Ingham, Victoria A; Jones, Christopher M; Pignatelli, Patricia; Balabanidou, Vasileia; Vontas, John; Wagstaff, Simon C; Moore, Jonathan D; Ranson, Hilary
2014-11-25
The elevated expression of enzymes with insecticide metabolism activity can lead to high levels of insecticide resistance in the malaria vector, Anopheles gambiae. In this study, adult female mosquitoes from an insecticide susceptible and resistant strain were dissected into four different body parts. RNA from each of these samples was used in microarray analysis to determine the enrichment patterns of the key detoxification gene families within the mosquito and to identify additional candidate insecticide resistance genes that may have been overlooked in previous experiments on whole organisms. A general enrichment in the transcription of genes from the four major detoxification gene families (carboxylesterases, glutathione transferases, UDP glucornyltransferases and cytochrome P450s) was observed in the midgut and malpighian tubules. Yet the subset of P450 genes that have previously been implicated in insecticide resistance in An gambiae, show a surprisingly varied profile of tissue enrichment, confirmed by qPCR and, for three candidates, by immunostaining. A stringent selection process was used to define a list of 105 genes that are significantly (p ≤0.001) over expressed in body parts from the resistant versus susceptible strain. Over half of these, including all the cytochrome P450s on this list, were identified in previous whole organism comparisons between the strains, but several new candidates were detected, notably from comparisons of the transcriptomes from dissected abdomen integuments. The use of RNA extracted from the whole organism to identify candidate insecticide resistance genes has a risk of missing candidates if key genes responsible for the phenotype have restricted expression within the body and/or are over expression only in certain tissues. However, as transcription of genes implicated in metabolic resistance to insecticides is not enriched in any one single organ, comparison of the transcriptome of individual dissected body parts cannot
Generating Genome-Scale Candidate Gene Lists for Pharmacogenomics
DEFF Research Database (Denmark)
Hansen, Niclas Tue; Brunak, Søren; Altman, R. B.
2009-01-01
A critical task in pharmacogenomics is identifying genes that may be important modulators of drug response. High-throughput experimental methods are often plagued by false positives and do not take advantage of existing knowledge. Candidate gene lists can usefully summarize existing knowledge...
Directory of Open Access Journals (Sweden)
Paniego Norma
2008-01-01
Full Text Available Abstract Background Considering that sunflower production is expanding to arid regions, tolerance to abiotic stresses as drought, low temperatures and salinity arises as one of the main constrains nowadays. Differential organ-specific sunflower ESTs (expressed sequence tags were previously generated by a subtractive hybridization method that included a considerable number of putative abiotic stress associated sequences. The objective of this work is to analyze concerted gene expression profiles of organ-specific ESTs by fluorescence microarray assay, in response to high sodium chloride concentration and chilling treatments with the aim to identify and follow up candidate genes for early responses to abiotic stress in sunflower. Results Abiotic-related expressed genes were the target of this characterization through a gene expression analysis using an organ-specific cDNA fluorescence microarray approach in response to high salinity and low temperatures. The experiment included three independent replicates from leaf samples. We analyzed 317 unigenes previously isolated from differential organ-specific cDNA libraries from leaf, stem and flower at R1 and R4 developmental stage. A statistical analysis based on mean comparison by ANOVA and ordination by Principal Component Analysis allowed the detection of 80 candidate genes for either salinity and/or chilling stresses. Out of them, 50 genes were up or down regulated under both stresses, supporting common regulatory mechanisms and general responses to chilling and salinity. Interestingly 15 and 12 sequences were up regulated or down regulated specifically in one stress but not in the other, respectively. These genes are potentially involved in different regulatory mechanisms including transcription/translation/protein degradation/protein folding/ROS production or ROS-scavenging. Differential gene expression patterns were confirmed by qRT-PCR for 12.5% of the microarray candidate sequences. Conclusion
Directory of Open Access Journals (Sweden)
Madhan R Tirumalai
Full Text Available The spores of several Bacillus species, including Bacillus pumilus SAFR-032 and B. safensis FO-36b, which were isolated from the spacecraft assembly facility at NASA's Jet Propulsion Laboratory, are unusually resistant to UV radiation and hydrogen peroxide. In order to identify candidate genes that might be associated with these resistances, the whole genome of B. pumilus SAFR-032, and the draft genome of B. safensis FO-36b were compared in detail with the very closely related type strain B. pumilus ATCC7061(T. 170 genes are considered characteristic of SAFR-032, because they are absent from both FO-36b and ATCC7061(T. Forty of these SAFR-032 characteristic genes are entirely unique open reading frames. In addition, four genes are unique to the genomes of the resistant SAFR-032 and FO-36b. Fifty three genes involved in spore coat formation, regulation and germination, DNA repair, and peroxide resistance, are missing from all three genomes. The vast majority of these are cleanly deleted from their usual genomic context without any obvious replacement. Several DNA repair and peroxide resistance genes earlier reported to be unique to SAFR-032 are in fact shared with ATCC7061(T and no longer considered to be promising candidates for association with the elevated resistances. Instead, several SAFR-032 characteristic genes were identified, which along with one or more of the unique SAFR-032 genes may be responsible for the elevated resistances. These new candidates include five genes associated with DNA repair, namely, BPUM_0608 a helicase, BPUM_0652 an ATP binding protein, BPUM_0653 an endonuclease, BPUM_0656 a DNA cytosine-5- methyltransferase, and BPUM_3674 a DNA helicase. Three of these candidate genes are in immediate proximity of two conserved hypothetical proteins, BPUM_0654 and BPUM_0655 that are also absent from both FO-36b and ATCC7061(T. This cluster of five genes is considered to be an especially promising target for future experimental
Candidate Gene Identification of Flowering Time Genes in Cotton
Directory of Open Access Journals (Sweden)
Corrinne E. Grover
2015-07-01
Full Text Available Flowering time control is critically important to all sexually reproducing angiosperms in both natural ecological and agronomic settings. Accordingly, there is much interest in defining the genes involved in the complex flowering-time network and how these respond to natural and artificial selection, the latter often entailing transitions in day-length responses. Here we describe a candidate gene analysis in the cotton genus , which uses homologs from the well-described flowering network to bioinformatically and phylogenetically identify orthologs in the published genome sequence from Ulbr., one of the two model diploid progenitors of the commercially important allopolyploid cottons, L. and L. Presence and patterns of expression were evaluated from 13 aboveground tissues related to flowering for each of the candidate genes using allopolyploid as a model. Furthermore, we use a comparative context to determine copy number variability of each key gene family across 10 published angiosperm genomes. Data suggest a pattern of repeated loss of duplicates following ancient whole-genome doubling events in diverse lineages. The data presented here provide a foundation for understanding both the parallel evolution of day-length neutrality in domesticated cottons and the flowering-time network, in general, in this important crop plant.
Evaluating historical candidate genes for schizophrenia
DEFF Research Database (Denmark)
Farrell, M S; Werge, T; Sklar, P
2015-01-01
Prior to the genome-wide association era, candidate gene studies were a major approach in schizophrenia genetics. In this invited review, we consider the current status of 25 historical candidate genes for schizophrenia (for example, COMT, DISC1, DTNBP1 and NRG1). The initial study for 24 of thes...
Directory of Open Access Journals (Sweden)
Hugo Bruno Correa Molinari
2013-03-01
Full Text Available The cell walls of grasses such as wheat, maize, rice and sugar cane, contain large amounts of ferulate that is ester-linked to the cell wall polysaccharide glucuronoarabinoxylan (GAX. This ferulate is considered to limit the digestibility of polysaccharide in grass biomass as it forms covalent linkages between polysaccharide and lignin components. Candidate genes within a grass-specific clade of the BAHD acyl-coA transferase superfamily have been identified as being responsible for the ester linkage of ferulate to GAX. Manipulation of these BAHD genes may therefore be a biotechnological target for increasing efficiency of conversion of grass biomass into biofuel. Here, we describe the expression of these candidate genes and amounts of bound ferulate from various tissues and developmental stages of the model grass Brachypodium distachyon. BAHD candidate transcripts and significant amounts of bound ferulate were present in every tissue and developmental stage. We hypothesise that BAHD candidate genes similar to the recently described rice OsPMT gene (PMT sub-clade are principally responsible for the bound coumaric acid (pCA, and that other BAHD candidates (non-PMT sub-clade are responsible for bound ferulic acid (FA. There were some similarities with between the ratio of expression non-PMT / PMT genes and the ratio of bound FA / pCA between tissue types, compatible with this hypothesis. However, much further work to modify BAHD genes in grasses and to characterise the heterologously expressed proteins is required to demonstrate their function.
Directory of Open Access Journals (Sweden)
Arjun Sham
Full Text Available Plants have evolved with intricate mechanisms to cope with multiple environmental stresses. To adapt with biotic and abiotic stresses, plant responses involve changes at the cellular and molecular levels. The current study was designed to investigate the effects of combinations of different environmental stresses on the transcriptome level of Arabidopsis genome using public microarray databases. We investigated the role of cyclopentenones in mediating plant responses to environmental stress through TGA (TGACG motif-binding factor transcription factor, independently from jasmonic acid. Candidate genes were identified by comparing plants inoculated with Botrytis cinerea or treated with heat, salt or osmotic stress with non-inoculated or non-treated tissues. About 2.5% heat-, 19% salinity- and 41% osmotic stress-induced genes were commonly upregulated by B. cinerea-treatment; and 7.6%, 19% and 48% of genes were commonly downregulated by B. cinerea-treatment, respectively. Our results indicate that plant responses to biotic and abiotic stresses are mediated by several common regulatory genes. Comparisons between transcriptome data from Arabidopsis stressed-plants support our hypothesis that some molecular and biological processes involved in biotic and abiotic stress response are conserved. Thirteen of the common regulated genes to abiotic and biotic stresses were studied in detail to determine their role in plant resistance to B. cinerea. Moreover, a T-DNA insertion mutant of the Responsive to Dehydration gene (rd20, encoding for a member of the caleosin (lipid surface protein family, showed an enhanced sensitivity to B. cinerea infection and drought. Overall, the overlapping of plant responses to abiotic and biotic stresses, coupled with the sensitivity of the rd20 mutant, may provide new interesting programs for increased plant resistance to multiple environmental stresses, and ultimately increases its chances to survive. Future research
Oiestad, A J; Martin, J M; Cook, J; Varella, A C; Giroux, M J
2017-07-01
The wheat stem sawfly (WSS) is an economically important pest of wheat in the Northern Great Plains. The primary means of WSS control is resistance associated with the single quantitative trait locus (QTL) , which controls most stem solidness variation. The goal of this study was to identify stem solidness candidate genes via RNA-seq. This study made use of 28 single nucleotide polymorphism (SNP) makers derived from expressed sequence tags (ESTs) linked to contained within a 5.13 cM region. Allele specific expression of EST markers was examined in stem tissue for solid and hollow-stemmed pairs of two spring wheat near isogenic lines (NILs) differing for the QTL. Of the 28 ESTs, 13 were located within annotated genes and 10 had detectable stem expression. Annotated genes corresponding to four of the ESTs were differentially expressed between solid and hollow-stemmed NILs and represent possible stem solidness gene candidates. Further examination of the 5.13 cM region containing the 28 EST markers identified 260 annotated genes. Twenty of the 260 linked genes were up-regulated in hollow NIL stems, while only seven genes were up-regulated in solid NIL stems. An -methyltransferase within the region of interest was identified as a candidate based on differential expression between solid and hollow-stemmed NILs and putative function. Further study of these candidate genes may lead to the identification of the gene(s) controlling stem solidness and an increased ability to select for wheat stem solidness and manage WSS. Copyright © 2017 Crop Science Society of America.
Candidate innate immune system gene expression in the ecological model Daphnia.
Decaestecker, Ellen; Labbé, Pierrick; Ellegaard, Kirsten; Allen, Judith E; Little, Tom J
2011-10-01
The last ten years have witnessed increasing interest in host-pathogen interactions involving invertebrate hosts. The invertebrate innate immune system is now relatively well characterised, but in a limited range of genetic model organisms and under a limited number of conditions. Immune systems have been little studied under real-world scenarios of environmental variation and parasitism. Thus, we have investigated expression of candidate innate immune system genes in the water flea Daphnia, a model organism for ecological genetics, and whose capacity for clonal reproduction facilitates an exceptionally rigorous control of exposure dose or the study of responses at many time points. A unique characteristic of the particular Daphnia clones and pathogen strain combinations used presently is that they have been shown to be involved in specific host-pathogen coevolutionary interactions in the wild. We choose five genes, which are strong candidates to be involved in Daphnia-pathogen interactions, given that they have been shown to code for immune effectors in related organisms. Differential expression of these genes was quantified by qRT-PCR following exposure to the bacterial pathogen Pasteuria ramosa. Constitutive expression levels differed between host genotypes, and some genes appeared to show correlated expression. However, none of the genes appeared to show a major modification of expression level in response to Pasteuria exposure. By applying knowledge from related genetic model organisms (e.g. Drosophila) to models for the study of evolutionary ecology and coevolution (i.e. Daphnia), the candidate gene approach is temptingly efficient. However, our results show that detection of only weak patterns is likely if one chooses target genes for study based on previously identified genome sequences by comparison to homologues from other related organisms. Future work on the Daphnia-Pasteuria system will need to balance a candidate gene approach with more comprehensive
Candidate genes in panic disorder
DEFF Research Database (Denmark)
Howe, A. S.; Buttenschön, Henriette N; Bani-Fatemi, A.
2016-01-01
The utilization of molecular genetics approaches in examination of panic disorder (PD) has implicated several variants as potential susceptibility factors for panicogenesis. However, the identification of robust PD susceptibility genes has been complicated by phenotypic diversity, underpowered...... association studies and ancestry-specific effects. In the present study, we performed a succinct review of case-control association studies published prior to April 2015. Meta-analyses were performed for candidate gene variants examined in at least three studies using the Cochrane Mantel-Haenszel fixed......-effect model. Secondary analyses were also performed to assess the influences of sex, agoraphobia co-morbidity and ancestry-specific effects on panicogenesis. Meta-analyses were performed on 23 variants in 20 PD candidate genes. Significant associations after correction for multiple testing were observed...
Test for positional candidate genes for body composition on pig chromosome 6
Directory of Open Access Journals (Sweden)
Pérez-Enciso Miguel
2002-07-01
Full Text Available Abstract One QTL affecting backfat thickness (BF, intramuscular fat content (IMF and eye muscle area (MA was previously localized on porcine chromosome 6 in an F2 cross between Iberian and Landrace pigs. This work was done to study the effect of two positional candidate genes on these traits: H-FABP and LEPR genes. The QTL mapping analysis was repeated with a regression method using genotypes for seven microsatellites and two PCR-RFLPs in the H-FABP and LEPR genes. H-FABP and LEPR genes were located at 85.4 and 107 cM respectively, by linkage analysis. The effects of the candidate gene polymorphisms were analyzed in two ways. When an animal model was fitted, both genes showed significant effects on fatness traits, the H-FABP polymorphism showed significant effects on IMF and MA, and the LEPR polymorphism on BF and IMF. But when the candidate gene effect was included in a QTL regression analysis these associations were not observed, suggesting that they must not be the causal mutations responsible for the effects found. Differences in the results of both analyses showed the inadequacy of the animal model approach for the evaluation of positional candidate genes in populations with linkage disequilibrium, when the probabilities of the parental origin of the QTL alleles are not included in the model.
Jouffe, Vincent; Rowe, Suzanne; Liaubet, Laurence; Buitenhuis, Bart; Hornshøj, Henrik; SanCristobal, Magali; Mormède, Pierre; de Koning, D J
2009-07-16
Microarray studies can supplement QTL studies by suggesting potential candidate genes in the QTL regions, which by themselves are too large to provide a limited selection of candidate genes. Here we provide a case study where we explore ways to integrate QTL data and microarray data for the pig, which has only a partial genome sequence. We outline various procedures to localize differentially expressed genes on the pig genome and link this with information on published QTL. The starting point is a set of 237 differentially expressed cDNA clones in adrenal tissue from two pig breeds, before and after treatment with adrenocorticotropic hormone (ACTH). Different approaches to localize the differentially expressed (DE) genes to the pig genome showed different levels of success and a clear lack of concordance for some genes between the various approaches. For a focused analysis on 12 genes, overlapping QTL from the public domain were presented. Also, differentially expressed genes underlying QTL for ACTH response were described. Using the latest version of the draft sequence, the differentially expressed genes were mapped to the pig genome. This enabled co-location of DE genes and previously studied QTL regions, but the draft genome sequence is still incomplete and will contain many errors. A further step to explore links between DE genes and QTL at the pathway level was largely unsuccessful due to the lack of annotation of the pig genome. This could be improved by further comparative mapping analyses but this would be time consuming. This paper provides a case study for the integration of QTL data and microarray data for a species with limited genome sequence information and annotation. The results illustrate the challenges that must be addressed but also provide a roadmap for future work that is applicable to other non-model species.
Johnson, Emma C; Border, Richard; Melroy-Greif, Whitney E; de Leeuw, Christiaan A; Ehringer, Marissa A; Keller, Matthew C
2017-11-15
A recent analysis of 25 historical candidate gene polymorphisms for schizophrenia in the largest genome-wide association study conducted to date suggested that these commonly studied variants were no more associated with the disorder than would be expected by chance. However, the same study identified other variants within those candidate genes that demonstrated genome-wide significant associations with schizophrenia. As such, it is possible that variants within historic schizophrenia candidate genes are associated with schizophrenia at levels above those expected by chance, even if the most-studied specific polymorphisms are not. The present study used association statistics from the largest schizophrenia genome-wide association study conducted to date as input to a gene set analysis to investigate whether variants within schizophrenia candidate genes are enriched for association with schizophrenia. As a group, variants in the most-studied candidate genes were no more associated with schizophrenia than were variants in control sets of noncandidate genes. While a small subset of candidate genes did appear to be significantly associated with schizophrenia, these genes were not particularly noteworthy given the large number of more strongly associated noncandidate genes. The history of schizophrenia research should serve as a cautionary tale to candidate gene investigators examining other phenotypes: our findings indicate that the most investigated candidate gene hypotheses of schizophrenia are not well supported by genome-wide association studies, and it is likely that this will be the case for other complex traits as well. Copyright © 2017 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.
Tiffin, Nicki
2010-09-27
Multiple factors underlie susceptibility to essential hypertension, including a significant genetic and ethnic component, and environmental effects. Blood pressure response of hypertensive individuals to salt is heterogeneous, but salt sensitivity appears more prevalent in people of indigenous African origin. The underlying genetics of salt-sensitive hypertension, however, are poorly understood. In this study, computational methods including text- and data-mining have been used to select and prioritize candidate aetiological genes for salt-sensitive hypertension. Additionally, we have compared allele frequencies and copy number variation for single nucleotide polymorphisms in candidate genes between indigenous Southern African and Caucasian populations, with the aim of identifying candidate genes with significant variability between the population groups: identifying genetic variability between population groups can exploit ethnic differences in disease prevalence to aid with prioritisation of good candidate genes. Our top-ranking candidate genes include parathyroid hormone precursor (PTH) and type-1angiotensin II receptor (AGTR1). We propose that the candidate genes identified in this study warrant further investigation as potential aetiological genes for salt-sensitive hypertension. © 2010 Tiffin et al.
Association of Candidate Genes With Submergence Response in Perennial Ryegrass
Directory of Open Access Journals (Sweden)
Xicheng Wang
2017-05-01
Full Text Available Perennial ryegrass is a popular cool-season grass species due to its high quality for forage and turf. The objective of this study was to identify associations of candidate genes with growth and physiological traits to submergence stress and recovery after de-submergence in a global collection of 94 perennial ryegrass accessions. Accessions varied largely in leaf color, plant height (HT, leaf fresh weight (LFW, leaf dry weight (LDW, and chlorophyll fluorescence (Fv/Fm at 7 days of submergence and in HT, LFW and LDW at 7 days of recovery in two experiments. Among 26 candidate genes tested by various models, single nucleotide polymorphisms (SNPs in 10 genes showed significant associations with traits including 16 associations for control, 10 for submergence, and 8 for recovery. Under submergence, Lp1-SST encoding sucrose:sucrose 1-fructosyltransferase and LpGA20ox encoding gibberellin 20-oxidase were associated with LFW and LDW, and LpACO1 encoding 1-aminocyclopropane-1-carboxylic acid oxidase was associated with LFW. Associations between Lp1-SST and HT, Lp6G-FFT encoding fructan:fructan 6G-fructosyltransferase and Fv/Fm, LpCAT encoding catalase and HT were also detected under submergence stress. Upon de-submergence, Lp1-SST, Lp6G-FFT, and LpPIP1 encoding plasma membrane intrinsic protein type 1 were associated with LFW or LDW, while LpCBF1b encoding C-repeat binding factor were associated with HT. Nine significant SNPs in Lp1-SST, Lp6G-FFT, LpCAT, and LpACO1 resulted in amino acid changes with five substitutions found in Lp1-SST under submergence or recovery. The results indicated that allelic diversity in genes involved in carbohydrate and antioxidant metabolism, ethylene and gibberellin biosynthesis, and transcript factor could contribute to growth variations in perennial ryegrass under submergence stress and recovery after de-submergence.
Modinos, Gemma; Iyegbe, Conrad; Prata, Diana; Rivera, Margarita; Kempton, Matthew J; Valmaggia, Lucia R; Sham, Pak C; van Os, Jim; McGuire, Philip
2013-11-01
The relatively high heritability of schizophrenia suggests that genetic factors play an important role in the etiology of the disorder. On the other hand, a number of environmental factors significantly influence its incidence. As few direct genetic effects have been demonstrated, and there is considerable inter-individual heterogeneity in the response to the known environmental factors, interactions between genetic and environmental factors may be important in determining whether an individual develops the disorder. To date, a considerable number of studies of gene-environment interactions (G×E) in schizophrenia have employed a hypothesis-based molecular genetic approach using candidate genes, which have led to a range of different findings. This systematic review aims to summarize the results from molecular genetic candidate studies and to review challenges and opportunities of this approach in psychosis research. Finally, we discuss the potential of future prospects, such as new studies that combine hypothesis-based molecular genetic candidate approaches with agnostic genome-wide association studies in determining schizophrenia risk. © 2013 Elsevier B.V. All rights reserved.
Reranking candidate gene models with cross-species comparison for improved gene prediction
Directory of Open Access Journals (Sweden)
Pereira Fernando CN
2008-10-01
Full Text Available Abstract Background Most gene finders score candidate gene models with state-based methods, typically HMMs, by combining local properties (coding potential, splice donor and acceptor patterns, etc. Competing models with similar state-based scores may be distinguishable with additional information. In particular, functional and comparative genomics datasets may help to select among competing models of comparable probability by exploiting features likely to be associated with the correct gene models, such as conserved exon/intron structure or protein sequence features. Results We have investigated the utility of a simple post-processing step for selecting among a set of alternative gene models, using global scoring rules to rerank competing models for more accurate prediction. For each gene locus, we first generate the K best candidate gene models using the gene finder Evigan, and then rerank these models using comparisons with putative orthologous genes from closely-related species. Candidate gene models with lower scores in the original gene finder may be selected if they exhibit strong similarity to probable orthologs in coding sequence, splice site location, or signal peptide occurrence. Experiments on Drosophila melanogaster demonstrate that reranking based on cross-species comparison outperforms the best gene models identified by Evigan alone, and also outperforms the comparative gene finders GeneWise and Augustus+. Conclusion Reranking gene models with cross-species comparison improves gene prediction accuracy. This straightforward method can be readily adapted to incorporate additional lines of evidence, as it requires only a ranked source of candidate gene models.
Disease candidate gene identification and prioritization using protein interaction networks
Directory of Open Access Journals (Sweden)
Aronow Bruce J
2009-02-01
Full Text Available Abstract Background Although most of the current disease candidate gene identification and prioritization methods depend on functional annotations, the coverage of the gene functional annotations is a limiting factor. In the current study, we describe a candidate gene prioritization method that is entirely based on protein-protein interaction network (PPIN analyses. Results For the first time, extended versions of the PageRank and HITS algorithms, and the K-Step Markov method are applied to prioritize disease candidate genes in a training-test schema. Using a list of known disease-related genes from our earlier study as a training set ("seeds", and the rest of the known genes as a test list, we perform large-scale cross validation to rank the candidate genes and also evaluate and compare the performance of our approach. Under appropriate settings – for example, a back probability of 0.3 for PageRank with Priors and HITS with Priors, and step size 6 for K-Step Markov method – the three methods achieved a comparable AUC value, suggesting a similar performance. Conclusion Even though network-based methods are generally not as effective as integrated functional annotation-based methods for disease candidate gene prioritization, in a one-to-one comparison, PPIN-based candidate gene prioritization performs better than all other gene features or annotations. Additionally, we demonstrate that methods used for studying both social and Web networks can be successfully used for disease candidate gene prioritization.
Candidate gene studies and the quest for the entrepreneurial gene
M.J.H.M. van der Loos (Matthijs); Ph.D. Koellinger (Philipp); P.J.F. Groenen (Patrick); C.A. Rietveld (Niels); F. Rivadeneira Ramirez (Fernando); F.J.A. van Rooij (Frank); A.G. Uitterlinden (André); A. Hofman (Albert); A.R. Thurik (Roy)
2011-01-01
textabstractCandidate gene studies of human behavior are gaining interest in economics and entrepreneurship research. Performing and interpreting these studies is not straightforward because the selection of candidates influences the interpretation of the results. As an example, Nicolaou et al.
Hindumathi, V; Kranthi, T; Rao, S B; Manimaran, P
2014-06-01
With rapidly changing technology, prediction of candidate genes has become an indispensable task in recent years mainly in the field of biological research. The empirical methods for candidate gene prioritization that succors to explore the potential pathway between genetic determinants and complex diseases are highly cumbersome and labor intensive. In such a scenario predicting potential targets for a disease state through in silico approaches are of researcher's interest. The prodigious availability of protein interaction data coupled with gene annotation renders an ease in the accurate determination of disease specific candidate genes. In our work we have prioritized the cervix related cancer candidate genes by employing Csaba Ortutay and his co-workers approach of identifying the candidate genes through graph theoretical centrality measures and gene ontology. With the advantage of the human protein interaction data, cervical cancer gene sets and the ontological terms, we were able to predict 15 novel candidates for cervical carcinogenesis. The disease relevance of the anticipated candidate genes was corroborated through a literature survey. Also the presence of the drugs for these candidates was detected through Therapeutic Target Database (TTD) and DrugMap Central (DMC) which affirms that they may be endowed as potential drug targets for cervical cancer.
Directory of Open Access Journals (Sweden)
Jinling Wang
2014-09-01
Full Text Available Background/Aims: Our aim was to explore the molecular mechanism underlying development of IgA nephropathy and discover candidate agents for IgA nephropathy. Methods: The differentially expressed genes (DEGs between patients with IgA nephropathy and normal controls were identified by the data of GSE35488 downloaded from GEO (Gene Expression Omnibus database. The co-expressed gene pairs among DEGs were screened to construct the gene-gene interaction network. Gene Ontology (GO enrichment analysis was performed to analyze the functions of DEGs. The biologically active small molecules capable of targeting IgA nephropathy were identified using the Connectivity Map (cMap database. Results: A total of 55 genes involved in response to organic substance, transcription factor activity and response to steroid hormone stimulus were identified to be differentially expressed in IgA nephropathy patients compared to healthy individuals. A network with 45 co-expressed gene pairs was constructed. DEGs in the network were significantly enriched in response to organic substance. Additionally, a group of small molecules were identified, such as doxorubicin and thapsigargin. Conclusion: Our work provided a systematic insight in understanding the mechanism of IgA nephropathy. Small molecules such as thapsigargin might be potential candidate agents for the treatment of IgA nephropathy.
Finding gene regulatory network candidates using the gene expression knowledge base.
Venkatesan, Aravind; Tripathi, Sushil; Sanz de Galdeano, Alejandro; Blondé, Ward; Lægreid, Astrid; Mironov, Vladimir; Kuiper, Martin
2014-12-10
Network-based approaches for the analysis of large-scale genomics data have become well established. Biological networks provide a knowledge scaffold against which the patterns and dynamics of 'omics' data can be interpreted. The background information required for the construction of such networks is often dispersed across a multitude of knowledge bases in a variety of formats. The seamless integration of this information is one of the main challenges in bioinformatics. The Semantic Web offers powerful technologies for the assembly of integrated knowledge bases that are computationally comprehensible, thereby providing a potentially powerful resource for constructing biological networks and network-based analysis. We have developed the Gene eXpression Knowledge Base (GeXKB), a semantic web technology based resource that contains integrated knowledge about gene expression regulation. To affirm the utility of GeXKB we demonstrate how this resource can be exploited for the identification of candidate regulatory network proteins. We present four use cases that were designed from a biological perspective in order to find candidate members relevant for the gastrin hormone signaling network model. We show how a combination of specific query definitions and additional selection criteria derived from gene expression data and prior knowledge concerning candidate proteins can be used to retrieve a set of proteins that constitute valid candidates for regulatory network extensions. Semantic web technologies provide the means for processing and integrating various heterogeneous information sources. The GeXKB offers biologists such an integrated knowledge resource, allowing them to address complex biological questions pertaining to gene expression. This work illustrates how GeXKB can be used in combination with gene expression results and literature information to identify new potential candidates that may be considered for extending a gene regulatory network.
Directory of Open Access Journals (Sweden)
Jing Zhao
Full Text Available Many diseases have complex genetic causes, where a set of alleles can affect the propensity of getting the disease. The identification of such disease genes is important to understand the mechanistic and evolutionary aspects of pathogenesis, improve diagnosis and treatment of the disease, and aid in drug discovery. Current genetic studies typically identify chromosomal regions associated specific diseases. But picking out an unknown disease gene from hundreds of candidates located on the same genomic interval is still challenging. In this study, we propose an approach to prioritize candidate genes by integrating data of gene expression level, protein-protein interaction strength and known disease genes. Our method is based only on two, simple, biologically motivated assumptions--that a gene is a good disease-gene candidate if it is differentially expressed in cases and controls, or that it is close to other disease-gene candidates in its protein interaction network. We tested our method on 40 diseases in 58 gene expression datasets of the NCBI Gene Expression Omnibus database. On these datasets our method is able to predict unknown disease genes as well as identifying pleiotropic genes involved in the physiological cellular processes of many diseases. Our study not only provides an effective algorithm for prioritizing candidate disease genes but is also a way to discover phenotypic interdependency, cooccurrence and shared pathophysiology between different disorders.
Candidate genes in ocular dominance plasticity
Rietman, M.L.; Sommeijer, J.-P.; Levelt, C.N.; Heimel, J.A.; Brussaard, A.B.; Borst, J.G.G.; Elgersma, Y.; Galjart, N.; van der Horst, G.T.; Pennartz, C.M.; Smit, A.B.; Spruijt, B.M.; Verhage, M.; de Zeeuw, C.I.
2012-01-01
Many studies have been devoted to the identification of genes involved in experience-dependent plasticity in the visual cortex. To discover new candidate genes, we have reexamined data from one such study on ocular dominance (OD) plasticity in recombinant inbred BXD mouse strains. We have correlated
Directory of Open Access Journals (Sweden)
Renesh Bedre
Full Text Available Aflatoxins are toxic and potent carcinogenic metabolites produced from the fungi Aspergillus flavus and A. parasiticus. Aflatoxins can contaminate cottonseed under conducive preharvest and postharvest conditions. United States federal regulations restrict the use of aflatoxin contaminated cottonseed at >20 ppb for animal feed. Several strategies have been proposed for controlling aflatoxin contamination, and much success has been achieved by the application of an atoxigenic strain of A. flavus in cotton, peanut and maize fields. Development of cultivars resistant to aflatoxin through overexpression of resistance associated genes and/or knocking down aflatoxin biosynthesis of A. flavus will be an effective strategy for controlling aflatoxin contamination in cotton. In this study, genome-wide transcriptome profiling was performed to identify differentially expressed genes in response to infection with both toxigenic and atoxigenic strains of A. flavus on cotton (Gossypium hirsutum L. pericarp and seed. The genes involved in antifungal response, oxidative burst, transcription factors, defense signaling pathways and stress response were highly differentially expressed in pericarp and seed tissues in response to A. flavus infection. The cell-wall modifying genes and genes involved in the production of antimicrobial substances were more active in pericarp as compared to seed. The genes involved in auxin and cytokinin signaling were also induced. Most of the genes involved in defense response in cotton were highly induced in pericarp than in seed. The global gene expression analysis in response to fungal invasion in cotton will serve as a source for identifying biomarkers for breeding, potential candidate genes for transgenic manipulation, and will help in understanding complex plant-fungal interaction for future downstream research.
Functional dissection of drought-responsive gene expression patterns in Cynodon dactylon L.
Kim, Changsoo; Lemke, Cornelia; Paterson, Andrew H
2009-05-01
Water deficit is one of the main abiotic factors that affect plant productivity in subtropical regions. To identify genes induced during the water stress response in Bermudagrass (Cynodon dactylon), cDNA macroarrays were used. The macroarray analysis identified 189 drought-responsive candidate genes from C. dactylon, of which 120 were up-regulated and 69 were down-regulated. The candidate genes were classified into seven groups by cluster analysis of expression levels across two intensities and three durations of imposed stress. Annotation using BLASTX suggested that up-regulated genes may be involved in proline biosynthesis, signal transduction pathways, protein repair systems, and removal of toxins, while down-regulated genes were mostly related to basic plant metabolism such as photosynthesis and glycolysis. The functional classification of gene ontology (GO) was consistent with the BLASTX results, also suggesting some crosstalk between abiotic and biotic stress. Comparative analysis of cis-regulatory elements from the candidate genes implicated specific elements in drought response in Bermudagrass. Although only a subset of genes was studied, Bermudagrass shared many drought-responsive genes and cis-regulatory elements with other botanical models, supporting a strategy of cross-taxon application of drought-responsive genes, regulatory cues, and physiological-genetic information.
ENU Mutagenesis in Mice Identifies Candidate Genes For Hypogonadism
Weiss, Jeffrey; Hurley, Lisa A.; Harris, Rebecca M.; Finlayson, Courtney; Tong, Minghan; Fisher, Lisa A.; Moran, Jennifer L.; Beier, David R.; Mason, Christopher; Jameson, J. Larry
2012-01-01
Genome-wide mutagenesis was performed in mice to identify candidate genes for male infertility, for which the predominant causes remain idiopathic. Mice were mutagenized using N-ethyl-N-nitrosourea (ENU), bred, and screened for phenotypes associated with the male urogenital system. Fifteen heritable lines were isolated and chromosomal loci were assigned using low density genome-wide SNP arrays. Ten of the fifteen lines were pursued further using higher resolution SNP analysis to narrow the candidate gene regions. Exon sequencing of candidate genes identified mutations in mice with cystic kidneys (Bicc1), cryptorchidism (Rxfp2), restricted germ cell deficiency (Plk4), and severe germ cell deficiency (Prdm9). In two other lines with severe hypogonadism candidate sequencing failed to identify mutations, suggesting defects in genes with previously undocumented roles in gonadal function. These genomic intervals were sequenced in their entirety and a candidate mutation was identified in SnrpE in one of the two lines. The line harboring the SnrpE variant retains substantial spermatogenesis despite small testis size, an unusual phenotype. In addition to the reproductive defects, heritable phenotypes were observed in mice with ataxia (Myo5a), tremors (Pmp22), growth retardation (unknown gene), and hydrocephalus (unknown gene). These results demonstrate that the ENU screen is an effective tool for identifying potential causes of male infertility. PMID:22258617
[Obesity studies in candidate genes].
Ochoa, María del Carmen; Martí, Amelia; Martínez, J Alfredo
2004-04-17
There are more than 430 chromosomic regions with gene variants involved in body weight regulation and obesity development. Polymorphisms in genes related to energy expenditure--uncoupling proteins (UCPs), related to adipogenesis and insulin resistance--hormone-sensitive lipase (HLS), peroxisome proliferator-activated receptor gamma (PPAR gamma), beta adrenergic receptors (ADRB2,3), and alfa tumor necrosis factor (TNF-alpha), and related to food intake--ghrelin (GHRL)--appear to be associated with obesity phenotypes. Obesity risk depends on two factors: a) genetic variants in candidate genes, and b) biographical exposure to environmental risk factors. It is necessary to perform new studies, with appropriate control groups and designs, in order to reach relevant conclusions with regard to gene/environmental (diet, lifestyle) interactions.
de Miguel, Marina; Cabezas, José-Antonio; de María, Nuria; Sánchez-Gómez, David; Guevara, María-Ángeles; Vélez, María-Dolores; Sáez-Laguna, Enrique; Díaz, Luis-Manuel; Mancha, Jose-Antonio; Barbero, María-Carmen; Collada, Carmen; Díaz-Sala, Carmen; Aranda, Ismael; Cervera, María-Teresa
2014-06-12
Understanding molecular mechanisms that control photosynthesis and water use efficiency in response to drought is crucial for plant species from dry areas. This study aimed to identify QTL for these traits in a Mediterranean conifer and tested their stability under drought. High density linkage maps for Pinus pinaster were used in the detection of QTL for photosynthesis and water use efficiency at three water irrigation regimes. A total of 28 significant and 27 suggestive QTL were found. QTL detected for photochemical traits accounted for the higher percentage of phenotypic variance. Functional annotation of genes within the QTL suggested 58 candidate genes for the analyzed traits. Allele association analysis in selected candidate genes showed three SNPs located in a MYB transcription factor that were significantly associated with efficiency of energy capture by open PSII reaction centers and specific leaf area. The integration of QTL mapping of functional traits, genome annotation and allele association yielded several candidate genes involved with molecular control of photosynthesis and water use efficiency in response to drought in a conifer species. The results obtained highlight the importance of maintaining the integrity of the photochemical machinery in P. pinaster drought response.
DEFF Research Database (Denmark)
Sahana, Goutam; Guldbrandtsen, Bernt; Bendixen, Christian
Six genomic regions affecting clinical mastitis were identified through a GWAS study with imputed BovineHD chip genotype data in the Nordic Holstein cattle population. The association analyses were carried out using a SNP-by-SNP analysis by fitting the regression of allele dosage and a polygenic...... Effect Predictor (VEP) vers. 2.6 using ENSEMBL vers. 67 databases. Candidate polymorphisms affecting clinical mastitis were selected based on their association with the traits and functional annotations. A strong positional candidate gene for mastitis resistance on chromosome-6 is the NPFFR2 which...... Factor Receptor Alpha (LIFR) emerged as a strong candidate gene for mastitis resistance. The LIFR gene is involved in acute phase response and is expressed in saliva and mammary gland....
Degrees of separation as a statistical tool for evaluating candidate genes.
Nelson, Ronald M; Pettersson, Mats E
2014-12-01
Selection of candidate genes is an important step in the exploration of complex genetic architecture. The number of gene networks available is increasing and these can provide information to help with candidate gene selection. It is currently common to use the degree of connectedness in gene networks as validation in Genome Wide Association (GWA) and Quantitative Trait Locus (QTL) mapping studies. However, it can cause misleading results if not validated properly. Here we present a method and tool for validating the gene pairs from GWA studies given the context of the network they co-occur in. It ensures that proposed interactions and gene associations are not statistical artefacts inherent to the specific gene network architecture. The CandidateBacon package provides an easy and efficient method to calculate the average degree of separation (DoS) between pairs of genes to currently available gene networks. We show how these empirical estimates of average connectedness are used to validate candidate gene pairs. Validation of interacting genes by comparing their connectedness with the average connectedness in the gene network will provide support for said interactions by utilising the growing amount of gene network information available. Copyright © 2014 Elsevier Ltd. All rights reserved.
Candidate genes detected in transcriptome studies are strongly dependent on genetic background.
Directory of Open Access Journals (Sweden)
Pernille Sarup
2011-01-01
Full Text Available Whole genome transcriptomic studies can point to potential candidate genes for organismal traits. However, the importance of potential candidates is rarely followed up through functional studies and/or by comparing results across independent studies. We have analysed the overlap of candidate genes identified from studies of gene expression in Drosophila melanogaster using similar technical platforms. We found little overlap across studies between putative candidate genes for the same traits in the same sex. Instead there was a high degree of overlap between different traits and sexes within the same genetic backgrounds. Putative candidates found using transcriptomics therefore appear very sensitive to genetic background and this can mask or override effects of treatments. The functional importance of putative candidate genes emerging from transcriptome studies needs to be validated through additional experiments and in future studies we suggest a focus on the genes, networks and pathways affecting traits in a consistent manner across backgrounds.
Functional validation of candidate genes detected by genomic feature models
DEFF Research Database (Denmark)
Rohde, Palle Duun; Østergaard, Solveig; Kristensen, Torsten Nygaard
2018-01-01
Understanding the genetic underpinnings of complex traits requires knowledge of the genetic variants that contribute to phenotypic variability. Reliable statistical approaches are needed to obtain such knowledge. In genome-wide association studies, variants are tested for association with trait...... then functionally assessed whether the identified candidate genes affected locomotor activity by reducing gene expression using RNA interference. In five of the seven candidate genes tested, reduced gene expression altered the phenotype. The ranking of genes within the predictive GO term was highly correlated...
Candidate genes and molecular markers associated with heat tolerance in colonial Bentgrass.
Jespersen, David; Belanger, Faith C; Huang, Bingru
2017-01-01
Elevated temperature is a major abiotic stress limiting the growth of cool-season grasses during the summer months. The objectives of this study were to determine the genetic variation in the expression patterns of selected genes involved in several major metabolic pathways regulating heat tolerance for two genotypes contrasting in heat tolerance to confirm their status as potential candidate genes, and to identify PCR-based markers associated with candidate genes related to heat tolerance in a colonial (Agrostis capillaris L.) x creeping bentgrass (Agrostis stolonifera L.) hybrid backcross population. Plants were subjected to heat stress in controlled-environmental growth chambers for phenotypic evaluation and determination of genetic variation in candidate gene expression. Molecular markers were developed for genes involved in protein degradation (cysteine protease), antioxidant defense (catalase and glutathione-S-transferase), energy metabolism (glyceraldehyde-3-phosphate dehydrogenase), cell expansion (expansin), and stress protection (heat shock proteins HSP26, HSP70, and HSP101). Kruskal-Wallis analysis, a commonly used non-parametric test used to compare population individuals with or without the gene marker, found the physiological traits of chlorophyll content, electrolyte leakage, normalized difference vegetative index, and turf quality were associated with all candidate gene markers with the exception of HSP101. Differential gene expression was frequently found for the tested candidate genes. The development of candidate gene markers for important heat tolerance genes may allow for the development of new cultivars with increased abiotic stress tolerance using marker-assisted selection.
Candidate genes and molecular markers associated with heat tolerance in colonial Bentgrass.
Directory of Open Access Journals (Sweden)
David Jespersen
Full Text Available Elevated temperature is a major abiotic stress limiting the growth of cool-season grasses during the summer months. The objectives of this study were to determine the genetic variation in the expression patterns of selected genes involved in several major metabolic pathways regulating heat tolerance for two genotypes contrasting in heat tolerance to confirm their status as potential candidate genes, and to identify PCR-based markers associated with candidate genes related to heat tolerance in a colonial (Agrostis capillaris L. x creeping bentgrass (Agrostis stolonifera L. hybrid backcross population. Plants were subjected to heat stress in controlled-environmental growth chambers for phenotypic evaluation and determination of genetic variation in candidate gene expression. Molecular markers were developed for genes involved in protein degradation (cysteine protease, antioxidant defense (catalase and glutathione-S-transferase, energy metabolism (glyceraldehyde-3-phosphate dehydrogenase, cell expansion (expansin, and stress protection (heat shock proteins HSP26, HSP70, and HSP101. Kruskal-Wallis analysis, a commonly used non-parametric test used to compare population individuals with or without the gene marker, found the physiological traits of chlorophyll content, electrolyte leakage, normalized difference vegetative index, and turf quality were associated with all candidate gene markers with the exception of HSP101. Differential gene expression was frequently found for the tested candidate genes. The development of candidate gene markers for important heat tolerance genes may allow for the development of new cultivars with increased abiotic stress tolerance using marker-assisted selection.
Genetics of human longevity with emphasis on the relevance of HSP70 as candidate genes
DEFF Research Database (Denmark)
Singh, Ripudaman; Kølvrå, Steen; Rattan, Suresh I S
2007-01-01
Human longevity is determined to a certain extent by genetic factors. Several candidate genes have been studied for their association with human longevity, but the data collected so far are inconclusive. One of the reasons is the choice of the candidate genes in addition to the choice...... of an appropriate study design and methodology. Since aging is characterized by a progressive accumulation of molecular damage and an attenuation of the cellular defense mechanisms, the focus of studies on human longevity association with genes has now shifted to the pathways of cellular maintenance and repair...... mechanisms. One such pathway includes the battery of stress response genes, especially the heat shock protein HSP70 genes. Three such genes, HSPA1A, HSPA1B and HSPA1L, are present within the MHC-III region on the short arm of chromosome 6. We and others have found alleles, genotypes and haplotypes which have...
Candidate genes for cross-resistance against DNA-damaging drugs
DEFF Research Database (Denmark)
Wittig, Rainer; Nessling, Michelle; Will, Rainer D
2002-01-01
Drug resistance of tumor cells leads to major drawbacks in the treatment of cancer. To identify candidate genes for drug resistance, we compared the expression patterns of the drug-sensitive human malignant melanoma cell line MeWo and three derived sublines with acquired resistance to the DNA...... as several apoptosis-related genes, in particular STK17A and CRYAB. As MPP1 and CRYAB are also among the 14 genes differentially expressed in all three of the drug-resistant sublines, they represent the strongest candidates for resistance against DNA-damaging drugs....
Mapping a candidate gene (MdMYB10 for red flesh and foliage colour in apple
Directory of Open Access Journals (Sweden)
Allan Andrew C
2007-07-01
Full Text Available Abstract Background Integrating plant genomics and classical breeding is a challenge for both plant breeders and molecular biologists. Marker-assisted selection (MAS is a tool that can be used to accelerate the development of novel apple varieties such as cultivars that have fruit with anthocyanin through to the core. In addition, determining the inheritance of novel alleles, such as the one responsible for red flesh, adds to our understanding of allelic variation. Our goal was to map candidate anthocyanin biosynthetic and regulatory genes in a population segregating for the red flesh phenotypes. Results We have identified the Rni locus, a major genetic determinant of the red foliage and red colour in the core of apple fruit. In a population segregating for the red flesh and foliage phenotype we have determined the inheritance of the Rni locus and DNA polymorphisms of candidate anthocyanin biosynthetic and regulatory genes. Simple Sequence Repeats (SSRs and Single Nucleotide Polymorphisms (SNPs in the candidate genes were also located on an apple genetic map. We have shown that the MdMYB10 gene co-segregates with the Rni locus and is on Linkage Group (LG 09 of the apple genome. Conclusion We have performed candidate gene mapping in a fruit tree crop and have provided genetic evidence that red colouration in the fruit core as well as red foliage are both controlled by a single locus named Rni. We have shown that the transcription factor MdMYB10 may be the gene underlying Rni as there were no recombinants between the marker for this gene and the red phenotype in a population of 516 individuals. Associating markers derived from candidate genes with a desirable phenotypic trait has demonstrated the application of genomic tools in a breeding programme of a horticultural crop species.
Candidate genes for COPD: current evidence and research
Directory of Open Access Journals (Sweden)
Kim WJ
2015-10-01
Full Text Available Woo Jin Kim,1 Sang Do Lee2 1Department of Internal Medicine and Environmental Health Center, Kangwon National University, Chuncheon, 2Department of Pulmonary and Critical Care Medicine, Clinical Research Center for Chronic Obstructive Airway Diseases, Asan Medical Center, University of Ulsan College of Medicine, Seoul, South Korea Abstract: COPD is a common complex disease characterized by progressive airflow limitation. Several genome-wide association studies (GWASs have discovered genes that are associated with COPD. Recently, candidate genes for COPD identified by GWASs include CHRNA3/5 (cholinergic nicotine receptor alpha 3/5, IREB2 (iron regulatory binding protein 2, HHIP (hedgehog-interacting protein, FAM13A (family with sequence similarity 13, member A, and AGER (advanced glycosylation end product–specific receptor. Their association with COPD susceptibility has been replicated in multiple populations. Since these candidate genes have not been considered in COPD, their pathological roles are still largely unknown. Herein, we review some evidences that they can be effective drug targets or serve as biomarkers for diagnosis or subtyping. However, more study is required to understand the functional roles of these candidate genes. Future research is needed to characterize the effect of genetic variants, validate gene function in humans and model systems, and elucidate the genes’ transcriptional and posttranscriptional regulatory mechanisms. Keywords: chronic obstructive pulmonary disease, genetics, genome-wide association study
Characterization of Gene Candidates for Vacuolar Sodium Transport from Hordeum Vulgare
Scheu, Arne Hagen August
2017-05-01
Soil salinity is a major abiotic stress for land plants, and multiple mechanisms of salt tolerance have evolved. Tissue tolerance is one of these mechanisms, which involves the sequestration of sodium into the vacuole to retain low cytosolic sodium concentrations. This enables the plant to maintain cellular functions, and ultimately maintain growth and yield. However, the molecular components involved in tissue tolerance remain elusive. Several candidate genes for vacuolar sodium sequestration have recently been identified by proteome analysis of vacuolar membranes purified from the salt-tolerant cereal Hordeum vulgare (barley). In this study, I aimed to characterize these candidates in more detail. I successfully cloned coding sequences for the majority of candidate genes with primers designed based on the barley reference genome sequence. During the course of this study a newer genome sequence with improved annotations was published, to which I also compared my observations. To study the candidate genes, I used the heterologous expression system Saccharomyces cerevisiae (yeast). I used several salt sensitive yeast strains (deficient in intrinsic sodium transporters) to test whether the candidate genes would affect their salt tolerance by mediating the sequestration of sodium into the yeast vacuole. I observed a reduction in growth upon expression for several of the gene candidate under salt-stress conditions. However, confocal microscopy suggests that most gene products are subject to degradation, and did not localize to the vacuolar membrane (tonoplast). Therefore, growth effects cannot be linked to protein function without further evidence. Various potential causes are discussed, including inaccuracies in the genome resource used as reference for primer design and issues inherent to the model system. Finally, I make suggestions on how to proceed to further characterize the candidate genes and hopefully identify novel sodium transporters from barley.
Inferring Gene Regulatory Networks Using Conditional Regulation Pattern to Guide Candidate Genes.
Directory of Open Access Journals (Sweden)
Fei Xiao
Full Text Available Combining path consistency (PC algorithms with conditional mutual information (CMI are widely used in reconstruction of gene regulatory networks. CMI has many advantages over Pearson correlation coefficient in measuring non-linear dependence to infer gene regulatory networks. It can also discriminate the direct regulations from indirect ones. However, it is still a challenge to select the conditional genes in an optimal way, which affects the performance and computation complexity of the PC algorithm. In this study, we develop a novel conditional mutual information-based algorithm, namely RPNI (Regulation Pattern based Network Inference, to infer gene regulatory networks. For conditional gene selection, we define the co-regulation pattern, indirect-regulation pattern and mixture-regulation pattern as three candidate patterns to guide the selection of candidate genes. To demonstrate the potential of our algorithm, we apply it to gene expression data from DREAM challenge. Experimental results show that RPNI outperforms existing conditional mutual information-based methods in both accuracy and time complexity for different sizes of gene samples. Furthermore, the robustness of our algorithm is demonstrated by noisy interference analysis using different types of noise.
Órpez-Zafra, Teresa; Pinto-Medel, María Jesús; Oliver-Martos, Begoña; Ortega-Pinazo, Jesús; Arnáiz, Carlos; Guijarro-Castro, Cristina; Varadé, Jezabel; Álvarez-Lafuente, Roberto; Urcelay, Elena; Sánchez-Jiménez, Francisca
2013-01-01
TRAIL and TRAIL Receptor genes have been implicated in Multiple Sclerosis pathology as well as in the response to IFN beta therapy. The objective of our study was to evaluate the association of these genes in relation to the age at disease onset (AAO) and to the clinical response upon IFN beta treatment in Spanish MS patients. We carried out a candidate gene study of TRAIL, TRAILR-1, TRAILR-2, TRAILR-3 and TRAILR-4 genes. A total of 54 SNPs were analysed in 509 MS patients under IFN beta treatment, and an additional cohort of 226 MS patients was used to validate the results. Associations of rs1047275 in TRAILR-2 and rs7011559 in TRAILR-4 genes with AAO under an additive model did not withstand Bonferroni correction. In contrast, patients with the TRAILR-1 rs20576-CC genotype showed a better clinical response to IFN beta therapy compared with patients carrying the A-allele (recessive model: p = 8.88×10−4, pc = 0.048, OR = 0.30). This SNP resulted in a non synonymous substitution of Glutamic acid to Alanine in position 228 (E228A), a change previously associated with susceptibility to different cancer types and risk of metastases, suggesting a lack of functionality of TRAILR-1. In order to unravel how this amino acid change in TRAILR-1 would affect to death signal, we performed a molecular modelling with both alleles. Neither TRAIL binding sites in the receptor nor the expression levels of TRAILR-1 in peripheral blood mononuclear cell subsets (monocytes, CD4+ and CD8+ T cells) were modified, suggesting that this SNP may be altering the death signal by some other mechanism. These findings show a role for TRAILR-1 gene variations in the clinical outcome of IFN beta therapy that might have relevance as a biomarker to predict the response to IFN beta in MS. PMID:23658636
Directory of Open Access Journals (Sweden)
Carlos López-Gómez
Full Text Available TRAIL and TRAIL Receptor genes have been implicated in Multiple Sclerosis pathology as well as in the response to IFN beta therapy. The objective of our study was to evaluate the association of these genes in relation to the age at disease onset (AAO and to the clinical response upon IFN beta treatment in Spanish MS patients. We carried out a candidate gene study of TRAIL, TRAILR-1, TRAILR-2, TRAILR-3 and TRAILR-4 genes. A total of 54 SNPs were analysed in 509 MS patients under IFN beta treatment, and an additional cohort of 226 MS patients was used to validate the results. Associations of rs1047275 in TRAILR-2 and rs7011559 in TRAILR-4 genes with AAO under an additive model did not withstand Bonferroni correction. In contrast, patients with the TRAILR-1 rs20576-CC genotype showed a better clinical response to IFN beta therapy compared with patients carrying the A-allele (recessive model: p = 8.88×10(-4, pc = 0.048, OR = 0.30. This SNP resulted in a non synonymous substitution of Glutamic acid to Alanine in position 228 (E228A, a change previously associated with susceptibility to different cancer types and risk of metastases, suggesting a lack of functionality of TRAILR-1. In order to unravel how this amino acid change in TRAILR-1 would affect to death signal, we performed a molecular modelling with both alleles. Neither TRAIL binding sites in the receptor nor the expression levels of TRAILR-1 in peripheral blood mononuclear cell subsets (monocytes, CD4+ and CD8+ T cells were modified, suggesting that this SNP may be altering the death signal by some other mechanism. These findings show a role for TRAILR-1 gene variations in the clinical outcome of IFN beta therapy that might have relevance as a biomarker to predict the response to IFN beta in MS.
Identification of candidate genes for dissecting complex branch number trait in chickpea.
Bajaj, Deepak; Upadhyaya, Hari D; Das, Shouvik; Kumar, Vinod; Gowda, C L L; Sharma, Shivali; Tyagi, Akhilesh K; Parida, Swarup K
2016-04-01
The present study exploited integrated genomics-assisted breeding strategy for genetic dissection of complex branch number quantitative trait in chickpea. Candidate gene-based association analysis in a branch number association panel was performed by utilizing the genotyping data of 401 SNP allelic variants mined from 27 known cloned branch number gene orthologs of chickpea. The genome-wide association study (GWAS) integrating both genome-wide GBS- (4556 SNPs) and candidate gene-based genotyping information of 4957 SNPs in a structured population of 60 sequenced desi and kabuli accessions (with 350-400 kb LD decay), detected 11 significant genomic loci (genes) associated (41% combined PVE) with branch number in chickpea. Of these, seven branch number-associated genes were further validated successfully in two inter (ICC 4958 × ICC 17160)- and intra (ICC 12299 × ICC 8261)-specific mapping populations. The axillary meristem and shoot apical meristem-specific expression, including differential up- and down-regulation (4-5 fold) of the validated seven branch number-associated genes especially in high branch number as compared to the low branch number-containing parental accessions and homozygous individuals of two aforesaid mapping populations was apparent. Collectively, this combinatorial genomic approach delineated diverse naturally occurring novel functional SNP allelic variants in seven potential known/candidate genes [PIN1 (PIN-FORMED protein 1), TB1 (teosinte branched 1), BA1/LAX1 (BARREN STALK1/LIKE AUXIN1), GRAS8 (gibberellic acid insensitive/GAI, Repressor of ga13/RGA and Scarecrow8/SCR8), ERF (ethylene-responsive element-binding factor), MAX2 (more axillary growth 2) and lipase] governing chickpea branch number. The useful information generated from this study have potential to expedite marker-assisted genetic enhancement by developing high-yielding cultivars with more number of productive (pods and seeds) branches in chickpea. Copyright © 2016 Elsevier
Characterisation of five candidate genes within the ETEC F4ab/ac candidate region in pigs
DEFF Research Database (Denmark)
Jacobsen, Mette Juul; Cirera Salicio, Susanna; Joller, David
2011-01-01
by haplotype sharing to a 2.5 Mb region on pig chromosome 13, a region containing 18 annotated genes. FINDINGS: The coding regions of five candidate genes for susceptibility to ETEC F4ab/ac infection (TFRC, ACK1, MUC20, MUC4 and KIAA0226), all located in the 2.5 Mb region, were investigated for the presence...... polymorphism in exon 22 of KIAA0226. Transcriptional profiles of the five genes were investigated in a porcine tissue panel including various intestinal tissues. All five genes were expressed in intestinal tissues at different levels but none of the genes were found differentially expressed between ETEC F4ab/ac...... of the amino acids composition. However, we cannot exclude that the five tested genes are bona fide candidate genes for susceptibility to ETEC F4ab/ac infection since the identified polymorphism might affect the translational apparatus, alternative splice forms may exist and post translational mechanisms might...
Web tools for the prioritization of candidate disease genes.
Oti, M.O.; Ballouz, S.; Wouters, M.A.
2011-01-01
Despite increasing sequencing capacity, genetic disease investigation still frequently results in the identification of loci containing multiple candidate disease genes that need to be tested for involvement in the disease. This process can be expedited by prioritizing the candidates prior to
Energy Technology Data Exchange (ETDEWEB)
Tanzi, R.E.; Romano, D.M.; Crowley, A.C. [Harvard Medical School, Charlestown, MA (United States)] [and others
1994-09-01
Genetic studies of kindreds displaying evidence for familial AD (FAD) have led to the localization of gene defects responsible for this disorder on chromosomes 14, 19, and 21. A minor early-onset FAD gene on chromosome 21 has been identified to enode the amyloid precursor protein (APP), and the late-onset FAD susceptibility locus on chromosome 19 has been shown to be in linkage disequilibrium with the E4 allele of the APOE gene. Meanwhile, the locus responsible for the major form of early-onset FAD on chromosome 14q24 has not yet been identified. By recombinational analysis, we have refined the minimal candidate region containing the gene defect to approximately 3 megabases in 14q24. We will describe our laboratory`s progress on attempts to finely localize this locus, as well as test known candidate genes from this region for either inclusion in the minimal candidate region or the presence of pathogenic mutations. Candidate genes that have been tested so far include cFOS, heat shock protein 70 member (HSF2A), transforming growth factor beta (TGFB3), the trifunctional protein C1-THF synthase (MTHFD), bradykinin receptor (BR), and the E2k component of a-ketoglutarate dehydrogenase. HSP2A, E2k, MTHFD, and BR do not map to the current defined minimal candidate region; however, sequence analysis must be performed to confirm exclusion of these genes as true candidates. Meanwhile, no pathogenic mutations have yet been found in cFOS or TGFB3. We have also isolated a large number of novel transcribed sequences from the minimal candidate region in the form of {open_quotes}trapped exons{close_quotes} from cosmids identified by hybridization to select YAC clones; we are currently in the process of searching for pathogenic mutations in these exons in affected individuals from FAD families.
Functional validation of candidate genes detected by genomic feature models
DEFF Research Database (Denmark)
Rohde, Palle Duun; Østergaard, Solveig; Kristensen, Torsten Nygaard
2018-01-01
to investigate locomotor activity, and applied genomic feature prediction models to identify gene ontology (GO) cate- gories predictive of this phenotype. Next, we applied the covariance association test to partition the genomic variance of the predictive GO terms to the genes within these terms. We...... then functionally assessed whether the identified candidate genes affected locomotor activity by reducing gene expression using RNA interference. In five of the seven candidate genes tested, reduced gene expression altered the phenotype. The ranking of genes within the predictive GO term was highly correlated......Understanding the genetic underpinnings of complex traits requires knowledge of the genetic variants that contribute to phenotypic variability. Reliable statistical approaches are needed to obtain such knowledge. In genome-wide association studies, variants are tested for association with trait...
