two restriction endonucleases in single and double digestions. Two of the algorithms are contained within a single computer program (called MPCIRC). The Rule-Oriented algorithm, constructs all logical circular map solutions within sixty seconds (14 double-digestion fragments) when used in conjunction with the Permutation method. The program is written in Apple...

  10. In Silico Detection and Typing of Plasmids using PlasmidFinder and Plasmid Multilocus Sequence Typing

    DEFF Research Database (Denmark)

    Carattoli, Alessandra; Zankari, Ea

    2014-01-01

    In the work presented here, we designed and developed two easy-to-use Web tools for in silico detection and characterization of whole-genome sequence (WGS) and whole-plasmid sequence data from members of the family Enterobacteriaceae. These tools will facilitate bacterial typing based on draft genomes of multidrug-resistant Enterobacteriaceae species by the rapid detection of known plasmid types. Replicon sequences from 559 fully sequenced plasmids associated with the family Enterobacteriaceae in the NCBI nucleotide database were collected to build a consensus database for integration into a Web tool called PlasmidFinder that can be used for replicon sequence analysis of raw, contig group, or completely assembled and closed plasmid sequencing data. The PlasmidFinder database currently consists of 116 replicon sequences that match with at least at 80% nucleotide identity all replicon sequences identified in the 559 fully sequenced plasmids. For plasmid multilocus sequence typing (pMLST) analysis, a database that is updated weekly was generated from www.pubmlst.org and integrated into a Web tool called pMLST. Both databases were evaluated using draft genomes from a collection of Salmonella enterica serovar Typhimurium isolates. PlasmidFinder identified a total of 103 replicons and between zero and five different plasmid replicons within each of 49 S. Typhimurium draft genomes tested. The pMLST Web tool was able to subtype genomic sequencing data of plasmids, revealing both known plasmid sequence types (STs) and new alleles and ST variants. In conclusion, testing of the two Web tools using both fully assembled plasmid sequences and WGS-generated draft genomes showed them to be able to detect a broad variety of plasmids that are often associated with antimicrobial resistance in clinically relevant bacterial pathogens.

  11. Growth dependence of conjugation explains limited plasmid invasion in biofilms: an individual?based modelling study

    DEFF Research Database (Denmark)

    Merkey, Brian; Lardon, Laurent

    2011-01-01

    Plasmid invasion in biofilms is often surprisingly limited in spite of the close contact of cells in a biofilm. We hypothesized that this poor plasmid spread into deeper biofilm layers is caused by a dependence of conjugation on the growth rate (relative to the maximum growth rate) of the donor. By extending an individual?based model of microbial growth and interactions to include the dynamics of plasmid carriage and transfer by individual cells, we were able to conduct in silico tests of this and other hypotheses on the dynamics of conjugal plasmid transfer in biofilms. For a generic model plasmid, we find that invasion of a resident biofilm is indeed limited when plasmid transfer depends on growth, but not so in the absence of growth dependence. Using sensitivity analysis we also find that parameters related to timing (i.e. a lag before the transconjugant can transfer, transfer proficiency and scan speed) and spatial reach (EPS yield, conjugal pilus length) are more important for successful plasmid invasionthan the recipients' growth rate or the probability of segregational loss. While this study identifies one factor that can limit plasmid invasion in biofilms, the new individual?based framework introduced in this work is a powerful tool that enables one to test additional hypotheses on the spread and role of plasmids in microbial biofilms.

  12. Plasmid-mediated transformation of Streptococcus mutans.

    OpenAIRE

    Kuramitsu, H. K.; Long, C. M.

    1982-01-01

    Streptococcus mutans GS-5 was transformed to erythromycin resistance with streptococcal plasmid pVA736. Transformation frequencies were higher with plasmids reisolated from transformed GS-5 cells relative to plasmid originally derived from S. sanguis Challis.

  13. Plasmid Rolling-Circle Replication.

    Science.gov (United States)

    Ruiz-Masó, J A; MachóN, C; Bordanaba-Ruiseco, L; Espinosa, M; Coll, M; Del Solar, G

    2015-02-01

    Plasmids are DNA entities that undergo controlled replication independent of the chromosomal DNA, a crucial step that guarantees the prevalence of the plasmid in its host. DNA replication has to cope with the incapacity of the DNA polymerases to start de novo DNA synthesis, and different replication mechanisms offer diverse solutions to this problem. Rolling-circle replication (RCR) is a mechanism adopted by certain plasmids, among other genetic elements, that represents one of the simplest initiation strategies, that is, the nicking by a replication initiator protein on one parental strand to generate the primer for leading-strand initiation and a single priming site for lagging-strand synthesis. All RCR plasmid genomes consist of a number of basic elements: leading strand initiation and control, lagging strand origin, phenotypic determinants, and mobilization, generally in that order of frequency. RCR has been mainly characterized in Gram-positive bacterial plasmids, although it has also been described in Gram-negative bacterial or archaeal plasmids. Here we aim to provide an overview of the RCR plasmids' lifestyle, with emphasis on their characteristic traits, promiscuity, stability, utility as vectors, etc. While RCR is one of the best-characterized plasmid replication mechanisms, there are still many questions left unanswered, which will be pointed out along the way in this review. PMID:26104557

  14. Vishal Mega-Mart- An Overview

    Directory of Open Access Journals (Sweden)

    Shikha Gupta

    2010-12-01

    Full Text Available In the background of high consumerism and income of the urban consumers, in recent year, a number of companies have expressed their interest towards retail sector outlets. As a result, numbers of shopping malls have started their operations in metro and urban areas. Pantaloon, big bazaar, Vishal Mega Mart, Reliance Fresh are the best known examples of retail sector outlets in India.Retailing is the interface between the producer and the individual consumer buying for personal consumption. This excludes direct interface between the manufacturer and institutional buyers such as the government and other bulk customers. A retailer is one who stocks the producer’s goods and is involved in the act of selling it to the individual consumer, at a margin of profit. As such, retailing is the last link that connects the individual consumer with the manufacturing and distribution chain. Some of the key features of retailing include: -Selling directly to customers without having any intermediaries-Selling in smaller units / quantities, breaking the bulk-Present in neighborhood or in the location which is quite convenient to the customers.-Very high in numbers-Recognized by their service levels-Fitting any size and or locationThe objective of this article is to study the Marketing Mix and Shareholding pattern of Vishal Mega-Mart, a renowned name in Retail Industry of India.

  15. Elluminate Article: Revisiting Mega-Universities

    Directory of Open Access Journals (Sweden)

    Eugene Rubin

    2006-06-01

    Full Text Available The publisher of IRRODL, The Canadian Institute of Distance Education Research (CIDER, is pleased to link here to a series of eight online seminars that took place over Spring 2006, using Elluminate live e-learning and collaborative solutions. These interactive CIDER Sessions disseminate research emanating from Canada's vibrant DE research community, and we feel these archived recordings are highly relevant to many in the international distance education research community. To access these sessions, you must first download FREE software. Visit http://www.elluminate.com/support/ (Elluminate Support for details on how to download this FREE software. * Revisiting Mega-Universities Gene Rubin and Claudine SchWeber University of Maryland University College

  16. ? radiation dosimetry in Mega rad range using sugar solution

    International Nuclear Information System (INIS)

    The formation of malonaldehyde under ? irradiation of solid sucrose and aqueous sucrose, fructose and arabinose solutions has been studied in the Mega rad range. Malonaldehyde (MA) concentration was estimated spectrophotometrically after complexing with 2-thio-barbituric acid. The effect of free radical scavengers (KI and N2O) on the yield of MA was investigated. Of the systems studied a 5% aqueous sucrose solution gave a proportional response of MA formation with dose in 0.2 to 5 Mega rad range. A 5% aqueous solution of sucrose prepared from sucrose irradiated in solid state also gave a smooth response of MA yield with dose from 8 to 30 Mega rad. The aqueous and solid sucrose systems together can be conveniently used for dosimetry in the range of 0.2 30 Mega rad. (author)

  17. Rare case of dystrophia myotonica with mega cisterna magna

    Directory of Open Access Journals (Sweden)

    Hetal Pandya

    2012-04-01

    Full Text Available Myotonic dystrophy is also known as dystrophia myotonica (DM. The condition is composed of at least two clinical disorders with overlapping phenotypes and distinct molecular genetic defects: myotonic dystrophy type 1, the classic disease originally described by Steinert, and myotonic dystrophy type 2, also called proximal myotonic myopathy (PROMM. Mega cisterna magna is thought to be an anatomic variant with no clinical significance. We report a rare case of type 1 dystrophia myotonica in combination with mega cisterna magna.

  18. Responding to Threats of Climate Change Mega-Catastrophes

    OpenAIRE

    Kousky, Carolyn; Rostapshova, Olga V.; Toman, Michael; Zeckhauser, Richard Jay

    2010-01-01

    There is a low but uncertain probability that climate change could trigger “mega-catastrophes,” severe and at least partly irreversible adverse effects across broad regions. This paper first discusses the state of current knowledge and the defining characteristics of potential climate change mega-catastrophes. While some of these characteristics present difficulties for using standard rational choice methods to evaluate response options, there is still a need to balance the benefits and c...

  19. Transportation planning for mega events: a model of urban change

    OpenAIRE

    Kassens, Eva; Potenske, Karen R.

    2010-01-01

    My study is about opportunities for revolutionary developments in urban transport. Often, we think of transport and urban development as an evolutionary process, yet there exist a few opportunities for cities to revolutionize their transport system within a short timeframe of only 10 years. Prime examples for such opportunities are mega events. Based on my hypothesis that mega event owners exercise a decisive influence on urban and transport planning through the requirements they impose on ci...

  20. The Java-Sumatra Aerial Mega-Tramway

    OpenAIRE

    Bolonkin, Alexander; Cathcart, Richard

    2007-01-01

    A mega-tramway based on the Indonesian islands of Sumatra and Java is proposed to span Sunda Strait. The Java-Sumatra Aerial Mega-Tramway (JSAMT) will be self-elevating and will regularly and cheaply launch passengers and cargoes via two conveyor belt-like facilities using standard winged shipping containers like those currently used by international trucking and ocean shipping industries that are volplaned across the Sunda Strait. The JSAMT will be a self-sustaining toll fa...

  1. Plasmid profiling of bacterial isolates from confined environments

    Science.gov (United States)

    van Houdt, Rob; Provoost, Ann; Coninx, Ilse; Leys, Natalie; Mergeay, Max

    Plasmid profiling of bacterial isolates from confined environments R. Van Houdt, I. Coninx, A. Provoost, N. Leys, and M. Mergeay Expertise group for Molecular and Cellular Biology, Institute for Environment, Health and Safety, Belgian Nuclear Research Centre (SCK•CEN), Boeretang 200, B-2400 Mol, Belgium. Human exploration of extreme and isolated hostile environments such as space requires special confined small volume habitats to protect and house the crew. However, human confinement in such small volume habitats has restrictions on waste disposal and personal hygiene and inevitably generates a particular community of microorganisms within the habitat. These microorganisms are mainly originating from the crew (skin, mucous membranes, upper respiratory tract, mouth, and gastrointestinal tract) but also include the residing environmental microorganisms. Earth-based confined habitats such as the Antarctic Research Station Concordia are used as test beds for long-duration spaceflights to study the physiologic and psychological adaptation to isolated environments. The dynamics of the environmental microbial population in such a test bed could render additional insights in assessing the potential health risks in long-duration space missions. Not only total bacterial contamination levels are important, but it is essential to identify also the predominant microbial taxa and their mobile genetic elements (MGE). These MGEs could be exchanged between bacteria by horizontal gene transfer and may alter the pathogenic potential since they often carry antibiotic resistance or more in general adaptation-enhancing traits. In this study several bacterial strains isolated in the Concordia research station were examined for their plasmid content. An optimized protocol for extraction of large plasmids showed the present of at least one plasmid in 50% of the strains. For all strains the minimal inhibitory concentration of a range of antibiotics was determined indicating resistance to different classes of antibiotics including aminoglycosides, penicillins, macrolides and chloramphenicol. Whether these antibiotic resistance determinants are plasmid-bound and whether these traits can be transferred to other bacteria is under investigation.

  2. The Mega-Terrorism - The Challenge of the Third Millennium

    Directory of Open Access Journals (Sweden)

    Daniel Andri?an

    2011-06-01

    Full Text Available The aim of this article is to describe the "new face" of terrorism in the twenty-first centuryindicating the transition to mass destruction weapons (nuclear terrorism, chemical, biological, toethnic-religious terrorism, the occurrence of massive gray area phenomena of terrorism and how thisphenomenon became a strategic weapon. Mega-terrorism has been existing, at a conceptual level,ever since the 70’s, when the experts of this phenomenon tried to find a semantic cover for thesituations that certain organizations, groups or terrorist or extremist sections would get someWeapons of Mass Destruction Systems. Actually, the 11th of September tragedy proves that megaterrorismrepresents the premeditated destruction, the lack of negotiations, of a tactical goal that wasto be accomplished by means of a threat. The mega-terrorism actors do not intend to get themselvesknown to the public, do not require anything, do not see the threat as means or device to reach theirpurpose. The 21 st century mega-terrorism simple logic is materialized in the systemic destroying ofthe enemy, no longer representing a political power or a government, but an entire ‘disobeying’,‘corrupted’, ‘unfaithful’ population indifferent to the mega-terrorist actors’ desires. New dimensionagainst mega-terrorism determines not only a rethinking of how to combat it, but also the realizationof a conceptual legal framework and measures established to materialize the political decision.

  3. Plasmid associated with diplococcin production in Streptococcus.

    OpenAIRE

    Davey, G. P.

    1984-01-01

    The ability to produce diplococcin (Dip+) was transferred by conjugation from Streptococcus cremoris 346 to two plasmid-free S. cremoris recipients at a high frequency (10(-1) per donor). Dip+ transconjugants from each mating gained a 54-megadalton plasmid. Spontaneous loss of this plasmid restored the Dip- phenotype.

  4. Characterization of the particulate air pollution in contrasted mega cities

    International Nuclear Information System (INIS)

    This work aims at characterizing the physics and the chemistry that govern particulate air pollution in two mega cities (Paris and Cairo) for which the size distribution and the chemical composition of airborne particles were poorly documented. Seasonal variations of the main aerosol sources and transformation processes are investigated in these two urban centres, with a particular attention to semi-volatile material and secondary organic aerosols. Short-term health effects of Paris size-segregated aerosols, as well as particulate pollution during the Cairo 'Black Cloud' season, are also emphasized here. Finally, the comparison of results obtained for the two mega cities and for another one (Beijing) allows investigating main factors responsible for particulate air pollution in urban centres with contrasted climatic conditions and development levels. Notably, this work also allows the build-up of an experimental dataset which is now available for the modelling of urban air quality and of environmental impacts of mega city air pollution. (author)

  5. Structure of mega-hemocyanin reveals protein origami in snails.

    Science.gov (United States)

    Gatsogiannis, Christos; Hofnagel, Oliver; Markl, Jürgen; Raunser, Stefan

    2015-01-01

    Mega-hemocyanin is a 13.5 MDa oxygen transporter found in the hemolymph of some snails. Similar to typical gastropod hemocyanins, it is composed of 400 kDa building blocks but has additional 550 kDa subunits. Together, they form a large, completely filled cylinder. The structural basis for this highly complex protein packing is not known so far. Here, we report the electron cryomicroscopy (cryo-EM) structure of mega-hemocyanin complexes from two different snail species. The structures reveal that mega-hemocyanin is composed of flexible building blocks that differ in their conformation, but not in their primary structure. Like a protein origami, these flexible blocks are optimally packed, implementing different local symmetries and pseudosymmetries. A comparison between the two structures suggests a surprisingly simple evolutionary mechanism leading to these large oxygen transporters. PMID:25482543

  6. [Elimination of various virulence plasmids by antibiotics].

    Science.gov (United States)

    Michel-Briand, Y; Laporte, J M; Dupont, M J; Couetdic, G

    1988-02-01

    The pathogenicity of some enterobacteria is due to a plasmid encoding for outer membrane proteins or for toxins. The elimination of the plasmid gives a non-virulent strain. We have tried to eliminate plasmids encoding for the thermostable toxin of Escherichia coli (plasmid pCSltl) or for the enteroinvasive property of Shigella (plasmids pWR24, pHW401, pWR110), of Salmonella (plasmid pSD6) and of Yersinia (plasmids pYL4 and P4). The loss of plasmid was confirmed by agarose gel electrophoresis of a crude lysate. Fourteen antibiotics belonging to different chemical families were used at subinhibitory concentration. A control experiment without antibiotic was carried out to detect spontaneous loss of plasmids. No antibiotic was able to eliminate plasmids pCSltl, pHW401, pSD6, pYL4. Novobiocin eliminated pWR24 and pWR110, rifampicin eliminated pWR110 and P4. Three other antibiotics gave a cure of bacteria harbouring plasmids pWR110 and P4 but the percentage of cure was too low for a therapeutical interest. PMID:3279385

  7. Plasmids and evolutionary rescue by drug resistance.

    Science.gov (United States)

    Tazzyman, Samuel J; Bonhoeffer, Sebastian

    2014-07-01

    Antibiotic resistance provides evolutionary rescue for bacterial populations under the threat of extinction through antibiotics. It can arise de novo through mutation in the population, or be obtained from other bacterial populations via the transfer of a resistance-conferring plasmid. We use stochastic modeling methods to establish whether the most likely source of rescue is via a plasmid or via the chromosome, and show that contrary to what is assumed plasmids are not necessarily beneficial locations for resistance genes. Competition at the plasmid level of selection is of great importance-the spread of a resistant plasmid in the population can be slowed or entirely stopped by a nonresistant version of the same plasmid. We suggest that future studies on antibiotic-resistant plasmids should explicitly consider competition at this level of selection. PMID:24749717

  8. Strategies simulation model for the gas business chain MEGAS

    International Nuclear Information System (INIS)

    MEGAS is a simulation model representing fundamental parameters of Corpoven's natural gas and NGL production, handling, processing, transportation and distribution systems in the Venezuelan mid-east, as well as its financial implications. Various strategies regarding development, prices, costs, new business opportunities, production scenarios, demand and energy policies can be evaluated through this model in order to determine, after analyzing the economics results, a set of strategies to follow in the mid and long term. MEGAS could be also used to make risk analysis studies, considering that probabilistic parameters and variables like gas quality, production, demand, plant shutdowns and others are to be represented by their distinctive function. It is possible to set up a probabilistic function for each economic indicator or operating variables with an appropriate experiment design. MEGAS is based on a dynamic simulation language, which facilitates both the real system components representation and the main variables statistical data accumulation. It also allows graphical representation of results and the simulation animation. Demand and price forecasts, new projects, costs and capabilities of the systems are some of the model input data. MEGAS should be considered as a tool that eases the strategic planning of the business, making it possible for the Corporation to foresee changes, both in the domestic and international market, to predict how these changes could affet, to predict how these changes could affect its business affairs and to visualize different return scenarios

  9. Conservation of Plasmid Maintenance Functions between Linear and Circular Plasmids in Borrelia burgdorferi

    OpenAIRE

    Stewart, Philip E.; Chaconas, George; Rosa, Patricia

    2003-01-01

    The Lyme disease agent Borrelia burgdorferi maintains both linear and circular plasmids that appear to be essential for mammalian infection. Recent studies have characterized the circular plasmid regions that confer autonomous replication, but the genetic elements necessary for linear plasmid maintenance have not been experimentally identified. Two vectors derived from linear plasmids lp25 and lp28-1 were constructed and shown to replicate autonomously in B. burgdorferi. These vectors identif...

  10. Diversity and epidemiology of plasmids from Enterobacteriaceae from human and non-human reservoirs

    DEFF Research Database (Denmark)

    Bielak, Eliza Maria

    2012-01-01

    The family of Enterobacteriaceae is comprised of Gram negative bacteria found in a variety of natural environments as well as in the gastrointestinal (GI) tracts of humans and many animals including diverse mammals, birds and reptiles. Three species of the enteric bacteria are largely responsible for causing infections both in humans and animals worldwide; these are Escherichia coli, Salmonella enterica and Klebsiella pneumoniae; ß-lactams are antimicrobials commonly prescribed to treat uncomplicated as well as severe infections caused by these Enterobacteriaceae and other Gram negative and also Gram positive bacteria. In particular, aminopenicillins, cephalosporins and carbapenems found broad application in treatment of infections caused by the aforementioned enteric species. Recently however, increasing levels of resistance to ß-lactams is observed in these key infectious agents as well as in many other previously susceptible species. This phenomenon has become a major public concern. Antimicrobials including ß-lactams have been often used in heavy amounts in farming, not only to treat the diagnosed infections in individual animals but also as prophylaxis, metaphylaxis and growth promotion. It is believed that these practices lead to the generation of reservoirs of antimicrobial resistance genes in the GI tracts of intensively reared food - production animals like pigs, poultry and cattle. Moreover, it has been previously shown that the bla genes (e.g. genes encoding resistance to ß-lactams) could be transmitted between different bacteria on mobile genetic elements (MGEs) like plasmids and variety of transposons. Evidences were also published indicating that zoonotic bacteria like E. coli or S. enterica resistant to diverse antimicrobials and harbouring plasmids might have been transmitted from farm animals to humans (farm workers, animal caretakers etc.). It has been therefore speculated whether the plasmids with the bla genes found in Enterobacteriaceae in humans could actually originate from the animal sources. The overall aim of this thesis was to verify if indeed related resistance plasmids can circulate between enteric bacteria from humans and food production animals; and if so, then which of these plasmid species are specifically associated with the epidemic types of blaTEM genes in Enterobacteriaceae. Furthermore, the association of the plasmid encoded blaTEM genes with transposable elements is also studied in order to get a broader perspective of which MGEs are involved in mobilization and spread of these bla genes in the diverse reservoirs. Finally, an attempt is made to encompass ecological aspects of plasmid driven transmission of resistance among the enteric bacteria. In the first study the relationship between plasmids harbouring blaTEM-52 genes isolated from humans, poultry and also meat products was examined. Twenty- two plasmids from a collection of E. coli and different serovars of S. enterica were characterized. The study delivered molecular evidences that epidemiologically related plasmids circulated in the diverse species of enteric bacteria and between humans and animals, and the possible transmission route could have been contaminated food products like meat. Two types of epidemic plasmids were detected in isolates of E. coli and S. enterica; namely undistinguishable IncI1 blaTEM-52 plasmids were found in human and poultry isolates of E. coli and S. enterica; also undistinguishable IncX1 plasmids were isolated from E. coli and S. enterica from human infections, poultry and meat products (from poultry, broiler and beef). The strains harbouring these plasmids were confirmed not to be clonally related, hence indicating the transmission of the plasmids between the different bacteria from humans and animals rather than isolation of the same bacterial clones from the different reservoirs. With relation to the study I, a range of other observations was made. On majority of the examined plasmids, the blaTEM-52 genes resided on the Tn3-related transposons. Further analysis of the genetic environment o

  11. Mega borg oil spill: Fate and effect studies

    International Nuclear Information System (INIS)

    The Mega Borg, a Norwegian tanker, released an estimated 5.1 million gallons (gal) of Palanca Angola crude oil into the Gulf of Mexico during a lightering accident and subsequent fire. The collection of reports was designed to provide a comprehensive overview of the spill chronology, the fate of the oil released, and subsequent studies that were conducted to assess the impacts of the oil spill on the environment and its biota

  12. Assessment of MEGA BORG impacts on sea turtles

    International Nuclear Information System (INIS)

    Studies were conducted to assess the impacts of the MEGA BORG oil spill on sea turtles in the path of the oil plume. Aerial surveys were performed to determine the presence of turtles and provide a gross visual assessment of potential impacts. Although extensive efforts were made to capture sea turtles around oil and gas platforms only one loggerhead sea turtle, Caretta caretta, was captured. Neither external visual inspection nor laboratory fecal analysis showed evidence of petroleum contamination

  13. A study of the decay ? ? e? by the MEGA experiment

    International Nuclear Information System (INIS)

    The MEGA experiment is designed to search for the lepton-flavor number non-conserving rare decay ? ? e?. Data- taking is complete, with 450 million events on tape taken over approximately 107 seconds. A small portion of the data sample has been processed through the complete event reconstruction codes to search for the ? ? e? process. No evidence for the ? ? e? decay is observed at a sensitivity of ?7 x 10-11 (90% confidence)

  14. The Mega-Terrorism - The Challenge of the Third Millennium

    OpenAIRE

    Daniel Andri?an

    2011-01-01

    The aim of this article is to describe the "new face" of terrorism in the twenty-first centuryindicating the transition to mass destruction weapons (nuclear terrorism, chemical, biological), toethnic-religious terrorism, the occurrence of massive gray area phenomena of terrorism and how thisphenomenon became a strategic weapon. Mega-terrorism has been existing, at a conceptual level,ever since the 70’s, when the experts of this phenomenon tried to find a semantic cover for thesituations tha...

  15. Resident Characteristics Report

    Department of Housing and Urban Development — The Resident Characteristics Report summarizes general information about households who reside in Public Housing, or who receive Section 8 assistance. The report...

  16. State of the art: integrating services for mega events

    Scientific Electronic Library Online (English)

    Jorge R. B., Garay; Gustavo M., Calixto; Alexandre M. De, Oliveira; Marcelo K., Zuffo.

    2014-08-01

    Full Text Available This paper describes the state of the art of a simplified model for integration of services in mega events. The project context, which was financed by the National Research Council – CNPq, is divided into six major areas or functional groups: Urban Mobility, Tourism, Airports, Security, Energy and T [...] elecommunications. The proposal is described in layers, as an infrastructure model of integration and services evaluation, describing its main layers and interaction processes. The proposal described in this paper is restricted to the telecommunication subproject; however, in the modeling of the scenario for the study case, it was necessary to consider requirements and variables that are common to all subprojects. In the specification process of these requirements, we noticed important processes that interact with some sectors in the city of São Paulo; however, in the mean time, we noticed some failures regarding the integration and collaboration performed by administrative elements of stadiums as a main focus in the mega event and part of our case study. Currently, the proposal is in its first version as open software for the evaluation of the services quality and the mega event infrastructure through the use of performance indicators.

  17. Comparison of typical mega cities in China using emergy synthesis

    Science.gov (United States)

    Zhang, L. X.; Chen, B.; Yang, Z. F.; Chen, G. Q.; Jiang, M. M.; Liu, G. Y.

    2009-06-01

    An emergy-based comparison analysis is conducted for three typical mega cities in China, i.e., Beijing, Shanghai and Guangzhou, from 1990 to 2005 in four perspectives including emergy intensity, resource structure, environmental pressure and resource use efficiency. A new index of non-renewable emergy/money ratio is established to indicate the utilization efficiency of the non-renewable resources. The results show that for the three mega urban systems, Beijing, Shanghai and Guangzhou, the total emergy inputs were 3.76E+23, 3.54E+23, 2.52E+23 sej in 2005, of which 64.88%, 91.45% and 72.28% were imported from the outsides, respectively. As to the indicators of emergy intensity involving the total emergy use, emergy density and emergy use per cap, three cities exhibited similar overall increase trends with annual fluctuations from 1990 to 2005. Shanghai achieved the highest level of economic development and non-renewable resource use efficiency, and meanwhile, lower proportion of renewable resource use and higher environmental pressure compared to those of Beijing and Guangzhou. Guangzhou has long term sustainability considering an amount of local renewable resources used, per capita emergy used, energy consumption per unit GDP and the ratio of waste to renewable emergy. It can be concluded that different emergy-based evaluation results arise from different geographical locations, resources endowments, industrial structures and urban orientations of the concerned mega cities.

  18. Reporter Plasmid to Identify Cancer Stem Cells

    Science.gov (United States)

    The NCI lentiviral plasmid can identify the putative cancer stem cell population through the expression of fluorescent or luminescent proteins and has the potential to advance new therapies. The key feature of the plasmid is a reporter system that only detects cells expressing the core stem cell transcription factors Sox2 and Oct4.

  19. Comparative analysis of plasmids in the genus Listeria.

    OpenAIRE

    Kuenne, Carsten; Voget, Sonja; Pischimarov, Jordan; Oehm, Sebastian; Goesmann, Alexander; Daniel, Rolf; Hain, Torsten; Chakraborty, Trinad

    2010-01-01

    BACKGROUND: We sequenced four plasmids of the genus Listeria, including two novel plasmids from L. monocytogenes serotype 1/2c and 7 strains as well as one from the species L. grayi. A comparative analysis in conjunction with 10 published Listeria plasmids revealed a common evolutionary background. PRINCIPAL FINDINGS: All analysed plasmids share a common replicon-type related to theta-replicating plasmid pAMbeta1. Nonetheless plasmids could be broadly divided into two distinct groups bas...

  20. Conservation of plasmid DNA sequences in coronatine-producing pathovars of Pseudomonas syringae

    International Nuclear Information System (INIS)

    In Pseudomonas syringae pv. tomato PT23.2, plasmid pPT23A (101 kb) is involved in synthesis of the phytotoxin coronatine. The physical characterization of mutations that abolished coronatine production indicated that at least 30 kb of pPT23A DNA are required for toxin synthesis. In the present study, 32P-labeled DNA fragments from the 30-kb region of pPT23A hybridized to plasmid DNAs from several coronatine-producing pathovars of P. syringae under conditions of high stringency. These experiments indicated that this region of pPT23A was strongly conserved in large plasmids (90 to 105 kb) that reside in P. syringae pv. atropurpurea, glycinea, and morsprunorum. The functional significance of the observed homology was demonstrated in marker-exchange experiments in which Tn5-inactivated sequences from the 30-kb region of pPT23A were used to mutate coronatine synthesis genes in the three heterologous pathovars. Physical characterization of the Tn5 insertions generated by marker exchange indicated that genes controlling coronatine synthesis in P. syringae pv. atropurpurea 1304, glycinea 4180, and morsprunorum 567 and 3714 were located on the large indigenous plasmids where homology was originally detected. Therefore, coronatine biosynthesis genes are strongly conserved in the plasmid DNAs of four producing pathovars, despite their disparate origins (California, Japan, New Zealand, Great Britain, and Italy)

  1. Conservation of plasmid DNA sequences in coronatine-producing pathovars of Pseudomonas syringae

    Energy Technology Data Exchange (ETDEWEB)

    Bender, C.L.; Young, S.A. (Oklahoma State Univ., Stillwater (United States)); Mitchell, R.E. (Dept. of Scientific and Industrial Research, Auckland (New Zealand))

    1991-04-01

    In Pseudomonas syringae pv. tomato PT23.2, plasmid pPT23A (101 kb) is involved in synthesis of the phytotoxin coronatine. The physical characterization of mutations that abolished coronatine production indicated that at least 30 kb of pPT23A DNA are required for toxin synthesis. In the present study, {sup 32}P-labeled DNA fragments from the 30-kb region of pPT23A hybridized to plasmid DNAs from several coronatine-producing pathovars of P. syringae under conditions of high stringency. These experiments indicated that this region of pPT23A was strongly conserved in large plasmids (90 to 105 kb) that reside in P. syringae pv. atropurpurea, glycinea, and morsprunorum. The functional significance of the observed homology was demonstrated in marker-exchange experiments in which Tn5-inactivated sequences from the 30-kb region of pPT23A were used to mutate coronatine synthesis genes in the three heterologous pathovars. Physical characterization of the Tn5 insertions generated by marker exchange indicated that genes controlling coronatine synthesis in P. syringae pv. atropurpurea 1304, glycinea 4180, and morsprunorum 567 and 3714 were located on the large indigenous plasmids where homology was originally detected. Therefore, coronatine biosynthesis genes are strongly conserved in the plasmid DNAs of four producing pathovars, despite their disparate origins (California, Japan, New Zealand, Great Britain, and Italy).

  2. Plasmid Mediated Salt Tolerance in Root Associated Bacteria from Erigerone linifolious

    Directory of Open Access Journals (Sweden)

    Azra Yasmin

    2000-01-01

    Full Text Available Bacterial strains (which could tolerate 2-3M NaCl in the growth medium were isolated from the roots of Erigerone linifolious. They were El-1, El-2, El-3 (from histoplane of roots and REl-1, REl-2, REl-3, REl-4, REl-5 (from the rhizoplane. All bacterial strains were motile rods (except El-2 which were cocci, exhibiting either Gram-negative (El-1, El-2, El-3, REl-1 or Gram-variable (REl-2, REl-3, REl-4, REl-5 staining. These strains were affiliated with genus Delya (El-1, Vibrio (El-3, REl-1, while four Gram-variable strains shaired characters with Bacillus pumilus. They have wide temperature and pH ranges with different optima. These strains also exhibit multiple salts/osmolytes/heavy metals/antibiotics resistance. Curing of plasmids from four of these strains revealed that salt tolerance and most of the other resistances were plasmid encoded. Plasmids residing in these halo-tolerant strains were conjugative (except pSH1413. Hybridization experiments revealed that one of these plasmids (pSH1414 belonged to IncN group of plasmids.

  3. Sequencing analysis and characterization of the plasmid pBIF10 isolated from Bifidobacterium longum.

    Science.gov (United States)

    Ma, Yongping; Xie, Ting-Ting; Hu, Qiongwen; Qiu, Zongyin; Song, Fangzhou

    2015-02-01

    A resident plasmid, pBIF10, was isolated from Bifidobacterium longum B200304, and the full-length sequence of pBIF10 was analyzed. In this sequence, we identified at least 17 major open reading frames longer than 200 bp. A tetracycline resistance gene, tetQ, was identified and verified to confer antibiotic resistance to tetracycline. The plasmid replicon with replication protein B gene (repB) and a typical iteron was identified in pBIF10. An artificial clone vector was constructed with the replicon of pBIF10; the results showed that repB controlled plasmid replication in other bifidobacteria host cells at low transformation frequency. Taken together, the analysis and characterization of pBIF10 provided necessary information for the understanding of antibiotic resistance mediated by a plasmid in a Bifidobacterium strain. GC% and repB sequence analyses indicated that pBIF10 was a molecular hybrid of at least 2 other bacterial genera plasmids. PMID:25587774

  4. Intergeneric Conjugation in Streptomyces peucetius and Streptomyces sp. Strain C5: Chromosomal Integration and Expression of Recombinant Plasmids Carrying the chiC Gene

    OpenAIRE

    Paranthaman, Senthamaraikannan; Dharmalingam, Kuppamuthu

    2003-01-01

    Intergeneric conjugal transfer of plasmid DNA from Escherichia coli to Streptomyces circumvents problems such as host-controlled restriction and instability of foreign DNA during the transformation of Streptomyces protoplasts. The anthracycline antibiotic-producing strains Streptomyces peucetius and Streptomyces sp. strain C5 were transformed using E. coli ET12567(pUZ8002) as a conjugal donor. When this donor species, carrying pSET152, was mated with Streptomyces strains, the resident plasmid...

  5. A Positive Study on the Residents' Tourism Expectation of Shanghai EXPO

    Directory of Open Access Journals (Sweden)

    ZHANG Yun-yao

    2010-09-01

    Full Text Available The attitude, cognition and expectation of residents in certain eventholding destination play a significant role to the success of this mega-event. This research analyzed the expectation of Shangehai residents, as well as the interdependent relationship between residents' expectation and 2010 Shanghai EXPO focusing on 2010 Shanghai EXPO. This study revealed that factor analysis selected 5 tourism expectation factors (infrastructural& environmentalfactor;positive attitude;social phenomenal;economic and price & real estate.Among Shanghai residents' demographic characteristics, except gender, the otherdemographic variables like age,educationallevel, marital level and profession all have obvious differences with the 5expectation factors.multi-regression analysis also revealed that Shanghai residents' expectation has apositive correlation with the active participating attitudes.Inthe end the insufficiency of this study is put forwardand recommendations on the futurestudyare alsogiven.

  6. Plasmid-encoded trimethoprim resistance in staphylococci.

    OpenAIRE

    Archer, G. L.; Coughter, J. P.; Johnston, J. L.

    1986-01-01

    High-level (greater than 1,000 micrograms/ml) resistance to the antimicrobial agent trimethoprim was found in 17 of 101 (17%) coagulase-negative staphylococci and 5 of 51 (10%) Staphylococcus aureus from a number of different hospitals in the United States. Resistance was plasmid encoded and could be transferred by conjugation in 4 of the 17 (24%) Tpr coagulase-negative staphylococci and 3 of the 5 (60%) Tpr S. aureus. A 1.2-kilobase segment of plasmid DNA from one of the plasmids (pG01) was ...

  7. Meta, mega e retroanálises correlacionais: comparando dados primários em Psicologia / Correlational meta, mega and retroanalyses: comparing primary data in Psychology / Meta, mega y retroanálisis correlacionales: comparando datos primarios en Psicología

    Scientific Electronic Library Online (English)

    Igor Reszka, Pinheiro; Roberto Moraes, Cruz.

    2014-06-01

    Full Text Available Na tentativa de promover a transformação de informações em conhecimento, este artigo compara as meta-análises com duas de suas variantes, as mega-análises e as retroanálises, técnicas desenvolvidas para a síntese e a equiparação de resultados pouco precisos ou contraditórios. Enquanto as meta-anális [...] es referem-se à síntese dos resultados de diferentes pesquisas primárias, as mega-análises referem-se à síntese dos dados coletados por pesquisas primárias e as retroanálises à recriação e posterior síntese desses mesmos dados. Por meio de uma simulação, o Estudo 1 pareia o viés médio de meta, mega e retroanálises em função de nove diferentes configurações que variam conforme a quantidade de estudos empregados e do tamanho da amostra individual de cada um desses estudos, nas modalidades de dados completos, leve e severa ausência de dados. No Estudo 2, os mesmos dados utilizados na simulação de ausência severa foram empregados para testar a precisão de mega e retroanálises quando se realiza a imputação de dados. Os resultados apontam para uma leve superioridade geral das mega-análises, diferença essa que diminui, até desaparecer, em situações ideais. Abstract in spanish En la tentativa de fomentar la transformación de informaciones en conocimiento, este artículo compara los meta-análisis con dos de sus variantes, los mega-análisis y los retro-análisis, técnicas desarrolladas para la síntesis y la equiparación de resultados poco precisos o contradictorios. Mientras [...] los meta-análisis se refieren a la síntesis de los resultados de distintas investigaciones primarias, los mega-análisis se refieren a la síntesis de los datos recolectados por investigaciones primarias, y los retro-análisis, a una nueva creación y posterior síntesis de esos mismos datos. Por medio de una simulación, el Estudio 01 parea el sesgo medio de meta-, mega- y retro-análisis en función de nueve distintas configuraciones que varían según la cantidad de estudios llevados a cabo y el tamaño de la muestra individual de cada uno de esos estudios, en las modalidades de datos completos, leve y severa ausencia de datos. En el estudio 02, los mismos datos utilizados en la simulación de ausencia severa han sido empleados para testar la precisión de mega- y retro-análisis cuando se lleva a cabo la imputación de datos. Los resultados señalan hacia una leve superioridad general de los mega-análisis. Esa diferencia disminuye, hasta desaparecer, en situaciones ideales Abstract in english In an attempt to promote the transformation of information into knowledge, this article compares meta-analyses with two of its variants, mega-analyses and retro-analyses, techniques developed to summarize and compare results that are not very accurate or contradictory. While meta-analyses refer to t [...] he synthesis of results of different primary researches. mega-analyses refer to the synthesis of results collected by primary researches and retroanalyses, to the recreation and posterior synthesis of that data. Using a simulation, Study 1 pairs the average trends from meta, mega and retroanalyses regarding nine different configurations that vary according to the number of studies used and the size of the individual sample of each of those studies, in the full data, light data and severe lack of data modes. In Study 2, the same data used in the simulation of severe lack of data were used to test the accuracy of mega and retroanalyses when performing data imputation. The results show a slight general superiority of mega-analyses, a difference that fades away in ideal situations.

  8. How to make mega-cities energy efficient?

    Energy Technology Data Exchange (ETDEWEB)

    Aoki, Hitoshi; Aoki, Yoshitaka

    2010-09-15

    Tokyo is a Megalopolis with 40 million+ population. It has an energy efficient profile due to its uniqueness as extensive mass rail transit networks, high density and compact urban formation, compact space oriented life style. The other feature is extensive use of electric heat pumps (EHP), which entails low carbon city profile. Further possibility is prepared with water thermal energy utilization, which is widely available also through EHP particularly in Tokyo central districts, which could make Tokyo one of the lowest carbon cities in the world. Emerging mega-cities are expected to learn from Tokyo's success and not from western conventional models.

  9. MegaPipe astrometry for the New Horizons spacecraft

    OpenAIRE

    Gwyn, Stephen D. J.

    2014-01-01

    The New Horizons spacecraft, launched by NASA in 2006, will arrive in the Pluto-Charon system on July 14, 2015. There, it will spend a few hours imaging Pluto and its moons. It will then have a small amount of reserve propellant which will be used to direct the probe on to a second, yet to be discovered object in the Kuiper Belt. Data from the MegaPrime camera on CFHT was used to build a precise, high density astrometric reference frame for both the final approach into the P...

  10. Mechanism of plasmid-mediated quinolone resistance

    OpenAIRE

    Tran, John H.; Jacoby, George A.

    2002-01-01

    Quinolones are potent antibacterial agents that specifically target bacterial DNA gyrase and topoisomerase IV. Widespread use of these agents has contributed to the rise of bacterial quinolone resistance. Previous studies have shown that quinolone resistance arises by mutations in chromosomal genes. Recently, a multiresistance plasmid was discovered that encodes transferable resistance to quinolones. We have cloned the plasmid-quinolone resistance gene, termed qnr, and fo...

  11. MegaPipe astrometry for the New Horizons spacecraft

    International Nuclear Information System (INIS)

    The New Horizons spacecraft, launched by NASA in 2006, will arrive in the Pluto-Charon system on July 14, 2015. There, it will spend a few hours imaging Pluto and its moons. It will then have a small amount of reserve propellant which will be used to direct the probe on to a second, yet to be discovered object in the Kuiper Belt. Data from the MegaPrime camera on CFHT was used to build a precise, high density astrometric reference frame for both the final approach into the Pluto system and the search for the secondary target. Pluto currently lies in the galactic plane. This is a hindrance in that there are potential problems with confusion. However, it is also a benefit, since it allows the use of the UCAC4 astrometric reference catalog, which is normally too sparse for use with MegaCam images. The astrometric accuracy of the final catalogs, as measured by the residuals, is 0.02 arcseconds

  12. MegaPipe astrometry for the New Horizons spacecraft

    CERN Document Server

    Gwyn, Stephen D J

    2014-01-01

    The New Horizons spacecraft, launched by NASA in 2006, will arrive in the Pluto-Charon system on July 14, 2015. There, it will spend a few hours imaging Pluto and its moons. It will then have a small amount of reserve propellant which will be used to direct the probe on to a second, yet to be discovered object in the Kuiper Belt. Data from the MegaPrime camera on CFHT was used to build a precise, high density astrometric reference frame for both the final approach into the Pluto system and the search for the secondary target. Pluto currently lies in the galactic plane. This is a hindrance in that there are potential problems with confusion. However, it is also a benefit, since it allows the use of the UCAC4 astrometric reference catalog, which is normally too sparse for use with MegaCam images. The astrometric accuracy of the final catalogs, as measured by the residuals, is 0.02 arcseconds.

  13. MegaPipe astrometry for the New Horizons spacecraft

    Science.gov (United States)

    Gwyn, S. D. J.

    2014-04-01

    The New Horizons spacecraft, launched by NASA in 2006, will arrive in the Pluto-Charon system on July 14, 2015. There, it will spend a few hours imaging Pluto and its moons. It will then have a small amount of reserve propellant which will be used to direct the probe on to a second, yet to be discovered object in the Kuiper Belt. Data from the MegaPrime camera on CFHT was used to build a precise, high density astrometric reference frame for both the final approach into the Pluto system and the search for the secondary target. Pluto currently lies in the galactic plane. This is a hindrance in that there are potential problems with confusion. However, it is also a benefit, since it allows the use of the UCAC4 astrometric reference catalog, which is normally too sparse for use with MegaCam images. The astrometric accuracy of the final catalogs, as measured by the residuals, is 0.02 arcseconds.

  14. Photoreactivation of ultraviolet-irradiated, plasmid-bearing, and plasmid-free strains of Bacillus anthracis.

    OpenAIRE

    Knudson, G B

    1986-01-01

    The effects of toxin- and capsule-encoding plasmids on the kinetics of UV inactivation of various strains of Bacillus anthracis were investigated. Plasmids pXO1 and pXO2 had no effect on bacterial UV sensitivity or photoreactivation. Vegetative cells were capable of photoreactivation, but photo-induced repair of UV damage was absent in B. anthracis Sterne spores.

  15. Small-plasmid-mediated antibiotic resistance is enhanced by increases in plasmid copy number and bacterial fitness.

    Science.gov (United States)

    San Millan, Alvaro; Santos-Lopez, Alfonso; Ortega-Huedo, Rafael; Bernabe-Balas, Cristina; Kennedy, Sean P; Gonzalez-Zorn, Bruno

    2015-06-01

    Plasmids play a key role in the horizontal spread of antibiotic resistance determinants among bacterial pathogens. When an antibiotic resistance plasmid arrives in a new bacterial host, it produces a fitness cost, causing a competitive disadvantage for the plasmid-bearing bacterium in the absence of antibiotics. On the other hand, in the presence of antibiotics, the plasmid promotes the survival of the clone. The adaptations experienced by plasmid and bacterium in the presence of antibiotics during the first generations of coexistence will be crucial for the progress of the infection and the maintenance of plasmid-mediated resistance once the treatment is over. Here we developed a model system using the human pathogen Haemophilus influenzae carrying the small plasmid pB1000 conferring resistance to ?-lactam antibiotics to investigate host and plasmid adaptations in the course of a simulated ampicillin therapy. Our results proved that plasmid-bearing clones compensated for the fitness disadvantage during the first 100 generations of plasmid-host adaptation. In addition, ampicillin treatment was associated with an increase in pB1000 copy number. The augmentation in both bacterial fitness and plasmid copy number gave rise to H. influenzae populations with higher ampicillin resistance levels. In conclusion, we show here that the modulations in bacterial fitness and plasmid copy number help a plasmid-bearing bacterium to adapt during antibiotic therapy, promoting both the survival of the host and the spread of the plasmid. PMID:25824216

  16. Mega-mining in Mexico. Structural reforms and resistance

    Directory of Open Access Journals (Sweden)

    Darcy Tetreault

    2013-11-01

    Full Text Available This article analyzes the structural causes of social environmental conflicts around mega-mining in Mexico and describes the emergence and coordination of resistance movements. It argues that neoliberal reforms have facilitated ‘accumulation by dispossession’ on two levels: first, by transferring public resources in the form of mineral reserves and state-run mining companies to the private sector; and second, bydispossessing smallholder farmers and indigenous communities of their land, water and cultural landscapes, in order to allow mining companies to carry out their activities. Furthermore, it argues that some factions of the resistance movements reflect ‘the environmentalism of the poor’ insofar as they seek to maintain natural resources outside of the sphere of the capitalist mode of production. Through a systematic revision of newspaper articles, blogs and scholarly publications, 29 high-profile eco-territorial mining conflicts are identified and a preliminary analysis of these is provided.

  17. BioShuttle-mediated Plasmid Transfer

    Directory of Open Access Journals (Sweden)

    Klaus Braun, Leonie von Brasch, Ruediger Pipkorn, Volker Ehemann, Juergen Jenne, Herbert Spring, Juergen Debus, Bernd Didinger, Werner Rittgen, Waldemar Waldeck

    2007-01-01

    Full Text Available An efficient gene transfer into target tissues and cells is needed for safe and effective treatment of genetic diseases like cancer. In this paper, we describe the development of a transport system and show its ability for transporting plasmids. This non-viral peptide-based BioShuttle-mediated transfer system consists of a nuclear localization address sequence realizing the delivery of the plasmid phNIS-IRES-EGFP coding for two independent reporter genes into nuclei of HeLa cells. The quantification of the transfer efficiency was achieved by measurements of the sodium iodide symporter activity. EGFP gene expression was measured with Confocal Laser Scanning Microscopy and quantified with biostatistical methods by analysis of the frequency of the amplitude distribution in the CLSM images. The results demonstrate that the “BioShuttle”-Technology is an appropriate tool for an effective transfer of genetic material carried by a plasmid.

  18. Sequence requirements for plasmid nuclear import

    OpenAIRE

    Dean, David A.; Dean, Brenda S.; Muller, Susanne; Smith, Louis C.

    1999-01-01

    The nuclear envelope is a major barrier for nuclear uptake of plasmids and represents one of the most significant unsolved problems of non-viral gene delivery. We have previously shown that the nuclear entry of plasmid DNA is sequence-specific, requiring a 366 bp fragment containing the SV40 origin of replication and early promoter. In this report, we show that, although fragments throughout this region can support varying degrees of nuclear import, the 72 bp repeats of the SV40 enhancer faci...

  19. Decoración de la decadencia: La balaustrada neobarroca como síntoma crítico en la mega ciudad de México

    Scientific Electronic Library Online (English)

    Peter, Krieger.

    2010-12-01

    Full Text Available Este ensayo revisa el uso libre de la balaustrada, un elemento decorativo tradicional cuya presencia en la arquitectura continúa hasta la actualidad, aun en los diferentes contextos culturales de la mega ciudad de México. Esta decoración neobarroca conquistó las fachadas de casi todas los tipos arqu [...] itectónicos y se le utiliza como elemento representativo en todas las clases sociales, desde la residencia de lujo hasta la autoconstrucción. Estos usos, fomentados por la ideología cultural de la posmodernidad, consisten en la negación del valor auténtico de la balaustrada histórica. Es un fenómeno crítico de la sociedad contemporánea que cada vez más remplaza la sustancia original por el producto fake y erosiona el conocimiento de la propia historia por la construcción de mundos ficticios. El ensayo reflexiona sobre los efectos de esta situación para la restauración de monumentos. Abstract in english This essay revises the unlimited uses of the balustrade, a traditional decorative element present until today, even in the different context of the Mexican megalopolis. This neobaroque decoration conquered the façades of almost all architectural types, for a social status, including the luxury resid [...] ential areas and also the self-constructed houses. These uses are based on postmodern cultural ideology and deny the authentic values of the historical balustrade. It is a critical phenomenon of contemporary society, where fake products replace more and more the original substance, and the knowledge of history is substituted by the construction of fictional worlds. The essay deals with the effects of this situation for the restoration of monuments.

  20. Marker rescue by a homologous recipient plasmid during transformation of gonococci by a hybrid Pcr plasmid.

    OpenAIRE

    Biswas, G D; Graves, J F; Sox, T E; Tenover, F C; Sparling, P F

    1982-01-01

    A 42-kilobase hybrid Pcr plasmid (pFA14) was formed when the naturally occurring 7.2-kilobase Pcr plasmid pFA3 was introduced by transformation into a competent gonococcal recipient containing the 36-kilobase conjugative plasmid pFA2 (Sox et al., J. Bacteriol. 138:510-518). Analysis of the structure of pFA14 showed that it was a stable recombinant between pFA3 and pFA2. The transformation efficiency of pFA14 was increased 300- to 10,000-fold by the presence in isogenic recipients of the homol...

  1. Investigating fusion plasma instabilities in the Mega Amp Spherical Tokamak using mega electron volt proton emissions (invited)

    Energy Technology Data Exchange (ETDEWEB)

    Perez, R. V., E-mail: rvale006@fiu.edu; Boeglin, W. U.; Angulo, A.; Avila, P.; Leon, O.; Lopez, C. [Department of Physics, Florida International University, 11200 SW 8 ST, CP204, Miami, Florida 33199 (United States); Darrow, D. S. [Princeton Plasma Physics Laboratory, James Forrestal Campus, P.O. Box 451, Princeton, New Jersey 08543 (United States); Cecconello, M.; Klimek, I. [Department of Physics and Astronomy, Uppsala University, Uppsala SE-751 20 (Sweden); Allan, S. Y.; Akers, R. J.; Keeling, D. L.; McClements, K. G.; Scannell, R.; Conway, N. J. [CCFE, Culham Science Centre, Abingdon, Oxfordshire OX14 3DB (United Kingdom); Turnyanskiy, M. [ITER Physics Department, EFDA CSU Garching, Boltzmannstrasse 2, D-85748, Garching (Germany); Jones, O. M. [CCFE, Culham Science Centre, Abingdon, Oxfordshire OX14 3DB (United Kingdom); Department of Physics, Durham University, Durham DH1 3LE (United Kingdom); Michael, C. A. [Australian National University, Canberra ACT 0200 (Australia)

    2014-11-15

    The proton detector (PD) measures 3 MeV proton yield distributions from deuterium-deuterium fusion reactions within the Mega Amp Spherical Tokamak (MAST). The PD’s compact four-channel system of collimated and individually oriented silicon detectors probes different regions of the plasma, detecting protons (with gyro radii large enough to be unconfined) leaving the plasma on curved trajectories during neutral beam injection. From first PD data obtained during plasma operation in 2013, proton production rates (up to several hundred kHz and 1 ms time resolution) during sawtooth events were compared to the corresponding MAST neutron camera data. Fitted proton emission profiles in the poloidal plane demonstrate the capabilities of this new system.

  2. Investigating fusion plasma instabilities in the Mega Amp Spherical Tokamak using mega electron volt proton emissions (invited)

    Science.gov (United States)

    Perez, R. V.; Boeglin, W. U.; Darrow, D. S.; Cecconello, M.; Klimek, I.; Allan, S. Y.; Akers, R. J.; Keeling, D. L.; McClements, K. G.; Scannell, R.; Turnyanskiy, M.; Angulo, A.; Avila, P.; Leon, O.; Lopez, C.; Jones, O. M.; Conway, N. J.; Michael, C. A.

    2014-11-01

    The proton detector (PD) measures 3 MeV proton yield distributions from deuterium-deuterium fusion reactions within the Mega Amp Spherical Tokamak (MAST). The PD's compact four-channel system of collimated and individually oriented silicon detectors probes different regions of the plasma, detecting protons (with gyro radii large enough to be unconfined) leaving the plasma on curved trajectories during neutral beam injection. From first PD data obtained during plasma operation in 2013, proton production rates (up to several hundred kHz and 1 ms time resolution) during sawtooth events were compared to the corresponding MAST neutron camera data. Fitted proton emission profiles in the poloidal plane demonstrate the capabilities of this new system.

  3. Investigating fusion plasma instabilities in the Mega Amp Spherical Tokamak using mega electron volt proton emissions (invited).

    Science.gov (United States)

    Perez, R V; Boeglin, W U; Darrow, D S; Cecconello, M; Klimek, I; Allan, S Y; Akers, R J; Keeling, D L; McClements, K G; Scannell, R; Turnyanskiy, M; Angulo, A; Avila, P; Leon, O; Lopez, C; Jones, O M; Conway, N J; Michael, C A

    2014-11-01

    The proton detector (PD) measures 3 MeV proton yield distributions from deuterium-deuterium fusion reactions within the Mega Amp Spherical Tokamak (MAST). The PD's compact four-channel system of collimated and individually oriented silicon detectors probes different regions of the plasma, detecting protons (with gyro radii large enough to be unconfined) leaving the plasma on curved trajectories during neutral beam injection. From first PD data obtained during plasma operation in 2013, proton production rates (up to several hundred kHz and 1 ms time resolution) during sawtooth events were compared to the corresponding MAST neutron camera data. Fitted proton emission profiles in the poloidal plane demonstrate the capabilities of this new system. PMID:25430211

  4. Self-transmissible plasmid in Zymomonas mobilis carrying antibiotic resistance.

    Science.gov (United States)

    Walia, S K; Carey, V C; All, B P; Ingram, L O

    1984-01-01

    The cryptic plasmid pRUT41 from Zymomonas mobilis was examined for its biological properties. This plasmid was found to be conjugally transferred from Z. mobilis CP4 to Escherichia coli BM21 and to carry genes for antibiotic resistance (gentamicin, kanamycin, and streptomycin). Covalently closed circular plasmid DNA was isolated from eight transconjugants of E. coli BM21. These plasmids were identical in mobility on agarose gels and exhibited the same restriction patterns as the native pRUT41 plasmid isolated from Z. mobilis. The plasmid location of the antibiotic resistance genes was further confirmed by transforming E. coli BM21 with isolated pRUT41 plasmid from strain CP4 and with plasmids from the transconjugants of BM21. Resistance to streptomycin, kanamycin, and gentamicin was tightly linked and transferred together in all cases. Images PMID:6364969

  5. Relationship between R and FP plasmids in Pseudomonas aeruginosa.

    OpenAIRE

    Royle, P. L.; Holloway, B. W.

    1980-01-01

    The plasmid FP110 possessing chromosome mobilizing ability for Pseudomonas aeruginosa but carrying no determinants for antibiotic resistance, is found to be related by incompatibility, entry exclusion, and other criteria to the independently isolated R plasmids R18-1 and R56Be which carry resistance determinants for carbenicillin. The frequency of FP plasmid appearance in clinical isolates of P. aeruginosa suggests the possibility that they may be a source of R plasmids in this bacterium.

  6. Plasmid Stability in Pseudomonas fluorescens in the Rhizosphere

    OpenAIRE

    Bij, A. J.; Weger, L. A.; Tucker, W. T.; Lugtenberg, B.

    1996-01-01

    Plasmids belonging to various incompatibility (Inc) groups were introduced into the efficiently root-colonizing strain Pseudomonas fluorescens WCS365, and their stabilities in complex and minimal media and in the rhizospheres of tomato, wheat, and potato plants grown under gnotobiotic conditions without selection pressure were tested. The IncP plasmid was found to be highly unstable under all conditions tested, whereas the IncQ and IncW plasmids showed intermediate stabilities and the plasmid...

  7. O'Mega & WHIZARD: Monte Carlo Event Generator Generation For Future Colliders

    OpenAIRE

    Ohl, Thorsten

    2000-01-01

    I describe the optimizing matrix element generator O'Mega and Wolfgang Kilian's event generator generator WHIZARD. These tools cooperate in the automated production of efficient unweighted event generators for linear collider physics.

  8. Enhanced Mission-Enabling Ultra-High Power Solar Array (Mega-ROSA EX) Project

    National Aeronautics and Space Administration — Mega-ROSA-EX is an enhanced, higher stiffness, higher sun-pointing accuracy, higher strength, higher specific power and even larger overall power / deployed size /...

  9. Promoter-probe plasmid for Bacillus subtilis.

    OpenAIRE

    Donnelly, C E; Sonenshein, A L

    1984-01-01

    We have constructed a promoter-probe expression vector for Bacillus subtilis. This plasmid, pCED6, can be used to fuse various DNA sequences to the structural gene of Escherichia coli beta-galactosidase, permitting analysis of the promoter activity of such sequences. pCED6 replicates and confers drug resistances in both E. coli and B. subtilis.

  10. Transfer of IncN plasmids to Pseudomonas aeruginosa.

    OpenAIRE

    Tardif, G.; Grant, R. B.

    1982-01-01

    Three of four N plasmids tested were found to be conjugatively transferable from Escherichia coli to Pseudomonas aeruginosa. The plasmids in the Pseudomonas transconjugants differed from the plasmids in the donor E. coli with respect to molecular weight, transfer ability, phenotype conferred, and stability. In some cases, the antibiotic and UV resistance genes appeared to integrate into the P. aeruginosa chromosome.

  11. Demonstration of Plasmid-Mediated Drug Resistance in Mycobacterium abscessus

    OpenAIRE

    Matsumoto, Cristianne Kayoko; Bispo, Paulo Jose? Martins; Santin, Katiane; Nogueira, Christiane Lourenc?o; Lea?o, Sylvia Cardoso

    2014-01-01

    Plasmid-mediated kanamycin resistance was detected in a strain of Mycobacterium abscessus subsp. bolletii responsible for a nationwide epidemic of surgical infections in Brazil. The plasmid did not influence susceptibility to tobramycin, streptomycin, trimethoprim-sulfamethoxazole, clarithromycin, or ciprofloxacin. Plasmid-mediated drug resistance has not been described so far in mycobacteria.

  12. Mega events, tourism and local development: the case of Torino 2006

    OpenAIRE

    Dansero, Egidio; Puttilli, Matteo Girolamo

    2010-01-01

    This paper examines the impact of mega-events such as Olympic Games on tourism development in host territories. In the first part, we adopt a territorialization approach to understand the relationship between the event and the host region.A mega-event is conceived as a great chance to generate new territory as it produces both tangible and intangible legacies that remain after the event ends: renewal of facilities for hospitality and accommodation, better infrastructures, better training for ...

  13. FCC resid processing

    International Nuclear Information System (INIS)

    This paper narrows the definition of reside processor to those FCC's which run feedstocks containing 1 wt.% or more Conradson carbon residue. With this new definition, the resid survey is revisited to see if any new conclusions can be drawn from the data. The authors break down the numbers and geography of resid processors, feed types, operating variables, and yields. After examining the state of resid processing in the FCC, the paper focuses on the design of cracking catalysts for handling resid feeds. There are important considerations involved in processing resid including high levels of contaminants such as vanadium and nickel, the impact on heat balance, and diffusion effects. Catalysts can be designed to improve the profitability of a resid operation. A clear picture of the roles of zeolite and matrix is presented, along with a discussion of the different types of zeoliters which are commonly used. The paper demonstrates how zeolite and matrix are best combined to meet objectives within a given set of constraints while processing resid

  14. Recent Mega-Thrust Tsunamigenic Earthquakes and PTHA

    Science.gov (United States)

    Lorito, S.

