WorldWideScience
 
 
1

Adenoid cystic carcinoma of the breast; Carcinome adenoide kystique du sein  

Energy Technology Data Exchange (ETDEWEB)

Adenoid cystic carcinoma of the breast is a rare neoplasm, accounting for only 0.1% of all malignant breast tumours. It is more common in women in the sixth decade of their lives and often in the sub areolar area. The clinical criteria is not specific and the radiographic examination showed a benign-appearing tumour. The preoperative diagnosis is possible with fine-needle aspiration cytology. The diagnosis is made by histological examination, presented a difficult differential diagnosis with cribriform carcinoma; so it is necessary to use histochemical or immunohistochemical techniques. The treatment is not well established. It consists of lumpectomy with radiation or mastectomy. Compared to other locations, adenoid cystic carcinoma of the breast has a favorable prognosis. Lymph node involvement or distant metastases seldom occur. The aim of our study is to describe the epidemiological, clinico pathological characteristics, the treatment and the prognosis of this rare type of breast tumour. (authors)

Kallel, R.; Bahri Zouari, I.; Gouiaa, N.; Charfi, S.; Ayadi, L.; Makni, S.; Sellami Boudawara, T. [CHU Habib-Bourguiba, Lab. d' Anatomie et de Cytologie Pathologiques, Sfax (Tunisia); Daoud, E. [CHU Habib Bourguiba, Service de Radiologie, Sfax (Tunisia); Daoud, J. [CHU Habib Bourguiba, Service de Radiotherapie, Sfax (Tunisia)

2009-07-15

2

Literature review on the role of radiotherapy in the treatment of nasopharyngeal cystic adenoid carcinomas about two cases; Revue de la litterature sur la place de la radiotherapie dans le traitement des carcinomes adenoides kystiques du nasopharynx a propos de deux cas  

Energy Technology Data Exchange (ETDEWEB)

The authors discuss the characteristics and the radiotherapy treatment procedures of cystic adenoid carcinomas, and more precisely the treatment of two of such cases of nasopharyngeal carcinomas. The first one had an incomplete resection surgery followed by curing radiotherapy: he has then been in local-regional control situation for 8 months. The second one had lung metastases, was treated chemotherapy and radiotherapy (decompressive treatment), and died six months after diagnosis. Radiotherapy is considered to be the treatment basis, whereas chemotherapy is a matter of controversy. Short communication

Hemmich, M.; Hassouni, K.; Elkacemi, H.; Errachdi, A.; Mouhajir, N.; Zaidi, H.; Benjaafar, N. [Institut national d' oncologie, Rabat (Morocco)

2011-10-15

3

Tonsils and Adenoids  

Science.gov (United States)

Your tonsils and adenoids are part of your lymphatic system. Your tonsils are in the back of your throat. Your adenoids ... by trapping germs coming in through your mouth and nose. Sometimes your tonsils and adenoids become infected. ...

4

Adenoid cystic carcinoma of palate.  

Science.gov (United States)

Adenoid cystic carcinoma is a rare tumor arising from the minor salivary glands;, the palate being the commonest site. Distant metastasis and perineural invasion areis common in adenoid cystic carcinoma. Diagnosis of adenoid cystic carcinoma is made usually with the help of clinical features, radiographic features and histologic features. We reported a case of adenoid cystic carcinoma of palate involving left maxillary sinus. The diagnosis of the case and brief review of literature of adenoid cystic carcinoma is discussed. The aim here is to highlight the importance of diagnosis, treatment and long-term follow-up of the patients with adenoid cystic carcinoma. PMID:23633876

Mehta, Dhaval N; Parikh, Shilpa J

2013-01-01

5

Vicissitude of Curetted Adenoid Vegetations  

Directory of Open Access Journals (Sweden)

Full Text Available Weights of curetted adenoid were measured and were compared with both weights of tonsils and the rate of adenoidectomy among the tonsillectomized cases. This study included 603 patients whose adenoids were curetted during the 11-year period. 90% of patients were 2 to 9 years old. The rate of curetted adenoid vegetation among the tonsillec-tomized cases was 80% among patients from 1 to 6 years old and 70% among patients of 7 and 8 years old. The rate remarkably decreased from 9 years of age. The average weight of the curetted adenoids in each age group ranged from 0.7 g to 1.9 g. There was no statistical correlation in the distribution of the average weight of the curetted adenoids between males and females as well as between the weight of the tonsils and the weight of the curetted adenoids. A hypothesis on the cause of adenoid hypertrophy was presented in this study.

Susumu Mukai

2013-05-01

6

Sphenoid sinus adenoid cystic carcinoma  

Directory of Open Access Journals (Sweden)

Full Text Available Introduction: The sphenoid adenoid cystic carcinoma is a rare malign neoplasm, in the head and neck and when located in the paranasal sinuses, it is formed in the minor salivary glands. It grows slowly and is characterized by a large invasion of the adjacent tissues, and also has a large capacity of metastasis. The surgery associated with post-operative radiotherapy is used as treatment. Objective: To describe a case of sphenoid sinus adenoid cystic carcinoma in a male, black, 62 year patient. Case Report: N.L.B., 62 years of age, male, had bloody rhinorrhea for 6 months associated with bilateral nasal obstruction. The nasofibroscopy showed lesion of polypoid aspect in the left nasal cavity. He was submitted to biopsy and the anatomopathological exam showed adenoid cystic carcinoma and the patient was forwarded to oncology. Conclusions: The importance of conducting the differential diagnosis between chronic nasosinusal infection and nasosinusal tumors.

Marambaia, Otavio

2008-12-01

7

Carcinome hépatocellulaire non fibrolamellaire sur foie sain  

Science.gov (United States)

Le carcinome hépatocellulaire (CHC) survient le plus souvent sur foie de cirrhose. Sa survenue sur un foie sain est exceptionnelle et pose un véritable défit diagnostique pour le clinicien. Nous rapportons l'observation d'un patient de 53 ans, sans antécédents pathologiques notables qui fût admis pour exploration d'une douleur de l'hypochondre droit évoluant depuis quelques mois avec une exacerbation récente, associée à un amaigrissement important et une altération de l’état général. L'examen clinique notait une hépatomégalie ferme et douloureuse. L’échographie abdominale montrait une masse hétérogène du secteur latéral droit du foie faisant 10 cm de grand axe. La TDM abdominale montrait une masse tissulaire, hétérogène, à vascularisation artérielle importante, mesurant 10 cm de diamètre et occupant le secteur latéral droit du foie. Cette tumeur comprime la branche portale droite sans signes d'extension. Il n'y avait pas d'adénopathie ni d’épanchement intra abdominal. La ponction biopsique écho-guidée avait conclu à un CHC non fibrolamellaire. Le bilan biologique, en particulier les transaminases, le taux de prothrombine, l’électrophorèse des protéines sanguine et l'alpha foeto-protéine, était sans anomalies. Les sérologies de l'hépatites virales B et C ainsi que la recherche des auto anticorps spécifiques des hépatites auto immunes et le bilan cuprique étaient aussi négatives. Vue l’âge, le stade avancé de la tumeur et l'altération de l’état général la conduite thérapeutique était de s'abstenir.

Bouomrani, Salem; Kilani, Ichrak; Nouma, Hanène; Slama, Alaeddine; Beji, Maher

2014-01-01

8

Métastase cérébrale d'un carcinome du col utérin  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Les métastases cérébrales des cancers du col de l?utérus sont extrêmement rares. Elles sont généralement supra-tentorielles, survenant à un stade avancé de la maladie et dans un cadre de néoplasie polymétastatique. La tumeur primitive est le plus souvent un carcinome épidermoïde peu différencié. Leur pronostic reste sombre malgré toutes les options thérapeutiques. Vu la rareté de cet événement et le peu de cas publiés dans la littérature, nous rapportons l'observation ...

Chekrine, Tarik; Hassouni, Abdesalam; Jouhadi, Hassan; Sahraoui, Souha; Bouchbika, Zineb; Taleb, Amina; Benchakroun, Nadia; Tawfiq, Nezha; Benider, Abdellatif

2013-01-01

9

Adenoid Reservoir for Pathogenic Biofilm Bacteria?  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Biofilms of pathogenic bacteria are present on the middle ear mucosa of children with chronic otitis media (COM) and may contribute to the persistence of pathogens and the recalcitrance of COM to antibiotic treatment. Controlled studies indicate that adenoidectomy is effective in the treatment of COM, suggesting that the adenoids may act as a reservoir for COM pathogens. To investigate the bacterial community in the adenoid, samples were obtained from 35 children undergoing adenoidectomy for ...

Nistico, L.; Kreft, R.; Gieseke, A.; Coticchia, J. M.; Burrows, A.; Khampang, P.; Liu, Y.; Kerschner, J. E.; Post, J. C.; Lonergan, S.; Sampath, R.; Hu, F. Z.; Ehrlich, G. D.; Stoodley, P.; Hall-stoodley, L.

2011-01-01

10

Adenoid cystic carcinoma of the nasal septum.  

Science.gov (United States)

Adenoid cystic carcinoma is a malignant tumour frequently described arising from seromucinous salivary tissue in the major and minor salivary glands. Within the nasal cavity, it is uncommon and usually involves the lateral wall. A rare case of adenoid cystic carcinoma of the nasal septum is presented along with a review of the literature. The presentation and management of this uncommon condition is discussed. PMID:14750355

Sivaji, N; Basavaraj, S; Stewart, W; Dempster, J

2003-12-01

11

Chimioembolisation des carcinomes hépatocellulaires : essai d'optimisation de la procédure  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Avec environ 700 000 décès en 2008, le carcinome hépatocellulaire se situe au 3ème rang de la mortalité par cancers dans le monde. La chimioembolisation est le traitement recommandé chez les patients atteints d'un carcinome hépatocellulaire de stade intermédiaire B de la classification Barcelona Clinic Liver Cancer. Cette technique de radiologie interventionnelle consiste en l'injection intraartérielle d'un agent anticancéreux à l'aide d'un vecteur (lipiodol ou microsphères d'embo...

Boulin, Mathieu

2011-01-01

12

Primary adenoid cystic carcinoma: an extremely rare eyelid tumor.  

Science.gov (United States)

Cutaneous adenoid cystic carcinoma is an extremely rare clinical entity. Among the few cases reported in the literature, most had contiguous involvement from the lacrimal gland. Primary adenoid cystic carcinoma is one of the rarest eyelid tumors. The authors report a case of adenoid cystic carcinoma arising from the lower eyelid. PMID:21629138

Ali, Mohammad Javed; Honavar, Santosh G; Naik, Milind N; Vemuganti, Geeta K

2012-01-01

13

Adenoid cystic carcinoma: An unusual presentation  

Science.gov (United States)

The adenoid cystic carcinoma is a relatively rare epithelial tumor of the major and minor salivary glands, accounting for about 1% of all malignant tumor of the oral and maxillofacial regions. Peak incidence occurs between the 5th and 6th decades of life. The clinical and pathological findings typical of this tumor include slow growth, peri-neural invasion, multiple local recurrences and distant metastasis. Herein, we report a case of adenoid cystic carcinoma of oropharynx with unusual clinical presentation. The diagnosis of this case and importance of cytology in diagnosing such cases is discussed.

Pushpanjali, M; Sujata, D Naga; Subramanyam, S Bala; Jyothsna, M

2014-01-01

14

Adenoid cystic carcinoma of buccal mucosa.  

Science.gov (United States)

Adenoid cystic carcinoma is a malignant neoplasm most commonly originating in the salivary glands of head and neck region. The clinical and pathological findings typical of this tumour include slow growth, perineural invasion and potential local recurrence. Up to 50% of these tumours occur in the intraoral minor salivary glands usually in the hard palate. We present a case report of a 26-year-old woman who was diagnosed with adenoid cystic carcinoma of the right buccal mucosa. The peculiarity of the lesion and the approach we made is the key factor in the presentation. PMID:23761566

Kumar, Anoop N; Harish, M; Alavi, Yasin A; Mallikarjuna, Rachappa

2013-01-01

15

Akt Inhibitor MK2206 in Treating Patients With Progressive, Recurrent, or Metastatic Adenoid Cyst Carcinoma  

Science.gov (United States)

Recurrent Adenoid Cystic Carcinoma of the Oral Cavity; Recurrent Salivary Gland Cancer; Salivary Gland Adenoid Cystic Carcinoma; Stage IVA Adenoid Cystic Carcinoma of the Oral Cavity; Stage IVA Salivary Gland Cancer; Stage IVB Adenoid Cystic Carcinoma of the Oral Cavity; Stage IVB Salivary Gland Cancer; Stage IVC Adenoid Cystic Carcinoma of the Oral Cavity; Stage IVC Salivary Gland Cancer

2014-09-15

16

Vorinostat in Treating Patients With Locally Advanced, Recurrent, or Metastatic Adenoid Cystic Carcinoma  

Science.gov (United States)

Recurrent Adenoid Cystic Carcinoma of the Oral Cavity; Recurrent Salivary Gland Cancer; Salivary Gland Adenoid Cystic Carcinoma; Stage III Adenoid Cystic Carcinoma of the Oral Cavity; Stage III Salivary Gland Cancer; Stage IVA Adenoid Cystic Carcinoma of the Oral Cavity; Stage IVA Salivary Gland Cancer; Stage IVB Adenoid Cystic Carcinoma of the Oral Cavity; Stage IVB Salivary Gland Cancer; Stage IVC Adenoid Cystic Carcinoma of the Oral Cavity; Stage IVC Salivary Gland Cancer; Tongue Cancer

2014-09-23

17

Assessment of nasopharyngeal airway and adenoid by MRI  

Energy Technology Data Exchange (ETDEWEB)

Adenoid is a kind of tonsil located in the posterior wall of nasopharynx. Enlargement of the adenoid can produce obstruction of the nasopharynx and Eustachian tube. Disturbance in discharge of nasal and paranasal secretions can be a cause of chronic rhinitis, sinusitis, and otitis media. Diagnosis of enlarged adenoid simply by inspection is different due to its location. Measurement of nasopharyngeal airway and adenoid using lateral radiographs of nasopharynx may be inaccurate for magnification and rotation. It was some limitations in demonstrating the actual state of nasopharyngeal airway and adenoid because it gives only two dimensional information. The authors measured the size and areas of nasopharyngeal airway and adenoid using MRI with sagittal and oblique coronal pilot views of T1 weighted spin echo. We categorized the patients into 4 groups according to the scoring system by symptoms such as apnea, mouth breathing, and snoring. The results of several measurment and their ratios were evaluated in these 4 categorized patients. The ratios of area of adenoid and nasopharyngeal airway (AA/Na) in each patient group were 6.52, 7.76, 10.53, 15.93, respectively. And the ratios of adenoid and nasopharyngeal airway (A/N) by Fujioka's method were 0.6, 0.65, 0.69, 0.71, respectively. We found that AA/Na might be the most effective index as an objective indicator in the evaluation of nasopharyngeal obstruction by the enlarged adenoid.

Jung, Myung Suk; Hur, Gham; Kim, Yong Hoon; Joe, Eun Ok; Lee, Seong Sook [Sanggae Paik Hospital, College of Medicine, Inje University, Seoul (Korea, Republic of)

1993-09-15

18

Le carcinome urothélial plasmocytoïde de la vessie : une entité histologique rare au pronostic sombre  

Science.gov (United States)

Résumé Introduction : Le carcinome urothélial plasmocytoïde est une variante histologique rare du carcinome urothélial. Seule une centaine de cas ont été décrits dans la littérature. Dans cette étude, nous faisons état de deux nouvelles observations. En combinant nos résultats à ceux des différentes séries décrites dans la littérature, nous tentons de définir les caractéristiques cliniques et pathologiques ainsi que l’approche thérapeutique de cette pathologie. Observations : Deux nouveaux cas de carcinome urothélial plasmocytoïde ont été diagnostiqués et pris en charge dans notre établissement. Les 2 patients étaient des hommes de 76 ans en moyenne. L’hématurie était le principal symptôme. Les deux patients ont subi une résection transurétrale de la vessie. Le stade tumoral au moment du diagnostic était avancé dans les deux cas (respectivement T3N0M0 et T3N1M0). Les deux patients ont été traités par cystoprostatectomie. L’analyse histologique de la pièce opératoire, complétée par une étude immunohistochimique, a confirmé le diagnostic de carcinome urothélial plasmocytoïde. Le premier patient est décédé un mois plus tard des suites d’une embolie pulmonaire. Le deuxième patient est décédé au bout de deux mois après avoir reçu deux cycles de chimiothérapie adjuvante. Les données recueillies sur les différentes séries décrites dans la littérature vont dans le même sens que nos données, à savoir un stade avancé au moment du diagnostic et un pronostic sombre. Conclusion : Le carcinome urothélial plasmocytoïde est une variante histologique rare et agressive du carcinome urothélial. Le diagnostic se fait souvent à un stade avancé, et le pronostic est peu encourageant. Le traitement repose le plus souvent sur une cystectomie, suivie d’une chimiothérapie adjuvante à base de cisplatine. L’intérêt d’une chimiothérapie néo-adjuvante n’a pas encore été établi. PMID:25408815

Benazzouz, Mohamed Hicham; Essatara, Younes; Elsayegh, Hachem; Iken, Ali; Benslimane, Lounis; Znati, Kaoutar; Nouini, Yassine

2014-01-01

19

Perineural spread in adenoid cystic carcinoma  

International Nuclear Information System (INIS)

This is a report of adenoid cystic carcinoma occurred in the palate in 30-year-old patient with a complaint of exophytic mass.The authors diagnosed it as adenoid cystic carcinoma by the clinical examination, radiographic findings and histopathological findings. The obtained results are as follows: 1. In the clinical examination, asymptomatic exophytic mass of palate was observed. 2. In radiographic findings, soft tissue mass infiltrated the left maxillary sinus, nasal cavity, infraorbital fossa, hard palate, pterygopalatine fossa and pterygoid plate, and enhanced soft tissue mass was also observed in CT. 3. In histopathological findings, tubular and solid patterns of glandular structures were observed and the infiltration of tumor cells into the nerve fibers was also observed. 4. Two years after radical surgery, radiation therapy and chemotherapy, the perineural spread to orbital area was observed. 5. Much longer follow-up than 5 years is needed for early diagnosis of recurrence and distant metastasis.

20

Perineural spread in adenoid cystic carcinoma  

Energy Technology Data Exchange (ETDEWEB)

This is a report of adenoid cystic carcinoma occurred in the palate in 30-year-old patient with a complaint of exophytic mass.The authors diagnosed it as adenoid cystic carcinoma by the clinical examination, radiographic findings and histopathological findings. The obtained results are as follows: 1. In the clinical examination, asymptomatic exophytic mass of palate was observed. 2. In radiographic findings, soft tissue mass infiltrated the left maxillary sinus, nasal cavity, infraorbital fossa, hard palate, pterygopalatine fossa and pterygoid plate, and enhanced soft tissue mass was also observed in CT. 3. In histopathological findings, tubular and solid patterns of glandular structures were observed and the infiltration of tumor cells into the nerve fibers was also observed. 4. Two years after radical surgery, radiation therapy and chemotherapy, the perineural spread to orbital area was observed. 5. Much longer follow-up than 5 years is needed for early diagnosis of recurrence and distant metastasis.

Lim, Sug Young; Choi, Eun Suk; Kim, Mi Sook; Koh, Kwang Joon [Dept. of Oral Radiology, College of Dentistry, Chonbuk National University, Chonju (Korea, Republic of)

1992-08-15

 
 
 
 
21

Adenoid cystic carcinoma of the breast  

International Nuclear Information System (INIS)

Adenoid cystic carcinoma of the breast is a rare neoplasm, accounting for only 0.1% of all malignant breast tumours. It is more common in women in the sixth decade of their lives and often in the sub areolar area. The clinical criteria is not specific and the radiographic examination showed a benign-appearing tumour. The preoperative diagnosis is possible with fine-needle aspiration cytology. The diagnosis is made by histological examination, presented a difficult differential diagnosis with cribriform carcinoma; so it is necessary to use histochemical or immunohistochemical techniques. The treatment is not well established. It consists of lumpectomy with radiation or mastectomy. Compared to other locations, adenoid cystic carcinoma of the breast has a favorable prognosis. Lymph node involvement or distant metastases seldom occur. The aim of our study is to describe the epidemiological, clinico pathological characteristics, the treatment and the prognosis of this rare type of breast tumour. (authors)

22

Adenoid Cystic Carcinoma of the Larynx  

Directory of Open Access Journals (Sweden)

Full Text Available This is case where a middle aged gentleman presented with history of progressively worseninghoarseness for 1 year. On further history taking and examination including imaging noted patient had supraglottic mass arising from left ventricle, measuring 2x2cm with smooth surface mimicking a benign lesion. Histopatological examination revealed as adenoid cystic carcinoma of left ventricle with perineural invasion . [Cukurova Med J 2014; 39(3.000: 611-615

Roopesh Sankaran

2014-06-01

23

Paediatric refractory rhinosinusitis secondary to hypertrophied adenoids: management and review of literature.  

Directory of Open Access Journals (Sweden)

Full Text Available Background /Objectives: Hypertrophied adenoids are the most common cause of refractory sinusitis in paediatric age. We study 42 cases of patients of chronic adenoiditis with adenoid facies and refractory chronic rhinosinusitis managed by endoscopic assisted adenoidectomy (EAA and conventional adenoidectomy (CA. Materials and method: 42 cases of chronic refractory sinusitis with adenoid facies secondary to hypertrophied adenoids were randomized into 2 groups during the study period of 12 months from August 2012 to July 2013. Group A (n=21 underwent endoscope assisted adenoidectomy and Group B(n=21 underwent conventional adenoidectomy. Result: Endoscopic assisted adenoidectomy proves to be more effective in managing adenoid facies and chronic refractory rhinosinusitis with adenoid hyperplasia. Conclusion: Visualization of the adenoid mass using endoscope helps complete removal of the diseased adenoids. Endoscopic assisted adenoidectomy is treatment of choice in adenoid facies and chronic refractory rhinosinusitis with adenoid hyperplasia and more effective than conventional adenoidectomy.

Gautham MK

2014-06-01

24

Plain radiographic evaluation of children with obstructive adenoids  

International Nuclear Information System (INIS)

Background: There are several methods of evaluating adenoidal size pre-operatively. Plain nasopharyngeal radiography is a common investigative modality: it has been advocated, and also condemned. Aim: This study was intended to assess nasopharyngeal airway obstruction by the adenoids using plain X-rays; and also to find correlation if any, with the symptomatology. Methods: This is a retrospective study carried out between January and December 2008. The case notes and plain X-rays of the nasopharynx of 34 paediatric patients with clinical features of obstructive adenoids were analyzed. Results: A total of 34 children were studied, 22 (64.7%) were males and 12 (35.3%) were females. Their ages ranged between 7 months and 10 years: mean age was 3.55 years, standard deviation 2.723. Majority (67.6%) of the children were in the age group 0-4 years. The lowest symptomatology assessment score was 0 and the highest was 3. Children 4 years and below had the highest symptomatology scores. The minimum adenoidal-nasopharyngeal ratio was 0.35 and the maximum was 0.94. There was no significant difference in the mean adenoidal-nasopharyngeal ratio of males and females (t = 0.407; p = 0.692). Many (75.0%) of the children with moderate to severe nasopharyngeal airway obstruction by the adenoids were in the age bracket 0-4 years. The lowest adenoidal-nasopharyngeal ratio score was 0 and the highest was 3. Children 4 years and below had the highest adenoidal-nasopharyngeal ratio scores. st adenoidal-nasopharyngeal ratio scores. There was a very weak nonsignificant correlation between the symptomatology assessment score and the radiological assessment score (r = 0.168; p = 0.375). Conclusion: The adenoidal-nasopharyngeal ratio is reliable in assessing the nasopharyngeal airway in children with obstructive adenoids.

25

Plain radiographic evaluation of children with obstructive adenoids  

Energy Technology Data Exchange (ETDEWEB)

Background: There are several methods of evaluating adenoidal size pre-operatively. Plain nasopharyngeal radiography is a common investigative modality: it has been advocated, and also condemned. Aim: This study was intended to assess nasopharyngeal airway obstruction by the adenoids using plain X-rays; and also to find correlation if any, with the symptomatology. Methods: This is a retrospective study carried out between January and December 2008. The case notes and plain X-rays of the nasopharynx of 34 paediatric patients with clinical features of obstructive adenoids were analyzed. Results: A total of 34 children were studied, 22 (64.7%) were males and 12 (35.3%) were females. Their ages ranged between 7 months and 10 years: mean age was 3.55 years, standard deviation 2.723. Majority (67.6%) of the children were in the age group 0-4 years. The lowest symptomatology assessment score was 0 and the highest was 3. Children 4 years and below had the highest symptomatology scores. The minimum adenoidal-nasopharyngeal ratio was 0.35 and the maximum was 0.94. There was no significant difference in the mean adenoidal-nasopharyngeal ratio of males and females (t = 0.407; p = 0.692). Many (75.0%) of the children with moderate to severe nasopharyngeal airway obstruction by the adenoids were in the age bracket 0-4 years. The lowest adenoidal-nasopharyngeal ratio score was 0 and the highest was 3. Children 4 years and below had the highest adenoidal-nasopharyngeal ratio scores. There was a very weak nonsignificant correlation between the symptomatology assessment score and the radiological assessment score (r = 0.168; p = 0.375). Conclusion: The adenoidal-nasopharyngeal ratio is reliable in assessing the nasopharyngeal airway in children with obstructive adenoids.

Kolo, E.S., E-mail: emmyk90@yahoo.com [Department of Otorhinolaryngology, Aminu Kano Teaching Hospital, Kano (Nigeria); Ahmed, A.O., E-mail: drahmedzizo@yahoo.com [Department of Otorhinolaryngology, Aminu Kano Teaching Hospital, Kano (Nigeria); Kazeem, M.J., E-mail: mjkazeem@yahoo.com [Department of Otorhinolaryngology, Aminu Kano Teaching Hospital, Kano (Nigeria); Nwaorgu, O.G.B., E-mail: onyinik@yahoo.com [Department of Otorhinolaryngology, Aminu Kano Teaching Hospital, Kano (Nigeria)

2011-08-15

26

Stimulation of adenoidal lymphocytes by Alloiococcus otitidis.  

Science.gov (United States)

Otitis media with effusion (OME) is characterized by persistent effusion in the middle ear cavity and by chronic inflammation in the middle ear mucosa. Alloiococcus otitidis, a gram-positive aerobic bacterium, has been isolated in middle ear effusion, and by means of sensitive polymerase chain reaction detection assays it has been detected in as many as 20% of middle ear aspirates of patients with OME. Because A otitidis may freely interact with leukocytes in the middle ear effusion, it may potentially modulate the inflammatory reaction in OME. To study the nature of these interactions, we applied an in vitro assay in which killed A otitidis bacteria were incubated with peripheral blood and adenoidal mononuclear cells. The expression of the proliferation-associated surface marker CD69 was then measured in B lymphocytes and in CD4+ helper and CD8+ cytotoxic-suppressor T lymphocytes by means of multicolor flow cytometry. Alloiococcus otitidis induced the expression of CD69 in both peripheral blood and adenoidal T and B cells. Among the T cells, the cytotoxic-suppressor T lymphocytes were preferentially activated. It was also tested whether A otitidis would have an effect in another cytotoxic and immunoregulatory system, namely, the induction of natural killer cell activity in peripheral blood mononuclear cells. However, the effect was minimal compared with that of Salmonella minnesota or Staphylococcus aureus. The results show that A otitidis has a unique immunostimulatory capacity in vitro that is mainly confined to CD8+ T lymphocytes. PMID:11051437

Tarkkanen, J; Himi, T; Harimaya, A; Atshushi, H; Carlson, P; Ylikoski, J; Mattila, P S

2000-10-01

27

A case of subglotitic adenoid cystic carcinoma  

Directory of Open Access Journals (Sweden)

Full Text Available Introcuction: Adenoid cystic carcinoma (ACC is the second most common salivary glands tumor and the most common malignant tumor of minor salivary glands and also submandibular glands; however ACC of the larynx and trachea is rare. These tumors generally present in subglottic region as smooth submucosal solid mass without ulceration. Their primary symptoms are often as respiratory problems. Materials and Methods: This study was done on a woman, 54 years, with subglottic ACC that presented with exertional dyspnea, stridor, cough and hoarseness. After confirmation of diagnosis with biopsy, the patient underwent a total laryngectomy and then postoperative radiotherapy. Conclusion: During one year follow up, the patient did not show any evidence of local recurrence or distant metastasis. Surgery with free margins in combination with postoperative radiotherapy was recommended to treat laryngeal ACC in order to obtain better survival.  

Masoud Naghibzadeh

2010-04-01

28

M?tastase c?r?brale d'un carcinome du col ut?rin  

Science.gov (United States)

Les métastases cérébrales des cancers du col de l?utérus sont extrêmement rares. Elles sont généralement supra-tentorielles, survenant à un stade avancé de la maladie et dans un cadre de néoplasie polymétastatique. La tumeur primitive est le plus souvent un carcinome épidermoïde peu différencié. Leur pronostic reste sombre malgré toutes les options thérapeutiques. Vu la rareté de cet événement et le peu de cas publiés dans la littérature, nous rapportons l'observation clinique d'une jeune patiente de 44 ans, opérée pour un carcinome du col utérin et qui présente 14 mois plus tard des métastases cérébrales sus et sous tentorielles associées à des métastases ganglionnaires lombo-aortique, médiastinale et sus-claviculaire. Elle a bénéficié d'un traitement palliatif associant une chimiothérapie et une radiothérapie pan encéphalique. Devant l'altération rapide de l'état général, la patiente a été mise sous un traitement symptomatique et des soins de support. PMID:23717727

Chekrine, Tarik; Hassouni, Abdesalam; Jouhadi, Hassan; Sahraoui, Souha; Bouchbika, Zineb; Taleb, Amina; Benchakroun, Nadia; Tawfiq, Nezha; Benider, Abdellatif

2013-01-01

29

La place de l'imagerie par r?sonance magn?tique dans le carcinome lobulaire du sein  

Science.gov (United States)

Le carcinome lobulaire reste une entité histologique peu fréquente du cancer du sein, toute fois la place qu'occupe le cancer du sein actuellement dans la cancérologie féminine, justifie la connaissance des particularités de ce type de cancer mammaire. Le diagnostic paraclinique est basée sur le couple écho-mammographie a la recherche de multifocalité, multicentricité ou bilatéralité, d'où l'intérêt de l'IRM qui est la technique la plus sensible pour la mise en évidence de ces lésions et qui est devenue un examen de pratique courante dans le carcinome lobulaire du sein. Par le présent travail, et sous la lumière de la revue de la littérature, nous allons essayer de dégager les aspects épidémiologiques, cliniques, et paracliniques, du carcinome lobulaire du sein, et insister sur les indications et l'intérêt de l'IRM dans la prise en charge de ce type histologique. PMID:25368710

Bouzoubaa, Wail; Laadioui, Meryem; Alaoui, Fatime Zahra Fdili; Jayi, Sofia; Bouguern, Hakima; Chaara, Hikmat; Melhouf, Moulay Abdelilah

2014-01-01

30

Atypical case of primary intraosseous adenoid cystic carcinoma of mandible.  

Science.gov (United States)

The Primary central salivary gland neoplasms of the mandible are infrequent. Their clinical and radiographic features may be similar to odontogenic tumors, which are otherwise common. Their accurate diagnosis becomes troublesome. Hence, diagnosis should depend on stringent diagnostic criteria. Adenoid cystic carcinoma is well known for its prolonged clinical course and its tendency for delayed onset of distant metastases. The long-term survival of these patients is therefore poor. Treatment modalities include surgery, radiotherapy and chemotherapy. The purpose of this paper is to report a case of primary central adenoid cystic carcinoma of mandible with an atypical presentation. PMID:24574668

Vinuth, Dp; Agarwal, Poonam; Dhirawani, Rajesh B; Dube, Gunjan

2013-09-01

31

Adenoid basal carcinoma of the cervix in a 20-year-old female: a case report  

Directory of Open Access Journals (Sweden)

Full Text Available Abstract Background Adenoid basal carcinoma of the cervix is a rare condition mostly occurring among postmenopausal women. Although it can be confused with adenoid cystic carcinoma of the cervix, adenoid basal carcinoma has several clinicopathologic features that will allow distinction from adenoid cystic carcinoma. Case presentation This is the case of a twenty-year old African-American female who initially presented with a high-grade squamous intraepithelial lesion on Pap smear, with a subsequent cervical LEEP specimen revealing adenoid basal carcinoma. The lesion showed the characteristic histologic features of adenoid basal carcinoma and was positive for the immunohistochemical marker EMA and negative for collagen IV, further defining the tumor while helping to rule out the possibility of adenoid cystic carcinoma. As far as the authors are aware, this is the youngest reported case of adenoid basal carcinoma to date. Conclusion This case shows that adenoid basal carcinoma can deviate markedly from its typical postmenopausal demographics to affect women as young as 20 years of age. In addition, adenoid basal carcinoma has several identifiable features that will differentiate it from adenoid cystic carcinoma including histologic and cellular morphologies, as well as immunohistochemistry. Treatment for most patients involves hysterectomy, LEEP, or a conization procedure which provides a favorable prognosis because of this lesion's low potential for recurrence and metastasis.

Schnee David

2006-08-01

32

Radiographic adenoid evaluation - suggestion of referral parameters / Avaliação radiográfica da adenoide - sugestão de parâmetros de referência  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese OBJETIVO: o objetivo deste estudo foi de investigar a utilidade de medidas radiográficas destinadas à avaliação da tonsila faríngea a serem utilizadas como potenciais parâmetros de encaminhamento. MÉTODOS: crianças de quatro a 14 anos, de ambos os gêneros, que apresentavam queixas referentes à [...] obstrução nasal foram submetidas à radiografia do cavum. Os registros radiográficos (n = 120) foram avaliados de acordo com parâmetros categóricos e quantitativos, e dados resultantes foram comparados ao exame padrão-ouro de videonasofaringoscopia, em relação às suas taxas de acurácia (sensibilidade, valor preditivo negativo, especificidade e valor preditivo positivo). RESULTADOS: os parâmetros radiográficos categóricos apresentaram baixa sensibilidade para a identificação de pacientes portadores de 2/3 de obstrução do espaço coanal. No entanto, alguns destes parâmetros apresentaram especificidades relativamente altas quando 3/4 de obstrução coanal era o ponto de corte de interesse. Dentre as variáveis quantitativas, um modelo matemático se mostrou mais adequado para identificar pacientes com mais de 2/3 de obstrução coanal. CONCLUSÃO: este modelo demonstrou, assim, ser potencialmente útil como método de rastreamento para identificação de pacientes com pelo menos 2/3 de obstrução adenoidiana. Além disso, um dos parâmetros categóricos analisados demonstrou ser relativamente mais útil e potencialmente seguro para eliminar pacientes queixosos com menos de 3/4 de obstrução a serem indicados à adenoidectomia. Abstract in english OBJECTIVE: this study aimed to evaluate the usefulness of current radiographic measurements, which were originally conceived to evaluate adenoid hypertrophy, as potential referral parameters. METHODS: children aged from 4 to 14 years, of both genders, who presented nasal obstruction complaints [...] , were subjected to cavum radiography. Radiographic examinations (n = 120) were evaluated according to categorical and quantitative parameters, and data were compared to gold-standard videonasopharyngoscopic examination, regarding accuracy (sensitivity, negative predictive value, specificity, and positive predictive value). RESULTS: radiographic grading systems presented low sensitivity for the identification of patients with two-thirds choanal space obstruction. However, some of these parameters presented relatively high specificity rates when three-quarters adenoid obstruction was the threshold of interest. Amongst the quantitative variables, a mathematical model was found to be more suitable for identifying patients with more than two-thirds obstruction. CONCLUSION: this model was shown to be potentially useful as a screening tool to include patients with, at least, two-thirds adenoid obstruction. Moreover, one of the categorical parameters was demonstrated to be relatively more useful, as well as a potentially safer assessment tool to exclude patients with less than three-quarters obstruction, to be indicated for adenoidectomy.

Murilo F.N., Feres; Juliana S., Hermann; Ana C., Sallum; Shirley S.N., Pignatari.

33

Radiographic adenoid evaluation - suggestion of referral parameters / Avaliação radiográfica da adenoide - sugestão de parâmetros de referência  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese OBJETIVO: o objetivo deste estudo foi de investigar a utilidade de medidas radiográficas destinadas à avaliação da tonsila faríngea a serem utilizadas como potenciais parâmetros de encaminhamento. MÉTODOS: crianças de quatro a 14 anos, de ambos os gêneros, que apresentavam queixas referentes à [...] obstrução nasal foram submetidas à radiografia do cavum. Os registros radiográficos (n = 120) foram avaliados de acordo com parâmetros categóricos e quantitativos, e dados resultantes foram comparados ao exame padrão-ouro de videonasofaringoscopia, em relação às suas taxas de acurácia (sensibilidade, valor preditivo negativo, especificidade e valor preditivo positivo). RESULTADOS: os parâmetros radiográficos categóricos apresentaram baixa sensibilidade para a identificação de pacientes portadores de 2/3 de obstrução do espaço coanal. No entanto, alguns destes parâmetros apresentaram especificidades relativamente altas quando 3/4 de obstrução coanal era o ponto de corte de interesse. Dentre as variáveis quantitativas, um modelo matemático se mostrou mais adequado para identificar pacientes com mais de 2/3 de obstrução coanal. CONCLUSÃO: este modelo demonstrou, assim, ser potencialmente útil como método de rastreamento para identificação de pacientes com pelo menos 2/3 de obstrução adenoidiana. Além disso, um dos parâmetros categóricos analisados demonstrou ser relativamente mais útil e potencialmente seguro para eliminar pacientes queixosos com menos de 3/4 de obstrução a serem indicados à adenoidectomia. Abstract in english OBJECTIVE: this study aimed to evaluate the usefulness of current radiographic measurements, which were originally conceived to evaluate adenoid hypertrophy, as potential referral parameters. METHODS: children aged from 4 to 14 years, of both genders, who presented nasal obstruction complaints [...] , were subjected to cavum radiography. Radiographic examinations (n = 120) were evaluated according to categorical and quantitative parameters, and data were compared to gold-standard videonasopharyngoscopic examination, regarding accuracy (sensitivity, negative predictive value, specificity, and positive predictive value). RESULTS: radiographic grading systems presented low sensitivity for the identification of patients with two-thirds choanal space obstruction. However, some of these parameters presented relatively high specificity rates when three-quarters adenoid obstruction was the threshold of interest. Amongst the quantitative variables, a mathematical model was found to be more suitable for identifying patients with more than two-thirds obstruction. CONCLUSION: this model was shown to be potentially useful as a screening tool to include patients with, at least, two-thirds adenoid obstruction. Moreover, one of the categorical parameters was demonstrated to be relatively more useful, as well as a potentially safer assessment tool to exclude patients with less than three-quarters obstruction, to be indicated for adenoidectomy.

Murilo F.N., Feres; Juliana S., Hermann; Ana C., Sallum; Shirley S.N., Pignatari.

2014-06-01

34

Carcinoma adenoide quístico primario de esófago / Primary adenoid cystic carcinoma of esophagus  

Scientific Electronic Library Online (English)

Full Text Available SciELO Peru | Language: Spanish Abstract in spanish Presentamos el caso de un paciente varón de 86 años con 6 meses de disfagia progresiva, baja de peso y edema de miembros inferiores. Tenía anemia microcítica e hipoalbuminemia severas. La radiografía contrastada mostraba al esófago con bordes irregulares que comprometían sus porciones cervical y dis [...] tal. En la tomografía axial computarizada fueron evidentes las adenopatías cervicales, derrame pleural bilateral y pronunciado engrosamiento esofágico. En la endoscopía se observaron desde el área subyacente al cricofaríngeo, lesiones elevadas dispersas, algunas con aspecto nodular y tumoral, que se distribuían una tras otra a lo largo del esófago hasta un área de estenosis (32 cm. de arcada dentaria); la estenosis estaba tapizada con una mucosa irregular y friable. El estudio Histológico reveló carcinoma adenoide quístico de esófago, con inmuno histoquímica positiva a citoqueratina. Mostramos los hallazgos clínico-patológicos e imágenes de este caso y revisamos lo reportado sobre esta rara entidad. Abstract in english We presented the case of a man of 86 years with 6 months of progressive dysphagia, weight loss and edema of lower limbs. He had both severe microcític anemia and hypoalbuminemia. The contrasted x-ray showed the esophagus with irregular edges that compromised their cervical and distal portions. In th [...] e computerized axial tomography cervical adenopathies, bilateral pleural effusion and pronouncing esophagic thickening were evident. In endoscopy dispersed elevated lesions were observed from the underlying area of the cricopharinx, some with nodular and tumor like aspect, that distributed throughout the esophagus until an area of stenosis (32 cm of dental arches); the estenosis was tapestried with an irregular and easy bleeding mucosa. The histological study revealed adenoid cystic carcinoma of esophagus, with positive inmunocytochemical to cytokeratin. We showed the clinical-pathological findings and images of this case and we reviewed reports of this rare entity.

Humberto, Perea Guerrero; Oscar, Frisancho Velarde; Américo, Palomino Portilla.

35

Carcinoma adenoide quístico primario de bronquio lobar: Caso clínico / Primary adenoid cystic carcinoma of the lobar bronehus: Case report  

Scientific Electronic Library Online (English)

Full Text Available SciELO Chile | Language: Spanish Abstract in spanish El carcinoma adenoide quístico primario de la vía aérea es una neoplasia muy rara. Reportamos el caso de un paciente de 60 años de edad quien consultó por hemoptisis y disnea de esfuerzo. Una tomografía computarizada del tórax reveló una masa en el bronquio fuente y lobar superior del pulmón derecho [...] . Se realizó una lobectomía superior derecha en manguito. El estudio histopatológico mostró un carcinoma adenoide quístico. Se administró radioterapia adyuvante. La cirugía y la radioterapia son las bases del manejo de este tipo de tumores. Abstract in english Primary airway adenoid cystic carcinoma is very uncommon. We report a 60 years old male consulting for hemoptysis and dyspnea. A chest CAT scan showed a mass in the right superior lobar bronehus. The patient was subjected to a right superior sleeve lobectomy and the pathological study of the surgica [...] l piece revealed an adenoid cystic carcinoma. The patient received adjuvant radiotherapy. Surgery and radiation therapy are the mainstay of treatment for this type of tumors.

LEONIDAS, TAPIAS-VARGAS; LUIS FELIPE, TAPIAS-VARGAS; LEONIDAS, TAPIAS; MARÍA EMMA, GARCÍA; JULIO CÉSAR, MANTILLA; ERNESTO, GARCÍA.

2011-02-01

36

Reprodutibilidade dos métodos radiográficos para avaliação da adenoide / Reliability of radiographic parameters in adenoid evaluation  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Embora a avaliação radiográfica da hipertrofia de tonsila faríngea tenha sido constantemente debatida, há ainda carência de estudos que testem a confiabilidade da maioria dos parâmetros radiográficos existentes. OBJETIVO: Verificar a reprodutibilidade intra e interexaminadores de vários métodos dest [...] inados à avaliação da tonsila faríngea. Forma de estudo: Estudo de série, metodológico e transversal. MATERIAL E MÉTODO: Quarenta crianças de ambos os sexos, de 4 a 14 anos, foram selecionadas mediante apresentação de queixas de obstrução nasal ou respiração oral, com suspeita de diagnóstico de hipertrofia de tonsila faríngea. Radiografias do cavum faríngeo e telerradiografias ortodônticas foram obtidas e, posteriormente, avaliadas por dois examinadores por meio de instrumentos de avaliação quantitativos e categóricos. RESULTADOS: Todos os parâmetros quantitativos de ambas as modalidades radiográficas apresentaram excelente reprodutibilidade intra e interexaminadores. Dentre os parâmetros categóricos de avaliação da radiografia de cavum, observou-se desempenho relativamente melhor de C-Kurien, C-Wang, C-Fujioka e C-Elwany sobre C-Cohen e C-Ysunza. Em relação aos sistemas destinados à classificação da telerradiografia, C-McNamara apresentou maior reprodutibilidade que C-Holmberg. CONCLUSÃO: A maioria dos instrumentos apresentou reprodutibilidade adequada. No entanto, novas investigações ainda devem ser realizadas com o intuito de determinar a capacidade de cada parâmetro em relação sua acurácia e viabilidade. Abstract in english The assessment of adenoids by x-ray imaging has been the topic of heated debate, but few studies have looked into the reliability of most existing radiographic parameters. OBJECTIVE: This study aims to verify the intra-examiner and inter-examiner reproducibility of the adenoid radiographic assessmen [...] t methods. MATERIALS AND METHODS: This is a cross-sectional case series study. Forty children of both genders aged between 4 and 14 were enrolled. They were selected based on complaints of nasal obstruction or mouth breathing and suspicion of pharyngeal tonsil hypertrophy. Cavum x-rays and orthodontic teleradiographs were assessed by two examiners in quantitative and categorical terms. RESULTS: All quantitative parameters in both x-ray modes showed excellent intra and inter-examiner reproducibility. Relatively better performance was observed in categorical parameters used in cavum x-ray assessment by C-Kurien, C-Wang, C-Fujioka, and C-Elwany over C-Cohen and C-Ysunza. As for orthodontic teleradiograph grading systems, C-McNamara has been proven to be more reliable than C-Holmberg. CONCLUSION: Most instruments showed adequate reproducibility levels. However, more research is needed to properly determine the accuracy and viability of each method.

Murilo Fernando Neuppmann, Feres; Helder Inocêncio Paulo de, Sousa; Sheila Márcia, Francisco; Shirley Shizue Nagata, Pignatari.

37

Reprodutibilidade dos métodos radiográficos para avaliação da adenoide Reliability of radiographic parameters in adenoid evaluation  

Directory of Open Access Journals (Sweden)

Full Text Available Embora a avaliação radiográfica da hipertrofia de tonsila faríngea tenha sido constantemente debatida, há ainda carência de estudos que testem a confiabilidade da maioria dos parâmetros radiográficos existentes. OBJETIVO: Verificar a reprodutibilidade intra e interexaminadores de vários métodos destinados à avaliação da tonsila faríngea. Forma de estudo: Estudo de série, metodológico e transversal. MATERIAL E MÉTODO: Quarenta crianças de ambos os sexos, de 4 a 14 anos, foram selecionadas mediante apresentação de queixas de obstrução nasal ou respiração oral, com suspeita de diagnóstico de hipertrofia de tonsila faríngea. Radiografias do cavum faríngeo e telerradiografias ortodônticas foram obtidas e, posteriormente, avaliadas por dois examinadores por meio de instrumentos de avaliação quantitativos e categóricos. RESULTADOS: Todos os parâmetros quantitativos de ambas as modalidades radiográficas apresentaram excelente reprodutibilidade intra e interexaminadores. Dentre os parâmetros categóricos de avaliação da radiografia de cavum, observou-se desempenho relativamente melhor de C-Kurien, C-Wang, C-Fujioka e C-Elwany sobre C-Cohen e C-Ysunza. Em relação aos sistemas destinados à classificação da telerradiografia, C-McNamara apresentou maior reprodutibilidade que C-Holmberg. CONCLUSÃO: A maioria dos instrumentos apresentou reprodutibilidade adequada. No entanto, novas investigações ainda devem ser realizadas com o intuito de determinar a capacidade de cada parâmetro em relação sua acurácia e viabilidade.The assessment of adenoids by x-ray imaging has been the topic of heated debate, but few studies have looked into the reliability of most existing radiographic parameters. OBJECTIVE: This study aims to verify the intra-examiner and inter-examiner reproducibility of the adenoid radiographic assessment methods. MATERIALS AND METHODS: This is a cross-sectional case series study. Forty children of both genders aged between 4 and 14 were enrolled. They were selected based on complaints of nasal obstruction or mouth breathing and suspicion of pharyngeal tonsil hypertrophy. Cavum x-rays and orthodontic teleradiographs were assessed by two examiners in quantitative and categorical terms. RESULTS: All quantitative parameters in both x-ray modes showed excellent intra and inter-examiner reproducibility. Relatively better performance was observed in categorical parameters used in cavum x-ray assessment by C-Kurien, C-Wang, C-Fujioka, and C-Elwany over C-Cohen and C-Ysunza. As for orthodontic teleradiograph grading systems, C-McNamara has been proven to be more reliable than C-Holmberg. CONCLUSION: Most instruments showed adequate reproducibility levels. However, more research is needed to properly determine the accuracy and viability of each method.

Murilo Fernando Neuppmann Feres

2012-08-01

38

Reprodutibilidade dos métodos radiográficos para avaliação da adenoide / Reliability of radiographic parameters in adenoid evaluation  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Embora a avaliação radiográfica da hipertrofia de tonsila faríngea tenha sido constantemente debatida, há ainda carência de estudos que testem a confiabilidade da maioria dos parâmetros radiográficos existentes. OBJETIVO: Verificar a reprodutibilidade intra e interexaminadores de vários métodos dest [...] inados à avaliação da tonsila faríngea. Forma de estudo: Estudo de série, metodológico e transversal. MATERIAL E MÉTODO: Quarenta crianças de ambos os sexos, de 4 a 14 anos, foram selecionadas mediante apresentação de queixas de obstrução nasal ou respiração oral, com suspeita de diagnóstico de hipertrofia de tonsila faríngea. Radiografias do cavum faríngeo e telerradiografias ortodônticas foram obtidas e, posteriormente, avaliadas por dois examinadores por meio de instrumentos de avaliação quantitativos e categóricos. RESULTADOS: Todos os parâmetros quantitativos de ambas as modalidades radiográficas apresentaram excelente reprodutibilidade intra e interexaminadores. Dentre os parâmetros categóricos de avaliação da radiografia de cavum, observou-se desempenho relativamente melhor de C-Kurien, C-Wang, C-Fujioka e C-Elwany sobre C-Cohen e C-Ysunza. Em relação aos sistemas destinados à classificação da telerradiografia, C-McNamara apresentou maior reprodutibilidade que C-Holmberg. CONCLUSÃO: A maioria dos instrumentos apresentou reprodutibilidade adequada. No entanto, novas investigações ainda devem ser realizadas com o intuito de determinar a capacidade de cada parâmetro em relação sua acurácia e viabilidade. Abstract in english The assessment of adenoids by x-ray imaging has been the topic of heated debate, but few studies have looked into the reliability of most existing radiographic parameters. OBJECTIVE: This study aims to verify the intra-examiner and inter-examiner reproducibility of the adenoid radiographic assessmen [...] t methods. MATERIALS AND METHODS: This is a cross-sectional case series study. Forty children of both genders aged between 4 and 14 were enrolled. They were selected based on complaints of nasal obstruction or mouth breathing and suspicion of pharyngeal tonsil hypertrophy. Cavum x-rays and orthodontic teleradiographs were assessed by two examiners in quantitative and categorical terms. RESULTS: All quantitative parameters in both x-ray modes showed excellent intra and inter-examiner reproducibility. Relatively better performance was observed in categorical parameters used in cavum x-ray assessment by C-Kurien, C-Wang, C-Fujioka, and C-Elwany over C-Cohen and C-Ysunza. As for orthodontic teleradiograph grading systems, C-McNamara has been proven to be more reliable than C-Holmberg. CONCLUSION: Most instruments showed adequate reproducibility levels. However, more research is needed to properly determine the accuracy and viability of each method.

Murilo Fernando Neuppmann, Feres; Helder Inocêncio Paulo de, Sousa; Sheila Márcia, Francisco; Shirley Shizue Nagata, Pignatari.

2012-08-01

39

Carcinome épidermoïde de l'urètre masculin révélé par une rupture spontanée de l'urètre.  

Science.gov (United States)

RéSUMé: Le carcinome épidermoïde de l'urètre masculin est une tumeur rare, les tumeurs de l'urètre tous types confondus représentant moins de 1 % des tumeurs de l'appareil urinaire. Le pronostic reste défavorable malgré un traitement chirurgical énergique. La radiochimiothérapie semble être un traitement prometteur, mais son rôle doit être défini par d'autres études.Nous rapportons un cas rare de carcinome épidermoïde de l'urètre bulbo-membraneux découvert à un stade localement avancé après observation d'une rupture urétrale transtumorale chez un homme âgé de 70 ans. Le patient a été traité, après drainage vésical, par une irradiation externe associée à une chimiothérapie par cisplatine, et est décédé après progression de la maladie sur un an.La rupture spontanée de l'urètre transtumorale est un mode de découverte exceptionnel témoignant d'une évolution locale défavorable, ce qui rend ces tumeurs difficilement opérables. Cependant, l'espoir actuel réside dans des protocoles thérapeutiques associant radiothérapie et chimiothérapie. PMID:21672490

Ghorbel, Jilani; Hafsia, Ghassen; Derouiche, Amine; Jrad, Anis; Chebil, Mohamed

2011-06-01

40

Carcinome collo?de du sein: ? propos d'un cas  

Science.gov (United States)

Nous rapportons le cas d'une tumeur colloïde du sein chez un homme. Cette situation rare interpelle par son mode de découverte. Nous avons pris en charge un homme de 60 ans atteint d'une lésion rétro-aréolaire droite classée cliniquement T4b N1 M0 et suspecte radiologiquement. L'analyse histologique (microbiopsie) a conclu à un carcinome colloïde muqueux associé à une petite composante canalaire classique de grade I de SBR du sein. Les traitements complémentaires associent mastectomie, curage, chimiothérapie, radiothérapie et hormonothérapie. Le cancer du sein est rare chez l'homme. Le carcinome colloïde est exceptionnel puisqu'il représente seulement 1 à 6% de l'ensemble des cancers du sein. Il est encore plus rare chez l'homme. Ces tumeurs touchent une population spécifique et ont un meilleur pronostic que les autres types prépondérant dans les cancers du sein chez l'homme. A travers cette observation et une revue de la littérature, nous essaierons de discuter les principales caractéristiques anatomo-cliniques et évolutives de cette forme rare du cancer du sein. PMID:24772222

Laabadi, Kamilia; Jayi, Sofia; Alaoui, Fatimazohra Fdili; Bouguern, Hakima; Chaara, Hikmat; Melhouf, My Abdelilah

2013-01-01

 
 
 
 
41

Adenoid cystic carcinoma: a retrospective clinical review.  

Science.gov (United States)

Adenoid cystic carcinoma (ACC) are uncommon tumors, representing about 10% to 15% of head and neck tumors. We compare the survival and control rates at our institution with those reported in the literature, and examine putative predictors of outcome. All patients registered with the tumor registry as having had ACC were identified. Demographic and survival variables were retrieved from the database. Additionally, a chart review of all patients was done to obtain specific information. Minor gland tumors were staged using the American Joint Committee on Cancer's criteria for squamous cell carcinomas in identical sites. Histopathologic variables retrieved included grade of the tumor, margins, and perineural invasion. Treatment modalities, field sizes, and radiation doses were recorded in applicable cases. An effort to retrieve archival tumor specimens for immunohistochemical analysis was undertaken. A total of 69 patients were treated for ACC from 1955 to 1999. One patient, who presented with fatal brain metastasis, was excluded from further analysis. Of the remaining 68 patients, 30 were men and 38 were women. The average age at diagnosis was 52 years, and mean follow-up was 13.2 years. Mean survival was 7.7 years. Overall survival (OS) rates at 5, 10, and 15 years were 72%, 44%, and 34%, and cause-specific survival was 83%, 71%, and 55%, respectively. Recurrence-free survival rates were 65%, 52%, and 30% at 5, 10, and 15 years, with a total of 29 of 68 (43%) eventually suffering a recurrence. Overall survival was adversely affected by advancing T and AJCC stage. Higher tumor grades were also associated with decreased OS, although the numbers compared were small. Primaries of the nasosinal region fared poorly when compared with other locations. Total recurrence-free survival, local and distant recurrence rates were distinctly better in primaries of the oral cavity/oropharynx when compared with those in other locations. Reduced distant recurrence-free survival was significantly associated with increasing stage. No other variables were predictive for recurrence. Additionally, we found that nasosinal tumors were more likely to display higher stage at presentation, and were more often associated with perineural invasion. Also of interest was the association of perineural invasion with margin status, with 15 of 20 patients with positive margins displaying perineural invasion, while only 5 of 17 with negative margins showed nerve invasion (P = 0.02). On immunohistochemistry, 2 cases of the 29 (7%) tumor specimens found displayed HER-2/neu positivity. No correlation between clinical behavior and positive staining could be demonstrated. Our data concur with previous reports on ACC in terms of survival and recurrence statistics. Stage and site of primary were important determinants of outcome. Grade may still serve a role in decision making. We could not demonstrate any differences attributable to primary modality of therapy, perhaps due to the nonrandomization of patients into the various treatment tracks and the inclusion of palliative cases. Similarly, perineural invasion, radiation dose and field size, and HER-2/neu positivity did not prove to be important factors in our experience. PMID:11410883

Khan, A J; DiGiovanna, M P; Ross, D A; Sasaki, C T; Carter, D; Son, Y H; Haffty, B G

2001-06-20

42

Adenoid cystic carcinoma of the buccal mucosa: a case report with review of literature.  

Science.gov (United States)

Minor salivary gland neoplasms of the buccal mucosa are relatively uncommon. Adenoid cystic carcinoma (ACC), a well-defined entity, occurs most of the times in the parotid, submandibular glands and palate, as far as the intraoral site is concerned. Adenoid cystic carcinoma tends to have an indolent, extended clinical course with wide local infiltration and late distant metastases. We are presenting a case of an adenoid cystic carcinoma of the buccal mucosa in a 48-year-old female patient. PMID:24783155

S, Vidyalakshmi; R, Aravindhan

2014-03-01

43

Adenoid cystic carcinoma of the minor salivary glands  

International Nuclear Information System (INIS)

Adenoid cystic carcinoma is a malignant salivary gland tumor with typical histologic patterns. The majority of the se tumors occurs in the minor salivary glands, especially mucosa of the hard palate. The authors experienced the patients, who complained the tumor-like soft tissue masses on the palatal and mouth floor area. After careful analysis of clinical, radiological and histopathological findings, we diagnosed them as adenoid cystic carcinomas in the minor salivary glands, obtained results were as follows : 1. Main clinical symptoms were a slow growing soft tissue mass with normal intact mucosa on the palatal area, and soft tissue mass with mild pain on the mouth floor area. 2. In the radiographic examinations, soft tissue masses were observed with invasion to adjacent structures, and moderate defined, heterogeneous soft tissue mass with enhanced margin, respectively. 3. In the histopathologic examinations, dark-stained, small uniform ballad's cells in the hyaline or fibrous stroma were observed as solid and cribriform patterns, respectively.

44

Adenoid cystic carcinoma on the dorsum of the tongue.  

Science.gov (United States)

Adenoid cystic carcinoma is a relatively rare epithelial tumor of the salivary glands accounting for about 5-10% of all salivary gland neoplasms. Approximately, 31% of salivary gland neoplasms affect minor salivary glands particularly the palate. It involves tongue in only 19.8% of cases and even rarely the dorsum of the tongue. We report such a rare case that affected dorsum of the tongue in a 45-year-old-female patient. PMID:23798839

Sengupta, Subhalakshmi; Roychowdhury, Anadi; Bhattacharya, Palash; Bandyopadhyay, Anjali

2013-01-01

45

Tomographie par émission de positons au 18F-fluorodesoxyglucose et carcinome épidermoïde des voies aérodigestives supérieures réfractaire au traitement  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Nous avons initialement réalisé une étude prospective évaluant l'intérêt de la TEP-TDM au FDG pour le diagnostic de récidive infra-clinique des carcinomes épidermoïdes des voies aéro-digestives supérieures. Nos résultats ont montré d'excellentes performances de l'examen en surveillance systématique, permettant notamment le diagnostic de récidive chez environ 1/3 des patients cliniquement asymptomatiques 1 an après la fin du traitement. Nous avons ensuite étudié le bénéfice...

Abgral, Ronan

2013-01-01

46

Difference in Cytokine Production and Cell Activation between Adenoidal Lymphocytes and Peripheral Blood Lymphocytes of Children with Otitis Media  

Digital Repository Infrastructure Vision for European Research (DRIVER)

We evaluated the immunological potential of adenoidal lymphocytes from children with recurrent otitis media. Interleukin-4 release and CD69 expression were lower in adenoidal lymphocytes than in peripheral blood lymphocytes (PBL). Our results suggest that there may be a difference between the immunological potential of adenoidal lymphocytes and that of PBL in children with otitis.

Harimaya, Atsushi; Tarkkanen, Jussi; Mattila, Petri; Fujii, Nobuhiro; Ylikoski, Jukka; Himi, Tetsuo

2005-01-01

47

Adenoid cystic carcinoma of the lacrimal gland : MYB gene activation, genomic imbalances, and clinical characteristics  

DEFF Research Database (Denmark)

To investigate genetic alterations in lacrimal gland adenoid cystic carcinomas (ACCs) with emphasis on the MYB-NFIB fusion oncogene and its downstream targets, MYB rearrangements, and copy number alterations in relation to clinical data and survival.

von Holstein, Sarah L; Fehr, André

2013-01-01

48

Nasopharyngeal Adenoid Cystic Carcinoma: Report of Five Cases and Treatment Outcome  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Background: The present study aimed to report the characteristics and treatment outcomes of five patients with nasopharyngeal adenoid cystic carcinoma and a literature review. Methods: Between 2000 and 2009, five consecutive patients (4 men, 1 woman) were diagnosed with nasopharyngeal adenoid cystic carcinoma and treated at our institution. Three patients had stage IVa (T4N0M0) and two patients had stage III (T3N0M0) cancer. Primary treatment consisted of concurrent chemoradiation in three pa...

Mahmood Shishegar; Seyed Basir Hashemi; Samiraz Razzaghi; Sayed Hamed Kabiri; Hajar Bahranifard; Bijan Khademi; Mohammad Mohammadianpanah

2011-01-01

49

Adenoid Cystic Carcinoma Mimicking an Oroantral Fistula: A Case Report  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in english Introduction Adenoid cystic carcinoma (ACC) is one of the most frequent malignant salivary gland tumors, which commonly affects the minor salivary glands of the mouth and is rare in the nose and paranasal sinuses. In the maxillary sinus, ACC can mimic inflammatory diseases and has a poor prognosis [...] . Objective To report a case of a 50-year-old man with ACC of the maxillary sinus whose clinical findings in the alveolar ridge mimicked an oroantral fistula. Case Report An excisional biopsy was performed and histopathologic analysis revealed ACC. Lung metastases and residual tumor in the maxillary sinus were detected by imaging methods. In view of the poor general health of the patient, no new surgical intervention was performed and he was only treated by radiotherapy and follow-up. Conclusion Although rare in the maxillary sinus, ACC should be included in the differential diagnosis of lesions affecting this site.

Bárbara Vanessa de Brito, Monteiro; Rafael Grotta, Grempel; Daliana Queiroga de Castro, Gomes; Gustavo Pina, Godoy; Márcia Cristina da Costa, Miguel.

2014-04-01

50

Intraosseous adenoid cystic carcinoma of maxilla: A rare case report.  

Science.gov (United States)

Adenoid cystic carcinoma (ACC) accounts for approximately 6-10% of all salivary gland tumors. Palatal minor salivary glands, parotid, and sub-mandibular glands are usually affected. Rarely, these lesions arising intraosseously have been reported. Mandible is commonly involved than maxilla. The present case is a giant ACC involving the right maxilla. A thorough clinical and radiographic evaluation was performed to assess the involvement of surrounding vital structures along with a meticulous metastatic work-up. Computed tomography showed a giant lesion in maxilla encroaching the left nasal fossa, antrum, buccal space, and oral cavity. No metastasis was noted. Histological evaluation from multiple sites showed both cribriform and solid patterns. Radiotherapy was given as patient did not comply for surgery. Though central ACC is extremely rare, especially in maxilla, it should be included in the differentials for lesions in maxilla. A prompt diagnosis with treatment and long-term follow-up is advised in such cases. PMID:24015018

Deshpande, Prasannasrinivas Suresh; Chintamaneni, Raja Lakshmi; Sujanamulk, Bhavana; Prabhat, M P V; Gummadapu, Sarat

2013-04-01

51

Adenoid cystic carcinoma of the mobile tongue: A rare case.  