Directory of Open Access Journals (Sweden)
Wanlada Klangnurak
Full Text Available We previously reported the microarray-based selection of three ovulation-related genes in zebrafish. We used a different selection method in this study, RNA sequencing analysis. An additional eight up-regulated candidates were found as specifically up-regulated genes in ovulation-induced samples. Changes in gene expression were confirmed by qPCR analysis. Furthermore, up-regulation prior to ovulation during natural spawning was verified in samples from natural pairing. Gene knock-out zebrafish strains of one of the candidates, the starmaker gene (stm, were established by CRISPR genome editing techniques. Unexpectedly, homozygous mutants were fertile and could spawn eggs. However, a high percentage of unfertilized eggs and abnormal embryos were produced from these homozygous females. The results suggest that the stm gene is necessary for fertilization. In this study, we selected additional ovulation-inducing candidate genes, and a novel function of the stm gene was investigated.
Yabu, Julie M; Siebert, Janet C; Maecker, Holden T
2016-01-01
Kidney transplantation is the most effective treatment for end-stage kidney disease. Sensitization, the formation of human leukocyte antigen (HLA) antibodies, remains a major barrier to successful kidney transplantation. Despite the implementation of desensitization strategies, many candidates fail to respond. Current progress is hindered by the lack of biomarkers to predict response and to guide therapy. Our objective was to determine whether differences in immune and gene profiles may help identify which candidates will respond to desensitization therapy. Single-cell mass cytometry by time-of-flight (CyTOF) phenotyping, gene arrays, and phosphoepitope flow cytometry were performed in a study of 20 highly sensitized kidney transplant candidates undergoing desensitization therapy. Responders to desensitization therapy were defined as 5% or greater decrease in cumulative calculated panel reactive antibody (cPRA) levels, and non-responders had 0% decrease in cPRA. Using a decision tree analysis, we found that a combination of transitional B cell and regulatory T cell (Treg) frequencies at baseline before initiation of desensitization therapy could distinguish responders from non-responders. Using a support vector machine (SVM) and longitudinal data, TRAF3IP3 transcripts and HLA-DR-CD38+CD4+ T cells could also distinguish responders from non-responders. Combining all assays in a multivariate analysis and elastic net regression model with 72 analytes, we identified seven that were highly interrelated and eleven that predicted response to desensitization therapy. Measuring baseline and longitudinal immune and gene profiles could provide a useful strategy to distinguish responders from non-responders to desensitization therapy. This study presents the integration of novel translational studies including CyTOF immunophenotyping in a multivariate analysis model that has potential applications to predict response to desensitization, select candidates, and personalize
Singh, A S; Shah, A; Brockmann, A
2018-02-01
In honey bees, continuous foraging at an artificial feeder induced a sustained upregulation of the immediate early genes early growth response protein 1 (Egr-1) and hormone receptor 38 (Hr38). This gene expression response was accompanied by an upregulation of several Egr-1 candidate downstream genes: ecdysone receptor (EcR), dopamine/ecdysteroid receptor (DopEcR), dopamine decarboxylase and dopamine receptor 2. Hr38, EcR and DopEcR are components of the ecdysteroid signalling pathway, which is highly probably involved in learning and memory processes in honey bees and other insects. Time-trained foragers still showed an upregulation of Egr-1 when the feeder was presented at an earlier time of the day, suggesting that the genomic response is more dependent on the food reward than training time. However, presentation of the feeder at the training time without food was still capable of inducing a transient increase in Egr-1 expression. Thus, learnt feeder cues, or even training time, probably affect Egr-1 expression. In contrast, whole brain Egr-1 expression changes did not differ between dancing and nondancing foragers. On the basis of our results we propose that food reward induced continuous foraging ultimately elicits a genomic response involving Egr-1 and Hr38 and their downstream genes. Furthermore this genomic response is highly probably involved in foraging-related learning and memory responses. © 2017 The Royal Entomological Society.
LOD score exclusion analyses for candidate genes using random population samples.
Deng, H W; Li, J; Recker, R R
2001-05-01
While extensive analyses have been conducted to test for, no formal analyses have been conducted to test against, the importance of candidate genes with random population samples. We develop a LOD score approach for exclusion analyses of candidate genes with random population samples. Under this approach, specific genetic effects and inheritance models at candidate genes can be analysed and if a LOD score is < or = - 2.0, the locus can be excluded from having an effect larger than that specified. Computer simulations show that, with sample sizes often employed in association studies, this approach has high power to exclude a gene from having moderate genetic effects. In contrast to regular association analyses, population admixture will not affect the robustness of our analyses; in fact, it renders our analyses more conservative and thus any significant exclusion result is robust. Our exclusion analysis complements association analysis for candidate genes in random population samples and is parallel to the exclusion mapping analyses that may be conducted in linkage analyses with pedigrees or relative pairs. The usefulness of the approach is demonstrated by an application to test the importance of vitamin D receptor and estrogen receptor genes underlying the differential risk to osteoporotic fractures.
The cld mutation: narrowing the critical chromosomal region and selecting candidate genes.
Péterfy, Miklós; Mao, Hui Z; Doolittle, Mark H
2006-10-01
Combined lipase deficiency (cld) is a recessive, lethal mutation specific to the tw73 haplotype on mouse Chromosome 17. While the cld mutation results in lipase proteins that are inactive, aggregated, and retained in the endoplasmic reticulum (ER), it maps separately from the lipase structural genes. We have narrowed the gene critical region by about 50% using the tw18 haplotype for deletion mapping and a recombinant chromosome used originally to map cld with respect to the phenotypic marker tf. The region now extends from 22 to 25.6 Mbp on the wild-type chromosome, currently containing 149 genes and 50 expressed sequence tags (ESTs). To identify the affected gene, we have selected candidates based on their known role in associated biological processes, cellular components, and molecular functions that best fit with the predicted function of the cld gene. A secondary approach was based on differences in mRNA levels between mutant (cld/cld) and unaffected (+/cld) cells. Using both approaches, we have identified seven functional candidates with an ER localization and/or an involvement in protein maturation and folding that could explain the lipase deficiency, and six expression candidates that exhibit large differences in mRNA levels between mutant and unaffected cells. Significantly, two genes were found to be candidates with regard to both function and expression, thus emerging as the strongest candidates for cld. We discuss the implications of our mapping results and our selection of candidates with respect to other genes, deletions, and mutations occurring in the cld critical region.
Identification of Inherited Retinal Disease-Associated Genetic Variants in 11 Candidate Genes.
Astuti, Galuh D N; van den Born, L Ingeborgh; Khan, M Imran; Hamel, Christian P; Bocquet, Béatrice; Manes, Gaël; Quinodoz, Mathieu; Ali, Manir; Toomes, Carmel; McKibbin, Martin; El-Asrag, Mohammed E; Haer-Wigman, Lonneke; Inglehearn, Chris F; Black, Graeme C M; Hoyng, Carel B; Cremers, Frans P M; Roosing, Susanne
2018-01-10
Inherited retinal diseases (IRDs) display an enormous genetic heterogeneity. Whole exome sequencing (WES) recently identified genes that were mutated in a small proportion of IRD cases. Consequently, finding a second case or family carrying pathogenic variants in the same candidate gene often is challenging. In this study, we searched for novel candidate IRD gene-associated variants in isolated IRD families, assessed their causality, and searched for novel genotype-phenotype correlations. Whole exome sequencing was performed in 11 probands affected with IRDs. Homozygosity mapping data was available for five cases. Variants with minor allele frequencies ≤ 0.5% in public databases were selected as candidate disease-causing variants. These variants were ranked based on their: (a) presence in a gene that was previously implicated in IRD; (b) minor allele frequency in the Exome Aggregation Consortium database (ExAC); (c) in silico pathogenicity assessment using the combined annotation dependent depletion (CADD) score; and (d) interaction of the corresponding protein with known IRD-associated proteins. Twelve unique variants were found in 11 different genes in 11 IRD probands. Novel autosomal recessive and dominant inheritance patterns were found for variants in Small Nuclear Ribonucleoprotein U5 Subunit 200 ( SNRNP200 ) and Zinc Finger Protein 513 ( ZNF513 ), respectively. Using our pathogenicity assessment, a variant in DEAH-Box Helicase 32 ( DHX32 ) was the top ranked novel candidate gene to be associated with IRDs, followed by eight medium and lower ranked candidate genes. The identification of candidate disease-associated sequence variants in 11 single families underscores the notion that the previously identified IRD-associated genes collectively carry > 90% of the defects implicated in IRDs. To identify multiple patients or families with variants in the same gene and thereby provide extra proof for pathogenicity, worldwide data sharing is needed.
Mining biological databases for candidate disease genes
Braun, Terry A.; Scheetz, Todd; Webster, Gregg L.; Casavant, Thomas L.
2001-07-01
The publicly-funded effort to sequence the complete nucleotide sequence of the human genome, the Human Genome Project (HGP), has currently produced more than 93% of the 3 billion nucleotides of the human genome into a preliminary `draft' format. In addition, several valuable sources of information have been developed as direct and indirect results of the HGP. These include the sequencing of model organisms (rat, mouse, fly, and others), gene discovery projects (ESTs and full-length), and new technologies such as expression analysis and resources (micro-arrays or gene chips). These resources are invaluable for the researchers identifying the functional genes of the genome that transcribe and translate into the transcriptome and proteome, both of which potentially contain orders of magnitude more complexity than the genome itself. Preliminary analyses of this data identified approximately 30,000 - 40,000 human `genes.' However, the bulk of the effort still remains -- to identify the functional and structural elements contained within the transcriptome and proteome, and to associate function in the transcriptome and proteome to genes. A fortuitous consequence of the HGP is the existence of hundreds of databases containing biological information that may contain relevant data pertaining to the identification of disease-causing genes. The task of mining these databases for information on candidate genes is a commercial application of enormous potential. We are developing a system to acquire and mine data from specific databases to aid our efforts to identify disease genes. A high speed cluster of Linux of workstations is used to analyze sequence and perform distributed sequence alignments as part of our data mining and processing. This system has been used to mine GeneMap99 sequences within specific genomic intervals to identify potential candidate disease genes associated with Bardet-Biedle Syndrome (BBS).
Type 1 Diabetes Candidate Genes Linked to Pancreatic Islet Cell Inflammation and Beta-Cell Apoptosis
DEFF Research Database (Denmark)
Størling, Joachim; Pociot, Flemming
2017-01-01
(GWAS) have identified more than 50 genetic regions that affect the risk of developing T1D. Most of these susceptibility loci, however, harbor several genes, and the causal variant(s) and gene(s) for most of the loci remain to be established. A significant part of the genes located in the T1D...... susceptibility loci are expressed in human islets and β cells and mounting evidence suggests that some of these genes modulate the β-cell response to the immune system and viral infection and regulate apoptotic β-cell death. Here, we discuss the current status of T1D susceptibility loci and candidate genes...
Defining the Human Macula Transcriptome and Candidate Retinal Disease Genes UsingEyeSAGE
Rickman, Catherine Bowes; Ebright, Jessica N.; Zavodni, Zachary J.; Yu, Ling; Wang, Tianyuan; Daiger, Stephen P.; Wistow, Graeme; Boon, Kathy; Hauser, Michael A.
2009-01-01
Purpose To develop large-scale, high-throughput annotation of the human macula transcriptome and to identify and prioritize candidate genes for inherited retinal dystrophies, based on ocular-expression profiles using serial analysis of gene expression (SAGE). Methods Two human retina and two retinal pigment epithelium (RPE)/choroid SAGE libraries made from matched macula or midperipheral retina and adjacent RPE/choroid of morphologically normal 28- to 66-year-old donors and a human central retina longSAGE library made from 41- to 66-year-old donors were generated. Their transcription profiles were entered into a relational database, EyeSAGE, including microarray expression profiles of retina and publicly available normal human tissue SAGE libraries. EyeSAGE was used to identify retina- and RPE-specific and -associated genes, and candidate genes for retina and RPE disease loci. Differential and/or cell-type specific expression was validated by quantitative and single-cell RT-PCR. Results Cone photoreceptor-associated gene expression was elevated in the macula transcription profiles. Analysis of the longSAGE retina tags enhanced tag-to-gene mapping and revealed alternatively spliced genes. Analysis of candidate gene expression tables for the identified Bardet-Biedl syndrome disease gene (BBS5) in the BBS5 disease region table yielded BBS5 as the top candidate. Compelling candidates for inherited retina diseases were identified. Conclusions The EyeSAGE database, combining three different gene-profiling platforms including the authors’ multidonor-derived retina/RPE SAGE libraries and existing single-donor retina/RPE libraries, is a powerful resource for definition of the retina and RPE transcriptomes. It can be used to identify retina-specific genes, including alternatively spliced transcripts and to prioritize candidate genes within mapped retinal disease regions. PMID:16723438
Directory of Open Access Journals (Sweden)
Clark Taane G
2010-04-01
Full Text Available Abstract Background Imprinted genes show expression from one parental allele only and are important for development and behaviour. This extreme mode of allelic imbalance has been described for approximately 56 human genes. Imprinting status is often disrupted in cancer and dysmorphic syndromes. More subtle variation of gene expression, that is not parent-of-origin specific, termed 'allele-specific gene expression' (ASE is more common and may give rise to milder phenotypic differences. Using two allele-specific high-throughput technologies alongside bioinformatics predictions, normal term human placenta was screened to find new imprinted genes and to ascertain the extent of ASE in this tissue. Results Twenty-three family trios of placental cDNA, placental genomic DNA (gDNA and gDNA from both parents were tested for 130 candidate genes with the Sequenom MassArray system. Six genes were found differentially expressed but none imprinted. The Illumina ASE BeadArray platform was then used to test 1536 SNPs in 932 genes. The array was enriched for the human orthologues of 124 mouse candidate genes from bioinformatics predictions and 10 human candidate imprinted genes from EST database mining. After quality control pruning, a total of 261 informative SNPs (214 genes remained for analysis. Imprinting with maternal expression was demonstrated for the lymphocyte imprinted gene ZNF331 in human placenta. Two potential differentially methylated regions (DMRs were found in the vicinity of ZNF331. None of the bioinformatically predicted candidates tested showed imprinting except for a skewed allelic expression in a parent-specific manner observed for PHACTR2, a neighbour of the imprinted PLAGL1 gene. ASE was detected for two or more individuals in 39 candidate genes (18%. Conclusions Both Sequenom and Illumina assays were sensitive enough to study imprinting and strong allelic bias. Previous bioinformatics approaches were not predictive of new imprinted genes
Candidate gene association studies in syndromic and non-syndromic cleft lip and palate
Energy Technology Data Exchange (ETDEWEB)
Daack-Hirsch, S.; Basart, A.; Frischmeyer, P. [Univ. of Iowa, IA (United States)] [and others
1994-09-01
Using ongoing case ascertainment through a birth defects registry, we have collected 219 nuclear families with non-syndromic cleft lip and/or palate and 111 families with a collection of syndromic forms. Syndromic cases include 24 with recognized forms and 72 with unrecognized syndromes. Candidate gene studies as well as genome-wide searches for evidence of microdeletions and isodisomy are currently being carried out. Candidate gene association studies, to date, have made use of PCR-based polymorphisms for TGFA, MSX1, CLPG13 (a CA repeat associated with a human homologue of a locus that results in craniofacial dysmorphogenesis in the mouse) and an STRP found in a Van der Woude syndrome microdeletion. Control tetranucleotide repeats, which insure that population-based differences are not responsible for any observed associations, are also tested. Studies of the syndromic cases have included the same list of candidate genes searching for evidence of microdeletions and a genome-wide search using tri- and tetranucleotide polymorphic markers to search for isodisomy or structural rearrangements. Significant associations have previously been identified for TGFA, and, in this report, identified for MSX1 and nonsyndromic cleft palate only (p = 0.04, uncorrected). Preliminary results of the genome-wide scan for isodisomy has returned no true positives and there has been no evidence for microdeletion cases.
DEFF Research Database (Denmark)
Rohde, Palle Duun; Madsen, Lisbeth Strøm; Arvidson, Sandra Marie Neumann
2016-01-01
Fruit flies are important model organisms for functional testing of candidate genes in multiple disciplines, including the study of human diseases. Here we use a high-throughput locomotor activity assay to test the response on activity behavior of gene disruption in Drosophila melanogaster. The aim...
CANDIDATE GENE ANALYSIS IN ISRAELI SOLDIERS WITH STRESS FRACTURES
Directory of Open Access Journals (Sweden)
Ran Yanovich
2012-03-01
Full Text Available To investigate the association of polymorphisms within candidate genes which we hypothesized may contribute to stress fracture predisposition, a case-control, cross- sectional study design was employed. Genotyping 268 Single Nucleotide Polymorphisms- SNPs within 17 genes in 385 Israeli young male and female recruits (182 with and 203 without stress fractures. Twenty-five polymorphisms within 9 genes (NR3C1, ANKH, VDR, ROR2, CALCR, IL6, COL1A2, CBG, and LRP4 showed statistically significant differences (p < 0.05 in the distribution between stress fracture cases and non stress fracture controls. Seventeen genetic variants were associated with an increased stress fracture risk, and eight variants with a decreased stress fracture risk. None of the SNP associations remained significant after correcting for multiple comparisons (false discovery rate- FDR. Our findings suggest that genes may be involved in stress fracture pathogenesis. Specifically, the CALCR and the VDR genes are intriguing candidates. The putative involvement of these genes in stress fracture predisposition requires analysis of more cases and controls and sequencing the relevant genomic regions, in order to define the specific gene mutations
Whole genome homology-based identification of candidate genes ...
African Journals Online (AJOL)
Josephine Erhiakporeh
2016-07-06
Jul 6, 2016 ... candidate genes for drought tolerance in sesame. (Sesamum ... Our results provided genomic resources for further functional analysis and genetic engineering .... reverse transcribed using the Reverse Transcription System.
Jazayeri, Roshanak; Hu, Hao; Fattahi, Zohreh; Musante, Luciana; Abedini, Seyedeh Sedigheh; Hosseini, Masoumeh; Wienker, Thomas F; Ropers, Hans Hilger; Najmabadi, Hossein; Kahrizi, Kimia
2015-10-01
Intellectual disability (ID) is a neuro-developmental disorder which causes considerable socio-economic problems. Some ID individuals are also affected by ataxia, and the condition includes different mutations affecting several genes. We used whole exome sequencing (WES) in combination with homozygosity mapping (HM) to identify the genetic defects in five consanguineous families among our cohort study, with two affected children with ID and ataxia as major clinical symptoms. We identified three novel candidate genes, RIPPLY1, MRPL10, SNX14, and a new mutation in known gene SURF1. All are autosomal genes, except RIPPLY1, which is located on the X chromosome. Two are housekeeping genes, implicated in transcription and translation regulation and intracellular trafficking, and two encode mitochondrial proteins. The pathogenesis of these variants was evaluated by mutation classification, bioinformatic methods, review of medical and biological relevance, co-segregation studies in the particular family, and a normal population study. Linkage analysis and exome sequencing of a small number of affected family members is a powerful new technique which can be used to decrease the number of candidate genes in heterogenic disorders such as ID, and may even identify the responsible gene(s).
Xiaoqing Yu; Guihua Bai; Shuwei Liu; Na Luo; Ying Wang; Douglas S. Richmond; Paula M. Pijut; Scott A. Jackson; Jianming Yu; Yiwei. Jiang
2013-01-01
Drought is a major environmental stress limiting growth of perennial grasses in temperate regions. Plant drought tolerance is a complex trait that is controlled by multiple genes. Candidate gene association mapping provides a powerful tool for dissection of complex traits. Candidate gene association mapping of drought tolerance traits was conducted in 192 diverse...
Identification of candidate genes for dyslexia susceptibility on chromosome 18.
Directory of Open Access Journals (Sweden)
Thomas S Scerri
2010-10-01
Full Text Available Six independent studies have identified linkage to chromosome 18 for developmental dyslexia or general reading ability. Until now, no candidate genes have been identified to explain this linkage. Here, we set out to identify the gene(s conferring susceptibility by a two stage strategy of linkage and association analysis.Linkage analysis: 264 UK families and 155 US families each containing at least one child diagnosed with dyslexia were genotyped with a dense set of microsatellite markers on chromosome 18. Association analysis: Using a discovery sample of 187 UK families, nearly 3000 SNPs were genotyped across the chromosome 18 dyslexia susceptibility candidate region. Following association analysis, the top ranking SNPs were then genotyped in the remaining samples. The linkage analysis revealed a broad signal that spans approximately 40 Mb from 18p11.2 to 18q12.2. Following the association analysis and subsequent replication attempts, we observed consistent association with the same SNPs in three genes; melanocortin 5 receptor (MC5R, dymeclin (DYM and neural precursor cell expressed, developmentally down-regulated 4-like (NEDD4L.Along with already published biological evidence, MC5R, DYM and NEDD4L make attractive candidates for dyslexia susceptibility genes. However, further replication and functional studies are still required.
BEEF CATTLE MUSCULARITY CANDIDATE GENES
Directory of Open Access Journals (Sweden)
Irida Novianti
2010-04-01
Full Text Available Muscularity is a potential indicator for the selection of more productive cattle. Mapping quantitative trait loci (QTL for traits related to muscularity is useful to identify the genomic regions where the genes affecting muscularity reside. QTL analysis from a Limousin-Jersey double backcross herd was conducted using QTL Express software with cohort and breed as the fixed effects. Nine QTL suggested to have an association with muscularity were identified on cattle chromosomes BTA 1, 2, 3, 4, 5, 8, 12, 14 and 17. The myostatin gene is located at the centromeric end of chromosome 2 and not surprisingly, the Limousin myostatin F94L variant accounted for the QTL on BTA2. However, when the myostatin F94L genotype was included as an additional fixed effect, the QTL on BTA17 was also no longer significant. This result suggests that there may be gene(s that have epistatic effects with myostatin located on cattle chromosome 17. Based on the position of the QTL in base pairs, all the genes that reside in the region were determined using the Ensembl data base (www.ensembl.org. There were two potential candidate genes residing within these QTL regions were selected. They were Smad nuclear interacting protein 1 (SNIP1 and similar to follistatin-like 5 (FSTL5. (JIIPB 2010 Vol 20 No 1: 1-10
Maga, A. Murat; Navarro, Nicolas; Cunningham, Michael L.; Cox, Timothy C.
2015-01-01
We describe the first application of high-resolution 3D micro-computed tomography, together with 3D landmarks and geometric morphometrics, to map QTL responsible for variation in skull shape and size using a backcross between C57BL/6J and A/J inbred strains. Using 433 animals, 53 3D landmarks, and 882 SNPs from autosomes, we identified seven QTL responsible for the skull size (SCS.qtl) and 30 QTL responsible for the skull shape (SSH.qtl). Size, sex, and direction-of-cross were all significant factors and included in the analysis as covariates. All autosomes harbored at least one SSH.qtl, sometimes up to three. Effect sizes of SSH.qtl appeared to be small, rarely exceeding 1% of the overall shape variation. However, they account for significant amount of variation in some specific directions of the shape space. Many QTL have stronger effect on the neurocranium than expected from a random vector that will parcellate uniformly across the four cranial regions. On the contrary, most of QTL have an effect on the palate weaker than expected. Combined interval length of 30 SSH.qtl was about 315 MB and contained 2476 known protein coding genes. We used a bioinformatics approach to filter these candidate genes and identified 16 high-priority candidates that are likely to play a role in the craniofacial development and disorders. Thus, coupling the QTL mapping approach in model organisms with candidate gene enrichment approaches appears to be a feasible way to identify high-priority candidates genes related to the structure or tissue of interest. PMID:25859222
Directory of Open Access Journals (Sweden)
Leah Y. Liu
2013-09-01
Genome-wide association studies (GWAS have revealed numerous associations between many phenotypes and gene candidates. Frequently, however, further elucidation of gene function has not been achieved. A recent GWAS identified 69 candidate genes associated with elevated liver enzyme concentrations, which are clinical markers of liver disease. To investigate the role of these genes in liver homeostasis, we narrowed down this list to 12 genes based on zebrafish orthology, zebrafish liver expression and disease correlation. To assess the function of gene candidates during liver development, we assayed hepatic progenitors at 48 hours post fertilization (hpf and hepatocytes at 72 hpf using in situ hybridization following morpholino knockdown in zebrafish embryos. Knockdown of three genes (pnpla3, pklr and mapk10 decreased expression of hepatic progenitor cells, whereas knockdown of eight genes (pnpla3, cpn1, trib1, fads2, slc2a2, pklr, mapk10 and samm50 decreased cell-specific hepatocyte expression. We then induced liver injury in zebrafish embryos using acetaminophen exposure and observed changes in liver toxicity incidence in morphants. Prioritization of GWAS candidates and morpholino knockdown expedites the study of newly identified genes impacting liver development and represents a feasible method for initial assessment of candidate genes to instruct further mechanistic analyses. Our analysis can be extended to GWAS for additional disease-associated phenotypes.
Essack, Magbubah
2012-10-26
Background: Estrogen therapy has positively impact the treatment of several cancers, such as prostate, lung and breast cancers. Moreover, several groups have reported the importance of estrogen induced gene regulation in esophageal cancer (EC). This suggests that there could be a potential for estrogen therapy for EC. The efficient design of estrogen therapies requires as complete as possible list of genes responsive to estrogen. Our study develops a systems biology methodology using esophageal squamous cell carcinoma (ESCC) as a model to identify estrogen responsive genes. These genes, on the other hand, could be affected by estrogen therapy in ESCC.Results: Based on different sources of information we identified 418 genes implicated in ESCC. Putative estrogen responsive elements (EREs) mapped to the promoter region of the ESCC genes were used to initially identify candidate estrogen responsive genes. EREs mapped to the promoter sequence of 30.62% (128/418) of ESCC genes of which 43.75% (56/128) are known to be estrogen responsive, while 56.25% (72/128) are new candidate estrogen responsive genes. EREs did not map to 290 ESCC genes. Of these 290 genes, 50.34% (146/290) are known to be estrogen responsive. By analyzing transcription factor binding sites (TFBSs) in the promoters of the 202 (56+146) known estrogen responsive ESCC genes under study, we found that their regulatory potential may be characterized by 44 significantly over-represented co-localized TFBSs (cTFBSs). We were able to map these cTFBSs to promoters of 32 of the 72 new candidate estrogen responsive ESCC genes, thereby increasing confidence that these 32 ESCC genes are responsive to estrogen since their promoters contain both: a/mapped EREs, and b/at least four cTFBSs characteristic of ESCC genes that are responsive to estrogen. Recent publications confirm that 47% (15/32) of these 32 predicted genes are indeed responsive to estrogen.Conclusion: To the best of our knowledge our study is the first
Essack, Magbubah; MacPherson, Cameron Ross; Schmeier, Sebastian; Bajic, Vladimir B.
2012-01-01
Background: Estrogen therapy has positively impact the treatment of several cancers, such as prostate, lung and breast cancers. Moreover, several groups have reported the importance of estrogen induced gene regulation in esophageal cancer (EC). This suggests that there could be a potential for estrogen therapy for EC. The efficient design of estrogen therapies requires as complete as possible list of genes responsive to estrogen. Our study develops a systems biology methodology using esophageal squamous cell carcinoma (ESCC) as a model to identify estrogen responsive genes. These genes, on the other hand, could be affected by estrogen therapy in ESCC.Results: Based on different sources of information we identified 418 genes implicated in ESCC. Putative estrogen responsive elements (EREs) mapped to the promoter region of the ESCC genes were used to initially identify candidate estrogen responsive genes. EREs mapped to the promoter sequence of 30.62% (128/418) of ESCC genes of which 43.75% (56/128) are known to be estrogen responsive, while 56.25% (72/128) are new candidate estrogen responsive genes. EREs did not map to 290 ESCC genes. Of these 290 genes, 50.34% (146/290) are known to be estrogen responsive. By analyzing transcription factor binding sites (TFBSs) in the promoters of the 202 (56+146) known estrogen responsive ESCC genes under study, we found that their regulatory potential may be characterized by 44 significantly over-represented co-localized TFBSs (cTFBSs). We were able to map these cTFBSs to promoters of 32 of the 72 new candidate estrogen responsive ESCC genes, thereby increasing confidence that these 32 ESCC genes are responsive to estrogen since their promoters contain both: a/mapped EREs, and b/at least four cTFBSs characteristic of ESCC genes that are responsive to estrogen. Recent publications confirm that 47% (15/32) of these 32 predicted genes are indeed responsive to estrogen.Conclusion: To the best of our knowledge our study is the first
Directory of Open Access Journals (Sweden)
Stéphanie Cornen
Full Text Available Breast cancers (BCs of the luminal B subtype are estrogen receptor-positive (ER+, highly proliferative, resistant to standard therapies and have a poor prognosis. To better understand this subtype we compared DNA copy number aberrations (CNAs, DNA promoter methylation, gene expression profiles, and somatic mutations in nine selected genes, in 32 luminal B tumors with those observed in 156 BCs of the other molecular subtypes. Frequent CNAs included 8p11-p12 and 11q13.1-q13.2 amplifications, 7q11.22-q34, 8q21.12-q24.23, 12p12.3-p13.1, 12q13.11-q24.11, 14q21.1-q23.1, 17q11.1-q25.1, 20q11.23-q13.33 gains and 6q14.1-q24.2, 9p21.3-p24,3, 9q21.2, 18p11.31-p11.32 losses. A total of 237 and 101 luminal B-specific candidate oncogenes and tumor suppressor genes (TSGs presented a deregulated expression in relation with their CNAs, including 11 genes previously reported associated with endocrine resistance. Interestingly, 88% of the potential TSGs are located within chromosome arm 6q, and seven candidate oncogenes are potential therapeutic targets. A total of 100 candidate oncogenes were validated in a public series of 5,765 BCs and the overexpression of 67 of these was associated with poor survival in luminal tumors. Twenty-four genes presented a deregulated expression in relation with a high DNA methylation level. FOXO3, PIK3CA and TP53 were the most frequent mutated genes among the nine tested. In a meta-analysis of next-generation sequencing data in 875 BCs, KCNB2 mutations were associated with luminal B cases while candidate TSGs MDN1 (6q15 and UTRN (6q24, were mutated in this subtype. In conclusion, we have reported luminal B candidate genes that may play a role in the development and/or hormone resistance of this aggressive subtype.
Epidermal growth factor gene is a newly identified candidate gene for gout
Lin Han; Chunwei Cao; Zhaotong Jia; Shiguo Liu; Zhen Liu; Ruosai Xin; Can Wang; Xinde Li; Wei Ren; Xuefeng Wang; Changgui Li
2016-01-01
Chromosome 4q25 has been identified as a genomic region associated with gout. However, the associations of gout with the genes in this region have not yet been confirmed. Here, we performed two-stage analysis to determine whether variations in candidate genes in the 4q25 region are associated with gout in a male Chinese Han population. We first evaluated 96 tag single nucleotide polymorphisms (SNPs) in eight inflammatory/immune pathway- or glucose/lipid metabolism-related genes in the 4q25 re...
Directory of Open Access Journals (Sweden)
Nicholas M Morton
Full Text Available Obesity and metabolic syndrome results from a complex interaction between genetic and environmental factors. In addition to brain-regulated processes, recent genome wide association studies have indicated that genes highly expressed in adipose tissue affect the distribution and function of fat and thus contribute to obesity. Using a stratified transcriptome gene enrichment approach we attempted to identify adipose tissue-specific obesity genes in the unique polygenic Fat (F mouse strain generated by selective breeding over 60 generations for divergent adiposity from a comparator Lean (L strain.To enrich for adipose tissue obesity genes a 'snap-shot' pooled-sample transcriptome comparison of key fat depots and non adipose tissues (muscle, liver, kidney was performed. Known obesity quantitative trait loci (QTL information for the model allowed us to further filter genes for increased likelihood of being causal or secondary for obesity. This successfully identified several genes previously linked to obesity (C1qr1, and Np3r as positional QTL candidate genes elevated specifically in F line adipose tissue. A number of novel obesity candidate genes were also identified (Thbs1, Ppp1r3d, Tmepai, Trp53inp2, Ttc7b, Tuba1a, Fgf13, Fmr that have inferred roles in fat cell function. Quantitative microarray analysis was then applied to the most phenotypically divergent adipose depot after exaggerating F and L strain differences with chronic high fat feeding which revealed a distinct gene expression profile of line, fat depot and diet-responsive inflammatory, angiogenic and metabolic pathways. Selected candidate genes Npr3 and Thbs1, as well as Gys2, a non-QTL gene that otherwise passed our enrichment criteria were characterised, revealing novel functional effects consistent with a contribution to obesity.A focussed candidate gene enrichment strategy in the unique F and L model has identified novel adipose tissue-enriched genes contributing to obesity.
Defining a new candidate gene for amelogenesis imperfecta: from molecular genetics to biochemistry.
Urzúa, Blanca; Ortega-Pinto, Ana; Morales-Bozo, Irene; Rojas-Alcayaga, Gonzalo; Cifuentes, Víctor
2011-02-01
Amelogenesis imperfecta is a group of genetic conditions that affect the structure and clinical appearance of tooth enamel. The types (hypoplastic, hypocalcified, and hypomature) are correlated with defects in different stages of the process of enamel synthesis. Autosomal dominant, recessive, and X-linked types have been previously described. These disorders are considered clinically and genetically heterogeneous in etiology, involving a variety of genes, such as AMELX, ENAM, DLX3, FAM83H, MMP-20, KLK4, and WDR72. The mutations identified within these causal genes explain less than half of all cases of amelogenesis imperfecta. Most of the candidate and causal genes currently identified encode proteins involved in enamel synthesis. We think it is necessary to refocus the search for candidate genes using biochemical processes. This review provides theoretical evidence that the human SLC4A4 gene (sodium bicarbonate cotransporter) may be a new candidate gene.
Sedeek, Khalid E M; Qi, Weihong; Schauer, Monica A; Gupta, Alok K; Poveda, Lucy; Xu, Shuqing; Liu, Zhong-Jian; Grossniklaus, Ueli; Schiestl, Florian P; Schlüter, Philipp M
2013-01-01
Sexually deceptive orchids of the genus Ophrys mimic the mating signals of their pollinator females to attract males as pollinators. This mode of pollination is highly specific and leads to strong reproductive isolation between species. This study aims to identify candidate genes responsible for pollinator attraction and reproductive isolation between three closely related species, O. exaltata, O. sphegodes and O. garganica. Floral traits such as odour, colour and morphology are necessary for successful pollinator attraction. In particular, different odour hydrocarbon profiles have been linked to differences in specific pollinator attraction among these species. Therefore, the identification of genes involved in these traits is important for understanding the molecular basis of pollinator attraction by sexually deceptive orchids. We have created floral reference transcriptomes and proteomes for these three Ophrys species using a combination of next-generation sequencing (454 and Solexa), Sanger sequencing, and shotgun proteomics (tandem mass spectrometry). In total, 121 917 unique transcripts and 3531 proteins were identified. This represents the first orchid proteome and transcriptome from the orchid subfamily Orchidoideae. Proteome data revealed proteins corresponding to 2644 transcripts and 887 proteins not observed in the transcriptome. Candidate genes for hydrocarbon and anthocyanin biosynthesis were represented by 156 and 61 unique transcripts in 20 and 7 genes classes, respectively. Moreover, transcription factors putatively involved in the regulation of flower odour, colour and morphology were annotated, including Myb, MADS and TCP factors. Our comprehensive data set generated by combining transcriptome and proteome technologies allowed identification of candidate genes for pollinator attraction and reproductive isolation among sexually deceptive orchids. This includes genes for hydrocarbon and anthocyanin biosynthesis and regulation, and the development of
Directory of Open Access Journals (Sweden)
A. Murat eMaga
2015-03-01
Full Text Available We describe the first application of high-resolution 3D micro-computed tomography, together with 3D landmarks and geometric morphometrics, to map QTL responsible for variation in skull shape and size using a backcross between C57BL/6J and A/J inbred strains. Using 433 animals, 53 3D landmarks, and 882 SNPs from autosomes, we identified seven QTL responsible for the skull size (SCS.qtl and 30 QTL responsible for the skull shape (SSH.qtl. Size, sex and direction-of-cross were all significant factors and included in the analysis as covariates. All autosomes harbored at least one SSH.qtl, sometimes up to three. Effect sizes of SSH.qtl appeared to be small, rarely exceeding 1% of the overall shape variation. However, they account for significant amount of variation in some specific directions of the shape space. Many QTL have stronger effect on the neurocranium than expected from a random vector that will parcellate uniformly across the four cranial regions. On the contrary, most of QTL have an effect on the palate weaker than expected. Combined interval length of 30 SSH.qtl was about 315MB and contained 2,476 known protein coding genes. We used a bioinformatics approach to filter these candidate genes and identified 16 high-priority candidates that are likely to play a role in the craniofacial development and disorders. Thus, coupling the QTL mapping approach in model organisms with candidate gene enrichment approaches appears to be a feasible way to identify high-priority candidates genes related to the structure or tissue of interest.
Speeding disease gene discovery by sequence based candidate prioritization
Directory of Open Access Journals (Sweden)
Porteous David J
2005-03-01
Full Text Available Abstract Background Regions of interest identified through genetic linkage studies regularly exceed 30 centimorgans in size and can contain hundreds of genes. Traditionally this number is reduced by matching functional annotation to knowledge of the disease or phenotype in question. However, here we show that disease genes share patterns of sequence-based features that can provide a good basis for automatic prioritization of candidates by machine learning. Results We examined a variety of sequence-based features and found that for many of them there are significant differences between the sets of genes known to be involved in human hereditary disease and those not known to be involved in disease. We have created an automatic classifier called PROSPECTR based on those features using the alternating decision tree algorithm which ranks genes in the order of likelihood of involvement in disease. On average, PROSPECTR enriches lists for disease genes two-fold 77% of the time, five-fold 37% of the time and twenty-fold 11% of the time. Conclusion PROSPECTR is a simple and effective way to identify genes involved in Mendelian and oligogenic disorders. It performs markedly better than the single existing sequence-based classifier on novel data. PROSPECTR could save investigators looking at large regions of interest time and effort by prioritizing positional candidate genes for mutation detection and case-control association studies.
Butsch Kovacic, Melinda; Biagini Myers, Jocelyn M.; Wang, Ning; Martin, Lisa J.; Lindsey, Mark; Ericksen, Mark B.; He, Hua; Patterson, Tia L.; Baye, Tesfaye M.; Torgerson, Dara; Roth, Lindsey A.; Gupta, Jayanta; Sivaprasad, Umasundari; Gibson, Aaron M.; Tsoras, Anna M.; Hu, Donglei; Eng, Celeste; Chapela, Rocío; Rodríguez-Santana, José R.; Rodríguez-Cintrón, William; Avila, Pedro C.; Beckman, Kenneth; Seibold, Max A.; Gignoux, Chris; Musaad, Salma M.; Chen, Weiguo; Burchard, Esteban González; Khurana Hershey, Gurjit K.
2011-01-01
Background Asthma is a chronic inflammatory disease with a strong genetic predisposition. A major challenge for candidate gene association studies in asthma is the selection of biologically relevant genes. Methodology/Principal Findings Using epithelial RNA expression arrays, HapMap allele frequency variation, and the literature, we identified six possible candidate susceptibility genes for childhood asthma including ADCY2, DNAH5, KIF3A, PDE4B, PLAU, SPRR2B. To evaluate these genes, we compared the genotypes of 194 predominantly tagging SNPs in 790 asthmatic, allergic and non-allergic children. We found that SNPs in all six genes were nominally associated with asthma (pasthma (OR = 2.3, pasthma population attributable risk of 18.5%. The association between KIF3A rs7737031 and asthma was validated in 3 independent populations, further substantiating the validity of our gene selection approach. Conclusions/Significance Our study demonstrates that KIF3A, a member of the kinesin superfamily of microtubule associated motors that are important in the transport of protein complexes within cilia, is a novel candidate gene for childhood asthma. Polymorphisms in KIF3A may in part be responsible for poor mucus and/or allergen clearance from the airways. Furthermore, our study provides a promising framework for the identification and evaluation of novel candidate susceptibility genes. PMID:21912604
Hawkins, Leigh K.; Tang, Juliet D.; Tomashek, John; Alves Oliveira, Dafne; Ogunola, Oluwaseun F.; Smith, J. Spencer; Williams, W. Paul
2018-01-01
Many projects have identified candidate genes for resistance to aflatoxin accumulation or Aspergillus flavus infection and growth in maize using genetic mapping, genomics, transcriptomics and/or proteomics studies. However, only a small percentage of these candidates have been validated in field conditions, and their relative contribution to resistance, if any, is unknown. This study presents a consolidated list of candidate genes identified in past studies or in-house studies, with descriptive data including genetic location, gene annotation, known protein identifiers, and associated pathway information, if known. A candidate gene pipeline to test the phenotypic effect of any maize DNA sequence on aflatoxin accumulation resistance was used in this study to determine any measurable effect on polymorphisms within or linked to the candidate gene sequences, and the results are published here. PMID:29385107
Directory of Open Access Journals (Sweden)
Leigh K. Hawkins
2018-01-01
Full Text Available Many projects have identified candidate genes for resistance to aflatoxin accumulation or Aspergillus flavus infection and growth in maize using genetic mapping, genomics, transcriptomics and/or proteomics studies. However, only a small percentage of these candidates have been validated in field conditions, and their relative contribution to resistance, if any, is unknown. This study presents a consolidated list of candidate genes identified in past studies or in-house studies, with descriptive data including genetic location, gene annotation, known protein identifiers, and associated pathway information, if known. A candidate gene pipeline to test the phenotypic effect of any maize DNA sequence on aflatoxin accumulation resistance was used in this study to determine any measurable effect on polymorphisms within or linked to the candidate gene sequences, and the results are published here.
A Generally Applicable Translational Strategy Identifies S100A4 as a Candidate Gene in Allergy
DEFF Research Database (Denmark)
Bruhn, Sören; Fang, Yu; Barrenäs, Fredrik
2014-01-01
The identification of diagnostic markers and therapeutic candidate genes in common diseases is complicated by the involvement of thousands of genes. We hypothesized that genes co-regulated with a key gene in allergy, IL13, would form a module that could help to identify candidate genes. We identi...
from microarrays and quantitative trait loci to candidate genes
Indian Academy of Sciences (India)
Unknown
2004-10-15
Oct 15, 2004 ... to candidate genes – A research plan and preliminary results using Drosophila as a model organism and climatic ... Recent developments in molecular genetics ..... scientists in agriculture, medicine and psychology for test-.
Candidate genes for drought tolerance and improved productivity in ...
Indian Academy of Sciences (India)
Madhu
Improving drought tolerance and productivity is one of the most difficult tasks for ... Keywords. Candidate gene; mapping population; polymerase chain reaction; single marker analysis. .... ple and the mean value computed. 2.4 Isolation of DNA.
Transcriptomic Analysis Reveals Candidate Genes for Female Sterility in Pomegranate Flowers
Directory of Open Access Journals (Sweden)
Lina Chen
2017-08-01
Full Text Available Pomegranate has two types of flowers on the same plant: functional male flowers (FMF and bisexual flowers (BF. BF are female-fertile flowers that can set fruits. FMF are female-sterile flowers that fail to set fruit and that eventually drop. The putative cause of pomegranate FMF female sterility is abnormal ovule development. However, the key stage at which the FMF pomegranate ovules become abnormal and the mechanism of regulation of pomegranate female sterility remain unknown. Here, we studied ovule development in FMF and BF, using scanning electron microscopy to explore the key stage at which ovule development was terminated and then analyzed genes differentially expressed (differentially expressed genes – DEGs between FMF and BF to investigate the mechanism responsible for pomegranate female sterility. Ovule development in FMF ceased following the formation of the inner integument primordium. The key stage for the termination of FMF ovule development was when the bud vertical diameter was 5.0–13.0 mm. Candidate genes influencing ovule development may be crucial factors in pomegranate female sterility. INNER OUTER (INO/YABBY4 (Gglean016270 and AINTEGUMENTA (ANT homolog genes (Gglean003340 and Gglean011480, which regulate the development of the integument, showed down-regulation in FMF at the key stage of ovule development cessation (ATNSII. Their upstream regulator genes, such as AGAMOUS-like (AG-like (Gglean028014, Gglean026618, and Gglean028632 and SPOROCYTELESS (SPL homolog genes (Gglean005812, also showed differential expression pattern between BF and FMF at this key stage. The differential expression of the ethylene response signal genes, ETR (ethylene-resistant (Gglean022853 and ERF1/2 (ethylene-responsive factor (Gglean022880, between FMF and BF indicated that ethylene signaling may also be an important factor in the development of pomegranate female sterility. The increase in BF observed after spraying with ethephon supported this
Directory of Open Access Journals (Sweden)
Kornelia Gudys
2018-06-01
Full Text Available Drought is one of the most adverse abiotic factors limiting growth and productivity of crops. Among them is barley, ranked fourth cereal worldwide in terms of harvested acreage and production. Plants have evolved various mechanisms to cope with water deficit at different biological levels, but there is an enormous challenge to decipher genes responsible for particular complex phenotypic traits, in order to develop drought tolerant crops. This work presents a comprehensive approach for elucidation of molecular mechanisms of drought tolerance in barley at the seedling stage of development. The study includes mapping of QTLs for physiological and biochemical traits associated with drought tolerance on a high-density function map, projection of QTL confidence intervals on barley physical map, and the retrievement of positional candidate genes (CGs, followed by their prioritization based on Gene Ontology (GO enrichment analysis. A total of 64 QTLs for 25 physiological and biochemical traits that describe plant water status, photosynthetic efficiency, osmoprotectant and hormone content, as well as antioxidant activity, were positioned on a consensus map, constructed using RIL populations developed from the crosses between European and Syrian genotypes. The map contained a total of 875 SNP, SSR and CGs, spanning 941.86 cM with resolution of 1.1 cM. For the first time, QTLs for ethylene, glucose, sucrose, maltose, raffinose, α-tocopherol, γ-tocotrienol content, and catalase activity, have been mapped in barley. Based on overlapping confidence intervals of QTLs, 11 hotspots were identified that enclosed more than 60% of mapped QTLs. Genetic and physical map integration allowed the identification of 1,101 positional CGs within the confidence intervals of drought response-specific QTLs. Prioritization resulted in the designation of 143 CGs, among them were genes encoding antioxidants, carboxylic acid biosynthesis enzymes, heat shock proteins, small auxin
Zhu, Jie; Qin, Yufang; Liu, Taigang; Wang, Jun; Zheng, Xiaoqi
2013-01-01
Identification of gene-phenotype relationships is a fundamental challenge in human health clinic. Based on the observation that genes causing the same or similar phenotypes tend to correlate with each other in the protein-protein interaction network, a lot of network-based approaches were proposed based on different underlying models. A recent comparative study showed that diffusion-based methods achieve the state-of-the-art predictive performance. In this paper, a new diffusion-based method was proposed to prioritize candidate disease genes. Diffusion profile of a disease was defined as the stationary distribution of candidate genes given a random walk with restart where similarities between phenotypes are incorporated. Then, candidate disease genes are prioritized by comparing their diffusion profiles with that of the disease. Finally, the effectiveness of our method was demonstrated through the leave-one-out cross-validation against control genes from artificial linkage intervals and randomly chosen genes. Comparative study showed that our method achieves improved performance compared to some classical diffusion-based methods. To further illustrate our method, we used our algorithm to predict new causing genes of 16 multifactorial diseases including Prostate cancer and Alzheimer's disease, and the top predictions were in good consistent with literature reports. Our study indicates that integration of multiple information sources, especially the phenotype similarity profile data, and introduction of global similarity measure between disease and gene diffusion profiles are helpful for prioritizing candidate disease genes. Programs and data are available upon request.
Directory of Open Access Journals (Sweden)
Adugna Abdi Woldesemayat
Full Text Available Crop response to the changing climate and unpredictable effects of global warming with adverse conditions such as drought stress has brought concerns about food security to the fore; crop yield loss is a major cause of concern in this regard. Identification of genes with multiple responses across environmental stresses is the genetic foundation that leads to crop adaptation to environmental perturbations.In this paper, we introduce an integrated approach to assess candidate genes for multiple stress responses across-species. The approach combines ontology based semantic data integration with expression profiling, comparative genomics, phylogenomics, functional gene enrichment and gene enrichment network analysis to identify genes associated with plant stress phenotypes. Five different ontologies, viz., Gene Ontology (GO, Trait Ontology (TO, Plant Ontology (PO, Growth Ontology (GRO and Environment Ontology (EO were used to semantically integrate drought related information.Target genes linked to Quantitative Trait Loci (QTLs controlling yield and stress tolerance in sorghum (Sorghum bicolor (L. Moench and closely related species were identified. Based on the enriched GO terms of the biological processes, 1116 sorghum genes with potential responses to 5 different stresses, such as drought (18%, salt (32%, cold (20%, heat (8% and oxidative stress (25% were identified to be over-expressed. Out of 169 sorghum drought responsive QTLs associated genes that were identified based on expression datasets, 56% were shown to have multiple stress responses. On the other hand, out of 168 additional genes that have been evaluated for orthologous pairs, 90% were conserved across species for drought tolerance. Over 50% of identified maize and rice genes were responsive to drought and salt stresses and were co-located within multifunctional QTLs. Among the total identified multi-stress responsive genes, 272 targets were shown to be co-localized within QTLs
Abbott, Kenneth L; Nyre, Erik T; Abrahante, Juan; Ho, Yen-Yi; Isaksson Vogel, Rachel; Starr, Timothy K
2015-01-01
Identification of cancer driver gene mutations is crucial for advancing cancer therapeutics. Due to the overwhelming number of passenger mutations in the human tumor genome, it is difficult to pinpoint causative driver genes. Using transposon mutagenesis in mice many laboratories have conducted forward genetic screens and identified thousands of candidate driver genes that are highly relevant to human cancer. Unfortunately, this information is difficult to access and utilize because it is scattered across multiple publications using different mouse genome builds and strength metrics. To improve access to these findings and facilitate meta-analyses, we developed the Candidate Cancer Gene Database (CCGD, http://ccgd-starrlab.oit.umn.edu/). The CCGD is a manually curated database containing a unified description of all identified candidate driver genes and the genomic location of transposon common insertion sites (CISs) from all currently published transposon-based screens. To demonstrate relevance to human cancer, we performed a modified gene set enrichment analysis using KEGG pathways and show that human cancer pathways are highly enriched in the database. We also used hierarchical clustering to identify pathways enriched in blood cancers compared to solid cancers. The CCGD is a novel resource available to scientists interested in the identification of genetic drivers of cancer. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Zhong, Chao; Sun, Suli; Li, Yinping; Duan, Canxing; Zhu, Zhendong
2018-03-01
A novel Phytophthora sojae resistance gene RpsHC18 was identified and finely mapped on soybean chromosome 3. Two NBS-LRR candidate genes were identified and two diagnostic markers of RpsHC18 were developed. Phytophthora root rot caused by Phytophthora sojae is a destructive disease of soybean. The most effective disease-control strategy is to deploy resistant cultivars carrying Phytophthora-resistant Rps genes. The soybean cultivar Huachun 18 has a broad and distinct resistance spectrum to 12 P. sojae isolates. Quantitative trait loci sequencing (QTL-seq), based on the whole-genome resequencing (WGRS) of two extreme resistant and susceptible phenotype bulks from an F 2:3 population, was performed, and one 767-kb genomic region with ΔSNP-index ≥ 0.9 on chromosome 3 was identified as the RpsHC18 candidate region in Huachun 18. The candidate region was reduced to a 146-kb region by fine mapping. Nonsynonymous SNP and haplotype analyses were carried out in the 146-kb region among ten soybean genotypes using WGRS. Four specific nonsynonymous SNPs were identified in two nucleotide-binding sites-leucine-rich repeat (NBS-LRR) genes, RpsHC18-NBL1 and RpsHC18-NBL2, which were considered to be the candidate genes. Finally, one specific SNP marker in each candidate gene was successfully developed using a tetra-primer ARMS-PCR assay, and the two markers were verified to be specific for RpsHC18 and to effectively distinguish other known Rps genes. In this study, we applied an integrated genomic-based strategy combining WGRS with traditional genetic mapping to identify RpsHC18 candidate genes and develop diagnostic markers. These results suggest that next-generation sequencing is a precise, rapid and cost-effective way to identify candidate genes and develop diagnostic markers, and it can accelerate Rps gene cloning and marker-assisted selection for breeding of P. sojae-resistant soybean cultivars.
Directory of Open Access Journals (Sweden)
Jana eSperschneider
2014-09-01
Full Text Available Plant pathogens cause severe losses to crop plants and threaten global food production. One striking example is the wheat stem rust fungus, Puccinia graminis f. sp. tritici, which can rapidly evolve new virulent pathotypes in response to resistant host lines. Like several other filamentous fungal and oomycete plant pathogens, its genome features expanded gene families that have been implicated in host-pathogen interactions, possibly encoding effector proteins that interact directly with target host defence proteins. Previous efforts to understand virulence largely relied on the prediction of secreted, small and cysteine-rich proteins as candidate effectors and thus delivered an overwhelming number of candidates. Here, we implement an alternative analysis strategy that uses the signal of adaptive evolution as a line of evidence for effector function, combined with comparative information and expression data. We demonstrate that in planta up-regulated genes that are rapidly evolving are found almost exclusively in pathogen-associated gene families, affirming the impact of host-pathogen co-evolution on genome structure and the adaptive diversification of specialised gene families. In particular, we predict 42 effector candidates that are conserved only across pathogens, induced during infection and rapidly evolving. One of our top candidates has recently been shown to induce genotype-specific hypersensitive cell death in wheat. This shows that comparative genomics incorporating the evolutionary signal of adaptation is powerful for predicting effector candidates for laboratory verification. Our system can be applied to a wide range of pathogens and will give insight into host-pathogen dynamics, ultimately leading to progress in strategies for disease control.
Hassani-Pak, Keywan; Rawlings, Christopher
2017-06-13
Genetics and "omics" studies designed to uncover genotype to phenotype relationships often identify large numbers of potential candidate genes, among which the causal genes are hidden. Scientists generally lack the time and technical expertise to review all relevant information available from the literature, from key model species and from a potentially wide range of related biological databases in a variety of data formats with variable quality and coverage. Computational tools are needed for the integration and evaluation of heterogeneous information in order to prioritise candidate genes and components of interaction networks that, if perturbed through potential interventions, have a positive impact on the biological outcome in the whole organism without producing negative side effects. Here we review several bioinformatics tools and databases that play an important role in biological knowledge discovery and candidate gene prioritization. We conclude with several key challenges that need to be addressed in order to facilitate biological knowledge discovery in the future.
Identification of Quantitative Trait Loci (QTL) and Candidate Genes for Cadmium Tolerance in Populus
Energy Technology Data Exchange (ETDEWEB)
Induri, Brahma R [West Virginia University; Ellis, Danielle R [West Virginia University; Slavov, Gancho [West Virginia University; Yin, Tongming [ORNL; Muchero, Wellington [ORNL; Tuskan, Gerald A [ORNL; DiFazio, Stephen P [West Virginia University
2012-01-01
Knowledge of genetic variation in response of Populus to heavy metals like cadmium (Cd) is an important step in understanding the underlying mechanisms of tolerance. In this study, a pseudo-backcross pedigree of Populus trichocarpa and Populus deltoides was characterized for Cd exposure. The pedigree showed significant variation for Cd tolerance thus enabling the identification of relatively tolerant and susceptible genotypes for intensive characterization. A total of 16 QTLs at logarithm of odds (LOD) ratio > 2.5, were found to be associated with total dry weight, its components, and root volume. Four major QTLs for total dry weight were mapped to different linkage groups in control (LG III) and Cd conditions (LG XVI) and had opposite allelic effects on Cd tolerance, suggesting that these genomic regions were differentially controlled. The phenotypic variation explained by Cd QTL for all traits under study varied from 5.9% to 11.6% and averaged 8.2% across all QTL. Leaf Cd contents also showed significant variation suggesting the phytoextraction potential of Populus genotypes, though heritability of this trait was low (0.22). A whole-genome microarray study was conducted by using two genotypes with extreme responses for Cd tolerance in the above study and differentially expressed genes were identified. Candidate genes including CAD2 (CADMIUM SENSITIVE 2), HMA5 (HEAVY METAL ATPase5), ATGTST1 (Arabidopsis thaliana Glutathione S-Transferase1), ATGPX6 (Glutathione peroxidase 6), and ATMRP 14 (Arabidopsis thaliana Multidrug Resistance associated Protein 14) were identified from QTL intervals and microarray study. Functional characterization of these candidate genes could enhance phytoremediation capabilities of Populus.
Eveno, Emmanuelle; Collada, Carmen; Guevara, M Angeles; Léger, Valérie; Soto, Alvaro; Díaz, Luis; Léger, Patrick; González-Martínez, Santiago C; Cervera, M Teresa; Plomion, Christophe; Garnier-Géré, Pauline H
2008-02-01
The importance of natural selection for shaping adaptive trait differentiation among natural populations of allogamous tree species has long been recognized. Determining the molecular basis of local adaptation remains largely unresolved, and the respective roles of selection and demography in shaping population structure are actively debated. Using a multilocus scan that aims to detect outliers from simulated neutral expectations, we analyzed patterns of nucleotide diversity and genetic differentiation at 11 polymorphic candidate genes for drought stress tolerance in phenotypically contrasted Pinus pinaster Ait. populations across its geographical range. We compared 3 coalescent-based methods: 2 frequentist-like, including 1 approach specifically developed for biallelic single nucleotide polymorphisms (SNPs) here and 1 Bayesian. Five genes showed outlier patterns that were robust across methods at the haplotype level for 2 of them. Two genes presented higher F(ST) values than expected (PR-AGP4 and erd3), suggesting that they could have been affected by the action of diversifying selection among populations. In contrast, 3 genes presented lower F(ST) values than expected (dhn-1, dhn2, and lp3-1), which could represent signatures of homogenizing selection among populations. A smaller proportion of outliers were detected at the SNP level suggesting the potential functional significance of particular combinations of sites in drought-response candidate genes. The Bayesian method appeared robust to low sample sizes, flexible to assumptions regarding migration rates, and powerful for detecting selection at the haplotype level, but the frequentist-like method adapted to SNPs was more efficient for the identification of outlier SNPs showing low differentiation. Population-specific effects estimated in the Bayesian method also revealed populations with lower immigration rates, which could have led to favorable situations for local adaptation. Outlier patterns are discussed
Directory of Open Access Journals (Sweden)
Fernanda M Rodríguez-Tornos
Full Text Available A unique synaptic activity-responsive element (SARE sequence, composed of the consensus binding sites for SRF, MEF2 and CREB, is necessary for control of transcriptional upregulation of the Arc gene in response to synaptic activity. We hypothesize that this sequence is a broad mechanism that regulates gene expression in response to synaptic activation and during plasticity; and that analysis of SARE-containing genes could identify molecular mechanisms involved in brain disorders. To search for conserved SARE sequences in the mammalian genome, we used the SynoR in silico tool, and found the SARE cluster predominantly in the regulatory regions of genes expressed specifically in the nervous system; most were related to neural development and homeostatic maintenance. Two of these SARE sequences were tested in luciferase assays and proved to promote transcription in response to neuronal activation. Supporting the predictive capacity of our candidate list, up-regulation of several SARE containing genes in response to neuronal activity was validated using external data and also experimentally using primary cortical neurons and quantitative real time RT-PCR. The list of SARE-containing genes includes several linked to mental retardation and cognitive disorders, and is significantly enriched in genes that encode mRNA targeted by FMRP (fragile X mental retardation protein. Our study thus supports the idea that SARE sequences are relevant transcriptional regulatory elements that participate in plasticity. In addition, it offers a comprehensive view of how activity-responsive transcription factors coordinate their actions and increase the selectivity of their targets. Our data suggest that analysis of SARE-containing genes will reveal yet-undescribed pathways of synaptic plasticity and additional candidate genes disrupted in mental disease.