    2013-05-01

    The occurrence of several mega-thrust tsunamigenic earthquakes in the last decade, including but not limited to the 2004 Sumatra-Andaman, the 2010 Maule, and 2011 Tohoku earthquakes, has been a dramatic reminder of the limitations in our capability of assessing earthquake and tsunami hazard and risk. However, the increasingly high-quality geophysical observational networks allowed the retrieval of most accurate than ever models of the rupture process of mega-thrust earthquakes, thus paving the way for future improved hazard assessments. Probabilistic Tsunami Hazard Analysis (PTHA) methodology, in particular, is less mature than its seismic counterpart, PSHA. Worldwide recent research efforts of the tsunami science community allowed to start filling this gap, and to define some best practices that are being progressively employed in PTHA for different regions and coasts at threat. In the first part of my talk, I will briefly review some rupture models of recent mega-thrust earthquakes, and highlight some of their surprising features that likely result in bigger error bars associated to PTHA results. More specifically, recent events of unexpected size at a given location, and with unexpected rupture process features, posed first-order open questions which prevent the definition of an heterogeneous rupture probability along a subduction zone, despite of several recent promising results on the subduction zone seismic cycle. In the second part of the talk, I will dig a bit more into a specific ongoing effort for improving PTHA methods, in particular as regards epistemic and aleatory uncertainties determination, and the computational PTHA feasibility when considering the full assumed source variability. Only logic trees are usually explicated in PTHA studies, accounting for different possible assumptions on the source zone properties and behavior. The selection of the earthquakes to be actually modelled is then in general made on a qualitative basis or remains implicit, despite different methods like event trees have been used for different applications. I will define a quite general PTHA framework, based on the mixed use of logic and event trees. I will first discuss a particular class of epistemic uncertainties, i.e. those related to the parametric fault characterization in terms of geometry, kinematics, and assessment of activity rates. A systematic classification in six justification levels of epistemic uncertainty related with the existence and behaviour of fault sources will be presented. Then, a particular branch of the logic tree is chosen in order to discuss just the aleatory variability of earthquake parameters, represented with an event tree. Even so, PTHA based on numerical scenarios is a too demanding computational task, particularly when probabilistic inundation maps are needed. For trying to reduce the computational burden without under-representing the source variability, the event tree is first constructed by taking care of densely (over-)sampling the earthquake parameter space, and then the earthquakes are filtered basing on their associated tsunami impact offshore, before calculating inundation maps. I'll describe this approach by means of a case study in the Mediterranean Sea, namely the PTHA for some locations of Eastern Sicily coasts and Southern Crete coast due to potential subduction earthquakes occurring on the Hellenic Arc.

  15. Comparison of virulence plasmids among Clostridium perfringens type E isolates.

    Science.gov (United States)

    Li, Jihong; Miyamoto, Kazuaki; McClane, Bruce A

    2007-04-01

    Clostridium perfringens type E isolates produce iota-toxin, which is encoded by iap and ibp genes. Using Southern blot analyses, the current study identified iap/ibp plasmids of approximately 97 or approximately 135 kb among eight type E isolates. For most of these isolates, their iap/ibp plasmid also encoded urease and lambda-toxin. However, the beta2-toxin gene, if present, was on a different plasmid from the iap/ibp plasmid. For all isolates, the iap/ibp plasmid carried a tcp locus, strongly suggesting that these plasmids are conjugative. Overlapping PCR analyses demonstrated some similarity between the iap/ibp plasmids and enterotoxin-encoding plasmids of type A isolates. Additional PCR analyses demonstrated that the iap/ibp locus is located near dcm sequences, an apparent plasmid hot spot for toxin gene insertion, and that two IS1151-related sequences are present in the iap/ibp locus. To begin testing whether those IS1151-like sequences can mobilize iap/ibp genes, a PCR assay was performed that amplifies a product only from circular DNA forms that could represent transposition intermediates. This PCR assay detected circular forms containing iap/ibp genes and silent enterotoxin gene sequences, with or without an IS1151-like sequence. Collectively, these results suggest that a mobile genetic element carrying iap/ibp has inserted onto a tcp-carrying enterotoxin plasmid in a type A isolate, creating a progenitor iap/ibp plasmid. That plasmid then spread via conjugation to other isolates, converting them to type E. Further iap/ibp plasmid diversity occurred when either the iap/ibp genes later remobilized and inserted onto other conjugative plasmids or some iap/ibp plasmids acquired additional DNA sequences. PMID:17261608

  16. The Kalimantan Border Oil Palm Mega-project

    International Nuclear Information System (INIS)

    A few years ago, the Indonesian government and sections of the palm oil industry united in the Indonesian Palm Oil Commission (IPOC) to undertake efforts to restore the atrocious public image that the palm oil industry had earned abroad for its role in the demise of Indonesia's tropical rainforests, the massive forest fires and haze in 1997-1998, and for the widespread conflicts between plantation companies and local communities. If IPOC succeeded in restoring the palm oil industry's image abroad, it was shattered again after June 2005 when the Indonesian Minister of Agriculture revealed details of a government plan to develop the world's largest oil palm plantation in a 5-10 kilometer band along the border of Kalimantan and Malaysia. To finance the USD 567 million plantation project, the Indonesian President and Chamber of Commerce and Industry (KADIN) had already met up with the Chinese government and private sector several times, resulting in Memoranda of Understanding between (among other) the Artha Graha and Sinar Mas groups from Indonesia and the Chinese CITIC group and Chinese Development Bank (CDB). The oil palm mega-project, launched in Indonesia under the banner of 'bringing prosperity, security and environmental protection to the Kalimantan border area', turned sour when a business plan developed by the Indonesian State Plantation Corporation (PTPN) began to circulate. This document contained a map that showed beyond doubt how the 1.8 million hectare oil pad doubt how the 1.8 million hectare oil palm project would trash the primary forests of three National Parks, cut through rugged slopes and mountains utterly unsuitable for oil palm cultivation and annihilate the customary rights land of the indigenous Dayak communities in the border area. This report describes what has come of the Kalimantan border oil palm mega-plan since it was announced, who is involved and what research, lobby and campaigning has led to so far. In particular, this study aims to inform civil society organizations, palm oil buyers, investors and government bodies outside Indonesia about the undiminished threats to the tropical rainforests and indigenous peoples related to Indonesia's oil palm expansion plans and the government's overall development agenda for Kalimantan

  17. Comparison of Virulence Plasmids among Clostridium perfringens Type E Isolates? †

    OpenAIRE

    Li, Jihong; Miyamoto, Kazuaki; Mcclane, Bruce A.

    2007-01-01

    Clostridium perfringens type E isolates produce iota-toxin, which is encoded by iap and ibp genes. Using Southern blot analyses, the current study identified iap/ibp plasmids of ?97 or ?135 kb among eight type E isolates. For most of these isolates, their iap/ibp plasmid also encoded urease and lambda-toxin. However, the beta2-toxin gene, if present, was on a different plasmid from the iap/ibp plasmid. For all isolates, the iap/ibp plasmid carried a tcp locus, strongly suggesting that the...

  18. “Festivalisation” of Urban Governance in South African Cities: Framing the Urban Social Sustainability of Mega-Event Driven Development from Below

    Directory of Open Access Journals (Sweden)

    Matthias Fleischer

    2013-12-01

    Full Text Available This article is based on field research in two South African host cities of the Men’s Football World Cup 2010 (eThekwini and Johannesburg. The discussed work is part of the research project “Festivalisation” of Urban Governance: The Production of Socio-Spatial Control in the Context of the FIFA World Cup 2010 in South Africa. In the context of mega-events, impacts and changes on urban development can vary on a spectrum of festivalisation between opposing poles, either “driven by the event”, or on the other hand where existing configurations of actors and established policies are “driving the event”. By drawing on a theoretical framework which is inspired by an analytical understanding of urban governance, our assumptions are that (a different configurations of governance promote different ways of handling the challenges associated to the hosting and (b that different types of “festivalisation” have different consequences and effects for the lived realities of the residents at a local level. The latter is an arena in which urban governance policies are translated, adapted, renegotiated or rejected. We argue that the bringing together of both spheres (local and metropolitan provides a profound understanding of the process of mega-event implementation and its relation to urban social sustainability.

  19. Intrauterine Infection with Plasmid-Free Chlamydia muridarum Reveals a Critical Role of the Plasmid in Chlamydial Ascension and Establishes a Model for Evaluating Plasmid-Independent Pathogenicity.

    Science.gov (United States)

    Chen, Jianlin; Yang, Zhangsheng; Sun, Xin; Tang, Lingli; Ding, Yiling; Xue, Min; Zhou, Zhiguang; Baseman, Joel; Zhong, Guangming

    2015-06-01

    Intravaginal infection with plasmid-competent but not plasmid-free Chlamydia muridarum induces hydrosalpinx in mouse upper genital tract, indicating a critical role of the plasmid in chlamydial pathogenicity. To evaluate the contribution of the plasmid to chlamydial ascension and activation of tubal inflammation, we delivered plasmid-free C. muridarum directly into the endometrium by intrauterine inoculation. We found that three of the six mouse strains tested, including CBA/J, C3H/HeJ, and C57BL/6J, developed significant hydrosalpinges when 1 × 10(7) inclusion-forming units (IFU) of plasmid-free C. muridarum were intrauterinally inoculated. Even when the inoculum was reduced to 1 × 10(4) IFU, the CBA/J mice still developed robust hydrosalpinx. The hydrosalpinx development in CBA/J mice correlated with increased organism ascension to the oviduct following the intrauterine inoculation. The CBA/J mice intravaginally infected with the same plasmid-free C. muridarum strain displayed reduced ascending infection and failed to develop hydrosalpinx. These observations have demonstrated a critical role of the plasmid in chlamydial ascending infection. The intrauterine inoculation of the CBA/J mice with plasmid-free C. muridarum not only resulted in more infection in the oviduct but also stimulated more inflammatory infiltration and cytokine production in the oviduct than the intravaginal inoculation, suggesting that the oviduct inflammation can be induced by plasmid-independent factors, which makes the hydrosalpinx induction in CBA/J mice by intrauterine infection with plasmid-free C. muridarum a suitable model for investigating plasmid-independent pathogenic mechanisms. PMID:25870225

  20. Role of Plasmid in Production of Acetobacter Xylinum Biofilms

    Directory of Open Access Journals (Sweden)

    Abbas Rezaee

    2005-01-01

    Full Text Available Acetobacter xylinum has the ability to produce cellulotic biofilms. Bacterial cellulose is expected to be used in many industrial or biomedical materials for its unique characteristics. A. xylinum contains a complex system of plasmid DNA molecules. A 44 kilobases (kb plasmid was isolated in wild type of A. xylinum. To improve the cellulose producing ability of A. xylinum, role of the plasmid in production of cellulose was studied. The comparisons between wild type and cured cells of A. xylinum showed that there is considerably difference in cellulose production. In order to study the relationship between plasmid and the rate of cellulose production, bacteria were screened for plasmid profile by a modified method for preparation of plasmid. This method yields high levels of pure plasmid DNA that can be used for common molecular techniques, such as digestion and transformation, with high efficiency.

  1. MODELING THE 1958 LITUYA BAY MEGA-TSUNAMI, II

    Directory of Open Access Journals (Sweden)

    Charles L. Mader

    2002-01-01

    Full Text Available Lituya Bay, Alaska is a T-Shaped bay, 7 miles long and up to 2 miles wide. The two arms at the head of the bay, Gilbert and Crillon Inlets, are part of a trench along the Fairweather Fault. On July 8, 1958, an 7.5 Magnitude earthquake occurred along the Fairweather fault with an epicenter near Lituya Bay.A mega-tsunami wave was generated that washed out trees to a maximum altitude of 520 meters at the entrance of Gilbert Inlet. Much of the rest of the shoreline of the Bay was denuded by the tsunami from 30 to 200 meters altitude.In the previous study it was determined that if the 520 meter high run-up was 50 to 100 meters thick, the observed inundation in the rest of Lituya Bay could be numerically reproduced. It was also concluded that further studies would require full Navier-Stokes modeling similar to those required for asteroid generated tsunami waves.During the Summer of 2000, Hermann Fritz conducted experiments that reproduced the Lituya Bay 1958 event. The laboratory experiments indicated that the 1958 Lituya Bay 524 meter run-up on the spur ridge of Gilbert Inlet could be caused by a landslide impact.The Lituya Bay impact landslide generated tsunami was modeled with the full Navier- Stokes AMR Eulerian compressible hydrodynamic code called SAGE with includes the effect of gravity.

  2. System modelling and identification of Mega-Amp Spherical Tokamak

    International Nuclear Information System (INIS)

    A dynamic system response model for plasma in Mega-Amp Spherical Tokamak (MAST) has been developed using RZIP. This is a linearized tokamak model. It assumes a constant plasma current distribution and axisymmetry. The plasma and conducting structures are approximated by discrete toroidal current filaments. RZIP generates a state-space model of the system behaviour, with PF coil voltages as inputs and various predicted diagnostic measurements as outputs. A separate SIMULINK model has been developed to represent the MAST plant, power supplies and analogue feedback controller. The RZIP and SIMULINK models were combined to produce a complete system model. This combined model was used to simulate test shots under both vacuum and plasma conditions. The two sets of traces cohere reasonably well, with some difference in attenuation levels. System identification experiments were carried out on the PF coils, with particular attention paid to the vertical field coils, under vacuum conditions. The frequency response behaviour was found using an excitation signal comprising a number of sinusoids. The RZIP model was verified by comparing its predicted response with experimental data

  3. Beyond the MEGA BORG: The future of cooperative damage assessments

    International Nuclear Information System (INIS)

    Prespill planning and coordination are the major requirements of industry and government to ensure future cooperative natural resource damage assessments (NRDA). Since oil spills most often occur without warning, both parties must be prepared prior to an oil spill into the environment. Federal and State co-trustees should enter into a Memorandum of Understanding (MOU) to ensure cooperation and coordination among trustees in all NRDA activities. The MOU should provide the framework whereby each trustee's resource interests can be represented. Ideally, MOUs should be prepared during the prespill planning process, although the MEGA BORG MOU was prepared soon after the actual discharge. The establishment of co-trustee working groups will foster the positive working relationships necessary in cooperative NRDAs. The trustees should identify all potential co-trustees in a given area and agree on a mechanism for trustee notification. Criteria for the rapid designation of the Lead Administrative Trustee and approaches for coordination with response agencies and potential responsible parties (PRPs) need to be developed. Most importantly, the trustees should identify PRPs and invite their participation in the prespill planning process

  4. Deficient sumoylation of yeast 2-micron plasmid proteins Rep1 and Rep2 associated with their loss from the plasmid-partitioning locus and impaired plasmid inheritance.

    Science.gov (United States)

    Pinder, Jordan B; McQuaid, Mary E; Dobson, Melanie J

    2013-01-01

    The 2-micron plasmid of the budding yeast Saccharomyces cerevisiae encodes copy-number amplification and partitioning systems that enable the plasmid to persist despite conferring no advantage to its host. Plasmid partitioning requires interaction of the plasmid Rep1 and Rep2 proteins with each other and with the plasmid-partitioning locus STB. Here we demonstrate that Rep1 stability is reduced in the absence of Rep2, and that both Rep proteins are sumoylated. Lysine-to-arginine substitutions in Rep1 and Rep2 that inhibited their sumoylation perturbed plasmid inheritance without affecting Rep protein stability or two-hybrid interaction between Rep1 and Rep2. One-hybrid and chromatin immunoprecipitation assays revealed that Rep1 was required for efficient retention of Rep2 at STB and that sumoylation-deficient mutants of Rep1 and Rep2 were impaired for association with STB. The normal co-localization of both Rep proteins with the punctate nuclear plasmid foci was also lost when Rep1 was sumoylation-deficient. The correlation of Rep protein sumoylation status with plasmid-partitioning locus association suggests a theme common to eukaryotic chromosome segregation proteins, sumoylated forms of which are found enriched at centromeres, and between the yeast 2-micron plasmid and viral episomes that depend on sumoylation of their maintenance proteins for persistence in their hosts. PMID:23555963

  5. Short-lived tectonic switch mechanism for long-term pulses of volcanic activity after mega-thrust earthquakes

    OpenAIRE

    Lupi, M.; Miller, S. A.

    2013-01-01

    Eruptive rates in volcanic arcs increase significantly after mega-thrust earthquakes in subduction zones. Over short to intermediate time periods the link between mega-thrust earthquakes and arc response can be attributed to dynamic triggering processes or static stress changes, but a fundamental mechanism that controls long-term pulses of volcanic activity after mega-thrust earthquakes has not been proposed yet. Using geomechanical, geological, and geophysical arguments, we propose tha...

  6. Ideal MHD stability of the mega-ampere spherical tokamak

    Science.gov (United States)

    Hole, M. J.; Akers, R. J.; Appel, L. C.; Buttery, R. J.; Brickley, C.; Conway, N. J.; Gryaznevich, M.; Hender, T. C.; Kwon, O. J.; Valovic, M.; Medvedev, S.; Patel, A.; Saarelma, S.; Taylor, D.; Wilson, H. R.; MAST Team

    2005-04-01

    In this work three techniques that refine the magnetic reconstruction of the mega-ampere spherical tokamak (MAST) equilibrium are detailed: kinetic reconstruction, in which the thermal pressure profile is fitted to thermal electron and ion data; bootstrap (BS) reconstruction, in which the edge current profile is modified to be self-consistent with the BS fraction (in the limit that edge current is BS dominated); and fast-particle reconstruction, in which an effective fast-ion pressure component is added, representing ions driven by charge exchange of the thermal ions with injected neutrals. Kinetic reconstructions for some high performance shots suggest normalized beta, ?n, up to 4.95 and BS fractions up to 30%, with internal inductance li ? 1 and pressure peaking factor p(0)/langprang ? 2.2. Full-orbit simulations suggest that up to 25% of the total stored energy in these high performance discharges is in the fast-ion population: addition of effective fast-particle pressures boosts ?n to 5.56. Ideal MHD pressure driven stability thresholds of n = 1, 2 and ? displacements are examined for kinetic and BS reconstructions of four high ?n MAST discharges. Based on kinetic reconstructions it is found that the no-wall instability threshold to external n = 1 displacements is ?n ? 5-6, and the with-wall ?n limit 10% higher than the no-wall limit. In comparison, the n = 1 no-wall instability threshold based on BS reconstructions is slightly below (?95%) that determined using kinetic reconstructions. Comparison to the MAST database suggests that MAST is approaching a regime in which passive stabilization is required to prevent ideal disruptions at higher ?n. Finally, vertical stability of an earlier set of MAST discharges is also examined, an estimate of the MAST effective wall for n = 0 modes provided, and the wall radius for marginal stability parameterized as a function of li and ?. Together, these provide a measure of proximity to marginal stability.

  7. Quality Control of Mega Voltage Portal Imaging System

    International Nuclear Information System (INIS)

    The Electronic Portal Imaging Device (EPID) is a system used to verify either the correct positioning of the patient during radiotherapy treatment or the linear accelerator beam parameters. The correct position of the patient corresponds to the position at which the patient was scanned at the CT simulator and according to which the therapy plan was made and optimized. Regarding this, besides the advanced treatment planning system and optimized treatment planning techniques, the day-to-day reproduction of simulated conditions is of great importance for the treatment outcome. Therefore, to verify the patient set-up portal imaging should be applied prior to the first treatment session and repeated according to treatment prescriptions during the treatment. In order to achieve full functionality and precision of the EPID, it must be included in radiotherapy Quality Control (QC) programme. The QC of the Mega Voltage portal imaging system was separated in two parts. In the first, the QC of the detector parameters should be performed. For this purpose, the FC2 and QC3 phantoms should be used, along with the Portal Image Processing System program (PIPSpro) package for data analysis. The second part of the QC of the linear accelerator's portal imaging system should include the QC of the CBCT. In this part a set of predefined manufacturer's tests using two different phantoms, one for the geometry calibration and the other for the image quality evaluation, should be performed. Also, the treatment conditions should be simulated using anthropomorphic phantoms and dose distributions for particular EPID protocols should be measured. Procedures for quality control of the portal imaging system developed and implemented at University Hospital Rijeka are presented in this paper.(author)

  8. An Assigned Teaching Resident Rotation

    Science.gov (United States)

    Daniels-Brady, Catherine; Rieder, Ronald

    2010-01-01

    Objective: The authors' adult psychiatry residency training program identified several educational needs for residents at their institution. Junior residents needed enhanced learning of clinical interviewing skills and learning connected to the inpatient psychiatry ward rotations, and senior residents needed opportunities to prepare for the…

  9. Homologous Recombination between Autonomously Replicating Plasmids in Mammalian Cells

    OpenAIRE

    AYARES, DAVID; Spencer, James; Schwartz, Faina; Morse, Brian; Kucherlapati, Raju

    1985-01-01

    The ability of autonomously replicating plasmids to recombine in mammalian cells was investigated. Two deletion plasmids of the eukaryotic-prokaryotic shuttle vector pSV2neo were cotransfected into transformed monkey COS cells. Examination of the low molecular weight DNA isolated after 48 hr of incubation revealed that recombination between the plasmids had occurred. The DNA was also used to transform recA- E. coli. Yield of neo R colonies signified homologous recombination. Examination of th...

  10. Streamlined Purification of Plasmid DNA From Prokaryotic Cultures

    OpenAIRE

    Pueschel, Laura; Li, Hongshan; Hymes, Matthew

    2011-01-01

    We describe the complete process of AcroPrep Advance Filter Plates for 96 plasmid preparations, starting from prokaryotic culture and ending with high purity DNA. Based on multi-well filtration for bacterial lysate clearance and DNA purification, this method creates a streamlined process for plasmid preparation. Filter plates containing silica-based media can easily be processed by vacuum filtration or centrifuge to yield appreciable quantities of plasmid DNA. Quantitative analyses determine ...

  11. Large linear plasmids of Borrelia species that cause relapsing fever.

    Science.gov (United States)

    Miller, Shelley Campeau; Porcella, Stephen F; Raffel, Sandra J; Schwan, Tom G; Barbour, Alan G

    2013-08-01

    Borrelia species of relapsing fever (RF) and Lyme disease (LD) lineages have linear chromosomes and both linear and circular plasmids. Unique to RF species, and little characterized to date, are large linear plasmids of ?160 kb, or ?10% of the genome. By a combination of Sanger and next-generation methods, we determined the sequences of large linear plasmids of two New World species: Borrelia hermsii, to completion of its 174-kb length, and B. turicatae, partially to 114 kb of its 150 kb. These sequences were then compared to corresponding sequences of the Old World species B. duttonii and B. recurrentis and to plasmid sequences of LD Borrelia species. The large plasmids were largely colinear, except for their left ends, about 27 kb of which was inverted in New World species. Approximately 60% of the B. hermsii lp174 plasmid sequence was repetitive for 6 types of sequence, and half of its open reading frames encoded hypothetical proteins not discernibly similar to proteins in the database. The central ?25 kb of all 4 linear plasmids was syntenic for orthologous genes for plasmid maintenance or partitioning in Borrelia species. Of all the sequenced linear and circular plasmids in Borrelia species, the large plasmid's putative partition/replication genes were most similar to those of the 54-kb linear plasmids of LD species. Further evidence for shared ancestry was the observation that two of the hypothetical proteins were predicted to be structurally similar to the LD species' CspA proteins, which are encoded on the 54-kb plasmids. PMID:23749977

  12. Drug resistance plasmids in Lactobacillus acidophilus and Lactobacillus reuteri.

    OpenAIRE

    Vescovo, M.; L. Morelli; V Bottazzi

    1982-01-01

    Sixteen strains of Lactobacillus reuteri and 20 strains of Lactobacillus acidophilus were tested for resistance to 22 antibiotics by using commercially available sensitivity disks. Evidence suggesting linkage of these resistances to plasmids was obtained by "curing" experiments with acridine dyes and high growth temperatures. Examination of plasmid patterns of agarose gel electrophoresis provided further evidence of loss in plasmid DNA under curing conditions in some of the strains examined.

  13. Pooling fMRI data: meta-analysis, mega-analysis and multi-center studies

    Directory of Open Access Journals (Sweden)

    SergiGCostafreda

    2009-09-01

    Full Text Available The quantitative analysis of pooled data from related fMRI experiments has the potential to significantly accelerate progress in brain mapping. Such data-pooling can be achieved through meta-analysis (the pooled analysis of published results, mega-analysis (the pooled analysis of raw data or multi-site studies which can be seen as designed mega-analyses. Current limitations in function-location brain mapping and how data-pooling can be used to remediate them are reviewed, with particular attention to power aggregation and mitigation of false positive results. Some recently developed analysis tools for meta- and mega-analysis are also presented, and recommendations for the conduct of valid fMRI data pooling are formulated.

  14. A Practical Data Recovery Technique for Long-Term Strain Monitoring of Mega Columns during Construction

    Directory of Open Access Journals (Sweden)

    Hyo Seon Park

    2013-08-01

    Full Text Available A practical data recovery method is proposed for the strain data lost during the safety monitoring of mega columns. The analytical relations among the measured strains are derived to recover the data lost due to unexpected errors in long-term measurement during construction. The proposed technique is applied to recovery of axial strain data of a mega column in an irregular building structure during construction. The axial strain monitoring using the wireless strain sensing system was carried out for one year and five months between 23 July 2010 and 22 February 2012. During the long-term strain sensing, three different types of measurement errors occurred. Using the recovery technique, the strain data that could not be measured at different intervals in the measurement were successfully recovered. It is confirmed that the problems that may occur during long-term wireless strain sensing of mega columns during construction could be resolved through the proposed recovery method.

  15. Construction of a eukaryotic expression plasmid of Humanin*

    OpenAIRE

    Luo, Ben-yan; Chen, Xiang-ming; Tang, Min; Chen, Feng; Chen, Zhi

    2004-01-01

    Objective: To construct a eukaryotic expression plasmid pcDNA3.1(-)-Humanin. Methods: The recombinant plasmid pGEMEX-1-Humanin was digested with restriction endonucleases BamH I and Hind III and the Humanin gene fragments, about 100 bp length, were obtained. Then the Humanin gene fragments were inserted into eukaryotic expression vector pcDNA3.1(-) and the recombinant plasmids pcDNA3.1(-)-Humanin were identified by sequencing. Results: Recombinant plasmid DNA successfully produced a band whic...

  16. Cloning of a Thiobacillus ferrooxidans plasmid in Escherichia coli.

    OpenAIRE

    Holmes, D S; Lobos, J. H.; Bopp, L H; Welch, G C

    1984-01-01

    Three separate plasmids of 6, 7, 16, and greater than 23 kilobases were purified from a single clone of Thiobacillus ferrooxidans ATCC 33020 grown in the presence of uranium. The 6.7-kilobase plasmid (pTf1) was cloned separately into the HindIII or BamHI site of Escherichia coli plasmid pBR322. Restriction maps of the recombinant plasmids, termed pTf100 and pTf110, respectively, were constructed, creating potential cloning vehicles for exchanging genetic information between E. coli and T. fer...

  17. Transposon-mediated conjugational transmission of nonconjugative plasmids.

    OpenAIRE

    Crisona, N J; Nowak, J.A.; Nagaishi, H; Clark, A.J.

    1980-01-01

    When coresident with conjugative plasmid pNC21, the nonconjugative deletion F-prime pJC59, which retains the F transfer origin oriT, was transmitted to transconjugants at a frequency comparable to that of pNC21. In addition, pJC59 was transmitted as an independent plasmid, physically separate from pNC21, an example of plasmid donation. In contrast, two plasmids that are derived from F and deleted for the oriT site, pJC61 and pML31, were transmitted at frequencies 10(4) lower than that of pNC2...

  18. Characterization of deletion derivatives of an autonomously replicating Neurospora plasmid.

    OpenAIRE

    Stohl, L L; Akins, R. A.; Lambowitz, A. M.

    1984-01-01

    We previously described two plasmids that replicate autonomously in both Neurospora and E. coli (Stohl and Lambowitz, Proc. Natl. Acad. Sci., U.S.A. 80, 1058-1062, 1983). One plasmid, pALS1, consists of the Neurospora ga-2+ gene (3 kb Hind III-fragment), the mitochondrial plasmid from N. intermedia strain P405-Labelle, and E. coli plasmid pBR325. The other, pALS2, is a putative deletion derivative of pALS1 that lacks most or all of the Labelle insert and that was repeatedly recovered from Neu...

  19. Mega Tsunamis of the World Ocean and Their Implication for the Tsunami Hazard Assessment

    Science.gov (United States)

    Gusiakov, V. K.

    2014-12-01

    Mega tsunamis are the strongest tsunamigenic events of tectonic origin that are characterized by run-up heights up to 40-50 m measured along a considerable part of the coastline (up to 1000 km). One of the most important features of mega-tsunamis is their ability to cross the entire oceanic basin and to cause an essential damage to its opposite coast. Another important feature is their ability to penetrate into the marginal seas (like the Sea of Okhotsk, the Bering Sea) and cause dangerous water level oscillations along the parts of the coast, which are largely protected by island arcs against the impact of the strongest regional tsunamis. Among all known historical tsunamis (nearly 2250 events during the last 4000 years) they represent only a small fraction (less than 1%) however they are responsible for more than half the total tsunami fatalities and a considerable part of the overall tsunami damage. The source of all known mega tsunamis is subduction submarine earthquakes with magnitude 9.0 or higher having a return period from 200-300 years to 1000-1200 years. The paper presents a list of 15 mega tsunami events identified so far in historical catalogs with their basic source parameters, near-field and far-field impact effects and their generation and propagation features. The far-field impact of mega tsunamis is largely controlled by location and orientation of their earthquake source as well as by deep ocean bathymetry features. We also discuss the problem of the long-term tsunami hazard assessment when the occurrence of mega tsunamis is taken into account.

  20. Viral/plasmid captures in Crenarchaea.

    Science.gov (United States)

    Das, Smarajit; Mitra, Sanga; Sahoo, Satyabrata; Chakrabarti, Jayprokas

    2014-04-01

    tRNA genes are the integration sites of viral/plasmid genomes into their hosts chromosomes by homologous recombination catalyzed by integrases. The crossover between viral/plasmid and host genomes leaves 3'-fractional tRNA motif as tell-tale marker of integration on host-chromosome. This 3'-fractional tRNA motif on host genome is our retrenched tRNA (rtRNA). To track integration in Crenarchaea, host rtRNAs, and conserved features in viral/plasmid tRNA motifs and in integrases were identified. The viral-integrase has a conserved 24-nucleotide long motif, GTATTATGTTTACTCAATAGAGAA in the N-terminal region. Upstream of the viral tRNA motif has a conserved poly-cytosine region and a hairpin secondary structure. Corresponding to a host tRNA, we observe up to two rtRNAs on crenarchaeal chromosome. The length of the rtRNA is not random. The fraction of tRNA excised off in rtRNA is either 61.8, or 50, or 38.2, or 23.6%. Thus, the integration fragments the tRNA nonrandomly dividing it approximately in ratios 3:2, or 1:1, or 2:3, or 1:3. More than 79% of rtRNAs have lengths that are excised 38.2% off tRNA. It turns out that 38.2% excision implies that the ratio of the length of tRNA to its rtRNA is just 1.618, the golden ratio. Hence, the vast majority of rtRNAs are at or near the golden ratio. Evidence emerges of new extremophile viral entities. PMID:23659319

  1. Geologic Signatures of the Mega-Impact on Vesta

    Science.gov (United States)

    Asphaug, E. I.; Jutzi, M.

    2011-12-01

    Like many solar system bodies, Vesta is dominated by the crater scar left by a large, late collision. One way to understand the asteroid's global geology -- and by extension, the geophysical behavior of rocky planetary embryos -- is to understand the mechanics of crater formation at this scale. Recent simulations (Melosh and Ivanov LPSC 2011; Jutzi and Asphaug GRL 2011) have used 2D and 3D hydrocodes with various models of interior rheology to best match the observations. The 3D model by Jutzi and Asphaug includes pre-impact rotation, which we have proposed would lead to unusual-looking topographic structures on the asteroid, for instance double-folded ejecta flaps. The figure below shows the thickness of ejecta following the collision, from 0 (blue) to 50 km (red), for three cases: (a) no rotation; impact on axis; (b) no rotation; 45° impact; and (c) 4 hr rotation; 45° impact. The dashed line and arrow indicate the rotation axis and the impact direction, respectively. In each case the crater diameter is ~400 km and the central peak is about 8-12 km above the deepest part of the floor. The effect of impact obliquity is rather small (if a somewhat larger scaled impactor is used) while pre-impact rotation has a huge effect on the outcome. The detailed structures that are left behind after this mega-cavity grows and collapses, depend on the relative timing of expansion and collapse, and spin rotation -- and of course, the orientation of the collision relative to the spin axis at the time of impact, and on the granular flow of rocks at fairly low gravity and strain rate. We aim to present our results in the context of released data from the Dawn mission, as they become available, and to present new model results and analyses. We will also present unpublished analysis of the ejecta products from these simulations. In addition, we will outline the validity of using a Mohr-Coulomb type granular model for our target, which although it predicts final crater topography reasonably well, including the central peak structure, may be a simplification of the internal structure and dynamical response. Vesta will guide us in understanding how to accurately model the kinds of collisions that led to the growth of planets.

  2. Cyclone Driven Sediment Loads in a Tropical Mega-River.

    Science.gov (United States)

    Darby, Stephen; Leyland, Julian; Hackney, Christopher; Heasley, Eleanore; Kummu, Matti; Lauri, Hannu; Parsons, Daniel; Nicholas, Andrew; Aalto, Rolf; Best, Jim

    2015-04-01

    Understanding the links between environmental change and sediment transport in the mega-rivers that dominate the flux of terrestrial sediment to their deltas and oceans remains a major challenge. Many large river systems display significant seasonality in flow regime, which is affected to a greater or lesser degree by the influence of large tropical storms, which act to increase their variability and thus drive uncertainty in predicting the impacts associated with changes in future flow regimes. Here we demonstrate the significance of tropical storms in driving sediment flux from one of the world's largest rivers, the Mekong, to its delta. Data was collected at Kratie, Cambodia; this being the site of the Mekong's final reliable flow gauging station before the Mekong delta. Suspended sediment fluxes were estimated by calibrating acoustic backscatter returns from an acoustic Doppler current profiler to observed suspended sediment concentrations (SSCs) across a monsoon cycle. The retrieved SSCs were combined with flow velocity estimates to recover the sediment flux. These estimates of flux were then used to build sediment rating curves to predict suspended flux as a function of flow discharge. A hydrological model, VMod, was then used to estimate daily discharge values for the same historical period, but for a scenario in which the effects of tropical storms on the flow regime are isolated. This was achieved by forcing the hydrological model with daily precipitation values that account for precipitation anomalies associated with observed tropical storms. The difference in cumulative sediment transport estimated by combining the two flow discharge scenarios with the constructed sediment rating curves allowed the contribution of tropical storms to the Lower Mekong's suspended sediment transport regime to be isolated. It was found that sediment loads in the Mekong River attenuate downstream from approximately 120 MT in Laos and Thailand to ~80-90 MT in the alluvial floodplain reaches of Cambodia. Furthermore, it is shown that the proportion of flux generated from tropical cyclones increases downstream and dominates (~60%) the flux observed around the confluence of the 3S basin (the Se San, Sre Pok and Se Kong Rivers) which drains the Vietnamese highlands. This implies future changes in cyclone tracks may impact upon sediment delivery to the Mekong delta.

  3. Cyclone Driven Sediment Loads in a Tropical Mega-River

    Science.gov (United States)

    Darby, S. E.; Leyland, J.; Hackney, C. R.; Heasley, E.; Kummu, M.; Lauri, H.; Parsons, D. R.; Nicholas, A. P.; Aalto, R. E.; Best, J.

    2014-12-01

    Understanding the links between environmental change and sediment transport in the mega-rivers that dominate the flux of terrestrial sediment to the oceans remains a major challenge. Many large river systems display significant seasonality in flow regime, which is affected to a greater or lesser degree by the influence of large tropical storms, which act to increase their variability and thus drive uncertainty in predicting the impacts associated with changes in future flow regimes. Here we quantify the significance of tropical storms in driving sediment flux from one of the world's largest rivers, the Mekong. Data was collected at Kratie, Cambodia; this being the site of the Mekong's final reliable flow gauging station before the Mekong delta. Suspended sediment fluxes were estimated by calibrating acoustic backscatter returns from an acoustic Doppler current profiler to observed suspended sediment concentrations (SSCs) across a monsoon cycle. The retrieved SSCs were combined with flow velocity estimates to recover the sediment flux. These estimates of flux were then used to build sediment rating curves, taking account of hysteresis effects associated with sediment starvation on the falling limb of the Mekong's flood pulse, to predict suspended flux as a function of flow discharge. The derived sediment rating curves were then employed in an effective discharge analysis, initially using gauged flows, which include the effects of tropical storms, for the period 1981-2013. A hydrological model was then used to estimate daily discharge values for the same historical period, but for a scenario in which the effects of tropical storms on the flow regime are isolated. This was achieved by forcing the hydrological model with daily precipitation values that account for precipitation anomalies associated with observed tropical storms. The difference in cumulative sediment transport estimated by combining the two flow discharge scenarios with the constructed sediment rating curves allowed the contribution of tropical storms to the Lower Mekong's suspended sediment transport regime to be isolated. This paper will outline the details of the methods employed and discuss the implications of the finding regarding the influence of the monsoon-tropical storm system in effluxing sediment to the Mekong delta.

  4. Mega sporting events: A poisoned chalice or a new dawn for low- and middle-income

    Directory of Open Access Journals (Sweden)

    Mark Tomlinson

    2011-06-01

    Full Text Available Mega sporting events in South Africa, which has the largest number of HIV-positive people in the world, and India, with 1.8 million deaths of children under 5 each year and 52 million stunted children, raise questions about the effective and, as importantly, the moral imperative of spending billions of dollars to host a sporting event. From a health perspective, selling alcohol and debt tarnishes further the notion of any intangible benefits of mega events to low- and middle-income countries.

  5. Excess Clustering on Large Scales in the MegaZ DR7 Photometric Redshift Survey

    OpenAIRE

    Thomas, S A; Abdalla, F. B.; Lahav, O

    2011-01-01

    We observe a large excess of power in the statistical clustering of Luminous Red Galaxies in the photometric SDSS galaxy sample called MegaZ DR7. This is seen over the lowest multipoles in the angular power spectra C_{\\ell} in four equally spaced redshift bins between 0.45 < z < 0.65. However, it is most prominent in the highest redshift band at ~ 4 sigma and it emerges at an effective scale k ~ 0.01 h Mpc^{-1}. Given that MegaZ DR7 is the largest cosmic volume galaxy survey...

  6. When bigger is better: the need for Amazonian mega-reserves.

    Science.gov (United States)

    Laurance, William F

    2005-12-01

    The rate of forest destruction has accelerated sharply in Brazilian Amazonia, but there are also vital conservation opportunities with the ongoing designation of important new protected areas. In a timely paper, Carlos Peres argues that an extensive network of mega-reserves, operationally defined as those exceeding 1 million ha in area, is needed to ensure the long-term persistence of Amazonian species and ecological processes. Although such protected areas might seem excessively large to some, disparate lines of evidence suggest that mega-reserves are vital for the future of Amazonian biodiversity. PMID:16701449

  7. Photonic plasmid stability of transformed Salmonella Typhimurium: A comparison of three unique plasmids

    Directory of Open Access Journals (Sweden)

    Lay Donald

    2009-07-01

    Full Text Available Abstract Background Acquiring a highly stable photonic plasmid in transformed Salmonella Typhimurium for use in biophotonic studies of bacterial tracking in vivo is critical to experimental paradigm development. The objective of this study was to determine stability of transformed Salmonella Typhimurium (S. typh-lux using three different plasmids and characterize their respective photonic properties. Results In presence of ampicillin (AMP, S. typh-lux with pCGLS-1, pAK1-lux and pXEN-1 plasmids exhibited 100% photon-emitting colonies over a 10-d study period. Photon emitters of S. typh-lux with pCGLS-1, pAK1-lux and pXEN-1 without AMP selection decreased over time (P 7 to 1 × 109 CFU, P 0.05; although photonic emissions across a range of bacterial concentrations were not different (1 × 104 to 1 × 106 CFU, P > 0.05. For very low density bacterial concentrations imaged in 96 well plates photonic emissions were positively correlated with bacterial concentration (P 3 to 1 × 105 CFU low to high were different in the 96-well plate format (P Conclusion These data characterize photon stability properties for S. typh-lux transformed with three different photon generating plasmids that may facilitate real-time Salmonella tracking using in vivo or in situ biophotonic paradigms.

  8. Photonic plasmid stability of transformed Salmonella typhimurium: A comparison of three unique plasmids

    Science.gov (United States)

    Acquiring a highly stable photonic plasmid in transformed Salmonella typhimurium for use in biophotonic studies of bacterial tracking in vivo is critical to experimental paradigm development. The objective of this study was to determine stability of transformed Salmonella typhimurium (S. typh-lux) u...

  9. Photonic Plasmid Stability of Transformed Salmonella Typhimurium: A Comparison of Three Unique Plasmids

    Science.gov (United States)

    Background: Acquiring a highly stable photonic plasmid in transformed Salmonella Typhimurium for use in biophotonic studies of bacterial tracking in vivo is critical to experimental paradigm development. The objective of this study was to determine stability of transformed Salmonella Typhimurium (S....

  10. [A novel Salmonella Typhimurium plasmid, pAnkS: an example for plasmid evolution in antibiotic resistance].

    Science.gov (United States)

    Sahin, Fikret; Karasartova, Djursun; Gerçeker, Devran; Aysev, A Derya; Erdem, Birsel

    2008-07-01

    In this study, a plasmid, carrying ampicillin resistance (ampR) gene, isolated from a clinical isolate of Salmonella enterica serotype Typhimurium presenting ACSSuT (ampicilin, chloramphenicol, streptomycin, sulphonamide, tetracycline) resistance phenotype, was defined. The length of complete sequence of this plasmid was 8271 base pairs (bp), and it was named as pAnkS owing to its isolation place (plasmid-Ankara- Salmonella). The plasmid was analyzed for potential reading frames and structural features indicative of transposons and transposon relics. The Xmnl enzyme restriction fragments of pAnkS were cloned into E. coli plasmid vectors (pBSK), sequenced and analyzed with the BLAST programs. Plasmid pAnkS has contained a previously defined enterohemorrhagic E. coli (EHEC) plasmid p4821 as a core region and also contained a complete Tn3-like transposon of 4950 bp consisting of the left terminal repeat, Tn3-related tnpR and tnpA genes for transposition functions, ampicillin resistance gene bla(TEM), and the right terminal repeats, pAnkS showed strong homology with another Salmonella plasmid, pNTP16, for sequences that belong to p4821 and partial Tn3 segments. It was found that pNTP16 also carries kanamycin resistance gene (kanR) in addition to ampR gene. Plasmid pAnkS is one of the few completely sequenced plasmids from Salmonella Typhimurium and is in the middle of the pathway of evolution of plasmid from p4821 to pNTP16. The identification of pAnkS might help better understanding of plasmid evolution. PMID:18822880

  11. Permissiveness of soil microbial communities towards broad host range plasmids

    DEFF Research Database (Denmark)

    Klümper, Uli

    2015-01-01

    Horizontal transfer of mobile genetic elements facilitates adaptive and evolutionary processes in bacteria. Among the known mobile genetic elements, plasmids can confer their hosts with accessory adaptive traits, such as antibiotic or heavy metal resistances, or additional metabolic pathways. Plasmids are implicated in the rapid spread of antibiotic resistance and the emergence of multi-resistant pathogenic bacteria, making it crucial to be able to quantify, understand, and, ideally, control plasmid transfer in mixed microbial communities. The fate of plasmids in microbial communities and the extent of bacterial phyla permissive towards plasmid receipt are largely unknown. Historically, methods exploring the underlying genetic and environmental factors of plasmid transfer have been heavily reliant on cultivation and expression of plasmid encoded phenotypes. This has provided an incomplete and potentially cultivation biased image of the extent of plasmid transfer. In this thesis, I investigated the extent of plasmid transfer in microbial communities at an unprecedented level of resolution and not reliant on cultivation. I focused on soil microbial communities. Their potential role as a reservoir for plasmids carrying antibiotic resistance genes is increasingly suspected to majorly contribute to the emergence of multi-resistant pathogens. More specifically, I examined what fraction of a soil microbial community is permissive to plasmids, identified the phylogenetic identity of this fraction and studied environmental factors that modulate plasmid transfer in soil microbial communities. In order to attain these goals, I developed a high-throughput method that enabled me to evaluate the permissiveness of bacterial communities towards introduced plasmids. This new approach is based on the introduction of fluorescently tagged conjugative plasmids into a soil microbial community in solid-surface filter matings under maximized cell-to-cell contact, followed by quantification of transfer events through advanced fluorescent microscopy, isolation of transconjugants through triple-gated fluorescent activated cell sorting and finally 16S rRNA targeted pyrosequencing of the sorted transconjugal pools. Employing this new method, I was able to map, for the first time, the diversity of all recipients in a soil microbial community for three broad host range model plasmids: RP4, pKJK5, and pIPO2tet. I found that a large fraction of soil the bacteria (up to 1 in 10,000) were able to take up any of these broad host range conjugal plasmids. The transconjugal pools comprised 11 bacterial phyla. This finding indicates that the realized transfer range of broad host range plasmids in environmental microbial communities is much larger than previously assumed. I was able to show abundant plasmid transfer from the Gram negative donor strains to a wide diversity of Gram positive soil bacteria, formerly thought to constitute distinct clusters of gene transfer. Moreover, among the observed transconjugants, I identified a core super-permissive fraction of taxa prone to receive diverse BHR plasmids from diverse donors. This fraction comprised the proteobacterial genera Pseudomonas, Enterobacterium and Burkolderia. These taxa are known to be evolutionary interlinked through chromosomal gene exchange. Hence, I was able to show that the gene pool of microbial communities may be directly interconnected through transfer of BHR plasmids at a so far unrecognized level. The developed method furthermore enabled me to explore how agronomic practices may affect gene transfer in soil microbial communities. I compared bacterial communities extracted from plots subjected to different treatments for their permissiveness towards the model BHR plasmids RP4, pRO101 and pIPO2tet. Periodic manure introduction increased the permissiveness of the community towards these plasmids by up to 100% compared to control treatments. However, the phylogenetic composition of the transconjugal pools remained similar. The underlying mechanisms remain unclear. Subsequently, I focusedon the

  12. Water Molecule Residence Times

    Science.gov (United States)

    Sill - Earth Systems Science

    2010-11-16

    How long will a molecule of Water stay in a particular reservoir? What is the average time a molecule of Water will stay in an ocean? What is the average time a molecule of water will stay in a river? A lake? As groundwater? A glacier? How long will a water vapor molecule stay suspended in the atmosphere? Why is the residence ...

  13. Plasmid-encoded copper resistance and precipitation by Mycobacterium scrofulaceum.

    OpenAIRE

    Erardi, F. X.; Failla, M. L.; Falkinham, J. O.

    1987-01-01

    A copper-tolerant Mycobacterium scrofulaceum strain was able to remove copper from culture medium by sulfate-dependent precipitation as copper sulfide. Such precipitation of copper sulfide was not observed in a derivative that lacks a 173-kilobase plasmid. In addition, the plasmid-carrying strain has a sulfate-independent copper resistance mechanism.

  14. Isolation of chromosomal and plasmid DNA from Staphylococcus epidermidis.

    Science.gov (United States)

    Lindgren, Jill K

    2014-01-01

    The following describes noncommercial methods for the purification of genomic and plasmid DNA from S. epidermidis. These include both large-scale, high molecular weight and quick, small-scale chromosomal DNA extractions, and also a standard alkaline lysis method of plasmid preparation. PMID:24222459

  15. Transformation of Bacillus subtilis by single-stranded plasmid DNA.

    OpenAIRE

    Rudolph, C F; Schmidt, B. J.; Saunders, C W

    1986-01-01

    The single-stranded form of a pE194-based plasmid transformed Bacillus subtilis protoplasts at least as efficiently as did the double-stranded plasmid, but the single-stranded form did not detectably transform B. subtilis competent cells.

  16. NATURAL TRANSFORMATION OF A MARINE VIBRIO SPECIES BY PLASMID DNA

    Science.gov (United States)

    A series of thirty marine and estuarine bacterial isolates was examined for the ability to naturally transform with plasmid DNA. One isolate from Tampa Bay, Florida, identified as Vibrio parahaemolyticus, successfully incorporated and maintained the broad host range plasmid pKT23...

  17. Replicon Typing of Plasmids Encoding Resistance to Newer ?-Lactams

    OpenAIRE

    Carattoli, Alessandra; Miriagou, Vivi; Bertini, Alessia; Loli, Alexandra; Colinon, Celine; Villa, Laura; Whichard, Jean M.; Rossolini, Gian Maria

    2006-01-01

    Polymerase chain reaction–based replicon typing represents a novel method to describe the dissemination and follow the evolution of resistance plasmids. We used this approach to study 26 epidemiologically unrelated Enterobacteriaceae and demonstrate the dominance of incompatibility (Inc) A/C or Inc N-related plasmids carrying some emerging resistance determinants to extended-spectrum cephalosporins and carbapenems.

  18. Replicon Typing of Plasmids Encoding Resistance to Newer ?-Lactams

    Science.gov (United States)

    Miriagou, Vivi; Bertini, Alessia; Loli, Alexandra; Colinon, Celine; Villa, Laura; Whichard, Jean M.; Rossolini, Gian Maria

    2006-01-01

    Polymerase chain reaction–based replicon typing represents a novel method to describe the dissemination and follow the evolution of resistance plasmids. We used this approach to study 26 epidemiologically unrelated Enterobacteriaceae and demonstrate the dominance of incompatibility (Inc) A/C or Inc N-related plasmids carrying some emerging resistance determinants to extended-spectrum cephalosporins and carbapenems. PMID:16836838

  19. Phage type conversion in Salmonella enterica serotype Enteritidis caused by the introduction of a resistance plasmid of incompatibility group X (IncX)

    DEFF Research Database (Denmark)

    Brown, D. J.; Baggesen, Dorte Lau

    1999-01-01

    The plasmid pOG670, a 54 kb, conjugative plasmid that specifies resistance to ampicillin and kanamycin and belonging to the incompatibility group X (IncX), was transferred into 10 isolates of Salmonella enterica serotype Enteritidis belonging to 10 different phage types (PT1, 2, 3, 4, 8, 9, 9b, 10, 11 and 13). Acquisition of the plasmid by these strains did not result in the loss of any resident plasmids but resulted in phage type conversion in 8 of the 10 strains (PT1, 2, 4, 8, 9, 9b, 10 and 11). The observed changes in phage type were found to result from the loss of sensitivity to 3 of the 10 typing phages used (phages 3, 5 and 7). Where the conversion resulted in a change to a defined phage type, both the new and original PTs belonged to the same, previously described, evolutionary lines. Enteritidis PTs 1, 4 and 8, commonly associated with poultry world-wide, were converted to PTs 21, 6 and 13a respectively. The results indicate a different route for phage type conversion Enteritidis from others reportedin the literature and, although IncX plasmids are not normally present in PT8 or PT13a, may suggest a possible mechanism/link connecting these phage types.

  20. Facilitators and Inhibitors of Bidding and Hosting Mega Sporting Events in Iran

    Directory of Open Access Journals (Sweden)

    Mohammad Koosha

    2013-01-01

    Full Text Available Legacies of hosting mega sporting events have been attempting idea for both the developed and the developing nations to participate in "bidding" competitions. Through mega sporting events bid process, despite all defined essentials infrastructures, the viewpoint of local organizing committee play a significant role to propose a winning bid and delivery of successful games. This research aims to identify the facilitators and inhibitors of bidding and hosting mega sporting events in Iran from the viewpoints of the Iranian distinguished professors in the sport management and the sport executive managers. Researcher questionnaire and Semi-structure interviews were conducted to gain in depth data. The results indicated that Iran currently has limitations to have winning bid and successful host mega sporting events; even though, it possesses the potential to do so. Public interest and support for hosting the sport events, good security condition against terrorism and tourist attractions are known as the strong points and he challenges and inhibitors which Iran is faced with includes: the qualitative and quantitative weakness in the transportation infrastructures and sport venues, west countries economic boycott, unstable government support and the lack of long-run planning for the events.

  1. Scaling Relation of Mega-fault Systems for Strong Ground Motion Prediction

    Science.gov (United States)

    Irikura, K.; Awata, Y.; Miyake, H.; Kagawa, T.; Miyakoshi, K.; Sato, T.; Dan, K.; Matsushima, S.

    2006-12-01

    We are studying scaling relations between fault length (L) and seismic moment (Mo) for mega-fault systems such as the 1906 San Francisco earthquake and the 2002 Denali earthquake. Scholz (2002) proposed an idea that the scaling relation changes from L-model to W-model for extra large earthquakes. According to the idea, Ikikura et al. (2004) proposed three-stage scaling relations between fault rupture area (S) and seismic moment; i.e., Mo is in proportion with S^{2/3} for MoAwata (2006) proposes liner relationship between behavioral fault segment length and its maximum displacement. He also proposed saturation of fault displacement in case of mega-fault system. We here propose and demonstrate new scaling relations between fault length and seismic moment for mega-fault systems compiling past earthquake data (introducing field data about behavioral fault segments). We compare the derived fault width with carefully validated fault width from waveform and geodetic inversions to develop scaling relation for strong ground motion estimation. ACKNOWLEDGEMENT: A portion of this study was supported by the JNES research topic 'Ground Motion Prediction for Mega-fault Systems Based on Dynamic Source Modeling' (P.I.: Kojiro Irikura). REFERENCES: Somerville et al. (1999), SRL. Irikura et al. (2004), 13WCEE. Scholz(2002),Cambridge University Press. Awata (2006), AGU 2006 Fall Meeting.

  2. Streamlined purification of plasmid DNA from prokaryotic cultures.

    Science.gov (United States)

    Pueschel, Laura; Li, Hongshan; Hymes, Matthew

    2011-01-01

    We describe the complete process of AcroPrep Advance Filter Plates for 96 plasmid preparations, starting from prokaryotic culture and ending with high purity DNA. Based on multi-well filtration for bacterial lysate clearance and DNA purification, this method creates a streamlined process for plasmid preparation. Filter plates containing silica-based media can easily be processed by vacuum filtration or centrifuge to yield appreciable quantities of plasmid DNA. Quantitative analyses determine the purified plasmid DNA is consistently of high quality with average OD(260/280;) ratios of 1.97. Overall, plasmid yields offer more pure DNA for downstream applications, such as sequencing and cloning. This streamlined method of using AcroPrep Advance Filter Plates allows for manual, semi-automated or fully-automated processing. PMID:21248696

  3. Mega-precovery and data mining of near-Earth asteroids and other Solar System objects

    Science.gov (United States)

    Popescu, M.; Vaduvescu, O.; Char, F.; Curelaru, L.; Euronear Team

    2014-07-01

    The vast collection of CCD images and photographic plate archives available from the world-wide archives and telescopes is still insufficiently exploited. Within the EURONEAR project we designed two data mining software with the purpose to search very large collections of archives for images which serendipitously include known asteroids or comets in their field, with the main aims to extend the arc and improve the orbits. In this sense, ''Precovery'' (published in 2008, aiming to search all known NEAs in few archives via IMCCE's SkyBoT server) and ''Mega-Precovery'' (published in 2010, querying the IMCCE's Miriade server) were made available to the community via the EURONEAR website (euronear.imcce.fr). Briefly, Mega-Precovery aims to search one or a few known asteroids or comets in a mega-collection including millions of images from some of the largest observatory archives: ESO (15 instruments served by ESO Archive including VLT), NVO (8 instruments served by U.S. NVO Archive), CADC (11 instruments, including HST and Gemini), plus other important instrument archives: SDSS, CFHTLS, INT-WFC, Subaru-SuprimeCam and AAT-WFI, adding together 39 instruments and 4.3 million images (Mar 2014), and our Mega-Archive is growing. Here we present some of the most important results obtained with our data-mining software and some new planned search options of Mega-Precovery. Particularly, the following capabilities will be added soon: the ING archive (all imaging cameras) will be included and new search options will be made available (such as query by orbital elements and by observations) to be able to target new Solar System objects such as Virtual Impactors, bolides, planetary satellites, TNOs (besides the comets added recently). In order to better characterize the archives, we introduce the ''AOmegaA'' factor (archival etendue) proportional to the AOmega (etendue) and the number of images in an archive. With the aim to enlarge the Mega-Archive database, we invite the observatories (particularly those storing their images online and also those that own plate archives which could be scanned on request) to contact us in order to add their instrument archives (consisting of an ASCII file with telescope pointings in a simple format) to our Mega-Precovery open project. We intend for the future to synchronise our service with the Virtual Observatory.

  4. Multilocus sequence typing of IncN plasmids

    DEFF Research Database (Denmark)

    García-Fernández, Aurora; Villa, Laura

    2011-01-01

    OBJECTIVES: Incompatibility group N (IncN) plasmids have been associated with the dissemination of antimicrobial resistance and are a major vehicle for the spread of blaVIM-1 in humans and blaCTX-M-1 in animals. A plasmid multilocus sequence typing (pMLST) scheme was developed for rapid categorization of IncN plasmids. METHODS: Twelve fully sequenced IncN plasmids available at GenBank were analysed in silico for selecting the loci for the IncN-specific pMLST. A total of 58 plasmids originating from different reservoirs (human, pig, poultry, cattle and horses) and geographic regions (Italy, Greece, Denmark, UK and The Netherlands) were classified by DNA sequencing of the amplicons obtained for the repA, traJ and korA loci. RESULTS: Eleven sequence types (STs) were defined on the basis of allele sequences of the three selected loci. Most plasmids carrying blaCTX-M-1 (24/27) isolated in different countries from both animals and humans belonged to ST1, suggesting dissemination of an epidemic plasmid through the food chain. Fifteen of 17 plasmids carrying blaVIM-1 from Klebsiella pneumoniae and Escherichia coli, isolated during a 5year period in Greece were assigned to ST10, suggesting that spread and persistence of this particular IncN-carrying blaVIM-1 lineage in Greece. CONCLUSIONS: This study proposes the use of pMLST as a suitable and rapid method for identification of IncN epidemic plasmid lineages. The recent spread of blaCTX-M-1 among humans and animals seems to be associated with the dissemination of an epidemic IncN plasmid lineage.

  5. Effect of 2MEGA labeling on membrane proteome analysis using LC-ESI QTOF MS.

    Science.gov (United States)

    Ji, Chengjie; Lo, Andy; Marcus, Sandra; Li, Liang

    2006-10-01

    One of the challenges associated with large-scale proteome analysis using tandem mass spectrometry (MS/MS) and automated database searching is to reduce the number of false positive identifications without sacrificing the number of true positives found. In this work, a systematic investigation of the effect of 2MEGA labeling (N-terminal dimethylation after lysine guanidination) on the proteome analysis of a membrane fraction of an Escherichia coli cell extract by 2-dimensional liquid chromatography MS/MS is presented. By a large-scale comparison of MS/MS spectra of native peptides with those from the 2MEGA-labeled peptides, the labeled peptides were found to undergo facile fragmentation with enhanced a1 or a1-related (a(1)-17 and a(1)-45) ions derived from all N-terminal amino acids in the MS/MS spectra; these ions are usually difficult to detect in the MS/MS spectra of nonderivatized peptides. The 2MEGA labeling alleviated the biased detection of arginine-terminated peptides that is often observed in MALDI and ESI MS experiments. 2MEGA labeling was found not only to increase the number of peptides and proteins identified but also to generate enhanced a1 or a1-related ions as a constraint to reduce the number of false positive identifications. In total, 640 proteins were identified from the E. coli membrane fraction, with each protein identified based on peptide mass and sequence match of one or more peptides using MASCOT database search algorithm from the MS/MS spectra generated by a quadrupole time-of-flight mass spectrometer. Among them, the subcellular locations of 336 proteins are presently known, including 258 membrane and membrane-associated proteins (76.8%). Among the classified proteins, there was a dramatic increase in the total number of integral membrane proteins identified in the 2MEGA-labeled sample (153 proteins) versus the unlabeled sample (77 proteins). PMID:17022628

  6. Dispersed Interactions of Urban Residents

    OpenAIRE

    Bazhanov, Andrei; Hartwick, John

    2006-01-01

    Beckmann's interaction model has each resident touching base in face-to-face activity with every other resident at the other's residence per unit time. We re-work his resulting ''interaction city'' with each resident ''operating with'' a Cobb-Douglas utility function. Similar but somewhat ''richer'' outcomes occur. We also investigate a new case with intermediate dispersion of face-to-face activity, one with scale economies in trip-making.

  7. The right hand copy of the nopaline Ti-plasmid 25 bp repeat is required for tumour formation.

    OpenAIRE

    Watson, M. D.; Carter, G H; Shaw, C H

    1984-01-01

    At either end of the nopaline Ti-plasmid T-region resides a copy of a 25 bp repeated element. The normal T-DNA endpoint is 1 bp internal of the right copy, with the transcription initiation site of the nopaline synthase (nos) gene being approximately 300 bp away in the same direction. Here we describe results which demonstrate that deletion of any combination of sequences between the nos initiation site and the right copy of the 25 bp repeat does not affect oncogenicity. Thus a mutant retaini...