Science.gov (United States)

Adenoid cystic carcinoma (ACC) occurs more commonly in the minor salivary glands of the palate on than the tongue. ACC is a malignant neoplasm that accounts for 1-2% of all head and neck malignancies and 10-15% of all salivary gland malignancies. ACC affects the exocrine glands at any site, but the parotid gland is the most common site in the head and neck region. Many factors should be taken into account in the prognosis of ACC, including the histological and clinical stages of the disease. The most striking feature of ACC is that it is locally aggressive, with a high recurrence level, perineural invasion and distant metastases, especially to the lungs and bones. The most common presentation histologically is the presence of cribriform appearance (Swiss cheese pattern). The present case is a rare one present on the tongue. PMID:23814551

Baskaran, Pavitra; Mithra, R; Sathyakumar, M; Misra, Satyaranjan

2012-12-01

52

Radiographic evaluation of adenoidal size in children with allergic perennial rhinitis: still the current method  

International Nuclear Information System (INIS)

Adenoid hypertrophy is known to be the most common cause of nasal obstruction in children; thus, adenoidectomy is one of the most commonly performed surgical procedures in children. Clinical assessment of adenoidal size is difficult, and objective measurement is desirable. The study included 39 children (17 girls and 22 boys, 5-9 years of age, mean age: 6.7 years) with signs of perennial allergic rhinitis and suspicion of adenoidal hypertrophy. To establish the best radiological method to measure the adenoidal size, three different procedures (Johanneson, Fuijoka, and Cohen/Konak) were used. The methods were evaluated against the degree to which the adenoids obstructed the nasopharyngeal space on flexible endoscopy of the postnasal space. Clinical symptomatology was also evaluated against the degree of obstruction. To estimate the correspondence between the results, we used Spearman's correlation test.The radiological method that best correlated with the endoscopic findings was that of Cohen and Konak, but neither radiology nor endoscopic scores correlated well with clinical symptoms. Conclusion: The side-adenoid assessment in allergic children. (author)

53

Inhibiting adenoid cystic carcinoma cells growth and metastasis by blocking the expression of ADAM 10 using RNA interference  

Directory of Open Access Journals (Sweden)

Full Text Available Abstract Background Adenoid cystic carcinoma is one of the most common types of salivary gland cancers. The poor long-term prognosis for patients with adenoid cystic carcinoma is mainly due to local recurrence and distant metastasis. Disintegrin and metalloprotease 10 (ADAM 10 is a transmembrane protein associated with metastasis in a number of diverse of cancers. The aim of this study was to analyze the relationship between ADAM 10 and the invasive and metastatic potentials as well as the proliferation capability of adenoid cystic carcinoma cells in vitro and in vivo. Methods Immunohistochemistry and Western blot analysis were applied to detect ADAM 10 expression levels in metastatic cancer tissues, corresponding primary adenoid cystic carcinoma tissues, adenoid cystic carcinoma cell lines with high metastatic potential, and adenoid cystic carcinoma cell lines with low metastatic potential. RNA interference was used to knockdown ADAM 10 expression in adenoid cystic carcinoma cell lines with high metastatic potential. Furthermore, the invasive and metastatic potentials as well as the proliferation capability of the treated cells were observed in vitro and in vivo. Results It was observed that ADAM 10 was expressed at a significantly higher level in metastatic cancer tissues and in adenoid cystic carcinoma cell lines with high metastatic potential than in corresponding primary adenoid cystic carcinomas and adenoid cystic carcinoma cell lines with low metastatic potential. Additionally, silencing of ADAM 10 resulted in inhibition of cell growth and invasion in vitro as well as inhibition of cancer metastasis in an experimental murine model of lung metastases in vivo. Conclusions These studies suggested that ADAM 10 plays an important role in regulating proliferation and metastasis of adenoid cystic carcinoma cells. ADAM 10 is potentially an important therapeutic target for the prevention of tumor metastases in adenoid cystic carcinoma.

Zhang Zhiyuan

2010-12-01

54

Inhibiting adenoid cystic carcinoma cells growth and metastasis by blocking the expression of ADAM 10 using RNA interference  

Science.gov (United States)

Background Adenoid cystic carcinoma is one of the most common types of salivary gland cancers. The poor long-term prognosis for patients with adenoid cystic carcinoma is mainly due to local recurrence and distant metastasis. Disintegrin and metalloprotease 10 (ADAM 10) is a transmembrane protein associated with metastasis in a number of diverse of cancers. The aim of this study was to analyze the relationship between ADAM 10 and the invasive and metastatic potentials as well as the proliferation capability of adenoid cystic carcinoma cells in vitro and in vivo. Methods Immunohistochemistry and Western blot analysis were applied to detect ADAM 10 expression levels in metastatic cancer tissues, corresponding primary adenoid cystic carcinoma tissues, adenoid cystic carcinoma cell lines with high metastatic potential, and adenoid cystic carcinoma cell lines with low metastatic potential. RNA interference was used to knockdown ADAM 10 expression in adenoid cystic carcinoma cell lines with high metastatic potential. Furthermore, the invasive and metastatic potentials as well as the proliferation capability of the treated cells were observed in vitro and in vivo. Results It was observed that ADAM 10 was expressed at a significantly higher level in metastatic cancer tissues and in adenoid cystic carcinoma cell lines with high metastatic potential than in corresponding primary adenoid cystic carcinomas and adenoid cystic carcinoma cell lines with low metastatic potential. Additionally, silencing of ADAM 10 resulted in inhibition of cell growth and invasion in vitro as well as inhibition of cancer metastasis in an experimental murine model of lung metastases in vivo. Conclusions These studies suggested that ADAM 10 plays an important role in regulating proliferation and metastasis of adenoid cystic carcinoma cells. ADAM 10 is potentially an important therapeutic target for the prevention of tumor metastases in adenoid cystic carcinoma. PMID:21171968

2010-01-01

55

Evaluation of the relation between adenoids hypertrophy and cranial base angles  

Directory of Open Access Journals (Sweden)

Full Text Available Background and Aim: Adenoids are normally large in children and their size starts to reduce during adolescence. Hypertrophic adenoids could be associated with allergic reactions. Enlarged adenoids result in nasal breathing difficulties and the child is forced to switch to mouth breathing. Airway obstruction causes postural alterations of jaw, tongue and head, and due to persistent obstruction, patient’s appearance changes to adenoid face. Evaluation of nasopharyngeal space in lateral cephalometic view is a simple and repeatable method for determination of the size and shape of adenoids and nasopharyngeal space which can provide a simple measurement of nasopharyngeal obstruction. The roof of nasopharyngeal space is covered by the sphenoid bone. Thus changes of nasorespiratory resistance by hypertrophic adenoids may affect the cranial base angles. In this study, the relationship between adenoid hypertrophy and cranial base angles was investigated. Materials and Methods: In this descriptive-analytic study, lateral cephalometric views of 7 to 14 y/o patients from the files of orthodontic centers in Rasht city were selected. The radiographs with proper resolution were separated for this research. Adenoid to nasorespiratory ratio (A/N Ratio was determined by Fujioka method and categorized in three groups: A (A/N 0.8, B (0.5adenoid hypertrophy (A and B groups was observed in 66% of cases whereas 34% were normal. The frequency of narrow, normal and wide cranial base angles in lateral ceph views was 28%, 30% and 42% respectively. There was significant difference among different cranial base angle regarding the presence or absence of adenoid hypertrophy (P<0.001. According to Pearson coefficient, there was significant relation between A/N ratio groups and different cranial base angles (R=0.2. Conclusion: Based on the results of this study, little correlation exists between A/N ratio and cranial base angle. Further studies are recommended to investigate the possible effects of other factors such as genetics and the environment.

Dalili Z

2006-07-01

56

Neutron radiotherapy for adenoid cystic carcinoma of minor salivary glands  

International Nuclear Information System (INIS)

Purpose: To examine the efficacy of fast neutron radiotherapy for the treatment of patients with locally advanced, adenoid cystic carcinoma of minor salivary glands and to identify prognostic variables associated with local control, overall survival, and cause specific survival. Methods and Materials: Eighty-four patients having adenoid cystic carcinoma of minor salivary glands were treated with fast neutron radiotherapy during the years 1985-1994. All patients had either unresectable disease or gross disease remaining after attempted surgical extirpation. Seventeen patients had previously received conventional radiotherapy and their subsequent treatment fields and doses for neutron radiotherapy were modified for critical sites (brainstem, spinal cord, brain). Although the median doses (tumor maximum and tumor minimum) only varied by ?10%, treatment portals were substantially smaller in these patients because of normal tissue complication considerations. Twelve patients (13%) had distant metastases at the time of treatment and were only treated palliatively with smaller treatment portals and lower median tumor doses (?80% of the doses delivered to curatively treated patients). Seventy-two patients were treated with curative intent, with nine of these having recurrent tumors after prior full-dose radiotherapy. The median duration of follow-up at the time of analysis was 31.5 months (range 3-115). Sites of disease and number of patients treated per disease site were as follows: paranasal sinus--31; oral cavity--20; oropharynx--12; nasopharynx--11; trachea--6; and other sites in the head and neck--4. Results: The 5-year actuarial local-regional tumor control rate for all patients treated with curative intent was 47%. Patients without involvement of the cavernous sinus, base of skull, or nasopharynx (51 patients) had a 5-year actuarial local-regional control rate of 59%, whereas local-regional control was significantly lower (15%) for patients with tumors involving these sites (p < 0.005). In the latter cases, normal tissue injury considerations precluded delivery of the full dose to the entire tumor. Patients with no history of prior radiotherapy (63 patients) had an actuarial local control rate of 57% at 5 years compared to 18% for those (9 patients) who had been previously irradiated with conventional photons (p = 0.018). Eliminating the dose-limiting factors of prior radiation therapy and/or high risk sites of involvement, the 5-year actuarial local-regional control rate for these 46 patients was 63%, with an actuarial cause specific survival rate of 79%. Lymph node status was a predictor of distant metastasis: 57% of node positive patients developed distant metastases by 5 years compared to 15% of patients with negative nodes (p < 0.0005), and patients who had nodal involvement developed distant metastases sooner than node negative patients (p < 0.0001). The 5-year actuarial overall survival and cause specific survival for the 72 patients treated with curative intent were 59% and 64%, respectively. Conclusions: Fast neutron radiotherapy offers high local-regional control and survival rates for patients with locally advanced, unresectable adenoid cystic carcinomas of minor salivary glands. It should be considered as initial primary treatment for these patients, as well as for other patients in whom surgical extirpation would cause considerable morbidity

57

The Role of Adenoid Mast Cells in the Pathogenesis of Secretory Otitis Media  

Directory of Open Access Journals (Sweden)

Full Text Available To investigate the possible role of adenoid mast cells in the etiology of secretory otitis media. Between 2001-2002, 25 patients with chronic adenoitis and chronic secretory otitis media and 25 patients with isolated adenoid hypertrophy were included to the study. Adenoidectomy performed to the all patients under general anesthesia. Adenoidectomy specimens were evaluated under the light microscopy and the number of mast cells were calculated for each patient. The number of mast cells were compared between two groups. The number of mast cells were between 4-84 in the otitis media with effusion and adenoid hypertrophy group (median:52, however it was between 2-63 (median: 23 in the isolated adenoid hypertrophy group. When comparing the two groups using Mann-Withney U test, the number of mast cells found to be significantly higher in the chronic secretory otitis media group (p<0.001.Based on our findings there is a relationship between increased adenoid mast cells and otitis media with effusion and these cells may have a possible role in the etiology of chronic secretory otitis media.

M. Faruk Oktay

2007-01-01

58

Radiologic evaluation of adenoids and tonsils in children with obstructive sleep apnea: Plain films and fluoroscopy  

Energy Technology Data Exchange (ETDEWEB)

Twenty-six children with obstructive sleep apnea were evaluated by lateral neck radiographs during wakefulness, and by polygraphic monitoring and upper airway fluoreoscopy during natural sleep. Children with craniofacial abnormalities, palatal surgery, and central nervous system disease were excluded from the study. Moderate or marked enlargement of tonsils and adenoids was noted on lateral neck radiographs of 18 of 26 patients. An objective measure of adenoidal enlargement, the adenoidal-nasopharyngeal ratio, correlated well with subjective judgment of adenoidal size but was not generally more useful than subjective estimation. Upper airway fluroescopy demonstrated the site and mechanism of obstruction in all patients. Because all children with moderate to marked adenotonsillar enlargement demonstrated obstruction at the adenoidal or tonsillar level on fluoroscopy, we now screen children with suspected sleep apnea with lateral airway radiographs and polysomnography. Fluoroscopy is reserved for children with mild adenotosillar enlargement, craniofacial dysplasia, prior cleft palate repair, or neuromuscular disorders. These results suggest that the pathogenesis of obstuctive sleep apnea in children involve anatomic factors which narrow the upper airway, sleep-related hypotonia of pharyngeal dilator musculature, and compensatory mechanisms to prevent or alleviate asphyxia.

Kreplick Fernbach, S.; Brouillette, T.; Riggs, T.W.; Hunt, C.E.

1983-07-01

59

The value of radiological examination in the management of adenoidal hypertrophy in a pediatric population  

International Nuclear Information System (INIS)

The objective of this study is to evaluate the role of radiological examination in the management of adenoidal hypertrophy. A retrospective study was carried out in the North West Armed Forces Hospital, Tabuk, Kingdom of Saudi Arabia on pediatric patients who had x-ray of lateral nasopharynx to exclude adenoidal hypertrophy, January 2001 to December 2001. The study included ; the age of patient, sex and reason for radiology examination and management rendered. A total of two hundred and ninety- seven pediatric patients were involved. Two hundred and thirteen males (71.7%) and 84(28.3%) females, age ranged between 2 months and 12 years. The reason given for radiological examination was one or more of following symptoms snoring,mouth breathing recurrent tonsillitis, runny nose, deafness and obstructive sleep apnea.Small adenoids reported in 63 patients (21.2%)and were treated for their complaints by primary physician. Two hundred and thirty four patients (78.8%) with large adenoids were referred to the otolaryngology department of these 33 patients lost follow up. One hundred and nineteen referred(40.1%) patients were treated conservatively, while 82 patients (27.6%) who showed resistance to medical treatment under went adeniodectomy with or without other related surgical procedures. It was concluded that radiological examination in the management of adenoidal hypertrophy had a limited role, increased Radiological Department workload wastage of resources in addition to unnecessary radiation exposure. (author)

60

Radiologic evaluation of adenoids and tonsils in children with obstructive sleep apnea: Plain films and fluoroscopy  

International Nuclear Information System (INIS)

Twenty-six children with obstructive sleep apnea were evaluated by lateral neck radiographs during wakefulness, and by polygraphic monitoring and upper airway fluoreoscopy during natural sleep. Children with craniofacial abnormalities, palatal surgery, and central nervous system disease were excluded from the study. Moderate or marked enlargement of tonsils and adenoids was noted on lateral neck radiographs of 18 of 26 patients. An objective measure of adenoidal enlargement, the adenoidal-nasopharyngeal ratio, correlated well with subjective judgment of adenoidal size but was not generally more useful than subjective estimation. Upper airway fluroescopy demonstrated the site and mechanism of obstruction in all patients. Because all children with moderate to marked adenotonsillar enlargement demonstrated obstruction at the adenoidal or tonsillar level on fluoroscopy, we now screen children with suspected sleep apnea with lateral airway radiographs and polysomnography. Fluoroscopy is reserved for children with mild adenotosillar enlargement, craniofacial dysplasia, prior cleft palate repair, or neuromuscular disorders. These results suggest that the pathogenesis of obstuctive sleep apnea in children involve anatomic factors which narrow the upper airway, sleep-related hypotonia of pharyngeal dilator musculature, and compensatory mechanisms to prevent or alleviate asphyxia. (orig.)

 
 
 
 
61

Adenoid cystic carcinoma of the parotid metastasizing to liver: case report  

Directory of Open Access Journals (Sweden)

Full Text Available Abstract Background Adenoid cystic carcinoma is a rare malignant parotid tumor. Metastasis can occur even a decade or more after initial treatment of the primary. Case presentation We report a 60 year old female patient who presented with adenoid cystic carcinoma of the parotid gland. She underwent a total conservative parotidectomy followed by adjuvant radiotherapy. While on follow up, patient developed multiple liver metastases which manifested three years later. Patient lived for another two years before she died of her disease. Conclusions Although distant metastases of adenoid cystic carcinoma develop frequently, isolated metastasis to liver is unusual. Even after manifestation of distant metastasis, patients can be expected to live for a number of years. Palliative chemotherapy can be considered in symptomatic cases while the usefulness of metastatectomy is controversial.

Mangala Gouri SR

2004-07-01

62

Asynchronous adenoid cystic carcinoma of the prostate and transitional cell carcinoma of the urinary bladder.  

Directory of Open Access Journals (Sweden)

Histologic variants of prostatic carcinoma are readily recognized. In this report, we describe a rare variant, adenoid cystic carcinoma, in a 75-year-old man previously diagnosed to have transitional cell carcinoma of the urinary bladder. The diagnosis of adenoid cystic carcinoma was made by the characteristic microscopic features of the tumor morphologically and immunohistochemically. Two months later he was found to have metastatic disease. The patient's treatment consisted of chemotherapy in combination with prednisone and hormonal therapy. Five and a half months after diagnosis, he died with metastatic disease. Making this case unique is the asynchronous occurrence of this variant with transitional cell carcinoma of the urinary bladder, which has never been reported in the literature. We discussed the histopathologic and immunohistochemical features of adenoid cystic carcinoma of the prostate with review of literature.

Luma M. Fayyad

2006-07-01

63

Pitfalls in magnetic resonance imaging of adenoid cystic carcinoma of the airways  

International Nuclear Information System (INIS)

Involvement of the airways by adenoid cystic carcinoma is best evaluated with multiple sequences of MRI in various planes, as long as the interpreting physician is aware of the potential pitfalls. Adenoid cystic carcinoma (cylindroma) of the airways is an uncommon malignancy which can be treated with positive results by surgery and radiation therapy. Pre-therapeutic assessment is important in determining the extent of local tumor invasion and the involvement of mediastinal structures, especially if surgery is proposed as part of the therapy. A case of adenoid cystic carcinoma of the airways with multi-planar MRI in multiple sequences is presented, together with a discussion of the pitfalls of chemical shift artifact in the distal trachea. (orig.)

64

Avaliação da radiografia cefalométrica lateral como meio de diagnóstico da hipertrofia de adenoide Evaluation of lateral cephalometric radiography as a mean of diagnosing adenoids hypertrophy  

Directory of Open Access Journals (Sweden)

Full Text Available INTRODUÇÃO: a hipertrofia de adenoide é uma das principais causas da respiração bucal. Entre os métodos utilizados para o diagnóstico dessa condição, os mais precisos são a endoscopia nasal e a ressonância magnética. No entanto, o método mais utilizado, em Odontologia, é a radiografia cefalométrica lateral. OBJETIVO: determinar a eficácia dessa radiografia no diagnóstico da hipertrofia de adenoide, pela sua comparação com a endoscopia nasal. MÉTODOS: foram avaliados 30 indivíduos (7 a 12 anos. Todos fizeram exame de endoscopia nasal e radiografia cefalométrica lateral. Nas endoscopias, foi registrada a porcentagem de obstrução da nasofaringe e, nas radiografias, a menor dimensão anteroposterior livre da nasofaringe. RESULTADOS: os exames se mostraram fortemente correlacionados (r = - 0,793, p-valor INTRODUCTION: One of the most usual causes of mouth breathing is adenoids hypertrophy with reduction of the nasopharyngeal space. The most precise diagnostic methods are magnetic resonance and nasal endoscopy, because they make possible a three dimension image of the nasopharynx. However, in Dentistry, cephalometric radiography is the method used in the majority of cases. That is why it is so important the evaluation of the efficacy of this diagnostic method. AIM: The aim of this paper is to determine the efficacy of the lateral cephalometric radiography in diagnosing adenoids hypertrophy, comparing this method to the nasal endoscopy. METHODS: Thirty patients (7 to 12 years, with no history of otolaryngological surgery, were evaluated. All of them were submitted to a nasal endoscopy and a lateral cephalometric radiography. In the endoscopic exams it was registered the percentage of nasopharyngeal obstruction and in the radiographic exams it was registered the minor nasopharyngeal dimension. RESULTS: The results of the exams showed a strong correlation with each other (r = - 0.793, p-value < 0.01. After that, reliability tests to the radiographic diagnose were performed, assuming that 75% (endoscopic exams and 5mm (radiographic exams were the limit values to the determination of the diagnose of severe adenoids hypertrophy. The radiographic exam showed a sensibility of 75%, specificity of 86.3%, positive predictive value of 66.7%, negative predictive value of 90.4% and an exactness of 83.3%. Therefore, lateral cephalometric radiography is an efficient method of adenoids hypertrophy diagnose. It was proved by the strong correlation of its results with the results of the nasal endoscopy, that is considered a method of excellence for diagnosing this condition.

Marcelo de Castellucci e Barbosa

2009-08-01

65

MRI diagnoses of perineural tumor spread in adenoid cystic carcinoma of minor salivary glands  

International Nuclear Information System (INIS)

Objective: To improve the MRI diagnosis of perineural tumor spread in adenoid cystic carcinoma minor salivary glands. Methods: Three cases adenoid cystic carcinoma of minor salivary glands with perineural tumor spread are reported. The MRI features were analyzed retrospectively. Results: Two lesions occurred in the minor salivary glands of the oral cavity and another in the space around the submandibular gland. All three cases presented clinically with abnormal nerve function. MRI showed nodular thickening of the nerve roots and cavernous sinuses with marked contrast enhancement. Conclusion: MRI displays tumor spread along the nerves clearly and is useful for diagnosis. (authors)

66

Adenoid Type of Basal Cell Carcinoma: Rare Histopathological Variant at an Unusual Location  

Science.gov (United States)

Basal Cell Carcinoma (BCC) is almost exclusively seen in head-neck region with rare involvement of trunk and extremities. The tumour is commonly seen on nose, eyelids, at the inner canthus of eyes and behind the ears. Adenoid type of BCC is one of the rare histopathological types of BCC which has not found to have any site predilection. We report two cases of BCC occurring at an unusual site i.e., lower back and both of them showed adenoid type of BCC on histopathology. Morphologically they were pigmented and ulcerative type of BCC respectively. PMID:23716827

Tambe, Swagata A; Ghate, Smita S; Jerajani, Hemangi R

2013-01-01

67

Adenoid type of Basal cell carcinoma: rare histopathological variant at an unusual location.  

Science.gov (United States)

Basal Cell Carcinoma (BCC) is almost exclusively seen in head-neck region with rare involvement of trunk and extremities. The tumour is commonly seen on nose, eyelids, at the inner canthus of eyes and behind the ears. Adenoid type of BCC is one of the rare histopathological types of BCC which has not found to have any site predilection. We report two cases of BCC occurring at an unusual site i.e., lower back and both of them showed adenoid type of BCC on histopathology. Morphologically they were pigmented and ulcerative type of BCC respectively. PMID:23716827

Tambe, Swagata A; Ghate, Smita S; Jerajani, Hemangi R

2013-03-01

68

Carcinoma adenoide cístico do conduto auditivo externo com envolvimento de mastoide  

Directory of Open Access Journals (Sweden)

Full Text Available Introdução: O carcinoma adenoide cístico (CAC no conduto auditivo externo é raro, tendo origem nas glândulas ceruminosas. Manifesta-se por otalgia em cerca de 90% dos pacientes. Relato do Caso: Neste artigo relatamos o caso de um paciente com Carcinoma Adenoide Cístico de conduto auditivo externo com envolvimento de mastoide que apresentava paralisia facial periférica. O tratamento é essencialmente cirúrgico, combinado ou não com radioterapia pós-operatória. Os fatores de mau prognóstico são a extensão do tumor, invasão do nervo facial e orelha média e acometimento linfonodal, diminuindo a sobrevida em cinco anos de 59% para 23%.

Tinoco, Paulo

2009-06-01

69

Nasofaringoscopia flexible como instrumento diagnóstico en pacientes con adenoiditis crónica  

Directory of Open Access Journals (Sweden)

Full Text Available Antecedentes: la hipertrofia adenoidea es una causa común de obstrucción nasal en la población pediátrica. La evaluación adenoidea en niños puede resultar difícil; tradicionalmente se ha utilizado la valoración clínica como método ideal y el diagnóstico se corrobora con una radiografía lateral de cráneo. Con la introducción de la nasofaringoscopia flexible, se ha evaluado a un gran número de niños sin exponerlos a la radiación. Objetivo: comparar la eficacia de la nasofibroscopia flexible vs la radiografía lateral de cráneo en el diagnóstico de adenoiditis. Material y métodos: se hizo un estudio retrospectivo, observacional, abierto y transversal en un centro de atención terciario. Resultados: se evaluaron 179 pacientes pediátricos de 2 a 14 años de edad, divididos en tre grupos, haciendo una equivalencia entre lo reportado en la radiografía lateral de cráneo y en la nasofaringoscopia flexible. La edad de mayor incidencia correspondió al intervalo de cuatro a ocho años, con 96 casos. Los síntomas más frecuentes fueron: respiración oral con 89% y rinolalia con 82%. El análisis estadístico se realizó con prueba exacta de Fisher, y se encontró una p < 0.002, con un intervalo de confianza de 95%. Mediante tablas de contingencia de 2 x 2 se determinó una sensibilidad de 95% para la nasofaringoscopia flexible y de 65% para la radiografía lateral de cráneo. Conclusión: la nasofaringoscopia flexible tiene mayor confiabilidad en la corroboración diagnóstica de la hipertrofia adenoidea que la radiografía lateral de cráneo; además, acorta el tiempo de conclusión terapéutica al demostrar en ese momento las obstrucciones objetivas del tejido adenoideo.

Mariana Dur\\u00E1n Ortiz

2012-01-01

70

Adenoid cystic carcinoma of hard palate with coincidental metastases to lung and liver.  

Science.gov (United States)

Adenoid cystic carcinoma is the most frequent pathology occurring in the minor salivary glands .It is usually slow growing; however, it can spread via perineural invasion, haematogenous and lymphatogenous metastasis. Most common sites of metastasis are lung and bone. Involvement of the other sites is not common. In this article, we present a woman with coincident lung and liver metastases. PMID:23446045

Akhavan, Ali; Binesh, Fariba; Navabii, Hossein

2013-01-01

71

Ultrastructural assessment of adenoid cystic carcinoma with emphasis on tumour infiltration periphery  

International Nuclear Information System (INIS)

Background: There is a wide variety of morphological and clinical types of tumours of the salivary glands. Almost 30 histological types of these neoplasms are known. Adenoid cystic carcinoma is a rarely occurring malignant epithelial neoplasm. It occurs in major salivary glands,but may also originate in the salivary glands of the respiratory tract. Aim: The aim of the present study was the ultrastructural assessment of the infiltration periphery of different histological types of adenoid cystic carcinoma of the salivary glands. Materials And Methods: Tissue samples from patients with adenoid cystic carcinoma of the salivary glands were studied. The study group consisted of 30 pts. 21 pts with tumour of parotid, 8 with submandibular and 1 with tumour of sublingual salivary glands. All patients were surgically treated and undergone supplementary treatment using radiotherapy in the Greater Poland Cancer Centre. Assessment of tissue samples was performed using morphological diagnoses and ultrastructural evaluation. Results: Ultrastructural electron microscopy assessment of adenoid cystic carcinoma revealed differentiation of the tumour cells towards ductal salivary, myoepithelial and pluripotential cells. Epithelial cells showed an increased nucleus-cytoplasm ratio, and their nucleoli were characteristic for actively proliferating cells. The analysis showed histological and structural differences between the central and peripheral parts of the tumour. Conclusions: The ultrastructural assessment of adenoid cystic carcinoma revealed that the cells in the peripheral parts of the tumour show a lower degree of maturation than the ones in its centre, peripheral stroma contains fewer collagen fibres, and dominant elements at the periphery of the tumour are proteoglycans and glycosaminoglycans, no histoformative features typical of the principal (central) part of the tumour were found at its periphery. (author)

72

Pseudovascular adenoid squamous cell carcinoma of oral cavity: A mimicker of angiosarcoma  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Pseudovascular adenoid squamous cell carcinoma (PASCC) is an uncommon histological variant of squamous cell carcinoma that can mimic vascular neoplasms, particularly angiosarcoma, in its morphologic characteristics. PASCC has been reported in the head and neck, as well as in the other organs such as the breast, lungs, urinary bladder, vulva, and uterine cervix. Only two cases of PASCC arising from the upper aerodigestive tract have been reported so far. We report a case of PASCC of oral cavit...

Vidyavathi, K.; Prasad, Csbr; Kumar, Harendra Ml; Deo, Rp

2012-01-01

73

Adenoid cystic carcinoma of the esophagus: report of two cases and review of the Chinese literature  

Directory of Open Access Journals (Sweden)

Full Text Available Abstract Squamous cell carcinoma is the major pathology type of esophageal cancer in China, where adenocarcinoma is rare and adenoid cystic carcinoma (ACC is more rare comparing to the western countries. We report the surgical and pathologic findings of two cases of primary ACC of the esophagus, and review of the Chinese literature of this tumor. Virtual slides The virtual slide(s for this article can be found here: http://www.diagnosticpathology.diagnomx.eu/vs/1507582238843246

Guo Xu-feng

2012-12-01

74

Carcinoma adenoide quístico del conducto auditivo externo: reporte de un caso  

Directory of Open Access Journals (Sweden)

Full Text Available El carcinoma adenoide quístico del conducto auditivo externo es un tumor extremadamente raro, con alta probabilidad de invasión perineural y de metástasis. Los objetivos de este trabajo son presentar un caso típico de una mujer de 63 años de edad, quien consultó por hipoacusia, plenitud aural y otalgia; así como describir la intervención quirúrgica realizada para su resección y su evolución postoperatoria.

Santiago Guti\\u00E9rrez Maldonado

2013-01-01

75

Radiotherapy after surgery for advanced adenoid cystic carcinoma of paranasal sinus  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Paranasal–sinus carcinoma and nasal-cavity carcinoma are fairly rare, representing about 3% of aerodigestive malignant disease. Locally advanced lesions are usually managed best by resection and postoperative radiotherapy. In January, 2001, a 55-year-old man with stage T4N0M0 adenoid cystic carcinoma of the nasal cavity and left maxillary sinus involving cavernous sinus, left orbital floor, ethmoid sinus, and the fifth cranial nerve received resection, postoperative interstitial high-dose-r...

Ruo Redda, Maria Grazia; Ragona, Riccardo; Succo, Giovanni; Guarneri, Alessia Silvia

2005-01-01

76

Laryngeal adenoid cystic carcinoma: case report / Carcinoma adenóide cístico de laringe: relato de caso  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese CONTEXTO: Carcinoma adenóide cístico (CAC) é um tumor maligno que ocorre tanto nas glândulas salivares maiores quanto nas menores. Localização laríngea é rara devido à paucidade de glândulas salivares acessórias nesta região. O carcinoma adenóide cístico representa menos de 1% das lesões malignas da [...] laringe e apenas 120 casos foram relatados na literatura. O CAC tem freqüência discretamente superior no sexo feminino e seu pico de incidência ocorre entre a quinta e sexta décadas de vida. Neste artigo, descrevemos um caso de CAC laríngeo e discutimos suas características clínicas e seu tratamento. RELATO DE CASO: Relatamos o caso de CAC numa paciente de 55 anos que apresentava disfonia e dispnéia. Características diagnósticas e avaliação terapêutica são descritas e a conduta clínica definida. Evolução clínica, estratégia terapêutica e procedimento cirúrgico são discutidos, bem como o tratamento adjuvante com radioterapia. O tumor, apesar de radiossensível, não é radiocurável. Abstract in english CONTEXT: Adenoid cystic carcinomas are malignant tumors that occur in both the major and the minor salivary glands. A laryngeal location is rare because of the paucity of accessory salivary glands in this area. Adenoid cystic carcinomas account for less than 1% of all malignant tumors in the larynx, [...] and only about 120 cases have been reported in the literature. These tumors have a slight female predisposition, and their peak incidence is in the fifth and sixth decades of life. In this article, we describe a case of laryngeal adenoid cystic carcinoma and discuss its clinical characteristics and treatment. CASE REPORT: We report on a case of laryngeal adenoid cystic carcinoma in a 55 year-old female patient who presented with dyspnea and hoarseness. Features of the diagnostic and therapeutic evaluation are described and the clinical management of such cases is outlined. The clinical course, definitive treatment strategy and surgical procedure, and also adjuvant treatment with irradiation are discussed. Although the tumor is radiosensitive, it is not radiocurable.

André, Del Negro; Edson, Ichihara; Alfio José, Tincani; Albina, Altemani; Antônio Santos, Martins.

77

Adenoid cystic carcinoma of the breast: Review of the literature and report of two cases  

Digital Repository Infrastructure Vision for European Research (DRIVER)

In this study, we report two cases of adenoid cystic carcinoma (ACC) of the breast. Two women presented to our hospital with a tender lump in the breast. Mammography and ultrasonography both revealed an ill-defined mass in the breast. We performed modified radical mastectomies on the patients, and pathological assessment following surgery showed ACC of the breast. Both patients received chemotherapy following surgery, have been followed up to date and remain in good health. In this study, we ...

Wang, Shaohua; Ji, Xiangjun; Wei, Yao; Yu, Zeping; Li, Ning

2012-01-01

78

[A novel view of prophylaxis and treatment of chronic adenoiditis in children].  

Science.gov (United States)

The present clinical study had the objective to evaluate the role of a hypertonic solution of sterile water from the Adriatic Sea in the prevention and treatment of chronic adenoiditis in children. It included 30 children aged from 2.5 to 15 years. The control group was comprised of 30 children treated by intransal drop infusion of physiological saline followed by irrigation of the nasal cavity with framicetin as recommended by the manufacturer. The study failed to reveal a significant difference (P > 0.05) between dynamics of the symptoms of chronic adenoiditis in the patients of either group assessed based on the 10-point analog visual scale. However, the frequency of relapses of adenoiditis during the observation period (3 months) was significantly lower in the patients treated with the hypertonic solution of sterile seawater. Microbiological investigations of the material from the pharyngonasal cavity showed no difference between the occurrence of tansient bacterial microflora in the patients of the study and control groups. PMID:21378744

Tulupov, D A; Karpova, E P; Voropaeva, E A

2011-01-01

79

Polymorphism of interleukin-1? gene and susceptibility to chronic adenoiditis development at children of Siberia  

Directory of Open Access Journals (Sweden)

Full Text Available The research objective was to establish a role of polymorphism of interleukin-1? gene in the locus 3954 (rs 1143634 on the chromosome 2q13-21 as a risk factor of an adverse course of the inflammatory process at chronic adenoiditis. The research is a part of the complex scientific subject "Translational Otorhinolaryngology" which was carried out in 2010-2012. The results of genotyping of 944 people were received. High total frequency of inheritance of mutant polymorphic allelic variants of interleukin-1? gene, including homozygous (C/C and heterozygous (?/? carriage is revealed at children with chronic adenoiditis. The frequency was 95,5% in sampling. At a homozygous carriage of oligonucleotide replacement of thymine for cytosine in the position 3954 of interleukin-1? gene functional activity of interleukin-1? changed- its pro-inflammatory effect increased by 100%. Children of this group had a heavy current chronic adenoiditis with the frequent aggravations, complications and the interfacing diseases at high concentration in blood serum interleukin-1? (298,4±8,2 pg/ml (control ? 65,43 pg/ml (p?0,001.

Natalia Terskova

2013-11-01

80

Exploring the characteristics of children with obstructive adenoid responding to mometasone fuorate monohydrate: preliminary results.  

Science.gov (United States)

This study aimed at observing the efficacy of mometasone fuorate monohydrate nasal spray on obstructive adenoids in children and identifying the characteristics of responders using a pilot study including children aged 2-11 years, with evidence of more than 50 % obstruction. Allergic rhinitis and nasal obstruction were evaluated on baseline (V0), 6- (V1), and 12-week (V2) visits. Degree of obstruction was evaluated by nasopharyngoscopy at V0 and V2. Subjects received 100 ?g mometasone fuorate daily. Results were compared with those of a matching control group. Nineteen children (8 females, 11 males; 2.25-8.50 years old, mean 4.24 years, median 4.00 years) completed treatment and follow-up adequately. There was 58 % reduction in a clinical score assessing the severity of adenoidal obstruction (P Mometasone furoate monohydrate nasal spray appears to be effective in treating children with obstructive adenoids. The effect seems to be independent of the presence of mild intermittent allergic rhinitis, the age of patient, or the severity of symptoms. PMID:23010795

Bitar, Mohamed A; Mahfoud, Lorice; Nassar, Jihad; Dana, Rouwayda

2013-03-01

 
 
 
 
81

Nasopharyngeal Adenoid Cystic Carcinoma: Report of Five Cases and Treatment Outcome  

Directory of Open Access Journals (Sweden)

Full Text Available Background: The present study aimed to report the characteristics and treatment outcomes of five patients with nasopharyngeal adenoid cystic carcinoma and a literature review. Methods: Between 2000 and 2009, five consecutive patients (4 men, 1 woman were diagnosed with nasopharyngeal adenoid cystic carcinoma and treated at our institution. Three patients had stage IVa (T4N0M0 and two patients had stage III (T3N0M0 cancer. Primary treatment consisted of concurrent chemoradiation in three patients andradiotherapy alone in two patients. Surgery was limited to endoscopic biopsy for histological diagnosis. Results: Four patients achieved complete response during or after completion of treatment and remained free of disease for a median of 27 months. Four patients developed local recurrence 8-30 months after initial treatment. The fifth patient is alive and free of disease.Conclusion: The findings of the present study and literature review suggest that local failure is a major problem in adenoid cystic carcinoma of the nasopharynx.

Mahmood Shishegar

2011-04-01

82

Sinonasal Adenoid Cystic Carcinoma: Clinical Case Report and Literature Review / Carcinoma Adenoide Quístico Nasosinusal: Caso Clínico y Revisión de la Literatura  

Scientific Electronic Library Online (English)

Full Text Available SciELO Chile | Language: English Abstract in spanish Se presenta el caso de un paciente de sexo masculino de 59 años con carcinoma adenoide quístico nasosinusal. El examen de resonancia magnética reveló la invasión de la órbita derecha y el cerebro a nivel del suelo de la fosa craneal anterior. Debido al gran volumen, se decidió realizar el tratamient [...] o de radio-quimioterapia para disminuir el tamaño de la lesión. Al término de la primera etapa del tratamiento, la reducción del tamaño del tumor fue confirmada por el examen de tomografía computarizada y se decidió realizar una resección quirúrgica con preservación del globo ocular derecho. En la actualidad el paciente se encuentra bajo el control periódico y sin mayores complicaciones. Abstract in english We present the case of a patient, a 59 year-old man, with Sinonasal Adenoid Cystic Carcinoma. Magnetic resonance exam revealed invasion of the right orbit and brain at the level of the anterior cranial fossa floor. Due to the large volume, we decided to perform radio-chemotherapy treatment to dimini [...] sh the size of the lesion. On conclusion of the first stage of treatment, reduction in tumor size was confirmed by computerized tomography exam and we decided to perform surgical resection with right ocular globe preservation. At present the patient is under periodic control and without major complications.

Ilson, Sepúlveda; Carolina, Delgado; Paulo, Flores; Ornella, Salvatori.

83

Promoter methylation and protein expression of the E-cadherin gene in the clinicopathologic assessment of adenoid cystic carcinoma.  

Science.gov (United States)

Adenoid cystic carcinoma, a relatively uncommon tumor of salivary glands, is characterized by a prolonged clinical course and a fatal outcome. The molecular events underlying their progression are unknown. In this study, we examined the methylation status of E-cadherin gene and its protein expression in 23 cases of adenoid cystic carcinoma and correlated the results with the clinicopathologic factors to determine its role in these tumors. We also analyzed the effect of 5-azacytidine on the re-expression in a methylated cell line of adenoid cystic carcinoma for this gene. In our study, E-cadherin immunoreactivity, although heterogeneous, showed a progressive reduction with high histological grade and in metastatic and recurrent lesions. Promoter methylation was detected in 16 of 23 cases (70%), but there was no correlation with the histological grade or patient prognosis. Microdissection of immuno-negative cells in heterogeneous tumors showed positive methlyation. In the cell line from salivary adenoid cystic carcinoma with methylated E-cadherin, 5-azacytidine restored the E-cadherin expression. Our results indicate that: (1) E-cadherin gene promoter is frequently methylated in adenoid cystic carcinoma, leading to reduced E-cadherin expression, (2) variable E-cadherin expression might result from the intratumoral heterogeneity, and (3) increased extent of methylated areas may be associated with progression and advancement of the disease. PMID:15044918

Maruya, Shin-ichiro; Kurotaki, Hidekachi; Wada, Ryuichi; Saku, Takashi; Shinkawa, Hideichi; Yagihashi, Soroku

2004-06-01

84

Adenoid cystic carcinoma presenting as an ulcer on the floor of the mouth: a rare case report.  

Science.gov (United States)

Adenoid cystic carcinoma is a rare epithelial tumour, and comprises about 1% of all malignant tumours of the oral and maxillofacial region. It is a malignant tumour which may develop in the trachea, bronchus, lungs or mammary glands, in addition to the head and neck region. Occurrences in the head and neck are mostly detected in the major salivary gland, oral cavity, pharynx and paranasal sinus where it presents as a slow growing firm nodular swelling. The aim of the article is to highlight the unique presentation of adenoid cystic carcinoma as a solitary ulcer on the floor of the mouth. PMID:25368840

Khan, Saba; Agwani, Khalid; Bhargava, Puneet; Kumar, Sreeja P

2014-10-01

85

Pseudovascular adenoid squamous cell carcinoma of oral cavity: A mimicker of angiosarcoma  

Science.gov (United States)

Pseudovascular adenoid squamous cell carcinoma (PASCC) is an uncommon histological variant of squamous cell carcinoma that can mimic vascular neoplasms, particularly angiosarcoma, in its morphologic characteristics. PASCC has been reported in the head and neck, as well as in the other organs such as the breast, lungs, urinary bladder, vulva, and uterine cervix. Only two cases of PASCC arising from the upper aerodigestive tract have been reported so far. We report a case of PASCC of oral cavity in a 40-year-old man, which mimicked an angiosarcoma initially. Immunohistochemical analysis led to a conclusive diagnosis of PASCC. PMID:22923907

Vidyavathi, K; Prasad, CSBR; Kumar, Harendra ML; Deo, RP

2012-01-01

86

Lacrimal gland adenoid cystic carcinoma: intracranial and extracranial en bloc resection.  

Science.gov (United States)

Adenoid cystic carcinoma of the lacrimal gland is a rare tumor, although it is the malignancy most frequently arising in the gland. Treatment has been unsuccessful generally, with a 15-year survival of less than 20 percent. Our experience with this tumor in a 61-year-old woman has led to a proposal for therapeutic management based on awareness of the lesion's natural history, an understanding of regional anatomy, and familiarity with therapies reported in the literature. The feasibility of adequate tumor ablation is determined from preoperative evaluation, including CT scan, initial exploratory craniotomy, and frozen-section examination of the cranial nerves transversing the orbit. Once resectability is confirmed, "curative" intracranial and extracranial en bloc resection is performed, including the tumor, the lacrimal gland, and all contiguous structures. The defect is immediately resurfaced with and "ice cream cone" forehead flap in anticipation of adjuvant radiotherapy. An orbital prosthesis is fitted as soon as the radiation reaction subsides, and a postablative CT scan is obtained as the baseline for follow-up. It remains to be seen whether this application of the technology of CT scanning and the techniques of craniofacial surgery will improve the prognosis for adenoid cystic carcinoma arising in the lacrimal gland. PMID:6269133

Marsh, J L; Wise, D M; Smith, M; Schwartz, H

1981-10-01

87

Multidisciplinary management of primary adenoid cystic carcinoma of the eyelid with perineural invasion.  

Science.gov (United States)

Primary cutaneous adenoid cystic carcinoma of the eyelid is an extremely rare entity with the propensity to recur locally, spread to regional lymph nodes, and invade perineural spaces. Of the 8 cases previously reported in the literature, only 2 were noted to be associated with perineural invasion, and neither of these was treated with radiation therapy. The authors report the case of a 35-year-old woman who presented with a progressively enlarging left lower eyelid lesion. An excisional biopsy with wide margins revealed a diagnosis of primary adenoid cystic carcinoma of the eyelid with perineural invasion. Because of the high risk of recurrence associated with perineural invasion, the patient received postoperative adjuvant radiation in the form of 50 Gy relative biological effectiveness of proton beam therapy to the postoperative tumor bed and to the infraorbital nerve tracking back to the apex of the orbit, followed by a 10-Gy boost to the lower eyelid tumor bed with orthovoltage x-rays. PMID:23446295

Bui, Marie; Frank, Steven J; Nasser, Qasiem J; El Sawy, Tarek; McLemore, Michael S; Morrison, William H; Esmaeli, Bita

2013-01-01

88

Immunohistochemical expression of progesterone receptors in adenoid cystic carcinoma and pleomorphic adenoma of salivary glands  

Directory of Open Access Journals (Sweden)

Full Text Available Background and Aim: The hormone receptor status in breast cancer has been pivotal in determining the likelihood of response to hormonal manipulation. Tumors which are both estrogen and progesterone receptor positive are much more likely to respond to anti-hormone therapy than negative tumors. There is well-established similarity between breast tissue and salivary glands. The aim of this study was to evaluate the progesterone receptor expression in pleomorphic adenoma and adenoid cystic carcinoma of salivary glands. Materials and Methods: In this descriptive study, immunohistochemical staining with progesterone antibody was performed on 14 pleomorphic adenoma (PA and 15 adenoid cystic carcinoma (ACC paraffin blocks. The percentage of positive cells was determined using an eye piece graticule. Immunoreactivity was categorized as either positive (reactivity more than 5% or negative (reactivity less than 5%. In addition the existence of progesterone receptor in tumor cells, stromal cells (fibroblasts, inflammatory cells and salivary glands around tumors was evaluated. Data were analyzed with T and Mann Whitney U tests with p<0.05 as the limit of significance. Results: Immunohistochemical staining for progesterone receptor was negative in 15 ACC and 13 PA. Only one case of PA showed immunoreactivity for progesterone receptor. Also, 12 normal salivary glands around tumor were positive. Inflammatory cells, endothelial cells and fibroblasts did not show immunoreactivity in most cases. Conclusion: The results indicate the lack of progesterone receptor expression in ACC and PA of salivary glands.

Eslami M

2006-06-01

89

Carcinoma adenóide cístico: relato de caso = Adenoid cystic carcinoma: case report  

Directory of Open Access Journals (Sweden)

Full Text Available O carcinoma adenóide cístico é uma neoplasia maligna rara de crescimento lento, caracterizado prognóstico reservado, devido a sua agressividade e grande potencial recidivante. A lesão é mais prevalente em pacientes na faixa etária entre 50 e 70 anos, sendo incomum em jovens. O artigo relata um caso de carcinoma adenóide cístico de glândulas salivares menores localizado no palato duro em pacientes com 26 ano, do sexo masculino que foi encaminhado para tratamento no Serviço de Cirurgia de Cabeça e Pescoço. Adenoid cystic carcinoma is a rare slow-growing malignant neoplasia characterized by a poor prognostic, due to his aggressive and large potential of recurrence. The lesion is more prevalent in patients between 50 and 70 years old, rarely occurring in young people. The article reports a case of adenoid cystic carcinoma in minor salivary glands located in hard palate in a male young adult who was referred for treatment at Head and Neck Surgery Unit of São Lucas Hospital – PUCRS.

Palmeiro, Mariana Reuter et al.

2005-01-01

90

Biological behavior and Treatment of Adenoid Cystic Carcinoma in the Head and Neck  

International Nuclear Information System (INIS)

Biological Behavior and treatment results of 33 patients with Adenoid Cystic Carcinoma (ACC) in the Head and Neck at Yonsei Cancer Center for 10 years between 1971 and 1980 were retrospectively analyzed. Most common, primary site was minor salivary glands such as maxillary sinus, nasal cavity and base of tongue. The typical biological behavior of these tumors was very slowly in growth with long rime of duration (mean 19 months) from I month to 10 years and more frequent of nerve invasion but rare invasion of neck nodes. Local control and failure pattern in the results of treatment, 16 of 17 patients with irradiation alone were seen complete or partial response but 5 cases of loco regional recurrence, 2 cases of failure of neck node and 4 cases of distant metastasis as lung and brain. On the other hand, among 10 cases of surgery and postoperative irradiation, 2 cases of locoreginal failure and 3 cases of distant metastasis as lung and bone. 2 of 4 cases with surgery alone were recurred within primary site. Actuarial overall NED survival at 5 and 10 years were 52.6% and 42.8%, respectively. Survival rate of 10 patients with surgery and postoperative irradiation was more high than 17 patients of radiation alone. Therefore, we have known that surgery with postoperative adjunctive irradiation is most effective treatment modality of adenoid cystic carcinoma in the head and neck. Primary site, treatment modality and with or without nerve and bone invasion have influenced on prognosis

91

Evaluación adenoídea mediante nasofaringolaringoscopía: Validación del método / Adenoids assessment using nasopharyngolaryngoscopy: A method validation  

Scientific Electronic Library Online (English)

Full Text Available SciELO Chile | Language: Spanish Abstract in spanish Introducción: La hiperplasia adenoidea es una patología frecuente en la edad pediátrica que determina un elevado porcentaje de los procedimientos quirúrgicos realizados en otorrinolaringología. Sin embargo, losimétodos con los que se cuentan en la actualidad para evaluar el tejido adenoideo y la ind [...] icación quirúrgica de su hiperplasia son subjetivos y tienen gran variación entre examinadores. Recientemente se ha propuesto una nueva clasificación que ha sido parcialmente validada en el extranjero, pero no en nuestroimedio. Objetivo: Validar un sistema de clasificación de la hiperplasia adenoidea con estudio endoscópico flexible transnasal. Material yimétodo: Se presentó la grabación de la nasofaringolaringoscopía de 50 pacientes a un grupo de 10 examinadores (5 residentes en formación y 5 otorrinolaringólogos) quienes clasificaron las imágenes según laimetodología propuesta. Se analizó el nivel de acuerdo entre los evaluadores utilizando el instrumento estadístico de la correlación intraclase. Resultados: Laimetodología propuesta sería completamente válida al ser implementada por otorrinolaringólogos con alimenos 5 años de experiencia (Intervalo del Coeficiente de Correlación Intraclase entre 0,61 y 0,80 para una confianza de 95%, representando un acuerdo significativamente sustancial entre evaluadores). Al ser utilizada por residentes en su período de formación, su validez sería sóloimoderada, no recomendándose el resultado del examen como parámetro único al decidir una conducta quirúrgica. Conclusiones: La escala de hiperplasia adenoidea propuesta sería válida y objetiva enimanos de operadores experimentados. Resta aún correlacionar sus resultados con clínica respiratoria alta e indicación quirúrgica y con la utilidad de implementar un entrenamiento dirigido en su uso paraimejorar su rendimiento como examen. Abstract in english Introduction. Adenoid hyperplasia is a frequent pediatric pathology that accounts for a large percentage of surgical ORL procedures. However, theimethods for adenoid evaluation and surgical indication in cases of adenoid hyperplasia available today are subjective and greatly variable across examiner [...] s. Recently, a new, partially validated classification has been proposed abroad, but a local evaluation is lacking. Aim. To valídate a classification system for adenoid hyperplasia by a trans-nasal flexible endoscopio study Material andimethod. Nasopharyngolaryngoscopy recordings of 50 patients were analyzed by a group of 10 examinéis (5 training residents and 5 otorhinolaryngologists), who classified the images according to the proposedimethodology. The degree of agreement among examinéis was analyzed by intra-class correlation. Resulte. The proposedimethod would be completely reliable and val id if implemented by otorhinolaryngologists with at least 5 years of experience (intra-class correlation coefficient interval between 0.61 and 0.80; 95% confidence level, representing a significant agreement among examiners). It has onlyimodérate validity when implemented by training residents, and the results ofsuch an evaluation are not recommended as the solé parameter when deciding a surgical treatment. Conclusión. The proposed adenoid hyperplasia scale seems to be valid and objective only in the hands of experimented operators. Its results areyet to be correlated with upper airway respiratory pathology and surgical indication, and with the usefulness of implementing a directed training program in order to improve its results as a diagnostic tool.

Carolina, Castillo T; Claudia, Corssen J; Hayo, Breinbauer K; Carlos, Namoncura P.

2008-08-01

92

Evaluación adenoídea mediante nasofaringolaringoscopía: Validación del método / Adenoids assessment using nasopharyngolaryngoscopy: A method validation  

Scientific Electronic Library Online (English)

Full Text Available SciELO Chile | Language: Spanish Abstract in spanish Introducción: La hiperplasia adenoidea es una patología frecuente en la edad pediátrica que determina un elevado porcentaje de los procedimientos quirúrgicos realizados en otorrinolaringología. Sin embargo, losimétodos con los que se cuentan en la actualidad para evaluar el tejido adenoideo y la ind [...] icación quirúrgica de su hiperplasia son subjetivos y tienen gran variación entre examinadores. Recientemente se ha propuesto una nueva clasificación que ha sido parcialmente validada en el extranjero, pero no en nuestroimedio. Objetivo: Validar un sistema de clasificación de la hiperplasia adenoidea con estudio endoscópico flexible transnasal. Material yimétodo: Se presentó la grabación de la nasofaringolaringoscopía de 50 pacientes a un grupo de 10 examinadores (5 residentes en formación y 5 otorrinolaringólogos) quienes clasificaron las imágenes según laimetodología propuesta. Se analizó el nivel de acuerdo entre los evaluadores utilizando el instrumento estadístico de la correlación intraclase. Resultados: Laimetodología propuesta sería completamente válida al ser implementada por otorrinolaringólogos con alimenos 5 años de experiencia (Intervalo del Coeficiente de Correlación Intraclase entre 0,61 y 0,80 para una confianza de 95%, representando un acuerdo significativamente sustancial entre evaluadores). Al ser utilizada por residentes en su período de formación, su validez sería sóloimoderada, no recomendándose el resultado del examen como parámetro único al decidir una conducta quirúrgica. Conclusiones: La escala de hiperplasia adenoidea propuesta sería válida y objetiva enimanos de operadores experimentados. Resta aún correlacionar sus resultados con clínica respiratoria alta e indicación quirúrgica y con la utilidad de implementar un entrenamiento dirigido en su uso paraimejorar su rendimiento como examen. Abstract in english Introduction. Adenoid hyperplasia is a frequent pediatric pathology that accounts for a large percentage of surgical ORL procedures. However, theimethods for adenoid evaluation and surgical indication in cases of adenoid hyperplasia available today are subjective and greatly variable across examiner [...] s. Recently, a new, partially validated classification has been proposed abroad, but a local evaluation is lacking. Aim. To valídate a classification system for adenoid hyperplasia by a trans-nasal flexible endoscopio study Material andimethod. Nasopharyngolaryngoscopy recordings of 50 patients were analyzed by a group of 10 examinéis (5 training residents and 5 otorhinolaryngologists), who classified the images according to the proposedimethodology. The degree of agreement among examinéis was analyzed by intra-class correlation. Resulte. The proposedimethod would be completely reliable and val id if implemented by otorhinolaryngologists with at least 5 years of experience (intra-class correlation coefficient interval between 0.61 and 0.80; 95% confidence level, representing a significant agreement among examiners). It has onlyimodérate validity when implemented by training residents, and the results ofsuch an evaluation are not recommended as the solé parameter when deciding a surgical treatment. Conclusión. The proposed adenoid hyperplasia scale seems to be valid and objective only in the hands of experimented operators. Its results areyet to be correlated with upper airway respiratory pathology and surgical indication, and with the usefulness of implementing a directed training program in order to improve its results as a diagnostic tool.

Carolina, Castillo T; Claudia, Corssen J; Hayo, Breinbauer K; Carlos, Namoncura P.

93

Evaluación adenoídea mediante nasofaringolaringoscopía: Validación del método Adenoids assessment using nasopharyngolaryngoscopy: A method validation  

Directory of Open Access Journals (Sweden)

Full Text Available Introducción: La hiperplasia adenoidea es una patología frecuente en la edad pediátrica que determina un elevado porcentaje de los procedimientos quirúrgicos realizados en otorrinolaringología. Sin embargo, losimétodos con los que se cuentan en la actualidad para evaluar el tejido adenoideo y la indicación quirúrgica de su hiperplasia son subjetivos y tienen gran variación entre examinadores. Recientemente se ha propuesto una nueva clasificación que ha sido parcialmente validada en el extranjero, pero no en nuestroimedio. Objetivo: Validar un sistema de clasificación de la hiperplasia adenoidea con estudio endoscópico flexible transnasal. Material yimétodo: Se presentó la grabación de la nasofaringolaringoscopía de 50 pacientes a un grupo de 10 examinadores (5 residentes en formación y 5 otorrinolaringólogos quienes clasificaron las imágenes según laimetodología propuesta. Se analizó el nivel de acuerdo entre los evaluadores utilizando el instrumento estadístico de la correlación intraclase. Resultados: Laimetodología propuesta sería completamente válida al ser implementada por otorrinolaringólogos con alimenos 5 años de experiencia (Intervalo del Coeficiente de Correlación Intraclase entre 0,61 y 0,80 para una confianza de 95%, representando un acuerdo significativamente sustancial entre evaluadores. Al ser utilizada por residentes en su período de formación, su validez sería sóloimoderada, no recomendándose el resultado del examen como parámetro único al decidir una conducta quirúrgica. Conclusiones: La escala de hiperplasia adenoidea propuesta sería válida y objetiva enimanos de operadores experimentados. Resta aún correlacionar sus resultados con clínica respiratoria alta e indicación quirúrgica y con la utilidad de implementar un entrenamiento dirigido en su uso paraimejorar su rendimiento como examen.Introduction. Adenoid hyperplasia is a frequent pediatric pathology that accounts for a large percentage of surgical ORL procedures. However, theimethods for adenoid evaluation and surgical indication in cases of adenoid hyperplasia available today are subjective and greatly variable across examiners. Recently, a new, partially validated classification has been proposed abroad, but a local evaluation is lacking. Aim. To valídate a classification system for adenoid hyperplasia by a trans-nasal flexible endoscopio study Material andimethod. Nasopharyngolaryngoscopy recordings of 50 patients were analyzed by a group of 10 examinéis (5 training residents and 5 otorhinolaryngologists, who classified the images according to the proposedimethodology. The degree of agreement among examinéis was analyzed by intra-class correlation. Resulte. The proposedimethod would be completely reliable and val id if implemented by otorhinolaryngologists with at least 5 years of experience (intra-class correlation coefficient interval between 0.61 and 0.80; 95% confidence level, representing a significant agreement among examiners. It has onlyimodérate validity when implemented by training residents, and the results ofsuch an evaluation are not recommended as the solé parameter when deciding a surgical treatment. Conclusión. The proposed adenoid hyperplasia scale seems to be valid and objective only in the hands of experimented operators. Its results areyet to be correlated with upper airway respiratory pathology and surgical indication, and with the usefulness of implementing a directed training program in order to improve its results as a diagnostic tool.

Carolina Castillo T

2008-08-01

94

Adenoid cystic carcinoma of minor salivary gland. Histochemical and electron microscopic studies of cystlike space.  

Science.gov (United States)

Five cases of adenoid cystic carcinoma of minor salivary glands were studied. The mucoid material in the characteristic cystlike space of this neoplasm was distaseresistant periodic acid-Schiff (PAS)--positive, alcain blue-positive, toluidine blue-positive, and mucicarmine-positive. Verhoeff-Van Gieson's method and Weighert's method did not reveal elastic tissue in the cystlike spaces. Mallory's method revealed that a central core in cystlike spaces was similar in stainability to collagen. Wilder's method did not reveal reticular fibers in these spaces. Electron microscopy revealed three readily recognizable zones: a juxtacellular zone of a network of replicated basal lamina, and intermediate zone of stellate granules of mucoid material, and a central core of densely packed aperiodic filaments or collagen fibrils. The histogenesis of cystlike spaces and their realtionship with biologic behaviors of the neoplasm were discussed. PMID:62333

Chen, S Y

1976-11-01

95

Identification of acid-sensing ion channels in adenoid cystic carcinomas  

International Nuclear Information System (INIS)

Tissue acidosis is an important feature of tumor. The response of adenoid cystic carcinoma (ACC) cells to acidic solution was studied using whole-cell patch-clamp recording in the current study. An inward, amiloride-sensitive Na+ current was identified in cultured ACC-2 cells while not in normal human salivary gland epithelial cells. Electrophysiological and pharmacological properties of the currents suggest that heteromeric acid-sensing ion channels (ASICs) containing 2a and 3 may be responsible for the proton-induced currents in the majority of ACC-2 cells. Consistent with it, analyses of RT-PCR and Western blotting demonstrated the presences of ASIC2a and 3 in ACC-2 cells. Furthermore, we observed the enhanced expression of ASIC2a and 3 in the sample of ACC tissues. These results indicate that the functional expression of ASICs is characteristic feature of ACC cells

96

The role of mometasone furoate nasal spray in the treatment of adenoidal hypertrophy in the adolescents: a prospective, randomized, cross-over study.  

Science.gov (United States)

Aim of this work is to find out whether the symptoms attributable to adenoid hypertrophy in adolescents may be treated with intranasal mometasone furoate (MF) application. To learn if adenoid hypertrophy in adolescents may decrease in size with intranasal MF. A prospective, double blind, randomized, cross-over study was conducted in 28 subjects (12-18 years) with adenoidal hypertrophy. Subjects used intranasal MF or placebo for a duration of 6 weeks with a wash out period of 3 weeks. Subjective symptoms and adenoid size were evaluated. At the initiation of the study, there was no significant difference between the mean symptom scores for any of the sinonasal symptoms between the two treatment groups. There was significant improvement in total subjective symptoms (nasal blockage, rhinorrhea, cough, snoring and disruption of quality of life scores) with MF compared with placebo. Analysis of the symptoms separately showed a significant positive effect of MF on all symptoms except for rhinorrhea. Nasal endoscopic evaluation failed to demonstrate any difference in the reduction of the adenoid size between the two groups. MF has significant advantage over placebo for the symptoms attributable to adenoid hypertrophy in adolescents. PMID:23381494

Yilmaz, Huseyin Baki; Celebi, Saban; Sahin-Yilmaz, Asli; Oysu, Cagatay

2013-09-01

97

Unintended Avulsion of Hypertrophic Adenoids in Posterior Nasopharynx: A Case Report of a Rare Complication Caused by Nasotracheal Intubation  

Science.gov (United States)

The enlarged adenoid serves as a mechanical obstacle on the nasopharynx to intricate nasotracheal intubation. No matter what video or direct laryngoscopic techniques are applied, nasotracheal tube navigation from the nasal valve area through the nasal cavity to the nasopharynx is always blind; trauma is not uncommon. Here we report a case of unintended avulsed adenoids that plugged the tube tip while the nasotracheal tube blindly navigated through the nasopharyngeal space. After failing to insert a bent tip of gum elastic bougie passing through the nasopharynx, an alternative method of NTI was performed by mounting the nasotracheal tube on a fiberoptic bronchoscope. The nasotracheal tube was successfully railroaded along the insertion tube of the fiberscope to the trachea. PMID:25057416

Chen, Hao-Hu; Chen, Li-Chuan; Hsieh, Yu-Hui; Chen, Mao-Kai; Chen, Chung-Ho; Cheng, Kuang-I

2014-01-01

98

Adenoid cystic carcinoma of the lacrimal gland simulating a dermoid cyst in a 9-year-old boy.  

Science.gov (United States)

Adenoid cystic carcinoma of the lacrimal gland is a malignant neoplasm that is generally found in adults and is usually managed by orbital exenteration and supplemental external beam irradiation or chemotherapy. A recent report has suggested that the tumor may have a less malignant course in children. We describe a case of adenoid cystic carcinoma of the lacrimal gland that simulated a dermoid cyst clinically and radiographically in a 9-year-old boy. The patient was treated with local surgical resection of the mass, followed by orbital plaque brachytherapy. Based on a review of the literature and our recent experience, the advisability of a more conservative approach to this tumor in selected cases is discussed. Although no prognostic conclusions can be drawn on the basis of a single case report with short follow-up, the relatively earlier detection of this tumor made possible by modern orbital imaging studies may allow total removal at an earlier stage and prevent orbital exenteration in a patient with normal vision. Recent developments suggest that there may be a basis for reassessing the advisability of a radical approach to the management of adenoid cystic carcinoma of the lacrimal gland in selected cases. PMID:9869804

Shields, J A; Shields, C L; Eagle, R C; Freire, J E; Mercado, G V; Schnall, B

1998-12-01

99

Detection of Respiratory Viruses in Nasopharyngeal Swab and Adenoid Tissue from Children Submitted to Adenoidectomy: Pre- and Postoperative Analysis  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in english Introduction The presence of respiratory viruses in lymphoid tissues of the nasopharynx and oropharynx and its impact on recurrent infections and hypertrophy of these tissues are not yet fully understood. Objective To identify and determine the prevalence of major respiratory viruses in nasopha [...] ryngeal secretions and adenoid tissue pre- and postoperatively of children undergoing adenoidectomy. Methods A prospective observational study was conducted in 36 patients under 12 years of age with upper airway lymphoid hypertrophy who were undergoing adenoidectomy, in which various respiratory viruses were investigated using real-time polymerase chain reaction in adenoid tissue and nasopharyngeal secretions collected preoperatively and 30 days postoperatively. Results At least 1 viral agent was isolated in any of the samples collected in 58.3% of children and 25.9% of total samples. Respiratory viruses were identified in 33.8% of preoperative nasopharyngeal specimens and in 19.8% of postoperative secretion. Of the 21 patients with positive results for any respiratory virus, 6 (28.6%) had more than 1 virus. Considering all 36 respiratory viruses found, the main agent isolated was rhinovirus (27.8%), followed by bocavirus (22.2%). Conclusion The virus found more frequently in all samples was rhinovirus. After removal of adenoid tissue, there was a decrease in the prevalence of the virus contained in nasopharyngeal secretion 30 days after surgery.