Terenina, E; Babigumira, B M; Le Mignon, G; Bazovkina, D; Rousseau, S; Salin, F; Bendixen, C; Mormede, P
2013-02-01
The hypothalamic-pituitary-adrenal (HPA) axis exerts a large range of effects on metabolism, the immune system, inflammatory processes, and brain functions. Together with the sympathetic nervous system, it is also the most important stress-responsive neuroendocrine system. Both systems influence production traits, carcass composition, and meat quality. The HPA axis may be a critical target for genetic selection of more robust animals. Indeed, numerous studies in various species have demonstrated the importance of genetic factors in shaping the individual HPA axis phenotype, and genetic polymorphism can be found at each level of the axis, including hormone production by the adrenal cortices under stimulation by adrenocorticotropic hormone (ACTH), hormone bioavailability, or receptor and postreceptor mechanisms. The aim of the present experiment was to extend these findings to the brain neurochemical systems involved in stress responses. To this end, a number of candidate genes were sequenced for molecular polymorphisms and their association was studied with stress neuroendocrine and production traits in a genetically diverse population consisting of 100 female pigs from an advanced intercross (F10-F12) between 2 highly divergent breeds, Large White (LW) and Meishan (MS). The LW breed has a high production potential for lean meat and a low HPA axis activity, and the MS breed has low growth rate, fat carcasses-but large litters of highly viable piglets-and a high HPA axis activity. Candidate genes were chosen in the catecholaminergic and serotonergic pathways, in the pituitary control of cortisol production, among genes previously demonstrated to be differentially expressed in ACTH-stimulated adrenal glands from LW and MS pigs, and in cortisol receptors. Sixty new polymorphisms were found. The association study with carcass and meat quality traits and with endocrine traits showed a number of significant results, such as monoamine oxidase (MAOA) polymorphisms with
Directory of Open Access Journals (Sweden)
Shaomei He
2017-08-01
Full Text Available Extracellular electron transfer (EET is recognized as a key biochemical process in circumneutral pH Fe(II-oxidizing bacteria (FeOB. In this study, we searched for candidate EET genes in 73 neutrophilic FeOB genomes, among which 43 genomes are complete or close-to-complete and the rest have estimated genome completeness ranging from 5 to 91%. These neutrophilic FeOB span members of the microaerophilic, anaerobic phototrophic, and anaerobic nitrate-reducing FeOB groups. We found that many microaerophilic and several anaerobic FeOB possess homologs of Cyc2, an outer membrane cytochrome c originally identified in Acidithiobacillus ferrooxidans. The “porin-cytochrome c complex” (PCC gene clusters homologous to MtoAB/PioAB are present in eight FeOB, accounting for 19% of complete and close-to-complete genomes examined, whereas PCC genes homologous to OmbB-OmaB-OmcB in Geobacter sulfurreducens are absent. Further, we discovered gene clusters that may potentially encode two novel PCC types. First, a cluster (tentatively named “PCC3” encodes a porin, an extracellular and a periplasmic cytochrome c with remarkably large numbers of heme-binding motifs. Second, a cluster (tentatively named “PCC4” encodes a porin and three periplasmic multiheme cytochromes c. A conserved inner membrane protein (IMP encoded in PCC3 and PCC4 gene clusters might be responsible for translocating electrons across the inner membrane. Other bacteria possessing PCC3 and PCC4 are mostly Proteobacteria isolated from environments with a potential niche for Fe(II oxidation. In addition to cytochrome c, multicopper oxidase (MCO genes potentially involved in Fe(II oxidation were also identified. Notably, candidate EET genes were not found in some FeOB, especially the anaerobic ones, probably suggesting EET genes or Fe(II oxidation mechanisms are different from the searched models. Overall, based on current EET models, the search extends our understanding of bacterial EET and
Directory of Open Access Journals (Sweden)
Caruso Marco
2012-02-01
Full Text Available Abstract Background Reproductive biology in citrus is still poorly understood. Although in recent years several efforts have been made to study pollen-pistil interaction and self-incompatibility, little information is available about the molecular mechanisms regulating these processes. Here we report the identification of candidate genes involved in pollen-pistil interaction and self-incompatibility in clementine (Citrus clementina Hort. ex Tan.. These genes have been identified comparing the transcriptomes of laser-microdissected stylar canal cells (SCC isolated from two genotypes differing for self-incompatibility response ('Comune', a self-incompatible cultivar and 'Monreal', a self- compatible mutation of 'Comune'. Results The transcriptome profiling of SCC indicated that the differential regulation of few specific, mostly uncharacterized transcripts is associated with the breakdown of self-incompatibility in 'Monreal'. Among them, a novel F-box gene showed a drastic up-regulation both in laser microdissected stylar canal cells and in self-pollinated whole styles with stigmas of 'Comune' in concomitance with the arrest of pollen tube growth. Moreover, we identify a non-characterized gene family as closely associated to the self-incompatibility genetic program activated in 'Comune'. Three different aspartic-acid rich (Asp-rich protein genes, located in tandem in the clementine genome, were over-represented in the transcriptome of 'Comune'. These genes are tightly linked to a DELLA gene, previously found to be up-regulated in the self-incompatible genotype during pollen-pistil interaction. Conclusion The highly specific transcriptome survey of the stylar canal cells identified novel genes which have not been previously associated with self-pollen rejection in citrus and in other plant species. Bioinformatic and transcriptional analyses suggested that the mutation leading to self-compatibility in 'Monreal' affected the expression of non
Talwar, Puneet; Gupta, Renu; Kushwaha, Suman; Agarwal, Rachna; Saso, Luciano; Kukreti, Shrikant; Kukreti, Ritushree
2018-04-19
Alzheimer's disease (AD) is genetically complex with multifactorial etiology. Here, we aim to identify the potential viral pathogens leading to aberrant inflammatory and oxidative stress response in AD along with potential drug candidates using systems biology approach. We retrieved protein interactions of amyloid precursor protein (APP) and tau protein (MAPT) from NCBI and genes for oxidative stress from NetAge, for inflammation from NetAge and InnateDB databases. Genes implicated in aging were retrieved from GenAge database and two GEO expression datasets. These genes were individually used to create protein-protein interaction network using STRING database (score≥0.7). The interactions of candidate genes with known viruses were mapped using virhostnet v2.0 database. Drug molecules targeting candidate genes were retrieved using the Drug-Gene Interaction Database (DGIdb). Data mining resulted in 2095 APP, 116 MAPT, 214 oxidative stress, 1269 inflammatory genes. After STRING PPIN analysis, 404 APP, 109 MAPT, 204 oxidative stress and 1014 inflammation related high confidence proteins were identified. The overlap among all datasets yielded eight common markers (AKT1, GSK3B, APP, APOE, EGFR, PIN1, CASP8 and SNCA). These genes showed association with hepatitis C virus (HCV), Epstein-Barr virus (EBV), human herpes virus 8 and Human papillomavirus (HPV). Further, screening of drugs targeting candidate genes, and possessing anti-inflammatory property, antiviral activity along with suggested role in AD pathophysiology yielded 12 potential drug candidates. Our study demonstrated the role of viral etiology in AD pathogenesis by elucidating interaction of oxidative stress and inflammation causing candidate genes with common viruses along with the identification of potential AD drug candidates. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Ali, Shafat; Chopra, Rupali; Manvati, Siddharth; Singh, Yoginder Pal; Kaul, Nabodita; Behura, Anita; Mahajan, Ankit; Sehajpal, Prabodh; Gupta, Subash; Dhar, Manoj K; Chainy, Gagan B N; Bhanwer, Amarjit S; Sharma, Swarkar; Bamezai, Rameshwar N K
2013-01-01
Type 2 diabetes (T2D) is a syndrome of multiple metabolic disorders and is genetically heterogeneous. India comprises one of the largest global populations with highest number of reported type 2 diabetes cases. However, limited information about T2D associated loci is available for Indian populations. It is, therefore, pertinent to evaluate the previously associated candidates as well as identify novel genetic variations in Indian populations to understand the extent of genetic heterogeneity. We chose to do a cost effective high-throughput mass-array genotyping and studied the candidate gene variations associated with T2D in literature. In this case-control candidate genes association study, 91 SNPs from 55 candidate genes have been analyzed in three geographically independent population groups from India. We report the genetic variants in five candidate genes: TCF7L2, HHEX, ENPP1, IDE and FTO, are significantly associated (after Bonferroni correction, ppopulation. Interestingly, SNP rs7903146 of the TCF7L2 gene passed the genome wide significance threshold (combined P value = 2.05E-08) in the studied populations. We also observed the association of rs7903146 with blood glucose (fasting and postprandial) levels, supporting the role of TCF7L2 gene in blood glucose homeostasis. Further, we noted that the moderate risk provided by the independently associated loci in combined population with Odds Ratio (OR)<1.38 increased to OR = 2.44, (95%CI = 1.67-3.59) when the risk providing genotypes of TCF7L2, HHEX, ENPP1 and FTO genes were combined, suggesting the importance of gene-gene interactions evaluation in complex disorders like T2D.
Directory of Open Access Journals (Sweden)
Ma Menggen
2010-06-01
Full Text Available Abstract Background Derived from our lignocellulosic conversion inhibitor-tolerant yeast, we generated an ethanol-tolerant strain Saccharomyces cerevisiae NRRL Y-50316 by enforced evolutionary adaptation. Using a newly developed robust mRNA reference and a master equation unifying gene expression data analyses, we investigated comparative quantitative transcription dynamics of 175 genes selected from previous studies for an ethanol-tolerant yeast and its closely related parental strain. Results A highly fitted master equation was established and applied for quantitative gene expression analyses using pathway-based qRT-PCR array assays. The ethanol-tolerant Y-50316 displayed significantly enriched background of mRNA abundance for at least 35 genes without ethanol challenge compared with its parental strain Y-50049. Under the ethanol challenge, the tolerant Y-50316 responded in consistent expressions over time for numerous genes belonging to groups of heat shock proteins, trehalose metabolism, glycolysis, pentose phosphate pathway, fatty acid metabolism, amino acid biosynthesis, pleiotropic drug resistance gene family and transcription factors. The parental strain showed repressed expressions for many genes and was unable to withstand the ethanol stress and establish a viable culture and fermentation. The distinct expression dynamics between the two strains and their close association with cell growth, viability and ethanol fermentation profiles distinguished the tolerance-response from the stress-response in yeast under the ethanol challenge. At least 82 genes were identified as candidate and key genes for ethanol-tolerance and subsequent fermentation under the stress. Among which, 36 genes were newly recognized by the present study. Most of the ethanol-tolerance candidate genes were found to share protein binding motifs of transcription factors Msn4p/Msn2p, Yap1p, Hsf1p and Pdr1p/Pdr3p. Conclusion Enriched background of transcription abundance
Silva, C; Garcia-Mas, J; Sánchez, A M; Arús, P; Oliveira, M M
2005-03-01
Blooming time is one of the most important agronomic traits in almond. Biochemical and molecular events underlying flowering regulation must be understood before methods to stimulate late flowering can be developed. Attempts to elucidate the genetic control of this process have led to the identification of a major gene (Lb) and quantitative trait loci (QTLs) linked to observed phenotypic differences, but although this gene and these QTLs have been placed on the Prunus reference genetic map, their sequences and specific functions remain unknown. The aim of our investigation was to associate these loci with known genes using a candidate gene approach. Two almond cDNAs and eight Prunus expressed sequence tags were selected as candidate genes (CGs) since their sequences were highly identical to those of flowering regulatory genes characterized in other species. The CGs were amplified from both parental lines of the mapping population using specific primers. Sequence comparison revealed DNA polymorphisms between the parental lines, mainly of the single nucleotide type. Polymorphisms were used to develop co-dominant cleaved amplified polymorphic sequence markers or length polymorphisms based on insertion/deletion events for mapping the candidate genes on the Prunus reference map. Ten candidate genes were assigned to six linkage groups in the Prunus genome. The positions of two of these were compatible with the regions where two QTLs for blooming time were detected. One additional candidate was localized close to the position of the Evergrowing gene, which determines a non-deciduous behaviour in peach.
Directory of Open Access Journals (Sweden)
Kehua Wang
2017-06-01
Full Text Available Perennial ryegrass (Lolium perenne is one of the most widely used forage and turf grasses in the world due to its desirable agronomic qualities. However, as a cool-season perennial grass species, high temperature is a major factor limiting its performance in warmer and transition regions. In this study, a de novo transcriptome was generated using a cDNA library constructed from perennial ryegrass leaves subjected to short-term heat stress treatment. Then the expression profiling and identification of perennial ryegrass heat response genes by digital gene expression analyses was performed. The goal of this work was to produce expression profiles of high temperature stress responsive genes in perennial ryegrass leaves and further identify the potentially important candidate genes with altered levels of transcript, such as those genes involved in transcriptional regulation, antioxidant responses, plant hormones and signal transduction, and cellular metabolism. The de novo assembly of perennial ryegrass transcriptome in this study obtained more total and annotated unigenes compared to previously published ones. Many DEGs identified were genes that are known to respond to heat stress in plants, including HSFs, HSPs, and antioxidant related genes. In the meanwhile, we also identified four gene candidates mainly involved in C4 carbon fixation, and one TOR gene. Their exact roles in plant heat stress response need to dissect further. This study would be important by providing the gene resources for improving heat stress tolerance in both perennial ryegrass and other cool-season perennial grass plants.
Defining the Sequence Elements and Candidate Genes for the Coloboma Mutation.
Directory of Open Access Journals (Sweden)
Elizabeth A. Robb
Full Text Available The chicken coloboma mutation exhibits features similar to human congenital developmental malformations such as ocular coloboma, cleft-palate, dwarfism, and polydactyly. The coloboma-associated region and encoded genes were investigated using advanced genomic, genetic, and gene expression technologies. Initially, the mutation was linked to a 990 kb region encoding 11 genes; the application of the genetic and genomic tools led to a reduction of the linked region to 176 kb and the elimination of 7 genes. Furthermore, bioinformatics analyses of capture array-next generation sequence data identified genetic elements including SNPs, insertions, deletions, gaps, chromosomal rearrangements, and miRNA binding sites within the introgressed causative region relative to the reference genome sequence. Coloboma-specific variants within exons, UTRs, and splice sites were studied for their contribution to the mutant phenotype. Our compiled results suggest three genes for future studies. The three candidate genes, SLC30A5 (a zinc transporter, CENPH (a centromere protein, and CDK7 (a cyclin-dependent kinase, are differentially expressed (compared to normal embryos at stages and in tissues affected by the coloboma mutation. Of these genes, two (SLC30A5 and CENPH are considered high-priority candidate based upon studies in other vertebrate model systems.
Polymorphisms of candidate genes associated with meat quality and ...
African Journals Online (AJOL)
Hung Nguyen
Abstract. The objectives of this study were to analyse genotype distribution and sequence variations of candidate genes putatively associated with meat quality and disease resistance in exotic and indigenous. Vietnamese pig breeds. For this purpose, 340 pigs from four indigenous and two exotic breeds were included.
Stabej, Polona; Imholz, Sandra; Versteeg, Serge A; Zijlstra, Carla; Stokhof, Arnold A; Domanjko-Petric, Aleksandra; Leegwater, Peter A J; van Oost, Bernard A
2004-10-13
Canine-dilated cardiomyopathy (DCM) in dogs is a disease of the myocardium associated with dilatation and impaired contraction of the ventricles and is suspected to have a genetic cause. A missense mutation in the desmin gene (DES) causes DCM in a human family. Human DCM closely resembles the canine disease. In the present study, we evaluated whether DES gene mutations are responsible for DCM in Dobermann dogs. We have isolated bacterial artificial chromosome clones (BACs) containing the canine DES gene and determined the chromosomal location by fluorescence in situ hybridization (FISH). Using data deposited in the NCBI trace archive and GenBank, the canine DES gene DNA sequence was assembled and seven single nucleotide polymorphisms (SNPs) were identified. From the canine DES gene BAC clones, a polymorphic microsatellite marker was isolated. The microsatellite marker and four informative desmin SNPs were typed in a Dobermann family with frequent DCM occurrence, but the disease phenotype did not associate with a desmin haplotype. We concluded that mutations in the DES gene do not play a role in Dobermann DCM. Availability of the microsatellite marker, SNPs and DNA sequence reported in this study enable fast evaluation of the DES gene as a DCM candidate gene in other dog breeds with DCM occurrence.
Directory of Open Access Journals (Sweden)
Shafat Ali
Full Text Available Type 2 diabetes (T2D is a syndrome of multiple metabolic disorders and is genetically heterogeneous. India comprises one of the largest global populations with highest number of reported type 2 diabetes cases. However, limited information about T2D associated loci is available for Indian populations. It is, therefore, pertinent to evaluate the previously associated candidates as well as identify novel genetic variations in Indian populations to understand the extent of genetic heterogeneity. We chose to do a cost effective high-throughput mass-array genotyping and studied the candidate gene variations associated with T2D in literature. In this case-control candidate genes association study, 91 SNPs from 55 candidate genes have been analyzed in three geographically independent population groups from India. We report the genetic variants in five candidate genes: TCF7L2, HHEX, ENPP1, IDE and FTO, are significantly associated (after Bonferroni correction, p<5.5E-04 with T2D susceptibility in combined population. Interestingly, SNP rs7903146 of the TCF7L2 gene passed the genome wide significance threshold (combined P value = 2.05E-08 in the studied populations. We also observed the association of rs7903146 with blood glucose (fasting and postprandial levels, supporting the role of TCF7L2 gene in blood glucose homeostasis. Further, we noted that the moderate risk provided by the independently associated loci in combined population with Odds Ratio (OR<1.38 increased to OR = 2.44, (95%CI = 1.67-3.59 when the risk providing genotypes of TCF7L2, HHEX, ENPP1 and FTO genes were combined, suggesting the importance of gene-gene interactions evaluation in complex disorders like T2D.
Positional RNA-Seq identifies candidate genes for phenotypic engineering of sexual traits
Arbore, Roberto; Sekii, Kiyono; Beisel, Christian; Ladurner, Peter; Berezikov, Eugene; Schaerer, Lukas
2015-01-01
Introduction: RNA interference (RNAi) of trait-specific genes permits the manipulation of specific phenotypic traits ("phenotypic engineering") and thus represents a powerful tool to test trait function in evolutionary studies. The identification of suitable candidate genes, however, often relies on
Candidate genes for drought tolerance and improved productivity in ...
Indian Academy of Sciences (India)
Madhu
tropics. Improving drought tolerance and productivity is one of the most difficult tasks for cereal breeders. The diffi- culty arises from the diverse strategies adopted by plants themselves to combat drought stress depending on the timing,. Candidate genes for drought tolerance and improved productivity in rice (Oryza sativa L.).
Polymorphisms of candidate genes associated with meat quality and ...
African Journals Online (AJOL)
The objectives of this study were to analyse genotype distribution and sequence variations of candidate genes putatively associated with meat quality and disease resistance in exotic and indigenous Vietnamese pig breeds. For this purpose, 340 pigs from four indigenous and two exotic breeds were included in the analysis ...
Saik, Olga V; Demenkov, Pavel S; Ivanisenko, Timofey V; Bragina, Elena Yu; Freidin, Maxim B; Goncharova, Irina A; Dosenko, Victor E; Zolotareva, Olga I; Hofestaedt, Ralf; Lavrik, Inna N; Rogaev, Evgeny I; Ivanisenko, Vladimir A
2018-02-13
Hypertension and bronchial asthma are a major issue for people's health. As of 2014, approximately one billion adults, or ~ 22% of the world population, have had hypertension. As of 2011, 235-330 million people globally have been affected by asthma and approximately 250,000-345,000 people have died each year from the disease. The development of the effective treatment therapies against these diseases is complicated by their comorbidity features. This is often a major problem in diagnosis and their treatment. Hence, in this study the bioinformatical methodology for the analysis of the comorbidity of these two diseases have been developed. As such, the search for candidate genes related to the comorbid conditions of asthma and hypertension can help in elucidating the molecular mechanisms underlying the comorbid condition of these two diseases, and can also be useful for genotyping and identifying new drug targets. Using ANDSystem, the reconstruction and analysis of gene networks associated with asthma and hypertension was carried out. The gene network of asthma included 755 genes/proteins and 62,603 interactions, while the gene network of hypertension - 713 genes/proteins and 45,479 interactions. Two hundred and five genes/proteins and 9638 interactions were shared between asthma and hypertension. An approach for ranking genes implicated in the comorbid condition of two diseases was proposed. The approach is based on nine criteria for ranking genes by their importance, including standard methods of gene prioritization (Endeavor, ToppGene) as well as original criteria that take into account the characteristics of an associative gene network and the presence of known polymorphisms in the analysed genes. According to the proposed approach, the genes IL10, TLR4, and CAT had the highest priority in the development of comorbidity of these two diseases. Additionally, it was revealed that the list of top genes is enriched with apoptotic genes and genes involved in
Johnson, Emma C; Border, Richard; Melroy-Greif, Whitney E; de Leeuw, Christiaan A; Ehringer, Marissa A; Keller, Matthew C
2017-01-01
BACKGROUND: A recent analysis of 25 historical candidate gene polymorphisms for schizophrenia in the largest genome-wide association study conducted to date suggested that these commonly studied variants were no more associated with the disorder than would be expected by chance. However, the same
Xie, Dongwei; Dai, Zhigang; Yang, Zemao; Sun, Jian; Zhao, Debao; Yang, Xue; Zhang, Liguo; Tang, Qing; Su, Jianguang
2017-01-01
Flax ( Linum usitatissimum L.) is an important cash crop, and its agronomic traits directly affect yield and quality. Molecular studies on flax remain inadequate because relatively few flax genes have been associated with agronomic traits or have been identified as having potential applications. To identify markers and candidate genes that can potentially be used for genetic improvement of crucial agronomic traits, we examined 224 specimens of core flax germplasm; specifically, phenotypic data for key traits, including plant height, technical length, number of branches, number of fruits, and 1000-grain weight were investigated under three environmental conditions before specific-locus amplified fragment sequencing (SLAF-seq) was employed to perform a genome-wide association study (GWAS) for these five agronomic traits. Subsequently, the results were used to screen single nucleotide polymorphism (SNP) loci and candidate genes that exhibited a significant correlation with the important agronomic traits. Our analyses identified a total of 42 SNP loci that showed significant correlations with the five important agronomic flax traits. Next, candidate genes were screened in the 10 kb zone of each of the 42 SNP loci. These SNP loci were then analyzed by a more stringent screening via co-identification using both a general linear model (GLM) and a mixed linear model (MLM) as well as co-occurrences in at least two of the three environments, whereby 15 final candidate genes were obtained. Based on these results, we determined that UGT and PL are candidate genes for plant height, GRAS and XTH are candidate genes for the number of branches, Contig1437 and LU0019C12 are candidate genes for the number of fruits, and PHO1 is a candidate gene for the 1000-seed weight. We propose that the identified SNP loci and corresponding candidate genes might serve as a biological basis for improving crucial agronomic flax traits.
Directory of Open Access Journals (Sweden)
Dongwei Xie
2018-01-01
Full Text Available Flax (Linum usitatissimum L. is an important cash crop, and its agronomic traits directly affect yield and quality. Molecular studies on flax remain inadequate because relatively few flax genes have been associated with agronomic traits or have been identified as having potential applications. To identify markers and candidate genes that can potentially be used for genetic improvement of crucial agronomic traits, we examined 224 specimens of core flax germplasm; specifically, phenotypic data for key traits, including plant height, technical length, number of branches, number of fruits, and 1000-grain weight were investigated under three environmental conditions before specific-locus amplified fragment sequencing (SLAF-seq was employed to perform a genome-wide association study (GWAS for these five agronomic traits. Subsequently, the results were used to screen single nucleotide polymorphism (SNP loci and candidate genes that exhibited a significant correlation with the important agronomic traits. Our analyses identified a total of 42 SNP loci that showed significant correlations with the five important agronomic flax traits. Next, candidate genes were screened in the 10 kb zone of each of the 42 SNP loci. These SNP loci were then analyzed by a more stringent screening via co-identification using both a general linear model (GLM and a mixed linear model (MLM as well as co-occurrences in at least two of the three environments, whereby 15 final candidate genes were obtained. Based on these results, we determined that UGT and PL are candidate genes for plant height, GRAS and XTH are candidate genes for the number of branches, Contig1437 and LU0019C12 are candidate genes for the number of fruits, and PHO1 is a candidate gene for the 1000-seed weight. We propose that the identified SNP loci and corresponding candidate genes might serve as a biological basis for improving crucial agronomic flax traits.
Selection in the dopamine receptor 2 gene: a candidate SNP study
Directory of Open Access Journals (Sweden)
Tobias Göllner
2015-08-01
Full Text Available Dopamine is a major neurotransmitter in the human brain and is associated with various diseases. Schizophrenia, for example, is treated by blocking the dopamine receptors type 2. Shaner, Miller & Mintz (2004 stated that schizophrenia was the low fitness variant of a highly variable mental trait. We therefore explore whether the dopamine receptor 2 gene (DRD2 underwent any selection processes. We acquired genotype data of the 1,000 Genomes project (phase I, which contains 1,093 individuals from 14 populations. We included single nucleotide polymorphisms (SNPs with two minor allele frequencies (MAFs in the analysis: MAF over 0.05 and over 0.01. This is equivalent to 151 SNPs (MAF > 0.05 and 246 SNPs (MAF > 0.01 for DRD2. We used two different approaches (an outlier approach and a Bayesian approach to detect loci under selection. The combined results of both approaches yielded nine (MAF > 0.05 and two candidate SNPs (MAF > 0.01, under balancing selection. We also found weak signs for directional selection on DRD2, but in our opinion these were too weak to draw any final conclusions on directional selection in DRD2. All candidates for balancing selection are in the intronic region of the gene and only one (rs12574471 has been mentioned in the literature. Two of our candidate SNPs are located in specific regions of the gene: rs80215768 lies within a promoter flanking region and rs74751335 lies within a transcription factor binding site. We strongly encourage research on our candidate SNPs and their possible effects.
DEFF Research Database (Denmark)
Goode, Ellen L; Fridley, Brooke L; Vierkant, Robert A
2009-01-01
Polymorphisms in genes critical to cell cycle control are outstanding candidates for association with ovarian cancer risk; numerous genes have been interrogated by multiple research groups using differing tagging single-nucleotide polymorphism (SNP) sets. To maximize information gleaned from......, and rs3212891; CDK2 rs2069391, rs2069414, and rs17528736; and CCNE1 rs3218036. These results exemplify the utility of imputation in candidate gene studies and lend evidence to a role of cell cycle genes in ovarian cancer etiology, suggest a reduced set of SNPs to target in additional cases and controls....
DEFF Research Database (Denmark)
Blomstrøm, Monica Marie
2016-01-01
several growth modulators and invasion modulators were identified and independently validated. These candidates revealed a group of genes with metastasis-related functions in vitro that are involved in RNA-related processes, such as RNA-processing. Moreover, a general feature was that proliferation......) and non-CSCs. The main goal of this project was to functionally characterize a set of candidate genes recovered from next-generation sequencing analysis for their role in breast cancer metastasis formation. The starting gene set comprised 104 gene variants; i.e. 57 wildtype and 47 mutated variants. During...
Identifying Novel Candidate Genes Related to Apoptosis from a Protein-Protein Interaction Network
Directory of Open Access Journals (Sweden)
Baoman Wang
2015-01-01
Full Text Available Apoptosis is the process of programmed cell death (PCD that occurs in multicellular organisms. This process of normal cell death is required to maintain the balance of homeostasis. In addition, some diseases, such as obesity, cancer, and neurodegenerative diseases, can be cured through apoptosis, which produces few side effects. An effective comprehension of the mechanisms underlying apoptosis will be helpful to prevent and treat some diseases. The identification of genes related to apoptosis is essential to uncover its underlying mechanisms. In this study, a computational method was proposed to identify novel candidate genes related to apoptosis. First, protein-protein interaction information was used to construct a weighted graph. Second, a shortest path algorithm was applied to the graph to search for new candidate genes. Finally, the obtained genes were filtered by a permutation test. As a result, 26 genes were obtained, and we discuss their likelihood of being novel apoptosis-related genes by collecting evidence from published literature.
Jorgensen, Stacy A; Preston, Jill C
2014-04-01
Evolutionary transitions in growth habit and flowering time responses to variable environmental signals have occurred multiple times independently across angiosperms and have major impacts on plant fitness. Proteins in the SPL family of transcription factors collectively regulate flowering time genes that have been implicated in interspecific shifts in annuality/perenniality. However, their potential importance in the evolution of angiosperm growth habit has not been extensively investigated. Here we identify orthologs representative of the major SPL gene clades in annual Arabidopsis thaliana and Mimulus guttatus IM767, and perennial A. lyrata and M. guttatus PR, and characterize their expression. Spatio-temporal expression patterns are complex across both diverse tissues of the same taxa and comparable tissues of different taxa, consistent with genic sub- or neo-functionalization. However, our data are consistent with a general role for several SPL genes in the promotion of juvenile to adult phase change and/or flowering time in Mimulus and Arabidopsis. Furthermore, several candidate genes were identified for future study whose differential expression correlates with growth habit and architectural variation in annual versus perennial taxa. Copyright © 2014 Elsevier Inc. All rights reserved.
'Omics' approaches in tomato aimed at identifying candidate genes ...
African Journals Online (AJOL)
adriana
2013-12-04
Dec 4, 2013 ... approaches could be combined in order to identify candidate genes for the genetic control of ascorbic ..... applied to other traits under the complex control of many ... Engineering increased vitamin C levels in ... Chem. Biol. 13:532–538. Giovannucci E, Rimm EB, Liu Y, Stampfer MJ, Willett WC (2002). A.
Identification of Candidate B-Lymphoma Genes by Cross-Species Gene Expression Profiling
Tompkins, Van S.; Han, Seong-Su; Olivier, Alicia; Syrbu, Sergei; Bair, Thomas; Button, Anna; Jacobus, Laura; Wang, Zebin; Lifton, Samuel; Raychaudhuri, Pradip; Morse, Herbert C.; Weiner, George; Link, Brian; Smith, Brian J.; Janz, Siegfried
2013-01-01
Comparative genome-wide expression profiling of malignant tumor counterparts across the human-mouse species barrier has a successful track record as a gene discovery tool in liver, breast, lung, prostate and other cancers, but has been largely neglected in studies on neoplasms of mature B-lymphocytes such as diffuse large B cell lymphoma (DLBCL) and Burkitt lymphoma (BL). We used global gene expression profiles of DLBCL-like tumors that arose spontaneously in Myc-transgenic C57BL/6 mice as a phylogenetically conserved filter for analyzing the human DLBCL transcriptome. The human and mouse lymphomas were found to have 60 concordantly deregulated genes in common, including 8 genes that Cox hazard regression analysis associated with overall survival in a published landmark dataset of DLBCL. Genetic network analysis of the 60 genes followed by biological validation studies indicate FOXM1 as a candidate DLBCL and BL gene, supporting a number of studies contending that FOXM1 is a therapeutic target in mature B cell tumors. Our findings demonstrate the value of the “mouse filter” for genomic studies of human B-lineage neoplasms for which a vast knowledge base already exists. PMID:24130802
Host genetic variation influences gene expression response to rhinovirus infection.
Directory of Open Access Journals (Sweden)
Minal Çalışkan
2015-04-01
Full Text Available Rhinovirus (RV is the most prevalent human respiratory virus and is responsible for at least half of all common colds. RV infections may result in a broad spectrum of effects that range from asymptomatic infections to severe lower respiratory illnesses. The basis for inter-individual variation in the response to RV infection is not well understood. In this study, we explored whether host genetic variation is associated with variation in gene expression response to RV infections between individuals. To do so, we obtained genome-wide genotype and gene expression data in uninfected and RV-infected peripheral blood mononuclear cells (PBMCs from 98 individuals. We mapped local and distant genetic variation that is associated with inter-individual differences in gene expression levels (eQTLs in both uninfected and RV-infected cells. We focused specifically on response eQTLs (reQTLs, namely, genetic associations with inter-individual variation in gene expression response to RV infection. We identified local reQTLs for 38 genes, including genes with known functions in viral response (UBA7, OAS1, IRF5 and genes that have been associated with immune and RV-related diseases (e.g., ITGA2, MSR1, GSTM3. The putative regulatory regions of genes with reQTLs were enriched for binding sites of virus-activated STAT2, highlighting the role of condition-specific transcription factors in genotype-by-environment interactions. Overall, we suggest that the 38 loci associated with inter-individual variation in gene expression response to RV-infection represent promising candidates for affecting immune and RV-related respiratory diseases.
Host genetic variation influences gene expression response to rhinovirus infection.
Çalışkan, Minal; Baker, Samuel W; Gilad, Yoav; Ober, Carole
2015-04-01
Rhinovirus (RV) is the most prevalent human respiratory virus and is responsible for at least half of all common colds. RV infections may result in a broad spectrum of effects that range from asymptomatic infections to severe lower respiratory illnesses. The basis for inter-individual variation in the response to RV infection is not well understood. In this study, we explored whether host genetic variation is associated with variation in gene expression response to RV infections between individuals. To do so, we obtained genome-wide genotype and gene expression data in uninfected and RV-infected peripheral blood mononuclear cells (PBMCs) from 98 individuals. We mapped local and distant genetic variation that is associated with inter-individual differences in gene expression levels (eQTLs) in both uninfected and RV-infected cells. We focused specifically on response eQTLs (reQTLs), namely, genetic associations with inter-individual variation in gene expression response to RV infection. We identified local reQTLs for 38 genes, including genes with known functions in viral response (UBA7, OAS1, IRF5) and genes that have been associated with immune and RV-related diseases (e.g., ITGA2, MSR1, GSTM3). The putative regulatory regions of genes with reQTLs were enriched for binding sites of virus-activated STAT2, highlighting the role of condition-specific transcription factors in genotype-by-environment interactions. Overall, we suggest that the 38 loci associated with inter-individual variation in gene expression response to RV-infection represent promising candidates for affecting immune and RV-related respiratory diseases.
Candidate Genes Detected in Transcriptome Studies are Strongly Dependent on Genetic Background
DEFF Research Database (Denmark)
Sarup, Pernille Merete; Sørensen, Jesper Givskov; Kristensen, Torsten Nygård
2011-01-01
identified from studies of gene expression in Drosophila melanogaster using similar technical platforms. We found little overlap across studies between putative candidate genes for the same traits in the same sex. Instead there was a high degree of overlap between different traits and sexes within the same...
Mina, Lida; Soule, Sharon E; Badve, Sunil; Baehner, Fredrick L; Baker, Joffre; Cronin, Maureen; Watson, Drew; Liu, Mei-Lan; Sledge, George W; Shak, Steve; Miller, Kathy D
2007-06-01
Primary chemotherapy provides an ideal opportunity to correlate gene expression with response to treatment. We used paraffin-embedded core biopsies from a completed phase II trial to identify genes that correlate with response to primary chemotherapy. Patients with newly diagnosed stage II or III breast cancer were treated with sequential doxorubicin 75 mg/M2 q2 wks x 3 and docetaxel 40 mg/M2 weekly x 6; treatment order was randomly assigned. Pretreatment core biopsy samples were interrogated for genes that might correlate with pathologic complete response (pCR). In addition to the individual genes, the correlation of the Oncotype DX Recurrence Score with pCR was examined. Of 70 patients enrolled in the parent trial, core biopsies samples with sufficient RNA for gene analyses were available from 45 patients; 9 (20%) had inflammatory breast cancer (IBC). Six (14%) patients achieved a pCR. Twenty-two of the 274 candidate genes assessed correlated with pCR (p < 0.05). Genes correlating with pCR could be grouped into three large clusters: angiogenesis-related genes, proliferation related genes, and invasion-related genes. Expression of estrogen receptor (ER)-related genes and Recurrence Score did not correlate with pCR. In an exploratory analysis we compared gene expression in IBC to non-inflammatory breast cancer; twenty-four (9%) of the genes were differentially expressed (p < 0.05), 5 were upregulated and 19 were downregulated in IBC. Gene expression analysis on core biopsy samples is feasible and identifies candidate genes that correlate with pCR to primary chemotherapy. Gene expression in IBC differs significantly from noninflammatory breast cancer.
Analysis of a positional candidate gene for inflammatory bowel disease: NRAMP2
Stokkers, P. C.; Huibregtse, K.; Leegwater, A. C.; Reitsma, P. H.; Tytgat, G. N.; van Deventer, S. J.
2000-01-01
Genome scans have identified a region spanning 40 cM on the long arm of chromosome 12 as a susceptibility locus for inflammatory bowel disease (IBD). This locus contains several candidate genes for IBD, one of which is the gene for the natural resistance associated macrophage protein 2 (NRAMP2).
Dou, Junling; Zhao, Shengjie; Lu, Xuqiang; He, Nan; Zhang, Lei; Ali, Aslam; Kuang, Hanhui; Liu, Wenge
2018-04-01
A 159 bp deletion in ClFS1 gene encoding IQD protein is responsible for fruit shape in watermelon. Watermelon [Citrullus lanatus (Thunb.) Matsum. & Nakai] is known for its rich diversity in fruit size and shape. Fruit shape has been one of the major objectives of watermelon breeding. However, the candidate genes and the underlying genetic mechanism for such an important trait in watermelon are unknown. In this study, we identified a locus on chromosome 3 of watermelon genome controlling fruit shape. Segregation analysis in F 2 and BC 1 populations derived from a cross between two inbred lines "Duan125" (elongate fruit) and "Zhengzhouzigua" (spherical fruit) suggests that fruit shape of watermelon is controlled by a single locus and elongate fruit (OO) is incompletely dominant to spherical fruit (oo) with the heterozygote (Oo) being oval fruit. GWAS profiles among 315 accessions identified a major locus designated on watermelon chromosome 3, which was confirmed by BSA-seq mapping in the F 2 population. The candidate gene was mapped to a region 46 kb on chromosome 3. There were only four genes present in the corresponding region in the reference genome. Four candidate genes were sequenced in this region, revealing that the CDS of Cla011257 had a 159 bp deletion which resulted in the omission of 53 amino acids in elongate watermelon. An indel marker was derived from the 159 bp deletion to test the F 2 population and 105 watermelon accessions. The results showed that Cla011257 cosegregated with watermelon fruit shape. In addition, the Cla011257 expression was the highest at ovary formation stage. The predicted protein of the Cla011257 gene fitted in IQD protein family which was reported to have association with cell arrays and Ca 2+ -CaM signaling modules. Clear understanding of the genes facilitating the fruit shape along with marker association selection will be an effective way to develop new cultivars.
Dynamic compression of chondrocyte-agarose constructs reveals new candidate mechanosensitive genes.
Directory of Open Access Journals (Sweden)
Carole Bougault
Full Text Available Articular cartilage is physiologically exposed to repeated loads. The mechanical properties of cartilage are due to its extracellular matrix, and homeostasis is maintained by the sole cell type found in cartilage, the chondrocyte. Although mechanical forces clearly control the functions of articular chondrocytes, the biochemical pathways that mediate cellular responses to mechanical stress have not been fully characterised. The aim of our study was to examine early molecular events triggered by dynamic compression in chondrocytes. We used an experimental system consisting of primary mouse chondrocytes embedded within an agarose hydrogel; embedded cells were pre-cultured for one week and subjected to short-term compression experiments. Using Western blots, we demonstrated that chondrocytes maintain a differentiated phenotype in this model system and reproduce typical chondrocyte-cartilage matrix interactions. We investigated the impact of dynamic compression on the phosphorylation state of signalling molecules and genome-wide gene expression. After 15 min of dynamic compression, we observed transient activation of ERK1/2 and p38 (members of the mitogen-activated protein kinase (MAPK pathways and Smad2/3 (members of the canonical transforming growth factor (TGF-β pathways. A microarray analysis performed on chondrocytes compressed for 30 min revealed that only 20 transcripts were modulated more than 2-fold. A less conservative list of 325 modulated genes included genes related to the MAPK and TGF-β pathways and/or known to be mechanosensitive in other biological contexts. Of these candidate mechanosensitive genes, 85% were down-regulated. Down-regulation may therefore represent a general control mechanism for a rapid response to dynamic compression. Furthermore, modulation of transcripts corresponding to different aspects of cellular physiology was observed, such as non-coding RNAs or primary cilium. This study provides new insight into how
Candidate genes for performance in horses, including monocarboxylate transporters
Directory of Open Access Journals (Sweden)
Inaê Cristina Regatieri
Full Text Available ABSTRACT: Some horse breeds are highly selected for athletic activities. The athletic potential of each animal can be measured by its performance in sports. High athletic performance depends on the animal capacity to produce energy through aerobic and anaerobic metabolic pathways, among other factors. Transmembrane proteins called monocarboxylate transporters, mainly the isoform 1 (MCT1 and its ancillary protein CD147, can help the organism to adapt to physiological stress caused by physical exercise, transporting lactate and H+ ions. Horse breeds are selected for different purposes so we might expect differences in the amount of those proteins and in the genotypic frequencies for genes that play a significant role in the performance of the animals. The study of MCT1 and CD147 gene polymorphisms, which can affect the formation of the proteins and transport of lactate and H+, can provide enough information to be used for selection of athletic horses increasingly resistant to intense exercise. Two other candidate genes, the PDK4 and DMRT3, have been associated with athletic potential and indicated as possible markers for performance in horses. The oxidation of fatty acids is highly effective in generating ATP and is controlled by the expression of PDK4 (pyruvate dehydrogenase kinase, isozyme 4 in skeletal muscle during and after exercise. The doublesex and mab-3 related transcription factor 3 (DMRT3 gene encodes an important transcription factor in the setting of spinal cord circuits controlling movement in vertebrates and may be associated with gait performance in horses. This review describes how the monocarboxylate transporters work during physical exercise in athletic horses and the influence of polymorphisms in candidate genes for athletic performance in horses.
No Association between Personality and Candidate Gene Polymorphisms in a Wild Bird Population.
Directory of Open Access Journals (Sweden)
Hannah A Edwards
Full Text Available Consistency of between-individual differences in behaviour or personality is a phenomenon in populations that can have ecological consequences and evolutionary potential. One way that behaviour can evolve is to have a genetic basis. Identifying the molecular genetic basis of personality could therefore provide insight into how and why such variation is maintained, particularly in natural populations. Previously identified candidate genes for personality in birds include the dopamine receptor D4 (DRD4, and serotonin transporter (SERT. Studies of wild bird populations have shown that exploratory and bold behaviours are associated with polymorphisms in both DRD4 and SERT. Here we tested for polymorphisms in DRD4 and SERT in the Seychelles warbler (Acrocephalus sechellensis population on Cousin Island, Seychelles, and then investigated correlations between personality and polymorphisms in these genes. We found no genetic variation in DRD4, but identified four polymorphisms in SERT that clustered into five haplotypes. There was no correlation between bold or exploratory behaviours and SERT polymorphisms/haplotypes. The null result was not due to lack of power, and indicates that there was no association between these behaviours and variation in the candidate genes tested in this population. These null findings provide important data to facilitate representative future meta-analyses on candidate personality genes.
Association analysis of 94 candidate genes and schizophrenia-related endophenotypes.
Directory of Open Access Journals (Sweden)
Tiffany A Greenwood
Full Text Available While it is clear that schizophrenia is highly heritable, the genetic basis of this heritability is complex. Human genetic, brain imaging, and model organism studies have met with only modest gains. A complementary research tactic is to evaluate the genetic substrates of quantitative endophenotypes with demonstrated deficits in schizophrenia patients. We used an Illumina custom 1,536-SNP array to interrogate 94 functionally relevant candidate genes for schizophrenia and evaluate association with both the qualitative diagnosis of schizophrenia and quantitative endophenotypes for schizophrenia. Subjects included 219 schizophrenia patients and normal comparison subjects of European ancestry and 76 schizophrenia patients and normal comparison subjects of African ancestry, all ascertained by the UCSD Schizophrenia Research Program. Six neurophysiological and neurocognitive endophenotype test paradigms were assessed: prepulse inhibition (PPI, P50 suppression, the antisaccade oculomotor task, the Letter-Number Span Test, the California Verbal Learning Test-II, and the Wisconsin Card Sorting Test-64 Card Version. These endophenotype test paradigms yielded six primary endophenotypes with prior evidence of heritability and demonstrated schizophrenia-related impairments, as well as eight secondary measures investigated as candidate endophenotypes. Schizophrenia patients showed significant deficits on ten of the endophenotypic measures, replicating prior studies and facilitating genetic analyses of these phenotypes. A total of 38 genes were found to be associated with at least one endophenotypic measure or schizophrenia with an empirical p-value<0.01. Many of these genes have been shown to interact on a molecular level, and eleven genes displayed evidence for pleiotropy, revealing associations with three or more endophenotypic measures. Among these genes were ERBB4 and NRG1, providing further support for a role of these genes in schizophrenia susceptibility
Directory of Open Access Journals (Sweden)
Erena A. Edae
2013-07-01
Full Text Available Functional markers are needed for key genes involved in drought tolerance to improve selection for crop yield under moisture stress conditions. The objectives of this study were to (i characterize five drought tolerance candidate genes, namely dehydration responsive element binding 1A (, enhanced response to abscisic acid ( and , and fructan 1-exohydrolase ( and , in wheat ( L. for nucleotide and haplotype diversity, Tajima’s D value, and linkage disequilibrium (LD and (ii associate within-gene single nucleotide polymorphisms (SNPs with phenotypic traits in a spring wheat association mapping panel ( = 126. Field trials were grown under contrasting moisture regimes in Greeley, CO, and Melkassa, Ethiopia, in 2010 and 2011. Genome-specific amplification and DNA sequence analysis of the genes identified SNPs and revealed differences in nucleotide and haplotype diversity, Tajima’s D, and patterns of LD. showed associations (false discovery rate adjusted probability value = 0.1 with normalized difference vegetation index, heading date, biomass, and spikelet number. Both and were associated with harvest index, flag leaf width, and leaf senescence. was associated with grain yield, and was associated with thousand kernel weight and test weight. If validated in relevant genetic backgrounds, the identified marker–trait associations may be applied to functional marker-assisted selection.
Screening key candidate genes and pathways involved in insulinoma by microarray analysis.
Zhou, Wuhua; Gong, Li; Li, Xuefeng; Wan, Yunyan; Wang, Xiangfei; Li, Huili; Jiang, Bin
2018-06-01
Insulinoma is a rare type tumor and its genetic features remain largely unknown. This study aimed to search for potential key genes and relevant enriched pathways of insulinoma.The gene expression data from GSE73338 were downloaded from Gene Expression Omnibus database. Differentially expressed genes (DEGs) were identified between insulinoma tissues and normal pancreas tissues, followed by pathway enrichment analysis, protein-protein interaction (PPI) network construction, and module analysis. The expressions of candidate key genes were validated by quantitative real-time polymerase chain reaction (RT-PCR) in insulinoma tissues.A total of 1632 DEGs were obtained, including 1117 upregulated genes and 514 downregulated genes. Pathway enrichment results showed that upregulated DEGs were significantly implicated in insulin secretion, and downregulated DEGs were mainly enriched in pancreatic secretion. PPI network analysis revealed 7 hub genes with degrees more than 10, including GCG (glucagon), GCGR (glucagon receptor), PLCB1 (phospholipase C, beta 1), CASR (calcium sensing receptor), F2R (coagulation factor II thrombin receptor), GRM1 (glutamate metabotropic receptor 1), and GRM5 (glutamate metabotropic receptor 5). DEGs involved in the significant modules were enriched in calcium signaling pathway, protein ubiquitination, and platelet degranulation. Quantitative RT-PCR data confirmed that the expression trends of these hub genes were similar to the results of bioinformatic analysis.The present study demonstrated that candidate DEGs and enriched pathways were the potential critical molecule events involved in the development of insulinoma, and these findings were useful for better understanding of insulinoma genesis.
Su, Junji; Li, Libei; Zhang, Chi; Wang, Caixiang; Gu, Lijiao; Wang, Hantao; Wei, Hengling; Liu, Qibao; Huang, Long; Yu, Shuxun
2018-06-01
Thirty significant associations between 22 SNPs and five plant architecture component traits in Chinese upland cotton were identified via GWAS. Four peak SNP loci located on chromosome D03 were simultaneously associated with more plant architecture component traits. A candidate gene, Gh_D03G0922, might be responsible for plant height in upland cotton. A compact plant architecture is increasingly required for mechanized harvesting processes in China. Therefore, cotton plant architecture is an important trait, and its components, such as plant height, fruit branch length and fruit branch angle, affect the suitability of a cultivar for mechanized harvesting. To determine the genetic basis of cotton plant architecture, a genome-wide association study (GWAS) was performed using a panel composed of 355 accessions and 93,250 single nucleotide polymorphisms (SNPs) identified using the specific-locus amplified fragment sequencing method. Thirty significant associations between 22 SNPs and five plant architecture component traits were identified via GWAS. Most importantly, four peak SNP loci located on chromosome D03 were simultaneously associated with more plant architecture component traits, and these SNPs were harbored in one linkage disequilibrium block. Furthermore, 21 candidate genes for plant architecture were predicted in a 0.95-Mb region including the four peak SNPs. One of these genes (Gh_D03G0922) was near the significant SNP D03_31584163 (8.40 kb), and its Arabidopsis homologs contain MADS-box domains that might be involved in plant growth and development. qRT-PCR showed that the expression of Gh_D03G0922 was upregulated in the apical buds and young leaves of the short and compact cotton varieties, and virus-induced gene silencing (VIGS) proved that the silenced plants exhibited increased PH. These results indicate that Gh_D03G0922 is likely the candidate gene for PH in cotton. The genetic variations and candidate genes identified in this study lay a foundation
Directory of Open Access Journals (Sweden)
Sehgal Deepmala
2012-01-01
Full Text Available Abstract Background Identification of genes underlying drought tolerance (DT quantitative trait loci (QTLs will facilitate understanding of molecular mechanisms of drought tolerance, and also will accelerate genetic improvement of pearl millet through marker-assisted selection. We report a map based on genes with assigned functional roles in plant adaptation to drought and other abiotic stresses and demonstrate its use in identifying candidate genes underlying a major DT-QTL. Results Seventy five single nucleotide polymorphism (SNP and conserved intron spanning primer (CISP markers were developed from available expressed sequence tags (ESTs using four genotypes, H 77/833-2, PRLT 2/89-33, ICMR 01029 and ICMR 01004, representing parents of two mapping populations. A total of 228 SNPs were obtained from 30.5 kb sequenced region resulting in a SNP frequency of 1/134 bp. The positions of major pearl millet linkage group (LG 2 DT-QTLs (reported from crosses H 77/833-2 × PRLT 2/89-33 and 841B × 863B were added to the present consensus function map which identified 18 genes, coding for PSI reaction center subunit III, PHYC, actin, alanine glyoxylate aminotransferase, uridylate kinase, acyl-CoA oxidase, dipeptidyl peptidase IV, MADS-box, serine/threonine protein kinase, ubiquitin conjugating enzyme, zinc finger C- × 8-C × 5-C × 3-H type, Hd3, acetyl CoA carboxylase, chlorophyll a/b binding protein, photolyase, protein phosphatase1 regulatory subunit SDS22 and two hypothetical proteins, co-mapping in this DT-QTL interval. Many of these candidate genes were found to have significant association with QTLs of grain yield, flowering time and leaf rolling under drought stress conditions. Conclusions We have exploited available pearl millet EST sequences to generate a mapped resource of seventy five new gene-based markers for pearl millet and demonstrated its use in identifying candidate genes underlying a major DT-QTL in this species. The reported gene
Liu, Bin; Jin, Min; Zeng, Pan
2015-10-01
The identification of gene-phenotype relationships is very important for the treatment of human diseases. Studies have shown that genes causing the same or similar phenotypes tend to interact with each other in a protein-protein interaction (PPI) network. Thus, many identification methods based on the PPI network model have achieved good results. However, in the PPI network, some interactions between the proteins encoded by candidate gene and the proteins encoded by known disease genes are very weak. Therefore, some studies have combined the PPI network with other genomic information and reported good predictive performances. However, we believe that the results could be further improved. In this paper, we propose a new method that uses the semantic similarity between the candidate gene and known disease genes to set the initial probability vector of a random walk with a restart algorithm in a human PPI network. The effectiveness of our method was demonstrated by leave-one-out cross-validation, and the experimental results indicated that our method outperformed other methods. Additionally, our method can predict new causative genes of multifactor diseases, including Parkinson's disease, breast cancer and obesity. The top predictions were good and consistent with the findings in the literature, which further illustrates the effectiveness of our method. Copyright © 2015 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
David Jean-Philippe
2009-11-01
Full Text Available Abstract Background Genome scans are becoming an increasingly popular approach to study the genetic basis of adaptation and speciation, but on their own, they are often helpless at identifying the specific gene(s or mutation(s targeted by selection. This shortcoming is hopefully bound to disappear in the near future, thanks to the wealth of new genomic resources that are currently being developed for many species. In this article, we provide a foretaste of this exciting new era by conducting a genome scan in the mosquito Aedes aegypti with the aim to look for candidate genes involved in resistance to Bacillus thuringiensis subsp. israelensis (Bti insecticidal toxins. Results The genome of a Bti-resistant and a Bti-susceptible strains was surveyed using about 500 MITE-based molecular markers, and the loci showing the highest inter-strain genetic differentiation were sequenced and mapped on the Aedes aegypti genome sequence. Several good candidate genes for Bti-resistance were identified in the vicinity of these highly differentiated markers. Two of them, coding for a cadherin and a leucine aminopeptidase, were further examined at the sequence and gene expression levels. In the resistant strain, the cadherin gene displayed patterns of nucleotide polymorphisms consistent with the action of positive selection (e.g. an excess of high compared to intermediate frequency mutations, as well as a significant under-expression compared to the susceptible strain. Conclusion Both sequence and gene expression analyses agree to suggest a role for positive selection in the evolution of this cadherin gene in the resistant strain. However, it is unlikely that resistance to Bti is conferred by this gene alone, and further investigation will be needed to characterize other genes significantly associated with Bti resistance in Ae. aegypti. Beyond these results, this article illustrates how genome scans can build on the body of new genomic information (here, full
Genomic dissection and prioritizing of candidate genes of QTL for ...
Indian Academy of Sciences (India)
Genomic dissection and prioritizing of candidate genes of QTL for regulating spontaneous arthritis on chromosome 1 in mice deficient for interleukin-1 receptor antagonist. Yanhong Cao, Jifei Zhang, Yan Jiao, Jian Yan, Feng Jiao, XiaoYun Liu, Robert W. Williams, Karen A. Hasty,. John M. Stuart and Weikuan Gu. J. Genet.
Mariette, Stéphanie; Wong Jun Tai, Fabienne; Roch, Guillaume; Barre, Aurélien; Chague, Aurélie; Decroocq, Stéphane; Groppi, Alexis; Laizet, Yec'han; Lambert, Patrick; Tricon, David; Nikolski, Macha; Audergon, Jean-Marc; Abbott, Albert G; Decroocq, Véronique
2016-01-01
In fruit tree species, many important traits have been characterized genetically by using single-family descent mapping in progenies segregating for the traits. However, most mapped loci have not been sufficiently resolved to the individual genes due to insufficient progeny sizes for high resolution mapping and the previous lack of whole-genome sequence resources of the study species. To address this problem for Plum Pox Virus (PPV) candidate resistance gene identification in Prunus species, we implemented a genome-wide association (GWA) approach in apricot. This study exploited the broad genetic diversity of the apricot (Prunus armeniaca) germplasm containing resistance to PPV, next-generation sequence-based genotyping, and the high-quality peach (Prunus persica) genome reference sequence for single nucleotide polymorphism (SNP) identification. The results of this GWA study validated previously reported PPV resistance quantitative trait loci (QTL) intervals, highlighted other potential resistance loci, and resolved each to a limited set of candidate genes for further study. This work substantiates the association genetics approach for resolution of QTL to candidate genes in apricot and suggests that this approach could simplify identification of other candidate genes for other marked trait intervals in this germplasm. © 2015 INRA, UMR 1332 BFP New Phytologist © 2015 New Phytologist Trust.
Chini, Vasiliki; Stambouli, Danai; Nedelea, Florina Mihaela; Filipescu, George Alexandru; Mina, Diana; Kambouris, Marios; El-Shantil, Hatem
2014-06-01
Prenatal diagnosis was requested for an undiagnosed eye disease showing X-linked inheritance in a family. No medical records existed for the affected family members. Mapping of the X chromosome and candidate gene mutation screening identified a c.C267A[p.F89L] mutation in NPD previously described as possibly causing Norrie disease. The detection of the c.C267A[p.F89L] variant in another unrelated family confirms the pathogenic nature of the mutation for the Norrie disease phenotype. Gene mapping, haplotype analysis, and candidate gene screening have been previously utilized in research applications but were applied here in a diagnostic setting due to the scarcity of available clinical information. The clinical diagnosis and mutation identification were critical for providing proper genetic counseling and prenatal diagnosis for this family.
Faba bean drought responsive gene identification and validation
Directory of Open Access Journals (Sweden)
Megahed H. Ammar
2017-01-01
Full Text Available This study was carried out to identify drought-responsive genes in a drought tolerant faba bean variety (Hassawi 2 using a suppressive subtraction hybridization approach (SSH. A total of 913 differentially expressed clones were sequenced from a differential cDNA library that resulted in a total of 225 differentially expressed ESTs. The genes of mitochondrial and chloroplast origin were removed, and the remaining 137 EST sequences were submitted to the gene bank EST database (LIBEST_028448. A sequence analysis identified 35 potentially drought stress-related ESTs that regulate ion channels, kinases, and energy production and utilization and transcription factors. Quantitative PCR on Hassawi 2 genotype confirmed that more than 65% of selected drought-responsive genes were drought-related. Among these induced genes, the expression levels of eight highly up-regulated unigenes were further analyzed across 38 selected faba bean genotypes that differ in their drought tolerance levels. These unigenes included ribulose 1,5-bisphosphate carboxylase (rbcL gene, non-LTR retroelement reverse related, probable cyclic nucleotide-gated ion channel, polyubiquitin, potassium channel, calcium-dependent protein kinase and putative respiratory burst oxidase-like protein C and a novel unigene. The expression patterns of these unigenes were variable across 38 genotypes however, it was found to be very high in tolerant genotype. The up-regulation of these unigenes in majority of tolerant genotypes suggests their possible role in drought tolerance. The identification of possible drought responsive candidate genes in Vicia faba reported here is an important step toward the development of drought-tolerant genotypes that can cope with arid environments.
Validation of candidate genes associated with cardiovascular risk factors in psychiatric patients
Windemuth, Andreas; de Leon, Jose; Goethe, John W.; Schwartz, Harold I.; Woolley, Stephen; Susce, Margaret; Kocherla, Mohan; Bogaard, Kali; Holford, Theodore R.; Seip, Richard L.; Ruaño, Gualberto
2016-01-01
The purpose of this study was to identify genetic variants predictive of cardiovascular risk factors in a psychiatric population treated with second generation antipsychotics (SGA). 924 patients undergoing treatment for severe mental illness at four US hospitals were genotyped at 1.2 million single nucleotide polymorphisms. Patients were assessed for fasting serum lipid (low density lipoprotein cholesterol [LDLc], high density lipoprotein cholesterol [HDLc], and triglycerides) and obesity phenotypes (body mass index, BMI). Thirteen candidate genes from previous studies of the same phenotypes in non-psychiatric populations were tested for association. We confirmed 8 of the 13 candidate genes at the 95% confidence level. An increased genetic effect size was observed for triglycerides in the psychiatric population compared to that in the cardiovascular population. PMID:21851846
Arun, Alok; Bauml?, V?ronique; Amelot, Ga?l; Nieberding, Caroline M.
2015-01-01
Real-time quantitative reverse transcription PCR (qRT-PCR) is a technique widely used to quantify the transcriptional expression level of candidate genes. qRT-PCR requires the selection of one or several suitable reference genes, whose expression profiles remain stable across conditions, to normalize the qRT-PCR expression profiles of candidate genes. Although several butterfly species (Lepidoptera) have become important models in molecular evolutionary ecology, so far no study aimed at ident...
Integrated database for identifying candidate genes for Aspergillus flavus resistance in maize.
Kelley, Rowena Y; Gresham, Cathy; Harper, Jonathan; Bridges, Susan M; Warburton, Marilyn L; Hawkins, Leigh K; Pechanova, Olga; Peethambaran, Bela; Pechan, Tibor; Luthe, Dawn S; Mylroie, J E; Ankala, Arunkanth; Ozkan, Seval; Henry, W B; Williams, W P
2010-10-07
Aspergillus flavus Link:Fr, an opportunistic fungus that produces aflatoxin, is pathogenic to maize and other oilseed crops. Aflatoxin is a potent carcinogen, and its presence markedly reduces the value of grain. Understanding and enhancing host resistance to A. flavus infection and/or subsequent aflatoxin accumulation is generally considered an efficient means of reducing grain losses to aflatoxin. Different proteomic, genomic and genetic studies of maize (Zea mays L.) have generated large data sets with the goal of identifying genes responsible for conferring resistance to A. flavus, or aflatoxin. In order to maximize the usage of different data sets in new studies, including association mapping, we have constructed a relational database with web interface integrating the results of gene expression, proteomic (both gel-based and shotgun), Quantitative Trait Loci (QTL) genetic mapping studies, and sequence data from the literature to facilitate selection of candidate genes for continued investigation. The Corn Fungal Resistance Associated Sequences Database (CFRAS-DB) (http://agbase.msstate.edu/) was created with the main goal of identifying genes important to aflatoxin resistance. CFRAS-DB is implemented using MySQL as the relational database management system running on a Linux server, using an Apache web server, and Perl CGI scripts as the web interface. The database and the associated web-based interface allow researchers to examine many lines of evidence (e.g. microarray, proteomics, QTL studies, SNP data) to assess the potential role of a gene or group of genes in the response of different maize lines to A. flavus infection and subsequent production of aflatoxin by the fungus. CFRAS-DB provides the first opportunity to integrate data pertaining to the problem of A. flavus and aflatoxin resistance in maize in one resource and to support queries across different datasets. The web-based interface gives researchers different query options for mining the database
Integrated bioinformatics analysis reveals key candidate genes and pathways in breast cancer.