  8. Resident-to-Resident Abuse: A Scoping Review.

    Science.gov (United States)

    McDonald, Lynn; Sheppard, Christine; Hitzig, Sander L; Spalter, Tal; Mathur, Avantika; Mukhi, Jason Singh

    2015-06-01

    Resident-to-resident abuse involves aggression and violence that occurs between long-term care (LTC) home residents and can have serious consequences for both aggressors and victims. To date, there has been no attempt to systematically assess the breadth of the problem in Canada. To address this gap, we undertook a scoping review to enhance understanding of resident-to-resident abuse in LTC homes. A redacted Canadian data set on resident-to-resident abuse is also reported on. Nine electronic literature databases were searched; a total of 784 abstracts were identified, but only 32 satisfied the inclusion criteria. The majority of records (75%) were retrospective case studies, qualitative studies, and reviews/commentaries. Of these, only 14 focused exclusively on resident-to-resident abuse. The redacted Canadian data set suggests resident-to-resident abuse makes up approximately one-third of reported abuse cases. Recommendations for future research, clinical practice, and policy are provided to raise awareness of this phenomenon to help decrease its incidence. PMID:25752919

  9. Antibiotic resistance plasmids of Staphylococcus aureus and their clinical importance

    International Nuclear Information System (INIS)

    A variety of plasmids were isolated physically, and most antibiotic resistance is thought to be plasmid mediated. A number of characters (e.g., resistance to erythromycin or methicillin, and production of pigment) are determined by genes that do not give clear indications of either plasmid or chromosomal location. Although the formation of a particular plasmid is probably, even in bacterial terms, a very rare event, once formed such an element can spread rapidly among the bacterial population. The spectacular increase in the incidence of penicillinase-producing hospital strains in the late 1940's could have been due in part to this process. Evidence is stronger, however, for the intercell transfer of recently isolated plasmids coding for resistance to fusidic acid (and penicillinase production), or for neomycin, or for tetracycline resistance. Study of bacterial plasmids can resolve fundamental biochemical problems, and give some insight into the life of the cell at the molecular level. But the immediate application of the study of staphylococcal plasmids may be directed towards improving the effectiveness of antibiotic therapy. The most important aspect of future anti-staphylococcal chemotherapy should thus be the limitation of the use of antibiotics, particularly for application to the skin and nose. (U.S.)

  10. Plasmid-associated sensitivity of Bacillus thuringiensis to UV light

    International Nuclear Information System (INIS)

    Spores and vegetative cells of Bacillus thuringiensis were more sensitive to UV light than were spores or cells of plasmid-cured B. thuringiensis strains or of the closely related Bacillus cereus. Introduction of B. thuringiensis plasmids into B. cereus by cell mating increased the UV sensitivity of the cells and spores. Protoxins encoded by one or more B. thuringiensis plasmids were not involved in spore sensitivity, since a B. thuringiensis strain conditional for protoxin accumulation was equally sensitive at the permissive and nonpermissive temperatures. In addition, introduction of either a cloned protoxin gene, the cloning vector, or another plasmid not containing a protoxin gene into a plasmid-cured strain of B. thuringiensis all increased the UV sensitivity of the spores. Although the variety of small, acid-soluble proteins was the same in the spores of all strains examined, the quantity of dipicolinic acid was about twice as high in the plasmid-containing strains, and this may account for the differences in UV sensitivity of the spores. The cells of some strains harboring only B. thuringiensis plasmids were much more sensitive than cells of any of the other strains, and the differences were much greater than observed with spores

  11. Low-level infrared laser effect on plasmid DNA.

    Science.gov (United States)

    Fonseca, Adenilson Souza; Geller, Mauro; Bernardo Filho, Mario; Valença, Samuel Santos; de Paoli, Flavia

    2012-01-01

    Low-level laser therapy is used in the treatment of many diseases based on its biostimulative effect. However, the photobiological basis for its mechanism of action and adverse effects are not well understood. The aim of this study, using experimental models, was to evaluate the effects of laser on bacterial plasmids in alkaline agarose gel electrophoresis and Escherichia coli cultures. The electrophoretic profile of bacterial plasmids in alkaline agarose gels were used for studying lesions in DNA exposed to infrared laser. Transformation efficiency and survival of Escherichia coli AB1157 (wild-type), BH20 (fpg/mutM(-)), BW9091 (xth(-)), and DH5?F'Iq (recA(-)) cells harboring pBSK plasmids were used as experimental models to assess the effect of laser on plasmid DNA outside and inside of cells. Data indicate low-level laser: (1) altered the electrophoretic profile of plasmids in alkaline gels at 2,500-Hz pulsed-emission mode but did not alter at continuous wave, 2.5- and 250-Hz pulsed-emission mode; (2) altered the transformation efficiency of plasmids in wild-type and fpg/mutM(-) E. coli cells; (3) altered the survival fpg/mutM(-), xthA(-) and recA(-) E. coli cultures harboring pBSK plasmids. Low-level infrared laser with therapeutic fluencies at high frequency in pulsed-emission modes have effects on bacterial plasmids. Infrared laser action can differently affect the survival of plasmids in E. coli cells proficient and deficient in DNA repair mechanisms, therefore, laser therapy protocol should take into account fluencies, frequencies and wavelength of laser, as well as tissue conditions and genetic characteristics of cells before beginning treatment. PMID:21556926

  12. Large Linear Plasmids of Borrelia Species That Cause Relapsing Fever

    OpenAIRE

    Miller, Shelley Campeau; Porcella, Stephen F.; Raffel, Sandra J.; Schwan, Tom G.; Barbour, Alan G.

    2013-01-01

    Borrelia species of relapsing fever (RF) and Lyme disease (LD) lineages have linear chromosomes and both linear and circular plasmids. Unique to RF species, and little characterized to date, are large linear plasmids of ?160 kb, or ?10% of the genome. By a combination of Sanger and next-generation methods, we determined the sequences of large linear plasmids of two New World species: Borrelia hermsii, to completion of its 174-kb length, and B. turicatae, partially to 114 kb of its 150 kb....

  13. Linearization of donor DNA during plasmid transformation in Neisseria gonorrhoeae.

    OpenAIRE

    Biswas, G D; Burnstein, K L; Sparling, P F

    1986-01-01

    We examined the fate of plasmid DNA after uptake during transformation in Neisseria gonorrhoeae. An 11.5-kilobase plasmid, pFA10, was processed to linear double-stranded DNA during uptake by competent cells, but cleavage of pFA10 was not site specific. A minority of pFA10 entered as open circles. A 42-kilobase plasmid, pFA14, was degraded into small fragments during uptake; no intracellular circular forms of pFA14 were evident. Since pFA10 DNA linearized by a restriction enzyme was not furthe...

  14. Evolving seismogenic plate boundary megathrust and mega-splay faults in subduction zone (Invited)

    Science.gov (United States)

    Kimura, G.; Hamahashi, M.; Fukuchi, R.; Yamaguchi, A.; Kameda, J.; Kitamura, Y.; Hashimoto, Y.; Hamada, Y.; Saito, S.; Kawasaki, R.

    2013-12-01

    Understanding the fault mechanism and its relationship to the sesimo-tsunamigenesis is a key of the scientific targets of subduction zone and therefore NantroSEIZE project of IODP and future new drilling project of International Ocean Discovery Program keeps focusing on that. Mega-splay fault branched from plate boundary megathrust in subduction zone is located around the border between outer and inner wedges and is considered to cause great earthquake and tsunami such as 1960 Alaska earthquake, 1944 and 1946 Nankai-Tonankai earthquakes, and 2004 Sumatra earthquakes. Seismic reflection studies for the mega-splay fault in 2D and 3D in the Nankai forearc present the reflector with negative or positive polarities with various amplitudes and suggest complicated petrophysical properties and condition of the fault and its surroundings. The Nankai mega-splay fault at a depth of ~5km is going to be drilled and cored by NantroSEIZE experiments and is expected for great progress of understanding of the fault mechanics. Before drilling the really targeted seismogenic fault, we are conducting many exercises of geophysical and geological observations. The core-log-seismic integrated exercise for the exhumed mega-splay fault by drilling was operated for the Nobeoka thrust in the Shimanto Belt, Kyushu, Japan. The Nobeoka thrust was once buried in the depth >~10km and suffered maximum temperature >~300 dgree C. As the core recovery is ~99%, perfect correlation between the core and logging data is possible. Thickness of the fault zone is >200 m with a ~50 cm thick central fault core dividing the phyllitic hanging wall and the footwall of broken-melange like cataclasite. A-few-meter-thick discrete damage zones with fault cores are recognized by difference in physical properties and visual deformation textures at several horizons in the fault zone. Host rocks for those damaged zones are completely lithified cataclasites with abundant mineral veins, which record the older and deeper deformation in the maximum depth >10km. Temperature difference between the hanging wall and footwall suggests the displacement along the Nobeoka thrust is >10km, which is almost similar to the mega-splay fault in the Nankai Trough. Geological and physical properties of the Nobeoka thrust suggest an evolving process of the seismogenic mega-splay fault associated with seismogenic up-thrust of the inner wedge of the accretionary prism.

  15. MegaFlex Scale-Up Cost & Risk Reduction for >50kW Future Power Demands Project

    National Aeronautics and Space Administration — As the MegaFlex solar array is scaled for power demands greater than 50kW over the next 20 years and deployed load requirements remain high or increase, advanced...

  16. Detection of plasmid deoxyribonucleic acid in an isolate of Lactobacillus acidophilus.

    OpenAIRE

    Klaenhammer, T. R.; Sutherland, S. M.

    1980-01-01

    Eight strains of Lactobacillus acidophilus were examined for the presence of plasmid deoxyribonucleic acid, and one, a pig intestinal isolate, showed the presence of a 13.7- and a 6.3-megadalton plasmid. This is the first reported evidence for plasmid deoxyribonucleic acid in Lactobacillus acidophilus. The functions of these plasmids are presently unknown.

  17. Parallels in portraits of leadership in mega churches of Gauteng (RSA) and Florida (USA) / Tsietsi John Maloma

    OpenAIRE

    Maloma, Tsietsi John

    2011-01-01

    This thesis, Parallels in portraits of leadership in mega churches of Gauteng (RSA) and Florida (USA), the researcher, studied literature on church leadership with special reference to the leadership of mega churches. He researched issues relating to the nature of church leadership by exploring relevant Bible passages, the lives of certain Bible characters that the Bible presents as good but not perfect leaders, as well as relevant key theological conceptions of leadership. The study accordin...

  18. E-marketing of sports mega-events with specific reference to the 2010 Soccer World Cup

    OpenAIRE

    Radikonyana, Paul Shimane

    2013-01-01

    From an analysis of the literature it is apparent that there has been no concerted effort to date to undertake a coherent and integrated assessment of the application of e-marketing in sport mega-events. A strategic evaluation of the e-marketing initiatives implemented since 2000 during national and international mega events, indicates that e-marketing, in most instances, took place in a limited and fragmented manner. However a further analysis of these case studies provides valuable perspect...

  19. Selection criteria of residents for residency programs in Kuwait

    OpenAIRE

    Marwan Yousef; Ayed Adel

    2013-01-01

    Abstract Background In Kuwait, 21 residency training programs were offered in the year 2011; however, no data is available regarding the criteria of selecting residents for these programs. This study aims to provide information about the importance of these criteria. Methods A self-administered questionnaire was used to collect data from members (e.g. chairmen, directors, assistants …etc.) of residency programs in Kuwait. A total of 108 members were invited to participate. They were asked t...

  20. Construction of three new Gateway® expression plasmids for Trypanosoma cruzi

    Scientific Electronic Library Online (English)

    Victoria L, Alonso; Carla, Ritagliati; Pamela, Cribb; Esteban C, Serra.

    1081-10-01

    Full Text Available We present here three expression plasmids for Trypanosoma cruzi adapted to the Gateway® recombination cloning system. Two of these plasmids were designed to express trypanosomal proteins fused to a double tag for tandem affinity purification (TAPtag). The TAPtag an [...] d Gateway® cassette were introduced into an episomal (pTEX) and an integrative (pTREX) plasmid. Both plasmids were assayed by introducing green fluorescent protein (GFP) by recombination and the integrity of the double-tagged protein was determined by western blotting and immunofluorescence microscopy. The third Gateway adapted vector assayed was the inducible pTcINDEX. When tested with GFP, pTcINDEX-GW showed a good response to tetracycline, being less leaky than its precursor (pTcINDEX).

  1. Results from beam tests of MEGA's low-mass, high-rate cylindrical MWPCs

    International Nuclear Information System (INIS)

    One of the leading experimental projects at LAMPF has been the MEGA experiment. This is an experiment to search for the rare decay ? ? e? with a sensitivity of 10-13. A prime component of this project has been the design and construction of high-rate, low mass MWPCs for the tracking of positrons from muon decay. With rate capabilities of 2 x 104 e+/mm2/s and a thickness of 3 x 10-4 radiation lengths, these chambers are state-of-the-art cylindrical MWPCs. Cylindrical chambers of this size (0.9 m2) and thinness have never been previously constructed. The MEGA project at LAMPF has recently succeeded in building chambers with these necessary performance characteristics as demonstrated by data taken from muon decays, cosmic rays, and sources

  2. Results from beam tests of MEGA's low-mass, high-rate cylindrical MWPCs

    International Nuclear Information System (INIS)

    One of the leading experimental projects at LAMPF has been the MEGA experiment. This is an experiment to search for the rare decay ??e? with a sensitivity of 10-13. A prime component of this project has been the design and construction of high-rate, low-mass MWPCs for the tracking of positrons from muon decay. With rate capabilities of 2x104 e+/mm2/s and a thickness of 3x10-4 radiation lengths, these chambers are state-of-the-art cylindrical MWPCs. Cylindrical chambers of this size (0.9 m2) and thinness have never been previously constructed. The MEGA project at LAMPF has recently succeeded in buildung chambers with these necessary performance characteristics as demonstrated by data taken from muon decays, cosmic rays, and sources. (orig.)

  3. Photon pair spectrometers in a ? ? e? decay search with the MEGA experiment

    International Nuclear Information System (INIS)

    The MEGA experiment at LAMPF is conducting a search for the lepton family number violating decay ?+?e+? with a branching ratio sensitivity of a few parts in 10-13. The detectors are contained in a 1.5 T solenoidal magnetic field. Positrons are confined to the central region and are measured by a set of cylindrical MWPCs. Photons are converted into e+e- pairs by one of three pair spectrometers in the outer region. Each pair spectrometer consists of an inner layer of plastic scintillator, two lead converters separated by a MWPC and three layers of drift chambers. The MEGA collaboration successfully concluded 1992 data taking with a set of positron MWPCs and two pair spectrometers. A brief overview of the pair spectrometer design and performance will be followed by a presentation of results to date of the data analysis

  4. A Biobrick Library for Cloning Custom Eukaryotic Plasmids

    OpenAIRE

    Marco Constante; Raik Gr\\xfcnberg; Mark Isalan

    2011-01-01

    Researchers often require customised variations of plasmids that are not commercially available. Here we demonstrate the applicability and versatility of standard synthetic biological parts (biobricks) to build custom plasmids. For this purpose we have built a collection of 52 parts that include multiple cloning sites (MCS) and common protein tags, protein reporters and selection markers, amongst others. Importantly, most of the parts are designed in a format to allow fusions that maintain th...

  5. Plasmid Involvement in Parathion Hydrolysis by Pseudomonas diminuta

    OpenAIRE

    Serdar, Cüneyt M.; Gibson, David T.; Munnecke, Douglas M.; Lancaster, John H.

    1982-01-01

    An organism identified as Pseudomonas diminuta was found to hydrolyze parathion. Cells grown for 48 h contained 3,400 U of parathion hydrolase activity per liter of broth. Expression of enzymatic activity was lost at a high frequency (9 to 12%) after treatment with mitomycin C. Hydrolase-negative derivatives were missing a plasmid present in the wild-type organism. The molecular mass of this plasmid (pCS1), as determined by electron microscopy, was about 44 × 106 daltons.

  6. Plasmid Involvement in Linalool Metabolism by Pseudomonas fluorescens

    OpenAIRE

    Vandenbergh, Peter A.; Cole, Ronald L.

    1986-01-01

    A bacterial strain was isolated from a wastewater lagoon and identified as Pseudomonas fluorescens. This isolate was able to utilize linalool as a sole carbon and energy source. The ability was found to be encoded on a 60-megadalton transmissible plasmid, pSRQ60. The plasmid was also mated into a commercial waste treatment strain, which expanded its ability to utilize other isoprenoid compounds.

  7. Construction of a bioluminescence reporter plasmid for Francisella tularensis

    OpenAIRE

    Bina, Xiaowen R.; Miller, Mark A.; Bina, James E.

    2010-01-01

    A Francisella tularensis shuttle vector that constitutively expresses the Photorhabdus luminescens lux operon in type A and type B strains of F. tularensis was constructed. The bioluminescence reporter plasmid was introduced into the live vaccine strain of F. tularensis and used to follow F. tularensis growth in a murine intranasal challenge model in real time by bioluminescence imaging. The results show that the new bioluminescence reporter plasmid represents a useful tool for tularemia rese...

  8. Isolation and properties of plasmids from Deinococcus radiodurans Sark

    International Nuclear Information System (INIS)

    Radioresistant bacterium, Deinococcus radiodurans, can repair completely almost all of DNA damages including double strand breaks induced by gamma-rays up to about 5 kGy. In order to reveal the repair mechanism, it is necessary to develop a cloning vector available for the genetic analysis. We tried to isolate plasmids from D.radiodurans Sark strain. In the present paper the isolation and properties of plasmids were described. (author)

  9. Alignment status of J-PARC main ring after the mega quake

    International Nuclear Information System (INIS)

    In J-PARC, positions of magnets have been measured in every two years for the check of alignment status. The displacements of magnets measured in August 2010 remained still small since the full alignment in autumn 2007. The 2011 Tohoku Pacific Earthquake happened in 11th March shook the ring for two minutes with seismic intensity six. We measured the magnet alignment status after the mega quake. (author)

  10. Efficacy and safety of oral mega pulse methylprednisolone for severe therapy resistant Alopecia areata.

    OpenAIRE

    Bin Saif, Ghada A.; Al-khawajah, Marwan M.; Al-otaibi, Hend M.; Al-roujayee, Abdulaziz S.; Alzolibani, Abdullateef A.; Kalantan, Hatem A.; Al-sheikh, Omar A.; Arafah, Maha M.

    2012-01-01

    OBJECTIVES To use intensive regimen of pulse steroid in the severe forms of Alopecia areata. METHODS This prospective randomized study was conducted at King Khalid University Hospital, Riyadh, Kingdom of Saudi Arabia between 2003 to 2009. Patients with Alopecia universalis, Alopecia totalis, or Alopecia ophiasis were assigned to one of the 3 treatment groups: Group A received oral mega pulse methylprednisolone (MP) for 3 consecutive days once every 2 weeks for 24 weeks; Group B recei...

  11. A survey on medicine consumption in the mega cities of Iran

    OpenAIRE

    Mehdi Rahimpour; Kamelia Saremi; Elham Shirvani; Hosna Gomari; Mahmoud Rahimpour; Amin Niroumanesh; Soroush Sardari

    2011-01-01

    Background: Studying medicine consumption is a significant parameter in the estimation of the health care system of a country. This study evaluates the amount of medicine consumption in the mega cities of Iran and indentifies individual factors that influence this consumption.
    Methods: In this study, a cross-sectional survey of public medicine consumption was directed at random samples that counted 628 persons of fi...

  12. Mitigation technique for use of CMOS image sensors in mega-joule class laser radiative environment

    International Nuclear Information System (INIS)

    Presented is a new mitigation technique to improve the radiation tolerance of CMOS image sensors to the radiation constraints associated to the fusion by inertial confinement experiments at mega-joule class laser facilities. Using the global reset mode, results acquired at the OMEGA facility show the efficiency of this technique to reduce by more than 70% the number of white pixels induced by the mixed 14 MeV neutron and gamma-ray pulse. (authors)

  13. Computer Arithmetic Algorithms for Mega-Digit Floating Point Numbers' Precision

    Directory of Open Access Journals (Sweden)

    Musbah J. Aqel

    2007-01-01

    Full Text Available IEEE standard 754 floating point is the most common representation used for floating point numbers, and many computer arithmetic algorithms are developed for basic operations on this standard. In this study, new computer algorithms are proposed to increase the precision range and to solve some problems that are available while using these algorithms. However, these algorithms provide an optional range of required accuracy (Mega-Digit precision to meet new computer's applications.

  14. Computer Arithmetic Algorithms for Mega-Digit Floating Point Numbers' Precision

    OpenAIRE

    Musbah J. Aqel; Mohammed H. Saleh

    2007-01-01

    IEEE standard 754 floating point is the most common representation used for floating point numbers, and many computer arithmetic algorithms are developed for basic operations on this standard. In this study, new computer algorithms are proposed to increase the precision range and to solve some problems that are available while using these algorithms. However, these algorithms provide an optional range of required accuracy (Mega-Digit precision) to meet new computer's applications.

  15. A Case with Mega Cisterna Magna Renal and Ear Anomalies: Is This a New Syndrome?

    OpenAIRE

    Çapan Konca; Bahar Caliskan; Mehmet Ali Tas

    2013-01-01

    Background. Extrarenal pathologies may be associated with renal position and fusion anomalies. According to the literature, our patient is the first horseshoe kidney case that had mega cisterna magna, arachnodactyly, and mild mental retardation. Case Report. A 9-year-old boy admitted because of the myoclonic jerks. He had a dysmorphic face, low-set and cup-shaped ears, arachnodactyly, and mild mental retardation. The patient's laboratory findings were normal except for a mild leucocytosis and...

  16. Low-mass, high-rate cylindrical MWPC's for the MEGA experiment

    International Nuclear Information System (INIS)

    The construction of MWPCs for the MEGA experiment at LAMPF are described. The chambers are cylindrical, low mass (3 x 10-4 radiation lengths), and are designed to operate at high rates (3 x 104 /mm2/s). Several novel construction techniques have been developed and custom electronics have been designed to help achieve the required performance, which corresponds to that needed at high luminosity colliders. 4 refs., 3 figs

  17. Improving Customer Satisfaction and Customer Service Levels : Case: Nakumatt Mega City Supermarket

    OpenAIRE

    Onyango, Shalotte Salmi

    2011-01-01

    The purpose of this thesis was to analyze the current customer satisfaction and service levels of the Nakumatt mega city Supermarket through an efficient customer satisfaction survey. It is important for a company to work towards satisfying customers’ needs and expectations in order to flourish. The main objective of the study was to discover solutions to improve customer satisfaction and to increase the level of Nakumatt customer services in order to retain and attract new customers. A...

  18. Lake Mega-Chad, a West African Monsoon indicator and tipping element

    Science.gov (United States)

    Armitage, Simon; Bristow, Charlie; Drake, Nick

    2015-04-01

    From the deglacial period to the mid-Holocene, North Africa was characterised by much wetter conditions than today. The broad timing of this period, termed the African Humid Period, is well known. However, the rapidity of the onset and termination of the African Humid Period are contested, with strong evidence for both abrupt and gradual change. We use optically stimulated luminescence dating of dunes, shorelines and fluvio-lacustrine deposits to reconstruct the fluctuations of Lake Mega-Chad, which was the largest pluvial lake in Africa. Humid conditions first occur at ~15 ka, followed by a return to relatively arid conditions. By 11.5 ka Lake Mega-Chad had reached a highstand, which persisted until 5.0 ka. Lake levels fell rapidly at 5 ka, indicating abrupt aridification across the entire Lake Mega-Chad Basin. This record provides strong terrestrial evidence that the African Humid Period ended abruptly, supporting the hypothesis that the African monsoon responds to insolation forcing in a markedly non-linear manner. In addition, Lake Mega-Chad exerts strong control on global biogeochemical cycles since the northern (Bodélé) basin is currently the World's greatest single dust source, and possibly an important source of limiting nutrients for both the Amazon basin and equatorial Atlantic. However, we demonstrate that the final desiccation of the Bodélé Basin occurred around 1 ka. Consequently, the present-day mode and scale of dust production from Bodélé Basin cannot have occurred prior to 1 ka, suggesting that its role in fertilizing marine and terrestrial ecosystems is either overstated or geologically recent.

  19. ADAPTION OF “MEGA EVENT IMPACT SCALE”: VALIDITY AND RELIABILITY STUDY (2011 ERZURUM 25. WINTER UNIVERSIADE)

    OpenAIRE

    Kerem Y?ld?r?m ?im?ek

    2012-01-01

    This study aims at carrying out validity and reliability studies and the adaption of Turkish version of the scale titled “Mega Event Impact Scale” and developed by Jie ve Yan (2010). The scale, which consists of five-point Likert scale 42 items, was administered to the local audience following 2011 Erzurum 25. Winter Universiade. The subjects of the study were 412 people (55 % male and 45 % female), who were chosen through random sampling method. Explanatory factor analysis, applied to de...

  20. Plasmid vector with temperature-controlled gene expression

    International Nuclear Information System (INIS)

    In plasmid pBR327, a fragment 169 b.p. long including promotor p3 of the bla gene has been deleted. The deletional derivative so obtained (pSP2) has been used to construct a recombinant plasmid bearing a fragment of phage ? DNA with the p/sub R/ promotor and the gene of the temperature-sensitive repressor cI. It has been shown that the plasmid vector so constructed (pCE119) with promotor cR performs repressor-cI-controlled transcription of the bla gene, as a result of which induction for an hour at 420C leads to an almost 100-fold increase in the amount of product of the bla gene as compared with that at 320C. The possibility of the use of plasmid cPE119 for the expression of other genes has been demonstrated for the case of the semisynthetic ?-galactosidase gene of E. coli. In this case, on induction of the cells with recombinant plasmid pCEZ12 for 3 hours at 420C, a 300-fold increase in the amount of active ?-galactosidase, as compared with that at 320C, was observed. It is important to point out that under these conditions (at 420C), at least 99% of the cells containing the plasmid retain the phenotype lacZ+, which indicates the stability of the proposed vector system

  1. The characteristics of micrococcus (deinococcus) radiodurans sark plasmids

    International Nuclear Information System (INIS)

    The characterization of micrococcus (deinococcus) radiodurans sark plasmids. This bacterium has been classified as a new genus deinococcus radiodurans which is resistant to gamma-rays. It can repair itself completely almost all of DNA damages including double strand breaks induced by gamma-rays up to about 5 KGy. To reveal the repair mechanism, several investigations had been done to develop a cloning vector available for the genetic analysis. For this purpose D. radiodurans Sark are to be prepared as a vector by studying the characteristics of its plasmid. Plasmids were isolated by electrophoresis using 0.6% low-melting-temperature agarose in TAE and run for 5.5 hours, followed by the identification. An antibiotic marker was also carried out in this experiment to identify its location in the genetic materials of the cell, beside making a restriction map of the plasmid. Results have shown that D. radiodurans Sark has 4 plasmids (P1, P2, P3, and P4) and the refampicin resistant genes were not found in the plasmid. (authors). 14 refs; 4 figs

  2. The Population Biology of Bacterial Plasmids: A Hidden Markov Model Approach

    OpenAIRE

    Ponciano, José M; De Gelder, Leen; Top, Eva M; Joyce, Paul

    2007-01-01

    Horizontal plasmid transfer plays a key role in bacterial adaptation. In harsh environments, bacterial populations adapt by sampling genetic material from a horizontal gene pool through self-transmissible plasmids, and that allows persistence of these mobile genetic elements. In the absence of selection for plasmid-encoded traits it is not well understood if and how plasmids persist in bacterial communities. Here we present three models of the dynamics of plasmid persistence in the absence of...

  3. Host range diversification within the IncP-1 plasmid group

    OpenAIRE

    Yano, Hirokazu; Rogers, Linda M.; Knox, Molly G.; Heuer, Holger; Smalla, Kornelia; Brown, Celeste J.; Top, Eva M.

    2013-01-01

    Broad-host-range plasmids play a critical role in the spread of antibiotic resistance and other traits. In spite of increasing information about the genomic diversity of closely related plasmids, the relationship between sequence divergence and host range remains unclear. IncP-1 plasmids are currently classified into six subgroups based on the genetic distance of backbone genes. We investigated whether plasmids from two subgroups exhibit a different host range, using two IncP-1? plasmids, an...

  4. Novel Plasmid Transformation Method Mediated by Chrysotile, Sliding Friction, and Elastic Body Exposure

    OpenAIRE

    Naoto Yoshida; Toshiaki Nakajima-Kambe; Kaori Matsuki; Toshiya Shigeno

    2007-01-01

    Escherichia coli as a plasmid recipient cell was dispersed in a chrysotile colloidal solution, containing chrysotile adsorbed to plasmid DNA (chrysotile-plasmid cell mixture). Following this, the chrysotile-plasmid cell mixture was dropped onto the surface of an elastic body, such as agarose, and treated physically by sliding a polystyrene streak bar over the elastic body to create friction. Plasmid DNA was easily incorporated into E. coli, and antibiotic resistance was conferred by transform...

  5. Identificación de mega?ambientes para potenciar el uso de genotipos superiores de arroz en Panamá / Identifying mega?environments to enhance the use of superior rice genotypes in Panama

    Scientific Electronic Library Online (English)

    Ismael, Camargo& #8209; Buitrago; Evelyn, Quirós& #8209; Mc Intire; Román, Gordón& #8209; Mendoza.

    1061-10-01

    Full Text Available El objetivo de este trabajo fue evaluar tres métodos para identificar mega?ambientes, para optimizar el uso del potencial genético de los cultivares de arroz, durante el proceso de selección, y para hacer recomendaciones sobre siembras comerciales en Panamá. Los datos experimentales fueron obtenidos [...] de los ensayos de productividad de cultivares precoces realizados entre 2006 y 2008. Para lograr la estratificación de los ambientes y definir los mega?ambientes, se utilizaron los métodos del genotipo vencedor mediante el modelo AMMI1, el modelo biplot GGE y el de conglomerado por el método de Ward, complementado con el biplot GGE. Los tres métodos utilizados identificaron dos mega?ambientes, donde los cultivares sobresalientes fueron Fedearroz 473 e Idiap 145?05. Hubo una coincidencia de 100% en el agrupamiento del conglomerado x el biplot GGE, mientras que entre conglomerado x AMMI1 y biplot GGE x AMMI1 fue de 95,2%. El genotipo más estable, en ambos mega?ambientes, fue el cultivar Idiap 145?05, lo que indica capacidad de adaptación amplia y específica. La capacidad adaptativa de los genotipos superiores y no las condiciones agroclimáticas de las localidades evaluadas fue responsable de la definición de los mega?ambientes. Abstract in english The objective of this work was to evaluate three methods to identify mega?environments, in order to optimize the use of the genetic potential of rice cultivars during the selection process and to make recommendations for commercial plantations in Panama. Experimental data were obtained from the test [...] performance, between 2006 and 2008, for early maturing cultivars. To achieve the stratification of environments and define mega?environments, the winner genotype method by the AMMI1 model, GGE biplot model and cluster by Ward's method supplemented by GGE biplot were used. The three methods used identified two mega?environments, where the outstanding cultivars were Fedearroz 473 e Idiap 145?05. There was 100% coincidence in the grouping of the cluster x the GGE biplot, with 95.2% coincidence between the AMMI1 x cluster and GGE biplot x AMMI1. The most stable genotype, in both mega?environments, was the Idiap?145?05 cultivar, which indicates its broad and specific adaptive capacity. The adaptive capacity of the superior genotypes and not the agroclimatic conditions of the assessed localities was responsible for defining the mega?environments.

  6. Identificación de mega?ambientes para potenciar el uso de genotipos superiores de arroz en Panamá Identifying mega?environments to enhance the use of superior rice genotypes in Panama

    Directory of Open Access Journals (Sweden)

    Ismael Camargo?Buitrago

    2011-09-01

    Full Text Available El objetivo de este trabajo fue evaluar tres métodos para identificar mega?ambientes, para optimizar el uso del potencial genético de los cultivares de arroz, durante el proceso de selección, y para hacer recomendaciones sobre siembras comerciales en Panamá. Los datos experimentales fueron obtenidos de los ensayos de productividad de cultivares precoces realizados entre 2006 y 2008. Para lograr la estratificación de los ambientes y definir los mega?ambientes, se utilizaron los métodos del genotipo vencedor mediante el modelo AMMI1, el modelo biplot GGE y el de conglomerado por el método de Ward, complementado con el biplot GGE. Los tres métodos utilizados identificaron dos mega?ambientes, donde los cultivares sobresalientes fueron Fedearroz 473 e Idiap 145?05. Hubo una coincidencia de 100% en el agrupamiento del conglomerado x el biplot GGE, mientras que entre conglomerado x AMMI1 y biplot GGE x AMMI1 fue de 95,2%. El genotipo más estable, en ambos mega?ambientes, fue el cultivar Idiap 145?05, lo que indica capacidad de adaptación amplia y específica. La capacidad adaptativa de los genotipos superiores y no las condiciones agroclimáticas de las localidades evaluadas fue responsable de la definición de los mega?ambientes.The objective of this work was to evaluate three methods to identify mega?environments, in order to optimize the use of the genetic potential of rice cultivars during the selection process and to make recommendations for commercial plantations in Panama. Experimental data were obtained from the test performance, between 2006 and 2008, for early maturing cultivars. To achieve the stratification of environments and define mega?environments, the winner genotype method by the AMMI1 model, GGE biplot model and cluster by Ward's method supplemented by GGE biplot were used. The three methods used identified two mega?environments, where the outstanding cultivars were Fedearroz 473 e Idiap 145?05. There was 100% coincidence in the grouping of the cluster x the GGE biplot, with 95.2% coincidence between the AMMI1 x cluster and GGE biplot x AMMI1. The most stable genotype, in both mega?environments, was the Idiap?145?05 cultivar, which indicates its broad and specific adaptive capacity. The adaptive capacity of the superior genotypes and not the agroclimatic conditions of the assessed localities was responsible for defining the mega?environments.

  7. A four-step approach for establishment of a national medical response to mega-terrorism.

    Science.gov (United States)

    Leiba, Adi; Blumenfeld, Amir; Hourvitz, Ariel; Weiss, Gali; Peres, Michal; Schwartz, Dagan; Goldberg, Avishay; Levi, Yehezkel; Bar-Dayan, Yaron

    2006-01-01

    A simplified, four-step approach was used to establish a medical management and response plan to mega-terrorism in Israel. The basic steps of this approach are: (1) analysis of a scenario based on past incidents; (2) description of relevant capabilities of the medical system; (3) analysis of gaps between the scenario and the expected response; and (4) development of an operational framework. Analyses of both the scenario and medical abilities led to the recommendation of an evidence-based contingency plan for mega-terrorism. An important lesson learned from the analyses is that a shortage in medical first responders would require the administration of advanced life support (ALS) by paramedics at the scene, along with simultaneous, rapid evacuation of urgent casualties to nearby hospitals by medics practicing basic life support (BLS). Ambulances and helicopters should triage casualties from inner to outer circle hospitals secondarily, preferentially Level-1 trauma centers. In conclusion, this four-step approach based on scenario analysis, mapping of medical capabilities, detection of bottlenecks, and establishment of a unique operational framework, can help other medical systems develop a response plan to mega-terrorist attacks. PMID:17334192

  8. A survey on medicine consumption in the mega cities of Iran

    Directory of Open Access Journals (Sweden)

    Mehdi Rahimpour

    2011-09-01

    Full Text Available

    Background: Studying medicine consumption is a significant parameter in the estimation of the health care system of a country. This study evaluates the amount of medicine consumption in the mega cities of Iran and indentifies individual factors that influence this consumption.
    Methods: In this study, a cross-sectional survey of public medicine consumption was directed at random samples that counted 628 persons of fifteen years and older in several public places in the mega cities of Iran. The data were collected through questionnaires administered at the public vaccination department of the Pasteur institute of Iran in Tehran, and in other public places in Esfahan. A multiple regression model was utilized to analyze individual information.
    Results: Our results showed that 59.4% of the respondents were current medicine consumers. Women used medicines less frequently. The rates of medicine consumption among the surveyed population, for daily and weekly-monthly consumption, were 21.8% and 37.6% respectively. In Iran, it emerged that 52.4% of the respondents obtained their medicines, such as acetaminophen antibiotics, and pain-killers, without a prescription.
    Conclusions: the study clearly showed that more than 53% of the medicine consuming persons undertake self treatment. Three factors gender, age and income level are the main factors influencing medicines consumed without physicians’ prescription in the mega cities of Iran.

  9. The effects of the MEGA BORG spill on Gulf of Mexico shrimp

    International Nuclear Information System (INIS)

    A brown shrimp stock model was developed at the NMFS Galveston Laboratory to assess the effects of the MEGA BORG oil spill on the brown shrimp population along the Texas coast. Water and sediment samples from near the MEGA BORG spill area were collected and analyzed by the Geochemical and Environmental Research Group at Texas A ampersand M University. Hydrocarbon concentrations found at the sediment collection stations ranged from 1.38 ug/g to 7.42 ug/g, while concentrations at the water column sampling sites ranged from 0.69 ug/l to 27.39 ug/l. Evaluation of chromatograms and analytical data suggested that sediments from the area contained primarily biogenic hydrocarbons. Only one station had elevated hydrocarbon levels. However, these values were only three to five times higher than the concentrations measured at the other stations. Evaluation of the water samples from the area showed only very low concentration levels of hydrocarbons were present in the water column. A bioassay study was conducted by the US Environmental Protection Agency, Environmental Research Laboratory in Gulf Breeze, Florida. The main conclusion from the bioassay study was that the concentrations of hydrocarbons measured at the field sites where water samples were taken tended to be three orders of magnitude lower than the hydrocarbon concentrations causing toxic responses in mysid and white shrimp. There were no detected effects of the brown shrimp population along the Texas coast from the MEpulation along the Texas coast from the MEGA BORG oil spill

  10. Ultra Mega Power Projects: Additional Re-Structural Capacity to Existing Indian Grid System

    Directory of Open Access Journals (Sweden)

    M.K.Singh

    2013-03-01

    Full Text Available The demand for power in India is ever increasing, as industrial sector is one of the largest consumers of electrical energy in India. More and more efforts are made by the Government every year to overcome this problem. Ultra Mega Power projects (UMPP are a series of ambitious power projects planned by the Government of India. With India being a country of chronic power deficit, the Government of India has planned to provide 'power for all' by the end of the eleventh plan. This would entail a creation of an additional capacity of at least 100,000 MW. The Ultra Mega Power projects, each with a capacity of 4000 megawatts or above, are being developed with an aim to bridge this gap. The UMPPs are seen as an expansion of the MPP (Mega Power Projects projects that the Government of India undertook in the nineties but met with limited success. The Ministry of Power in association with Central Electricity Authority and Power Finance Corporation Ltd. has launched an initiative for development of coal-based UMPP's in India. These projects will be awarded to developers on the basis of competitive bidding.

  11. Trends in vehicular emissions in China's mega cities from 1995 to 2005

    International Nuclear Information System (INIS)

    Multiyear inventories of vehicular emissions in Beijing, Shanghai and Guangzhou from 1995 through 2005 have been developed in this paper to study the vehicle emissions trends in China's mega cities during the past decade. The results show that the vehicular emissions of CO, HC, NOx and PM10 have begun to slow their growth rates and perhaps even to decline in recent years due to the implementation of measures to control vehicular emissions in these cities. However, vehicular CO2 emissions have substantially increased and still continue to grow due to little fuel economy improvement. Passenger cars and large vehicles (including heavy duty trucks and buses) are the major sources of vehicular CO2 and CO emissions while large vehicles were responsible for nearly 70% and 80% of the vehicular NOx and PM10 emissions in these mega cities. Motorcycles are also important contributors to vehicular emissions in Guangzhou and Shanghai. - The vehicular emissions (except CO2) in China's mega cities have begun to slow their rates of growth and even to decline during the past decade.

  12. Incorporating resident research into the dermatology residency program

    Directory of Open Access Journals (Sweden)

    Wagner RF Jr

    2013-04-01

    Full Text Available Richard F Wagner Jr, Sharon S Raimer, Brent C Kelly Department of Dermatology, The University of Texas Medical Branch, Galveston, Texas, USA Abstract: Programmatic changes for the dermatology residency program at The University of Texas Medical Branch were first introduced in 2005, with the faculty goal incorporating formal dermatology research projects into the 3-year postgraduate training period. This curriculum initially developed as a recommendation for voluntary scholarly project activity by residents, but it evolved into a program requirement for all residents in 2009. Departmental support for this activity includes assignment of a faculty mentor with similar interest about the research topic, financial support from the department for needed supplies, materials, and statistical consultation with the Office of Biostatistics for study design and data analysis, a 2-week elective that provides protected time from clinical activities for the purpose of preparing research for publication and submission to a peer-reviewed medical journal, and a departmental award in recognition for the best resident scholarly project each year. Since the inception of this program, five classes have graduated a total of 16 residents. Ten residents submitted their research studies for peer review and published their scholarly projects in seven dermatology journals through the current academic year. These articles included three prospective investigations, three surveys, one article related to dermatology education, one retrospective chart review, one case series, and one article about dermatopathology. An additional article from a 2012 graduate about dermatology education has also been submitted to a journal. This new program for residents was adapted from our historically successful Dermatology Honors Research Program for medical students at The University of Texas Medical Branch. Our experience with this academic initiative to promote dermatology research by residents is outlined. It is recommended that additional residency programs should consider adopting similar research programs to enrich resident education. Keywords: dermatology, resident, research, education, accreditation

  13. The Development of a Modified Method for Isolating Plasmids from Exopolysaccharide Producing Lactobacillus Species Using Conventional Plasmid Isolation Methods

    OpenAIRE

    ÇATALOLUK, Osman

    2003-01-01

    Lactic acid bacteria (LAB) are a key element in the dairy industry. The gene products encoded by the plasmids of LAB carry out fermentation. To date, many successful plasmid isolation studies have been conducted with Escherichia coli, Staphilococcus, Streptococcus, Salmonella, Listeria and many strains of LAB. However, since LAB comprise a conglomerate of seven different genera, each with its own physiological and morphological characteristics, and produce a large amount of exopolysaccharide ...

  14. Curing the plasmid pMC1 from the poly (?-glutamic acid) producing Bacillus amyloliquefaciens LL3 strain using plasmid incompatibility.

    Science.gov (United States)

    Feng, Jun; Gu, Yanyan; Wang, Jingqiang; Song, Cunjiang; Yang, Chao; Xie, Hui; Zhang, Wei; Wang, Shufang

    2013-09-01

    Bacillus amyloliquefaciens LL3 is a glutamate-independent poly-?-glutamic acid (?-PGA) producing strain which consists of a circular chromosome (3,995,227 bp) and an endogenous plasmid pMC1 (6,758 bp). The study of the function of native plasmid and the genome-size reduction of the B. amyloliquefaciens LL3 strain requires elimination of the endogenous plasmid. Traditional plasmid-curing procedures using sodium dodecyl sulfate (SDS) or acridine orange combined with heat treatment have been shown to be ineffective in this strain. Plasmid incompatibility is an effective method for curing which has been studied before. In our research, the hypothetical Rep protein gene and the origin of replication of the endogenous plasmid were cloned into the temperature-sensitive vector yielding the incompatible plasmid pKSV7-rep-ori. This plasmid was transformed into LL3 by electroporation. The analysis of the strain bearing incompatible plasmids after incubation at 30 °C for 30 generations showed the production of plasmid cured strains. High frequency of elimination was achieved with more than 93 % of detected strains showing to be plasmid-cured. This is the first report describing plasmid cured in a ?-PGA producing strain using this method. The plasmid-cured strains showed an increase of ?-PGA production by 6 % and led to a yield of 4.159 g/l, compared to 3.918 g/l in control and cell growth increased during the early stages of the exponential phase. Gel permeation chromatography (GPC) characterization revealed that the ?-PGA produced by plasmid-cured strains and the wild strains were identical in terms of molecular weight. What is more, the further study of plasmid function showed that curing of the endogenous plasmid did not affect its sporulation efficiency. PMID:23873640

  15. A socio-ecological adaptive approach to contaminated mega-site management: From 'control and correct' to 'coping with change'

    Science.gov (United States)

    Schirmer, Mario; Lyon, Ken; Armstrong, James E.; Farrell, Katharine N.

    2012-01-01

    Mega-sites have a notable impact on surrounding ecological systems. At such sites there are substantial risks associated with complex socio-ecological interactions that are hard to characterize, let alone model and predict. While the urge to control and clean-up mega-sites (control and correct) is understandable, rather than setting a goal of cleaning up such sites, we suggest a more realistic response strategy is to address these massive and persistent sources of contamination by acknowledging their position as new features of the socio-ecological landscapes within which they are located. As it seems nearly impossible to clean up such sites, we argue for consideration of a 'coping with change' rather than a 'control and correct' approach. This strategy recognizes that the current management option for a mega-site, in light of its physical complexities and due to changing societal preferences, geochemical transformations, hydrogeology knowledge and remedial technology options may not remain optimal in future, and therefore needs to be continuously adapted, as community, ecology, technology and understanding change over time. This approach creates an opportunity to consider the relationship between a mega-site and its human and ecological environments in a different and more dynamic way. Our proposed approach relies on iterative adaptive management to incorporate mega-site management into the overall socio-ecological systems of the site's context. This approach effectively embeds mega-site management planning in a triple bottom line and environmental sustainability structure, rather than simply using single measures of success, such as contaminant-based guidelines. Recognizing that there is probably no best solution for managing a mega-site, we present a starting point for engaging constructively with this seemingly intractable issue. Therefore, we aim to initiate discussion about a new approach to mega-site management, in which the complexity of the problems posed by mega-sites is reflected upon in its entirety. These complexities are associated with uncertainties and unknowns that have to be addressed, as they have an impact on the strategies being developed and applied. We contend that the best that can be hoped for in mega-site management is an acceptable solution for the current state of affairs, with good flexibility to modify strategies as new site conditions, remediation possibilities, community preferences and management objectives develop over time.

  16. A socio-ecological adaptive approach to contaminated mega-site management: from 'control and correct' to 'coping with change'.

    Science.gov (United States)

    Schirmer, Mario; Lyon, Ken; Armstrong, James E; Farrell, Katharine N

    2012-01-01

    Mega-sites have a notable impact on surrounding ecological systems. At such sites there are substantial risks associated with complex socio-ecological interactions that are hard to characterize, let alone model and predict. While the urge to control and clean-up mega-sites (control and correct) is understandable, rather than setting a goal of cleaning up such sites, we suggest a more realistic response strategy is to address these massive and persistent sources of contamination by acknowledging their position as new features of the socio-ecological landscapes within which they are located. As it seems nearly impossible to clean up such sites, we argue for consideration of a 'coping with change' rather than a 'control and correct' approach. This strategy recognizes that the current management option for a mega-site, in light of its physical complexities and due to changing societal preferences, geochemical transformations, hydrogeology knowledge and remedial technology options may not remain optimal in future, and therefore needs to be continuously adapted, as community, ecology, technology and understanding change over time. This approach creates an opportunity to consider the relationship between a mega-site and its human and ecological environments in a different and more dynamic way. Our proposed approach relies on iterative adaptive management to incorporate mega-site management into the overall socio-ecological systems of the site's context. This approach effectively embeds mega-site management planning in a triple bottom line and environmental sustainability structure, rather than simply using single measures of success, such as contaminant-based guidelines. Recognizing that there is probably no best solution for managing a mega-site, we present a starting point for engaging constructively with this seemingly intractable issue. Therefore, we aim to initiate discussion about a new approach to mega-site management, in which the complexity of the problems posed by mega-sites is reflected upon in its entirety. These complexities are associated with uncertainties and unknowns that have to be addressed, as they have an impact on the strategies being developed and applied. We contend that the best that can be hoped for in mega-site management is an acceptable solution for the current state of affairs, with good flexibility to modify strategies as new site conditions, remediation possibilities, community preferences and management objectives develop over time. PMID:21890232

  17. Resident training in pathology: From resident's point of view

    Directory of Open Access Journals (Sweden)

    Kemal KÖSEMEHMETO?LU

    2008-01-01

    Full Text Available In many recent studies in the literature have described and commented on “competency based resident training” in pathology. According to this model, competencies are subclassified in 6 main categories: Patient care, medical knowledge, practice based learning and improvement, interpersonal and communication skills, professionalism, and systems based practice. Assessment of competency forms the main component of this model.Under the framework of Ankara Society of Pathology, a working group, composed of 11 residents, 6 of which representing the Training and Research Hospitals of Ministry of Health and the rest representing the university hospitals in Ankara, was established in order to participate in the think-tank about resident training in pathology. A questionnaire, composed of 12 questions, was prepared. According to this questionnaire, the number of trainers in the university hospitals is much higher than in the commercial hospitals. While the total number of cases and cases per resident do not differ between the university and commercial hospitals, microscopes used for the educational purposes are significantly less in the commercial hospitals, that is due to less number of binocular microscopes. The amount of resident training program, which consists of intra and intersectional meetings, are similar in the university and commercial hospitals, however, theoretic lectures are given only in 3 departments. Residents working in the university hospitals have obviously heavier burden than in the commercial hospitals. Lastly, residents generally exclaimed that the time dedicated to the macroscopy training is less sufficient than time used for the microscopy training.The factors affecting the training of resident in pathology are divided into two main groups: 1 Factors directly affecting training (quality of trainer, time dedicated for education, feed back, eg. and 2 Conditions which waste residents' time. For instant, workload which does need qualified staff and increases the burden on residents may be reassigned to medical secretary or pathology assistants; therefore energy of residents can be saved for educational activities. Optimization of physical working conditions, assortment of training programs, rotation in lacking subjects and consultations will enhance the quality of the education of the resident. Feedback assessment of trainer and trainee is an essential part of a training program.In conclusion, an ideal resident from the resident's point of view is the person who is endowed with medical and pathological knowledge, orderly interrelates with staff, professionally communicates with clinicians, manages a laboratory and is trained hard to achieve all the above mentioned competencies.

  18. POTENTIAL FOR TRANSDUCTION OF PLASMIDS IN A NATURAL FRESHWATER ENVIRONMENT: EFFECT OF PLASMID DONOR CONCENTRATION AND A NATURAL MICROBIAL COMMUNITY ON TRANSDUCTION IN 'PSEUDOMONAS AERUGINOSA'

    Science.gov (United States)

    The transduction of Pseudomonas aeruginosa plasmid Rms149 by the generalized transducing phage DS1 was shown to occur during a nine day incubation of environmental test chambers in a freshwater reservoir. Plasmid DNA was transferred from a nonlysogenic plasmid donor to a DS1 lyso...

  19. Perceptions of Residence Hall Security.

    Science.gov (United States)

    Wills, Sara B.; Hines, Edward R.

    1994-01-01

    The purpose of this study was to determine the perceptions of students and parents pertaining to security measures within and immediately surrounding residence halls. Also examined what students and parents believed could be done to create a nonthreatening environment for students living in residence halls. (Author)

  20. Applying Expectancy Theory to residency training: proposing opportunities to understand resident motivation and enhance residency training.

    Science.gov (United States)

    Shweiki, Ehyal; Martin, Niels D; Beekley, Alec C; Jenoff, Jay S; Koenig, George J; Kaulback, Kris R; Lindenbaum, Gary A; Patel, Pankaj H; Rosen, Matthew M; Weinstein, Michael S; Zubair, Muhammad H; Cohen, Murray J

    2015-01-01

    Medical resident education in the United States has been a matter of national priority for decades, exemplified initially through the Liaison Committee for Graduate Medical Education and then superseded by the Accreditation Council for Graduate Medical Education. A recent Special Report in the New England Journal of Medicine, however, has described resident educational programs to date as prescriptive, noting an absence of innovation in education. Current aims of contemporary medical resident education are thus being directed at ensuring quality in learning as well as in patient care. Achievement and work-motivation theories attempt to explain people's choice, performance, and persistence in tasks. Expectancy Theory as one such theory was reviewed in detail, appearing particularly applicable to surgical residency training. Correlations between Expectancy Theory as a work-motivation theory and residency education were explored. Understanding achievement and work-motivation theories affords an opportunity to gain insight into resident motivation in training. The application of Expectancy Theory in particular provides an innovative perspective into residency education. Afforded are opportunities to promote the development of programmatic methods facilitating surgical resident motivation in education. PMID:25995656

  1. Complete sequence of a bla(KPC)-harboring cointegrate plasmid isolated from Escherichia coli.

    Science.gov (United States)

    Chavda, Kalyan D; Chen, Liang; Jacobs, Michael R; Rojtman, Albert D; Bonomo, Robert A; Kreiswirth, Barry N

    2015-05-01

    Horizontal transfer of bla(KPC)-harboring plasmids contributes significantly to the inter- and intraspecies spread of Klebsiella pneumoniae carbapenemase (KPC). Here we report the complete nucleotide sequence of a bla(KPC)-harboring IncFIA plasmid, pBK32533, from Escherichia coli. pBK32533 is a cointegrate plasmid comprising of a 72-kb sequence identical to that of the nonconjugative pBK30661 plasmid plus an additional 170-kb element that harbors the genes for plasmid transfer. pBK32533 demonstrates how bla(KPC) can be spread from a nonconjugative plasmid through cointegration. PMID:25753632

  2. IS257-mediated cointegration in the evolution of a family of staphylococcal trimethoprim resistance plasmids.

    OpenAIRE

    Leelaporn, A.; Firth, N.; Paulsen, I. T.; Skurray, R. A.

    1996-01-01

    Analyses of the Staphylococcus epidermidis multiresistance plasmids pSK697 and pSK818 have revealed them to be closely related to the trimethoprim resistance plasmid pSK639, also isolated from S. epidermidis. pSK697 and pSK818 were found to contain a cointegrated copy of a second plasmid related to the S. epidermidis multidrug antiseptic and disinfectant resistance plasmid pSK108 and the S. aureus tetracycline resistance plasmid pT181, respectively. In contrast to pSK639, both plasmids were f...

  3. Sport mega-events: can legacies and development be equitable and sustainable? / Mega-eventos esportivos: podem desenvolvimento e legado ser equalitários e sustentáveis? / Sport mega-eventos: pueden ser legados y el desarrollo equitativo y sostenible?

    Scientific Electronic Library Online (English)

    Jay, Coakley; Doralice Lange, Souza.

    2013-09-01

    Full Text Available Os mega-eventos esportivos (MEE) envolvem lutas para se determinar a definição de legado e as prioridades que guiam os processos de planejamento, financiamento e processos de implementação de resultados. A história mostra que os legados refletem os interesses do capital, e os benefícios são usufruid [...] os principalmente, se não exclusivamente, por interesses empresariais poderosos, por alguns líderes políticos e por organizações que governam o esporte de alto rendimento. Este artigo aborda os desafios enfrentados pelas cidades e países que hospedam MEE e demonstra que legados justos e equalitários e resultados em termos de desenvolvimento são alcançados somente quando as vozes e os interesses da população em geral são ouvidos e considerados como prioridade durante o processo de planejamento, financiamento e implementação. Ele também demonstra que a representação plena no processo de definição e prossecução de legados e a consecução de resultados em termos de desenvolvimento podem ser prejudicados por crenças populares sobre o poder do esporte. Abstract in spanish Los mega-eventos deportivos (DME) implican luchas para determinar la definición del legado y las prioridades que guían los procesos de planificación, financiación financiamiento y ejecución de los resultados. La historia muestra que los legados reflejan los intereses del capital y que los beneficios [...] son disfrutados principalmente, si no exclusivamente por los intereses empresariales poderosos, por algunos líderes políticos y por las organizaciones que dirigen los deportes de alto rendimiento. Este artículo aborda los desafíos que enfrentan las ciudades y los países anfitriones de los DME, y demuestra que legados justos y equitativos y resultados en sentido de desarrollo se logran solamente cuando se considera y se da prioridad a las voces e intereses de la población en general durante el proceso de planificación, financiamiento e implementación. Él también demuestra que la representación plena en el proceso de definición y consecución de los legados y los resultados en sentido de desarrollo pueden ser socavadas por las creencias populares sobre el poder del deporte. Abstract in english Sport mega-events (SMEs) involve struggles to determine the definition of legacy and the outcome priorities that guide legacy planning, funding, and implementation processes. History shows that legacies reflect the interests of capital, and legacy benefits are enjoyed primarily, if not exclusively, [...] by powerful business interests, a few political leaders, and organizations that govern high performance sports. This paper addresses challenges faced by cities and countries that host SMEs, and shows that fair and equitable legacies and developmental outcomes are achieved only when the voices and interests of the general population are taken into account and given priority during the process of planning, funding and implementation. It also explains how full representation in the process of defining and achieving legacies and developmental outcomes may be undermined by populist beliefs about the power of sport.

  4. Topographic and road control of mega-gullies in Kinshasa (DR Congo)

    Science.gov (United States)

    Makanzu Imwangana, Fils; Dewitte, Olivier; Ntombi, Médard; Moeyersons, Jan

    2014-07-01

    Diachronic mapping (1957, 1967, 2007 and 2010) shows an exponentially growing mega-gully network since roads were constructed through in the forests and plantations which occupied the sandy soils of the high town of Kinshasa. We found that the spatial occurrence of the mega-gullies (width ? 5 m) in this newly urbanized environment is controlled by two factors. First, there is a topographic control, given by the relation S = 0.00008A- 1.459, with S being the slope gradient (m m- 1) of the soil surface at the gully head and A the drainage area (ha) above the head. There is also a ‘road’ control, expressed by S = 22.991Lc- 1.999, with Lc being the cumulated length of roads in the basin above the gully head. The co-existence of both controls reflects the fact that the local sands are highly permeable and hence roads are more important generators of continuous runoff. The S-A relation noted above should not be applied outside the town where the road network is less dense. In contrast, the S-Lc relation may be used in both the town and rural areas underlain by porous soils where roads are the only generators of continuous runoff. We further conclude that the high town of Kinshasa is one of the most vulnerable places for gullying, and gullying can potentially transform the town into a badland. ‘Artisanal’ gully treatment is more successful than generally believed and the S-Lc relation can be a tool for mega-gully prevention.

  5. Seismic Regime in the Vicinity of the 2011 Tohoku Mega Earthquake (Japan, M w = 9)

    Science.gov (United States)

    Rodkin, M. V.; Tikhonov, I. N.

    2014-12-01

    The 2011 Tohoku mega earthquake ( M w = 9) is unique due to a combination of its large magnitude and the high level of detail of regional seismic data. The authors analyzed the seismic regime in the vicinity of this event using data from the Japan Meteorological Agency catalog and world databases. It was shown that a regional decrease in b-value and of the number of main shocks took place in the 6-7 years prior to the Tohoku mega earthquake. The space-time area of such changes coincided with the development of precursor effects in this area, as revealed by Lyubushin (Geofiz Prots Biosfera 10:9-35, 2011) from the analysis of microseisms recorded by the broadband seismic network F-net in Japan. The combination of episodes of growth in the number of earthquakes, accompanied by a corresponding decrease in the b-value and average depth of the earthquakes, was observed for the foreshock and aftershock sequences of the 2011 Tohoku earthquake. Some of these anomalies were similar to those observed (also post factum) by Katsumata (Earth Planets Space 63:709-712, 2011), Nanjo et al. (Geophys Res Lett 39, 2012), and Huang and Ding (Bull Seismol Soc Am 102:1878-1883, 2012), whereas others were not described before. The correlation of the periods of growth in seismic activity with the decrease of the average depth of earthquakes can be explained by the growth of fluid activity and the tendency of a penetration of low density fluids into the upper horizons of the lithosphere. The unexpectedly strong Tohoku mega earthquake with a rather small rupture area caused an unexpectedly high tsunami wave. From here it seems plausible that M9+ earthquakes with a large tsunami could occur in other subduction zones where such cases were suggested before to be impossible.

  6. Scaling Relations of Source Parameters of Earthquakes Occurring on Inland Crustal Mega-Fault Systems

    Science.gov (United States)

    Murotani, Satoko; Matsushima, Shinichi; Azuma, Takashi; Irikura, Kojiro; Kitagawa, Sadayuki

    2015-05-01

    We examined a new scaling relation between source area S and seismic moment M 0 for large crustal earthquakes on "mega-fault" systems, including earthquakes with magnitudes larger than M w7.4. We focused on earthquakes that occurred on inland crustal mega-fault systems, such as the 2008 Wenchuan and 2002 Denali earthquakes, and compiled the source parameters using 11 inland crustal earthquakes which analyses of source rupture processes by waveform inversion as well as investigation of surface ruptures via geomorphological surveys. We found that the maximum surface rupture displacement is two to three times larger than the average slip on the source fault, and the length of the surface rupture is equivalent to the length of the source fault. Furthermore, our compiled data shows the displacement of the surface rupture D saturates around 10 m when the length of the surface rupture L reaches 100 km. Assuming that the average width of the source fault W = 18 km (for Japanese inland crustal earthquakes) and the saturated surface displacement D = 10 m, we found that the scaling relations between rupture area S and seismic moment M 0 have three stages. For the first stage, S is proportional to M {0/2/3} for earthquakes smaller than M 0 = 7.5 × 1018 Nm. For the second stage, S ranges from M {0/1/2} to M {0/2/3}, depending on the thickness of the seismogenic zone. For the third stage, S is proportional to M 0 because of the saturation of the slip on the fault. From our compiled data, we derived the third scaling relation between source area S and seismic moment M 0 for inland crustal mega-fault systems to be S (km2) = 1.0 × 10-17 M 0 (Nm), where M 0 > 1.8 × 1020 (Nm).

  7. Construction and Characterization of a Highly Efficient Francisella Shuttle Plasmid

    Science.gov (United States)

    Maier, Tamara M.; Havig, Andrea; Casey, Monika; Nano, Francis E.; Frank, Dara W.; Zahrt, Thomas C.