Osvaldo Vinícius, Biill Primo; Edmir Américo, Lourenço; Saulo Duarte, Passos.

100

Detection of Respiratory Viruses in Nasopharyngeal Swab and Adenoid Tissue from Children Submitted to Adenoidectomy: Pre- and Postoperative Analysis  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in english Introduction The presence of respiratory viruses in lymphoid tissues of the nasopharynx and oropharynx and its impact on recurrent infections and hypertrophy of these tissues are not yet fully understood. Objective To identify and determine the prevalence of major respiratory viruses in nasopha [...] ryngeal secretions and adenoid tissue pre- and postoperatively of children undergoing adenoidectomy. Methods A prospective observational study was conducted in 36 patients under 12 years of age with upper airway lymphoid hypertrophy who were undergoing adenoidectomy, in which various respiratory viruses were investigated using real-time polymerase chain reaction in adenoid tissue and nasopharyngeal secretions collected preoperatively and 30 days postoperatively. Results At least 1 viral agent was isolated in any of the samples collected in 58.3% of children and 25.9% of total samples. Respiratory viruses were identified in 33.8% of preoperative nasopharyngeal specimens and in 19.8% of postoperative secretion. Of the 21 patients with positive results for any respiratory virus, 6 (28.6%) had more than 1 virus. Considering all 36 respiratory viruses found, the main agent isolated was rhinovirus (27.8%), followed by bocavirus (22.2%). Conclusion The virus found more frequently in all samples was rhinovirus. After removal of adenoid tissue, there was a decrease in the prevalence of the virus contained in nasopharyngeal secretion 30 days after surgery.

Osvaldo Vinícius, Biill Primo; Edmir Américo, Lourenço; Saulo Duarte, Passos.

2014-04-01

 
 
 
 
101

Haemophilus influenzae resides and multiplies intracellularly in human adenoid tissue as demonstrated by in situ hybridization and bacterial viability assay.  

Science.gov (United States)

The DNA oligomer 5'-d(TGCGGCCTCTCAGTCCCGCACTTTCATCTTCC)-3' specifically recognizes Haemophilus influenzae 16S rRNA. We report here the use of this oligonucleotide, with a fluorescein label tagged on its 5' end, as a probe for the in situ detection of nonencapsulated nontypeable H. influenzae in sections of adenoid tissue from 10 children who were clinically infection free but were having their adenoids removed because of nasal obstruction. In some cases, the reticular crypt epithelium was focally infiltrated by H. influenzae. The reservoir for these bacterial colonizations, in all likelihood long standing, seemed to be macrophage-like cells found in the subepithelial layers in all 10 cases. These mononuclear cells contained up to 200 intracellular H. influenzae cells. In the transmission electron macroscope, macrophage-like cells with intracellular bacteria with coccoid morphology, at least some of which were dividing, were seen. Adenoid cell suspensions, enriched for macrophages by use of paramagnetic beads coated with monoclonal antibodies against the CD14 marker, yielded up to 1,100 CFU of nontypeable H. influenzae per 10(5) cells after killing of extracellular bacteria with gentamicin followed by mechanical lysis of the cells. Images PMID:7507900

Forsgren, J; Samuelson, A; Ahlin, A; Jonasson, J; Rynnel-Dagoo, B; Lindberg, A

1994-01-01

102

Cultivo primario de células ciliadas de adenoides humanos: Un modelo experimental para evaluar la actividad ciliar in vitro / Primary culture of human adenoid ciliated cells: An experimental model to evaluate ciliar activity in vitro  

Scientific Electronic Library Online (English)

Full Text Available SciELO Chile | Language: Spanish Abstract in spanish Introducción: El clearance mucociliar normal es el mecanismo de defensa básico de las vías respiratorias. Sin embargo, los mecanismos de control ciliar aún se desconocen. Con el fin de entenderlo mejor, se han desarrollado diferentes técnicas de cultivo de células ciliadas. Objetivos: Desarrollar un [...] modelo experimental a partir de cultivos primarios de tejido adenoideo y cornete medio. Caracterizarla respuesta a adenosin trifosfato (ATP), agonista conocido de la frecuencia de batido ciliar (FBC). Material y método: Cultivos primarios a partir de explantes de epitelio adenoideo y cornete medio humano. Medición de FBC, con técnica de microfotodensitometría, en condición basal y en respuesta a ATP a diferentes concentraciones. Resultados: La FBC basal (promedio (X) ±desv estándar (DE)) para los cultivos de cornete medio fue 11,9 ±1,5 Hz y para tejido adenoideo fue 10,9 ±1,9 (p >0,05). Se observó un aumento en la FBC en respuesta a ATP, dosis dependiente. No hubo diferencia significativa en la FBC basal ni en la respuesta a ATP entre cultivos de cornete medio y adenoides. Conclusión: El cultivo primario de células ciliadas nasales a partir de explantes de adenoides, es un modelo experimental reproducible, en el que es posible observar actividad ciliary una respuesta funcional concordante con lo descrito en la literatura Abstract in english Introduction. Mucociliary clearance constitutes the main defense mechanism of the airway, but the mechanisms of ciliary control are still unknown. With the aim of a better understanding of this process, many ciliated cells culture techniques have been developed. Aims. 1. To develop an experimental m [...] odel based on primary cultures from adenoid and middle turbinate tissue. 2. To characterize in this model the response to ATP, a known agonist of ciliary beat frequency (CBF). Material and Method. Primary cultures derived from human adenoid tissue and middle turbinate epithelial explants were obtained. CFB was measured by microphotodensitometry, both in basal conditions and in response to ATP at different concentrations. Results. Basal CFB (average (X) +- standard deviation (SD)) for middle turbinate cultures was 11.9 +-1.5 Hz, and for adenoid tissue was 10.9 +-1.9 Hz (p

Claudia, González; Trinidad, Sánchez; Ximena, Fonseca; Manuel, Villalón.

2007-08-01

103

Results of fast neutron therapy of adenoid cystic carcinoma of the salivary glands  

International Nuclear Information System (INIS)

Purpose: The slowly growing adenoid cystic carcinomas show a poor response after conventional photon therapy. An alternative could be the irradiation with fast neutrons. In this study we want to evaluate the advantage of neutron therapy in comparison to photon therapy. Material and methods: Between 1986 and 1995, 72 patients with adenoid cystic carcinomas of the salivary glands were treated in Muenster with fast neutrons by a d, T-14 MeV neutron generator. Median age of the patients was 54 years. 91,6 % of the patients were surgically pretreated. All of them had either recurrences or macroscopic tumor rests prior to neutron therapy. The total neutron dose applied was between 10.02 Gy and 15,03 Gy with single doses of 1,67 Gy given in a hypofractionated fashion three times a week. Median follow-up was 50 months. Results: 52,7 % of the patients achieved a complete remission after neutron therapy and 47,3 % a partial remission. The survival probability, calculated by the Kaplan-Meier method, was 86 % after one year, 73 % after two years and 53 % after five years. The recurrence-free survival was 83 % after one year, 71 % after two years and 45% after five years. The univariate Kaplan - Meier analysis showed a significant correlation (p<0,05) between different prognostic factors (tumorvolume, dosage and histologic grading) and survival. The early side effects observed were skin reactions I deg. -II deg. (57 %) (EORTC/RTOG) and mucositis I deg. -II deg. (32 %). Two patientositis I deg. -II deg. (32 %). Two patients suffered from radiation induced mucosal ulcers III deg. -IV deg. . Late effects seen included teleangiectasia I deg. -II deg. in 67 %, subcutaneous fibrosis in 36 % and xerostomia in I deg. -II deg. (32 %). Conclusion: Neutron beam therapy seems to be an effective treatment in these selected patients. The observed control rate was 73,4%, compared to an average local control rate of 28% of patients treated with photons. The appeared side effects were mild to moderate

104

Adenoid Cystic Carcinoma of the Nasal Cavity and Paranasal Sinuses: A Meta-Analysis  

DEFF Research Database (Denmark)

Objectives To identify independent predictors of outcome in patients with adenoid cystic carcinoma (ACC) of the paranasal sinuses and skull base. Design Meta-analysis of the literature and data from the International ACC Study Group. Setting University-affiliated medical center. Participants The study group consisted of 520 patients, 99 of them from the international cohort. The median follow-up period was 60 months (range, 32 to 100 months). Main Outcome Measures Overall survival (OS) and disease-specific survival (DSS). Results The 5-year OS and DSS of the entire cohort were 62% and 67%, respectively. The local recurrence rate was 36.6%, and the regional recurrence rate was 7%. Distant metastasis, most commonly present in the lung, was recorded in 106 patients (29.1%). In the international cohort, positive margins and ACC of the sphenoid or ethmoidal sinuses were significant predictors of outcome (p <0.001). Perineural invasion and adjuvant treatment (radiotherapy or chemoradiation) were not associated withprognosis. Conclusion Tumor margin status and tumor site are associated with prognosis in ACC of the paranasal sinuses, whereas perineural invasion is not. Adjuvant treatment apparently has no impact on outcome.

Amit, M.; Binenbaum, Y.

2013-01-01

105

Intracranial extension of adenoid cystic carcinoma of the palate: a case report  

Energy Technology Data Exchange (ETDEWEB)

Intracranial involvement by adenoid cystic carcinoma (ACC) is very rare and there is no report of intracranial extension from the palate ACC in Korea. Intracranial involvement can occur in one of three ways: direct extension, perineural spread, and hematogenous spread. A case report of a 35-year-old woman with intracranial ACC is presented. Initially she had ACC of the right palate and was treated by surgery and postoperative radiation therapy. Three years and 10 months later, the paresthesia in the distribution of ophthalmic and maxillary branch of right trigeminal nerve developed without evidence of recurrence in CT scan. Ptosis and total ophthalmoplegia developed sequentially and the second operation was performed. It was suggested that the tumor was spread perineurally along the trigeminal nerve into the Gasserian ganglion and then cavernous sinus and orbit. Seven years and 6 months after the first operation, direct intracranial extension into the right temporal lobe developed via sphenoid bone, sphenoid sinus and temporal bone and the third operation was done. And then Jung metastasis was diagnosed. She is alive for 9 years 5 months after first operation.

Oh, Yoon Kyeong; Kee, Keun Hong [College of Medicine, Chosun Univ., Kwangju (Korea, Republic of)

1999-12-01

106

Pattern of failure and role of radiotherapy in adenoid cystic carcinoma of the head and neck  

Energy Technology Data Exchange (ETDEWEB)

This retrospective study reviewed 55 patients with adenoid cystic carcinoma of the head and neck who were treated with radiotherapy for primary sites between 1980 and 1998. The treatment modality consisted of radiotherapy combined with surgery in 44 patients and radiotherapy without surgery in 11. Chemotherapy was also administered to 9 operated and 6 unoperated patients. The range of prescribed doses was 25-65 Gy (median 50 Gy) for patients who underwent surgery, and 60-70 Gy (median 65 Gy) for those who did not. Local failure occurred in 16 patients (29%), and 20 (36%) developed distant metastasis, which were common types of failure. Although not statistically significant different, local relapse free rates of early stage tumors were better than those of advanced stage tumors (p=0.08). The local relapse free rates were influenced by the primary sites (major vs. minor salivary glands) (p=0.04). These factors, however, had no impact on survival. Three patients developed recurrences in the skull base probably thorough perineural spread. Neck failure was also uncommon type of recurrence, occurring in only two patients. We also discuss elective irradiation to the neck nodes and the skull base. (author)

Seo, Yuji; Yoshida, Hiroshi; Miyano, Takashi [Asahikawa Medical Univ., Hokkaido (Japan); Ohmori, Keiichi; Sugita, Tadashi; Taguchi, Masami; Hamamoto, Yasushi

2001-12-01

107

Pattern of failure and role of radiotherapy in adenoid cystic carcinoma of the head and neck  

International Nuclear Information System (INIS)

This retrospective study reviewed 55 patients with adenoid cystic carcinoma of the head and neck who were treated with radiotherapy for primary sites between 1980 and 1998. The treatment modality consisted of radiotherapy combined with surgery in 44 patients and radiotherapy without surgery in 11. Chemotherapy was also administered to 9 operated and 6 unoperated patients. The range of prescribed doses was 25-65 Gy (median 50 Gy) for patients who underwent surgery, and 60-70 Gy (median 65 Gy) for those who did not. Local failure occurred in 16 patients (29%), and 20 (36%) developed distant metastasis, which were common types of failure. Although not statistically significant different, local relapse free rates of early stage tumors were better than those of advanced stage tumors (p=0.08). The local relapse free rates were influenced by the primary sites (major vs. minor salivary glands) (p=0.04). These factors, however, had no impact on survival. Three patients developed recurrences in the skull base probably thorough perineural spread. Neck failure was also uncommon type of recurrence, occurring in only two patients. We also discuss elective irradiation to the neck nodes and the skull base. (author)

108

Molecular and morphological analysis of adenoid cystic carcinoma of the breast with synchronous tubular adenosis.  

Science.gov (United States)

Adenoid cystic carcinoma (ACC) of the breast is a rare tumour. Its recognition as a special type of breast carcinoma is very important because its prognosis is better than the not-otherwise-specified invasive ductal carcinoma and its treatment may not include axillary dissection. Tubular adenosis (TA) is a very rare condition of the breast that is histologically benign; however, it has been described in association with invasive ductal carcinoma. There are scant data regarding the molecular genomic alterations in ACC of the breast and no data has been presented on TA. Herein, we provide a morphological characterisation of TA arising synchronically with ACC in the breast. To characterise these lesions, we performed ultrastructural analysis, three-dimensional reconstruction and molecular analysis using immunohistochemistry and comparative genomic hybridisation. The copy number alterations found in ACC were restricted to small deletions on 16p and 17q only, whereas the TA harboured gains on 1q, 5p, 8q, 10q, 11p and 11q and losses on 1p, 10q, 11q, 12q, 14q, 15q and 16q. These molecular data highlight the genomic instability of TA, a benign florid proliferation intermingled with ACC, and do not provide evidence of molecular evolution from TA to ACC. PMID:19031084

Da Silva, Leonard; Buck, Lyndall; Simpson, Peter T; Reid, Lynne; McCallum, Naomi; Madigan, Barry J; Lakhani, Sunil R

2009-01-01

109

[Molecular approaches to systemic therapy of adenoid cystic carcinoma of the head and neck area].  

Science.gov (United States)

The adenoid cystic carcinoma (ACC) is a neurotropic salivary gland tumor with a high blood-borne metastasis tendency. The treatment of choice for localized disease consists of radical surgical resection and, depending on resection status, adjuvant radiotherapy. Due to the high recurrence rate with limited local therapeutic options and frequent occurrence of distant metastases, one is confronted inevitably with the search for an adequate systemic therapy. ACC shows little response to a variety of chemotherapeutic agents, partial or complete remissions are extremely rare. Beside classical chemotherapies, immunotherapeutics and targeted therapies with more favorable side effect profiles were tested in trials, but due to the small number of patients, a definitive statement on the effectiveness can be hardly made. This results in the need for prospective multicenter studies that allow clear recommendations for systemic therapy of the tumor. The present paper gives an overview of the sub-cellular and genetic characteristics of ACC, which represent possible targets for systemic therapies and have partly already been included in running clinical trials. PMID:25302595

Büchsenschütz, K; Veit, J A; Schuler, P J; Thierauf, J; Laban, S; Fahimi, F; Bankfalvi, A; Lang, S; Sauerwein, W; Hoffmann, T K

2014-10-01

110

Expressions of ABCG2, CD133, and podoplanin in salivary adenoid cystic carcinoma.  

Science.gov (United States)

Adenoid cystic carcinoma (ACC) is one of the most common salivary gland malignant tumors with a high risk of recurrence and metastasis. Current studies on cancer stem cells (CSCs) have verified that CSCs are the driving force behind tumor initiation and progression, suggesting that new cancer therapies may be established by effectively targeting and killing the CSCs. The primary goal of this study is to investigate the expression patterns of ABCG2, CD133, and podoplanin in ACC of minor salivary glands by immunohistochemistry analysis. We found that ABCG2 was weakly expressed in normal looking salivary gland tissues. A significant upregulation of ABCG2 expression in ACC was observed with a similar expression pattern of Ki-67. CD133 was detected in apical membrane of epithelial cells and podoplanin was expressed positively in myoepithelial cells of both normal looking tissue and ACC. However, no significant difference was found of the expression pattern of CD133 and podoplanin between normal looking tissues and ACC. Our observations suggest that CSCs may exist in quiescent cells with ABCG2 positive staining, which are surrounded by cells with positive expression of ABCG2 and Ki-67 in ACC, and costaining with ABCG2 and Ki-67 may help predict the location of CSCs. PMID:24804195

Li, Wuwei; Tamamura, Ryo; Wang, Bo; Liu, Qigui; Liu, Han; Liu, Tingjiao; Katase, Naoki; Xiao, Jing; Nagatsuka, Hitoshi

2014-01-01

111

Avaliação radiográfica da adenóide em crianças: métodos de mensuração e parâmetros da normalidade Radiographic evaluation of adenoidal size in children: methods of measurement and parameters of normality  

Directory of Open Access Journals (Sweden)

Full Text Available A radiografia da nasofaringe (ou radiografia do cavum ainda é o exame por imagem mais usado para a avaliação do tamanho da adenóide. Dada a variedade e a complexidade dos métodos de mensuração preconizados, muitos radiologistas preferem a avaliação subjetiva, que pode ser imprecisa e não-acurada. Esta revisão enumera e descreve os diversos métodos de mensuração radiográfica da adenóide propostos na literatura, considerando praticidade, acurácia e precisão, com o objetivo de indicar os mais adequados para a prática cotidiana.Radiograph of the nasopharynx is still the most commonly used imaging method to investigate the adenoidal tissue. Due to the variety and complexity of proposed methods to measure the adenoid size, some radiologists prefer subjective evaluation, which can, however, be imprecise and inaccurate. We review and describe several methods to determine the adenoid size, taking into account the practicity, accuracy and precision with the aim of pointing out the best methods to be applied in daily routine practice.

Severino Aires de Araújo Neto

2004-12-01

112

Recurrent prognostic factors and expression of GLUT-1, PI3K and p-Akt in adenoid cystic carcinomas of the head and neck: Clinicopathological features and biomarkers of adenoid cystic carcinoma  

Digital Repository Infrastructure Vision for European Research (DRIVER)

The purpose of this study was to explore the factors associated with the recurrence of adenoid cystic carcinomas (ACCs). We examined the recurrence values of clinicopathological variables and GLUT-1, p-Akt and PI3K expression in 42 patients with ACC. Of the 42 patients, 17 developed recurrence following initial surgery. The positive rates of GLUT-1, PI3K and p-Akt protein expression in ACC were 38.1, 38.1 and 50.0%, respectively. The expression of GLUT-1, p-Akt or PI3K protein in ACC was high...

Fang, Jin; Bao, Yang-yang; Zhou, Shui-hong; Luo, Xing-mei; Yao, Hong-tian; He, Jian-feng; Wang, Qin-ying

2012-01-01

113

Results of fast neutron therapy of adenoid-cystic carcinomas of the head and neck at the neutron therapy facility Hamburg-Eppendorf  

Energy Technology Data Exchange (ETDEWEB)

Between 1977 and 1987, 30 patients with adenoid-cystic carcinomas of the head and neck region were treated, at the Hamburg-Eppendorf neutron therapy facility, with a 14 MeV-DT-generator. The present review deals with 15 patients treated before October 1986 e.g. with follow up longer than one year. These results, although preliminary, tend to confirm that fast neutrons is the best irradiation modality of adenoid-cystic carcinomas of the head and neck-region, especially when surgery is not possible, or cannot be radical.

Schwarz, R.; Brockmann, W.P.; Junker, A.

1989-04-01

114

Reoperaciones posadenoidectomía por hiperplasia adenoidea obstructiva / Post-adenoidectomy reoperations due to obstructive adenoid hyperplasia  

Scientific Electronic Library Online (English)

Full Text Available SciELO Chile | Language: Spanish Abstract in spanish Introducción: La incidencia de reoperación posadenoidectomía, ya sea una segunda adenoidectomía o una amigdalectomía, no es conocida en nuestro medio. Publicaciones extranjeras muestran 2% de readenoidectomías y 8% de amigdalectomías posteriores. Objetivo: Describir las adenoidectomías efectuadas en [...] nuestro centro, evaluar la prevalencia de reoperaciones y buscar posibles factores asociados a éstas. Material y método: Estudio retrospectivo descriptivo y analítico. Se revisaron fichas de pacientes adenoidectomizados por roncopatía con pausas respiratorias entre enero de 1999 y diciembre 2010. Se registraron datos demográficos, controles y nasofaringolaringoscopías (NFL). Se consignaron las reoperaciones (readenoidectomías y amigdalectomías). Resultados: Se revisaron 106 fichas. Un 55,7% de los pacientes eran hombres. A la NFL, 42% de los pacientes tenían adenoides grado 3y 58% grado 4 de Parikh. Un 5,6% de los pacientes fueron reoperados (1 adenoidectomía y 5 adenoamigdalectomías). Se observó diferencia significativa en edad (p =0,04) y tamaño amigdalino (p =0,004) entre los reoperados y lo no reoperados. No hubo asociación por sexo (p =0,45), asma (p =0,31) ni rinitis (p =0,18). Sin embargo, a la regresión logística multivariada, ninguna variable se asoció significativamente de manera independiente con la necesidad de reoperación. Conclusión: La prevalencia de reoperaciones fue similar a la publicada, no encontrándose asociación con otros factores. Abstract in english Introduction: The incidence of post-adenoidectomy reoperation, be it a second adenoidectomy or a tonsillectomy, is unknown within our environment. Foreign publications show a 2% of re-adenoidectomies and an 8% of ulterior tonsillectomies. Aim: To describe the adenoidectomies performed at our center, [...] to assess the prevalence of reoperations, and to seek possible associated factors to the latter. Material y method: Descriptive and analytical retrospective assessment. A review was performed of records for patients that between January of 1999 and December of 2010 underwent adenoidectomy on account of snoring pathology. Demographics, controls, nasopharyngolaryngoscopies and reoperations (re-adenoidectomies and tonsillectomies) were recorded. Results: The review entailed checking 106 records. 55,7% of patients were men. 42% of patients had Parikh?s Grade III adenoids and 58% showed Grade IV ones. 5,6% of patients underwent reoperation. A significant difference could be observed in age (p=0,04) and tonsillar size (p=0,004) between those that had and had not undergone reoperation. There was no gender association (p=0,45), neither for asthma (p=0,31) or rhinitis (p=0,18). Yet, by multivariate logistic regression, no variable was significantly associated by itself to the need for reoperation. Conclusion: Reoperation prevalence was similar to that published, and no association to other factors was discovered.

Michelle, Arroyo D; Mauricio, Urrutia C; Ariel, Cisternas V.

2014-04-01

115

Reoperaciones posadenoidectomía por hiperplasia adenoidea obstructiva / Post-adenoidectomy reoperations due to obstructive adenoid hyperplasia  

Scientific Electronic Library Online (English)

Full Text Available SciELO Chile | Language: Spanish Abstract in spanish Introducción: La incidencia de reoperación posadenoidectomía, ya sea una segunda adenoidectomía o una amigdalectomía, no es conocida en nuestro medio. Publicaciones extranjeras muestran 2% de readenoidectomías y 8% de amigdalectomías posteriores. Objetivo: Describir las adenoidectomías efectuadas en [...] nuestro centro, evaluar la prevalencia de reoperaciones y buscar posibles factores asociados a éstas. Material y método: Estudio retrospectivo descriptivo y analítico. Se revisaron fichas de pacientes adenoidectomizados por roncopatía con pausas respiratorias entre enero de 1999 y diciembre 2010. Se registraron datos demográficos, controles y nasofaringolaringoscopías (NFL). Se consignaron las reoperaciones (readenoidectomías y amigdalectomías). Resultados: Se revisaron 106 fichas. Un 55,7% de los pacientes eran hombres. A la NFL, 42% de los pacientes tenían adenoides grado 3y 58% grado 4 de Parikh. Un 5,6% de los pacientes fueron reoperados (1 adenoidectomía y 5 adenoamigdalectomías). Se observó diferencia significativa en edad (p =0,04) y tamaño amigdalino (p =0,004) entre los reoperados y lo no reoperados. No hubo asociación por sexo (p =0,45), asma (p =0,31) ni rinitis (p =0,18). Sin embargo, a la regresión logística multivariada, ninguna variable se asoció significativamente de manera independiente con la necesidad de reoperación. Conclusión: La prevalencia de reoperaciones fue similar a la publicada, no encontrándose asociación con otros factores. Abstract in english Introduction: The incidence of post-adenoidectomy reoperation, be it a second adenoidectomy or a tonsillectomy, is unknown within our environment. Foreign publications show a 2% of re-adenoidectomies and an 8% of ulterior tonsillectomies. Aim: To describe the adenoidectomies performed at our center, [...] to assess the prevalence of reoperations, and to seek possible associated factors to the latter. Material y method: Descriptive and analytical retrospective assessment. A review was performed of records for patients that between January of 1999 and December of 2010 underwent adenoidectomy on account of snoring pathology. Demographics, controls, nasopharyngolaryngoscopies and reoperations (re-adenoidectomies and tonsillectomies) were recorded. Results: The review entailed checking 106 records. 55,7% of patients were men. 42% of patients had Parikh?s Grade III adenoids and 58% showed Grade IV ones. 5,6% of patients underwent reoperation. A significant difference could be observed in age (p=0,04) and tonsillar size (p=0,004) between those that had and had not undergone reoperation. There was no gender association (p=0,45), neither for asthma (p=0,31) or rhinitis (p=0,18). Yet, by multivariate logistic regression, no variable was significantly associated by itself to the need for reoperation. Conclusion: Reoperation prevalence was similar to that published, and no association to other factors was discovered.

Michelle, Arroyo D; Mauricio, Urrutia C; Ariel, Cisternas V.

116

CT diagnosis of adenoid cystic carcinoma of the nasal cavity and paranasal sinus  

International Nuclear Information System (INIS)

Purpose: To assess CT findings and their clinical value in the diagnosis of adenoid cystic carcinoma (ACC) of the nasal cavity and paranasal sinus. Materials and methods: Pre-treatment CT findings in 17 histologically proven cases of ACC of the nasal and paranasal sinus were reviewed. 3 cases had plain CT, 2 cases both pre- and post-contrast enhanced CT, and 12 cases contrast enhanced CT. There were 18 axial and 16 coronal scans. Results: Tumors originated from and localized in the nasal cavity in 2 cases. In 15 cases, tumors were located in maxillary sinus and invaded adjacent organs or/and structures, including ipsilateral ethmoid sinus, sphenoid sinus and nasal cavity, contralateral maxillary sinus, orbit, palate, infratemporal fossa, pterygopalatine fossa, parapharyngeal space, inferior orbital fissure and foramen oval. In 7 cases, lesions invaded intracranial structures as well as the cavernous sinus. Altogether there were 2 cases of stage I, 3 cases stage III, and 12 cases stage IV. Adjacent bony changes were found in 16 cases, with bony remodeling (4 cases) and bony erosion combined with expansion (12) (71%). The diameter of the mass was larger than 5 cm in 71% of the cases. In 41% of the cases, tumors were irregular in shape, mottled pattern of lucencies within the tumor was shown in 82% of cases. Scattered calcification could be identified in 3 cases. Conclusion: Most of ACC of the nasal cavity and paranasal sinus had mottle pattern of lucencies within the tumor, irregular in shape, adjacent bony remodeling and/or erosive destruction. These findings indicate the histologic and biologic characteristics of the tumor with slow growing and perineural invasion. Apart from axial scan, coronal scan and contrast administration are mandated for the diagnosis and staging ACC

117

Management of Adenoid Cystic Carcinoma of the Breast: A Rare Cancer Network Study  

Energy Technology Data Exchange (ETDEWEB)

Background: Mammary adenoid cystic carcinoma (ACC) is a rare breast cancer. The aim of this retrospective study was to assess prognostic factors and patterns of failure, as well as the role of radiation therapy (RT), in ACC. Methods: Between January 1980 and December 2007, 61 women with breast ACC were treated at participating centers of the Rare Cancer Network. Surgery consisted of lumpectomy in 41 patients and mastectomy in 20 patients. There were 51(84%) stage pN0 and 10 stage cN0 (16%) patients. Postoperative RT was administered to 40 patients (35 after lumpectomy, 5 after mastectomy). Results: With a median follow-up of 79 months (range, 6-285), 5-year overall and disease-free survival rates were 94% (95% confidence interval [CI], 88%-100%) and 82% (95% CI, 71%-93%), respectively. The 5-year locoregional control (LRC) rate was 95% (95% CI, 89%-100%). Axillary lymph node dissection or sentinel node biopsy was performed in 84% of cases. All patients had stage pN0 disease. In univariate analysis, survival was not influenced by the type of surgery or the use of postoperative RT. The 5-year LRC rate was 100% in the mastectomy group versus 93% (95% CI, 83%-100%) in the breast-conserving surgery group, respectively (p = 0.16). For the breast-conserving surgery group, the use of RT significantly correlated with LRC (p = 0.03); the 5-year LRC rates were 95% (95% CI, 86%-100%) for the RT group versus 83% (95% CI, 54%-100%) for the group receiving no RT. No local failures occurred in patients with positive margins, all of whom received postoperative RT. Conclusion: Breast-conserving surgery is the treatment of choice for patients with ACC breast cancer. Axillary lymph node dissection or sentinel node biopsy might not be recommended. Postoperative RT should be proposed in the case of breast-conserving surgery.

Khanfir, Kaouthar, E-mail: kaouthar.khanfir@rsv-gnw.ch [Hopital de Sion, CHCVs, Sion (Switzerland); Kallel, Adel [Institut Gustave Roussy, Villejuif (France); Villette, Sylviane [Centre Rene Huguenin, Paris (France); Belkacemi, Yazid [CHU Henri Mondor, Centre Oscar Lambret, Lille (France); Vautravers, Claire [Centre George Francois Leclerc, Dijon (France); Nguyen, TanDat [Institut Jean Gaudinot, Reims (France); Miller, Robert [Mayo Clinic, Rochester, Minnesota (United States); Li Yexiong [Peking Union Medical College, Beijing (China); Taghian, Alphonse G. [Massachusetts General Hospital, Boston, Massachusetts (United States); Boersma, Liesbeth [Maastricht University Medical Center (MAASTRO clinic), Maastricht (Netherlands); Poortmans, Philip [Dr. Bernard Verbeeten Institute, Tilburg (Netherlands); Goldberg, Hadassah [Western Galilee Hospital-Nahariya, Nahariya (Israel); Vees, Hansjorg [Hopitaux Universitaires de Geneve, Geneva (Switzerland); Senkus, Elzbieta [Medical University of Gdansk, Gdansk (Poland); Igdem, Sefik; Ozsahin, Mahmut [Istanbul Bilim University, Istanbul (Turkey); Jeanneret Sozzi, Wendy [Centre Hospitalier Universitaire Vaudois, Lausanne (Switzerland)

2012-04-01

118

Expression of p-AKT characterizes adenoid cystic carcinomas of head and neck with a higher risk for tumor relapses  

Directory of Open Access Journals (Sweden)

Full Text Available Abstract Background Adenoid cystic carcinomas are rare tumors with an indolent clinical course, but frequent local relapses. The identification of tumors with a higher relapse risk seems to be interesting. Hence we investigated parameters of glucose metabolism, which were found associated with poor prognosis in other malignancies. Methods Specimen of 29 patients were investigated immunohistochemically with antibodies against p-AKT, TKTL-1 (transketolase-like 1, M2PK (M2 pyruvate kinase, and GLUT-1. Proliferation was investigated by staining with Ki67. The tumors were located at the major or minor salivary glands. Only the typical cribriform subtype was investigated. The initial tumor stage was pT1 or pT2. Results Expression of p-AKT was significantly (P = 0.036 associated with a higher relapse risk in multivariate analysis. Low expression of M2PK was non-significantly (P = 0.065 predictive for a higher risk. TKTL-1 and GLUT-1 were expressed in the majority of cases, albeit not associated with relapse risk. Conclusion Adenoid cystic carcinomas positive for p-AKT show a higher relapse risk. However, other parameters of glucose metabolism investigated here or proliferation (Ki67 were not predictive in this entity. Our findings demonstrate a possible background for therapeutic approaches targeting the inhibition of PI3K/AKT pathway.

Müller-Hermelink Hans-Konrad

2009-06-01

119

A retrospective study of 18 cases of adenoid cystic cancer at a tertiary care centre in Delhi  

Directory of Open Access Journals (Sweden)

Full Text Available Context: Adenoid cystic carcinoma (ACC is a rare neoplasm that usually arises from the salivary, lacrimal, or other exocrine glands. It is characteristically locally infiltrative in nature and has a tendency toward local recurrence, high propensity for perineural invasion, and prolonged clinical course. Aim: To analyze the presentation and natural history of cases of adenoid cystic tumors of salivary glands in our institution; and to compare with the existing literature. Design and Setting: Retrospective study at the Department of Radiotherapy. Materials and Methods: Data on 18 patients of ACC of the salivary glands treated between 2004 and 2008 were reviewed with respect to clinical presentation, stage, and histology. Results: There were 8 cases of major salivary gland tumors (47%, of which 2 were in the submandibular and 6 were involving the parotid. Ten patients (53% had minor salivary gland involvement. Two patients had metastasis at the time of presentation. All patients underwent surgery. Radiotherapy was delivered to 16 patients and chemotherapy to 6 patients (concurrent, n = 3 and adjuvant, n = 3 and no adjuvant therapy was given to 2 patients. All patients were alive at a median follow-up of 3 years. No patient developed local or distant failure during the study duration. Conclusion: ACC has locally aggressive behavior. Radiotherapy adjuvant to surgery improves local control in locally advanced disease. Longer follow-up is mandatory in view of incidence of late metastasis.

Sharma K

2010-01-01

120

Sinonasal tract and nasopharyngeal adenoid cystic carcinoma: a clinicopathologic and immunophenotypic study of 86 cases.  

Science.gov (United States)

Primary sinonasal tract and nasopharyngeal adenoid cystic carcinomas (STACC) are uncommon tumors that are frequently misclassified, resulting in inappropriate clinical management. Eighty-six cases of STACC included 45 females and 41 males, aged 12-91 years (mean 54.4 years). Patients presented most frequently with obstructive symptoms (n = 54), followed by epistaxis (n = 23), auditory symptoms (n = 12), nerve symptoms (n = 11), nasal discharge (n = 11), and/or visual symptoms (n = 10), present for a mean of 18.2 months. The tumors involved the nasal cavity alone (n = 25), nasopharynx alone (n = 13), maxillary sinus alone (n = 4), or a combination of the nasal cavity and paranasal sinuses (n = 44), with a mean size of 3.7 cm. Patients presented equally between low and high stage disease: stage I and II (n = 42) or stage III and IV (n = 44) disease. Histologically, the tumors were invasive (bone: n = 66; neural: n = 47; lymphovascular: n = 33), composed of a variety of growth patterns, including cribriform (n = 33), tubular (n = 16), and solid (n = 9), although frequently a combination of these patterns was seen within a single tumor. Pleomorphism was mild with an intermediate N:C ratio in cells containing hyperchromatic nuclei. Reduplicated basement membrane and glycosaminoglycan material was commonly seen. Necrosis (n = 16) and atypical mitotic figures (n = 11) were infrequently present. Pleomorphic adenoma was present in 9 cases; de-differentiation was seen in two patients. Immunohistochemical studies showed positive reactions for pan-cytokeratin, CK7, CK5/6, CAM5.2, and EMA, with myoepithelial reactivity with SMA, p63, calponin, S100 protein and SMMHC. CD117, CEA, GFAP and p16 were variably present. CK20 and HR HPV were negative. STACC needs to be considered in the differential diagnosis of most sinonasal malignancies, particularly poorly differentiated carcinoma, olfactory neuroblastoma and pleomorphic adenoma. Surgery (n = 82), often accompanied by radiation therapy (n = 36), was generally employed. A majority of patients developed a recurrence (n = 52) 2-144 months after initial presentation. Overall mean follow-up was 19.4 years (range 0.4-37.5 years): 46 patients died with disease (mean 6.4 years); 5 were alive with disease (mean 5.4 years), and 35 patients were either alive or had died of unrelated causes (mean 16.3 years). ACC of the SNT is uncommon. Recurrences are common. The following parameters, when present, suggest an increased incidence of either recurrence or dying with disease: mixed site of involvement, high stage disease (stage IV), skull base involvement, tumor recurrence, a solid histology, perineural invasion, bone invasion, and lymphovascular invasion. PMID:24037641

Thompson, Lester D R; Penner, Carla; Ho, Ngoc J; Foss, Robert D; Miettinen, Markku; Wieneke, Jacqueline A; Moskaluk, Christopher A; Stelow, Edward B

2014-03-01

 
 
 
 
121

Management of Adenoid Cystic Carcinoma of the Breast: A Rare Cancer Network Study  

International Nuclear Information System (INIS)

Background: Mammary adenoid cystic carcinoma (ACC) is a rare breast cancer. The aim of this retrospective study was to assess prognostic factors and patterns of failure, as well as the role of radiation therapy (RT), in ACC. Methods: Between January 1980 and December 2007, 61 women with breast ACC were treated at participating centers of the Rare Cancer Network. Surgery consisted of lumpectomy in 41 patients and mastectomy in 20 patients. There were 51(84%) stage pN0 and 10 stage cN0 (16%) patients. Postoperative RT was administered to 40 patients (35 after lumpectomy, 5 after mastectomy). Results: With a median follow-up of 79 months (range, 6–285), 5-year overall and disease-free survival rates were 94% (95% confidence interval [CI], 88%–100%) and 82% (95% CI, 71%–93%), respectively. The 5-year locoregional control (LRC) rate was 95% (95% CI, 89%–100%). Axillary lymph node dissection or sentinel node biopsy was performed in 84% of cases. All patients had stage pN0 disease. In univariate analysis, survival was not influenced by the type of surgery or the use of postoperative RT. The 5-year LRC rate was 100% in the mastectomy group versus 93% (95% CI, 83%–100%) in the breast-conserving surgery group, respectively (p = 0.16). For the breast-conserving surgery group, the use of RT significantly correlated with LRC (p = 0.03); the 5-year LRC rates were 95% (95% CI, 86%–100%) for the RT group versus 83% (95% CI, 54%–100%) for the group receiving no RT. No logroup receiving no RT. No local failures occurred in patients with positive margins, all of whom received postoperative RT. Conclusion: Breast-conserving surgery is the treatment of choice for patients with ACC breast cancer. Axillary lymph node dissection or sentinel node biopsy might not be recommended. Postoperative RT should be proposed in the case of breast-conserving surgery.

122

Radiographic adenoid evaluation: proposal of an objective parameter / Avaliação radiográfica da tonsila faríngea: proposição de um método de medição objetivo  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Objetivo O objetivo deste estudo foi avaliar parâmetros radiográficos atuais destinados à verificação da adenoide e obstrução nasofaríngea e apresentar um método de avaliação alternativo. Materiais e Métodos Crianças (4 a 14 anos) que apresentavam queixas de obstrução nasal e/ou respiração oral f [...] oram submetidas ao exame radiográfico de cavum faríngeo. Cento e vinte registros foram avaliados por parâmetros radiográficos quantitativos, e estes dados foram correlacionados ao exame de videonasofaringoscopia, aqui considerado como padrão ouro, em relação à porcentagem de obstrução coanal. Posteriormente, uma análise de regressão foi realizada com os mesmos parâmetros quantitativos, de modo que um modelo original fosse criado com o objetivo de predição do percentual de obstrução coanal. Resultados Os parâmetros quantitativos atuais demonstraram correlações moderadas, quando não fracas, ao percentual de obstrução. O modelo de regressão desenvolvido (110.119*A/N) demonstrou capacidade satisfatória de “prever” o real percentual de obstrução adenóidea. Conclusão Uma vez que os parâmetros radiográficos atuais apresentam limitações, o modelo original aqui apresentado deve ser considerado como um método de avaliação adenóidea alternativo, a ser utilizado quando a videonasofaringoscopia estiver indisponível. Abstract in english Objective The objective of the present study was to evaluate current radiographic parameters designed to investigate adenoid hypertrophy and nasopharyngeal obstruction, and to present an alternative radiographic assessment method. Materials and Methods In order to do so, children (4 to14 years ol [...] d) who presented with nasal obstruction or oral breathing complaints were submitted to cavum radiographic examination. One hundred and twenty records were evaluated according to quantitative radiographic parameters, and data were correlated with a gold-standard videonasopharyngoscopic study, in relation to the percentage of choanal obstruction. Subsequently, a regression analysis was performed in order to create an original model so the percentage of the choanal obstruction could be predicted. Results The quantitative parameters demonstrated moderate, if not weak correlation with the real percentage of choanal obstruction. The regression model (110.119*A/N) demonstrated a satisfactory ability to “predict” the actual percentage of choanal obstruction. Conclusion Since current adenoid quantitative radiographic parameters present limitations, the model presented by the present study might be considered as an alternative assessment method in cases where videonasopharyngoscopic evaluation is unavailable.

Murilo Fernando Neuppmann, Feres; Juliana Sato, Hermann; Ana Carolina, Sallum; Shirley Shizue Nagata, Pignatari.

123

Radiographic adenoid evaluation: proposal of an objective parameter / Avaliação radiográfica da tonsila faríngea: proposição de um método de medição objetivo  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Objetivo O objetivo deste estudo foi avaliar parâmetros radiográficos atuais destinados à verificação da adenoide e obstrução nasofaríngea e apresentar um método de avaliação alternativo. Materiais e Métodos Crianças (4 a 14 anos) que apresentavam queixas de obstrução nasal e/ou respiração oral f [...] oram submetidas ao exame radiográfico de cavum faríngeo. Cento e vinte registros foram avaliados por parâmetros radiográficos quantitativos, e estes dados foram correlacionados ao exame de videonasofaringoscopia, aqui considerado como padrão ouro, em relação à porcentagem de obstrução coanal. Posteriormente, uma análise de regressão foi realizada com os mesmos parâmetros quantitativos, de modo que um modelo original fosse criado com o objetivo de predição do percentual de obstrução coanal. Resultados Os parâmetros quantitativos atuais demonstraram correlações moderadas, quando não fracas, ao percentual de obstrução. O modelo de regressão desenvolvido (110.119*A/N) demonstrou capacidade satisfatória de “prever” o real percentual de obstrução adenóidea. Conclusão Uma vez que os parâmetros radiográficos atuais apresentam limitações, o modelo original aqui apresentado deve ser considerado como um método de avaliação adenóidea alternativo, a ser utilizado quando a videonasofaringoscopia estiver indisponível. Abstract in english Objective The objective of the present study was to evaluate current radiographic parameters designed to investigate adenoid hypertrophy and nasopharyngeal obstruction, and to present an alternative radiographic assessment method. Materials and Methods In order to do so, children (4 to14 years ol [...] d) who presented with nasal obstruction or oral breathing complaints were submitted to cavum radiographic examination. One hundred and twenty records were evaluated according to quantitative radiographic parameters, and data were correlated with a gold-standard videonasopharyngoscopic study, in relation to the percentage of choanal obstruction. Subsequently, a regression analysis was performed in order to create an original model so the percentage of the choanal obstruction could be predicted. Results The quantitative parameters demonstrated moderate, if not weak correlation with the real percentage of choanal obstruction. The regression model (110.119*A/N) demonstrated a satisfactory ability to “predict” the actual percentage of choanal obstruction. Conclusion Since current adenoid quantitative radiographic parameters present limitations, the model presented by the present study might be considered as an alternative assessment method in cases where videonasopharyngoscopic evaluation is unavailable.

Murilo Fernando Neuppmann, Feres; Juliana Sato, Hermann; Ana Carolina, Sallum; Shirley Shizue Nagata, Pignatari.

2014-04-01

124

[Sinonasal cystic adenoid carcinoma with epiphora and orbital involvement. Report of a case and review of the literature].  

Science.gov (United States)

We report the clinical case of a 41 years old male with nasal obstruction of 1 year, epistaxis and epiphora. The ENT exam showed a bleeding red mass in left nasal fossa and CT joint to IRM revealed a tumoral process on that level and informed about its extension to adyacents structures (cavum, ethmoides, sphenoids and maxillary sinus). The biopsy was positive for cystic adenoid carcinoma. Our patient was operated by paralateronasal rhinotomy with removal of the tumor. One year later we found recurrence on the left orbital floor and maxilar sinus. The Oncology Department informed that it was not possible a treatment with radiotherapy or chemotherapy because the low sensitivity of that lesion those treatment. PMID:16001694

Pino Rivero, V; González Palomino, A; Pantoja Hernández, C G; Marcos García, M; Trinidad Ruiz, G; Pardo Romero, G; Blasco Huelva, A

2005-01-01

125

Tumour response following high-dose intratumoural application of Viscum album on a patient with adenoid cystic carcinoma.  

Science.gov (United States)

Adenoid cystic carcinoma (ACC) is a rare type of cancer that typically originates in the salivary glands. Surgical removal can lead to functional loss and psychological distress. Viscum album extract (VAE) is a herbal remedy with dose-dependent cytotoxic, apoptogenic and immunological effects. In some case reports, tumour regression has been observed following high-dose local applications of VAE. An active 88-year-old man with fast-growing ACC of the hard palate refused surgical removal and received high-dose intratumoural injections of VAE (alone) over a 10-month period. The tumour decreased in size, softened and loosened from its surroundings. A biopsy during the course showed inflammation. The patient remained well and without functional limitations during the therapy and follow-up period (5 months). VAE produced no reported side effects. This aged patient exemplifies a satisfying course of ACC under VAE resulting in good quality of life and partial tumour regression. PMID:25082867

Werthmann, Paul Georg; Helling, Dieter; Heusser, Peter; Kienle, Gunver Sophia

2014-01-01

126

Hubungan Imunoekspresi E-cadherin dan C-erbB2 dengan Derajat Keganasan Histopatologik Karsinoma Kistik Adenoid Kelenjar Liur  

Directory of Open Access Journals (Sweden)

Full Text Available Adenoid cystic carcinoma (ACC is the most common salivary gland malignancies, with high rate of local recurrence and unpredictable prognosis. Based on previous research, prognosis of ACC in salivary gland which is correlated with survival rates, is related with histopathological malignancy degree based on its growth pattern type. This study was conducted in Pathology Anatomy Department of Medical Faculty, Padjadjaran University Bandung in 2009. The aim of this study was to analyze the alteration of immunoexpression of E-cadherin (adhesion molecule of epithelial cells and C-erbB2 proto-oncogen (the family of C-erbB/epidermal growth factor receptor in salivary gland. Adenoid cystic carcinoma correlated with cross-sectional non-random study on 51 paraffin blocks, from patients with salivary gland ACC retrospectively. The repeated histopatologic examination was to diagnose ACC and to get data of the histopathological malignancy degree (according to Szantos and Batsakis modification, and it was continued with immunohistochemistry examination of E-cadherin and C-erbB2. The alteration of negative immunoexpression of E-cadherin (82% had correlation significantly (p<0.001 with the histological malignancy degrees 1, 2, and 3 (4%, 33% and 46%. The C-erbB2 immunoexpression change had no correlation with the increasing histopatologic malignancy degree (p=0.11. The alteration of C-erbB2 immunoexpression, increased from first (5% to second degree (11% but decreased on the third degree (8%. In conclusions, the immunoexpression of E-cadherin can be used as tumor marker to predict malignancy prognosis of salivary gland ACC. The expression changes of C-erbB2 in ACC indicate its biological behavior and the main role of C-erbB2 on salivary gland ACC is in the initiation and promotion phase of carcinogenesis.

Marry Siti Mariam

2012-06-01

127

An unusual presentation of adenoid cystic carcinoma of the minor salivary glands with cranial nerve palsy: a case study  

Directory of Open Access Journals (Sweden)

Full Text Available Abstract Background Adenoid Cystic Carcinoma (ACC is a rare tumor entity and comprises about 1% of all malignant tumor of the oral and maxillofacial region. It is slow growing but a highly invasive cancer with a high recurrence rate. Intracranial ACC is even more infrequent and could be primary or secondary occurring either by direct invasion, hematogenous spread, or perineural spread. We report the first case of the 5th and 6th nerve palsy due to cavernous sinus invasion by adenoid cystic carcinoma. Case presentation A 49-year-old African American female presented to the emergency room complaining of severe right-sided headache, photophobia, dizziness and nausea, with diplopia. The patient had a 14 year history migraine headaches, hypertension, and mild intermittent asthma. Physical examination revealed right lateral rectus muscle palsy with esotropia. There was numbness in all three divisions of the right trigeminal nerve. Motor and sensory examination of extremities was normal. An MRI of the brain/brain stem was obtained which showed a large mass in the clivus extending to involve the nasopharynx, pterygoid plate, sphenoid and right cavernous sinuses. Biopsy showed an ACC tumor with a cribriform pattern of the minor salivary glands. The patient underwent total gross surgical resection and radiation therapy. Conclusion This is a case of ACC of the minor salivary glands with intracranial invasion. The patient had long history of headaches which changed in character during the past year, and symptoms of acute 5th and 6th cranial nerve involvement. Our unique case demonstrates direct invasion of cavernous sinus and could explain the 5th and 6th cranial nerve involvement as histopathology revealed no perineural invasion.

Morris Pierre A

2007-08-01

128

Adenoid cystic carcinoma of the head and neck treated by surgery with or without postoperative radiation therapy: Prognostic features of recurrence  

International Nuclear Information System (INIS)

Purpose: This study sought to review a single-institution experience with the management of adenoid cystic carcinoma of the head and neck. Methods and Materials: Between 1960 and 2004, 140 patients with adenoid cystic carcinoma of the head and neck were treated with definitive surgery. Ninety patients (64%) received postoperative radiation to a median dose of 64 Gy (range, 54-71 Gy). Distribution of T stage was: 26% T1, 28% T2, 20% T3, and 26% T4. Seventy-eight patients (56%) had microscopically positive margins. Median follow-up was 66 months (range, 7-267 months). Results: The 5- and 10-year rate estimates of local control were 88% and 77%, respectively. A Cox proportional hazards model identified T4 disease (p = 0.0001), perineural invasion (p = 0.008), omission of postoperative radiation (p = 0.007), and major nerve involvement (p = 0.02) as independent predictors of local recurrence. Radiation dose lower than 60 Gy (p = 0.0004), T4 disease (p 0.005), and major nerve involvement (p = 0.02) were predictors of local recurrence among those treated with surgery and postoperative radiation. The 10-year overall survival and distant metastasis-free survival were 64% and 66%, respectively. Conclusion: Combined-modality therapy with surgery followed by radiation to doses in excess of 60 Gy should be considered the standard of care for adenoid cystic carcinoma of the head and neck

129

Avaliação radiográfica da adenóide em crianças: métodos de mensuração e parâmetros da normalidade / Radiographic evaluation of adenoidal size in children: methods of measurement and parameters of normality  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese A radiografia da nasofaringe (ou radiografia do cavum) ainda é o exame por imagem mais usado para a avaliação do tamanho da adenóide. Dada a variedade e a complexidade dos métodos de mensuração preconizados, muitos radiologistas preferem a avaliação subjetiva, que pode ser imprecisa e não-acurada. E [...] sta revisão enumera e descreve os diversos métodos de mensuração radiográfica da adenóide propostos na literatura, considerando praticidade, acurácia e precisão, com o objetivo de indicar os mais adequados para a prática cotidiana. Abstract in english Radiograph of the nasopharynx is still the most commonly used imaging method to investigate the adenoidal tissue. Due to the variety and complexity of proposed methods to measure the adenoid size, some radiologists prefer subjective evaluation, which can, however, be imprecise and inaccurate. We rev [...] iew and describe several methods to determine the adenoid size, taking into account the practicity, accuracy and precision with the aim of pointing out the best methods to be applied in daily routine practice.

Severino Aires de, Araújo Neto; Suélio Marinho de, Queiroz; Emílio Carlos Elias, Baracat; Inês Minniti Rodrigues, Pereira.

130

Intraoral adenoid cystic carcinoma: is the presence of perineural invasion associated with the size of the primary tumour, local extension, surgical margins, distant metastases, and outcome?  

Science.gov (United States)

Adenoid cystic carcinoma is the most common malignancy of the minor salivary glands, and its biological behaviour is characterised by slow and indolent growth; rare involvement of regional lymph nodes; a high propensity for perineural invasion; multiple or delayed recurrences, or both; and a high incidence of distant metastases. Our aim was to find out the relation between the presence of perineural invasion and these factors. Between 1 January 1984 and 1 May 2008, 26 cases of adenoid cystic carcinoma of the intraoral salivary glands, which had initially been treated surgically, were reviewed retrospectively. The most common site was the palate, and perineural invasion was reported in 13 of the 26 resected specimens. There was no significant association between it and the size of the primary tumour (OR=1.0; p=1.00), invasion of the surgical margins (OR=2.08; p=0.4), the presence of distant metastases (OR=3.43; p=0.197), or local control (p=0.76). It was exclusively present in patients with local extension, and was significantly associated with outcome (p=0.04). Resection with clear margins is the gold standard of care for patients with intraoral adenoid cystic carcinoma, and the role of adjuvant irradiation remains controversial. Given its paradoxical and complex biological behaviour, large studies with long term follow-up are needed to define the clinicopathological and immunohistochemical variables associated with outcome, as well as the optimal treatment. PMID:24325947

Lukši?, Ivica; Suton, Petar; Macan, Darko; Dinjar, Kristijan

2014-03-01

131

[The experimentally-based rationale for the application of the new methods designed to treat fungal adenoiditis in the children].  

Science.gov (United States)

The objective of the present was to evaluate the influence of local anesthetics protargol, miramistin, chlorohexidine, and photodynamic therapy (PDT) on the polyresistant strain of Candida tropicalis isolated from a sick child presenting with fungal adenoiditis. In vitro experiments were designed to estimate the inactivation potential of the Candida tropicalis blastospore suspension (5.10? CFU/ml) following the preliminary incubation with a 5 mcmol/l methylene blue solution. A Kreolka FDT apparatus operated at the 680 nm wavelength was employed as the source of radiation in a broad power and time ranges. Simultaneously, experiments were carried out to determine the minimum concentration of the protargol, miramistin, and chlorohexidine solutions inhibiting the growth of the same fungal strain. The minimum growth inhibitory concentrations of these solutions were found to be 0.1%, 0.005%, and 0.005% respectively. The photodynamic therapy using the minimal inhibitory dose of 150 J with a 5 min exposition and an output power of 0.5 W completely suppressed the growth of the Candida tropicalis colonies in the presence of methylene blue as the photosensitizer. PMID:25377679

2014-01-01

132

Analysis of failure in patients with adenoid cystic carcinoma of the head and neck an international collaborative study  

DEFF Research Database (Denmark)

BACKGROUND Adenoid cystic carcinoma (ACC) is a locally aggressive tumor with a high prevalence of distant metastases. The current study aimed to identify independent predictors of outcome and to characterize the patterns of failure. METHODS: An international retrospective review of 489 ACC patients treated between 1985 and 2011 in 9 cancer centers worldwide. RESULTS: Five-year overall-survival (OS), disease-specific survival(DSS) and disease-free survival (DFS) were 76%, 80% and 68%, respectively. Independent predictors of OS and DSS were: age, site, N classification and presence of distant metastases(DM). N stage, age and bone invasion were associated with DFS on multivariate analysis. Age, tumor site, orbital invasion and N stage were independent predictors of DM. CONCLUSION: The clinical course of ACC is slow but persistent. Paranasal sinus origin is associated with the lowest distant metastasis rate but with the poorest outcome. These prognostic estimates should be considered when tailoring treatment for patients with ACC. Head Neck, 2013.

Amit, Moran; Binenbaum, Yoav

2013-01-01

133

International collaborative validation of intraneural invasion as a prognostic marker in adenoid cystic carcinoma of the head and neck  

DEFF Research Database (Denmark)

BACKGROUND: The purpose of this study was to characterize the incidence, pattern of spread, and prognostic correlation of nerve invasion in patients with adenoid cystic carcinoma (ACC). METHODS: Using 3 different pathological categories of perineural invasion, intraneural invasion, and perineural inflammation, we investigated the prognostic value of nerve invasion in a total of 495 ACCs from 9 international patient cohorts with median follow-up 90 months (range, 12-288 months). RESULTS: Of 239 patients (48%) with nerve invasion, 174 (73%) had perineural invasion, 65 (27%) intraneural invasion, and 37 (15%) perineural inflammation. Multivariate Cox regression analysis identified tumor site (p = .008; hazard ratio [HR] = 1.8; 95% confidence interval [CI] = 0.07-3.7) and intraneural invasion (p < .001; HR = 5.9; 95% CI = 0.8-12.3) as independent prognostic markers for both overall survival (OS) and disease-specific survival (DSS), but not of distant metastases. CONCLUSION: Although perineural invasion has no impact on survival, intraneural invasion is an independent predictor of poor prognosis. Recognition of intraneural invasion may help optimize treatment of patients with head and neck ACC. © 2014 Wiley Periodicals, Inc. Head Neck, 2014.

Amit, Moran; Binenbaum, Yoav

2014-01-01

134

Investigation of myoepithelial cell differentiation into Schwann-like cells in salivary adenoid cystic carcinoma associated with perineural invasion.  

Science.gov (United States)

Perineural invasion (PNI) is common in salivary adenoid cystic carcinoma (SACC). The aim of the present study was to explore the association of the Schwann-like cell differentiation with PNI in SACC. Twenty-eight cases of SACC and 10 cases of acinic cell carcinoma (ACA) were examined for the expression of the Schwann cell markers Leu-7 by immunohistochemical staining. The correlation between Leu-7 expression and PNI was analyzed using ? analysis. Immunofluorescence double-staining and pre-embedding immunogold-silver cytochemistry were used to detect the co-expression and the location of Leu-7 and the myoepithelial cell marker ?-smooth muscle actin (?-SMA). PNI was identified in 16 SACCs (57.1%) and 1 ACA (10%) and the overexpression of Leu-7 was detected in 22 SACCs (78.6%) and in none of the ACAs (0%). The differences between PNI and Leu-7 expression in SACC and ACA were significant (P<0.05). A correlation was identified between the expression of Leu-7 and PNI in SACC (?=0.533, P=0.01). In SACC, Leu-7 and ?-SMA were co-expressed in the cytoplasm in the same myoepithelial cells. We suggest that Schwann?like cell differentiation correlates with PNI in SACC and that the differentiation of myoepithelial into Schwann?like cells may be one of the mechanisms through which PNI occurs in SACC. PMID:22842649

Chen, Wei; Dong, Shaozhong; Zhou, Jun; Sun, Moyi

2012-10-01

135

Clinicopathological significance of L-type amino acid transporter 1 (LAT1) expression in patients with adenoid cystic carcinoma.  

Science.gov (United States)

The expression of L-type amino acid transporter 1 (LAT1) is correlated with tumor cell growth and survival. However, the clinicopathological significance of LAT1 expression in adenoid cystic carcinoma (ACC) remains to be elucidated. The aim of this study is to investigate the clinicopathological significance of LAT1 expression in ACC. A total of 30 patients with ACC were retrospectively reviewed. Tumor sections were stained by immunohistochemistry for LAT1, p53, and CD98, and cell proliferation and microvessel density (MVD) were determined by Ki-67 and CD34, respectively. High LAT1 and CD98 expression were observed in 27 % (8/30) and 23 % (7/30) of samples, respectively (p > 0.999). The high expression of LAT1 was significantly correlated with cell proliferation (Ki-67) and the cell cycle regulator p53. By univariate analysis, solid histological pattern, maxillary tumor site, LAT1, CD98, Ki-67 and p53 were significantly associated with poor prognosis. Multivariate analysis demonstrated that the high expression of LAT1 was an independent prognostic factor for predicting poor prognosis after surgical resection. LAT1 is a promising clinical marker to predict the outcome after surgery in patients with ACC. PMID:23516127

Kaira, Kyoichi; Toyoda, Minoru; Shino, Masato; Sakakura, Koichi; Takahashi, Katsumasa; Tominaga, Hideyuki; Oriuchi, Noboru; Kanai, Yoshikatsu; Oyama, Tetsunari; Chikamatsu, Kazuaki

2013-10-01

136

Expression of c-kit and Slug correlates with invasion and metastasis of salivary adenoid cystic carcinoma.  

Science.gov (United States)

The overexpression of c-kit seems to be frequent and specific in salivary adenoid cystic carcinoma (ACC), however, there is little information on correlation between c-kit expression and the invasion and metastasis. Recently, the data showed that Slug, a transcription factor of epithelial-mesenchymal transitions (EMT), is a molecular target that contributes to the biological specificity of c-kit signaling pathway. In this study, the expression of c-kit and Slug was evaluated in two ACC cell lines and 121 patients with ACC. The results of real-time RT-PCR and Western blot showed that ACC-2 and ACC-M cell lines expressed c-kit and Slug mRNA and protein. The immunohistochemical assay in patients demonstrated that positive expression of c-kit and Slug was observed in 108/121 (89.26%) and 87/121 (71.90%) of cases, respectively, and that c-kit and Slug expression was significantly associated with tumor site, TNM stage, histological pattern, perineural invasion, local regional recurrence and distant metastasis of patients with ACC (P<0.05). Furthermore, there was a significant association between the positive expression of c-kit and that of Slug (P=0.046). These findings indicated that c-kit/Slug pathway might participate in the invasion and metastasis of salivary ACC. PMID:20219417

Tang, Yaling; Liang, Xinhua; Zheng, Min; Zhu, Zhiyu; Zhu, Guiquan; Yang, Jing; Chen, Yu

2010-04-01

137

High Expression of SOX2 Is Associated with Poor Prognosis in Patients with Salivary Gland Adenoid Cystic Carcinoma  

Directory of Open Access Journals (Sweden)

Full Text Available Sex determining region Y-BOX2 (SOX2, one of the key members of the SOX family, is a transcription factor that is involved in the maintenance of embryonic stem cell pluripotency and in multiple developmental processes. Recent studies have shown that SOX2 is aberrantly expressed in several types of tumors. The present study aimed to investigate the clinicopathological and prognostic significance of SOX2 in adenoid cystic carcinoma (ACC of salivary gland. In this study, the expression of SOX2 in ACC tissues and matched adjacent non-cancerous tissues was measured by immunohistochemistry, western blot, and quantitative polymerase chain reaction. High SOX2 expression occurred in approximately 62.6% of primary ACC. In addition, high expression of SOX2 was significantly associated with T classification (p = 0.003 and distant metastasis (p = 0.002. The 5-year overall survival (OS and disease-free survival (DFS in patients with high SOX2 expression is poorer than those with low SOX2 expression. When adjusted by multivariate analysis, high SOX2 expression, together with distant metastasis, was an independent prognostic factor. The findings of the present study provide evidence that SOX2 represents a potential novel prognostic biomarker for ACC patients.

Wei Dai

2014-05-01

138

Long-term remission of adenoid cystic tongue carcinoma with low dose naltrexone and vitamin d3 - a case report.  