Wang, Yuzhi; Zhang, Yi; Huang, Qian; Li, Chengwen
2018-04-19
Breast cancer (BC) is the leading malignancy in women worldwide, yet relatively little is known about the genes and signaling pathways involved in BC tumorigenesis and progression. The present study aimed to elucidate potential key candidate genes and pathways in BC. Five gene expression profile data sets (GSE22035, GSE3744, GSE5764, GSE21422 and GSE26910) were downloaded from the Gene Expression Omnibus (GEO) database, which included data from 113 tumorous and 38 adjacent non‑tumorous tissue samples. Differentially expressed genes (DEGs) were identified using t‑tests in the limma R package. These DEGs were subsequently investigated by pathway enrichment analysis and a protein‑protein interaction (PPI) network was constructed. The most significant module from the PPI network was selected for pathway enrichment analysis. In total, 227 DEGs were identified, of which 82 were upregulated and 145 were downregulated. Pathway enrichment analysis results revealed that the upregulated DEGs were mainly enriched in 'cell division', the 'proteinaceous extracellular matrix (ECM)', 'ECM structural constituents' and 'ECM‑receptor interaction', whereas downregulated genes were mainly enriched in 'response to drugs', 'extracellular space', 'transcriptional activator activity' and the 'peroxisome proliferator‑activated receptor signaling pathway'. The PPI network contained 174 nodes and 1,257 edges. DNA topoisomerase 2‑a, baculoviral inhibitor of apoptosis repeat‑containing protein 5, cyclin‑dependent kinase 1, G2/mitotic‑specific cyclin‑B1 and kinetochore protein NDC80 homolog were identified as the top 5 hub genes. Furthermore, the genes in the most significant module were predominantly involved in 'mitotic nuclear division', 'mid‑body', 'protein binding' and 'cell cycle'. In conclusion, the DEGs, relative pathways and hub genes identified in the present study may aid in understanding of the molecular mechanisms underlying BC progression and provide
Directory of Open Access Journals (Sweden)
David G Ashbrook
2015-07-01
Full Text Available Bipolar disorder (BD is a significant neuropsychiatric disorder with a lifetime prevalence of ~1%. To identify genetic variants underlying BD genome-wide association studies (GWAS have been carried out. While many variants of small effect associated with BD have been identified few have yet been confirmed, partly because of the low power of GWAS due to multiple comparisons being made. Complementary mapping studies using murine models have identified genetic variants for behavioral traits linked to BD, often with high power, but these identified regions often contain too many genes for clear identification of candidate genes. In the current study we have aligned human BD GWAS results and mouse linkage studies to help define and evaluate candidate genes linked to BD, seeking to use the power of the mouse mapping with the precision of GWAS. We use quantitative trait mapping for open field test and elevated zero maze data in the largest mammalian model system, the BXD recombinant inbred mouse population, to identify genomic regions associated with these BD-like phenotypes. We then investigate these regions in whole genome data from the Psychiatric Genomics Consortium’s bipolar disorder GWAS to identify candidate genes associated with BD. Finally we establish the biological relevance and pathways of these genes in a comprehensive systems genetics analysis.We identify four genes associated with both mouse anxiety and human BD. While TNR is a novel candidate for BD, we can confirm previously suggested associations with CMYA5, MCTP1 and RXRG. A cross-species, systems genetics analysis shows that MCTP1, RXRG and TNR coexpress with genes linked to psychiatric disorders and identify the striatum as a potential site of action. CMYA5, MCTP1, RXRG and TNR are associated with mouse anxiety and human BD. We hypothesize that MCTP1, RXRG and TNR influence intercellular signaling in the striatum.
Natural Genetic Variation and Candidate Genes for Morphological Traits in Drosophila melanogaster
Carreira, Valeria Paula; Mensch, Julián; Hasson, Esteban; Fanara, Juan José
2016-01-01
Body size is a complex character associated to several fitness related traits that vary within and between species as a consequence of environmental and genetic factors. Latitudinal and altitudinal clines for different morphological traits have been described in several species of Drosophila and previous work identified genomic regions associated with such variation in D. melanogaster. However, the genetic factors that orchestrate morphological variation have been barely studied. Here, our main objective was to investigate genetic variation for different morphological traits associated to the second chromosome in natural populations of D. melanogaster along latitudinal and altitudinal gradients in Argentina. Our results revealed weak clinal signals and a strong population effect on morphological variation. Moreover, most pairwise comparisons between populations were significant. Our study also showed important within-population genetic variation, which must be associated to the second chromosome, as the lines are otherwise genetically identical. Next, we examined the contribution of different candidate genes to natural variation for these traits. We performed quantitative complementation tests using a battery of lines bearing mutated alleles at candidate genes located in the second chromosome and six second chromosome substitution lines derived from natural populations which exhibited divergent phenotypes. Results of complementation tests revealed that natural variation at all candidate genes studied, invected, Fasciclin 3, toucan, Reticulon-like1, jing and CG14478, affects the studied characters, suggesting that they are Quantitative Trait Genes for morphological traits. Finally, the phenotypic patterns observed suggest that different alleles of each gene might contribute to natural variation for morphological traits. However, non-additive effects cannot be ruled out, as wild-derived strains differ at myriads of second chromosome loci that may interact
Candidate genes expressed in human islets and their role in the pathogenesis of type 1 diabetes
DEFF Research Database (Denmark)
Storling, Joachim; Brorsson, Caroline Anna
2013-01-01
In type 1 diabetes (T1D), the insulin-producing β cells are destroyed by an immune-mediated process leading to complete insulin deficiency. There is a strong genetic component in T1D. Genes located in the human leukocyte antigen (HLA) region are the most important genetic determinants of disease......, but more than 40 additional loci are known to significantly affect T1D risk. Since most of the currently known genetic candidates have annotated immune cell functions, it is generally considered that most of the genetic susceptibility in T1D is caused by variation in genes affecting immune cell function....... Recent studies, however, indicate that most T1D candidate genes are expressed in human islets suggesting that the functions of the genes are not restricted to immune cells, but also play roles in the islets and possibly the β cells. Several candidates change expression levels within the islets following...
Zhang, Q; Baldwin, V J; Acland, G M; Parshall, C J; Haskel, J; Aguirre, G D; Ray, K
1999-01-01
Photoreceptor dysplasia (pd) is one of a group of at least six distinct autosomal and one X-linked retinal disorders identified in dogs which are collectively known as progressive retinal atrophy (PRA). It is an early onset retinal disease identified in miniature schnauzer dogs, and pedigree analysis and breeding studies have established autosomal recessive inheritance of the disease. Using a gene-based approach, a number of retina-expressed genes, including some members of the phototransduction pathway, have been causally implicated in retinal diseases of humans and other animals. Here we examined seven such potential candidate genes (opsin, RDS/peripherin, ROM1, rod cGMP-gated cation channel alpha-subunit, and three subunits of transducin) for their causal association with the pd locus by testing segregation of intragenic markers with the disease locus, or, in the absence of informative polymorphisms, sequencing of the coding regions of the genes. Based on these results, we have conclusively excluded four photoreceptor-specific genes as candidates for pd by linkage analysis. For three other photoreceptor-specific genes, we did not find any mutation in the coding sequences of the genes and have excluded them provisionally. Formal exclusion would require investigation of the levels of expression of the candidate genes in pd-affected dogs relative to age-matched controls. At present we are building suitable informative pedigrees for the disease locus with a sufficient number of meiosis to be useful for genomewide screening. This should identify markers linked to the disease locus and eventually permit progress toward the identification of the photoreceptor dysplasia gene and the disease-causing mutation.
Motamayor, Juan C; Mockaitis, Keithanne; Schmutz, Jeremy; Haiminen, Niina; Livingstone, Donald; Cornejo, Omar; Findley, Seth D; Zheng, Ping; Utro, Filippo; Royaert, Stefan; Saski, Christopher; Jenkins, Jerry; Podicheti, Ram; Zhao, Meixia; Scheffler, Brian E; Stack, Joseph C; Feltus, Frank A; Mustiga, Guiliana M; Amores, Freddy; Phillips, Wilbert; Marelli, Jean Philippe; May, Gregory D; Shapiro, Howard; Ma, Jianxin; Bustamante, Carlos D; Schnell, Raymond J; Main, Dorrie; Gilbert, Don; Parida, Laxmi; Kuhn, David N
2013-06-03
Theobroma cacao L. cultivar Matina 1-6 belongs to the most cultivated cacao type. The availability of its genome sequence and methods for identifying genes responsible for important cacao traits will aid cacao researchers and breeders. We describe the sequencing and assembly of the genome of Theobroma cacao L. cultivar Matina 1-6. The genome of the Matina 1-6 cultivar is 445 Mbp, which is significantly larger than a sequenced Criollo cultivar, and more typical of other cultivars. The chromosome-scale assembly, version 1.1, contains 711 scaffolds covering 346.0 Mbp, with a contig N50 of 84.4 kbp, a scaffold N50 of 34.4 Mbp, and an evidence-based gene set of 29,408 loci. Version 1.1 has 10x the scaffold N50 and 4x the contig N50 as Criollo, and includes 111 Mb more anchored sequence. The version 1.1 assembly has 4.4% gap sequence, while Criollo has 10.9%. Through a combination of haplotype, association mapping and gene expression analyses, we leverage this robust reference genome to identify a promising candidate gene responsible for pod color variation. We demonstrate that green/red pod color in cacao is likely regulated by the R2R3 MYB transcription factor TcMYB113, homologs of which determine pigmentation in Rosaceae, Solanaceae, and Brassicaceae. One SNP within the target site for a highly conserved trans-acting siRNA in dicots, found within TcMYB113, seems to affect transcript levels of this gene and therefore pod color variation. We report a high-quality sequence and annotation of Theobroma cacao L. and demonstrate its utility in identifying candidate genes regulating traits.
Expression studies of the obesity candidate gene FTO in pig
DEFF Research Database (Denmark)
Madsen, Majbritt Busk; Birck, Malene Muusfeldt; Fredholm, Merete
2010-01-01
Obesity is an increasing problem worldwide and research on candidate genes in good animal models is highly needed. The pig is an excellent model as its metabolism, organ size, and eating habits resemble that of humans. The present study is focused on the characterization of the fat mass and obesity...... associated gene (FTO) in pig. This gene has recently been associated with increased body mass index in several human populations. To establish information on the expression profile of FTO in the pig we performed quantitative PCR in a panel of adult pig tissues and in tissues sampled at different...... and cerebellum). Additionally, in order to see the involvement of the FTO gene in obesity, the changes in expression level were investigated in a nutritional study in brain of Gottingen minipigs under a high cholesterol diet. Significantly higher (P
Candidate gene association analyses for ketosis resistance in Holsteins.
Kroezen, V; Schenkel, F S; Miglior, F; Baes, C F; Squires, E J
2018-06-01
High-yielding dairy cattle are susceptible to ketosis, a metabolic disease that negatively affects the health, fertility, and milk production of the cow. Interest in breeding for more robust dairy cattle with improved resistance to disease is global; however, genetic evaluations for ketosis would benefit from the additional information provided by genetic markers. Candidate genes that are proposed to have a biological role in the pathogenesis of ketosis were investigated in silico and a custom panel of 998 putative single nucleotide polymorphism (SNP) markers was developed. The objective of this study was to test the associations of these new markers with deregressed estimated breeding values (EBV) for ketosis. A sample of 653 Canadian Holstein cows that had been previously genotyped with a medium-density SNP chip were regenotyped with the custom panel. The EBV for ketosis in first and later lactations were obtained for each animal and deregressed for use as pseudo-phenotypes for association analyses. Results of the mixed inheritance model for single SNP association analyses suggested 15 markers in 6 unique candidate genes were associated with the studied trait. Genes encoding proteins involved in metabolic processes, including the synthesis and degradation of fatty acids and ketone bodies, gluconeogenesis, lipid mobilization, and the citric acid cycle, were identified to contain SNP associated with ketosis resistance. This work confirmed the presence of previously described quantitative trait loci for dairy cattle, suggested novel markers for ketosis-resistance, and provided insight into the underlying biology of this disease. Copyright © 2018 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Ruby Chandna
Full Text Available The real time quantitative reverse transcription PCR (qRT-PCR is becoming increasingly important to gain insight into function of genes. Given the increased sensitivity, ease and reproducibility of qRT-PCR, the requirement of suitable reference genes for normalization has become important and stringent. It is now known that the expression of internal control genes in living organism vary considerably during developmental stages and under different experimental conditions. For economically important Brassica crops, only a couple of reference genes are reported till date. In this study, expression stability of 12 candidate reference genes including ACT2, ELFA, GAPDH, TUA, UBQ9 (traditional housekeeping genes, ACP, CAC, SNF, TIPS-41, TMD, TSB and ZNF (new candidate reference genes, in a diverse set of 49 tissue samples representing different developmental stages, stress and hormone treated conditions and cultivars of Brassica juncea has been validated. For the normalization of vegetative stages the ELFA, ACT2, CAC and TIPS-41 combination would be appropriate whereas TIPS-41 along with CAC would be suitable for normalization of reproductive stages. A combination of GAPDH, TUA, TIPS-41 and CAC were identified as the most suitable reference genes for total developmental stages. In various stress and hormone treated samples, UBQ9 and TIPS-41 had the most stable expression. Across five cultivars of B. juncea, the expression of CAC and TIPS-41 did not vary significantly and were identified as the most stably expressed reference genes. This study provides comprehensive information that the new reference genes selected herein performed better than the traditional housekeeping genes. The selection of most suitable reference genes depends on the experimental conditions, and is tissue and cultivar-specific. Further, to attain accuracy in the results more than one reference genes are necessary for normalization.
Characterization of Gene Candidates for Vacuolar Sodium Transport from Hordeum Vulgare
Scheu, Arne Hagen August
2017-01-01
Various potential causes are discussed, including inaccuracies in the genome resource used as reference for primer design and issues inherent to the model system. Finally, I make suggestions on how to proceed to further characterize the candidate genes and hopefully identify novel sodium transporters from barley.
Resolving candidate genes of mouse skeletal muscle QTL via RNA-Seq and expression network analyses
Directory of Open Access Journals (Sweden)
Lionikas Arimantas
2012-11-01
Full Text Available Abstract Background We have recently identified a number of Quantitative Trait Loci (QTL contributing to the 2-fold muscle weight difference between the LG/J and SM/J mouse strains and refined their confidence intervals. To facilitate nomination of the candidate genes responsible for these differences we examined the transcriptome of the tibialis anterior (TA muscle of each strain by RNA-Seq. Results 13,726 genes were expressed in mouse skeletal muscle. Intersection of a set of 1061 differentially expressed transcripts with a mouse muscle Bayesian Network identified a coherent set of differentially expressed genes that we term the LG/J and SM/J Regulatory Network (LSRN. The integration of the QTL, transcriptome and the network analyses identified eight key drivers of the LSRN (Kdr, Plbd1, Mgp, Fah, Prss23, 2310014F06Rik, Grtp1, Stk10 residing within five QTL regions, which were either polymorphic or differentially expressed between the two strains and are strong candidates for quantitative trait genes (QTGs underlying muscle mass. The insight gained from network analysis including the ability to make testable predictions is illustrated by annotating the LSRN with knowledge-based signatures and showing that the SM/J state of the network corresponds to a more oxidative state. We validated this prediction by NADH tetrazolium reductase staining in the TA muscle revealing higher oxidative potential of the SM/J compared to the LG/J strain (p Conclusion Thus, integration of fine resolution QTL mapping, RNA-Seq transcriptome information and mouse muscle Bayesian Network analysis provides a novel and unbiased strategy for nomination of muscle QTGs.
Peñagaricano, Francisco; Zorrilla, Pilar; Naya, Hugo; Robello, Carlos; Urioste, Jorge I
2012-02-01
The white coat colour of sheep is an important economic trait. For unknown reasons, some animals are born with, and others develop with time, black skin spots that can also produce pigmented fibres. The presence of pigmented fibres in the white wool significantly decreases the fibre quality. The aim of this work was to study gene expression in black spots (with and without pigmented fibres) and white skin by microarray techniques, in order to identify the possible genes involved in the development of this trait. Five unrelated Corriedale sheep were used and, for each animal, the three possible comparisons (three different hybridisations) between the three samples of interest were performed. Differential gene expression patterns were analysed using different t-test approaches. Most of the major genes with well-known roles in skin pigmentation, e.g. ASIP, MC1R and C-KIT, showed no significant difference in the gene expression between white skin and black spots. On the other hand, many of the differentially expressed genes (raw P-value spots. The gene expression of C-FOS and KLF4, transcription factors involved in the cellular response to external factors such as ultraviolet light, was validated by quantitative polymerase chain reaction (PCR). This exploratory study provides a list of candidate genes that could be associated with the development of black skin spots that should be studied in more detail. Characterisation of these genes will enable us to discern the molecular mechanisms involved in the development of this feature and, hence, increase our understanding of melanocyte biology and skin pigmentation. In sheep, understanding this phenomenon is a first step towards developing molecular tools to assist in the selection against the presence of pigmented fibres in white wool.
Epidermal growth factor gene is a newly identified candidate gene for gout.
Han, Lin; Cao, Chunwei; Jia, Zhaotong; Liu, Shiguo; Liu, Zhen; Xin, Ruosai; Wang, Can; Li, Xinde; Ren, Wei; Wang, Xuefeng; Li, Changgui
2016-08-10
Chromosome 4q25 has been identified as a genomic region associated with gout. However, the associations of gout with the genes in this region have not yet been confirmed. Here, we performed two-stage analysis to determine whether variations in candidate genes in the 4q25 region are associated with gout in a male Chinese Han population. We first evaluated 96 tag single nucleotide polymorphisms (SNPs) in eight inflammatory/immune pathway- or glucose/lipid metabolism-related genes in the 4q25 region in 480 male gout patients and 480 controls. The SNP rs12504538, located in the elongation of very-long-chain-fatty-acid-like family member 6 gene (Elovl6), was found to be associated with gout susceptibility (Padjusted = 0.00595). In the second stage of analysis, we performed fine mapping analysis of 93 tag SNPs in Elovl6 and in the epidermal growth factor gene (EGF) and its flanking regions in 1017 male patients gout and 1897 healthy male controls. We observed a significant association between the T allele of EGF rs2298999 and gout (odds ratio = 0.77, 95% confidence interval = 0.67-0.88, Padjusted = 6.42 × 10(-3)). These results provide the first evidence for an association between the EGF rs2298999 C/T polymorphism and gout. Our findings should be validated in additional populations.
Schmouth, Jean-François; Arenillas, David; Corso-Díaz, Ximena; Xie, Yuan-Yun; Bohacec, Slavita; Banks, Kathleen G; Bonaguro, Russell J; Wong, Siaw H; Jones, Steven J M; Marra, Marco A; Simpson, Elizabeth M; Wasserman, Wyeth W
2015-07-24
Nr2e1 (nuclear receptor subfamily 2, group e, member 1) encodes a transcription factor important in neocortex development. Previous work has shown that nuclear receptors can have hundreds of target genes, and bind more than 300 co-interacting proteins. However, recognition of the critical role of Nr2e1 in neural stem cells and neocortex development is relatively recent, thus the molecular mechanisms involved for this nuclear receptor are only beginning to be understood. Serial analysis of gene expression (SAGE), has given researchers both qualitative and quantitative information pertaining to biological processes. Thus, in this work, six LongSAGE mouse libraries were generated from laser microdissected tissue samples of dorsal VZ/SVZ (ventricular zone and subventricular zone) from the telencephalon of wild-type (Wt) and Nr2e1-null embryos at the critical development ages E13.5, E15.5, and E17.5. We then used a novel approach, implementing multiple computational methods followed by biological validation to further our understanding of Nr2e1 in neocortex development. In this work, we have generated a list of 1279 genes that are differentially expressed in response to altered Nr2e1 expression during in vivo neocortex development. We have refined this list to 64 candidate direct-targets of NR2E1. Our data suggested distinct roles for Nr2e1 during different neocortex developmental stages. Most importantly, our results suggest a possible novel pathway by which Nr2e1 regulates neurogenesis, which includes Lhx2 as one of the candidate direct-target genes, and SOX9 as a co-interactor. In conclusion, we have provided new candidate interacting partners and numerous well-developed testable hypotheses for understanding the pathways by which Nr2e1 functions to regulate neocortex development.
Directory of Open Access Journals (Sweden)
Saba Garshasbi
2015-10-01
Full Text Available Background: Cancer and obesity are two major public health concerns. More than 12 million cases of cancer are reported annually. Many reports confirmed obesity as a risk factor for cancer. The molecular relationship between obesity and breast cancer has not been clear yet. The purpose of this study was to investigate priorities of effective genes in the molecular relationship between obesity and breast cancer. Methods: In this study, computer simulation method was used for prioritizing the genes that involved in the molecular links between obesity and breast cancer in laboratory of systems biology and bioinformatics (LBB, Tehran University, Tehran, Iran, from March to July 2014. In this study, ENDEAVOUR software was used for prioritizing the genes and integrating multiple data sources was used for data analysis. Training genes were selected from effective genes in obesity and/or breast cancer. Two groups of candidate genes were selected. The first group was included the existential genes in 5 common region chromosomes (between obesity and breast cancer and the second group was included the results of genes microarray data analysis of research Creighton, et al (In 2012 on patients with breast cancer. The microarray data were analyzed with GER2 software (R online software on GEO website. Finally, both training and candidate genes were entered in ENDEAVOUR software package. Results: The candidate genes were prioritized to four style and five genes in ten of the first priorities were repeated twice. In other word, the outcome of prioritizing of 72 genes (Product of microarray data analysis and genes of 5 common chromosome regions (Between obesity and breast cancer showed, 5 genes (TNFRSF10B, F2, IGFALS, NTRK3 and HSP90B1 were the priorities in the molecular connection between obesity and breast cancer. Conclusion: There are some common genes between breast cancer and obesity. So, molecular relationship is confirmed. In this study the possible effect
Directory of Open Access Journals (Sweden)
Sandra M Mathioni
Full Text Available Plants and animals have evolved a first line of defense response to pathogens called innate or basal immunity. While basal defenses in these organisms are well studied, there is almost a complete lack of understanding of such systems in fungal species, and more specifically, how they are able to detect and mount a defense response upon pathogen attack. Hence, the goal of the present study was to understand how fungi respond to biotic stress by assessing the transcriptional profile of the rice blast pathogen, Magnaporthe oryzae, when challenged with the bacterial antagonist Lysobacter enzymogenes. Based on microscopic observations of interactions between M. oryzae and wild-type L. enzymogenes strain C3, we selected early and intermediate stages represented by time-points of 3 and 9 hours post-inoculation, respectively, to evaluate the fungal transcriptome using RNA-seq. For comparative purposes, we also challenged the fungus with L. enzymogenes mutant strain DCA, previously demonstrated to be devoid of antifungal activity. A comparison of transcriptional data from fungal interactions with the wild-type bacterial strain C3 and the mutant strain DCA revealed 463 fungal genes that were down-regulated during attack by C3; of these genes, 100 were also found to be up-regulated during the interaction with DCA. Functional categorization of genes in this suite included those with roles in carbohydrate metabolism, cellular transport and stress response. One gene in this suite belongs to the CFEM-domain class of fungal proteins. Another CFEM class protein called PTH11 has been previously characterized, and we found that a deletion in this gene caused advanced lesion development by C3 compared to its growth on the wild-type fungus. We discuss the characterization of this suite of 100 genes with respect to their role in the fungal defense response.
Rankinen, Tuomo; Rice, Treva; Boudreau, Anik; Leon, Arthur S; Skinner, James S; Wilmore, Jack H; Rao, D C; Bouchard, Claude
2003-09-29
A genome-wide linkage scan for endurance training-induced changes in submaximal exercise stroke volume (DeltaSV50) in the HERITAGE Family Study revealed two chromosomal regions (2q31-q32 and 10p11.2) with at least suggestive evidence of linkage among white families. Here we report a further characterization of the quantitative trait locus (QTL) in chromosome 2q31 and provide evidence that titin (TTN) is likely a candidate gene involved. The original linkage was detected with two markers (D2S335 and D2S1391), and the QTL covered approximately 25 million base pairs (Mb). We added 12 microsatellite markers resulting in an average marker density of one marker per 2.3 Mb. The evidence of linkage increased from P = 0.006 to P = 0.0002 and 0.00002 in the multi- and single-point analyses, respectively. The strongest evidence of linkage was seen with two markers in and near the TTN gene. Transmission/disequilibrium test (TDT) with the same marker set provided evidence for association with one of the TTN markers (D2S385; P = 0.004). TTN is a major contributor to the elasticity of cardiomyocytes and a key regulator of the Frank-Starling mechanism. Since TTN is the largest gene in the human genome, the challenge is to identify the DNA sequence variants contributing to the interindividual differences in cardiac adaptation to endurance training.
Ayadi, M; Hanana, M; Kharrat, N; Merchaoui, H; Marzoug, R Ben; Lauvergeat, V; Rebaï, A; Mzid, R
2016-10-01
WRKY transcription factors belong to a large family of plant transcriptional regulators whose members have been reported to be involved in a wide range of biological roles including plant development, adaptation to environmental constraints and response to several diseases. However, little or poor information is available about WRKY's in Citrus. The recent release of completely assembled genomes sequences of Citrus sinensis and Citrus clementina and the availability of ESTs sequences from other citrus species allowed us to perform a genome survey for Citrus WRKY proteins. In the present study, we identified 100 WRKY members from C. sinensis (51), C. clementina (48) and Citrus unshiu (1), and analyzed their chromosomal distribution, gene structure, gene duplication, syntenic relation and phylogenetic analysis. A phylogenetic tree of 100 Citrus WRKY sequences with their orthologs from Arabidopsis has distinguished seven groups. The CsWRKY genes were distributed across all ten sweet orange chromosomes. A comprehensive approach and an integrative analysis of Citrus WRKY gene expression revealed variable profiles of expression within tissues and stress conditions indicating functional diversification. Thus, candidate Citrus WRKY genes have been proposed as potentially involved in fruit acidification, essential oil biosynthesis and abiotic/biotic stress tolerance. Our results provided essential prerequisites for further WRKY genes cloning and functional analysis with an aim of citrus crop improvement.
Candidate gene linkage approach to identify DNA variants that predispose to preterm birth
DEFF Research Database (Denmark)
Bream, Elise N A; Leppellere, Cara R; Cooper, Margaret E
2013-01-01
Background:The aim of this study was to identify genetic variants contributing to preterm birth (PTB) using a linkage candidate gene approach.Methods:We studied 99 single-nucleotide polymorphisms (SNPs) for 33 genes in 257 families with PTBs segregating. Nonparametric and parametric analyses were...... through the infant and/or the mother in the etiology of PTB....
Case-control study of candidate gene methylation and adenomatous polyp formation.
Alexander, M; Burch, J B; Steck, S E; Chen, C-F; Hurley, T G; Cavicchia, P; Shivappa, N; Guess, J; Zhang, H; Youngstedt, S D; Creek, K E; Lloyd, S; Jones, K; Hébert, J R
2017-02-01
Colorectal cancer (CRC) is one of the most common and preventable forms of cancer but remains the second leading cause of cancer-related death. Colorectal adenomas are precursor lesions that develop in 70-90 % of CRC cases. Identification of peripheral biomarkers for adenomas would help to enhance screening efforts. This exploratory study examined the methylation status of 20 candidate markers in peripheral blood leukocytes and their association with adenoma formation. Patients recruited from a local endoscopy clinic provided informed consent and completed an interview to ascertain demographic, lifestyle, and adenoma risk factors. Cases were individuals with a histopathologically confirmed adenoma, and controls included patients with a normal colonoscopy or those with histopathological findings not requiring heightened surveillance (normal biopsy, hyperplastic polyp). Methylation-specific polymerase chain reaction was used to characterize candidate gene promoter methylation. Odds ratios (ORs) and 95 % confidence intervals (95% CIs) were calculated using unconditional multivariable logistic regression to test the hypothesis that candidate gene methylation differed between cases and controls, after adjustment for confounders. Complete data were available for 107 participants; 36 % had adenomas (men 40 %, women 31 %). Hypomethylation of the MINT1 locus (OR 5.3, 95% CI 1.0-28.2) and the PER1 (OR 2.9, 95% CI 1.1-7.7) and PER3 (OR 11.6, 95% CI 1.6-78.5) clock gene promoters was more common among adenoma cases. While specificity was moderate to high for the three markers (71-97 %), sensitivity was relatively low (18-45 %). Follow-up of these epigenetic markers is suggested to further evaluate their utility for adenoma screening or surveillance.
Directory of Open Access Journals (Sweden)
Alok Arun
Full Text Available Real-time quantitative reverse transcription PCR (qRT-PCR is a technique widely used to quantify the transcriptional expression level of candidate genes. qRT-PCR requires the selection of one or several suitable reference genes, whose expression profiles remain stable across conditions, to normalize the qRT-PCR expression profiles of candidate genes. Although several butterfly species (Lepidoptera have become important models in molecular evolutionary ecology, so far no study aimed at identifying reference genes for accurate data normalization for any butterfly is available. The African bush brown butterfly Bicyclus anynana has drawn considerable attention owing to its suitability as a model for evolutionary ecology, and we here provide a maiden extensive study to identify suitable reference gene in this species. We monitored the expression profile of twelve reference genes: eEF-1α, FK506, UBQL40, RpS8, RpS18, HSP, GAPDH, VATPase, ACT3, TBP, eIF2 and G6PD. We tested the stability of their expression profiles in three different tissues (wings, brains, antennae, two developmental stages (pupal and adult and two sexes (male and female, all of which were subjected to two food treatments (food stress and control feeding ad libitum. The expression stability and ranking of twelve reference genes was assessed using two algorithm-based methods, NormFinder and geNorm. Both methods identified RpS8 as the best suitable reference gene for expression data normalization. We also showed that the use of two reference genes is sufficient to effectively normalize the qRT-PCR data under varying tissues and experimental conditions that we used in B. anynana. Finally, we tested the effect of choosing reference genes with different stability on the normalization of the transcript abundance of a candidate gene involved in olfactory communication in B. anynana, the Fatty Acyl Reductase 2, and we confirmed that using an unstable reference gene can drastically alter the
Arun, Alok; Baumlé, Véronique; Amelot, Gaël; Nieberding, Caroline M
2015-01-01
Real-time quantitative reverse transcription PCR (qRT-PCR) is a technique widely used to quantify the transcriptional expression level of candidate genes. qRT-PCR requires the selection of one or several suitable reference genes, whose expression profiles remain stable across conditions, to normalize the qRT-PCR expression profiles of candidate genes. Although several butterfly species (Lepidoptera) have become important models in molecular evolutionary ecology, so far no study aimed at identifying reference genes for accurate data normalization for any butterfly is available. The African bush brown butterfly Bicyclus anynana has drawn considerable attention owing to its suitability as a model for evolutionary ecology, and we here provide a maiden extensive study to identify suitable reference gene in this species. We monitored the expression profile of twelve reference genes: eEF-1α, FK506, UBQL40, RpS8, RpS18, HSP, GAPDH, VATPase, ACT3, TBP, eIF2 and G6PD. We tested the stability of their expression profiles in three different tissues (wings, brains, antennae), two developmental stages (pupal and adult) and two sexes (male and female), all of which were subjected to two food treatments (food stress and control feeding ad libitum). The expression stability and ranking of twelve reference genes was assessed using two algorithm-based methods, NormFinder and geNorm. Both methods identified RpS8 as the best suitable reference gene for expression data normalization. We also showed that the use of two reference genes is sufficient to effectively normalize the qRT-PCR data under varying tissues and experimental conditions that we used in B. anynana. Finally, we tested the effect of choosing reference genes with different stability on the normalization of the transcript abundance of a candidate gene involved in olfactory communication in B. anynana, the Fatty Acyl Reductase 2, and we confirmed that using an unstable reference gene can drastically alter the expression
Function of the auxin-responsive gene TaSAUR75 under salt and drought stress
Directory of Open Access Journals (Sweden)
Yuan Guo
2018-04-01
Full Text Available Small auxin-upregulated RNAs (SAURs are genes regulated by auxin and environmental factors. In this study, we identified a SAUR gene in wheat, TaSAUR75. Under salt stress, TaSAUR75 is downregulated in wheat roots. Subcellular localization revealed that TaSAUR75 was localized in both the cytoplasm and nucleus. Overexpression of TaSAUR75 increased drought and salt tolerance in Arabidopsis. Transgenic lines showed higher root length and survival rate and higher expression of some stress-responsive genes than control plants under salt and drought stress. Less H2O2 accumulated in transgenic lines than in control plants under drought stress. Our findings reveal a positive regulatory role of the auxin-responsive gene TaSAUR75 in plant responses to drought and salt stress and provide a candidate gene for improvement of abiotic stress tolerance in crop breeding.
Identifying candidate driver genes by integrative ovarian cancer genomics data
Lu, Xinguo; Lu, Jibo
2017-08-01
Integrative analysis of molecular mechanics underlying cancer can distinguish interactions that cannot be revealed based on one kind of data for the appropriate diagnosis and treatment of cancer patients. Tumor samples exhibit heterogeneity in omics data, such as somatic mutations, Copy Number Variations CNVs), gene expression profiles and so on. In this paper we combined gene co-expression modules and mutation modulators separately in tumor patients to obtain the candidate driver genes for resistant and sensitive tumor from the heterogeneous data. The final list of modulators identified are well known in biological processes associated with ovarian cancer, such as CCL17, CACTIN, CCL16, CCL22, APOB, KDF1, CCL11, HNF1B, LRG1, MED1 and so on, which can help to facilitate the discovery of biomarkers, molecular diagnostics, and drug discovery.
González-Plaza, Juan J; Ortiz-Martín, Inmaculada; Muñoz-Mérida, Antonio; García-López, Carmen; Sánchez-Sevilla, José F; Luque, Francisco; Trelles, Oswaldo; Bejarano, Eduardo R; De La Rosa, Raúl; Valpuesta, Victoriano; Beuzón, Carmen R
2016-01-01
Plant architecture is a critical trait in fruit crops that can significantly influence yield, pruning, planting density and harvesting. Little is known about how plant architecture is genetically determined in olive, were most of the existing varieties are traditional with an architecture poorly suited for modern growing and harvesting systems. In the present study, we have carried out microarray analysis of meristematic tissue to compare expression profiles of olive varieties displaying differences in architecture, as well as seedlings from their cross pooled on the basis of their sharing architecture-related phenotypes. The microarray used, previously developed by our group has already been applied to identify candidates genes involved in regulating juvenile to adult transition in the shoot apex of seedlings. Varieties with distinct architecture phenotypes and individuals from segregating progenies displaying opposite architecture features were used to link phenotype to expression. Here, we identify 2252 differentially expressed genes (DEGs) associated to differences in plant architecture. Microarray results were validated by quantitative RT-PCR carried out on genes with functional annotation likely related to plant architecture. Twelve of these genes were further analyzed in individual seedlings of the corresponding pool. We also examined Arabidopsis mutants in putative orthologs of these targeted candidate genes, finding altered architecture for most of them. This supports a functional conservation between species and potential biological relevance of the candidate genes identified. This study is the first to identify genes associated to plant architecture in olive, and the results obtained could be of great help in future programs aimed at selecting phenotypes adapted to modern cultivation practices in this species.
Riazuddin, S; Hussain, M; Razzaq, A; Iqbal, Z; Shahzad, M; Polla, D L; Song, Y; van Beusekom, E; Khan, A A; Tomas-Roca, L; Rashid, M; Zahoor, M Y; Wissink-Lindhout, W M; Basra, M A R; Ansar, M; Agha, Z; van Heeswijk, K; Rasheed, F; Van de Vorst, M; Veltman, J A; Gilissen, C; Akram, J; Kleefstra, T; Assir, M Z; Grozeva, D; Carss, K; Raymond, F L; O'Connor, T D; Riazuddin, S A; Khan, S N; Ahmed, Z M; de Brouwer, A P M; van Bokhoven, H; Riazuddin, S
2017-11-01
Intellectual disability (ID) is a clinically and genetically heterogeneous disorder, affecting 1-3% of the general population. Although research into the genetic causes of ID has recently gained momentum, identification of pathogenic mutations that cause autosomal recessive ID (ARID) has lagged behind, predominantly due to non-availability of sizeable families. Here we present the results of exome sequencing in 121 large consanguineous Pakistani ID families. In 60 families, we identified homozygous or compound heterozygous DNA variants in a single gene, 30 affecting reported ID genes and 30 affecting novel candidate ID genes. Potential pathogenicity of these alleles was supported by co-segregation with the phenotype, low frequency in control populations and the application of stringent bioinformatics analyses. In another eight families segregation of multiple pathogenic variants was observed, affecting 19 genes that were either known or are novel candidates for ID. Transcriptome profiles of normal human brain tissues showed that the novel candidate ID genes formed a network significantly enriched for transcriptional co-expression (P<0.0001) in the frontal cortex during fetal development and in the temporal-parietal and sub-cortex during infancy through adulthood. In addition, proteins encoded by 12 novel ID genes directly interact with previously reported ID proteins in six known pathways essential for cognitive function (P<0.0001). These results suggest that disruptions of temporal parietal and sub-cortical neurogenesis during infancy are critical to the pathophysiology of ID. These findings further expand the existing repertoire of genes involved in ARID, and provide new insights into the molecular mechanisms and the transcriptome map of ID.
2013-01-01
Background Theobroma cacao L. cultivar Matina 1-6 belongs to the most cultivated cacao type. The availability of its genome sequence and methods for identifying genes responsible for important cacao traits will aid cacao researchers and breeders. Results We describe the sequencing and assembly of the genome of Theobroma cacao L. cultivar Matina 1-6. The genome of the Matina 1-6 cultivar is 445 Mbp, which is significantly larger than a sequenced Criollo cultivar, and more typical of other cultivars. The chromosome-scale assembly, version 1.1, contains 711 scaffolds covering 346.0 Mbp, with a contig N50 of 84.4 kbp, a scaffold N50 of 34.4 Mbp, and an evidence-based gene set of 29,408 loci. Version 1.1 has 10x the scaffold N50 and 4x the contig N50 as Criollo, and includes 111 Mb more anchored sequence. The version 1.1 assembly has 4.4% gap sequence, while Criollo has 10.9%. Through a combination of haplotype, association mapping and gene expression analyses, we leverage this robust reference genome to identify a promising candidate gene responsible for pod color variation. We demonstrate that green/red pod color in cacao is likely regulated by the R2R3 MYB transcription factor TcMYB113, homologs of which determine pigmentation in Rosaceae, Solanaceae, and Brassicaceae. One SNP within the target site for a highly conserved trans-acting siRNA in dicots, found within TcMYB113, seems to affect transcript levels of this gene and therefore pod color variation. Conclusions We report a high-quality sequence and annotation of Theobroma cacao L. and demonstrate its utility in identifying candidate genes regulating traits. PMID:23731509
Directory of Open Access Journals (Sweden)
Na Liu
2016-07-01
Full Text Available Kernel starch content is an important trait in maize (Zea mays L. as it accounts for 65% to 75% of the dry kernel weight and positively correlates with seed yield. A number of starch synthesis-related genes have been identified in maize in recent years. However, many loci underlying variation in starch content among maize inbred lines still remain to be identified. The current study is a genome-wide association study that used a set of 263 maize inbred lines. In this panel, the average kernel starch content was 66.99%, ranging from 60.60% to 71.58% over the three study years. These inbred lines were genotyped with the SNP50 BeadChip maize array, which is comprised of 56,110 evenly spaced, random SNPs. Population structure was controlled by a mixed linear model (MLM as implemented in the software package TASSEL. After the statistical analyses, four SNPs were identified as significantly associated with starch content (P ≤ 0.0001, among which one each are located on chromosomes 1 and 5 and two are on chromosome 2. Furthermore, 77 candidate genes associated with starch synthesis were found within the 100-kb intervals containing these four QTLs, and four highly associated genes were within 20-kb intervals of the associated SNPs. Among the four genes, Glucose-1-phosphate adenylyltransferase (APS1; Gene ID GRMZM2G163437 is known as an important regulator of kernel starch content. The identified SNPs, QTLs, and candidate genes may not only be readily used for germplasm improvement by marker-assisted selection in breeding, but can also elucidate the genetic basis of starch content. Further studies on these identified candidate genes may help determine the molecular mechanisms regulating kernel starch content in maize and other important cereal crops.
Molecular evolution of candidate genes for crop-related traits in sunflower (Helianthus annuus L.).
Mandel, Jennifer R; McAssey, Edward V; Nambeesan, Savithri; Garcia-Navarro, Elena; Burke, John M
2014-01-01
Evolutionary analyses aimed at detecting the molecular signature of selection during crop domestication and/or improvement can be used to identify genes or genomic regions of likely agronomic importance. Here, we describe the DNA sequence-based characterization of a pool of candidate genes for crop-related traits in sunflower. These genes, which were identified based on homology to genes of known effect in other study systems, were initially sequenced from a panel of improved lines. All genes that exhibited a paucity of sequence diversity, consistent with the possible effects of selection during the evolution of cultivated sunflower, were then sequenced from a panel of wild sunflower accessions an outgroup. These data enabled formal tests for the effects of selection in shaping sequence diversity at these loci. When selection was detected, we further sequenced these genes from a panel of primitive landraces, thereby allowing us to investigate the likely timing of selection (i.e., domestication vs. improvement). We ultimately identified seven genes that exhibited the signature of positive selection during either domestication or improvement. Genetic mapping of a subset of these genes revealed co-localization between candidates for genes involved in the determination of flowering time, seed germination, plant growth/development, and branching and QTL that were previously identified for these traits in cultivated × wild sunflower mapping populations.
Directory of Open Access Journals (Sweden)
Xing Li
2014-01-01
Full Text Available Background. Symptoms and signs (symptoms in brief are the essential clinical manifestations for individualized diagnosis and treatment in traditional Chinese medicine (TCM. To gain insights into the molecular mechanism of symptoms, we develop a computational approach to identify the candidate genes of symptoms. Methods. This paper presents a network-based approach for the integrated analysis of multiple phenotype-genotype data sources and the prediction of the prioritizing genes for the associated symptoms. The method first calculates the similarities between symptoms and diseases based on the symptom-disease relationships retrieved from the PubMed bibliographic database. Then the disease-gene associations and protein-protein interactions are utilized to construct a phenotype-genotype network. The PRINCE algorithm is finally used to rank the potential genes for the associated symptoms. Results. The proposed method gets reliable gene rank list with AUC (area under curve 0.616 in classification. Some novel genes like CALCA, ESR1, and MTHFR were predicted to be associated with headache symptoms, which are not recorded in the benchmark data set, but have been reported in recent published literatures. Conclusions. Our study demonstrated that by integrating phenotype-genotype relationships into a complex network framework it provides an effective approach to identify candidate genes of symptoms.
Epidermal growth factor gene is a newly identified candidate gene for gout
Han, Lin; Cao, Chunwei; Jia, Zhaotong; Liu, Shiguo; Liu, Zhen; Xin, Ruosai; Wang, Can; Li, Xinde; Ren, Wei; Wang, Xuefeng; Li, Changgui
2016-01-01
Chromosome 4q25 has been identified as a genomic region associated with gout. However, the associations of gout with the genes in this region have not yet been confirmed. Here, we performed two-stage analysis to determine whether variations in candidate genes in the 4q25 region are associated with gout in a male Chinese Han population. We first evaluated 96 tag single nucleotide polymorphisms (SNPs) in eight inflammatory/immune pathway- or glucose/lipid metabolism-related genes in the 4q25 region in 480 male gout patients and 480 controls. The SNP rs12504538, located in the elongation of very-long-chain-fatty-acid-like family member 6 gene (Elovl6), was found to be associated with gout susceptibility (Padjusted = 0.00595). In the second stage of analysis, we performed fine mapping analysis of 93 tag SNPs in Elovl6 and in the epidermal growth factor gene (EGF) and its flanking regions in 1017 male patients gout and 1897 healthy male controls. We observed a significant association between the T allele of EGF rs2298999 and gout (odds ratio = 0.77, 95% confidence interval = 0.67–0.88, Padjusted = 6.42 × 10−3). These results provide the first evidence for an association between the EGF rs2298999 C/T polymorphism and gout. Our findings should be validated in additional populations. PMID:27506295
Zang, Wen; Eckstein, Peter E; Colin, Mark; Voth, Doug; Himmelbach, Axel; Beier, Sebastian; Stein, Nils; Scoles, Graham J; Beattie, Aaron D
2015-07-01
The candidate gene for the barley Un8 true loose smut resistance gene encodes a deduced protein containing two tandem protein kinase domains. In North America, durable resistance against all known isolates of barley true loose smut, caused by the basidiomycete pathogen Ustilago nuda (Jens.) Rostr. (U. nuda), is under the control of the Un8 resistance gene. Previous genetic studies mapped Un8 to the long arm of chromosome 5 (1HL). Here, a population of 4625 lines segregating for Un8 was used to delimit the Un8 gene to a 0.108 cM interval on chromosome arm 1HL, and assign it to fingerprinted contig 546 of the barley physical map. The minimal tilling path was identified for the Un8 locus using two flanking markers and consisted of two overlapping bacterial artificial chromosomes. One gene located close to a marker co-segregating with Un8 showed high sequence identity to a disease resistance gene containing two kinase domains. Sequence of the candidate gene from the parents of the segregating population, and in an additional 19 barley lines representing a broader spectrum of diversity, showed there was no intron in alleles present in either resistant or susceptible lines, and fifteen amino acid variations unique to the deduced protein sequence in resistant lines differentiated it from the deduced protein sequences in susceptible lines. Some of these variations were present within putative functional domains which may cause a loss of function in the deduced protein sequences within susceptible lines.
Directory of Open Access Journals (Sweden)
Pablo Palma
Full Text Available Preoperative chemoradiation significantly improves oncological outcome in locally advanced rectal cancer. However there is no effective method of predicting tumor response to chemoradiation in these patients. Peripheral blood mononuclear cells have emerged recently as pathology markers of cancer and other diseases, making possible their use as therapy predictors. Furthermore, the importance of the immune response in radiosensivity of solid organs led us to hypothesized that microarray gene expression profiling of peripheral blood mononuclear cells could identify patients with response to chemoradiation in rectal cancer. Thirty five 35 patients with locally advanced rectal cancer were recruited initially to perform the study. Peripheral blood samples were obtained before neaodjuvant treatment. RNA was extracted and purified to obtain cDNA and cRNA for hybridization of microarrays included in Human WG CodeLink bioarrays. Quantitative real time PCR was used to validate microarray experiment data. Results were correlated with pathological response, according to Mandard´s criteria and final UICC Stage (patients with tumor regression grade 1-2 and downstaging being defined as responders and patients with grade 3-5 and no downstaging as non-responders. Twenty seven out of 35 patients were finally included in the study. We performed a multiple t-test using Significance Analysis of Microarrays, to find those genes differing significantly in expression, between responders (n = 11 and non-responders (n = 16 to CRT. The differently expressed genes were: BC 035656.1, CIR, PRDM2, CAPG, FALZ, HLA-DPB2, NUPL2, and ZFP36. The measurement of FALZ (p = 0.029 gene expression level determined by qRT-PCR, showed statistically significant differences between the two groups. Gene expression profiling reveals novel genes in peripheral blood samples of mononuclear cells that could predict responders and non-responders to chemoradiation in patients with
Moon, Myungjin; Nakai, Kenta
2018-04-01
Currently, cancer biomarker discovery is one of the important research topics worldwide. In particular, detecting significant genes related to cancer is an important task for early diagnosis and treatment of cancer. Conventional studies mostly focus on genes that are differentially expressed in different states of cancer; however, noise in gene expression datasets and insufficient information in limited datasets impede precise analysis of novel candidate biomarkers. In this study, we propose an integrative analysis of gene expression and DNA methylation using normalization and unsupervised feature extractions to identify candidate biomarkers of cancer using renal cell carcinoma RNA-seq datasets. Gene expression and DNA methylation datasets are normalized by Box-Cox transformation and integrated into a one-dimensional dataset that retains the major characteristics of the original datasets by unsupervised feature extraction methods, and differentially expressed genes are selected from the integrated dataset. Use of the integrated dataset demonstrated improved performance as compared with conventional approaches that utilize gene expression or DNA methylation datasets alone. Validation based on the literature showed that a considerable number of top-ranked genes from the integrated dataset have known relationships with cancer, implying that novel candidate biomarkers can also be acquired from the proposed analysis method. Furthermore, we expect that the proposed method can be expanded for applications involving various types of multi-omics datasets.
International Nuclear Information System (INIS)
Bougas, Bérénice; Normandeau, Eric; Pierron, Fabien; Campbell, Peter G.C.; Bernatchez, Louis; Couture, Patrice
2013-01-01
Highlights: •The transcriptional responses of Perca flavescens to both metal and non metal stressors were measured with a 1000 candidate-gene microarray. •475, 287 and 176 genes were differentially transcribed depending on temperature, Ni and Cd concentrations, respectively. •Genes involved in iron metabolism, transcriptional and translational processes, vitamin metabolism, blood coagulation, and calcium transport were impacted by metals. •The developed microarray contributes to a better characterization of the impact of different stressors on the transcriptome. -- Abstract: The molecular mechanisms underlying nickel (Ni) and cadmium (Cd) toxicity and their specific effects on fish are poorly understood. Documenting gene transcription profiles offers a powerful approach toward identifying the molecular mechanisms affected by these metals and to discover biomarkers of their toxicity. However, confounding environmental factors can complicate the interpretation of the results and the detection of biomarkers for fish captured in their natural environment. In the present study, a 1000 candidate-gene microarray, developed from a previous RNA-seq study on a subset of individual fish from contrasting level of metal contamination, was used to investigate the transcriptional response to metal (Ni and Cd) and non metal (temperature, oxygen, and diet) stressors in yellow perch (Perca flavescens). Specifically, we aimed at (1) identifying transcriptional signatures specific to Ni and Cd exposure, (2) investigating the mechanisms of their toxicity, and (3) developing a predictive tool to identify the sublethal effects of Ni and Cd contaminants in fish sampled from natural environments. A total of 475 genes displayed significantly different transcription levels when temperature varied while 287 and 176 genes were differentially transcribed at different concentrations of Ni and Cd, respectively. These metals were found to mainly affect the transcription level of genes
Energy Technology Data Exchange (ETDEWEB)
Bougas, Bérénice, E-mail: Berenice.Bougas@ete.inrs.ca [Institut National de la Recherche Scientifique, Centre INRS Eau Terre et Environnement, 490, rue de la Couronne, Québec, Québec G1K 9A9 (Canada); Département de biologie, Institut de Biologie Intégrative et des Systèmes (IBIS), Université Laval, Québec, Québec G1V 0A6 (Canada); Normandeau, Eric [Département de biologie, Institut de Biologie Intégrative et des Systèmes (IBIS), Université Laval, Québec, Québec G1V 0A6 (Canada); Pierron, Fabien [Université de Bordeaux, EPOC, UMR 5805, F-33400 Talence (France); CNRS, EPOC, UMR 5805, F-33400 Talence (France); Campbell, Peter G.C. [Institut National de la Recherche Scientifique, Centre INRS Eau Terre et Environnement, 490, rue de la Couronne, Québec, Québec G1K 9A9 (Canada); Bernatchez, Louis [Département de biologie, Institut de Biologie Intégrative et des Systèmes (IBIS), Université Laval, Québec, Québec G1V 0A6 (Canada); Couture, Patrice [Institut National de la Recherche Scientifique, Centre INRS Eau Terre et Environnement, 490, rue de la Couronne, Québec, Québec G1K 9A9 (Canada)
2013-10-15
Highlights: •The transcriptional responses of Perca flavescens to both metal and non metal stressors were measured with a 1000 candidate-gene microarray. •475, 287 and 176 genes were differentially transcribed depending on temperature, Ni and Cd concentrations, respectively. •Genes involved in iron metabolism, transcriptional and translational processes, vitamin metabolism, blood coagulation, and calcium transport were impacted by metals. •The developed microarray contributes to a better characterization of the impact of different stressors on the transcriptome. -- Abstract: The molecular mechanisms underlying nickel (Ni) and cadmium (Cd) toxicity and their specific effects on fish are poorly understood. Documenting gene transcription profiles offers a powerful approach toward identifying the molecular mechanisms affected by these metals and to discover biomarkers of their toxicity. However, confounding environmental factors can complicate the interpretation of the results and the detection of biomarkers for fish captured in their natural environment. In the present study, a 1000 candidate-gene microarray, developed from a previous RNA-seq study on a subset of individual fish from contrasting level of metal contamination, was used to investigate the transcriptional response to metal (Ni and Cd) and non metal (temperature, oxygen, and diet) stressors in yellow perch (Perca flavescens). Specifically, we aimed at (1) identifying transcriptional signatures specific to Ni and Cd exposure, (2) investigating the mechanisms of their toxicity, and (3) developing a predictive tool to identify the sublethal effects of Ni and Cd contaminants in fish sampled from natural environments. A total of 475 genes displayed significantly different transcription levels when temperature varied while 287 and 176 genes were differentially transcribed at different concentrations of Ni and Cd, respectively. These metals were found to mainly affect the transcription level of genes
Longevity Candidate Genes and Their Association With Personality Traits in the Elderly
Luciano, M.; Lopez, L.M.; de Moor, M.H.M.; Harris, S.E.; Davies, G.; Nutile, T.; Krueger, R.F.; Esko, T.; Schlessinger, D.; Toshiko, T.; Derringer, J.; Realo, A.; Hansell, N.K.; Pergadia, M.L.; Pesonen, A.-K.; Sanna, S.; Terracciano, A.; Madden, P.A.F.; Penninx, B.W.J.H.; Spinhoven, Ph.D.; Hartman, C.A.; Oostra, B.A.; Janssens, A.C.J.W.; Eriksson, J.G.; Starr, J.M.; Cannas, A.; Ferrucci, L.; Metspalu, A.; Wright, M.J.; Heath, A.C.; van Duijn, C.M.; Bierut, L.J.; Raikkonen, K.; Martin, N.G.; Ciullo, M.; Rujescu, D.; Boomsma, D.I.; Deary, I.J.
2012-01-01
Human longevity and personality traits are both heritable and are consistently linked at the phenotypic level. We test the hypothesis that candidate genes influencing longevity in lower organisms are associated with variance in the five major dimensions of human personality (measured by the NEO-FFI
Longevity candidate genes and their association with personality traits in the elderly
Luciano, Michelle; Lopez, Lorna M.; de Moor, Marleen H. M.; Harris, Sarah E.; Davies, Gail; Nutile, Teresa; Krueger, Robert F.; Esko, Tonu; Schlessinger, David; Toshiko, Tanaka; Derringer, Jaime L.; Realo, Anu; Hansell, Narelle K.; Pergadia, Michele L.; Pesonen, Anu-Katriina; Sanna, Serena; Terracciano, Antonio; Madden, Pamela A. F.; Penninx, Brenda; Spinhoven, Philip; Hartman, Catherina A.; Oostra, Ben A.; Janssens, A. Cecile J. W.; Eriksson, Johan G.; Starr, John M.; Cannas, Alessandra; Ferrucci, Luigi; Metspalu, Andres; Wright, Margeret J.; Heath, Andrew C.; van Duijn, Cornelia M.; Bierut, Laura J.; Raikkonen, Katri; Martin, Nicholas G.; Ciullo, Marina; Rujescu, Dan; Boomsma, Dorret I.; Deary, Ian J.
Human longevity and personality traits are both heritable and are consistently linked at the phenotypic level. We test the hypothesis that candidate genes influencing longevity in lower organisms are associated with variance in the five major dimensions of human personality (measured by the NEO-FFI
Yıldırım, Kubilay; Uylaş, Senem
2016-12-01
Boron (B) is an essential nutrient for normal growth of plants. Despite its low abundance in soils, it could be highly toxic to plants in especially arid and semi-arid environments. Poplars are known to be tolerant species to B toxicity and accumulation. However, physiological and gene regulation responses of these trees to B toxicity have not been investigated yet. Here, B accumulation and tolerance level of black poplar clones were firstly tested in the current study. Rooted cutting of these clones were treated with elevated B toxicity to select the most B accumulator and tolerant genotype. Then we carried out a microarray based transcriptome experiment on the leaves and roots of this genotype to find out transcriptional networks, genes and molecular mechanisms behind B toxicity tolerance. The results of the study indicated that black poplar is quite suitable for phytoremediation of B pollution. It could resist 15 ppm soil B content and >1500 ppm B accumulation in leaves, which are highly toxic concentrations for almost all agricultural plants. Transcriptomics results of study revealed totally 1625 and 1419 altered probe sets under 15 ppm B toxicity in leaf and root tissues, respectively. The highest induction were recorded for the probes sets annotated to tyrosine aminotransferase, ATP binding cassette transporters, glutathione S transferases and metallochaperone proteins. Strong up regulation of these genes attributed to internal excretion of B into the cell vacuole and existence of B detoxification processes in black poplar. Many other candidate genes functional in signalling, gene regulation, antioxidation, B uptake and transport processes were also identified in this hyper B accumulator plant for the first time with the current study. Copyright © 2016 Elsevier Masson SAS. All rights reserved.
Marone, Daniela; Russo, Maria A; Laidò, Giovanni; De Vita, Pasquale; Papa, Roberto; Blanco, Antonio; Gadaleta, Agata; Rubiales, Diego; Mastrangelo, Anna M
2013-08-19
Powdery mildew (Blumeria graminis f. sp. tritici) is one of the most damaging diseases of wheat. The objective of this study was to identify the wheat genomic regions that are involved in the control of powdery mildew resistance through a quantitative trait loci (QTL) meta-analysis approach. This meta-analysis allows the use of collected QTL data from different published studies to obtain consensus QTL across different genetic backgrounds, thus providing a better definition of the regions responsible for the trait, and the possibility to obtain molecular markers that will be suitable for marker-assisted selection. Five QTL for resistance to powdery mildew were identified under field conditions in the durum-wheat segregating population Creso × Pedroso. An integrated map was developed for the projection of resistance genes/ alleles and the QTL from the present study and the literature, and to investigate their distribution in the wheat genome. Molecular markers that correspond to candidate genes for plant responses to pathogens were also projected onto the map, particularly considering NBS-LRR and receptor-like protein kinases. More than 80 independent QTL and 51 resistance genes from 62 different mapping populations were projected onto the consensus map using the Biomercator statistical software. Twenty-four MQTL that comprised 2-6 initial QTL that had widely varying confidence intervals were found on 15 chromosomes. The co-location of the resistance QTL and genes was investigated. Moreover, from analysis of the sequences of DArT markers, 28 DArT clones mapped on wheat chromosomes have been shown to be associated with the NBS-LRR genes and positioned in the same regions as the MQTL for powdery mildew resistance. The results from the present study provide a detailed analysis of the genetic basis of resistance to powdery mildew in wheat. The study of the Creso × Pedroso durum-wheat population has revealed some QTL that had not been previously identified. Furthermore
Alienness: Rapid Detection of Candidate Horizontal Gene Transfers across the Tree of Life
Directory of Open Access Journals (Sweden)
Corinne Rancurel
2017-09-01
Full Text Available Horizontal gene transfer (HGT is the transmission of genes between organisms by other means than parental to offspring inheritance. While it is prevalent in prokaryotes, HGT is less frequent in eukaryotes and particularly in Metazoa. Here, we propose Alienness, a taxonomy-aware web application available at http://alienness.sophia.inra.fr. Alienness parses BLAST results against public libraries to rapidly identify candidate HGT in any genome of interest. Alienness takes as input the result of a BLAST of a whole proteome of interest against any National Center for Biotechnology Information (NCBI protein library. The user defines recipient (e.g., Metazoa and donor (e.g., bacteria, fungi branches of interest in the NCBI taxonomy. Based on the best BLAST E-values of candidate donor and recipient taxa, Alienness calculates an Alien Index (AI for each query protein. An AI > 0 indicates a better hit to candidate donor than recipient taxa and a possible HGT. Higher AI represent higher gap of E-values between candidate donor and recipient and a more likely HGT. We confirmed the accuracy of Alienness on phylogenetically confirmed HGT of non-metazoan origin in plant-parasitic nematodes. Alienness scans whole proteomes to rapidly identify possible HGT in any species of interest and thus fosters exploration of HGT more easily and largely across the tree of life.
Directory of Open Access Journals (Sweden)
Xinyan Wang
Full Text Available Chronic obstructive pulmonary disease (COPD is a multi-factor disease, in which metabolic disturbances played important roles. In this paper, functional information was integrated into a COPD-related metabolic network to assess similarity between genes. Then a gene prioritization method was applied to the COPD-related metabolic network to prioritize COPD candidate genes. The gene prioritization method was superior to ToppGene and ToppNet in both literature validation and functional enrichment analysis. Top-ranked genes prioritized from the metabolic perspective with functional information could promote the better understanding about the molecular mechanism of this disease. Top 100 genes might be potential markers for diagnostic and effective therapies.
International Nuclear Information System (INIS)
Simbaqueba, Jaime; Cotes, Alba Marina; Barrero, Luz Stella
2011-01-01
Induced systemic resistance (ISR) is a mechanism by which plants enhance defenses against any stress condition. ISR and growth promotion are enhanced when tomato (Solanum lycopersicum) is inoculated with several strains of Trichoderma ssp. this study aims to genetically map tomato candidate genes involved in ISR and growth promotion induced by the Colombian native isolate Trichoderma koningiopsis th003. Forty-nine candidate genes previously identified on tomato plants treated with th003 and T. hamatum T382 strains were evaluated for polymorphisms and 16 of them were integrated on the highly saturated genetic linkage map named TOMATO EXPEN 2000. The location of six unigenes was similar to the location of resistance gene analogs (RGAS), defense related ests and resistance QTLs previously reported, suggesting new possible candidates for these quantitative trait loci (QTL) regions. The candidate gene-markers may be used for future ISR or growth promotion assisted selection in tomato.