    2004-01-01

    Francisella tularensis is a facultative intracellular pathogen that infects a wide variety of mammals and causes tularemia in humans. It is recognized as a potential agent of bioterrorism due to its low infectious dose and multiple routes of transmission. To date, genetic manipulation in Francisella spp. has been limited due to the inefficiency of DNA transformation, the relative lack of useful selective markers, and the lack of stably replicating plasmids. Therefore, the goal of this study was to develop an enhanced shuttle plasmid that could be utilized for a variety of genetic procedures in both Francisella and Escherichia coli. A hybrid plasmid, pFNLTP1, was isolated that was transformed by electroporation at frequencies of >1 × 107 CFU ?g of DNA?1 in F. tularensis LVS, Francisella novicida U112, and E. coli DH5?. Furthermore, this plasmid was stably maintained in F. tularensis LVS after passage in the absence of antibiotic selection in vitro and after 3 days of growth in J774A.1 macrophages. Importantly, F. tularensis LVS derivatives carrying pFNLTP1 were unaltered in their growth characteristics in laboratory medium and macrophages compared to wild-type LVS. We also constructed derivatives of pFNLTP1 containing expanded multiple cloning sites or temperature-sensitive mutations that failed to allow plasmid replication in F. tularensis LVS at the nonpermissive temperature. In addition, the utility of pFNLTP1 as a vehicle for gene expression, as well as complementation, was demonstrated. In summary, we describe construction of a Francisella shuttle plasmid that is transformed at high efficiency, is stably maintained, and does not alter the growth of Francisella in macrophages. This new tool should significantly enhance genetic manipulation and characterization of F. tularensis and other Francisella biotypes. PMID:15574954

  8. 38 CFR 51.70 - Resident rights.

    Science.gov (United States)

    2010-07-01

    ...resident has the right to freedom from chemical or physical restraint. (4) In the case of a resident determined incompetent... (B) A significant change in the resident's physical, mental, or psychosocial status (i.e.,...

  9. 7 CFR 273.3 - Residency.

    Science.gov (United States)

    2010-01-01

    ...residency require an intent to reside permanently in the State or project area. Persons in a project area solely for vacation purposes shall not be considered residents. (b) When a household moves within the State, the State agency may...

  10. Conjugative plasmids harboring tet(W) and tet(M) involved in the transfer of tetracycline resistance.

    Czech Academy of Sciences Publication Activity Database

    Kyselková, Martina; Kopejtka, Karel; Volná, Lucie; Bhumibhamon, G.; Chro?áková, Alica; Jirout, Ji?í; Schmitt, H.; Heuer, H.; Smalla, K.; Elhottová, Dana

    Santander : International Society for Plasmid Biology, 2012. [International Plasmid Biology Conference 2012. 12.09.2012-16.09.2012, Santander] Institutional support: RVO:60077344 Keywords : conjugative plasmids harboring * tetracycline resistance Subject RIV: EH - Ecology, Behaviour

  11. Tunable mega-ampere electron current propagation in solids by dynamic control of lattice melt.

    Science.gov (United States)

    MacLellan, D A; Carroll, D C; Gray, R J; Booth, N; Burza, M; Desjarlais, M P; Du, F; Neely, D; Powell, H W; Robinson, A P L; Scott, G G; Yuan, X H; Wahlström, C-G; McKenna, P

    2014-10-31

    The influence of lattice-melt-induced resistivity gradients on the transport of mega-ampere currents of fast electrons in solids is investigated numerically and experimentally using laser-accelerated protons to induce isochoric heating. Tailoring the heating profile enables the resistive magnetic fields which strongly influence the current propagation to be manipulated. This tunable laser-driven process enables important fast electron beam properties, including the beam divergence, profile, and symmetry to be actively tailored, and without recourse to complex target manufacture. PMID:25396375

  12. [Mega-duodenum and constipation after surgery for congenital atresia of the jejunum].

    Science.gov (United States)

    Karstensen, John; Raahave, Dennis; Kirkegaard, Preben

    2011-06-20

    A 33 year-old female presented with constipation and a right-sided palpable abdominal mass, suspected to be the colon. The colonic transit time was prolonged, but the dilated organ was a mega duodenum that had developed after surgery for three jejunal atresies performed one day after birth. The colon was malrotated, being situated to the left of the columna. Renewed resection surgery was uneventful, and after such surgery the constipation receded and the colonic transit time returned to normal. PMID:21689512

  13. Rupture process of the 2013 Okhotsk deep mega earthquake from iterative backprojection and compress sensing methods

    Science.gov (United States)

    Qin, W.; Yin, J.; Yao, H.

    2013-12-01

    On May 24th 2013 a Mw 8.3 normal faulting earthquake occurred at a depth of approximately 600 km beneath the sea of Okhotsk, Russia. It is a rare mega earthquake that ever occurred at such a great depth. We use the time-domain iterative backprojection (IBP) method [1] and also the frequency-domain compressive sensing (CS) technique[2] to investigate the rupture process and energy radiation of this mega earthquake. We currently use the teleseismic P-wave data from about 350 stations of USArray. IBP is an improved method of the traditional backprojection method, which more accurately locates subevents (energy burst) during earthquake rupture and determines the rupture speeds. The total rupture duration of this earthquake is about 35 s with a nearly N-S rupture direction. We find that the rupture is bilateral in the beginning 15 seconds with slow rupture speeds: about 2.5km/s for the northward rupture and about 2 km/s for the southward rupture. After that, the northward rupture stopped while the rupture towards south continued. The average southward rupture speed between 20-35 s is approximately 5 km/s, lower than the shear wave speed (about 5.5 km/s) at the hypocenter depth. The total rupture length is about 140km, in a nearly N-S direction, with a southward rupture length about 100 km and a northward rupture length about 40 km. We also use the CS method, a sparse source inversion technique, to study the frequency-dependent seismic radiation of this mega earthquake. We observe clear along-strike frequency dependence of the spatial and temporal distribution of seismic radiation and rupture process. The results from both methods are generally similar. In the next step, we'll use data from dense arrays in southwest China and also global stations for further analysis in order to more comprehensively study the rupture process of this deep mega earthquake. Reference [1] Yao H, Shearer P M, Gerstoft P. Subevent location and rupture imaging using iterative backprojection for the 2011 Tohoku Mw 9.0 earthquake. Geophysical Journal International, 2012, 190(2): 1152-1168. [2]Yao H, Gerstoft P, Shearer P M, et al. Compressive sensing of the Tohoku-Oki Mw 9.0 earthquake: Frequency-dependent rupture modes. Geophysical Research Letters, 2011, 38(20).

  14. Sub-mega joule laser target designs for direct-drive ignition and moderate gains

    International Nuclear Information System (INIS)

    We report here exploratory studies of direct-drive target designs that require substantially less than a mega joule of laser energy for ignition and moderate gains. The target physics advantages of the Krypton Fluoride laser are exploited to achieve increased implosion velocities that allow ignition and gain at reduced energy. Use of increased laser irradiance allows use of limited aspect ratio targets. The highest performing designs make use of a short spike prepulse to set up an adiabat that can be favourable to gain. These designs have application in reducing the driver size needed for experimental laser fusion facilities and may be applicable to the gains needed for the energy application

  15. Development of a hardened imaging system for the Laser MegaJoule

    Directory of Open Access Journals (Sweden)

    Rousseau A.

    2013-11-01

    Full Text Available The Laser MegaJoule (LMJ facility will host inertial confinement fusion experiments in order to achieve ignition by imploding a Deuterium-Tritium microballoon. In this context an X-ray imager is necessary to diagnose the core size and shape of the DT-target in the 10–100?keV band in complement of neutron imaging system. Such a diagnostic will be composed of two parts: an X-ray optical system and a detection assembly. Each element will be affected by the harsh environment created by fusion reactions.

  16. MegaZ-LRG: A photometric redshift catalogue of one million SDSS Luminous Red Galaxies

    OpenAIRE

    Collister, Adrian; Lahav, ofer; Blake, Chris; Cannon, Russell; Croom, Scott; Drinkwater, Michael; Edge, Alastair; Eisenstein, Daniel; Loveday, Jon; Nichol, Robert; Pimbblet, Kevin; de Propris, Roberto; Roseboom, Isaac; Ross, Nic; Donald P. Schneider

    2006-01-01

    We describe the construction of MegaZ-LRG, a photometric redshift catalogue of over one million luminous red galaxies (LRGs) in the redshift range 0.4 < z < 0.7 with limiting magnitude i < 20. The catalogue is selected from the imaging data of the Sloan Digital Sky Survey (SDSS) Data Release 4. The 2dF-SDSS LRG and Quasar (2SLAQ) spectroscopic redshift catalogue of 13 000 intermediate-redshift LRGs provides a photometric redshift training set, allowing use of ANNz, a neural network-based phot...

  17. Establishment of a production line for the fabrication of mega-curie sealed 60Co sources

    International Nuclear Information System (INIS)

    In order to change the status that highly radioactive 60Co sources in China are de- pendent on imports, the fabrication technology of sealed 60Co sources was successfully developed and a mega Curie production line was established. This paper describes the hot cell facilities for the 60Co source encapsulation and quality control, the model and main technical parameters of the sealed 60Co source, the fabrication process, some key techniques in the re- search and development of the sealed 60Co source, etc. (authors)

  18. Festifavelisation: mega-events, slums and strategic city-staging – the example of Rio de Janeiro

    Directory of Open Access Journals (Sweden)

    Steinbrink, Malte

    2013-11-01

    Full Text Available Mega-events are increasingly often taking place in countries of the Global South. In the socio-spatially deeply fragmented host cities these spectacles encompass extremely transformative urban processes. This paper will consider the festivalisation of Rio de Janeiro in the preparatory phase of the 2014 FIFA World Cup and the 2016 Summer Olympics. It focuses on the urban policy in relation to how Rio deals with its favelas. The aim of the article is to critically assess current measures of ‘invisibilisation’, ‘pacification’, ‘beautification’ and ‘touristic staging’ of favelas against the backdrop of the upcoming events.

  19. Infectious alphavirus production from a simple plasmid transfection+

    Directory of Open Access Journals (Sweden)

    Olson Ken E

    2011-07-01

    Full Text Available Abstract We have developed a new method for producing infectious double subgenomic alphaviruses from plasmids transfected into mammalian cells. A double subgenomic Sindbis virus (TE3'2J was transcribed from a cytomegalovirus PolII promoter, which results in the production of infectious virus. Transfection of as little as 125 ng of plasmid is able to produce 1 × 108 plaque forming units/ml (PFU/ml of infectious virus 48 hours post-transfection. This system represents a more efficient method for producing recombinant Sindbis viruses.

  20. Association of lupin mitochondrial plasmid DNA with mitochondrial protein

    International Nuclear Information System (INIS)

    Lupinus albus mitochondrial plasmids and Lupinus mitochondrial and total proteins have been used for studying the formation of complexes by gel retardation and UV crosslinking assays. All the results suggest formation of a specific complex between mitochondrial plasmids and proteins. Lupinus albus mitochondrial proteins recovered from the complex and resolved by two-dimensional gel electrophoresis (2-D SDS-PAGE) displayed a pI of about 5.6 and 5.8 and a molecular weight of 30 and 31 kDa. (author)

  1. Status and Perspectives of the Mini-MegaTORTORA Wide-field Monitoring System with High Temporal Resolution

    Directory of Open Access Journals (Sweden)

    Sergey Karpov

    2013-01-01

    Full Text Available Here we briefly summarize our long-term experience of constructing and operating wide-field monitoring cameras with sub-second temporal resolution to look for optical components of GRBs, fast-moving satellites and meteors. The general hardware requirements for these systems are discussed, along with algorithms for real-time detection and classification of various kinds of short optical transients. We also give a status report on the next generation, the MegaTORTORA multi-objective and transforming monitoring system, whose 6-channel (Mini-MegaTORTORA-Spain and 9-channel prototypes (Mini-MegaTORTORA-Kazan we have been building at SAO RAS. This system combines a wide field of view with subsecond temporal resolution in monitoring regime, and is able, within fractions of a second, to reconfigure itself to follow-up mode, which has better sensitivity and simultaneously provides multi-color and polarimetric information on detected transients.

  2. US dermatology residency program rankings.

    Science.gov (United States)

    Aquino, Lisa L; Wen, Ge; Wu, Jashin J

    2014-10-01

    Unlike many other adult specialties, US News & World Report does not rank dermatology residency programs annually. We conducted a study to rank individual US dermatology residency programs based on set criteria. For each residency program, data from 2008 related to a number of factors were collected, including annual amount of National Institutes of Health (NIH) and Dermatology Foundation (DF) funding received; number of publications from full-time faculty members; number of faculty lectures given at 5 annual society meetings; and number of full-time faculty members who were on the editorial boards of 6 dermatology journals with the highest impact factors. Most of the data were obtained through extensive Internet searches, and missing data were obtained by contacting individual residency programs. The programs were ranked based on the prior factors according to a weighted ranking algorithm. A list of overall rankings also was created. PMID:25372254

  3. Burnout among Dutch medical residents

    OpenAIRE

    Meindert Slagter

    2010-01-01

    Medical residents (doctors in training to become medical specialists) fulfill an important role in the Dutch healthcare system. They take their share of responsibility for efficient patient care in hospitals, mental healthcare centres, rehabilitation centres and other medical institutions. Medical residents see the period of training for medical specialist as a valuable phase in their lives. It is a phase in which finding a balance between training, work and private life plays an important pa...

  4. Possible involvement of a plasmid in arginine auxotrophic mutation of Streptomyces kasugaensis.

    OpenAIRE

    Nakano, M. M.; Ozawa, K.; Ogawara, H.

    1980-01-01

    Streptomyces kasugaensis gave arginine auxotrophic mutants at high frequency, The coupled loss and reappearance of plasmid deoxyribonucleic acid with arginine auxotrophy suggested that the insertion of the plasmid into chromosomal deoxyribonucleic acid caused the arginine auxotrophy.

  5. On conjugative plasmids: mathematical models of their population dynamics and population genetics

    OpenAIRE

    Hoeven, Nelly

    1985-01-01

    in this thesis several mathematical models are formulated to analyse the population dynamics of plasmids. Furthermore it is investigated how selection affects the characteristics of the population dynamics of plasmids. ... Zie: Summary and general conclusions

  6. Small plasmids in Streptococcus dysgalactiae subsp. equisimilis isolated from human infections in southern India and sequence analysis of two novel plasmids.

    Science.gov (United States)

    Bergmann, René; Nitsche-Schmitz, D Patric

    2015-05-01

    Small plasmids are frequently found in S. pyogenes isolates from human infections in India. Streptococcus dysgalactiae subsp. equisimilis (SDSE) is a streptococcal subspecies that is genetically similar to S. pyogenes and has a similar ecology. Therefore, we determined the distribution of small plasmids in a collection of 254 SDSE isolates, comprising 44 different emm-types and emm non-typable strains, from southern India, utilizing an established PCR based method. Briefly, 1.2% (n=3) of the isolates were positive for repA (encoding the replication initiation protein A) and 1.6% (n=4) were repB positive (encoding the replication initiation protein B). One isolate (G315) showed a co-detection of repB and dysA (encoding the bacteriocin dysgalacticin) which is characteristic for previously described pDN281/pW2580-like plasmids, observed in SDSE and S. pyogenes. The remaining plasmid bearing isolates showed no characteristic co-detection of known plasmid-associated genes. Thus, plasmids pG271 and pG279, representatives for repB and repA harboring plasmids, respectively, were analyzed. The plasmids pG271 and pG279 could be assigned to the pMV158 and the pC194/pUB110 family of rolling-circle plasmids, respectively. Like the characterized small native plasmids of S. pyogenes from India, the SDSE plasmids discovered and described in this study did not carry any of the known antibiotic resistance genes. SDSE bore less of the investigated small native plasmids that were distinct from the small native plasmids of S. pyogenes of the same geographic region. This indicates a low rate of lateral transfer of these genetic elements between these two related streptococcal species. PMID:25769407

  7. Plasmid pattern analysis of Staphylococcal epidermidis isolates from patients with prosthetic valve endocarditis.

    OpenAIRE

    Archer, G. L.; Vishniavsky, N.; Stiver, H. G.

    1982-01-01

    The electrophoretic pattern formed by individual bacterial plasmid DNA molecules of differing molecular size was evaluated as an epidemiological marker among isolates of Staphylococcus epidermidis from patients with prosthetic valve endocarditis (PVE). Purified covalently closed circular plasmid DNA was obtained from selected isolates, and 79% of the plasmids were found to be less than 10 megadaltons in size; only these small plasmids were sought in subsequent screening gels. Crude cell lysat...

  8. Plasmid marker rescue transformation proceeds by breakage-reunion in Bacillus subtilis.

    OpenAIRE

    Weinrauch, Y.; Dubnau, D.

    1987-01-01

    Bacillus subtilis carrying a plasmid which replicates with a copy number of about 1 was transformed with linearized homologous plasmid DNA labeled with the heavy isotopes 2H and 15N, in the presence of 32Pi and 6-(p-hydroxyphenylazo)-uracil to inhibit DNA replication. Plasmid DNA was isolated from the transformed culture and fractionated in cesium chloride density gradients. The distribution of total and donor plasmid DNA was examined, using specific hybridization probes. The synthesis of new...

  9. Phylogenetic Analysis of the pPT23A Plasmid Family of Pseudomonas syringae?

    OpenAIRE

    Ma, Zhonghua; Smith, James J.; Zhao, Youfu; Jackson, Robert W.; Arnold, Dawn L.; Murillo, Jesu?s; Sundin, George W.

    2006-01-01

    The pPT23A plasmid family of Pseudomonas syringae contains members that contribute to the ecological and pathogenic fitness of their P. syringae hosts. In an effort to understand the evolution of these plasmids and their hosts, we undertook a comparative analysis of the phylogeny of plasmid genes and that of conserved chromosomal genes from P. syringae. In total, comparative sequence and phylogenetic analyses were done utilizing 47 pPT23A family plasmids (PFPs) from 16 pathovars belonging to ...

  10. Simple and rapid method for isolating large plasmid DNA from lactic streptococci.

    OpenAIRE

    Anderson, D. G.; McKay, L L

    1983-01-01

    A procedure for the rapid isolation of plasmid DNA larger than 30 megadaltons from lactic streptococci is described. This protocol can be used on a preparative scale to isolate sufficient quantities of plasmid DNA required for restriction analysis, cloning, or transformation experiments. A scaled-down protocol is very useful for rapidly screening the plasmid content of streptococcal strains. With this methodology, previously undetected large plasmids were observed.

  11. Cloning and sequencing of a plasmid-borne gene (opd) encoding a phosphotriesterase.

    OpenAIRE

    McDaniel, C S; Harper, L L; Wild, J. R.

    1988-01-01

    Plasmid pCMS1 was isolated from Pseudomonas diminuta MG, a strain which constitutively hydrolyzes a broad spectrum of organophosphorus compounds. The native plasmid was restricted with PstI, and individual DNA fragments were subcloned into pBR322. A recombinant plasmid transformed into Escherichia coli possessed weak hydrolytic activity, and Southern blotting with the native plasmid DNA verified that the DNA sequence originated from pCMS1. When the cloned 1.3-kilobase fragment was placed behi...

  12. MEGA (Multiple Essential Genes Assembling) Deletion and Replacement Method for Genome Reduction in Escherichia coli.

    Science.gov (United States)

    Xue, Xiaoli; Wang, Tao; Jiang, Peng; Shao, Yangyang; Zhou, Min; Zhong, Li; Wu, Ronghai; Zhou, Jianting; Xia, Haiyang; Zhao, Guoping; Qin, Zhongjun

    2015-06-19

    Top-down reduction of the bacterial genome to construct desired chassis cells is important for synthetic biology. However, the current progress in the field of genome reduction is greatly hindered by indispensable life-essential genes that are interspersed throughout the chromosomal loci. Here, we described a new method designated as "MEGA (Multiple Essential Genes Assembling) deletion and replacement" that functions by assembling multiple essential genes in an E. coli-S. cerevisiae shuttle vector, removing targeted chromosomal regions containing essential and nonessential genes using a one-round deletion, and then integrating the cloned essential genes into the in situ chromosomal loci via I-SceI endonuclease cleavage. As a proof of concept, we separately generated three large deletions (80-205 kbp) in the E. coli MDS42 chromosome. We believe that the MEGA deletion and replacement method has potential to become widely used in large-scale genome reductions in other sequenced organisms in addition to E. coli. PMID:25494410

  13. The mega-Gray-level glucose dosimeter using optical rotation change

    International Nuclear Information System (INIS)

    Dosimetric characteristics of glucose dosimeter based on the radiation induced change in optical rotation of D-glucose solution was studied for the high-dose dosimetry at mega-Gray level. D-glucose solution of 20 wt% concentration was used for dosimeter solution. The optical rotation of solution is independent of the temperature of solution during measurement in the range of 5 to 30 deg C and stable for a long period at room temperature before and after irradiation. Radiation induced optical rotation change also does not depend on the temperature during irradiation in the range of 25 to 50 deg C. Glucose dosimeter was found to be very reproducible in mega-Gray level and covers high dose range from 0.01 to 4.30 MGy within the accuracy of ± 4 %. As to the radiation chemical mechanism, the optical rotation change of glucose solution is ascribed to radiation induced decomposition of D-glucose, and the G value for the decomposition, which is 4.1 to initial stage of irradiation, decreases with the increase of dose. (author)

  14. Mega-science accelerator projects in China and their impact on economy

    International Nuclear Information System (INIS)

    Along with the rapid development of national economy in China, a number of mega-science projects have been or being constructed. In respect to the large accelerator-based projects, the Beijing Electron-Positron Colliders (BEPC) and its upgrading project BEPC?, the Hefei Light Source (HLS), the Heavy Ion Research Facility in Lanzhou (HIRFL) and its Cooling Storage Rings (HIRFL-CSR) and the Shanghai Synchrotron Radiation Facility (SSRF) were successfully constructed and put into operation. The Beijing Radioactive Ion Facility (BRIF) and the China Spallation Neutron Source (CSNS) are under construction. A particle accelerator is an integration of many HI-tech components. In order to reach the scientific goal of an accelerator project, a great deal new technologies need to be developed during its construction and operation and thus speed up technology development and this will positively impact on the economy. In this paper, the mega-science accelerator projects are briefly described and applications of accelerators in the economy are reviewed. The paper emphasizes spin-off of the accelerator technology developed during R and D and construction of the projects. Approaches of collaboration between academia and industry are discussed. With some examples, the benefits experienced in the laboratory-industry collaboration and approach of its economic compact are illustrated. (author)

  15. A Case with Mega Cisterna Magna Renal and Ear Anomalies: Is This a New Syndrome?

    Science.gov (United States)

    Caliskan, Bahar; Tas, Mehmet Ali

    2013-01-01

    Background. Extrarenal pathologies may be associated with renal position and fusion anomalies. According to the literature, our patient is the first horseshoe kidney case that had mega cisterna magna, arachnodactyly, and mild mental retardation. Case Report. A 9-year-old boy admitted because of the myoclonic jerks. He had a dysmorphic face, low-set and cup-shaped ears, arachnodactyly, and mild mental retardation. The patient's laboratory findings were normal except for a mild leucocytosis and hypochromic microcytic anemia. His cerebrospinal fluid was cytologically and biochemically normal. Cranial MRI revealed 1.5?cm diametered mega cisterna magna in the retrocerebellar region. Although there were no significant epileptical discharges in the electroencephalography, there were slow wave discharges arising from the anterior regions of both hemispheres. Because he had stomachache, abdominal ultrasonography was performed, and horseshoe kidney was determined. Abdominal CT did not reveal any abnormalities except the horseshoe kidney. There were not any cardiac pathologies in echocardiography. He had normal 46XY karyotype and there were no repeated chromosomal derangements, but we could not evaluate for molecular and submicroscopic somatic changes. He was treated with valproic acid and myoclonic jerks did not repeat. Conclusion. We suggest that the presence of these novel findings may represent a newly recognized, separate syndrome. PMID:23762068

  16. Recurrent Pleistocene mega-failures on the SW Barents Sea margin

    Science.gov (United States)

    Hjelstuen, Berit Oline; Eldholm, Olav; Faleide, Jan Inge

    2007-06-01

    Submarine slides have been instrumental in shaping the Late Neogene NE Atlantic continental margin. We document a margin setting north of 70°N capable of generating recurrent huge Pleistocene mass-movements. The 1.0-0.2 Ma old Bjørnøya Fan Slide Complex includes three buried mega-slides, which have left scars containing up to 500 m-thick debris units. The two largest slides may have had a retrogressive development, cover areas of the order of ˜ 120 × 10 3 km 2, and involved ˜ 25 × 10 3 km 3 of sediments. Thus, the failures involved an order of magnitude more sediment than the Storegga Slide, the world's largest exposed slide. The mega-slides occurred during the Northern Hemisphere Glaciations, characterized by greatly enhanced deposition rates leading to the construction of the 3-km-thick Bjørnøya Trough Mouth Fan that progressively loaded a softer Miocene-Oligocene substratum. This setting induced excess pore pressure and sediment instability, conditions favorable for sliding. External trigger mechanisms, such as earthquakes, may have facilitated the mass-wasting process.

  17. Finding ultracool brown dwarfs with MegaCam on CFHT: method and first results

    CERN Document Server

    Delorme, Philippe; Forveille, Thierry; Delfosse, Xavier; Reylé, Céline; Bertin, Emmanuel; Albert, Loic; Artigau, Etienne; Robin, Annie C; Allard, France; Doyon, Rene; Hill, Gary J

    2008-01-01

    We present the first results of a wide field survey for cool brown dwarfs with the MegaCam camera on the CFHT telescope, the Canada-France Brown Dwarf Survey, hereafter CFBDS. Our objectives are to find ultracool brown dwarfs and to constrain the field-brown dwarf mass function thanks to a larger sample of L and T dwarfs. We identify candidates in CFHT/MegaCam i' and z' images using optimised psf-fitting within Source Extractor, and follow them up with pointed near-infrared imaging on several telescopes. We have so far analysed over 350 square degrees and found 770 brown dwarf candidates brighter than z'{AB}=22.5. We currently have J-band photometry for 220 of these candidates, which confirms 37% as potential L or T dwarfs. Some are among the reddest and farthest brown dwarfs currently known, including an independent identification of the recently published ULAS J003402.77-005206.7 and the discovery of a second brown dwarf later than T8, CFBDS J005910.83-011401.3. Infrared spectra of three T dwarf candidates ...

  18. Sustainable Science? Reducing the Carbon Impact of Scientific Mega-Meetings

    Directory of Open Access Journals (Sweden)

    Alexandra G. Ponette-González

    2011-10-01

    Full Text Available Scientists across the globe recognize the importance of reducing carbon emissions to combat climate change.  At the same time, we have increased our carbon footprint through air travel to the growing number of scientific society “mega-meetings” that host thousands of attendees.  Although alternative solutions have been proposed to reduce the environmental impact of annual conferences, these have yet to be evaluated against the business-as-usual scenario.  Here, we use 9 years of annual meeting attendance data from the Ecological Society of America and the Association of American Geographers to assess the efficacy of two additional solutions: 1 alternate large national meetings that require significant air travel with smaller regional meetings that do not; and 2 incorporate geography into the meeting location selection process.  The carbon footprint of annual mega-meetings ranged 3-fold, from 1196-4062 metric tons of CO2.  Results indicate that an alternating schedule of national and regional meetings can reduce conference-related CO2 emissions up to 73%, while improved spatial planning may result in further reductions.  We discuss the benefits and tradeoffs of proposals to green scientific meetings, with a view to spark further debate on how to increase the sustainability of scientific conferences.

  19. Photon detector for MEGA. Final report, July 16, 1992--May 31, 1993

    International Nuclear Information System (INIS)

    During the past year, we have continued our work on the photon detector for the MEGA experiment at Los Alamos. The MEGA photon detector is designed to observe the 52.83 MeV photon produced in a ? ? e? decay with an energy resolution of 1.25 MeV, a position resolution of 2 x 5 mm2, a directional resolution of 10 degree, a time resolution of 500 ps, and an efficiency of about 5.4%. (All quoted resolutions are FWHM.) It consists of three independent concentric cylindrical pair spectrometers mounted within a 1.5 T magnetic field produced by a superconducting solenoid magnet. Each pair spectrometer includes two thin (0.045 radiation lengths each) Pb foils to convert photons into e+e- pairs. The two smaller pair spectrometers have three drift chamber layers to track the e+e- pairs and thereby determine both their locations and their vector momenta. The third pair spectrometer has four layers of drift chamber, together with a larger turning region, to provide better tracking information for high energy photons such as those from the ?0 ? 2? decay

  20. An instability theory for the formation of ribbed moraine, drumlins and mega-scale glacial lineations.

    Science.gov (United States)

    Fowler, A C; Chapwanya, M

    2014-11-01

    We present a theory for the coupled flow of ice, subglacial water and subglacial sediment, which is designed to represent the processes which occur at the bed of an ice sheet. The ice is assumed to flow as a Newtonian viscous fluid, the water can flow between the till and the ice as a thin film, which may thicken to form streams or cavities, and the till is assumed to be transported, either through shearing by the ice, squeezing by pressure gradients in the till, or by fluvial sediment transport processes in streams or cavities. In previous studies, it was shown that the dependence of ice sliding velocity on effective pressure provided a mechanism for the generation of bedforms resembling ribbed moraine, while the dependence of fluvial sediment transport on water film depth provides a mechanism for the generation of bedforms resembling mega-scale glacial lineations. Here, we combine these two processes in a single model, and show that, depending largely on the granulometry of the till, instability can occur in a range of types which range from ribbed moraine through three-dimensional drumlins to mega-scale glacial lineations. PMID:25383019

  1. Deep sequencing reveals complex spurious transcription from transiently transfected plasmids.

    Czech Academy of Sciences Publication Activity Database

    Nejepínská, Jana; Malík, Radek; Moravec, Martin

    2012-01-01

    Ro?. 7, ?. 8 (2012), e43283. ISSN 1932-6203 R&D Projects: GA ?R GA204/09/0085 Grant ostatní: EMBO(XE) 0001488 Institutional research plan: CEZ:AV0Z50520514 Institutional support: RVO:68378050 Keywords : transient plasmid transfection * deep sequencing Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.730, year: 2012

  2. Plasmid-determined copper resistance in Pseudomonas syringae from impatiens

    Energy Technology Data Exchange (ETDEWEB)

    Cooksey, D.A. (Univ. of California, Riverside (USA))

    1990-01-01

    A strain of Pseudomonas syringae was recently identified as the cause of a new foliar blight of impatiens. The bacterium was resistant to copper compounds, which are used on a variety of crops for bacterial and fungal disease control. The bacterium contained a single 47-kilobase plasmid (pPSI1) that showed homology to a copper resistance operon previously cloned and characterized from P. syringae pv. tomato plasmid pPT23D (D. Cooksey, Appl. Environ. Microbiol. 53:454-456, 1987). pPSI1 was transformed by electroporation into a copper-sensitive P. syringae strain, and the resulting transformants were copper resistant. A physical map of pPSI1 was constructed, and the extent of homology to pPT23D outside the copper resistance operon was determined in Southern hybridizations. The two plasmids shared approximately 20 kilobases of homologous DNA, with the remainder of each plasmid showing no detectable homology. The homologous regions hybridized strongly, but there was little or no conservation of restriction enzyme recognition sites.

  3. Magnetic Nanoparticles for Plasmid DNA Adsorption via Hydrophobic Interaction

    OpenAIRE

    Gungunes H.; Uzek R.; Uzun L.; Ozkara S.; ?enel S.; Denizli A.

    2012-01-01

    This study aims the preparation of magnetic poly(2-hydroxyethylmethacrylate-N-methacryloyl-Lphenylalanine), [poly(HEMA-MAPA)] nanoparticles for plasmid DNA separation on the basis of hydrophobic interactions. Magnetic nanoparticles will be produced emulsion polymerization of 2- hydroxyethylmethacrylate (HEMA) and N-methacryloyl-L-phenylalanine (MAPA) monomers. Nanosized particles including hydrophobic groups stemmed from polymerizable derivative of phenylalanine aminoacid were ...

  4. Recombinogenic engineering of conjugative plasmids with fluorescent marker cassettes

    DEFF Research Database (Denmark)

    Reisner, A.; Molin, SØren

    2002-01-01

    An efficient approach for the insertion of fluorescent marker genes with sequence specificity into conjugative plasmids in Escherichia coli is described. For this purpose, homologous recombination of linear double-stranded targeting DNA was mediated by the bacteriophage lambda recombination functions using very short regions of homology. Initial manipulation of the IncFII target plasmids R1 and R1drd19 indicated that the linear targeting DNA should be devoid of all extraneous homologies to. the target molecule for optimal insertion specificity. Indeed, a simple recombination assay proved that in the presence of additional homologous regions in the targeting DNA, strand exchanges occurred exclusively within the longest regions of homology. A versatile panel of vectors was created to facilitate convenient PCR amplification of targeting DNAs containing various combinations of different antibiotic resistance genes and fluorescent markers. The choice of 5' non-homologous extensions in primer pairs used for amplifying the marker cassettes determines the site specificity of the targeting DNA. This methodology is applicable to the modification of all plasmids that replicate in E coli and is not restricted by plasmid size.

  5. PLASMIDS FOR EXPRESSION OF HETEROLOGOUS PROTEINS IN RHIZOPUS ORYZAE

    Science.gov (United States)

    Rhizopus oryzae has long been used for enzyme production (e.g., glucoamylase and lipase), organic acid synthesis, and various fermented food applications. In this work, we describe a set of plasmid-based expression vectors that can be used for the production of heterologous proteins in R. oryzae. ...

  6. Geminiviruses: a tale of a plasmid becoming a virus

    Directory of Open Access Journals (Sweden)

    Krupovic Mart

    2009-05-01

    Full Text Available Abstract Background Geminiviruses (family Geminiviridae are small single-stranded (ss DNA viruses infecting plants. Their virion morphology is unique in the known viral world – two incomplete T = 1 icosahedra are joined together to form twinned particles. Geminiviruses utilize a rolling-circle mode to replicate their genomes. A limited sequence similarity between the three conserved motifs of the rolling-circle replication initiation proteins (RCR Reps of geminiviruses and plasmids of Gram-positive bacteria allowed Koonin and Ilyina to propose that geminiviruses descend from bacterial replicons. Results Phylogenetic and clustering analyses of various RCR Reps suggest that Rep proteins of geminiviruses share a most recent common ancestor with Reps encoded on plasmids of phytoplasmas, parasitic wall-less bacteria replicating both in plant and insect cells and therefore occupying a common ecological niche with geminiviruses. Capsid protein of Satellite tobacco necrosis virus was found to be the best template for homology-based structural modeling of the geminiviral capsid protein. Good stereochemical quality of the generated models indicates that the geminiviral capsid protein shares the same structural fold, the viral jelly-roll, with the vast majority of icosahedral plant-infecting ssRNA viruses. Conclusion We propose a plasmid-to-virus transition scenario, where a phytoplasmal plasmid acquired a capsid-coding gene from a plant RNA virus to give rise to the ancestor of geminiviruses.

  7. Introduction of a Streptococcus cremoris plasmid in Bacillus subtilis.

    OpenAIRE

    Vosman, B.; Venema, G

    1983-01-01

    Streptococcus cremoris Wg2 plasmid pWV01 was introduced in Bacillus subtilis by protoplast transformation. The yield of pWV01 isolated from B. subtilis was low. pWV01 contains a unique site for the restriction endonuclease MboI.

  8. CRYPTIC PLASMIDS ISOLATED FROM CAMPYLOBACTER STRAINS REPRESENT MULTIPLE, NOVEL INCOMPATIBILITY GROUPS

    Science.gov (United States)

    Three small, cryptic plasmids from the multi-drug-resistant (MDR) Campylobacter coli strain RM2228 and one small, cryptic plasmid from the MDR Campylobacter jejuni strain RM1170 were sequenced and characterized. pCC2228-1 has some similarity to Firmicutes RepL-family plasmids that replicate via a r...

  9. The distribution of plasmids that carry virulence and resistance genes in Staphylococcus aureus is lineage associated

    Directory of Open Access Journals (Sweden)

    McCarthy Alex J

    2012-06-01

    Full Text Available Abstract Background Staphylococcus aureus is major human and animal pathogen. Plasmids often carry resistance genes and virulence genes that can disseminate through S. aureus populations by horizontal gene transfer (HGT mechanisms. Sequences of S. aureus plasmids in the public domain and data from multi-strain microarrays were analysed to investigate (i the distribution of resistance genes and virulence genes on S. aureus plasmids, and (ii the distribution of plasmids between S. aureus lineages. Results A total of 21 plasmid rep gene families, of which 13 were novel to this study, were characterised using a previously proposed classification system. 243 sequenced plasmids were assigned to 39 plasmid groups that each possessed a unique combination of rep genes. We show some resistance genes (including ermC and cat and virulence genes (including entA, entG, entJ, entP were associated with specific plasmid groups suggesting there are genetic pressures preventing recombination of these genes into novel plasmid groups. Whole genome microarray analysis revealed that plasmid rep, resistance and virulence genes were associated with S. aureus lineages, suggesting restriction-modification (RM barriers to HGT of plasmids between strains exist. Conjugation transfer (tra complex genes were rare. Conclusion This study argues that genetic pressures are restraining the spread of resistance and virulence genes amongst S. aureus plasmids, and amongst S. aureus populations, delaying the emergence of fully virulent and resistant strains.

  10. Impact of Flavophospholipol and Vancomycin on Conjugational Transfer of Vancomycin Resistance Plasmids

    OpenAIRE

    Riedl, Sabine; Ohlsen, Knut; Werner, Guido; Witte, Wolfgang; Hacker, Jo?rg

    2000-01-01

    The influence of vancomycin and flavophospholipol (FPL) on the transfer rate of conjugative plasmids harboring the vancomycin resistance operon vanA was determined in several clinical and animal isolates of Enterococcus faecium. FPL significantly inhibited the frequency of transfer of conjugative VanA plasmids up to 70-fold. Vancomycin had no significant effect on the transfer rate of VanA plasmids.

  11. Generation and Molecular Characterization of New Temperature-Sensitive Plasmids Intended for Genetic Engineering of Pasteurellaceae

    Science.gov (United States)

    Temperature-sensitive (TS) plasmids were generated through chemical mutagenesis of a derivative of the streptomycin resistance parent plasmid pD70, isolated from Mannheimia hemolytica serotype 1. Three TS plasmids which failed to replicate at or above 42°C in M. hemolytica but which were fully func...

  12. Familial clustering of the Streptococcus mutans cryptic plasmid strain in a dental clinic population.

    OpenAIRE

    Caufield, P. W.; Wannemuehler, Y. M.; Hansen, J. B.

    1982-01-01

    Of Streptococcus mutans strains from 100 pedodontic patients, 13% contained the common cryptic plasmid. Family members of four plasmid-positive patients harbored plasmid-positive S. mutans at a significantly greater frequency compared with the pedodontic population, but there was not a one-to-one correlation of strains between mothers and children.

  13. Antibiotic resistance of vibrio cholerae: special considerations of R-plasmids.

    Science.gov (United States)

    Kuwahara, S

    1978-09-01

    Studies on the transmission of R plasmid by conjugation between enterobacteria and vibrio or related bacteria were reviewed. The majority of the reports confirmed successful transmission from enterobacteria to Vibrio cholerae and related species, although the transmission frequencies were extremely low and the transmitted R plasmid was very unstable except for thermosensitive kanamycin plasmid and usual R plasmid coexisting with P plasmid. Strains of V. cholerae and Aeromonas liquefaciens as well as A. salmonicida bearing R plasmid were detected in nature. R plasmid was relatively unstable in V. cholerae strains with which transmission of R plasmid to enterobacteria was confirmed. At present, only 3 R plasmids have been obtained from naturally occurring strains of V. cholerae. Although the 2 European plasmids belong to the C incompatibility group with 98 megadalton closed covalent circular DNA molecule, one plasmid belongs to the J group with more than 25 megadalton molecular weight, and no CCC of satelite DNA was detected in bacteria harboring this plasmid. PMID:581573

  14. Plasmid-determined silver resistance in Pseudomonas stutzeri isolated from a silver mine.

    OpenAIRE

    Haefeli, C; Franklin, C.; Hardy, K.

    1984-01-01

    A silver-resistant strain of Pseudomonas stutzeri was isolated from a silver mine. It harbored three plasmids, the largest of which (pKK1; molecular weight, 49.4 X 10(6)) specified silver resistance. Plasmid pKK1 was apparently nonconjugative but could be transferred to Pseudomonas putida by mobilization with plasmid R68.45.

  15. Usefulness of plasmid profiles for differentiation of Shigella isolates in Bangladesh.

    OpenAIRE

    Tacket, C. O.; Shahid, N.; Huq, M. I.; Alim, A. R.; Cohen, M. L.

    1984-01-01

    We studied the plasmid profiles of 136 Shigella isolates in Bangladesh to determine whether plasmid profiles could be used for differentiation of strains for epidemiological studies. Many different plasmid patterns were observed within each species, indicating that many genetically different strains of Shigella are responsible for illness in Bangladesh.

  16. DETERMINATION OF PLASMID DNA CONCENTRATION MAINTAINED BY NONCULTURABLE ESCHERICHIA COLI IN MARINE MICROCOSMS

    Science.gov (United States)

    The concentration of plasmid pBR322 DNA in nonculturable Escherichia coli JM83 was measured to determine whether the plasmid concentration changed during survival of E. coli in marine and estuarine water. . coli JM83 containing the plasmid pBR322 was placed in both sterile seawat...

  17. Applying Expectancy Theory to residency training: proposing opportunities to understand resident motivation and enhance residency training

    Directory of Open Access Journals (Sweden)

    Shweiki E

    2015-04-01

    Full Text Available Ehyal Shweiki,1 Niels D Martin,2 Alec C Beekley,1 Jay S Jenoff,1 George J Koenig,1 Kris R Kaulback,1 Gary A Lindenbaum,1 Pankaj H Patel,1 Matthew M Rosen,1 Michael S Weinstein,1 Muhammad H Zubair,2 Murray J Cohen1 1Department of Surgery, Thomas Jefferson University Hospital, Philadelphia, PA, USA; 2Department of Surgery, Perelman School of Medicine at the University of Pennsylvania, Philadelphia, PA, USA Abstract: Medical resident education in the United States has been a matter of national priority for decades, exemplified initially through the Liaison Committee for Graduate Medical Education and then superseded by the Accreditation Council for Graduate Medical Education. A recent Special Report in the New England Journal of Medicine, however, has described resident educational programs to date as prescriptive, noting an absence of innovation in education. Current aims of contemporary medical resident education are thus being directed at ensuring quality in learning as well as in patient care. Achievement and work-motivation theories attempt to explain people's choice, performance, and persistence in tasks. Expectancy Theory as one such theory was reviewed in detail, appearing particularly applicable to surgical residency training. Correlations between Expectancy Theory as a work-motivation theory and residency education were explored. Understanding achievement and work-motivation theories affords an opportunity to gain insight into resident motivation in training. The application of Expectancy Theory in particular provides an innovative perspective into residency education. Afforded are opportunities to promote the development of programmatic methods facilitating surgical resident motivation in education. Keywords: learning, education, achievement

  18. Mega-asperity model for the 2011 Tohoku-Oki earthquake, Japan

    Science.gov (United States)

    Kumagai, H.; Pulido Hernandez, N. E.; Fukuyama, E.; Aoi, S.

    2011-12-01

    We performed moment tensor inversion of the 2011 Mw 9.0 Tohoku-Oki earthquake using regional seismic waveforms, which indicates that the earthquake can be approximated by a point source. We used strong-motion seismograms from a nationwide broadband seismic network of the F-net installed and operated by the National Research Institute for Earth Science and Disaster Prevention (NIED). At each F-net station, a velocity-type strong-motion seismometer is installed at the end of a 30-50 m long vault to record strong motions up to +-2 m/s. We selected five F-net stations with the hypocentral distances more than several hundred kilometers. We used a waveform inversion method that assumes a double-couple focal mechanism for a point source [Nakano et al., 2008, GJI]. Our inversion using the strong-motion seismograms band-pass filtered between 0.006 and 0.02 Hz indicates that the best-fit source location was obtained at 38.25 N, 143.25 E at a depth of 30 km, at which the normalized residual was 0.13. The estimated mechanism and moment magnitude (Mw = 9.0) are consistent with those estimated from global broadband seismographic network data by the global CMT project and the National Earthquake Information Center (NEIC) of the U.S. Geological Survey. We fitted the omega-square model to amplitude spectra of observed vertical displacement seismograms, which resulted in the corner frequency of around 0.017 Hz. This implies average slip of roughly 70 m over a circular fault with radius of 70 km. These results suggest that a strongly localized asperity (mega asperity) was ruptured during the earthquake. For the northeastern Japan subduction zone, where the old Pacific Sea plate subducts along the Japan Trench, the seismic coupling was believed to be very small. The occurrence of the mega earthquake is apparently not compatible with weak seismic coupling. However, as suggested by Scholz and Small [1997, Geology], the subduction of a large seamount increases the normal stress across the subduction interface, which produces local seismic coupling in decoupled plates. If we consider a subducted seamount as the mega asperity at the source of the Tohoku-Oki earthquake, the occurrence of the mega earthquake in the decoupled plates is reasonably explained. Asano et al. [2011, EPS] indicated that all the CMT solutions of aftershocks above the source region of the Tohoku-Oki earthquake were characterized by normal faulting. A similar aftershock pattern was observed during the 1994 Java earthquake (Mw7.6). This earthquake occurred in a weakly coupled plate interface and its large slip area was coincident with a well identified seamount in this region. We can find a velocity anomaly near the source region of the Tohoku-Oki earthquake in the velocity model of Miura et al. [2005, Tectonophyics], which was obtained from a seismic line experiment off-Miyagi perpendicular to the trench. This velocity anomaly may be related with the subduction process of a seamount at this region. Further extensive refraction and reflection seismic surveys along the Japan Trench would contribute to verify our mega-asperity model and to evaluate seismic and tsunami hazards along the Japan Trench.

  19. Mega Virus

    Science.gov (United States)

    Amy R. Taylor

    2009-04-01

    The study of science at the extremes of size often involves creating and testing models of science phenomena. Scientists and engineers often build models at different sizes and scales. These models can be physical, such as a Styrofoam ball model of the so

  20. Expansion of a plasmid classification system for Gram-positive bacteria and determination of the diversity of plasmids in Staphylococcus aureus strains of human, animal, and food origins.

    DEFF Research Database (Denmark)

    Lozano, C.; Garcia-Migura, L.

    2012-01-01

    An expansion of a previously described plasmid classification was performed and used to reveal the plasmid content of a collection of 92 Staphylococcus aureus strains of different origins. rep genes of other genera were detected in Staphylococcus. S1 pulsed-field gel electrophoresis (PFGE) hybridizations were performed with 18 representative S. aureus strains, and a high number of plasmids of different sizes and organizations were detected. Copyright © 2012, American Society for Microbiology. All Rights Reserved.

  1. Currents, Water Budget and Turn-Over Time Within A Man-Made Coastal Mega-Structure: Palm Jumeirah, Southern Arabian Gulf, United Arab Emirates

    Science.gov (United States)

    Cavalcante, G.; Kjerfve, B.

    2009-05-01

    Large-scale land reclamation projects along the coastline of Dubai, United Arab Emirates (UAE), are set to expand from 45 km of natural shoreline to more than 1,500 km by 2010. The increasing scale of coastal development in Dubai has large-scale effects on water movement throughout the project area. Palm Jumeirah is the oldest, most well-developed of several man-made coastal mega-constructions in Dubai. This construction project started 6 years ago, has an overall surface area of 7.9 km2 and a footprint of 23 km2, and is connected to the coast via a 5-km long spine from the mainland to the crescent tip. We made time series observations of hydrographic properties and currents within the Palm Jumeirah Lagoon (PJL) during 29 days in April/May 2008 to examine the current flows, water budget, salt transport, and turn-over time. The currents and water flow within the PJL were quite variable, with stronger currents, greater material transports, lower water temperatures, and slightly lower salinities in areas close to the entrances where flushing is ample. Due to the shallow water depths, we found only weak vertical stratification during a tidal cycle. The lagoon system is comprised of 18 blind channels surrounded by a semi-circular open channel, which in turn is linked to the coastal waters by 4 gaps (one each on the East and West sides and two at the base of the development) in the rocky breakwater that surrounds the development. We found substantial differences in water discharge between the east and west gaps, with high discharge on average exiting the east gap and extremely low water discharge exiting the west gap. Our results indicate that the PJL is flushed unequally between the east and west sides with residence times of 1.2 and 42 days for the east and west sides of the development, respectively. Previous studies of water residence time using the DELFT3D hydrodynamics simulation modeling software did not capture this difference accurately, estimating residence times for the two sides of PJL to be 14 and 28 days, respectively. Stratification remains absent during the spring-neap tidal cycle with well mixed conditions throughout the lagoon system. PJL tides are mixed mainly semidiurnal, with the spring and neap tidal ranges measuring 116 and 56 cm, respectively, with no measureable change in either amplitude or phase within the man-made lagoon.

  2. Complementation of Conjugation Functions of Streptomyces lividans Plasmid pIJ101 by the Related Streptomyces Plasmid pSB24.2

    OpenAIRE

    Pettis, Gregg S.; Prakash, Shubha

    1999-01-01

    A database search revealed extensive sequence similarity between Streptomyces lividans plasmid pIJ101 and Streptomyces plasmid pSB24.2, which is a deletion derivative of Streptomyces cyanogenus plasmid pSB24.1. The high degree of relatedness between the two plasmids allowed the construction of a genetic map of pSB24.2, consisting of putative transfer and replication loci. Two pSB24.2 loci, namely, the cis-acting locus for transfer (clt) and the transfer-associated korB gene, were shown to be ...

  3. Influence of Different Functional Elements of Plasmid pGT232 on Maintenance of Recombinant Plasmids in Lactobacillus reuteri Populations In Vitro and In Vivo

    OpenAIRE

    Heng, Nicholas C. K.; Bateup, Judith M.; Loach, Diane M.; Wu, Xiyang; Jenkinson, Howard F; Morrison, Mark; Tannock, Gerald W

    1999-01-01

    Plasmid pGT232 (5.1 kb), an indigenous plasmid of Lactobacillus reuteri 100-23, was determined, on the basis of nucleotide and deduced protein sequence data, to belong to the pC194-pUB110 family of plasmids that replicate via the rolling-circle mechanism. The minimal replicon of pGT232 was located on a 1.7-kb sequence consisting of a double-strand origin of replication and a gene encoding the replication initiation protein, repA. An erythromycin-selectable recombinant plasmid containing this ...

  4. Coupling between the Basic Replicon and the Kis-Kid Maintenance System of Plasmid R1: Modulation by Kis Antitoxin Levels and Involvement in Control of Plasmid Replication

    Directory of Open Access Journals (Sweden)

    Juan López-Villarejo

    2015-02-01

    Full Text Available kis-kid, the auxiliary maintenance system of plasmid R1 and copB, the auxiliary copy number control gene of this plasmid, contribute to increase plasmid replication efficiency in cells with lower than average copy number. It is thought that Kis antitoxin levels decrease in these cells and that this acts as the switch that activates the Kid toxin; activated Kid toxin reduces copB-mRNA levels and this increases RepA levels that increases plasmid copy number. In support of this model we now report that: (i the Kis antitoxin levels do decrease in cells containing a mini-R1 plasmid carrying a repA mutation that reduces plasmid copy number; (ii kid-dependent replication rescue is abolished in cells in which the Kis antitoxin levels or the CopB levels are increased. Unexpectedly we found that this coordination significantly increases both the copy number of the repA mutant and of the wt mini-R1 plasmid. This indicates that the coordination between plasmid replication functions and kis-kid system contributes significantly to control plasmid R1 replication.

  5. Isolation and Characterization of a Rolling-Circle-Type Plasmid from Rhodococcus erythropolis and Application of the Plasmid to Multiple-Recombinant-Protein Expression

    OpenAIRE

    Nakashima, Nobutaka; Tamura, Tomohiro

    2004-01-01

    We isolated, sequenced, and characterized the cryptic plasmid pRE8424 from Rhodococcus erythropolis DSM8424. Plasmid pRE8424 is a 5,987-bp circular plasmid; it carries six open reading frames and also contains cis-acting elements, specifically a single-stranded origin and a double-stranded origin, which are characteristic of rolling-circle-replication plasmids. Experiments with pRE8424 derivatives carrying a mutated single-stranded origin sequence showed that single-stranded DNA intermediates...

  6. Superstructure of the centromeric complex of TubZRC plasmid partitioning systems

    OpenAIRE

    Aylett, Christopher H. S.; Lo?we, Jan

    2012-01-01

    Bacterial plasmid partitioning systems segregate plasmids into each daughter cell. In the well-understood ParMRC plasmid partitioning system, adapter protein ParR binds to centromere parC, forming a helix around which the DNA is externally wrapped. This complex stabilizes the growth of a filament of actin-like ParM protein, which pushes the plasmids to the poles. The TubZRC plasmid partitioning system consists of two proteins, tubulin-like TubZ and TubR, and a DNA centromere, tubC, which perf...

  7. Long- term manure exposure increases soil bacterial community potential for plasmid uptake

    DEFF Research Database (Denmark)

    Musovic, Sanin; Klümper, Uli

    2014-01-01

    Microbial communities derived from soils subject to different agronomic treatments were challenged with three broad host range plasmids, RP4, pIPO2tet and pRO101, via solid surface filter matings to assess their permissiveness. Approximately 1 in 10 000 soil bacterial cells could receive and maintain the plasmids. The community permissiveness increased up to 100% in communities derived from manured soil. While the plasmid transfer frequency was significantly influenced by both the type of plasmid and the agronomic treatment, the diversity of the transconjugal pools was purely plasmid dependent and was dominated by ?- and ?-Proteobacteria.

  8. Long-term manure exposure increases soil bacterial community potential for plasmid uptake

    DEFF Research Database (Denmark)

    Musovic, Sanin; Klümper, Uli

    2014-01-01

    Microbial communities derived from soils subject to different agronomic treatments were challenged with three broad host range plasmids, RP4, pIPO2tet and pRO101, via solid surface filter matings to assess their permissiveness. Approximately 1 in 10000 soil bacterial cells could receive and maintain the plasmids. The community permissiveness increased up to 100% in communities derived from manured soil. While the plasmid transfer frequency was significantly influenced by both the type of plasmid and the agronomic treatment, the diversity of the transconjugal pools was purely plasmid dependent and was dominated by ?- and ?-Proteobacteria. © 2013 Society for Applied Microbiology and John Wiley & Sons Ltd.

  9. Incompatibility of plasmids containing the replication origin of the Escherichia coli chromosome.

    OpenAIRE

    Yamaguchi, K; Yamaguchi, M.; Tomizawa, J

    1982-01-01

    Plasmids containing the replication origin of the Escherichia coli chromosome (oriC plasmids) are unstable in certain recA strains of E. coli. However, they can be maintained more stably in other recA strains. This stable maintenance has allowed us to study the incompatibility properties of oriC plasmids. We have found that two oriC plasmids are incompatible: they cannot be stably coinherited in individual dividing cells. An oriC plasmid is excluded from growing bacteria at a much faster rate...

  10. Tumor induction by Agrobacterium rhizogenes involves the transfer of plasmid DNA to the plant genome

    OpenAIRE

    White, Frank F.; Ghidossi, Gina; Gordon, Milton P.; Nester, Eugene W.

    1982-01-01

    The DNA from tumors of Nicotiana glauca initiated by strains of Agrobacterium rhizogenes was shown to contain sequences that are homologous to the root-inducing (Ri) plasmid of the bacterium. Two independently established tumor lines contained a similar portion of the Ri-plasmid. The Ri-plasmid also hybridized to DNA fragments from uninfected N. glauca. A cosmid clone of the Ri-plasmid encompassing the region containing the Ri-plasmid sequences that are stably transferred to the plant also hy...

  11. The Emotional Intelligence of Resident Physicians

    OpenAIRE

    Mckinley, Sophia Kim

    2014-01-01

    Since academic literature indicates that emotional intelligence (EI) is tied to work performance, there is increasing interest in understanding physician EI. We studied the EI of resident physicians in surgery, pediatric, and pathology residency programs at three academic centers to describe the EI profiles of residents in different specialties and determine whether gender differences in resident physician EI profiles mirror those in the general population. 325 residents were electronically...

  12. Conducting a Successful Residency Research Project

    OpenAIRE

    Barletta, Jeffrey F.

    2008-01-01

    The residency research project can be a challenging endeavor for pharmacy residents since they typically have limited experience in this area. Furthermore, as the number of accredited residency programs has increased, so has the demand for preceptors with research experience. This review is intended to assist the resident and preceptor by providing steps and guidance with conducting a successful residency research project. Items such as idea generation, proposing the right type of project, de...

  13. The Aftershock Analyses of 27 February 2010 Chile M=8.8 Mega Earthquake

    Science.gov (United States)

    Lee, C.-S.; Klingelhoefer, F.; Gutscher, M.; Miller, M.; Gallardo, V.

    2012-04-01

    In 1960, the biggest earthquake (M=9.5), the human ever recorded event, occurred in south Chile. Subsequently several mega earthquake (M >8) occurred, including the M=8.8 earthquake in 2010. This reflects that an incomplete release of tectonic energy exists in the Chile subduction system. The west coast of Chile is a long convergence plate boundary between the Nazca and the South American plate. The Nazca Plate subducts beneath the South American Plate toward the northeast with a convergence rate of about 6.5 cm/year, accumulating the stress in the lower part of the subducted plate to some extent resulting in destructive ruptures. On 27 February 2010, the Maule mega earthquake (M=8.8) occurred offshore central Chile. The epicenter (35.9° S, 72.73° W) is located at 115 km, NE of Concepción, the second biggest city in Chile. The main shock was a thrust-type subduction earthquake where the Nazca Plate subducted into the South America Plate (the Chile subduction system). The focal depth of main shock is 35 km which caused more than 500-km long rupture in the accretionary prism and produced a destructive tsunami of more than 20 m. It killed several hundreds of people and damaged countless buildings. Even up to today, aftershocks and volcanic activities continue to occur in this region. During May-August of last year, we shipped 20 OBSs to Chile and conducted two aftershock surveys in the tsunami-affected area. The OBSs recorded more than 4,000 aftershock events, magnitude from M=6.0 to 1.0. Results show that the aftershock data were concentrated into two masses: the landward side of the paleo-accretionary prism and the seaward side of the subducting plate, leaving a "white zone" in the frontal accretionary prisms. Both data sets consistently indicate the same result. The angle between the paleo-accretionary prism and the subduction plate seems to be greater than that of the frontal-accretionary prism. We suggest that the greater of the splay fault angle the higher the risk for the occurrence of a destructive tsunami. Even though our study covered only a short period of aftershocks it appears to show shows important basic characteristics of the 2010 Maule mega event.

  14. Mega-prizes in medicine: big cash awards may stimulate useful and rapid therapeutic innovation.

    Science.gov (United States)

    Charlton, Bruce G

    2007-01-01

    Following Horrobin's suggestion of 1986, I argue that offering very large prizes (tens of millions of US dollars, or more) for solving specific therapeutic problems, would be an excellent strategy for promoting the rapid development of effective new treatments. The two mainstream ways of paying for medical research are funding the process with grants or funding the outcome via patent protection. When grants are used to fund the process of research the result tends to be 'pure' science, guided by intrinsic scientific objectives. Practical results, such as useful therapeutic advances, are a by-product. Patent-seeking research, by contrast, is more focused on technology than science. It seeks practical results; and aims to pay for itself (and make a profit) in the long term by generating a patentable product or procedure. Prize-seeking research is subject to different incentives and applicable to different situations than either process-funded or patent-seeking research. Prize seeking researchers have a strong incentive to solve the specified problem as rapidly as possible, but the problem may be solved using old ideas that are scientifically mundane or unpatentable technologies and methods. Prizes therefore seem to generate solutions which are incremental extensions, new applications or novel combinations of already-existing technologies. The main use of mega-prizes in medicine would be to accelerate therapeutic progress in stagnant fields of research and to address urgent problems. For example, medical charities focused on specific diseases should consider accumulating their resources until they can offer a mega-prize for solving a clinical problem of special concern to their patients. Prize money should be big enough to pay for the research and development, the evaluation of the new treatment in a clinical trial, and with a large profit left-over to compensate for the intrinsic risk of competing. Sufficiently large amounts of money, and the prestige and publicity derived from winning a mega-prize, could rapidly mobilize research efforts to discover a whole range of scientifically un-glamorous but clinically-useful therapeutic breakthroughs. PMID:17052861

  15. Presence and analysis of plasmids in human and animal associated Arcobacter species

    DEFF Research Database (Denmark)

    Douidah, Laid; De Zutter, Lieven

    2014-01-01

    In this study, we report the screening of four Arcobacter species for the presence of small and large plasmids. Plasmids were present in 9.9% of the 273 examined strains. One Arcobacter cryaerophilus and four Arcobacter butzleri plasmids were selected for further sequencing. The size of three small plasmids isolated from A. butzleri and the one from A. cryaerophilus strains ranged between 4.8 and 5.1 kb, and the size of the large plasmid, isolated from A. butzleri, was 27.4 kbp. The G+C content of all plasmids ranged between 25.4% and 26.2%. A total of 95% of the large plasmid sequence represents coding information, which contrasts to the 20 to 30% for the small plasmids. Some of the open reading frames showed a high homology to putative conserved domains found in other related organisms, such as replication, mobilization and genes involved in type IV secretion system. The large plasmid carried 35 coding sequences, including seven genes in a contiguous region of 11.6 kbp that encodes an orthologous type IV secretion system found in the Wolinella succinogenes genome, Helicobacter pylori and Campylobacter jejuni plasmids, which makes this plasmid interesting for further exploration.