Science.gov (United States)

Naltrexone (ReVia®) is a long-acting oral pure opiate antagonist which is approved for the treatment of alcohol addiction as a 50mg per day tablet. The mechanism of action is complete opiate blockade, which removes the pleasure sensation derived from drinking alcohol (created by endorphins). Low Dose Naltrexone ("LDN") in the range of 3-4.5 mg per day has been shown to have the opposite effect - brief opiate receptor blockade with resulting upregulation of endogenous opiate production. Through the work of Bihari and Zagon, it has been determined that the level of the endogenous opiate methionine-enkephalin is increased by LDN. Met-enkephalin is involved in regulating cell proliferation and can inhibit cancer cell growth in multiple cell lines. Increased met-enkepahlin levels created by LDN thus have the potential to inhibit cancer growth in humans. Phase II human trials of met-enkephalin, case reports published by Berkson and Rubin, and the clinical experience of Bihari confirmed the potential role of LDN in treating pancreatic and other cancers. However, large scale trials are lacking and are unlikely to be funded given the current non-proprietary status of naltrexone. A case report is presented of successful treatment of adenoid cystic carcinoma as further evidence of LDN's potential as a unique non-toxic cancer therapy. PMID:25284545

Khan, Akbar

2014-09-01

139

EXPRESSION OF MATRIX METALLOPROTEINASE MMP-2 AND ITS TISSUE INHIBITOR TIMP-2 IN INTRAORAL PLEOMORPHIC ADENOMA AND ADENOID CYSTIC CARCINOMA  

Directory of Open Access Journals (Sweden)

Full Text Available Matrix metalloproteinases (MMPs are proteolytic enzymes that are capable of degrading different substrates within extracellular matrix (ECM, and are believed to be crucial for tumor invasion and metastasis. Tissue inhibitors of MMP (TIMPs can inhibit the action of MMPs The aim of this study was to analyze protein expression of MMP-2 and TIMP-2 in intraoral pleomorphic adenoma (PLA and adenoid cystic carcinoma (ACC. A total of 35 formalin-fixed paraffin-embedded specimens comprising 19 PLA and 16 ACC were utilized in this study. A standard immunohistochemical technique was used to determine the expression levels of MMP-2 and TIMP-2 proteins. Sections were assessed semi quantitatively .Staining was scored as 0 ( 50% positive tumor cells. For statistical analysis, tumors were divided into two groups, low expressors ( 0-1+ and high expressors (2-3+. PLA showed higher TIMP-2 expression than ACC (p<0.05. No significant difference was observed between PLA and ACC regarding MMP-2 expression. MMP-2 and TIMP-2 expressed mainly in the cytoplasm of epithelial/ myoepithelial components of PLA and neoplastic epithelial cells of ACC. Myoepithelial cells may be the primary source of gelatinases in PLA and the down regulation of TIMP-2 expression in ACC might be responsible for metastasis and recurrence. The ratio value of MMP-2/TIMP-2 is valuable parameter to demonstrate the ECM degradation/ deposition imbalance.

Natheer Hashim AL-Rawi

2011-04-01

140

{sup 125}I brachytherapy alone for recurrent or locally advanced adenoid cystic carcinoma of the oral and maxillofacial region  

Energy Technology Data Exchange (ETDEWEB)

Background and purpose: This retrospective study was to evaluate the local control and survival of {sup 125}I brachytherapy for recurrent and/or locally advanced adenoid cystic carcinoma (ACC) of the oral and maxillofacial region. Patients and methods: A total of 38 patients with recurrent and/or locally advanced ACC of the oral and maxillofacial region received {sup 125}I brachytherapy alone from 2001-2010. Twenty-nine were recurrent cases following previous surgery and radiation therapy. The other 9 cases involved primary tumors. Overall, 12 tumors were located in the major salivary glands, 12 in the minor salivary glands, and 14 in the paranasal region, the nasal cavity or the skull base. The prescribed dose was 100-160 Gy. Results: Patients were followed for 12-122 months (median 51 months). The 2-, 5-, and 10-year local tumor control rates were 86.3, 59, and 31.5 %, respectively. The 2-, 5-, and 10-year overall survival rates were 92.1, 65 and 34.1 %, respectively. Tumors > 6 cm had significantly lower local control and survival rates. No severe complications were observed during follow-up. Conclusion: {sup 125}I brachytherapy is a feasible and effective modality for the treatment of locally advanced unresectable or recurrent ACC. (orig.)

Huang, M.W.; Zheng, L.; Liu, S.M.; Shi, Y.; Zhang, J.; Yu, G.Y.; Zhang, J.G. [Peking Univ. School and Hospital of Stomatology, Beijing (China). Dept. of Oral and Maxillofacial Surgery

2013-06-15

 
 
 
 
141

125I brachytherapy alone for recurrent or locally advanced adenoid cystic carcinoma of the oral and maxillofacial region  

International Nuclear Information System (INIS)

Background and purpose: This retrospective study was to evaluate the local control and survival of 125I brachytherapy for recurrent and/or locally advanced adenoid cystic carcinoma (ACC) of the oral and maxillofacial region. Patients and methods: A total of 38 patients with recurrent and/or locally advanced ACC of the oral and maxillofacial region received 125I brachytherapy alone from 2001-2010. Twenty-nine were recurrent cases following previous surgery and radiation therapy. The other 9 cases involved primary tumors. Overall, 12 tumors were located in the major salivary glands, 12 in the minor salivary glands, and 14 in the paranasal region, the nasal cavity or the skull base. The prescribed dose was 100-160 Gy. Results: Patients were followed for 12-122 months (median 51 months). The 2-, 5-, and 10-year local tumor control rates were 86.3, 59, and 31.5 %, respectively. The 2-, 5-, and 10-year overall survival rates were 92.1, 65 and 34.1 %, respectively. Tumors > 6 cm had significantly lower local control and survival rates. No severe complications were observed during follow-up. Conclusion: 125I brachytherapy is a feasible and effective modality for the treatment of locally advanced unresectable or recurrent ACC. (orig.)

142

Induction of autophagy-dependent cell death by the survivin suppressant YM155 in salivary adenoid cystic carcinoma.  

Science.gov (United States)

Adenoid cystic carcinoma (ACC) is one of the most common malignancies of the major and minor salivary glands. However, the molecular mechanism underlying the aggressive growth of human salivary ACC remains unclear. In the present study, we showed that survivin, which belongs to the family of inhibitors of apoptosis, is closely related to the high expression of CDK4 and cyclin D1 in human ACC specimens. By employing the small-molecule drug YM155, we found that the inhibition of survivin in ACC cells caused significant cell death and induced autophagy. Chloroquine, an autophagy inhibitor, prevented cell death induced by YM155, suggesting YM155-induced autophagy contributed to the cell death effects in ACC cells. More importantly, evidence obtained from a xenograft model using ACC-2 cells proved the occurrence of YM155-induced autophagy and cell death in vivo was correlated with the suppression of Erk1/2 and S6 activation as well as increased TFEB nuclear translocation. Taken together, our results indicate YM155 is a novel inducer of autophagy-dependent cell death and possesses therapeutic potential in ACC. PMID:24370995

Wang, Yu-Fan; Zhang, Wei; He, Ke-Fei; Liu, Bing; Zhang, Lu; Zhang, Wen-Feng; Kulkarni, Ashok B; Zhao, Yi-Fang; Sun, Zhi-Jun

2014-04-01

143

Adenoid cystic carcinoma of the salivary glands. Management of recurrent, advanced, or persistent disease with hyperthermia and radiation therapy.  

Science.gov (United States)

Adenoid cystic carcinomas (ACC) of the salivary glands are aggressive tumors characterized by multiple late local recurrences and distant metastases. Current therapy includes wide local excision and high-dose postoperative radiation therapy (XRT) (5400 to 7000 cGy). Despite early aggressive treatment, local recurrence remains a major problem with limited safe and effective therapeutic options available. The excellent local responses obtained in four patients (six sites) with ACC of the head and neck treated either with additional low-dose irradiation (2160 to 3420 cGy) in conjunction with two to five hyperthermia (HT) treatments or with full dose XRT and HT as part of the overall treatment plan are reported. All HT treatments were for 45 minutes once steady state conditions were obtained. Monitored intratumoral temperatures for all treatments achieved average maximum (Tmax), average mean (Tave), and average minimum (Tmin) temperatures of 44.2 degrees C, 41.2 degrees C, and 38.9 degrees C, respectively. A complete response was obtained for all six fields with no significant long-term complications. Two patients remain alive and free of local disease at 42 and 63 months of follow-up. Two patients died--one with metastases (with persistent local control) and one with a local recurrence at 9 and 30 months, respectively, after XRT and HT. This is the first report of HT and low-dose XRT in the management of previously irradiated ACC and suggests a potential role for the use of this modality in the treatment of ACC. PMID:2160315

Barnett, T A; Kapp, D S; Goffinet, D R

1990-06-15

144

Therapeutic strategies for adenoid cystic carcinoma of the nasal and paranasal sinus from the long-term treatment results  

International Nuclear Information System (INIS)

This article presents long-term treatment results by analyzing 24 cases with adenoid cystic carcinoma (ACC) of the nasal and paranasal sinus treated from 1975 to 1995 at Akita University Hospital and Chiba University Hospital. The basic strategies for treatment for ACC of the nasal and paranasal sinuses are en bloc tumor resection, followed by primary reconstruction of the maxilla. Preoperative and postoperative radiation were combined. Cumulative 5-year and 10-year survival rates were 70.6% and 47.1% for maxillary sinus tumors, respectively. Cumulative 5-year and 10-year survival rates for nasal tumors were 100% and 75.0%, and those for sphenoid sinus tumors were 50.0% and 0%, respectively. The patient with ethomoid sinus who needed skull base surgery is alive at 8.1 years after therapy. Treatment results closely correlated with tumor extension. Cumulative 5-year survival rates for T2, T3 and, T4 patients with maxillary sinus tumors were 85.7%, 71.4%, and 33.3%, respectively. And cumulative 10-year survival rates for T2, T3, and T4 were 71.4%, 42.9%, and 0%, respectively. The histopathological effects of preoperative radiation were Shimosato II a in 6 out of 10 patients, II b in 2, and III in 2, respectively. Only fast neutron therapy reached Shimosato III. Two of the patients with Shimosato II a died of distant metastasis. The above data suggests that, although radiation therapy alone cannot cure tumors, preoperative full-dose radiation may prevent the development ose radiation may prevent the development of distant metastasis if it can achieve histopathological effects of a higher classification than Shimosato II b. Because chemotherapy and radiation is not very effective on ACC, the role of skull base surgeries for nasal-paranasal sinus malignancies that invade the skull base is valuable, particularly in cases having a relatively small mass in the ethmoid sinus. (author)

145

A 20-Year Retrospective Study of Salivary Gland Adenoid Cystic Carcinoma in a Sample of Iranian Patients  

Directory of Open Access Journals (Sweden)

Full Text Available Objective: The aim of the present study was to investigate the demographic and pathological aspects of adenoid cystic carcinomas (ACC in an Iranian sample based on a 20-year archive review.Materials and Methods: In this descriptive study, tumors of the head and neck registered between 1980 and 2000 were evaluated and cases of ACC were selected. Patients’ medical records and pathology reports were reviewed. Variables such as age, sex, duration of disease,symptoms, site of tumor involvement and tumor diameter as well as pathologic features were recorded. Analysis was performed using chi-square and t-tests; P<0.05 was considered as the level of significance.Results: ACC was the most common malignant tumor followed by mucoepidermoid carcinoma and adenocarcinoma NOS. A total of 120 ACCs were found, of which 50.8% occurred in females and 49.2% in males. Patients’ ages ranged from 5 to 90 with a mean of 49.2 (SD=15.9 years. In 60.9% of cases, minor salivary glands were involved and the palate was the most common site. The greatest tumor diameter was between 2-15cm with a mean of 4.6 cm (SD=2.9. The most prevalent histologic appearance was cribriform, followed by tubular pattern. No significant relation was observed between lymph node metastasisand patients’ age, sex, disease duration, greatest tumor diameter and site of involvement.Conclusion: Our findings were relatively similar to other reports from different parts of the world. Further analytic and case-control studies are recommended to gain a better understanding of different aspects of ACC.

M. Khalili

2009-03-01

146

Cervical adenoid basal carcinoma associated with invasive squamous cell carcinoma: A report of rare co-existence and review of literature  

Directory of Open Access Journals (Sweden)

Full Text Available Abstract Cervical adenoid basal carcinoma (ABC rarely can harbor associated malignancies like adenoid cystic carcinoma or squamous cell carcinoma (SCC, which express markedly different prognosis from a pure ABC, making an appropriate biopsy essential to provide a clear diagnosis and therapeutic plan. We report a 64-year-old asymptomatic lady with an abnormal cervical cytology, who underwent a conization to reveal an ABC with overlying microinvasive SCC. Doubtful resection margins led us to perform radical hysterectomy with lymph node dissection. Subsequent pathological examination showed a true invasive SCC co-existing with ABC, with invasion of the parametrium. Unlike the indolent course of many pure ABC patients, the prognosis of 11 previously reported co-existing invasive SCC with ABC patients appears to depend on the SCC component. Our case reiterates the importance of adequate biopsy with careful interpretation to cover the possibility of a co-existent malignancy. Besides, it presents an argument in favor of radical surgery for the primary treatment of suspicious associated malignancy, and supports adjuvant treatment according to the unfavorable extent of the co-existent invasive carcinoma.

Lee Chung Won

2011-10-01

147

Mechanisms of apple polyphenols-induced proliferation inhibiting and apoptosis in a metastatic oral adenoid cystic carcinoma cell line.  

Science.gov (United States)

Adenoid cystic carcinoma (ACC) is characterized by intensive local invasion and high incidence of distant metastases. Conventional chemotherapy for ACC produces a poor result. We aimed to evaluate the effect of apple polyphenols (APs), a novel nutraceutical agent, on the proliferation and apoptosis levels in a metastatic oral ACC cell line. A metastatic ACC (ACC-M) cell line and control cells (MRC-5 cells derived from normal lung tissue) were treated with APs at different concentrations. MTT assay was used to determine the in vitro cytotoxicity. The cell cycle distribution and apoptosis levels were measured by flow cytometry. To evaluate the mechanism of APs, vascular endothelial growth factor receptor-2 (VEGFR-2) and caspase-3 messenger ribonucleic acid (mRNA) and protein levels were evaluated by reverse transcription-polymerase chain reaction and Western blots, respectively. After cells were cultured for 24 hours or 48 hours, the critical concentration of cytotoxicity of APs in MRC-5 cells was found to be 250 ?g/mL. In contrast, in the concentration range of 100-250 ?g/mL, the cytotoxicity of APs in ACC-M cells was time- and dose-dependent: ACC-M cell proliferation declined at 100 ?g/mL when cultured for 48 hours, whereas growth was not inhibited at the concentrations of APs below 200 ?g/mL when cultured for 24 hours. In selected time and dose patterns (ACC-M cells cultured at the concentrations of 150 and 250 ?g/mL for 48 hours), the flow cytometry performance showed that apoptosis and necrosis occurred in APs-treated ACC-M cells. Also, in these patterns, VEGFR-2 mRNA and protein levels decreased whereas the levels of caspase-3 increased. In summary, APs could inhibit proliferation and induce apoptosis in ACC-M cells in vitro. These effects may be related to the downregulation of VEGFR-2 expression and the activation of caspase-3 expression. PMID:23639509

Zheng, Chao-Qun; Qiao, Bin; Wang, Miao; Tao, Qian

2013-05-01

148

Adenoid cystic carcinomas constitute a genomically distinct subgroup of triple-negative and basal-like breast cancers.  

Science.gov (United States)

Adenoid cystic carcinoma (AdCC) is a rare form of triple-negative and basal-like breast cancer that has an indolent clinical behaviour. Four breast AdCCs were recently shown to harbour the recurrent chromosomal translocation t(6;9)(q22-23;p23-24), which leads to the formation of the MYB-NFIB fusion gene. Our aims were (i) to determine the prevalence of the MYB-NFIB fusion gene in AdCCs of the breast; (ii) to characterize the gene copy number aberrations found in AdCCs; and (iii) to determine whether AdCCs are genomically distinct from histological grade-matched or triple-negative and basal-like invasive ductal carcinomas of no special type (IDC-NSTs). The presence of the MYB-NFIB fusion gene was investigated in 13 AdCCs of the breast by fluorescence in situ hybridization (FISH) and reverse transcriptase-PCR (RT-PCR), and MYB and BRCA1 RNA expression was determined by quantitative RT-PCR. Fourteen AdCCs, 14 histological grade-matched IDC-NSTs, and 14 IDC-NSTs of triple-negative and basal-like phenotype were microdissected and subjected to high-resolution microarray-based comparative genomic hybridization (aCGH). The MYB-NFIB fusion gene was detected in all but one AdCC. aCGH analysis demonstrated a relatively low number of copy number aberrations and a lack of recurrent amplifications in breast AdCCs. Contrary to grade-matched IDC-NSTs, AdCCs lacked 1q gains and 16q losses, and in contrast with basal-like IDC-NSTs, AdCCs displayed fewer gene copy number aberrations and expressed MYB and BRCA1 at significantly higher levels. Breast AdCCs constitute an entity distinct from grade-matched and triple-negative and basal-like IDC-NSTs, emphasizing the importance of histological subtyping of triple-negative and basal-like breast carcinomas. PMID:22015727

Wetterskog, Daniel; Lopez-Garcia, Maria Angeles; Lambros, Maryou B; A'Hern, Roger; Geyer, Felipe C; Milanezi, Fernanda; Cabral, Maria C; Natrajan, Rachael; Gauthier, Arnaud; Shiu, Kai-Keen; Orr, Nicholas; Shousha, Sami; Gatalica, Zoran; Mackay, Alan; Palacios, Jose; Reis-Filho, Jorge S; Weigelt, Britta

2012-01-01

149

Carcinoma adenoideo quístico del dorso de la lengua: Presentación de un caso clínico / Adenoid cystic carcinoma of the dorsum of the tongue: Presentation of a case  

Scientific Electronic Library Online (English)

Full Text Available SciELO Spain | Language: Spanish Abstract in spanish El carcinoma adenoideo quístico es la neoplasia maligna de glándulas salivales menores más frecuente (76.5%), se caracteriza clínicamente por ser de crecimiento lento, la localización más frecuente es el paladar duro. Histopatológicamente presenta tres patrones, cribiforme, tubular y sólido; el tipo [...] sólido esta relacionado con un pobre pronóstico a diferencia del tipo cribiforme que tiene un mejor pronóstico. El tratamiento de elección es la excisión quirúrgica con márgenes amplios y cuando existe metástasis a nódulos linfáticos está indicada la radioterapia posquirúrgica. Se presenta el caso clínico de un hombre de 19 años de edad con recidiva de lesión en dorso de lengua y diagnóstico previo de adenoma monomorfo. En la segunda biopsia se diagnostica como carcinoma adenoideo quístico, por lo que probablemente hubo un error en el diagnóstico original, se decide usar inmunohistoquímica: CALP, CEA, Antígeno Epitelial de Membrana, Proteína Ácido Fibrilar Glial, Ki67, las cuales se observaron positivas en diferentes intensidades, lo que corroboró el diagnóstico de carcinoma adenoideo quístico. El paciente presentó recidiva después de 2 años. Abstract in english Adenoid cystic carcinoma is the most frequent malignant neoplasm of minor salivary glands (76.5%); it is clinically characterized by slow growth, and its most frequent localization is the hard palate. Histopathologically it presents three patterns, cribriform, tubular and solid; the solid type is re [...] lated to a poor prognostic contrary to the cribriform type, which has a better prognosis. Surgical excision with wide margins is the treatment of choice, if it metastasizes to lymph nodules, post surgical radiotherapy is recommended. A 19 year-old man presented a recurrent lesion on the dorsum of the tongue previously diagnosed as monomorphic adenoma. In a second biopsy it was diagnosed as adenoid cystic carcinoma. The following immunohistochemical studies were ordered: CALP, CEA, Epithelial Membrane Antigen, Glial Fibrilar Acid Protein, Ki67; all of these studies were positive and with different intensities, corroborating the diagnosis of adenoid cystic carcinoma. The patient had a recurrence after 2 years.

Dolores, Carrasco Ortiz; Beatriz, Aldape Barrios.

2006-09-01

150

Carcinoma adenoideo quístico del dorso de la lengua: Presentación de un caso clínico / Adenoid cystic carcinoma of the dorsum of the tongue: Presentation of a case  

Scientific Electronic Library Online (English)

Full Text Available SciELO Spain | Language: Spanish Abstract in spanish El carcinoma adenoideo quístico es la neoplasia maligna de glándulas salivales menores más frecuente (76.5%), se caracteriza clínicamente por ser de crecimiento lento, la localización más frecuente es el paladar duro. Histopatológicamente presenta tres patrones, cribiforme, tubular y sólido; el tipo [...] sólido esta relacionado con un pobre pronóstico a diferencia del tipo cribiforme que tiene un mejor pronóstico. El tratamiento de elección es la excisión quirúrgica con márgenes amplios y cuando existe metástasis a nódulos linfáticos está indicada la radioterapia posquirúrgica. Se presenta el caso clínico de un hombre de 19 años de edad con recidiva de lesión en dorso de lengua y diagnóstico previo de adenoma monomorfo. En la segunda biopsia se diagnostica como carcinoma adenoideo quístico, por lo que probablemente hubo un error en el diagnóstico original, se decide usar inmunohistoquímica: CALP, CEA, Antígeno Epitelial de Membrana, Proteína Ácido Fibrilar Glial, Ki67, las cuales se observaron positivas en diferentes intensidades, lo que corroboró el diagnóstico de carcinoma adenoideo quístico. El paciente presentó recidiva después de 2 años. Abstract in english Adenoid cystic carcinoma is the most frequent malignant neoplasm of minor salivary glands (76.5%); it is clinically characterized by slow growth, and its most frequent localization is the hard palate. Histopathologically it presents three patterns, cribriform, tubular and solid; the solid type is re [...] lated to a poor prognostic contrary to the cribriform type, which has a better prognosis. Surgical excision with wide margins is the treatment of choice, if it metastasizes to lymph nodules, post surgical radiotherapy is recommended. A 19 year-old man presented a recurrent lesion on the dorsum of the tongue previously diagnosed as monomorphic adenoma. In a second biopsy it was diagnosed as adenoid cystic carcinoma. The following immunohistochemical studies were ordered: CALP, CEA, Epithelial Membrane Antigen, Glial Fibrilar Acid Protein, Ki67; all of these studies were positive and with different intensities, corroborating the diagnosis of adenoid cystic carcinoma. The patient had a recurrence after 2 years.

Dolores, Carrasco Ortiz; Beatriz, Aldape Barrios.

151

Estudo clínico, randomizado, duplo-cego, em crianças com adenóide obstrutiva, submetidas a tratamento homeopático / Prospective, randomized, double-blind clinical trial about efficacy of homeopathic treatment in children with obstructive adenoid  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese OBJETIVO: Avaliar a eficácia e segurança do tratamento homeopático em crianças com adenóide obstrutiva, com indicação cirúrgica. FORMA DE ESTUDO: Clínico prospectivo. Material e método: Estudo prospectivo, duplo-cego, randomizado, em que foram incluídas 40 crianças com idade variando de 3 a 7 anos, [...] 20 crianças foram tratadas com medicação homeopática individualizada (Simillimum), baseada no princípio da similitude e 20 crianças receberam placebo. Todas as crianças do grupo medicação homeopática foram medicadas diariamente com Agraphis nutans 6 CH, Thuya 6 CH e Adenóide 21CH; e as do grupo placebo receberam diariamente medicamentos sem o princípio ativo. A duração do estudo de cada paciente foi de 4 meses. A avaliação dos resultados foi clínica, por meio de questionário padrão, de exame otorrinolaringológico e nasofaringoscopia direta com fibroscópio flexível, no primeiro e no último dia de tratamento. Utilizou-se como critério de inclusão a adenóide que ocupou mais do que 70% da luz coanal. RESULTADOS: Das 20 crianças tratadas com medicamento homeopático, 13 não apresentaram alteração no tamanho da adenóide nos exames nasofaringoscópicos e 7 tiveram diminuição da adenóide; das 20 crianças que receberam placebo por 4 meses, 11 não apresentaram alterações no tamanho da adenóide, 4 tiveram diminuição da adenóide e 5 crianças tiveram aumento. Não houve diferença estatística significante entre os grupos (P= 0,069). Na avaliação clínica da evolução dos pacientes, dos 20 pacientes tratados com medicamento homeopático, 17 se mantiveram inalterados, com respiração oral e ronco, um paciente melhorou, ficando sem ronco e dois foram curados, isto é, a respiração alterou-se de oral para nasal e sem ronco. Dos 20 pacientes tratados com placebo, 17 pacientes se mantiveram inalterados, um paciente melhorou do ronco e dois foram curados, não tendo havido diferença estatística significante entre os grupos (P>0,999). CONCLUSÕES: O tratamento homeopático não foi eficaz nas crianças com adenóide obstrutiva, mantendo-se a indicação cirúrgica em 85% dos pacientes. O medicamento homeopático não provocou eventos adversos nas crianças. Abstract in english AIM: the efficacy and security of homeopathic treatment was investigated on children with obstructive adenoid justifying an operation. STUDY DESIGN: Clinical prospective. MATERIAL AND METHOD: In a prospective, randomized, double-blind clinical trial included 40 children between the ages of 3 to 7 ye [...] ars old, 20 children were treated with homeopathic medication, based in the principle of similarity (Simillimum), and 20 children with placebo. All the children of the homeopathic group/ adenoid, were treated daily with Agraphis nutans 6 CH, Thuya 6 CH and Adenoid 21CH, and the patients of the placebo group received daily placebo medication. The duration of the study of each children was 4 months. The evaluation of the results was clinical, and it was made by questionnaire standard, clinical examination and direct flexible fiberoptic nasopharyngoscopy, in the first and last day of treatment. The criterion of selection was the adenoid that occuped more than 70% of the coanal space. RESULTS: From the group of 20 children treated with homeopathic treatment, 13 did not show any change on the size of adenoid after nasopharyngoscopy, and 7 children had their adenoid decreased; from another group of 20 children that have treated with placebo for 4 months, 11 did not show any change on the size of their adenoid, 4 had their adenoid decreased and 5 had their adenoid increased. The statistical analysis showed a not significant difference (P= 0,069). The clinical evaluation of the patients showed that from the group of 20 patients treated with homeopathy, 17 kept unchanging, with oral breathing and snoring, one patient got better, eliminating the snoring and two were cured, which mean that their oral breathing turned to nasal breathing w

Sergio E., Furuta; Luc L.M., Weckx; Claudia R., Figueiredo.

2003-06-01

152

Estudo clínico, randomizado, duplo-cego, em crianças com adenóide obstrutiva, submetidas a tratamento homeopático / Prospective, randomized, double-blind clinical trial about efficacy of homeopathic treatment in children with obstructive adenoid  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese OBJETIVO: Avaliar a eficácia e segurança do tratamento homeopático em crianças com adenóide obstrutiva, com indicação cirúrgica. FORMA DE ESTUDO: Clínico prospectivo. Material e método: Estudo prospectivo, duplo-cego, randomizado, em que foram incluídas 40 crianças com idade variando de 3 a 7 anos, [...] 20 crianças foram tratadas com medicação homeopática individualizada (Simillimum), baseada no princípio da similitude e 20 crianças receberam placebo. Todas as crianças do grupo medicação homeopática foram medicadas diariamente com Agraphis nutans 6 CH, Thuya 6 CH e Adenóide 21CH; e as do grupo placebo receberam diariamente medicamentos sem o princípio ativo. A duração do estudo de cada paciente foi de 4 meses. A avaliação dos resultados foi clínica, por meio de questionário padrão, de exame otorrinolaringológico e nasofaringoscopia direta com fibroscópio flexível, no primeiro e no último dia de tratamento. Utilizou-se como critério de inclusão a adenóide que ocupou mais do que 70% da luz coanal. RESULTADOS: Das 20 crianças tratadas com medicamento homeopático, 13 não apresentaram alteração no tamanho da adenóide nos exames nasofaringoscópicos e 7 tiveram diminuição da adenóide; das 20 crianças que receberam placebo por 4 meses, 11 não apresentaram alterações no tamanho da adenóide, 4 tiveram diminuição da adenóide e 5 crianças tiveram aumento. Não houve diferença estatística significante entre os grupos (P= 0,069). Na avaliação clínica da evolução dos pacientes, dos 20 pacientes tratados com medicamento homeopático, 17 se mantiveram inalterados, com respiração oral e ronco, um paciente melhorou, ficando sem ronco e dois foram curados, isto é, a respiração alterou-se de oral para nasal e sem ronco. Dos 20 pacientes tratados com placebo, 17 pacientes se mantiveram inalterados, um paciente melhorou do ronco e dois foram curados, não tendo havido diferença estatística significante entre os grupos (P>0,999). CONCLUSÕES: O tratamento homeopático não foi eficaz nas crianças com adenóide obstrutiva, mantendo-se a indicação cirúrgica em 85% dos pacientes. O medicamento homeopático não provocou eventos adversos nas crianças. Abstract in english AIM: the efficacy and security of homeopathic treatment was investigated on children with obstructive adenoid justifying an operation. STUDY DESIGN: Clinical prospective. MATERIAL AND METHOD: In a prospective, randomized, double-blind clinical trial included 40 children between the ages of 3 to 7 ye [...] ars old, 20 children were treated with homeopathic medication, based in the principle of similarity (Simillimum), and 20 children with placebo. All the children of the homeopathic group/ adenoid, were treated daily with Agraphis nutans 6 CH, Thuya 6 CH and Adenoid 21CH, and the patients of the placebo group received daily placebo medication. The duration of the study of each children was 4 months. The evaluation of the results was clinical, and it was made by questionnaire standard, clinical examination and direct flexible fiberoptic nasopharyngoscopy, in the first and last day of treatment. The criterion of selection was the adenoid that occuped more than 70% of the coanal space. RESULTS: From the group of 20 children treated with homeopathic treatment, 13 did not show any change on the size of adenoid after nasopharyngoscopy, and 7 children had their adenoid decreased; from another group of 20 children that have treated with placebo for 4 months, 11 did not show any change on the size of their adenoid, 4 had their adenoid decreased and 5 had their adenoid increased. The statistical analysis showed a not significant difference (P= 0,069). The clinical evaluation of the patients showed that from the group of 20 patients treated with homeopathy, 17 kept unchanging, with oral breathing and snoring, one patient got better, eliminating the snoring and two were cured, which mean that their oral breathing turned to nasal breathing w

Sergio E., Furuta; Luc L.M., Weckx; Claudia R., Figueiredo.

153

Incidence of cervical lymph node metastasis and its association with outcomes in patients with adenoid cystic carcinoma. An international collaborative study  

DEFF Research Database (Denmark)

BACKGROUND: The patterns of regional metastasis in adenoid cystic carcinoma (ACC) of the head and neck and its association with outcome is not established. METHODS: We conducted a retrospective multicentered multivariate analysis of 270 patients who underwent neck dissection. RESULTS: The incidence rate of neck metastases was 29%. The rate observed in the oral cavity is 37%, and in the major salivary glands is 19% (p = .001). The rate of occult nodal metastases was 17%. Overall 5-year survival rates were 44% in patients undergoing therapeutic neck dissections, and 65% and 73% among those undergoing elective neck dissections, with and without nodal metastases, respectively (p = .017). Multivariate analysis revealed that the primary site, nodal classification, and margin status were independent predictors of survival. CONCLUSION: Our findings support the consideration of elective neck treatment in patients with ACC of the oral cavity. © 2014 Wiley Periodicals, Inc. Head Neck, 2014.

Amit, Moran; Binenbaum, Yoav

2014-01-01

154

Concurrent occurrence of adenoid cystic carcinoma of the salivary glands with small cell carcinoma of the liver: A rare case report  

Science.gov (United States)

Adenoid cystic carcinoma (ACC) is a clinically deceptive and histologically specific malignancy of salivary gland origin. It is the most common minor salivary gland malignancy. Small cell carcinoma (SCC) is a type of undifferentiated malignant neuroendocrine tumor reported rarely in the liver. Though there are many reported cases of SCC involving liver and ACC of minor salivary glands, the review of literature does not show any reports of concomitant occurrence of these two tumors. We describe a rare case of ACC of the oral cavity and its coexistence with a SCC involving liver, identified and confirmed by histological, and immunohistochemical observations. To our knowledge, this is the first reported case of an ACC of the oral cavity and SCC of liver occurring concomitantly in the same patient. PMID:24250095

Premkumar, Jeyanthi; Karthik, S; Sathyakumar, M; Martin, Yakob

2013-01-01

155

Carcinoma adenóide cístico: revisão da literatura e relato de caso clínico / Adenoid cystic carcinoma: review of the literature and case report  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O carcinoma adenóide cístico (CAC) é neoplasia maligna de glândula salivar que acomete principalmente as glândulas parótidas, as submandibulares e as salivares acessórias, sendo raro nas glândulas sublinguais. Com crescimento lento e natureza infiltrativa, clinicamente apresenta-se como nódulo de co [...] nsistência endurecida. O presente trabalho teve como objetivo revisar a literatura atual sobre o tema em relação aos aspectos clínicos e histopatológicos, bem como relatar um caso de CAC na região submandibular. Abstract in english The adenoid cystic carcinoma (ACC) is a malignant neoplasm of salivary gland that arises preferencially in parotid glands, submandibular and minor salivary glands, but is uncommon in sublingual glands. The ACC is a slow growth and infiltrative tumour that clinically is characterized by a firm mass. [...] The present study aims to rewiew the atually literature of the ACC in relation of clinical and histopathological features and describes a case of ACC in submandibular gland.

Adriana Terezinha N. N., Alves; Flávia Dantas, Soares; Arley, Silva Junior; Ney, Medeiros; Adrianna, Milagres.

156

Concurrent occurrence of adenoid cystic carcinoma of the salivary glands with small cell carcinoma of the liver: A rare case report.  

Science.gov (United States)

Adenoid cystic carcinoma (ACC) is a clinically deceptive and histologically specific malignancy of salivary gland origin. It is the most common minor salivary gland malignancy. Small cell carcinoma (SCC) is a type of undifferentiated malignant neuroendocrine tumor reported rarely in the liver. Though there are many reported cases of SCC involving liver and ACC of minor salivary glands, the review of literature does not show any reports of concomitant occurrence of these two tumors. We describe a rare case of ACC of the oral cavity and its coexistence with a SCC involving liver, identified and confirmed by histological, and immunohistochemical observations. To our knowledge, this is the first reported case of an ACC of the oral cavity and SCC of liver occurring concomitantly in the same patient. PMID:24250095

Premkumar, Jeyanthi; Karthik, S; Sathyakumar, M; Martin, Yakob

2013-05-01

157

Carcinoma adenóide cístico: revisão da literatura e relato de caso clínico Adenoid cystic carcinoma: review of the literature and case report  

Directory of Open Access Journals (Sweden)

Full Text Available O carcinoma adenóide cístico (CAC é neoplasia maligna de glândula salivar que acomete principalmente as glândulas parótidas, as submandibulares e as salivares acessórias, sendo raro nas glândulas sublinguais. Com crescimento lento e natureza infiltrativa, clinicamente apresenta-se como nódulo de consistência endurecida. O presente trabalho teve como objetivo revisar a literatura atual sobre o tema em relação aos aspectos clínicos e histopatológicos, bem como relatar um caso de CAC na região submandibular.The adenoid cystic carcinoma (ACC is a malignant neoplasm of salivary gland that arises preferencially in parotid glands, submandibular and minor salivary glands, but is uncommon in sublingual glands. The ACC is a slow growth and infiltrative tumour that clinically is characterized by a firm mass. The present study aims to rewiew the atually literature of the ACC in relation of clinical and histopathological features and describes a case of ACC in submandibular gland.

Adriana Terezinha N. N. Alves

2004-12-01

158

In vitro angiogenesis and expression of nuclear factor ?B and VEGF in high and low metastasis cell lines of salivary gland Adenoid Cystic Carcinoma  

Directory of Open Access Journals (Sweden)

Full Text Available Abstract Background Adenoid cystic carcinoma is a high malignant carcinoma characterized by intensive local invasion and high incidence of distant metastasis. Although many reports have demonstrated that angiogenesis has played an important role in tumor metastasis, the relationship between metastasis characters and angiogenesis ability in high and low metastasis cell lines of Adenoid cystic carcinoma has rarely been reported. The present study aimed to compare the angiogenesis ability of ACC-M (high metastasis and ACC-2 (low metastasis cell lines in vitro. Furthermore, the activity of nuclear factor ?appa B and the expression of vascular endothelial growth factor (VEGF in ACC-2 and ACC-M were also detected. Methods Electrophoretic mobility shift assay was used to detect nuclear factor ?appa B activity. Semi-quantitative RT-PCR was used to quantify the mRNA level of VEGF. Immuofluorescence double staining and semi-quantitative confocal laser scanning analysis was carried out to detect nuclear factor ?appa B nuclear localization and staining intensity of VEGF. The angiogenesis ability of ACC-M and ACC-2 was compared by an in vitro three-dimensional angiogenic model assay. The vector transfection assay was performed to transfect the PCMV-I?B?M vector into ACCs cell lines expressing the phosphorylation defective I?B?M. Results Nuclear factor ?appa B activity and the rate of nuclear factor ?appa B nuclear localization in ACC-M was significantly higher than that in ACC-2. Moreover, ACC-M exhibited higher mRNA and protein levels of vascular endothelial growth factor than ACC-2. VEGF mRNA expression was effectively decreased by inhibition of nuclear factor ?appa B activity. Furthermore, ACC-M could remarkably stimulate the migration and tube formation of endothelial cells and induce The umbilical vein endothelial cells sprouting into the gel matrix. Conclusion These results implicated that ACCs cells with higher metastasis feature might present greater angiogenesis ability.

Peng Bin

2007-06-01

159

Tonsils and Adenoids  

Science.gov (United States)

... neck. He or she may use a small mirror or a flexible lighted instrument to see these ... recommended if there are recurrent infections despite antibiotic therapy, and/or difficulty breathing due to enlarged tonsils ...

160

Avaliação da pressão inspiratória em crianças com aumento do volume de tonsilas Evaluation of inspiratory pressure in children with enlarged tonsils and adenoids  

Directory of Open Access Journals (Sweden)

Full Text Available Crianças com aumento do volume de tonsilas palatina e faríngea freqüentemente apresentam anormalidades respiratórias tais como ronco, respiração oral e apnéia do sono. Sabe-se que a obstrução de vias aéreas superiores e conseqüentemente a respiração oral podem resultar em problemas pulmonares. OBJETIVO: Avaliar a pressão inspiratória em crianças com obstrução de vias aéreas superiores devido ao aumento do volume de tonsilas. FORMA DE ESTUDO: clínico com coorte transversal. MATERIAL E MÉTODO: Nós avaliamos 37 crianças (4-13 anos, ambos os sexos com aumento do volume de tonsilas que seriam submetidas à cirurgia de Adenoamigdalectomia na Divisão de Otorrinolaringologia da Universidade de São Paulo no mesmo período. O grupo controle foi composto de 28 crianças sem aumento de volume tonsilar que foram submetidas aos mesmos testes. A pressão Inspiratória foi obtida pelo uso do manovacuômetro. RESULTADOS: Observamos uma menor pressão inspiratória no grupo com aumento do volume de tonsilas. A média do grupo com aumento do volume das tonsilas foi 14,607 cm/H2O e do grupo normal foi de 27,580 cm/H2O (PChildren with enlarged tonsils and adenoids usually present breathing abnormalities such as snoring, mouth breathing and sleep apnea. It is known that upper airway obstruction and consequent mouth breathing may result in pulmonary diseases. AIM: The goal of this preliminary study was to evaluate the inspiratory pressure in children with upper airway obstruction due to enlarged tonsils. STUDY DESIGN: clinical with transversal cohort. MATERIAL AND METHOD: We evaluated 37 children (4 -13 years old, female/male with enlarged tonsils who would be submitted to a T&A surgery in the Department of Otolaryngology, Medical School, University of Sao Paulo, from October 2002 to March 2003. The control group comprised 28 children without tonsillar disease submitted to the same tests. Inspiratory pressure was obtained using a manometer and vacuum meter. RESULTS: We could observe lower inspiratory pressures in children with upper airway obstruction. The mean of inspiratory pressure in the upper airway obstruction group was 14.607cm/H2O and in the control group was of 27.580cm/H2O. CONCLUSIONS: Enlarged tonsils and adenoids were associated with poor inspiratory pressure, resulting in increased breathing effort and work of the involved muscles.

Melissa Guerato Pires

2005-10-01

 
 
 
 
161

Avaliação da pressão inspiratória em crianças com aumento do volume de tonsilas / Evaluation of inspiratory pressure in children with enlarged tonsils and adenoids  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese Crianças com aumento do volume de tonsilas palatina e faríngea freqüentemente apresentam anormalidades respiratórias tais como ronco, respiração oral e apnéia do sono. Sabe-se que a obstrução de vias aéreas superiores e conseqüentemente a respiração oral podem resultar em problemas pulmonares. OBJET [...] IVO: Avaliar a pressão inspiratória em crianças com obstrução de vias aéreas superiores devido ao aumento do volume de tonsilas. FORMA DE ESTUDO: clínico com coorte transversal. MATERIAL E MÉTODO: Nós avaliamos 37 crianças (4-13 anos, ambos os sexos) com aumento do volume de tonsilas que seriam submetidas à cirurgia de Adenoamigdalectomia na Divisão de Otorrinolaringologia da Universidade de São Paulo no mesmo período. O grupo controle foi composto de 28 crianças sem aumento de volume tonsilar que foram submetidas aos mesmos testes. A pressão Inspiratória foi obtida pelo uso do manovacuômetro. RESULTADOS: Observamos uma menor pressão inspiratória no grupo com aumento do volume de tonsilas. A média do grupo com aumento do volume das tonsilas foi 14,607 cm/H2O e do grupo normal foi de 27,580 cm/H2O (P Abstract in english Children with enlarged tonsils and adenoids usually present breathing abnormalities such as snoring, mouth breathing and sleep apnea. It is known that upper airway obstruction and consequent mouth breathing may result in pulmonary diseases. AIM: The goal of this preliminary study was to evaluate the [...] inspiratory pressure in children with upper airway obstruction due to enlarged tonsils. STUDY DESIGN: clinical with transversal cohort. MATERIAL AND METHOD: We evaluated 37 children (4 -13 years old, female/male) with enlarged tonsils who would be submitted to a T&A surgery in the Department of Otolaryngology, Medical School, University of Sao Paulo, from October 2002 to March 2003. The control group comprised 28 children without tonsillar disease submitted to the same tests. Inspiratory pressure was obtained using a manometer and vacuum meter. RESULTS: We could observe lower inspiratory pressures in children with upper airway obstruction. The mean of inspiratory pressure in the upper airway obstruction group was 14.607cm/H2O and in the control group was of 27.580cm/H2O. CONCLUSIONS: Enlarged tonsils and adenoids were associated with poor inspiratory pressure, resulting in increased breathing effort and work of the involved muscles.

Melissa Guerato, Pires; Renata Cantisani, Di Francesco; Anete Sevciovic, Grumach; João Ferreira de, Mello Jr..

2005-10-01

162

Expression of beclin 1 in primary salivary adenoid cystic carcinoma and its relation to Bcl-2 and p53 and prognosis  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in english Beclin 1 plays a critical role in autophagy and functions as a haploinsufficient tumor suppressor. The expression and prognostic significance of beclin 1 in head and neck adenoid cystic carcinoma (ACC) are largely unexplored. Therefore, we investigated the expression of beclin 1, Bcl-2, and p53 in [...] head and neck ACC tissue. Tissue samples from 35 cases (15 females, 20 males) of head and neck ACC were utilized for immunohistochemistry. Beclin 1 expression was observed in 32 cases (91.4%) and considered to be high in 15 cases (42.9%) and low in 20 cases (57.1%). Beclin 1 expression was significantly correlated with a histological growth pattern (P=0.046) and histological grade (P=0.037). Beclin 1 expression was inversely correlated with Bcl-2 expression (P=0.013) and significantly associated with overall survival (P=0.006). Bcl-2 and p53 expression were observed in 21 cases (60.0%) and 16 cases (45.7%). Bcl-2 expression was significantly correlated with perineural invasion (P=0.041) and not associated with overall survival (P=0.053). p53 expression was directly correlated with beclin 1 expression (P=0.044). Our results indicated that beclin 1 may be a novel, promising prognostic factor for clinical outcome in head and neck ACC patients and may play a part in the development of head and neck ACC by interacting with Bcl-2 and p53.

L.C., Jiang; S.Y., Huang; D.S., Zhang; S.H., Zhang; W.G., Li; P.H., Zheng; Z.W., Chen.

163

RASSF1A Promoter Hypermethylation Is a Strong Biomarker of Poor Survival in Patients with Salivary Adenoid Cystic Carcinoma in a Chinese Population  

Science.gov (United States)

In addition to the clinicopathological parameters, molecular biomarkers are becoming increasingly important in the prognostic evaluation of cancer patients. This study aimed to determine the molecular alterations in the RAS association domain family protein1A gene (RASSF1A) in salivary adenoid cystic carcinoma (ACC) and to evaluate the potential of such alterations as prognostic markers. One hundred and sixty-seven ACC tumor tissues and 50 samples of matched normal salivary gland tissues from the same patients were analyzed for RASSF1A promoter methylation status by bisulfite sequencing PCR (BSP) and/or methylation-specific PCR (MSP). Fifty ACC tumor tissues and matched normal salivary gland tissues were analyzed for loss of heterozygosity (LOH) by examining two microsatellite markers (D3S1478, D3S1621) at 3p21. RASSF1A gene mutations were detected by direct sequencing of all six exons in 50 tumor and normal tissue specimens. Over-all, RASSF1A promoter hypermethylation was detected in 35.3% (59/167) of ACC tissues and was associated with histologically solid tumor pattern (P?=?0.002) and advanced TNM stage (P?=?0.014). RASSF1A LOH was observed in 18.0% (9/50) of cases, and no somatic mutation of RASSF1A was detected in any cases. RASSF1A promoter methylation was associated with the poor over-all survival (Log-rank test, P <0.001) and disease-free survival (Log-rank test, P <0.001) and identified as an independent predicator of over-all patient survival (P?=?0.009) and disease-free survival (P <0.001). It was concluded that RASSF1A methylation is involved in the development, differentiation and progression of ACC and is a strong independent biomarker of poor survival in ACC patients in a Chinese population. PMID:25302792

Zhang, Chun-Ye; Zhao, Yang-Xing; Xia, Rong-Hui; Han, Jing; Wang, Bing-Shun; Tian, Zhen; Wang, Li-Zhen; Hu, Yu-Hua; Li, Jiang

2014-01-01

164

Expression of beclin 1 in primary salivary adenoid cystic carcinoma and its relation to Bcl-2 and p53 and prognosis  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in english Beclin 1 plays a critical role in autophagy and functions as a haploinsufficient tumor suppressor. The expression and prognostic significance of beclin 1 in head and neck adenoid cystic carcinoma (ACC) are largely unexplored. Therefore, we investigated the expression of beclin 1, Bcl-2, and p53 in [...] head and neck ACC tissue. Tissue samples from 35 cases (15 females, 20 males) of head and neck ACC were utilized for immunohistochemistry. Beclin 1 expression was observed in 32 cases (91.4%) and considered to be high in 15 cases (42.9%) and low in 20 cases (57.1%). Beclin 1 expression was significantly correlated with a histological growth pattern (P=0.046) and histological grade (P=0.037). Beclin 1 expression was inversely correlated with Bcl-2 expression (P=0.013) and significantly associated with overall survival (P=0.006). Bcl-2 and p53 expression were observed in 21 cases (60.0%) and 16 cases (45.7%). Bcl-2 expression was significantly correlated with perineural invasion (P=0.041) and not associated with overall survival (P=0.053). p53 expression was directly correlated with beclin 1 expression (P=0.044). Our results indicated that beclin 1 may be a novel, promising prognostic factor for clinical outcome in head and neck ACC patients and may play a part in the development of head and neck ACC by interacting with Bcl-2 and p53.

L.C., Jiang; S.Y., Huang; D.S., Zhang; S.H., Zhang; W.G., Li; P.H., Zheng; Z.W., Chen.

2014-03-01

165

Comprehensive genomic profiling of relapsed and metastatic adenoid cystic carcinomas by next-generation sequencing reveals potential new routes to targeted therapies.  

Science.gov (United States)

We hypothesized that next-generation sequencing could reveal actionable genomic alterations (GAs) and potentially expand treatment options for patients with advanced adenoid cystic carcinoma (ACC). Genomic profiling using next-generation sequencing was performed on hybridization-captured, adapter ligation libraries derived from 28 relapsed and metastatic formalin-fixed paraffin-embedded ACC. The 3230 exons of 182 cancer-related genes and 37 introns of 14 genes frequently rearranged in cancer were fully sequenced using the Illumina HiSeq 2000. All classes of GAs were evaluated. Actionable GAs were defined as those impacting targeted anticancer therapies on the market or in registered clinical trials. A total of 44 GAs were identified in the 28 ACC tumors, with 12 of 28 (42.9%) of tumors harboring at least 1 potentially actionable GA. The most common nonactionable GAs were identified in KD6MA (5 cases; 18%), ARID1A (4 cases; 14%), RUNX1 (2 cases; 7%), and MYC (2 cases; 7%). Actionable GAs included NOTCH1 (3 cases; 11%), MDM2 (2 cases; 7%), PDGFRA (2 cases; 7%), and CDKN2A/B (p16) (2 cases; 7%). Other potentially actionable GAs identified in a single case included: mutations in AKT1, BAP1, EGFR, and PIK3CA, homozygous deletion of FBXW7, and amplifications of CDK4, FGFR1, IGF1R, KDR, KIT, and MCL1. The frequency of GA in ACC is lower than that seen in the more common solid tumors. Comprehensive genomic profiling of ACC can identify actionable GAs in a subset of patients that could influence therapy for these difficult-to-treat progressive neoplasms. PMID:24418857

Ross, Jeffrey S; Wang, Kai; Rand, Janna V; Sheehan, Christine E; Jennings, Timothy A; Al-Rohil, Rami N; Otto, Geoff A; Curran, John C; Palmer, Gary; Downing, Sean R; Yelensky, Roman; Lipson, Doron; Balasubramanian, Sohail; Garcia, Lazaro; Mahoney, Kristen; Ali, Siraj M; Miller, Vincent A; Stephens, Philip J

2014-02-01

166

Nimotuzumab suppresses epithelial-mesenchymal transition and enhances apoptosis in low-dose UV-C treated salivary adenoid cystic carcinoma cell lines in vitro.  

Science.gov (United States)

Salivary adenoid cystic carcinoma (SACC), which is one of the most common malignant tumors of the salivary glands, is associated with a poor long-term outcome. There are currently few therapeutic options for patients with SACC. Recent studies have shown the potential of the application of ultraviolet-C (UV-C) irradiation for the treatment of human cancer. In the present study, we investigated the effects of UV-C in the SACC cell lines SACC-83 and SACC-LM. High-dose UV-C (200?J/m) induced apoptosis and inhibited colony formation significantly. However, low-dose UV-C (10?J/m), which had little effect on apoptosis and colony formation, increased the ability of migration in SACC cells accompanied by a decrease in E-cadherin and an increase in vimentin, suggesting the occurrence of epithelial-mesenchymal transition (EMT). Low-dose UV-C (10?J/m) also resulted in upregulation of the phosphorylated forms of epidermal growth factor receptor (EGFR) and Akt (p-EGFR and p-Akt, respectively). Pretreatment with Nimotuzumab, an anti-EGFR monoclonal antibody, reversed the EMT as well as upregulation of p-EGFR/p-Akt induced by UV-C. Moreover, Nimotuzumab enhanced UV-C induced apoptosis and inhibition of colony formation. Our results indicate that EMT exerts a protective effect against apoptosis induced by low-dose UV-C. Thus, the combined application of Nimotuzumab and low-dose UV-C in vitro has an advantageous antitumor effect in SACC compared with the application of UV-C alone. PMID:25035960

Jiang, Yang; Ge, Xi-Yuan; Liu, Shu-Ming; Zheng, Lei; Huang, Ming-Wei; Shi, Yan; Fu, Jia; Zhang, Jian-Guo; Li, Sheng-Lin

2014-10-01

167

The T-box transcription factor Brachyury regulates epithelial–mesenchymal transition in association with cancer stem-like cells in adenoid cystic carcinoma cells  

Directory of Open Access Journals (Sweden)

Full Text Available Abstract Background The high frequencies of recurrence and distant metastasis of adenoid cystic carcinoma (AdCC emphasize the need to better understand the biological factors associated with these outcomes. To analyze the mechanisms of AdCC metastasis, we established the green fluorescence protein (GFP-transfected subline ACCS-GFP from the AdCC parental cell line and the metastatic ACCS-M GFP line from an in vivo metastasis model. Methods Using these cell lines, we investigated the involvement of the epithelial–mesenchymal transition (EMT and cancer stem cell (CSCs in AdCC metastasis by real-time RT-PCR for EMT related genes and stem cell markers. Characteristics of CSCs were also analyzed by sphere-forming ability and tumorigenicity. Short hairpin RNA (shRNA silencing of target gene was also performed. Results ACCS-M GFP demonstrated characteristics of EMT and additionally displayed sphere-forming ability and high expression of EMT-related genes (Snail, Twist1, Twist2, Slug, zinc finger E-box binding homeobox 1 and 2 [Zeb1 and Zeb2], glycogen synthase kinase 3 beta [Gsk3? and transforming growth factor beta 2 [Tgf-?2], stem cell markers (Nodal, Lefty, Oct-4, Pax6, Rex1, and Nanog, and differentiation markers (sex determining region Y [Sox2], Brachyury, and alpha fetoprotein [Afp]. These observations suggest that ACCS-M GFP shows the characteristics of CSCs and CSCs may be involved in the EMT of AdCC. Surprisingly, shRNA silencing of the T-box transcription factor Brachyury (also a differentiation marker resulted in downregulation of the EMT and stem cell markers. In addition, sphere-forming ability, EMT characteristics, and tumorigenicity were simultaneously lost. Brachyury expression in clinical samples of AdCC was extremely high and closely related to EMT. This finding suggests that regulation of EMT by Brachyury in clinical AdCC may parallel that observed in vitro in this study. Conclusions The use of a single cell line is a limitation of this study. However, parallel data from in vitro and clinical samples suggest the possibility that EMT is directly linked to CSCs and that Brachyury is a regulator of EMT and CSCs.

Shimoda Miyuki

2012-08-01

168

Infrequent alternations of RB pathway (Rb-p16INK4A-cyclinD1) in adenoid cystic carcinoma of salivary glands.  

Science.gov (United States)

Retinoblastoma (Rb) tumor suppressor genes' products and of the proteins regulating its phosphorylation and function in G1 arrest, p16INK4A and cyclin D1, play important roles in the regulation of the cell cycle. Rb gene inactivation, reflected by the absence of Rb protein expression, has been reported in oral squamous cell carcinomas. p16INK4A is frequently deleted, methylated, or mutated, and cyclin D1 gene amplification in many malignancies including oral squamous cell carcinomas (SCC). These findings suggested that Rb pathway of G1 arrest are the most commonly affected genes in Oral SCC. However, alternation of Rb pathway in salivary gland tumors was not clear. In this study, the expressions of Rb, p16INK4A, and cyclin D1 alternations were analyzed by immunohistochemical assay in 5 specimens of normal salivary glands and twenty-two cases of adenoid cystic carcinomas (ACC). Proliferating cell nuclear antigen (PCNA) labelling index (P.I.) was used for the evaluation of cell proliferation. Rb was consistently expressed in normal salivary glands and ACC. Loss of p16INK4A expression was observed in three cases (13.6%) of ACC. And overexpression of cyclin D1 was observed in four cases (18.2%). The three p16INK4A absent cases were the tumors with predominantly solid pattern and those cases were overexpressed cyclin D1. The cell proliferation activities of p16INK4A absent tumors (P.I. = 24.2 +/- 2.1%) were significantly higher than those of p16INK4A present tumors (P.I. = 10.4 +/- 3.5%) (P < 0.05). Cyclin D1 expression was also related to cell proliferation (P.I. of cyclin D1 negative cases vs. cyclin D1 positive: 10.1 +/- 3.0% vs. 22.6 +/- 3.4%) (P < 0.05). These findings suggested, however, alternations of Rb pathway were infrequent events in ACC of salivary glands and inactivation of p16INK4A, cyclin D1 overexpression may be related to the high cell proliferating activity of ACC. PMID:10928172

Shintani, S; Mihara, M; Nakahara, Y; Kiyota, A; Yoshihama, Y; Ueyama, Y; Matsumura, T

2000-01-01

169

Tratamiento quirúrgico del carcinoma adenoideo quístico de la tráquea: Presentación de un caso y revisión de la literatura / Surgical treatment of adenoid cystic carcinoma of the trachea: Report of a case and review of the literature  

Scientific Electronic Library Online (English)

Full Text Available SciELO Mexico | Language: Spanish Abstract in spanish Introducción: Los tumores malignos primarios de tráquea son raros, en el adulto representan el 90% de todos los tumores traqueales. El carcinoma adenoideo quístico es el segundo más frecuente con aproximadamente del 10-15% de los casos. Los síntomas son inespecíficos y los más frecuentes suelen ser: [...] tos, ronquera, disnea, sibilancias y estridor. La broncoscopia es el método para la obtención de tejido para el estudio histológico. La resección quirúrgica es el tratamiento de elección siempre que sea posible. Métodos: Se presenta el caso de una mujer de 59 años de edad con diagnóstico de carcinoma adenoideo quístico en tercio medio de la tráquea, a quien se le realizó resección traqueal con anastomosis terminoterminal, obteniendo resección completa, no recibió adyuvancia, con seguimiento de 15 meses sin recurrencia. Discusión y conclusiones: El manejo de pacientes con carcinoma adenoideo quístico debe ser multidisciplinario. A la paciente se le pronosticó una tasa de sobrevida a 5 años de 91% por tratarse de una enfermedad localizada. El diagnóstico de este tipo de tumores tiene un subregistro y el manejo quirúrgico está subutilizado en México. Los pacientes con este tipo de tumores, en particular, y todos los tumores traqueales, en general, deben ser referidos a centros con experiencia para el manejo de patología traqueal. Abstract in english Introduction: Primary malignant tumors of the trachea are rare, but they represent 90% of all tumors of the trachea. The adenoid cystic carcinoma is the second most frequent hystologic type of tumor growing in the trachea with aproximately 10 to 15% of all cases. Symptoms are unspecific and the most [...] frequent are cough, hoarseness, dyspnea, wheezzing and stridor. Bronchoscopy is the study of choice to obtain tissue for histopathologic study. Surgery is the treatment of choice when possible. Methods: We present the case of a 59 years old female with an adenoid cystic carcinoma of the middle third of the trachea, treated with surgical resection, obtaining a complete resection, with no adyuvant therapy, and with 14 months follow-up without recurrence. Discussion and conclusions: Treatment of adenoid cystic carcinoma should be multidisciplinary. In our patient had forecast a rate of 5-year survival of 91% because it was a localized disease. We consider that patients with any type of tracheal tumor should be referred to a specialized center with experience in the treatment of tracheal pathology.

Marco Antonio, Iñiguez-García; Enrique, Guzmán-de-Alba; César, Luna-Rivero; Gustavo Félix, Salazar-Otaola; Carlos Manuel, Núñez-Bustos; Juan Carlos, Vázquez-Minero.

170

Tratamiento quirúrgico del carcinoma adenoideo quístico de la tráquea: Presentación de un caso y revisión de la literatura / Surgical treatment of adenoid cystic carcinoma of the trachea: Report of a case and review of the literature  

Scientific Electronic Library Online (English)

Full Text Available SciELO Mexico | Language: Spanish Abstract in spanish Introducción: Los tumores malignos primarios de tráquea son raros, en el adulto representan el 90% de todos los tumores traqueales. El carcinoma adenoideo quístico es el segundo más frecuente con aproximadamente del 10-15% de los casos. Los síntomas son inespecíficos y los más frecuentes suelen ser: [...] tos, ronquera, disnea, sibilancias y estridor. La broncoscopia es el método para la obtención de tejido para el estudio histológico. La resección quirúrgica es el tratamiento de elección siempre que sea posible. Métodos: Se presenta el caso de una mujer de 59 años de edad con diagnóstico de carcinoma adenoideo quístico en tercio medio de la tráquea, a quien se le realizó resección traqueal con anastomosis terminoterminal, obteniendo resección completa, no recibió adyuvancia, con seguimiento de 15 meses sin recurrencia. Discusión y conclusiones: El manejo de pacientes con carcinoma adenoideo quístico debe ser multidisciplinario. A la paciente se le pronosticó una tasa de sobrevida a 5 años de 91% por tratarse de una enfermedad localizada. El diagnóstico de este tipo de tumores tiene un subregistro y el manejo quirúrgico está subutilizado en México. Los pacientes con este tipo de tumores, en particular, y todos los tumores traqueales, en general, deben ser referidos a centros con experiencia para el manejo de patología traqueal. Abstract in english Introduction: Primary malignant tumors of the trachea are rare, but they represent 90% of all tumors of the trachea. The adenoid cystic carcinoma is the second most frequent hystologic type of tumor growing in the trachea with aproximately 10 to 15% of all cases. Symptoms are unspecific and the most [...] frequent are cough, hoarseness, dyspnea, wheezzing and stridor. Bronchoscopy is the study of choice to obtain tissue for histopathologic study. Surgery is the treatment of choice when possible. Methods: We present the case of a 59 years old female with an adenoid cystic carcinoma of the middle third of the trachea, treated with surgical resection, obtaining a complete resection, with no adyuvant therapy, and with 14 months follow-up without recurrence. Discussion and conclusions: Treatment of adenoid cystic carcinoma should be multidisciplinary. In our patient had forecast a rate of 5-year survival of 91% because it was a localized disease. We consider that patients with any type of tracheal tumor should be referred to a specialized center with experience in the treatment of tracheal pathology.

Marco Antonio, Iñiguez-García; Enrique, Guzmán-de-Alba; César, Luna-Rivero; Gustavo Félix, Salazar-Otaola; Carlos Manuel, Núñez-Bustos; Juan Carlos, Vázquez-Minero.

2014-06-01

171

Carcinoma adenoescamoso do colo uterino mimetizando carcinoma adenóide basal: relato de um caso e revisão da literatura Adenosquamous carcinoma of the cervix mimicking adenoid basal carcinoma: case report and review of the literature  

Directory of Open Access Journals (Sweden)

Full Text Available O carcinoma adenoescamoso do colo uterino é definido como um tumor que contém uma mistura de células malignas com diferenciação escamosa e glandular. A literatura salienta a importância de se fazer esse diagnóstico, uma vez que, quando os componentes não são bem diferenciados ou não se encontram evidentes na amostra analisada, esse tumor pode ser erroneamente interpretado como carcinoma escamoso ou adenocarcinoma. O presente trabalho descreve a apresentação pouco comum de um carcinoma adenoescamoso. Após sucessivos diagnósticos citológicos não concordantes e complicados por uma história de sangramento uterino anormal ocasionado por endometriose cervical, a paciente de 47 anos foi submetida a histerectomia total, obtendo diagnóstico definitivo. Esse particular tumor aqui relatado foi diagnosticado como carcinoma adenoescamoso, mas em muitos aspectos apresentou-se semelhante ao carcinoma adenóide basal. Elementos característicos do carcinoma adenóide basal, como presença de lesão intra-epitelial escamosa na superfície, diferenciação escamosa e glandular no centro dos blocos neoplásicos e células basalóides na profundidade da lesão, foram observados em nosso caso. Em contrapartida, os seguintes elementos normalmente não observados no carcinoma adenóide basal estavam presentes: atipias e figuras de mitose nas células indiferenciadas da profundidade do tumor e lesão intra-epitelial escamomucinosa (SMILE na superfície. Fatores epidemiológicos e clínicos, como idade (47, raça (branca e forma de apresentação clínica (massa visível na inspeção cervical, também colaboraram para afastar esse diagnóstico diferencial. Outros diagnósticos diferenciais do carcinoma adenoescamoso do colo uterino incluem o carcinoma puramente escamoso ou glandular, o tumor de colisão e o adenocarcinoma de endométrio com diferenciação escamosa invadindo o colo uterino.Adenosquamous carcinoma of the uterine cervix is defined as a tumor that contains a mixture of malignant cells with squamous and glandular differentiation. The literature points to the importance of making this diagnosis when the cellular components are still well differentiated in the sample, otherwise the tumor may be erroneously interpreted as squamous carcinoma or adenocarcinoma. This study describes an unusual presentation of a adenosquamous carcinoma in a 47 year old patient. After conflicting cytological diagnoses and a history of abnormal uterine bleeding caused by cervical endometriosis, the patient was subjected to radical hysterectomy and a final diagnosis was obtained. The tumor was diagnosed as adenosquamous carcinoma. In many aspects, however, it was similar to the adenoid basal carcinoma. Characteristic features of the adenoid basal carcinoma such as the presence of high-grade squamous intraepithelial lesion in the surface epithelium, squamous and glandular differentiation in the center of the neoplastic mass, and basaloid cells in deep areas of the tumor were observed. Therefore, the following elements usually absent from adenoid basal carcinoma were present in this case: atypia and mitotic figures in undifferentiated cells, squamous-mucinous intraepithelial lesion (SMILE in the superficial areas. Epidemiological and clinical data, such as patient age (47, race (white and presentation (a cervical mass, concurred to exclude the diagnosis of adenoid basal carcinoma. Other differential diagnoses include pure squamous carcinoma or adenocarcinoma, collision tumor, and endometrial adenocarcinoma with squamous differentiation invading the uterine cervix.