Directory of Open Access Journals (Sweden)
Karina Banasik
2011-01-01
Full Text Available Candidate genes for non-alcoholic fatty liver disease (NAFLD identified by a bioinformatics approach were examined for variant associations to quantitative traits of NAFLD-related phenotypes.By integrating public database text mining, trans-organism protein-protein interaction transferal, and information on liver protein expression a protein-protein interaction network was constructed and from this a smaller isolated interactome was identified. Five genes from this interactome were selected for genetic analysis. Twenty-one tag single-nucleotide polymorphisms (SNPs which captured all common variation in these genes were genotyped in 10,196 Danes, and analyzed for association with NAFLD-related quantitative traits, type 2 diabetes (T2D, central obesity, and WHO-defined metabolic syndrome (MetS.273 genes were included in the protein-protein interaction analysis and EHHADH, ECHS1, HADHA, HADHB, and ACADL were selected for further examination. A total of 10 nominal statistical significant associations (P<0.05 to quantitative metabolic traits were identified. Also, the case-control study showed associations between variation in the five genes and T2D, central obesity, and MetS, respectively. Bonferroni adjustments for multiple testing negated all associations.Using a bioinformatics approach we identified five candidate genes for NAFLD. However, we failed to provide evidence of associations with major effects between SNPs in these five genes and NAFLD-related quantitative traits, T2D, central obesity, and MetS.
Huang, Jianzi; Lu, Xiang; Yan, Hao; Chen, Shouyi; Zhang, Wanke; Huang, Rongfeng; Zheng, Yizhi
2012-04-01
Semi-mangroves form a group of transitional species between glycophytes and halophytes, and hold unique potential for learning molecular mechanisms underlying plant salt tolerance. Millettia pinnata is a semi-mangrove plant that can survive a wide range of saline conditions in the absence of specialized morphological and physiological traits. By employing the Illumina sequencing platform, we generated ~192 million short reads from four cDNA libraries of M. pinnata and processed them into 108,598 unisequences with a high depth of coverage. The mean length and total length of these unisequences were 606 bp and 65.8 Mb, respectively. A total of 54,596 (50.3%) unisequences were assigned Nr annotations. Functional classification revealed the involvement of unisequences in various biological processes related to metabolism and environmental adaptation. We identified 23,815 candidate salt-responsive genes with significantly differential expression under seawater and freshwater treatments. Based on the reverse transcription-polymerase chain reaction (RT-PCR) and real-time PCR analyses, we verified the changes in expression levels for a number of candidate genes. The functional enrichment analyses for the candidate genes showed tissue-specific patterns of transcriptome remodelling upon salt stress in the roots and the leaves. The transcriptome of M. pinnata will provide valuable gene resources for future application in crop improvement. In addition, this study sets a good example for large-scale identification of salt-responsive genes in non-model organisms using the sequencing-based approach.
DEFF Research Database (Denmark)
Severinsen, Jacob; Binderup, Helle; Mors, Ole
Chromosome 22q is suspected to harbor risk genes for schizophrenia as well as bipolar affective disorder. This is evidenced through genetic mapping studies, investigations of cytogenetic abnormalities, and direct examination of candidate genes. In a recent study of distantly related patients from...... the Faroe Islands we have obtained evidence suggesting two regions on chromosome 22q13 to potentially harbor susceptibility genes for both schizophrenia and bipolar affective disorder. We have selected a number of candidate genes from these two regions for further analysis, including the neuro-gene WKL1...... and unrelated controls, and in a Scottish case-control sample comprising 200 schizophrenics, 200 bipolar patients and 200 controls. None of the investigated SNPs have so far showed strong evidence of association to either bipolar disorder or schizophrenia....
Woldesemayat, Adugna Abdi; Van Heusden, Peter; Ndimba, Bongani K; Christoffels, Alan
2017-12-22
Drought is the most disastrous abiotic stress that severely affects agricultural productivity worldwide. Understanding the biological basis of drought-regulated traits, requires identification and an in-depth characterization of genetic determinants using model organisms and high-throughput technologies. However, studies on drought tolerance have generally been limited to traditional candidate gene approach that targets only a single gene in a pathway that is related to a trait. In this study, we used sorghum, one of the model crops that is well adapted to arid regions, to mine genes and define determinants for drought tolerance using drought expression libraries and RNA-seq data. We provide an integrated and comparative in silico candidate gene identification, characterization and annotation approach, with an emphasis on genes playing a prominent role in conferring drought tolerance in sorghum. A total of 470 non-redundant functionally annotated drought responsive genes (DRGs) were identified using experimental data from drought responses by employing pairwise sequence similarity searches, pathway and interpro-domain analysis, expression profiling and orthology relation. Comparison of the genomic locations between these genes and sorghum quantitative trait loci (QTLs) showed that 40% of these genes were co-localized with QTLs known for drought tolerance. The genome reannotation conducted using the Program to Assemble Spliced Alignment (PASA), resulted in 9.6% of existing single gene models being updated. In addition, 210 putative novel genes were identified using AUGUSTUS and PASA based analysis on expression dataset. Among these, 50% were single exonic, 69.5% represented drought responsive and 5.7% were complete gene structure models. Analysis of biochemical metabolism revealed 14 metabolic pathways that are related to drought tolerance and also had a strong biological network, among categories of genes involved. Identification of these pathways, signifies the
Sequence-Based Introgression Mapping Identifies Candidate White Mold Tolerance Genes in Common Bean
Directory of Open Access Journals (Sweden)
Sujan Mamidi
2016-07-01
Full Text Available White mold, caused by the necrotrophic fungus (Lib. de Bary, is a major disease of common bean ( L.. WM7.1 and WM8.3 are two quantitative trait loci (QTL with major effects on tolerance to the pathogen. Advanced backcross populations segregating individually for either of the two QTL, and a recombinant inbred (RI population segregating for both QTL were used to fine map and confirm the genetic location of the QTL. The QTL intervals were physically mapped using the reference common bean genome sequence, and the physical intervals for each QTL were further confirmed by sequence-based introgression mapping. Using whole-genome sequence data from susceptible and tolerant DNA pools, introgressed regions were identified as those with significantly higher numbers of single-nucleotide polymorphisms (SNPs relative to the whole genome. By combining the QTL and SNP data, WM7.1 was located to a 660-kb region that contained 41 gene models on the proximal end of chromosome Pv07, while the WM8.3 introgression was narrowed to a 1.36-Mb region containing 70 gene models. The most polymorphic candidate gene in the WM7.1 region encodes a BEACH-domain protein associated with apoptosis. Within the WM8.3 interval, a receptor-like protein with the potential to recognize pathogen effectors was the most polymorphic gene. The use of gene and sequence-based mapping identified two candidate genes whose putative functions are consistent with the current model of pathogenicity.
Zhang, Tianxiao; Hou, Liping; Chen, David T; McMahon, Francis J; Wang, Jen-Chyong; Rice, John P
2018-03-01
Bipolar disorder is a mental illness with lifetime prevalence of about 1%. Previous genetic studies have identified multiple chromosomal linkage regions and candidate genes that might be associated with bipolar disorder. The present study aimed to identify potential susceptibility variants for bipolar disorder using 6 related case samples from a four-generation family. A combination of exome sequencing and linkage analysis was performed to identify potential susceptibility variants for bipolar disorder. Our study identified a list of five potential candidate genes for bipolar disorder. Among these five genes, GRID1(Glutamate Receptor Delta-1 Subunit), which was previously reported to be associated with several psychiatric disorders and brain related traits, is particularly interesting. Variants with functional significance in this gene were identified from two cousins in our bipolar disorder pedigree. Our findings suggest a potential role for these genes and the related rare variants in the onset and development of bipolar disorder in this one family. Additional research is needed to replicate these findings and evaluate their patho-biological significance. Copyright © 2017 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Adam Alexander Thil Smith
2012-05-01
Full Text Available Of all biochemically characterized metabolic reactions formalized by the IUBMB, over one out of four have yet to be associated with a nucleic or protein sequence, i.e. are sequence-orphan enzymatic activities. Few bioinformatics annotation tools are able to propose candidate genes for such activities by exploiting context-dependent rather than sequence-dependent data, and none are readily accessible and propose result integration across multiple genomes. Here, we present CanOE (Candidate genes for Orphan Enzymes, a four-step bioinformatics strategy that proposes ranked candidate genes for sequence-orphan enzymatic activities (or orphan enzymes for short. The first step locates "genomic metabolons", i.e. groups of co-localized genes coding proteins catalyzing reactions linked by shared metabolites, in one genome at a time. These metabolons can be particularly helpful for aiding bioanalysts to visualize relevant metabolic data. In the second step, they are used to generate candidate associations between un-annotated genes and gene-less reactions. The third step integrates these gene-reaction associations over several genomes using gene families, and summarizes the strength of family-reaction associations by several scores. In the final step, these scores are used to rank members of gene families which are proposed for metabolic reactions. These associations are of particular interest when the metabolic reaction is a sequence-orphan enzymatic activity. Our strategy found over 60,000 genomic metabolons in more than 1,000 prokaryote organisms from the MicroScope platform, generating candidate genes for many metabolic reactions, of which more than 70 distinct orphan reactions. A computational validation of the approach is discussed. Finally, we present a case study on the anaerobic allantoin degradation pathway in Escherichia coli K-12.
International Nuclear Information System (INIS)
Michels, Evi; Speleman, Frank; Hoebeeck, Jasmien; De Preter, Katleen; Schramm, Alexander; Brichard, Bénédicte; De Paepe, Anne; Eggert, Angelika; Laureys, Geneviève; Vandesompele, Jo
2008-01-01
Recurrent loss of part of the long arm of chromosome 11 is a well established hallmark of a subtype of aggressive neuroblastomas. Despite intensive mapping efforts to localize the culprit 11q tumour suppressor gene, this search has been unsuccessful thus far as no sufficiently small critical region could be delineated for selection of candidate genes. To refine the critical region of 11q loss, the chromosome 11 status of 100 primary neuroblastoma tumours and 29 cell lines was analyzed using a BAC array containing a chromosome 11 tiling path. For the genes mapping within our refined region of loss, meta-analysis on published neuroblastoma mRNA gene expression datasets was performed for candidate gene selection. The DNA methylation status of the resulting candidate gene was determined using re-expression experiments by treatment of neuroblastoma cells with the demethylating agent 5-aza-2'-deoxycytidine and bisulphite sequencing. Two small critical regions of loss within 11q23 at chromosomal band 11q23.1-q23.2 (1.79 Mb) and 11q23.2-q23.3 (3.72 Mb) were identified. In a first step towards further selection of candidate neuroblastoma tumour suppressor genes, we performed a meta-analysis on published expression profiles of 692 neuroblastoma tumours. Integration of the resulting candidate gene list with expression data of neuroblastoma progenitor cells pinpointed CADM1 as a compelling candidate gene. Meta-analysis indicated that CADM1 expression has prognostic significance and differential expression for the gene was noted in unfavourable neuroblastoma versus normal neuroblasts. Methylation analysis provided no evidence for a two-hit mechanism in 11q deleted cell lines. Our study puts CADM1 forward as a strong candidate neuroblastoma suppressor gene. Further functional studies are warranted to elucidate the role of CADM1 in neuroblastoma development and to investigate the possibility of CADM1 haploinsufficiency in neuroblastoma
SNP discovery in candidate adaptive genes using exon capture in a free-ranging alpine ungulate
Roffler, Gretchen H.; Amish, Stephen J.; Smith, Seth; Cosart, Ted F.; Kardos, Marty; Schwartz, Michael K.; Luikart, Gordon
2016-01-01
Identification of genes underlying genomic signatures of natural selection is key to understanding adaptation to local conditions. We used targeted resequencing to identify SNP markers in 5321 candidate adaptive genes associated with known immunological, metabolic and growth functions in ovids and other ungulates. We selectively targeted 8161 exons in protein-coding and nearby 5′ and 3′ untranslated regions of chosen candidate genes. Targeted sequences were taken from bighorn sheep (Ovis canadensis) exon capture data and directly from the domestic sheep genome (Ovis aries v. 3; oviAri3). The bighorn sheep sequences used in the Dall's sheep (Ovis dalli dalli) exon capture aligned to 2350 genes on the oviAri3 genome with an average of 2 exons each. We developed a microfluidic qPCR-based SNP chip to genotype 476 Dall's sheep from locations across their range and test for patterns of selection. Using multiple corroborating approaches (lositan and bayescan), we detected 28 SNP loci potentially under selection. We additionally identified candidate loci significantly associated with latitude, longitude, precipitation and temperature, suggesting local environmental adaptation. The three methods demonstrated consistent support for natural selection on nine genes with immune and disease-regulating functions (e.g. Ovar-DRA, APC, BATF2, MAGEB18), cell regulation signalling pathways (e.g. KRIT1, PI3K, ORRC3), and respiratory health (CYSLTR1). Characterizing adaptive allele distributions from novel genetic techniques will facilitate investigation of the influence of environmental variation on local adaptation of a northern alpine ungulate throughout its range. This research demonstrated the utility of exon capture for gene-targeted SNP discovery and subsequent SNP chip genotyping using low-quality samples in a nonmodel species.
RNA-Seq analysis reveals candidate genes for ontogenic resistance in Malus-Venturia pathosystem.
Directory of Open Access Journals (Sweden)
Michele Gusberti
Full Text Available Ontogenic scab resistance in apple leaves and fruits is a horizontal resistance against the plant pathogen Venturia inaequalis and is expressed as a decrease in disease symptoms and incidence with the ageing of the leaves. Several studies at the biochemical level tried to unveil the nature of this resistance; however, no conclusive results were reported. We decided therefore to investigate the genetic origin of this phenomenon by performing a full quantitative transcriptome sequencing and comparison of young (susceptible and old (ontogenic resistant leaves, infected or not with the pathogen. Two time points at 72 and 96 hours post-inoculation were chosen for RNA sampling and sequencing. Comparison between the different conditions (young and old leaves, inoculated or not should allow the identification of differentially expressed genes which may represent different induced plant defence reactions leading to ontogenic resistance or may be the cause of a constitutive (uninoculated with the pathogen shift toward resistance in old leaves. Differentially expressed genes were then characterised for their function by homology to A. thaliana and other plant genes, particularly looking for genes involved in pathways already suspected of appertaining to ontogenic resistance in apple or other hosts, or to plant defence mechanisms in general. IN THIS WORK, FIVE CANDIDATE GENES PUTATIVELY INVOLVED IN THE ONTOGENIC RESISTANCE OF APPLE WERE IDENTIFIED: a gene encoding an "enhanced disease susceptibility 1 protein" was found to be down-regulated in both uninoculated and inoculated old leaves at 96 hpi, while the other four genes encoding proteins (metallothionein3-like protein, lipoxygenase, lipid transfer protein, and a peroxidase 3 were found to be constitutively up-regulated in inoculated and uninoculated old leaves. The modulation of the five candidate genes has been validated using the real-time quantitative PCR. Thus, ontogenic resistance may be the result
Santos, Jansen Rodrigo Pereira; Ndeve, Arsenio Daniel; Huynh, Bao-Lam; Matthews, William Charles; Roberts, Philip Alan
2018-01-01
Cowpea is one of the most important food and forage legumes in drier regions of the tropics and subtropics. However, cowpea yield worldwide is markedly below the known potential due to abiotic and biotic stresses, including parasitism by root-knot nematodes (Meloidogyne spp., RKN). Two resistance genes with dominant effect, Rk and Rk2, have been reported to provide resistance against RKN in cowpea. Despite their description and use in breeding for resistance to RKN and particularly genetic mapping of the Rk locus, the exact genes conferring resistance to RKN remain unknown. In the present work, QTL mapping using recombinant inbred line (RIL) population 524B x IT84S-2049 segregating for a newly mapped locus and analysis of the transcriptome changes in two cowpea near-isogenic lines (NIL) were used to identify candidate genes for Rk and the newly mapped locus. A major QTL, designated QRk-vu9.1, associated with resistance to Meloidogyne javanica reproduction, was detected and mapped on linkage group LG9 at position 13.37 cM using egg production data. Transcriptome analysis on resistant and susceptible NILs 3 and 9 days after inoculation revealed up-regulation of 109 and 98 genes and down-regulation of 110 and 89 genes, respectively, out of 19,922 unique genes mapped to the common bean reference genome. Among the differentially expressed genes, four and nine genes were found within the QRk-vu9.1 and QRk-vu11.1 QTL intervals, respectively. Six of these genes belong to the TIR-NBS-LRR family of resistance genes and three were upregulated at one or more time-points. Quantitative RT-PCR validated gene expression to be positively correlated with RNA-seq expression pattern for eight genes. Future functional analysis of these cowpea genes will enhance our understanding of Rk-mediated resistance and identify the specific gene responsible for the resistance.
Directory of Open Access Journals (Sweden)
Xiangshu Dong
Full Text Available Genome-wide dissection of the heat stress response (HSR is necessary to overcome problems in crop production caused by global warming. To identify HSR genes, we profiled gene expression in two Chinese cabbage inbred lines with different thermotolerances, Chiifu and Kenshin. Many genes exhibited >2-fold changes in expression upon exposure to 0.5- 4 h at 45°C (high temperature, HT: 5.2% (2,142 genes in Chiifu and 3.7% (1,535 genes in Kenshin. The most enriched GO (Gene Ontology items included 'response to heat', 'response to reactive oxygen species (ROS', 'response to temperature stimulus', 'response to abiotic stimulus', and 'MAPKKK cascade'. In both lines, the genes most highly induced by HT encoded small heat shock proteins (Hsps and heat shock factor (Hsf-like proteins such as HsfB2A (Bra029292, whereas high-molecular weight Hsps were constitutively expressed. Other upstream HSR components were also up-regulated: ROS-scavenging genes like glutathione peroxidase 2 (BrGPX2, Bra022853, protein kinases, and phosphatases. Among heat stress (HS marker genes in Arabidopsis, only exportin 1A (XPO1A (Bra008580, Bra006382 can be applied to B. rapa for basal thermotolerance (BT and short-term acquired thermotolerance (SAT gene. CYP707A3 (Bra025083, Bra021965, which is involved in the dehydration response in Arabidopsis, was associated with membrane leakage in both lines following HS. Although many transcription factors (TF genes, including DREB2A (Bra005852, were involved in HS tolerance in both lines, Bra024224 (MYB41 and Bra021735 (a bZIP/AIR1 [Anthocyanin-Impaired-Response-1] were specific to Kenshin. Several candidate TFs involved in thermotolerance were confirmed as HSR genes by real-time PCR, and these assignments were further supported by promoter analysis. Although some of our findings are similar to those obtained using other plant species, clear differences in Brassica rapa reveal a distinct HSR in this species. Our data could also provide a
Sánchez Timm, Eduardo; Hidalgo Pardo, Lisette; Pacheco Coello, Ricardo; Chávez Navarrete, Tatiana; Navarrete Villegas, Oscar; Santos Ordóñez, Efrén
2016-01-01
Bananas and plantains are considered an important crop around the world. Banana production is affected by several constraints, of which Black Sigatoka Disease, caused by the fungus Mycosphaerella fijiensis, is considered one of the most important diseases in banana plantations. The banana accession 'Calcutta-4' has a natural resistance to Black Sigatoka; however, the fruit is not valuable for commercialization. Gene identification and expression studies in 'Calcutta-4' might reveal possible gene candidates for resistant to the disease and elucidate mechanisms for resistance. A subtracted cDNA library was generated from leaves after 6, 9 and 12 days inoculated with M. fijiensis conidia on greenhouse banana plants of the accession 'Calcutta-4'. Bioinformatic analysis revealed 99 good quality sequences. Blast2go analysis revealed that 31% of the sequences could not be categorized and, according to the Biological Process Category, 32 and 28 ESTs are related to general metabolic and cellular processes, respectively; while 10 ESTs response to stimulus. Seven sequences were redundant and one was similar to genes that may be involved in pathogen resistance including the putative disease resistance protein RGA1. Genes encoding zinc finger domains were identified and may play an important role in pathogen resistance by inducing the expression of downstream genes. Expression analysis of four selected genes was performed using RT-qPCR during the early stage of the disease development at 6, 9, 12 and 15 days post inoculation showing a peak of up regulation at 9 or 12 days post inoculation. Three of the four genes showed an up-regulation of expression in 'Calcutta-4' when compared to 'Williams' after inoculation with M. fijiensis, suggesting a fine regulation of specific gene candidates that may lead to a resistance response. The genes identified in early responses in a plant-pathogen interaction may be relevant for the resistance response of 'Calcutta-4' to Black Sigatoka
Directory of Open Access Journals (Sweden)
Eduardo Sánchez Timm
Full Text Available Bananas and plantains are considered an important crop around the world. Banana production is affected by several constraints, of which Black Sigatoka Disease, caused by the fungus Mycosphaerella fijiensis, is considered one of the most important diseases in banana plantations. The banana accession 'Calcutta-4' has a natural resistance to Black Sigatoka; however, the fruit is not valuable for commercialization. Gene identification and expression studies in 'Calcutta-4' might reveal possible gene candidates for resistant to the disease and elucidate mechanisms for resistance. A subtracted cDNA library was generated from leaves after 6, 9 and 12 days inoculated with M. fijiensis conidia on greenhouse banana plants of the accession 'Calcutta-4'. Bioinformatic analysis revealed 99 good quality sequences. Blast2go analysis revealed that 31% of the sequences could not be categorized and, according to the Biological Process Category, 32 and 28 ESTs are related to general metabolic and cellular processes, respectively; while 10 ESTs response to stimulus. Seven sequences were redundant and one was similar to genes that may be involved in pathogen resistance including the putative disease resistance protein RGA1. Genes encoding zinc finger domains were identified and may play an important role in pathogen resistance by inducing the expression of downstream genes. Expression analysis of four selected genes was performed using RT-qPCR during the early stage of the disease development at 6, 9, 12 and 15 days post inoculation showing a peak of up regulation at 9 or 12 days post inoculation. Three of the four genes showed an up-regulation of expression in 'Calcutta-4' when compared to 'Williams' after inoculation with M. fijiensis, suggesting a fine regulation of specific gene candidates that may lead to a resistance response. The genes identified in early responses in a plant-pathogen interaction may be relevant for the resistance response of 'Calcutta-4' to
Directory of Open Access Journals (Sweden)
Crespo Andre LB
2009-06-01
chymotrypsin-like protease genes, and 1 aminopeptidase genes in the resistant strain as compared with the susceptible strain. In contrast, the expression of 3 trypsin- like and 3 chymotrypsin-like protease genes, 2 aminopeptidase genes, and 2 alkaline phosphatase genes were increased in the resistant strain. Such differential expressions of the candidate genes may suggest their involvement in Cry1Ab resistance. Indeed, certain trypsin-like and chymotrypsin-like proteases have previously been found to activate or degrade Bt protoxins and toxins, whereas several aminopeptidases, cadherin-like proteins and alkaline phosphatases have been demonstrated to serve as Bt receptor proteins in other insect species. Conclusion We developed a relatively large EST database consisting of 12,519 high-quality sequences from a total of 15,000 cDNAs from the larval gut of ECB. To our knowledge, this database represents the largest gut-specific EST database from a lepidopteran pest. Our work provides a foundation for future research to develop an ECB gut-specific DNA microarray which can be used to analyze the global changes of gene expression in response to Bt protoxins/toxins and the genetic difference(s between Bt- resistant and susceptible strains. Furthermore, we identified 52 candidate genes that may potentially be involved in Bt toxicity and resistance. Differential expressions of 15 out of the 41 selected candidate genes examined by RT-PCR, including 5 genes with apparently decreased expression and 10 with increased expression in Cry1Ab-resistant strain, may help us conclusively identify the candidate genes involved in Bt resistance and provide us with new insights into the mechanism of Cry1Ab resistance in ECB.
SNP discovery in candidate adaptive genes using exon capture in a free-ranging alpine ungulate
Gretchen H. Roffler; Stephen J. Amish; Seth Smith; Ted Cosart; Marty Kardos; Michael K. Schwartz; Gordon Luikart
2016-01-01
Identification of genes underlying genomic signatures of natural selection is key to understanding adaptation to local conditions. We used targeted resequencing to identify SNP markers in 5321 candidate adaptive genes associated with known immunological, metabolic and growth functions in ovids and other ungulates. We selectively targeted 8161 exons in protein-coding...
Directory of Open Access Journals (Sweden)
Cintia V. Acuña
2014-12-01
Full Text Available Aim of study: To analyze the feasibility of extrapolating conclusions on wood quality genetic control between different Eucalyptus species, particularly from species with better genomic information, to those less characterized. For this purpose, the first step is to analyze the conservation and cross-transferability of microsatellites markers (SSRs located in candidate genes.Area of study: Eucalyptus species implanted in Argentina coming from different Australian origins.Materials and methods: Twelve validated and polymorphic SSRs in candidate genes (SSR-CGs for wood quality in E. globulus were selected for cross species amplification in six species: E. grandis, E. saligna, E. dunnii, E. viminalis, E. camaldulensis and E. tereticornis.Main results: High cross-species transferability (92% to 100% was found for the 12 polymorphic SSRs detected in E. globulus. These markers revealed allelic diversity in nine important candidate genes: cinnamoyl CoA reductase (CCR, cellulose synthase 3 (CesA3, the transcription factor LIM1, homocysteine S-methyltransferase (HMT, shikimate kinase (SK, xyloglucan endotransglycosylase 2 (XTH2, glutathione S-transferase (GST, glutamate decarboxylase (GAD and peroxidase (PER.Research highlights: The markers described are potentially suitable for comparative QTL mapping, molecular marker assisted breeding (MAB and for population genetic studies across different species within the subgenus Symphyomyrtus.Keywords: validation; cross-transferability; SSR; functional markers; eucalypts; Symphyomyrtus.
Identification of a p53-response element in the promoter of the proline oxidase gene
International Nuclear Information System (INIS)
Maxwell, Steve A.; Kochevar, Gerald J.
2008-01-01
Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site
Identification of microdeletions in candidate genes for cleft lip and/or palate
DEFF Research Database (Denmark)
Shi, Min; Mostowska, Adrianna; Jugessur, Astanand
2009-01-01
for deletion detection. Apparent Mendelian inconsistencies between parents and children suggested deletion events in 15 individuals in 11 genomic regions. We confirmed deletions involving CYP1B1, FGF10, SP8, SUMO1, TBX1, TFAP2A, and UGT7A1, including both de novo and familial cases. Deletions of SUMO1, TBX1......, and TFAP2A are likely to be etiologic. CONCLUSIONS: These deletions suggest the potential roles of genes or regulatory elements contained within deleted regions in the etiology of clefting. Our analysis took advantage of genotypes from a candidate-gene-based SNP survey and proved to be an efficient...... analytical approach to interrogate genes potentially involved in clefting. This can serve as a model to find genes playing a role in complex traits in general....
Targeting 160 candidate genes for blood pressure regulation with a genome-wide genotyping array.
Directory of Open Access Journals (Sweden)
Siim Sõber
2009-06-01
Full Text Available The outcome of Genome-Wide Association Studies (GWAS has challenged the field of blood pressure (BP genetics as previous candidate genes have not been among the top loci in these scans. We used Affymetrix 500K genotyping data of KORA S3 cohort (n = 1,644; Southern-Germany to address (i SNP coverage in 160 BP candidate genes; (ii the evidence for associations with BP traits in genome-wide and replication data, and haplotype analysis. In total, 160 gene regions (genic region+/-10 kb covered 2,411 SNPs across 11.4 Mb. Marker densities in genes varied from 0 (n = 11 to 0.6 SNPs/kb. On average 52.5% of the HAPMAP SNPs per gene were captured. No evidence for association with BP was obtained for 1,449 tested SNPs. Considerable associations (P50% of HAPMAP SNPs were tagged. In general, genes with higher marker density (>0.2 SNPs/kb revealed a better chance to reach close to significance associations. Although, none of the detected P-values remained significant after Bonferroni correction (P<0.05/2319, P<2.15 x 10(-5, the strength of some detected associations was close to this level: rs10889553 (LEPR and systolic BP (SBP (P = 4.5 x 10(-5 as well as rs10954174 (LEP and diastolic BP (DBP (P = 5.20 x 10(-5. In total, 12 markers in 7 genes (ADRA2A, LEP, LEPR, PTGER3, SLC2A1, SLC4A2, SLC8A1 revealed considerable association (P<10(-3 either with SBP, DBP, and/or hypertension (HYP. None of these were confirmed in replication samples (KORA S4, HYPEST, BRIGHT. However, supportive evidence for the association of rs10889553 (LEPR and rs11195419 (ADRA2A with BP was obtained in meta-analysis across samples stratified either by body mass index, smoking or alcohol consumption. Haplotype analysis highlighted LEPR and PTGER3. In conclusion, the lack of associations in BP candidate genes may be attributed to inadequate marker coverage on the genome-wide arrays, small phenotypic effects of the loci and/or complex interaction with life-style and metabolic parameters.
Perceptions of Linguistically Responsive Teaching in Teacher Candidates/Novice Teachers
Tandon, Madhavi; Viesca, Kara Mitchell; Hueston, Colin; Milbourn, Tamara
2017-01-01
This qualitative study examined data from 36 teacher candidates and novice teachers to explore their perceptions and understandings of linguistic responsiveness. The findings illustrate the challenge of demonstrating linguistically responsive teaching practices in the early and initial stages of entering the teaching profession, and more research…
Prioritizing chronic obstructive pulmonary disease (COPD) candidate genes in COPD-related networks.
Zhang, Yihua; Li, Wan; Feng, Yuyan; Guo, Shanshan; Zhao, Xilei; Wang, Yahui; He, Yuehan; He, Weiming; Chen, Lina
2017-11-28
Chronic obstructive pulmonary disease (COPD) is a multi-factor disease, which could be caused by many factors, including disturbances of metabolism and protein-protein interactions (PPIs). In this paper, a weighted COPD-related metabolic network and a weighted COPD-related PPI network were constructed base on COPD disease genes and functional information. Candidate genes in these weighted COPD-related networks were prioritized by making use of a gene prioritization method, respectively. Literature review and functional enrichment analysis of the top 100 genes in these two networks suggested the correlation of COPD and these genes. The performance of our gene prioritization method was superior to that of ToppGene and ToppNet for genes from the COPD-related metabolic network or the COPD-related PPI network after assessing using leave-one-out cross-validation, literature validation and functional enrichment analysis. The top-ranked genes prioritized from COPD-related metabolic and PPI networks could promote the better understanding about the molecular mechanism of this disease from different perspectives. The top 100 genes in COPD-related metabolic network or COPD-related PPI network might be potential markers for the diagnosis and treatment of COPD.
Directory of Open Access Journals (Sweden)
Inês Barroso
2003-10-01
Full Text Available Type 2 diabetes is an increasingly common, serious metabolic disorder with a substantial inherited component. It is characterised by defects in both insulin secretion and action. Progress in identification of specific genetic variants predisposing to the disease has been limited. To complement ongoing positional cloning efforts, we have undertaken a large-scale candidate gene association study. We examined 152 SNPs in 71 candidate genes for association with diabetes status and related phenotypes in 2,134 Caucasians in a case-control study and an independent quantitative trait (QT cohort in the United Kingdom. Polymorphisms in five of 15 genes (33% encoding molecules known to primarily influence pancreatic beta-cell function-ABCC8 (sulphonylurea receptor, KCNJ11 (KIR6.2, SLC2A2 (GLUT2, HNF4A (HNF4alpha, and INS (insulin-significantly altered disease risk, and in three genes, the risk allele, haplotype, or both had a biologically consistent effect on a relevant physiological trait in the QT study. We examined 35 genes predicted to have their major influence on insulin action, and three (9%-INSR, PIK3R1, and SOS1-showed significant associations with diabetes. These results confirm the genetic complexity of Type 2 diabetes and provide evidence that common variants in genes influencing pancreatic beta-cell function may make a significant contribution to the inherited component of this disease. This study additionally demonstrates that the systematic examination of panels of biological candidate genes in large, well-characterised populations can be an effective complement to positional cloning approaches. The absence of large single-gene effects and the detection of multiple small effects accentuate the need for the study of larger populations in order to reliably identify the size of effect we now expect for complex diseases.
The landscape of human genes involved in the immune response to parasitic worms
Directory of Open Access Journals (Sweden)
Fumagalli Matteo
2010-08-01
Full Text Available Abstract Background More than 2 billion individuals worldwide suffer from helminth infections. The highest parasite burdens occur in children and helminth infection during pregnancy is a risk factor for preterm delivery and reduced birth weight. Therefore, helminth infections can be regarded as a strong selective pressure. Results Here we propose that candidate susceptibility genes for parasitic worm infections can be identified by searching for SNPs that display a strong correlation with the diversity of helminth species/genera transmitted in different geographic areas. By a genome-wide search we identified 3478 variants that correlate with helminth diversity. These SNPs map to 810 distinct human genes including loci involved in regulatory T cell function and in macrophage activation, as well as leukocyte integrins and co-inhibitory molecules. Analysis of functional relationships among these genes identified complex interaction networks centred around Th2 cytokines. Finally, several genes carrying candidate targets for helminth-driven selective pressure also harbour susceptibility alleles for asthma/allergy or are involved in airway hyper-responsiveness, therefore expanding the known parallelism between these conditions and parasitic infections. Conclusions Our data provide a landscape of human genes that modulate susceptibility to helminths and indicate parasitic worms as one of the major selective forces in humans.
International Nuclear Information System (INIS)
Konlechner, Cornelia; Türktaş, Mine; Langer, Ingrid; Vaculík, Marek; Wenzel, Walter W.; Puschenreiter, Markus; Hauser, Marie-Theres
2013-01-01
Salix caprea is well suited for phytoextraction strategies. In a previous survey we showed that genetically distinct S. caprea plants isolated from metal-polluted and unpolluted sites differed in their zinc (Zn) and cadmium (Cd) tolerance and accumulation abilities. To determine the molecular basis of this difference we examined putative homologues of genes involved in heavy metal responses and identified over 200 new candidates with a suppression subtractive hybridization (SSH) screen. Quantitative expression analyses of 20 genes in leaves revealed that some metallothioneins and cell wall modifying genes were induced irrespective of the genotype's origin and metal uptake capacity while a cysteine biosynthesis gene was expressed constitutively higher in the metallicolous genotype. The third and largest group of genes was only induced in the metallicolous genotype. These data demonstrate that naturally adapted woody non-model species can help to discover potential novel molecular mechanisms for metal accumulation and tolerance. -- Highlights: ► The transcriptional Zn/Cd response of the willow Salix caprea was quantified. ► Two genotypes from a highly contaminated and a control environment were compared. ► In addition to candidate genes an SSH library revealed over 200 metal induced genes. ► Constitutive upregulation and isolate-specific induction of genes were revealed. ► Willows adapt to environmental Zn/Cd contamination on the transcriptional level. -- Expression analyzes reveal different responses to Cd and Zn exposure of S. caprea genotypes with different heavy metal accumulation abilities
Görücü Yilmaz, Şenay; Erdal, Mehmet E; Avci Özge, Aynur; Sungur, Mehmet A
2016-01-01
Alzheimer disease (AD) is a common complex neurodegenerative disorder accounting for nearly 50% to 70% of dementias worldwide. Yet the current diagnostic options for AD are limited. New diagnostic innovation strategies focusing on novel molecules and pathways are sorely needed. In this connection, microRNAs (miRNAs) are conserved small noncoding RNAs that regulate posttranscriptional gene expression and are vital for neuronal development and its functional sustainability. Conceivably, biological pathways responsible for the biogenesis of miRNAs represent a veritable set of upstream candidate genes that can be potentially associated with the AD pathophysiology. Notably, whereas functional single-nucleotide polymorphisms (SNPs) in miRNA biogenesis pathway genes have been studied in other complex diseases, surprisingly, virtually no such study has been conducted on their relevance in AD. Moreover, novel diagnostics identified in easily accessible peripheral tissues such as the whole blood samples represent the initial entry or gateway points on the biomarker discovery critical path for AD. To the best of our knowledge, we report here the first association study of functional SNPs, as measured by real-time PCR in 10 "upstream" candidate genes critically situated on the miRNA biogenesis pathway, in a large sample of AD patients (N=172) and healthy controls (N=109) in a hitherto understudied world population from the Mersin region of the Eastern Mediterranean. We observed a significant association between 2 candidate genes and AD, TARBP2 rs784567 genotype and AD (χ=6.292, P=0.043), and a trend for RNASEN rs10719 genotype (χ=4.528, P=0.104) and allele (P=0.035). Functional SNP variations in the other 8 candidate genes (DGCR8, XPO5, RAN, DICER1, AGO1, AGO2, GEMIN3, and GEMIN4) did not associate with AD in our sample. Given the putative biological importance of miRNA biogenesis pathways, these emerging data can provide a new foundation to stimulate future debate and
N.V. Zaitseva; O.V. Dolgilh; A.V. Krivtsov; K.G. Starkova; V.A. Luchnikova; O.A. Bubnov; E.A. Otavina; N.V. Bezruchenko; N.A. Vdovina
2015-01-01
A sequencing of the candidate genes of the pupils, exposed to strontium by the method of targeted resequencing has been performed. It is shown, that under conditions of increased revenues of strontium in drinking water the number of polymorphonuclear altered portions of candidate genes increases. As a result of the targeted resequencing in conditions of strontium exposure, the maximum polymorph modifications of the following genes are defined: sulfotransferase 1A1 (SULT1A1) and methylenetetra...
DEFF Research Database (Denmark)
Sørensen, Mette; Nygaard, Marianne; Debrabant, Birgit
2016-01-01
additional genes repeatedly considered as candidates for human longevity: APOE, APOA4, APOC3, ACE, CETP, HFE, IL6, IL6R, MTHFR, TGFB1, SIRTs 1, 3, 6; and HSPAs 1A, 1L, 14. Altogether, 1,049 single nucleotide polymorphisms (SNPs) were genotyped in 1,088 oldest-old (age 92-93 years) Danes and analysed......In this study we explored the association between aging-related phenotypes previously reported to predict survival in old age and variation in 77 genes from the DNA repair pathway, 32 genes from the growth hormone 1/ insulin-like growth factor 1/insulin (GH/IGF-1/INS) signalling pathway and 16...... in the relevant phenotype over time (7 years of follow-up) and none of the SNPs could be confirmed in a replication sample of 1,281 oldest-old Danes (age 94-100). Hence, our study does not support association between common variation in the investigated longevity candidate genes and aging-related phenotypes...
Directory of Open Access Journals (Sweden)
Seungbok Lee
Full Text Available Alopecia areata (AA is a common autoimmune disorder mostly presented as round patches of hair loss and subclassified into alopecia totalis/alopecia universalis (AT/AU based on the area of alopecia. Although AA is relatively common, only 5% of AA patients progress to AT/AU, which affect the whole scalp and whole body respectively. To determine genetic determinants of this orphan disease, we undertook whole-exome sequencing of 6 samples from AU patients, and 26 variants in immune-related genes were selected as candidates. When an additional 14 AU samples were genotyped for these candidates, 6 of them remained at the level of significance in comparison with 155 Asian controls (p<1.92×10(-3. Linkage disequilibrium was observed between some of the most significant SNPs, including rs41559420 of HLA-DRB5 (p<0.001, OR 44.57 and rs28362679 of BTNL2 (p<0.001, OR 30.21. While BTNL2 was reported as a general susceptibility gene of AA previously, HLA-DRB5 has not been implicated in AA. In addition, we found several genetic variants in novel genes (HLA-DMB, TLR1, and PMS2 and discovered an additional locus on HLA-A, a known susceptibility gene of AA. This study provides further evidence for the association of previously reported genes with AA and novel findings such as HLA-DRB5, which might represent a hidden culprit gene for AU.
Dmitriev, Alexey A; Krasnov, George S; Rozhmina, Tatiana A; Novakovskiy, Roman O; Snezhkina, Anastasiya V; Fedorova, Maria S; Yurkevich, Olga Yu; Muravenko, Olga V; Bolsheva, Nadezhda L; Kudryavtseva, Anna V; Melnikova, Nataliya V
2017-12-28
Flax (Linum usitatissimum L.) is a crop plant used for fiber and oil production. Although potentially high-yielding flax varieties have been developed, environmental stresses markedly decrease flax production. Among biotic stresses, Fusarium oxysporum f. sp. lini is recognized as one of the most devastating flax pathogens. It causes wilt disease that is one of the major limiting factors for flax production worldwide. Breeding and cultivation of flax varieties resistant to F. oxysporum is the most effective method for controlling wilt disease. Although the mechanisms of flax response to Fusarium have been actively studied, data on the plant response to infection and resistance gene candidates are currently very limited. The transcriptomes of two resistant and two susceptible flax cultivars with respect to Fusarium wilt, as well as two resistant BC 2 F 5 populations, which were grown under control conditions or inoculated with F. oxysporum, were sequenced using the Illumina platform. Genes showing changes in expression under F. oxysporum infection were identified in both resistant and susceptible flax genotypes. We observed the predominant overexpression of numerous genes that are involved in defense response. This was more pronounced in resistant cultivars. In susceptible cultivars, significant downregulation of genes involved in cell wall organization or biogenesis was observed in response to F. oxysporum. In the resistant genotypes, upregulation of genes related to NAD(P)H oxidase activity was detected. Upregulation of a number of genes, including that encoding beta-1,3-glucanase, was significantly greater in the cultivars and BC 2 F 5 populations resistant to Fusarium wilt than in susceptible cultivars in response to F. oxysporum infection. Using high-throughput sequencing, we identified genes involved in the early defense response of L. usitatissimum against the fungus F. oxysporum. In response to F. oxysporum infection, we detected changes in the
Early embryonic failure: Expression and imprinted status of candidate genes on human chromosome 21
Energy Technology Data Exchange (ETDEWEB)
Sherman, L.S.; Bennett, P.R.; Moore, G.E. [Queen Charlotte`s and Chelsea Hospital, London (United Kingdom)
1994-09-01
Two cases of maternal uniparental (hetero)disomy for human chromosome 21 (mUPD21) have been identified in a systematic search for UPD in 23 cases of early embryonic failure (EEF). Bi-parental origin of the other chromosome pairs was confirmed using specific VNTR probes or dinucleotide repeat analysis. Both maternally and paternally derived isochromosomes 21q have previously been identified in two individuals with normal phenotypes. Full UPD21 has a different mechanism of origin than uniparental isochromosome 21q and its effect on imprinted genes and phenotypic outcome will therefore not necessarily be the same. EEF associated with mUPD21 suggests that developmentally important genes on HSA 21 may be imprinted such that they are only expressed from either the maternally or paternally derived alleles. We have searched for monoallelic expression of candidate genes on HSA 21 in human pregnancy (CBS, IFNAR, COL6A1) using intragenic DNA polymorphisms. These genes were chosen either because their murine homologues lie in imprinted regions or because they are potentially important in embryogenesis. Once imprinted candidate genes have been identified, their methylation status and expression in normal, early embryonic failure and uniparental disomy 21 pregnancies will be studied. At the same time, a larger number of cases of EEF are being examined to further investigate the incidence of UPD21 in this group.
Directory of Open Access Journals (Sweden)
N.V. Zaitseva
2015-12-01
Full Text Available A sequencing of the candidate genes of the pupils, exposed to strontium by the method of targeted resequencing has been performed. It is shown, that under conditions of increased revenues of strontium in drinking water the number of polymorphonuclear altered portions of candidate genes increases. As a result of the targeted resequencing in conditions of strontium exposure, the maximum polymorph modifications of the following genes are defined: sulfotransferase 1A1 (SULT1A1 and methylenetetrahydrofolate. It was shown that the structure of the mutations in conditions of the strontium exposure was characterized by the formation of defects in the gene mapping detoxification (38.5 % of all mutations and immunoregulation (22.5 %. Analysis of the cause-effect relationships in the system "factor - the number of mutations" revealed that candidate genes reflecting strontium exposure conditions (content of strontium in drinking water is 1.3 MAC, are genes: cytochrome P450, glutathione - transaminase (detoxification; dopamine (CNS, interleukin 17 and the major histocompatibility complex (immune system, methylene-tetra-hydro-folate-reductase (reproduction.
VennPainter: A Tool for the Comparison and Identification of Candidate Genes Based on Venn Diagrams.
Directory of Open Access Journals (Sweden)
Guoliang Lin
Full Text Available VennPainter is a program for depicting unique and shared sets of genes lists and generating Venn diagrams, by using the Qt C++ framework. The software produces Classic Venn, Edwards' Venn and Nested Venn diagrams and allows for eight sets in a graph mode and 31 sets in data processing mode only. In comparison, previous programs produce Classic Venn and Edwards' Venn diagrams and allow for a maximum of six sets. The software incorporates user-friendly features and works in Windows, Linux and Mac OS. Its graphical interface does not require a user to have programing skills. Users can modify diagram content for up to eight datasets because of the Scalable Vector Graphics output. VennPainter can provide output results in vertical, horizontal and matrix formats, which facilitates sharing datasets as required for further identification of candidate genes. Users can obtain gene lists from shared sets by clicking the numbers on the diagram. Thus, VennPainter is an easy-to-use, highly efficient, cross-platform and powerful program that provides a more comprehensive tool for identifying candidate genes and visualizing the relationships among genes or gene families in comparative analysis.
Directory of Open Access Journals (Sweden)
Irina A Zalenskaya
Full Text Available Inflammation and immune activation of the cervicovaginal mucosa are considered factors that increase susceptibility to HIV infection. Therefore, it is essential to screen candidate anti-HIV microbicides for potential mucosal immunomodulatory/inflammatory effects prior to further clinical development. The goal of this study was to develop an in vitro method for preclinical evaluation of the inflammatory potential of new candidate microbicides using a microarray gene expression profiling strategy.To this end, we compared transcriptomes of human vaginal cells (Vk2/E6E7 treated with well-characterized pro-inflammatory (PIC and non-inflammatory (NIC compounds. PICs included compounds with different mechanisms of action. Gene expression was analyzed using Affymetrix U133 Plus 2 arrays. Data processing was performed using GeneSpring 11.5 (Agilent Technologies, Santa Clara, CA.Microarraray comparative analysis allowed us to generate a panel of 20 genes that were consistently deregulated by PICs compared to NICs, thus distinguishing between these two groups. Functional analysis mapped 14 of these genes to immune and inflammatory responses. This was confirmed by the fact that PICs induced NFkB pathway activation in Vk2 cells. By testing microbicide candidates previously characterized in clinical trials we demonstrated that the selected PIC-associated genes properly identified compounds with mucosa-altering effects. The discriminatory power of these genes was further demonstrated after culturing vaginal cells with vaginal bacteria. Prevotella bivia, prevalent bacteria in the disturbed microbiota of bacterial vaginosis, induced strong upregulation of seven selected PIC-associated genes, while a commensal Lactobacillus gasseri associated to vaginal health did not cause any changes.In vitro evaluation of the immunoinflammatory potential of microbicides using the PIC-associated genes defined in this study could help in the initial screening of candidates prior
Energy Technology Data Exchange (ETDEWEB)
Stein, J.D.; Nelson, L.D.; Conner, B.J. [Univ. of Texas, Houston (United States)] [and others
1994-09-01
Nonsyndromic cleft lip with or without cleft palate (CL(P)) involves fusion or growth failure of facial primordia during development. Complex segregation analysis of clefting populations suggest that an autosomal dominant gene may play a role in this common craniofacial disorder. We have ascertained 16 multigenerational families with CL(P) and tested linkage to 29 candidate genes and 139 mapped short tandem repeat markers. The candidate genes were selected based on their expression in craniofacial development or were identified through murine models. These include: TGF{alpha}, TGF{beta}1, TGF{beta}2, TGF{beta}3, EGF, EGFR, GRAS, cMyc, FGFR, Jun, JunB, PDFG{alpha}, PDGF{beta}, IGF2R, GCR Hox7, Hox8, Hox2B, twirler, 5 collagen and 3 extracellular matrix genes. Linkage was tested assuming an autosomal dominant model with sex-specific decreased penetrance. Linkage to all of the candidate loci was excluded in 11 families. RARA was tested and was not informative. However, haplotype analysis of markers flanking RARA on 17q allowed exclusion of this candidate locus. We have previously excluded linkage to 61 STR markers in 11 families. Seventy-eight mapped short tandem repeat markers have recently been tested in 16 families and 30 have been excluded. The remaining are being analyzed and an exclusion map is being developed based on the entire study results.
Directory of Open Access Journals (Sweden)
Fatou K. Ndiaye
2017-06-01
Full Text Available Objectives: Genome-wide association studies (GWAS have identified >100 loci independently contributing to type 2 diabetes (T2D risk. However, translational implications for precision medicine and for the development of novel treatments have been disappointing, due to poor knowledge of how these loci impact T2D pathophysiology. Here, we aimed to measure the expression of genes located nearby T2D associated signals and to assess their effect on insulin secretion from pancreatic beta cells. Methods: The expression of 104 candidate T2D susceptibility genes was measured in a human multi-tissue panel, through PCR-free expression assay. The effects of the knockdown of beta-cell enriched genes were next investigated on insulin secretion from the human EndoC-βH1 beta-cell line. Finally, we performed RNA-sequencing (RNA-seq so as to assess the pathways affected by the knockdown of the new genes impacting insulin secretion from EndoC-βH1, and we analyzed the expression of the new genes in mouse models with altered pancreatic beta-cell function. Results: We found that the candidate T2D susceptibility genes' expression is significantly enriched in pancreatic beta cells obtained by laser capture microdissection or sorted by flow cytometry and in EndoC-βH1 cells, but not in insulin sensitive tissues. Furthermore, the knockdown of seven T2D-susceptibility genes (CDKN2A, GCK, HNF4A, KCNK16, SLC30A8, TBC1D4, and TCF19 with already known expression and/or function in beta cells changed insulin secretion, supporting our functional approach. We showed first evidence for a role in insulin secretion of four candidate T2D-susceptibility genes (PRC1, SRR, ZFAND3, and ZFAND6 with no previous knowledge of presence and function in beta cells. RNA-seq in EndoC-βH1 cells with decreased expression of PRC1, SRR, ZFAND6, or ZFAND3 identified specific gene networks related to T2D pathophysiology. Finally, a positive correlation between the expression of Ins2 and the
A comprehensive candidate gene approach identifies genetic variation associated with osteosarcoma
International Nuclear Information System (INIS)
Mirabello, Lisa; Grotmol, Tom; Douglass, Chester; Hayes, Richard B; Hoover, Robert N; Savage, Sharon A; Yu, Kai; Berndt, Sonja I; Burdett, Laurie; Wang, Zhaoming; Chowdhury, Salma; Teshome, Kedest; Uzoka, Arinze; Hutchinson, Amy
2011-01-01
Osteosarcoma (OS) is a bone malignancy which occurs primarily in adolescents. Since it occurs during a period of rapid growth, genes important in bone formation and growth are plausible modifiers of risk. Genes involved in DNA repair and ribosomal function may contribute to OS pathogenesis, because they maintain the integrity of critical cellular processes. We evaluated these hypotheses in an OS association study of genes from growth/hormone, bone formation, DNA repair, and ribosomal pathways. We evaluated 4836 tag-SNPs across 255 candidate genes in 96 OS cases and 1426 controls. Logistic regression models were used to estimate the odds ratios (OR) and 95% confidence intervals (CI). Twelve SNPs in growth or DNA repair genes were significantly associated with OS after Bonferroni correction. Four SNPs in the DNA repair gene FANCM (ORs 1.9-2.0, P = 0.003-0.004) and 2 SNPs downstream of the growth hormone gene GH1 (OR 1.6, P = 0.002; OR 0.5, P = 0.0009) were significantly associated with OS. One SNP in the region of each of the following genes was significant: MDM2, MPG, FGF2, FGFR3, GNRH2, and IGF1. Our results suggest that several SNPs in biologically plausible pathways are associated with OS. Larger studies are required to confirm our findings
Tsuchida, Shuichi; Kagi, Akiko; Koyama, Hidekazu; Tagawa, Masahiro
2007-12-01
Xanthine urolithiasis was found in a 4-year-old spayed female Himalayan cat with a 10-month history of intermittent haematuria and dysuria. Ultrasonographs indicated the existence of several calculi in the bladder that were undetectable by survey radiographic examination. Four bladder stones were removed by cystotomy. The stones were spherical brownish-yellow and their surface was smooth and glossy. Quantitative mineral analysis showed a representative urolith to be composed of more than 95% xanthine. Ultrasonographic examination of the bladder 4.5 months postoperatively indicated the recurrence of urolithiasis. Analysis of purine concentration in urine and blood showed that the cat excreted excessive amounts of xanthine. In order to test the hypothesis that xanthinuria was caused by a homozygote of the inherited mutant allele of a gene responsible for deficiency of enzyme activity in purine degradation pathway, the allele composition of xanthine dehydrogenase (XDH) gene (one of the candidate genes for hereditary xanthinuria) was evaluated. The cat with xanthinuria was a heterozygote of the polymorphism. A single nucleotide polymorphism analysis of the cat XDH gene strongly indicated that the XDH gene of the patient cat was composed of two kinds of alleles and ruled out the hypothesis that the cat inherited the same recessive XDH allele suggesting no activity from a single ancestor.
DEFF Research Database (Denmark)
Banasik, Karina; Justesen, Johanne M.; Hornbak, Malene
2011-01-01
Objective: Candidate genes for non-alcoholic fatty liver disease (NAFLD) identified by a bioinformatics approach were examined for variant associations to quantitative traits of NAFLD-related phenotypes. Research Design and Methods: By integrating public database text mining, trans-organism protein...
A meta-analysis based method for prioritizing candidate genes involved in a pre-specific function
Directory of Open Access Journals (Sweden)
Jingjing Zhai
2016-12-01
Full Text Available The identification of genes associated with a given biological function in plants remains a challenge, although network-based gene prioritization algorithms have been developed for Arabidopsis thaliana and many non-model plant species. Nevertheless, these network-based gene prioritization algorithms have encountered several problems; one in particular is that of unsatisfactory prediction accuracy due to limited network coverage, varying link quality, and/or uncertain network connectivity. Thus a model that integrates complementary biological data may be expected to increase the prediction accuracy of gene prioritization. Towards this goal, we developed a novel gene prioritization method named RafSee, to rank candidate genes using a random forest algorithm that integrates sequence, evolutionary, and epigenetic features of plants. Subsequently, we proposed an integrative approach named RAP (Rank Aggregation-based data fusion for gene Prioritization, in which an order statistics-based meta-analysis was used to aggregate the rank of the network-based gene prioritization method and RafSee, for accurately prioritizing candidate genes involved in a pre-specific biological function. Finally, we showcased the utility of RAP by prioritizing 380 flowering-time genes in Arabidopsis. The ‘leave-one-out’ cross-validation experiment showed that RafSee could work as a complement to a current state-of-art network-based gene prioritization system (AraNet v2. Moreover, RAP ranked 53.68% (204/380 flowering-time genes higher than AraNet v2, resulting in an 39.46% improvement in term of the first quartile rank. Further evaluations also showed that RAP was effective in prioritizing genes-related to different abiotic stresses. To enhance the usability of RAP for Arabidopsis and non-model plant species, an R package implementing the method is freely available at http://bioinfo.nwafu.edu.cn/software.
Directory of Open Access Journals (Sweden)
Asis Shrestha
Full Text Available Manganese (Mn is an essential micro-nutrient for plants, but flooded rice fields can accumulate high levels of Mn2+ leading to Mn toxicity. Here, we present a genome-wide association study (GWAS to identify candidate loci conferring Mn toxicity tolerance in rice (Oryza sativa L.. A diversity panel of 288 genotypes was grown in hydroponic solutions in a greenhouse under optimal and toxic Mn concentrations. We applied a Mn toxicity treatment (5 ppm Mn2+, 3 weeks at twelve days after transplanting. Mn toxicity caused moderate damage in rice in terms of biomass loss and symptom formation despite extremely high shoot Mn concentrations ranging from 2.4 to 17.4 mg g-1. The tropical japonica subpopulation was more sensitive to Mn toxicity than other subpopulations. Leaf damage symptoms were significantly correlated with Mn uptake into shoots. Association mapping was conducted for seven traits using 416741 single nucleotide polymorphism (SNP markers using a mixed linear model, and detected six significant associations for the traits shoot manganese concentration and relative shoot length. Candidate regions contained genes coding for a heavy metal transporter, peroxidase precursor and Mn2+ ion binding proteins. The significant marker SNP-2.22465867 caused an amino acid change in a gene (LOC_Os02g37170 with unknown function. This study demonstrated significant natural variation in rice for Mn toxicity tolerance and the possibility of using GWAS to unravel genetic factors responsible for such complex traits.
Directory of Open Access Journals (Sweden)
Jansen Rodrigo Pereira Santos
Full Text Available Cowpea is one of the most important food and forage legumes in drier regions of the tropics and subtropics. However, cowpea yield worldwide is markedly below the known potential due to abiotic and biotic stresses, including parasitism by root-knot nematodes (Meloidogyne spp., RKN. Two resistance genes with dominant effect, Rk and Rk2, have been reported to provide resistance against RKN in cowpea. Despite their description and use in breeding for resistance to RKN and particularly genetic mapping of the Rk locus, the exact genes conferring resistance to RKN remain unknown. In the present work, QTL mapping using recombinant inbred line (RIL population 524B x IT84S-2049 segregating for a newly mapped locus and analysis of the transcriptome changes in two cowpea near-isogenic lines (NIL were used to identify candidate genes for Rk and the newly mapped locus. A major QTL, designated QRk-vu9.1, associated with resistance to Meloidogyne javanica reproduction, was detected and mapped on linkage group LG9 at position 13.37 cM using egg production data. Transcriptome analysis on resistant and susceptible NILs 3 and 9 days after inoculation revealed up-regulation of 109 and 98 genes and down-regulation of 110 and 89 genes, respectively, out of 19,922 unique genes mapped to the common bean reference genome. Among the differentially expressed genes, four and nine genes were found within the QRk-vu9.1 and QRk-vu11.1 QTL intervals, respectively. Six of these genes belong to the TIR-NBS-LRR family of resistance genes and three were upregulated at one or more time-points. Quantitative RT-PCR validated gene expression to be positively correlated with RNA-seq expression pattern for eight genes. Future functional analysis of these cowpea genes will enhance our understanding of Rk-mediated resistance and identify the specific gene responsible for the resistance.
Identifying Candidate Reprogramming Genes in Mouse Induced Pluripotent Stem Cells.
Gao, Fang; Li, Jingyu; Zhang, Heng; Yang, Xu; An, Tiezhu
2017-08-01
Factor-based induced reprogramming approaches have tremendous potential for human regenerative medicine, but the efficiencies of these approaches are still low. In this study, we analyzed the global transcriptional profiles of mouse induced pluripotent stem cells (miPSCs) and mouse embryonic stem cells (mESCs) from seven different labs and present here the first successful clustering according to cell type, not by lab of origin. We identified 2131 different expression genes (DEs) as candidate pluripotency-associated genes by comparing mESCs/miPSCs with somatic cells and 720 DEs between miPSCs and mESCs. Interestingly, there was a significant overlap between the two DE sets. Therefore, we defined the overlap DEs as "consensus DEs" including 313 miPSC-specific genes expressed at a higher level in miPSCs versus mESCs and 184 mESC-specific genes in total and reasoned that these may contribute to the differences in pluripotency between mESCs and miPSCs. A classification of "consensus DEs" according to their different expression levels between somatic cells and mESCs/miPSCs shows that 86% of the miPSC-specific genes are more highly expressed in somatic cells, while 73% of mESC-specific genes are highly expressed in mESCs/miPSCs, indicating that the miPSCs have not efficiently silenced the expression pattern of the somatic cells from which they are derived and failed to completely induce the genes with high expression levels in mESCs. We further revealed a strong correlation between oocyte-enriched factors and insufficiently induced mESC-specific genes and identified 11 hub genes via network analysis. In light of these findings, we postulated that these key hub genes might not only drive somatic cell nuclear transfer (SCNT) reprogramming but also augment the efficiency and quality of miPSC reprogramming.
Raskin, Leon; Guo, Yan; Du, Liping; Clendenning, Mark; Rosty, Christophe; Lindor, Noralane M; Gruber, Stephen B; Buchanan, Daniel D
2017-11-07
The underlying genetic cause of colorectal cancer (CRC) can be identified for 5-10% of all cases, while at least 20% of CRC cases are thought to be due to inherited genetic factors. Screening for highly penetrant mutations in genes associated with Mendelian cancer syndromes using next-generation sequencing (NGS) can be prohibitively expensive for studies requiring large samples sizes. The aim of the study was to identify rare single nucleotide variants and small indels in 40 established or candidate CRC susceptibility genes in 1,046 familial CRC cases (including both MSS and MSI-H tumor subtypes) and 1,006 unrelated controls from the Colon Cancer Family Registry Cohort using a robust and cost-effective DNA pooling NGS strategy. We identified 264 variants in 38 genes that were observed only in cases, comprising either very rare (minor allele frequency cancer susceptibility genes BAP1, CDH1, CHEK2, ENG, and MSH3 . For the candidate CRC genes, we identified likely pathogenic variants in the helicase domain of POLQ and in the LRIG1 , SH2B3 , and NOS1 genes and present their clinicopathological characteristics. Using a DNA pooling NGS strategy, we identified novel germline mutations in established CRC susceptibility genes in familial CRC cases. Further studies are required to support the role of POLQ , LRIG1 , SH2B3 and NOS1 as CRC susceptibility genes.