  16. Comparative analysis of staphylococcal plasmids carrying three streptogramin-resistance genes: vat-vgb-vga.

    Science.gov (United States)

    Allignet, J; El Solh, N

    1999-09-01

    Several staphylococcal plasmids (26-45 kb) carry all three streptogramin-resistance (Sg(R)) genes, vat, vgb, and vga. Seven such plasmids harbored by independent strains belonging to three taxa (Staphylococcus aureus, S. simulans, and S. cohnii subsp. urealyticum) were compared and the deleted derivative of one of them, pIP680 (11.3 kb), carrying the three streptogramin-resistance genes was sequenced. The seven native plasmids had in common a 12.1-kb part cocarrying the three Sg(R) genes. Sequence analysis of pIP680 revealed that the simultaneous presence of these three genes has probably resulted from cointegration of two plasmids: (i) a pAMbeta1-like plasmid harboring vat-vgb and whose replication gene has been inactivated by an IS257 insertion and (ii) a functional vga plasmid whose replication is similar to that of two staphylococcal plasmids, pSX267 and pSK41. PMID:10489330

  17. Differences in the stability of the plasmids of Yersinia pestis cultures in vitro: impact on virulence

    Directory of Open Access Journals (Sweden)

    TC Leal-Balbino

    2004-11-01

    Full Text Available Plasmid and chromosomal genes encode determinants of virulence for Yersinia pestis, the causative agent of plague. However, in vitro, Y. pestis genome is very plastic and several changes have been described. To evaluate the alterations in the plasmid content of the cultures in vitro and the impact of the alterations to their pathogenicity, three Y. pestis isolates were submitted to serial subculture, analysis of the plasmid content, and testing for the presence of characteristic genes in each plasmid of colonies selected after subculture. Different results were obtained with each strain. The plasmid content of one of them was shown to be stable; no apparent alteration was produced through 32 subcultures. In the other two strains, several alterations were observed. LD50 in mice of the parental strains and the derived cultures with different plasmid content were compared. No changes in the virulence plasmid content could be specifically correlated with changes in the LD50.

  18. Differences in the stability of the plasmids of Yersinia pestis cultures in vitro: impact on virulence

    Scientific Electronic Library Online (English)

    TC, Leal-Balbino; NC, Leal; CV, Lopes; AMP de, Almeida.

    2004-11-01

    Full Text Available Plasmid and chromosomal genes encode determinants of virulence for Yersinia pestis, the causative agent of plague. However, in vitro, Y. pestis genome is very plastic and several changes have been described. To evaluate the alterations in the plasmid content of the cultures in vitro and the impact o [...] f the alterations to their pathogenicity, three Y. pestis isolates were submitted to serial subculture, analysis of the plasmid content, and testing for the presence of characteristic genes in each plasmid of colonies selected after subculture. Different results were obtained with each strain. The plasmid content of one of them was shown to be stable; no apparent alteration was produced through 32 subcultures. In the other two strains, several alterations were observed. LD50 in mice of the parental strains and the derived cultures with different plasmid content were compared. No changes in the virulence plasmid content could be specifically correlated with changes in the LD50.

  19. A simple procedure for isolation of cloning vectors and endogenous plasmids from viridans group streptococci and Staphylococcus aureus.

    OpenAIRE

    Vriesema, A J; Zaat, S A; Dankert, J.

    1996-01-01

    Isolation of plasmid DNA from viridans group streptococci is difficult, and preparations are often heavily contaminated with chromosomal DNA. We developed a simple protocol to isolate pure plasmid DNA for use in different molecular techniques, including automated sequencing. The protocol is also applicable for plasmid isolation from Staphylococcus aureus. In addition, the protocol allows isolation of pure endogenous plasmids from streptococci and S. aureus.

  20. Characterization of a linear DNA plasmid from the filamentous fungal plant pathogen Glomerella musae [Anamorph: Colletotrichum musae (Berk. and Curt.) arx.

    Science.gov (United States)

    Freeman, S.; Redman, R.S.; Grantham, G.; Rodriguez, R.J.

    1997-01-01

    A 7.4-kilobase (kb) DNA plasmid was isolated from Glomerella musae isolate 927 and designated pGML1. Exonuclease treatments indicated that pGML1 was a linear plasmid with blocked 5' termini. Cell-fractionation experiments combined with sequence-specific PCR amplification revealed that pGML1 resided in mitochondria. The pGML1 plasmid hybridized to cesium chloride-fractionated nuclear DNA but not to A + T-rich mitochondrial DNA. An internal 7.0-kb section of pGML1 was cloned and did not hybridize with either nuclear or mitochondrial DNA from G. musae. Sequence analysis revealed identical terminal inverted repeats (TIR) of 520 bp at the ends of the cloned 7.0-kb section of pGML1. The occurrence of pGML1 did not correspond with the pathogenicity of G. musae on banana fruit. Four additional isolates of G. musae possessed extrachromosomal DNA fragments similar in size and sequence to pGML1.

  1. Leading by Metaphors –A Case Study of a Mega IT Project in a Danish Bank

    DEFF Research Database (Denmark)

    Svejvig, Per; Fladkjær Nielsen, Anne-Dorte

    2014-01-01

    Contrary to the existing literature and studies of large-scale IT projects, empirical data from a mega IT project in mid-sized Danish Bank, Jyske Bank, demonstrates a successful implementation of a highly complex IT platform transition. Linguistic representations and especially extensive use of metaphors by executive management to form and shape the megaproject appeared to have significant impact on guidance of individual and collective action, and thereby presumably one of the important factors for the successful implementation. To learn from this case study, we investigate the use of metaphors in the megaproject and discuss how leading by metaphors are enacted. Our findings are that (1) storytelling with metaphors can act as backbone for communication, (2) metaphors can set direction for technical capabilities, and finally (3) metaphors can be used to emphasize emotional intelligence.

  2. Lessons from the Twin Mega-Crises: The Financial Meltdown and the BP Oil Spill

    Directory of Open Access Journals (Sweden)

    Hershey H. Friedman

    2014-09-01

    Full Text Available This paper explores the synchronicity of two mega-crises we are now facing: The BP oil spill and the repercussions of the 2008 financial meltdown. It examines some key common threads in both of these crises. The overarching message is that firms must maintain a culture of social responsibility, must behave in an ethical manner, and must do everything possible to avoid societal harm. The three key lessons to be learned from the twin crises are to consider and mange risk in decision making; minimize conflicts of interest in the hope that executives will then not engage in actions that involve excessive risk to stakeholders; and that government regulation can be beneficial, rather than harmful to business and society – as long as it does not stifle innovation and growth.

  3. Mega debris flow deposits on the western Wilkes Land margin, East Antarctica

    Science.gov (United States)

    Donda, F.; O'Brien, P.E.; De Santis, L.; Rebesco, M.; Brancolini, Giuliano

    2007-01-01

    Multichannel seismic data collected off Western Wilkes Land (East Antarctica) reveal the occurrence of mega debris flow deposits on the lower slope and rise that were formed throughout the Miocene. Commonly, debris flow units are separated by thin deposits of well-stratified facies, interpreted as predominantly glaciomarine mixed contouritic and distal turbidite deposits. These units could act as weak layers and could have played a major role in the slope instability. High sedimentation rates, due to large amounts of sediment delivered from a temperate, wet-based ice sheet, constituted a key factor in the sediment failures. The main trigger mechanism would probably have been earthquakes enhanced by isostatic rebound following major ice sheet retreats.

  4. Overview of the ARGOS X-ray framing camera for Laser MegaJoule

    International Nuclear Information System (INIS)

    Commissariat à l’Énergie Atomique et aux Énergies Alternatives has developed the ARGOS X-ray framing camera to perform two-dimensional, high-timing resolution imaging of an imploding target on the French high-power laser facility Laser MegaJoule. The main features of this camera are: a microchannel plate gated X-ray detector, a spring-loaded CCD camera that maintains proximity focus in any orientation, and electronics packages that provide remotely-selectable high-voltages to modify the exposure-time of the camera. These components are integrated into an “air-box” that protects them from the harsh environmental conditions. A miniaturized X-ray generator is also part of the device for in situ self-testing purposes

  5. Vulnerability of optical detection systems to mega-joule class laser radiative environment

    International Nuclear Information System (INIS)

    The Laser MegaJoule (LMJ) facility will host inertial confinement fusion experiments in order to achieve ignition by imploding a Deuterium-Tritium filled micro balloon. In this context an X-ray imaging system is necessary to diagnose the core size and the shape of the target in the 10-100 keV band. Such a diagnostic will be composed of two parts: an X-ray optical system and a detection assembly. The survivability of each element of this diagnostic has to be ensured within the mixed pulse consisting of X-rays, gamma rays and 14 MeV neutrons created by fusion reactions. The design of this diagnostic will take into account optics and detectors vulnerability to neutron yield of at least 1016. In this work, we will present the main results of our vulnerability studies and of our hardening-by-system and hardening-by-design studies. (authors)

  6. La Organización Mundial de Comercio, los acuerdos mega-regionales y los usos estratégicos del regionalismo

    Directory of Open Access Journals (Sweden)

    Roberto Bouzas

    2014-01-01

    Full Text Available La parálisis de la Ronda Doha, el desarrollo de grandes negociaciones “mega-regionales” y la proliferación de acuerdos preferenciales han avivado los debates sobre la gobernanza del comercio internacional. Mientras que una interpretación benévola sobre estos acuerdos parece estar ganando lugar, en este artículo sostenemos que los atributos del “regionalismo del siglo XXI” son menos novedosos que lo que se insinúa; y que existe una notable continuidad en los incentivos y las características del “nuevo regionalismo” de los noventa y el llamado “regionalismo del siglo XXI”. Afirmamos que aun cuando los componentes discriminatorios de estos regionalismos hayan sido atenuados por el contenido y naturaleza de la agenda regulatoria, el conflicto básico entre las dos modalidades de gobernanza del régimen de comercio internacional sigue vigente.

  7. Overview of the ARGOS X-ray framing camera for Laser MegaJoule

    Energy Technology Data Exchange (ETDEWEB)

    Trosseille, C., E-mail: clement.trosseille@cea.fr; Aubert, D.; Auger, L.; Bazzoli, S.; Brunel, P.; Burillo, M.; Chollet, C.; Jasmin, S.; Maruenda, P.; Moreau, I.; Oudot, G.; Raimbourg, J.; Soullié, G.; Stemmler, P.; Zuber, C. [CEA, DAM, DIF, F-91297 Arpajon (France); Beck, T. [CEA, DEN, CADARACHE, F-13108 St Paul lez Durance (France); Gazave, J. [CEA, DAM, CESTA, F-33116 Le Barp (France)

    2014-11-15

    Commissariat à l’Énergie Atomique et aux Énergies Alternatives has developed the ARGOS X-ray framing camera to perform two-dimensional, high-timing resolution imaging of an imploding target on the French high-power laser facility Laser MegaJoule. The main features of this camera are: a microchannel plate gated X-ray detector, a spring-loaded CCD camera that maintains proximity focus in any orientation, and electronics packages that provide remotely-selectable high-voltages to modify the exposure-time of the camera. These components are integrated into an “air-box” that protects them from the harsh environmental conditions. A miniaturized X-ray generator is also part of the device for in situ self-testing purposes.

  8. Direct-drive shock-ignition for the Laser MegaJoule

    International Nuclear Information System (INIS)

    We present a review of direct-drive shock ignition studies done as an alternative for the Laser MegaJoule (LMJ). One and two dimensional systematic analyses of HiPER-like shock-ignited target designs are performed for the fuel assembly irradiation uniformity using the whole LMJ configuration or a part of the facility, and for the uniformity of the ignitor spike. High-gain shock-ignition is shown to be possible with intensity of each quad less than 1015 W/cm2 but low modes asymmetries displace the power required in the ignitor spike towards higher powers. Shock-ignition of Direct-Drive Double-Shell non-cryogenic targets is also addressed. (authors)

  9. Mountain Megas: America's Newest Metropolitan Places and a Federal Partnership to Help Them Prosper

    Science.gov (United States)

    In the years after the Civil War, the population of the intermountain West began to boom as people moved across the Mississippi River for new opportunities as homesteaders, prospectors, and enterprising dry goods merchants. 130 years later or so, it appears that this region of the United States is experiencing yet another renaissance. This report from the Brookings Institution's "Blueprint for American Prosperity" series takes a close look at the growth this region has experienced in recent years. Written by Robert E. Lang, Andrea Sarzynski, and Mark Muro, the report is divided into six chapters, including "Megapolitan Development in the Intermountain West" and "Forging a New Federal-Mega Agenda for the Intermountain West". Visitors can also avail themselves of a brief executive summary if they are in a hurry, and they may also wish to pay particular attention to the report's conclusions as well.

  10. “Creative obstructions” and more : On cross sectorial mega-event collaboration outcomes

    DEFF Research Database (Denmark)

    Ren, Carina Bregnholm; Petersen, Morten Krogh

    Abstract: ATLAS, Special track 6: Reinventing the local in tourism landscapes “Creative obstructions” and more? On cross sectorial mega-event collaboration outcomesCarina Ren (ren@ccg.aau.dk) & Morten Krogh Petersen (mkp@learning.aau.dk), Aalborg UniversityIn May of 2014, Copenhagen was the host of the yearly Eurovision Song Contest (ESC). In this paper, we discuss how the public-private co-creation set-up of this mega-event can be seen as a network project simultaneously enacting global state competitiveness and local place and identity. According to Cerny (1997), the dynamics of political globalization have altered the roles of the state so that it “is no longer able to act as a decommodifying hierarchy (i.e., taking economic activities out of the market). It must act more and more as a collective commodifying agent – (i.e., putting activities into the market) – and even as a market actor itself (p. 267, italics in the original). Short of cases (in a Danish context at least), which document the varied effects of state competitiveness through the blurring of public and private boundaries, we decided to engage with ESC 2014 to explore its set-up, described by the partners as a containing a number of creative obstructions in order to create “much more than a song contest”. Through fieldwork and collaboration with the public and private ESC partners, we describe how the mega-event linked corporate, municipal, regional and national activities and interests in new ways. Also, the event was to engage the public as co-creators of the week-long event itself but also, importantly, of much longer-lasting and broader outcomes. This was achieved through a number of outreach schemes within tourism, education, industrial development and sustainability in sub-events, collaborating with an unconventional array of actors such as NGOs, schools and a private real estate company hosting the venue. One outcome of this collaboration was the same-sex ‘Wonderful Weddings’ events offered by the municipality in collaboration with Wonderful Copenhagen to celebrate and accommodate for a large Eurovision gay segment. We discuss how in spite of close collaboration, common values such as tolerance and sustainability heralded by all stakeholders became not only a creative but rather an actual obstruction.Through the case of ESC 2014, we point to a number of outcomes of what Cerny and others have described as a development towards the marketization of the state and the state as a ‘marketizer’. We argue that at least in relation to events, the forces of a competition state are not singularly homogenizing, but also lead to increased heterogeneity (Kaspersen & Thorsager 2010). This point may also be transferred to the field of city branding, and challenges the idea that globalization and associated increased competition between cities unequivocally leads to uniformity (see Ooi 2014).ReferenceCerny, P. G. (1997), Paradoxes of the Competition State: The Dynamics of Political Globalization. Government and Opposition, 32: 251–274. doi: 10.1111/j.1477-7053.1997.tb00161.x. Kaspersen, L. B & L. Thorsager (2010): Responding to Globalisation: Changing the State Strategy from Infrastructural Power to Authoritarian Liberal Power. In: M. Böss (ed.) The Nation-State in Transformation: Economic Globalisation, Institutional Mediation and Political Values. Aarhus: Aarhus University Press, p.247-267 Ooi, C. S. (2014) The Making of the Copy-cat City: Accreditation Tactics in Place Branding. In P. O. Berg & E. Björner (eds.) Branding Chinese Mega-Cities: Policies, Practices and Positioning. Cheltenham: Edward Elgar Publishing, Incorporated, p. 232–248

  11. Narrow linewidth picosecond UV pulsed laser with mega-watt peak power.

    Science.gov (United States)

    Huang, Chunning; Deibele, Craig; Liu, Yun

    2013-04-01

    We demonstrate a master oscillator power amplifier (MOPA) burst mode laser system that generates 66 ps/402.5 MHz pulses with mega-watt peak power at 355 nm. The seed laser consists of a single frequency fiber laser (linewidth control of the EOM. The multi-stage Nd:YAG amplifier system allows a uniformly temporal shaping of the macropulse with a tunable pulse duration. The light output from the amplifier is converted to 355 nm, and over 1 MW peak power is obtained when the laser is operating in a 5-?s/10-Hz macropulse mode. The laser output has a transform-limited spectrum with a very narrow linewidth of individual longitudinal modes. The immediate application of the laser system is the laser-assisted hydrogen ion beam stripping for the Spallation Neutron Source (SNS). PMID:23572001

  12. The first light of Mini-MegaTORTORA wide-field monitoring system

    CERN Document Server

    Biryukov, A; Karpov, S; Bondar, S; Ivanov, E; Katkova, E; Perkov, A; Sasyuk, V

    2014-01-01

    Here we describe the first light of the novel 9-channel wide-field optical monitoring system with sub-second temporal resolution, Mini-MegaTORTORA, which is being tested now at Special Astrophysical Observatory on Russian Caucasus. The system is able to observe the sky simultaneously in either wide (~900 square degrees) or narrow (~100 square degrees) fields of view, either in clear light or with any combination of color (Johnson B, V or R) polarimetric filters installed, with exposure times ranging from 100 ms to 100 s. The primary goal of the system is the detection of rapid -- with sub-second characteristic time-scales -- optical transients, but it may be also used for studying the variability of the sky objects on longer time scales.

  13. Impact of environmental contamination on laser induced damage of silica optics in Laser MegaJoule

    International Nuclear Information System (INIS)

    Laser induced damage impact of molecular contamination on fused polished silica samples in a context of high power laser fusion facility, such as Laser MegaJoule (LMJ) has been studied. One of the possible causes of laser induced degradation of optical component is the adsorption of molecular or particular contamination on optical surfaces. In the peculiar case of LMJ, laser irradiation conditions are a fluence of 10 J/cm2, a wavelength of 351 nm, a pulse duration of 3 ns for a single shot/days frequency. Critical compounds have been identified thanks to environmental measurements, analysis of material outgassing, and identification of surface contamination in the critical environments. Experiments of controlled contamination involving these compounds have been conducted in order to understand and model mechanisms of laser damage. Various hypotheses are proposed to explain the damage mechanism. (author)

  14. Mega Borg oil spill of the Texas coast: An open-water bioremediation test

    International Nuclear Information System (INIS)

    Nature has developed hydrocarbons as a part of life. Since the origin of life, more than 60,000 organic molecules have evolved that make up protoplasm; a given percentage of these molecules are hydrocarbons. Commercial hydrocarbon deposits are a by-product of this natural process and a continual source of oil in the aquatic environment through seeps. As a result, nature has also evolved a recycling system for the hydrocarbons. This cycle is the basis for a program of bioremediation using microorganisms. Effort has been made to develop mixed cultures capable of a wide range of hydrocarbon metabolism and co-metabolism. The cultures are economically produced in high concentrations as a dry powder with a shelf life of one year. The result is an economical process for the application of bacteria to hydrocarbon pollutants on water and soils. The process of bioremediation to the recent Mega Borg accident will be discussed

  15. ADAPTION OF “MEGA EVENT IMPACT SCALE”: VALIDITY AND RELIABILITY STUDY (2011 ERZURUM 25. WINTER UNIVERSIADE

    Directory of Open Access Journals (Sweden)

    Kerem Y?ld?r?m ?im?ek

    2012-05-01

    Full Text Available This study aims at carrying out validity and reliability studies and the adaption of Turkish version of the scale titled “Mega Event Impact Scale” and developed by Jie ve Yan (2010. The scale, which consists of five-point Likert scale 42 items, was administered to the local audience following 2011 Erzurum 25. Winter Universiade. The subjects of the study were 412 people (55 % male and 45 % female, who were chosen through random sampling method. Explanatory factor analysis, applied to determine construct validity of the scale, revealed a construct with 36 items and 8 factors. The internalconsistency reliability coefficient for the whole study was found 0.917. The findings showed that internal consistency reliability of factor items had an item / total correlation coefficient ranging between 0.50 and 0.85. The results were discussed in terms of the validity and reliability of the Turkish version of the scale.

  16. Finding ultracool brown dwarfs with MegaCam on CFHT: method and first results

    Science.gov (United States)

    Delorme, P.; Willott, C. J.; Forveille, T.; Delfosse, X.; Reylé, C.; Bertin, E.; Albert, L.; Artigau, E.; Robin, A. C.; Allard, F.; Doyon, R.; Hill, G. J.

    2008-06-01

    Aims: We present the first results of a wide field survey for cool brown dwarfs with the MegaCam camera on the CFHT telescope, the Canada-France Brown Dwarf Survey, hereafter CFBDS. Our objectives are to find ultracool brown dwarfs and to constrain the field-brown dwarf mass function thanks to a larger sample of L and T dwarfs. Methods: We identify candidates in CFHT/MegaCam i' and z' images using optimised psf-fitting within Source Extractor, and follow them up with pointed near-infrared imaging on several telescopes. Results: We have so far analysed over 350 square degrees and found 770 brown dwarf candidates brighter than z'_AB=22.5. We currently have J-band photometry for 220 of these candidates, which confirms 37% as potential L or T dwarfs. Some are among the reddest and farthest brown dwarfs currently known, including an independent identification of the recently published ULAS J003402.77-005206.7 and the discovery of a second brown dwarf later than T8, CFBDS J005910.83-011401.3. Infrared spectra of three T dwarf candidates confirm their nature, and validate the selection process. Conclusions: The completed survey will discover ~100 T dwarfs and ~500 L dwarfs or M dwarfs later than M8, approximately doubling the number of currently known brown dwarfs. The resulting sample will have a very well-defined selection function, and will therefore produce a very clean luminosity function. Based on observations obtained with MegaPrime/MegaCam, a joint project of CFHT and CEA/DAPNIA, at the Canada-France-Hawaii Telescope (CFHT) which is operated by the National Research Council (NRC) of Canada, the Institut National des Sciences de l'Univers of the Centre National de la Recherche Scientifique (CNRS) of France, and the University of Hawaii. This work is based in part on data products produced at TERAPIX and the Canadian Astronomy Data Centre as part of the Canada-France-Hawaii Telescope Legacy Survey, a collaborative project of NRC and CNRS. Based on observations made with the ESO New Technology Telescope at the La Silla Observatory under programme ID 76.C-0540(A), 77.C-0594, 77.A-0707, 78.A-0651, 78.C-0629 and 79.A-0663. Based on observations obtained at the Gemini Observatory, which is operated by the Association of Universities for Research in Astronomy, Inc., under a cooperative agreement with the NSF on behalf of the Gemini partnership: the National Science Foundation (United States), the Science and Technology Facilities Council (United Kingdom), the National Research Council (Canada), CONICYT (Chile), the Australian Research Council (Australia), CNPq (Brazil) and CONICET (Argentina). Based on observations with the Kitt Peak National Observatory, National Optical Astronomy Observatory, which is operated by the Association of Universities for Research in Astronomy, Inc. (AURA) under cooperative agreement with the National Science Foundation. Based on observations made with the Nordic Optical Telescope, operated on the island of La Palma jointly by Denmark, Finland, Iceland, Norway, and Sweden, in the Spanish Observatorio del Roque de los Muchachos of the Instituto de Astrofisica de Canarias. This paper includes data taken at The McDonald Observatory of The University of Texas at Austin.

  17. Mega-city and great earthquake distributions: the search of basic links.

    Science.gov (United States)

    Levin, Boris; Sasorova, Elena; Domanski, Andrej

    2013-04-01

    The ever-increasing population density in large metropolitan cities near major active faults (e.g. Tokyo, Lisbon, San-Francisco, et al.) and recent catastrophic earthquakes in Japan, Indonesia and Haiti (loss of life more 500000), highlight the need for searching of causal relationships between distributions of earthquake epicenters and mega-cities at the Earth [1]. The latitudinal distribution of mega-cities calculated with using Internet data base, discovers a curious peculiarity: the density of large city numbers, related to 10-degree latitude interval, demonstrates two maximums in middle latitudes (±30-40°) on both sides of the equator. These maximums are separated by clean local minimum near equator, and such objects (mega-cities) are practically absent in the high latitudes. In the last two decades, it was shown [2, 3, 4] that a seismic activity of the Earth is described by the similar bimodal latitudinal distribution. The similarity between bimodal distributions for geophysical phenomena and mega-city locations attracts common attention. The peak values in the both distributions (near ±35°) correspond to location of well-known "critical latitudes" at the planet. These latitudes were determined [5], as the lines of intersection of a sphere and a spheroid of equal volume (±35°15'52?). Increasing of the angular velocity of a celestial body rotation leads to growth of oblateness of planet, and vice versa, the oblateness is decreasing with reducing of velocity of rotation. So, well-known effect of the Earth rotation instability leads to small pulsations of the geoid. In the critical latitudes, the geoid radius-vector is equal to the radius of sphere. The zones of near critical latitudes are characterized by high density of faults in the Earth crust and manifestation of some geological peculiarities (hot spot distribution, large ore deposit distribution, et al.). The active faults existence has led to an emanation of depth fluids, which created the good conditions for agriculture. Areas of ancient civilizations (Babylonia, Mesopotamia, Greece) always are concentrated near zones of high seismic activity. Catastrophic earthquakes occurred with interval about 200-500 years, and memory of population was limited usually by duration of 2-3 generations, i.e. by interval 50-80 years. The proposed hypothesis of exposed latitudinal zones at the Earth as pulsating geoid may present nowadays basic interest. References. 1.Ben-Zion Y. Earthquake physics and seismic hazard. 8-th Alexander von Humboldt International Conference. EGU Series. Natural Disasters, Global Change, and the Preservation of World Heritage Sites. Cusco. Peru. 2012. P.14. 2.Sun W. Seismic energy distribution in latitude and a possible tidal stress explanation // Physics of the Earth and Planetary Interiors. 1992. Vol. 71. P. 205-216. 3.Levin B.W., Sasorova E.V. Latitudinal distribution of earthquakes in the Andes and its peculiarity. Advances in Geosciences. 2009. 22. 139-145. www.adv.geosci.net/22/139/2009/ 4.Levin B.W., Sasorova E.V. Seismicity of the Pacific region: global feature detection. - M.: Janus-K. 2012. 308 p. 5.Veronnet, Alex. Rotation de l'ellipsoide hétérogène et figure exacte de la Terre. Journal de mathématiques pures et appliquées. 1912. 6e série, tome 8, p. 331-463.

  18. The BG measurement system for hazardous substances (BGMG) and the exposure database of hazardous substances (MEGA).

    Science.gov (United States)

    Gabriel, Stefan

    2006-01-01

    German employers' liability insurance associations or Berufsgenossenschaften (BGs)--institutions for statutory accident insurance--maintain a measurement system for hazardous substances, the so-called BGMG. The aim of the BGMG is to determine and document valid results of measurements of exposure primarily for prevention purposes. The data are collected systematically, in parallel to the sampling in a company. Parameters which are supposed to have a visible effect on exposure levels are documented. The MEGA database (documentation of measurement data relating to workplace exposure to hazardous substances) holds 1,629 million measurement values, which have been compiled in since 1972. The database offers a host of selection possibilities for assessments depending on the evaluation strategy. PMID:16554004

  19. Teaching Medical Ethics during Residency.

    Science.gov (United States)

    Perkins, Henry S.

    1989-01-01

    Three reasons for teaching medical ethics during residency are presented. Key ethical concepts to be addressed include moral aspects of medical practice, obtaining informed consent, dealing with incompetent patients and those who refuse treatment, knowing when to withhold or disclose clinical information, and using medical resources properly. (MSE)

  20. Cleaner in Hall of Residence

    Science.gov (United States)

    Hotel and Catering Industry Training Board, Wembley (England).

    This syllabus is intended for the use of training personnel in drawing up training programs for cleaners in halls of residence. Its main objective is to produce fully trained cleaners, thereby maintaining and raising standards. The syllabus is divided into three sections: Introduction to Housekeeping Employees, and Tasks Performed by the Majority…

  1. Characterizing Mega-Earthquake Related Tsunami on Subduction Zones without Large Historical Events

    Science.gov (United States)

    Williams, C. R.; Lee, R.; Astill, S.; Farahani, R.; Wilson, P. S.; Mohammed, F.

    2014-12-01

    Due to recent large tsunami events (e.g., Chile 2010 and Japan 2011), the insurance industry is very aware of the importance of managing its exposure to tsunami risk. There are currently few tools available to help establish policies for managing and pricing tsunami risk globally. As a starting point and to help address this issue, Risk Management Solutions Inc. (RMS) is developing a global suite of tsunami inundation footprints. This dataset will include both representations of historical events as well as a series of M9 scenarios on subductions zones that have not historical generated mega earthquakes. The latter set is included to address concerns about the completeness of the historical record for mega earthquakes. This concern stems from the fact that the Tohoku Japan earthquake was considerably larger than had been observed in the historical record. Characterizing the source and rupture pattern for the subduction zones without historical events is a poorly constrained process. In many case, the subduction zones can be segmented based on changes in the characteristics of the subducting slab or major ridge systems. For this project, the unit sources from the NOAA propagation database are utilized to leverage the basin wide modeling included in this dataset. The length of the rupture is characterized based on subduction zone segmentation and the slip per unit source can be determined based on the event magnitude (i.e., M9) and moment balancing. As these events have not occurred historically, there is little to constrain the slip distribution. Sensitivity tests on the potential rupture pattern have been undertaken comparing uniform slip to higher shallow slip and tapered slip models. Subduction zones examined include the Makran Trench, the Lesser Antilles and the Hikurangi Trench. The ultimate goal is to create a series of tsunami footprints to help insurers understand their exposures at risk to tsunami inundation around the world.

  2. Road traffic administration and management in the third world mega-city: Lagos, Nigeria

    Directory of Open Access Journals (Sweden)

    R.A. Asiyanbola

    2012-09-01

    Full Text Available Observation from the literature shows that a city can only be as big as its transportation facilities can enable its people goes about their businesses, move and distribute their goods and services. In spite of these positive aspects of urban transportation system on one side of the coin, the other side of the coin reflects its negative impact that relate to traffic management and administration and road safety. The daily movement of people and freights within and outside the mega-city of LAGOS is becoming more difficult and complex. This is reflected in the increasing bumper-to-bumper traffic being experienced in the mega-city of Lagos during 6.30 am – 11.30am morning peak hours and (3.00pm – 7.30 pm evening peak hours. It now seems that traffic congestions are becoming forcefully acceptable excuses for workers being late to work in Lagos metropolis. One approach at solving this problem adopted by the Lagos State Government is traffic management through the establishment of the Lagos State Traffic Management Authority (LASTMA. Traffic management could be regarded as a systematic and sustained effort on directing and controlling all traffics on our roads to make them free from negative effects of the transport system. The aim of this research work was to assess the impact of the Lagos State Traffic Management Authority (LASTMA with particular reference on the efforts to reduce road traffic problems. Both secondary and primary data sources that were collected in 2008 were used in the study. Policy implications of the findings are discussed in the paper.

  3. Late Neogene Submarine Mega-slides on the SW Barents Sea Margin

    Science.gov (United States)

    Hjelstuen, B.; Eldholm, O.; Faleide, J.

    2005-12-01

    The Late Neogene history of the NE Atlantic continental margin is characterized by numerous mass movement features reflecting a variety of scales and processes. Such slide processes have also been reported on the margin off the western Barents Sea, where the Bjornoyrenna Slide is a major feature. We have now further studied the Late Neogene sequences in this area by analyzing high quality multi-channel seismic lines on the continental slope and in the adjacent Lofoten Basin, allowing resolution of these features at depth. The seismic data reveal the existence of three pre-Holocene mega-slides, Slides I-III, of which we have calculated the extent, timing and the volume of sediment involved in the mass movements. We document that major sliding may occurred as a far back as 1.5 Ma, and that the largest slide, Slide II (0.5-1.0 Ma), affected an area of 120 000 km2 and involved about 25 000 km3 of sediments. The dimensions of even the smallest slide, Slide I, is comparable with the Holocene Storegga Slide, considered the world's largest exposed submarine slide, affecting an area of about 95 000 km2. In terms of sediment volume, the two largest mega-slide events are as much as a magnitude larger than the Storegga Slide. Since about 2.6 Ma, the Northern Hemisphere Glaciations have left a thick cover of dense deposits over a softer substratum, inducing potential instability. The initial slide activity appears coeval with a glacial intensification at about 1.6 Ma, when ice sheets advanced to the shelf edge. We interpret that the repetitive advance of ice sheets to their maximum position caused an increased sediment supply onto the continental margin creating instable conditions, contributing to the release of these huge slide events.

  4. Mega-phylogeny approach for comparative biology: an alternative to supertree and supermatrix approaches

    Directory of Open Access Journals (Sweden)

    Beaulieu Jeremy M

    2009-02-01

    Full Text Available Abstract Background Biology has increasingly recognized the necessity to build and utilize larger phylogenies to address broad evolutionary questions. Large phylogenies have facilitated the discovery of differential rates of molecular evolution between trees and herbs. They have helped us understand the diversification patterns of mammals as well as the patterns of seed evolution. In addition to these broad evolutionary questions there is increasing awareness of the importance of large phylogenies for addressing conservation issues such as biodiversity hotspots and response to global change. Two major classes of methods have been employed to accomplish the large tree-building task: supertrees and supermatrices. Although these methods are continually being developed, they have yet to be made fully accessible to comparative biologists making extremely large trees rare. Results Here we describe and demonstrate a modified supermatrix method termed mega-phylogeny that uses databased sequences as well as taxonomic hierarchies to make extremely large trees with denser matrices than supermatrices. The two major challenges facing large-scale supermatrix phylogenetics are assembling large data matrices from databases and reconstructing trees from those datasets. The mega-phylogeny approach addresses the former as the latter is accomplished by employing recently developed methods that have greatly reduced the run time of large phylogeny construction. We present an algorithm that requires relatively little human intervention. The implemented algorithm is demonstrated with a dataset and phylogeny for Asterales (within Campanulidae containing 4954 species and 12,033 sites and an rbcL matrix for green plants (Viridiplantae with 13,533 species and 1,401 sites. Conclusion By examining much larger phylogenies, patterns emerge that were otherwise unseen. The phylogeny of Viridiplantae successfully reconstructs major relationships of vascular plants that previously required many more genes. These demonstrations underscore the importance of using large phylogenies to uncover important evolutionary patterns and we present a fast and simple method for constructing these phylogenies.

  5. The application of water soluble, mega-Stokes-shifted BODIPY fluorophores to cell and tissue imaging.

    Science.gov (United States)

    Moriarty, R D; Martin, A; Adamson, K; O'Reilly, E; Mollard, P; Forster, R J; Keyes, T E

    2014-03-01

    BODIPY (4,4-difluoro-4-bora-3a,4a-diaza-s-indacene) fluorophores are widely used in bioimaging to label proteins, lipids and nucleotides, but in spite of their attractive optical properties they tend to be prone to self-quenching because of their notably small Stokes shift. Herein, we compare two BODIPY compounds from a recently developed family of naphthyridine substituted BODIPY derivatives, one a visible emitting derivative (BODIPY-VIS) and one a near-infrared emitting fluorophore with a Stokes shift of approximately 165 nm as contrast reagents for live mammalian cells and murine brain tissue. The compounds were rendered water soluble by their conjugation to polyethylene glycol (PEG). Both PEGylated compounds exhibited good cell uptake compared with their parent compounds and confocal fluorescence microscopy revealed all dyes explored to be nuclear excluding, localizing predominantly within the lipophilic organelles; the endoplasmic reticulum and mitochondria. Cytotoxicity studies revealed that these BODIPY derivatives are modestly cytotoxic at concentrations exceeding 10 ?M where they induce apoptosis and necrosis. Although the quantum yield of emission of the visible emitting fluorophore was over an order of magnitude greater than the Mega-Stokes shifted probe, the latter showed considerably reduced tendency to self quench and less interference from autofluorescence. The near-infrared probe also showed good penetrability and staining in live tissue samples. In the latter case similar tendency to exclude the nucleus and to localize in the mitochondria and endoplasmic reticulum was observed as in live cells. This to our knowledge is the first demonstration of such a Mega-Stokes BODIPY probe applied to cell and tissue imaging. PMID:24467513

  6. Air-quality measurements in mega-cities: Focus on gaseous organic and particulate pollutants and comparison between two contrasted cities, Paris and Beijing

    International Nuclear Information System (INIS)

    The rapid and important development of large urban areas ('mega-cities'), especially in developing countries, causes and will cause serious air-quality problems. Pollutant measurements in these cities help to characterize the chemical nature and the quantity of these pollutants and to constrain air-quality models. This paper focuses on measurements of volatile organic compounds and aerosols that have an important impact on air quality. We present a brief review on existing measurements and experimental strategies in mega-cities and then we show results from recent measurement campaigns that took place in two contrasted mega-cities: Paris and Beijing. (authors)

  7. Transformation of Clostridium perfringens L forms with shuttle plasmid DNA.

    OpenAIRE

    Mahony, D. E.; Mader, J. A.; Dubel, J. R.

    1988-01-01

    L-form (L-phase) cultures of Clostridium perfringens were tested for their transformability with plasmid DNA. Three L-form strains were transformable, but one, strain L-13, was superior to the others. This strain was easily and reproducibly transformed with previously described shuttle vectors which were derived from either C. perfringens or Escherichia coli. Strain L-13 was transformable by a variety of methods, and a new micromethod worked well under both aerobic and anaerobic conditions. T...

  8. Autonomous plasmid-like replication of a conjugative transposon

    OpenAIRE

    Lee, Catherine A.; Babic, Ana; Grossman, Alan. D.

    2009-01-01

    Integrative and conjugative elements (ICEs), a.k.a. conjugative transposons, are mobile genetic elements involved in many biological processes, including pathogenesis, symbiosis and the spread of antibiotic resistance. Unlike conjugative plasmids that are extra-chromosomal and replicate autonomously, ICEs are integrated in the chromosome and replicate passively during chromosomal replication. It is generally thought that ICEs do not replicate autonomously. We found that when induced, Bacillus...

  9. Plasmid-associated phenathrene degradation by Chesapeake Bay sediment bacteria.

    OpenAIRE

    Okpokwasili, G.; Somerville, C.; Grimes, D.; Colwell, R.

    1984-01-01

    A differential, phenanthrene-enrichment agar plating technique was used to isolate phenanthrene-degrading bacteria from phenanthrene-enriched Chesapeake Bay sediment. One of the isolates, a yellow pigmented, slime-producing, Gram-negative rod identified as Flavobacterium sp. has been studied in detail. It has been found to carry a single plasmid with a mass of about 34 megadaltons. Results of hydrocarbon adherence tests showed that the organism adhered only minimally to n-octane and n-hexadec...

  10. Plasmid-encoded lysine decarboxylation in Proteus morganii.

    OpenAIRE

    Cornelis, G.; Bouchaute, M.; Wauters, G.

    1981-01-01

    As a rule, Proteus morganii does not decarboxylate lysine. However, lysine-positive P. morganii strains have been recently described. We suspected a plasmid origin for this atypical character, and we analyzed 14 strains to study this question. Among these strains, 8 yielded lysine-negative segregants after acridine orange or ethidium bromide treatment, and 10 transferred their lysine-positive character to a recipient P. morganii strain. All of the 14 strains analyzed at least segregated or co...

  11. Construction and Characterization of a Highly Efficient Francisella Shuttle Plasmid

    OpenAIRE

    Maier, Tamara M.; Havig, Andrea; Casey, Monika; Nano, Francis E.; Frank, Dara W.; Zahrt, Thomas C

    2004-01-01

    Francisella tularensis is a facultative intracellular pathogen that infects a wide variety of mammals and causes tularemia in humans. It is recognized as a potential agent of bioterrorism due to its low infectious dose and multiple routes of transmission. To date, genetic manipulation in Francisella spp. has been limited due to the inefficiency of DNA transformation, the relative lack of useful selective markers, and the lack of stably replicating plasmids. Therefore, the goal of this study w...

  12. Virulence Plasmids of Nonsporulating Gram-Positive Pathogens

    OpenAIRE

    Tyne, Daria; Gilmore, Michael S.

    2014-01-01

    Gram-positive bacteria are leading causes of many types of human infection, including pneumonia, skin and nasopharyngeal infections, as well as urinary tract and surgical wound infections among hospitalized patients. These infections have become particularly problematic because many of the species causing them have become highly resistant to antibiotics. The role of mobile genetic elements, such as plasmids, in the dissemination of antibiotic resistance among Gram-positive bacteria has been w...

  13. Mercury and organomercurial resistance determined by plasmids in Staphylococcus aureus

    Energy Technology Data Exchange (ETDEWEB)

    Weiss, A.A.; Murphy, S.D.; Silver, S.D.

    1977-01-01

    Four independently isolated plasmids of S. aureus contain genes conferring resistance to ionic mercury (Hg/sup 2 +/) and the organomercurials phenylmercury acetate (PMA), p-hydroxymeribenzoate (pHMB), and florescein mercuric acetate (FMA), but not merbromin, thiomerosal, methyl- or ethyl-mercury to which broad-range plasmids from other species confer resistance. The mechanism of resistance to PMA involves enzymatic hydrolysis (hydrolase) to benzene plus Hg/sup 2 +/ which is reduced (reductase) to Hg/sup 0/ and lost from the system by volatilization. The organomercurials, FMA, and pHMB are not degraded and resistance involves some other mechanism. Resistance to mercury and all organomercurials is inducible. The range of inducers includes mercury, PMA, and several organomercurials including merbromin which is not a substrate. Mercury-sensitive mutants have been isolated from plasmids pII147 and pI258 and they fall into three classes: (i) strains devoid of both hydrolase and reductase activities; (ii) strains with normal hydrolase activity, and no reductase; and (iii) strains with normal hydrolase activity and low and variable levels of reductase. The mutants were sensitive to all organomercurials as well as mercury.

  14. Peaceful coexistence amongst Borrelia plasmids: getting by with a little help from their friends?

    Science.gov (United States)

    Chaconas, George; Norris, Steven J

    2013-09-01

    Borrelia species comprise a unique genus of bacterial pathogens. These organisms contain a segmented genome with up to two dozen plasmids ranging in size from 5 kb up to about 200 kb. The plasmids have also been referred to as mini-chromosomes or essential genetic elements, as some of them carry information important for infection of vertebrates or for survival in the tick vector. Most of the plasmids are linear with covalently closed hairpin telomeres and these linear plasmids are in a constant state of genetic rearrangement. The mechanisms of plasmid replication, maintenance and partitioning remain largely obscure and are complicated by a long doubling time, the requirement for expensive media and inefficient genetic manipulation. A set of five parologous protein families (PFs) are believed to confer the ability for autonomous replication and plasmid maintenance. The number of plasmids also complicates analyses because of the possibility that PFs from one plasmid may sometimes function in trans on other plasmids. Two papers in the last year have moved the field forward and their combined data suggest that trans complementation amongst Borrelia plasmids may sometimes occur. PMID:23727020

  15. Investigation of diversity of plasmids carrying the blaTEM-52 gene

    DEFF Research Database (Denmark)

    Bielak, Eliza Maria; Bergenholtz, Rikke D

    2011-01-01

    Objectives: To investigate the diversity of plasmids that carry blaTEM-52 genes among Escherichia coli and Salmonella enterica originating from animals, meat products and humans. Methods: A collection of 22 blaTEM-52-encoding plasmids was characterized by restriction fragment length polymorphism (RFLP), replicon typing (by PCR or replicon sequencing), susceptibility testing, assessment of plasmid ability to self-transfer by conjugation and typing of the genetic environment of the blaTEM-52 gene. Detected IncI1 plasmids underwent further plasmid multilocus sequence typing. Results: RFLP profiles demonstrated dissemination of blaTEM-52 in Denmark (imported meat from Germany), France, Belgium and the Netherlands from 2000 to 2006 by mainly two different plasmids, one encoding blaTEM-52b (IncX1A, 45 kb) and the other blaTEM-52c (IncI1, 80 kb). In addition, blaTEM-52b was also found to be located on various other plasmids belonging to IncA/C and IncL/M, while blaTEM-52c was found on IncN-like as well as on IncR plasmids. In the majority of cases (n¼21) the blaTEM-52 gene was located on a Tn3 transposon. Seven out of 10 blaTEM-52 plasmids tested in conjugation experiments were shown to be capable of self-transfer to a plasmid-free E. coli recipient. Conclusions: The blaTEM-52 gene found in humans could have been transmitted on transferable plasmids originating from animal sources. Some of the blaTEM-52 plasmids carry replicons that differ from the classical ones. Two novel replicons were detected, IncX1A and IncN-like. Unlike its predecessor blaTEM-1, the blaTEM-52 gene was not detected on F-type replicons suggesting that this gene evolved on other types of plasmid scaffolds.

  16. Investigation of diversity of plasmids carrying the blaTEM-52 gene

    DEFF Research Database (Denmark)

    Bielak, Eliza Maria; Bergenholtz, Rikke D.

    2011-01-01

    OBJECTIVES: To investigate the diversity of plasmids that carry blaTEM-52 genes among Escherichia coli and Salmonella enterica originating from animals, meat products and humans. METHODS: A collection of 22 blaTEM-52-encoding plasmids was characterized by restriction fragment length polymorphism (RFLP), replicon typing (by PCR or replicon sequencing), susceptibility testing, assessment of plasmid ability to self-transfer by conjugation and typing of the genetic environment of the blaTEM-52 gene. Detected IncI1 plasmids underwent further plasmid multilocus sequence typing. RESULTS: RFLP profiles demonstrated dissemination of blaTEM-52 in Denmark (imported meat from Germany), France, Belgium and the Netherlands from 2000 to 2006 by mainly two different plasmids, one encoding blaTEM-52b (IncX1A, 45 kb) and the other blaTEM-52c (IncI1, 80 kb). In addition, blaTEM-52b was also found to be located on various other plasmids belonging to IncA/C and IncL/M, while blaTEM-52c was found on IncN-like as well as on IncR plasmids. In the majority of cases (n = 21) the blaTEM-52 gene was located on a Tn3 transposon. Seven out of 10 blaTEM-52 plasmids tested in conjugation experiments were shown to be capable of self-transfer to a plasmid-free E. coli recipient. CONCLUSIONS: The blaTEM-52 gene found in humans could have been transmitted on transferable plasmids originating from animal sources. Some of the blaTEM-52 plasmids carry replicons that differ from the classical ones. Two novel replicons were detected, IncX1A and IncN-like. Unlike its predecessor blaTEM-1, the blaTEM-52 gene was not detected on F-type replicons suggesting that this gene evolved on other types of plasmid scaffolds.

  17. Residents' experiences of abuse, discrimination and sexual harassment during residency training. McMaster University Residency Training Programs.

    OpenAIRE

    Cook, D J; Liutkus, J F; Risdon, C L; Griffith, L E; Guyatt, G H; Walter, S.D.

    1996-01-01

    OBJECTIVE: To assess the prevalence of psychological abuse, physical assault, and discrimination on the basis of gender and sexual orientation, and to examine the prevalence and impact of sexual harassment in residency training programs. DESIGN: Self-administered questionnaire. SETTING: McMaster University, Hamilton, Ont. PARTICIPANTS: Residents in seven residency training programs during the academic year from July 1993 to June 1994. Of 225 residents 186 (82.7%) returned a completed question...

  18. Beyond the Mega Events: “Useful” Policies for Urban Mobility Dopo il Grande Evento: politiche “utili” per la mobilità

    Directory of Open Access Journals (Sweden)

    Andrea Ceudech

    2008-08-01

    Full Text Available The paper analyses, through different examples, the limits of the urban mobility policies implemented for mega events, highlighting the tendency to privilege the infrastructure realization, more than policies on services, whose real usefulness is often put in doubt from the practice and whose maintenance often become a new cost for the community. On the base of a short review of the mobility policies mainly implemented in the preparation and management of the mega events, the paper highlights, from a critical point of view, the strengths and weaknesses of some experiences with reference to the real usefulness of urban mobility for the community beyond the mega event. The outcomes and the so-called “legacy” of the mega events for the cities are very different. Mega sport events, like the Olympic Games, have often involved only the realization of works for the event while events like the International Expositions have determined the acquisition of areas on which setting up the structures for the event. Only in few cases the works realized for the events have been inserted in a wider requalification or regeneration than programme involving the whole city and have been used as tools to achieve a stable improvement of the urban quality, above all regarding mobility. On the base of such considerations some aspects and key-points of urban mobility policies are highlighted in order to achieve real advantages to the community once the mega event is finished.Il contributo indaga i limiti delle politiche urbane e in particolare di quelle sulla mobilità attuate per i Grandi Eventi, evidenziando in molti casi la tendenza a privilegiare la realizzazione di infrastrutture, più che politiche sui servizi, la cui reale utilità è spesso messa in dubbio dalla pratica e i cui costi manutentivi divengono spesso nuovi carichi per la collettività. Sulla base di una breve rassegna delle politiche sulla mobilità maggiormente implementate nella preparazione e gestione dei Grandi Eventi, il contributo evidenzia in maniera critica punti di forza e punti di debolezza delle esperienze analizzate in riferimento sia alla gestione del grande evento, sia in riferimento alla loro reale utilità per la collettività dopo che il grande evento è terminato. Nell’ultima parte del contributo si evidenziano i principali requisiti che le politiche sulla mobilità devono possedere affinché apportino reali vantaggi alla città anche una volta che il Grande Evento è terminato.

  19. Short-lived tectonic switch mechanism for long-term pulses of volcanic activity after mega-thrust earthquakes

    Directory of Open Access Journals (Sweden)

    M. Lupi

    2013-06-01

    Full Text Available Eruptive rates in volcanic arcs increase significantly after mega-thrust earthquakes in subduction zones. Over short to intermediate time periods the link between mega-thrust earthquakes and arc response can be attributed to dynamic triggering processes or static stress changes, but a fundamental mechanism that controls long-term pulses of volcanic activity after mega-thrust earthquakes has not been proposed yet. Using geomechanical, geological, and geophysical arguments, we propose that increased eruption rates over longer timescales are due to the relaxation of the compressional regime that accompanies mega-thrust subduction zone earthquakes. More specifically, the reduction of the horizontal stress ?h promotes the occurrence of short-lived strike-slip kinematics rather than reverse faulting in the volcanic arc. The relaxation of the pre-earthquake compressional regime facilitates magma mobilization by providing a short-circuit pathway to shallow depths by significantly increasing the hydraulic properties of the system. The timescale for the onset of strike-slip faulting depends on the degree of shear stress accumulated in the arc during inter-seismic periods, which in turn is connected to the degree of strain-partitioning at convergent margins. We performed Coulomb stress transfer analysis to determine the order of magnitude of the stress perturbations in present-day volcanic arcs in response to five actual mega-thrust earthquakes; the 2005 M8.6, 2007 M8.5, and 2007 M7.9 Sumatra earthquakes; the 2010 M8.8 Maule, Chile earthquake; and the 2011 M9.0 Tohoku, Japan earthquake. We find that all, but one, the shallow earthquakes that occurred in the arcs of Sumatra, Chile and Japan show a marked lateral component. Our hypothesis suggests that the long-term response of volcanic arcs to subduction zone mega-thrust earthquakes will be manifested as predominantly strike-slip seismic events, and that these future earthquakes will be followed closely by seismic swarms, inflation, and other indications of a rising magma source.

  20. Short-lived tectonic switch mechanism for long-term pulses of volcanic activity after mega-thrust earthquakes

    Science.gov (United States)

    Lupi, M.; Miller, S. A.

    2014-01-01

    Eruptive rates in volcanic arcs increase significantly after subduction mega-thrust earthquakes. Over short to intermediate time periods the link between mega-thrust earthquakes and arc response can be attributed to dynamic triggering processes or static stress changes, but a fundamental mechanism that controls long-term pulses of volcanic activity after mega-thrust earthquakes has not been proposed yet. Using geomechanical, geological, and geophysical arguments, we propose that increased eruption rates over longer timescales are due to the relaxation of the compressional regime that accompanies mega-thrust subduction zone earthquakes. More specifically, the reduction of the horizontal stress ?h promotes the occurrence of short-lived strike-slip kinematics rather than reverse faulting in the volcanic arc. The relaxation of the pre-earthquake compressional regime facilitates magma mobilisation by providing a short-circuit pathway to shallow depths by significantly increasing the hydraulic properties of the system. The timescale for the onset of strike-slip faulting depends on the degree of shear stress accumulated in the arc during inter-seismic periods, which in turn is connected to the degree of strain-partitioning at convergent margins. We performed Coulomb stress transfer analysis to determine the order of magnitude of the stress perturbations in present-day volcanic arcs in response to five recent mega-thrust earthquakes; the 2005 M8.6, 2007 M8.5, and 2007 M7.9 Sumatra earthquakes; the 2010 M8.8 Maule, Chile earthquake; and the 2011 M9.0 Tohoku, Japan earthquake. We find that all but one the shallow earthquakes that occurred in the arcs of Sumatra, Chile and Japan show a marked lateral component. We suggests that the long-term response of volcanic arcs to subduction zone mega-thrust earthquakes will be manifested as predominantly strike-slip seismic events, and that these future earthquakes may be followed closely by indications of rising magma to shallower depths, e.g. surface inflation and seismic swarms.

  1. 42 CFR 483.20 - Resident assessment.

    Science.gov (United States)

    2010-10-01

    ...SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES...Disease diagnoses and health conditions. (xi...Activity pursuit. (xiv) Medications. (xv) Special treatments...resident's physical or mental condition. (For purposes...area of the resident's health status, and...

  2. 24 CFR 964.140 - Resident training.

    Science.gov (United States)

    2010-04-01

    ...to Housing and Urban Development (Continued) OFFICE...OF HOUSING AND URBAN DEVELOPMENT TENANT PARTICIPATION... HUD encourages a partnership between the residents...2) Organizational development training for Resident...3) Public housing policies, programs,...

  3. Does Global seismic energy release increase? An analysis based on the Lithospheric Seismic Energy Flow Model (LSEFM). The case of mega - earthquakes (M > 9)

    CERN Document Server

    Thanassoulas, C; Verveniotis, G; Zymaris, N

    2012-01-01

    In this work the data of the earthquake catalog of the NOAA, National Geophysical Data Center (NGDC) are processed in terms of global seismic energy release. The determined Global Cumulative Seismic Energy Release (GCSER) graph as a function of time, is analyzed in the magnitude domain (discrete energy windows). Characteristic components of the analyzed graph are: its accelerated deformation character observed for energy windows lower than the background seismicity (M = 7.0 - 7.5), its lock state that started on 1923 and long seismic quiescence periods that preceded recent mega - earthquakes. The background GCSER value oscillates during the last century with a period of 60 years and with increasing amplitude. The recent (1952 - 2012) 5 mega - earthquakes are closely related to the amplitude increase of the GCSER oscillation. Hence, it is suggested that more mega - earthquakes are probable due to occur in the future. A global mechanism is postulated for the generation of the mega - earthquakes based on the pri...

  4. Isolation and preliminary characterization of a plasmid mutant derepressed for conjugal transfer in Staphylococcus aureus.

    Science.gov (United States)

    Asch, D K; Goering, R V; Ruff, E A

    1984-11-01

    The plasmid pCRG1600 is a 52.9-kb self-transmissible plasmid coding for resistance to aminoglycoside and beta-lactam antibiotics in Staphylococcus aureus. When transferred by transduction, plasmid deletion mutants affecting one or more antibiotic-resistance genes were readily obtained. Of these, one derivative (pCRG1690) was found to exhibit a conjugal transfer frequency ca. 100-fold higher than that of the wild-type plasmid. A preliminary physical-genetic map of pCRG1600 located tra in a 14.6-kb region within the 16.9-kb XbaI-A fragment. An 8.5-kb deletion to the left of tra in pCRG1690 was specifically associated with the increased conjugal transferability of the plasmid. Thus, pCRG1690 appears similar to plasmids derepressed for conjugal transfer (drd) in gram-negative bacterial species. PMID:6528001

  5. Detection of Conjugative Plasmid Encoded Ampicillin and Tetracycline Resistant in Klebsiella pneumonia

    Directory of Open Access Journals (Sweden)

    Dogan Ozdemir

    2013-03-01

    Full Text Available Klebsiella pneumonia were isolated and identified on the basis of morphology, growth, and biochemical characteristics. All the isolates offered different resistance patterns against antibiotics including Ampicillin, Cefotaxime, Erythromycin, tetracycline and Chloramphenicol. Transformation and conjugation techniques were used for plasmid transfer studies. The conjugation experiment showed that ? 51kbp conjugative plasmid conferring resistance to tetracycline and ampicillins were successfully transferred to the recipient cells E. coli MM294. The rest of the plasmid borne markers was non-conjugative/nontransferable. Conjugative plasmids carry a tremendous potential to disseminate resistance markers to distant recipient cells. The protocol is reliable enough to be used for large-scale visualization of native plasmids and we have used it to visualize and isolate DNA from hundreds of multidrug resistance plasmids.

  6. Characterization of atypical Aeromonas salmonicida isolates by ribotyping and plasmid profiling

    DEFF Research Database (Denmark)

    Pedersen, Karl; Dalsgaard, Inger

    1996-01-01

    A total of 38 strains of atypical Aeromonas salmonicida, three oxidase-negative but otherwise typical Aer. salmonicida, three typical Aer. salmonicida, and two reference strains, isolated from several countries and fish species were examined with respect to rRNA gene restriction patterns (ribotypes) and plasmid profiles. Most epidemiologically unrelated strains had different ribotypes, whereas isolates from the same outbreak were identical. All strains, except one, carried one or more large plasmids (>55 kbp) and all strains, except two, additionally carried one or more smaller plasmids. Many strains isolated from the same outbreak showed different plasmid profiles although some plasmids were identical. The results suggest the existence of several atypical Aer, salmonicida. It also seems that ribotypes are stable properties for these bacteria while the plasmids are more labile.

  7. Aerosol optical properties in a rural environment near the mega-city Guangzhou, China: implications for regional air pollution and radiative forcing

    OpenAIRE

    R. M. Garland; Yang, H; Schmid, O; Rose, D; Nowak, A.; Achtert, P.; Wiedensohler, A.; Takegawa, N; Kita, K.; Miyazaki, Y.; Kondo, Y.; HU, M; Shao, M.; Zeng, L; Zhang, Y.

    2008-01-01

    The scattering and absorption of solar radiation by atmospheric aerosols is a key element of the Earth's radiative energy balance and climate. The optical properties of aerosol particles are, however, highly variable and not well characterized, especially near newly emerging mega-cities. In this study, aerosol optical properties were measured at a regional background site approximately 60 km northwest of the mega-city Guangzhou in southeast China. The measurements were part of the "...

  8. Sexual Health Education: A Psychiatric Resident's Perspective

    Science.gov (United States)

    Waineo, Eva; Arfken, Cynthia L.; Morreale, Mary K.

    2010-01-01

    Objective: This report discusses psychiatric residents' perceptions of sexual health education and their opinions regarding curricular improvements. Methods: An anonymous, web-based survey was sent to residents in one general psychiatry program (N = 33). The response rate was 69.7%. Results: Residents reported inadequate experience in multiple…

  9. Residence Hall Damage: Analysis and Control.

    Science.gov (United States)

    Scheuermann, Thomas A.

    The problems of residence hall damage and vandalism are examined in this booklet. An analysis and control program is proposed to provide a systematic method of dealing with the problem. A list of basic assumptions held by students and staff on residence hall damage is presented for discussion. Problems created by damage to residence halls are also…

  10. Cloning in Streptococcus lactis of plasmid-mediated UV resistance and effect on prophage stability

    International Nuclear Information System (INIS)

    Plasmid pIL7 (33 kilobases) from Streptococcus lactis enhances UV resistance and prophage stability. A 5.4-kilobase pIL7 fragment carrying genes coding for both characters was cloned into S. lactis, using plasmid pHV1301 as the cloning vector. The recombinant plasmid was subsequently transferred to three other S. lactis strains by transformation or protoplast fusion. Cloned genes were expressed in all tested strains

  11. Transfer of plasmid RSF1010 by conjugation from Escherichia coli to Streptomyces lividans and Mycobacterium smegmatis.

    OpenAIRE

    Gormley, E. P.; Davies, J.

    1991-01-01

    The plasmid RSF1010 belongs to a class of plasmids (IncQ) that replicate in a range of bacterial hosts. Although non-self-transmissible, it can be mobilized at high frequency between different gram-negative bacterial species if transfer functions are supplied in trans. We report the transfer of RSF1010 by conjugation from Escherichia coli to the gram-positive actinomycetes Streptomyces lividans and Mycobacterium smegmatis. In its new hosts, the plasmid was stable with respect to structure and...

  12. Epidemiology of Virulence-Associated Plasmids and Outer Membrane Protein Patterns Within Seven Common Salmonella Serotypes

    OpenAIRE

    Helmuth, R.; Stephan, R.; Bunge, C.; Hoog, B.; Steinbeck, A.; Bulling, E.

    1986-01-01

    Antibiotic-sensitive Salmonella isolates belonging to seven common serotypes and originating from 29 different countries from all continents were investigated for their plasmid DNA content (337 isolates) and their outer membrane protein profiles (216 isolates). Of the S. typhimurium, S. enteritidis, S. dublin, and S. choleraesuis isolates, 90% or more carried a serotype-specific plasmid. The molecular sizes of the plasmids were 60 megadaltons (Md) for S. typhimurium, 37 Md for S. enteritidis,...

  13. Self-transmissible plasmids in staphylococci that encode resistance to aminoglycosides.

    OpenAIRE

    Archer, G. L.; Johnston, J. L.

    1983-01-01

    High-level resistance to gentamicin, tobramycin, and kanamycin was transferred between staphylococci of the same and different species by filter mating. Resistance and transfer proficiency were mediated by plasmids ranging from 38 to 54 kilobases in size. All of the plasmids encoded intermediate resistance to amikacin and netilmicin and resistance to ethidium bromide; some encoded beta-lactamase production. None of these plasmids carried resistance to other antibiotics or heavy metals. Transf...