Álvaro Piazzeta Pinto

2007-02-01

172

Carcinoma adenoescamoso do colo uterino mimetizando carcinoma adenóide basal: relato de um caso e revisão da literatura / Adenosquamous carcinoma of the cervix mimicking adenoid basal carcinoma: case report and review of the literature  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O carcinoma adenoescamoso do colo uterino é definido como um tumor que contém uma mistura de células malignas com diferenciação escamosa e glandular. A literatura salienta a importância de se fazer esse diagnóstico, uma vez que, quando os componentes não são bem diferenciados ou não se encontram evi [...] dentes na amostra analisada, esse tumor pode ser erroneamente interpretado como carcinoma escamoso ou adenocarcinoma. O presente trabalho descreve a apresentação pouco comum de um carcinoma adenoescamoso. Após sucessivos diagnósticos citológicos não concordantes e complicados por uma história de sangramento uterino anormal ocasionado por endometriose cervical, a paciente de 47 anos foi submetida a histerectomia total, obtendo diagnóstico definitivo. Esse particular tumor aqui relatado foi diagnosticado como carcinoma adenoescamoso, mas em muitos aspectos apresentou-se semelhante ao carcinoma adenóide basal. Elementos característicos do carcinoma adenóide basal, como presença de lesão intra-epitelial escamosa na superfície, diferenciação escamosa e glandular no centro dos blocos neoplásicos e células basalóides na profundidade da lesão, foram observados em nosso caso. Em contrapartida, os seguintes elementos normalmente não observados no carcinoma adenóide basal estavam presentes: atipias e figuras de mitose nas células indiferenciadas da profundidade do tumor e lesão intra-epitelial escamomucinosa (SMILE) na superfície. Fatores epidemiológicos e clínicos, como idade (47), raça (branca) e forma de apresentação clínica (massa visível na inspeção cervical), também colaboraram para afastar esse diagnóstico diferencial. Outros diagnósticos diferenciais do carcinoma adenoescamoso do colo uterino incluem o carcinoma puramente escamoso ou glandular, o tumor de colisão e o adenocarcinoma de endométrio com diferenciação escamosa invadindo o colo uterino. Abstract in english Adenosquamous carcinoma of the uterine cervix is defined as a tumor that contains a mixture of malignant cells with squamous and glandular differentiation. The literature points to the importance of making this diagnosis when the cellular components are still well differentiated in the sample, other [...] wise the tumor may be erroneously interpreted as squamous carcinoma or adenocarcinoma. This study describes an unusual presentation of a adenosquamous carcinoma in a 47 year old patient. After conflicting cytological diagnoses and a history of abnormal uterine bleeding caused by cervical endometriosis, the patient was subjected to radical hysterectomy and a final diagnosis was obtained. The tumor was diagnosed as adenosquamous carcinoma. In many aspects, however, it was similar to the adenoid basal carcinoma. Characteristic features of the adenoid basal carcinoma such as the presence of high-grade squamous intraepithelial lesion in the surface epithelium, squamous and glandular differentiation in the center of the neoplastic mass, and basaloid cells in deep areas of the tumor were observed. Therefore, the following elements usually absent from adenoid basal carcinoma were present in this case: atypia and mitotic figures in undifferentiated cells, squamous-mucinous intraepithelial lesion (SMILE) in the superficial areas. Epidemiological and clinical data, such as patient age (47), race (white) and presentation (a cervical mass), concurred to exclude the diagnosis of adenoid basal carcinoma. Other differential diagnoses include pure squamous carcinoma or adenocarcinoma, collision tumor, and endometrial adenocarcinoma with squamous differentiation invading the uterine cervix.

Álvaro Piazzeta, Pinto; Luiz Roberto, Maia.

2007-02-01

173

Thomsen-Friedenreich (T) antigen as marker of myoepithelial and basal cells in the parotid gland, pleomorphic adenomas and adenoid cystic carcinomas. An immunohistological comparison between T and sialosyl-T antigens, alpha-smooth muscle actin and cytokeratin 14  

DEFF Research Database (Denmark)

Controversy centres on the role and identification of myoepithelial (MEC) and basal cells in salivary gland tumours, and recent studies suggest that both basal cells and myoepithelial cells participate in the formation of salivary gland tumours. We have correlated the expression of different well-known markers of normal MEC/basal cells (i.e. alpha-smooth muscle actin and cytokeratin 14) with T (Thomsen-Friedenreich) antigen and its sialylated derivative: sialosyl-T antigen,) in 17 normal parotid glands and in two tumour types with MEC participation (i.e pleomorphic adenomas (PA) and adenoid cystic carcinomas (ACC)) using immunohistology with well-defined monoclonal antibodies (MAbs). Paraffin-embedded/fresh frozen tissue sections were studied from 33/17 patients with PA and 15/7 patients with ACC. In normal parotid tissue coexpression of alpha-smooth muscle actin, cytokeratin 14, T and sialosyl-T antigens was found in all MEC and in some of the basal cells lining striated ducts. The remaining basal cells exclusively expressed cytokeratin 14, T and sialosyl-T antigens. In the tumours, cells believed to be modified myoepithelial cells showed two different staining patterns: 1) Coexpression of alpha-smooth muscle actin, cytokeratin 14, T and sialosyl-T antigens, and 2) Coexpression of cytokeratin 14, T and sialosyl-T antigens, but no alpha-smooth muscle actin. The epithelial ductular structures in the tumours showed aberrant expression of cytokeratin 14, T and sialosyl-T antigens, and cytokeratin 14 was the only marker of cells in solid undifferentiated areas of adenoid cystic carcinomas. Our study supports the view, that modified "myoepithelial" cells in the tumours consist of a mixture of basal cells and myoepithelial cells. None of the investigated structures was in itself an ideal marker in the identification of MEC/basal cells. The cells can be identified by a combination of markers (i.e. cytokeratin 14, alpha-smooth-muscle actin, T and sialosyl-T antigens).

Therkildsen, M H; Mandel, U

1995-01-01

174

/ Un cas atypique d’angiomatose kystique / An atypical case of cystic angiomatosis  

Scientific Electronic Library Online (English)

Full Text Available SciELO Cuba | Language: Spanish Abstract in spanish [...] Abstract in english The paper presents a patient with bone cystic angiomatosis that is an infrequent benign tumor of vascular origin atypically located in the radius and the ulna. The clinical picture and the applied treatment are set forth. [...

175

MRI of cystic collection of the three joint; Les collections kystiques du genou en IRM  

Energy Technology Data Exchange (ETDEWEB)

We present the main MR features of cystic lesions around the knee joint. Popliteal cysts are the most frequently seen. The usually result from extrusion of joint fluid into the gastrocnemio-semimembranosus bursa but they can have an atypical location or extension. They are most often due to a meniscal, ligamentous, degenerative or inflammatory joint disease responsible for a chronic joint effusion. Meniscal cysts are always associated with a horizontal tear. Medial meniscal cysts are larger and can extend far from the joint. Bursitis occur as a result of inflammation or infection of a bursa. Their location is stereotyped and they do not communicate with the knee joint. Ganglion cysts or ganglia are benign cystic lesions which can affect peri-articular tissues as well as subchondral bone or cruciate ligaments. MRI is now a simple and noninvasive way of obtaining etiologic diagnosis and guiding therapy. (authors). 46 refs.

Boutry, N.; Cotten, A.; Dewatre, F.; Chastanet, P.; Gougeon, F. [Hopital R. Salengro, C.H.U., 59 - Lille (France)

1997-09-01

176

Modalidad quirúrgica como alternativa en la otitis media serosa por hipertrofia adenoidea: Pinar del Río, 2008 / An alternative surgical method in the serous otitis media due to adenoid hypertrophia: Pinar del Rio, 2008  

Scientific Electronic Library Online (English)

Full Text Available SciELO Cuba | Language: Spanish Abstract in spanish La hipoacusia tiene repercusión negativa en el aprendizaje y comportamiento social de los niños, por lo que se hace necesaria la aplicación de técnicas quirúrgicas cada día más eficientes que reduzcan esta problemática. Con el objetivo de demostrar la eficacia de una nueva modalidad quirúrgica consi [...] stente en realizar adenoidectomía y doble miringotomía con aspiración del contenido seromucoso y de proponer una estrategia para solución quirúrgica definitiva en el nivel secundario y preventiva en el nivel primario, se realizó una investigación de innovación _ tecnológica, descriptiva, longitudinal prospectiva en niños con hipoacusia conductiva por otitis media serosa secundaria a hipertrofia adenoidea, que asistieron a las consultas de audiología del Hospital Pediátrico Provincial Docente" Pepe Portilla" y del Policlínico Universitario Dr." Ernesto Guevara" de Sandino. El universo estuvo constituido por todos los niños con hipoacusia conductiva registrados en consulta de audiología. La muestra resultó de 109 pacientes con hipoacusia por Otitis Media Serosa secundaria a Hipertrofia Adenoidea, provenientes de 10 municipios de nuestra provincia, entre los 4 y 12 años de edad; mediante muestreo intencional. A todos los pacientes se les realizó examen otorrinolaringológico y audiometría tonal. Se utilizaron métodos de encuesta, análisis documental y de la Estadística Descriptiva utilizando medidas de frecuencias absolutas y relativas porcentuales. Se calcularon intervalos de confianza para algunas de las frecuencias relativas buscadas y previo consentimiento informado se trataron quirúrgicamente, reevaluados en consulta, donde se comprobó que 108 pacientes evolucionaron satisfactoriamente, concluyendo que es una técnica eficaz. Abstract in english Hypoakusia has a negative repercussion in learning and social behaviour in children so it is mandatory the implementation of surgical techniques in order to minimize this condition.. A new descriptive longitudinal and prospective technique was performed in children suffering from conductive hypoakus [...] ia due to serous otitis media secondary to adenoid hypertrophia attending to the hearing care office at "Pepe Portilla"Pediatric Hospital and "Dr.Ernesto Guevara "Policlinic in Sandino in order to show the efficacy of a new definitive surgical technique (adenotomy and double miringotomy with aspiration of the seromucus content ) and to propose an strategy for a definitive surgical solution in the secondary level being preventive at primary level. Universe was comprised of all the children suffering from conductive hypoakusia who were recorded in the auditory care office, the sample had 109 patients coming from 10 municipalities of our province and suffering from hipoakusia due to serous otitis media secondary to adenoid hypertrophia, they were 4 and 12 year old. All the patients were given otolaringologic examinations and tonal audiometry. Survey methods, documental analisis and descriptive statistic method were applied using relative and absolute percentage frequency measurements.Confidence intervals for some relative frequencies and previous informed consent were estimated; patients were surgically treated and reevaluated at the office showing that 108 patients had a satisfactory natural history and concluding that it is an efficient technique.

Fidel, Castro Pérez; Amaelis, Arada Rodríguez; José G, Sanabria Negrín; Antonio, Paz Cordobés.

2008-12-01

177

Modalidad quirúrgica como alternativa en la otitis media serosa por hipertrofia adenoidea: Pinar del Río, 2008 An alternative surgical method in the serous otitis media due to adenoid hypertrophia: Pinar del Rio, 2008  

Directory of Open Access Journals (Sweden)

Full Text Available La hipoacusia tiene repercusión negativa en el aprendizaje y comportamiento social de los niños, por lo que se hace necesaria la aplicación de técnicas quirúrgicas cada día más eficientes que reduzcan esta problemática. Con el objetivo de demostrar la eficacia de una nueva modalidad quirúrgica consistente en realizar adenoidectomía y doble miringotomía con aspiración del contenido seromucoso y de proponer una estrategia para solución quirúrgica definitiva en el nivel secundario y preventiva en el nivel primario, se realizó una investigación de innovación _ tecnológica, descriptiva, longitudinal prospectiva en niños con hipoacusia conductiva por otitis media serosa secundaria a hipertrofia adenoidea, que asistieron a las consultas de audiología del Hospital Pediátrico Provincial Docente" Pepe Portilla" y del Policlínico Universitario Dr." Ernesto Guevara" de Sandino. El universo estuvo constituido por todos los niños con hipoacusia conductiva registrados en consulta de audiología. La muestra resultó de 109 pacientes con hipoacusia por Otitis Media Serosa secundaria a Hipertrofia Adenoidea, provenientes de 10 municipios de nuestra provincia, entre los 4 y 12 años de edad; mediante muestreo intencional. A todos los pacientes se les realizó examen otorrinolaringológico y audiometría tonal. Se utilizaron métodos de encuesta, análisis documental y de la Estadística Descriptiva utilizando medidas de frecuencias absolutas y relativas porcentuales. Se calcularon intervalos de confianza para algunas de las frecuencias relativas buscadas y previo consentimiento informado se trataron quirúrgicamente, reevaluados en consulta, donde se comprobó que 108 pacientes evolucionaron satisfactoriamente, concluyendo que es una técnica eficaz.Hypoakusia has a negative repercussion in learning and social behaviour in children so it is mandatory the implementation of surgical techniques in order to minimize this condition.. A new descriptive longitudinal and prospective technique was performed in children suffering from conductive hypoakusia due to serous otitis media secondary to adenoid hypertrophia attending to the hearing care office at "Pepe Portilla"Pediatric Hospital and "Dr.Ernesto Guevara "Policlinic in Sandino in order to show the efficacy of a new definitive surgical technique (adenotomy and double miringotomy with aspiration of the seromucus content and to propose an strategy for a definitive surgical solution in the secondary level being preventive at primary level. Universe was comprised of all the children suffering from conductive hypoakusia who were recorded in the auditory care office, the sample had 109 patients coming from 10 municipalities of our province and suffering from hipoakusia due to serous otitis media secondary to adenoid hypertrophia, they were 4 and 12 year old. All the patients were given otolaringologic examinations and tonal audiometry. Survey methods, documental analisis and descriptive statistic method were applied using relative and absolute percentage frequency measurements.Confidence intervals for some relative frequencies and previous informed consent were estimated; patients were surgically treated and reevaluated at the office showing that 108 patients had a satisfactory natural history and concluding that it is an efficient technique.

Fidel Castro Pérez

2008-12-01

178

Optimization of radiation therapy for locally advanced adenoid cystic carcinomas with infiltration of the skull base using photon intensity-modulated radiation therapy (IMRT) and a carbon ion boost  

International Nuclear Information System (INIS)

Background: Tumor doses > 70 Gy are needed for local control in adenoid cystic carcinomas. These tumor doses cannot be delivered if the tolerance doses to neighboring organs at risk (OAR) are respected. This treatment planning study investigates the physical advantage of combined photon intensity-modulated radiation therapy (IMRT) plus carbon ion boost compared to photon IMRT alone. Patients and Methods: For nine patients, treatment plans were generated using a) photon IMRT alone (integrated boost concept), and b) sum plans consisting of a photon IMRT plan and a carbon ion boost plan. 54 Gy were prescribed to the planning target volume 1 (PTV1), the boost volume (PTV2) received 72 Gy. The tolerance doses of the delineated OAR were strictly adhered to. Plan quality of IMRT plans and sum plans was compared using adequate physical parameters. Results: Both therapy techniques lead to highly conformal dose distributions that allow the prescription of the desired target doses. Target conformality and heterogeneity as well as target coverage for PTV1 are comparable for both techniques. The target coverage for PTV2 can be significantly improved using carbon ion beams (median 95% coverage 93.7% vs 87%; p = 0.039). Furthermore, the mean doses to the OAR can be reduced by 8.3% (median % reduction of mean doses to OAR; p = 0.00001) using carbon ions. Conclusions: The combination of photon IMRT with carbon ions improves the target coverage for the boost volume and offers better sparing of OAR close to the PTV2 (gross tumor volume) in comparison with photon IMRT alone. A clinical study has been initiated to evaluate whether these potential advantages translate into clinical benefit. (orig.)

179

Análise quantitativa das AgNORs no carcinoma adenóide cístico intra-oral através da técnica de dupla marcação PCNA/AgNOR / PCNA/AgNOR double staining technique in adenoid cystic carcinoma  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese A análise quantitativa das AgNORs e a imunomarcação para o PCNA têm sido empregadas de forma independente na avaliação da proliferação celular de vários tumores, e, em muitos casos, têm mostrado correlação positiva. Entretanto poucos trabalhos têm avaliado, em um mesmo corte histológico, a relação e [...] ntre PCNA e AgNOR. O objetivo deste trabalho foi otimizar a técnica de dupla marcação com a finalidade de se estudar simultaneamente a correlação entre PCNA e AgNOR no carcinoma adenóide cístico (CAC) de glândulas salivares menores. Foram selecionados 16 casos de CAC classificados de acordo com o subtipo histológico. A análise quantitativa das AgNORs foi feita por meio de análise de imagens. As AgNORs foram contadas em cem núcleos PCNA positivos e em cem núcleos PCNA negativos. O número médio de AgNOR nos núcleos PCNA positivos foi 2,14 ± 0,77, e, nos núcleos PCNA negativos, 1,97 ± 0,79, entretanto esta diferença não se mostrou estatisticamente significante (p = 0,2537). Nosso trabalho não mostrou correlação entre o número de AgNOR e a imunomarcação para o PCNA em CAC quando estes marcadores foram demonstrados simultaneamente através da dupla marcação. Quanto à técnica, o uso do microondas melhorou a coloração da AgNOR, permitindo uma redução no tempo de incubação com a solução de prata e uma melhor individualização das AgNORs, o que facilitou os procedimentos de contagem. Abstract in english No previous studies have simultaneously assessed the relationship between AgNORs and PCNA expression in salivary gland tumors. We describe a method to demonstrate both PCNA and AgNORs in the same slice of routinely processed tissue. We also evaluated the effect of microwaving on the AgNORs reaction. [...] Sixteen cases of adenoid cystic carcinoma (ACC) were selected and the double staining technique was performed in order to quantify the number of AgNORs in PCNA-positive and negative cells. The best results were obtained when AgNOR was performed after the immunostaining. The microwave oven heating improved the AgNORs staining. Our results did not show a statistical difference between the mean number of AgNORs in PCNA-negative and positive cells. There is no association between PCNA and AGNOR in ACC when they are assessed by double-staining.

Elena Riet-Correa, Rivero; Maria Cássia Ferreira de, Aguiar.

180

Profil ?pid?miologique des tumeurs malignes primitives des glandes salivaires : ? propos de 154 cas  

Science.gov (United States)

Introduction Les tumeurs des glandes salivaires sont des tumeurs rares représentant 3à 5% des tumeurs de la tête et du cou. La classification de l'OMS 2005 distingue les tumeurs épithéliales, les tumeurs mésenchymateuses, les tumeurs hématologiques et les tumeurs secondaires. Méthodes Notre travail consiste en une étude rétrospective réalisée sur une période de 10 ans allant de janvier 2002 à janvier 2012. Les critères d'inclusion étaient: l'âge, le sexe, le siège de la tumeur et le type histologique. Résultats L'incidence annuelle des tumeurs malignes primitives des glandes salivaires dans notre série était de 15 cas par an. Cent cinquante quatre cas de tumeurs malignes primitives des glandes salivaires ont été colligés sans prédominance de sexe (78 femmes (50,6%) et 76 hommes (49,4%)). La moyenne d'âge était de 60 ans avec des extrêmes de 4 et 83 ans et un pic de fréquence entre 51et 70 ans. Deux tiers des cas (65%) avaient une localisation au niveau des glandes principales avec 66 cas au niveau de la parotide (43%) et 34 cas au niveau de la glande sous maxillaire (22%). Cinquante quatre patients avaient une tumeur maligne des glandes salivaires accessoires (35%) dont 61% au niveau du palais. Aucun cas de tumeur maligne de la glande sublinguale n'a été recensé dans notre étude. Le type histologique prédominant dans notre série était le carcinome adénoïde kystique et retrouvé chez 43 patients (27,9%), suivi de l'adénocarcinome sans autre indication chez 37 patients (24%) puis du carcinome mucoépidermoïde chez 16 patients (10,4%) et de l'adénocarcinome polymorphe de bas grade également chez 16 patients (10. 4%). Conclusion Les tumeurs malignes des glandes salivaires représentent un ensemble hétérogène de maladies de caractérisation complexe et de fréquence variable. PMID:25120861

Setti, Khadija; Mouanis, Mohamed; Moumni, Abdelmounim; Maher, Mostafa; Harmouch, Amal

2014-01-01

 
 
 
 
181

Adenoid cystic carcinoma in head and neck  

International Nuclear Information System (INIS)

Distant metastasis developed in 11.5%, whereas 69.2% patients were treated by surgery followed by postoperative radiotherapy, only 11.1% develop recurrence at the primary site. Radiotherapy was given to only one patient (3.8%), who was alive with disease at the time of last follow up. Conclusion: The peak age incidence of ACC in head and neck region was in 5th decade with slight male preponderance. Tumor was more common in minor salivary glands and palate was the commonest site of origin. FNAC was helpful in diagnosis of ACC in majority of cases. Cribriform subtype was the commonest histological pattern. ACC had very low regional lymph node metastasis. Lung was the commonest site of distant metastasis. surgical excision followed by radiotherapy was the best treatment modality for achieving local control on disease. (author)

182

External radiotherapy for hepatocellular carcinoma; Radiotherapie externe des carcinomes hepatocellulaires  

Energy Technology Data Exchange (ETDEWEB)

For a long time radiotherapy has been excluded from the therapeutic strategy for hepatocellular carcinoma, given its significant toxicity on the non-tumoral liver parenchyma. Conformal radiation is a recent advance in the field of radiotherapy, allowing dose escalation and combination with other therapeutic options for hepatocellular carcinoma, including trans-arterial chemo-embolization. Conformal radiotherapy is associated with interesting features, especially in cirrhotic patients: wide availability, non-invasiveness, possibility to target multiple localizations anywhere within the liver parenchyma, and favorable tolerance profile even in patients with cirrhosis and/or in a poor medical condition. Recently, radiation delivery has been optimized through several technical developments: respiratory gating and intensity-modulated radiotherapy, which allow a better focalization of the ballistics, stereotactic techniques and proton-beam radiotherapy, whose availability is currently limited in Europe. Given the high response rates of hepatocellular carcinoma to radiation, conformal radiotherapy may be regarded as a curative-intent treatment for hepatocellular carcinoma, similar to surgery and per-cutaneous techniques. Yet the impact of radiotherapy has to be evaluated in randomized trials to better integrate in the complex therapeutic algorithm of hepatocellular carcinoma. (authors)

Girard, N. [Service de pneumologie, hopital Louis-Pradel, hospices civils de Lyon, 28, avenue du Doyen-Jean-Lepine, 69500 Bron (France); UMR 754, universite Claude-Bernard Lyon-1, 43, boulevard du 11-Novembre-1918, 69622 Villeurbanne cedex (France); Mornex, F. [Departement de radiotherapie-oncologie, centre hospitalier Lyon-Sud, 165, chemin du Grand-Revoyet, 69495 Pierre-Benite cedex (France); EA 37-38, universite Claude-Bernard Lyon-1, 43, boulevard du 11-Novembre-1918, 69622 Villeurbanne cedex (France)

2011-02-15

183

Reirradiation of head and neck cancers; Reirradiation des carcinomes de la tete et du cou  

Energy Technology Data Exchange (ETDEWEB)

Locally advanced head and neck cancers are primarily treated by a multimodal approach, including a combination of surgery, radiotherapy and chemotherapy. However, local relapse rate in a previously irradiated area remains high. Reirradiation for a non-operable recurrence or a new primary tumour is now a therapeutic option thanks to technical progresses. This review presents results of published series in terms of toxicity and tumour response. All the publications are heterogeneous (population, dose, fractionation, concomitant chemotherapy or targeted therapy) and it is thus difficult to compare results. Reirradiation is feasible and appears less toxic with new techniques such as image guided radiotherapy (IMRT) or stereotactic radiotherapy, which could offer precise radiation delivery while sparing healthy tissues. Concomitant chemotherapy or targeted therapy may improve local control. Prospective evaluation of tumour response and complications is necessary. (authors)

Comet, B.; Lartigau, E. [Departement universitaire de radiotherapie, centre Oscar-Lambret, 59 - Lille (France); Universite Lille-2, 59 - Lille (France)

2010-10-15

184

Therapy of metastasized differentiated thyroid carcinoms; Therapie des metastasierten differenzierten Schilddruesenkarzinoms  

Energy Technology Data Exchange (ETDEWEB)

Therapy with radioiodine is the only curative option in differentiated metastasized thyroid carcinoma (subsequent to surgical intervention). Therapy in case of metatases is of particular relevance in patients with thyroid carcinoma of stage pT4, i.e. in case of expansive growth, as this stage is characterized by frequent hematogenous dissemination of tumor cells. As to histology there are prognostic differences: Follicular thyroid carcinomas are more frequently associated with osseous metastases than papillary carcinomas, and osseous metastases can only be successfully treated in a relatively small percentage. In cases of initial osseous metastases, however, the results of radioiodine therapy are more promising. Compared with delayed development of osseous metastases, initial metastases show significantly radioiodine uptake on average. To date, it has been clarified that there are good chances to cure patients with initial bone metastases by consequent high-dose radioiodine therapy, contrary to wide-spread opinion. Apart from radioiodine uptake, tumor stage, histology, and location of metastases, the patient's age at manifestation of disease is a further prognostic factor when treating metastases of the differentiated thyroid carcinoma. The potential of therapy is limited by hematoxicity when the dose administered exceeds 50-100 GBq. Alternative modalities of therapy like external radiation or chemotherapy by itself or combined with radiation are not sufficiently effective until now. Recently developed therapeutic concepts are still in an experimental stage. After a period of stagnation in methodological development of radioiodine therapy, modifications of treatment modalities (e.g., by combining external radiation with chemotherapy, by applying retinoids or rhTSH etc.) are being evaluated. (orig./MG) [German] Die Radiojodtherapie (RJT) ist derzeit die einzige Behandlungsform mit kurativem Ansatz beim differenzierten metastasierten SD-Karzinom (nach vorangegangener chirurgischer Intervention). Diese therapeutische Option kommt vor allem Patienten mit organueberschreitendem Wachstum des Primaertumors zugute, da im pT4-Stadium eine haematogene Metastasierung besonders haeufig ist. Hinsichtlich der Histologie bestehen prognostische Unterschiede insofern, als follikulaere SD-Karzinome haeufiger ossaer metastasieren als papillaere Karzinome, und ossaere Metastasen durch RJT seltener kurativ behandelt werden koennen. Guenstiger sind die Ergebnisse der RJT bei der Behandlung initialer ossaerer Metastasen, die im Vergleich zu spaeter auftretenden ossaeren Metastasen eine signifikant hoehere RJ-Aufnahme und -Speicherung aufweisen. Es ist inzwischen eindeutig belegt, dass durch eine konsequente hochdosierte RJT insbesondere bei Patienten mit initialen Knochenmetastasen (entgegen weitverbreiteter Meinung) gute Heilungschancen bestehen. Neben der RJ-Speicherung, dem Tumorstadium, der Histologie und der Lokalisation der Metastasen ist das Alter des Patienten bei Erstdiagnose ein weiterer prognostischer Faktor bei der Behandlung von Metastasen des differenzierten SD-Karzinoms. Limitiert wird die RJT durch die Haematotoxizitaet, die vor allem ab einer Aktivitaet von 50-100 GBq besonders zum Ausdruck kommt. Andere Therapieformen, wie z.B. Radiatio, Chemotherapie allein oder als Kombinationsbehandlung, sind bislang nicht zufriedenstellend wirksam. Neuere Behandlungskonzepte sind noch im experimentellen Stadium. Nach einer laengeren Phase des methodischen Entwicklungsstillstandes der RJT zeichnen sich nun Veraenderungen der Behandlungsmodalitaeten (z.B. durch Kombination mit externer Radiatio und Chemotherapie, durch Einsatz von Retinioden und rhTSH etc.) ab, die zu einer weiteren Verbesserung der Ergebnisse fuehren bzw. das Spektrum der behandelbaren Patienten erweitern koennten. (orig./MG)

Petrich, T.; Knapp, W.H. [Medizinische Hochschule Hannover (Germany). Klinik fuer Nuklearmedizin

2000-03-01

185

Skeleton scintigraphy and radiologic data at 403 patients with prostata carcinom  

International Nuclear Information System (INIS)

In a retrospective study 403 patients with prostatic carcinoma (PC) were examined to shed light on the relation between the rate of metastases and the stage of local tumor spread as well as the histomorphologic tumor type; to establish the rate of metastases detected by bone scanning versus radiology; and to compare the contributions of bone scanning versus radiology in monitoring the response of bone metastases to treatment. Results: (1) The rate of metastases was found to increase as a function of primary tumor size and increasing dedifferentiation; however, bone metastases were also seen in highly differentiated stage O and A PC. (2) Solitary metastases were confined to the pelvic bones and lumbar vertebrae. (3) About one third of all bone metastases were radiologically silent; in sporadic cases receiving contrasexual therapy they remained silent for more than 5 years. (4) Bone scnaning showed 73.3% of patients to respond to contrasexual therapy and 26.7% to be non- responders. (6) There were some differences or even discrepancies between bone scans and radiology in documenting the results of treatment. Conclusions: Repeated bone scans are required for monitoring the course of the disease even if the primary tumor is extremely small and histologically well differentiated. Bone scans are superior to radiology in detecting metastases. While repeat X-rays during the course of a disease furnish important information, they are unsuited for monitoring the response to trensuited for monitoring the response to treatment. (Author)

186

Sorafenib and radiotherapy association for hepatocellular carcinoma; Sorafenib et radiotherapie dans le carcinome hepatocellulaire  

Energy Technology Data Exchange (ETDEWEB)

Conformal radiotherapy is a promising therapeutic strategy for hepatocellular carcinoma (HCC), producing local control rates above 90% within the radiation beam. However, survival after radiotherapy remains limited by the high frequency of intra- and extra-hepatic recurrences, which occurs in 40-50 and 20-30% of cases, respectively. Sorafenib (BAY43-9006, Nexavar; Bayer, West Haven, CT) is a small molecule inhibitor that demonstrated potent activity to target v-raf murine sarcoma oncogene homologue B1 (BRAF) and VEGFR tyrosine kinases. Sorafenib is the only drug that demonstrated effectiveness to increase overall survival in advanced or metastatic hepatocellular carcinoma. The rationale to combine radiotherapy with sorafenib is the following: (1) targeting RAS-RAF-MAPK and VEGFR signaling pathways, which are specifically activated after exposure to radiation, and responsible for radio-resistance phenomenon; (2) enhancing the oxygen effect through normalization of the surviving tumor vasculature; and (3) synchronization of the cell cycle. Sorafenib and radiotherapy represent complementary strategies, as radiotherapy may be useful to prolong the effect of sorafenib through control of the macroscopic disease, when sorafenib may target latent microscopic disease. Sorafenib and radiotherapy associations are thus based on a relevant biological and clinical rationale and are being evaluated in ongoing phase I-II trials. (authors)

Girard, N. [Service de pneumologie, hopital Louis-Pradel, hospices Civils de Lyon, 28, avenue du Doyen-Jean-Lepine, 69500 Bron (France); UMR 754, universite Claude-Bernard Lyon 1, 43, boulevard du 11-novembre-1918, 69622 Villeurbanne cedex (France); Mornex, F. [UMR 754, universite Claude-Bernard Lyon 1, 43, boulevard du 11-novembre-1918, 69622 Villeurbanne cedex (France); Departement de radiotherapie-oncologie, centre hospitalier Lyon Sud, 165, chemin du Grand-Revoyet, 69495 Pierre-Benite cedex (France)

2011-02-15

187

Non-surgical management of hepatocellular carcinoma; Prise en charge non chirurgicale du carcinome hepatocellulaire  

Energy Technology Data Exchange (ETDEWEB)

Most of patients with hepatocellular carcinoma (HCC) cannot benefit from surgical therapies. Among non-surgical options, only radiofrequency can challenge surgery for small size tumours. Conformal radiotherapy is likely highly efficient on solitary tumours, but controlled studies are warranted to conclude. Other options are purely palliative. Trans-arterial hepatic chemo-embolization is the goal-standard for multifocal hepatocellular carcinoma and Sorafenib for hepatocellular carcinoma with portal vein invasion, leading to modest but significant benefit on survival rates. Yttrium-90 radio-embolization is under evaluation through controlled studies, and could be of major interest for multifocal hepatocellular carcinoma with or without portal venous invasion. (authors)

Merle, P. [Service d' hepato-gastroenterologie, hopital de l' Hotel-Dieu, 69 - Lyon (France); Inserm U871 -Oncogenese hepatique et hepatites virales-, 69 - Lyon (France); IFR62 Lyon-Est, universite Lyon 1, 69 - Lyon (France); Mornex, F. [Departement de radiotherapie-oncologie, centre hospitalier Lyon-Sud, 69 - Pierre-Benite (France)

2010-10-15

188

Late neurotoxicity after nasopharyngeal carcinoma treatment;Toxicite neurologique tardive apres traitement des carcinomes nasopharynges  

Energy Technology Data Exchange (ETDEWEB)

Purpose A retrospective analysis of risk factors for late neurological toxicity after nasopharyngeal carcinoma radiotherapy. Patients and methods Between 1993 and 2004, 239 patients with non metastatic nasopharyngeal carcinoma were treated by radiotherapy associated or not to chemotherapy. Radiotherapy was delivered with two modalities: hyperfractionated for 82 patients and conventional fractionation for 157 patients. We evaluated the impact of tumour stage, age, gender, radiotherapy schedule and chemotherapy on neurological toxicity. Results After a mean follow-up of 107 months (35-176 months), 21 patients (8.8%) developed neurological complications, such as temporal necrosis in nine cases, brain stem necrosis in five cases, optics nerve atrophy in two cases and myelitis in one case. Five- and ten-year free of toxicity survival was 95 and 84% respectively. Young patients had greater risk of temporal necrosis, and hyperfractionated radiotherapy was associated with a significantly higher risk of neurological complications (14.6% vs 5.7%, p = 0.02). On multivariate analysis, hyperfractionation and age were insignificant. Conclusion Late neurological toxicity after radiotherapy for nasopharyngeal carcinoma was rare. Younger age and hyperfractionation were considered as risk factors of neurological toxicity in our study

Siala, W.; Mnejja, W.; Daoud, J. [Hopital Habib-Bourguiba, Service de Radiotherapie Carcinologique, Sfax (Tunisia); Khabir, A.; Boudawara, T. [Hopital Habib-Bourguiba, Service d' Anatomopathologie, Sfax (Tunisia); Ben Mahfoudh, K. [Hopital Habib-Bourguiba, Service de Radiologie, Sfax (Tunisia); Ghorbel, A. [Hopital Habib-Bourguiba, Service d' ORL, Sfax (Tunisia); Frikha, M. [Hopital Habib-Bourguiba, Service de Carcinologie Medicale, Sfax (Tunisia)

2009-12-15

189

Nasopharyngeal carcinomas: from biology to clinic; Les carcinomes du nasopharynx: de la biologie a la clinique  

Energy Technology Data Exchange (ETDEWEB)

Nasopharyngeal carcinomas (NPC) are very different from other head and neck cancers because of their specific multi-factorial etiology and their geographic distribution. Epstein-Barr Virus (EBV) is implicated in onco-genesis of NPC in association with genetic alterations such as inactivation of the p16/Ink4, p19/ARF, RASSFI or Blu genes. Tumoral tissues include a very abundant characteristic lymphoid infiltrate. Inflammatory cytokines are produced by both malignant and infiltrating cells. There is no efficient immune response against the tumor. On the opposite, infiltrating lymphocytes might play a role in tumor development. Serological methods and detection of circulating viral DNA are expected to become useful for early detection of relapse and on a longer term for primary screening. NPC are often diagnosed at a late stage because patients may remain asymptomatic for a long time. Computed tomography (CT scan) and magnetic resonance imaging (MRI) are complementary for the initial evaluation. Positron emission tomography (PET) is efficient for the evaluation of treatment efficiency and detection of relapses. Treatment is based on radiotherapy and chemotherapy. Their optimal use needs to be evaluated by phase III trials but positive results have been obtained by concomitant association of radiotherapy and chemotherapy. Targeted therapies are being studied with strategies based on disruption of viral latency, use of replicative adeno-viruses or anti-tumor vaccination. (author)

Rivera, S.; Maingon, P. [Centre Georges-Francois-Leclerc, Dept. de Radiotherapie, 21 - Dijon (France); Keryer, C.; Busson, P. [Institut Gustave-Roussy, CNRS/UMR 8126, 94 - Villejuif (France)

2005-02-15

190

Studies on therapeutic method of liver cancer(hapatocellular carcinome)by Holmium-166 radionuclide  

Energy Technology Data Exchange (ETDEWEB)

As the study of radioactive nuclide, Holmium-166 in the treatment of liver cancer(hepatocellular carcinoma), this study was performed under the base of animal experimental. Using dog liver, percutaneous injection of Ho-166 MAA or chitosan with premade dose was done under the ultrasound guidance. Continuously the same procedure as previous one was performed in the skin hapatoma, which was developed by the injection of hepatocellular carcinoma cell in the nude mouse, In case of injected normal liver of dog, imaging study including ultrasound, CT and MRI was done in order to evaluate effect of Ho-166 and pathologic reaction. The result showed well defined nectosis of normal liver as well as skin hepatoma. The area of nectosis is dependent on the dose of injected Ho-166. Generally, pathologic reaction is tissue coagulation nectosis, Ho-166 particles, fibrosis and hemorrhage. In the clinical study, 50 patients with hapatoma was selected for this study under the agreement of patient. Under ultrasound guidance percutaneous injection of Ho-166 Maa or chitosan to tumor was performed and follow-up study was extended from 6 to 12 month. The result showed that 64% of patient were completely treated. Overall, the effect of treatment could be obtained in 41 patient (82%) among 50 hepatoma patient. Conclusively Ho-166 is thought to be a compromising agent in the treatment of hepatocellular carcinoma and one of therapeutic modality, if it is established internally and world-wide. In the future, the popular percutaneous ethanol injection method will be replaced to this method. 19 refs., 1 tabs., 14 figs. (author)

Lee, Jong Tae; Yoo, H. S.; Kim, M. J.; Han, K. H.; Park, C. I. [Yonsei University Medical College, Seoul (Korea, Republic of)

1997-07-01

191

Analysis of the economic impact of cystic echinococcosis in Spain / Analyse de l'impact économique de l'échinococcose kystique en Espagne / Análisis del impacto económico de la hidatidosis en España  

Scientific Electronic Library Online (English)

Full Text Available SciELO Public Health | Language: English Abstract in spanish OBJETIVO: Estimar las pérdidas económicas totales ocasionadas por la hidatidosis humana y animal en España en 2005. MÉTODOS: Los datos sobre la incidencia anual de la hidatidosis se obtuvieron a partir de los registros de vigilancia epidemiológica y de los mataderos. Los datos sobre el tratamiento y [...] la pérdida de productividad (humana y animal) relacionada con la enfermedad se obtuvieron a partir de la literatura científica. Los costes directos fueron los asociados al diagnóstico, el tratamiento quirúrgico o farmacológico, la atención médica y la hospitalización en humanos, y los decomisos de vísceras infectadas en animales de abasto (ganado ovino, caprino, bovino y porcino). Los costes indirectos comprendieron la pérdida de productividad en humanos y la reducción de las tasas de crecimiento, fecundidad y producción de leche en el ganado. Para representar la incertidumbre asociada a los parámetros analizados se utilizó el método del hipercubo latino. RESULTADOS: Las pérdidas económicas totales atribuibles a la hidatidosis humana y animal fueron estimadas en 148 964 534 euros (€) (intervalo de credibilidad del 95%, IC95%: 21 980 446-394 012 706). Las pérdidas estimadas de origen humano fueron de € 133 416 601 (IC95%: 6 658 738-379 273 434), y de € 15 532 242 (IC95%: 13 447 378-17 789 491) las de origen animal. CONCLUSIÓN: La hidatidosis es una zoonosis desatendida que en España sigue constituyendo un problema de salud humana y animal. Son necesarios datos más exactos sobre la prevalencia de la hidatidosis en humanos (sobre todo en los casos no diagnosticados o asintomáticos) y mejores métodos para calcular la pérdida de productividad en animales. La hidatidosis sigue afectando a ciertas zonas de España pese a las varias campañas de control emprendidas desde 1986. Dada la gran carga económica de la hidatidosis, es necesaria una mayor financiación para reducir las tasas de infección humana y animal mediante mejoras en la vigilancia de la enfermedad, el tratamiento periódico de los perros y la cooperación entre organismos oficiales. Abstract in english OBJECTIVE: To estimate the overall economic losses due to human and animal cystic echinococcosis (CE) in Spain in 2005. METHODS: We obtained data on annual CE incidence from surveillance and abattoir records, and on CE-related treatment and productivity losses (human and animal) from the scientific [...] literature. Direct costs were those associated with diagnosis, surgical or chemotherapeutic treatment, medical care and hospitalization in humans, and condemnation of offal in livestock (sheep, goats, cattle and pigs). Indirect costs comprised human productivity losses and the reduction in growth, fecundity and milk production in livestock. The Latin hypercube method was used to represent the uncertainty surrounding the input parameters. FINDINGS: The overall economic loss attributable to CE in humans and animals in 2005 was estimated at 148 964 534 euros (€) (95% credible interval, CI: 21 980 446-394 012 706). Human-associated losses were estimated at €133 416 601 (95% CI: 6 658 738-379 273 434) and animal-associated losses at €15 532 242 (95% CI: 13 447 378-17 789 491). CONCLUSION: CE is a neglected zoonosis that remains a human and animal health concern for Spain. More accurate data on CE prevalence in humans (particularly undiagnosed or asymptomatic cases) and better methods to estimate productivity losses in animals are needed. CE continues to affect certain areas of Spain, despite several control initiatives since 1986. Given the high economic burden of CE, additional funding is needed to reduce human and animal infection rates through improved disease surveillance, regular treatment of dogs and greater cooperation between agencies.

Christine, Benner; Hélène, Carabin; Luisa P, Sánchez-Serrano; Christine M, Budke; David, Carmena.

2010-01-01

192

Squamous cell carcinoma complicating an hereditary epidermo-lysis bullosa; Carcinome spinocellulaire compliquant une epidermolyse bulleuse hereditaire  

Energy Technology Data Exchange (ETDEWEB)

The dystrophic form of hereditary epidermo-lysis bullosa is associated with an increased frequency of squamous cell carcinoma. We report a new case. An 18-year-old patient, carrying a Hallopeau Siemens hereditary epidermo-lysis bullosa, presented a subcutaneous nodular lesion, for 1 year that ulcerated and budded with inguinal lymphadenopathy. The histological study ted to the conclusion of a well differentiated squamous cell carcinoma. The patient was treated surgically. Tumor and metastatic lymph nodes were excised. A radiotherapy was decided but the postoperative course was fatal due to an infection and to a deterioration of her general condition. Squamous cell carcinoma frequently occurs on the cicatricial lesion of hereditary epidermo-lysis bullosa and usually affects males with recessive hereditary epidermo-lysis bullosa. Metastases are frequent, precocious and multiple. The treatment may be surgical. The particularities of our observation are the young age of patient and the localization. (author)

Mseddi, M.; Turki, H.; Marrekchi, S.; Abdelmaksoud, W.; Masmoudi, A.; Bouassida, S.; Zahaf, A. [Centre Hospitalier Universitaire Hedi Chaker, Service de Dermatologie, Sfax (Tunisia)

2004-08-01

193

The evolving role of radiation therapy in hepatocellular carcinoma; Place de la radiotherapie dans le carcinome hepatocellulaire  

Energy Technology Data Exchange (ETDEWEB)

Technical advancements in imaging, in radiation therapy (R.T.) planning and R.T. delivery, have facilitated the safe delivery of conformal radiation therapy to patients with unresectable hepatocellular carcinoma (H.C.C.). Although experience in liver cancer R.T. is limited, the R.T. technologies and tools to deliver R.T. safely are being disseminated rapidly. A variety of doses and R.T. fractionations have been used to treat H.C.C., and R.T. has been used in combination with other therapies including trans arterial hepatic chemo embolization (T.A.C.E.). Outcomes following R.T. alone or R.T. and T.A.C.E. appear better than outcomes following similar historical controls of T.A.C.E. alone, however, randomized trials of R.T. are needed. The first site of recurrence following R.T. is most often within the liver, away from the high dose volume, providing rationale for combining R.T. with regional or systemic therapies. Given the vascular properties of H.C.C., the combination of R.T. with anti-V.E.G.F. targeted agents may improve outcomes further. (author)

Dawson, L.A. [Toronto Univ., Dept. of Radiation Oncology, Princess Margaret Hospital, Ontario (Canada)

2008-03-15

194

Stereotactic radiation therapy and selective internal radiation therapy for hepatocellular carcinoma; Radiotherapie stereotaxique et radiotherapie interne selective du carcinome hepatocellulaire  

Energy Technology Data Exchange (ETDEWEB)

Recent technological advances allow precise and safe radiation delivery in hepatocellular carcinoma. Stereotactic body radiotherapy is a conformal external beam radiation technique that uses a small number of relatively large fractions to deliver potent doses of radiation therapy to extracranial sites. It requires stringent breathing motion control and image guidance. Selective internal radiotherapy or radio-embolization refers to the injection of radioisotopes, usually delivered to liver tumors via the hepatic artery. Clinical results for both treatments show that excellent local control is possible with acceptable toxicity. Most appropriate patient populations and when which type of radiation therapy should be best employed in the vast therapeutic armamentarium of hepatocellular carcinoma are still to be clarified. (authors)

Bujold, A.; Dawson, L.A. [Radiation Medicine Program, Princess Margaret Hospital, 610, University Avenue, Toronto M5G 2C1 (Canada)

2011-02-15

195

Radio-embolization for hepatocellular carcinoma; Traitement des carcinomes hepatocellulaires par injection intra-arterielle de radio-isotopes  

Energy Technology Data Exchange (ETDEWEB)

Hepatocellular carcinoma is now a major public health concern. In intermediate stages (one third of hepatocellular carcinoma patients), chemo-embolization is the standard of care despite a poor tolerance and a moderate efficacy. Moreover, despite recent improvements, this technique seems in a dead end. Radio-embolization could be an excellent tool for such patients. Currently {sup 131}I-Lipiodol, {sup 188}Re-Lipiodol, {sup 90}Y-glass or resin microspheres are available. More recent and promising data come from microspheres, but phase II and III studies are needed before drawing any conclusion. In the future, the combination of radio-embolization with systemic chemotherapy or targeted agents (particularly anti-angiogenic drugs) seems very promising. (authors)

Raoul, J.L. [Departement d' oncologie medicale, centre Eugene-Marquis, rue de la bataille Flandres-Dunkerque, CS 44229, 35042 Rennes cedex (France); Inserm U911, centre Eugene-Marquis, CS 44229, 35042 Rennes cedex (France); Edeline, J.; Pracht, M.; Boucher, E. [Departement d' oncologie medicale, centre Eugene-Marquis, rue de la bataille Flandres-Dunkerque, CS 44229, 35042 Rennes cedex (France); Rolland, Y. [Departement d' imagerie medicale, centre Eugene-Marquis, CS 44229, 35042 Rennes cedex (France); Garin, E. [Inserm U911, centre Eugene-Marquis, CS 44229, 35042 Rennes cedex (France); Departement d' imagerie medicale, centre Eugene-Marquis, CS 44229, 35042 Rennes cedex (France)

2011-02-15

196

Prophylactic cranial irradiation in small-cell lung cancer; Irradiation prophylactique cerebrale dans les carcinomes bronchiques a petites cellules  

Energy Technology Data Exchange (ETDEWEB)

In small-cell lung cancer, there is a high risk of cranial relapse, which may reach nearly 50% at 2 years in patients in complete remission following appropriate induction treatment. Several randomized studies have shown that prophylactic cranial irradiation reduces the risk of tumour dissemination by 2- to 3-fold. However, prophylactic cranial irradiation remains a controversial issue due to its potential neurotoxicity, which has been reported in a number of small-scale retrospective studies, and also because of the absence of a significant effect on overall survival observed in the various randomized trials, which were not carried out on a sufficientlylarge scale. In contradiction with these findings, a recently published meta-analysis evaluating the role of prophylactic cranial irradiation in complete responders not only confirmed its positive effect on the incidence of brain metastases at 3 years, but also showed an absolute increase in overall survival of 5%. It is concluded that prophylactic cranial irradiation should therefore be considered as part of the standard treatment in small-cell lung cancer complete responders. However, several questions still remain unanswered, such as the optimal radiation dose to be prescribed, the optimal time interval between induction treatment and cranial irradiation, and the long-term evaluation of possible late sequelae. These issues should be examined in further prospective studies. (author)

Bardet, E. [Centre Regional de Lutte contre le cancer Nantes-Atlantique Rene-Gauducheau, 44 - Saint-Herblain (France); Le Pechoux, C. [Institut Gustave Roussy, 94 - Villejuif (France)

1999-11-01

197

Invasive cervical carcinoma: methods of investigation, diagnostic strategy; Carcinomes invasifs du col uterin: methodes d`exploration strategie diagnostique  

Energy Technology Data Exchange (ETDEWEB)

The authors review various techniques, including endo-sonography, computed tomography, magnetic resonance imaging and lymphography for the pre therapeutic evaluation of cancer of the uterine cervix, as well as for post therapeutic follow up. The pre-therapeutic examination should evaluate size of the primary tumor and tumor extension to vagina, parametria, bladder, rectum and pelvic sidewall. Pelvic lymph nodes evaluation is assessed by CT, MRI or lymphography. In stage IB, IIA and proximal IIB carcinoma, most patients will be operated and will have an intraoperative lymph node exploration and thus a surgical and clinico-pathological staging will be performed. In this case, clinical staging is often accurate. For larger tumors, radiological exploration will be more thorough for an optimal determination of the tumoral stage. (authors). 72 refs.

Ternier, F.; Rosello, R.; Stefano-Louineau, D. Di.; Le Brigand, B.; Mouillac, G.; Resbeut, M. [Institut Paoli-Calmettes, 13 - Marseille (France); Kind, M. [Fondation Bergonie, 33 - Bordeaux (France)

1997-09-01

198

Is the adaptive tomography of cervical carcinomas necessary?; La tomotherapie adaptative des carcinomes du col uterin est-elle necessaire?  

Energy Technology Data Exchange (ETDEWEB)

The authors report the study of the macroscopic tumour volume (GTV, gross tumour volume) and its possible repercussion on organs at risk during a tomo-therapy with an additional concomitant centro-pelvic irradiation. Ten women with non-operable cervical carcinomas have been treated by tomo-therapy and chemotherapy. A high-energy conical tomography has been performed before each session. Data obtained from these tomographies have been used in the adaptive therapy module of a tomo-therapy planimetry software. It appears that there is no evidence of significant variations of doses at the level of organs at risk with the use of such software. Short communication

Le Tinier, F.; Nickers, P.; Reynaert, N.; Castelain, B.; Lacornerie, T.; Attar, M.; Lartigau, E. [Centre Oscar-Lambret, 59 - Lille (France)

2010-10-15

199

Prevalence of Microorganisms and Immunoglobulins in Children with Tonsillar Hypertrophy and Adenoiditis  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in english Introduction: Benign idiopathic tonsillar hypertrophy (HBI) may affect a child's quality of life and sleep. Several studies have sought to relate the clinical features of HBI with the infectious and/or immunologic changes that occur. Objective: To increase the knowledge of the etiology of HBI. [...] Data Synthesis: From 2012 to 2013 we conducted a retrospective observational study of 101 children with HBI who underwent tonsillectomies at Ambulatory ENT General Hospital of the East Zone of São Paulo City, a region with a poor socioeconomic population. Preoperative serologic results were available to confirm mononucleosis, cytomegalovirus, anti-streptolysin O (ASLO) and immunoglobulins. The mean patient age was 5.8 years (55% male, 45% female). Using the Mann-Whitney U test, we identified significant gender differences in the parameters of immunoglobulins (Ig) M (IgM), IgA, and IgE. Forty-seven percent of the patients had increased ASLO levels, and 37% had increased IgE levels. Conclusion: An evaluation of a patient's serologic parameters and laboratory results may be relevant to the etiology and prevention of HBI. Based on the results obtained from the study sample, the identification of etiologic agents and causative factors remain a public health challenge that affects the quality of life of children.

Henrique Prestes, Miramontes; Djalma José, Fagundes; Julia Coelho Lima e, Jurgielewicz; Haroldo Prestes, Miramontes Neto; Renan Gianotto de, Oliveira; Gustavo Gianotto de, Oliveira; Maria Rosa Machado de, Souza.

2014-09-01

200

Prognostic factors affecting the clinical outcome of adenoid cystic carcinoma of the head and neck  

International Nuclear Information System (INIS)

evelopment of distant metastasis. Therefore, more research is needed to identify molecular biomarkers that predict the clinical outcome and to develop effective treatment for patients with ACC. (author)

 
 
 
 
201

Results of fast neutron therapy of adenoid cystic carcinoma of the salivary glands  

International Nuclear Information System (INIS)

72 consecutive patients with ACC were treated with fast neutrons, 66 after surgery, 6 for primarily unresectable disease, 43/66 for macroscopic residual disease, 23/66 for unresectable recurrent disease. 45/72 tumors were localized in the minor, 27 in the major salivary glands. T-stage was in 13 pts T2, in 33 T3, in 26 T4; positive nodes were in 10 pts. M+ in 15 pts. Mean tumor volume was 89 cm3. Neutron therapy was 15.03 Gy in 3 weeks with 1.67 Gy per fraction three times per week. Individual computer assisted treatment planning was performed based on CT and/or MRI, using bolus material if necessary. Target volume was the macroscopic tumor volume with a generous safety margin. Results: Complete response was achieved in 28 pts, partial response in 35 pts. Local control was observed in 73.4% after a mean observation period of 36 months. Overall and recurrence free survival was 85%/81% at two years, and 58%/53% at 5 years (Kaplan-Meier). In univariate analysis tumor volume (> 100 cm3), distant metastases, histologic subtype (solid) and neutron dose (<15 Gy) turned out to be significant parameters for predicting outcome, in multivariate analysis tumor volume and histologic subtype remained the only significant parameters. Acute morbidity was grade III/IV (EORTC/RTOG) in 6% for skin (desquamation), in 4% for mucosa (ulceration), late morbidity (grade III/IV) in one patient with local temporal brain necrosis. (orig.)(orig.)

202

Prevalence of Microorganisms and Immunoglobulins in Children with Tonsillar Hypertrophy and Adenoiditis  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in english Introduction: Benign idiopathic tonsillar hypertrophy (HBI) may affect a child's quality of life and sleep. Several studies have sought to relate the clinical features of HBI with the infectious and/or immunologic changes that occur. Objective: To increase the knowledge of the etiology of HBI. [...] Data Synthesis: From 2012 to 2013 we conducted a retrospective observational study of 101 children with HBI who underwent tonsillectomies at Ambulatory ENT General Hospital of the East Zone of São Paulo City, a region with a poor socioeconomic population. Preoperative serologic results were available to confirm mononucleosis, cytomegalovirus, anti-streptolysin O (ASLO) and immunoglobulins. The mean patient age was 5.8 years (55% male, 45% female). Using the Mann-Whitney U test, we identified significant gender differences in the parameters of immunoglobulins (Ig) M (IgM), IgA, and IgE. Forty-seven percent of the patients had increased ASLO levels, and 37% had increased IgE levels. Conclusion: An evaluation of a patient's serologic parameters and laboratory results may be relevant to the etiology and prevention of HBI. Based on the results obtained from the study sample, the identification of etiologic agents and causative factors remain a public health challenge that affects the quality of life of children.

Henrique Prestes, Miramontes; Djalma José, Fagundes; Julia Coelho Lima e, Jurgielewicz; Haroldo Prestes, Miramontes Neto; Renan Gianotto de, Oliveira; Gustavo Gianotto de, Oliveira; Maria Rosa Machado de, Souza.

203

Treatment of locally advanced adenoid cystic carcinoma of the head and neck with neutron radiotherapy  

International Nuclear Information System (INIS)

was 72%; and the 5-year actuarial cause-specific survival rate was 77%. Variables associated with decreased local-regional control in the patients with GRD as determined by multivariate analysis included base of skull involvement (p < 0.01) and biopsy only versus an attempted surgical resection prior to treatment (p = 0.03). Patients without these negative factors had an actuarial local-regional control rate of 80% at 5 years. Patients with microscopic residual disease (n = 8) had a 5-year actuarial local-regional control rate of 100%. Base of skull involvement (p < 0.001), lymph node metastases at the time of treatment (p < 0.01), biopsy only prior to neutron radiotherapy (p = 0.03), and recurrent tumors (p = 0.04) were found to be associated with a diminished cause-specific survival as ascertained by multivariate analysis. Patients with base of skull involvement and positive lymph nodes at presentation had an increased rate of the development of distant metastases at 5 years, (p < 0.01 and p <0.001, respectively). No statistical difference in outcome was observed between major and minor salivary gland sites. Conclusions: Fast neutron radiotherapy is an effective treatment for locally advanced ACC of the head and neck region with acceptable toxicity. Further improvements in local-regional control are not likely to impact survival until more effective systemic agents are developed to prevent and/or treat distant metastatic disease

204

Intra-arterial injection of 131-I-Lipiodol in the treatment of hepato-cellular carcinoma; Lipiocis et carcinome hepato-cellulaire  

Energy Technology Data Exchange (ETDEWEB)

The incidence of hepatocellular carcinoma (HCC) is increasing in developed countries and the general status of HCC patients is now by far better than a few years ago, allowing physicians to propose some different treatments of these patients. Among these treatments, intra-arterial injection of 131-iodine-labelled Lipiodol could be used in palliative, curative or adjuvant settings. After a brief summary of the modalities of this treatment, requiring the collaboration of Gastro-enterologists, Oncologists, Radiologists and Nuclear Medicine physicians, the different possibilities of therapeutic uses of this new approach are described and an outlook of these developments is proposed. (author)

Raoul, J.L. [Centre E. Marquis, 35 - Rennes (France)

2001-11-01

205

Trans-arterial chemo-embolization and conformal radiotherapy for hepatocellular carcinoma; Chimioembolisation et radiotherapie de conformation dans le traitement du carcinome hepatocellulaire  

Energy Technology Data Exchange (ETDEWEB)

Hepatocellular carcinoma is a poor prognosis tumour. The potential curative therapeutic options are ortho-topic liver transplantation, surgical resection and radiofrequency ablation. Unfortunately, only a minority of patients (around 20%) are eligible for these techniques. Thus, patients can benefit from palliative options, such as trans-arterial chemo-embolization (TACE) or sorafenib that bring only modest benefit on survival. Conformal radiotherapy allows delivering high dose radiation within a precise tumour volume while sparing the surrounding liver parenchyma. As employed in mono-therapy, conformal radiotherapy is highly efficient for small size hepatocellular carcinoma (< 5 cm). Above 5 cm, its efficacy is more limited but its association with TACE gives spectacular rates of complete responses. Controlled phase 2 or 3 trials are urgently warranted to define its indications in the therapeutic algorithm of hepatocellular carcinoma. (authors)

Merle, P. [Service d' hepatogastroenterologie, hopital de l' Hotel-dieu, 1, place de l' Hopital, 69002 Lyon (France); Inserm U871, equipe ' Oncogenese hepatique et hepatites virales' , 151, cours Albert-Thomas, 69003 Lyon (France); Universite Claude-Bernard Lyon 1, IFR62 Lyon-Est, 8, avenue Rockefeller, 69008 Lyon (France); Mornex, F. [Departement de radiotherapie-oncologie, centre hospitalier Lyon-Sud, chemin du Grand-Revoyet, 69310 Pierre-Benite (France); equipe ' Ciblage therapeutique par les agents physiques' , EA 37-38, universite Claude-Bernard Lyon 1, 43, boulevard du 11-Novembre-1918, 69622 Villeurbanne cedex (France)

2011-02-15

206

Inoperable metastatic giant basal cell trunk carcinoma: radiotherapy can be useful; Carcinome basocellulaire geant du tronc metastatique inoperable: la radiotherapie peut etre utile  

Energy Technology Data Exchange (ETDEWEB)

The authors evoke some characteristics of the basal cell carcinoma (slow evolution, local morbidity) and report and discuss the case of a giant basal cell trunk carcinoma, associated with several symptoms (pain, bleeding, anaemia), already metastatic at the moment of diagnosis, and locally treated by irradiation. Due to its size and expansion, this carcinoma was considered as inoperable. An external radiotherapy has been performed and resulted in a significant clinical tumour reduction. But the metastatic risk is high in such cases. Radiotherapy is then a therapeutic option for a local treatment with a durable efficiency. Short communication

Mania, A.; Durando, X.; Lapeyre, M. [Centre Jean-Perrin, Clermont-Ferrand (France); Barthelemy, I. [CHU Estaing, Clermont-Ferrand (France)

2011-10-15

207

COMPARISON AND EVALUATION OF VALUE OF THYROGLOBULIN LEVEL IN SERUM AND 1-131 WHOLE BODY SCAN (1-131 WBS IN PATIENTS WITH DIFFERENTIATED THYROID CARCINOM  

Directory of Open Access Journals (Sweden)

Full Text Available This study was done in research institute of nuclear medicine from 1988-1992 for evaluation of the value of serum thyroglobulin level in comparison with 1-131 whole body scan (1-131 WBS in patients with differentiated thyroid carcinoma. 204 patients who had total or near total thyroidectomy treated with 1-131 were evaluated in this study. Out of 204 patients 136 did not have regional or distant metastases. 68 patients had recurrence and metastases in which 42 cases showed good correlation between hTG and 1-131 WBS. In 14 cases with recurrence and metastases only 1-131 WBS was diagnostic and in 12 cases hTG was diagnostic while 1-131 WBS was negative. With the help of other diagnostic modolities such as Tl-201, chest X-ray biopsy and repeated 1-131 WBS during 5 years of follow-up regional recurrence and metastases were diagnosed. Serum hTG level for diagnosis of recurrence and metastases hud a sensitivity of 79.4%, specificity 90.4% and accuracy of 86.8% while 1-131 WBS had sensitivity of 82.3%, accuracy of 94.1% and specificity of 100%.  

A. Vakili

1998-06-01

208

Ductal in situ carcinoma: is it ethical to consider the breast conserving?; Carcinome canalaire in situ: est-il ethique de considerer le traitement conservateur comme un standard?  

Energy Technology Data Exchange (ETDEWEB)

The increasing incidence of DCIS during the past 20 years needs a continuous evaluation of the treatment strategies and a multidisciplinary decision process. The management of the DCIS remains a challenging issue in 2003. Mastectomy should still be considered as the reference treatment which is able to guarantee cure in almost all cases, whereas breast conserving surgery followed by radiation therapy is associated with 7-10% of local recurrence. However, the increasing knowledge of the predictive factors of the local recurrence allows to propose a conservative treatment strategy to a large amount of patients, without negative impact on their prognosis. This review presents the arguments that permit to justify, the reasoned choice of the different therapeutic options according to the clinico-pathological situations. (author)

Barillot, I. [Centre de Lutte Contre le Cancer Georges-Francois-Leclerc, Dept. de Radiotherapie, 21 - Dijon (France); Cutuli, B. [Polyclinique de Courlancy, Service de Radiotherapie-Cancerologie, 51 - Reims (France); Arnould, L. [Centre de Lutte Contre le Cancer Georges-Francois-Leclerc, Service d' Anatomie Pathologique, 21 - Dijon (France)

2004-02-01

209

Stereotactic radiotherapy of lung carcinomas with real time target tracking without fiducial; Radiotherapie stereotaxique de carcinomes pulmonaires avec suivi de la cible en temps reel sans fiduciel  

Energy Technology Data Exchange (ETDEWEB)

The authors discuss the results obtained on 51 patients treated with the Xsight Lung Tracking System (which do not need fiducial) for non-small-cell lung carcinomas. Results are analyzed and discussed in terms of gross tumour volume, session duration, survival rate by one year or two years, local control rate, later diagnosis (pneumopathy, lung fibrosis), and toxicity. These results suggest that this treatment mode could be an interesting option for non-operable patients. Short communication

Bibault, J.E.; Prevost, B.; Dansin, E.; Mirabel, X.; Lacornerie, T.; Lartigau, E. [Service universitaire de radiotherapie, centre Oscar-Lambret, Lille, (France)

2011-10-15

210

Chemoradiotherapy in head and neck squamous cell carcinoma: focus on targeted therapies; La chimioradiotherapie des carcinomes epidermoides des voies aerodigestives superieures: point sur les therapeutiques ciblees  

Energy Technology Data Exchange (ETDEWEB)

Radiotherapy is an essential treatment for many patients with head and neck squamous cell carcinoma. Its association with molecular targeted therapies represents a real progress. Among the recent advances in the molecular targeted therapy of cancer, the applications centred on E.G.F.R. are currently the most promising and the most advanced at clinical level. Considering the set of therapeutic tools targeting E.G.F.R., there are at present two well-identified emerging categories of drugs with monoclonal antibodies, on the one hand, and tyrosine kinase inhibitors, on the other. In many preclinical studies, the combination of anti-E.G.F.R. drugs with irradiation has led to additive or supra-additive cytotoxic effects. Furthermore, anti-angiogenic agents have shown promising results in association with anti-E.G.F.R. drugs and radiotherapy. This research effort has recently produced encouraging clinical results in advanced head and neck cancer with combination of cetuximab (an anti-E.G.F.R. monoclonal antibody) with irradiation with a significant impact on patient survival. Active and efficient clinical research is currently ongoing to determine the place of molecular targeted therapies in the treatment of head and neck cancer, particularly in association with radiotherapy. (authors)

Bozec, A. [Centre Antoine-Lacassagne, Dept. de Chirurgie, Institut Universitaire de la Face et du Cou, 06 - Nice (France); Thariat, J.; Bensadoun, R.J. [Centre Antoine-Lacassagne, Dept. de Radiotherapie, Institut Universitaire de la Face et du Cou, 06 - Nice (France); Milano, G. [Centre Antoine-Lacassagne, Unite d' Oncopharmacologie, Institut Universitaire de la Face et du Cou, 06 - Nice (France)

2008-01-15

211

Pseudo-angiomatous liver metastasis of thyroid medullary carcinoma: multimodality diagnostic approach; Metastase hepatique pseudoangiomateuse d'un carcinome medullaire de la thyroide: approche diagnostique multimodalite  

Energy Technology Data Exchange (ETDEWEB)

Purpose: Illustrate the result of the diagnosis by multimodality imaging (MRI, scintigraphy {sup 123}I-Mibg, PET/CT{sup 18}F-F.D.G. and {sup 18}F-F DOPA) with liver metastasis looking like a single angioma in a patient with atypical medullary thyroid carcinoma. Conclusions: Angiomas must be taken into account in the differential diagnosis of liver metastasis of endocrine tumors, particularly in the case of small injuries where it may be difficult to differentiate a peripheral nodular contrast enhancement of a globular enhancement characteristics of angiomas. (N.C.)