Directory of Open Access Journals (Sweden)
Atkins John F
2010-01-01
Full Text Available Abstract Background Overlapping genes are common in RNA viruses where they serve as a mechanism to optimize the coding potential of compact genomes. However, annotation of overlapping genes can be difficult using conventional gene-finding software. Recently we have been using a number of complementary approaches to systematically identify previously undetected overlapping genes in RNA virus genomes. In this article we gather together a number of promising candidate new overlapping genes that may be of interest to the community. Results Overlapping gene predictions are presented for the astroviruses, seadornaviruses, cytorhabdoviruses and coronaviruses (families Astroviridae, Reoviridae, Rhabdoviridae and Coronaviridae, respectively.
Directory of Open Access Journals (Sweden)
Rajani Rai
2015-11-01
Full Text Available Gallbladder cancer is the most common and a highly aggressive biliary tract malignancy with a dismal outcome. The pathogenesis of the disease is multifactorial, comprising the combined effect of multiple genetic variations of mild consequence along with numerous dietary and environmental risk factors. Previously, we demonstrated the association of several candidate gene variations with GBC risk. In this study, we aimed to identify the combination of gene variants and their possible interactions contributing towards genetic susceptibility of GBC. Here, we performed Multifactor-Dimensionality Reduction (MDR and Classification and Regression Tree Analysis (CRT to investigate the gene–gene interactions and the combined effect of 14 SNPs in nine genes (DR4 (rs20576, rs6557634; FAS (rs2234767; FASL (rs763110; DCC (rs2229080, rs4078288, rs7504990, rs714; PSCA (rs2294008, rs2978974; ADRA2A (rs1801253; ADRB1 (rs1800544; ADRB3 (rs4994; CYP17 (rs2486758 involved in various signaling pathways. Genotyping was accomplished by PCR-RFLP or Taqman allelic discrimination assays. SPSS software version 16.0 and MDR software version 2.0 were used for all the statistical analysis. Single locus investigation demonstrated significant association of DR4 (rs20576, rs6557634, DCC (rs714, rs2229080, rs4078288 and ADRB3 (rs4994 polymorphisms with GBC risk. MDR analysis revealed ADRB3 (rs4994 to be crucial candidate in GBC susceptibility that may act either alone (p < 0.0001, CVC = 10/10 or in combination with DCC (rs714 and rs2229080, p < 0.0001, CVC = 9/10. Our CRT results are in agreement with the above findings. Further, in-silico results of studied SNPs advocated their role in splicing, transcriptional and/or protein coding regulation. Overall, our result suggested complex interactions amongst the studied SNPs and ADRB3 rs4994 as candidate influencing GBC susceptibility.
Maria F. Pomponio; Susana Marcucci Poltri; Diego Lopez Lauenstein; Susana Torales
2014-01-01
Aim of the study: Identify and compare SNPs on candidate genes related to abiotic stress in Prosopis chilensis, Prosopis flexuosa and interspecific hybridsArea of the study: Chaco árido, Argentina. Material and Methods: Fragments from 6 candidate genes were sequenced in 60 genotypes. DNA polymorphisms were analyzed.Main Results: The analysis revealed that the hybrids had the highest rate of polymorphism, followed by P. flexuosa and P. chilensis, the values found are comparable to other forest...
Directory of Open Access Journals (Sweden)
Kathiravan Periasamy
Full Text Available Sheep chromosome 3 (Oar3 has the largest number of QTLs reported to be significantly associated with resistance to gastro-intestinal nematodes. This study aimed to identify single nucleotide polymorphisms (SNPs within candidate genes located in sheep chromosome 3 as well as genes involved in major immune pathways. A total of 41 SNPs were identified across 38 candidate genes in a panel of unrelated sheep and genotyped in 713 animals belonging to 22 breeds across Asia, Europe and South America. The variations and evolution of immune pathway genes were assessed in sheep populations across these macro-environmental regions that significantly differ in the diversity and load of pathogens. The mean minor allele frequency (MAF did not vary between Asian and European sheep reflecting the absence of ascertainment bias. Phylogenetic analysis revealed two major clusters with most of South Asian, South East Asian and South West Asian breeds clustering together while European and South American sheep breeds clustered together distinctly. Analysis of molecular variance revealed strong phylogeographic structure at loci located in immune pathway genes, unlike microsatellite and genome wide SNP markers. To understand the influence of natural selection processes, SNP loci located in chromosome 3 were utilized to reconstruct haplotypes, the diversity of which showed significant deviations from selective neutrality. Reduced Median network of reconstructed haplotypes showed balancing selection in force at these loci. Preliminary association of SNP genotypes with phenotypes recorded 42 days post challenge revealed significant differences (P<0.05 in fecal egg count, body weight change and packed cell volume at two, four and six SNP loci respectively. In conclusion, the present study reports strong phylogeographic structure and balancing selection operating at SNP loci located within immune pathway genes. Further, SNP loci identified in the study were found to have
Transcriptome Analysis of Early Responsive Genes in Rice during Magnaporthe oryzae Infection
Directory of Open Access Journals (Sweden)
Yiming Wang
2014-12-01
Full Text Available Rice blast disease caused by Magnaporthe oryzae is one of the most serious diseases of cultivated rice (Oryza sativa L. in most rice-growing regions of the world. In order to investigate early response genes in rice, we utilized the transcriptome analysis approach using a 300 K tilling microarray to rice leaves infected with compatible and incompatible M. oryzae strains. Prior to the microarray experiment, total RNA was validated by measuring the differential expression of rice defense-related marker genes (chitinase 2, barwin, PBZ1, and PR-10 by RT-PCR, and phytoalexins (sakuranetin and momilactone A with HPLC. Microarray analysis revealed that 231 genes were up-regulated (>2 fold change, p < 0.05 in the incompatible interaction compared to the compatible one. Highly expressed genes were functionally characterized into metabolic processes and oxidation-reduction categories. The oxidative stress response was induced in both early and later infection stages. Biotic stress overview from MapMan analysis revealed that the phytohormone ethylene as well as signaling molecules jasmonic acid and salicylic acid is important for defense gene regulation. WRKY and Myb transcription factors were also involved in signal transduction processes. Additionally, receptor-like kinases were more likely associated with the defense response, and their expression patterns were validated by RT-PCR. Our results suggest that candidate genes, including receptor-like protein kinases, may play a key role in disease resistance against M. oryzae attack.
International Nuclear Information System (INIS)
Wang, Xuting; Tomso, Daniel J.; Liu Xuemei; Bell, Douglas A.
2005-01-01
Single nucleotide polymorphisms (SNPs) in the human genome are DNA sequence variations that can alter an individual's response to environmental exposure. SNPs in gene coding regions can lead to changes in the biological properties of the encoded protein. In contrast, SNPs in non-coding gene regulatory regions may affect gene expression levels in an allele-specific manner, and these functional polymorphisms represent an important but relatively unexplored class of genetic variation. The main challenge in analyzing these SNPs is a lack of robust computational and experimental methods. Here, we first outline mechanisms by which genetic variation can impact gene regulation, and review recent findings in this area; then, we describe a methodology for bioinformatic discovery and functional analysis of regulatory SNPs in cis-regulatory regions using the assembled human genome sequence and databases on sequence polymorphism and gene expression. Our method integrates SNP and gene databases and uses a set of computer programs that allow us to: (1) select SNPs, from among the >9 million human SNPs in the NCBI dbSNP database, that are similar to cis-regulatory element (RE) consensus sequences; (2) map the selected dbSNP entries to the human genome assembly in order to identify polymorphic REs near gene start sites; (3) prioritize the candidate polymorphic RE containing genes by searching the existing genotype and gene expression data sets. The applicability of this system has been demonstrated through studies on p53 responsive elements and is being extended to additional pathways and environmentally responsive genes
Patankar, Himanshu V; Al-Harrasi, Ibtisam; Al-Yahyai, Rashid; Yaish, Mahmoud W
2018-06-01
Although date palm is a relatively salt-tolerant plant, the molecular basis of this tolerance is complex and poorly understood. Therefore, this study aimed to identify the genes involved in salinity tolerance using a basic yeast functional bioassay. To achieve this, a date palm cDNA library was overexpressed in Saccharomyces cerevisiae cells. The expression levels of selected genes that make yeast cells tolerant to salt were subsequently validated in the leaf and root tissues of date palm seedlings using a quantitative PCR method. About 6000 yeast transformant cells were replica printed and screened on a synthetic minimal medium containing 1.0 M of NaCl. The screening results showed the presence of 62 salt-tolerant transformant colonies. Sequence analysis of the recombinant yeast plasmids revealed the presence of a group of genes with potential salt-tolerance functions, such as aquaporins (PIP), serine/threonine protein kinases (STKs), ethylene-responsive transcription factor 1 (ERF1), and peroxidases (PRX). The expression pattern of the selected genes endorsed the hypothesis that these genes may be involved in salinity tolerance, as they showed a significant (p < 0.05) overexpression trend in both the leaf and root tissues in response to salinity. The genes identified in this project are suitable candidates for the further functional characterization of date palms.
Halimaa, Pauliina; Lin, Ya-Fen; Ahonen, Viivi H; Blande, Daniel; Clemens, Stephan; Gyenesei, Attila; Häikiö, Elina; Kärenlampi, Sirpa O; Laiho, Asta; Aarts, Mark G M; Pursiheimo, Juha-Pekka; Schat, Henk; Schmidt, Holger; Tuomainen, Marjo H; Tervahauta, Arja I
2014-03-18
Populations of Noccaea caerulescens show tremendous differences in their capacity to hyperaccumulate and hypertolerate metals. To explore the differences that could contribute to these traits, we undertook SOLiD high-throughput sequencing of the root transcriptomes of three phenotypically well-characterized N. caerulescens accessions, i.e., Ganges, La Calamine, and Monte Prinzera. Genes with possible contribution to zinc, cadmium, and nickel hyperaccumulation and hypertolerance were predicted. The most significant differences between the accessions were related to metal ion (di-, trivalent inorganic cation) transmembrane transporter activity, iron and calcium ion binding, (inorganic) anion transmembrane transporter activity, and antioxidant activity. Analysis of correlation between the expression profile of each gene and the metal-related characteristics of the accessions disclosed both previously characterized (HMA4, HMA3) and new candidate genes (e.g., for nickel IRT1, ZIP10, and PDF2.3) as possible contributors to the hyperaccumulation/tolerance phenotype. A number of unknown Noccaea-specific transcripts also showed correlation with Zn(2+), Cd(2+), or Ni(2+) hyperaccumulation/tolerance. This study shows that N. caerulescens populations have evolved great diversity in the expression of metal-related genes, facilitating adaptation to various metalliferous soils. The information will be helpful in the development of improved plants for metal phytoremediation.
Meta-analysis and candidate gene mining of low-phosphorus tolerance in maize.
Zhang, Hongwei; Uddin, Mohammed Shalim; Zou, Cheng; Xie, Chuanxiao; Xu, Yunbi; Li, Wen-Xue
2014-03-01
Plants with tolerance to low-phosphorus (P) can grow better under low-P conditions, and understanding of genetic mechanisms of low-P tolerance can not only facilitate identifying relevant genes but also help to develop low-P tolerant cultivars. QTL meta-analysis was conducted after a comprehensive review of the reports on QTL mapping for low-P tolerance-related traits in maize. Meta-analysis produced 23 consensus QTL (cQTL), 17 of which located in similar chromosome regions to those previously reported to influence root traits. Meanwhile, candidate gene mining yielded 215 genes, 22 of which located in the cQTL regions. These 22 genes are homologous to 14 functionally characterized genes that were found to participate in plant low-P tolerance, including genes encoding miR399s, Pi transporters and purple acid phosphatases. Four cQTL loci (cQTL2-1, cQTL5-3, cQTL6-2, and cQTL10-2) may play important roles for low-P tolerance because each contains more original QTL and has better consistency across previous reports. © 2014 Institute of Botany, Chinese Academy of Sciences.
Influence of SNPs in nutrient-sensitive candidate genes and gene-diet interactions on blood lipids
DEFF Research Database (Denmark)
Brahe, Lena Kirchner; Angquist, Lars; Larsen, Lesli Hingstrup
2013-01-01
Blood lipid response to a given dietary intervention could be determined by the effect of diet, gene variants or gene-diet interactions. The objective of the present study was to investigate whether variants in presumed nutrient-sensitive genes involved in lipid metabolism modified lipid profile ...
Hook, Paul W; McClymont, Sarah A; Cannon, Gabrielle H; Law, William D; Morton, A Jennifer; Goff, Loyal A; McCallion, Andrew S
2018-03-01
Genetic variation modulating risk of sporadic Parkinson disease (PD) has been primarily explored through genome-wide association studies (GWASs). However, like many other common genetic diseases, the impacted genes remain largely unknown. Here, we used single-cell RNA-seq to characterize dopaminergic (DA) neuron populations in the mouse brain at embryonic and early postnatal time points. These data facilitated unbiased identification of DA neuron subpopulations through their unique transcriptional profiles, including a postnatal neuroblast population and substantia nigra (SN) DA neurons. We use these population-specific data to develop a scoring system to prioritize candidate genes in all 49 GWAS intervals implicated in PD risk, including genes with known PD associations and many with extensive supporting literature. As proof of principle, we confirm that the nigrostriatal pathway is compromised in Cplx1-null mice. Ultimately, this systematic approach establishes biologically pertinent candidates and testable hypotheses for sporadic PD, informing a new era of PD genetic research. Copyright © 2018 American Society of Human Genetics. All rights reserved.
Walsh, Kyle M; Anderson, Erik; Hansen, Helen M; Decker, Paul A; Kosel, Matt L; Kollmeyer, Thomas; Rice, Terri; Zheng, Shichun; Xiao, Yuanyuan; Chang, Jeffrey S; McCoy, Lucie S; Bracci, Paige M; Wiemels, Joe L; Pico, Alexander R; Smirnov, Ivan; Lachance, Daniel H; Sicotte, Hugues; Eckel-Passow, Jeanette E; Wiencke, John K; Jenkins, Robert B; Wrensch, Margaret R
2013-02-01
Genomewide association studies (GWAS) and candidate-gene studies have implicated single-nucleotide polymorphisms (SNPs) in at least 45 different genes as putative glioma risk factors. Attempts to validate these associations have yielded variable results and few genetic risk factors have been consistently replicated. We conducted a case-control study of Caucasian glioma cases and controls from the University of California San Francisco (810 cases, 512 controls) and the Mayo Clinic (852 cases, 789 controls) in an attempt to replicate previously reported genetic risk factors for glioma. Sixty SNPs selected from the literature (eight from GWAS and 52 from candidate-gene studies) were successfully genotyped on an Illumina custom genotyping panel. Eight SNPs in/near seven different genes (TERT, EGFR, CCDC26, CDKN2A, PHLDB1, RTEL1, TP53) were significantly associated with glioma risk in the combined dataset (P 0.05). Although several confirmed associations are located near genes long known to be involved in gliomagenesis (e.g., EGFR, CDKN2A, TP53), these associations were first discovered by the GWAS approach and are in noncoding regions. These results highlight that the deficiencies of the candidate-gene approach lay in selecting both appropriate genes and relevant SNPs within these genes. © 2012 WILEY PERIODICALS, INC.
Patterns of linkage disequilibrium and haplotype distribution in disease candidate genes.
Long, Ji-Rong; Zhao, Lan-Juan; Liu, Peng-Yuan; Lu, Yan; Dvornyk, Volodymyr; Shen, Hui; Liu, Yong-Jun; Zhang, Yuan-Yuan; Xiong, Dong-Hai; Xiao, Peng; Deng, Hong-Wen
2004-05-24
The adequacy of association studies for complex diseases depends critically on the existence of linkage disequilibrium (LD) between functional alleles and surrounding SNP markers. We examined the patterns of LD and haplotype distribution in eight candidate genes for osteoporosis and/or obesity using 31 SNPs in 1,873 subjects. These eight genes are apolipoprotein E (APOE), type I collagen alpha1 (COL1A1), estrogen receptor-alpha (ER-alpha), leptin receptor (LEPR), parathyroid hormone (PTH)/PTH-related peptide receptor type 1 (PTHR1), transforming growth factor-beta1 (TGF-beta1), uncoupling protein 3 (UCP3), and vitamin D (1,25-dihydroxyvitamin D3) receptor (VDR). Yin yang haplotypes, two high-frequency haplotypes composed of completely mismatching SNP alleles, were examined. To quantify LD patterns, two common measures of LD, D' and r2, were calculated for the SNPs within the genes. The haplotype distribution varied in the different genes. Yin yang haplotypes were observed only in PTHR1 and UCP3. D' ranged from 0.020 to 1.000 with the average of 0.475, whereas the average r2 was 0.158 (ranging from 0.000 to 0.883). A decay of LD was observed as the intermarker distance increased, however, there was a great difference in LD characteristics of different genes or even in different regions within gene. The differences in haplotype distributions and LD patterns among the genes underscore the importance of characterizing genomic regions of interest prior to association studies.
Directory of Open Access Journals (Sweden)
Ferrell Robert E
2011-01-01
Full Text Available Abstract Background Abdominal aortic aneurysm (AAA is a complex disorder with multiple genetic risk factors. Using affected relative pair linkage analysis, we previously identified an AAA susceptibility locus on chromosome 19q13. This locus has been designated as the AAA1 susceptibility locus in the Online Mendelian Inheritance in Man (OMIM database. Methods Nine candidate genes were selected from the AAA1 locus based on their function, as well as mRNA expression levels in the aorta. A sample of 394 cases and 419 controls was genotyped for 41 SNPs located in or around the selected nine candidate genes using the Illumina GoldenGate platform. Single marker and haplotype analyses were performed. Three genes (CEBPG, PEPD and CD22 were selected for DNA sequencing based on the association study results, and exonic regions were analyzed. Immunohistochemical staining of aortic tissue sections from AAA and control individuals was carried out for the CD22 and PEPD proteins with specific antibodies. Results Several SNPs were nominally associated with AAA (p CEBPG, peptidase D (PEPD, and CD22. Haplotype analysis found a nominally associated 5-SNP haplotype in the CEBPG/PEPD locus, as well as a nominally associated 2-SNP haplotype in the CD22 locus. DNA sequencing of the coding regions revealed no variation in CEBPG. Seven sequence variants were identified in PEPD, including three not present in the NCBI SNP (dbSNP database. Sequencing of all 14 exons of CD22 identified 20 sequence variants, five of which were in the coding region and six were in the 3'-untranslated region. Five variants were not present in dbSNP. Immunohistochemical staining for CD22 revealed protein expression in lymphocytes present in the aneurysmal aortic wall only and no detectable expression in control aorta. PEPD protein was expressed in fibroblasts and myofibroblasts in the media-adventitia border in both aneurysmal and non-aneurysmal tissue samples. Conclusions Association testing
DEFF Research Database (Denmark)
Jones, Sophie; Grignard, Lynn; Nebie, Issa
2015-01-01
for the future evaluation of vaccine immunogenicity and efficacy in populations naturally exposed to malaria. METHODS: We determined naturally acquired antibody responses to the recombinant proteins Pfs48/45-10C and Pfs230-230CMB in children from three malaria endemic settings in Ghana, Tanzania and Burkina Faso......OBJECTIVES: Pfs48/45 and Pfs230 are Plasmodium falciparum sexual stage proteins and promising malaria transmission-blocking vaccine candidates. Antibody responses against these proteins may be naturally acquired and target antigens may be under selective pressure. This has consequences....... We also examined genetic polymorphisms in the P. falciparum gene pfs48/45. RESULTS: Antibody prevalence was 1.1-18.2% for 10C and 6.7-18.9% for 230CMB. In Burkina Faso we observed evidence of an age-dependent acquisition pattern for both 10C (p assays...
Directory of Open Access Journals (Sweden)
Meki Shehabu Muktar
2015-09-01
Full Text Available Late blight of potato (Solanum tuberosum L. caused by the oomycete Phytophthora infestans (Mont. de Bary, is one of the most important bottlenecks of potato production worldwide. Cultivars with high levels of durable, race unspecific, quantitative resistance are part of a solution to this problem. However, breeding for quantitative resistance is hampered by the correlation between resistance and late plant maturity, which is an undesirable agricultural attribute. The objectives of our research are (i the identification of genes that condition quantitative resistance to P. infestans not compromised by late plant maturity and (ii the discovery of diagnostic single nucleotide polymorphism (SNP markers to be used as molecular tools to increase efficiency and precision of resistance breeding. Twenty two novel candidate genes were selected based on comparative transcript profiling by SuperSAGE (serial analysis of gene expression in groups of plants with contrasting levels of maturity corrected resistance (MCR. Reproducibility of differential expression was tested by quantitative real time PCR and allele specific pyrosequencing in four new sets of genotype pools with contrasting late blight resistance levels, at three infection time points and in three independent infection experiments. Reproducibility of expression patterns ranged from 28% to 97%. Association mapping in a panel of 184 tetraploid cultivars identified SNPs in five candidate genes that were associated with MCR. These SNPs can be used in marker-assisted resistance breeding. Linkage mapping in two half-sib families (n = 111 identified SNPs in three candidate genes that were linked with MCR. The differentially expressed genes that showed association and/or linkage with MCR putatively function in phytosterol synthesis, fatty acid synthesis, asparagine synthesis, chlorophyll synthesis, cell wall modification and in the response to pathogen elicitors.
Mao, Guangzhi; Ma, Qiang; Wei, Hengling; Su, Junji; Wang, Hantao; Ma, Qifeng; Fan, Shuli; Song, Meizhen; Zhang, Xianlong; Yu, Shuxun
2018-02-01
The young leaves of virescent mutants are yellowish and gradually turn green as the plants reach maturity. Understanding the genetic basis of virescent mutants can aid research of the regulatory mechanisms underlying chloroplast development and chlorophyll biosynthesis, as well as contribute to the application of virescent traits in crop breeding. In this study, fine mapping was employed, and a recessive gene (v 1 ) from a virescent mutant of Upland cotton was narrowed to an 84.1-Kb region containing ten candidate genes. The GhChlI gene encodes the cotton Mg-chelatase I subunit (CHLI) and was identified as the candidate gene for the virescent mutation using gene annotation. BLAST analysis showed that the GhChlI gene has two copies, Gh_A10G0282 and Gh_D10G0283. Sequence analysis indicated that the coding region (CDS) of GhChlI is 1269 bp in length, with three predicted exons and one non-synonymous nucleotide mutation (G1082A) in the third exon of Gh_D10G0283, with an amino acid (AA) substitution of arginine (R) to lysine (K). GhChlI-silenced TM-1 plants exhibited a lower GhChlI expression level, a lower chlorophyll content, and the virescent phenotype. Analysis of upstream regulatory elements and expression levels of GhChlI showed that the expression quantity of GhChlI may be normal, and with the development of the true leaf, the increase in the Gh_A10G0282 dosage may partially make up for the deficiency of Gh_D10G0283 in the v 1 mutant. Phylogenetic analysis and sequence alignment revealed that the protein sequence encoded by the third exon of GhChlI is highly conserved across diverse plant species, in which AA substitutions among the completely conserved residues frequently result in changes in leaf color in various species. These results suggest that the mutation (G1082A) within the GhChlI gene may cause a functional defect of the GhCHLI subunit and thus the virescent phenotype in the v 1 mutant. The GhChlI mutation not only provides a tool for understanding the
Uddin, Raihan; Singh, Shiva M
2017-01-01
As humans age many suffer from a decrease in normal brain functions including spatial learning impairments. This study aimed to better understand the molecular mechanisms in age-associated spatial learning impairment (ASLI). We used a mathematical modeling approach implemented in Weighted Gene Co-expression Network Analysis (WGCNA) to create and compare gene network models of young (learning unimpaired) and aged (predominantly learning impaired) brains from a set of exploratory datasets in rats in the context of ASLI. The major goal was to overcome some of the limitations previously observed in the traditional meta- and pathway analysis using these data, and identify novel ASLI related genes and their networks based on co-expression relationship of genes. This analysis identified a set of network modules in the young, each of which is highly enriched with genes functioning in broad but distinct GO functional categories or biological pathways. Interestingly, the analysis pointed to a single module that was highly enriched with genes functioning in "learning and memory" related functions and pathways. Subsequent differential network analysis of this "learning and memory" module in the aged (predominantly learning impaired) rats compared to the young learning unimpaired rats allowed us to identify a set of novel ASLI candidate hub genes. Some of these genes show significant repeatability in networks generated from independent young and aged validation datasets. These hub genes are highly co-expressed with other genes in the network, which not only show differential expression but also differential co-expression and differential connectivity across age and learning impairment. The known function of these hub genes indicate that they play key roles in critical pathways, including kinase and phosphatase signaling, in functions related to various ion channels, and in maintaining neuronal integrity relating to synaptic plasticity and memory formation. Taken together, they
Pacheco Coello, Ricardo; Chávez Navarrete, Tatiana; Navarrete Villegas, Oscar; Santos Ordóñez, Efrén
2016-01-01
Bananas and plantains are considered an important crop around the world. Banana production is affected by several constraints, of which Black Sigatoka Disease, caused by the fungus Mycosphaerella fijiensis, is considered one of the most important diseases in banana plantations. The banana accession ‘Calcutta-4’ has a natural resistance to Black Sigatoka; however, the fruit is not valuable for commercialization. Gene identification and expression studies in ‘Calcutta-4’ might reveal possible gene candidates for resistant to the disease and elucidate mechanisms for resistance. A subtracted cDNA library was generated from leaves after 6, 9 and 12 days inoculated with M. fijiensis conidia on greenhouse banana plants of the accession ‘Calcutta-4’. Bioinformatic analysis revealed 99 good quality sequences. Blast2go analysis revealed that 31% of the sequences could not be categorized and, according to the Biological Process Category, 32 and 28 ESTs are related to general metabolic and cellular processes, respectively; while 10 ESTs response to stimulus. Seven sequences were redundant and one was similar to genes that may be involved in pathogen resistance including the putative disease resistance protein RGA1. Genes encoding zinc finger domains were identified and may play an important role in pathogen resistance by inducing the expression of downstream genes. Expression analysis of four selected genes was performed using RT-qPCR during the early stage of the disease development at 6, 9, 12 and 15 days post inoculation showing a peak of up regulation at 9 or 12 days post inoculation. Three of the four genes showed an up-regulation of expression in ‘Calcutta-4’ when compared to ‘Williams’ after inoculation with M. fijiensis, suggesting a fine regulation of specific gene candidates that may lead to a resistance response. The genes identified in early responses in a plant-pathogen interaction may be relevant for the resistance response of ‘Calcutta-4
Directory of Open Access Journals (Sweden)
Miller Nicola
2007-11-01
Full Text Available Abstract Background Real-time quantitative PCR (RQ-PCR forms the basis of many breast cancer biomarker studies and novel prognostic assays, paving the way towards personalised cancer treatments. Normalisation of relative RQ-PCR data is required to control for non-biological variation introduced during sample preparation. Endogenous control (EC genes, used in this context, should ideally be expressed constitutively and uniformly across treatments in all test samples. Despite widespread recognition that the accuracy of the normalised data is largely dependent on the reliability of the EC, there are no reports of the systematic validation of genes commonly used for this purpose in the analysis of gene expression by RQ-PCR in primary breast cancer tissues. The aim of this study was to identify the most suitable endogenous control genes for RQ-PCR analysis of primary breast tissue from a panel of eleven candidates in current use. Oestrogen receptor alpha (ESR1 was used a target gene to compare the effect of choice of EC on the estimate of gene quantity. Results The expression and validity of candidate ECs (GAPDH, TFRC, ABL, PPIA, HPRT1, RPLP0, B2M, GUSB, MRPL19, PUM1 and PSMC4 was determined in 6 benign and 21 malignant primary breast cancer tissues. Gene expression data was analysed using two different statistical models. MRPL19 and PPIA were identified as the most stable and reliable EC genes, while GUSB, RPLP0 and ABL were least stable. There was a highly significant difference in variance between ECs. ESR1 expression was appreciably higher in malignant compared to benign tissues and there was a significant effect of EC on the magnitude of the error associated with the relative quantity of ESR1. Conclusion We have validated two endogenous control genes, MRPL19 and PPIA, for RQ-PCR analysis of gene expression in primary breast tissue. Of the genes in current use in this field, the above combination offers increased accuracy and resolution in the
Baker, J B; Dutta, D; Watson, D; Maddala, T; Munneke, B M; Shak, S; Rowinsky, E K; Xu, L-A; Harbison, C T; Clark, E A; Mauro, D J; Khambata-Ford, S
2011-02-01
Although it is accepted that metastatic colorectal cancers (mCRCs) that carry activating mutations in KRAS are unresponsive to anti-epidermal growth factor receptor (EGFR) monoclonal antibodies, a significant fraction of KRAS wild-type (wt) mCRCs are also unresponsive to anti-EGFR therapy. Genes encoding EGFR ligands amphiregulin (AREG) and epiregulin (EREG) are promising gene expression-based markers but have not been incorporated into a test to dichotomise KRAS wt mCRC patients with respect to sensitivity to anti-EGFR treatment. We used RT-PCR to test 110 candidate gene expression markers in primary tumours from 144 KRAS wt mCRC patients who received monotherapy with the anti-EGFR antibody cetuximab. Results were correlated with multiple clinical endpoints: disease control, objective response, and progression-free survival (PFS). Expression of many of the tested candidate genes, including EREG and AREG, strongly associate with all clinical endpoints. Using multivariate analysis with two-layer five-fold cross-validation, we constructed a four-gene predictive classifier. Strikingly, patients below the classifier cutpoint had PFS and disease control rates similar to those of patients with KRAS mutant mCRC. Gene expression appears to identify KRAS wt mCRC patients who receive little benefit from cetuximab. It will be important to test this model in an independent validation study.
Directory of Open Access Journals (Sweden)
Sebastian Moschen
Full Text Available Cultivated sunflower (Helianthus annuus L., an important source of edible vegetable oil, shows rapid onset of senescence, which limits production by reducing photosynthetic capacity under specific growing conditions. Carbon for grain filling depends strongly on light interception by green leaf area, which diminishes during grain filling due to leaf senescence. Transcription factors (TFs regulate the progression of leaf senescence in plants and have been well explored in model systems, but information for many agronomic crops remains limited. Here, we characterize the expression profiles of a set of putative senescence associated genes (SAGs identified by a candidate gene approach and sunflower microarray expression studies. We examined a time course of sunflower leaves undergoing natural senescence and used quantitative PCR (qPCR to measure the expression of 11 candidate genes representing the NAC, WRKY, MYB and NF-Y TF families. In addition, we measured physiological parameters such as chlorophyll, total soluble sugars and nitrogen content. The expression of Ha-NAC01, Ha-NAC03, Ha-NAC04, Ha-NAC05 and Ha-MYB01 TFs increased before the remobilization rate increased and therefore, before the appearance of the first physiological symptoms of senescence, whereas Ha-NAC02 expression decreased. In addition, we also examined the trifurcate feed-forward pathway (involving ORE1, miR164, and ethylene insensitive 2 previously reported for Arabidopsis. We measured transcription of Ha-NAC01 (the sunflower homolog of ORE1 and Ha-EIN2, along with the levels of miR164, in two leaves from different stem positions, and identified differences in transcription between basal and upper leaves. Interestingly, Ha-NAC01 and Ha-EIN2 transcription profiles showed an earlier up-regulation in upper leaves of plants close to maturity, compared with basal leaves of plants at pre-anthesis stages. These results suggest that the H. annuus TFs characterized in this work could
Moschen, Sebastian; Bengoa Luoni, Sofia; Paniego, Norma B; Hopp, H Esteban; Dosio, Guillermo A A; Fernandez, Paula; Heinz, Ruth A
2014-01-01
Cultivated sunflower (Helianthus annuus L.), an important source of edible vegetable oil, shows rapid onset of senescence, which limits production by reducing photosynthetic capacity under specific growing conditions. Carbon for grain filling depends strongly on light interception by green leaf area, which diminishes during grain filling due to leaf senescence. Transcription factors (TFs) regulate the progression of leaf senescence in plants and have been well explored in model systems, but information for many agronomic crops remains limited. Here, we characterize the expression profiles of a set of putative senescence associated genes (SAGs) identified by a candidate gene approach and sunflower microarray expression studies. We examined a time course of sunflower leaves undergoing natural senescence and used quantitative PCR (qPCR) to measure the expression of 11 candidate genes representing the NAC, WRKY, MYB and NF-Y TF families. In addition, we measured physiological parameters such as chlorophyll, total soluble sugars and nitrogen content. The expression of Ha-NAC01, Ha-NAC03, Ha-NAC04, Ha-NAC05 and Ha-MYB01 TFs increased before the remobilization rate increased and therefore, before the appearance of the first physiological symptoms of senescence, whereas Ha-NAC02 expression decreased. In addition, we also examined the trifurcate feed-forward pathway (involving ORE1, miR164, and ethylene insensitive 2) previously reported for Arabidopsis. We measured transcription of Ha-NAC01 (the sunflower homolog of ORE1) and Ha-EIN2, along with the levels of miR164, in two leaves from different stem positions, and identified differences in transcription between basal and upper leaves. Interestingly, Ha-NAC01 and Ha-EIN2 transcription profiles showed an earlier up-regulation in upper leaves of plants close to maturity, compared with basal leaves of plants at pre-anthesis stages. These results suggest that the H. annuus TFs characterized in this work could play important
DEFF Research Database (Denmark)
de Kovel, Carolien G F; Brilstra, Eva H; van Kempen, Marjan J A
2016-01-01
BACKGROUND: Many genes are candidates for involvement in epileptic encephalopathy (EE) because one or a few possibly pathogenic variants have been found in patients, but insufficient genetic or functional evidence exists for a definite annotation. METHODS: To increase the number of validated EE...
Energy Technology Data Exchange (ETDEWEB)
Goodman, A.B. [Columbia Univ. School of Public Health, New York, NY (United States)
1994-09-15
Among relatives of Ashkenazi schizophrenic probands the rate of amyotrophic lateral sclerosis was 3/1,000, compared to expected population rates of approximately 2/100,000. Relative risk of bleeding disorders, including hematologic cancers, was increased more than three-fold compared to controls. Co-occurrence of motor neuron disease and blood dyscrasias, accompanied by psychosis, has long been recognized. A virally-mediated autoimmune pathogenesis has been proposed. However, the familial co-occurrence of these three disease entities raises the possibility that the disease constellation be considered as a manifestation of a common underlying genetic defect. Such expansion of the spectrum of affectation might enhance the power of both candidate gene and linkage studies. Based on these findings, the loci suggested as candidate regions in schizophrenia include a potential hot spot on chromosome 21q21-q22, involving the superoxide dismutase and amyloid precursor protein genes. Alternatively, genes on other chromosomes involved in the expression, transcription, or regulation of these genes, or associated with the illnesses of high frequency in these pedigrees are suggested. Candidates include the choroid plexus transport protein, transthyretin at 18q11.2-q12.1; the t(14;18)(q22;21) characterizing B-cell lymphoma-2, the most common form of hematologic cancer; and the 14q24 locus of early onset Alzheimer`s disease, c-Fos, transforming growth factor beta 3, and heat shock protein A2. Expression of hematologic cancers and the suggested candidate genes are known to involve retinoid pathways, and retinoid disregulation has been proposed as a cause of schizophrenia. 67 refs., 2 figs., 1 tab.
Deep Sequencing of 71 Candidate Genes to Characterize Variation Associated with Alcohol Dependence.
Clark, Shaunna L; McClay, Joseph L; Adkins, Daniel E; Kumar, Gaurav; Aberg, Karolina A; Nerella, Srilaxmi; Xie, Linying; Collins, Ann L; Crowley, James J; Quackenbush, Corey R; Hilliard, Christopher E; Shabalin, Andrey A; Vrieze, Scott I; Peterson, Roseann E; Copeland, William E; Silberg, Judy L; McGue, Matt; Maes, Hermine; Iacono, William G; Sullivan, Patrick F; Costello, Elizabeth J; van den Oord, Edwin J
2017-04-01
Previous genomewide association studies (GWASs) have identified a number of putative risk loci for alcohol dependence (AD). However, only a few loci have replicated and these replicated variants only explain a small proportion of AD risk. Using an innovative approach, the goal of this study was to generate hypotheses about potentially causal variants for AD that can be explored further through functional studies. We employed targeted capture of 71 candidate loci and flanking regions followed by next-generation deep sequencing (mean coverage 78X) in 806 European Americans. Regions included in our targeted capture library were genes identified through published GWAS of alcohol, all human alcohol and aldehyde dehydrogenases, reward system genes including dopaminergic and opioid receptors, prioritized candidate genes based on previous associations, and genes involved in the absorption, distribution, metabolism, and excretion of drugs. We performed single-locus tests to determine if any single variant was associated with AD symptom count. Sets of variants that overlapped with biologically meaningful annotations were tested for association in aggregate. No single, common variant was significantly associated with AD in our study. We did, however, find evidence for association with several variant sets. Two variant sets were significant at the q-value <0.10 level: a genic enhancer for ADHFE1 (p = 1.47 × 10 -5 ; q = 0.019), an alcohol dehydrogenase, and ADORA1 (p = 5.29 × 10 -5 ; q = 0.035), an adenosine receptor that belongs to a G-protein-coupled receptor gene family. To our knowledge, this is the first sequencing study of AD to examine variants in entire genes, including flanking and regulatory regions. We found that in addition to protein coding variant sets, regulatory variant sets may play a role in AD. From these findings, we have generated initial functional hypotheses about how these sets may influence AD. Copyright © 2017 by the Research Society on
Directory of Open Access Journals (Sweden)
Jan E Aagaard
Full Text Available Understanding the genetic basis of reproductive isolation promises insight into speciation and the origins of biological diversity. While progress has been made in identifying genes underlying barriers to reproduction that function after fertilization (post-zygotic isolation, we know much less about earlier acting pre-zygotic barriers. Of particular interest are barriers involved in mating and fertilization that can evolve extremely rapidly under sexual selection, suggesting they may play a prominent role in the initial stages of reproductive isolation. A significant challenge to the field of speciation genetics is developing new approaches for identification of candidate genes underlying these barriers, particularly among non-traditional model systems. We employ powerful proteomic and genomic strategies to study the genetic basis of conspecific pollen precedence, an important component of pre-zygotic reproductive isolation among yellow monkeyflowers (Mimulus spp. resulting from male pollen competition. We use isotopic labeling in combination with shotgun proteomics to identify more than 2,000 male function (pollen tube proteins within maternal reproductive structures (styles of M. guttatus flowers where pollen competition occurs. We then sequence array-captured pollen tube exomes from a large outcrossing population of M. guttatus, and identify those genes with evidence of selective sweeps or balancing selection consistent with their role in pollen competition. We also test for evidence of positive selection on these genes more broadly across yellow monkeyflowers, because a signal of adaptive divergence is a common feature of genes causing reproductive isolation. Together the molecular evolution studies identify 159 pollen tube proteins that are candidate genes for conspecific pollen precedence. Our work demonstrates how powerful proteomic and genomic tools can be readily adapted to non-traditional model systems, allowing for genome-wide screens
A family with X-linked anophthalmia: exclusion of SOX3 as a candidate gene.
Slavotinek, Anne; Lee, Stephen S; Hamilton, Steven P
2005-10-01
We report on a four-generation family with X-linked anophthalmia in four affected males and show that this family has LOD scores consistent with linkage to Xq27, the third family reported to be linked to the ANOP1 locus. We sequenced the SOX3 gene at Xq27 as a candidate gene for the X-linked anophthalmia based on the high homology of this gene to SOX2, a gene previously mutated in bilateral anophthlamia. However, no amino acid sequence alterations were identified in SOX3. We have improved the definition of the phenotype in males with anophthalmia linked to the ANOP1 locus, as microcephaly, ocular colobomas, and severe renal malformations have not been described in families linked to ANOP1. (c) 2005 Wiley-Liss, Inc.
Smith, Gilbert; Macias-Muñoz, Aide; Briscoe, Adriana D
2016-09-02
Heliconius possess a unique ability among butterflies to feed on pollen. Pollen feeding significantly extends their lifespan, and is thought to have been important to the diversification of the genus. We used RNA sequencing to examine feeding-related gene expression in the mouthparts of four species of Heliconius and one nonpollen feeding species, Eueides isabella We hypothesized that genes involved in morphology and protein metabolism might be upregulated in Heliconius because they have longer proboscides than Eueides, and because pollen contains more protein than nectar. Using de novo transcriptome assemblies, we tested these hypotheses by comparing gene expression in mouthparts against antennae and legs. We first looked for genes upregulated in mouthparts across all five species and discovered several hundred genes, many of which had functional annotations involving metabolism of proteins (cocoonase), lipids, and carbohydrates. We then looked specifically within Heliconius where we found eleven common upregulated genes with roles in morphology (CPR cuticle proteins), behavior (takeout-like), and metabolism (luciferase-like). Closer examination of these candidates revealed that cocoonase underwent several duplications along the lineage leading to heliconiine butterflies, including two Heliconius-specific duplications. Luciferase-like genes also underwent duplication within lepidopterans, and upregulation in Heliconius mouthparts. Reverse-transcription PCR confirmed that three cocoonases, a peptidase, and one luciferase-like gene are expressed in the proboscis with little to no expression in labial palps and salivary glands. Our results suggest pollen feeding, like other dietary specializations, was likely facilitated by adaptive expansions of preexisting genes-and that the butterfly proboscis is involved in digestive enzyme production. © The Author(s) 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Directory of Open Access Journals (Sweden)
Yue-zhi Wang
Full Text Available Sand pear (Pyrus pyrifolia russet pericarp is an important trait affecting both the quality and stress tolerance of fruits. This trait is controlled by a relative complex genetic process, with some fundamental biological questions such as how many and which genes are involved in the process remaining elusive. In this study, we explored differentially expressed genes between the russet- and green-pericarp offspring from the sand pear (Pyrus pyrifolia cv. 'Qingxiang' × 'Cuiguan' F1 group by RNA-seq-based bulked segregant analysis (BSA. A total of 29,100 unigenes were identified and 206 of which showed significant differences in expression level (log2fold values>1 between the two types of pericarp pools. Gene Ontology (GO analyses detected 123 unigenes in GO terms related to 'cellular_component' and 'biological_process', suggesting developmental and growth differentiations between the two types. GO categories associated with various aspects of 'lipid metabolic processes', 'transport', 'response to stress', 'oxidation-reduction process' and more were enriched with genes with divergent expressions between the two libraries. Detailed examination of a selected set of these categories revealed repressed expressions of candidate genes for suberin, cutin and wax biosynthesis in the russet pericarps.Genes encoding putative cinnamoyl-CoA reductase (CCR, cinnamyl alcohol dehydrogenase (CAD and peroxidase (POD that are involved in the lignin biosynthesis were suggested to be candidates for pigmentation of sand pear russet pericarps. Nine differentially expressed genes were analyzed for their expressions using qRT-PCR and the results were consistent with those obtained from Illumina RNA-sequencing. This study provides a comprehensive molecular biology insight into the sand pear pericarp pigmentation and appearance quality formation.
DEFF Research Database (Denmark)
Refsgaard, Lena; Olesen, Morten Salling; Møller, Daniel Vega
2012-01-01
INTRODUCTION: Arrhythmogenic right ventricular cardiomyopathy (ARVC) is a genetically determined heart disease characterized by fibrofatty infiltrations in the myocardium, right and/or left ventricular involvement, and ventricular tachyarrhythmias. Although ten genes have been associated with ARVC......, only about 40% of the patients have an identifiable disease-causing mutation. In the present study we aimed at investigating the involvement of the genes SCN1B-SCN4B, FHL1, and LMNA in the pathogenesis of ARVC. METHODS: Sixty-five unrelated patients (55 fulfilling ARVC criteria and 10 borderline cases...... of the variants was non-synonymous. No disease-causing mutations were identified. CONCLUSIONS: In our limited sized cohort the six studied candidate genes were not associated with ARVC....
Aghnoum, R.; Marcel, T.C.; Johrde, A.; Pecchioni, N.; Schweizer, P.; Niks, R.E.
2010-01-01
The basal resistance of barley to powdery mildew (Blumeria graminis f. sp. hordei) is a quantitatively inherited trait that is based on nonhypersensitive mechanisms of defense. A functional genomic approach indicates that many plant candidate genes are involved in the defense against formation of
Directory of Open Access Journals (Sweden)
Xueyan Shan
2011-06-01
Full Text Available A public candidate gene testing pipeline for resistance to aflatoxin accumulation or Aspergillus flavus infection in maize is presented here. The pipeline consists of steps for identifying, testing, and verifying the association of selected maize gene sequences with resistance under field conditions. Resources include a database of genetic and protein sequences associated with the reduction in aflatoxin contamination from previous studies; eight diverse inbred maize lines for polymorphism identification within any maize gene sequence; four Quantitative Trait Loci (QTL mapping populations and one association mapping panel, all phenotyped for aflatoxin accumulation resistance and associated phenotypes; and capacity for Insertion/Deletion (InDel and SNP genotyping in the population(s for mapping. To date, ten genes have been identified as possible candidate genes and put through the candidate gene testing pipeline, and results are presented here to demonstrate the utility of the pipeline.
Talukder, Zahirul I; Hulke, Brent S; Qi, Lili; Scheffler, Brian E; Pegadaraju, Venkatramana; McPhee, Kevin; Gulya, Thomas J
2014-01-01
Functional markers for Sclerotinia basal stalk rot resistance in sunflower were obtained using gene-level information from the model species Arabidopsis thaliana. Sclerotinia stalk rot, caused by Sclerotinia sclerotiorum, is one of the most destructive diseases of sunflower (Helianthus annuus L.) worldwide. Markers for genes controlling resistance to S. sclerotiorum will enable efficient marker-assisted selection (MAS). We sequenced eight candidate genes homologous to Arabidopsis thaliana defense genes known to be associated with Sclerotinia disease resistance in a sunflower association mapping population evaluated for Sclerotinia stalk rot resistance. The total candidate gene sequence regions covered a concatenated length of 3,791 bp per individual. A total of 187 polymorphic sites were detected for all candidate gene sequences, 149 of which were single nucleotide polymorphisms (SNPs) and 38 were insertions/deletions. Eight SNPs in the coding regions led to changes in amino acid codons. Linkage disequilibrium decay throughout the candidate gene regions declined on average to an r (2) = 0.2 for genetic intervals of 120 bp, but extended up to 350 bp with r (2) = 0.1. A general linear model with modification to account for population structure was found the best fitting model for this population and was used for association mapping. Both HaCOI1-1 and HaCOI1-2 were found to be strongly associated with Sclerotinia stalk rot resistance and explained 7.4 % of phenotypic variation in this population. These SNP markers associated with Sclerotinia stalk rot resistance can potentially be applied to the selection of favorable genotypes, which will significantly improve the efficiency of MAS during the development of stalk rot resistant cultivars.
Bazzi, Gaia; Podofillini, Stefano; Gatti, Emanuele; Gianfranceschi, Luca; Cecere, Jacopo G; Spina, Fernando; Saino, Nicola; Rubolini, Diego
2017-10-01
The timing of major life-history events, such as migration and moult, is set by endogenous circadian and circannual clocks, that have been well characterized at the molecular level. Conversely, the genetic sources of variation in phenology and in other behavioral traits have been sparsely addressed. It has been proposed that inter-individual variability in the timing of seasonal events may arise from allelic polymorphism at phenological candidate genes involved in the signaling cascade of the endogenous clocks. In this study of a long-distance migratory passerine bird, the willow warbler Phylloscopus trochilus , we investigated whether allelic variation at 5 polymorphic loci of 4 candidate genes ( Adcyap1 , Clock , Creb1 , and Npas2 ), predicted 2 major components of the annual schedule, namely timing of spring migration across the central Mediterranean sea and moult speed, the latter gauged from ptilochronological analyses of tail feathers moulted in the African winter quarters. We identified a novel Clock gene locus ( Clock region 3) showing polyQ polymorphism, which was however not significantly associated with any phenotypic trait. Npas2 allele size predicted male (but not female) spring migration date, with males bearing longer alleles migrating significantly earlier than those bearing shorter alleles. Creb1 allele size significantly predicted male (but not female) moult speed, longer alleles being associated with faster moult. All other genotype-phenotype associations were statistically non-significant. These findings provide new evidence for a role of candidate genes in modulating the phenology of different circannual activities in long-distance migratory birds, and for the occurrence of sex-specific candidate gene effects.
Directory of Open Access Journals (Sweden)
Valheria Castiblanco
2018-01-01
Full Text Available Fusarium culmorum is one of the species causing Fusarium head blight (FHB in cereals in Europe. We aimed to investigate the association between the nucleotide diversity of ten F. culmorum candidate genes and field ratings of aggressiveness in winter rye. A total of 100 F. culmorum isolates collected from natural infections were phenotyped for FHB at two locations and two years. Variance components for aggressiveness showed significant isolate and isolate-by-environment variance, as expected for quantitative host-pathogen interactions. Further analysis of the isolate-by-environment interaction revealed the dominant role of the isolate-by-year over isolate-by-location interaction. One single-nucleotide polymorphism (SNP in the cutinase (CUT gene was found to be significantly (p < 0.001 associated with aggressiveness and explained 16.05% of the genotypic variance of this trait in rye. The SNP was located 60 base pairs before the start codon, which suggests a role in transcriptional regulation. Compared to a previous study in winter wheat with the same nucleotide sequences, a larger variation of pathogen aggressiveness on rye was found and a different candidate gene was associated with pathogen aggressiveness. This is the first report on the association of field aggressiveness and a host-specific candidate gene codifying for a protein that belongs to the secretome in F. culmorum.
Whole Exome Sequencing in Females with Autism Implicates Novel and Candidate Genes
Directory of Open Access Journals (Sweden)
Merlin G. Butler
2015-01-01
Full Text Available Classical autism or autistic disorder belongs to a group of genetically heterogeneous conditions known as Autism Spectrum Disorders (ASD. Heritability is estimated as high as 90% for ASD with a recently reported compilation of 629 clinically relevant candidate and known genes. We chose to undertake a descriptive next generation whole exome sequencing case study of 30 well-characterized Caucasian females with autism (average age, 7.7 ± 2.6 years; age range, 5 to 16 years from multiplex families. Genomic DNA was used for whole exome sequencing via paired-end next generation sequencing approach and X chromosome inactivation status. The list of putative disease causing genes was developed from primary selection criteria using machine learning-derived classification score and other predictive parameters (GERP2, PolyPhen2, and SIFT. We narrowed the variant list to 10 to 20 genes and screened for biological significance including neural development, function and known neurological disorders. Seventy-eight genes identified met selection criteria ranging from 1 to 9 filtered variants per female. Five females presented with functional variants of X-linked genes (IL1RAPL1, PIR, GABRQ, GPRASP2, SYTL4 with cadherin, protocadherin and ankyrin repeat gene families most commonly altered (e.g., CDH6, FAT2, PCDH8, CTNNA3, ANKRD11. Other genes related to neurogenesis and neuronal migration (e.g., SEMA3F, MIDN, were also identified.
Dynamic QTL analysis and candidate gene mapping for waterlogging tolerance at maize seedling stage.
Directory of Open Access Journals (Sweden)
Khalid A Osman
Full Text Available Soil waterlogging is one of the major abiotic stresses adversely affecting maize growth and yield. To identify dynamic expression of genes or quantitative trait loci (QTL, QTL associated with plant height, root length, root dry weight, shoot dry weight and total dry weight were identified via conditional analysis in a mixed linear model and inclusive composite interval mapping method at three respective periods under waterlogging and control conditions. A total of 13, 19 and 23 QTL were detected at stages 3D|0D (the period during 0-3 d of waterlogging, 6D|3D and 9D|6D, respectively. The effects of each QTL were moderate and distributed over nine chromosomes, singly explaining 4.14-18.88% of the phenotypic variation. Six QTL (ph6-1, rl1-2, sdw4-1, sdw7-1, tdw4-1 and tdw7-1 were identified at two consistent stages of seedling development, which could reflect a continuous expression of genes; the remaining QTL were detected at only one stage. Thus, expression of most QTL was influenced by the developmental status. In order to provide additional evidence regarding the role of corresponding genes in waterlogging tolerance, mapping of Expressed Sequence Tags markers and microRNAs were conducted. Seven candidate genes were observed to co-localize with the identified QTL on chromosomes 1, 4, 6, 7 and 9, and may be important candidate genes for waterlogging tolerance. These results are a good starting point for understanding the genetic basis for selectively expressing of QTL in different stress periods and the common genetic control mechanism of the co-localized traits.
Directory of Open Access Journals (Sweden)
Abirami eRamalingam
2015-12-01
Full Text Available Drought stress has been one of the serious constraints affecting chickpea productivity to a great extent. Genomic assisted breeding in chickpea has been effective in providing a yield advantage of up to 24 %, thus having a potential to accelerate breeding precisely and efficiently. In order to do so, understanding the molecular mechanisms for drought tolerance and identification of candidate genes are crucial. Transcription factors (TFs have important roles in the regulation of plant stress related genes. In this context, quantitative real time-PCR (qRT-PCR was used to study the differential gene expression of selected TFs, identified from large-scale gene expression analysis, in contrasting drought responsive genotypes. Root tissues of ICC 4958 (tolerant, ICC 1882 (sensitive, JG 11 (elite and JG 11+ (introgression line were used for the study. Subsequently, a candidate single repeat MYB gene (1R-MYB that was remarkably induced in the drought tolerant genotypes under drought stress was cloned and subjected to Y2H analysis by screening a root cDNA library. The protein-protein interaction study identified three interacting peptides, a galactinol-sucrose galactosyltransferase 2, a CBL (Calcineurin B-like-interacting serine/threonine-protein kinase 25 and an ABA responsive 17-like, which were confirmed by the co-transformation of candidate plasmids in yeast. These findings provide preliminary insights into the ability of 1R-MYB TF to co-regulate drought tolerance mechanism in chickpea roots.
Genome-scale expression studies and comprehensive loss-of-function genetic screens have focused almost exclusively on the highest confidence candidate genes. Here, we describe a strategy for characterizing the lower confidence candidates identified by such approaches.
Ryu, S; Huh, I-S; Cho, E-Y; Cho, Y; Park, T; Yoon, S C; Joo, Y H; Hong, K S
2016-03-01
This study aimed to investigate the association of multiple candidate genes with weight gain and appetite change during antipsychotic treatment. A total of 233 single nucleotide polymorphisms (SNPs) within 60 candidate genes were genotyped. BMI changes for up to 8 weeks in 84 schizophrenia patients receiving antipsychotic medication were analyzed using a linear mixed model. In addition, we assessed appetite change during antipsychotic treatment in a different group of 46 schizophrenia patients using the Drug-Related Eating Behavior Questionnaire. No SNP showed a statistically significant association with BMI or appetite change after correction for multiple testing. We observed trends of association (PGHRL showed suggestive evidence of association with not only weight gain (P=0.001) but also appetite change (P=0.042). Patients carrying the GG genotype of rs696217 exhibited higher increase in both BMI and appetite compared to patients carrying the GT/TT genotype. Our findings suggested the involvement of a GHRL polymorphism in weight gain, which was specifically mediated by appetite change, during antipsychotic treatment in schizophrenia patients. © Georg Thieme Verlag KG Stuttgart · New York.
Identification of candidate new cancer susceptibility genes using yeast genomics
International Nuclear Information System (INIS)
Brown, M.; Brown, J.A.; Game, J.C.
2003-01-01
A large proportion of cancer susceptibility syndromes are the result of mutations in genes in DNA repair or in cell-cycle checkpoints in response to DNA damage, such as ataxia telangiectasia (AT), Fanconi's anemia (FA), Bloom's syndrome (BS), Nijmegen breakage syndrome (NBS), and xeroderma pigmentosum (XP). Mutations in these genes often cause gross chromosomal instability leading to an increased mutation rate of all genes including those directly responsible for cancer. We have proposed that because the orthologs of these genes in budding yeast, S. cerevisiae, confer protection against killing by DNA damaging agents it should be possible to identify new cancer susceptibility genes by identifying yeast genes whose deletion causes sensitivity to DNA damage. We therefore screened the recently completed collection of individual gene deletion mutants to identify genes that affect sensitivity to DNA-damaging agents. Screening for sensitivity in this obtained up to now with the F98 glioma model othe fact that each deleted gene is replaced by a cassette containing two molecular 'barcodes', or 20-mers, that uniquely identify the strain when DNA from a pool of strains is hybridized to an oligonucleotide array containing the complementary sequences of the barcodes. We performed the screen with UV, IR, H 2 0 2 and other DNA damaging agents. In addition to identifying genes already known to confer resistance to DNA damaging agents we have identified, and individually confirmed, several genes not previously associated with resistance. Several of these are of unknown function. We have also examined the chromosomal stability of selected strains and found that IR sensitive strains often but not always exhibit genomic instability. We are presently constructing a yeast artificial chromosome to globally interrogate all the genes in the deletion pool for their involvement in genomic stability. This work shows that budding yeast is a valuable eukaryotic model organism to identify
Yu, Guohua; Cui, Zhenling; Sun, Xian; Peng, Jinfu; Jiang, Jun; Wu, Wei; Huang, Wenhua; Chu, Kaili; Zhang, Lu; Ge, Baoxue; Li, Yao
2015-05-01
Global analysis of expression profiles using DNA microarrays was performed between a reference strain H37Rv and two clinical extensively drug-resistant isolates in response to three anti-tuberculosis drug exposures (isoniazid, capreomycin, and rifampicin). A deep analysis was then conducted using a combination of genome sequences of the resistant isolates, resistance information, and related public microarray data. Certain known resistance-associated gene sets were significantly overrepresented in upregulated genes in the resistant isolates relative to that observed in H37Rv, which suggested a link between resistance and expression levels of particular genes. In addition, isoniazid and capreomycin response genes, but not rifampicin, either obtained from published works or our data, were highly consistent with the differentially expressed genes of resistant isolates compared to those of H37Rv, indicating a strong association between drug resistance of the isolates and genes differentially regulated by isoniazid and capreomycin exposures. Based on these results, 92 genes of the studied isolates were identified as candidate resistance genes, 10 of which are known resistance-related genes. Regulatory network analysis of candidate resistance genes using published networks and literature mining showed that three two-component regulatory systems and regulator CRP play significant roles in the resistance of the isolates by mediating the production of essential envelope components. Finally, drug sensitivity testing indicated strong correlations between expression levels of these regulatory genes and sensitivity to multiple anti-tuberculosis drugs in Mycobacterium tuberculosis. These findings may provide novel insights into the mechanism underlying the emergence and development of drug resistance in resistant tuberculosis isolates and useful clues for further studies on this issue. Copyright © 2015 Elsevier Ltd. All rights reserved.
Mondal, M; Sengupta, M; Samanta, S; Sil, A; Ray, K
2012-12-15
Albinism represents a group of genetic disorders with a broad spectrum of hypopigmentary phenotypes dependent on the genetic background of the patients. Oculocutaneous albinism (OCA) patients have little or no pigment in their eyes, skin and hair, whereas ocular albinism (OA) primarily presents the ocular symptoms, and the skin and hair color may vary from near normal to very fair. Mutations in genes directly or indirectly regulating melanin production are responsible for different forms of albinism with overlapping clinical features. In this study, 27 albinistic individuals from 24 families were screened for causal variants by a PCR-sequencing based approach. TYR, OCA2, TYRP1, SLC45A2, SLC24A5, TYRP2 and SILV were selected as candidate genes. We identified 5 TYR and 3 OCA2 mutations, majority in homozygous state, in 8 unrelated patients including a case of autosomal recessive ocular albinism (AROA). A homozygous 4-nucleotide novel insertion in SLC24A5 was detected in a person showing with extreme cutaneous hypopigmentation. A potential causal variant was identified in the TYRP2 gene in a single patient. Haplotype analyses in the patients carrying homozygous mutations in the classical OCA genes suggested founder effect. This is the first report of an Indian AROA patient harboring a mutation in OCA2. Our results also reveal for the first time that mutations in SLC24A5 could contribute to extreme hypopigmentation in humans. Copyright © 2012 Elsevier B.V. All rights reserved.
Pyun, Jung-A; Kim, Sunshin; Cho, Nam H; Koh, InSong; Lee, Jong-Young; Shin, Chol; Kwack, KyuBum
2014-05-01
The aim of this study was to identify polymorphisms and gene-gene interactions that are significantly associated with age at menarche and age at menopause in a Korean population. A total of 3,452 and 1,827 women participated in studies of age at menarche and age at natural menopause, respectively. Linear regression analyses adjusted for residence area were used to perform genome-wide association studies (GWAS), candidate gene association studies, and interactions between the candidate genes for age at menarche and age at natural menopause. In GWAS, four single nucleotide polymorphisms (SNPs; rs7528241, rs1324329, rs11597068, and rs6495785) were strongly associated with age at natural menopause (lowest P = 9.66 × 10). However, GWAS of age at menarche did not reveal any strong associations. In candidate gene association studies, SNPs with P menopause, there was a significant interaction between intronic SNPs on ADAM metallopeptidase with thrombospondin type I motif 9 (ADAMTS9) and SMAD family member 3 (SMAD3) genes (P = 9.52 × 10). For age at menarche, there were three significant interactions between three intronic SNPs on follicle-stimulating hormone receptor (FSHR) gene and one SNP located at the 3' flanking region of insulin-like growth factor 2 receptor (IGF2R) gene (lowest P = 1.95 × 10). Novel SNPs and synergistic interactions between candidate genes are significantly associated with age at menarche and age at natural menopause in a Korean population.