  14. Characterization of a macrolide, lincosamide, and streptogramin resistance plasmid in Staphylococcus epidermidis.

    OpenAIRE

    Parisi, J. T.; Robbins, J.; Lampson, B. C.; Hecht, D. W.

    1981-01-01

    A strain of Staphylococcus epidermidis was transduced to erythromycin resistance, and all of the transductants exhibited the macrolide, lincosamide, streptogramin B resistance phenotype. Curing and antibiotic disk studies also indicated that these resistances were controlled by a single plasmid determinant and were constitutive. Agarose gel electrophoresis of plasmid deoxyribonucleic acid (DNA) from donor, cured, and transduced strains showed that a single plasmid was responsible. This plasmi...

  15. Novel mechanism for plasmid-mediated erythromycin resistance by pNE24 from Staphylococcus epidermidis.

    OpenAIRE

    Lampson, B. C.; Von David, W.; Parisi, J. T.

    1986-01-01

    We describe an unusual type of erythromycin resistance (Emr) mediated by a plasmid designated pNE24 from Staphylococcus epidermidis. This 26.5-kilobase plasmid encodes resistance strictly to 14-membered macrolide antibiotics, erythromycin, and oleandomycin. Resistance to other macrolide-lincosamide-streptogramin B (MLS) antibiotics was not observed even after a prior induction stimulus with various MLS antibiotics. Plasmid pNE24 was found to express resistance constitutively and manifested a ...

  16. Transfer of multiple drug resistance plasmids between bacteria of diverse origins in natural microenvironments.

    OpenAIRE

    Kruse, H.; Sørum, H.

    1994-01-01

    Plasmids harboring multiple antimicrobial-resistance determinants (R plasmids) were transferred in simulated natural microenvironments from various bacterial pathogens of human, animal, or fish origin to susceptible strains isolated from a different ecological niche. R plasmids in a strain of the human pathogen Vibrio cholerae O1 E1 Tor and a bovine Escherichia coli strain were conjugated to a susceptible strain of the fish pathogenic bacterium Aeromonas salmonicida subsp. salmonicida in mari...

  17. Broad host range plasmids can invade an unexpectedly diverse fraction of a soil bacterial community

    DEFF Research Database (Denmark)

    Klümper, Uli; Riber, Leise

    2015-01-01

    Conjugal plasmids can provide microbes with full complements of new genes and constitute potent vehicles for horizontal gene transfer. Conjugal plasmid transfer is deemed responsible for the rapid spread of antibiotic resistance among microbes. While broad host range plasmids are known to transfer to diverse hosts in pure culture, the extent of their ability to transfer in the complex bacterial communities present in most habitats has not been comprehensively studied. Here, we isolated and characterized transconjugants with a degree of sensitivity not previously realized to investigate the transfer range of IncP- and IncPromA-type broad host range plasmids from three proteobacterial donors to a soil bacterial community. We identified transfer to many different recipients belonging to 11 different bacterial phyla. The prevalence of transconjugants belonging to diverse Gram-positive Firmicutes and Actinobacteria suggests that inter-Gram plasmid transfer of IncP-1 and IncPromA-type plasmids is a frequent phenomenon. While the plasmid receiving fractions of the community were both plasmid- and donor- dependent, we identified a core super-permissive fraction that could take up different plasmids from diverse donor strains. This fraction, comprising 80% of the identified transconjugants, thus has the potential to dominate IncP- and IncPromA-type plasmid transfer in soil. Our results demonstrate that these broad host range plasmids have a hitherto unrecognized potential to transfer readily to very diverse bacteria and can, therefore, directly connect large proportions of the soil bacterial gene pool. This finding reinforces the evolutionary and medical significances of these plasmids.The ISME Journal advance online publication, 21 October 2014; doi:10.1038/ismej.2014.191.

  18. Narrow- and Broad-Host-Range Symbiotic Plasmids of Rhizobium spp. Strains That Nodulate Phaseolus vulgaris

    OpenAIRE

    Brom, Susana; Martinez, Esperanza; Dávila, Guillermo; Palacios, Rafael

    1988-01-01

    Agrobacterium transconjugants containing symbiotic plasmids from different Rhizobium spp. strains that nodulate Phaseolus vulgaris were obtained. All transconjugants conserved the parental nodulation host range. Symbiotic (Sym) plasmids of Rhizobium strains isolated originally from P. vulgaris nodules, which had a broad nodulation host range, and single-copy nitrogenase genes conferred a Fix+ phenotype to the Agrobacterium transconjugants. A Fix? phenotype was obtained with Sym plasmids of ...

  19. Lactobacillus fermentum 3872 genome sequencing reveals plasmid and chromosomal genes potentially involved in a probiotic activity.

    Science.gov (United States)

    Lehri, B; Seddon, A M; Karlyshev, A V

    2015-06-01

    In this report we describe a Lactobacillus fermentum 3872 plasmid (pLF3872) not previously found in any other strain of this species. The analysis of the complete sequence of this plasmid revealed the presence of a gene encoding a large collagen-binding protein (CBP), as well as the genes responsible for plasmid maintenance and conjugation. Potential roles of CBP and a chromosomally encoded fibronectin-binding protein (FbpA) in probiotic activity are discussed. PMID:25908870

  20. Use of pIVEX plasmids for protein overproduction in Escherichia coli

    OpenAIRE

    Betton Jean-Michel; Rogé Julie

    2005-01-01

    Abstract Background The pIVEX plasmids are vectors optimized for expression in the Rapid Translation System (RTS) cell-free system under control of bacteriophage T7 transcription elements. Even if these plasmids are intended for use in vitro, it is usually worthwhile to compare both cell-free and bacterial expression from the same genetic construct. However, some RTS users encountered problems when they introcuded these plasmids into Escherichia coli host strains producing the T7 RNA polymera...

  1. Heterogeneous Selection in a Spatially Structured Environment Affects Fitness Tradeoffs of Plasmid Carriage in Pseudomonads?

    OpenAIRE

    Slater, Frances R.; Bruce , Kenneth D.; Ellis, Richard J; Lilley, Andrew K.; Turner, Sarah L

    2008-01-01

    Environmental conditions under which fitness tradeoffs of plasmid carriage are balanced to facilitate plasmid persistence remain elusive. Periodic selection for plasmid-encoded traits due to the spatial and temporal variation typical in most natural environments (such as soil particles, plant leaf and root surfaces, gut linings, and the skin) may play a role. However, quantification of selection pressures and their effects is difficult at a scale relevant to the bacterium in situ. The present...

  2. Quantification Bias Caused by Plasmid DNA Conformation in Quantitative Real-Time PCR Assay

    OpenAIRE

    Lin, Chih-Hui; Chen, Yu-Chieh; Pan, Tzu-Ming

    2011-01-01

    Quantitative real-time PCR (qPCR) is the gold standard for the quantification of specific nucleic acid sequences. However, a serious concern has been revealed in a recent report: supercoiled plasmid standards cause significant over-estimation in qPCR quantification. In this study, we investigated the effect of plasmid DNA conformation on the quantification of DNA and the efficiency of qPCR. Our results suggest that plasmid DNA conformation has significant impact on the accuracy of absolute qu...

  3. Plasmid profiles and antibiotic susceptibility patterns of Staphylococcus aureus isolates from Nigeria.

    Science.gov (United States)

    Olukoya, D K; Asielue, J O; Olasupo, N A; Ikea, J K

    1995-06-01

    In an investigation into the problems of infections due to Staphylococcus aureus in Nigeria, 100 strains were isolated from various hospitals in Lagos. The strains were screened for the presence of plasmids and for susceptibility to antimicrobial agents. Plasmids were extracted by modification of the method of Takahashi and Nagono[1]. The plasmids were diverse in nature. The strains were found to be highly resistant to commonly prescribed antibiotics. PMID:8669391

  4. Ca2+ Promoted the Low Transformation Efficiency of Plasmid DNA Exposed to PAH Contaminants

    OpenAIRE

    Kang, Fuxing; Wang, Hong; Gao, Yanzheng; Jian LONG; Wang, Qian

    2013-01-01

    The effects of interactions between genetic materials and polycyclic aromatic hydrocarbons (PAHs) on gene expression in the extracellular environment remain to be elucidated and little information is currently available on the effect of ionic strength on the transformation of plasmid DNA exposed to PAHs. Phenanthrene and pyrene were used as representative PAHs to evaluate the transformation of plasmid DNA after PAH exposure and to determine the role of Ca2+ during the transformation. Plasmid ...

  5. Tracking aeolian transport patterns across a mega-nourishment using video imagery

    Science.gov (United States)

    Wijnberg, Kathelijne; van der Weerd, Lianne; Hulscher, Suzanne

    2014-05-01

    Coastal dune areas protect the hinterland from flooding. In order to maintain the safety level provided by the dunes, it may be necessary to artificially supply the beach-dune system with sand. How to best design these shore nourishments, amongst others with respect to optimal dune growth on the long-term (decadal scale), is not yet clear. One reason for this is that current models for aeolian transport on beaches appear to have limited predictive capabilities regarding annual onshore sediment supply. These limited capabilities may be attributed to the lack of appropriate input data, for instance on moisture content of the beach surface, or shortcomings in process understanding. However, it may also be argued that for the long-term prediction of onshore aeolian sand supply from the beach to the dunes, we may need to develop some aggregated-scale transport equations, because the detailed input data required for the application of process-scale transport equations may never be available in reality. A first step towards the development of such new concepts for aggregated-scale transport equations is to increase phenomenological insight into the characteristics and number of aeolian transport events that account for the annual volume changes of the foredunes. This requires high-frequency, long-term data sets to capture the only intermittently occurring aeolian transport events. Automated video image collection seems a promising way to collect such data. In the present study we describe the movement (direction and speed) of sand patches and aeolian bed forms across a nourished site, using video imagery, to characterize aeolian transport pathways and their variability in time. The study site is a mega-nourishment (21 Mm3 of sand) that was recently constructed at the Dutch coast. This mega-nourishment, also referred to as the Sand Motor, is a pilot project that may potentially replace current practice of more frequently applying small scale nourishments. The mega-nourishment site has been, and still is, monitored intensively since its construction in 2011. The monitoring program includes an Argus video system consisting of 8 cameras, mounted on a 40 meter high tower in the middle of the Sand Motor, which collects snap shots and time-exposure images every half an hour. Also two Pan-Tilt-Zoom cameras can be used to zoom in at specific locations. In addition to the remote sensing by Argus, also bathymetric and topographic surveys are conducted every two months, LIDAR flights cover the beach and dune area every six months, and in the near future dune topography will be measured using Terrestrial laser scanning. A weather station mounted at the tower also collects wind data. These additional data sources will be used later on to explain observed aeolian transport pathways and assess their effect on dune evolution.

  6. Novel DC ring topology and protection system - a comprehensive solution for mega city power grids

    Science.gov (United States)

    Haj-Maharsi, Mohamed Yassine

    2009-07-01

    The development of mega cities leads to increased load concentration and brings additional challenges to managing the electrical grid while keeping power available for critical loads. Techniques using FACTS devices are being applied to alleviate power management difficulties and to confine faults in their originating areas in order to limit the risk of cascading failures in the grid. The addition of many FACTS devices often results in control and protection coordination difficulties, power oscillations between connected networks, subsynchronous resonance problems, and torsional interactions with nearby generator units. The most effective solution is obtained when the individual AC subsystems representing sources and loads are decoupled so a fault in a given subsystem is not propagated to another subsystem. This solution can be achieved by the deployment of a DC system where power sources and loads are connected to the DC bus through voltage source converters. For a mega city, this would be conceived as a DC ring feeding multiple loads and connected to remote and local power sources. Unfortunately, the lack of fast DC circuit breakers has been one of the key issues affecting extensive applications of DC systems with common DC buses; a DC fault would discharge all the capacitors of the DC bus and cause delays in system recovery and possibly a wide system collapse. In this research, I provide a comprehensive solution to mega city power grid problems by proposing a DC system topology that enables grid expansions without affecting existing protection settings or changing existing AC breaker ratings. I also propose the means for protecting the DC system by designing a fast DC breaker and developing a control algorithm capable of isolating DC faults without blocking converter stations or depleting DC bus capacitors. My contribution is three folds: (1) I modeled and simulated Shanghai power grid and performed a study to identify short circuit and voltage stability problems using data provided by ABB corporate research located in China. I built on the work that had been performed in ABB China by considering different contingencies and I applied solutions using individual FACTS devices such as FCL, SVC-LightRTM, and HVDC-LightRTM. I analyzed the results from each solution in order to assess its merits and limitations in dealing with fault current and voltage stability problems. Then I presented a novel DC ring topology that provides redundancy, better protection against cascading faults, and does not increase short circuit levels. With this topology, adding loads or power sources does not impact system protection or performance. (2) I proposed two novel designs for a DC circuit breaker that is of critical importance to DC applications using multiple converter stations. The proposed designs solve the problem of DC fault clearing without causing significant voltage drops, current oscillations, or shutting down of any converter station connected to the DC bus. The DC breaker rated at a voltage of 320 kV and a current of 3000 A can interrupt DC currents as high as 70 kA within 800 mus. (3) I proposed a novel placement of the DC circuit breakers within the DC ring topology combined with an intelligent protection algorithm that optimizes fault detection and isolation without affecting the rest of the DC system. The protection scheme uses local measurements and special coordination techniques for clearing solid faults and uses differential measurements to identify and isolate high impedance faults.

  7. Studies on the drift properties and spatial resolution using a microMEGAS-equipped time projection chamber

    International Nuclear Information System (INIS)

    R and D studies on the performance as well as on the gas properties of the microMEGAS-based time projection chamber with standard readout were carried out in June 2005 using 4 GeV/c pion beam in a magnetic field from 0 to 1 T at the proton synchrotron beam line at KEK, Japan. Analysis of the electron drift velocity, diffusion constant and point resolution of padrow measurement for MicroMEGAS TPC filled with 95% argon and 5% isobutane gas are presented. The underlying physical mechanism which determines the optimal TPC performance are briefly discussed. Preliminary measurements of gas properties and spatial resolution in close agreement with the analytical calculation and MAGBOLTZ simulation are summarized and presented in this paper. (author)

  8. Study on the effect of humidity and dust on leakage current of bulk micro-MEGAS detector

    CERN Document Server

    Wang, Bo; Qi, Hui-Rong; Liu, Jing; Zhang, Xin-Shuai; Zhang, Tian-Chong; Yi, Fu-Ting; Ou-Yang, Qun; Chen, Yuan-Bo

    2013-01-01

    In this paper, the effect of humidity and dust trapped in avalanche region on leakage current of bulk micro-MEGAS detector is studied. Pyralux PC1025 layers of DuPont are introduced in bulk technique and micro-MEGAS detector with pillars of 300{\\mu}m in diameter is fabricated. Leakage current is tested in air with different humidity. Silicon carbide powder and PMMA (polymethyl methacrylate) powder are added as dust to avalanche region. Leakage current with and without powder is tested in air and results are depicted in the same figure. Test results indicate that leakage current increases with both storage humidity and test humidity, and also increases when powder is introduced in avalanche region.

  9. Mega jardines infantiles: heterotopías para el gobierno de la población infantil en Medellín / Mega-kindergartens: heterotopias for governing the infant population in Medellin / Mega jardins de infância: heterotopias para o governo da população infantil em Medellin

    Scientific Electronic Library Online (English)

    Andrés Klaus, Runge Peña; Sara Carolina, Carrillo David.

    2013-12-01

    Full Text Available No marco de uma política integral de atenção para a infância, durante as últimas administrações a cidade de Medellín realizou um grande investimento em infraestrutura, especificamente para a construção, em lugares estratégicos da cidade, de grandes jardins de infância. Este texto tem como propósito [...] pensar em chave foucaultiana esses espaços como heterotopias, isto é, como espaços para o governo (governamentalidade) da população infantil. No texto se considera que a reestruturação e ressignificação do espaço educativo escolar e das práticas desenvolvidas na sua interioridade não obedecem, principalmente, a uma preocupação pedagógica ou filantrópica que poderia ser interpretada de maneira independente de um contexto histórico e social, nas margens de determinados interesses e relações de poder. Numa primeira parte, seguindo Foucault, se revisa o conceito de heterotopia e se propõe que esses espaços educativos outros -além da sua função educativa e formativa- cumprem um papel governamental em quanto permitem o governo da população infantil ao constituírem-se em lugares estratégicos para a implantação de tecnologias sociais como a prevenção. Abstract in spanish En el marco de una nueva política de atención integral a la infancia, durante las últimas administraciones la ciudad de Medellín ha venido realizando una considerable inversión en infraestructura urbana, específicamente con la creación, en lugares estratégicos de la ciudad, de grandes jardines infan [...] tiles. Este escrito tiene como propósito pensar en clave foucaultiana esos espacios como heterotopías, es decir, como espacios otros para el gobierno (gubernamentalidad) de la población infantil. Partimos así, del presupuesto según el cual la reestructuración y resignificación del espacio educativo escolar y de las prácticas en su interior no obedece a una suerte de preocupación pedagógica y filantrópica que sin más se pueda considerar desligada de un contexto histórico y social y al margen de ciertos intereses y de ciertas relaciones de poder. Para ello, y de la mano de Foucault, en una primera parte se le pasa revista al concepto de heterotopía y a sus particularidades; en la segunda parte, se profundiza en la caracterización de los mega jardines infantiles como heterotopías y se plantea que estos espacios educativos otros -además de su función educativa y formativa- cumplen con un papel gubernamental en el sentido que permiten el gobierno de la población infantil gracias a que se convierten en lugares estratégicos para la implementación de tecnologías sociales como la prevención. Abstract in english Under a new policy of comprehensive child care during the past administrations Medellin has been making a considerable investment in urban infrastructure, specifically the creation in strategic locations in the city, large kindergartens. This paper aims to reflect upon these spaces as key Foucauldia [...] n heterotopias, ie, as other spaces for the government (governmentality) of children. So, we start from the estimation that restructuring and redefining educational space and practices therein are not due to a kind of educational and philanthropic concern that no more can be considered detached from a historical and social context and outside certain interests and certain power relations.

  10. The Chief Resident Role in Emergency Medicine Residency Programs

    Directory of Open Access Journals (Sweden)

    Hafner, John W. Jr., MD, MPH

    2010-05-01

    Full Text Available Study Objectives: Although other specialties have examined the role of the chief resident (CR, the role and training of the emergency medicine (EM CR has largely been undefined.Methods: A survey was mailed to all EM CRs and their respective program directors (PD in 124 EM residency programs. The survey consisted of questions defining demographics, duties of the typical CR, and opinions regarding the level of support and training received. Multiple choice, Likert scale (1 strong agreement, 5 strong disagreement and short-answer responses were used. We analyzed associations between CR and PD responses using Chi-square, Student’s T and Mann-Whitney U tests.Results: Seventy-six percent of CRs and 65% of PDs responded and were similar except for age (31 vs. 42 years; p<0.001. CR respondents were most often male, in year 3 of training and held the position for 12 months. CRs and PDs agreed that the assigned level of responsibility is appropriate (2.63 vs. 2.73, p=0.15; but CRs underestimate their influence in the residency program (1.94 vs. 2.34, p=0.002 and the emergency department (2.61 vs. 3.03, p=0.002. The majority of CRs (70% and PDs (77% report participating in an extramural training program, and those CRs who participated in training felt more prepared for their job duties (2.26 vs. 2.73; p=0.03.Conclusion: EM CRs feel they have appropriate job responsibility but believe they are less influential in program and department administration than PD respondents. Extramural training programs for incoming CRs are widely used and felt to be helpful. [West J Emerg Med. 2010; 11(2:120-125.

  11. The Role of Mega-events in Country Branding : Case Study on Brand of Ukraine before European Football Championship 2012

    OpenAIRE

    Klonova, Anastasiia

    2012-01-01

    Successful presentation of a country as a brand and positioning its unique image on the global level can give significant opportunities for development and progress of the state in the different areas. This research applies theories on the country branding to estimate impact of mega sport events on the image of state. To accomplish these goal I used case study – formation of brand Ukraine before hosting European Football Championship 2012 (EURO 2012). To investigate  brand strategy of Ukra...

  12. The Effects of Herbivory by a Mega- and Mesoherbivore on Tree Recruitment in Sand Forest, South Africa

    OpenAIRE

    Lagendijk, D. D. Georgette; Mackey, Robin L.; Page, Bruce R.; Slotow, Rob

    2011-01-01

    Herbivory by megaherbivores on woody vegetation in general is well documented; however studies focusing on the individual browsing effects of both mega- and mesoherbivore species on recruitment are scarce. We determined these effects for elephant Loxodonta africana and nyala Tragelaphus angasii in the critically endangered Sand Forest, which is restricted to east southern Africa, and is conserved mainly in small reserves with high herbivore densities. Replicated experimental treatments (400 m...

  13. Along came a mega-event : prospects of competitiveness for a 2010 FIFA World Cup™ host city

    OpenAIRE

    Kruger, Elizabeth Ann; Heath, Ernest Thomas

    2013-01-01

    South Africa’s hosting of the 2010 FIFA World Cup™ came at a time when countries and cities worldwide were increasingly competing for this sought-after status. The benefits and challenges of such an event have received significant attention from researchers and practitioners alike. No tourism destination is guaranteed long-term competitiveness by being offered the once-off opportunity to host a major international event. This study aimed to determine whether a mega-event would make a grea...

  14. The Water Situation of the Future Mega City "Urumqi" (NW-China) – Resources, Risk, Conservation and Management

    OpenAIRE

    Yao, Yuan

    2013-01-01

    Urumqi is located in the remote center of the Eurasian continent. It is a future mega-city with rapid economic development and high population density in China's western interior. Urumqi's water resource problems are the main research objects in this thesis. Several models have been put forward to predict water demand in Urumqi and useful suggestions have been gathered to reduce water scarcity. In 2010, the average annual water resources of Urumqi were at 939.22 million m³ and the average...

  15. Impacts of Mega-droughts on Water and Food Security in the Indo-Gangetic Plains: A Paleoclimate Scenario Analysis

    Science.gov (United States)

    Zhu, T.; Pitois, G.; Ringler, C.; Wang, D.; Rosegrant, M. W.

    2014-12-01

    Spanning over Pakistan, northern India, Nepal, and Bangladesh, the Indo-Gangetic Plains (IGP) is the home of several hundred million people and the "bread basket" for much of South Asia. The flat terrain, fertile soils, and favorable climate of the IGP make it agriculturally productive. However prolonged droughts caused by consecutive monsoon failures can seriously affect crop production and social wellbeing, in particular for the eastern part of the plains where agriculture remains largely rain-fed. Severe droughts were observed in the IGP historically, and recent paleoclimate studies reveal that more severe and long-lasting "mega-droughts" had happened in the distant past. Agricultural losses from major droughts can dramatically affect food systems and increase the vulnerability of resource-poor people given the delicate balance between food supply and demand under growing natural resource scarcity. To estimate the potential impacts of "mega-droughts" on the water and food systems in the IGP, we develop worst-case drought scenarios through inverse modeling of tree-ring-based PDSI reconstruction that covers the period 1300-1899 (A.D.), and analyze these historic mega-drought scenarios using IFPRI's IMPACT global water and food projections model. The base year of the IMPACT model is parameterized using socioeconomic and engineering data that reflect today's water management and infrastructure, agricultural technologies, population, income, and market institutions. The base year simulation is validated against observations to ensure model fidelity. Anticipated changes of the above factors in the future out to 2050 are specified using demographic and economic growth projections and literature data. Model simulation results represent the consequences of mega-droughts in the IGP given technological and socioeconomic conditions of today and in the future. We also explore policy options for increasing the resilience of water and food systems in the IGP, through scenario analysis, and recommendations are made concerning investment in water infrastructure and agricultural technologies, in addition to trade policies.

  16. Comparative Sequence Analysis of a Multidrug-Resistant Plasmid from Aeromonas hydrophila

    OpenAIRE

    Del Castillo, Carmelo S.; Hikima, Jun-ichi; Jang, Ho-bin; Nho, Seong-won; Jung, Tae-sung; Wongtavatchai, Janenuj; Kondo, Hidehiro; Hirono, Ikuo; Takeyama, Haruko; Aoki, Takashi

    2013-01-01

    Aeromonas hydrophila is a pathogenic bacterium that has been implicated in fish, animal, and human disease. Recently, a multidrug resistance (MDR) plasmid, pR148, was isolated from A. hydrophila obtained from a tilapia (Oreochromis niloticus) farm in Thailand. pR148 is a 165,906-bp circular plasmid containing 147 coding regions showing highest similarity to pNDM-1_Dok1, an MDR plasmid isolated from a human pathogen. pR148 was also very similar to other IncA/C plasmids isolated from humans, an...

  17. Mobilization functions of the bacteriocinogenic plasmid pRJ6 of Staphylococcus aureus.

    Science.gov (United States)

    Varella Coelho, Marcus Livio; Ceotto, Hilana; Madureira, Danielle Jannuzzi; Nes, Ingolf F; Bastos, Maria do Carmo de Freire

    2009-06-01

    Plasmid pRJ6 is the first known bacteriocinogenic mobilizable (Mob) plasmid of Staphylococcus aureus. Its Mob region is composed of four mob genes (mobCDAB) arranged as an operon, a genetic organization uncommon among S. aureus Mob plasmids. oriT (pRJ6) was detected in a region of 431 bp, positioned immediately upstream of mobC. This region, when cloned into pCN37, was able to confer mobilization to the re-combinant plasmid only in the presence of pRJ6. The entire Mob region, including oriT (pRJ6), is much more similar to Mob regions from several coagulase-negative staphylococci plasmids, although some remarkable similarities with S. aureus Mob plasmids can also be noted. These similarities include the presence within oriT (pRJ6) of the three mcb (MobC binding sites), firstly described in pC221 and pC223, an identical nick site also found in these same plasmids, and a nearly identical sra(pC223) site (sequence recognized by MobA). pRJ6 was successfully transferred to S. epidermidis by conjugation in the presence of the conjugative plasmid pGOl. Altogether these findings suggest that pRJ6 might have been originally a coagulase-negative staphylococci plasmid that had been transferred successfully to S. aureus. PMID:19557350

  18. Plasmid marker rescue transformation proceeds by breakage-reunion in Bacillus subtilis

    International Nuclear Information System (INIS)

    Bacillus subtilis carrying a plasmid which replicates with a copy number of about 1 was transformed with linearized homologous plasmid DNA labeled with the heavy isotopes 2H and 15N, in the presence of 32Pi and 6-(p-hydroxyphenylazo)-uracil to inhibit DNA replication. Plasmid DNA was isolated from the transformed culture and fractionated in cesium chloride density gradients. The distribution of total and donor plasmid DNA was examined, using specific hybridization probes. The synthesis of new DNA, associated with the integration of donor moiety, was also monitored. Donor-specific sequences were present at a density intermediate between that of light and hybrid DNA. This recombinant DNA represented 1.4% of total plasmid DNA. The latter value corresponded well with the transforming activity (1.7%) obtained for the donor marker. Newly synthesized material associated with plasmid DNA at the recombinant density amounted to a minor portion of the recombinant plasmid DNA. These data suggest that, like chromosomal transformation, plasmid marker rescue transformation does not require replication for the integration of donor markers and, also like chromosomal transformation, proceeds by a breakage-reunion mechanism. The extent of donor DNA replacement of recipient DNA per plasmid molecule of 54 kilobases (27 kilobase pairs) was estimated as 16 kilobases

  19. Peaceful coexistence amongst Borrelia plasmids: getting by with a little help from their friends?

    OpenAIRE

    Chaconas, George; Norris, Steven J.

    2013-01-01

    Borrelia species comprise a unique genus of bacterial pathogens. These organisms contain a segmented genome with up to two dozen plasmids ranging in size from 5kb up to about 200 kb. The plasmids have also been referred to as mini-chromosomes or essential genetic elements, as some of them carry information important for infection of vertebrates or for survival in the tick vector. Most of the plasmids are linear with covalently closed hairpin telomeres and these linear plasmids are in a consta...

  20. Conjugative Plasmid Transfer and Adhesion Dynamics in an Escherichia coli Biofilm? †

    OpenAIRE

    Ong, Cheryl-lynn Y; Beatson, Scott A.; McEwan, Alastair G; Schembri, Mark A

    2009-01-01

    A conjugative plasmid from the catheter-associated urinary tract infection strain Escherichia coli MS2027 was sequenced and annotated. This 42,644-bp plasmid, designated pMAS2027, contains 58 putative genes and is most closely related to plasmids belonging to incompatibility group X (IncX1). Plasmid pMAS2027 encodes two important virulence factors: type 3 fimbriae and a type IV secretion (T4S) system. Type 3 fimbriae, recently found to be functionally expressed in E. coli, played an important...

  1. Evolution of a selfish genetic element: the 2 micron plasmid of saccharomyces spp.

    OpenAIRE

    Harrison, Eleanor

    2010-01-01

    The 2 Micron plasmid is a multicopy DNA circle inhabiting the genome of the budding yeasts, Sacchormyces spp. The plasmid confers no known benefits to the host, but imposes a small fitness cost. However the plasmid is able to drive, i.e. to transmit to >50% of sexual offspring, which allows the element to spread through an outcrossing host population. Therefore we can consider the plasmid a selfish genetic element of yeast. Here we draw on a number of approaches to improve our ...

  2. Computational design and characterization of a temperature-sensitive plasmid replicon for gram positive thermophiles

    Directory of Open Access Journals (Sweden)

    Olson Daniel G

    2012-05-01

    Full Text Available Abstract Background Temperature-sensitive (Ts plasmids are useful tools for genetic engineering, but there are currently none compatible with the gram positive, thermophilic, obligate anaerobe, Clostridium thermocellum. Traditional mutagenesis techniques yield Ts mutants at a low frequency, and therefore requires the development of high-throughput screening protocols, which are also not available for this organism. Recently there has been progress in the development of computer algorithms which can predict Ts mutations. Most plasmids currently used for genetic modification of C. thermocellum are based on the replicon of plasmid pNW33N, which replicates using the RepB replication protein. To address this problem, we set out to create a Ts plasmid by mutating the gene coding for the RepB replication protein using an algorithm designed by Varadarajan et al. (1996 for predicting Ts mutants based on the amino-acid sequence of the protein. Results A library of 34 mutant plasmids was designed, synthesized and screened, resulting in 6 mutants which exhibited a Ts phenotype. Of these 6, the one with the most temperature-sensitive phenotype (M166A was compared with the original plasmid. It exhibited lower stability at 48°C and was completely unable to replicate at 55°C. Conclusions The plasmid described in this work could be useful in future efforts to genetically engineer C. thermocellum, and the method used to generate this plasmid may be useful for others trying to make Ts plasmids.

  3. Prevalence of Pseudomonas aeruginosa FP plasmids which enhance spontaneous and UV-induced mutagenesis

    International Nuclear Information System (INIS)

    From work reported here and from previous studies 16 out of 53 (30%) FP plasmids (i.e. those plasmids that promote host chromosome transfer) of Pseudomonas aeruginosa are found to protect host cells against UV irradiation. 13 of these UV-protecting FP plasmids were tested to determine their mode of DNA repair and were found to contribute to error-prone repair because of their enhancement of UV-induced mutagenesis and in most instances spontaneous mutagenesis as well. Some of these plasmids were tested for their behaviour in a DNA polymerase I deficient (Pol-) mutant of P. aeruginosa; the remainder could not be tested due to plasmid instability in the Pol- mutant. 11 of these FP plasmids provided wild type level of UV protection to the mutant. 4 of the plasmids tested (FP18, FP103, FP109 and FP111) were able to enhance the mutant's ability to host cell reactivate UV irradiated phage, though not to the level of the Pol+ parent. The presence of FP18 or FP111 in the Pol- mutant did not increase polymerase I-like enzymatic activity. It is concluded that the plasmids do not confer a polymerase activity functionally equivalent to host DNA polymerase I. The implications of the prevalence of FP plasmids in P. aeruginosa which enhance multagenesis are discussed. (Auth.)

  4. Relationship between the limited and wide host range octopine-type Ti plasmids of Agrobacterium tumefaciens.

    OpenAIRE

    Thomashow, M. F.; Knauf, V C; Nester, E W

    1981-01-01

    The relationship between the limited host range octopine Ti plasmids and the wide host range octopine Ti plasmids pTiB6806 and pTiA6 was studied. The limited host range Ti plasmids shared extensive deoxyribonucleic acid homology; pTiAg63 and pTiAg162 were essentially completely homologous with pTiAg158 while pTiAg57 shared approximately 64% homology with pTiAg158. In contrast, the limited host range octopine Ti plasmids only shared 6 to 15% homology with the wide host range octopine Ti plasmi...

  5. Construction and characterization of hybrid plasmids containing the Escherichia coli nrd region.

    OpenAIRE

    Platz, A; Sjöberg, B M

    1980-01-01

    Recombinant plasmids containing all or part of the genetic region of Escherichia coli coding for the two subunits of ribonucleoside diphosphate reductase (proteins B1 and B2) were constructed with the aid of the multicopy plasmid pBR322. Two of these plasmids (pPS1 and pPS2) appeared to carry both a regulator and the complete structural information for the enzyme and, after transformation of E. coli, directed a 10- to 20-fold overproduction of both proteins B1 and B2. The other plasmids (pPS1...

  6. Repair of UV-irradiated plasmid DNA in excision repair deficient mutants of Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    The repair of UV-irradiated DNA of plasmid YEp13 was studied in the incision defective strains by measurement of cell transformation frequency. In Saccharomyces cerevisiae, rad1,2,3 and 4 mutants could repair UV-damaged plasmid DNA. In Escherichia coli, uvrA mutant was unable to repair UV-damaged plasmid DNA; however, pretreatment of the plasmid with Micrococcus luteus endonuclease increased repair. It was concluded that all the mutations of yeast were probably limited only to the nuclear DNA. (author)

  7. Reversible entrapment of plasmid deoxyribonucleic acid on different chromatographic supports.

    Science.gov (United States)

    Gabor, Boštjan; ?ernigoj, Urh; Barut, Miloš; Štrancar, Aleš

    2013-10-11

    HPLC based analytical assay is a powerful technique that can be used to efficiently monitor plasmid DNA (pDNA) purity and quantity throughout the entire purification process. Anion exchange monolithic and non-porous particle based stationary phases were used to study the recovery of the different pDNA isoforms from the analytical column. Three differently sized pDNA molecules of 3.0kbp, 5.2kbp and 14.0kbp were used. Plasmid DNA was injected onto columns under the binding conditions and the separation of the isoforms took place by increasing the ionic strength of the elution buffer. While there was no substantial decrease of the recovered supercoiled and linear isoforms of the pDNA with the increase of the plasmid size and with the increase of the flow rate (recoveries in all cases larger than 75%), a pronounced decrease of the oc isoform recovery was observed. The entrapment of the oc pDNA isoform occurred under non-binding conditions as well. The partial oc isoform elution from the column could be achieved by decreasing the flow rate of the elution mobile phase. The results suggested a reversible entrapment of the oc isoform in the restrictions within the pores of the monolithic material as well as within the intra-particle space of the non-porous particles. This phenomenon was observed on both types of the stationary phase morphologies and could only be connected to the size of a void space through which the pDNA needs to migrate. A prediction of reversible pDNA entrapment was successfully estimated with the calculation of Peclet numbers, Pe, which defines the ratio between a convective and diffusive mass transport. PMID:24021834

  8. Bronchoscopy Simulation in Anesthesia Resident Education

    Directory of Open Access Journals (Sweden)

    John Pawlowski

    2013-05-01

    Full Text Available Simulation in residency training is becoming more popular but there is limited evidence showing that it can improve a resident’s fund of knowledge, particularly in anesthesiology. We looked at whether a bronchoscopy simulation could improve performance on a thoracic anesthesia knowledge test administered both before and after using the simulator. Fourteen first-year anesthesiology residents completed the study with an average improvement on the test of 28% (p 0.05. We conclude that bronchoscopy simulation is an effective method of educating anesthesiology residents.

  9. Research by residents: Obstacles and opportunities.

    Science.gov (United States)

    Torous, John; Padmanabhan, Jaya

    2015-02-01

    As the psychiatric field continues to evolve in a world with nascent mobile technology (Hilty et al., 2014), novel neuroscience and genetic research, and new payment and care models (Fried et al., 2014) it is likely that the psychiatry residents learn today will not match what they will be practicing tomorrow. Residents have the opportunity to help shape that future through conducting research today. While the prospect of research can initially seem daunting to the busy resident, here we examine, from psychiatry residents' perspective, the common pitfalls and rewards of research during residency. PMID:25591922

  10. A Medicolegal Curriculum for Internal Medicine Residents

    OpenAIRE

    Kollas, Chad D.; Frey, Carolin M.

    1999-01-01

    Many residents lack knowledge about medicolegal issues. To assess the ability of 64 primary care residents to learn legal medicine, we studied the impact of a medicolegal curriculum in a randomized, controlled study. We measured residents' medicolegal knowledge using a novel test, the Legal Medicine Evaluation (LME). We found that the mean LME score of residents exposed to the curriculum increased 15.5 points (on a 100-point scale) to 65.9 ( p < .01), while the mean LME score of control resid...

  11. Strike-slip motion of a mega-splay fault system in the Nankai oblique subduction zone

    Science.gov (United States)

    Tsuji, Takeshi; Ashi, Juichiro; Ikeda, Yasutaka

    2014-12-01

    We evaluated the influence of the trench-parallel component of plate motion on the active fault system within the Nankai accretionary wedge from reflection seismic profiles, high-resolution seafloor bathymetry, and deep-towed sub-bottom profiles. Our study demonstrated that a large portion of the trench-parallel component of oblique plate subduction is released by strike-slip motion along a fault located just landward of and merging down-dip with a mega-splay fault. The shallow portion of the splay fault system, forming a flower structure, seems to accommodate dominant strike-slip motion, while most of the dip-slip motion could propagate to the trenchward décollement. Numerous fractures developed around the strike-slip fault release overpressured pore fluid trapped beneath the mega-splay fault. The well-developed fractures could be related to the change in stress orientation within the accretionary wedge. Therefore, the strike-slip fault located at the boundary between the inner and outer wedges is a key structure controlling the stress state (including pore pressure) within the accretionary prism. In addition, the strike-slip motion contributes to enhancing the continuous mega-splay fault system (outer ridge), which extends for approximately 200 km parallel to the Nankai Trough.

  12. MegaSNPHunter: a learning approach to detect disease predisposition SNPs and high level interactions in genome wide association study

    Directory of Open Access Journals (Sweden)

    Xue Hong

    2009-01-01

    Full Text Available Abstract Background The interactions of multiple single nucleotide polymorphisms (SNPs are highly hypothesized to affect an individual's susceptibility to complex diseases. Although many works have been done to identify and quantify the importance of multi-SNP interactions, few of them could handle the genome wide data due to the combinatorial explosive search space and the difficulty to statistically evaluate the high-order interactions given limited samples. Results Three comparative experiments are designed to evaluate the performance of MegaSNPHunter. The first experiment uses synthetic data generated on the basis of epistasis models. The second one uses a genome wide study on Parkinson disease (data acquired by using Illumina HumanHap300 SNP chips. The third one chooses the rheumatoid arthritis study from Wellcome Trust Case Control Consortium (WTCCC using Affymetrix GeneChip 500K Mapping Array Set. MegaSNPHunter outperforms the best solution in this area and reports many potential interactions for the two real studies. Conclusion The experimental results on both synthetic data and two real data sets demonstrate that our proposed approach outperforms the best solution that is currently available in handling large-scale SNP data both in terms of speed and in terms of detection of potential interactions that were not identified before. To our knowledge, MegaSNPHunter is the first approach that is capable of identifying the disease-associated SNP interactions from WTCCC studies and is promising for practical disease prognosis.

  13. Plasmid Mediated Chromate Resistance in Bacteria Isolated from Industrial Waste

    OpenAIRE

    Sikander Sultan; Shahida Hasnain

    2005-01-01

    In order to study the genetic basis and mechanism of chromate resistance in chromate resistant bacteria, conjugal transfer as well as curing of plasmids in these bacteria and its effect on chromium uptake are being investigated. From the effluent of Shafiq Tannery, Kasur, Pakistan, four bacterial strains STCr-1, STCr-2, STCr-3 and STCr-4 which could endure 40 mg mL-1 of potassium chromate in nutrient agar medium were isolated. All of them were gram negative, aerobic and motile rods. One strai...

  14. Deletion analysis of the F plasmid oriT locus.

    OpenAIRE

    Fu, Y. H.; Tsai, M. M.; Luo, Y. N.; Deonier, R. C.

    1991-01-01

    Functional domains of the Escherichia coli F plasmid oriT locus were identified by deletion analysis. DNA sequences required for nicking or transfer were revealed by cloning deleted segments of oriT into otherwise nonmobilizable pUC8 vectors and testing for their ability to promote transfer or to be nicked when tra operon functions were provided in trans. Removal of DNA sequences to the right of the central A + T-rich region (i.e., from the direction of traM) did not affect the susceptibility...

  15. Analysis of mini-F plasmid replication by transposition mutagenesis.

    OpenAIRE

    Bergquist, P. L.; Downard, R A; Caughey, P. A.; Gardner, R C; Lane, H E

    1981-01-01

    Derivatives of a mini-F plasmid in which Tn3 is inserted in F deoxyribonucleic acid were obtained, and the sites of insertion for 40 of the derivatives were mapped. Tn3 was found to insert at many sites within mini-F, but most insertions were within the 43.0- to 43.7-kilobase (kb), 44.2- to 44.7-kb, and 45.9- to 46.3-kb segments. Hence, these segments are unnecessary for mini-F replication. Most of the Tn3 derivatives were similar to their parent miniplasmid with respect to copy number, stabi...

  16. Drug resistance and plasmid profile of shigellae in Taiwan.

    OpenAIRE

    Lin, S. R.; S. F. Chang

    1992-01-01

    One hundred and twenty-eight shigella strains isolated from newborn and infant human faecal specimens at Kaohsiung Medical College Hospital in Taiwan were serogrouped, serotyped and examined for drug-resistance patterns and for the presence of plasmids. Forty-seven per cent of the isolates were found to belong to the Shigella sonnei serogroup, 41% to the S. flexneri group, 9% to the S. boydii group and 3% to the S. dysenteriae group. The serotype with the greatest number of strains was S. son...

  17. Kinetic modeling of plasmid DNA degradation in rat plasma

    OpenAIRE

    Houk, Brett E.; Hochhaus, Gunther; Hughes, Jeffrey A.

    1999-01-01

    A major obstacle in gene delivery is the transport of intact plasmid DNA (pDNA) to target sites. We sought to investigate the kinetic processes underlying the degradation of pDNA in a rat plasma model, as this is one of the main components responsible for the clearance of pDNA after intravenous administration. We further sought to construct a complete kinetic model to describe the degradation of all three topoforms (supercoiled, open circular, and linear) of pDNA in a rat plasma model. Superc...

  18. Pharmacy Residents’ Pursuit of Academic Positions

    Science.gov (United States)

    Shin, Tiffany R.; Mehta, Bella H.; Rodis, Jennifer L.; Pruchnicki, Maria C.

    2015-01-01

    Objective. To describe pharmacy residents’ interest in and pursuit of academic positions. Methods. An electronic presurvey and postsurvey were sent to pharmacy residents during the 2011-2012 residency year. The initial survey evaluated residents’ job preferences and interest in academia at the beginning of residency, and the follow-up survey focused on job selection and reasons for pursuing or not pursuing positions in academia. Results. Nine hundred thirty-six residents responded to the initial survey and 630 participated in both the initial and follow-up survey. Forty-eight percent of those responding to both surveys strongly considered a career in academia in the initial survey, 28% applied for an academic position, and 7% accepted a position. Second-year postgraduate residents were more likely than first-year postgraduate residents to apply for and be offered a faculty position. Conclusion. Pharmacy residents are interested in academia. While increasing interest among residents is encouraging for faculty recruitment, the academy should also encourage and develop adequate training experiences to prepare residents to succeed in these positions. PMID:25995513

  19. Pharmacy residents' pursuit of academic positions.

    Science.gov (United States)

    Shin, Tiffany R; Clark Dula, Colleen A; Mehta, Bella H; Rodis, Jennifer L; Pruchnicki, Maria C

    2015-04-25

    Objective. To describe pharmacy residents' interest in and pursuit of academic positions. Methods. An electronic presurvey and postsurvey were sent to pharmacy residents during the 2011-2012 residency year. The initial survey evaluated residents' job preferences and interest in academia at the beginning of residency, and the follow-up survey focused on job selection and reasons for pursuing or not pursuing positions in academia. Results. Nine hundred thirty-six residents responded to the initial survey and 630 participated in both the initial and follow-up survey. Forty-eight percent of those responding to both surveys strongly considered a career in academia in the initial survey, 28% applied for an academic position, and 7% accepted a position. Second-year postgraduate residents were more likely than first-year postgraduate residents to apply for and be offered a faculty position. Conclusion. Pharmacy residents are interested in academia. While increasing interest among residents is encouraging for faculty recruitment, the academy should also encourage and develop adequate training experiences to prepare residents to succeed in these positions. PMID:25995513

  20. Introducing "optimal challenges" in resident training

    DEFF Research Database (Denmark)

    SØrensen, Anette Bagger; Christensen, Mette Krogh

    Background: Residents are often caught between two interests: the resident’s desire to participate in challenging learning situations and the department’s work planning. However, these interests may clash if they are not coordinated by the senior doctors, and challenging learning situations risk being subject to work planning. Summary of work: Inspired by Csikszentmihalyi’s concept of optimal challenges, an intervention study aimed at introducing a more suitable planning of resident’s learning in terms of optimal allocation of educational patient contacts. The objective was to coordinating residents’ individual competences and learning needs with patient characteristics in order to match each resident with a case (an outpatient or a patient) that meets the learning needs of the resident and thus pose an optimal challenge to the resident. Summary of results: The preliminary results show that the residents benefit from the intervention because they experienced more optimal challenges than before the intervention. However, the matching of resident and case seems to work against the established culture in the department: the daily work has for many years been organized so that senior doctors have their “own” patients and they do not “share” patients with residents. Thus the patients were accustomed to have their “own” specialist doctor. Conclusion: The intervention generated optimal challenges, but revealed the need for more team-based organization of senior doctors and residents’ working relationships in order to meet the health system’s and the patients’ call for continuity in the treatment. Take-home message: The matching of resident and case stimulates optimal learning situations, but cultural and organizational values concerning the doctor-patient continuity are challenged.

  1. Surgical Resident for a Day

    Science.gov (United States)

    Techtronics Program,

    Students act as surgical residents for the day. Working in teams, they use surgical instruments to complete tasks that are inside of a box, hidden from direct view. They are able to see inside of the box with the help of a "laparoscope" (webcam and flashlight). This engaging activity shows students one application of engineered medical instrumentation and gives them first-hand experience in seeing how form fits function. They also learn that an engineer's job does not end with a finished product because s/he must train others to use the device correctly.

  2. A high resolution Mirnov array for the Mega Ampere Spherical Tokamak

    Science.gov (United States)

    Hole, M. J.; Appel, L. C.; Martin, R.

    2009-12-01

    Over the past two decades, the increase in neutral-beam heating and ? particle production in magnetically confined fusion plasmas has led to an increase in energetic particle driven mode activity, much of which has an electromagnetic signature which can be detected by the use of external Mirnov coils. Typically, the frequency and spatial wave number band of such oscillations increase with increasing injection energy, offering new challenges for diagnostic design. In particular, as the frequency approaches the megahertz range, care must be taken to model the stray capacitance of the coil, which limits the resonant frequency of the probe; model transmission line effects in the system, which if unchecked can produce system resonances; and minimize coil conductive shielding, so as to minimize skin currents which limit the frequency response of the coil. As well as optimizing the frequency response, the coils should also be positioned to confidently identify oscillations over a wide wave number band. This work, which draws on new techniques in stray capacitance modeling and coil positioning, is a case study of the outboard Mirnov array for high-frequency acquisition in the Mega Ampere Spherical Tokamak, and is intended as a roadmap for the design of high frequency, weak field strength magnetic diagnostics.

  3. Commissioning and clinical implementation of a mega-voltage cone beam CT system for treatment localization

    International Nuclear Information System (INIS)

    The improvement in conformal radiotherapy techniques with steep dose gradients has allowed for the delivery of higher doses to a tumor volume while maintaining the sparing of surrounding normal tissue. In this situation, verification of patient setup and evaluation of internal organ motion just prior to radiation delivery is a crucial step. To this end, several volumetric image-guided techniques have been developed for patient localization, such as the Siemens MVision mega-voltage cone beam CT (MV-CBCT) system. In this work, the commissioning and clinical implementation of the MVision system is presented. The geometry and gain calibration procedures for the system are described, and guidelines for quality assurance procedures are provided. Different MV-CBCT clinical protocols, ranging from daily to weekly image-guidance, which includes image acquisition, reconstruction, registration with planning CT, and treatment couch offsets corrections, were commissioned. The image quality characteristics of the MVision system were measured and assessed qualitatively and quantitatively, including the image noise and uniformity, low-contrast resolution, and spatial resolution. Furthermore, the image reconstruction and registration software was evaluated. Data show that a 2 cm large object with 1% electron density contrast can be detected with the MVision system with 10 cGy at isocenter and that the registration software is accurate within 2 mm in the anterior-posterior, left-right, mm in the anterior-posterior, left-right, and superior-inferior directions

  4. Electron spin resonance dating of mega-fauna from Lagoa dos Porcos, Piaui (Brazil))

    International Nuclear Information System (INIS)

    Excavations performed at Lagoa dos Porcos site revealed a vast amount of extinct mammal fossil remains, becoming one of the richest palaeontological occurrences in the Serra da Capivara National Park region, a UNESCO World Heritage. Although anatomic and taxonomic aspects of extinct Quaternary mammals are relatively well known, chronologic information for deposits is rare. In this context, electron spin resonance (ESR) dating of mega-fauna samples provides important information for establishing a chronological background. This work presents the ESR dating of two teeth, one of Gomphotheriidae and other of Toxodontinae. Dose-response curves of each sample were constructed using spectra acquired with a JEOL FA-200 X-Band spectrometer resulting in equivalent dose (De) of 220±40 Gy and 39±2 Gy for Toxodontinae and Gomphotheriidae tooth, respectively. The conversion of De in age was made using ROSY ESR dating software resulting in 26±4 and 22±3 ka. These results place Lagoa dos Porcos fossil assemblage within the Late Pleistocene. These dates overlap with a period of abrupt increase in rainfall in northeast Brazil, and it is possible that this environmental change is related to the formation of this deposit. (authors)

  5. Dense transient plasmas driven by a mega-ampere device in the Chilean Nuclear Energy Commission

    International Nuclear Information System (INIS)

    Recently, the pulse power generator SPEED 2, a medium energy and large current device (187kJ, 4MA, 300kV, 400ns, dI/dt ? 1013 A/s), has been transfered from the Duesseldorf University to the Plasma Physics Group of the Comision Chilena de Energia Nuclear (CCHEN). The SPEED 2 arrived at CCHEN in May 2001 and was in operation in January 2002, being the most powerful device for dense transient plasma in the Southern Hemisphere. Experiments in different Z-pinch configurations using the SPEED 2 generator will be carried out at CCHEN in the future. Possible objectives using the SPEED 2 devices are discussed in this work: a) Neutron flux characteristics from plasma focus discharges operating in D2 (with temporal and spatial resolution) correlated to discharge parameters, plasma dynamics and instabilities. Particular investigation of the effect of insulator surface preparation and conditioning on pinch behavior and neutron yield, b) High brightness and soft X- ray radiation from transient electrical discharges, especially in wire arrays, and c) Magnetic confinement in a quasistatic z-pinch at mega ampere peak current. Plasma dynamics and stability in an original quasi-static z-pinch configuration (a gas embedded compressional Z-pinch) and in a combination scheme that use gas puff and plasma focus will be studied at high current using the SPEED 2 generator. Results about SPEED 2 performance, obtained in Chile, are presented

  6. Experimental studies in mega ampere gas embedded Z-pinch with different initial conditions of preionization

    International Nuclear Information System (INIS)

    New experimental results of the gas embedded z-pinch research program of the Chilean Nuclear Energy Commission are presented. Different initial conditions of preionization are studied by using several geometries for the electrodes in combination with a pulsed laser (10 ns FWMH at 1064 nm). The initial conditions obtained correspond to a hollow plasma column and a coaxial double column. The details of the preionization schemes and the structure of the initial plasma are studied by using a small generator (1.2 ? F, 30 kV, 180 kA in short circuit, 540 J, 300 ns rise time, dI/dt of 6 x 1011 A/s). Thus, experiments at mega ampere currents using deuterium as working gas are driven by the SPEED2 generator (4.1 ? F equivalent Marx generator capacity, 180 kV, 2.5 MA in short circuit, 70 kJ, 400 ns rise time, dI/dt of 1013 A/s). The diagnostics used are: current derivative and voltage signals, neutron detections using silver activation counters, and 3He proportional counters; scintillators with photomultilier; and optical refractive diagnostics (schlieren, shadowgraphy and interferometry), using a pulsed Nd-YAG laser (8 ns FWMH at 532 nm). Neutrons have been detected. The stability of the plasma column and the processes of neutron production (thermonuclear vs. beam-target) are discussed. (author)

  7. Experimental studies in a gas embedded Z-pinch operating at mega amperes currents

    International Nuclear Information System (INIS)

    A gas embedded Z-pinch has been implemented using the SPEED2 generator (4.1 ?F equivalent Marx generator capacity, 300 kV, 4 MA in short circuit, 187 kJ, 400 ns rise time, dI/dt ? 1013 A/s). Initial conditions to produce a gas embedded Z-pinch suitable to be driven by the SPEED2 and with enhanced stability by means of resistive effects and by finite Larmor radius effects were obtained using a 0-D model. Thus, electrodes were constructed in order to obtain a double column Z-pinch and a hollow discharge. Experiments were carried out in deuterium at mega amperes currents. The diagnostics used are: current derivative and voltage signals, neutron detections using silver activation counters, and He3 detectors; scintillators with photomultilier; and interferograms using a pulse Nd-YAG laser (8 ns FWMH at 532 nm). A plasma column apparently stable is obtained and neutrons have been detected. (author)

  8. A Miocene hyperdiverse crocodylian community reveals peculiar trophic dynamics in proto-Amazonian mega-wetlands.

    Science.gov (United States)

    Salas-Gismondi, Rodolfo; Flynn, John J; Baby, Patrice; Tejada-Lara, Julia V; Wesselingh, Frank P; Antoine, Pierre-Olivier

    2015-04-01

    Amazonia contains one of the world's richest biotas, but origins of this diversity remain obscure. Onset of the Amazon River drainage at approximately 10.5 Ma represented a major shift in Neotropical ecosystems, and proto-Amazonian biotas just prior to this pivotal episode are integral to understanding origins of Amazonian biodiversity, yet vertebrate fossil evidence is extraordinarily rare. Two new species-rich bonebeds from late Middle Miocene proto-Amazonian deposits of northeastern Peru document the same hyperdiverse assemblage of seven co-occurring crocodylian species. Besides the large-bodied Purussaurus and Mourasuchus, all other crocodylians are new taxa, including a stem caiman-Gnatusuchus pebasensis-bearing a massive shovel-shaped mandible, procumbent anterior and globular posterior teeth, and a mammal-like diastema. This unusual species is an extreme exemplar of a radiation of small caimans with crushing dentitions recording peculiar feeding strategies correlated with a peak in proto-Amazonian molluscan diversity and abundance. These faunas evolved within dysoxic marshes and swamps of the long-lived Pebas Mega-Wetland System and declined with inception of the transcontinental Amazon drainage, favouring diversification of longirostrine crocodylians and more modern generalist-feeding caimans. The rise and demise of distinctive, highly productive aquatic ecosystems substantially influenced evolution of Amazonian biodiversity hotspots of crocodylians and other organisms throughout the Neogene. PMID:25716785

  9. Deep imaging of the shell elliptical galaxy NGC3923 with MegaCam

    CERN Document Server

    Bílek, Michal; Gwyn, Stephen; Ebrová, Ivana; Bartošková, Kate?ina; Jungwiert, Bruno; Jílková, Lucie

    2015-01-01

    Context. The elliptical galaxy NGC 3923 is known to be surrounded by a number of stellar shells, a probable remnant of an accreted galaxy. Despite its uniqueness, the deepest images of its outskirts come from the 80s. B\\'{i}lek et al. (2014) predicted a new shell to lie in this region on the basis of the MOND theory of modified dynamics. Aims. To obtain the deepest image ever of the galaxy and to map the tidal features in it. Methods. The image of the galaxy was taken by the MegaCam camera at the Canada-France-Hawaii Telescope in the $g'$ band. It reached the surface-brightness limit of 29 mag arcsec$^{-2}$. Moreover, we reanalyze an archival HST image of the galaxy. Results. We detected up to 42 shells in NGC 3923. This is by far most of all galaxies. We present the description of the shells and other tidal features in the galaxy. A probable progenitor of some of these features was discovered. The shell system likely originates from two or more progenitors. The predicted shell was not detected, but we found ...

  10. Caribou, individual-based modeling and mega-industry in central West Greenland

    DEFF Research Database (Denmark)

    Raundrup, Katrine; Nymand, Josephine

    Spatial distribution of caribou (Rangifer tarandus groenlandicus) in West Greenland is a result of both short and long term changes in the Arctic landscape. To understand present distribution 40 satellite collars were deployed on 40 female caribou in the Akia-Maniitsoq herd, central West Greenland in 2008. The collars provided GPS-positions with 1-3-hours intervals hence giving detailed information on the spatial distribution of the animals. The detailed information prompt opportunities to introduce statistical models to enhance the understanding of causal effects on the distribution of the caribou in West Greenland. In a newly started PhD-project the focus will be the implementation of spatially explicit individual based modeling (IBM). The project relies on existing knowledge on caribou behavior and feeding ecology along with data on variations in the vegetation. By relating vegetation, snow distribution and caribou in a realistic but manipulable “virtual world” of an IBM it is possible to examine the plausible effects of different environmental impacts on the population dynamics of caribou in West Greenland. The simulations will include introduction of mega-industry, roads, and transmission lines in an area. Further, enhanced or lowered hunting pressure, and changed weather conditions can be studied using IBM. Thus, both short and long term changes in the landscape will be studied and provide insights in how the specific spatial changes impact caribou in West Greenland.

  11. Toroidal ripple transport of beam ions in the mega-ampere spherical tokamak

    Energy Technology Data Exchange (ETDEWEB)

    McClements, K. G. [EURATOM/CCFE Fusion Association, Culham Science Centre, Abingdon, Oxfordshire OX14 3DB (United Kingdom); Hole, M. J. [Plasma Research Laboratory, Research School of Physical Science and Engineering, Australian National University, Canberra, ACT 0200 (Australia)

    2012-07-15

    The transport of injected beam ions due to toroidal magnetic field ripple in the mega-ampere spherical tokamak (MAST) is quantified using a full orbit particle tracking code, with collisional slowing-down and pitch-angle scattering by electrons and bulk ions taken into account. It is shown that the level of ripple losses is generally rather low, although it depends sensitively on the major radius of the outer midplane plasma edge; for typical values of this parameter in MAST plasmas, the reduction in beam heating power due specifically to ripple transport is less than 1%, and the ripple contribution to beam ion diffusivity is of the order of 0.1 m{sup 2} s{sup -1} or less. It is concluded that ripple effects make only a small contribution to anomalous transport rates that have been invoked to account for measured neutron rates and plasma stored energies in some MAST discharges. Delayed (non-prompt) losses are shown to occur close to the outer midplane, suggesting that banana-drift diffusion is the most likely cause of the ripple-induced losses.

  12. Particle confinement of pellet-fuelled H-mode plasmas in the Mega Ampere Spherical Tokamak

    Science.gov (United States)

    Valovi?, M.; Axon, K.; Garzotti, L.; Saarelma, S.; Thyagaraja, A.; Akers, R.; Gurl, C.; Kirk, A.; Lloyd, B.; Maddison, G. P.; Patel, A.; Shibaev, S.; Scannell, R.; Taylor, D.; Walsh, M.; MAST Team

    2008-07-01

    This paper quantifies the particle confinement of pellet-fuelled plasmas in the Mega Ampere Spherical Tokamak (MAST). The dataset is restricted mostly to neutral beam heated plasmas and to shallow pellets launched from the high field side. It is shown that the pellet deposition can be explained only by invoking the ?B drift of the pellet ablatant. The pellet creates a zone with positive density gradient and increased temperature gradient. Simulations show that these changes could increase the level of micro-turbulence and thus enhance further the penetration of pellet-deposited particles towards the core. Post-pellet dynamics of the density profile is characterised by the pellet retention time ?pel. It is shown that ?pel correlates with the status of the edge transport barrier (L-mode or H-mode) and decreases rapidly for pellet deposition radius rpel approaching the plasma edge. For ELMy H-mode and ITER-like pellets, rpel ? 0.8a, the pellet retention time is about 20% of the energy confinement time. The fuelling requirement by the pellets for ITER is discussed.