Imperiale, A.; Keomany, J.; Rust, E.; Constantinesco, A. [CHU de Strasbourg, Service de biophysique et medecine nucleaire, 67 (France); Greget, M. [CHU de Strasbourg, Service de radiologie 1, 67 (France); Chabrier, G.; Goichot, B. [CHU de Strasbourg, Service de medecine interne, endocrinologie et nutrition, 67 (France); Detour, J. [CHU de Strasbourg, Service de radiopharmacie, 67 (France); Pessaux, P. [CHU de Strasbourg, Service de chirurgie generale, hepatique et endocrinienne, 67 (France)

2010-07-01

212

Paclitaxel, carboplatin followed by a concomitant chemoradiotherapy in the undifferentiated cavum cancers; Paclitaxel, carboplatine suivi d'une chimioradiotherapie concomitante dans les carcinomes indifferencies du cavum  

Energy Technology Data Exchange (ETDEWEB)

Purpose: for more than two decades, the association of cisplatin and 5-fluoro-uracil stayed the standard treatment for epidermoid carcinomas of aero digestive system. Recently, the taxanes showed their efficiency in this pathology during studies of phase 2 and it is expected from the paclitaxel and carboplatin association followed by a concomitant radio chemotherapy a better rate of local control of the metastatic disease and complete remission for a long time. Conclusion: the use of the protocol of chemotherapy followed by a concomitant chemoradiotherapy can be a standard of therapy for the locally evolved injuries. It gives a high objective response rate and local control and a global survival rate at five years at 58%. (N.C.)

Djekkoun, R.; Ferdi, N.; Boudaoud, K. [CAC CHU, Constantine (Algeria); Bouzid, K. [CPMC, Alger (Algeria)

2009-10-15

213

Merkel cell carcinoma: Outcome and role of radiotherapy; Carcinome a cellules de Merkel: prise en charge et place de la radiotherapie  

Energy Technology Data Exchange (ETDEWEB)

Merkel cell carcinoma (M.C.C.) are rare neuroendocrine malignant tumor of the skin, occurring in elderly patients. It affects primarily the sun-exposed areas of the skin, with approximately 50% of all tumors occurring in the face and neck and 40% in the extremities. Immunohistochemical markers (C.K.20+, C.K.7- and T.T.F.1-) are used to distinguish between M.C.C. and other tumors. M.C.C. have a tendency to rapid local progression, frequent spread to regional lymph nodes and distant metastases. Due to the rarity of the disease, the optimal treatment has not been fully defined. Localized stages (stages I and II) are treated by surgical excision of the primary tumor (with 2 to 3 cm margin) and lymphadenectomy in case of node-positive disease, followed by external beam radiotherapy (E.B.R.T.) to a total dose of 50 to 60 Gy in the tumor bed. Adjuvant E.B.R.T. has been shown to decrease markedly locoregional recurrences and to increase survival in recent studies. Treatment of lymph nodes area is more controversial. Chemotherapy is recommended only for metastatic disease. (authors)

Salvador Alonso, R.; Lahbabi, I.; Ben Hassel, M.; Boisselier, P.; Crevoisier, R. de [Centre Eugene-Marquis, Dept. de Radiotherapie, 35 - Rennes (France); Chaari, N. [Institut Gustave-Roussy, Dept. de Radiotherapie, 94 - Villejuif (France); Lesimple, T. [Centre Eugene-Marquis, Dept. d' Oncologie Medicale, 35 - Rennes (France); Chevrier, S. [Centre Hospitalier Prive de Saint-Gregoire, Dept. de Chirurgie Plastique, 35 - Saint-Gregoire (France)

2008-09-15

214

Management of Merkel cell carcinoma: Role of radiotherapy in elderly patients; Prise en charge des carcinomes a cellules de Merkel: place de la radiotherapie chez les patients ages  

Energy Technology Data Exchange (ETDEWEB)

Purpose Merkel cell carcinoma carcinoma (M.C.C.) or primary cutaneous neuroendocrine carcinoma is a rare and aggressive malignancy affecting elderly. Optimal therapeutic strategy has not yet been established in elderly patients. Patients and methods From March 1996 to March 2007, 29 patients with Merkel cell carcinoma of were treated at the University Hospital of Amiens, France. Adjuvant radiotherapy (R.T.) was performed for 14 patients (50%) on the tumor bed with margins of 3 to 5 cm, an average dose of 46 Gy (30-60 Gy), by 2 Gy per fraction. Ten of them also received R.T. to the lymph node area at mean dose of 44.3 Gy (26-50 Gy). Duration of R.T. was 35 days. A retrospective analysis was conducted to better evaluate survival and prognostic factors. Results Median overall survival (O.S.) was 18.9 months (3-122) and the median time to progression (M.T.P.) 5.5 months (1-26). At 5 years, O.S. for irradiated patients was 47% (IC95: 12-82%) versus 27% (IC95: 5-49%) in cases of surgery alone (p = 0.032). The most frequent sites of recurrence were nodal (34.5%), local (24.1%) and metastatic (17.2%). For patients over 70 years, eight (36.5%) were free of disease at last news, 8 (36.5%) had died from cancer and six from other causes (27%). In this subgroup, M.T.P. was 6 months (2-19) and median O.S. of 19 months (4-87). There was no acute toxicity greater than grade 2. Conclusion Although limited by a retrospective analysis, this report suggests an advantage of postoperative R.T. for patients with M.C.C.. It combined low toxicity and improvement of survival. Prospective multicenter trials are needed to clarify and validate the optimal strategy. (authors)

Assouline, A.; Krzisch, C. [CHU d' Amiens, Service de radiotherapie, hopital Sud, 80 - Amiens (France); Assouline, A.; Levy, A.; Mazeron, J.J. [Groupe hospitalier Pitie-Salpetriere, universite Paris-6, Service de radiotherapie, 75 - Paris (France); Mazeron, J.J. [Paris-6 Univ., 75 (France); Chargari, C. [Hopital d' instruction des armees du Val-de-Grace, Service de radiotherapie, 75 - Paris (France)

2010-01-15

215

Interest of the low energy hypo fractionated radiotherapy in the cutaneous carcinomas; Interet de la radiotherapie hypofractionnee de basse energie dans les carcinomes cutanes  

Energy Technology Data Exchange (ETDEWEB)

The low energy radiotherapy must keep its dominating place in the treatment of skin carcinomas. It is more important when the patients are old and suffer from others diseases. The therapy (three irradiations delivered at one week interval) is particularly well adapted to this population whom number is increasing. It is a low cost treatment and easy to realize. (N.C.)

Belembaogo, E.; Calitchi, E.; Le Bourgeois, J.P. [Hopital Henri-Mondor, 94 - Creteil (France)

1997-09-01

216

Stereotactic radiotherapy for lung cancer: Non-invasive real-time tumor tracking; Radiotherapie stereotaxique de carcinomes bronchiques primitifs: suivi non invasif de la cible en temps reel  

Energy Technology Data Exchange (ETDEWEB)

Purpose: Stereotactic radiation therapy using the CyberKnife{sup R} has been introduced in France in 2006. Two treatment modalities are currently available: the first one (Synchrony{sup R}) is a real-time fiducial-based target tracking system, while the other (Xsight Lung Tracking [XLT] System{sup R}) is completely fiducial-free. Patients and methods: Sixty-eight patients were treated for a pulmonary tumor between June 2007 and November 2009. Since august 2008, the XLT System{sup R} was used for 26 patients. We report the necessary conditions for the XLT System (position, laterality and size of the tumor), the toxicity and outcome of this treatment. Results: Twenty-two patients were analyzed. Median follow-up was 6 months (min = 3; max = 16). Local control rate was 100%. The main toxicity was grade grade 1 pulmonary alveolitis (27%). No grade 3 or 4 toxicities were reported. Conclusion: The high local control rate and low toxicity obtained with the CyberKnife{sup R} XLT System{sup R} suggest that such treatment is an alternative for inoperable patients. (authors)

Bibault, J.E.; Prevost, B.; Mirabel, X.; Lacornerie, T.; Dubus, F.; Lartigau, E. [Departement universitaire de radiotherapie, universite Lille 2, CyberKnife Nord-Ouest, centre Oscar-Lambret, 59 - Lille (France); Dansin, E. [Departement d' oncologie generale, centre Oscar-Lambret, 59 - Lille (France)

2010-12-15

217

Epidermoid carcinomas of the anal margin treated by curative goal irradiation; Carcinomes epidermoides de la marge anale traites par irradiation a visee curative  

Energy Technology Data Exchange (ETDEWEB)

Purpose: to evaluate the toxicity, the local control rate and the survival of patients suffering of an epidermoid carcinoma of the anal margin treated by curative and conservative irradiation. Conclusion: the excision should be reserved for small tumors away from the anal canal. The curative radiotherapy is recommended for the tumors with incomplete resection and for that ones of big volume or localised near the anal canal. (N.C.00.

Huguet, F.; Touboul, E.; Schlienger, M. [Hopital Tenon, 75 - Paris (France); Tiret, E.; Godeberge, P.; Contou, J.F. [Hopital Saint-Antoine, 75 - Paris (France); Soudan, D. [Institut Mutualiste Montsouris, 75 - Paris (France); Roseau, G. [Hopital Leopold-Bellan, 75 - Paris (France)

2009-10-15

218

Nasopharynx carcinomas. about 1342 cases treated at Oran, Algeria; Carcinomes du nasopharynx. A propos de 1342 cas traites a Oran, Algerie  

Energy Technology Data Exchange (ETDEWEB)

The purpose was to describe the epidemiology, clinical and therapy characteristics of the cavum cancer and the different post therapy results. The cavum cancer is frequent in west Algeria. It is the first cancer of superior aero digestive tracts, the fifth one fro man and the seventh for woman. It represents 8% of the whole of cancers treated at the radiotherapy service in Oran. It is chemosensitive and can be cured by radiotherapy but the frequency of locoregional recurrences and metastases remains high, despite all therapeutic methods used. (N.C.)

Khaldi, H.; Aid, M.; Lahmer, K.; Dali-Youcef, A.F. [Radiotherapie, Oran (Algeria)

2009-10-15

219

Post irradiation eardrum: a rare complication of the radiotherapy of naso-pharynx carcinomas; Necrose tympanique postradique: une complication rare de la radiotherapie des carcinomes nasopharynges  

Energy Technology Data Exchange (ETDEWEB)

The eardrum necrosis is a serious and dreadful complication but rarely described after irradiation of cavum cancers. We report in this work five cases of eardrum necrosis after radiotherapy of nasopharynx carcinomas. Patients and methods: between february 1993 and december 2004 239 patients suffering of anon metastatic nasopharynx cancer have been treated by classical irradiation associated or not to a chemotherapy. The radiotherapy was delivered at the dose of 70 to 75 Gy in the cavum and the ganglions initially reached according a classical modality of hyperfractionated one. We analysed retrospectively the delayed complications occurred six months or more after the radiotherapy beginning. Results: Five cases of eardrum necrosis were reported sixty five months after the end of radiotherapy. these patients suffered of hypoacusia and buzzing. The clinical examination allowed to bring out the eardrum perforation that did not exist before radiotherapy. The total dose of irradiation was 75 Gy for a patient and 71.5 Gy according a hyperfractionated modality for four patients. Three patients had an hearing prosthesis in order to improve their quality of life. Conclusion: the eardrum necrosis after radiotherapy for nasopharynx cancer is a rare and unusual complication, very few reported in the literature. The total dose of irradiation is considered as the principal factor of occurrence risk in such complication. (N.C.)

Siala, W.; Mnejja, W.; Daoud, J. [CHU Habib-Bourguiba, Service de Radiotherapie Oncologique, Sfax (Tunisia); Khabir, A. [CHU Habib-Bourguiba, Service d' Anatomopathologie, Sfax (Tunisia); Ghorbel, A. [CHU Habib-Bourguiba, Service d' ORL, Sfax (Tunisia); Frikha, M. [CHU Habib-Bourguiba, Service d' Oncologie Medicale, Sfax (Tunisia)

2009-10-15

220

Re-irradiation of local relapses of patients treated for a nasopharyngeal undifferentiated carcinoma; Reirradiation des recidives locales des patients traites pour carcinome indifferencie du nasopharynx  

Energy Technology Data Exchange (ETDEWEB)

The authors report a retrospective a study based on eight men and five women who have been treated for a local relapse of a nasopharyngeal carcinoma, and who have been re-irradiated between 2003 and 2008. The relapse was either local or local and ganglionary. The relapse stage was either I, II or III. The authors aimed at assessing the re-irradiation toxicity. Results are encouraging, but a combination of external radiotherapy and curie-therapy could improve the local control rate. Short communication

Zenati, S.; Hamzi, L.; Afiane, M. [Centre Pierre-et-Marie-Curie, Alger (Algeria); Zenati, S.; Afiane, M. [Faculte de medecine, Alger (Algeria)

2010-10-15

 
 
 
 
221

Choanal stenosis: a rare complication of radiotherapy for nasopharyngeal carcinoma; Stenose choanale post-radique: une complication rare de la radiotherapie des carcinomes nasopharynges  

Energy Technology Data Exchange (ETDEWEB)

Choanal stenosis is usually a congenital anomaly in children. Acquired choanal stenosis after radiotherapy for nasopharyngeal carcinoma is a very rare pathology; only two publications report seven cases in the literature. We describe the clinical history, preoperative evaluation, surgical treatment and outcome of a case of acquired choanal stenosis after radiotherapy. The patient, a 56-year-old woman, presented with a history of nasopharyngeal carcinoma (T2- NO-MO) one year before that had been successful treated with radiotherapy (68 Gy). At the end of radiotherapy, she complained of complete nasal obstruction, anosmia and hearing loss due to a bilateral serous otitis media. Bilateral complete choanal stenosis was confirmed by endoscopy and CT scan. Functional endoscopic surgery was performed, and nasal stents were left in place for 3 weeks. One year after, the patient have good airflow, and a patent nasopharynx without choanal stenosis. In conclusion, choanal stenosis is an unusual complication of radiotherapy that can be successfully treated with trans-nasal endoscopic resection. (authors)

Bonfils, P.; Preobrajenski, N. de [Universite Rene-Descartes, Hopital Europeen Georges-Pompidou, Service d' ORL et de Chirurgie Cervicofaciale, Faculte de Medecine Paris-Descartes, 75 - Paris (France); Florent, A. [Cabinet d' ORL, 75 - Paris (France); Bensimon, J.L. [Cabinet de radiologie, 75 - Paris (France)

2007-05-15

222

Amputación interescapulotorácica por cromomicosis y carcinoma epidermoide / Amputation interscapulothracique pourchr4omomycose et6 carcinome épidermoide / Interscapulothoracic amputation by chromomycosis and epidermoid carcinoma  

Scientific Electronic Library Online (English)

Full Text Available SciELO Cuba | Language: Spanish Abstract in spanish Paciente del sexo masculino y blanco de 74 años de edad, con lesión dermatológica hiperpigmentada y verrucosa de más de 25 años de evolución en codo y antebrazo izquierdo; asimismo posee otra de piel en forma de coliflor y cuya evolución es reciente. Ambas presentaron diagnóstico histopatológico de [...] cromomicosis. El tratamiento inicial fue la exéresis con margen oncológico de la lesión en forma de coliflor y la electrofulguración, curetaje del resto de la lesión y tratamiento antimicótico. En un período de 5 meses el enfermo presenta evolución tórpida con toma del estado general y elefantiasis del miembro superior izquierdo hasta región supraclavicular que obliga a realizarle amputación interescapulotorácica por la técnica de Berger para mejorar la calidad de vida. El diagnóstico histopatológico de los paquetes ganglionares resecados mostró metástasis de un carcinoma epidermoide. Abstract in english The case of a 74-year-old white male patient with a hyperpigmented and verrucose dermatological injury of more than 25 years of evolution in his left elbow and forearm is reported. He also has another cauliflower-like skin injury of recent evolution. Both presented histopathological diagnosis of chr [...] omomycosis. The initial treatment was exeresis with oncological margin of the cauliflower-like injury and electrofulguration, curettage of the rest of the injury and antimycotic treatment. In 5 months, the patient had a torpid evolution with taking of the general state and elephantiasis of the upper left extremity to the supraclavicular region that led to the interscapulothoracic amputation by Berger’s technique to improve his quality of life. The histopathological diagnosis of the resected ganglionar packages showed metastasis of an epidermoid carcinoma.

Hiralio, Collazo Álvarez; Eridán, González Velázquez; Andrés G, Pardillo Morales; Stephen Yecc, Collazo Marín.

223

Genetic Relatedness between Pneumococcal Populations Originating from the Nasopharynx, Adenoid, and Tympanic Cavity of Children with Otitis Media  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Previous studies have shown that Streptococcus pneumoniae exists in both middle ear effusions and the upper respiratory region from children with otitis media with effusion (OME), but it remains unclear whether these strains represent genetically identical clones. Therefore, it cannot be determined whether these bacteria originate from a common source. To determine the presence of pneumococci at different anatomical locations of OME patients, conventional culture and PCR techniques were used....

Tonnaer, Edith L.; Rijkers, Ger T.; Meis, Jacques F.; Klaassen, Corne? H.; Bogaert, Debby; Hermans, Peter W.; Curfs, Jo H.

2005-01-01

224

The influence of H1-, H2- and H3-receptors on the spontaneous and ConA induced histamine release from human adenoidal mast cells.  

Science.gov (United States)

The effects of the H3-agonist R-alpha-methylhistamine (R-alpha-MeHA) and the H3-antagonist thioperamide on the spontaneous and concanavalin A (ConA) induced histamine release from human mast cells were tested and compared with the effect of some H1- and H2-receptor active substances. R-alpha-MeHA (10(-9)-10(-7) M) exerted no effect on histamine release whereas thioperamide increased the spontaneous release at 10(-6)-10(-4) M but inhibited the ConA induced release in a narrow concentration range (10(-6)-10(-5) M). This enhancement might be taken as an indication of the existence of H3-receptor dependent autoregulation although presently other mechanism cannot be excluded. PMID:1654736

Bent, S; Fehling, U; Braam, U; Schunack, W; Schmutzler, W

1991-05-01

225

Resection and Reconstruction of Maxillary Class IIIc Defect in a Case of Adenoid Cystic Carcinoma: Cost-Sensitive Technique without Microvascular Grafts.  

Science.gov (United States)

ACC is a rare malignant tumor that affects most commonly the major and minor salivary glands and rarely the paranasal sinuses, lacrimal gland, larynx, ear, vulva, and so forth. The maxillary sinus when affected is considered having a poor prognosis due to delayed diagnosis and delayed treatment credited to its slow spread, late symptoms, and complex anatomy which hampers surgical resection. The expressions of tumor markers too have a significant role in determining the prognosis. The treatment of choice consists of wide radical resection of the tumor followed by radiotherapy. Rehabilitation options in cases with huge maxillary defects still need further exploration. PMID:24069539

Adwani, Dwarkadas; Bhattacharya, Anirudh; Arora, Rajender Singh; Soni, Ramawatar; Adwani, Nitin

2013-01-01

226

Oesophageal squamous cell carcinoma Stade 3. State of surgery after radio chemotherapy (R.C.T.); Carcinomes malpighiens de l'oesophage de stade 3, place de la chirurgie apres chimioradiotherapie  

Energy Technology Data Exchange (ETDEWEB)

Neo-adjuvant chemoradiotherapy is the gold standard of the treatment of advanced oesophageal squamous cell carcinoma. The role of surgery L. chemoradiotherapy is still debated. Feasibility of curative resection depends on dose of radiotherapy, morbi-mortality rates, and nutrition status at the end of the protocol especially for non-responders patients. Adding surgery to radio-chemotherapy improves local tumour control but does not increase overall survival of patients with advanced oesophageal squamous cell carcinoma. According to the two randomized trials published on the subject, surgery is not recommended after chemoradiotherapy for responders. Recommendations of French National Thesaurus are: exclusive chemoradiotherapy as reference, oesophagectomy for residual tumour as alternative for operable patients. Surgery may be proposed for selected non-responders patients and some complete pathology response in expert center. (author)

Triboulet, J.P.; Mariette, C. [Hopital Claude-Huriez, Service de Chirurgie Digestive et Generale, 59 - Lille (France)

2006-11-15

227

Treatment of hepatocellular carcinoma by intra-arterial injection of {sup 131}I labeled iodized oil (Lipiocis); Traitement des carcinomes hepatocellulaires par injection intraarterielle hepatique d`huiles iodees radiomarquees (Lipiocis)  

Energy Technology Data Exchange (ETDEWEB)

When injected into the hepatic artery of patients with hepatocellular carcinoma (HCC), Lipiodol was demonstrated to remain selectively for a long time within the tumors. Biodistribution studies have shown that 80% of Lipiodol was retained by the liver, with a tumor/liver ratio of 4,5 and an effective half life of 5,5 d. The injection of a therapeutic activity (2,2 GBq) was well tolerated and associated with a response rate of 40%. Thereafter two phase II trials were initiated. In the first one the survival rate of HCC patients with portal vein thrombosis treated with Lipiocis was demonstrated to be significantly longer than that of a control group. In the second study, comparing Lipiocis to chemoembolization, preliminary results have shown that both treatments were as effective but that Lipiocis was significantly better tolerated than chemoembolization. (author). 7 refs., 2 figs.

Raoul, J.L. [Centre Eugene-Marquis, 35 - Rennes (France)

1995-12-31

228

Significado clínico-patológico das expressões citofotométricas do Ki-67 e Caspase-3 no carcinoma de células escamosas do esôfago Clinicopathologic significance of the Ki-67 and Caspase-3 cytophotometric expressions in the esophageal squamous cell carcinomal  

Directory of Open Access Journals (Sweden)

Full Text Available RACIONAL: A escolha da forma de tratamento do carcinoma de células escamosa de esôfago ainda hoje é orientada pelo estadiamento tumoral, onde as características histopatológicas do tumor são o maior determinante. Parale-lamente, desenvolvem-se estudos para entender o comportamento da biologia tumoral por método imunoistoquímico de quantificação manual, avaliando a ati-vidade proliferativa ou apoptótica do tecido em análise. As desvantagens conti-das no modo manual fizeram surgir e desenvolver método computadorizado de análise de imagem. OBJETIVOS: Verificar as expressões dos marcadores KI-67 e Caspase-3 e correlacioná-las com as características clínico-patológicas do tumor. MÉTODOS: Foram estudados 29 blocos parafinados provenientes de pa-cientes portadores de carcinoma de células escamosas de esôfago submetidos à esofagectomia e pertencentes a acervos de laboratórios de patologia. Proce-deu-se preparo das lâminas por técnica imunoistoquímica convencional. A quantificação da imunorreatividade às proteínas Ki-67 e Caspase-3 foi realizada pelo software de análise de imagem computadorizada SAMBA (Systeme d'Analyse Microphotometrique a Balayage Automatique através do índice de marcagem encontrado. RESULTADOS: Predominaram na amostra o sexo mascu-lino (82,7%; maiores de 50 anos; tumores moderadamente diferenciados (68,98%; estágio III (72,42%; lesões >3cm e localizadas no ? inferior do ór-gão. Os índices médios de marcagem identificados foram de 62,05% para o Ki-67 e 86,06% para a Caspase-3, e não mostraram correlação com as caracterís-ticas clínico-patológicas como sexo, idade, estadiamento tumoral, grau de pro-fundidade da lesão e comprometimento linfonodal. Houve significante diferença de expressão do Ki-67 entre os graus histológicos (P=0,047 e correlação entre os índices dos marcadores estudados (r=0,41 e P =0,032. CONCLUSÃO: Na presente investigação as atividades das proteínas estudadas se mostraram in-tensas sendo que a da Caspase-3 foi superior ao Ki-67 mas sem correlação com as características clínico-patológicas.BACKGROUND: The esophageal squamous cell carcinoma treatment strategy is still based on the tumor staging, where tumor histopathologic charac-teristics are the major determinants. In parallel, studies have been developed in order to better understand the tumor biology using immunohistochemical meth-ods with manual quantification evaluating the proliferative and apoptotic activi-ties of the cells. The disadvantages related to the manual method rose the de-velopment of computerized ways to do the image analysis. OBJETIVES: To verify the expressions of the markers Ki-67 (proliferative and Caspase-3 (apoptotic and to correlate them with the clinic and pathologic characteristics of the tumor. METHODS: Twenty-nine paraffin embedded blocks were studied, each one con-taining tissue samples from patients with esophageal squamous cell carcinoma submitted to esophagectomies. The clinic and pathological data were obtained from histopathologic informations and from medical records. The slides were prepared following the routine immunohistochemical method until the point to utilize the specific antibodies (MIB-1 and CPP32. Positive quantification of the immunoreactivity to the proteins Ki-67 and Caspase-3 was performed by the software for computerized image analysis SAMBA (Systeme d' Analyse Micro-photometrique a Balayage Automatique. Statistical analysis was done having P3cm; and lesions located in the lower third of the organ. The mean score indexes found were 62.05% for Ki-67 and 86.06% for Caspase-3 and there was no correlation with the clinic or pathologi-cal characteristics as gender, age and tumor staging. There was significant dif-ference of Ki-67 expression among the histological grades (P=0.047 and corre-lation between the evaluated indexes (r=0.41 and P=0.032. CONCLUSION: The protein expressions were high and the Caspase-3 protein activity was higher than the Ki-67, without correlation with clinic or pathological characteris

Gilmar Pereira Silva

2008-06-01

229

Re-irradiation in stereotactic conditions and cetuximab for local relapses of epidermoid carcinoma of head and neck; Reirradiation en conditions stereotaxiques et cetuximab pour des recidives locales de carcinome epidermoide de la tete et du cou  

Energy Technology Data Exchange (ETDEWEB)

The authors report a work aimed at assessing the feasibility and toxicity of a re-irradiation treatment in stereotactic conditions using CyberKnife and cetuximab in the case of local relapses of epidermoid cancers of the ORL sphere. Thirty three patients have been submitted to this treatment between June 2007 and April 2009. Although six patients died by six months, this treatment seems to be a good alternative, and presents an acceptable short-term toxicity. Further studies are needed to compare this technique to other therapeutic techniques, and to assess the risk of long term complications. Short communication

Vasseur, F.; Comet, B.; Faivre-Pierret, M.; Coche-Dequeant, B.; Degardin, M.; Lefebvre, J.L.; Lacornerie, T.; Lartigau, E. [Departement universitaire de radiotherapie, centre Oscar Lambret, 59 - Lille (France); Universite Lille-2, 59 (France)

2010-10-15

230

Interest of the SPECT-CT hybrid imaging in the management of thyroid differentiated carcinomas; Interets de l'imagerie hybride TEMP-TDM dans la prise en charge des carcinomes differencies de la thyroide  

Energy Technology Data Exchange (ETDEWEB)

Purpose: Images merging, associating SPECT and CT, integers functional and anatomical data. The purpose of our study was to evaluate the SPECT contribution coupled to CT in our daily practice of the management thyroid differentiated carcinomas. Conclusions: SPECT/CT merging got by a hybrid system allows a better anatomical location and improves the diagnostic value of examination in the extension assessment of thyroid differentiated carcinomas. (N.C.)

Menemani, A.; Mebarki, M.; Slama, A.; Meghelli, S.; Lachachi, B.; Krim, M.; Berber, N. [CHU Tlemcen, Service de medecine nucleaire (Algeria)

2010-07-01

231

Basal cell carcinoma of the scalp after radiation therapy for tinea capitis: 33 patients; Carcinomes basocellulaires du cuir chevelu secondaires a une radiotherapie pour teigne: une serie de 33 malades  

Energy Technology Data Exchange (ETDEWEB)

Occurrence of basal cell carcinoma (BCC) following radiotherapy for tinea capitis is well known. The aim of this study was to specify the clinical and histological features of these BCC seen in 33 patients (1995 000). Twenty seven men and six women were diagnosed with BCC. The age of onset varied between 32 an 62 years. Radiotherapy was received between 5 and 17 years of age. The interval between irradiation and the onset of carcinoma varied between 21 and 51 years. Total number of lesions was 55. Forty percent of BCC occurred on the occipital area, the number varied from 1 to 5 and the size from 2 to 45 mm. Clinically, the nodular type was found in 51% of cases. Pigment was present in 64% of cases. Histological study showed a nodular aspect in 76% and pigmentation in 63% of cases. Nodular and pigmented type were the predominant BCC occurring after radiotherapy for tinea capitis in our series. In the literature, BCC are the most frequent carcinomas occurring after radiotherapy (70-100%). Pigmentation was not described in other series. The nodular histological form was the most frequent. (author)

Mseddi, M.; Bouassida, S.; Marrekchi, S.; Khemakhem, M.; Gargouri, N.; Turki, H.; Zahaf, A. [Centre Hospitalier Universitaire Hedi Chaker, Service de Dermatologie, Sfax (Tunisia)

2004-08-01

232

Influence of MRI abnormality in skull base bone on prognosis of nasopharyngeal carcinoma; Influence de l'atteinte asseuse de la base du crane par IRM sur le pronostic des carcinomes nasopharynges  

Energy Technology Data Exchange (ETDEWEB)

Purpose. To evaluate the influence of skull base bone (SBB) abnormality showed by MRI on prognosis of nasopharyngeal carcinoma (NPC). Patients and methods. From March 1993 to December 1998, 122 NPC patients received prime radiotherapy treatment. All of them were proved pathologically and checked by magnetic resonance imaging (MRI). Every patient received radiation through conjoint facio-cervical field and conventional dose-fractionation schedules. The total dose to the primary tumor was 60 5 Gy (median, 70 Gy). The Kaplan Meier method, the Log-rank test and the Cox regression model were used to evaluate the significance of prognostic factors on NPC patient survival. Results. The overall median survival period was 50 (6 2) months, and the 1, 3 and 5 year-survival rates were, respectively, 99.2%, 87.9%, and 73.3%. The 1, 3, and 5 year-survival rates of abnormality and normality of the SBB on MRI were 98.9%, 87.2%, 71.9%, and 100.0%, 89.8%, 77.0%, respectively (P 0.4233). Gender, age, head pain, SBB abnormality, cranial nerve palsy, cervical lymphadenopathy and primary tumor extent were analyzed with the Cox regression model and SBB abnormality on MRI did not prove to have statistical significance (P = 0.6934). According to the analysis of regrouping, patients with SBB abnormalities {>=} sites have a worse prognosis (P = 0.0427). Then. the above seven factors are analyzed by Cox regression model and the result had statistical significance (P = 0.0385). Conclusion. The SBB abnormality on MRI is of no obvious influence on prognosis of NPC. However, when SBB abnormality sites were {>=} 2, there is obvious statistical significance on the prognosis. (author)

Jin-Cheng, Lu; Qing, Wei; Yi-Qin, Zhang; Feng, Li [Jiangsu Cancer Hospital, Dept. of Radiotherapy, Nanjing (China)

2004-08-01

233

The value of skeletal scintigraphy in the clinical follow-up of carcinomas of the uterine body and cervix. Die Wertigkeit der Skelettszintigraphie in der Nachsorge des Corpus- und Collum-Carcinoms  

Energy Technology Data Exchange (ETDEWEB)

The study is based on a survey of 235 patients. A total of 139 women suffered from cervical carcinomas, which were accompanied by a second tumour in 16 cases, and malignancy of the body of the uterus was seen in 96 patients, 17 of whom displayed an additional carcinoma. The rate of uterine carcinomas metastising into the skeleton was calculated to be 4.3% or 4.8%. On an average, the diagnosis was proven one year after the discovery of malignant uterine changes. Measurements of alkaline phosphatase to test for the presence of skeletal metastases led to false-negative results in a large percentage of cases. In 139 patients the radionuclide was seen to accumulate in tissues other than the bones, which in 122 cases were the renal region and efferent urinary passages. Results obtained by more specific methods of examination were contrasted with the bone scintigrams and confirmed the previous diagnosis for 40 of those 122 patients (33%). In 11 of 18 patients (58%), where high density areas were detected in organs not belonging to the renal and urinary systems, the diagnosis suggested by the skeletal scientigrams could likewise be confirmed by further procedures. The findings revealed here would appear to suggest that radionuclide examinations of the skeleton are no longer advisable as a routine procedure in the follow-up of asymptomatic patients treated for uterine carcinomas. Quite apart from the low rate of skeletal metastases and uncertainties surrounding their treatment, some consideration must be given to the fact that a major part of presumptive diagnoses based on skeletal scintigrams are still eluding further verification. (orig./MG).

Thaler, B.

1989-06-01

234

4D-CT scan and radiotherapy for hepatocellular carcinoma: Role in the definition of internal target volume (ITV); Scanographie quadrimensionelle et irradiation des carcinomes hepatocellulaires: role dans la definition du volume cible interne (ITV)  

Energy Technology Data Exchange (ETDEWEB)

Purpose. - To evaluate the role of 4D-CT scan and the breath-related margins in the definition of internal target volume (ITV) during radiotherapy for hepatocellular carcinoma. Patients and methods. - All patients treated for hepatocellular carcinoma that underwent a 4D-CT simulation scan were retrospectively analysed in order to assess breath-related movements of GTV in the 3-D directions. After a standard CT-scan simulation performed to contour GTV and organs at risk (OARs), a 4D-scan simulation was then realized in order to contour ITV. Margins to be added for every patient to pass from GTV to ITV were calculated and evaluated also regarding liver lobe and GTV size (< or > 5 cm). Results. - Twenty-seven hepatocellular carcinoma patients were evaluated (total: 28 lesions). Median tumor movements in the cranio-caudal, lateral and anteroposterior direction were 8.6 mm (range: 0-72.9 mm), 6.5 mm (range: 1-68.1 mm) and 9.1 mm (range: 1-34 mm), respectively. ITV had a median volume increase of 94% (range: 8-403%). Conclusion. - Tumour breath-related displacements are significant. 4D-CT simulation scan allows to precisely define these displacements and to tailor the treatment. A precise evaluation of breath-related effects on GTV is essential, particularly with new conformal radiotherapy techniques as intensity modulated radiotherapy (IMRT) and/or stereotactic body radiotherapy. (authors)

De Baria, B.; Sellal, N.; Mornexa, F. [EA3738, universite Claude-Bernard Lyon 1, chemin du Grand-Revoyet, 69310 Pierre-Benite (France); Departement de radiotherapie-oncologie, centre hospitalier Lyon Sud, chemin du Grand-Revoyet, 69310 Pierre-Benite (France)

2011-02-15

235

Gingival metastasis from the lung through a needle and a pin: a case report; Un carcinome pulmonaire metastase a la gencive via une aiguille de couture: a propos d'un cas  

Energy Technology Data Exchange (ETDEWEB)

Gingival metastases are very rare. We report the case of a 47 year-old man presenting with a gingival metastasis from a non small cell lung carcinoma. According to the literature, the most probable way of spread of such metastasis is hematogenous. Local implantation of cancer cells, present in patient's expectoration, in a fragile gingival may be an other pathway of lung cancer metastasizing in this region as we will try to describe in this case report. Cytological and/or histological investigation is needed to assess the malignant and the metastatic character of these gingival lesions. A rapid regression is observed after a flash of external beam radiation; nevertheless metastasis prognosis depends on the primary tumour progress. (authors)

Hentati, D.; Chraiet, N.; Kochbati, L.; Maalej, M. [Institut Salah-Azaiz, Service de Radiotherapie Carcinologique, Tunis (Tunisia)

2007-12-15

236

Significado clínico-patológico das expressões citofotométricas do Ki-67 e Caspase-3 no carcinoma de células escamosas do esôfago / Clinicopathologic significance of the Ki-67 and Caspase-3 cytophotometric expressions in the esophageal squamous cell carcinomal  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese RACIONAL: A escolha da forma de tratamento do carcinoma de células escamosa de esôfago ainda hoje é orientada pelo estadiamento tumoral, onde as características histopatológicas do tumor são o maior determinante. Parale-lamente, desenvolvem-se estudos para entender o comportamento da biologia tumora [...] l por método imunoistoquímico de quantificação manual, avaliando a ati-vidade proliferativa ou apoptótica do tecido em análise. As desvantagens conti-das no modo manual fizeram surgir e desenvolver método computadorizado de análise de imagem. OBJETIVOS: Verificar as expressões dos marcadores KI-67 e Caspase-3 e correlacioná-las com as características clínico-patológicas do tumor. MÉTODOS: Foram estudados 29 blocos parafinados provenientes de pa-cientes portadores de carcinoma de células escamosas de esôfago submetidos à esofagectomia e pertencentes a acervos de laboratórios de patologia. Proce-deu-se preparo das lâminas por técnica imunoistoquímica convencional. A quantificação da imunorreatividade às proteínas Ki-67 e Caspase-3 foi realizada pelo software de análise de imagem computadorizada SAMBA (Systeme d'Analyse Microphotometrique a Balayage Automatique) através do índice de marcagem encontrado. RESULTADOS: Predominaram na amostra o sexo mascu-lino (82,7%); maiores de 50 anos; tumores moderadamente diferenciados (68,98%); estágio III (72,42%); lesões >3cm e localizadas no ? inferior do ór-gão. Os índices médios de marcagem identificados foram de 62,05% para o Ki-67 e 86,06% para a Caspase-3, e não mostraram correlação com as caracterís-ticas clínico-patológicas como sexo, idade, estadiamento tumoral, grau de pro-fundidade da lesão e comprometimento linfonodal. Houve significante diferença de expressão do Ki-67 entre os graus histológicos (P=0,047) e correlação entre os índices dos marcadores estudados (r=0,41 e P =0,032). CONCLUSÃO: Na presente investigação as atividades das proteínas estudadas se mostraram in-tensas sendo que a da Caspase-3 foi superior ao Ki-67 mas sem correlação com as características clínico-patológicas. Abstract in english BACKGROUND: The esophageal squamous cell carcinoma treatment strategy is still based on the tumor staging, where tumor histopathologic charac-teristics are the major determinants. In parallel, studies have been developed in order to better understand the tumor biology using immunohistochemical meth- [...] ods with manual quantification evaluating the proliferative and apoptotic activi-ties of the cells. The disadvantages related to the manual method rose the de-velopment of computerized ways to do the image analysis. OBJETIVES: To verify the expressions of the markers Ki-67 (proliferative) and Caspase-3 (apoptotic) and to correlate them with the clinic and pathologic characteristics of the tumor. METHODS: Twenty-nine paraffin embedded blocks were studied, each one con-taining tissue samples from patients with esophageal squamous cell carcinoma submitted to esophagectomies. The clinic and pathological data were obtained from histopathologic informations and from medical records. The slides were prepared following the routine immunohistochemical method until the point to utilize the specific antibodies (MIB-1 and CPP32). Positive quantification of the immunoreactivity to the proteins Ki-67 and Caspase-3 was performed by the software for computerized image analysis SAMBA (Systeme d' Analyse Micro-photometrique a Balayage Automatique). Statistical analysis was done having P3cm; and lesions located in the lower third of the organ. The mean score indexes found were 62.05% for Ki-67 and 86.06% for Caspase-3 and there was no correlation with the clinic or pathologi-cal characteristics as gender, age and tumor staging. There was significant dif-ference of Ki-67 expression among the histological grades (P=0.047) and corre-lation between the evaluated indexes (r=0.41 and P=0.032). CONCLUSION: The protein expressions were high and the Caspase-3

Gilmar Pereira, Silva; Osvaldo, Malafaia; Ronaldo Máfia, Cuenca; Jurandir Marcondes, Ribas-Filho; Paulo Afonso Nunes, Nassif; Carmen Australia Paredes Marcondes, Ribas; Jorge Luiz de Matos, Zeve.

237

Interest of a treatment combined by radioimmunotherapy and Avastin 1 in a murine model of thyroid medullary carcinoma; Interet d'un traitement combine par radioimmunotherapie et Avastin1 dans un modele murin de carcinome medullaire de la thyroide  

Energy Technology Data Exchange (ETDEWEB)

The objective of this study was to evaluate the efficiency and the toxicity of the association radioimmunotherapy and bevacizumab on a murine model grafted by the human line T.T. of thyroid medullar cancer. After results it appears that in pretreatment, bevacizumab (Avastin) improves the efficiency of radioimmunotherapy without increasing the toxicity face the radioimmunotherapy alone. (N.C.)

Salaun, P.Y.; Bodet-Milin, C.; Paris, F.; Frampas, E.; Sai Maurel, C.; Faivre Chauvet, A.; Barbet, J.; Kraeber Bodere, F. [Unite Inserm U892, Brest, (France)

2009-05-15

238

Retrospective study of the local control and the cosmetic result of 147 face carcinomas after interstitial brachytherapy; Etude retrospective du controle local et du resultat cosmetique de 147 carcinomes de la face apres curietherapie interstitielle  

Energy Technology Data Exchange (ETDEWEB)

The purpose was to evaluate retrospectively the local control rate and the cosmetic results for patients that received an interstitial brachytherapy for a base or spino-cellular carcinoma of face orifices areas. The interstitial brachytherapy by iridium 192 is an excellent alternative to surgery in the skin carcinomas of the face, as well at the level of local control as the cosmetic and functional results. (N.C.)

Ducassou, A.; David, I.; Bonnet, J.; Delannes, M. [Institut Claudius-Regaud, Service de Radiotherapie, 31 - Toulouse (France)

2009-10-15

239

Epidermoid carcinomas of the anal canal treated with definitive radiation therapy in a series of 305 patients; Carcinomes epidermoides du canal anal traites par irradiation a visee curative: a propos de 305 patients  

Energy Technology Data Exchange (ETDEWEB)

Purpose. - To identify prognostic factors and treatment toxicity in a series of epidermoid cancers of the anal canal without evident metastasis. Patients and methods. - Between June 1972 and January 1997, 305 patients (pts) were treated with curative-intent radiation therapy (RT). The T-stages according to the 1987 UICC classification were: 26 T1, 141 T2, 104 T3, and 34 T4. There were 49 pts with nodal involvement at presentation. Pretreatment anal function scoring according to our in-house system was: 22 scored 0, 182 scored 1, 74 scored 2, 7 scored 3. 11 scored 4, and 9 not available pts. The treatment started with external beam RT (EBRT) in 303 pts (median dose: 45 Gy). After a rest period of 4 to 6 weeks, a boost of 20 Gy was delivered by EBRT in 279 pts and by interstitial {sup 192}Ir brachytherapy (Bcy) in 17 pts. Seven pts received only one course of EBRT (mean dose: 49.5 Gy) and 2 pts were treated with interstitial {sup 192}Ir Bcy alone (55 and 60 Gy, respectively). concomitant chemotherapy (5-fluoro-uracil and either mitomycin C or cisplatin) was delivered to 19 pts. Mean follow-up was 103 months. Results. - At the end of RT local tumor clinical complete response (cCR) rate was 80%. Out of 61 non responders or local progressive tumors 27 (44%) were salvaged with abdomino-perineal resection (APR). The rate of local tumor relapse (LR) was 12%. Out of 37 LTR, 20 (54%) were salvaged with APR and one with interstitial {sup 192}Ir Bcy. The overall local tumor control (LC) rate with or without salvage local treatment was 84%. LC rate with a good anal function scoring (score 0 and 1) was 56.5%0. Among 181/186 available pts who preserved their anus, 94% had a good anal function scoring. For a subgroup of 15 pts with length tumor <2 cm-N0, the LC rate after the end of RT was 100% the LC rate with or without local salvage treatment was 100%, and among 13 available pts who preserved their anus, the anal function scoring was good in 12 pts (92%). The 10-years disease-free survival was 74%. After multivariate analysis, 3 independent predicting factors significantly influenced the disease-free survival: gap duration between 2 courses of RT (>38 days vs {<=}38 days, P=0.0025), pretreatment anal function scoring (0 vs 1 vs 2 vs 3 vs 4, P =4.4 10{sup -6}), and cCR after the end of RT (no complete response vs complete response, P =2.5 10{sup -14}). Conclusion. - We confirm excellent results with RT in T1 and T2 lesions. However, chemoradiotherapy should be preferred to improves survival free. of colostomy with a good anal sphincter function for tumors more than or equal to 2 cm in length and locally advanced tumors. (author)

Deniaud-Alexandre, E.; Touboul, E.; Huang, R.; Qu, S.H.; Pene, F.; Schlienger, M. [Hopital Tenon, Service d' Oncologie-Radiotherapie, 75 - Paris (France); Tiret, E.; Parc, R. [Hopital Saint-Antoine, Service de Chirurgie Digestive, 75 - Paris (France); Sezeur, A. [Hopital des Diaconesses, Service de Chirurgie Generale, 75 - Paris (France); Houry, S. [Hopital Tenon AP-HP, Service de Chirurgie Digestive, 75 - Paris (France); Gallot, D. [Groupe Hospitalier Bichat-Claude-Bernard, Service de Chirurgie Generale et Digestive B, 75 - Paris (France)

2003-08-01

240

Class T4 (Stage 3B) epidermoid carcinomas of the anal channel; Carcinomes epidermoides du canal anal classes T4 (stade 3B): traitement conservateur par irradiation ou irradiation preoperatoire  

Energy Technology Data Exchange (ETDEWEB)

The local control rate with a correct anal function is low after radiotherapy with curative aim with or without concomitant chemotherapy. For the patients whom the tumoral response is under 50% after the first irradiation fractions and/or that have a bad anal function even before therapy (scores 3-4), the sphincter preservation is compromised and the conservative treatment is questionable. (N.C.)

Deniaud-Alexandre, E.; Touboul, E.; Huguet, F.; Pene, F.; Schlienger, M. [Hopital Tenon APHP, Service d' Oncologie-Radiotherapie, 75 - Paris (France); Tiret, E.; Parc, R. [Hopital Saint-Antoine, APHP, Service de Chirurgie Digestive, 75 - Paris (France); Sezeur, A. [Groupe Hospitalier des Diaconesses-Croix Saint-Simon, Service de Chirurgie Digestive, 75 - Paris (France); Hannoun, L. [Groupe Hospitalier Pitie-Salpetriere APHP, Service de Chirurgie Digestive, 75 - Paris (France); Houry, S. [Hopital Tenon APHP, Service de Chirurgie Digestive, 75 - Paris (France)

2006-11-15

 
 
 
 
241

Long-term results and prognostic factors of squamous cell carcinoma of the anal canal treated by irradiation; Resultats a long terme et facteurs pronostiques des carcinomes epidermoides du canal anal traites par irradiation  

Energy Technology Data Exchange (ETDEWEB)

Purpose To analyze the prognostic factors of loco regional control (L.R.C.), specific survival (S.S.) and sphincter conservation (S.C.) of patients treated by curative and conservative irradiation for an epidermoid cancer of anal canal in our institution. Patients and methods From 1976 to 2005, 286 patients (pts) were treated by exclusive radiotherapy (180 pts) or chemo-radiotherapy (106 pts) followed by a brachytherapy boost (233 pts) or external beam radiotherapy boost (24 pts). Forty-three pts were stage I, 154 stage II, 31 stage IIIA and 53 stage IIIB. Results The mean follow-up was 65 months (range: 1.3-250 months). The 5-years-overall survival and S.S. rates were 66.4% and 78.1% respectively. In multivariate analysis, tumor size (? 40 mm) [R.R. = 2.1], node involvement (R.R. = 2.4), and poor response (< 75%) to first course irradiation [R.R. = 1.9], local relapse (R.R. = 4.5) and distant metastases were factors of poor prognosis for S.S.. Five-years-L.R.C. were 71.5% (88% for stage I, 69% for stage II, 77%, for stage IIIA and 60% for stage IIIB). Prognosis factors of L.C.R. were tumor size (R.R. = 2.5), response to first course of irradiation (R.R. = 2.9). S.C. was 71% at 5 years. Prognosis factors of S.C. were tumor size (R.R. = 1.9) and response to first course of irradiation (R.R. = 2.4). Conclusion The results of this series are similar to those of the literature. As well as initial tumor extension, response to first course of irradiation was found as prognostic factor on L..R., S.S., S.C.. Our results are similar to other series and brachytherapy seems not to be deleterious. Its impact to local control remains to be evaluated. (authors)

Tournier-Rangeard, L.; Peiffert, D.; Lafond, C.; Mege, A. [Centre Alexis-Vautrin, Dept. de Radiotherapie et Curietherapie, 54 - Vandoeuvre-les-Nancy (France); Metayer, Y.; Marchesi, V.; Buchheit, I. [Centre Alexis-Vautrin, Dept. de Radiophysique, 54 - Vandoeuvre-les-Nancy (France); Uwer, L.; Conroy, T.; Kaminsky, M.C. [Centre Alexis-Vautrin, Dept. d' Oncologie Medicale, 54 - Vandoeuvre-les-Nancy (France)

2007-06-15

242

Preoperative concomitant radio chemotherapy in bulky carcinoma of the cervix: Institut Curie experience; Chimioradiotherapie concomitante preoperatoire dans les carcinomes du col uterin de stades IB2 a IIB: experience de l'Institut Curie  

Energy Technology Data Exchange (ETDEWEB)

Purpose: To evaluate the treatment results of patients (pts) with Figo stage IB2, IIA, IIB cervical carcinoma (C.C.) treated with preoperative radio chemotherapy, followed by extended radical hysterectomy. Patients and methods: Retrospective study of 148 women treated to the Curie Institute for operable Figo Stage IB2 to IIB, biopsy proved C.C.. Among them, 70 pts, median age 46 years, were treated using the same regimen associating primary radio cis-platinum based chemotherapy,intracavitary LDR brachytherapy, followed by extended radical hysterectomy. Kaplan-Meier estimates were used to draw survival curves. Comparisons of survival distribution were assessed by the log-rank test. Results: Complete histological local-regional response was obtained in 56% of the pts (n = 39). Residual macroscopic or microscopic disease in the cervix was observed in 28 pts (40%). All but one had in situ microscopic residual C.C.. Lateral residual disease in the parametria was also present in nine pts, all with residual C.C.. Pelvic lymph nodes were free from microscopic disease in 56 pts (80%). Eight of 55 (11%) radiological N0 patients had microscopic nodal involvement, as compared to 6/15 (40%) radiological N1 (p = 0.03). Seventeen pts (25%) had residual cervix disease but negative nodes. After median follow-up of 40 months (range, 8-141), 38/70 patients (54.1%) are still alive and free of disease, six (8.6%) alive with disease, and 11 (15.8%) patients were lost for follow-up but free of disease. Conclusion: The treatment of locally advanced C.C. needs a new multidisciplinary diagnostic and treatment approach using new therapeutic arms to improve the survival and treatment tolerance among women presenting this disease. (authors)

Kirova, Y.M.; Bourhaleb, Z.; Campitelli, M.; De la Rochefordiere, A. [Institut Curie, Groupe de Gynecologie, Service d' Oncologie et de Radiotherapie, 75 - Paris (France); Alran, S.; Fourchotte, V. [Institut Curie, Groupe de Gynecologie, Service de Chirurgie, 75 - Paris (France); Plancher, C. [Institut Curie, Groupe de Gynecologie, Service de Biostatistique, 75 - Paris (France); Beuzeboc, P.; Cottu, P. [Institut Curie, Groupe de Gynecologie, Service d' Oncologie Medicale, 75 - Paris (France); Petrow, P. [Institut Curie, Groupe de Gynecologie, Service de Radiologie, 75 - Paris (France); Cremoux, P. de; Sastre-Garau, X. [Institut Curie, Groupe de Pathologie, Service de Radiologie, 75 - Paris (France)

2009-07-15

243

Neck dissection following chemo radiation for node positive head and neck carcinomas;Place du curage ganglionnaire apres chimioradiotherapie dans les carcinomes epidermoides des voies aerodigestives superieures avec atteinte ganglionnaire initiale (nasopharynx exclu)  

Energy Technology Data Exchange (ETDEWEB)

The optimal timing and extent of neck dissection in the context of chemo radiation for head and neck cancer remains controversial. For some institutions, it is uncertain whether neck dissection should still be performed up front especially for cystic nodes. For others, neck dissection can be performed after chemo radiation and can be omitted for N1 disease as long as a complete response to chemo radiation is obtained. The question is debated for N2 and N3 disease even after a complete response as the correlation between radiological and clinical assessment and pathology may not be reliable. Response rates are greater than or equal to 60% and isolated neck failures are less than or equal to 10% with current chemo radiation protocols. Some therefore consider that systematic up front or planned neck dissection would lead to greater than or equal to 50% unnecessary neck dissections for N2-N3 disease. Positron-emission tomography (PET) scanning to assess treatment response and have shown a very high negative predictive value of greater than or equal to 95% when using a standard uptake value of 3 for patients with a negative PET at four months after the completion of therapy. These data may support the practice of observing PET-negative necks. More evidence-based data are awaited to assess the need for neck dissection on PET. Selective neck dissection based on radiological assessment and preoperative findings and not exclusively on initial nodal stage may help to limit morbidity and to improve the quality of life without increasing the risk of neck failure. Adjuvant regional radiation boosts might be discussed on an individual basis for aggressive residual nodal disease with extra-capsular spread and uncertain margins but evidence is missing. Medical treatments aiming at reducing the metastatic risk especially for N3 disease are to be evaluated

Thariat, J. [Centre de lutte contre le cancer Antoine-Lacassagne, Dept. de Radiotherapie, Oncologie, 06 - Nice (France); IBDC CNRS UMR 6543, 06 - Nice (France); Thariat, J.; Marcy, P.Y.; Bozec, A.; Peyrade, F.; Hofman, P. [Universite de Nice-Sophia-Antipolis, 06 - Nice (France); Hamoir, M. [Cliniques universitaires Saint-Luc, UCL, Dept. de chirurgie ORL, Bruxelles (Belgium); Janot, F. [Institut Gustave-Roussy, Dept. de chirurgie ORL, 94 -Villejuif (France); De Mones, E. [CHU de Bordeaux, Dept. de chirurgie ORL, 33 - Bordeaux (France); Marcy, P.Y. [Centre de lutte contre le cancer Antoine-Lacassagne, Dept. de Radiologie, 06 - Nice (France); Carrier, P. [CHU de Nice, Dept. de Medecine Nucleaire, 06 - Nice (France); Bozec, I. [Centre de lutte contre le cancer Antoine-Lacassagne, Dept. chirurgie ORL, 06 - Nice (France); Guevara, J.; Santini, J. [CHU Pasteur, Dept. de chirurgie ORL, 06 - Nice (France); Albert, S. [CHU Bichat, Dept. de chirurgie ORL, 75 - Paris (France); Vedrine, P.O. [CHG Cannes, 06 (France); Graff, P. [Centre de Lutte Contre le Cancer Alexis-Vautrin, Dept. de chirurgie ORL, 54 - Nancy (France); Peyrade, F. [Centre de lutte contre le cancer Antoine-Lacassagne, Dept. d' Oncologie Medicale, 06 - Nice (France); Hofman, P. [CHU de Nice, Dept. de Pathologie clinique et experimentale, 06 - (France); Centre de lutte contre le cancer Antoine-Lacassagne, CHU et tumorotheque CHU-CLCC, 06 - Nice (France); Bourhis, J. [Institut Gustave-Roussy, Dept. de Radiotherapie-oncologie, 94 - Villejuif (France); Lapeyre, M. [Centre de lutte contre le cancer Jean-Perrin, Dept. de Radiotherapie-oncologie, 63 - Clermont-Ferrand (France)

2009-12-15

244

Secondary mandibular fibrosarcoma after chemoradiotherapy for undifferentiated nasopharyngeal carcinoma. Report of a case and literature review; Fibrosarcome secondaire de la mandibule apres chimioradiotherapie pour carcinome indifferencie du nasopharynx. A propos d'une observation et revue de la litterature  

Energy Technology Data Exchange (ETDEWEB)

Secondary mandibular fibrosarcoma after chemoradiotherapy for undifferentiated nasopharyngeal carcinoma. Report of a case and literature review. Secondary tumours to radio- and/or chemotherapy have rarely been reported after treatment for head and neck cancers. We report a case of mandibular fibrosarcoma observed 7 years after chemoradiotherapy for undifferentiated nasopharyngeal carcinoma in a patient treated when 20 years old. (authors)

Kochbati, L.; Besbes, M.; Benna, F.; Maalej, M. [Institut Salah Azaiz, Service de Radiotherapie, Tunis (Tunisia); Boussen, H.; Ben Ayed, F. [Institut Salah Azaiz, Service de Medecine, Tunis (Tunisia); Gritli, S.; Ladgham, A. [Institut Salah Azaiz, Service de Chirurgie ORL, Tunis (Tunisia); Saadi, A. [Institut Salah Azaiz, Service de Radiodiagnostic, Tunis (Tunisia); El May, A. [Institut Salah Azaiz, Service d' Anatomopathologie, Tunis (Tunisia)

2001-06-01

245

Nasopharynx carcinoma treatment: from the conventional radiotherapy to the conformal radiotherapy with intensity modulation; Traitement du carcinome du nasopharynx: de la radiotherapie conventionnelle a la radiotherapie conformationnelle avec modulation d'intensite  

Energy Technology Data Exchange (ETDEWEB)

The objective of this study was to evaluate retrospectively the impact of factors linked to the radiotherapy realisation on the local and locoregional control, the global survival, the survival without disease of patients suffering of naso-pharynx carcinoma. Conclusion: the patients suffering of a nasopharynx carcinoma treated by irradiation associated to chemotherapy have an improved global survival and an improved survival without disease. The conformal radiotherapy with or without modulated intensity reduce the risk of serous otitis, trismus and xerostomia at long term. It seems necessary to realize multi centric studies with a longer period of follow up before asserting the advantages of the I.M.R.T. in comparison to the classical and conformal technique in the treatment of naso-pharynx carcinomas. (N.C.)

Mokaouim, K.; Grehange, G.; Truc, G.; Peingnaux, K.; Martin, E.; Zanetta, S.; Bruchon, Y.; Bonnetain, F.; Maingon, P. [Centre Georges-Francois Leclerc, 21 - Dijon (France)

2009-10-15

246

What extension evaluation before therapy have we to do in the nasopharynx cancers?; Quel bilan d'extension pretherapeutique faut-il faire dans les carcinomes du nasopharynx?  

Energy Technology Data Exchange (ETDEWEB)

NMR imaging has proved its superiority on scanography in the study of limits and tumor extension and should be the first examination. The practice of of a scanography or cervical NMR should be the best mean of ganglions evaluation. As regards the extension evaluation at distance, it is recommended to require systematically a thorax radiograph and a bone scintigraphy for any patient. The liver echography is rather indicated among male patients, aged between 40 and 45 and having a stage 3 lymph node (according to the U.I.C.C. 1997 classification). (N.C.)

Elloumi, F.; Mnejja, W.; Siala, W.; Daoud, J. [Centre Hospitallie Universitaire Habib-Bourguiba, Service de Radiotherapie Carcinologique, Sfax (Tunisia); Hammami, B.; Ghorbel, M. [Centre Hospitallie Universitaire Habib-Bourguiba, Service ORL, Sfax (Tunisia); Frikhan, M. [Centre Hospitallie Universitaire Habib-Bourguiba, Service de Carcinologie Medicale, Sfax (Tunisia)

2007-11-15

247

Radio-induced glioblastoma and myxoma after treatment of undifferentiated carcinoma of the nasopharynx; Glioblastome et myxome radio-induits apres traitement d'un carcinome indiffencie du nasopharynx  

Energy Technology Data Exchange (ETDEWEB)

Radio-induced tumor have been known for a long time to occur after treatment of cancer during childhood. This entity is exceptional following radiotherapy of the cavum. Skull and facial osteosarcoma were described after treatment of UCNT. We report two observations of radio-induced tumors arising respectively three and seven years after treatment of UCNT. The first one is a temporo-parietal glioblastoma and the second is a rhino- and pharyngeal myxoma. The two patients are alive after treatment of the second tumor. The delay of appearance of these tumors, their situation in the field's irradiated and dose received suggests their radioinduced nature. However, the cytogenetic study is necessary to confirm the implication of radiotherapy in the genesis of these cancers. (authors)

Daoud, J.; Ben Salah, H. [Centre Hospitalier Universitaire Habib-Bourguiba, Service de Carcinologie-Radiotherapie, Sfax (Tunisia); Kammoun, W.; Ghorbel, A.; Drira, M.M. [Centre Hospitalier Universitaire Habib-Bourguiba, Service ORL, Sfax (Tunisia); Frikha, M. [Centre Hospitalier Universitaire Habib-Bourguiba, Service de Carcinologie Medicale, Sfax (Tunisia); Jlidi, R. [Centre Hospitalier Universitaire Habib-Bourguiba, Lab. d' Anatomo-Pathologie, Sfax (Tunisia); Besbes, M.; Maalej, M. [Institut Salah-Azaiz, Service de Carcinologie-Radiotherapie, Tunis (Tunisia)

2000-12-01

248

Nasopharyngeal carcinoma. Clinical diagnosis, external radiotherapy and brachytherapy. Status of the art in 2001; Carcinomes du nasopharynx. Aspects cliniques, indications et resultats de la radiotherapie transcutanee et de la curietherapie. Etat de la question en 2001  

Energy Technology Data Exchange (ETDEWEB)

Nasopharynx carcinomas (NPC) are a very special head and neck cancer, in term of epidemiology, clinic and pathology. Endemic disease in South East Asia, undifferentiated nasopharynx carcinoma are very frequent CT scan and NMR allow a better knowledge of the modalities of the clinical presentation. Prognostic factors include local and regional extension. NPC is a well known radiosensitive disease with a dose-response curve well established. Modern imaging modalities and modification of the ballistic explain the amelioration of the local control and the diminution of therapeutic sequelae. Brachytherapy is an interesting modalities for the boost and the treatment of recurrent disease. The exact place of 3 D CRT and IMRT is not yet known as modifications of fractionation. Local control for T1 T2 tumor is excellent but is related to clinical extension (cranial and neurologic involvement) and nodal extension (supra clavicular N3) and show the interest of combined chemo-radiotherapy protocols. (authors)

Eschwege, F.; Bourkhis, J. [Institut Gustave Roussy, Dept. de Radiotherapie, 94 - Villejuif (France); El Gueddari, B. [Institut National d' Oncologie, Rabat (Morocco)

2001-11-01

249

Preoperative scintigraphic detection of lung metastases of a follicular thyroid carcinoma associated with hyperthyroidism; Detection scintigraphique preoperatoire de metastases pulmonaires d'un carcinome vesiculaire de la thyroide associe a une hyperthyroidie  

Energy Technology Data Exchange (ETDEWEB)

Preoperative accumulation of radioiodine in metastases of thyroid carcinoma and its association with hyperthyroidism are uncommon. We report a case of 58-year-old woman with follicular thyroid carcinoma revealed by thyrotoxicosis caused by a hot nodule, and bilateral pulmonary uptake of I-131 before total thyroidectomy. Despite four ablative doses of I-131, bone metastases were identified and the patient died 42 month after the initial diagnosis. (authors)

Biyi, A.; Oufroukhi, Y.; Doudouh, A. [Hopital Militaire d' Instruction Mohammed V, Rabat Instituts, Service de Medecine Nucleaire, Rabat (Morocco); Baizri, H.; El Quatni, M. [Hopital Militaire d' Instruction Mohammed V, Service d' Endocrinologie, Rabat (Morocco); Al Bouzidi, A. [Hopital Militaire d' Instruction Mohammed V, Service d' Anatomie Pathologique, Rabat (Morocco)

2009-10-15

250

Significado clínico-patológico das expressões citofotométricas do Ki-67 e Caspase-3 no carcinoma de células escamosas do esôfago / Clinicopathologic significance of the Ki-67 and Caspase-3 cytophotometric expressions in the esophageal squamous cell carcinomal  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese RACIONAL: A escolha da forma de tratamento do carcinoma de células escamosa de esôfago ainda hoje é orientada pelo estadiamento tumoral, onde as características histopatológicas do tumor são o maior determinante. Parale-lamente, desenvolvem-se estudos para entender o comportamento da biologia tumora [...] l por método imunoistoquímico de quantificação manual, avaliando a ati-vidade proliferativa ou apoptótica do tecido em análise. As desvantagens conti-das no modo manual fizeram surgir e desenvolver método computadorizado de análise de imagem. OBJETIVOS: Verificar as expressões dos marcadores KI-67 e Caspase-3 e correlacioná-las com as características clínico-patológicas do tumor. MÉTODOS: Foram estudados 29 blocos parafinados provenientes de pa-cientes portadores de carcinoma de células escamosas de esôfago submetidos à esofagectomia e pertencentes a acervos de laboratórios de patologia. Proce-deu-se preparo das lâminas por técnica imunoistoquímica convencional. A quantificação da imunorreatividade às proteínas Ki-67 e Caspase-3 foi realizada pelo software de análise de imagem computadorizada SAMBA (Systeme d'Analyse Microphotometrique a Balayage Automatique) através do índice de marcagem encontrado. RESULTADOS: Predominaram na amostra o sexo mascu-lino (82,7%); maiores de 50 anos; tumores moderadamente diferenciados (68,98%); estágio III (72,42%); lesões >3cm e localizadas no ? inferior do ór-gão. Os índices médios de marcagem identificados foram de 62,05% para o Ki-67 e 86,06% para a Caspase-3, e não mostraram correlação com as caracterís-ticas clínico-patológicas como sexo, idade, estadiamento tumoral, grau de pro-fundidade da lesão e comprometimento linfonodal. Houve significante diferença de expressão do Ki-67 entre os graus histológicos (P=0,047) e correlação entre os índices dos marcadores estudados (r=0,41 e P =0,032). CONCLUSÃO: Na presente investigação as atividades das proteínas estudadas se mostraram in-tensas sendo que a da Caspase-3 foi superior ao Ki-67 mas sem correlação com as características clínico-patológicas. Abstract in english BACKGROUND: The esophageal squamous cell carcinoma treatment strategy is still based on the tumor staging, where tumor histopathologic charac-teristics are the major determinants. In parallel, studies have been developed in order to better understand the tumor biology using immunohistochemical meth- [...] ods with manual quantification evaluating the proliferative and apoptotic activi-ties of the cells. The disadvantages related to the manual method rose the de-velopment of computerized ways to do the image analysis. OBJETIVES: To verify the expressions of the markers Ki-67 (proliferative) and Caspase-3 (apoptotic) and to correlate them with the clinic and pathologic characteristics of the tumor. METHODS: Twenty-nine paraffin embedded blocks were studied, each one con-taining tissue samples from patients with esophageal squamous cell carcinoma submitted to esophagectomies. The clinic and pathological data were obtained from histopathologic informations and from medical records. The slides were prepared following the routine immunohistochemical method until the point to utilize the specific antibodies (MIB-1 and CPP32). Positive quantification of the immunoreactivity to the proteins Ki-67 and Caspase-3 was performed by the software for computerized image analysis SAMBA (Systeme d' Analyse Micro-photometrique a Balayage Automatique). Statistical analysis was done having P3cm; and lesions located in the lower third of the organ. The mean score indexes found were 62.05% for Ki-67 and 86.06% for Caspase-3 and there was no correlation with the clinic or pathologi-cal characteristics as gender, age and tumor staging. There was significant dif-ference of Ki-67 expression among the histological grades (P=0.047) and corre-lation between the evaluated indexes (r=0.41 and P=0.032). CONCLUSION: The protein expressions were high and the Caspase-3

Gilmar Pereira, Silva; Osvaldo, Malafaia; Ronaldo Máfia, Cuenca; Jurandir Marcondes, Ribas-Filho; Paulo Afonso Nunes, Nassif; Carmen Australia Paredes Marcondes, Ribas; Jorge Luiz de Matos, Zeve.