Jones, Sophie; Grignard, Lynn; Nebie, Issa; Chilongola, Jaffu; Dodoo, Daniel; Sauerwein, Robert; Theisen, Michael; Roeffen, Will; Singh, Shrawan Kumar; Singh, Rajesh Kumar; Singh, Sanjay; Kyei-Baafour, Eric; Tetteh, Kevin; Drakeley, Chris; Bousema, Teun
2015-07-01
Pfs48/45 and Pfs230 are Plasmodium falciparum sexual stage proteins and promising malaria transmission-blocking vaccine candidates. Antibody responses against these proteins may be naturally acquired and target antigens may be under selective pressure. This has consequences for the future evaluation of vaccine immunogenicity and efficacy in populations naturally exposed to malaria. We determined naturally acquired antibody responses to the recombinant proteins Pfs48/45-10C and Pfs230-230CMB in children from three malaria endemic settings in Ghana, Tanzania and Burkina Faso. We also examined genetic polymorphisms in the P. falciparum gene pfs48/45. Antibody prevalence was 1.1-18.2% for 10C and 6.7-18.9% for 230CMB. In Burkina Faso we observed evidence of an age-dependent acquisition pattern for both 10C (p < 0.001) and 230CMB (p = 0.031). Membrane feeding assays on a separate dataset demonstrated an association between functional transmission reducing activity and antibody prevalence for both 10C (p = 0.017) and 230CMB (p = 0.049). 17 single nucleotide polymorphisms were found in pfs48/45 (from 126 samples), with 5 non-synonymous SNPs in the Pfs48/45 10C region. We conclude there are naturally acquired antibody responses to both vaccine candidates which have functional relevance by reducing the transmissibility of infected individuals. We identified genetic polymorphisms, in pfs48/45 which exhibited geographical specificity. Copyright © 2015 The British Infection Association. Published by Elsevier Ltd. All rights reserved.
DEFF Research Database (Denmark)
Grauers, Anna; Wang, Jingwen; Einarsdottir, Elisabet
2015-01-01
samples from 100 surgically treated idiopathic scoliosis patients. Novel or rare missense, nonsense, or splice site variants were selected for individual genotyping in the 1,739 cases and 1,812 controls. In addition, the 5'UTR, noncoding exon and promoter regions of LBX1, not covered by exome sequencing...... by exome sequencing after filtration and an initial genotyping validation. However, we could not verify any association to idiopathic scoliosis in the large cohort of 1,739 cases and 1,812 controls. We did not find any variants in the 5'UTR, noncoding exon and promoter regions of LBX1. CONCLUSIONS: Here...... that are significantly associated with idiopathic scoliosis in Asian and Caucasian populations, rs11190870 close to the LBX1 gene being the most replicated finding. PURPOSE: The aim of the present study was to investigate the genetics of idiopathic scoliosis in a Scandinavian cohort by performing a candidate gene study...
A fruit quality gene map of Prunus
Directory of Open Access Journals (Sweden)
Bliss Fredrick A
2009-12-01
Full Text Available Abstract Background Prunus fruit development, growth, ripening, and senescence includes major biochemical and sensory changes in texture, color, and flavor. The genetic dissection of these complex processes has important applications in crop improvement, to facilitate maximizing and maintaining stone fruit quality from production and processing through to marketing and consumption. Here we present an integrated fruit quality gene map of Prunus containing 133 genes putatively involved in the determination of fruit texture, pigmentation, flavor, and chilling injury resistance. Results A genetic linkage map of 211 markers was constructed for an intraspecific peach (Prunus persica progeny population, Pop-DG, derived from a canning peach cultivar 'Dr. Davis' and a fresh market cultivar 'Georgia Belle'. The Pop-DG map covered 818 cM of the peach genome and included three morphological markers, 11 ripening candidate genes, 13 cold-responsive genes, 21 novel EST-SSRs from the ChillPeach database, 58 previously reported SSRs, 40 RAFs, 23 SRAPs, 14 IMAs, and 28 accessory markers from candidate gene amplification. The Pop-DG map was co-linear with the Prunus reference T × E map, with 39 SSR markers in common to align the maps. A further 158 markers were bin-mapped to the reference map: 59 ripening candidate genes, 50 cold-responsive genes, and 50 novel EST-SSRs from ChillPeach, with deduced locations in Pop-DG via comparative mapping. Several candidate genes and EST-SSRs co-located with previously reported major trait loci and quantitative trait loci for chilling injury symptoms in Pop-DG. Conclusion The candidate gene approach combined with bin-mapping and availability of a community-recognized reference genetic map provides an efficient means of locating genes of interest in a target genome. We highlight the co-localization of fruit quality candidate genes with previously reported fruit quality QTLs. The fruit quality gene map developed here is a
TGIF1 is a potential candidate gene for high myopia in ethnic Kashmiri population.
Ahmed, Ishfaq; Rasool, Shabhat; Jan, Tariq; Qureshi, Tariq; Naykoo, Niyaz A; Andrabi, Khurshid I
2014-03-01
High myopia is a complex disorder that imposes serious consequences on ocular health. Linkage analysis has identified several genetic loci with a series of potential candidate genes that reveal an ambiguous pattern of association with high myopia due to population heterogeneity. We have accordingly chosen to examine the prospect of association of one such gene [transforming growth β-induced factor 1 (TGIF1)] in population that is purely ethnic (Kashmiri) and represents a homogeneous cohort from Northern India. Cases with high myopia with a spherical equivalent of ≥-6 diopters (D) and emmetropic controls with spherical equivalent within ±0.5 D in one or both eyes represented by a sample size of 212 ethnic Kashmiri subjects and 239 matched controls. Genomic DNA was genotyped for sequence variations in TGIF1 gene and allele frequencies tested for Hardy-Weinberg disequilibrium. Potential association was evaluated using χ(2) or Fisher's exact test. Two previously reported missense variations C > T, rs4468717 (first base of codon 143) changing proline to serine and rs2229333 (second base of codon 143) changing proline to leucine were identified in exon 10 of TGIF1. Both variations exhibited possibly significant (p population. In silico predictions show that substitutions are likely to have an impact on the structure and functional properties of the protein, making it imperative to understand their functional consequences in relation to high myopia. TGIF1 is a relevant candidate gene with potential to contribute in the genesis of high myopia.
Directory of Open Access Journals (Sweden)
Asep Gunawan
Full Text Available Boar taint is an unpleasant smell and taste of pork meat derived from some entire male pigs. The main causes of boar taint are the two compounds androstenone (5α-androst-16-en-3-one and skatole (3-methylindole. It is crucial to understand the genetic mechanism of boar taint to select pigs for lower androstenone levels and thus reduce boar taint. The aim of the present study was to investigate transcriptome differences in boar testis and liver tissues with divergent androstenone levels using RNA deep sequencing (RNA-Seq. The total number of reads produced for each testis and liver sample ranged from 13,221,550 to 33,206,723 and 12,755,487 to 46,050,468, respectively. In testis samples 46 genes were differentially regulated whereas 25 genes showed differential expression in the liver. The fold change values ranged from -4.68 to 2.90 in testis samples and -2.86 to 3.89 in liver samples. Differentially regulated genes in high androstenone testis and liver samples were enriched in metabolic processes such as lipid metabolism, small molecule biochemistry and molecular transport. This study provides evidence for transcriptome profile and gene polymorphisms of boars with divergent androstenone level using RNA-Seq technology. Digital gene expression analysis identified candidate genes in flavin monooxygenease family, cytochrome P450 family and hydroxysteroid dehydrogenase family. Moreover, polymorphism and association analysis revealed mutation in IRG6, MX1, IFIT2, CYP7A1, FMO5 and KRT18 genes could be potential candidate markers for androstenone levels in boars. Further studies are required for proving the role of candidate genes to be used in genomic selection against boar taint in pig breeding programs.
Kovi, Mallikarjuna Rao; Zhang, Yushan; Yu, Sibin; Yang, Gaiyu; Yan, Wenhao; Xing, Yongzhong
2011-09-01
Appropriate plant height is crucial for lodging resistance to improve the rice crop yield. The application of semi-dwarf 1 led to the green revolution in the 1960s, by predominantly increasing the rice yield. However, the frequent use of single sd1 gene sources may cause genetic vulnerability to pests and diseases. Identifying useful novel semi-dwarf genes is important for the genetic manipulation of plant architecture in practical rice breeding. In this study, introgression lines derived from two parents contrasting in plant height, Zhenshan 97 and Pokkali were employed to locate a gene with a large effect on plant height by the bulk segregant analysis method. A major gene, ph1, was mapped to a region closely linked to sd1 on chromosome 1; the additive effects of ph1 were more than 50 cm on the plant height and 2 days on the heading date in a BC(4)F(2) population and its progeny. ph1 was then fine mapped to BAC AP003227. Gene annotation indicated that LOC_OS01g65990 encoding a chitin-inducible gibberellin-responsive protein (CIGR), which belongs to the GRAS family, might be the right candidate gene of ph1. Co-segregation analysis of the candidate gene-derived marker finally confirmed its identity as the candidate gene. A higher expression level of the CIGR was detected in all the tested tissues in tall plants compared to those of short plants, especially in the young leaf sheath containing elongating tissues, which indicated its importance role in regulating plant height. ph1 showed a tremendous genetic effect on plant height, which is distinct from sd1 and could be a new resource for breeding semi-dwarf varieties.
Evaluation of common genetic variants in 82 candidate genes as risk factors for neural tube defects
LENUS (Irish Health Repository)
Pangilinan, Faith
2012-08-02
AbstractBackgroundNeural tube defects (NTDs) are common birth defects (~1 in 1000 pregnancies in the US and Europe) that have complex origins, including environmental and genetic factors. A low level of maternal folate is one well-established risk factor, with maternal periconceptional folic acid supplementation reducing the occurrence of NTD pregnancies by 50-70%. Gene variants in the folate metabolic pathway (e.g., MTHFR rs1801133 (677 C > T) and MTHFD1 rs2236225 (R653Q)) have been found to increase NTD risk. We hypothesized that variants in additional folate\\/B12 pathway genes contribute to NTD risk.MethodsA tagSNP approach was used to screen common variation in 82 candidate genes selected from the folate\\/B12 pathway and NTD mouse models. We initially genotyped polymorphisms in 320 Irish triads (NTD cases and their parents), including 301 cases and 341 Irish controls to perform case–control and family based association tests. Significantly associated polymorphisms were genotyped in a secondary set of 250 families that included 229 cases and 658 controls. The combined results for 1441 SNPs were used in a joint analysis to test for case and maternal effects.ResultsNearly 70 SNPs in 30 genes were found to be associated with NTDs at the p < 0.01 level. The ten strongest association signals (p-value range: 0.0003–0.0023) were found in nine genes (MFTC, CDKN2A, ADA, PEMT, CUBN, GART, DNMT3A, MTHFD1 and T (Brachyury)) and included the known NTD risk factor MTHFD1 R653Q (rs2236225). The single strongest signal was observed in a new candidate, MFTC rs17803441 (OR = 1.61 [1.23-2.08], p = 0.0003 for the minor allele). Though nominally significant, these associations did not remain significant after correction for multiple hypothesis testing.ConclusionsTo our knowledge, with respect to sample size and scope of evaluation of candidate polymorphisms, this is the largest NTD genetic association study reported to date. The scale of the study and the
Lawrenson, Kate; Li, Qiyuan; Kar, Siddhartha; Seo, Ji-Heui; Tyrer, Jonathan; Spindler, Tassja J; Lee, Janet; Chen, Yibu; Karst, Alison; Drapkin, Ronny; Aben, Katja K H; Anton-Culver, Hoda; Antonenkova, Natalia; Baker, Helen; Bandera, Elisa V; Bean, Yukie; Beckmann, Matthias W; Berchuck, Andrew; Bisogna, Maria; Bjorge, Line; Bogdanova, Natalia; Brinton, Louise A; Brooks-Wilson, Angela; Bruinsma, Fiona; Butzow, Ralf; Campbell, Ian G; Carty, Karen; Chang-Claude, Jenny; Chenevix-Trench, Georgia; Chen, Anne; Chen, Zhihua; Cook, Linda S; Cramer, Daniel W; Cunningham, Julie M; Cybulski, Cezary; Dansonka-Mieszkowska, Agnieszka; Dennis, Joe; Dicks, Ed; Doherty, Jennifer A; Dörk, Thilo; du Bois, Andreas; Dürst, Matthias; Eccles, Diana; Easton, Douglas T; Edwards, Robert P; Eilber, Ursula; Ekici, Arif B; Fasching, Peter A; Fridley, Brooke L; Gao, Yu-Tang; Gentry-Maharaj, Aleksandra; Giles, Graham G; Glasspool, Rosalind; Goode, Ellen L; Goodman, Marc T; Grownwald, Jacek; Harrington, Patricia; Harter, Philipp; Hasmad, Hanis Nazihah; Hein, Alexander; Heitz, Florian; Hildebrandt, Michelle A T; Hillemanns, Peter; Hogdall, Estrid; Hogdall, Claus; Hosono, Satoyo; Iversen, Edwin S; Jakubowska, Anna; James, Paul; Jensen, Allan; Ji, Bu-Tian; Karlan, Beth Y; Kruger Kjaer, Susanne; Kelemen, Linda E; Kellar, Melissa; Kelley, Joseph L; Kiemeney, Lambertus A; Krakstad, Camilla; Kupryjanczyk, Jolanta; Lambrechts, Diether; Lambrechts, Sandrina; Le, Nhu D; Lee, Alice W; Lele, Shashi; Leminen, Arto; Lester, Jenny; Levine, Douglas A; Liang, Dong; Lissowska, Jolanta; Lu, Karen; Lubinski, Jan; Lundvall, Lene; Massuger, Leon F A G; Matsuo, Keitaro; McGuire, Valerie; McLaughlin, John R; Nevanlinna, Heli; McNeish, Ian; Menon, Usha; Modugno, Francesmary; Moysich, Kirsten B; Narod, Steven A; Nedergaard, Lotte; Ness, Roberta B; Azmi, Mat Adenan Noor; Odunsi, Kunle; Olson, Sara H; Orlow, Irene; Orsulic, Sandra; Weber, Rachel Palmieri; Pearce, Celeste L; Pejovic, Tanja; Pelttari, Liisa M; Permuth-Wey, Jennifer; Phelan, Catherine M; Pike, Malcolm C; Poole, Elizabeth M; Ramus, Susan J; Risch, Harvey A; Rosen, Barry; Rossing, Mary Anne; Rothstein, Joseph H; Rudolph, Anja; Runnebaum, Ingo B; Rzepecka, Iwona K; Salvesen, Helga B; Schildkraut, Joellen M; Schwaab, Ira; Sellers, Thomas A; Shu, Xiao-Ou; Shvetsov, Yurii B; Siddiqui, Nadeem; Sieh, Weiva; Song, Honglin; Southey, Melissa C; Sucheston, Lara; Tangen, Ingvild L; Teo, Soo-Hwang; Terry, Kathryn L; Thompson, Pamela J; Timorek, Agnieszka; Tsai, Ya-Yu; Tworoger, Shelley S; van Altena, Anne M; Van Nieuwenhuysen, Els; Vergote, Ignace; Vierkant, Robert A; Wang-Gohrke, Shan; Walsh, Christine; Wentzensen, Nicolas; Whittemore, Alice S; Wicklund, Kristine G; Wilkens, Lynne R; Woo, Yin-Ling; Wu, Xifeng; Wu, Anna H; Yang, Hannah; Zheng, Wei; Ziogas, Argyrios; Monteiro, Alvaro; Pharoah, Paul D; Gayther, Simon A; Freedman, Matthew L
2015-09-22
Genome-wide association studies have reported 11 regions conferring risk of high-grade serous epithelial ovarian cancer (HGSOC). Expression quantitative trait locus (eQTL) analyses can identify candidate susceptibility genes at risk loci. Here we evaluate cis-eQTL associations at 47 regions associated with HGSOC risk (P≤10(-5)). For three cis-eQTL associations (P<1.4 × 10(-3), FDR<0.05) at 1p36 (CDC42), 1p34 (CDCA8) and 2q31 (HOXD9), we evaluate the functional role of each candidate by perturbing expression of each gene in HGSOC precursor cells. Overexpression of HOXD9 increases anchorage-independent growth, shortens population-doubling time and reduces contact inhibition. Chromosome conformation capture identifies an interaction between rs2857532 and the HOXD9 promoter, suggesting this SNP is a leading causal variant. Transcriptomic profiling after HOXD9 overexpression reveals enrichment of HGSOC risk variants within HOXD9 target genes (P=6 × 10(-10) for risk variants (P<10(-4)) within 10 kb of a HOXD9 target gene in ovarian cells), suggesting a broader role for this network in genetic susceptibility to HGSOC.
Isolation and characterization of the human CDX1 gene: A candidate gene for diastrophic dysplasia
Energy Technology Data Exchange (ETDEWEB)
Bonner, C.; Loftus, S.; Wasmuth, J.J. [Univ. of California, Irvine, CA (United States)
1994-09-01
Diastrophic dysplasia is an autosomal recessive disorder characterized by short stature, dislocation of the joints, spinal deformities and malformation of the hands and feet. Multipoint linkage analysis places the diastrophic dysplasia (DTD) locus in 5q31-5q34. Linkage disequilibrium mapping places the DTD locus near CSFIR in the direction of PDGFRB (which is tandem to CSFIR). This same study tentatively placed PDGFRB and DTD proximal to CSFIR. Our results, as well as recently reported work from other laboratories, suggest that PDGFRB (and possibly DTD) is distal rather than proximal to CSFIR. We have constructed a cosmid contig covering approximately 200 kb of the region containing CSFIR. Several exons have been {open_quotes}trapped{close_quotes} from these cosmids using exon amplification. One of these exons was trapped from a cosmid isolated from a walk from PDGFRB, approximately 80 kb from CSFIR. This exon was sequenced and was determined to be 89% identical to the nucleotide sequence of exon two of the murine CDX1 gene (100% amino acid identity). The exon was used to isolate the human CDX gene. Sequence analysis of the human CDX1 gene indicates a very high degree of homology to the murine gene. CDX1 is a caudal type homeobox gene expressed during gastrulation. In the mouse, expression during gastrulation begins in the primitive streak and subsequently localizes to the ectodermal and mesodermal cells of the primitive streak, neural tube, somites, and limb buds. Later in gastrulation, CDX1 expression becomes most prominent in the mesoderm of the forelimbs, and, to a lesser extent, the hindlimbs. CDX1 is an intriguing candidate gene for diastrophic dysplasia. We are currently screening DNA from affected individuals and hope to shortly determine whether CDX1 is involved in this disorder.
Physiological responses of astronaut candidates to simulated +Gx orbital emergency re-entry.
Wu, Bin; Xue, Yueying; Wu, Ping; Gu, Zhiming; Wang, Yue; Jing, Xiaolu
2012-08-01
We investigated astronaut candidates' physiological and pathological responses to +Gx exposure during simulated emergency return from a running orbit to advance astronaut +Gx tolerance training and medical support in manned spaceflight. There were 13 male astronaut candidates who were exposed to a simulated high +Gx acceleration profile in a spacecraft during an emergency return lasting for 230 s. The peak value was 8.5 G. Subjective feelings and symptoms, cardiovascular and respiratory responses, and changes in urine component before, during, and after +Gx exposure were investigated. Under high +Gx exposure, 15.4% of subjects exhibited arrhythmia. Heart rate (HR) increased significantly and four different types of HR response curves were distinguished. The ratio of QT to RR interval on the electrocardiograms was significantly increased. Arterial oxygen saturation (SaO2) declined with increasing G value and then returned gradually. SaO2 reached a minimum (87.7%) at 3 G during the decline phase of the +Gx curve. Respiratory rate increased significantly with increasing G value, while the amplitude and area of the respiratory waves were significantly reduced. The overshoot appeared immediately after +Gx exposure. A few subjects suffered from slight injuries, including positive urine protein (1/13), positive urinary occult blood (1/13), and a large area of petechiae on the back (1/13). Astronaut candidates have relatively good tolerance to the +Gx profile during a simulation of spacecraft emergent ballistic re-entry. However, a few subjects exhibited adverse physiological responses and slight reversible pathological injuries.
Directory of Open Access Journals (Sweden)
Lulu Xie
2016-08-01
Full Text Available Introgression breeding is a widely used method for the genetic improvement of crop plants; however, the mechanism underlying candidate gene flow patterns during hybridization is poorly understood. In this study, we used a powerful pipeline to investigate a Chinese cabbage (Brassica rapa L. ssp. pekinensis introgression line with the anthocyanin overaccumulation phenotype. Our purpose was to analyze the gene flow patterns during hybridization and elucidate the genetic factors responsible for the accumulation of this important pigment compound. We performed RNA-seq analysis by using two pipelines, one with and one without a reference sequence, to obtain transcriptome data. We identified 930 significantly differentially expressed genes (DEGs between the purple-leaf introgression line and B. rapa green cultivar, namely, 389 up-regulated and 541 down-regulated DEGs that mapped to the B. rapa reference genome. Since only one anthocyanin pathway regulatory gene was identified, i.e., Bra037887 (bHLH, we mined unmapped reads, revealing 2,031 de novo assembled unigenes, including c3563g1i2. Phylogenetic analysis suggested that c3563g1i2, which was transferred from the Brassica B genome of the donor parental line Brassica juncea, may represent an R2R3-MYB transcription factor that participates in the ternary transcriptional activation complex responsible for the anthocyanin overaccumulation phenotype of the B. rapa introgression line. We also identified genes involved in cold and light reaction pathways that were highly upregulated in the introgression line, as confirmed using quantitative real-time PCR analysis. The results of this study shed light on the mechanisms underlying the purple leaf trait in Brassica plants and may facilitate the use of introgressive hybridization for many traits of interest.
Directory of Open Access Journals (Sweden)
Close Eimear
2010-05-01
Full Text Available Abstract Background Recent whole genome analysis and follow-up studies have identified many new risk variants for coeliac disease (CD, gluten intolerance. The majority of newly associated regions encode candidate genes with a clear functional role in T-cell regulation. Furthermore, the newly discovered risk loci, together with the well established HLA locus, account for less than 50% of the heritability of CD, suggesting that numerous additional loci remain undiscovered. Linkage studies have identified some well-replicated risk regions, most notably chromosome 5q31 and 11q23. Methods We have evaluated six candidate genes in one of these regions (11q23, namely CD3E, CD3D, CD3G, IL10RA, THY1 and IL18, as risk factors for CD using a 2-phase candidate gene approach directed at chromosome 11q. 377 CD cases and 349 ethnically matched controls were used in the initial screening, followed by an extended sample of 171 additional coeliac cases and 536 additional controls. Results Promotor SNPs (-607, -137 in the IL18 gene, which has shown association with several autoimmune diseases, initially suggested association with CD (P IL18-137/-607 also supported this effect, primarily due to one relatively rare haplotype IL18-607C/-137C (P Conclusion Haplotypes of the IL18 promotor region may contribute to CD risk, consistent with this cytokine's role in maintaining inflammation in active CD.
Directory of Open Access Journals (Sweden)
Sarpras M
Full Text Available Bhut jolokia, commonly known as Ghost chili, a native Capsicum species found in North East India was recorded as the naturally occurring hottest chili in the world by the Guinness Book of World Records in 2006. Although few studies have reported variation in pungency content of this particular species, no study till date has reported detailed expression analysis of candidate genes involved in capsaicinoids (pungency biosynthesis pathway and other fruit metabolites. Therefore, the present study was designed to evaluate the diversity of fruit morphology, fruiting habit, capsaicinoids and other metabolite contents in 136 different genotypes mainly collected from North East India. Significant intra and inter-specific variations for fruit morphological traits, fruiting habits and 65 fruit metabolites were observed in the collected Capsicum germplasm belonging to three Capsicum species i.e., Capsicum chinense (Bhut jolokia, 63 accessions, C. frutescens (17 accessions and C. annuum (56 accessions. The pungency level, measured in Scoville Heat Unit (SHU and antioxidant activity measured by 2, 2-diphenyl-1-picrylhydrazyl (DPPH free radical scavenging assay showed maximum levels in C. chinense accessions followed by C. frutescens accessions, while C. annuum accessions showed the lowest value for both the traits. The number of different fruit metabolites detected did not vary significantly among the different species but the metabolite such as benzoic acid hydroxyl esters identified in large percentage in majority of C. annuum genotypes was totally absent in the C. chinense genotypes and sparingly present in few genotypes of C. frutescens. Significant correlations were observed between fruit metabolites capsaicin, dihydrocapsaicin, hexadecanoic acid, cyclopentane, α-tocopherol and antioxidant activity. Furthermore, comparative expression analysis (through qRT-PCR of candidate genes involved in capsaicinoid biosynthesis pathway revealed many fold higher
M, Sarpras; Gaur, Rashmi; Sharma, Vineet; Chhapekar, Sushil Satish; Das, Jharna; Kumar, Ajay; Yadava, Satish Kumar; Nitin, Mukesh; Brahma, Vijaya; Abraham, Suresh K; Ramchiary, Nirala
2016-01-01
Bhut jolokia, commonly known as Ghost chili, a native Capsicum species found in North East India was recorded as the naturally occurring hottest chili in the world by the Guinness Book of World Records in 2006. Although few studies have reported variation in pungency content of this particular species, no study till date has reported detailed expression analysis of candidate genes involved in capsaicinoids (pungency) biosynthesis pathway and other fruit metabolites. Therefore, the present study was designed to evaluate the diversity of fruit morphology, fruiting habit, capsaicinoids and other metabolite contents in 136 different genotypes mainly collected from North East India. Significant intra and inter-specific variations for fruit morphological traits, fruiting habits and 65 fruit metabolites were observed in the collected Capsicum germplasm belonging to three Capsicum species i.e., Capsicum chinense (Bhut jolokia, 63 accessions), C. frutescens (17 accessions) and C. annuum (56 accessions). The pungency level, measured in Scoville Heat Unit (SHU) and antioxidant activity measured by 2, 2-diphenyl-1-picrylhydrazyl (DPPH) free radical scavenging assay showed maximum levels in C. chinense accessions followed by C. frutescens accessions, while C. annuum accessions showed the lowest value for both the traits. The number of different fruit metabolites detected did not vary significantly among the different species but the metabolite such as benzoic acid hydroxyl esters identified in large percentage in majority of C. annuum genotypes was totally absent in the C. chinense genotypes and sparingly present in few genotypes of C. frutescens. Significant correlations were observed between fruit metabolites capsaicin, dihydrocapsaicin, hexadecanoic acid, cyclopentane, α-tocopherol and antioxidant activity. Furthermore, comparative expression analysis (through qRT-PCR) of candidate genes involved in capsaicinoid biosynthesis pathway revealed many fold higher expression of
Zeng, T; Huang, L; Ren, J; Chen, L; Tian, Y; Huang, Y; Zhang, H; Du, J; Lu, L
2017-12-01
Feed represents two-thirds of the total costs of poultry production, especially in developing countries. Improvement in feed efficiency would reduce the amount of feed required for production (growth or laying), the production cost, and the amount of nitrogenous waste. The most commonly used measures for feed efficiency are feed conversion ratio (FCR) and residual feed intake (RFI). As a more suitable indicator assessing feed efficiency, RFI is defined as the difference between observed and expected feed intake based on maintenance and growth or laying. However, the genetic and biological mechanisms regulating RFI are largely unknown. Identifying molecular mechanisms explaining divergence in RFI in laying ducks would lead to the development of early detection methods for the selection of more efficient breeding poultry. The objective of this study was to identify duodenum genes and pathways through transcriptional profiling in 2 extreme RFI phenotypes (HRFI and LRFI) of the duck population. Phenotypic aspects of feed efficiency showed that RFI was strongly positive with FCR and feed intake (FI). Transcriptomic analysis identified 35 differentially expressed genes between LRFI and HRFI ducks. These genes play an important role in metabolism, digestibility, secretion, and innate immunity including (), (), (), β (), and (). These results improve our knowledge of the biological basis underlying RFI, which would be useful for further investigations of key candidate genes for RFI and for the development of biomarkers.
Butler, Merlin G; McGuire, Austen; Manzardo, Ann M
2015-04-01
Obesity is a growing public health concern now reaching epidemic status worldwide for children and adults due to multiple problems impacting on energy intake and expenditure with influences on human reproduction and infertility. A positive family history and genetic factors are known to play a role in obesity by influencing eating behavior, weight and level of physical activity and also contributing to human reproduction and infertility. Recent advances in genetic technology have led to discoveries of new susceptibility genes for obesity and causation of infertility. The goal of our study was to provide an update of clinically relevant candidate and known genes for obesity and infertility using high resolution chromosome ideograms with gene symbols and tabular form. We used computer-based internet websites including PubMed to search for combinations of key words such as obesity, body mass index, infertility, reproduction, azoospermia, endometriosis, diminished ovarian reserve, estrogen along with genetics, gene mutations or variants to identify evidence for development of a master list of recognized obesity genes in humans and those involved with infertility and reproduction. Gene symbols for known and candidate genes for obesity were plotted on high resolution chromosome ideograms at the 850 band level. Both infertility and obesity genes were listed separately in alphabetical order in tabular form and those highlighted when involved with both conditions. By searching the medical literature and computer generated websites for key words, we found documented evidence for 370 genes playing a role in obesity and 153 genes for human reproduction or infertility. The obesity genes primarily affected common pathways in lipid metabolism, deposition or transport, eating behavior and food selection, physical activity or energy expenditure. Twenty-one of the obesity genes were also associated with human infertility and reproduction. Gene symbols were plotted on high resolution
Directory of Open Access Journals (Sweden)
Chunhua eMa
2016-05-01
Full Text Available Background: Platycodon grandiflorum is the only species in the genus Platycodon of the family Campanulaceae, which has been traditionally used as a medicinal plant for its lung-heat-clearing, antitussive, and expectorant properties in China, Japanese and Korean. Oleanane-type triterpenoid saponins were the main chemical components of P. grandiflorum and platycodin D was the abundant and main bioactive component, but little is known about their biosynthesis in plants. Hence, P. grandiflorum is an ideal medicinal plant for studying the biosynthesis of Oleanane-type saponins. In addition, the genomic information of this important herbal plant is unavailable.Principal Findings:A total of 58,580,566 clean reads were obtained, which were assembled into 34,053 unigenes, with an average length of 936 bp and N50 of 1,661 bp by analyzing the transcriptome data of P. grandiflorum. Among these 34,053 unigenes, 22,409 unigenes (65.80% were annotated based on the information available from public databases, including Nr, NCBI, Swiss-Prot, KOG and KEGG. Furthermore, 21 candidate cytochrome P450 genes and 17 candidate UDP-glycosyltransferase genes most likely involved in triterpenoid saponins biosynthesis pathway were discovered from the transcriptome sequencing of P. grandiflorum. In addition, 10,626 SSRs were identified based on the transcriptome data, which would provide abundant candidates of molecular markers for genetic diversity and genetic map for this medicinal plant.Conclusion:The genomic data obtained from P. grandiflorum, especially the identification of putative genes involved in triterpenoid saponins biosynthesis pathway, will facilitate our understanding of the biosynthesis of triterpenoid saponins at molecular level.
[Identification of candidate genes and expression profiles, as doping biomarkers].
Paparini, A; Impagnatiello, F; Pistilli, A; Rinaldi, M; Gianfranceschi, G; Signori, E; Stabile, A M; Fazio, V; Rende, M; Romano Spica, V
2007-01-01
Administration of prohibited substances to enhance athletic performance represents an emerging medical, social, ethical and legal issue. Traditional controls are based on direct detection of substances or their catabolites. However out-of-competition doping may not be easily revealed by standard analytical methods. Alternative indirect control strategies are based on the evaluation of mid- and long-term effects of doping in tissues. Drug-induced long-lasting changes of gene expression may be taken as effective indicators of doping exposure. To validate this approach, we used real-time PCR to monitor the expression pattern of selected genes in human haematopoietic cells exposed to nandrolone, insulin-like growth factor I (IGF-I) or growth hormone (GH). Some candidate genes were found significantly and consistently modulated by treatments. Nandrolone up-regulated AR, ESR2 and PGR in K562 cells, and SRD5A1, PPARA and JAK2 in Jurkat cells; IGF-I up-regulated EPOR and PGR in HL60 cells, and SRD5A1 in Jurkat; GH up-regulated SRD5A1 and GHR in K562. GATA1 expression was down-regulated in IGF-1-treated HL60, ESR2 was down-regulated in nandrolone-treated Jurkat, and AR and PGR were down-regulated in GH-treated Jurkat. This pilot study shows the potential of molecular biology-based strategies in anti-doping controls.
Rrp1b, a new candidate susceptibility gene for breast cancer progression and metastasis.
Directory of Open Access Journals (Sweden)
Nigel P S Crawford
2007-11-01
Full Text Available A novel candidate metastasis modifier, ribosomal RNA processing 1 homolog B (Rrp1b, was identified through two independent approaches. First, yeast two-hybrid, immunoprecipitation, and functional assays demonstrated a physical and functional interaction between Rrp1b and the previous identified metastasis modifier Sipa1. In parallel, using mouse and human metastasis gene expression data it was observed that extracellular matrix (ECM genes are common components of metastasis predictive signatures, suggesting that ECM genes are either important markers or causal factors in metastasis. To investigate the relationship between ECM genes and poor prognosis in breast cancer, expression quantitative trait locus analysis of polyoma middle-T transgene-induced mammary tumor was performed. ECM gene expression was found to be consistently associated with Rrp1b expression. In vitro expression of Rrp1b significantly altered ECM gene expression, tumor growth, and dissemination in metastasis assays. Furthermore, a gene signature induced by ectopic expression of Rrp1b in tumor cells predicted survival in a human breast cancer gene expression dataset. Finally, constitutional polymorphism within RRP1B was found to be significantly associated with tumor progression in two independent breast cancer cohorts. These data suggest that RRP1B may be a novel susceptibility gene for breast cancer progression and metastasis.
Taguchi, Y-H
2017-12-21
Although post-traumatic stress disorder (PTSD) is primarily a mental disorder, it can cause additional symptoms that do not seem to be directly related to the central nervous system, which PTSD is assumed to directly affect. PTSD-mediated heart diseases are some of such secondary disorders. In spite of the significant correlations between PTSD and heart diseases, spatial separation between the heart and brain (where PTSD is primarily active) prevents researchers from elucidating the mechanisms that bridge the two disorders. Our purpose was to identify genes linking PTSD and heart diseases. In this study, gene expression profiles of various murine tissues observed under various types of stress or without stress were analyzed in an integrated manner using tensor decomposition (TD). Based upon the obtained features, ∼ 400 genes were identified as candidate genes that may mediate heart diseases associated with PTSD. Various gene enrichment analyses supported biological reliability of the identified genes. Ten genes encoding protein-, DNA-, or mRNA-interacting proteins-ILF2, ILF3, ESR1, ESR2, RAD21, HTT, ATF2, NR3C1, TP53, and TP63-were found to be likely to regulate expression of most of these ∼ 400 genes and therefore are candidate primary genes that cause PTSD-mediated heart diseases. Approximately 400 genes in the heart were also found to be strongly affected by various drugs whose known adverse effects are related to heart diseases and/or fear memory conditioning; these data support the reliability of our findings. TD-based unsupervised feature extraction turned out to be a useful method for gene selection and successfully identified possible genes causing PTSD-mediated heart diseases.
Directory of Open Access Journals (Sweden)
Astanand Jugessur
Full Text Available Facial clefts are common birth defects with a strong genetic component. To identify fetal genetic risk factors for clefting, 1536 SNPs in 357 candidate genes were genotyped in two population-based samples from Scandinavia (Norway: 562 case-parent and 592 control-parent triads; Denmark: 235 case-parent triads.We used two complementary statistical methods, TRIMM and HAPLIN, to look for associations across these two national samples. TRIMM tests for association in each gene by using multi-SNP genotypes from case-parent triads directly without the need to infer haplotypes. HAPLIN on the other hand estimates the full haplotype distribution over a set of SNPs and estimates relative risks associated with each haplotype. For isolated cleft lip with or without cleft palate (I-CL/P, TRIMM and HAPLIN both identified significant associations with IRF6 and ADH1C in both populations, but only HAPLIN found an association with FGF12. For isolated cleft palate (I-CP, TRIMM found associations with ALX3, MKX, and PDGFC in both populations, but only the association with PDGFC was identified by HAPLIN. In addition, HAPLIN identified an association with ETV5 that was not detected by TRIMM.Strong associations with seven genes were replicated in the Scandinavian samples and our approach effectively replicated the strongest previously known association in clefting--with IRF6. Based on two national cleft cohorts of similar ancestry, two robust statistical methods and a large panel of SNPs in the most promising cleft candidate genes to date, this study identified a previously unknown association with clefting for ADH1C and provides additional candidates and analytic approaches to advance the field.
Rao, Shitao; Leung, Cherry She Ting; Lam, Macro Hb; Wing, Yun Kwok; Waye, Mary Miu Yee; Tsui, Stephen Kwok Wing
2017-03-01
To date almost 200 genes were found to be associated with major depressive disorder (MDD) or suicide attempts (SA), but very few genes were reported for their molecular mechanisms. This study aimed to find out whether there were common or rare variants in three candidate genes altering the risk for MDD and SA in Chinese. Three candidate genes (HOMER1, SLC6A4 and TEF) were chosen for resequencing analysis and association studies as they were reported to be involved in the etiology of MDD and SA. Following that, bioinformatics analyses were applied on those variants of interest. After resequencing analysis and alignment for the amplicons, a total of 34 common or rare variants were found in the randomly selected 36 Hong Kong Chinese patients with both MDD and SA. Among those, seven variants show potentially deleterious features. Rs60029191 and a rare variant located in regulatory region of the HOMER1 gene may affect the promoter activities through interacting with predicted transcription factors. Two missense mutations existed in the SLC6A4 coding regions were firstly reported in Hong Kong Chinese MDD and SA patients, and both of them could affect the transport efficiency of SLC6A4 to serotonin. Moreover, a common variant rs6354 located in the untranslated region of this gene may affect the expression level or exonic splicing of serotonin transporter. In addition, both of a most studied polymorphism rs738499 and a low-frequency variant in the promoter region of the TEF gene were found to be located in potential transcription factor binding sites, which may let the two variants be able to influence the promoter activities of the gene. This study elucidated the potentially molecular mechanisms of the three candidate genes altering the risk for MDD and SA. These findings implied that not only common variants but rare variants could make contributions to the genetic susceptibility to MDD and SA in Chinese. Copyright © 2016 Elsevier B.V. All rights reserved.
Identification and Evolutionary Analysis of Potential Candidate Genes in a Human Eating Disorder
Directory of Open Access Journals (Sweden)
Ubadah Sabbagh
2016-01-01
Full Text Available The purpose of this study was to find genes linked with eating disorders and associated with both metabolic and neural systems. Our operating hypothesis was that there are genetic factors underlying some eating disorders resting in both those pathways. Specifically, we are interested in disorders that may rest in both sleep and metabolic function, generally called Night Eating Syndrome (NES. A meta-analysis of the Gene Expression Omnibus targeting the mammalian nervous system, sleep, and obesity studies was performed, yielding numerous genes of interest. Through a text-based analysis of the results, a number of potential candidate genes were identified. VGF, in particular, appeared to be relevant both to obesity and, broadly, to brain or neural development. VGF is a highly connected protein that interacts with numerous targets via proteolytically digested peptides. We examined VGF from an evolutionary perspective to determine whether other available evidence supported a role for the gene in human disease. We conclude that some of the already identified variants in VGF from human polymorphism studies may contribute to eating disorders and obesity. Our data suggest that there is enough evidence to warrant eGWAS and GWAS analysis of these genes in NES patients in a case-control study.
Identification and Evolutionary Analysis of Potential Candidate Genes in a Human Eating Disorder.
Sabbagh, Ubadah; Mullegama, Saman; Wyckoff, Gerald J
2016-01-01
The purpose of this study was to find genes linked with eating disorders and associated with both metabolic and neural systems. Our operating hypothesis was that there are genetic factors underlying some eating disorders resting in both those pathways. Specifically, we are interested in disorders that may rest in both sleep and metabolic function, generally called Night Eating Syndrome (NES). A meta-analysis of the Gene Expression Omnibus targeting the mammalian nervous system, sleep, and obesity studies was performed, yielding numerous genes of interest. Through a text-based analysis of the results, a number of potential candidate genes were identified. VGF, in particular, appeared to be relevant both to obesity and, broadly, to brain or neural development. VGF is a highly connected protein that interacts with numerous targets via proteolytically digested peptides. We examined VGF from an evolutionary perspective to determine whether other available evidence supported a role for the gene in human disease. We conclude that some of the already identified variants in VGF from human polymorphism studies may contribute to eating disorders and obesity. Our data suggest that there is enough evidence to warrant eGWAS and GWAS analysis of these genes in NES patients in a case-control study.
DEFF Research Database (Denmark)
Buonincontri, Roberta; Bache, Iben; Silahtaroglu, Asli
2011-01-01
Dyslexia is one of the most common neurodevelopmental disorders where likely many genes are involved in the pathogenesis. So far six candidate dyslexia genes have been proposed, and two of these were identified by rare chromosomal translocations in affected individuals. By systematic re......-examination of all translocation carriers in Denmark, we have identified 16 different translocations associated with dyslexia. In four families, where the translocation co-segregated with the phenotype, one of the breakpoints concurred (at the cytogenetic level) with either a known dyslexia linkage region--at 15q21...... (DYX1), 2p13 (DYX3) and 1p36 (DYX8)--or an unpublished linkage region at 19q13. As a first exploitation of this unique cohort, we identify three novel candidate dyslexia genes, ZNF280D and TCF12 at 15q21, and PDE7B at 6q23.3, by molecular mapping of the familial translocation with the 15q21 breakpoint....
Directory of Open Access Journals (Sweden)
Aaron R Wolen
Full Text Available Individual differences in initial sensitivity to ethanol are strongly related to the heritable risk of alcoholism in humans. To elucidate key molecular networks that modulate ethanol sensitivity we performed the first systems genetics analysis of ethanol-responsive gene expression in brain regions of the mesocorticolimbic reward circuit (prefrontal cortex, nucleus accumbens, and ventral midbrain across a highly diverse family of 27 isogenic mouse strains (BXD panel before and after treatment with ethanol.Acute ethanol altered the expression of ~2,750 genes in one or more regions and 400 transcripts were jointly modulated in all three. Ethanol-responsive gene networks were extracted with a powerful graph theoretical method that efficiently summarized ethanol's effects. These networks correlated with acute behavioral responses to ethanol and other drugs of abuse. As predicted, networks were heavily populated by genes controlling synaptic transmission and neuroplasticity. Several of the most densely interconnected network hubs, including Kcnma1 and Gsk3β, are known to influence behavioral or physiological responses to ethanol, validating our overall approach. Other major hub genes like Grm3, Pten and Nrg3 represent novel targets of ethanol effects. Networks were under strong genetic control by variants that we mapped to a small number of chromosomal loci. Using a novel combination of genetic, bioinformatic and network-based approaches, we identified high priority cis-regulatory candidate genes, including Scn1b, Gria1, Sncb and Nell2.The ethanol-responsive gene networks identified here represent a previously uncharacterized intermediate phenotype between DNA variation and ethanol sensitivity in mice. Networks involved in synaptic transmission were strongly regulated by ethanol and could contribute to behavioral plasticity seen with chronic ethanol. Our novel finding that hub genes and a small number of loci exert major influence over the ethanol
Directory of Open Access Journals (Sweden)
Lingli Zhang
2017-04-01
Full Text Available The Aegilops kotschyi thermo-sensitive cytoplasmic male sterility (K-TCMS system may facilitate hybrid wheat (Triticum aestivum L. seed multiplication and production. The K-TCMS line is completely male sterile during the normal wheat-growing season, whereas its fertility can be restored in a high-temperature environment. To elucidate the molecular mechanisms responsible for male sterility/fertility conversion and candidate genes involved with pollen development in K-TCMS, we employed RNA-seq to sequence the transcriptomes of anthers from K-TCMS line KTM3315A during development under sterile and fertile conditions. We identified 16840 differentially expressed genes (DEGs in different stages including15157 known genes (15135 nuclear genes and 22 plasmagenes and 1683 novel genes. Bioinformatics analysis identified possible metabolic pathways involved with fertility based on KEGG pathway enrichment of the DEGs expressed in fertile and sterile plants. We found that most of the genes encoding key enzyme in the phenylpropanoid biosynthesis and jasmonate biosynthesis pathways were significant upregulated in uninucleate, binuclate or trinucleate stage, which both interact with MYB transcription factors, and that link between all play essential roles in fertility conversion. The relevant DEGs were verified by quantitative RT-PCR. Thus, we suggested that phenylpropanoid biosynthesis and jasmonate biosynthesis pathways were involved in fertility conversion of K-TCMS wheat. This will provide a new perspective and an effective foundation for the research of molecular mechanisms of fertility conversion of CMS wheat. Fertility conversion mechanism in thermo-sensitive cytoplasmic male sterile/fertile wheat involves the phenylpropanoid biosynthesis pathway, jasmonate biosynthesis pathway, and MYB transcription factors.
Bagheri, Masoumeh; Moradi-Sharhrbabak, M; Miraie-Ashtiani, R; Safdari-Shahroudi, M; Abdollahi-Arpanahi, R
2016-02-01
Mastitis is a major source of economic loss in dairy herds. The objective of this research was to evaluate the association between genotypes within SLC11A1 and CXCR1 candidate genes and clinical mastitis in Holstein dairy cattle using the selective genotyping method. The data set contained clinical mastitis records of 3,823 Holstein cows from two Holstein dairy herds located in two different regions in Iran. Data included the number of cases of clinical mastitis per lactation. Selective genotyping was based on extreme values for clinical mastitis residuals (CMR) from mixed model analyses. Two extreme groups consisting of 135 cows were formed (as cases and controls), and genotyped for the two candidate genes, namely, SLC11A1 and CXCR1, using polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) and polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP), respectively. Associations between single nucleotide polymorphism (SNP) genotypes with CMR and breeding values for milk and protein yield were carried out by applying logistic regression analyses, i.e. estimating the probability of the heterogeneous genotype in the dependency of values for CMR and breeding values (BVs). The sequencing results revealed a novel mutation in 1139 bp of exon 11 of the SLC11A1 gene and this SNP had a significant association with CMR (P G and these genotypes had significant relationships with CMR. Overall, the results showed that SLC11A1 and CXCR1 are valuable candidate genes for the improvement of mastitis resistance as well as production traits in dairy cattle populations.
Ramirez-Córdova, Jesús; Drnevich, Jenny; Madrigal-Pulido, Jaime Alberto; Arrizon, Javier; Allen, Kirk; Martínez-Velázquez, Moisés; Alvarez-Maya, Ikuri
2012-08-01
During ethanol fermentation, yeast cells are exposed to stress due to the accumulation of ethanol, cell growth is altered and the output of the target product is reduced. For Agave beverages, like tequila, no reports have been published on the global gene expression under ethanol stress. In this work, we used microarray analysis to identify Saccharomyces cerevisiae genes involved in the ethanol response. Gene expression of a tequila yeast strain of S. cerevisiae (AR5) was explored by comparing global gene expression with that of laboratory strain S288C, both after ethanol exposure. Additionally, we used two different culture conditions, cells grown in Agave tequilana juice as a natural fermentation media or grown in yeast-extract peptone dextrose as artificial media. Of the 6368 S. cerevisiae genes in the microarray, 657 genes were identified that had different expression responses to ethanol stress due to strain and/or media. A cluster of 28 genes was found over-expressed specifically in the AR5 tequila strain that could be involved in the adaptation to tequila yeast fermentation, 14 of which are unknown such as yor343c, ylr162w, ygr182c, ymr265c, yer053c-a or ydr415c. These could be the most suitable genes for transforming tequila yeast to increase ethanol tolerance in the tequila fermentation process. Other genes involved in response to stress (RFC4, TSA1, MLH1, PAU3, RAD53) or transport (CYB2, TIP20, QCR9) were expressed in the same cluster. Unknown genes could be good candidates for the development of recombinant yeasts with ethanol tolerance for use in industrial tequila fermentation.
Directory of Open Access Journals (Sweden)
Maria F. Pomponio
2014-12-01
Full Text Available Aim of the study: Identify and compare SNPs on candidate genes related to abiotic stress in Prosopis chilensis, Prosopis flexuosa and interspecific hybridsArea of the study: Chaco árido, Argentina. Material and Methods: Fragments from 6 candidate genes were sequenced in 60 genotypes. DNA polymorphisms were analyzed.Main Results: The analysis revealed that the hybrids had the highest rate of polymorphism, followed by P. flexuosa and P. chilensis, the values found are comparable to other forest tree species.Research highlights: This approach will help to study genetic diversity variation on natural populations for assessing the effects of environmental changes.Keywords: SNPs; abiotic stress; interspecific variation; molecular markers.
Nazari-Ghadikolaei, Anahit; Mehrabani-Yeganeh, Hassan; Miarei-Aashtiani, Seyed R; Staiger, Elizabeth A; Rashidi, Amir; Huson, Heather J
2018-01-01
The Markhoz goat provides an opportunity to study the genetics underlying coat color and mohair traits of an Angora type goat using genome-wide association studies (GWAS). This indigenous Iranian breed is valued for its quality mohair used in ceremonial garments and has the distinction of exhibiting an array of coat colors including black, brown, and white. Here, we performed 16 GWAS for different fleece (mohair) traits and coat color in 228 Markhoz goats sampled from the Markhoz Goat Research Station in Sanandaj, Kurdistan province, located in western Iran using the Illumina Caprine 50K beadchip. The Efficient Mixed Model Linear analysis was used to identify genomic regions with potential candidate genes contributing to coat color and mohair characteristics while correcting for population structure. Significant associations to coat color were found within or near the ASIP, ITCH, AHCY , and RALY genes on chromosome 13 for black and brown coat color and the KIT and PDGFRA genes on chromosome 6 for white coat color. Individual mohair traits were analyzed for genetic association along with principal components that allowed for a broader perspective of combined traits reflecting overall mohair quality and volume. A multitude of markers demonstrated significant association to mohair traits highlighting potential candidate genes of POU1F1 on chromosome 1 for mohair quality, MREG on chromosome 2 for mohair volume, DUOX1 on chromosome 10 for yearling fleece weight, and ADGRV1 on chromosome 7 for grease percentage. Variation in allele frequencies and haplotypes were identified for coat color and differentiated common markers associated with both brown and black coat color. This demonstrates the potential for genetic markers to be used in future breeding programs to improve selection for coat color and mohair traits. Putative candidate genes, both novel and previously identified in other species or breeds, require further investigation to confirm phenotypic causality and
Ballester, Maria; Ramayo-Caldas, Yuliaxis; Revilla, Manuel; Corominas, Jordi; Castelló, Anna; Estellé, Jordi; Fernández, Ana I; Folch, Josep M
2017-04-19
In the present study, liver co-expression networks and expression Genome Wide Association Study (eGWAS) were performed to identify DNA variants and molecular pathways implicated in the functional regulatory mechanisms of meat quality traits in pigs. With this purpose, the liver mRNA expression of 44 candidates genes related with lipid metabolism was analysed in 111 Iberian x Landrace backcross animals. The eGWAS identified 92 eSNPs located in seven chromosomal regions and associated with eight genes: CROT, CYP2U1, DGAT1, EGF, FABP1, FABP5, PLA2G12A, and PPARA. Remarkably, cis-eSNPs associated with FABP1 gene expression which may be determining the C18:2(n-6)/C18:3(n-3) ratio in backfat through the multiple interaction of DNA variants and genes were identified. Furthermore, a hotspot on SSC8 associated with the gene expression of eight genes was identified and the TBCK gene was pointed out as candidate gene regulating it. Our results also suggested that the PI3K-Akt-mTOR pathway plays an important role in the control of the analysed genes highlighting nuclear receptors as the NR3C1 or PPARA. Finally, sex-dimorphism associated with hepatic lipid metabolism was identified with over-representation of female-biased genes. These results increase our knowledge of the genetic architecture underlying fat composition traits.
Directory of Open Access Journals (Sweden)
Matthieu Jourdan
Full Text Available Accumulated in large amounts in carrot, carotenoids are an important product quality attribute and therefore a major breeding trait. However, the knowledge of carotenoid accumulation genetic control in this root vegetable is still limited. In order to identify the genetic variants linked to this character, we performed an association mapping study with a candidate gene approach. We developed an original unstructured population with a broad genetic basis to avoid the pitfall of false positive detection due to population stratification. We genotyped 109 SNPs located in 17 candidate genes – mostly carotenoid biosynthesis genes – on 380 individuals, and tested the association with carotenoid contents and color components. Total carotenoids and β-carotene contents were significantly associated with genes zeaxanthin epoxydase (ZEP, phytoene desaturase (PDS and carotenoid isomerase (CRTISO while α-carotene was associated with CRTISO and plastid terminal oxidase (PTOX genes. Color components were associated most significantly with ZEP. Our results suggest the involvement of the couple PDS/PTOX and ZEP in carotenoid accumulation, as the result of the metabolic and catabolic activities respectively. This study brings new insights in the understanding of the carotenoid pathway in non-photosynthetic organs.
Loci and candidate genes conferring resistance to soybean cyst nematode HG type 2.5.7.
Zhao, Xue; Teng, Weili; Li, Yinghui; Liu, Dongyuan; Cao, Guanglu; Li, Dongmei; Qiu, Lijuan; Zheng, Hongkun; Han, Yingpeng; Li, Wenbin
2017-06-14
Soybean (Glycine max L. Merr.) cyst nematode (SCN, Heterodera glycines I,) is a major pest of soybean worldwide. The most effective strategy to control this pest involves the use of resistant cultivars. The aim of the present study was to investigate the genome-wide genetic architecture of resistance to SCN HG Type 2.5.7 (race 1) in landrace and elite cultivated soybeans. A total of 200 diverse soybean accessions were screened for resistance to SCN HG Type 2.5.7 and genotyped through sequencing using the Specific Locus Amplified Fragment Sequencing (SLAF-seq) approach with a 6.14-fold average sequencing depth. A total of 33,194 SNPs were identified with minor allele frequencies (MAF) over 4%, covering 97% of all the genotypes. Genome-wide association mapping (GWAS) revealed thirteen SNPs associated with resistance to SCN HG Type 2.5.7. These SNPs were distributed on five chromosomes (Chr), including Chr7, 8, 14, 15 and 18. Four SNPs were novel resistance loci and nine SNPs were located near known QTL. A total of 30 genes were identified as candidate genes underlying SCN resistance. A total of sixteen novel soybean accessions were identified with significant resistance to HG Type 2.5.7. The beneficial alleles and candidate genes identified by GWAS might be valuable for improving marker-assisted breeding efficiency and exploring the molecular mechanisms underlying SCN resistance.
Klein, Ronald; Li, Xiaohui; Kuo, Jane Z; Klein, Barbara E K; Cotch, Mary Frances; Wong, Tien Y; Taylor, Kent D; Rotter, Jerome I
2013-11-01
To describe the relationships of selected candidate genes to the prevalence of early age-related macular degeneration (AMD) in a cohort of whites, blacks, Hispanics, and Chinese Americans. Cross-sectional study. setting: Multicenter study. study population: A total of 2456 persons aged 45-84 years with genotype information and fundus photographs. procedures: Twelve of 2862 single nucleotide polymorphisms (SNPs) from 11 of 233 candidate genes for cardiovascular disease were selected for analysis based on screening with marginal unadjusted P value ethnic groups. Logistic regression models tested for association in case-control samples. main outcome measure: Prevalence of early AMD. Early AMD was present in 4.0% of the cohort and varied from 2.4% in blacks to 6.0% in whites. The odds ratio increased from 2.3 for 1 to 10.0 for 4 risk alleles in a joint effect analysis of Age-Related Maculopathy Susceptibility 2 rs10490924 and Complement Factor H Y402H (P for trend = 4.2×10(-7)). Frequencies of each SNP varied among the racial/ethnic groups. Adjusting for age and other factors, few statistically significant associations of the 12 SNPs with AMD were consistent across all groups. In a multivariate model, most candidate genes did not attenuate the comparatively higher odds of AMD in whites. The higher frequency of risk alleles for several SNPs in Chinese Americans may partially explain their AMD frequency's approaching that of whites. The relationships of 11 candidate genes to early AMD varied among 4 racial/ethnic groups, and partially explained the observed variations in early AMD prevalence among them. Copyright © 2013 Elsevier Inc. All rights reserved.
Gene up-regulation in response to predator kairomones in the water flea, Daphnia pulex
Directory of Open Access Journals (Sweden)
Okada Yasukazu
2010-04-01
Full Text Available Abstract Background Numerous cases of predator-induced polyphenisms, in which alternate phenotypes are produced in response to extrinsic stimuli, have been reported in aquatic taxa to date. The genus Daphnia (Branchiopoda, Cladocera provides a model experimental system for the study of the developmental mechanisms and evolutionary processes associated with predator-induced polyphenisms. In D. pulex, juveniles form neckteeth in response to predatory kairomones released by Chaoborus larvae (Insecta, Diptera. Results Previous studies suggest that the timing of the sensitivity to kairomones in D. pulex can generally be divided into the embryonic and postembryonic developmental periods. We therefore examined which of the genes in the embryonic and first-instar juvenile stages exhibit different expression levels in the presence or absence of predator kairomones. Employing a candidate gene approach and identifying differentially-expressed genes revealed that the morphogenetic factors, Hox3, extradenticle and escargot, were up-regulated by kairomones in the postembryonic stage and may potentially be responsible for defense morph formation. In addition, the juvenile hormone pathway genes, JHAMT and Met, and the insulin signaling pathway genes, InR and IRS-1, were up-regulated in the first-instar stage. It is well known that these hormonal pathways are involved in physiological regulation following morphogenesis in many insect species. During the embryonic stage when morphotypes were determined, one of the novel genes identified by differential display was up-regulated, suggesting that this gene may be related to morphotype determination. Biological functions of the up-regulated genes are discussed in the context of defense morph formation. Conclusions It is suggested that, following the reception of kairomone signals, the identified genes are involved in a series of defensive phenotypic alterations and the production of a defensive phenotype.