  13. A review of plasma boundary phenomena in the mega ampere spherical tokamak

    International Nuclear Information System (INIS)

    Enhanced diagnostics and an expanded operational space in Mega Ampere Spherical Tokamak (MAST) has lead to a wealth of data on the plasma boundary becoming available over the last year of operations and has significantly advanced the understanding of this region in the spherical tokamak and, more generally, is contributing to an improved understanding of the underlying plasma phenomena for this important region of the tokamak. Amongst the observations reported in this paper are that MAST is able to achieve simultaneous high confinement and high density with Type III ELMs for connected double-null discharges in which most (>93%) of the power efflux from the core observed at the targets (including during ELMs) arrives at the large wetted area outboard targets and is evenly distributed between the upper and lower divertor regions. Significant particle fluxes are reported well beyond the outboard separatrix during ELMs (up to 20 cm distant from the plasma) and appear to be associated with the radial expansion of a localised structure at around 1 km s-1. The result of preliminary experiments to broaden the SOL by asymmetric divertor biasing are also presented which show an encouraging, qualitative agreement with theory and demonstrate clear evidence for both SOL broadening and target power reduction

  14. Dolicomegarterias ilíacas.: Presentación de un caso. / Iliac mega-dolicho arteries: Presentation of a case

    Scientific Electronic Library Online (English)

    Yariana, Martínez Sánchez; Enélida, Matos Abrahantes; Juliana M, Tarajano Márquez; Jacqueline, Ramos Serpa; José Antonio, Rodríguez González.

    2010-02-01

    Full Text Available Las anomalías del árbol vascular son comunes. Los aneurismas aislados de las arterias ilíacas son de observación bastante rara. Representan un porcentaje escaso de las distintas estadísticas y a menudo se resalta su aislamiento, precisamente para recordar su rareza. Reportamos un caso masculino, de [...] 74 años de edad, que asistió a consulta por presentar síntomas urinarios. Se le realizó un ultrasonido de abdomen, observándose hidronefrosis renal bilateral moderada, además masas complejas una en cada fosa ilíaca. Se le indicó Tomografía Axial Computarizada de abdomen, donde se confirmó la hidronefrosis renal bilateral y aneurismas de ambas arterias ilíacas. Se completó el estudio con un Angiotac, y se demostró que ambas ilíacas estaban tortuosas y dilatadas (DOLICOMEGARTERIAS). Abstract in english Vascular tree anomalies are common. Iliac arteries isolated aneurisms are very unusual. They represent an scarce percent of the different statistics and their isolation is frequently highlighted, precisely to recollect their rareness.We report the case of a male, 74-years-old patient, assisting the [...] consultation with urinary symptoms. An abdominal ultrasound was made, showing moderated bilateral renal hydronephrosis and also complex masses in each iliac fosse. An abdomen computed axial tomography was indicated, confirming the bilateral renal hydronephrosis and aneurisms in both iliac arteries. The study was completed with an Angiotac and it was demonstrated that both iliac arteries were tortuous and dilated ( Mega-dolicho arteries ).

  15. Observational study of aerosol hygroscopic growth factors over rural area near Beijing mega-city

    Directory of Open Access Journals (Sweden)

    X. L. Pan

    2009-02-01

    Full Text Available We investigated aerosol hygroscopic growth property and its influence on scattering coefficient using M9003 nephelometers in coupling with a relative humidity controlled inlet system at a rural site near Beijing mega-city (Jingjintang from 24th April to15th May 2006. Inlet relative humidity was controlled in an increasing range of 40%–90% while the aerosol hygroscopic growth factor, f(RH=80%, varied in a range of 1.07–2.35 during the measurement. Estimated periodic mean values of aerosol hygroscopic growth factors are 1.27–1.34, 1.17–1.23, 1.55–1.59 and 2.33–2.48 for clean, dust, urban pollution and mixed pollution periods respectively. An examination of chemical composition of daily filter samples highlighted that aerosol hygroscopicity was generally enhanced with the increasing ratio of ammonium sulfate (AS to organic matter (OMC. Furthermore, strong hygroscopic organic aerosols were observed on 11th (f(RH=80%=2.23 and 15th (f(RH=80%=2.21 of May with organic carbon proportions of PM2.1 reaching 42.3% and 43.0% respectively. Back-trajectory analysis indicated that solar radiation and vertical convective movement along the air mass pathway might strongly influence the hygroscopic properties of organic matter.

  16. A high resolution Mirnov array for the Mega Ampere Spherical Tokamak

    International Nuclear Information System (INIS)

    Over the past two decades, the increase in neutral-beam heating and ? particle production in magnetically confined fusion plasmas has led to an increase in energetic particle driven mode activity, much of which has an electromagnetic signature which can be detected by the use of external Mirnov coils. Typically, the frequency and spatial wave number band of such oscillations increase with increasing injection energy, offering new challenges for diagnostic design. In particular, as the frequency approaches the megahertz range, care must be taken to model the stray capacitance of the coil, which limits the resonant frequency of the probe; model transmission line effects in the system, which if unchecked can produce system resonances; and minimize coil conductive shielding, so as to minimize skin currents which limit the frequency response of the coil. As well as optimizing the frequency response, the coils should also be positioned to confidently identify oscillations over a wide wave number band. This work, which draws on new techniques in stray capacitance modeling and coil positioning, is a case study of the outboard Mirnov array for high-frequency acquisition in the Mega Ampere Spherical Tokamak, and is intended as a roadmap for the design of high frequency, weak field strength magnetic diagnostics.

  17. Experimental studies in a gas embedded Z-pinch operating at mega amperes currents

    International Nuclear Information System (INIS)

    A gas embedded Z-pinch has been implemented using the SPEED2 generator (4.1 ?F equivalent Marx generator capacity, 300 kV, 4 MA in short circuit, 187 kJ, 400 ns rise time, dI/dt?1013 A/s). Initial conditions to produce a gas embedded Z-pinch suitable of be driven by the SPEED2 and with enhanced stability by means of resistive effects and by finite Larmor radius effects were obtained using a 0-D model. Thus, electrodes were constructed in order to obtain a double column Z-pinch and a hollow discharge. Experiments were carried out in deuterium at mega amperes currents. The diagnostics used are: current derivative and voltage signals, neutron detections using silver activation counters, and 3He detectors; scintillators with photomultiplier; and interferograms using a pulse Nd-YAG laser (8ns FWMH at 532nm). Optical diagnostics show an apparently stable plasma column and a density of 1024m-3 was obtained on the axis at 300ns since the initiation of the discharge. Neutrons have been detected in the 3He detectors. (author)

  18. Photon detector for MEGA: Progress report, July 15, 1987-July 15, 1988

    International Nuclear Information System (INIS)

    Last October and November, we had prototype runs at LAMPF to test our designs and to confirm the background and trigger rates predicted by our Monte Carlo studies. Since these two runs, our hardware efforts have been directed toward beginning mass production of the detector elements. In parallel, we have been continuing our pattern recognition efforts, pointing toward the goal of having subroutines ready for the intelligent, second-stage trigger by this coming fall. During October, our group carried out an experiment on a prototype detector in the LAMPF Test Channel which allowed us to study the performance of our scintillators, light guides, phototubes, and electronics in a well-controlled environment. This was followed in November by the first major prototype run inside the MEGA solenoid at the LAMPF Stopped Muon Channel (SMC). For this run, we fabricated a plane of 12 scintillators, each 1 x 5 x 180 cm3, together with Al and lucite sheets whose thicknesses were chosen to reproduce the mass and radiation lengths that will be present in the real photon detector

  19. Assessment of injury from the MEGA BORG oil spill: A case of cooperative damage assessment

    International Nuclear Information System (INIS)

    The tanker MEGA BORG exploded while lightering about 60 miles offshore of Galveston, Texas on 8 June 1990. The explosion was followed by a spectacular fire and major release of Angolan crude. Up to 5.1 million gallons of the 41 million gallon cargo was lost to the sea or burning over a period of seven days. Vessel interests took responsibility for the spill and employed skimming and dispersive cleanup techniques. It is estimated that approximately 126 gallons ultimately reached shore in western Louisiana. Within a day of the explosion, the Norwegian vessel owner, French cargo owner and the Norwegian vessel insurer entered into discussion with the Texas Water Commission and the National Oceanic and Atmospheric Administration regarding damage assessment options. Within the next two days the owners agreed to fund and participate in a cooperative preliminary assessment of environmental injury. Five projects were funded to determine whether there was sufficient injury to justify the completion of a full natural resource damage assessment: (1) Fate of spilled oil; (2) Effects on shrimp fishery; (3) Effects on marine mammals and turtles; (4) Effects of beach oiling and (5) Effects on recreation. Funds were also provided for report preparation and project management. Several issues of major concern were considered by vessel interests prior to agreement. Many of these issues are common to consideration of cooperative assessments and may be critical importance to future incideny be critical importance to future incidents particularly if the damage assessment regulations developed pursuant to the Oil Pollution Act encourage cooperative responses

  20. Scandinavian links : Mega bridges/tunnels linking the scandinavian peninsula to the european continent

    DEFF Research Database (Denmark)

    Matthiessen, Christian Wichmann; Knowles, Richard D.

    2014-01-01

    The European Round Table of Industrialists identified in the 1980ies 14 missing links in the transportation network of the continent. Three of them were found around the Danish island of Zealand. One link is within the nation, the other two are between nations. One link connects heavy economic centres, one joins more thinly populated regions, and the last one links peripheral areas. Two of them (The Great Belt Link and the Oresund Link) have been constructed and are in full operation. The third (the Fehmarnbelt Link) has been decided 2008 on bilateral government level. The three links are impressive mega structures spanning international waterways. These waterways between the Baltic Sea and the North Sea have played major roles in history. The length of each of the crossings are around 20 km. The fixed links closes gaps between the Scandinavian and European motorway and rail networks. They concentrate traffic flows and create strong transport corridors. They are the basis of new regional development regimes.“Ferries connect systems, fixed links unite systems”.

  1. How soon would the next mega-earthquake occur in Japan?

    Directory of Open Access Journals (Sweden)

    Alexey Lyubushin

    2013-08-01

    Full Text Available The problem of seismic danger estimate in Japan after Tohoku mega-earthquake 11 March of 2011 is considered. The estimates are based on processing low-frequency seismic noise wave-forms from broadband network F-net. A new method of dynamic estimate of seismic danger is used for this problem. The method is based on calculating multi-fractal properties and minimum entropy of squared orthogonal wavelet coefficients for seismic noise. The analysis of the data using notion of “spots of seismic danger” shows that the seismic danger in Japan remains at high level after 2011. 03. 11 within north-east part of Philippine plate—at the region of Nankai Though which traditionally is regarded as the place of strongest earthquakes. It is well known that estimate of time moment of future shock is the most difficult problem in earthquake prediction. In this paper we try to find some peculiarities of the seismic noise data which could extract future danger time interval by analogy with the behavior before Tohoku earthquake. Two possible precursors of this type were found. They are the results of estimates within 1-year moving time window: based on correlation between 2 mean multi-fractal parameters of the noise and based on cluster analysis of annual clouds of 4 mean noise parameters. Both peculiarities of the noise data extract time interval 2013-2014 as the danger.

  2. Liquid Metal Angiography for Mega Contrast X-ray Visualization of Vascular Network

    CERN Document Server

    Wang, Qian; Pan, Keqin; Liu, Jing

    2013-01-01

    Visualizing the anatomical vessel networks plays a vital role in physiological or pathological investigations. However, identifying the fine structures of the smallest capillary vessels via conventional imaging ways remains a big challenge. Here, the room temperature liquid metal angiography was proposed for the first time to produce mega contrast X-ray images for multi-scale vasculature mapping. Gallium was used as the room temperature liquid metal contrast agent and perfused into the vessels of in vitro pig hearts and kidneys. We scanned the samples under X-ray and compared the angiograms with those obtained via conventional contrast agent--the iohexol. As quantitatively proved by the gray scale histograms, the contrast of the vessels to the surrounding tissues in the liquid metal angiograms is orders higher than that of the iohexol enhanced images. And the resolution of the angiograms has reached 100{\\mu}m, which means the capillaries can be clearly distinguished in the liquid metal enhanced images. With t...

  3. A case with oto-spondylo-mega-epiphyseal-dysplasia (OSMED): the clinical recognition and differential diagnosis.

    Science.gov (United States)

    Karaer, Kadri; Rosti, Rasim Ozgür; Torun, Deniz; Sanal, Hatice Tuba; Bahçe, Muhterem; Güran, Sefik

    2011-01-01

    The oto-spondylo-mega-epiphyseal-dysplasia (OSMED) phenotype is an autosomal recessive trait that is a skeletal dysplasia with the hallmark findings of limb shortening, multiple skeletal and radiological abnormalities, mid-face hypoplasia with a flat nasal bridge, small upturned nasal tip, and sensorineural hearing loss. A 3.5-year-old girl born to consanguineous Turkish parents had characteristic facial features at birth: mid-face hypoplasia, mild hypertelorism, upslanting palpebral fissures, prominent supraorbital ridges, depressed nasal bridge, small upturned nasal tip, long philtrum, and micrognathia. Radiological examination at three years of age revealed large flaring metaphyses and wide flat epiphyses. The humerus and femur showed the characteristic dumbbell shape. She had bilateral hearing loss with no ophthalmologic findings. There is continuing debate over the clinical overlap and differential diagnosis of OSMED syndrome. The patient was examined considering Weissenbacher-Zweymuller, Stickler type 3, Marshall syndrome, and Kniest dysplasia as possible differential diagnoses. We believe that the presented patient clinically manifested features of OSMED syndrome. We would like to point out that the management of OSMED calls for a coordinated multidisciplinary approach. PMID:21980822

  4. Sustainable urban transport indicators: tool for evaluating transport sustainability in the mega cities of Pakistan

    International Nuclear Information System (INIS)

    Urban Transport is an important sector to accomplish the goal of sustainable development in Pakistan. This is important because of the high growth of the transport sector's energy consumption, road crashes and greenhouse gas emissions. This becomes significant in the Pakistani cities where motor vehicle fleet is growing at two to three times the rate of population. Transport Policies has resulted high growth of urban road traffic, increasing air and noise pollution throughout the country. This situation raised the question how to achieve sustainable urban transport in the mega cities of Pakistan? Development of sustainable urban transport indicators will provide an opportunity to analyze current transport policies to assess Pakistan progress towards or away from sustainability. Medium Term Development Framework (2005-10) has selected to analyze against establish sustainable urban transport indicators for Pakistan. On the basis of analysis, it has found that MWF has tried to address transport problem in a piecemeal manner, rather than adopting a holistic approach. Implementing MTDF policies on transport is not fully matched with a long term commitment to achieving sustainable development in Pakistan. (author)

  5. Physico-chemical characteristics of Jharkhand and West Bengal thermal springs along SONATA mega lineament, India

    Science.gov (United States)

    Singh, Hemant K.; Chandrasekharam, D.; Vaselli, O.; Trupti, G.; Singh, B.; Lashin, Aref; Arifi, Nassir Al

    2015-03-01

    The chemical and isotopic compositions of thermal springs located along the Son-Narmada-Tapti (SONATA) mega lineament in central India have been investigated. The issuing temperatures of the thermal waters vary from 31° to 89°C for the thermal springs and 24° to 25°C for the cold springs. These thermal springs are located on the Archean Chotanagpur Gneissic Complex (CGC) in the eastern part of peninsular India. The thermal springs are mostly alkaline in nature with pH varying from 7.5 to 9.5. Piper diagram suggests that the chemistry of the thermal waters is compatible with the granitic host rocks through which the waters circulate. Mineral saturation index suggests that the thermal waters are saturated with cristobalite and quartz at lower temperatures (less than ˜130 to 150°C), and calcite and forsterite at higher temperatures (˜160° to 250°C). The estimated reservoir temperature based on chemical geothermometers is in the range of 132°-265°C, which favours a medium enthalpy geothermal system. Oxygen isotope fractionation of Bakreswar and Tantloi thermal springs highlights a higher reservoir temperature than estimated by chemical geothermometer. Positive gravity anomalies over Bakreswar and Tantloi areas strongly suggest a basement/mantle upliftment or mafic intrusion which could account for the heat source close to the surface. However, the large negative gravity anomaly depression around the Surajkund and Katkamsandi thermal springs indicates presence of deep seated faults.

  6. 24 CFR 902.52 - Distribution of survey to residents.

    Science.gov (United States)

    2010-04-01

    ...4: Resident Service and Satisfaction § 902.52 Distribution of survey to residents...receive the Resident Service and Satisfaction... (b) Survey distribution by third party... The Resident Service and...

  7. Molecular and population analyses of a recombination event in the catabolic plasmid pJP4.

    Science.gov (United States)

    Larraín-Linton, Juanita; De la Iglesia, Rodrigo; Melo, Francisco; González, Bernardo

    2006-10-01

    Cupriavidus necator JMP134(pJP4) harbors a catabolic plasmid, pJP4, which confers the ability to grow on chloroaromatic compounds. Repeated growth on 3-chlorobenzoate (3-CB) results in selection of a recombinant strain, which degrades 3-CB better but no longer grows on 2,4-dichlorophenoxyacetate (2,4-D). We have previously proposed that this phenotype is due to a double homologous recombination event between inverted repeats of the multicopies of this plasmid within the cell. One recombinant form of this plasmid (pJP4-F3) explains this phenotype, since it harbors two copies of the chlorocatechol degradation tfd gene clusters, which are essential to grow on 3-CB, but has lost the tfdA gene, encoding the first step in degradation of 2,4-D. The other recombinant plasmid (pJP4-FM) should harbor two copies of the tfdA gene but no copies of the tfd gene clusters. A molecular analysis using a multiplex PCR approach to distinguish the wild-type plasmid pJP4 from its two recombinant forms, was carried out. Expected PCR products confirming this recombination model were found and sequenced. Few recombinant plasmid forms in cultures grown in several carbon sources were detected. Kinetic studies indicated that cells containing the recombinant plasmid pJP4-FM were not selectable by sole carbon source growth pressure, whereas those cells harboring recombinant plasmid pJP4-F3 were selected upon growth on 3-CB. After 12 days of repeated growth on 3-CB, the complete plasmid population in C. necator JMP134 apparently corresponds to this form. However, wild-type plasmid forms could be recovered after growing this culture on 2,4-D, indicating that different plasmid forms can be found in C. necator JMP134 at the population level. PMID:16980481

  8. Novel assay to measure the plasmid mobilizing potential of mixed microbial communities

    DEFF Research Database (Denmark)

    Klümper, Uli; Droumpali, Ariadni

    2014-01-01

    Mobilizable plasmids lack necessary genes for complete conjugation and are therefore non-self-transmissible. Instead, they rely on the conjugation system of conjugal plasmids to be horizontally transferred to new recipients. While community permissiveness, the fraction of a mixed microbial community that can receive self-transmissible conjugal plasmids, has been studied, the intrinsic ability of a community to mobilize plasmids that lack conjugation systems is unexplored. Here, we present a novel framework and experimental method to estimate the mobilization potential of mixed communities. We compare the transfer frequency of a mobilizable plasmid to that of a mobilizing and conjugal plasmid measured for a model strain and for the assayed community. With Pseudomonas putida carrying the gfp-tagged mobilizable RSF1010 plasmid as donor strain, we conducted solid surface mating experiments with either a P. putida strain carrying the mobilizing plasmid RP4 or a model bacterial community that was extracted from theinner walls of a domestic shower conduit. Additionally, we estimated the permissiveness of the same community for RP4 using P. putida as donor strain. The permissiveness of the model community for RP4 (at 1.16x10-4 transconjugants per recipient (T/R)) was similar to that previously measured for soil microbial communities. RSF1010 was mobilized by the model community at a frequency of 1.16x10-5 T/R, only one order of magnitude lower than its permissiveness to RP4. This mobilization frequency is unexpectedly high considering that (i) mobilization requires the presence of mobilizing conjugal plasmids within the permissive fraction of the recipients; (ii) in pure culture experiments with P. putida retromobilization of RSF1010 through RP4 only took place in approximately half of the donors receiving the conjugal plasmid in the first step. Further work is needed to establish how plasmid mobilization potential varies within and across microbial communities.

  9. Sequence analysis and characterization of two cryptic plasmids derived from Lactobacillus buchneri CD034.

    Science.gov (United States)

    Heinl, Stefan; Spath, Katharina; Egger, Esther; Grabherr, Reingard

    2011-09-01

    Lactobacillus buchneri is probably the most beneficial microorganism for efficient preservation of animal feed silages made from grass, maize and other plant material against aerobic spoilage. Its obligatory heterofermentative nature, acid resistance and robustness have drawn attention to this species for applications as silage starter culture as well as for genetic engineering. For the first time, two cryptic plasmids present in the same L. buchneri strain, L. buchneri CD034, were isolated, sequenced and characterized. The larger plasmid, designated pCD034-1 was found to be 3424 bp in length with a G+C content of 38.36%. The smaller plasmid, designated pCD034-2 was found to be 2707 bp in length with a G+C content of 38.60%. On both plasmids we predicted three open reading frames. On pCD034-1, ORF 1 encodes a putative replication protein which shares 99% identity with the RepA protein of a Lactobacillus plantarum derived pC194/pUB110-family plasmid. ORF 2 encodes a putative protein of unknown function. ORF 1 and ORF 2 of pCD034-2 correspond to RepA and RepB proteins similar to those of plasmid pLB4 from L. plantarum. ORF 3 of both plasmids encodes a putative mobilization protein similar to that of the pediococcal plasmid pF8801. Double strand origins, putative single strand origins and typical mobilization start signals were identified. Both plasmids were shown to be maintained at relatively high plasmid copy numbers. Two shuttle vectors carrying the origins of replication of pCD034-1 and pCD034-2 were constructed and used to successfully transform two other species isolated from the same environment. Hence, we consider the two novel L. buchneri plasmids a valuable resource for the generation of shuttle and expression vectors for LAB. PMID:21907734

  10. Antibacterial and Plasmid Curing Activity of Lactic Acid Bacteria against Multidrug Resistant Bacteria Strains

    Directory of Open Access Journals (Sweden)

    Nehal El-Deeb

    2015-01-01

    Full Text Available Multiple Drug Resistance (MDR is a serious health problem and major challenge to global drug discovery programs. Most of the genetic determinants that confer resistance to antibiotics are located on plasmids in bacteria. The present investigation was undertaken to investigate the antibacterial effect and the ability of extra- and intra-cellular extracts of Lactic Acid Bacteria (LAB to cure plasmid acquiring resistance in certain clinical antibiotic-resistant bacterial isolates (Pseudomonas aeruginosa, Staphylococcus aureus, Klebsiella pneumoniae and Shigella sp.. Transformation experiments were carried out using clinical isolates as plasmid donor and Escherichia coli strain HB101 (sensitive to the tested antibiotic, as recipient. Minimal Inhibitory Concentration (MIC of LAB extracts was determined using the microtiter plate method. Plasmid curing activity of LAB extracts was determined by evaluating the inability of bacterial colonies (pre-treated with LAB extract for 18 h to grow in the presence of antibiotics. The physical loss of plasmid DNA in the cured derivatives was further confirmed by agarose gel electrophoresis. The LAB showed antibacterial effect, inhibited up to 90% of bacterial biofilm formation and cured the pathogenic bacteria from plasmids. The presence of plasmid in transformants was confirmed through electrophoresis and the transformants were also tested for each antibiotic resistance already recorded for the donor isolates. Both extracts (extra-and intra-cellular extracts inhibited the growth of the clinical isolates. Extracellular extracts exceeded 90% inhibition on some isolates. The LAB extract mediated plasmid curing resulted in the subsequent loss of antibiotic (Chl, Dox, Ery, Gm, Kaf, Lin and Pen resistance encoded in the plasmids as revealed by antibiotic resistance profile of cured strains. The extracellular extract of LAB may be a source of anti-plasmid (plasmid borne multiple antibiotic resistance agents of natural origin.

  11. Analysis of plasmid DNA synthesis by double tracer method

    International Nuclear Information System (INIS)

    An Escherichia coli strain, CR34, harboring both pSC101 and ColEl-amp plasmids was exposed to media containing rifampicin (100 ?g/ml) and/or chloramphenicol (180 ?g/ml) and the cells were labeled for 20 min with 3H-thymine at 3,25 and 50 min after exposure to drug(s). The plasmid DNA synthesis was assayed by DNA-DNA hybridization with 14C-labeled pSC134 DNA as internal marker. In the presence of rifampicin, the replication of pSC 101 was from 57 to 104% that in its absence, and that of ColEl-amp was from 17 to 26%. The DNA replication of pSC101 after addition of chloramphenicol was reduced to 35 to 75%, and that of ColEl-amp was reduced to 39% and then restored to 92%. This restoration was not observed in the presence of rifampicin. (author)

  12. Partition locus-based classification of selected plasmids in Klebsiella pneumoniae, Escherichia coli and Salmonella enterica spp.: an additional tool.

    Science.gov (United States)

    Bousquet, A; Henquet, S; Compain, F; Genel, N; Arlet, G; Decré, D

    2015-03-01

    The dissemination of antimicrobial resistance genes in Enterobacteriaceae has been largely attributed to plasmids, circular DNA molecules capable of autonomous replication. Whereas high-copy-number plasmids primarily rely on passive diffusion for plasmid maintenance, low-copy-number plasmids utilize so-called partition (par) systems. Plasmid partition relies on three structures, i.e. a centromere like DNA site, a centromere-binding protein and an ATPase or a GTPase motor protein for plasmid positioning. Identification and classification of plasmids is essential for tracing plasmids conferring drug resistance. PCR-based replicon typing is currently the standard method for plasmid identification but there are new classification schemes, especially the relaxase gene typing (PRaseT). Here we developed a multiplex PCR set targeting par loci found on the plasmids most frequently encountered in Enterobacteriaceae. This method, called "plasmid partition gene typing" (PAR-T), was validated with 136 transconjugants or transformants harboring various replicon types. The method was tested with 30 multidrug-resistant clinical isolates including Escherichia coli, Klebsiella pneumoniae and Salmonella enterica subsp. enterica carrying 1-4 replicons; all replicons were tested in parallel with PRaseT for comparison. Six multiplex PCRs and one simplex PCR including 18 pairs of primers recognized plasmids of groups IncA/C, FIA, FIB, FIC, FIIk, FII, HI1, HI2, I1, L/M, N, X. Our set of multiplex PCRs showed high specificity for the classification of resistance plasmids except for IncX replicons. PMID:25623509

  13. Home visits in family medicine residency

    Science.gov (United States)

    Jakubovicz, Difat; Srivastava, Anita

    2015-01-01

    Abstract Problem addressed There has been a decline in family physicians providing home visits to housebound patients. Objective of program To increase family medicine residents’ exposure to home visits; their comfort and skills in providing home visits; and their willingness to provide home visits after graduation. Program description Between 2000 and 2010, each family practice resident at St Joseph’s Health Centre Family Medicine Teaching Unit in Toronto, Ont, was assigned at least 1 housebound patient to care for longitudinally over 2 years; the rationale for this was to increase the sense of “ownership” and responsibility among residents for their assigned homebound patients. Starting in 2003, until the program’s conclusion in 2010, residents were asked to fill out surveys before and after the program to assess their comfort with and confidence in providing home visits, as well as their satisfaction with the program. Survey responses were analyzed for changes over the course of residency training. A total of 85 residents completed the home visit teaching program between 2003 and 2010 inclusive. Conclusion While residents’ willingness to provide home visits did not increase over the course of residency, their confidence in making housecalls did increase. There was also a trend toward increased confidence among residents in working with community agencies. Thus, having home visit patients be a part of resident practices might play an important role in increasing the likelihood that future family physicians will continue to care for their patients when those patients are no longer ambulatory.

  14. Linear plasmid SLP2 is maintained by partitioning, intrahyphal spread, and conjugal transfer in Streptomyces.

    Science.gov (United States)

    Hsu, Chin-Chen; Chen, Carton W

    2010-01-01

    Low-copy-number plasmids generally encode a partitioning system to ensure proper segregation after replication. Little is known about partitioning of linear plasmids in Streptomyces. SLP2 is a 50-kb low-copy-number linear plasmid in Streptomyces lividans, which contains a typical parAB partitioning operon. In S. lividans and Streptomyces coelicolor, a parAB deletion resulted in moderate plasmid loss and growth retardation of colonies. The latter was caused by conjugal transfer from plasmid-containing hyphae to plasmidless hyphae. Deletion of the transfer (traB) gene eliminated conjugal transfer, lessened the growth retardation of colonies, and increased plasmid loss through sporulation cycles. The additional deletion of an intrahyphal spread gene (spd1) caused almost complete plasmid loss in a sporulation cycle and eliminated all growth retardation. Moreover, deletion of spd1 alone severely reduced conjugal transfer and stability of SLP2 in S. coelicolor M145 but had no effect on S. lividans TK64. These results revealed the following three systems for SLP2 maintenance: partitioning and spread for moving the plasmid DNA along the hyphae and into spores and conjugal transfer for rescuing plasmidless hyphae. In S. lividans, both spread and partitioning appear to overlap functionally, but in S. coelicolor, spread appears to play the main role. PMID:19880600

  15. Cloning, sequencing, and sequence analysis of two novel plasmids from the thermophilic anaerobic bacterium Anaerocellum thermophilum

    DEFF Research Database (Denmark)

    Clausen, Anders; Mikkelsen, Marie Just

    2004-01-01

    The nucleotide sequence of two novel plasmids isolated from the extreme thermophilic anaerobic bacterium Anaerocellum thermophilum DSM6725 (A. thermophilum), growing optimally at 70degreesC, has been determined. pBAS2 was found to be a 3653 bp plasmid with a GC content of 43%, and the sequence revealed 10 open reading frames (ORFs). The two largest of these, namely Orf21 and Orf41, showed similarity to a Bacillus plasmid recombinase and a Pseudoalteromonas plasmid replication protein, respectively. A sequence with homology to double stranded replication origins from rolling circle plasmids was found, but no single stranded intermediates, characteristic of rolling circle replication, were found on Southern blots. The larger plasmid, pBAL, was found to be a 8294 bp plasmid with a GC content of 39%. It revealed 17 ORFs, of which three showed similarity at the amino acid (aa) level to known proteins. Orf22 showed the strongest similarity (33% aa) to replication proteins from large multiresistance Staphylococcal and Lactococcal plasmids, all of which are believed to replicate via a theta-like replication mechanism. Orf32 showed similarity to both DNA repair proteins and DNA polymerases with highest similarity to DNA repair protein from Campylobacter jejuni (25% aa). Orf34 showed similarity to sigma factors with highest similarity (28% aa) to the sporulation specific Sigma factor, Sigma 28(K) from Bacillus thuringiensis.

  16. Efficient transformation of Amycolatopsis orientalis (Nocardia orientalis) protoplasts by Streptomyces plasmids.

    OpenAIRE

    Matsushima, P.; Mchenney, M. A.; Baltz, R. H.

    1987-01-01

    Conditions for efficient transformation of Amycolatopsis orientalis (Nocardia orientalis) protoplasts by Streptomyces plasmid cloning vectors were identified. Three streptomycete plasmid origins of replication function in A. orientalis, as do the apramycin resistance gene from Escherichia coli, the thiostrepton resistance gene from Streptomyces azureus, and the tyrosinase gene from Streptomyces antibioticus. A. orientalis appears to express some restriction and modification, because highest t...

  17. Genomic analysis and Next Generation Sequencing (NGS) of MDR plasmids in Salmonella enterica

    Science.gov (United States)

    Food animals harboring Multi-Drug Resistant (MDR) Salmonella enterica are a possible source of zoonotic human infections and are a potential risk to human health. MDR genes can be transmitted in a number of ways including via plasmids. MDR plasmid prevalence and distribution was investigated by stud...

  18. Enhanced Immunogenicity to Mycobacterium tuberculosis by Vaccination with an Alphavirus Plasmid Replicon Expressing Antigen 85A

    OpenAIRE

    Kirman, Joanna R.; Turon, Tara; Su, Hua; Li, Amy; Kraus, Carl; Polo, John M.; Belisle, John; Morris, Sheldon; Seder, Robert A

    2003-01-01

    The immunogenicity of a plasmid DNA vaccine incorporating Sindbis virus RNA replicase functions (pSINCP) and expressing antigen 85A (Ag85A) from Mycobacterium tuberculosis was compared with a conventional plasmid DNA vector encoding Ag85A. pSINCP-85A was highly immunogenic in mice and gave enhanced long-term protection against M. tuberculosis compared with the conventional vector.

  19. EFFECTS OF SEGREGATION AND SELECTION ON INSTABILITY OF PLASMID PACYC184 IN 'ESCHERICHIA COLI'B

    Science.gov (United States)

    The authors use a mathematical model to analyze the dynamics of loss of nonconjugative pACYC184 from populations of Escherichia coli B in glucose-limited continuous culture. The model incorporates both plasmid segregation and selection against plasmid carriage. It is concluded th...

  20. Development of plasmid-mediated resistance in Vibrio cholerae during treatment with trimethoprim-sulfamethoxazole.

    Science.gov (United States)

    Dupont, M J; Jouvenot, M; Couetdic, G; Michel-Briand, Y

    1985-02-01

    The persistence of Vibrio cholerae, biotype el tor, in a patient treated with trimethoprim-sulfamethoxazole was due to the acquisition of a conjugative resistance plasmid. The plasmid, with a molecular size of 72 megadaltons, belonged to incompatibility group 6-C and conferred resistance to ampicillin, chloramphenicol, sulfonamide, and trimethoprim. PMID:3885851

  1. Development of plasmid-mediated resistance in Vibrio cholerae during treatment with trimethoprim-sulfamethoxazole.

    OpenAIRE

    Dupont, M. J.; Jouvenot, M.; Couetdic, G.; Michel-briand, Y.

    1985-01-01

    The persistence of Vibrio cholerae, biotype el tor, in a patient treated with trimethoprim-sulfamethoxazole was due to the acquisition of a conjugative resistance plasmid. The plasmid, with a molecular size of 72 megadaltons, belonged to incompatibility group 6-C and conferred resistance to ampicillin, chloramphenicol, sulfonamide, and trimethoprim.

  2. Conjugal Transfer of R-Plasmid R1drd-19 in Escherichia coli Below 22°C

    OpenAIRE

    Singleton, Paul; Anson, Avril E.

    1981-01-01

    The conjugal transfer of R-plasmids is known to occur at temperatures above 22°C. We found that R1drd-19 is transferable below 22°C, and we discuss this finding in the context of plasmid transfer in environmental waters.

  3. Detection and subcellular localization of two Sym plasmid-dependent proteins of Rhizobium leguminosarum biovar viciae.

    OpenAIRE

    Maagd, R. A.; Wijffelman, C. A.; Pees, E.; Lugtenberg, B. J.

    1988-01-01

    The previously described Sym plasmid-dependent 24-kilodalton rhi protein of Rhizobium leguminosarum biovar viciae was localized in the cytosol fraction. Another Sym plasmid-dependent protein of 50 kilodaltons is secreted into the growth medium, and its expression is dependent on both the nodD gene and a nod gene inducer.

  4. Replicon typing of plasmids encoding resistance to newer beta-lactams.

    Science.gov (United States)

    Carattoli, Alessandra; Miriagou, Vivi; Bertini, Alessia; Loli, Alexandra; Colinon, Celine; Villa, Laura; Whichard, Jean M; Rossolini, Gian Maria

    2006-07-01

    Polymerase chain reaction-based replicon typing represents a novel method to describe the dissemination and follow the evolution of resistance plasmids. We used this approach to study 26 epidemiologically unrelated Enterobacteriaceae and demonstrate the dominance of incompatibility (Inc) A/C or Inc N-related plasmids carrying some emerging resistance determinants to extended-spectrum cephalosporins and carbapenems. PMID:16836838

  5. Feasibility of an innovative third-year chief resident system: an internal medicine residency leadership study

    Directory of Open Access Journals (Sweden)

    Victor O. Kolade

    2014-07-01

    Full Text Available Introduction: The role of the internal medicine chief resident includes various administrative, academic, social, and educational responsibilities, fulfillment of which prepares residents for further leadership tasks. However, the chief resident position has historically only been held by a few residents. As fourth-year chief residents are becoming less common, we considered a new model for rotating third-year residents as the chief resident. Methods: Online surveys were given to all 29 internal medicine residents in a single university-based program after implementation of a leadership curriculum and specific job description for the third-year chief resident. Chief residents evaluated themselves on various aspects of leadership. Participation was voluntary. Descriptive statistics were generated using SPSS version 21. Results: Thirteen junior (first- or second-year resident responses reported that the chief residents elicited input from others (mean rating 6.8, were committed to the team (6.8, resolved conflict (6.7, ensured efficiency, organization and productivity of the team (6.7, participated actively (7.0, and managed resources (6.6. Responses from senior residents averaged 1 point higher for each item; this pattern repeated itself in teaching evaluations. Chief resident self-evaluators were more comfortable running a morning report (8.4 than with being chief resident (5.8. Conclusion: The feasibility of preparing internal medicine residents for leadership roles through a rotating PGY-3 (postgraduate year chief residency curriculum was explored at a small internal medicine residency, and we suggest extending the study to include other programs.

  6. Frequency and diversity of small cryptic plasmids in the genus Rahnella

    Directory of Open Access Journals (Sweden)

    Summers David K

    2010-02-01

    Full Text Available Abstract Background Rahnella is a widely distributed genus belonging to the Enterobacteriaceae and frequently present on vegetables. Although Rahnella has interesting agro-economical and industrial properties and several strains possess antibiotic resistances and toxin genes which might spread within microbial communities, little is known about plasmids of this genus. Thus, we isolated a number of Rahnella strains and investigated their complements of small plasmids. Results In total 53 strains were investigated and 11 plasmids observed. Seven belonged to the ColE1 family; one was ColE2-like and three shared homology to rolling circle plasmids. One of them belonged to the pC194/pUB110 family and two showed similarity to poorly characterised plasmid groups. The G+C content of two rolling circle plasmids deviated considerably from that of Rahnella, indicating that their usual hosts might belong to other genera. Most ColE1-like plasmids formed a subgroup within the ColE1 family that seems to be fairly specific for Rahnella. Intriguingly, the multimer resolution sites of all ColE1-like plasmids had the same orientation with respect to the origin of replication. This arrangement might be necessary to prevent inappropriate synthesis of a small regulatory RNA that regulates cell division. Although the ColE1-like plasmids did not possess any mobilisation system, they shared large parts with high sequence identity in coding and non-coding regions. In addition, highly homologous regions of plasmids isolated from Rahnella and the chromosomes of Erwinia tasmaniensis and Photorhabdus luminescens could be identified. Conclusions For the genus Rahnella we observed plasmid-containing isolates at a frequency of 19%, which is in the average range for Enterobacteriaceae. These plasmids belonged to diffent groups with members of the ColE1-family most frequently found. Regions of striking sequence homology of plasmids and bacterial chromosomes highlight the importance of plasmids for lateral gene transfer (including chromosomal sequences to distinct genera.

  7. Regular cellular distribution of plasmids by oscillating and filament-forming ParA ATPase of plasmid pB171

    DEFF Research Database (Denmark)

    Ebersbach, Gitte; Ringgaard, Simon

    2006-01-01

    Centromere-like loci from bacteria segregate plasmids to progeny cells before cell division. The ParA ATPase (a MinD homologue) of the par2 locus from plasmid pB171 forms oscillating helical structures over the nucleoid. Here we show that par2 distributes plasmid foci regularly along the length of the cell even in cells with many plasmids. In vitro, ParA binds ATP and ADP and has a cooperative ATPase activity. Moreover, ParA forms ATP-dependent filaments and cables, suggesting that ParA can provide the mechanical force for the observed regular distribution of plasmids. ParA and ParB interact with each other in a bacterial two-hybrid assay but do not interact with FtsZ, eight other essential cell division proteins or MreB actin. Based on these observations, we propose a simple model for how oscillating ParA filaments can mediate regular cellular distribution of plasmids. The model functions without the involvement of partition-specific host cell receptors and is thus consistent with the striking observation that partition loci can function in heterologous host organisms.

  8. Isolation by genetic labeling of a new mycobacterial plasmid, pJAZ38, from Mycobacterium fortuitum.

    Science.gov (United States)

    Gavigan, J A; Aínsa, J A; Pérez, E; Otal, I; Martín, C

    1997-07-01

    In a two-step mating experiment with recipient strains of Mycobacterium smegmatis, the Mycobacterium fortuitum cryptic plasmid pJAZ38 was isolated. Plasmid pJAZ38 was genetically labeled by cointegration formation mediated by the kanamycin-resistant mycobacterial transposon Tn611. The region responsible for replication of pJAZ38 was located and sequenced. This region showed homology with the Mycobacterium avium plasmid pLR7 and the Mycobacterium scrofulaceum plasmid pMSC262, a family of plasmids which have been found to be widespread throughout the mycobacteria. Further experiments showed pJAZ38 to be stably inherited in the absence of selection pressure and compatible with the most commonly used mycobacterial replicon, pAL5000. In contrast to pLR7 and pMSC262, pJAZ38 was able to replicate in M. smegmatis mc(2)155, making it a useful tool for mycobacterial genetics. PMID:9209023

  9. Antibiotic resistance and plasmid carriage among Escherichia coli isolates from chicken meat in Malaysia

    International Nuclear Information System (INIS)

    Escherichia coli isolates from 131 raw chicken meat samples were tested for susceptibility to 12 antibiotics. Plasmids were isolated from many samples and their DNA molecular weight calculated. An 81.7% plasmid occurrence rate was observed among the isolates, ranging from 0 to 8 in number and with sizes from 1.2 to 118.6 MDa. Plasmids were detected in 93.8% of E. coIi isolates resistant to all 12 antibiotics, and in 90.5% of E. coli isolates resistant to 11. Three (2.8%) isolates harboured 8 plasmids and were resistant to all 12 antibiotics. Antibiotic resistant genes in bacteria are usually carried in extrachromosomal DNA and it is postulated that E. coli with a high number of plasmids possesses wider resistance to antibiotics. (author)

  10. DNA sequence analysis of a small cryptic plasmid from Lactococcus lactis subsp. lactis M14.

    Science.gov (United States)

    Raha, A R; Hooi, W Y; Mariana, N S; Radu, S; Varma, N R S; Yusoff, K

    2006-07-01

    A small plasmid designated pAR141 was isolated from Lactococcus lactis subsp. lactis M14 and its complete 1,594 base pair nucleotide sequence was determined. Analysis of the sequence indicated that this plasmid does not carry any industrially important determinants besides the elements involved in plasmid replication and control. The transcriptional repressor CopG and replication initiation protein RepB appeared as a single operon. A small countertranscribed RNA (ctRNA) coding region was found between the copG and repB genes. The double strand origin (dso) and single strand origin (sso) of rolling circle replicating (RCR) plasmids were also identified in pAR141, suggesting that this plasmid replicates by rolling circle (RC) mode. This observation was supported by S1 nuclease and Southern hybridization analyses. PMID:16675013

  11. Elimination of a virulence plasmid from Shigella sonnei and Escherichia coli by antibiotics.

    Science.gov (United States)

    Michel-Briand, Y; Laporte, J M; Couetdic, G; Sansonetti, P J

    1986-01-01

    Plasmid pWR105 is a non-self-conjugative plasmid conferring enteroinvasive properties on Shigella sonnei. Loss of this plasmid is accompanied by loss of the invasive phenotype as well as of the form I antigen expression. Thirteen antibiotics belonging to different chemical families were used at subinhibitory concentrations to eliminate pWR105 from S. sonnei and Escherichia coli K12. Rifampicin, novobiocin, chloramphenicol, cotrimoxazole and erythromycin eliminated the plasmid from both strains. Clindamycin eliminated pWR105 from E. coli only. Several other antibiotics gave a low rate of cure (ciprofloxacin, nalidixic acid, oxolinic acid, nifurzide, tilbroquinol, minocycline). We may expect that these antibiotics would destabilize plasmids from other Shigella species and enteroinvasive E. coli, as these extrachromosomal DNA molecules share a high degree of homology. PMID:3318870

  12. A Bipolar Spindle of Antiparallel ParM Filaments Drives Bacterial Plasmid Segregation

    DEFF Research Database (Denmark)

    Gayathri, P; Fujii, T

    2012-01-01

    To ensure their stable inheritance by daughter cells during cell division, bacterial low copy-number plasmids make simple DNA segregating machines that use an elongating protein filament between sister plasmids. In the ParMRC system of Escherichia coli R1 plasmid, ParM, an actin-like protein, forms the spindle between ParRC complexes on sister plasmids. Using a combination of structural work and total internal reflection fluorescence microscopy, we show that ParRC bound and could accelerate growth at only one end of polar ParM filaments, mechanistically resembling eukaryotic formins. The architecture of ParM filaments enabled two ParRC-bound filaments to associate in an antiparallel orientation, forming a bipolar spindle. The spindle elongated as a bundle of at least two antiparallel filaments, thereby pushing two plasmid clusters toward the poles.

  13. Effect of the atmospheric pressure nonequilibrium plasmas on the conformational changes of plasmid DNA

    International Nuclear Information System (INIS)

    The cold atmospheric pressure plasma, which has been widely used for biomedical applications, may potentially affect the conformation of DNA. In this letter, an atmospheric pressure plasma plume is used to investigate its effects on the conformational changes of DNA of plasmid pAHC25. It is found that the plasma plume could cause plasmid DNA topology alteration, resulting in the percentage of the supercoiled plasmid DNA form decreased while that of the open circular and linearized form of plasmid DNA increased as detected by agrose gel electrophoresis. On the other hand, further investigation by using polymerase chain reaction method shows that the atmospheric pressure plasma jet treatments under proper conditions does not affect the genes of the plasmid DNA, which may have potential application in increasing the transformation frequency by genetic engineering.

  14. Stress and burnout among Swiss dental residents

    OpenAIRE

    Divaris, Kimon; Lai, Caroline S; Polychronopoulou, Argy; Eliades, Theodore; KATSAROS, CHRISTOS

    2012-01-01

    Stress and burnout have been well-documented in graduate medical and undergraduate dental education, but studies among dental graduate students and residents are sparse. The purpose of this investigation was to examine perceived stressors and three dimensions of burnout among dental residents enrolled in the University of Bern, Switzerland. Thirty-six residents enrolled in five specialty programmes were administered the Graduate Dental Environment Stress (GDES30) questionnaire and the Maslach...

  15. Identification of DNA homologies among H incompatibility group plasmids by restriction enzyme digestion and Southern transfer hybridization.

    OpenAIRE

    Whiteley, M.; Taylor, D. E.

    1983-01-01

    Plasmids belonging to the three HI plasmid incompatibility subgroups were characterized by the use of restriction enzymes and Southern transfer hybridization. A diversity of restriction enzyme patterns was noted among the HI subgroups, and a small amount of DNA homology was observed by probing these digests with a nick-translated HI1 plasmid. Within a single subgroup (HI1 and HI2), similar restriction enzyme patterns were noted. Plasmids of all three HI subgroups and the HII group had a guani...

  16. Occurrence of plasmids and antibiotic resistance among Campylobacter jejuni and Campylobacter coli isolated from healthy and diarrheic animals.

    OpenAIRE

    Bradbury, W C; Munroe, D L

    1985-01-01

    Serologically defined strains of Campylobacter jejuni and Campylobacter coli from healthy and diarrheic animals were examined for the occurrence of plasmid DNA in association with the antibiotic susceptibility of the bacterial host and the health status of the animal host. Of all campylobacter organisms surveyed, 53% (116 of 200) contained plasmid DNA. A plasmid occurrence rate of 73.8% was obtained for C. coli from healthy pigs, contrasted by lower plasmid occurrence rates for C. coli from d...

  17. Optimization of Plasmid Maintenance in the Attenuated Live Vector Vaccine Strain Salmonella typhi CVD 908-htrA†

    OpenAIRE

    Galen, James E; Nair, Jay; Wang, Jin Yuang; Wasserman, Steven S.; Tanner, Michael K.; SZTEIN, MARCELO B.; Levine, Myron M

    1999-01-01

    The broad objective of the research presented here is to develop a noncatalytic plasmid maintenance system for the stabilization of multicopy expression plasmids encoding foreign antigens in a Salmonella typhi live-vector vaccine strain such as CVD 908-htrA. We have enhanced the maintenance of expression plasmids at two independent levels. First, we removed dependence upon balanced-lethal maintenance systems that involve catalytic enzymes expressed from multicopy plasmids...

  18. Dissimilar plasmids isolated from Pseudomonas diminuta MG and a Flavobacterium sp. (ATCC 27551) contain identical opd genes.

    OpenAIRE

    Harper, L L; McDaniel, C S; Miller, C.E; Wild, J. R.

    1988-01-01

    The opd (organophosphate-degrading) gene derived from a 43-kilobase-pair plasmid (pSM55) of a Flavobacterium sp. (ATCC 27551) has a sequence identical to that of the plasmid-borne gene of Pseudomonas diminuta. Hybridization studies with DNA fragments obtained by restriction endonuclease digestion of plasmid DNAs demonstrated that the identical opd sequences were encoded on dissimilar plasmids from the two sources.

  19. Extraction of Dengue 2 Plasmid DNA Vaccine (pD2) from Cell Lysates by Aqueous Two-Phase Systems

    OpenAIRE

    Keila Aparecida Moreira; Adilson Castro Chaves; Ernesto Torres Marques; Duarte Miguel Ferreira Prazeres; Walter Mendes de Azevedo; Ana Lucia Figueiredo Porto; Jose Luiz de Lima Filho

    2007-01-01

    This research describes the partitioning in PEG/phosphate systems of the plasmid pD2, a dengue 2 plasmid DNA vaccine, present in a clarified E. coli alkaline lysate. Factors that affect the partition as PEG molecular weight, plasmid concentration and the lysate volume loaded in the system were investigated. Results showed that partition behavior of plasmid DNA depends on the system molecular weight, a considerable amount of protein of the cell lysate was accumulated in the interphase of the s...

  20. Relationship of the Presence and Copy Number of Plasmids to Exopolysaccharide Production and Symbiotic Effectiveness in Rhizobium fredii USDA 206 †

    OpenAIRE

    Barbour, W. Mark; Elkan, Gerald H.

    1989-01-01

    Rhizobium fredii USDA 206 harbors four large plasmids, one of which carries nodulation and nitrogen fixation genes. Previously isolated groups of plasmid-cured derivatives of strain USDA 206 were compared with each other to determine possible plasmid functions. Mutant strain 206CANS was isolated as a nonmucoid (Muc?) derivative of strain 206CA, a mutant that was cured of two plasmids. The Muc? phenotype of 206CANS was only expressed when the strain was grown on certain media, particularly...

  1. Replicon Typing of Plasmids Carrying CTX-M or CMY ?-Lactamases Circulating among Salmonella and Escherichia coli Isolates†

    OpenAIRE

    Hopkins, Katie L.; Liebana, Ernesto; Villa, Laura; Batchelor, Miranda; Threlfall, E. John; Carattoli, Alessandra

    2006-01-01

    Replicon typing of plasmids carrying blaCTX-M or blaCMY ?-lactamase genes indicates a predominance of I1 and A/C replicons among blaCMY-carrying plasmids and five different plasmid scaffolds associated with the different types of blaCTX-M genes (I1, FII, HI2, K, and N). These results demonstrate the association of certain ?-lactamase genes with specific plasmid backbones.

  2. pA506, a conjugative plasmid of the plant epiphyte Pseudomonas fluorescens A506.

    Science.gov (United States)

    Stockwell, Virginia O; Davis, Edward W; Carey, Alyssa; Shaffer, Brenda T; Mavrodi, Dmitri V; Hassan, Karl A; Hockett, Kevin; Thomashow, Linda S; Paulsen, Ian T; Loper, Joyce E

    2013-09-01

    Conjugative plasmids are known to facilitate the acquisition and dispersal of genes contributing to the fitness of Pseudomonas spp. Here, we report the characterization of pA506, the 57-kb conjugative plasmid of Pseudomonas fluorescens A506, a plant epiphyte used in the United States for the biological control of fire blight disease of pear and apple. Twenty-nine of the 67 open reading frames (ORFs) of pA506 have putative functions in conjugation, including a type IV secretion system related to that of MOBP6 family plasmids and a gene cluster for type IV pili. We demonstrate that pA506 is self-transmissible via conjugation between A506 and strains of Pseudomonas spp. or the Enterobacteriaceae. The origin of vegetative replication (oriV) of pA506 is typical of those in pPT23A family plasmids, which are present in many pathovars of Pseudomonas syringae, but pA506 lacks repA, a defining locus for pPT23A plasmids, and has a novel partitioning region. We selected a plasmid-cured derivative of A506 and compared it to the wild type to identify plasmid-encoded phenotypes. pA506 conferred UV resistance, presumably due to the plasmid-borne rulAB genes, but did not influence epiphytic fitness of A506 on pear or apple blossoms in the field. pA506 does not appear to confer resistance to antibiotics or other toxic elements. Based on the conjugative nature of pA506 and the large number of its genes that are shared with plasmids from diverse groups of environmental bacteria, the plasmid is likely to serve as a vehicle for genetic exchange between A506 and its coinhabitants on plant surfaces. PMID:23811504

  3. Distribution and diversity of mycoplasma plasmids: lessons from cryptic genetic elements

    Directory of Open Access Journals (Sweden)

    Breton Marc

    2012-11-01

    Full Text Available Abstract Background The evolution of mycoplasmas from a common ancestor with Firmicutes has been characterized not only by genome down-sizing but also by horizontal gene transfer between mycoplasma species sharing a common host. The mechanisms of these gene transfers remain unclear because our knowledge of the mycoplasma mobile genetic elements is limited. In particular, only a few plasmids have been described within the Mycoplasma genus. Results We have shown that several species of ruminant mycoplasmas carry plasmids that are members of a large family of elements and replicate via a rolling-circle mechanism. All plasmids were isolated from species that either belonged or were closely related to the Mycoplasma mycoides cluster; none was from the Mycoplasma bovis-Mycoplasma agalactiae group. Twenty one plasmids were completely sequenced, named and compared with each other and with the five mycoplasma plasmids previously reported. All plasmids share similar size and genetic organization, and present a mosaic structure. A peculiar case is that of the plasmid pMyBK1 from M. yeatsii; it is larger in size and is predicted to be mobilizable. Its origin of replication and replication protein were identified. In addition, pMyBK1 derivatives were shown to replicate in various species of the M. mycoides cluster, and therefore hold considerable promise for developing gene vectors. The phylogenetic analysis of these plasmids confirms the uniqueness of pMyBK1 and indicates that the other mycoplasma plasmids cluster together, apart from the related replicons found in phytoplasmas and in species of the clade Firmicutes. Conclusions Our results unraveled a totally new picture of mycoplasma plasmids. Although they probably play a limited role in the gene exchanges that participate in mycoplasma evolution, they are abundant in some species. Evidence for the occurrence of frequent genetic recombination strongly suggests they are transmitted between species sharing a common host or niche.

  4. Plasmid profile analysis in identification of epidemic strains of Salmonella enterica serovar Enteritidis

    Directory of Open Access Journals (Sweden)

    Miljkovi?-Selimovi? Biljana

    2008-01-01

    Full Text Available Background/Aim. As illness caused by Sallmonella enterica serovar Enteritidis (S. Enteritidis occurs not only as sporadic cases but as outbreaks, to reveal the source and routes of spreading of infection it is necessary to identify epidemic strain by the use of some typing methods. To determine whether plasmid profile analysis, as genotyping method, could be applied for the investigation of epidemic strains, isolates of S. Enteritidis, recovered from patient's stools and food associated with outbreaks and those isolated from sporadic cases of diarrhea, were investigated. Methods. Investigation of antibiotic resistance was performed by Kirby - Bauer disc-diffusion method. Isolation of plasmid DNA was carried out by Birnboim and Dolly alkaline lysis method, modified by Ish-Horovitz. Results. Out of 276 izolates of S. Enteritidis 94 were isolated from patient's stools and food associated with outbreaks and 182 were isolated from sporadic cases of diarrhea. The presence of 12 plasmid profiles was established. An average correlation degree of plasmid profiles between the strains was 0.84, that implies high degree of similarity of plasmid profiles of epidemic and non- epidemic strains isolated at our geographic region for the given period of time. Conclusion. The strains of S. Enteritidis, isolated in outbreaks of enterocolitis as well as from spordic cases of diarrhea in the same period of time and at the same area, frequently exhibit the same plasmid profile characterized by a single plasmid of 38 MDa. Therefore, in most cases plasmid profile analysis is not valuable in the identification of epidemic strains of S. Enteritidis. However, for this purpose plasmid profile analysis could be used when drug-resistant strains of S. Enteritidis are isolated, as they often possess additional resistant plasmids what increases discrimination power of this method.

  5. Genome Stability of Lyme Disease Spirochetes: Comparative Genomics of Borrelia burgdorferi Plasmids

    Energy Technology Data Exchange (ETDEWEB)

    Casjens S. R.; Dunn J.; Mongodin, E. F.; Qiu, W.-G.; Luft, B. J.; Schutzer, S. E.; Gilcrease, E. B.; Huang, W. M.; Vujadinovic, M.; Aron, J. K.; Vargas, L. C.; Freeman, S.; Radune, D.; Weidman, J. F.; Dimitrov, G. I.; Khouri, H. M.; Sosa, J. E.; Halpin, R. A.; Fraser, C. M.

    2012-03-14

    Lyme disease is the most common tick-borne human illness in North America. In order to understand the molecular pathogenesis, natural diversity, population structure and epizootic spread of the North American Lyme agent, Borrelia burgdorferi sensu stricto, a much better understanding of the natural diversity of its genome will be required. Towards this end we present a comparative analysis of the nucleotide sequences of the numerous plasmids of B. burgdorferi isolates B31, N40, JD1 and 297. These strains were chosen because they include the three most commonly studied laboratory strains, and because they represent different major genetic lineages and so are informative regarding the genetic diversity and evolution of this organism. A unique feature of Borrelia genomes is that they carry a large number of linear and circular plasmids, and this work shows that strains N40, JD1, 297 and B31 carry related but non-identical sets of 16, 20, 19 and 21 plasmids, respectively, that comprise 33-40% of their genomes. We deduce that there are at least 28 plasmid compatibility types among the four strains. The B. burgdorferi {approx}900 Kbp linear chromosomes are evolutionarily exceptionally stable, except for a short {le}20 Kbp plasmid-like section at the right end. A few of the plasmids, including the linear lp54 and circular cp26, are also very stable. We show here that the other plasmids, especially the linear ones, are considerably more variable. Nearly all of the linear plasmids have undergone one or more substantial inter-plasmid rearrangements since their last common ancestor. In spite of these rearrangements and differences in plasmid contents, the overall gene complement of the different isolates has remained relatively constant.

  6. The large universal Pantoea plasmid LPP-1 plays a major role in biological and ecological diversification

    Directory of Open Access Journals (Sweden)

    De Maayer Pieter

    2012-11-01

    Full Text Available Abstract Background Pantoea spp. are frequently isolated from a wide range of ecological niches and have various biological roles, as plant epi- or endophytes, biocontrol agents, plant-growth promoters or as pathogens of both plant and animal hosts. This suggests that members of this genus have undergone extensive genotypic diversification. One means by which this occurs among bacteria is through the acquisition and maintenance of plasmids. Here, we have analyzed and compared the sequences of a large plasmid common to all sequenced Pantoea spp. Results and discussion The Large PantoeaPlasmids (LPP-1 of twenty strains encompassing seven different Pantoea species, including pathogens and endo-/epiphytes of a wide range of plant hosts as well as insect-associated strains, were compared. The LPP-1 plasmid sequences range in size from ~281 to 794 kb and carry between 238 and 750 protein coding sequences (CDS. A core set of 46 proteins, encompassing 2.2% of the total pan-plasmid (2,095 CDS, conserved among all LPP-1 plasmid sequences, includes those required for thiamine and pigment biosynthesis. Phylogenetic analysis reveals that these plasmids have arisen from an ancestral plasmid, which has undergone extensive diversification. Analysis of the proteins encoded on LPP-1 also showed that these plasmids contribute to a wide range of Pantoea phenotypes, including the transport and catabolism of various substrates, inorganic ion assimilation, resistance to antibiotics and heavy metals, colonization and persistence in the host and environment, pathogenesis and antibiosis. Conclusions LPP-1 is universal to all Pantoea spp. whose genomes have been sequenced to date and is derived from an ancestral plasmid. LPP-1 encodes a large array of proteins that have played a major role in the adaptation of the different Pantoea spp. to their various ecological niches and their specialization as pathogens, biocontrol agents or benign saprophytes found in many diverse environments.

  7. Plasmid DNA Analysis of Pasteurella multocida Serotype B isolated from Haemorrhagic Septicaemia outbreaks in Malaysia

    Directory of Open Access Journals (Sweden)

    Jamal, H.

    2005-01-01

    Full Text Available A total of 150 purified isolates of Pasteurella multocida serotype B were used (Salmah, 2004 for plasmid DNA curing experiment to determine hyaluronidase activity, antibiotic resistance pattern (ARP and mice lethality test (LD50 for their role of pathogenicity. A plasmid curing experiment was carried out by using the intercalating agent; ethidium bromide and rifampicin, where it was found all the plasmids had been cured (plasmidless from Pasteurella multocida. All of these plasmidless isolates maintained their phenotypic characteristics. They showed the same antibiotic resistancepattern as before curing, produced hyaluronidase and possessed lethality activity in mice when injected intraperitoneally(i.p. Based on this observation, the antibiotic resistance, hyaluronidase activity and mice virulence could probably be chromosomal-mediated. Plasmids were detected 100% in all P. multocida isolates with identical profile of 2 plasmids size 3.0 and 5.5 kb. No large plasmids could be detected in all isolates. Since all the isolates appeared to have identicalplasmid profiles, they were subjected to restriction enzyme(RE analysis. From RE analysis results obtained, it can be concluded that the plasmid DNA in serotype B isolates are identical. Only 4 of 32 REs were found to cleave these plasmids with identical restriction fingerprints; BglII, HaeIII, RsaI and SspI. From RE analysis results, it can be concluded that the plasmid DNA isolates are identical. This plasmid might not played any role in pathogenicity of Pasteurella multocida serotype B, however this information is important for the construction of shuttle vectors in genetic studies of the pathogenicity of haemorrhagic septicaemia(HS.