2008-06-01

251

Oral Cancer Removal and Palate Reconstruction  

Medline Plus

Full Text Available ... Browne is going to remove an adenoid cystic carcinoma from the hard palate… [clears throat]…of a ... the defect. 00:06:37 Often, adenoid cystic carcinoma, the type of cancer that we’re working ...

252

 

Medline Plus

Full Text Available ... Adenoids Coblation Assisted Tonsillectomy (Georgetown University Hospital, Washington, DC, 2/23/2004) Diabetes Mellitus Diabetic Eye Problems ... Adenoids Coblation Assisted Tonsillectomy (Georgetown University Hospital, Washington, DC, 2/23/2004) Endocrine System Adrenal Gland Cancer ...

253

Tonsillectomy and Adenoidectomy  

Medline Plus

Full Text Available ... the mouth. The tonsils are part of the immune system and help fight infections. Eustachian tube The adenoids ... mouth. The adenoids are also part of the immune system and help fight infections. The uvula is also ...

254

Investigation of distribution of zinc, iron and antimony in healthy and pathologicaly altered liver tissues  

International Nuclear Information System (INIS)

The study aimed at demonstrating of changes in the content of Zn, Fe and Sb as a function of tissues pathological alterations in different diseases of liver. The following tissues were analysed by means of instrumental neutron activation analysis: healthy liver, cirrhotic liver, liver with primary carcinome, cirrhotic liver associated with primary evoluted carcinome. The samples were irradiated by thermal neutron flux theta=1,29 - 2.1x10-17 n/m2.s, time of irradiation 3 days, cooling time -7-40 days. The results indicated significant differences in the element contents in healthy and pathological livers

255

Intra-arterial injection of lipid nano-capsules charged in rhenium-188, for the treatment of hepatocellular carcinomas among the rat; Injection intra-arterielle de nanocapsules lipidiques chargees en rhenium-188, pour le traitement des carcinomes hepatocellulaires chez le rat  

Energy Technology Data Exchange (ETDEWEB)

The objective of this study was to evaluate the therapy efficiency of the {sup 188}Re incorporated in the middle of lipid capsules (N.C.L. {sup 188}Re-S.S.S.) on a hepato carcinoma model of rat. The preliminary results are encouraging and show the efficiency of a single injection of N.C.L.{sup 188}Re-S.S.S. in a hepato carcinoma model of rat. (N.C.)

Vanpouille, C.; Lacoeuille, F.; Hindre, F. [Inserm U646, Angers, (France); Roux, J. [service commun animalerie, hospitalo-universitaire, Angers, (France); Aube, C. [service de radiologie, CHU d' Angers, (France); Oberti, F. [service de gastro-enterologie et hepatologie, CHU d' Angers, (France); Lejeune, J.J.; Couturier, O. [service de medecine nucleaire, CHU d' Angers, (France)

2009-05-15

256

Total encephalic radiotherapy and concomitant administering of trastuzumab for brain metastases of a mammary carcinoma with HER2 overexpression: experience of the Curie Institute; Radiotherapie encephalique totale et administration concomitante de trastuzumab pour des metastases cerebrales d'un carcinome mammaire surexprimant HER2: experience de l'institut Curie  

Energy Technology Data Exchange (ETDEWEB)

The authors report a retrospective study of assessment of the tolerance to and of the activity of the trastuzumab in association with a total encephalic irradiation. The study is based on 31 patients suffering from brain metastases in relationship with a mammary cancer with HER2 expression, and who have been submitted to a total encephalic radiotherapy with a trastuzumab treatment. This medicine appears to be efficient and harmless. A clinic trial should confirm these results. Short communication

Chargari, C.; Idrissi, H.R.; Pierga, J.Y.; Bollet, M.; Dieras, V.; Campana, F.; Cottu, P.; Fourquet, A.; Kirova, Y. [Institut Curie, 75 - Paris (France)

2010-10-15

257

Interest of the SPECT-CT to D.M.S.A.-V images merging in the management of thyroid medullary carcinomas; Interets de la fusion d'image TEMP-TDM au DMSA-V dans la prise en charge des carcinomes medullaires de la thyroide  

Energy Technology Data Exchange (ETDEWEB)

Purpose: hybrid imaging associating SPECT and CT, integers functional and anatomical data. The aim of this communication is to present the contribution of the SPECT coupled to CT with D.M.S.A. V. in our daily practice of the medullary thyroid carcinomas management. Conclusions: the SPECT/CT got by a system of images merging allows a better anatomical location and improves the management of thyroid medullary carcinomas. (N.C.)

Menemani, A.; Mebarki, M.; Slama, A.; Khellil, N.; Meghelli, S.; Lachachi, B.; Krim, M.; Merad, S.; Berber, N. [CHU Tlemcen, Service de medecine nucleaire (Algeria)

2010-07-01

258

Comparison of the results obtained with two thyroglobulin (Tg) dosage kits in patients afflicted with differentiated thyroid carcinoma. Consequences for practice; Comparaison des resultats obtenus avec deux trousses de dosage de la thyroglobuline (Tg) chez les patients atteints de carcinome differencie de la thyroide. Consequences pour la pratique  

Energy Technology Data Exchange (ETDEWEB)

We have compared the results obtained with two thyroglobulin dosage kits after thyroidectomy for thyroid differentiated carcinoma: T1 = ELSA-HTG, CIS bio international (detection threshold: 0.5 ng/mL) and T2 = Tg IRMA, ERIA Diagnostics Pasteur (detection threshold = 0.2 ng/mL). T2 has been utilized in 2 populations presenting an undetectable Tg by T1 (< 0.5 ng/mL) in spite of presence of {sup 131}I cervical fixations: either in anti-Tg Ac absence (population P1, 102 cases) or in their presence (population P2, 16 cases). T2 has been utilized in a third population presenting Tg rates detectable by T1 (P3, 37 cases, Tg from 0.5 to 37.7 ng/mL). The dosages were performed under simulation by endogenous TSH. The following results were obtained by T2: Tg > 0.2 ng/mL 61 times of 106 (P1) and 6 times of 16 (P2), Tg > 0.2 ng/mL 45 times of 106 (P1) and 5 times of 16 (P2). For P3, Tg with T2 is always higher than Tg by T1 (average value in ng/mL, [range]: 11.2 [1.8-71] for T2 vs 4.6 [0.5-37.7] for T1; p = 0.0001), correlation coefficient (r = 0.96) and regression straight (Tg T2 = Tg T1 x 1.84 + 3.55; p = 0.0001) showing a strong correlation between T1 and T2. A Tg rate detectable or increasing by the kit T2 vs a reference obtained with kit T1 should be interpreted cautiously. The linear relation described above is applicable to values detectable and lower than 40 ng/mL by T1. For the other values (undetectable or higher than 40 ng/mL, by T1) and in case of doubt, a re-dosage of the anterior serums on tubes in serothec is necessary

Muratet, J.P.; Minier, J.F.; Daver, A.; Larra, F. [Centre Paul Papin, 2, rue Moll, Angers cedex 01 (France)

1997-12-31

259

Combination of radiotherapy and cetuximab for patients suffering from of an advanced and non operable epidermoid carcinoma of the ORL sphere: results and side effects; Association de radiotherapie et de cetuximab chez des patients atteints d'un carcinome epidermoide de la sphere ORL evolue non operable: resultats et effets secondaires  

Energy Technology Data Exchange (ETDEWEB)

The authors report a retrospective survey of a set of locally advanced epidermoid carcinomas treated by irradiation and cetuximab. They assessed the response to the treatment, the specific survival, and the global survival as well as the tolerance. The survey is based on 31 men and 5 women suffering from different stage 4 non-metastatic advanced epidermoid carcinomas of the ORL sphere. Short communication

Acevedo, C.; Valette, G.; Bouchekoua, M.; Marianowski, R.; Pradier, O. [CHU Morvan, 29 - Brest (France)

2010-10-15

260

Interest of the PET with F.D.G. in the evaluation of patients candidates to hepatic transplantation for hepatocellular carcinoma; Interet de la TEP au FDG dans l'evaluation des malades candidats a la transplantation hepatique pour carcinome hepatocellulaire  

Energy Technology Data Exchange (ETDEWEB)

Purpose: the objective of this study was to evaluate the interest of PET with F.D.G. as predictive factor of progression and output of liver transplant list for hepatocellular carcinoma. Conclusions: These preliminary data show that the positivity of PET with F.D.G. is strongly associated to a output of liver transplant list for tumor progression. (N.C.)

El Bez, I.; Hamza, F.; Yeddes, I.; Evangelista, E.; Meignan, M.; Itti, E. [CHU Henri-Mondor, Service de medecine nucleaire, 94 - Creteil (France); Decaens, T.; Duvoux, C. [CHU Henri-Mondor, Service d' hepato-gastroenterologie medecine nucleaire, 94 - Creteil (France); Luciani, A. [CHU Henri-Mondor, Service de radiologie, 94 - Creteil (France); Laurent, A. [CHU Henri-Mondor, Service de chirurgie digestive, 94 - Creteil (France)

2010-07-01

 
 
 
 
261

Thyroid medullar carcinoma and therapy follow up with the help of PET/T.D.M. with {sup 18}F-DOPA: about four cases; Carcinome medullaire de la thyroide et suivi therapeutique a l'aide de la TEP-TDM a la 18F-DOPA: a propos de quatre cas  

Energy Technology Data Exchange (ETDEWEB)

The objective was to study the contribution of the PET-T.D.M. to the dihydro phenylalanine labelled with {sup 18}F ({sup 18}F-DOPA) in the therapy follow up of patients with antecedents of thyroid medullar carcinomas and suspicion of biological recurrence. In spite of the very preliminary character of these results, these first cases show the interest of the PET-T.D.M. with {sup 18}F-DOPA in the therapy follow up and the coverage of patients reached by thyroid medullar carcinoma in biological recurrence. (N.C.)

Imperiale, A.; Ben-sellem, D.; Keomany, J.; Constantinesco, A. [Biophysique et medecine nucleaire, CHU de Strasbourg, (France); Detour, J.; Beretz, L. [radiopharmacie, CHU de Strasbourg, (France); Chabrier, G.; Goichot, B. [medecine interne et nutrition, CHU de Strasbourg, (France)

2009-05-15

262

Thyroid medullary carcinoma and PET/CT with {sup 18}F-DOPA in the post surgery follow up: preliminary results; Carcinome medullaire de la thyroide et TEP/TDM a la {sup 18}F-DOPA dans le suivi post-chirurgical: resultats preliminaires  

Energy Technology Data Exchange (ETDEWEB)

Purpose: to study the contribution of the PET/CT with {sup 18}F DOPA in the therapy follow-up of patients with a history of medullary thyroid carcinoma and biological suspicion of residual disease or recurrence. Conclusions: The preliminary results show the interest of the PET/CT with {sup 18}F DOPA in the therapy follow-up and the management of patients suffering of medullary thyroid carcinoma in biological relapse. (N.C.)

Keomany, J.; Rust, E.; Constantinesco, A.; Imperiale, A. [CHU de Strasbourg, Service de biophysique et medecine nucleaire, 67 (France); Detour, J. [CHU de Strasbourg, Service de radiopharmacie, 67 (France); Chabrier, G.; Goichot, B. [CHU de Strasbourg, Service de medecine interne, endocrinologie et nutrition, 67 (France); Schneegans, O. [FNCLCC Paul-Strauss, 67 - Strasbourg (France)

2010-07-01

263

Irradiation of hepatocellular carcinoma: Impact of breathing on motions and variations of volume of the tumor, liver and upper abdominal organs; L'irradiation des carcinomes hepatocellulaires: impact de la respiration sur les mouvements et variations de volume de la tumeur, du foie et des organes intra-abdominaux  

Energy Technology Data Exchange (ETDEWEB)

Purpose: To evaluate the amplitude of motion and the variations of volume of the tumor, the liver and upper abdominal organs induced by breathing during the irradiation of hepatocellular carcinoma (H.C.C.). Material and methods: Two scanners were performed in inhale and in exhale not forced in 20 patients with a H.C.C.. The liver (left/right lobes), the tumor, the duodenum, the two kidneys and the pancreas were delineated on each acquisition. The superposition of the two spirals made it possible to measure the displacements and variations of volume of these structures in the cranio caudal (C.C.), lateral (Lat), and anteroposterior (A.P.) directions. Results:The mean displacement of the tumour in C.C., Lat and A.P. was of 19.7 {+-} 8.3 mm, 4.5 {+-} 2.3 mm, and 8.9 {+-} 6.5 mm. The greatest amplitude of movement was obtained in C.C. for the right and left hepatic lobes (19 {+-} 6.5 mm, 10 {+-} 5.6 mm), the duodenum(12.6 {+-} 6.4 mm), the kidneys right and left (15.5 {+-} 6.1 mm, 16.2 {+-} 10 mm) and the pancreas (13.2 {+-} 6 mm). No significant variation of volume was observed for these organs. Conclusion: The movements of the tumour, the liver and the abdominal organs, induced by breathing are significant. The respiratory gating appears essential in particular with the development of new techniques of irradiation such as the intensity-modulated radiotherapy (I.M.R.T.) or the stereotactic body radiation therapy (S.B.R.T.). (authors)

Kubas, A.; Mornex, F.; D' Hombres, A.; Lorchel, F.; Chapet, O. [Centre hospitalier Lyon-Sud, Service de Radiotherapie-oncologie Rhone-Alpes, 69 - Pierre-Benite (France); Merle, P. [Hopital de l' Hotel-Dieu, Service d' Hepatogastroenterologie, 69 - Lyon (France)

2008-12-15

264

Study of the correlation between immunohistochemistry of the initial tumor and PET/CT after recombining TSH (RHTSH) in case of tumor recurrence in differentiated thyroid carcinomas; Etude de la correlation entre l'immunohistochimie de la tumeur initiale et la TEP-FDG/TDM apres TSH recombinante (RHTSH) en cas de recidive tumorale dans les carcinomes thyroidiens differencies  

Energy Technology Data Exchange (ETDEWEB)

Purpose: In patients with differentiated thyroid carcinoma, the correlation between the value of thyroglobulin and the positivity of F.D.G.-PET remains controversial. We looked at whether the immunohistochemical criteria of the original tumor could be predictive of a positive PET in cases of tumor recurrence. Conclusions: on a larger series, we have not confirmed the results of Hooft (JCEM 2005). This study did not reveal immunohistochemical marker, present in the original tumor, which would be predictive of a positive PET-F.D.G. in the search for a recurrence. The study of NIS and GLUT1 expression is underway. (N.C.)

Lansoy-Kuhn, C.; Mechken, F.; Edet-Sanson, A.; Vera, P. [Centre Becquerel and QuantIF LITIS EA4108, Service de medecine nucleaire, 76 - Rouen (France); D' anjou, J.; Cornic, M. [Centre Henri-Becquerel, service anatomopathologie, 76 - Rouen (France)

2010-07-01

265

Air breath control radiotherapy in severe insufficiency respiratory patients with N.S.C.L.: application for deformable registration method in thoracic radiotherapy; Radiotherapie avec blocage respiratoire pour les grands insuffisants respiratoires atteints d'un carcinome pulmonaire non a petites cellules (Protocole RESPI 2000): application a la modelisation des deformations d'organes par recalage deformable  

Energy Technology Data Exchange (ETDEWEB)

Purpose. Using deformable registration methods from a phase two clinical study of air breath control during radiotherapy in patients suffering from severe respiratory insufficiency and non-small cell lung carcinoma. Patients and methods, Between April 2002 and November 2005, 22 patients with severe respiratory insufficiency were treated with curative intent by conformal therapy combined with active breathing control. Results. After a mean of follow-up of 22 months, the local control rate is 28% and the method is feasible despite the severe respiratory insufficiency. However the overall survival is still poor due to metastatic widespread. For the second part of the study, the clinical protocol was also used for two studies using deformable registration methods. In the first study, a deformable registration method has been developed in order to register several breath-hold 3D CT of the same patient acquired at several days of interval. It allowed quantifying the inter-fraction breath-hold reproducibility by analysing the resulting displacement field. For 6 patients, the breath-hold was effective, while for 2 patients, motion greater than 10 mm were detected. The second study aimed to simulate 4D images from 3D breath-hold images. Developing an ad-hoc methodology based on the interpolation of 3D dense deformation fields performed it. The approach has been validated with expert selected landmarks, with accuracy lower than 3 mm. Conclusion. ABC is feasible, even in case of severe insufficiency respiratory syndrome but metastatic widespread disease is still a major challenge even with an acceptable local control rate without serious side effects: regarding the deformable registration method. Such artificial 4D images could allow decreasing the dose need to acquire a full 4D image, to simulate irregular breathing pattern and to be used for 4D dosimetry planning. (author)

Sarrut, D.; Pommier, P.; Carrie, C. [Centre Leon-Berard, Dept. de Radiotherapie, CREATIS, Unite CNRS 5515, Inserm 630, 69 - Lyon (France); Perol, D. [Centre Leon-Berard, Dept. de Biostatistique, 69 - Lyon (France)

2006-11-15

266

Tolerance and efficacy of conformal radiotherapy for hepatocellular carcinoma in cirrhotic patients. Results of the French RTF1 phase 2 trial; Tolerance et efficacite de la radiotherapie de conformation en cas de carcinome hepatocellulaire chez le patient cirrhotique. Resultats de l'essai de phase II RTF1  

Energy Technology Data Exchange (ETDEWEB)

Purpose. - While some patients presenting with hepatocellular carcinoma (HCC) benefit from curative therapies (transplantation, surgery, percutaneous ablation), others are only candidates for palliative options such as chemo-embolization or symptomatic care. Although conventional external-beam radiotherapy of the liver is regarded as little efficient and potentially toxic in cirrhotic patients, 3-dimensional conformal radiotherapy (CRT), by decreasing the amount of normal liver included in the radiation portal, allows dose escalation to occur without increasing the risk of radiation-induced hepatitis. This trial was designed to assess the efficacy and tolerance of CRT for small-size HCC in cirrhotic patients. Patients and methods. - Prospective phase II trial including stage A/B cirrhotic patients with small-size HCC not suitable for curative treatments; CRT consisted in a standard fractionation radiation, with a total dose of 66 Gy. Results. - Twenty-seven patients were included, 15 of whom had previously been treated for HCC; mean age was 68. Among the 23 assessable patients, 18 (78%) presented with complete response, 3 (13%) with partial response, and 2 with no response. Acute complications occurred in 24 patients, and were mainly acceptable (grade 1/2: 22 patients, grade 3/4: 11 patients, 4 (15%) of whom had clinical and/or hematological toxicities). Only 2 (9%) grade 3/4 clinical and/or hematological late toxicities are reported. Conclusion. - CRT is a non-invasive curative technique highly suitable for small-size HCC in cirrhotic patients; further investigations are needed to compare it to the other available treatments, and to integrate it into the curative therapeutic algorithm of HCC. (author)

Mornex, F.; Girard, N.; Wautot, V.; Khodri, M. [Centre Hospitalier Lyon-Sud, Dept. de Radiotherapie-Oncologie, 69 - Pierre-Benite (France); Merle, P.; Kubas, A.; Trepo, C. [Hopital de l' Hotel-Dieu, Service d' hepatogastroenterologie, 69 - Lyon (France); Beziat, C. [Hopital de l' Hotel-Dieu, Dept. de Radiologie, 69 - Lyon (France)

2005-11-15

267

Diagnostic performances of the S.R.S. (scintigraphy of somatostatin receptors) and of the PET-F.D.G. in the extension situation of the well differentiated endocrine carcinomas at high Ki67; Performances diagnostiques de la SRS et de la TEP-FDG dans le bilan d'extension des carcinomes endocrines bien differencies a Ki67 eleve ({>=} 10%)  

Energy Technology Data Exchange (ETDEWEB)

The results suggest that among 90% of patients with well differentiated endocrine carcinomas at high Ki, the PET-F.D.G. is more noticeable or equivalent to the scintigraphy of somatostatin receptors (S.R.S.). (N.C.)

Abgrala, R.; Leboulleux, S.; Deandreis, D.; Lumbroso, J.; Schlumberger, M.; Baudin, E. [Medecine nucleaire, institut Gustave-Roussy, Villejuif, (France); Auperin, A. [Biostatistiques, Institut Gustave-Roussy, Villejuif, (France); Dromain, C. [radiologie, institut Gustave-Roussy, Villejuif, (France); Guigay, J. [pneumologie, institut Gustave-Roussy, Villejuif, (France); Ducreux, M. [hepato-gastroenterologie, Institut Gustave-Roussy, Villejuif, (France)

2009-05-15

268

Whole brain radiation with supplementary boost for patients for unique brain metastasis from a primitive lung cancer; Experience de l'irradiation encephalique totale avec escalade de dose focalisee pour le traitement des metastases cerebrales uniques d'un carcinome bronchopulmonaire  

Energy Technology Data Exchange (ETDEWEB)

Purpose. - To assess the potential benefit of a boost in patients treated with whole brain irradiation by a conventional linear accelerator for lung cancer solitary brain metastasis. Patients and methods. - From 2002 to 2006, a retrospective analysis was carried out from 64 unselected consecutive patients with secondary brain metastasis from lung cancer, treated with whole brain irradiation without surgical resection. Thirty patients (47%) received a boost in their brain metastases. Three potential prognostic factors were studied: sex, RPA score and improvement of neurological symptoms after radiotherapy. An analysis was conducted to determine whether an additional dose may improve survival in the absence of surgical resection. Results. - The mean follow-up was 4.9 months. The median overall survival was 8.5 months (6.4 to 10.7 months). The total dose of radiotherapy was the only significant prognostic factor for overall survival. The median overall survival was 6.2 months for patients without additional radiation versus 11.2 months for patients receiving a boost dose (p = 0.011). Sex, RPA score and improvement of neurological symptoms after radiotherapy were not found as prognostic factors for overall survival. Conclusions. - Boost delivered after whole brain radiation therapy by a conventional particle accelerator may provide a benefit in selected patients, especially for centres that do not have radiotherapy techniques in stereotactic conditions. This warrants further prospective assessment. (authors)

Levy, A.; Lamproglou, I. [Service de radiotherapie, groupe hospitalier Pitie-Salpetriere, 47-83, boulevard de l' Hopital, 75013 Paris (France); Chargari, C. [Service de radiotherapie, groupe hospitalier Pitie-Salpetriere, 47-83, boulevard de l' Hopital, 75013 Paris (France); Service de radiotherapie, hopital d' instruction des armees Val-de-Grace, 75005 Paris (France); Mazeron, J.J. [Service de radiotherapie, groupe hospitalier Pitie-Salpetriere, 47-83, boulevard de l' Hopital, 75013 Paris (France); Universite Pierre-et-Marie-Curie Paris 6, 4, place Jussieu, 75005 Paris (France); Krzisch, C. [Service de radiotherapie, CHU d' Amiens-Picardie, place Victor-Pauchet, 80054 Amiens cedex (France); Assouline, A. [Service de radiotherapie, groupe hospitalier Pitie-Salpetriere, 47-83, boulevard de l' Hopital, 75013 Paris (France); Universite Pierre-et-Marie-Curie Paris 6, 4, place Jussieu, 75005 Paris (France); Service de radiotherapie, CHU d' Amiens-Picardie, place Victor-Pauchet, 80054 Amiens cedex (France)

2011-08-15

269

Epidermoid carcinomas of the anal channel treated by concomitant association of radiotherapy and chemotherapy by 5-fluorouracil and cisplatin. Evaluation of functional results; Carcinomes epidermoides du canal anal traites par association concomitante de radiotherapie et de chimiotherapie par 5-fluorouracile et cisplatine. Evaluation des resultats fonctionnels  

Energy Technology Data Exchange (ETDEWEB)

The good results got after chemoradiotherapy are confirmed. The quality of tumoral response after the first series of irradiation is probably the most powerful factor of independent prediction of survival in complete remission. (N.C.)

Deniaud-Alexandre, E.; Touboul, E.; Huguet, F.; Pene, F.; Schlienger, M. [Hopital Tenon, APHP, Service d' Oncologie-Radiotherapie, 75 - Paris (France); Tiret, E.; Parc, R. [Hopital Saint-Antoine, APHP, Service de Chirurgie Digestive, 75 - Paris (France); Sezeur, A. [Groupe Hospitalier de la Pitie-Salpetriere, APHP, Service de Chirurgie Digestive, 75 - Paris (France); Hannoun, L. [Groupe Hospitalier Diaconesses Croix-Saint-Simon, Service de Chirurgie Digestive, 75 - Paris (France); Houry, S. [Hopital Tenon, APHP, Service de Chirurgie Digestive, 75 - Paris (France)

2006-11-15

270

Conservative treatment of epidermoid carcinomas of the anal duct by external irradiation followed by low dose rate brachytherapy by iridium 192; Traitement conservateur des carcinomes epidermoides du canal anal par irradiation externe suivie de curietherapie de bas debit de dose par Iridium 192  

Energy Technology Data Exchange (ETDEWEB)

The association of external radiotherapy and brachytherapy is an efficient loco regional treatment of epidermoid carcinomas of the anal duct with an acceptable delayed toxicity rate and a high rate of the sphincter function conservation. (N.C.)

Minsat, M.; Moureau-Zabotto, L.; Giovannini, M.; Lelong, B.; Viret, F.; Bories, E.; Tallet, A.; Salem, N. [Institut Paoli-Calmettes, 13 - Marseille (France)

2007-11-15

271

Survival over ten years after chemotherapy by paclitaxel and carboplatin, followed by a concomitant chemo-radiotherapy in nasopharyngeal undifferentiated carcinomas; Survie a dix ans apres chimiotherapie par paclitaxel et carboplatine, suivie d'une chimioradiotherapie concomitante dans les carcinomes indifferencies du nasopharynx  

Energy Technology Data Exchange (ETDEWEB)

Based on 28 patients suffering from a cavum carcinoma and having been treated by neo-adjuvant chemotherapy (with paclitaxel and carboplatin) followed by a concomitant chemo-radiotherapy and an adjuvant chemotherapy, the authors analyse the response over time and identify the main causes of death. They also conclude that randomized studies are necessary to better asses the treatment efficiency. Short communication

Djekkoun, R.; Ferdi, N.; Bouzid, K. [CHU de Constantine, Constantine (Algeria)

2011-10-15

272

Mediastinal radiotherapy after multidrug chemotherapy and prophylactic cranial irradiation in patients with SCLC - treatment results after long-term follow-up and literature overview; Radiotherapie mediastinale apres chimiotherapie et irradiation prophylactique de l'encephale chez des patients atteints d'un carcinome bronchique a petites cellules - Resultats et revue de la litterature  

Energy Technology Data Exchange (ETDEWEB)

Introduction. - Curative therapy for patients with small-cell lung cancer (SCLC) is based on multidrug chemotherapy combinations and radiotherapy. After a long time follow-up, the aim of the study was to evaluate the efficacy and toxicity of sequential chemo-radiotherapy and the effect of prophylactic cranial irradiation (PCI). Methods. - From 1995-2005, 96 patients with SCLC (64 limited-disease [LD], 32 extensive-disease [ED]; median age 61 years [range 39-79]) were treated at our department with varying chemotherapy regimens and sequential mediastinal radiotherapy (50 Gy + 10 Gy boost in case of residual disease after chemotherapy). Afterwards, 15 patients with LD, good general condition and at least partial response after local treatment received PCI (30 Gy). Results. - After a median follow-up of 78.6 months, 20 patients remained alive (20.8%, median survival time 18.2 months). The 2-/5-year overall survival rates were 33.8% and 12.6%, the 2-/5-year loco-regional control rates were 30.3% and 24.5%, respectively. Distant metastases occurred in 43 patients (24 cerebral). Cerebral metastasis occurred in 6.7% and 27.2% of the patients with PCI and without PCI respectively. Only tumor stage showed a statistically significant impact on overall survival and loco-regional control in multivariate analysis. Radiotherapy was well tolerated. Grade 3/4 toxicity occurred in seven patients. Prognosis of patients with SCLC remains poor. Administration of PCI in selected patients bears a decrease in the incidence of cerebral metastases. Alternative chemotherapy schemes as well as irradiation schemes and techniques should be the substance of future randomized trials. (authors)

Herrmann, M.K.A.; Bloch, E.; Overbeck, T.; Wolff, H.A.; Hille, A.; Hess, C.F.; Christiansen, H. [Department of Radiotherapy, University Hospital Goettingen, Robert-Koch-Str. 40, 37075 Goettingen (Germany); Koerber, W. [Department of Pneumology, Weende Hospital, Section Lenglern, Pappelweg 5, 37120 Bovenden-Lenglern (Germany); Vorwerk, H. [Department of Hematology and Oncology, University Hospital Goettingen, Robert-Koch-Str. 40, 37075 Goettingen (Germany); Muller, M.; Pradier, O. [Department de cancerologie, CHU Morvan, 5, avenue Foch, 29200 Brest cedex (France)

2011-04-15

273

Operable bulky stages IB and 2 squamous-cell carcinomas of uterine cervix treated with combined primary radiation therapy and surgery; Carcinomes epidermoides du col uterin operables de stades IB et 2 de gros volume traites par irradiation premiere et chirurgie  

Energy Technology Data Exchange (ETDEWEB)

Operable bulky stages IB and II squamous-cell carcinomas of uterine cervix treated with combined primary radiation therapy and surgery. Purpose. - To identify prognostic factors and treatment toxicity in a series of operable bulky stages I and II cervical carcinomas treated with a therapeutic modality combining primary irradiation and surgery. Patients and methods. - Between July 1982 and May 1996, 66 patients with bulky squamous-cell cervical carcinomas (stages IB2, IIA, and IIB with 1/3 proximal parametrial invasion) underwent primary external beam pelvic radiation therapy (37.40 Gy to 40 Gy over 4.5 weeks) and low-dose. (author)

Bernard, A.; Touboul, E.; Deniaud-Alexandre, E. [Hopital Tenon, Oncologie-Radiotherapie, 75 - Paris (France); Lefranc, J.P.; Blondon, J. [Groupe Hospitalier la Pitie-Salpetriere, Chirurgie Gynecologique, 75 - Paris (France); Genestie, C. [Groupe Hospitalier la Pitie-Salpetriere, Anatamopathologie, 75 - Paris (France); Uzan, S. [Hopital Tenon, Gynecologie Obstetrique, 75 - Paris (France)

2002-04-01

274

Statistical study of a series of 672 carcinomas of the cervix: results and complications according to age and modalities of treatment; Etude statistique d`une serie de 672 carcinomes du col uterin. Resultats et complications selon l`age et les modalites de traitement  

Energy Technology Data Exchange (ETDEWEB)

The study on 672 infiltrating carcinomas of the cervix treated from 1977 until the end of 1991, by a radiosurgical combination or by exclusive irradiation. The radiosurgical series includes stages 1 B and II and patients under 50 years because of the therapeutic protocol. Most of the patients over 50 years and all stages III were treated by exclusive irradiation. External beam irradiation was most often performed in 4 fields by linear accelerator of 12 and 25 MeV. Utero vaginal brachytherapy used the technique of molds. In 55 cases, a complementary interstitial brachytherapy was applied on residual node. A computer dosimetry was made for each patient with calculation of the doses delivered to organs at risk and to node areas . The results at 5 years are as follows for the total series: locoregional control (LRC) 79%, specific survival (SS) 73%, overall survival 70%. For stage I, the LRC of the radiosurgical series is 92%, that of the series of exclusive irradiation 87%. For stage II, the LRC is 70% in the radiosurgical series and 79% in the series of exclusive irradiation. Conversely, for distal stage II, the difference is very significant in favour of exclusive irradiation (LRC 31%/77%, SS 26%/70%). If we consider the results according to age, the difference for distal stage II comes mostly from patients under 50 years and especially those aged 40 years or under. For stage III, the LRC is 61% for patients over 50 years and 34% for those aged 50 years or under. As the nodes, the results of surgical pieces and lymphadenectomy are studied. The patients under 40 years in stages II and III present more metastases than others. Among the therapeutic factors, the dose rate and the treatment duration were particularly studied. A detailed study of the complications is made for the radiosurgical series as for the series of exclusive irradiation according to the French Italian glossary of complications as well as a study of the factors inducing them.

Pernot, M.; Hoffstetter, S.; Peiffert, D.; Carolus, J.M.; Guillemin, F.; Verhaeghe, J.L.; Marchal, C.; Luporsi, E.; Beckendorf, V.; Stines, J.; Aletti, P.; Dartois, D.; Lesur, A.; Bey, P. [Centre de Lutte Contre le Cancer, 54 - Nancy (France)

1995-12-31

275

Radiosensitivity of centro pelvis carcinomas of the uterine cervix with a diameter higher than 4 cm. Study of prognosis factors of the tumor response; Radiosensibilite des carcinomes centropelviens du col uterin de diametre superieur a 4 cm. Etude des facteurs pronostiques de la reponse tumorale  

Energy Technology Data Exchange (ETDEWEB)

In this study, has been recovered four parameters in interaction with the tumor radiosensitivity of the carcinomas of the uterine cervix. The hemoglobinemia was this one that had the highest importance. These data confirm the importance of the relation between tissues oxygenation and the radiosensitivity of the uterus carcinomas. (N.C.)

Le Floch, O.; Ryo, N.; Garaud, P.; Calais, G.; Bougnoux, P.; Lansac, J.; Body, G. [Hopital Bretonneau, 37 - Tours (France)

1998-09-01

276

Naso pharyngeal carcinoma. Modalities of radiation therapy and combinations of radiotherapy and chemotherapy: state of art and perspectives; Les carcinomes du nasopharynx. Les modalites de la radiotherapie et les associations de la radiotherapie et de la chimiotherapie: etat actuel et perspectives  

Energy Technology Data Exchange (ETDEWEB)

Nasopharyngeal carcinoma (NPC) is a highly radiosensitive and chemo-sensitive. In the patient with locally advanced tumours, the results of conventional radiotherapy are unsatisfactory with significant rates of both local recurrences and distant metastases. The aim of this review is to report the innovative strategies for treatment of the nasopharyngeal carcinoma. Altered fractionation techniques can improve local control. The impact of the innovative techniques, including conformal radiation, stereotactic radiation and IMRT, on survival, must be evaluated in randomized trials. The encouraging early results obtained with concurrent (more than sequential) chemotherapy and radiotherapy must be confirmed in prospective randomized trial in endemic areas. (authors)

Daoud, J.; Frikha, M. [Centre Hospitalier Universitaire Habib Bourguiba, Sfax (Tunisia)

2001-11-01

277

Fluoro choline({sup 18}F) has a clinical usefulness in prostate cancer and in hepatocellular carcinoma sometimes in the same patient;La fluorocholine({sup 18}F) a une utilite clinique dans le cancer de la prostate et le carcinome hepatocellulaire parfois chez le meme malade  

Energy Technology Data Exchange (ETDEWEB)

Case report: In order to stage hepatocellular carcinoma (H.C.C.), a patient was referred to PET/CT using fluorodeoxyglucose({sup 18}F) (F.D.G.) and, if necessary, fluoro choline({sup 18}F) (F.C.H.). H.C.C. was proven by biopsy of a hepatic mass discovered on CT performed for a biological recurrence of prostate cancer. Result: F.D.G. PET/CT did not show any anomaly. F.C.H. PET/CT was thus performed and showed various foci: the hepatic mass, a large abdominal adenopathy and an unexpected sub centimeter lung nodule. The diagnostic uncertainty mostly concerned this lung nodule which was biopsied and consisted of a metastasis of the prostate cancer. Due to the presence of two metastatic cancers, the patient's management was altered, with chemotherapy for the H.C.C. and hormone therapy for the prostate cancer. Conclusion: Several types of cancer take-up fluoro choline({sup 18}F), which is a powerful tool to detect metastases, in particular in case of rising levels of marker with a negative F.D.G. PET/CT. Even when F.D.G. PET/CT is positive, F.C.H. may reveal unexpected foci with other metabolic characteristics, although it is not specific of a given primary cancer, as well as F.D.G.. For staging of H.C.C., we thus recommend to perform PET/CT with both tracers. (authors)

Balogova, S.; Kerrou, K.; Huchet, V.; Gutman, F.; Montravers, F.; Talbot, J.N. [Universite Pierre-et-Marie-Curie, Service de medecine nucleaire, hopital Tenon, AP-HP, 75 - Paris (France); Balogova, S. [Universite Comenius, Bratislava (Slovakia); Bumsel, F. [Universite Pierre-et-Marie-Curie, Service d' hepato-gastro-enterologie, hopital Saint-Antoine, AP-HP, 75 - Paris (France); Nataf, V. [Hopital Tenon, AP-HP, Radiopharmacie, 75 - Paris (France); Mal, F. [Institut mutualiste Montsouris, Departement de pathologie digestive, 75 - Paris (France)

2010-07-15

278

Metastatic calcifications of hyperparathyroidism detected by M.D.P.- Tc 99 m bone scintigraphy in patients with parathyroid carcinoma: A case report; Les calcifications metastatiques de l'hyperparathyroidie identifiees par scintigraphie osseuse au M.D.P.-Tc 99 m dans le cadre du carcinome parathyroidien: a propos d'un cas  

Energy Technology Data Exchange (ETDEWEB)

The authors report a case of gastric, renal, pulmonary, and myocardial uptake of M.D.P.-Tc 99 m in a patient with parathyroid carcinoma. Parathyroid carcinoma is a rare cause of primary hyperparathyroidism which becomes complicated during its evolution by metastatic calcifications. Metastatic calcifications are frequently located in lungs and heart. If an adequate treatment is not undertaken, these calcifications progress and evolve into severe respiratory and cardiac complications. In our patient, quasi-complete disappearance of metastatic calcifications on the follow-up bone scintigraphy, performed four weeks after surgical cure of parathyroid tumour, indicates the great interest of this examination in early identification of metastatic calcifications and monitoring of their disappearance after treatment. (authors)

Doudouh, A.; Biyi, A.; Oufroukhi, Y.; Zekri, A. [Hopital Militaire Mohammed-5, Service de Medecine Nucleaire, Rabat (Morocco); Sekkach, Y. [Hopital Militaire Mohammed-5, Service de Medecine B, Rabat (Morocco)

2008-02-15

279

Impact of {sup 18}F-fluoro-deoxy-glucose positron emission tomography (F.D.G.-PET) in recurrent colorectal cancer; Evaluation de la TEP au {sup 18}F-F.D.G. dans l'exploration de la recidive des carcinomes colorectaux  

Energy Technology Data Exchange (ETDEWEB)

Purpose The aim of the study was to evaluate the diagnostic performance, the prognosis factors and the therapeutic impact of {sup 18}F-F.D.G. positron emission tomography (F.D.G.-PET) in the detection of recurrent colorectal cancers. Methods Sixty PET/CT with {sup 18}F-F.D.G. and CT were performed in 52 patients, at the Paul Papin cancer center between 2003 and 2005, following suspicion of colorectal cancer relapse. The F.D.G.-PET impact on the clinical management was studied by examination of multidisciplinary consultations results. Survival analysis were realized with a mean follow up of 2.2 years. Results Recurrence was confirmed for 50 explorations by histologic (n = 32), radiologic (n = 14) or clinical (n = 4) findings. Twenty patients died during the time of the study. On a patient based analysis, F.D.G.-PET sensitivity, specificity and overall accuracy were 90, 90, 90% respectively compared with 74, 50 and 70% for CT. F.D.G.-PET changed the clinical management in 18 cases (30%). A positive F.D.G.-PET signal, more than one hepatic lesion, more than two lymph node lesions detected on F.D.G.-PET and more than two hepatic lesions on CT were characterized as bad prognostic factors for survival. Multivariate analysis showed that the only independent bad prognostic factor was the F.D.G.-PET detection of more than two liver lesions. Conclusion These results confirmed the important impact of F.D.G.-PET in the clinical management of patients with a suspected recurrence of colorectal cancer. (authors)

Metrard, G.; Morel, O.; Girault, S.; Soulie, P.; Guerin-Meyer, V.; Lorimier, G.; Gamelin, E. [Centre Paul-Papin, 49 - Angers (France); Metrard, G.; Jeanguillaume, C.; Berthelot, C.; Le Jeune, J.J. [Centre Hospitalier Universitaire, Service de Medecine Nucleaire, 49 - Angers (France); Parot-Schinkel, E. [Centre Hospitalier Universitaire, Service de Recherche Clinique, 49 - Angers (France)

2009-09-15

280

Tumeur neuroendocrine mammaire primitive: ? propos d'un cas rare  

Science.gov (United States)

Les carcinomes neuroendocrine primitifs du sein sont des tumeurs rares et représentent 2 à 5% des cancers mammaires. Nous rapportons le cas de localisation mammaire chez une patiente de 50 ans. Il s'agit d'une tumeur classée T4d N1 M0. La tumeur est suspecte radiologiquement. Une microbiopsie est réalisée. L’étude anatomopathologique et immunohistochimique est en faveur d'une tumeur neuroendocrine primitive du sein à grande cellules exprimant les récepteurs progestéroniques seulement. Vu le caractère inflammatoire de la tumeur une chimiothérapie est démarrée avec bonne évolution clinique. A la fin de la chimiothérapie on prévoit de réaliser une mastectomie avec curage axillaire et en fonction des résultats définitifs, une radiothérapie. Une hormonothérapie sera envisagée une 2ème étude immunohistochimique sur la pièce de mastectomie. Vu la rareté des carcinomes neuroendocrines mammaires primitifs, il n'existe pas de standard thérapeutique et le pronostic demeure difficile à déterminer. PMID:24772221

Laabadi, Kamilia; Jayi, Sofia; El Houari, Aziza; Tawfic, Harmouch; Bouguern, Hakima; Chaara, Hikmat; Melhouf, Abdilah; Amarti, Afaf

2013-01-01

 
 
 
 
281

Wavelength and light-dose dependence in tumour phototherapy with haematoporphyrin derivative.  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Red light (c. 630 nm) is almost universally used in tumour phototherapy as it is the most penetrating of the porphyrin excitation wavebands. However, measurements of tumour attenuation of light of different wavelengths and of the excitation spectrum of haematoporphyrin derivative in vitro suggested that green light might be more efficient than red in destroying thin tumours. Experimentally, we confirmed this for tumours up to approximately 1.2 mm thick, a depth exceeding that of most carcinom...

Gemert, J. C.; Berenbaum, M. C.; Gijsbers, G. H.

1985-01-01

282

Tonsillectomy and Adenoidectomy  

Medline Plus

Full Text Available ... while sleeping. This condition is known as obstructive sleep apnea or OSA. Taking the tonsils and adenoids ... of bleeding too much. In cases of obstructive sleep apnea or OSA, the doctor is able to ...

283

Tonsillectomy and Adenoidectomy  

Medline Plus

Full Text Available ... infections or inflammation. This can sometimes lead to hearing loss. Symptoms & Causes The most common reason that ... adenoids and clogged Eustachian tubes, can lead to hearing loss. Sometimes hearing loss can cause speech problems. ...

284

Snoring  

Medline Plus

Full Text Available ... caused by a variety of things. It's the soft tissues in the back of the mouth and ... it and they vibrate. It's the uvula, the soft palate, the tonsils, the adenoids and it is ...

285

Tonsillectomy and Adenoidectomy  

Medline Plus

Full Text Available ... Eustachian tube The adenoids are located behind the soft palate. The soft palate is the back, muscular part of the ... It dangles down from the middle of the soft palate. Behind the uvula, there is a passageway ...

286

Oral Cancer Removal and Palate Reconstruction  

Medline Plus

Full Text Available ... can see where the Page 3 of 15 trigeminal mer…nerve is emerging from the skull base ... head up along the second division of the trigeminal nerve toward the brain. 00:13:55 Adenoid ...

287

Coblation Assisted Tonsillectomy  

Medline Plus

Full Text Available ... Retractor for the tonsillar pillars. This is a mirror that I use to visualize the adenoids. These ... a plica semilunares and there’s actually a little space in there where, if you can get in ...

288

Immunohistochemical study of androgen, estrogen and progesterone receptors in salivary gland tumors  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in english The aim of this work was to study the immunohistochemical expression of androgen receptor, estrogen receptor and progesterone receptor in pleomorphic adenomas, Warthin's tumors, mucoepidermoid carcinomas and adenoid cystic carcinomas of salivary glands. A total of 41 pleomorphic adenomas, 30 Warthin [...] 's tumors, 30 mucoepidermoid carcinomas and 30 adenoid cystic carcinomas were analyzed, and the immunohistochemical expression of these hormone receptors were assessed. It was observed that all cases were negative for estrogen and progesterone receptors. Androgen receptor was positive in 2 cases each of pleomorphic adenoma, mucoepidermoid carcinoma and adenoid cystic carcinoma. In conclusion, the results do not support a role of estrogen and progesterone in the tumorigenesis of pleomorphic adenomas, Warthin's tumors, mucoepidermoid carcinomas and adenoid cystic carcinomas. However, androgen receptors can play a role in a small set of salivary gland tumors, and this would deserve further studies.

Fabio Augusto, Ito; Kazuhiro, Ito; Ricardo Della, Coletta; Pablo Agustín, Vargas; Márcio Ajudarte, Lopes.

289

Tonsillectomy and Adenoidectomy  

Medline Plus

Full Text Available ... middle ear infections or inflammation. This can sometimes lead to hearing loss. Symptoms & Causes The most common ... to swollen adenoids and clogged Eustachian tubes, can lead to hearing loss. Sometimes hearing loss can cause ...

290

Tonsillectomy and Adenoidectomy  

Medline Plus

Full Text Available ... Last reviewed: 03/14/2012 1 Swelling and inflammation around the adenoids can cause blockage of the ... with pus and cause middle ear infections or inflammation. This can sometimes lead to hearing loss. Symptoms & ...

291

 

Medline Plus

Full Text Available ... and adenoids Snoring by itself is not necessarily dangerous, but some snorers have such severe airflow blockage ... This condition, called sleep apnea, is common but dangerous if left untreated.

292

A report of laryngeal adenocystic carcinoma metastatic to the spleen and the role of splenectomy in the management of metastatic disease: a case report  

Directory of Open Access Journals (Sweden)

Full Text Available Abstract Introduction Adenoid cystic carcinoma (ACC of the larynx is a rare malignancy characterized by an indolent course and late pulmonary metastases. Metastases from the larynx to the spleen are an unusual event. In the present report, we discuss a patient with adenoid cystic carcinoma of the larynx metastatic to the spleen. A review of the literature did not yield any other such incidents. We review the clinical presentation and course of adenoid cystic carcinoma, as well as the role of splenectomy for metastases. Case presentation We present a case of laryngeal adenoid cystic carcinoma in a 26-year-old Caucasian man treated with total laryngectomy and ionizing radiation. He initially developed asynchronous pulmonary metastases, which were resected. Our patient subsequently presented with a symptomatic splenic lesion consistent with metastatic disease, for which he underwent laparoscopic splenectomy. Conclusions Splenectomy might be indicated for isolated metastases. A splenectomy effectively addresses symptoms and serves as a cytoreduction modality.

Murray Bryce W

2010-07-01

293

Otitis Media  

Medline Plus

Full Text Available ... tube remains plugged, the fluid cannot drain and begins to collect in the middle ear. Adenoids are ... can also affect adults. Middle ear inflammation often begins when infections that cause sore throats, colds, or ...

294

Tonsillectomy and Adenoidectomy  

Medline Plus

Full Text Available ... while sleeping. This condition is known as obstructive sleep apnea or OSA. Taking the tonsils and adenoids help ... of bleeding too much. In cases of obstructive sleep apnea or OSA, the doctor is able to diagnose ...

295

Oral Cancer Removal and Palate Reconstruction  

Medline Plus

Full Text Available ... talk a little bit about the expected post-op course. I think most patients find this operation ... we rely on MRI and CT Scanning post-op. Unfortunately, with adenoid cystic carcinoma, many of these ...

296

Coblation Assisted Tonsillectomy  

Medline Plus

Full Text Available ... used for tamponading and a variety of tonsillar clamps are used, a curved tonsillar tenaculum or straight. ... I use to visualize the adenoids. These are clamps and red tubes that we use to retract ...

297

Management of difficult airway by retrograde tracheal intubation  

International Nuclear Information System (INIS)

A case of difficult intubation is presented in a patient of adenoid carcinoma with a large right-sided facial defect. She was managed with radiotherapy and a myocutaneous flap reconstruction was done with retrograde tracheal intubation. (author)

298

Coblation Assisted Tonsillectomy  

Medline Plus

Full Text Available ... published in Laryngology and Otology in 2002. This double-blinded randomized study used the patients as their ... to visualize the adenoids. These are clamps and red tubes that we use to retract the palate ...

299

Oral Cancer Removal and Palate Reconstruction  

Medline Plus

Full Text Available ... to the next scan, you can appreciate a feature that is quite typical for adenoid cystic carcinoma. ... Again, I think one of the other important features here is if we look at this slide, ...

300

Tonsillectomy and Adenoidectomy  

Medline Plus

Full Text Available ... for adults as well. Tonsillectomy and adenoidectomy, or T&A, can help to prevent frequent sore throats ... the adenoids. The combined operation is called a T&A. The surgeon may decide to do one ...

 
 
 
 
301

Oral Cancer Removal and Palate Reconstruction  

Medline Plus

Full Text Available ... the trigeminal nerve toward the brain. 00:13:55 Adenoid cystic carcinoma is particularly difficult to treat ... involves having a university dental program nearby. 00:55:05 Many insurance companies, unfortunately, are very stingy ...

302

Otitis Media  

Medline Plus

Full Text Available ... to collect in the middle ear. Adenoids are special glands that help fight infections. They are located ... doctors recommend that a child with tubes wear special earplugs while swimming or bathing so that water ...

303

Coblation Assisted Tonsillectomy  

Medline Plus

Full Text Available ... medication. I have had comments from recovery room nurses who noticed the difference, so after the first ... adenoids. NORMAN SANDERS, M.D. Are your postoperative results similar for chronic tonsillitis versus hypertrophy? EARL HARLEY, ...

304

Tonsillitis  

Science.gov (United States)

... and soft foods, like soups, milkshakes, smoothies, ice pops, or ice cream. Make sure that your child ... Enlarged Adenoids Strep Test: Rapid Strep Test: Throat Culture Strep Throat Tonsils and Tonsillectomies Peritonsillar Abscess All ...

305

Immunohistochemical study of androgen, estrogen and progesterone receptors in salivary gland tumors  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in english The aim of this work was to study the immunohistochemical expression of androgen receptor, estrogen receptor and progesterone receptor in pleomorphic adenomas, Warthin's tumors, mucoepidermoid carcinomas and adenoid cystic carcinomas of salivary glands. A total of 41 pleomorphic adenomas, 30 Warthin [...] 's tumors, 30 mucoepidermoid carcinomas and 30 adenoid cystic carcinomas were analyzed, and the immunohistochemical expression of these hormone receptors were assessed. It was observed that all cases were negative for estrogen and progesterone receptors. Androgen receptor was positive in 2 cases each of pleomorphic adenoma, mucoepidermoid carcinoma and adenoid cystic carcinoma. In conclusion, the results do not support a role of estrogen and progesterone in the tumorigenesis of pleomorphic adenomas, Warthin's tumors, mucoepidermoid carcinomas and adenoid cystic carcinomas. However, androgen receptors can play a role in a small set of salivary gland tumors, and this would deserve further studies.

Fabio Augusto, Ito; Kazuhiro, Ito; Ricardo Della, Coletta; Pablo Agustín, Vargas; Márcio Ajudarte, Lopes.

2009-12-01

306

[Carcinoma ex pleomorphic adenoma occurring in the sublingual gland: a case report].  

Science.gov (United States)

Carcinoma ex pleomorphic adenoma occurring in the sublingual gland is extremely rare. In this report, a case of adenoid cystic carcinoma ex pleomorphic adenoma of the sublingual gland was presented. PMID:25241550

Luo, Chunyuan; Zhang, Qiang; Chen, Linlin; Wang, Yujiang; Tan, Weibing

2014-08-01

307

Immunohistochemical study of androgen, estrogen and progesterone receptors in salivary gland tumors  

Directory of Open Access Journals (Sweden)

Full Text Available The aim of this work was to study the immunohistochemical expression of androgen receptor, estrogen receptor and progesterone receptor in pleomorphic adenomas, Warthin's tumors, mucoepidermoid carcinomas and adenoid cystic carcinomas of salivary glands. A total of 41 pleomorphic adenomas, 30 Warthin's tumors, 30 mucoepidermoid carcinomas and 30 adenoid cystic carcinomas were analyzed, and the immunohistochemical expression of these hormone receptors were assessed. It was observed that all cases were negative for estrogen and progesterone receptors. Androgen receptor was positive in 2 cases each of pleomorphic adenoma, mucoepidermoid carcinoma and adenoid cystic carcinoma. In conclusion, the results do not support a role of estrogen and progesterone in the tumorigenesis of pleomorphic adenomas, Warthin's tumors, mucoepidermoid carcinomas and adenoid cystic carcinomas. However, androgen receptors can play a role in a small set of salivary gland tumors, and this would deserve further studies.

Fabio Augusto Ito

2009-12-01

308

Oral Cancer Removal and Palate Reconstruction  

Medline Plus

Full Text Available ... and talk a little bit about the expected post-op course. I think most patients find this ... and we rely on MRI and CT Scanning post-op. Unfortunately, with adenoid cystic carcinoma, many of ...

309

Otitis Media  

Medline Plus

Full Text Available ... for your specific condition. ©1995-2013, The Patient Education Institute, Inc. www.X-Plain.com ol190106 Last reviewed: 09/21/2013 5 If a child has enlarged or infected adenoids, the doctor may ...

310

Drug: D06938 [KEGG MEDICUS  

Full Text Available D06938 Formula, Drug Keigairengyoto Scutellaria root [DR:D06688], Phellodendron bark [DR:D06689] ... D06777] | Saposhnikovia root [DR:D06787]) Empyema; Chronic ... rhinitis; Chronic ... adenoiditis; Acne Therapeutic ca ...

311

Long term follow-up in patients with a naso-pharynx carcinoma after induction chemotherapy by cisplatin, 5-fluoro-uracil and bleomycin (pbf) followed by a bi-fractionated radiotherapy and a consolidation chemotherapy; Survie a long terme chez des patients atteints d'un carcinome du nasopharynx apres chimiotherapie d'induction par cisplatine, 5-fluoro-uracile et bleomycine (pbf) suivie d'une radiotherapie bifractionnee et une chimiotherapie de consolidation  

Energy Technology Data Exchange (ETDEWEB)

The purpose of this study was to evaluate the efficiency and the long term survival after neoadjuvant chemotherapy by cisplatin, 5-fluoro-uracil and bleomycin, followed by a bi fractionated radiotherapy and an adjuvant chemotherapy. The protocol associating a P.B.F. type chemotherapy in the locally evolved disease is justified by its efficiency in terms of objective response rate and local control rate, that expressed by an improvement of the global survival rate and survival without disease at five and ten years. The adjuvant chemotherapy is very toxic and did not show any benefit. (N.C.)

Djekkoun, R.; Boudaoud, K.; Ferdi, N.; Filali, T. [CAC CHU, Constantine (Algeria)

2009-10-15

312

Associations between Adenotonsillar Hypertrophy, Age, and Obesity in Children with Obstructive Sleep Apnea  

Science.gov (United States)

Objective To investigate the contributions of adenoid and tonsil size to childhood obstructive sleep apnea (OSA) and the interactions between adenotonsillar hypertrophy, age, and obesity in children with OSA. Methods In total, 495 symptomatic patients were recruited. The patients were assigned to four groups according to age?toddler (age 1-3, n=42), preschool (age 3-6, n=164), school (age 6-12, n=200), and adolescence (age 12-18, n=89). All subjects had tonsil size graded by otolaryngologists, adenoid size determined on lateral radiographs (Fujioka method), and a full-night polysomnography. The apnea-hypopnea index (AHI), adenoid size, and tonsil size were compared in obese and non-obese children in the four age groups. Adjusted odds ratios (ORs) and 95% confidence interval (CI) of adenotonsillar hypertrophy and OSA risk were estimated by multi-logistic regression. Results The AHI was positively related to tonsil grade (r=0.33, p <0.001) and adenoid size (r=0.24, p <0.01) in all patients. Tonsil grade was positively related to AHI in all four age groups. Adenoid size was positively related to AHI in the toddler, preschool, school groups, but not in the adolescent group (r=0.11, p=0.37). Tonsil grade and adenoid size were both positively related to AHI in obese and non-obese children. In the regression model, obesity (OR=2.89; 95% CI 1.47-5.68), tonsillar hypertrophy (OR=3.15; 95% CI 2.04-4.88), and adenoidal hypertrophy (OR=1.89; 95% CI 1.19-3.00) significantly increased OSA risk. Conclusions Adenotonsillar hypertrophy and obesity are the major determinants of OSA in children. However, the influence of adenoid size decreases in adolescence. PMID:24205291

Kang, Kun-Tai; Chou, Chen-Han; Weng, Wen-Chin; Lee, Pei-Lin; Hsu, Wei-Chung

2013-01-01

313

Etude de la réplication du VHB et de la réponse à l'intracellulaire à l'infection virale  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Le VHB est un problème majeur puisque les 350 millions de porteurs chroniques existant ont un risque accru de développer une cirrhose ou un carcinome hépatocellulaire. Compte tenu du manque de système d'étude du VHB in vitro qui soit facile d'accès et pleinement satisfaisant, l'objectif était d'améliorer l'un de ceux qui utilisent des baculovirus VHB recombinants pour délivrer le génome VHB dans des cellules hépatocytaires. La pertinence de ce système pour réaliser des tests phé...

Lucifora, Julie

2008-01-01

314

La tumeur de Buschke-Lowenstein anorectale: ? propos de 16 cas et revue de la litt?rature  

Science.gov (United States)

La tumeur de Buschke-Lowenstein est une affection rare appartenant au groupe des carcinomes verruqueux. Elle survient le plus souvent chez des sujets pubères en pleine activité sexuelle. Une infection par human papillomavirus (HPV) 6 et 11 est volontiers associée à ces tumeurs. Elle se caractérise par la fréquence des récidives et le risque de transformation maligne. Son traitement est difficile même si l'histologie confirme la bénignité. A partir de 16 observations de TBL et d'une revue de la littérature, les auteurs soulignent les aspects épidémiologiques, cliniques, thérapeutiques et évolutifs de cette affection. PMID:24847393

Njoumi, Noureddine; Tarchouli, Mohamed; Ratbi, Moulay Brahim; Elochi, Mohamed Reda; Yamoul, Rajae; Hachi, Hafid; Bougtab, Abdesslam

2013-01-01

315

AcEST: BP920838 [AcEST  

Full Text Available YMU001_000142_C12 505 Adiantum capillus-veneris mRNA. clone: YMU001_000142_C12. BP920838 - Show ... Trich... 59 1e-07 tr|Q8QFR3|Q8QFR3_XENLA Papillary renal ... cell carcinoma protein OS... 54 6e-06 tr|B7ZQF8|B7 ... 6e-06 tr|B2RYA6|B2RYA6_RAT Prcc protein (Papillary renal ... cell carcinom... 53 1e-05 tr|Q32NN3|Q32NN3_XENLA P ...

316

Prospective study of factors of prognosis of survival without disease and of global five year and ten-year survival in a series of 90 patients suffering from a stage IIB or III cervical epidermoid carcinoma which had been treated by concomitant chemo-radiotherapy; etude prospective des facteurs pronostiques de survie sans maladie et de survie globale a cinq et dix dans une serie de 90 patientes atteintes d'un carcinome epidermoide du col uterin de stade IIB ou III dont le traitement etait une chimioradiotherapie concomitante  

Energy Technology Data Exchange (ETDEWEB)

The authors report the study of some factors (TNM stage, tumour size, histological sub-type and haemoglobin concentration) of survival without disease and of global survival by analyzing the files of 90 patients who had chemotherapy concomitantly with external radiotherapy (five 1,8 Gy sessions a week for four to five weeks) followed by utero-vaginal curietherapy. It appears that chemo-radiotherapy is well tolerated and that some factors very significantly affect global survival and survival without disease. Concomitant chemo-radiotherapy significantly delays the occurrence of recurrence and metastases, notably for locally advanced tumours. Short communication

Ferdi, N.; Djekkoun, R.; Aouati, E.; Chirouf, A.; Aouati, S.; Afiane, M. [CHU de Constantine (Algeria)

2011-10-15

317

Cell cycle break and apoptosis induction for the HPV-18 positive human head and neck carcinomas lines, after exposure to 5-fluorouracils and ionizing radiations:NF-kB implication in the radiosensitivity and spontaneous apoptosis; Arrets du cycle cellulaire et induction d'apoptose pour les lignees de carcinome humain de la tete et du cou HPV-18 positives, apres exposition au 5-fluorouracile et aux radiations ionisantes: implication de NF-kB dans la radiosensibilite et l'apoptose spontanee  

Energy Technology Data Exchange (ETDEWEB)

The P-53 protein holds an important contribution in the control of the cell cycle as well as the apoptosis control. But in numerous cancers the P-53 protein functionality is blocked by mutations or by its gene obliteration. The distribution of cells in the cell cycle as well as the apoptosis induction have been studied after exposure to 5-Fluorouracils (5-F.U.) or ionizing radiations. The two types of stress can induce dependent P-53 apoptosis after 5-F.U. exposure and independent P-53 apoptosis after ionizing radiation exposure. The P-53 protein is not the only one to have an important part in the cell cycle and apoptosis control, the transcription factor is important as well as the cells sensitivity to a stress such ionizing radiation. This could open new approaches of increasing the biological effects of ionizing radiations. (N.C.)

Didelot, C

2002-04-15

318

Multiple head and neck neoplasia following radiation for benign disease during childhood  

International Nuclear Information System (INIS)

A woman received radiation therapy to the adenoids for benign disease at the age of 10 years and subsequently developed an adenocarcinoma of the middle ear, a parathyroid adenoma, and a papillary carcinoma of the thyroid gland in adulthood. This appears to be the first such case on record. The literature of neoplasia after head and neck irradiation is briefly reviewed

319

Tonsillectomy and Adenoidectomy  

Medline Plus

Full Text Available ... X-Plain.com ol040105 Last reviewed: 03/14/2012 1 Swelling and inflammation around the adenoids can ... X-Plain.com ol040105 Last reviewed: 03/14/2012 2 If antibiotics do not work to eliminate ...

320

Tonsillectomy for Sleep Apnea May Trigger Weight Gain  

Science.gov (United States)

... on this page, please enable JavaScript. Tonsillectomy for Sleep Apnea May Trigger Weight Gain Study found overweight kids ... 28, 2014 Related MedlinePlus Pages Obesity in Children Sleep Apnea Tonsils and Adenoids MONDAY, July 28, 2014 (HealthDay ...

 
 
 
 
321

Tonsillectomy and Adenoidectomy  

Medline Plus

Full Text Available ... www.X-Plain.com ol040105 Last reviewed: 03/14/2012 1 Swelling and inflammation around the adenoids ... www.X-Plain.com ol040105 Last reviewed: 03/14/2012 2 If antibiotics do not work to ...

322

A Prognostic Index for Predicting Lymph Node Metastasis in Minor Salivary Gland Cancer  

International Nuclear Information System (INIS)

mucoepidermoid carcinoma but not for adenoid cystic carcinoma. Conclusions: A prognostic index using the four clinicopathological factors listed here can effectively differentiate patients into risk groups of nodal metastasis. The precision of this index is subject to the limitations of SEER data and should be validated in further clinical studies.

323

[Sweat gland carcinomas of the skin].  

Science.gov (United States)

Sweat gland carcinomas are rare malignant tumors of the skin. The well-defined entities porocarcinoma, microcystic adnexal carcinoma, aggressive digital papillary adenocarcinoma, mucinous eccrine carcinoma, adenoid cystic carcinoma, spiradenocarcinoma, cylindrocarcinoma, hidradenocarcinoma are described. The article summarizes essential clinical, prognostic and histopathological findings of these tumors and takes in focus special recommendations for dermatologists and surgeons to plan biopsies and operations. PMID:18214401

Rütten, A; Requena, L

2008-02-01

324

Correlation Between Upper Airways Obstructive Indexes in Adenotonsilar Hypertrophy with Mean Pulmonary Arterial Pressure  

Directory of Open Access Journals (Sweden)

Full Text Available Introduction: Hypertrophied tonsils and adenoids may cause upper airway obstruction and cardio-pulmonary complications due to pulmonary arterial hypertension. The aim of this study was to determine the correlation between mean pulmonary arterial pressure (mPAP and selected adenotonsilar hypertrophy indexes. Materials and Methods: Thirty two patients with upper-airway obstruction resulting from hypertrophied tonsils and adenoids were included in our study. Mean pulmonary arterial pressure was measured by a non-invasive method using color doppler echocardiography. Upper airway obstruction was evaluated by clinical OSA (obstructive sleep apnea scoring and also adenoidal-nasopharyngeal (A/N ratio in the lateral neck radiography. Results: Fifty percent of the patients with a normal OSA score, 20% of those with a suspected OSA score and also 50% of cases with OSA had pulmonary hypertension (mPAP>20mmHg which was not statistically significant  (P=0.198.  Mean Adenoidal-nasopharyngeal ratio in patients with a normal mPAP (mPAP?20mmHg was 0.61±0.048 and it was 0.75±0.09 in those with pulmonary hypertension; the difference was statistically significant (P=0.016. Conclusion: It seems that A/N ratio could be used as a predicting factor for increased mPAP in children with upper airway obstruction and a pediatric cardiologist consultation may be necessary before some surgical interventions.

Ehsan Khadivi

2010-07-01

325

Coblation Assisted Tonsillectomy  

Medline Plus

Full Text Available ... that can promote bleeding, but regular Children’s Tylenol works just as well in most of these children. ... SANDERS, M.D. How does the bending device work for adenoids? EARL HARLEY, M.D. You oftentimes ...

326

Otitis Media  

Medline Plus

Full Text Available ... is primarily a disease that affects infants and young children, it can also affect adults. Middle ear inflammation often begins when infections that ... in children are larger than they are in adults. Enlarged adenoids can ... difficult to detect. Children that young do not have good enough speech and language ...

327

Drug: D06933 [KEGG MEDICUS  

Full Text Available D06933 Formula, Drug Kikyoto Glycyrrhiza [DR:D04365], Platycodon root [DR:D06703] Adenoiditis; P ... gs in Japan [BR:br08301] 5 Crude drugs and Chinese medicine ... formulations 52 Traditional Chinese medicine s 520 ... Traditional Chinese medicine s 5200 Traditional Chinese medicine s D06933 Kikyoto ...

328

 

Medline Plus

Full Text Available ... Thyroid Gland (Baptist Health South Florida, Miami, FL, 2/01/2012) Uterine Cancer Robot-Assisted Gynecologic Oncology Surgery ( ... Thyroid Gland (Baptist Health South Florida, Miami, FL, 2/01/2012) Tonsils and Adenoids Coblation Assisted Tonsillectomy (Georgetown ...

329

Lesiones benignas de mama que pueden simular un carcinoma en estudios imagenológicos / Benign breast lesions that mimic carcinoma in diagnostic imaging  

Scientific Electronic Library Online (English)

Full Text Available SciELO Argentina | Language: Spanish Abstract in spanish La mayoría de las lesiones que se encuentran al realizar estudios mamarios son benignas. Muchas de ellas tienen un aspecto típico y definido, ya sea en mamografía o ecografía y no requieren de evaluaciones adicionales. Existe un grupo de entidades benignas que, sin embargo, puede simular un carcinom [...] a en las imágenes. Los radiólogos debemos conocer las características de las mismas y tenerlas en cuenta como posibles diagnósticos diferenciales de una imagen de alta sospecha. Abstract in english Most of the lesions found during breast imaging exams are benign. Many of them have a typical and definite appearance on mammography and ultrasound, and require no further evaluation. However, some benign lesions cannot be differentiated from carcinomas, given their suspicious and less specific radi [...] ological features. Radiologists should be aware of the imaging characteristics of these lesions and include them in the differential diagnosis of a malignant-appearing finding.

Mariana, Castro Barba; María Paz, Cobos Bombardiere; Flavia, Sarquis; Griselda, Luna; Bárbara, Miller.

330

Neuroendocrine tumor of the skin of head and neck  

Directory of Open Access Journals (Sweden)

Full Text Available Background. Merkel cell carcinom is a rare neuroendrocine tumor of skin which manifests it self through aggressive growth and early regional metastasis. It develops mainly in older population. Locally, the tumor spreads intracutaneously. Case report. We showed two cases (females of 89 and 70 years old hospitalized within the last two years. The first patient was treated surgically three times. After the surgery, the patient was treated with radio therapy, and died 3 years from the beginning of the treatment. The second patient with this neuroendocrine tumor with the high malignancy potential and huge regional metastasis, was treated surgically, and died a month and a half after the operation. Conclusion. These two cases confirmed the aggressive and recidivant growth of this tumor with the difficult pathologic investigation, and the extremely bad prognosis inspite of the treatment.

Stoši? Srboljub

2005-01-01

331

Lesiones benignas de mama que pueden simular un carcinoma en estudios imagenológicos / Benign breast lesions that mimic carcinoma in diagnostic imaging  

Scientific Electronic Library Online (English)

Full Text Available SciELO Argentina | Language: Spanish Abstract in spanish La mayoría de las lesiones que se encuentran al realizar estudios mamarios son benignas. Muchas de ellas tienen un aspecto típico y definido, ya sea en mamografía o ecografía y no requieren de evaluaciones adicionales. Existe un grupo de entidades benignas que, sin embargo, puede simular un carcinom [...] a en las imágenes. Los radiólogos debemos conocer las características de las mismas y tenerlas en cuenta como posibles diagnósticos diferenciales de una imagen de alta sospecha. Abstract in english Most of the lesions found during breast imaging exams are benign. Many of them have a typical and definite appearance on mammography and ultrasound, and require no further evaluation. However, some benign lesions cannot be differentiated from carcinomas, given their suspicious and less specific radi [...] ological features. Radiologists should be aware of the imaging characteristics of these lesions and include them in the differential diagnosis of a malignant-appearing finding.

Mariana, Castro Barba; María Paz, Cobos Bombardiere; Flavia, Sarquis; Griselda, Luna; Bárbara, Miller.

2011-03-01

332

Inflammatory cytokine detection in adenotonsill and peripheral blood mononuclear cells- culture in adenotonsillectomy patients: a comparative study  

Directory of Open Access Journals (Sweden)

Full Text Available Background: Tonsils and adenoid hypertrophy is a major respiratory symptom in children which is partly due to recruitment of inflammatory cells in upper airway lymph nodes as a result of the effects of synthesis and release of different inflammatory cytokines. It seems that infections play role in concert with these cytokines leading to tonsilar hypertrophy and other pathologic consequences. It is proposed that cellular infiltrate of tonsils and adenoids may secrete different quantities of these cytokines compared with peripheral blood mononuclear cells (PBMC cultures.Methods: Among patients who were admitted for adenotonsillectomy to the ENT ward, 37 patients, under 1-12 years old patients with fulfill criteria selected to include the study. Excised adenoid and tonsils cultured and inflammatory cytokines Interferon-? (INF-?, Interlukine-1 (IL-1, IL-6, IL-8 and tumor necrosis factor-? (TNF-? measured in cellular culture supernatant. The same cytokines measured in PBMC cultures.Results: The data shows that there is a significant difference between IFN-? and IL-8 amounts in adenoid tissue culture supernatant and PBMC culture of our patients. Furth-ermore, the amounts of IFN-?, IL-1 and IL-8 showed considerable difference between tonsilar tissue culture supernatant and PBMC culture of these patients. Although there is a significant correlation between IL-6 amounts in tissue culture supernatant and PBMC culture (P=0.02, the respective data for TNF is only almost significant.Conclusion: Inflammatory cytokines may have significant role in the early provoke of inflammation occurred in hypertrophied tonsils and adenoid. The majority of these cyt-okines increase the expression of adhesion molecules on epithelial cells and influence the recruitment of leucocytes and inflamed tonsils. On the other hand lack of sufficient cytokine release may lead to persistent infections and may cause chronic inflammation and hypertrophied tissue.

Farhadi M

2013-04-01

333

Profil des cancers gyn?cologiques et mammaires ? Yaound? - Cameroun  

Science.gov (United States)

Introduction En Afrique subsaharienne, les cancers constituent un fléau dont les caractéristiques restent à préciser. Méthodes Afin de déterminer les aspects histologiques et cliniques des cancers gynécologiques et mammaires au Cameroun, nous avons mené une étude descriptive et rétrospective sur une période de 54 mois à l'Hôpital Gynéco-Obstétrique et Pédiatrique de Yaoundé. Résultats Les 424 cas enregistrés se répartissaient ainsi: cancers du col de l'utérus: 210 cas (49.5%); du sein: 144 cas (34%); de l'ovaire: 31 cas (7.4%); de l'endomètre: 21 cas (4.9%); de la vulve: 14 cas (3.3%); du vagin: 1 cas (0.2%) et les sarcomes utérins: 3 cas (0.7%). Pour le cancer du sein, l’âge moyen au diagnostic était de 46.08±4.0 ans, 92.4% de patientes présentaient une masse (dont 60.9% localisées au quadrant supéro-externe), 76.4% étaient découverts aux stades T3 et T4, et 71.5% étaient les carcinomes canalaires. Pour les cancers du col, l’âge moyen au diagnostic était de 52.43±3.82 ans, 62.9% étaient découverts aux stades FIGO 1 et 2, et 87.6% étaient des carcinomes épidermoïdes. Pour le cancer de l'ovaire, l’âge moyen au diagnostic était de 49.0±9.31 ans, 90.3% étaient des tumeurs épithéliales et 74.2% étaient aux stades 2 et 3 (FIGO). Quant aux cancers de l'endomètre, l’âge moyen au diagnostic était de 59±14.55 ans, 90.5% étaient des adénocarcinomes. Conclusion Les principaux cancers étaient ceux du col de l'utérus et du sein. Le diagnostic étant souvent fait aux stades tardifs et par conséquent de mauvais pronostic, la prévention des cancers gynécologiques et mammaires devrait être renforcée au Cameroun. PMID:24932339

Sando, Zacharie; Fouogue, Jovanny Tsuala; Fouelifack, Florent Ymele; Fouedjio, Jeanne Hortence; Mboudou, Emile Telesphore; Essame, Jean Louis Oyono

2014-01-01

334

Autoradiographic studies and experiments on partical synchronization of human tumors, especially mammary carcinomas, in vitro and in vivo following xenotransplantation to NU/NU mice  

International Nuclear Information System (INIS)

Human mammary carcinomes were evaluated radiographically in vitro in the native state. Penetration dephts up to 552 ?m into the tissue were reached by the incubating medium. The labelling indices for the 3H-thymidine autoradiography lay between 1.5 and 19.3 percent. A correlation of the autoradiographic labelling indices with the findings of a simultaneously performed in vitro sensitivity test against cytostalics could not be proved. There seems to be a relation between the histomorphological tumour image and the proliferation behaviour expressed by the autoradiographic labelling index. Human mammary carcinomes were cultivated as xeno-transplant on thymus-aplastic NU/NU mice in parallel to this investigation. These heterotransplants show a remarkable correlation to the proliferation behaviour of the directly examined human tumours, after an autoradiographic in-vivo-labelling, with index values between 1.5 and 23.8 percent. This parallelism in the biological behaviour represents a further proof for the usefulness of the oncological test model of the NU/NU mouse as a carrier for human cacinomes. The application of this pre-therapeutical test model followed by determination of the synchronization behaviour of three human malignomas after xeno-transplantation onto NU/NU mice. For all three tumous an individual synchronization behaviour could be determined. Therapy attempts followed with cyclophosphonide or ionizing radiation by using the optimal cell-cycle therapy. Therefore an improvement of the therapeutical success by means of pre-therapeutical synchronization of human tumours can be reached in particular cases. (orig./MG)

335

Mucocèle appendiculaire : à propos d’un cas observé à Lubumbashi  

Directory of Open Access Journals (Sweden)

Full Text Available RESUMELa mucocèle appendiculaire est une entité pathologique rare, mais potentiellement dangereuse ; elle se présente sous différentes formes cliniques. Nous rapportons ici un cas d'une patiente âgée de 49 ans sans antécédents chirurgicaux chez qui nous avons découvert d’une façon fortuite cette affection. La clinique était celle d’un syndrome appendiculaire aigu patent et elle révélait une masse dans la fosse iliaque droite. Les examens de laboratoire ont montré une hyperleucocytose et une vitesse de sédimentation augmentée. L'échographie a démontré une masse kystique péricaecal. La patiente a subi une appendicectomie avec cæcectomie partielle et la pièce opératoire appendiculaire mesurait 153 mm de longueur et 64 mm de diamètre. L’analyse anatomopathologique de celle-ci a confirmé le diagnostic de mucocèle appendiculaire sans cellules de malignité. Les suites opératoires ont été simples et la patiente est sortie au cinquième jour postopératoire. Mots-clés : Mucocèle appendiculaire Tumeur muco-sécrétant appendiculaire ; Appendicite ; LubumbashiSummary The appendiceal mucocele is a rare, but potentially dangerous pathological entity which presents in various clinical forms. We report here a case of a 49-year-old female patient without surgical history to whom we fortuitously discovered this affection. She came with clinical signs of an acute appendicitis and revealed a mass in the right iliac fossa. The examinations of laboratory showed an increase of white cells and of erythrocytes sedimentation rate. The ultrasound revealed a fluid pericaecal mass. The patient underwent an appendectomy with partial cæcectomy. The removed appendix measured 153 mm in length over 64 mm. The pathology confirmed the diagnosis and ruled out a malignant process. The postoperative went well and the patient was discharged on the fifth post-operative day.

KIPILI A

2013-01-01

336

Carbon ion radiotherapy for non squamous cell carcinoma in head and neck region  

International Nuclear Information System (INIS)

Between April 1997 and February 2006, 239 patients with malignant head and neck tumors were treated by carbon ion radiotherapy. The patients consisted of 130 males and 109 females aged from 16 to 79 years (average age 56.5 years). Histologically, the tumors were classified as follows: 85 with malignant mucosal melanomas, 70 with adenoid cystic carcinomas, 27 with adenocarcinomas, and 57 with other histological types of tumors. Although grade 3 acute reactions in normal tissues of skin and mucosa appeared in approximately 10% of the patients, the late reactions were grade 2 or less. Carbon ion radiotherapy can be therefore described as presenting no clinical problems. Five-year local control by histological type was 75% for the malignant mucosal melanomas, 78% for the adenocarcinomas, and 67% for the adenoid cystic carcinomas. The therapeutic effectiveness of the carbon ion radiotherapy was particularly outstanding for locally advanced non-squamous cell carcinomas which make a tumor intractable to photon radiotherapy. (author)

337

Long-term prognosis of maxillary sinus malignant tumor patients treated by fast neutron radiation therapy  

Energy Technology Data Exchange (ETDEWEB)

From 1976 through 1990, 19 patients with maxillary sinus malignant tumor were treated with combination therapy consisting of maxillectomy and radiation of fast neutron. Fast neutron radiotherapy was performed at National Institute of Radiological Sciences. Eight patients had adenoid cystic carcinomas, three patients squamous cell carcinomas, one patient a carcinoma in pleomorphic adenoma, four patients fibrosarcomas, one patient osteosarcoma, one patient chondrosarcoma and one patient rhabdomyosarcoma. Fast neutron therapy after/before surgery was effective in fresh cases with T2-3N0M0 adenoid cystic carcinomas and sarcomas (except for fibrosarcoma). Nine patients were alive more than three years after treatment. And serious complications of fast neutron radiation therapy appeared in six of these nine patients. Visual impairment of opposite side occurred in four patients. Bone necrosis occured in one patient and brain dysfunction in one patient. (author).

Kishi, Hirohisa; Numata, Tsutomu; Yuza, Jun; Suzuki, Haruhiko; Konno, Akiyoshi [Chiba Univ. (Japan). School of Medicine; Miyamoto, Tadaaki

1995-03-01

338

Radiotherapy in epithelial tumors of the parotid gland: Case presentation and literature review  

International Nuclear Information System (INIS)

A group of 113 patients irradiated for parotid tumor was studied retrospectively. Sixty-two patients were irradiated after superficial parotidectomy or enucleation of a pleomorphic adenoma. None of them had a recurrence after 5-15 years. Sixteen patients were irradiated postoperatively after surgery for a recurrence of pleomorphic adenoma. Only one of them had developed a recurrent tumor. Thirty-five patients with a malignant parotid tumor were treated by irradiation, 22 after surgery and 13 after biopsy only. Patients with a low malignancy tumor (10/11) and adenoid cystic carcinoma (6/12) responded better than patients with a high malignancy carcinoma (2/12). A tumor larger than 4 cm, facial nerve palsy, lymph node metastasis, and inoperability indicate a poor prognosis. With high dose radiotherapy it is possible to treat inoperable tumors successfully. Adenoid cystic carcinomas can respond well to irradiation alone.43 references

339

Assessment of nasal obstruction with flexible nasal endoscopy  

International Nuclear Information System (INIS)

Objective was to report the value of nasal endoscopy as an outpatient procedure in the diagnosis of posterior nasal obstruction. Over one year period, from March 2002 to March 2003, we evaluated 130 adult patients that attended the Ear, Nose and Throat Department of Sohag University Hospital in Egypt with persistent nasal obstruction via anterior rhinoscopy and flexible nasopharyngoscopy. We reported the cause and site of obstruction in relation to the choanae. We confirmed the diagnosis by CT scanning, rigid endoscopic examination under general anesthesia, and histopathological analysis of biopsies taken. Forty-six percent of our cases had posterior nasal obstruction, 43.5% due to post-choanal lesions (mainly adenoid), 33% due to pre-choanal lesions (mainly choanal polyps), and 23.5% due to choanal lesions (mainly choanal adenoid). We conclude that flexible nasal endoscopy is superior to visual examination in the evaluation of nasal obstruction; hence, we recommend its routine use. (author)

340

Oral epithelial cells are susceptible to cell-free and cell-associated HIV-1 infection in vitro  

International Nuclear Information System (INIS)

Epithelial cells lining the oral cavity are exposed to HIV-1 through breast-feeding and oral-genital contact. Genital secretions and breast milk of HIV-1-infected subjects contain both cell-free and cell-associated virus. To determine if oral epithelial cells can be infected with HIV-1 we exposed gingival keratinocytes and adenoid epithelial cells to cell-free virus and HIV-1-infected peripheral blood mononuclear cells and monocytes. Using primary isolates we determined that gingival keratinocytes are susceptible to HIV-1 infection via cell-free CD4-independent infection only. R5 but not X4 viral strains were capable of infecting the keratinocytes. Further, infected cells were able to release infectious virus. In addition, primary epithelial cells isolated from adenoids were also susceptible to infection; both cell-free and cell-associated virus infected these cells. These data have potential implications in the transmission of HIV-1 in the oral cavity

 
 
 
 
341

Combined treatment of malignant salivary gland tumours with intensity-modulated radiation therapy (IMRT) and carbon ions: COSMIC  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Abstract Background Local control in malignant salivary gland tumours is dose dependent. High local control rates in adenoid cystic carcinomas could be achieved by highly conformal radiotherapy techniques and particle (neutron/carbon ion) therapy. Considering high doses are needed to achieve local control, all malignant salivary gland tumours probably profit from the use of particle therapy, which in case of carbon ion treatment, has been shown to be accompanied by only mild ...

Windemuth-Kieselbach Christine; Nikoghosyan Anna; Jensen Alexandra D; Debus Jürgen; Münter Marc W

2010-01-01

342

HUMORAL AND CELLULAR IMMUNITY PARAMETERS IN CHILDREN BEFORE AND AFTER ADENOTONSILLECTOMY  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Adenoids and tonsils are active lymphoid organs and play an important role ?against invading antigens of upper aerodigestive tract in children. ?The present study analyzes the changes in cellular and humoral immunity of children six ?months after adenotonsillectomy. The study population consisted of 30 children whit chronic adenotonsillar hypertrophy and 30 age-matched healthy children. ?In all children serum level of IgM and IgG, percentage of T lymphocytes (C...

Baradaranfar, M. H.; Dodangeh, F.; Atar, S. Taghipour-zahir M.

2007-01-01

343

Malignant minor salivary gland tumors: a retrospective study of 27 cases  

Digital Repository Infrastructure Vision for European Research (DRIVER)

PURPOSE: Malignant tumors of the intra-oral minor salivary glands are uncommon. The aim of this study was to give information concerning the clinical features of these tumors, the distribution of location, treatment opportunities, and outcome. METHODS: Twenty-seven patients with malignant salivary gland tumors that were treated between January 1999 and December 2008 were evaluated retrospectively. RESULTS: Of the 27 minor salivary gland carcinomas, 48.1% were adenoid cystic carcinomas (ACC), ...

Kruse, A. L. D.; Gra?tz, K. W.; Obwegeser, J. A.; Lu?bbers, H. T.

2010-01-01

344

Immunohistochemical characterisation of extracellular matrix components of salivary gland tumours.  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Proteoglycans (PGs) were localised immunohistochemically in 52 salivary gland tumours including pleomorphic adenoma, adenoid cystic carcinoma, acinic cell carcinoma, oncocytoma, mucoepidermoid carcinoma, clear cell tumour and Warthin tumour, using antibodies raised against large PG, small PG, chondroitin 4-sulphate PG, chondroitin 6-sulphate PG, heparan sulphate PG and keratan sulphate PG. Large PGs were mainly observed in mucinous materials of extracellular matrix (ECM) and interstitial fibr...

Nara, Y.; Takeuchi, J.; Yoshida, K.; Fukatsu, T.; Nagasaka, T.; Kawaguchi, T.; Meng, N.; Kikuchi, H.; Nakashima, N.

1991-01-01

345

The correlation between tonsil size and academic performance is not a direct one, but the results of various factors  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Chronic upper airway obstruction most often occurs when both tonsils and adenoid are enlarged but may occur when either is enlarged. Obstructive sleep syndrome in young children has been reported to be associated with an adverse effect on learning and academic performance. The aim of this study was to evaluate the effect of relative size of the tonsil on academic performance in 4th grade school children. In 320 children, physical examination to determine the size of tonsils was performed by t...

Kargoshaie, Aa; Najafi, M.; Akhlaghi, M.; Khazraie, Hr; Hekmatdoost, A.

2009-01-01

346

Recent advances and controversies concerning adnexal neoplasms.  

Science.gov (United States)

This article reviews the diagnostic clinical and histologic features of a group of adnexal tumors, including papillary eccrine adenoma, adenoid cystic carcinoma, Merkel's cell carcinoma, aggressive digital papillary adenoma (and adenocarcinoma), Bowen's disease, intraepidermal epithelioma, microcystic adnexal carcinoma and related tumors, and subcutaneous trichoepithelioma. These are adnexal tumors either often not recognized, because of their rarity, or the origin, biologic potential, and classification of which have been controversial. PMID:1309688

Smith, K J; Skelton, H G; Holland, T T

1992-01-01

347

Investigation of CT and MRI findings of cranio-orbital communicating lesions  

International Nuclear Information System (INIS)

hyperostosis and widespread dural involvement, 1 chondrosarcoma involving frontal lobe and orbit, 3 adenoid cystic carcinomas involving frontal lobe, and 1 malignant meningioma with bone destruction of the superior orbital wall. Conclusion: CT and MRI could definitely demonstrate communicating passages of cranio-orbital communicating lesions and their imaging changes, which could contribute to diagnosis and differential diagnosis and provide valuable information for determining treatment measures and surgical approach

348

Imaging of nasopharyngeal cysts and bursae  

International Nuclear Information System (INIS)

Cysts and bursae of the nasopharynx are uncommon and seldom symptomatic when compared with malignant tumors of this region. However, it is noteworthy that in the presence of symptoms, a good knowledge of their radiological appearance is useful to establish the correct diagnosis. Cysts of Rathke's pouch, pharyngeal bursa of Luschka, Tornwaldt's cysts, retentional cysts of the seromucinous glands, oncocytic cysts, intra-adenoid cysts, branchial cysts, prevertebral or retropharyngeal abscess and pseudocysts of the nasopharynx will be discussed in this paper. (orig.)

349

Tracheal squamous cell carcinoma treated endoscopically.  

Science.gov (United States)

Malignant primary tracheal tumors are extremely rare. The most common malignant primary tracheal tumors are squamous cell carcinoma and adenoid cystic carcinomas. In this brief report, we describe a patient who presented with a primary papillary squamous cell carcinoma in-situ at multiple areas in the trachea with a significant airway obstruction. Our case was successfully managed using a combination of electrocautery and argon photocoagulation for endotracheal ablation of the tumor and adjuvant external beam radiotherapy. PMID:23168962

Ly, Vanthanh; Gupta, Sandeep; Desoto, Fidelina; Cutaia, Michael

2010-10-01

350

Evaluation of Ga-67 scintigraphy for salivary gland tumors  

Energy Technology Data Exchange (ETDEWEB)

It is often difficult to exactly grasp the malignancy of salivary gland tumor because of inadaptability of percutaneous biopsy. The purpose of this study is to discuss whether Ga-67 scintigraphy on patient with salivary gland tumor can provide useful information for differential diagnosis. We studied retrospectivelly the case records of twenty patients with parotid or submandibular gland tumors admitted to the Nippon Dental University, School of Dentistry at Niigata, between January 1984 and December 1991. The final diagnoses of these twenty patients were pleomorphic adenoma in 11, adenocarcinoma in 3, adenoid cystic carcinoma in 3, Warthin's tumor in 1, oncocytoma in 1, and carcinoma in pleomorphic adenoma in 1. The scintigraphic patterns of the twenty patients were classified as negative (-), weakly positive (+), moderate positive (++), strongly positive (+++). Malignant tumors showed increased activity in Ga-67 images except those in three patients with adenoid cystic carcinomas. We concluded that Ga-67 scintigraphy may be useful to distinguish benign salivary gland tumors from adenocarcinoma or carcinoma in pleomorphic adenoma, but not be useful in detection of adenoid cystic carcinoma. (author).

Takase, Hiroshi; Toyama, Michio; Eguchi, Tooru; Maeda, Kadzuo (Nippon Dental Univ., Niigata (Japan))

1993-09-01

351

Intravoxel incoherent motion MRI: emerging applications for nasopharyngeal carcinoma at the primary site  

Energy Technology Data Exchange (ETDEWEB)

We compared pure molecular diffusion (D), perfusion-related diffusion (D*), perfusion fraction (f) and apparent diffusion coefficient (ADC) based on intravoxel incoherent motion (IVIM) theory in patients with nasopharyngeal carcinoma (NPC). Sixty-five consecutive patients (48 men) with suspected NPC were examined using a 3.0-T MR system. Diffusion-weighted imaging (DWI) was performed with 13 b values (range, 0-800 s/mm{sup 2}). We regarded the result of endoscopy and biopsy as the gold standard for detection. D, D* and f were compared between patients with primary NPC and enlarged adenoids. IVIM DWI was successful in 37 of 40 NPC and 23 of 25 enlarged adenoids cases. D (P = 0.001) and f (P < 0.0001) were significantly lower in patients with NPC than in patients with enlarged adenoids, whereas D* was significantly higher (P < 0.0001). However, the ADC was not significantly different between the two groups (P > 0.05). The area under the ROC curve (AUC) for D was 0.849 and was significantly larger than that for ADC (P < 0.05). IVIM DWI is a feasible technique for investigating primary NPC. D was significantly decreased in primary NPC, and increased D* reflected increased blood vessel generation and parenchymal perfusion in primary NPC. (orig.)

Zhang, Shui-xing; Jia, Qian-jun; Liang, Chang-hong; Chen, Wen-bo; Qiu, Qian-hui; Li, He [Guangdong Academy of Medical Sciences/Guangdong General Hospital, Department of Radiology, Guangzhou, Guangdong Prov. (China); Zhang, Zhong-ping [Applied Science Lab, Guangzhou, Guangdong Prov. (China)

2014-08-15

352

Relationship between Helicobacter pylori Adenotonsillar Colonization and Frequency of Adenotonsillitis in Children  

Science.gov (United States)

Background: There are insufficient data in the literature on the presence of Helicobacter pylori in tonsil and adenoid tissue of patients with only airway obstruction. This study examined the presence of H. pylori in surgical cases with airway obstruction or recurrent infection. Aims: To investigate the relationship between H. pylori adenotonsillar colonisation and the frequency of adenotonsillitis and to compare paediatric and adult patients according to H. pylori tonsillar colonisation. Study Design: Prospective clinical trial. Methods: Patients scheduled for adenoidectomy or tonsillectomy were classified into three groups based on indications: paediatric infection (n=29), paediatric obstruction (n=29) and adult infection (n=12). Tissue samples obtained from patients were examined for the presence of H. pylori by culture, rapid urease test and polymerase chain reaction. Results: Forty-nine tonsil tissues were examined. Positive results were found in two specimens with the rapid urease test (4.1%) and three with polymerase chain reaction examination (6.1%). Only three positive polymerase chain reaction results (5.8%) were identified in 52 adenoid tissue samples. There were no statistically significant differences in the presence of H. pylori between paediatric infection and obstruction groups or between paediatric infection and adult infection groups. Conclusion: In our study, there was a low incidence of H. pylori colonisation in tonsil and adenoid tissues. Regarding H. pylori colonisation, there was no significant difference between paediatric infection and obstruction groups. Also, no significant difference was found between adult and paediatric cases.

Guclu, Oguz; Akcal?, Alper; Sahin, Erkan Melih; Tekin, Kaz?m; Barutcu, Ozan; Otkun, Muserref Tatman; Derekoy, Fevzi Sefa

2013-01-01

353

Evaluation of Ga-67 scintigraphy for salivary gland tumors  

International Nuclear Information System (INIS)

It is often difficult to exactly grasp the malignancy of salivary gland tumor because of inadaptability of percutaneous biopsy. The purpose of this study is to discuss whether Ga-67 scintigraphy on patient with salivary gland tumor can provide useful information for differential diagnosis. We studied retrospectivelly the case records of twenty patients with parotid or submandibular gland tumors admitted to the Nippon Dental University, School of Dentistry at Niigata, between January 1984 and December 1991. The final diagnoses of these twenty patients were pleomorphic adenoma in 11, adenocarcinoma in 3, adenoid cystic carcinoma in 3, Warthin's tumor in 1, oncocytoma in 1, and carcinoma in pleomorphic adenoma in 1. The scintigraphic patterns of the twenty patients were classified as negative (-), weakly positive (+), moderate positive (++), strongly positive (+++). Malignant tumors showed increased activity in Ga-67 images except those in three patients with adenoid cystic carcinomas. We concluded that Ga-67 scintigraphy may be useful to distinguish benign salivary gland tumors from adenocarcinoma or carcinoma in pleomorphic adenoma, but not be useful in detection of adenoid cystic carcinoma. (author)

354

[Changing the contents of Fe and Mn in the tonsils of children exposed to passive smoking and their local imission example Chorzow].  

Science.gov (United States)

The subject of the research were samples of overgrown adenoids removed by adenoidectomy 56 children, including 30 boys and 26 girls, exposure and unexposure from passive smoking, living in the administrative area of Chorzów. The statistic characteristic of Fe and Mn occurrence is presented in the thesis. The studies were carried out on the changes of Fe and Mn and other elements, (B, Al, La, Cd, Co, Cr, Cu, Ni, Pb, Zn, As, Se, Hg, V, Be, Mo, Sn, V, Ti, Sb, Bi, TI, Zr, Ca, Mg, Na, Ba, Sr, Li) respectively. The elemental composition of adenoids was determined with ICP-AES method (Inductively Coupled Plasma - Atomic Emission Spectroscopy). The studies on Fe and Mn occurrence in adenoids showed the presence of its higher concentrations in exposure boys (Fe - 116.13 microg/g; Mn - 0.70 microg/g), in comparison with exposure girls from passive smoking (93.06 microg/g; Mn - 0.57 microg/g). PMID:21360931

Nogaj, Ewa; Kwapuli?ski, Jerzy; Bazowska, Maria; Krawczyk, ?ukasz; Ahnert, Bozena; Rzepka, Jerzy; Nogaj, Piotr; Olender, Jacek; Paprotny, ?ukasz

2010-01-01

355

WholeBbody Positron-Emission-Tomography (WB-PET) in oncology; Ganzkoerper-Positronen-Emissions-Tomographie (GK-PET) in der Onkologie  

Energy Technology Data Exchange (ETDEWEB)

The new generation of high sensitive PET-Scanners with an FOV of about 15 cm allows to recognize with high sensitivity and good spezificity malign tumors and their metastases with 18F-FDG in a Whole-Body-Scan in 35 to 50 min scan time. 357 FDG-WB-PET-Scans have been performed in Tuebingen during 1 1/2 years since January 1994 in tumor patients and have been compared and evaluated to the results of other imaging methods performed in the same time together with clinics and in follow-up. In 4 groups of tumors - Melanoma - malign Lymphoma - Breast Cancer - Thyroid Cancer - and a fifth group of 24 various types of malign tumors we found a sensitivity of 88%, a specificity of 80% and an accuracy of 90%. Foci smaller than 6-8 mm diametre - mostly lung metastases or lymphomas - and also tumors of low malignancy such as 131l-trapping Tyroid Carcinomas and Ganglioneuroblastomas have been found false negative. Flase positive we found inflammated lymph nodes, abscesses and also benign thyroid adenomas. This high sensitivity makes 18F-FDG-WB-PET an important method for tumor searching and diagnosis of tumor spreading, esp. for primary and secondary staging in the future, but also as the unique imaging method which allows determination of resting tumor vitality after therapy. Further multi-center studies will be necessary before this method can be introduced to routine, that also is limited by the high costs of the procedure. (orig.) [Deutsch] Die neue Generation der hochaufloesenden PET-Scanner mit einer axialen Feldbreite von 15 cm ermoeglicht es, mit hoher Sensitivitaet und guter Spezifitaet maligne Tumoren und ihre Metastasen mit 18F-Fluordeoxyglukose in einem Ganzkoerper-Scan mit 35-50 min Scan-Zeit zu erkennen. 357 FDG-GK-PET Scans wurden in 1 1/2 Jahren ab Januar 1994 in Tuebingen bei Tumor-Patienten durchgefuehrt und mit gleichzeitig erstellten anderen bildgebenden Verfahren zusammen mit der Klinik und im Follow Up ausgewertet. Bei den vier Tumorgruppen Melanom - Malignes Lymphom - Mamma-Carcinom - Schilddruesen-Carcinom und einer fuenften Gruppe, in der 24 verschiedene maligne Tumoren untersucht worden waren, ergaben sich eine Sensitivitaet von 88%, eine Spezifitaet von 80% und eine Treffsicherheit von 90%. Falsch negativ waren Herde <6-8 mm im Durchmesser, meist Lungenmetastasen oder Lymphome, sowie niedrig maligne Tumoren wie 131J-speichernde Schilddruesen-Carcinome und auch Ganglioneuroblastome. Falsch positiv ergaben sich entzuendliche Lymphknoten, Abszesse, aber auch benigne Schilddruesenadenome. Bei der gefundenen hohen Sensitivitaet duerfte 18FDG-GK-PET in Zukunft ein wertvolles Verfahren zur Tumorsuche und Tumorausbreitungsdiagnostik sowie fuer das primaere und sekundaere Staging sein, aber auch zur Bestimmung der Restaktivitaet in Tumoren nach Therapie als einziges bildgebendes Verfahren eine Aussage ermoeglichen. Weitere Multizenterstudien sind notwendig, bevor das Verfahren in die Routine eingefuehrt werden kann, dem allerdings bisher auch die hohen Kosten noch entgegenstehen. (orig.)

Feine, U. [Nuklearmedizinische Abt., Tuebingen Univ. (Germany); Lietzenmayer, R. [Nuklearmedizinische Abt., Tuebingen Univ. (Germany); Mueller-Schauenburg, W. [Nuklearmedizinische Abt., Tuebingen Univ. (Germany); Geiger, L. [Nuklearmedizinische Abt., Tuebingen Univ. (Germany); Hanke, J.P. [Nuklearmedizinische Abt., Tuebingen Univ. (Germany); Weisser, G. [Nuklearmedizinische Abt., Tuebingen Univ. (Germany); Woehrle, H. [Nuklearmedizinische Abt., Tuebingen Univ. (Germany)

1996-02-01

356

Transoral Robotic Surgery in Treating Patients With Benign or Stage I-IV Head and Neck Cancer  

Science.gov (United States)

Recurrent Adenoid Cystic Carcinoma of the Oral Cavity; Recurrent Lymphoepithelioma of the Nasopharynx; Recurrent Lymphoepithelioma of the Oropharynx; Recurrent Mucoepidermoid Carcinoma of the Oral Cavity; Recurrent Squamous Cell Carcinoma of the Hypopharynx; Recurrent Squamous Cell Carcinoma of the Larynx; Recurrent Squamous Cell Carcinoma of the Lip and Oral Cavity; Recurrent Squamous Cell Carcinoma of the Nasopharynx; Recurrent Squamous Cell Carcinoma of the Oropharynx; Recurrent Verrucous Carcinoma of the Larynx; Recurrent Verrucous Carcinoma of the Oral Cavity; Stage I Adenoid Cystic Carcinoma of the Oral Cavity; Stage I Lymphoepithelioma of the Nasopharynx; Stage I Lymphoepithelioma of the Oropharynx; Stage I Mucoepidermoid Carcinoma of the Oral Cavity; Stage I Squamous Cell Carcinoma of the Hypopharynx; Stage I Squamous Cell Carcinoma of the Larynx; Stage I Squamous Cell Carcinoma of the Lip and Oral Cavity; Stage I Squamous Cell Carcinoma of the Nasopharynx; Stage I Squamous Cell Carcinoma of the Oropharynx; Stage I Verrucous Carcinoma of the Larynx; Stage I Verrucous Carcinoma of the Oral Cavity; Stage II Adenoid Cystic Carcinoma of the Oral Cavity; Stage II Lymphoepithelioma of the Nasopharynx; Stage II Lymphoepithelioma of the Oropharynx; Stage II Mucoepidermoid Carcinoma of the Oral Cavity; Stage II Squamous Cell Carcinoma of the Hypopharynx; Stage II Squamous Cell Carcinoma of the Larynx; Stage II Squamous Cell Carcinoma of the Lip and Oral Cavity; Stage II Squamous Cell Carcinoma of the Nasopharynx; Stage II Squamous Cell Carcinoma of the Oropharynx; Stage II Verrucous Carcinoma of the Larynx; Stage II Verrucous Carcinoma of the Oral Cavity; Stage III Adenoid Cystic Carcinoma of the Oral Cavity; Stage III Lymphoepithelioma of the Nasopharynx; Stage III Lymphoepithelioma of the Oropharynx; Stage III Mucoepidermoid Carcinoma of the Oral Cavity; Stage III Squamous Cell Carcinoma of the Hypopharynx; Stage III Squamous Cell Carcinoma of the Larynx; Stage III Squamous Cell Carcinoma of the Lip and Oral Cavity; Stage III Squamous Cell Carcinoma of the Nasopharynx; Stage III Squamous Cell Carcinoma of the Oropharynx; Stage III Verrucous Carcinoma of the Larynx; Stage III Verrucous Carcinoma of the Oral Cavity; Stage IV Adenoid Cystic Carcinoma of the Oral Cavity; Stage IV Lymphoepithelioma of the Nasopharynx; Stage IV Lymphoepithelioma of the Oropharynx; Stage IV Mucoepidermoid Carcinoma of the Oral Cavity; Stage IV Squamous Cell Carcinoma of the Hypopharynx; Stage IV Squamous Cell Carcinoma of the Larynx; Stage IV Squamous Cell Carcinoma of the Lip and Oral Cavity; Stage IV Squamous Cell Carcinoma of the Nasopharynx; Stage IV Squamous Cell Carcinoma of the Oropharynx; Stage IV Verrucous Carcinoma of the Larynx; Stage IV Verrucous Carcinoma of the Oral Cavity

2014-11-07

357

Acetylcysteine Rinse in Reducing Saliva Thickness and Mucositis in Patients With Head and Neck Cancer Undergoing Radiation Therapy  

Science.gov (United States)

Mucositis; Oral Complications; Recurrent Adenoid Cystic Carcinoma of the Oral Cavity; Recurrent Basal Cell Carcinoma of the Lip; Recurrent Lymphoepithelioma of the Nasopharynx; Recurrent Lymphoepithelioma of the Oropharynx; Recurrent Mucoepidermoid Carcinoma of the Oral Cavity; Recurrent Salivary Gland Cancer; Recurrent Squamous Cell Carcinoma of the Larynx; Recurrent Squamous Cell Carcinoma of the Lip and Oral Cavity; Recurrent Squamous Cell Carcinoma of the Nasopharynx; Recurrent Squamous Cell Carcinoma of the Oropharynx; Recurrent Verrucous Carcinoma of the Larynx; Recurrent Verrucous Carcinoma of the Oral Cavity; Stage I Adenoid Cystic Carcinoma of the Oral Cavity; Stage I Basal Cell Carcinoma of the Lip; Stage I Lymphoepithelioma of the Nasopharynx; Stage I Lymphoepithelioma of the Oropharynx; Stage I Mucoepidermoid Carcinoma of the Oral Cavity; Stage I Salivary Gland Cancer; Stage I Squamous Cell Carcinoma of the Larynx; Stage I Squamous Cell Carcinoma of the Lip and Oral Cavity; Stage I Squamous Cell Carcinoma of the Nasopharynx; Stage I Squamous Cell Carcinoma of the Oropharynx; Stage I Verrucous Carcinoma of the Larynx; Stage I Verrucous Carcinoma of the Oral Cavity; Stage II Adenoid Cystic Carcinoma of the Oral Cavity; Stage II Basal Cell Carcinoma of the Lip; Stage II Lymphoepithelioma of the Nasopharynx; Stage II Lymphoepithelioma of the Oropharynx; Stage II Mucoepidermoid Carcinoma of the Oral Cavity; Stage II Salivary Gland Cancer; Stage II Squamous Cell Carcinoma of the Larynx; Stage II Squamous Cell Carcinoma of the Lip and Oral Cavity; Stage II Squamous Cell Carcinoma of the Nasopharynx; Stage II Squamous Cell Carcinoma of the Oropharynx; Stage II Verrucous Carcinoma of the Larynx; Stage II Verrucous Carcinoma of the Oral Cavity; Stage III Adenoid Cystic Carcinoma of the Oral Cavity; Stage III Basal Cell Carcinoma of the Lip; Stage III Lymphoepithelioma of the Nasopharynx; Stage III Lymphoepithelioma of the Oropharynx; Stage III Mucoepidermoid Carcinoma of the Oral Cavity; Stage III Salivary Gland Cancer; Stage III Squamous Cell Carcinoma of the Larynx; Stage III Squamous Cell Carcinoma of the Lip and Oral Cavity; Stage III Squamous Cell Carcinoma of the Nasopharynx; Stage III Squamous Cell Carcinoma of the Oropharynx; Stage III Verrucous Carcinoma of the Larynx; Stage III Verrucous Carcinoma of the Oral Cavity; Stage IV Lymphoepithelioma of the Nasopharynx; Stage IV Squamous Cell Carcinoma of the Nasopharynx; Stage IVA Adenoid Cystic Carcinoma of the Oral Cavity; Stage IVA Basal Cell Carcinoma of the Lip; Stage IVA Lymphoepithelioma of the Oropharynx; Stage IVA Mucoepidermoid Carcinoma of the Oral Cavity; Stage IVA Salivary Gland Cancer; Stage IVA Squamous Cell Carcinoma of the Larynx; Stage IVA Squamous Cell Carcinoma of the Lip and Oral Cavity; Stage IVA Squamous Cell Carcinoma of the Oropharynx; Stage IVA Verrucous Carcinoma of the Larynx; Stage IVA Verrucous Carcinoma of the Oral Cavity; Stage IVB Adenoid Cystic Carcinoma of the Oral Cavity; Stage IVB Basal Cell Carcinoma of the Lip; Stage IVB Lymphoepithelioma of the Oropharynx; Stage IVB Mucoepidermoid Carcinoma of the Oral Cavity; Stage IVB Salivary Gland Cancer; Stage IVB Squamous Cell Carcinoma of the Larynx; Stage IVB Squamous Cell Carcinoma of the Lip and Oral Cavity; Stage IVB Squamous Cell Carcinoma of the Oropharynx; Stage IVB Verrucous Carcinoma of the Larynx; Stage IVB Verrucous Carcinoma of the Oral Cavity; Stage IVC Adenoid Cystic Carcinoma of the Oral Cavity; Stage IVC Basal Cell Carcinoma of the Lip; Stage IVC Lymphoepithelioma of the Oropharynx; Stage IVC Mucoepidermoid Carcinoma of the Oral Cavity; Stage IVC Salivary Gland Cancer; Stage IVC Squamous Cell Carcinoma of the Larynx; Stage IVC Squamous Cell Carcinoma of the Lip and Oral Cavity; Stage IVC Squamous Cell Carcinoma of the Oropharynx; Stage IVC Verrucous Carcinoma of the Larynx; Stage IVC Verrucous Carcinoma of the Oral Cavity; Tongue Cancer

2014-09-12

358

Visualization of Abdominal Organs by Intra-Arterial Injection of 131I-Labelled Albumin Macroaggregates  

International Nuclear Information System (INIS)

Perfusion scintigrams of the abdominal organs were made after intra-arterial injection of 131I-MAA through the lying catheter immediately after angiographic examination of the coeliac and superior mesenteric artery vascular system. The anatomical architecture of the coeliac artery makes it impossible to visualize a single organ by scanning with this technique because several organs get their blood supply from the branches of this artery. Interpretation of a perfusion scintigram alone is therefore impossible. For better interpretation some simple methods have been developed: (1) Selective or even superselective,catheterization techniques; (2) Supplementation of the perfusion scintigram by a subsequent scintigram which delineates a single organ, like-liver, by means of colloidal radiogold; and (3) Photographic superposition of one scintigram over another to give a clear identification of the individual organs, especially the pancreatic head, by subtraction of the optic density. Mostly patients suspected of pancreatic carcinome were studied. The results correlated well with those of other methods, especially coeliac arteriography, and have been-partly confirmed by surgical intervention. Thus, perfusion scintigraphy of the abdominal organs seems to be a useful complement to coeliac arteriography in diagnosing pancreatic diseases. (author)

359

Cell uptake and oral absorption of titanium dioxide nanoparticles.  

Science.gov (United States)

Large efforts are invested on the development of in vitro tests to evaluate nanomaterial (NM) toxicity. In order to assess the relevance of the adverse effects identified in in vitro toxicity tests a thorough understanding of the biokinetics of NMs is critical. We used different in vitro and in vivo test methods to evaluate cell uptake and oral absorption of titanium dioxide nanoparticles (TiO2 NPs). These NPs were readily uptaken by A549 cells (carcinomic human alveolar basal epithelial cells) in vitro. Such rapid uptake contrasted with a very low oral absorption in a differentiated Caco-2 monolayer system (human epithelial colorectal adenocarcinoma cells) and after oral gavage administration to rats. In this oral study, no significant increase in the levels of titanium was recorded by ICP-MS in any of the tissues evaluated (including among other: small intestine, Peyer's patches, mesenteric lymph nodes, liver, and spleen). No NPs were observed by TEM in sections of the small intestine, except for several particles in the cytoplasm of a cell from a Peyer's Patch area. The observation of NPs in Peyer's Patch suggests that the Caco-2 monolayer system is likely to underestimate the potential for oral absorption of NPs and that the model could be improved by including M-cells in co-culture. PMID:24793716

Janer, G; Mas del Molino, E; Fernández-Rosas, E; Fernández, A; Vázquez-Campos, S

2014-07-15

360

Charges in haemostasis during radiotherapy of uterine carcinoma  

International Nuclear Information System (INIS)

Clinical chemical parameters for coagulation and fibrinolysis were determined in 20 patients suffering from uterine cancer both during radium implantation with low dose anticoagulation and during the time period of percutaneous post-irradiation. In spite of strong immobilization the partial anticoagulation stabilised haemostasis. A large increase in fibrinogen concentration within the normal range of values, caused by increased production and release from the outer areas of the tumour, cannot be prevented. In addition, in the majority of cases there is a drop in AT III concentration in the pathological range. Percutaneous post-irradiation treatment for further tumour regression leads to a stabilization of the overall tests for clotting. The activated fibrinolysis and elevated levels of fibrin clearage products noted at commencement of the tests showed a normalizing tendency with progressing tumour regression and this was accompanied by a decrease in fibrinogen concentration. A low-dose anticoagulation with 3 x 5000 USP E. Heparin subcutaneous can be recommended as clinical consequences for treating frequently adipose carcinomal patients. Optimal commencement of anticoagulation is 3 hr. pre-operative. (orig./MG)

 
 
 
 
361

Percutaneous laser ablation of hepatocellular carcinoma in patients with liver cirrhosis awaiting liver transplantation  

International Nuclear Information System (INIS)

Objective: The aim of this study was to determine the effectiveness and safety of percutaneous laser ablation for the treatment of cirrhotic patients with hepatocellular carcinoma awaiting liver transplantation. Materials and methods: The data of 9 male cirrhotic patients (mean age 50 years, range 45-60 years) with 12 biopsy proven nodules of hepatocellular carcinoma (mean diameter 2.0 cm, range 1.0-3.0 cm) treated by laser ablation before liver transplantation between June 2000 and January 2006 were retrospectively reviewed. Laser ablation was carried out by inserting 300 nm optical fibers through 21-Gauge needles (from two to four) positioned under ultrasound guidance into the target lesions. A continuous wave Neodymium:Yttrium Aluminium Garnet laser was used. Transarterial chemoembolization prior to liver transplantation was performed in two incompletely ablated tumors. Results: No procedure-related major complications were recorded. During the waiting time to liver transplantation local tumor progression after ablation occurred in 3 nodules (25%). At histological examination of the explanted livers complete necrosis was found in 8 nodules (66.7%, all treated exclusively with laser ablation), partial necrosis >50% in 3 nodules (25%), and partial necrosis <50% in 1 nodule. Conclusion: In patients with cirrhotic livers awaiting liver transplantation, percutaneous laser ablation is safe and effective for the management of small hepatocellular carcinoma.l hepatocellular carcinoma.

362

Cancer du sein de l'homme: ? propos de 6 cas  

Science.gov (United States)

Le but de ce travail était d'analyser les caractéristiques cliniques, histologiques, thérapeutiques et pronostiques du cancer du sein chez l'homme. Il s'agissait d'une étude rétrospective portant sur six patients colligés au service de gynécologie obstétrique II, CHU Hassan II durant la période 2009-2012. L’âge moyen de nos patients est de 65.3 ans. Il s'agit dans 83.3% des cas, d'une tumeur rétroaréolaire dont la taille moyenne est de 44.16 mm. Nous avons retrouvé 4 (66.7%) T4, 1 (16.7%) T3 et dans un cas, une tumeur inclassable. Le type histologique le plus représenté est le carcinome canalaire infiltrant (66.7%). Le taux d'envahissement ganglionnaire axillaire est de 66.7%. L'hormonodépendance de ces tumeurs est prouvée dans 100% des cas. La survie à cinq ans est en cours d’évaluation. L'envahissement ganglionnaire, l'invasion du derme, le stade clinique TNM sont des facteurs qui influencent significativement la survenue de métastases. Aucun de ces facteurs de risque n'est apparu significatif en termes de survie globale. Le cancer du sein chez l'homme est une maladie rare (environ 1% des cancers du sein) au pronostic sombre. Le diagnostic est le plus souvent tardif et les lésions sont traitées à des stades avancés. PMID:24711870

Laabadi, Kamilia; Jayi, Sofia; Alaoui, Fatimazohra Fdili; Bouguern, Hakima; Chaara, Hikmat; Melhouf, My Abdelilah; Hassani, Karim Ibn Majdoub; Laalim, Said Ait; Anoun, Hicham; Toughrai, Imane; Mazaz, Khalid

2013-01-01

363

Papillome invers?: ?tude r?trospective ? propos de 22 cas  

Science.gov (United States)

Le papillome inversé est une tumeur bénigne naso-sinusienne rare, marquée par une forte agressivité locale, un taux élevé de récidive après chirurgie et un risque imprévisible d'association à un carcinome épidermoïde. Il s'agit d'une étude rétrospective de 22 cas de papillome inversé, colligés entre janvier 2000 et décembre 2012 au service d'oto-rhino-laryngologie et chirurgie cervico-faciale de l'hôpital militaire Avicenne de Marrakech. L'objectif de ce travail est d’étudier le profil épidémiologique, clinique, endoscopique, radiologique, thérapeutique et évolutif du papillome inversé. Le sex-ratio a été de 3,7 en faveur du sexe masculin avec une moyenne d’âge de 44 ans et un pic de fréquence entre la quatrième et la cinquième décade. Les symptômes cliniques ont été dominés par l'obstruction nasale. Le bilan radiologique faisant appel au couple TDM et IRM naso-sinusiennes constitue un moyen essentiel pour le diagnostic positif et dans choix de la technique opératoire. La voie vestibulaire sous labiale de Rouge Denker a été utilisée chez 4 patients, 12 patients ont bénéficié d'une chirurgie endoscopique endonasale et 6 patients d'une combinaison des deux voies précédentes. Cinq patients ont eu une récidive du papillome inversé, après un délai moyen de 26 mois. PMID:25161752

Chihani, Mehdi; Nadour, Karim; Touati, Mohamed; Darouassi, Youssef; Ammar, Haddou; Bouaity, Brahim

2014-01-01

364

Use of in vitro assays to assess the potential antiproliferative and cytotoxic effects of saffron (Crocus sativus L. in human lung cancer cell line  

Directory of Open Access Journals (Sweden)

Full Text Available Background: Saffron is harvested from the dried, dark red stigmas of Crocus sativus flowers. It is used as a spice for flavoring and coloring food as a perfume. It is often used for treating several diseases. We investigated the potential of the ethanolic extract of saffron to induce antiproliferative and cytotoxic effects in cultured carcinomic human alveolar basal epithelial cells in comparison with non-malignant (L929 cells. Materials and Methods: Both cells were cultured in Dulbecco?s modified Eagle?s medium and treated with the ethanolic extract of saffron at various concentrations for two consecutive days. Our study resulted in sequences of events marked by apoptosis, such as loss of cell viability, morphology changes that were evaluated by MTT assay and invert-microscope, respectively. Results: The results showed that the ethanolic extract of saffron decreased cell viability in malignant cells as a concentration and time-dependent manner. The IC 50 values against the lung cancer cell line were determined as 1500 and 565 ?g/ml after 24 and 48 h, respectively. However, the extract at different concentrations could not significantly decrease the cell viability in L929 cells. Morphology of MCF7 cells treated with the ethanolic extract confirmed the MTT results. Conclusion: We also showed that even higher concentrations of saffron is safe for L929, but the extract exerts pro-apoptotic effects in a lung cancer-derived cell line and could be considered as a potential chemotherapeutic agent in lung cancer.

Samarghandian Saeed

2010-01-01

365

Is routine pathological examination required in South African children undergoing adenotonsillectomy?  

Scientific Electronic Library Online (English)

Full Text Available SciELO South Africa | Language: English Abstract in english OBJECTIVE: We aimed to determine the incidence of abnormal pathological findings in the tonsils and/or adenoids of children undergoing tonsillectomy and/or adenoidectomy, and the incidence of tuberculosis of the tonsils and adenoids; suggest criteria to identify children at risk for adenotonsillar t [...] uberculosis; and investigate the association between HIV and adenotonsillar abnormality, the cost-effectiveness of routine pathological examination of adenotonsillectomy specimens, and criteria to decide which specimens to send for histological examination. METHODS: We undertook an 8-month prospective study on all children (>12 years) undergoing consecutive tonsillectomy or adenotonsillectomy (T&A) at Red Cross War Memorial Children's Hospital. Patients were assessed pre-operatively and tonsil sizes graded pre- and intra-operatively. Blood was taken for HIV testing, and all tonsils and adenoids were examined histologically. A cost-benefit analysis was done to determine the cost-effectiveness of adenotonsillectomy routine pathology. RESULTS: A total of 344 tonsils were analysed from 172 children (102 boys, 70 girls); 1 patient had nasopharyngeal tuberculosis, and 1 lymphoma of the tonsils; 13 (7.6%) patients had clinically asymmetrically enlarged tonsils but no significant abnormal pathological finding. The average cost of detecting a clinically significant abnormality was R22 744 (R45 488 ÷ 2 abnormalities). CONCLUSIONS: The following criteria could improve cost-effectiveness of pathological examination of adenotonsillectomy specimens: positive tuberculosis contact at home, systemic symptoms of fever and weight loss, cervical lymphadenopathy >3 cm, suspicious nasopharyngeal appearance, HIV-positive patient, rapid tonsillar enlargement or significant tonsillar asymmetry. On our evidence, routine pathological investigation for South African children does not seem to be justified.

Anton C, van Lierop; C A J, Prescott.

2009-11-01

366

Uncommon breast lesions. Radiologic and pathologic findings  

International Nuclear Information System (INIS)

To illustrate the radiologic findings in several uncommon breast and infrequent diseases that present with unusual mammographic images. We reviewed the mammograms performed in our department between 1998 and 1995, selecting 16 patients (12 women and 4 men). Nine patients had benign breast lesions (adenomyoepithelioma, epidermal cyst, adenoid cystic carcinoma, myofibroblastoma, multiple hamartomas, intra cystic papillomas, lipoma, idiopathic granulomatous mastitis and fat necrosis) and 7 patients presented malignant breast diseases (malignant fibrous histiocytoma, intra cystic carcinoma, primary lymphoma of the breast, liposarcoma and metastasis). We present a review of the radiologic and pathologic findings in several uncommon breast diseases. (Author) 14 refs

367

Histopathological Assessment and Immunohistochemical Study of Nasopharyngeal Low Grade MALT Lymphoma  

International Nuclear Information System (INIS)

Introduction: MALT lymphoma arises in a variety of body tissues, but most often in the stomach. Though relatively rare, these MALT lymphomas may arise within several sites in the head and neck, and often present diagnostic and therapeutic challenges. Immunohistochemical analysis are helpful in confirming the diagnosis between the MALT-lymphoma and the reactive lymphoid hyperplasia. MALT-type lymphoma demonstrated characteristic negative staining for CD3, CD5 and CD43, positive staining for CD20, and monotypic staining for either kappa or lambda light chain immunoglobulin markers, whereas reactive lymphoid hyperplasia all expressed Band T cell markers. Material and Methods: 41 cases of nasopharyngeal masses were obtained from the files at pathology department, Mansoura Faculty of Medicine through the period from 2002 till 2006. 31 cases were corresponded histomorphologically to low-grade B-cell lymphoma of mucosa associated lymphoid tissue (MALT) type and 10 patients with reactive lymphoid hyperplasia of the adenoid. Hematoxylin-eosin-stained slides were reviewed to confirm the diagnosis. Immunohistochemical studies were performed on formalin-fixed, paraffin-embedded sections using the labeled streptavidin-biotin-peroxidase complex method with DAB as chromogen. The following antibodies were evaluated CD20, CD3, Kappa, lambda and cytokeratin antibodies. Results: All cases of low grade MALT lymphoma show Iymphoepitheliallesion and proliferation of centrocyte like cells. 14 cases (45.1 %) show subepithelial plasma cells. Dutcher bodies were demonstrated in 10 cases (32.2%). Monocytoid B-cells were seen in 12 cases (38.7%). Six (60%) out of the ten cases of adenoids show transmigrating lymphocyte without formation of lymphoepithelial lesion. All cases with MALT-type lymphoma expressed CD20 and not CD3 whereas 10 cases of adenoid, all expressed Band T cell markers. Immunohistochemical staining showed that 31 cases of low grade MALT lymphoma were positive for immunoglobin light chain (kappa or lambda) while 10 cases of adenoid were positive for both kappa and lambda light chain. Conclusion: Immunohistochemical analysis are helpful in confirming the diagnosis between the MALT lymphoma and the reactive lymphoid hyperplasia of the nasopharynx

368

Basal cell carcinoma arising on the skin with chronic radiation dermatitis  

International Nuclear Information System (INIS)

In a 86-year-old woman, basal cell carcinoma (BCC) arose on the skin with chronic radiation dermatitis. She, at the age of 46, received irradiation to the abdomen for cancer of the uterine cervix. Radiation source and dose were unknown. A verrucous eruption appeared on the irradiated field of the right abdomen, and gradually expanded. Histological examination showed that proliferation of tumor cells with adenoid and cystose structure extended to the epidermis. Electron microscopic study showed both clear and dark tumor cells, although dark cells were few in number. A review of the literature showed that BCC arising on the skin with chronic radiation dermatitis is uncommon in Japan. (Namekawa, K.)

369

Situational Awareness: Regulation of the Myb Transcription Factor in Differentiation, the Cell Cycle and Oncogenesis  

Directory of Open Access Journals (Sweden)

Full Text Available This review summarizes the mechanisms that control the activity of the c-Myb transcription factor in normal cells and tumors, and discusses how c-Myb plays a role in the regulation of the cell cycle. Oncogenic versions of c-Myb contribute to the development of leukemias and solid tumors such as adenoid cystic carcinoma, breast cancer and colon cancer. The activity and specificity of the c-Myb protein seems to be controlled through changes in protein-protein interactions, so understanding how it is regulated could lead to the development of novel therapeutic strategies.

Olivia L. George

2014-10-01

370

Submaxilectomía: causas y complicaciones. Revisión de 160 casos / Submandibular gland excisions: causes and complications. A review of 160 cases  

Scientific Electronic Library Online (English)

Full Text Available SciELO Spain | Language: Spanish Abstract in spanish Objetivo: Presentamos una revisión de 160 submaxilectomías realizadas en el Hospital La Paz de Madrid durante 10 años. Material y métodos: Se revisan retrospectivamente todas las historias clínicas de los