  8. Underwater Dendrochronology of the Sierra Nevada: Testing the Medieval Mega-Drought Hypothesis

    Science.gov (United States)

    Biondi, F.; Kleppe, J. A.; Brothers, D.; Kent, G.

    2006-12-01

    As stated in the NAS STR Report, "regional and large-scale reconstructions of changes in other climatic variables, such as precipitation, over the last 2,000 years would provide a valuable complement to those made for temperature." In this context, we focus on the 'Medieval Mega-drought Hypothesis', which is based on radiocarbon dating of dead trees and stumps found underwater in Sierra Nevada lakes and streambeds, and states that century-long dry periods caused lakes to retreat and streams to dry up, with the most recent mega-droughts happening during medieval times. While several paleoclimatic records support this hypothesis, some do not, and the possibility exists that geomorphic processes, such as landslides caused by seismic events, were responsible for the presence of trees and stumps under current bodies of water. Given the relevance of this hypothesis, not only for sustainable water management but also for social stability and security, it is necessary to test it beyond reasonable doubt. One way to do so is by measuring the location, orientation, and time of origin of underwater trees, to determine if they were transported or grew in situ. For example, during 2005 wood samples were retrieved from submerged trees at Fallen Leaf Lake, California. The trees had been previously located and documented using an ROV that can obtain high resolution color video, and collect small surface samples using a gripper, down to a water depth of about 150 m. For tree-ring dating, a reference chronology from AD 543 to 2003 was developed using live and dead western juniper trees located near the lake. One underwater sample, i.e. a branch cross section that included 69 rings, was then dated to AD 1085-1153. This shows that it is feasible to obtain calendar dates and continuous ring-width series from underwater trees in the Sierra Nevada. Submerged trees in Fallen Leaf Lake were mapped in summer 2006 using an EdgeTech 4200 side-scan system capable of decimeter resolution. The 5 km2 side-scan survey required about two days of survey time, providing rapid identification of the underwater targets. Side-scan sonar imagery was complemented with sub-bottom seismic CHIRP profiling to assess fault movement and landslide formation. Initial evaluation of these data does not suggest a landslide origin for submerged trees in Fallen Leaf Lake. However, sub-bottom mapping of the West Tahoe fault underlying the southernmost end of Fallen Leaf Lake, combined with evidence that these trees are at a depth equivalent to the modern level of Lake Tahoe, may suggest a linkage between Fallen Leaf Lake levels and earthquake-generated permeability along the West Tahoe fault. These preliminary results indicate that the question of climatic vs. non-climatic origin of submerged trees is best answered by mapping and dating them in more than one lake. As tree-ring samples are collected and entered into a master chronology, they could also yield a continuous, annually resolved record over several millennia, because some submerged trees have already been radiocarbon dated to the mid-Holocene. It is by collating a myriad of wood samples buried in streambeds and lakes that the longest tree-ring chronologies, now going back 12,460 years, have been developed in central Europe.

  9. General practitioner residency consultations: video feedback analysis

    Directory of Open Access Journals (Sweden)

    Afonso M. Cavaco

    2011-12-01

    Full Text Available Objectives: The purpose of this study was to analyse longitudinally two decades of Portuguese general practi-tioner (GP residents' consultation features, such as consultation length- estimating its major determinants- as well as to compare with GP residents from other Western practices. Methods: This pilot study followed a retrospective and descriptive design, comprising of the analysis of videotaped consultations with real patients from GP residents (southern Portugal, between 1990 and 2008. Main studied variables were consultation length and purpose, participant demographics and residency site characteristics. Results: From 516 residents, 68.0were females, mainly between 26-35 years old (50.6. Female patients' proportion equalled doctors', with the most frequent age group being the 46-65 years old (41.3. The consultation took on average 22 minutes and 22 seconds, with no significant differences by year and residency location. Main consultation purposes were previous scheduling (31.6 and acute symptoms (30.0. Duration was consistently longer than practising GPs from other countries, keeping in mind the supervised practice. Significant and positive predictors of consultation length were number of attendants and patients' frequency at the residency site. Conclusions: South Portugal GP residency program consultations were lengthier in comparison to similar practice in Europe and other Western countries. Length correlated preferably with patient related variables than with professionals', while confirming the longitudinal homogeneity in the residency consultation format for the last two decades.

  10. Radiology residents' experience with intussusception reduction

    International Nuclear Information System (INIS)

    Residents should be exposed to adequate procedural volume to act independently upon completion of training. Informal inquiry led us to question whether residents encounter enough intussusception reductions to become comfortable with the procedure. We sought to determine radiology residents' exposure to intussusception reductions, and whether their experiences vary by region or institution. U.S. radiology residency program directors were asked to encourage their residents to complete a 12-question online survey describing characteristics of their pediatric radiology department, experiences with intussusception reduction, and confidence in their own ability to perform the procedure. Six hundred sixty-four residents responded during the study period. Of those, 308 (46.4%) had not experienced an intussusception reduction, and 228 (34%) had experienced only one or two. Twenty-two percent of fourth-year residents had never experienced an intussusception reduction, and 21% had experienced only one. Among second- through fourth-year residents, only 99 (18.3%) felt confident that they could competently reduce an intussusception (P < 0.0001), and 336 (62.2%) thought they would benefit from a computer-assisted training model simulating intussusception reduction (P < 0.0001). Radiology residents have limited opportunity to learn intussusception reduction and therefore lack confidence. Most think they would benefit from additional training with a computer-simulation model. (orig.) with a computer-simulation model. (orig.)

  11. El erizo de mar Diadema antillarum Phillipi, 1845 influye sobre la diversidad y composición de la comunidad de mega-invertebrados vágiles en fondos rocosos del Archipiélago Canario / The sea urchin Diadema antillarum Phillipi, 1845 influences the diversity and composition of the mobile mega-invertebrate community on rocky bottoms off the Canary Archipelago

    Scientific Electronic Library Online (English)

    Leonor, Ortega; Fernando, Tuya; Ricardo J, Haroun.

    2009-08-01

    Full Text Available Se describe el efecto de la densidad del erizo Diadema antillarum sobre la diversidad y composición de la comunidad de mega-invertebrados vágiles (> 2 cm) que habita fondos rocosos del Archipiélago Canario (Atlántico oriental). Específicamente, se predijo que (1) las altas densidades de D. antillaru [...] m producen una baja diversidad de la comunidad de mega-invertebrados vágiles, y (2) la composición de las comunidades de mega-invertebrados varía entre fondos con diferentes densidades de D. antillarum. La presencia de especies mega-invertebradas, y la densidad de individuos de D. antillarum, se registraron visualmente en cuadrados de 2 x 2 m (n = 16 réplicas) en un total de 24 localidades (tres localidades en cada una de las ocho islas principales del archipiélago), visitadas en cuatro ocasiones entre febrero-2003 y octubre-2004. Se observaron 33 taxones de mega-invertebrados vágiles. Se registró una relación inversa entre la riqueza específica y la densidad de D. antillarum (r s = -0,20; P 8 ind. m-2), la riqueza de especies fue siempre baja ( Abstract in english The effect of the sea urchin Diadema antillarum density over the diversity and composition of the mobile mega-invertebrate community (> 2 cm) inhabiting shallow rocky reefs off the Canary Archipelago (eastern Atlantic) is described. Specifically, it was predicted that (1) high densities of D. antill [...] arum produce a low diversity of the mobile mega-invertebrate community, and (2) the composition of this community changes between rocky bottoms (= reefs) under different densities of D. antillarum. The presence of mega-invertebrate taxa, and the density of D. antillarum individuals were recorded visually using 2 x 2 m quadrats (n = 16 replicates) in each of 24 locations (three locations in each of the eight main islands of the archipelago), which were visited in four occasions between February-2003 and October-2004. Thrity-three taxa of mobile mega-invertebrates were observed. We registered a decline in the richness of such assemblages with increasing densities of D. antillarum (r s = -0.20; P 8 ind. m-2). A CAP ordination analysis showed significant differences in the composition of the mega-invertebrate community between rocky bottoms under different densities of D. antillarum, and we registered a negative correlation between the presence of some taxa and the densities of sea urchin. Consequently, the sea urchin D. antillarum influences the diversity and composition of the mobile mega-invertebrate community on rocky bottoms off the Canary Archipelago.

  12. An NMR solution study of the mega-oligosaccharide, rhamnogalacturonan II

    International Nuclear Information System (INIS)

    Rhamnogalacturonan II (RG-II) is a structurally complex pectic mega-oligosaccharide that is released enzymatically from the primary cell wall of higher plants. It contains roughly 30 monosaccharide units (MW ?5 kDa) including very unusual residues such as Kdo, Dha, aceric acid and apiose. Previous studies have demonstrated that these monomers are arranged into four structurally well-defined oligosaccharide side chains (A-D), linked to a homogalacturonan mainchain, but the specific attachment sites of these branches on the pectic backbone have not yet been elucidated. In the present work, fairly complete assignments of the 750 MHz 1 H NMR spectra and partial assignments of the 13 C NMR spectra of the sodium-borohydride-reduced RG-II monomer were obtained for a 5 mM sample isolated from red wine. On the whole, these data corroborate the primary structures of the sidechains previously established by methylation analysis, partial hydrolysis and FAB-MS spectrometry but some heterogeneity has been demonstrated (partial substitution at B5, B6, and A5). The preferred orientations of the majority of the sidechain glycosidic linkages in the RG-II monomer have been determined from the sequential nOe data and the solution structure is generally in good agreement with the stable conformers previously obtained by molecular modeling (MM3) of the disaccharide and sidechain oligosaccharide building blocks. All of a two-residue, a three-residue, and a four-residsidue, a three-residue, and a four-residue segment of the backbone have been tentatively identified from long range interactions between sidechain protons as well as in the mainchain. Taking into account the length of the 9-mer galacturonan mainchain described in prior work, these building blocks constitute almost the complete structure of RG-II (Scheme 2)

  13. Increased precipitation drives mega slump development and destabilization of ice-rich permafrost terrain, northwestern Canada

    Science.gov (United States)

    Kokelj, S. V.; Tunnicliffe, J.; Lacelle, D.; Lantz, T. C.; Chin, K. S.; Fraser, R.

    2015-06-01

    It is anticipated that an increase in rainfall will have significant impacts on the geomorphology of permafrost landscapes. Field observations, remote sensing and historical climate data were used to investigate the drivers, processes and feedbacks that perpetuate the growth of large retrogressive thaw slumps. These "mega slumps" (5-40 ha) are now common in formerly glaciated, fluvially incised, ice-cored terrain of the Peel Plateau, NW Canada. Individual thaw slumps can persist for decades and their enlargement due to ground ice thaw can displace up to 106 m3 of materials from slopes to valley bottoms reconfiguring slope morphology and drainage networks. Analysis of Landsat images (1985-2011) indicate that the number and size of active slumps and debris tongue deposits has increased significantly with the recent intensification of rainfall. The analyses of high resolution climatic and photographic time-series for summers 2010 and 2012 shows strong linkages amongst temperature, precipitation and the downslope sediment flux from active slumps. Ground ice thaw supplies meltwater and sediments to the slump scar zone and drives diurnal pulses of surficial flow. Coherence in the timing of down valley debris tongue deposition and fine-scaled observations of sediment flux indicate that heavy rainfall stimulates major mass flow events. Evacuation of sediments from the slump scar zone can help to maintain a headwall of exposed ground ice, perpetuating slump growth and leading to larger disturbances. The development of debris tongue deposits divert streams and increase thermoerosion to initiate adjacent slumps. We conclude that higher rainfall can intensify thaw slump activity and rapidly alter the slope-sediment cascade in regions of ice-cored glaciogenic deposits.

  14. The Aftershock Analyses of the February 27 2010 Chile M=8.8 Mega Earthquake

    Science.gov (United States)

    Wei, H.; Miller, M.; Gallardo, V. A.; Klingelhoefer, F.; Lin, J.; Lee, C.

    2011-12-01

    In February 27 2010, Chile mega earthquake (M=8.8) occurred at the Maule area in middle of Chile. The epicenter location is 115 km, NNE direction (35.9° S, 72.73° W) from Concepción, the second biggest city in Chile. The main shock, in which the focal depth is about 35 km, is a thrust - type subduction earthquake where the Nazca Plate subduct/collied into the South America Plate (the Chile subduction system). The main shock caused more than 500-km long rupture in the accretionary prism that produced a destructive tsunami. It killed many thousands of people and damaged more buildings. Even up to today, the aftershocks and volcanic activities still occur continuously in this region. In 1960, the biggest earthquake (M=9.5), the human ever recorded event, occurred in south Chile. This imply that an incomplete release of tectonic energy. In order to understand the processes, we have deployed 18 OBSs at 4 months after the main shock. We recorded a total of 23-day data (July 15 - August 8). In this study, we analyses the P-wave and S-wave arrivals. The events were relocated by using one-dimensional global velocity model (iasp91). An initial result shows that the events were divided into three groups, and each of these groups mainly occurred at a shallow depth of 20-40 km. We propose that the plates keep in colliding and compressing in which the accretionary prism is uplifted. The thrust faults were probably grown in its stress intensity. This may provide a clue for the possible source of the future earthquake and tsunami.

  15. The poloidal distribution of turbulent fluctuations in the Mega-Ampere Spherical Tokamak

    International Nuclear Information System (INIS)

    Recently, it was shown that intermittency observed in magnetic fusion devices is caused by large-scales events with high radial velocity reaching about 1/10th of the sound speed (called avaloids or blobs) [G. Antar et al., Phys. Rev. Lett. 87 065001 (2001)]. In the present paper, the poloidal distribution of turbulence is investigated on the Mega-Ampere Spherical Tokamak [A. Sykes et al., Phys. Plasmas 8 2101 (2001)]. To achieve our goal, target probes that span the divertor strike points are used and one reciprocating probe at the midplane. Moreover, a fast imaging camera that can reach 10 ?s exposure time looks tangentially at the plasma allowing us to view a poloidal cut of the plasma. The two diagnostics allow us to have a rather accurate description of the particle transport in the poloidal plane for L-mode discharges. Turbulence properties at the low-field midplane scrape-off layer are discussed and compared to other poloidal positions. On the low-field target divertor plates, avaloids bursty signature is not detected but still intermittency is observed far from the strike point. This is a consequence of the field line expansion which transforms a structure localized in the poloidal plane into a structure which expands over several tens of centimeters at the divertor target plates. Around the X point and in the high-field side, however, different phenomena enter into play suppressing the onset of convective transport generation. No signs of intermittency are oberation. No signs of intermittency are observed in these regions. Accordingly, like 'normal' turbulence, the onset of convective transport is affected by the local magnetic curvature and shear

  16. Spill-of-opportunity testing of dispersant effectiveness at the Mega Borg oil spill

    International Nuclear Information System (INIS)

    The release of 3.9 million gallons of Angola Planca crude oil from the stricken tanker Mega Borg 57 miles offshore of Galveston, Texas in June 1990 provided a valuable opportunity to document dispersant effectiveness under field conditions. Aerial application of Corexit 9527 (968 gallons total in four adjacent passes) onto an identified test portion of the slick was evaluated by concurrent observations from a command-and-control aircraft and surface vessels (with videotape and 35-mm photographic documentation) and ground truth measurements, including continuous 4-meter-depth ultraviolet/fluorescence and a discrete water sampling program. Using the study plan outlined by Payne and colleagues, target and control areas were designated before dispersant application by deployment of smoke bombs and coded three-meter drogues. Postdispersant surface vessel placement and 30 liter water sampling activities from the Texas A ampersand M research vessel HOS Citation were aided by the smoke bombs, the free-drifting drogues, and directions from the command-and-control aircraft. Subsequent FID GC and GC/MS analyses of water sample extracts allowed quantitation of the dispersed oil concentrations under both treated and control areas. Although the spilled oil was extremely light (API gravity 39.0) and subject to significant natural dispersion, the field observations, filmed documentation, and water column data clearly demonstrated an increase in dispersed oil concentrations beneath thin dispersed oil concentrations beneath the treated slick. The distribution of dispersed oil droplets was very heterogeneous and reflected the patchy distribution of oil on the water surface before dispersant application. Maximum concentrations of dispersed hydrocarbons in the center of the treated zone were 22,000 ?g/L (22 ppm) for total aliphatic and 5.6 ?g/L (5.6 ppb) for total aromatics 60 to 90 minutes after dispersant application. Elevated levels were generally limited to the upper 1 to 3 meters of the water column

  17. Direct Democracy in Decision Making for Mega-Projects: A New Culture of “Governance in Partnership”?

    Directory of Open Access Journals (Sweden)

    Rainer ROTHFUß

    2012-12-01

    Full Text Available Decision making for urban and transport infrastructure mega-projects has been increasingly contested in the recent past. Citizens obviously do not see themselves well enough represented through the elected politicians. Regular information and participation fora do not seem to offer satisfactory co-decision opportunities for increasingly critical citizens. The paper analyses the theoretical background of the current planning crisis and suggests more radical forms of citizens’ involvement: The hypothesis suggests that instruments for direct democratic decision making can open up new pathways to support the break-through of the citizens’ will. The paper analyses an interesting case study where two referenda around the same issue closely followed each other: Firstly, a top-down initiated referendum with a tendentious formulation of the question and with strong single-sided media support and, secondly, a referendum initiated by a citizens’ petition. Even though the citizens’ initiative managed to win the referendum, invalidating the previous decisions, a new challenge lies in the lacking motivation of political leaders to implement it. Finally, the case study helps to formulate some proposals for improvement of direct democratic instruments. The main lesson that can be learned from the case study, however, is that our societies are in desperate need for a new “culture of governance in partnership” with the people, the stakeholders and the affected neighbouring societies. Political decision making and planning needs more transparent, fair and honest communication, exchange and mutual respect and learning. Such culture would make societies more liveable and, at the same time, resilient against any sort of crisis.

  18. The internal structure of the Mega-dunes in the Badainjaran desert revealed by ground penetrating radar and its implications to arid hydrology

    Science.gov (United States)

    Qian, R.; Li, J.; Liu, L.

    2013-12-01

    Badainjaran desert in northwestern China has the world's highest stationary sand dunes, which are up to 500 m tall. Despite the prevailing dry and windy weather conditions the mega dunes were relatively moist underneath a dry surface layer of about 20 cm. It is very common to see a lake directly at the foot of the leeward side of a mega dune. Using 50- and 100-MHz antenna we conducted ground penetrating radar (GPR) surveys on both the windward and leeward of three mega dunes in southeastern Badainjaran desert. The GPR surveys clearly revealed the existence of numerous, almost evenly spaced calcareous cement and travertine features at shallow depth on the windward side of the mega dunes. The leeward tilted orientation of these calcareous cement and travertine features will be likely inducing more infiltration toward the leeward thus getting more recharge to the lake than the windward side. This trend may be one key factors to keep the lake exist in a very arid environment with high evaporation rate. The GPR profile also clearly depicted the shape of the water table beneath the mega dunes. The water table is gradually elevated outward from the lake, implies that the lake is possibly recharged by both precipitation from the vadose zone and the free water recharge from beneath the water table. A preliminary precipitation-evaporation-yield analysis based on our observation indicates that the lakes we studied may be survival if no further reduction of precipitation in this desert area.

  19. The impact of mega-catastrophes on insurers: an exposure-based analysis of the U.S. homeowners' insurance market.

    Science.gov (United States)

    Hagendorff, Bjoern; Hagendorff, Jens; Keasey, Kevin

    2015-01-01

    Insurance is a key risk-sharing mechanism that protects citizens and governments from the losses caused by natural catastrophes. Given the increase in the frequency and intensity of natural catastrophes over recent years, this article analyzes the performance effects of mega-catastrophes for U.S. insurance firms using a measure of market expectations. Specifically, we analyze the share price losses of insurance firms in response to catastrophe events to ascertain whether mega-catastrophes significantly damage the performance of insurers and whether different types of mega-catastrophes have different impacts. The main message from our analysis is that the impact of mega-catastrophes on insurers has not been too damaging. While the exact impact of catastrophes depends on the nature of the event and the degree of competition within the relevant insurance market (less competition allows insurers to recoup catastrophe losses through adjustments to premiums), our overall results suggest that U.S. insurance firms can adequately manage the risks and costs of mega-catastrophes. From a public policy perspective, our results show that insurance provides a robust means of sharing catastrophe losses to help reduce the financial consequences of a catastrophe event. PMID:25041510

  20. Damage to plasmid DNA induced by low energy carbon ions

    Energy Technology Data Exchange (ETDEWEB)

    Hunniford, C A [Centre for Plasma Physics, School of Mathematics and Physics, Queen' s University Belfast, University Road, Belfast, BT7 1NN (United Kingdom); Timson, D J [School of Biological Sciences, Medical Biology Centre, Queen' s University Belfast, 97 Lisburn Road, Belfast, BT9 7BL (United Kingdom); Davies, R J H [School of Biological Sciences, Medical Biology Centre, Queen' s University Belfast, 97 Lisburn Road, Belfast, BT9 7BL (United Kingdom); McCullough, R W [Centre for Plasma Physics, School of Mathematics and Physics, Queen' s University Belfast, University Road, Belfast, BT7 1NN (United Kingdom)

    2007-07-07

    The damage induced in supercoiled plasmid DNA molecules by 1-6 keV carbon ions has been investigated as a function of ion exposure, energy and charge state. The production of short linear fragments through multiple double strand breaks has been demonstrated and exponential exposure responses for each of the topoisomers have been found. The cross section for the loss of supercoiling was calculated to be (2.2 {+-} 0.5) x 10{sup -14} cm{sup 2} for 2 keV C{sup +} ions. For singly charged carbon ions, increased damage was observed with increasing ion energy. In the case of 2 keV doubly charged ions, the damage was greater than for singly charged ions of the same energy. These observations demonstrate that ion induced damage is a function of both the kinetic and potential energies of the ion.

  1. Impact of a Residency Interest Group on Students Applying for Residency

    OpenAIRE

    Stover, Kayla R.; Fleming, Laurie W.; Riche, Daniel M.; Sherman, Justin J.; Bloodworth, Lauren S.

    2014-01-01

    Objective. To determine the impact of a faculty-directed, residency interest group on the knowledge, confidence, and preparedness about residency-related topics of third-year (P3) and fourth-year (P4) pharmacy students.

  2. Factors affecting plasmid production in Escherichia coli from a resource allocation standpoint

    Directory of Open Access Journals (Sweden)

    Cunningham Drew S

    2009-05-01

    Full Text Available Abstract Background Plasmids are being reconsidered as viable vector alternatives to viruses for gene therapies and vaccines because they are safer, non-toxic, and simpler to produce. Accordingly, there has been renewed interest in the production of plasmid DNA itself as the therapeutic end-product of a bioprocess. Improvement to the best current yields and productivities of such emerging processes would help ensure economic feasibility on the industrial scale. Our goal, therefore, was to develop a stoichiometric model of Escherichia coli metabolism in order to (1 determine its maximum theoretical plasmid-producing capacity, and to (2 identify factors that significantly impact plasmid production. Results Such a model was developed for the production of a high copy plasmid under conditions of batch aerobic growth on glucose minimal medium. The objective of the model was to maximize plasmid production. By employing certain constraints and examining the resulting flux distributions, several factors were determined that significantly impact plasmid yield. Acetate production and constitutive expression of the plasmid's antibiotic resistance marker exert negative effects, while low pyruvate kinase (Pyk flux and the generation of NADPH by transhydrogenase activity offer positive effects. The highest theoretical yield (592 mg/g resulted under conditions of no marker or acetate production, nil Pyk flux, and the maximum allowable transhydrogenase activity. For comparison, when these four fluxes were constrained to wild-type values, yields on the order of tens of mg/g resulted, which are on par with the best experimental yields reported to date. Conclusion These results suggest that specific plasmid yields can theoretically reach 12 times their current experimental maximum (51 mg/g. Moreover, they imply that abolishing Pyk activity and/or transhydrogenase up-regulation would be useful strategies to implement when designing host strains for plasmid production; mutations that reduce acetate production would also be advantageous. The results further suggest that using some other means for plasmid selection than antibiotic resistance, or at least weakening the marker's expression, would be beneficial because it would allow more precursor metabolites, energy, and reducing power to be put toward plasmid production. Thus far, the impact of eliminating Pyk activity has been explored experimentally, with significantly higher plasmid yields resulting.

  3. Awareness of Infectious Diseases in Obstetrics and Gynecology Among Residents and Residency Directors

    OpenAIRE

    Soper, David E.; Larraine Presley; Galen E. Switzer; Beigi, Richard H.

    2006-01-01

    Awareness of the subspecialty of infectious diseases in obstetrics and gynecology is low among United States residents and residency directors. Objective. Given the burden of infectious diseases on women's health, we sought to assess current awareness, interest, and perceived value of the subspecialty of infectious diseases in obstetrics and gynecology among current United States obstetrics and gynecology residents and residency directors. Methods. Two separate surveys addressing awarenes...

  4. Regional disparity and cost-effective SO2 pollution control in China: A case study in 5 mega-cities

    International Nuclear Information System (INIS)

    With rapid development, increasing sulfur dioxide (SO2) emission becomes a key environmental issue in China. To respond to this challenge, the Chinese government established a top-down scheme to reduce its SO2 emissions. However, regional disparity and the associated cost differences brought uncertainties to the policy effectiveness and efficiency. Few studies focus on this field. Therefore, this study tries to fill such a gap by investigating the differences of SO2 emissions, reduction potential, and cost-effectiveness through use of the GAINS-China model in five mega-cities in China, namely, Beijing, Shanghai, Tianjin, Chongqing, and Hong Kong. A scenario analysis approach is employed, focusing on two technologies named flue gas desulfurization (FGD) and limestone injection (LINJ). Results demonstrated that a large SO2 reduction potential exists, as well as a great disparity, among the five mega-cities. Chongqing had the largest reduction potential with lowest unit cost, while Beijng and Hong Kong showed the lowest reduction potential with higher unit cost. In Beijing and Shanghai, FGD and LINJ in the power generation sector had the larger reduction potential with the highest cost-effectiveness. However, in Chongqing, the industry sectors also had large reduction potentials. Finally, appropriate SO2 control strategies and policies are raised by considering the local realities. - Highlights: • The cost-effectiveness of SO2 control policy was analyzed in five mega-cities in China. • Reduction potential and cost-effectiveness were closely linked to regional disparity. • Beijing and Hong Kong showed lower reduction potential and higher marginal reduction cost. • Chongqing showed the largest reduction potential and the lowest marginal reduction cost

  5. Pharmacist educators in family medicine residency programs: A qualitative analysis

    OpenAIRE

    Jorgenson Derek; Muller Andries; Whelan Anne

    2012-01-01

    Abstract Background 25-29% of North American family medicine residency programs utilize a pharmacist to teach residents. Little is known about the impact that these pharmacist educators have on residency training. The purpose of this study was to examine the experiences of residents, residency directors and pharmacists within Canadian family medicine residency programs that employ a pharmacist educator to better understand the impact of the role. Methods Recruitment from three cohorts (reside...

  6. Systematic analysis of direct-drive baseline designs for shock ignition with the Laser MegaJoule

    International Nuclear Information System (INIS)

    We present direct-drive target design studies for the laser Megajoule using two distinct initial aspect ratios (A = 34 and A = 5). Laser pulse shapes are optimized by a random walk method and drive power variations are used to cover a wide variety of implosion velocities between 260 km/s and 365 km/s. For selected implosion velocities and for each initial aspect ratio, scaled-target families are built in order to find self-ignition threshold. High-gain shock ignition is also investigated in the context of Laser MegaJoule for marginally igniting targets below their own self-ignition threshold. (authors)

  7. Resident Performance and Sleep Deprivation: A Review.

    Science.gov (United States)

    Asken, Michael J.; Raham, David C.

    1983-01-01

    A review of the literature on resident performance and sleep deprivation suggests that current research is sparse and inconclusive, and existing research suggests potentially severe negative effects. It is proposed that justifications for sleep-depriving night call schedules remain untested, and their use as part of residency training should be…

  8. Current Perspectives on Chief Residents in Psychiatry

    Science.gov (United States)

    Warner, Christopher H.; Rachal, James; Breitbach, Jill; Higgins, Michael; Warner, Carolynn; Bobo, William

    2007-01-01

    Objective: The authors examine qualitative data from outgoing chief residents in psychiatry from the 2004-2005 academic year to 1) determine common characteristics between programs, 2) examine the residents' perspectives on their experiences, and 3) determine their common leadership qualities. Method: The authors sent out self-report surveys via…

  9. Arthroscopic training resources in orthopedic resident education.

    Science.gov (United States)

    Koehler, Ryan; John, Tamara; Lawler, Jeffrey; Moorman, Claude; Nicandri, Gregg

    2015-02-01

    The purpose of this study was to determine the frequency of use, perceived effectiveness, and preference for arthroscopic surgical skill training resources. An electronic survey was sent to orthopedics residents, residency program directors, and orthopedic sports medicine attending physicians in the United States. The frequency and perceived effectiveness of 10 types of adjunctive arthroscopic skills training was assessed. Residents and faculty members were asked to rate their confidence in resident ability to perform common arthroscopic procedures. Surveys were completed by 40 of 152 (26.3%) orthopedic residency program directors, 70 of 426 (16.4%) sports medicine faculty, and 235 of 3,170 (7.4%) orthopedic residents. The use of adjunctive methods of training varied from only 9.8% of programs with virtual reality training to 80.5% of programs that used reading of published materials to develop arthroscopic skill. Practice on cadaveric specimens was viewed as the most effective and preferred adjunctive method of training. Residents trained on cadaveric specimens reported increased confidence in their ability to perform arthroscopic procedures. The resources for developing arthroscopic surgical skill vary considerably across orthopedic residency programs in the United States. Adjunctive training methods were perceived to be effective at supplementing traditional training in the operating room. PMID:24510522

  10. Displacing Media: LCD LAB Artistic Residency

    OpenAIRE

    Filipe Pais

    2012-01-01

    This review refers to an artistic residency which took place at LCD LAB -  CAAA at Guimarães, in March, exploring a strategy for media art called Media Displacement. The text introduces the strategy very briefly and describes the residency's organization, structure, processses and the results produced.

  11. Displacing Media: LCD LAB Artistic Residency

    Directory of Open Access Journals (Sweden)

    Filipe Pais

    2012-12-01

    Full Text Available This review refers to an artistic residency which took place at LCD LAB -  CAAA at Guimarães, in March, exploring a strategy for media art called Media Displacement. The text introduces the strategy very briefly and describes the residency's organization, structure, processses and the results produced.

  12. A Sexuality Curriculum for Gynecology Residents

    Science.gov (United States)

    Levine, Stephen B.; And Others

    1978-01-01

    The summary report of an educational research program conducted with the obstetrics and gynecology residents at University Hospitals of Cleveland in 1976 is presented. The goals were to provide residents with basic knowledge about female sexual problems, assess skill and comfort in interviewing patients with sexual problems, document the effects…

  13. IncP plasmids are most effective in mediating conjugation between Escherichia coli and streptomycetes.

    Science.gov (United States)

    Luzhetskyy, A; Fedoryshyn, M; Gromyko, O; Ostash, B; Rebets, Y; Bechthold, A; Fedorenko, V

    2006-05-01

    Mobilizable shuttle plasmids containing the origin of transfer (oriT) region of plasmid F (IncFI), ColIb-P9 (IncI1), and RP4/RP1 (IncPalpha) were constructed to test the ability of the cognate conjugation system to mediate gene transfer from Escherichia coli to Streptomyces. The conjugative system of the IncPalpha plasmids was shown to be most effective in conjugative transfer, giving peak values of (2.7 +/- 0.2) x 10(-2) S. lividans TK24 exconjugants per recipient cell. To assess whether the mating-pair formation system or the DNA-processing apparatus of the IncPalpha plasmids is crucial in conjugative transfer, an assay with an IncQ-based mobilizable plasmid (RSF1010) specifying its own DNA-processing system was developed. Only the IncPalpha plasmid mobilized the construct to S. lividans indicating that the mating-pair formation system is primarly responsible for the promiscuous transfer of the plasmids between E. coli and Streptomyces. Dynamic of conjugative transfer from E. coli to S. lividans was investigated and exconjugants starting from the first hour of mating were obtained. PMID:16808239

  14. Use of a shuttle plasmid to study mutations in human cells by ionizing radiation

    International Nuclear Information System (INIS)

    The nature of mutagenic changes induced by ionizing radiation in human cells is being studied in a SV40-based shuttle plasmid pZ 189 containing E. coli supF-tRNA as the target gene. The mutant plasmids are detected by phenotypic screening of the plasmid-bearing bacteria and the mutations in the tRNA gene identified by direct sequencing of the recovered plasmid. The whole plasmid, the tRNA gene fragment, or a segment of it are irradiated in vitro before introduction of the plasmid into human cells. Preliminary results show mutations in about 4% of the reconstituted plasmids containing X-irradiated (5 Gy) tRNA gene fragments following their replication in E. coli. Two independent isolates among the mutants had the same C->G transversion. X-ray induced chromosome aberrations in the lymphoblastoid cells are also analyzed in order to compare genomic changes at the molecular and microscopic levels. A linear increase in aberrations was observed in G2-irradiated cells

  15. GenoLIB: a database of biological parts derived from a library of common plasmid features

    Science.gov (United States)

    Adames, Neil R.; Wilson, Mandy L.; Fang, Gang; Lux, Matthew W.; Glick, Benjamin S.; Peccoud, Jean

    2015-01-01

    Synthetic biologists rely on databases of biological parts to design genetic devices and systems. The sequences and descriptions of genetic parts are often derived from features of previously described plasmids using ad hoc, error-prone and time-consuming curation processes because existing databases of plasmids and features are loosely organized. These databases often lack consistency in the way they identify and describe sequences. Furthermore, legacy bioinformatics file formats like GenBank do not provide enough information about the purpose of features. We have analyzed the annotations of a library of ?2000 widely used plasmids to build a non-redundant database of plasmid features. We looked at the variability of plasmid features, their usage statistics and their distributions by feature type. We segmented the plasmid features by expression hosts. We derived a library of biological parts from the database of plasmid features. The library was formatted using the Synthetic Biology Open Language, an emerging standard developed to better organize libraries of genetic parts to facilitate synthetic biology workflows. As proof, the library was converted into GenoCAD grammar files to allow users to import and customize the library based on the needs of their research projects. PMID:25925571

  16. Phylogenetic analysis of the pPT23A plasmid family of Pseudomonas syringae.

    Science.gov (United States)

    Ma, Zhonghua; Smith, James J; Zhao, Youfu; Jackson, Robert W; Arnold, Dawn L; Murillo, Jesús; Sundin, George W

    2007-02-01

    The pPT23A plasmid family of Pseudomonas syringae contains members that contribute to the ecological and pathogenic fitness of their P. syringae hosts. In an effort to understand the evolution of these plasmids and their hosts, we undertook a comparative analysis of the phylogeny of plasmid genes and that of conserved chromosomal genes from P. syringae. In total, comparative sequence and phylogenetic analyses were done utilizing 47 pPT23A family plasmids (PFPs) from 16 pathovars belonging to six genomospecies. Our results showed that the plasmid replication gene (repA), the only gene currently known to be distributed among all the PFPs, had a phylogeny that was distinct from that of the P. syringae hosts of these plasmids and from those of other individual genes on PFPs. The phylogenies of two housekeeping chromosomal genes, those for DNA gyrase B subunit (gyrB) and primary sigma factor (rpoD), however, were strongly associated with genomospecies of P. syringae. Based on the results from this study, we conclude that the pPT23A plasmid family represents a dynamic genome that is mobile among P. syringae pathovars. PMID:17114318

  17. Reverse micellar extraction systems for the purification of pharmaceutical grade plasmid DNA.

    Science.gov (United States)

    Streitner, Nadine; Voss, Carsten; Flaschel, Erwin

    2007-08-31

    Plasmid DNA as an active pharmaceutical ingredient (API) is gaining more and more importance. For the production of multigram quantities of this substance robust and scalable processes comprising several purification steps have to be designed. One main challenge is the initial separation of plasmid DNA and RNA in such a purification scheme. In this study we investigated the distribution of plasmid DNA and RNA in reverse micellar two-phase systems which is considered to be the basis for the development of an extractive purification step that can easily be integrated into common processes. For this purpose the distribution of the 4.6kb plasmid pUT649 and Escherichia coli RNA in systems comprising isooctane, ethylhexanol, and the surfactant methyltrioctylammoniumchloride (TOMAC) under the influence of different salts was studied. Anion concentrations at which the partitioning behaviour for nucleic acids inverted (inversion point) were identified. Systems capable of separating RNA from plasmid DNA were further analysed and applied to extract RNA from plasmid DNA out of a preconditioned cleared lysate. The capability of reverse micellar systems for plasmid form separation was also shown by capillary and agarose gel electrophoresis. PMID:17673324

  18. Characterization of Antimicrobial Resistance Dissemination across Plasmid Communities Classified by Network Analysis

    Directory of Open Access Journals (Sweden)

    Akifumi Yamashita

    2014-04-01

    Full Text Available The global clustering of gene families through network analysis has been demonstrated in whole genome, plasmid, and microbiome analyses. In this study, we carried out a plasmidome network analysis of all available complete bacterial plasmids to determine plasmid associations. A blastp clustering search at 100% aa identity cut-off and sharing at least one gene between plasmids, followed by a multilevel community network analysis revealed that a surprisingly large number of the plasmids were connected by one largest connected component (LCC, with dozens of community sub-groupings. The LCC consisted mainly of Bacilli and Gammaproteobacteria plasmids. Intriguingly, horizontal gene transfer (HGT was noted between different phyla (i.e., Staphylococcus and Pasteurellaceae, suggesting that Pasteurellaceae can acquire antimicrobial resistance (AMR genes from closely contacting Staphylococcus spp., which produce the external supplement of V-factor (NAD. Such community network analysis facilitate displaying possible recent HGTs like a class 1 integron, str and tet resistance markers between communities. Furthermore, the distribution of the Inc replicon type and AMR genes, such as the extended-spectrum ß-lactamase (ESBL CTX-M or the carbapenemases KPC NDM-1, implies that such genes generally circulate within limited communities belonging to typical bacterial genera. Thus, plasmidome network analysis provides a remarkable discriminatory power for plasmid-related HGT and evolution.

  19. Construction of an artificial recombinant bicistronic plasmid DNA vaccine against porcine rotavirus

    Directory of Open Access Journals (Sweden)

    Tingting Cui

    2013-03-01

    Full Text Available The attenuated Salmonella typhimurium ?4550 strain was used to harbour a reconstructed bicistronic DNA vaccine against porcine rotavirus, which carried the rotavirus nonstructural protein 4 (NSP4 and VP7 genes simultaneously. Using a balanced lethal system, the kanamycin resistance gene of expressing eukaryotic plasmids pVAX1 and pVAXD were replaced by the aspartate ?-semialdehyde dehydrogenase (asd gene. The NSP4 cleavage product (259–525 of rotavirus OSU strain and VP7 full-length genes were amplified by reverse transcription polymerase chain reaction and then inserted into the eukaryotic single-expression plasmid, pVAX1-asd, and the eukaryotic dual-expression plasmid, pVAXD-asd, respectively. The recombinant plasmids pVAX1-asd-NSP4, pVAX1-asd-VP7 and pVAXD-asd-NSP4-VP7 were transformed into the attenuated S. typhimurium ?4550 strain by electrotransformation. An indirect immunofluorescence assay of the expressed COS-7 cell suggested that the recombinant S. typhimurium ?4550 strain was constructed successfully. The recombinant S. typhimurium ?4550 strain was orally administered to BALB/c mice. The group immunised with dual- expression plasmids produced a significantly higher level of serum Immunoglobulin G (IgG and intestinal Immunoglobulin A (IgA than the group immunised with single-expression plasmids. These results indicated that eukaryotic bicistronic plasmid DNA vaccines could be successfully constructed to enhance humoural, mucosal and cellular immune response against rotavirus infection.

  20. RP4 promotion of transfer of a large Agrobacterium plasmid which confers virulence.

    Science.gov (United States)

    Chilton, M D; Farrand, S K; Levin, R; Nester, E W

    1976-08-01

    Introduction of RP4 plasmid into Agrobacterium tumefaciens promotes the transfer on solid medium of large virulence-associated plasmids from virulent donor strains to a plasmidless avirulent recipient. Exconjugants were selected for the ability to utilize octopine or nopaline as the sole source of arginine, traits which are coded for by virulence-associated plasmids in the strains employed here. All exconjugants retained the arginine auxotrophy of the recipient strain, and were resistant to ampicillin and kanamycin, drugs to which RP4 confers resistance. Five exconjugant clones from one cross were shown by alkaline sucrose gradient analysis to contain both RP4 plasmid and the large virulence-associated plasmid of the donor strain. All five exconjugants exhibited virulence on carrot, sunflower and kalanchoe plants. These results indicate that virulence and the ability to degrade octopine are plasmid-borne traits in A. tumefaciens strains 15955 and A6, and extend the evidence that large plasmids in A. tumefaciens are vectors of virulence genes. PMID:971805

  1. Plasmid-mediated fitness advantage of Acinetobacter baylyi in sulfadiazine-polluted soil.

    Science.gov (United States)

    Jechalke, Sven; Kopmann, Christoph; Richter, Mona; Moenickes, Sylvia; Heuer, Holger; Smalla, Kornelia

    2013-11-01

    LowGC-type plasmids conferring resistance to sulfonamides have been frequently isolated from manure and manured soil. However, knowledge on the dynamics of plasmid-carrying populations in soil and their response to the presence of sulfonamides is scarce. Here, we investigated effects of the sulfonamide resistance conferring plasmid pHHV216 on the fitness of Acinetobacter baylyi BD413 in soil after application of manure with or without the sulfonamide antibiotic sulfadiazine (SDZ). The persistence of A. baylyi BD413 pHHV216 in competition to its plasmid-free variant was followed in soil microcosms. CFU counts showed a decrease in A. baylyi BD413 in manured soils over the experimental period of 32 days by about 0.5 log units. The proportion of the plasmid-carrying populations decreased from 50 to advantage for the plasmid-carrying population of BD413 in soil, while the plasmid conferred a fitness disadvantage when selective pressure by SDZ was absent. In future, this method may be used as a tool for the assessment of bioavailability of antibiotics in soil. PMID:24118075

  2. Pseudomonas aeruginosa plasmids controlling resistance to ultraviolet irradiation and enhanced mutability

    International Nuclear Information System (INIS)

    Propagation on resistance plasmides of Pseudomonas aeruginosa genes to antibiotics determining bacterial cell resistance to ultraviolet irradiation and elevated mutability as well as mechanisms of these processes was studied. It is established that 11 out of 35 investigated plasmids of P. aeruginosa of P-2 incompatibility group increase resistance to the ultraviolet irradiation of P. aeruginosa strains of the initial type with uvr- and pol A mutations. Two pBS12 and pBS31 plasmids studied more detailed protect from lethal effect of methylmethanesulfonate for strains both with Uvr+ and Uvr phenotypes. Under the ultraviolet irradiation frequency of revertant appearance to His+ Trp+ increases in the initial type strains (His- Trp-) containing pBS12 and pBS31 plasmids. Sodium arsenite eliminates completely the protective effect to the ultraviolet irradiation determined with the pBS12 and pBS31 plasmids. It is suggested that the pBS12 and pBS31 plasmids contain genes in its composition which funcitioning during the participation of recA+ of dependent arsenite-sensitive way of dark DNA recovery considerably increases the resistance level of P. aeruginosa cells to the ultraviolet irradiation and their mutability. Wide propagation on resistance plasmids of genes increasing bacteria resistance to the ultraviolet irradiation and their mutability is concluded

  3. Novel Plasmid Transformation Method Mediated by Chrysotile, Sliding Friction, and Elastic Body Exposure

    Directory of Open Access Journals (Sweden)

    Naoto Yoshida

    2007-01-01

    Full Text Available Escherichia coli as a plasmid recipient cell was dispersed in a chrysotile colloidal solution, containing chrysotile adsorbed to plasmid DNA (chrysotile-plasmid cell mixture. Following this, the chrysotile-plasmid cell mixture was dropped onto the surface of an elastic body, such as agarose, and treated physically by sliding a polystyrene streak bar over the elastic body to create friction. Plasmid DNA was easily incorporated into E. coli, and antibiotic resistance was conferred by transformation. The transformation efficiency of E. coli cultured in solid medium was greater than that of E. coli cultured in broth. To obtain greater transformation efficiency, we attempted to determine optimal transformation conditions. The following conditions resulted in the greatest transformation efficiency: the recipient cell concentration within the chrysotileplasmid cell mixture had an optical density greater than or equal to 2 at 550 nm, the vertical reaction force applied to the streak bar was greater than or equal to 40 g, and the rotation speed of the elastic body was greater than or equal to 34 rpm. Under these conditions, we observed a transformation efficiency of 107 per ?g plasmid DNA. The advantage of achieving bacterial transformation using the elastic body exposure method is that competent cell preparation of the recipient cell is not required. In addition to E. coli, other Gram negative bacteria are able to acquire plasmid DNA using the elastic body exposure method.

  4. Construction of an artificial recombinant bicistronic plasmid DNA vaccine against porcine rotavirus

    Scientific Electronic Library Online (English)

    Tingting, Cui; Jun, Xiong; Yongzhi, Wang; Xintian, Wen; Xiaobo, Huang; Yong, Huang; Xiaoping, Ma; Zhongkai, Hu; Qin, Zhao; Sanjie, Cao.

    Full Text Available The attenuated Salmonella typhimurium ?4550 strain was used to harbour a reconstructed bicistronic DNA vaccine against porcine rotavirus, which carried the rotavirus nonstructural protein 4 (NSP4) and VP7 genes simultaneously. Using a balanced lethal system, the kanamycin resistance gene of expressi [...] ng eukaryotic plasmids pVAX1 and pVAXD were replaced by the aspartate ?-semialdehyde dehydrogenase (asd) gene. The NSP4 cleavage product (259-525) of rotavirus OSU strain and VP7 full-length genes were amplified by reverse transcription polymerase chain reaction and then inserted into the eukaryotic single-expression plasmid, pVAX1-asd, and the eukaryotic dual-expression plasmid, pVAXD-asd, respectively. The recombinant plasmids pVAX1-asd-NSP4, pVAX1-asd-VP7 and pVAXD-asd-NSP4-VP7 were transformed into the attenuated S. typhimurium ?4550 strain by electrotransformation. An indirect immunofluorescence assay of the expressed COS-7 cell suggested that the recombinant S. typhimurium ?4550 strain was constructed successfully. The recombinant S. typhimurium ?4550 strain was orally administered to BALB/c mice. The group immunised with dual-expression plasmids produced a significantly higher level of serum Immunoglobulin G (IgG) and intestinal Immunoglobulin A (IgA) than the group immunised with single-expression plasmids. These results indicated that eukaryotic bicistronic plasmid DNA vaccines could be successfully constructed to enhance humoural, mucosal and cellular immune response against rotavirus infection.

  5. Host range of enterococcal vanA plasmids among Gram-positive intestinal bacteria

    DEFF Research Database (Denmark)

    Werner, Guido; Freitas, Ana R.

    2010-01-01

    OBJECTIVES: The most prevalent type of acquired glycopeptide resistance is encoded by the vanA transposon Tn1546 located mainly on transferable plasmids in Enterococcus faecium. The limited occurrence in other species could be due to the lack of inter-species transferability and/or stability of Tn1546-containing plasmids in other species. We investigated the in vitro transferability of 14 pre-characterized vanA-containing plasmids hosted by E. faecium (n = 9), Enterococcus faecalis (n = 4) and Enterococcus raffinosus (n = 1) into several enterococcal, lactobacterial, lactococcal and bifidobacterial recipients. METHODS: A filter-mating protocol was harmonized using procedures of seven partner laboratories. Donor strains were mated with three E. faecium recipients, three E. faecalis recipients, a Lactobacillus acidophilus recipient, a Lactococcus lactis recipient and two Bifidobacterium recipients. Transfer rates were calculated per donor and recipient. Transconjugants were confirmed by determining their phenotypic and genotypic properties. Stability of plasmids in the new host was assessed in long-term growth experiments. RESULTS: In total, 282 enterococcal matings and 73 inter-genus matings were performed and evaluated. In summary, intra-species transfer was far more frequent than inter-species transfer, if that was detectable at all. All recipients of the same species behaved similarly. Inter-genus transfer was shown for broad host range control plasmids (pIP501/pAM?1) only. Acquired resistance plasmids remained stable in the new host. CONCLUSIONS: Intra-species transfer of enterococcal vanA plasmids was far more frequent than transfer across species or genus barriers and may thus explain the preferred prevalence of vanA-containing plasmids among E. faecium. A reservoir of vanA plasmids in non-enterococcal intestinal colonizers does not seem to be reasonable.

  6. Natural plasmid transformation in a high-frequency-of transformation marine Vibrio strain

    International Nuclear Information System (INIS)

    The estuarine bacterium Vibrio strain DI-9 has been shown to be naturally transformable with both broad host range plasmid multimers and homologous chromosomal DNA at average frequencies of 3.5 x 10-9 and 3.4 x 10-7 transformants per recipient, respectively. Growth of plasmid transformants in nonselective medium resulted in cured strains that transformed 6 to 42,857 times more frequently than the parental strain, depending on the type of transforming DNA. These high-frequency-of-transformation (HfT) strains were transformed at frequencies ranging from 1.1 x 10-8 to 1.3 x 10-4 transformants per recipient with plasmid DNA and at an average frequency of 8.3 x 10-5 transformants per recipient with homologous chromosomal DNA. The highest transformation frequencies were observed by using multimers of an R1162 derivative carrying the transposon Tn5 (pQSR50). Probing of total DNA preparations from one of the cured strains demonstrated that no plasmid DNA remained in the cured strains which may have provided homology to the transforming DNA. All transformants and cured strains could be differentiated from the parental strains by colony morphology. DNA binding studies indicated that late-log-phase HfT strains bound [3H]bacteriophage lambda DNA 2.1 times more rapidly than the parental strain. These results suggest that the original plasmid transformation event of strain DI-9 was the result of uptake and expression-9 was the result of uptake and expression of plasmid DNA by a competent mutant (HfT strain). Additionally, it was found that a strain of Vibrio parahaemolyticus, USFS 3420, could be naturally transformed with plasmid DNA. Natural plasmid transformation by high-transforming mutants may be a means of plasmid acquisition by natural aquatic bacterial populations

  7. Replication efficiency of rolling-circle replicon-based plasmids derived from porcine circovirus 2 in eukaryotic cells.

    OpenAIRE

    Faurez, Florence; Dory, Daniel; Henry, Aure?lie; Bougeard, Ste?phanie; Jestin, Andre?

    2010-01-01

    In this study, a method was developed to measure replication rates of rolling-circle replicon-based plasmids in eukaryotic cells. This method is based on the discriminative quantitation of MboI-resistant, non-replicated input plasmids and DpnI-resistant, replicated plasmids. To do so, porcine circovirus type 2 (PCV2) replicon-based plasmids were constructed. These plasmids contained the PCV2 origin of replication, the PCV2 Rep promoter and the PCV2 Rep gene. The results show that the replicat...

  8. Extraction of Dengue 2 Plasmid DNA Vaccine (pD2 from Cell Lysates by Aqueous Two-Phase Systems

    Directory of Open Access Journals (Sweden)

    Keila Aparecida Moreira

    2007-01-01

    Full Text Available This research describes the partitioning in PEG/phosphate systems of the plasmid pD2, a dengue 2 plasmid DNA vaccine, present in a clarified E. coli alkaline lysate. Factors that affect the partition as PEG molecular weight, plasmid concentration and the lysate volume loaded in the system were investigated. Results showed that partition behavior of plasmid DNA depends on the system molecular weight, a considerable amount of protein of the cell lysate was accumulated in the interphase of the systems. The best recovery plasmid yield (37% was obtained with PEG 400 (20/20% w/w systems with a 60% (w/w lysate load.

  9. The conjugal transfer system of Agrobacterium tumefaciens octopine-type Ti plasmids is closely related to the transfer system of an IncP plasmid and distantly related to Ti plasmid vir genes.

    OpenAIRE

    Alt-mo?rbe, J.; Stryker, J. L.; Fuqua, C.; Li, P. L.; Farrand, S. K.; Winans, S. C.

    1996-01-01

    We have determined the DNA sequences of two unlinked regions of octopine-type Ti plasmids that contain genes required for conjugal transfer. Both regions previously were shown to contain sequences that hybridize with tra genes of the nopaline-type Ti plasmid pTiC58. One gene cluster (designated tra) contains a functional oriT site and is probably required for conjugal DNA processing, while the other gene cluster (designated trb) probably directs the synthesis of a conjugal pilus and mating po...

  10. Complete nucleotide sequence of a linear plasmid from Streptomyces clavuligerus and characterization of its RNA transcripts.

    OpenAIRE

    Wu, X.; Roy, K. L.

    1993-01-01

    The complete nucleotide sequence of a small linear plasmid (pSCL1) from Streptomyces clavuligerus has been determined. This plasmid is 11,696 bp in length, has a 72% G+C content, and has approximately 900-bp inverted terminal repeat sequences. A comparison of the inverted terminal repeats of pSCL1 with those of a linear plasmid from S. rochei shows that the two terminal sequences have a high degree of similarity (approximately 70%). Several small inverted repeats found in the long terminal se...

  11. A palindromic mutation of the linear killer plasmid k2 of yeast.

    OpenAIRE

    We?solowski-louvel, M.; Fukuhara, H.

    1990-01-01

    Production of the killer toxin in Kluyveromyces lactis is dependent on the presence of two linear DNA plasmids, k1 and k2. We isolated a non-killer mutant, VM5, with a modified plasmid composition. It had lost k1, but conserved k2, and acquired, in addition, three new DNA species. The new species were found to be rearranged derivatives of the k2 plasmid. One of them, pVM5-1, was made of the left terminal 4720 bp sequence of k2, including the inverted terminal repeat, and was organized as a la...

  12. Bacillus stearothermophilus contains a plasmid-borne gene for alpha-amylase.

    OpenAIRE

    Mielenz, J R

    1983-01-01

    The gene for thermostable alpha-amylase from the thermophilic bacterium Bacillus stearothermophilus has been cloned and expressed in Escherichia coli. Each alpha-amylase-producing colony contained at least a 9.7-kilobase-pair (kb) chimeric plasmid composed of the vector pBR322 and a common 5.4-kb HindIII fragment of DNA. B. stearothermophilus contains four plasmids with sizes from 12 kb to over 108 kb. Restriction endonuclease analysis of these naturally occurring plasmids showed they also co...

  13. Antibiotic resistance and plasmids carriage among Escherichia coli isolates from chicken meat in Malaysia

    International Nuclear Information System (INIS)

    One hundred and thirty-one Escherichia coli isolates from raw chicken meat were tested for antibiotic susceptibility to twelve antibiotics, namely ampicillin 10?g, cefoparazone 30?g, cephradine 30?g, ciprofloxacin 5?g, chloramphenicol 30?g, enrofloxacin 5?g, erythromycin 15?g, kanamycin 30?g, nalidixic acid 30?g, tetracycline 30?g, trimethoprim 5?g, and vancomycin 30?g. The plasmid isolation was carried out according to the method described by Maniatis et al, with modifications as in the protocol provided by Taq Dye Deoxy Terminator Cycle Sequencing Kit (ABI P/ N 401150). The newly modified method is a mini alkaline-lysis / PGE precipitation procedure and easy to perform on large numbers of samples. The graphical method of relating the logarithm of the molecular weight of a DNA molecule (log C) to its electrophoretic mobility (m) in gels was used to determine the molecular weight of plasmid. Plasmids of known molecular weight from E. coli V517 were used as standards for calibrating the size of plasmid DNA molecules. In this study DNA fragments are referred to as plasmids. In all Escherichia coli isolates resistance to ampicillin (96.2%), cefoperazone (83.3%), cephradine (93.9%), ciprofloxacin (78.0%), chloramphenical (75.6%), enrofloxacin (72.0%), erythromycin (84.0%), kanamycin (50.8%), nalidixic acid (94.7%), tetracycline (90.2%), trimethoprim (94.7%) and vancomycin (100%) was observed (Table I). Plasmid occurrence rates of 81.7% were observed among E. c81.7% were observed among E. coli isolates from the chicken meat. The number of plasmids ranged from 0 to 8 and the sizes of plasmids ranged from 1.2 MDa to 118.6 MDa. Plasmids were detected in 93.8% of E. coli isolates that were resistant to all 12 antibiotics and in 90.5% of E. coli isolates resistant to 11 antibodies (Table II). Three (2.8%) E. coli isolates harboured 8 plasmids and showed resistant to 12 antibiotics (Table III). The antibiotic resistance among the E. coli isolates in this study was compared and it was found a higher percentage of E. coli isolates resistant to ampicillin (96.9%), cephradine (94.7%) and trimethoprim (96.3%) had plasmids. It is known that antibiotic resistant genes in bacteria are usually carried in extrachromosomal DNA and therefore it may be concluded that when E. coli contained a high number of plasmids, it possessed a higher resistance to antibiotics

  14. Replication and segregation of a miniF plasmid during the division cycle of Escherichia coli.

    OpenAIRE

    Helmstetter, C E; Thornton, M; Zhou, P.; Bogan, J A; Leonard, A C; Grimwade, J E

    1997-01-01

    Replication of the miniF plasmid pML31 was examined during the division cycle of Escherichia coli growing with doubling times between 40 and 90 min at 37 degrees C and compared to the replication of plasmid pBR322 and the minichromosome pAL70. The replication pattern of pML31 was indistinguishable from that of pBR322 at all growth rates and very different from the cell-cycle-specific replication of the minichromosome. It is concluded that both pML31 and pBR322 plasmids can replicate at all st...

  15. Contribution of Salmonella gallinarum large plasmid toward virulence in fowl typhoid.

    OpenAIRE

    Barrow, P. A.; Simpson, J. M.; Lovell, M. A.; Binns, M. M.

    1987-01-01

    Four strains of Salmonella gallinarum isolated from independent cases of fowl typhoid all possessed both an 85-kilobase and a 2.5-kilobase plasmid. Each plasmid was eliminated in turn from one of the strains by transposon labeling and curing at 42 degrees C. Elimination of the small plasmid had no effect on the high virulence of the strain for newly hatched and 2-week-old chickens. Whereas oral inoculation of 2-week-old chickens with the parent strain produced 90% mortality with characteristi...

  16. Sequence organization of the circular plasmid pKD1 from the yeast Kluyveromyces drosophilarum.

    OpenAIRE

    Chen, X. J.; Saliola, M.; Falcone, C.; Bianchi, M. M.; Fukuhara, H.

    1986-01-01

    pKD1 is the only circular plasmid known in the genus Kluyveromyces. Nucleotide sequence analysis has revealed that this 4757 base-pairs long plasmid contained three major open reading frames, A, B, and C, and a pair of inverted repeats of 346 base-pairs. The molecule exists in two isomeric forms generated by internal recombination at these repeats. The functional organization of pKD1 genome appears to be quite analogous to that of the 2u plasmid of Saccharomyces cerevisiae. There is however l...

  17. Comparative Genomic Analysis of the pPT23A Plasmid Family of Pseudomonas syringae

    OpenAIRE

    Zhao, Youfu; Ma, Zhonghua; Sundin, George W.

    2005-01-01

    Members of the pPT23A plasmid family of Pseudomonas syringae play an important role in the interaction of this bacterial pathogen with host plants. Complete sequence analysis of several pPT23A family plasmids (PFPs) has provided a glimpse of the gene content and virulence function of these plasmids. We constructed a macroarray containing 161 genes to estimate and compare the gene contents of 23 newly analyzed and eight known PFPs from 12 pathovars of P. syringae, which belong to four genomosp...

  18. Gene transfer of Alcaligenes eutrophus JMP134 plasmid pJP4 to indigenous soil recipients.

    OpenAIRE

    DiGiovanni, G D; Neilson, J W; Pepper, I L; Sinclair, N A

    1996-01-01

    This study evaluated the potential for gene transfer of a large catabolic plasmid from an introduced organism to indigenous soil recipients. The donor organism Alcaligenes eutrophus JMP134 contained the 80-kb plasmid pJP4, which contains genes that code for mercury resistance. Genes on this plasmid plus chromosomal genes also allow degradation of 2,4-dichloruphenoxyacetic acid (2,4-D). When JMP134 was inoculated into a nonsterile soil microcosm amended with 1,000 micrograms of 2,4-D g-1, sign...

  19. Effect of Sym Plasmid Curing on Symbiotic Effectiveness in Rhizobium fredii†

    OpenAIRE

    Mathis, James N.; Barbour, W. Mark; Elkan, Gerald H.

    1985-01-01

    A mutant, USDA 206C, of Rhizobium fredii USDA 206 was obtained by passage on acridine plates. This mutant was cured of its 197-megadalton Sym plasmid but retained its symbiotic effectiveness. Multiple plasmid and chromosomally borne nif gene copies have previously been shown in R. fredii USDA 206. HindIII and EcoRI restriction enzyme digests of plasmid and total DNA showed that at least two nif gene copies are probably missing in USDA 206C. To compare the symbiotic effectiveness of USDA 206 a...

  20. Bovine papillomavirus vector that propagates as a plasmid in both mouse and bacterial cells.

    OpenAIRE

    Dimaio, D.; Treisman, R.; Maniatis, T.

    1982-01-01

    We report the construction of a bovine papillomavirus (BPV)-derived recombinant plasmid that propagates as an extrachromosomal element in both mouse and bacterial cells. Plasmids composed of a subgenomic transforming fragment of BPV DNA, a deletion derivative of pBR322, and a 7.6-kilobase fragment of DNA from the human beta-globin gene cluster efficiently induce focus formation on mouse C127 cells. BPV-beta-globin hybrids are maintained in the transformed cells as plasmids with a copy number ...