Ip, Jacque P K; Nagakura, Ikue; Petravicz, Jeremy; Li, Keji; Wiemer, Erik A C; Sur, Mriganka
2018-04-18
Microdeletion of a region in chromosome 16p11.2 increases susceptibility to autism. Although this region contains exons of 29 genes, disrupting only a small segment of the region, which spans five genes, is sufficient to cause autistic traits. One candidate gene in this critical segment is MVP , which encodes for the major vault protein (MVP) that has been implicated in regulation of cellular transport mechanisms. MVP expression levels in MVP +/- mice closely phenocopy those of 16p11.2 mutant mice, suggesting that MVP +/- mice may serve as a model of MVP function in 16p11.2 microdeletion. Here we show that MVP regulates the homeostatic component of ocular dominance (OD) plasticity in primary visual cortex. MVP +/- mice of both sexes show impairment in strengthening of open-eye responses after several days of monocular deprivation (MD), whereas closed-eye responses are weakened as normal, resulting in reduced overall OD plasticity. The frequency of miniature EPSCs (mEPSCs) in pyramidal neurons is decreased in MVP +/- mice after extended MD, suggesting a reduction of functional synapses. Correspondingly, upregulation of surface GluA1 AMPA receptors is reduced in MVP +/- mice after extended MD, and is accompanied by altered expression of STAT1 and phosphorylated ERK, which have been previously implicated in OD plasticity. Normalization of STAT1 levels by introducing STAT1 shRNA rescues surface GluA1 and open-eye responses, implicating STAT1 as a downstream effector of MVP. These findings demonstrate a specific role for MVP as a key molecule influencing the homeostatic component of activity-dependent synaptic plasticity, and potentially the corresponding phenotypes of 16p11.2 microdeletion syndrome. SIGNIFICANCE STATEMENT Major vault protein (MVP), a candidate gene in 16p11.2 microdeletion syndrome, has been implicated in the regulation of several cellular processes including transport mechanisms and scaffold signaling. However, its role in brain function and
Evaluation of common genetic variants in 82 candidate genes as risk factors for neural tube defects
Directory of Open Access Journals (Sweden)
Pangilinan Faith
2012-08-01
Full Text Available Abstract Background Neural tube defects (NTDs are common birth defects (~1 in 1000 pregnancies in the US and Europe that have complex origins, including environmental and genetic factors. A low level of maternal folate is one well-established risk factor, with maternal periconceptional folic acid supplementation reducing the occurrence of NTD pregnancies by 50-70%. Gene variants in the folate metabolic pathway (e.g., MTHFR rs1801133 (677 C > T and MTHFD1 rs2236225 (R653Q have been found to increase NTD risk. We hypothesized that variants in additional folate/B12 pathway genes contribute to NTD risk. Methods A tagSNP approach was used to screen common variation in 82 candidate genes selected from the folate/B12 pathway and NTD mouse models. We initially genotyped polymorphisms in 320 Irish triads (NTD cases and their parents, including 301 cases and 341 Irish controls to perform case–control and family based association tests. Significantly associated polymorphisms were genotyped in a secondary set of 250 families that included 229 cases and 658 controls. The combined results for 1441 SNPs were used in a joint analysis to test for case and maternal effects. Results Nearly 70 SNPs in 30 genes were found to be associated with NTDs at the p MFTC, CDKN2A, ADA, PEMT, CUBN, GART, DNMT3A, MTHFD1 and T (Brachyury and included the known NTD risk factor MTHFD1 R653Q (rs2236225. The single strongest signal was observed in a new candidate, MFTC rs17803441 (OR = 1.61 [1.23-2.08], p = 0.0003 for the minor allele. Though nominally significant, these associations did not remain significant after correction for multiple hypothesis testing. Conclusions To our knowledge, with respect to sample size and scope of evaluation of candidate polymorphisms, this is the largest NTD genetic association study reported to date. The scale of the study and the stringency of correction are likely to have contributed to real associations failing to survive
Directory of Open Access Journals (Sweden)
Magnus Elfwing
Full Text Available Analysis of selective sweeps to pinpoint causative genomic regions involved in chicken domestication has revealed a strong selective sweep on chromosome 4 in layer chickens. The autoregulatory α-adrenergic receptor 2C (ADRA2C gene is the closest to the selective sweep and was proposed as an important gene in the domestication of layer chickens. The ADRA2C promoter region was also hypermethylated in comparison to the non-selected ancestor of all domesticated chicken breeds, the Red Junglefowl, further supporting its relevance. In mice the receptor is involved in the fight-or-flight response as it modulates epinephrine release from the adrenals. To investigate the involvement of ADRA2C in chicken domestication, we measured gene expression in the adrenals and radiolabeled receptor ligand in three brain regions comparing the domestic White Leghorn strain with the wild ancestor Red Junglefowl. In adrenals ADRA2C was twofold greater expressed than the related receptor gene ADRA2A, indicating that ADRA2C is the predominant modulator of epinephrine release but no strain differences were measured. In hypothalamus and amygdala, regions associated with the stress response, and in striatum, receptor binding pIC50 values ranged between 8.1-8.4, and the level was not influenced by the genotyped allele. Because chicken strains differ in morphology, physiology and behavior, differences attributed to a single gene may be lost in the noise caused by the heterogeneous genetic background. Therefore an F10 advanced intercross strain between White Leghorn and Red Junglefowl was used to investigate effects of ADRA2C alleles on fear related behaviors and fecundity. We did not find compelling genotype effects in open field, tonic immobility, aerial predator, associative learning or fecundity. Therefore we conclude that ADRA2C is probably not involved in the domestication of the stress response in chicken, and the strong selective sweep is probably caused by selection
Genome-Wide Identification and Analysis of Drought-Responsive Genes and MicroRNAs in Tobacco
Directory of Open Access Journals (Sweden)
Fuqiang Yin
2015-03-01
Full Text Available Drought stress response is a complex trait regulated at transcriptional and post-transcriptional levels in tobacco. Since the 1990s, many studies have shown that miRNAs act in many ways to regulate target expression in plant growth, development and stress response. The recent draft genome sequence of Nicotiana benthamiana has provided a framework for Digital Gene Expression (DGE and small RNA sequencing to understand patterns of transcription in the context of plant response to environmental stress. We sequenced and analyzed three Digital Gene Expression (DGE libraries from roots of normal and drought-stressed tobacco plants, and four small RNA populations from roots, stems and leaves of control or drought-treated tobacco plants, respectively. We identified 276 candidate drought responsive genes (DRGs with sequence similarities to 64 known DRGs from other model plant crops, 82 were transcription factors (TFs including WRKY, NAC, ERF and bZIP families. Of these tobacco DRGs, 54 differentially expressed DRGs included 21 TFs, which belonged to 4 TF families such as NAC (6, MYB (4, ERF (10, and bZIP (1. Additionally, we confirmed expression of 39 known miRNA families (122 members and five conserved miRNA families, which showed differential regulation under drought stress. Targets of miRNAs were further surveyed based on a recently published study, of which ten targets were DRGs. An integrated gene regulatory network is proposed for the molecular mechanisms of tobacco root response to drought stress using differentially expressed DRGs, the changed expression profiles of miRNAs and their target transcripts. This network analysis serves as a reference for future studies on tobacco response stresses such as drought, cold and heavy metals.
Burt, Andrew J; William, H Manilal; Perry, Gregory; Khanal, Raja; Pauls, K Peter; Kelly, James D; Navabi, Alireza
2015-01-01
Anthracnose, caused by Colletotrichum lindemuthianum, is an important fungal disease of common bean (Phaseolus vulgaris). Alleles at the Co-4 locus confer resistance to a number of races of C. lindemuthianum. A population of 94 F4:5 recombinant inbred lines of a cross between resistant black bean genotype B09197 and susceptible navy bean cultivar Nautica was used to identify markers associated with resistance in bean chromosome 8 (Pv08) where Co-4 is localized. Three SCAR markers with known linkage to Co-4 and a panel of single nucleotide markers were used for genotyping. A refined physical region on Pv08 with significant association with anthracnose resistance identified by markers was used in BLAST searches with the genomic sequence of common bean accession G19833. Thirty two unique annotated candidate genes were identified that spanned a physical region of 936.46 kb. A majority of the annotated genes identified had functional similarity to leucine rich repeats/receptor like kinase domains. Three annotated genes had similarity to 1, 3-β-glucanase domains. There were sequence similarities between some of the annotated genes found in the study and the genes associated with phosphoinositide-specific phosphilipases C associated with Co-x and the COK-4 loci found in previous studies. It is possible that the Co-4 locus is structured as a group of genes with functional domains dominated by protein tyrosine kinase along with leucine rich repeats/nucleotide binding site, phosphilipases C as well as β-glucanases.
Directory of Open Access Journals (Sweden)
Michael J McCarthy
Full Text Available Circadian rhythm abnormalities in bipolar disorder (BD have led to a search for genetic abnormalities in circadian "clock genes" associated with BD. However, no significant clock gene findings have emerged from genome-wide association studies (GWAS. At least three factors could account for this discrepancy: complex traits are polygenic, the organization of the clock is more complex than previously recognized, and/or genetic risk for BD may be shared across multiple illnesses. To investigate these issues, we considered the clock gene network at three levels: essential "core" clock genes, upstream circadian clock modulators, and downstream clock controlled genes. Using relaxed thresholds for GWAS statistical significance, we determined the rates of clock vs. control genetic associations with BD, and four additional illnesses that share clinical features and/or genetic risk with BD (major depression, schizophrenia, attention deficit/hyperactivity. Then we compared the results to a set of lithium-responsive genes. Associations with BD-spectrum illnesses and lithium-responsiveness were both enriched among core clock genes but not among upstream clock modulators. Associations with BD-spectrum illnesses and lithium-responsiveness were also enriched among pervasively rhythmic clock-controlled genes but not among genes that were less pervasively rhythmic or non-rhythmic. Our analysis reveals previously unrecognized associations between clock genes and BD-spectrum illnesses, partly reconciling previously discordant results from past GWAS and candidate gene studies.
No association between the PREP gene and lithium responsive bipolar disorder
Directory of Open Access Journals (Sweden)
Grof Paul
2007-02-01
Full Text Available Abstract Background Bipolar disorder (BD is a major psychiatric condition that commonly requires prophylactic and episodic treatment. Lithium (Li has been used for over 40 years now as an effective prophylactic agent. Response to Li treatment seems to be, at least in part, genetically determined. Although we ignore how Li specifically prevents mood episodes, it has previously been suggested that Li exerts an effect on the phosphoinositide pathway, and more recently, it has been proposed that Li may modulate prolyl endopeptidase (PREP. Methods In this study we carried out an association study looking at the PREP gene, located on ch 6q22. Five intronic single nucleotide polymorphisms (SNP, three coding SNPs and one SNP in the 5' UTR were investigated for their frequency in a BD sample of 180 excellent Li responders, 69 Li nonresponders and 126 controls. Genotyping was carried out using the SNaPshot reaction from Applied Biosystems, which is a modified fluorescent single base pair extension procedure. Results Following correction for multiple testing, no significant genotypic, allelic or estimated haplotypic differences were found between responders and nonresponders or between BD patients and controls. Conclusion PREP is an interesting candidate gene to investigate in genetic studies of BD, but our findings do not support the hypothesis that genetic variation in this gene plays a major role in the etiology of BD or Li response.
Shchetynsky, Klementy; Diaz-Gallo, Lina-Marcella; Folkersen, Lasse; Hensvold, Aase Haj; Catrina, Anca Irinel; Berg, Louise; Klareskog, Lars; Padyukov, Leonid
2017-02-02
Here we integrate verified signals from previous genetic association studies with gene expression and pathway analysis for discovery of new candidate genes and signaling networks, relevant for rheumatoid arthritis (RA). RNA-sequencing-(RNA-seq)-based expression analysis of 377 genes from previously verified RA-associated loci was performed in blood cells from 5 newly diagnosed, non-treated patients with RA, 7 patients with treated RA and 12 healthy controls. Differentially expressed genes sharing a similar expression pattern in treated and untreated RA sub-groups were selected for pathway analysis. A set of "connector" genes derived from pathway analysis was tested for differential expression in the initial discovery cohort and validated in blood cells from 73 patients with RA and in 35 healthy controls. There were 11 qualifying genes selected for pathway analysis and these were grouped into two evidence-based functional networks, containing 29 and 27 additional connector molecules. The expression of genes, corresponding to connector molecules was then tested in the initial RNA-seq data. Differences in the expression of ERBB2, TP53 and THOP1 were similar in both treated and non-treated patients with RA and an additional nine genes were differentially expressed in at least one group of patients compared to healthy controls. The ERBB2, TP53. THOP1 expression profile was successfully replicated in RNA-seq data from peripheral blood mononuclear cells from healthy controls and non-treated patients with RA, in an independent collection of samples. Integration of RNA-seq data with findings from association studies, and consequent pathway analysis implicate new candidate genes, ERBB2, TP53 and THOP1 in the pathogenesis of RA.
Mota, R R; Guimarães, S E F; Fortes, M R S; Hayes, B; Silva, F F; Verardo, L L; Kelly, M J; de Campos, C F; Guimarães, J D; Wenceslau, R R; Penitente-Filho, J M; Garcia, J F; Moore, S
2017-12-01
We performed a genome-wide mapping for the age at first calving (AFC) with the goal of annotating candidate genes that regulate fertility in Nellore cattle. Phenotypic data from 762 cows and 777k SNP genotypes from 2,992 bulls and cows were used. Single nucleotide polymorphism (SNP) effects based on the single-step GBLUP methodology were blocked into adjacent windows of 1 Megabase (Mb) to explain the genetic variance. SNP windows explaining more than 0.40% of the AFC genetic variance were identified on chromosomes 2, 8, 9, 14, 16 and 17. From these windows, we identified 123 coding protein genes that were used to build gene networks. From the association study and derived gene networks, putative candidate genes (e.g., PAPPA, PREP, FER1L6, TPR, NMNAT1, ACAD10, PCMTD1, CRH, OPKR1, NPBWR1 and NCOA2) and transcription factors (TF) (STAT1, STAT3, RELA, E2F1 and EGR1) were strongly associated with female fertility (e.g., negative regulation of luteinizing hormone secretion, folliculogenesis and establishment of uterine receptivity). Evidence suggests that AFC inheritance is complex and controlled by multiple loci across the genome. As several windows explaining higher proportion of the genetic variance were identified on chromosome 14, further studies investigating the interaction across haplotypes to better understand the molecular architecture behind AFC in Nellore cattle should be undertaken. © 2017 Blackwell Verlag GmbH.
Xia, Chongjing; Wang, Meinan; Cornejo, Omar E; Jiwan, Derick A; See, Deven R; Chen, Xianming
2017-01-01
Stripe (yellow) rust, caused by Puccinia striiformis f. sp. tritici ( Pst ), is one of the most destructive diseases of wheat worldwide. Planting resistant cultivars is an effective way to control this disease, but race-specific resistance can be overcome quickly due to the rapid evolving Pst population. Studying the pathogenicity mechanisms is critical for understanding how Pst virulence changes and how to develop wheat cultivars with durable resistance to stripe rust. We re-sequenced 7 Pst isolates and included additional 7 previously sequenced isolates to represent balanced virulence/avirulence profiles for several avirulence loci in seretome analyses. We observed an uneven distribution of heterozygosity among the isolates. Secretome comparison of Pst with other rust fungi identified a large portion of species-specific secreted proteins, suggesting that they may have specific roles when interacting with the wheat host. Thirty-two effectors of Pst were identified from its secretome. We identified candidates for Avr genes corresponding to six Yr genes by correlating polymorphisms for effector genes to the virulence/avirulence profiles of the 14 Pst isolates. The putative AvYr76 was present in the avirulent isolates, but absent in the virulent isolates, suggesting that deleting the coding region of the candidate avirulence gene has produced races virulent to resistance gene Yr76 . We conclude that incorporating avirulence/virulence phenotypes into correlation analysis with variations in genomic structure and secretome, particularly presence/absence polymorphisms of effectors, is an efficient way to identify candidate Avr genes in Pst . The candidate effector genes provide a rich resource for further studies to determine the evolutionary history of Pst populations and the co-evolutionary arms race between Pst and wheat. The Avr candidates identified in this study will lead to cloning avirulence genes in Pst , which will enable us to understand molecular mechanisms
Jiang, Li; Edwards, Stefan M; Thomsen, Bo; Workman, Christopher T; Guldbrandtsen, Bernt; Sørensen, Peter
2014-09-24
Prioritizing genetic variants is a challenge because disease susceptibility loci are often located in genes of unknown function or the relationship with the corresponding phenotype is unclear. A global data-mining exercise on the biomedical literature can establish the phenotypic profile of genes with respect to their connection to disease phenotypes. The importance of protein-protein interaction networks in the genetic heterogeneity of common diseases or complex traits is becoming increasingly recognized. Thus, the development of a network-based approach combined with phenotypic profiling would be useful for disease gene prioritization. We developed a random-set scoring model and implemented it to quantify phenotype relevance in a network-based disease gene-prioritization approach. We validated our approach based on different gene phenotypic profiles, which were generated from PubMed abstracts, OMIM, and GeneRIF records. We also investigated the validity of several vocabulary filters and different likelihood thresholds for predicted protein-protein interactions in terms of their effect on the network-based gene-prioritization approach, which relies on text-mining of the phenotype data. Our method demonstrated good precision and sensitivity compared with those of two alternative complex-based prioritization approaches. We then conducted a global ranking of all human genes according to their relevance to a range of human diseases. The resulting accurate ranking of known causal genes supported the reliability of our approach. Moreover, these data suggest many promising novel candidate genes for human disorders that have a complex mode of inheritance. We have implemented and validated a network-based approach to prioritize genes for human diseases based on their phenotypic profile. We have devised a powerful and transparent tool to identify and rank candidate genes. Our global gene prioritization provides a unique resource for the biological interpretation of data
DEFF Research Database (Denmark)
Marroqui, Laura; Dos Santos, Reinaldo Sousa; Fløyel, Tina
2015-01-01
histocompatibility complex (MHC) class I proteins, a hallmark of early β-cell inflammation in type 1 diabetes. Importantly, TYK2 inhibition prevented PIC-induced β-cell apoptosis via the mitochondrial pathway of cell death. The present findings suggest that TYK2 regulates apoptotic and proinflammatory pathways...... in pancreatic β-cells via modulation of IFNα signaling, subsequent increase in MHC class I protein, and modulation of chemokines such as CXCL10 that are important for recruitment of T cells to the islets.......Pancreatic β-cells are destroyed by an autoimmune attack in type 1 diabetes. Linkage and genome-wide association studies point to >50 loci that are associated with the disease in the human genome. Pathway analysis of candidate genes expressed in human islets identified a central role for interferon...
Directory of Open Access Journals (Sweden)
Hernández-Moneo Jose-Luis
2006-09-01
Full Text Available Abstract Background Conventional cytogenetic and comparative genomic hybridization (CGH studies in brain malignancies have shown that glioblastoma multiforme (GBM is characterized by complex structural and numerical alterations. However, the limited resolution of these techniques has precluded the precise identification of detailed specific gene copy number alterations. Results We performed a genome-wide survey of gene copy number changes in 20 primary GBMs by CGH on cDNA microarrays. A novel amplicon at 4p15, and previously uncharacterized amplicons at 13q32-34 and 1q32 were detected and are analyzed here. These amplicons contained amplified genes not previously reported. Other amplified regions containg well-known oncogenes in GBMs were also detected at 7p12 (EGFR, 7q21 (CDK6, 4q12 (PDGFRA, and 12q13-15 (MDM2 and CDK4. In order to identify the putative target genes of the amplifications, and to determine the changes in gene expression levels associated with copy number change events, we carried out parallel gene expression profiling analyses using the same cDNA microarrays. We detected overexpression of the novel amplified genes SLA/LP and STIM2 (4p15, and TNFSF13B and COL4A2 (13q32-34. Some of the candidate target genes of amplification (EGFR, CDK6, MDM2, CDK4, and TNFSF13B were tested in an independent set of 111 primary GBMs by using FISH and immunohistological assays. The novel candidate 13q-amplification target TNFSF13B was amplified in 8% of the tumors, and showed protein expression in 20% of the GBMs. Conclusion This high-resolution analysis allowed us to propose novel candidate target genes such as STIM2 at 4p15, and TNFSF13B or COL4A2 at 13q32-34 that could potentially contribute to the pathogenesis of these tumors and which would require futher investigations. We showed that overexpression of the amplified genes could be attributable to gene dosage and speculate that deregulation of those genes could be important in the development
Soerensen, Mette; Nygaard, Marianne; Debrabant, Birgit; Mengel-From, Jonas; Dato, Serena; Thinggaard, Mikael; Christensen, Kaare; Christiansen, Lene
2016-06-01
In this study we explored the association between aging-related phenotypes previously reported to predict survival in old age and variation in 77 genes from the DNA repair pathway, 32 genes from the growth hormone 1/ insulin-like growth factor 1/insulin (GH/IGF-1/INS) signalling pathway and 16 additional genes repeatedly considered as candidates for human longevity: APOE, APOA4, APOC3, ACE, CETP, HFE, IL6, IL6R, MTHFR, TGFB1, SIRTs 1, 3, 6; and HSPAs 1A, 1L, 14. Altogether, 1,049 single nucleotide polymorphisms (SNPs) were genotyped in 1,088 oldest-old (age 92-93 years) Danes and analysed with phenotype data on physical functioning (hand grip strength), cognitive functioning (mini mental state examination and a cognitive composite score), activity of daily living and self-rated health. Five SNPs showed association to one of the phenotypes; however, none of these SNPs were associated with a change in the relevant phenotype over time (7 years of follow-up) and none of the SNPs could be confirmed in a replication sample of 1,281 oldest-old Danes (age 94-100). Hence, our study does not support association between common variation in the investigated longevity candidate genes and aging-related phenotypes consistently shown to predict survival. It is possible that larger sample sizes are needed to robustly reveal associations with small effect sizes. Copyright © 2016 Elsevier Inc. All rights reserved.
Qi, Xiaoxiao; Wu, Jun; Wang, Lifen; Li, Leiting; Cao, Yufen; Tian, Luming; Dong, Xingguang; Zhang, Shaoling
2013-10-23
'Kuerlexiangli' (Pyrus sinkiangensis Yu), a native pear of Xinjiang, China, is an important agricultural fruit and primary export to the international market. However, fruit with persistent calyxes affect fruit shape and quality. Although several studies have looked into the physiological aspects of the calyx abscission process, the underlying molecular mechanisms remain unknown. In order to better understand the molecular basis of the process of calyx abscission, materials at three critical stages of regulation, with 6000 × Flusilazole plus 300 × PBO treatment (calyx abscising treatment) and 50 mg.L-1GA3 treatment (calyx persisting treatment), were collected and cDNA fragments were sequenced using digital transcript abundance measurements to identify candidate genes. Digital transcript abundance measurements was performed using high-throughput Illumina GAII sequencing on seven samples that were collected at three important stages of the calyx abscission process with chemical agent treatments promoting calyx abscission and persistence. Altogether more than 251,123,845 high quality reads were obtained with approximately 8.0 M raw data for each library. The values of 69.85%-71.90% of clean data in the digital transcript abundance measurements could be mapped to the pear genome database. There were 12,054 differentially expressed genes having Gene Ontology (GO) terms and associating with 251 Kyoto Encyclopedia of Genes and Genomes (KEGG) defined pathways. The differentially expressed genes correlated with calyx abscission were mainly involved in photosynthesis, plant hormone signal transduction, cell wall modification, transcriptional regulation, and carbohydrate metabolism. Furthermore, candidate calyx abscission-specific genes, e.g. Inflorescence deficient in abscission gene, were identified. Quantitative real-time PCR was used to confirm the digital transcript abundance measurements results. We identified candidate genes that showed highly dynamic changes in
Directory of Open Access Journals (Sweden)
Wanwipa Vongsangnak
2016-10-01
Full Text Available Bioluminescence, which living organisms such as fireflies emit light, has been studied extensively for over half a century. This intriguing reaction, having its origins in nature where glowing insects can signal things such as attraction or defense, is now widely used in biotechnology with applications of bioluminescence and chemiluminescence. Luciferase, a key enzyme in this reaction, has been well characterized; however, the enzymes involved in the biosynthetic pathway of its substrate, luciferin, remains unsolved at present. To elucidate the luciferin metabolism, we performed a de novo transcriptome analysis using larvae of the firefly species, Luciola aquatilis. Here, a comparative analysis is performed with the model coleopteran insect Tribolium casteneum to elucidate the metabolic pathways in L. aquatilis. Based on a template luciferin biosynthetic pathway, combined with a range of protein and pathway databases, and various prediction tools for functional annotation, the candidate genes, enzymes, and biochemical reactions involved in luciferin metabolism are proposed for L. aquatilis. The candidate gene expression is validated in the adult L. aquatilis using reverse transcription PCR (RT-PCR. This study provides useful information on the bio-production of luciferin in the firefly and will benefit to future applications of the valuable firefly bioluminescence system.
Shen, K A; Meyers, B C; Islam-Faridi, M N; Chin, D B; Stelly, D M; Michelmore, R W
1998-08-01
The recent cloning of genes for resistance against diverse pathogens from a variety of plants has revealed that many share conserved sequence motifs. This provides the possibility of isolating numerous additional resistance genes by polymerase chain reaction (PCR) with degenerate oligonucleotide primers. We amplified resistance gene candidates (RGCs) from lettuce with multiple combinations of primers with low degeneracy designed from motifs in the nucleotide binding sites (NBSs) of RPS2 of Arabidopsis thaliana and N of tobacco. Genomic DNA, cDNA, and bacterial artificial chromosome (BAC) clones were successfully used as templates. Four families of sequences were identified that had the same similarity to each other as to resistance genes from other species. The relationship of the amplified products to resistance genes was evaluated by several sequence and genetic criteria. The amplified products contained open reading frames with additional sequences characteristic of NBSs. Hybridization of RGCs to genomic DNA and to BAC clones revealed large numbers of related sequences. Genetic analysis demonstrated the existence of clustered multigene families for each of the four RGC sequences. This parallels classical genetic data on clustering of disease resistance genes. Two of the four families mapped to known clusters of resistance genes; these two families were therefore studied in greater detail. Additional evidence that these RGCs could be resistance genes was gained by the identification of leucine-rich repeat (LRR) regions in sequences adjoining the NBS similar to those in RPM1 and RPS2 of A. thaliana. Fluorescent in situ hybridization confirmed the clustered genomic distribution of these sequences. The use of PCR with degenerate oligonucleotide primers is therefore an efficient method to identify numerous RGCs in plants.
Feline Coronavirus 3c Protein: A Candidate for a Virulence Marker?
Directory of Open Access Journals (Sweden)
A. S. Hora
2016-01-01
Full Text Available Feline infectious peritonitis virus (FIPV is highly virulent and responsible for the highly fatal disease feline infectious peritonitis (FIP, whereas feline enteric coronavirus (FECV is widespread among the feline population and typically causes asymptomatic infections. Some candidates for genetic markers capable of differentiating these two pathotypes of a unique virus (feline coronavirus have been proposed by several studies. In the present survey, in order to search for markers that can differentiate FECV and FIPV, several clones of the 3a–c, E, and M genes were sequenced from samples obtained from cats with or without FIP. All genes showed genetic diversity and suggested the presence of FCoV mutant spectrum capable of producing a virulent pathotype in an individual-specific way. In addition, all the feline coronavirus FIPV strains demonstrated a truncated 3c protein, and the 3c gene was the only observed pathotypic marker for FCoVs, showing that 3c gene is a candidate marker for the distinction between the two pathotypes when the mutant spectrum is taken into account.
Yu, Hong; Soler, Marçal; Mila, Isabelle; San Clemente, Hélène; Savelli, Bruno; Dunand, Christophe; Paiva, Jorge A. P.; Myburg, Alexander A.; Bouzayen, Mondher; Grima-Pettenati, Jacqueline; Cassan-Wang, Hua
2014-01-01
Auxin is a central hormone involved in a wide range of developmental processes including the specification of vascular stem cells. Auxin Response Factors (ARF) are important actors of the auxin signalling pathway, regulating the transcription of auxin-responsive genes through direct binding to their promoters. The recent availability of the Eucalyptus grandis genome sequence allowed us to examine the characteristics and evolutionary history of this gene family in a woody plant of high economic importance. With 17 members, the E. grandis ARF gene family is slightly contracted, as compared to those of most angiosperms studied hitherto, lacking traces of duplication events. In silico analysis of alternative transcripts and gene truncation suggested that these two mechanisms were preeminent in shaping the functional diversity of the ARF family in Eucalyptus. Comparative phylogenetic analyses with genomes of other taxonomic lineages revealed the presence of a new ARF clade found preferentially in woody and/or perennial plants. High-throughput expression profiling among different organs and tissues and in response to environmental cues highlighted genes expressed in vascular cambium and/or developing xylem, responding dynamically to various environmental stimuli. Finally, this study allowed identification of three ARF candidates potentially involved in the auxin-regulated transcriptional program underlying wood formation. PMID:25269088
Directory of Open Access Journals (Sweden)
Hong Yu
Full Text Available Auxin is a central hormone involved in a wide range of developmental processes including the specification of vascular stem cells. Auxin Response Factors (ARF are important actors of the auxin signalling pathway, regulating the transcription of auxin-responsive genes through direct binding to their promoters. The recent availability of the Eucalyptus grandis genome sequence allowed us to examine the characteristics and evolutionary history of this gene family in a woody plant of high economic importance. With 17 members, the E. grandis ARF gene family is slightly contracted, as compared to those of most angiosperms studied hitherto, lacking traces of duplication events. In silico analysis of alternative transcripts and gene truncation suggested that these two mechanisms were preeminent in shaping the functional diversity of the ARF family in Eucalyptus. Comparative phylogenetic analyses with genomes of other taxonomic lineages revealed the presence of a new ARF clade found preferentially in woody and/or perennial plants. High-throughput expression profiling among different organs and tissues and in response to environmental cues highlighted genes expressed in vascular cambium and/or developing xylem, responding dynamically to various environmental stimuli. Finally, this study allowed identification of three ARF candidates potentially involved in the auxin-regulated transcriptional program underlying wood formation.
Directory of Open Access Journals (Sweden)
Henrik Bjørn Nielsen
2007-08-01
Full Text Available The systematic comparison of transcriptional responses of organisms is a powerful tool in functional genomics. For example, mutants may be characterized by comparing their transcript profiles to those obtained in other experiments querying the effects on gene expression of many experimental factors including treatments, mutations and pathogen infections. Similarly, drugs may be discovered by the relationship between the transcript profiles effectuated or impacted by a candidate drug and by the target disease. The integration of such data enables systems biology to predict the interplay between experimental factors affecting a biological system. Unfortunately, direct comparisons of gene expression profiles obtained in independent, publicly available microarray experiments are typically compromised by substantial, experiment-specific biases. Here we suggest a novel yet conceptually simple approach for deriving 'Functional Association(s by Response Overlap' (FARO between microarray gene expression studies. The transcriptional response is defined by the set of differentially expressed genes independent from the magnitude or direction of the change. This approach overcomes the limited comparability between studies that is typical for methods that rely on correlation in gene expression. We apply FARO to a compendium of 242 diverse Arabidopsis microarray experimental factors, including phyto-hormones, stresses and pathogens, growth conditions/stages, tissue types and mutants. We also use FARO to confirm and further delineate the functions of Arabidopsis MAP kinase 4 in disease and stress responses. Furthermore, we find that a large, well-defined set of genes responds in opposing directions to different stress conditions and predict the effects of different stress combinations. This demonstrates the usefulness of our approach for exploiting public microarray data to derive biologically meaningful associations between experimental factors. Finally, our
LOD score exclusion analyses for candidate QTLs using random population samples.
Deng, Hong-Wen
2003-11-01
While extensive analyses have been conducted to test for, no formal analyses have been conducted to test against, the importance of candidate genes as putative QTLs using random population samples. Previously, we developed an LOD score exclusion mapping approach for candidate genes for complex diseases. Here, we extend this LOD score approach for exclusion analyses of candidate genes for quantitative traits. Under this approach, specific genetic effects (as reflected by heritability) and inheritance models at candidate QTLs can be analyzed and if an LOD score is < or = -2.0, the locus can be excluded from having a heritability larger than that specified. Simulations show that this approach has high power to exclude a candidate gene from having moderate genetic effects if it is not a QTL and is robust to population admixture. Our exclusion analysis complements association analysis for candidate genes as putative QTLs in random population samples. The approach is applied to test the importance of Vitamin D receptor (VDR) gene as a potential QTL underlying the variation of bone mass, an important determinant of osteoporosis.
Miao, Yuanxin; Soudy, Fathia; Xu, Zhong; Liao, Mingxing; Zhao, Shuhong; Li, Xinyun
2017-01-01
Feed efficiency (FE) is a very important trait in livestock industry. Identification of the candidate genes could be of benefit for the improvement of FE trait. Mouse is used as the model for many studies in mammals. In this study, the candidate genes related to FE and coat color were identified using C57BL/6J (C57) × Kunming (KM) F2 mouse population. GWAS results showed that 61 and 2 SNPs were genome-wise suggestive significantly associated with feed conversion ratio (FCR) and feed intake (FI) traits, respectively. Moreover, the Erbin, Msrb2, Ptf1a, and Fgf10 were considered as the candidate genes of FE. The Lpl was considered as the candidate gene of FI. Further, the coat color trait was studied. KM mice are white and C57 ones are black. The GWAS results showed that the most significant SNP was located at chromosome 7, and the closely linked gene was Tyr. Therefore, our study offered useful target genes related to FE in mice; these genes may play similar roles in FE of livestock. Also, we identified the major gene of coat color in mice, which would be useful for better understanding of natural mutation of the coat color in mice.
Directory of Open Access Journals (Sweden)
Yuanxin Miao
2017-01-01
Full Text Available Feed efficiency (FE is a very important trait in livestock industry. Identification of the candidate genes could be of benefit for the improvement of FE trait. Mouse is used as the model for many studies in mammals. In this study, the candidate genes related to FE and coat color were identified using C57BL/6J (C57 × Kunming (KM F2 mouse population. GWAS results showed that 61 and 2 SNPs were genome-wise suggestive significantly associated with feed conversion ratio (FCR and feed intake (FI traits, respectively. Moreover, the Erbin, Msrb2, Ptf1a, and Fgf10 were considered as the candidate genes of FE. The Lpl was considered as the candidate gene of FI. Further, the coat color trait was studied. KM mice are white and C57 ones are black. The GWAS results showed that the most significant SNP was located at chromosome 7, and the closely linked gene was Tyr. Therefore, our study offered useful target genes related to FE in mice; these genes may play similar roles in FE of livestock. Also, we identified the major gene of coat color in mice, which would be useful for better understanding of natural mutation of the coat color in mice.
Eskandari, Mehrzad; Cober, Elroy R; Rajcan, Istvan
2013-07-01
Increasing the oil concentration in soybean seeds has been given more attention in recent years because of demand for both edible oil and biodiesel production. Oil concentration in soybean is a complex quantitative trait regulated by many genes as well as environmental conditions. To identify genes governing seed oil concentration in soybean, 16 putative candidate genes of three important gene families (GPAT: acyl-CoA:sn-glycerol-3-phosphate acyltransferase, DGAT: acyl-CoA:diacylglycerol acyltransferase, and PDAT: phospholipid:diacylglycerol acyltransferase) involved in triacylglycerol (TAG) biosynthesis pathways were selected and their sequences retrieved from the soybean database ( http://www.phytozome.net/soybean ). Three sequence mutations were discovered in either coding or noncoding regions of three DGAT soybean isoforms when comparing the parents of a 203 recombinant inbreed line (RIL) population; OAC Wallace and OAC Glencoe. The RIL population was used to study the effects of these mutations on seed oil concentration and other important agronomic and seed composition traits, including seed yield and protein concentration across three field locations in Ontario, Canada, in 2009 and 2010. An insertion/deletion (indel) mutation in the GmDGAT2B gene in OAC Wallace was significantly associated with reduced seed oil concentration across three environments and reduced seed yield at Woodstock in 2010. A mutation in the 3' untranslated (3'UTR) region of GmDGAT2C was associated with seed yield at Woodstock in 2009. A mutation in the intronic region of GmDGAR1B was associated with seed yield and protein concentration at Ottawa in 2010. The genes identified in this study had minor effects on either seed yield or oil concentration, which was in agreement with the quantitative nature of the traits. However, the novel gene-specific markers designed in the present study can be used in soybean breeding for marker-assisted selection aimed at increasing seed yield and oil
Energy Technology Data Exchange (ETDEWEB)
Brulle, Franck; Lemiere, Sebastien [Univ Lille Nord de France, F-59000 Lille (France); LGCgE, Equipe Ecologie Numerique et Ecotoxicologie, Lille 1, F-59650 Villeneuve d' Ascq (France); Waterlot, Christophe; Douay, Francis [Univ Lille Nord de France, F-59000 Lille (France); LGCgE, Equipe Sols et Environnement, Groupe ISA, 48 boulevard Vauban, F-59046 Lille Cedex (France); Vandenbulcke, Franck, E-mail: franck.vandenbulcke@univ-lille1.fr [Univ Lille Nord de France, F-59000 Lille (France); LGCgE, Equipe Ecologie Numerique et Ecotoxicologie, Lille 1, F-59650 Villeneuve d' Ascq (France)
2011-11-15
Past activities of 2 smelters (Metaleurop Nord and Nyrstar) led to the accumulation of high amounts of Metal Trace Elements (TEs) in top soils of the Noyelles-Godault/Auby area, Northern France. Earthworms were exposed to polluted soils collected in this area to study and better understand the physiological changes, the mechanisms of acclimation, and detoxification resulting from TE exposure. Previously we have cloned and transcriptionally characterized potential biomarkers from immune cells of the ecotoxicologically important earthworm species Eisenia fetida exposed in vivo to TE-spiked standard soils. In the present study, analysis of expression kinetics of four candidate indicator genes (Cadmium-metallothionein, coactosin like protein, phytochelatin synthase and lysenin) was performed in E. fetida after microcosm exposures to natural soils exhibiting an environmental cadmium (Cd) gradient in a kinetic manner. TE body burdens were also measured. This microcosm study provided insights into: (1) the ability of the 4 tested genes to serve as expression biomarkers, (2) detoxification processes through the expression analysis of selected genes, and (3) influence of land uses on the response of potential biomarkers (gene expression or TE uptake). - Highlights: {yields} Expression biomarkers in animals exposed to Cadmium-contaminated field soils. {yields} Expression kinetics to test the ability of genes to serve as expression biomarkers. {yields} Study of detoxification processes through the expression analysis of selected genes.
Zhang, Peng; Zhu, Yuqiang; Wang, Lili; Chen, Liping; Zhou, Shengjun
2015-12-14
Powdery mildew (PM) is the most common fungal disease of cucumber and other cucurbit crops, while breeding the PM-resistant materials is the effective way to defense this disease, and the recent development of modern genetics and genomics make us aware of that studying the resistance genes is the essential way to breed the PM high-resistance plant. With the ever increasing throughput of next-generation sequencing (NGS), the development of specific length amplified fragment sequencing (SLAF-seq) as a high-resolution strategy for large-scale de novo SNP discovery is gradually applied for functional gene mining. Here we combined the bulked segregant analysis (BSA) with SLAF-seq to identify candidate genes associated with PM resistance in cucumber. A segregating population comprising 251 F2 individuals was developed using H136 (female parent) as susceptible parent and BK2 (male parent) as resistance donor. After PMR test, total genomic DNA was prepared from each plant. Systemic genomic analysis of the GC content, repeat sequence, etc. was carried out by prediction software SLAF_Predict to establish condition to ensure the uniformity and density of the molecular markers. After samples were gel purified, SLAFs were generated at Biomarker Technologies Corporation in Beijing. Based on SLAF tags and the PMR test result, the hot region were annotated. A total of 73,100 high-quality SLAF tags with an average depth of 99.11× were sequenced. Among these, 5,355 polymorphic tags were identified with a polymorphism rate of 7.34 %, including 7.09 % SNPs and other polymorphism types. Finally, 140 associated SLAFs were identified, and two main Hot Regions were detected on chromosome 1 and 6, which contained five genes invovled in defense response, toxin metabolism, cell stress response, and injury response in cucumber. Associated markers identified by super-BSA in this study, could not only speed up the study of the PMR genes, but also provide a feasible solution for breeding the
Huang, Kristen M; Geunes-Boyer, Scarlett; Wu, Sufen; Dutra, Amalia; Favor, Jack; Stambolian, Dwight
2004-05-01
Xcat mice display X-linked congenital cataracts and are a mouse model for the human X-linked cataract disease Nance Horan syndrome (NHS). The genetic defect in Xcat mice and NHS patients is not known. We isolated and sequenced a BAC contig representing a portion of the Xcat critical region. We combined our sequencing data with the most recent mouse sequence assemblies from both Celera and public databases. The sequence of the 2.2-Mb Xcat critical region was then analyzed for potential Xcat candidate genes. The coding regions of the seven known genes within this area (Rai2, Rbbp7, Ctps2, Calb3, Grpr, Reps2, and Syap1) were sequenced in Xcat mice and no mutations were detected. The expression of Rai2 was quantitatively identical in wild-type and Xcat mutant eyes. These results indicate that the Xcat mutation is within a novel, undiscovered gene.
DEFF Research Database (Denmark)
Wit, Janneke; Frydenberg, Jane; Sarup, Pernille Merete
2013-01-01
usually focussed on one sex and on flies originating from one genetic background, and results from different studies often do not overlap. Using D. melanogaster selected for increased longevity we aimed to find robust longevity related genes by examining gene expression in both sexes of flies originating......Elucidating genes that affect life span or that can be used as biomarkers for ageing has received attention in diverse studies in recent years. Using model organisms and various approaches several genes have been linked to the longevity phenotype. For Drosophila melanogaster those studies have...... from different genetic backgrounds. Further, we compared expression changes across three ages, when flies were young, middle aged or old, to examine how candidate gene expression changes with the onset of ageing. We selected 10 genes based on their expression differences in prior microarray studies...
Directory of Open Access Journals (Sweden)
Wu Bin
2012-01-01
Full Text Available Abstract Background Digitalis purpurea is an important ornamental and medicinal plant. There is considerable interest in exploring its transcriptome. Results Through high-throughput 454 sequencing and subsequent assembly, we obtained 23532 genes, of which 15626 encode conserved proteins. We determined 140 unigenes to be candidates involved in cardiac glycoside biosynthesis. It could be grouped into 30 families, of which 29 were identified for the first time in D. purpurea. We identified 2660 mRNA-like npcRNA (mlncRNA candidates, an emerging class of regulators, using a computational mlncRNA identification pipeline and 13 microRNA-producing unigenes based on sequence conservation and hairpin structure-forming capability. Twenty five protein-coding unigenes were predicted to be targets of these microRNAs. Among the mlncRNA candidates, only 320 could be grouped into 140 families with at least two members in a family. The majority of D. purpurea mlncRNAs were species-specific and many of them showed tissue-specific expression and responded to cold and dehydration stresses. We identified 417 protein-coding genes with regions significantly homologous or complementary to 375 mlncRNAs. It includes five genes involved in secondary metabolism. A positive correlation was found in gene expression between protein-coding genes and the homologous mlncRNAs in response to cold and dehydration stresses, while the correlation was negative when protein-coding genes and mlncRNAs were complementary to each other. Conclusions Through comprehensive transcriptome analysis, we not only identified 29 novel gene families potentially involved in the biosynthesis of cardiac glycosides but also characterized a large number of mlncRNAs. Our results suggest the importance of mlncRNAs in secondary metabolism and stress response in D. purpurea.
DEFF Research Database (Denmark)
Rasmussen, Malene B; Nielsen, Jakob V; Lourenço, Charles M
2014-01-01
(SRO) involved five RefSeq genes, including the transcription factor gene ZBTB20 and the dopamine receptor gene DRD3, considered as candidate genes for the syndrome. METHODS AND RESULTS: We used array comparative genomic hybridization and next-generation mate-pair sequencing to identify key structural...... patient with developmental delay and autism, we detected the first microdeletion at 3q13.31, which truncated ZBTB20 but did not involve DRD3 or the other genes within the previously defined SRO. Zbtb20 directly represses 346 genes in the developing murine brain. Of the 342 human orthologous ZBTB20...
Directory of Open Access Journals (Sweden)
Andrew J Burt
Full Text Available Anthracnose, caused by Colletotrichum lindemuthianum, is an important fungal disease of common bean (Phaseolus vulgaris. Alleles at the Co-4 locus confer resistance to a number of races of C. lindemuthianum. A population of 94 F4:5 recombinant inbred lines of a cross between resistant black bean genotype B09197 and susceptible navy bean cultivar Nautica was used to identify markers associated with resistance in bean chromosome 8 (Pv08 where Co-4 is localized. Three SCAR markers with known linkage to Co-4 and a panel of single nucleotide markers were used for genotyping. A refined physical region on Pv08 with significant association with anthracnose resistance identified by markers was used in BLAST searches with the genomic sequence of common bean accession G19833. Thirty two unique annotated candidate genes were identified that spanned a physical region of 936.46 kb. A majority of the annotated genes identified had functional similarity to leucine rich repeats/receptor like kinase domains. Three annotated genes had similarity to 1, 3-β-glucanase domains. There were sequence similarities between some of the annotated genes found in the study and the genes associated with phosphoinositide-specific phosphilipases C associated with Co-x and the COK-4 loci found in previous studies. It is possible that the Co-4 locus is structured as a group of genes with functional domains dominated by protein tyrosine kinase along with leucine rich repeats/nucleotide binding site, phosphilipases C as well as β-glucanases.
Exome sequencing in 53 sporadic cases of schizophrenia identifies 18 putative candidate genes.
Directory of Open Access Journals (Sweden)
Michel Guipponi
Full Text Available Schizophrenia (SCZ is a severe, debilitating mental illness which has a significant genetic component. The identification of genetic factors related to SCZ has been challenging and these factors remain largely unknown. To evaluate the contribution of de novo variants (DNVs to SCZ, we sequenced the exomes of 53 individuals with sporadic SCZ and of their non-affected parents. We identified 49 DNVs, 18 of which were predicted to alter gene function, including 13 damaging missense mutations, 2 conserved splice site mutations, 2 nonsense mutations, and 1 frameshift deletion. The average number of exonic DNV per proband was 0.88, which corresponds to an exonic point mutation rate of 1.7×10(-8 per nucleotide per generation. The non-synonymous-to-synonymous mutation ratio of 2.06 did not differ from neutral expectations. Overall, this study provides a list of 18 putative candidate genes for sporadic SCZ, and when combined with the results of similar reports, identifies a second proband carrying a non-synonymous DNV in the RGS12 gene.
Arrighi, J.F.; Barre, A.; Amor, Ben B.; Bersoult, A.; Campos Soriano, L.; Mirabella, R.; Carvalho-Niebel, de F.; Journet, E.P.; Ghérardi, M.; Huguet, T.; Geurts, R.; Dénarié, J.; Rougé, P.; Gough, C.
2006-01-01
Rhizobial Nod factors are key symbiotic signals responsible for starting the nodulation process in host legume plants. Of the six Medicago truncatula genes controlling a Nod factor signaling pathway, Nod Factor Perception (NFP) was reported as a candidate Nod factor receptor gene. Here, we provide
Assessment of PALB2 as a candidate melanoma susceptibility gene.
Directory of Open Access Journals (Sweden)
Lauren G Aoude
Full Text Available Partner and localizer of BRCA2 (PALB2 interacts with BRCA2 to enable double strand break repair through homologous recombination. Similar to BRCA2, germline mutations in PALB2 have been shown to predispose to Fanconi anaemia as well as pancreatic and breast cancer. The PALB2/BRCA2 protein interaction, as well as the increased melanoma risk observed in families harbouring BRCA2 mutations, makes PALB2 a candidate for melanoma susceptibility. In order to assess PALB2 as a melanoma predisposition gene, we sequenced the entire protein-coding sequence of PALB2 in probands from 182 melanoma families lacking pathogenic mutations in known high penetrance melanoma susceptibility genes: CDKN2A, CDK4, and BAP1. In addition, we interrogated whole-genome and exome data from another 19 kindreds with a strong family history of melanoma for deleterious mutations in PALB2. Here we report a rare known deleterious PALB2 mutation (rs118203998 causing a premature truncation of the protein (p.Y1183X in an individual who had developed four different cancer types, including melanoma. Three other family members affected with melanoma did not carry the variant. Overall our data do not support a case for PALB2 being associated with melanoma predisposition.
Terabayashi, Yasunobu; Sano, Motoaki; Yamane, Noriko; Marui, Junichiro; Tamano, Koichi; Sagara, Junichi; Dohmoto, Mitsuko; Oda, Ken; Ohshima, Eiji; Tachibana, Kuniharu; Higa, Yoshitaka; Ohashi, Shinichi; Koike, Hideaki; Machida, Masayuki
2010-12-01
Kojic acid is produced in large amounts by Aspergillus oryzae as a secondary metabolite and is widely used in the cosmetic industry. Glucose can be converted to kojic acid, perhaps by only a few steps, but no genes for the conversion have thus far been revealed. Using a DNA microarray, gene expression profiles under three pairs of conditions significantly affecting kojic acid production were compared. All genes were ranked using an index parameter reflecting both high amounts of transcription and a high induction ratio under producing conditions. After disruption of nine candidate genes selected from the top of the list, two genes of unknown function were found to be responsible for kojic acid biosynthesis, one having an oxidoreductase motif and the other a transporter motif. These two genes are closely associated in the genome, showing typical characteristics of genes involved in secondary metabolism. Copyright © 2010 Elsevier Inc. All rights reserved.
Sandhu, Maninder; Sureshkumar, V; Prakash, Chandra; Dixit, Rekha; Solanke, Amolkumar U; Sharma, Tilak Raj; Mohapatra, Trilochan; S V, Amitha Mithra
2017-09-30
Genome-wide microarray has enabled development of robust databases for functional genomics studies in rice. However, such databases do not directly cater to the needs of breeders. Here, we have attempted to develop a web interface which combines the information from functional genomic studies across different genetic backgrounds with DNA markers so that they can be readily deployed in crop improvement. In the current version of the database, we have included drought and salinity stress studies since these two are the major abiotic stresses in rice. RiceMetaSys, a user-friendly and freely available web interface provides comprehensive information on salt responsive genes (SRGs) and drought responsive genes (DRGs) across genotypes, crop development stages and tissues, identified from multiple microarray datasets. 'Physical position search' is an attractive tool for those using QTL based approach for dissecting tolerance to salt and drought stress since it can provide the list of SRGs and DRGs in any physical interval. To identify robust candidate genes for use in crop improvement, the 'common genes across varieties' search tool is useful. Graphical visualization of expression profiles across genes and rice genotypes has been enabled to facilitate the user and to make the comparisons more impactful. Simple Sequence Repeat (SSR) search in the SRGs and DRGs is a valuable tool for fine mapping and marker assisted selection since it provides primers for survey of polymorphism. An external link to intron specific markers is also provided for this purpose. Bulk retrieval of data without any limit has been enabled in case of locus and SSR search. The aim of this database is to facilitate users with a simple and straight-forward search options for identification of robust candidate genes from among thousands of SRGs and DRGs so as to facilitate linking variation in expression profiles to variation in phenotype. Database URL: http://14.139.229.201.
Irradiation response of rapidly solidified Path A type prime candidate alloys
International Nuclear Information System (INIS)
Imeson, E.; Tong, C.; Lee, M.; Vander Sande, J.B.; Harling, O.K.
1981-01-01
The objective of this study is to present a first assessment of the microstructural response to neutron irradiation shown by Path A alloys prepared by rapid solidification processing. To more fully demonstrate the potential of the method, alloys with increased titanium and carbon content have been used in addition to the Path A prime candidate alloy
Prioritization of epilepsy associated candidate genes by convergent analysis.
Jia, Peilin; Ewers, Jeffrey M; Zhao, Zhongming
2011-02-24
Epilepsy is a severe neurological disorder affecting a large number of individuals, yet the underlying genetic risk factors for epilepsy remain unclear. Recent studies have revealed several recurrent copy number variations (CNVs) that are more likely to be associated with epilepsy. The responsible gene(s) within these regions have yet to be definitively linked to the disorder, and the implications of their interactions are not fully understood. Identification of these genes may contribute to a better pathological understanding of epilepsy, and serve to implicate novel therapeutic targets for further research. In this study, we examined genes within heterozygous deletion regions identified in a recent large-scale study, encompassing a diverse spectrum of epileptic syndromes. By integrating additional protein-protein interaction data, we constructed subnetworks for these CNV-region genes and also those previously studied for epilepsy. We observed 20 genes common to both networks, primarily concentrated within a small molecular network populated by GABA receptor, BDNF/MAPK signaling, and estrogen receptor genes. From among the hundreds of genes in the initial networks, these were designated by convergent evidence for their likely association with epilepsy. Importantly, the identified molecular network was found to contain complex interrelationships, providing further insight into epilepsy's underlying pathology. We further performed pathway enrichment and crosstalk analysis and revealed a functional map which indicates the significant enrichment of closely related neurological, immune, and kinase regulatory pathways. The convergent framework we proposed here provides a unique and powerful approach to screening and identifying promising disease genes out of typically hundreds to thousands of genes in disease-related CNV-regions. Our network and pathway analysis provides important implications for the underlying molecular mechanisms for epilepsy. The strategy can be
Prioritization of epilepsy associated candidate genes by convergent analysis.
Directory of Open Access Journals (Sweden)
Peilin Jia
2011-02-01
Full Text Available Epilepsy is a severe neurological disorder affecting a large number of individuals, yet the underlying genetic risk factors for epilepsy remain unclear. Recent studies have revealed several recurrent copy number variations (CNVs that are more likely to be associated with epilepsy. The responsible gene(s within these regions have yet to be definitively linked to the disorder, and the implications of their interactions are not fully understood. Identification of these genes may contribute to a better pathological understanding of epilepsy, and serve to implicate novel therapeutic targets for further research.In this study, we examined genes within heterozygous deletion regions identified in a recent large-scale study, encompassing a diverse spectrum of epileptic syndromes. By integrating additional protein-protein interaction data, we constructed subnetworks for these CNV-region genes and also those previously studied for epilepsy. We observed 20 genes common to both networks, primarily concentrated within a small molecular network populated by GABA receptor, BDNF/MAPK signaling, and estrogen receptor genes. From among the hundreds of genes in the initial networks, these were designated by convergent evidence for their likely association with epilepsy. Importantly, the identified molecular network was found to contain complex interrelationships, providing further insight into epilepsy's underlying pathology. We further performed pathway enrichment and crosstalk analysis and revealed a functional map which indicates the significant enrichment of closely related neurological, immune, and kinase regulatory pathways.The convergent framework we proposed here provides a unique and powerful approach to screening and identifying promising disease genes out of typically hundreds to thousands of genes in disease-related CNV-regions. Our network and pathway analysis provides important implications for the underlying molecular mechanisms for epilepsy. The
International Nuclear Information System (INIS)
Ji, Xinglai; Tang, Jie; Halberg, Richard; Busam, Dana; Ferriera, Steve; Peña, Maria Marjorette O; Venkataramu, Chinnambally; Yeatman, Timothy J; Zhao, Shaying
2010-01-01
We are developing a cross-species comparison strategy to distinguish between cancer driver- and passenger gene alteration candidates, by utilizing the difference in genomic location of orthologous genes between the human and other mammals. As an initial test of this strategy, we conducted a pilot study with human colorectal cancer (CRC) and its mouse model C57BL/6J Apc Min/+ , focusing on human 5q22.2 and 18q21.1-q21.2. We first performed bioinformatics analysis on the evolution of 5q22.2 and 18q21.1-q21.2 regions. Then, we performed exon-targeted sequencing, real time quantitative polymerase chain reaction (qPCR), and real time quantitative reverse transcriptase PCR (qRT-PCR) analyses on a number of genes of both regions with both human and mouse colon tumors. These two regions (5q22.2 and 18q21.1-q21.2) are frequently deleted in human CRCs and encode genuine colorectal tumor suppressors APC and SMAD4. They also encode genes such as MCC (mutated in colorectal cancer) with their role in CRC etiology unknown. We have discovered that both regions are evolutionarily unstable, resulting in genes that are clustered in each human region being found scattered at several distinct loci in the genome of many other species. For instance, APC and MCC are within 200 kb apart in human 5q22.2 but are 10 Mb apart in the mouse genome. Importantly, our analyses revealed that, while known CRC driver genes APC and SMAD4 were disrupted in both human colorectal tumors and tumors from Apc Min/+ mice, the questionable MCC gene was disrupted in human tumors but appeared to be intact in mouse tumors. These results indicate that MCC may not actually play any causative role in early colorectal tumorigenesis. We also hypothesize that its disruption in human CRCs is likely a mere result of its close proximity to APC in the human genome. Expanding this pilot study to the entire genome may identify more questionable genes like MCC, facilitating the discovery of new CRC driver gene candidates
Ji, Xinglai; Tang, Jie; Halberg, Richard; Busam, Dana; Ferriera, Steve; Peña, Maria Marjorette O; Venkataramu, Chinnambally; Yeatman, Timothy J; Zhao, Shaying
2010-08-13
We are developing a cross-species comparison strategy to distinguish between cancer driver- and passenger gene alteration candidates, by utilizing the difference in genomic location of orthologous genes between the human and other mammals. As an initial test of this strategy, we conducted a pilot study with human colorectal cancer (CRC) and its mouse model C57BL/6J ApcMin/+, focusing on human 5q22.2 and 18q21.1-q21.2. We first performed bioinformatics analysis on the evolution of 5q22.2 and 18q21.1-q21.2 regions. Then, we performed exon-targeted sequencing, real time quantitative polymerase chain reaction (qPCR), and real time quantitative reverse transcriptase PCR (qRT-PCR) analyses on a number of genes of both regions with both human and mouse colon tumors. These two regions (5q22.2 and 18q21.1-q21.2) are frequently deleted in human CRCs and encode genuine colorectal tumor suppressors APC and SMAD4. They also encode genes such as MCC (mutated in colorectal cancer) with their role in CRC etiology unknown. We have discovered that both regions are evolutionarily unstable, resulting in genes that are clustered in each human region being found scattered at several distinct loci in the genome of many other species. For instance, APC and MCC are within 200 kb apart in human 5q22.2 but are 10 Mb apart in the mouse genome. Importantly, our analyses revealed that, while known CRC driver genes APC and SMAD4 were disrupted in both human colorectal tumors and tumors from ApcMin/+ mice, the questionable MCC gene was disrupted in human tumors but appeared to be intact in mouse tumors. These results indicate that MCC may not actually play any causative role in early colorectal tumorigenesis. We also hypothesize that its disruption in human CRCs is likely a mere result of its close proximity to APC in the human genome. Expanding this pilot study to the entire genome may identify more questionable genes like MCC, facilitating the discovery of new CRC driver gene candidates.
Identification of heat-responsive genes in carnation (Dianthus caryophyllus L. by RNA-seq
Directory of Open Access Journals (Sweden)
Xueli eWan
2015-07-01
Full Text Available Carnation (Dianthus caryophyllus L. is an important flower crop, having substantial commercial value as a cut-flower due to the long vase-life and wide array of flower colours and forms. Standard carnation varieties perform well under cool climates but are very susceptible to high temperatures which adversely affect the yield and the quality of the cut-flowers. Despite several studies of carnation contributing to the number of expressed sequence tags (ESTs, transcriptomic information of this species remains very limited, particularly regarding abiotic stress-related genes. Here, transcriptome analysis was performed to generate expression profiles of heat stress (HS-responsive genes in carnation. We sequenced a cDNA library constructed with mixed RNA from carnation leaves subjected to 42oC HS (0, 0.5, 1 and 2 h and 46oC HS (0.5, 1 and 2 h, and obtained 45,604,882 high quality paired-end reads. After de novo assembly and quantitative assessment, 99,255 contigs were generated with an average length of 1053bp. We then obtained functional annotations by aligning contigs with public protein databases including NR, SwissProt, KEGG and COG. Using the above carnation transcriptome as the reference, we compared the effects of high temperature treatments (42oC: duration 0.5, 2 or 12h delivered to aseptic carnation seedlings, relative to untreated controls, using the FPKM metric. Overall, 11,471 genes were identified which showed a significant response to one or more of the three HS treatment times. In addition, based on GO and metabolic pathway enrichment analyses, a series of candidate genes involved in thermo-tolerance responses were selected and characterized. This study represents the first expression profiling analysis of D. caryophyllus under heat stress treatments. Numerous genes were found to be induced in response to HS, the study of which may advance our understanding of heat response of carnation.
Directory of Open Access Journals (Sweden)
Shuhua Ma
Full Text Available Due to its accuracy, sensitivity and high throughput, real time quantitative PCR (RT-qPCR has been widely used in analysing gene expression. The quality of data from such analyses is affected by the quality of reference genes used. Expression stabilities for nine candidate reference genes widely used in soybean were evaluated under different stresses in this study. Our results showed that EF1A and ACT11 were the best under salinity stress, TUB4, TUA5 and EF1A were the best under drought stress, ACT11 and UKN2 were the best under dark treatment, and EF1B and UKN2 were the best under virus infection. EF1B and UKN2 were the top two genes which can be reliably used in all of the stress conditions assessed.
Directory of Open Access Journals (Sweden)
Xinghai Yang
2017-09-01
Full Text Available Nitrogen is a major nutritional element in rice production. However, excessive application of nitrogen fertilizer has caused severe environmental pollution. Therefore, development of rice varieties with improved nitrogen use efficiency (NUE is urgent for sustainable agriculture. In this study, bulked segregant analysis (BSA combined with whole genome re-sequencing (WGS technology was applied to finely map quantitative trait loci (QTL for NUE. A key QTL, designated as qNUE6 was identified on chromosome 6 and further validated by Insertion/Deletion (InDel marker-based substitutional mapping in recombinants from F2 population (NIL-13B4 × GH998. Forty-four genes were identified in this 266.5-kb region. According to detection and annotation analysis of variation sites, 39 genes with large-effect single-nucleotide polymorphisms (SNPs and large-effect InDels were selected as candidates and their expression levels were analyzed by qRT-PCR. Significant differences in the expression levels of LOC_Os06g15370 (peptide transporter PTR2 and LOC_Os06g15420 (asparagine synthetase were observed between two parents (Y11 and GH998. Phylogenetic analysis in Arabidopsis thaliana identified two closely related homologs, AT1G68570 (AtNPF3.1 and AT5G65010 (ASN2, which share 72.3 and 87.5% amino acid similarity with LOC_Os06g15370 and LOC_Os06g15420, respectively. Taken together, our results suggested that qNUE6 is a possible candidate gene for NUE in rice. The fine mapping and candidate gene analysis of qNUE6 provide the basis of molecular breeding for genetic improvement of rice varieties with high NUE, and lay the foundation for further cloning and functional analysis.
LENUS (Irish Health Repository)
Brophy, Karen
2010-01-01
BACKGROUND: Recent whole genome analysis and follow-up studies have identified many new risk variants for coeliac disease (CD, gluten intolerance). The majority of newly associated regions encode candidate genes with a clear functional role in T-cell regulation. Furthermore, the newly discovered risk loci, together with the well established HLA locus, account for less than 50% of the heritability of CD, suggesting that numerous additional loci remain undiscovered. Linkage studies have identified some well-replicated risk regions, most notably chromosome 5q31 and 11q23. METHODS: We have evaluated six candidate genes in one of these regions (11q23), namely CD3E, CD3D, CD3G, IL10RA, THY1 and IL18, as risk factors for CD using a 2-phase candidate gene approach directed at chromosome 11q. 377 CD cases and 349 ethnically matched controls were used in the initial screening, followed by an extended sample of 171 additional coeliac cases and 536 additional controls. RESULTS: Promotor SNPs (-607, -137) in the IL18 gene, which has shown association with several autoimmune diseases, initially suggested association with CD (P < 0.05). Follow-up analyses of an extended sample supported the same, moderate effect (P < 0.05) for one of these. Haplotype analysis of IL18-137\\/-607 also supported this effect, primarily due to one relatively rare haplotype IL18-607C\\/-137C (P < 0.0001), which was independently associated in two case-control comparisons. This same haplotype has been noted in rheumatoid arthritis. CONCLUSION: Haplotypes of the IL18 promotor region may contribute to CD risk, consistent with this cytokine\\'s role in maintaining inflammation in active CD.
LENUS (Irish Health Repository)
Brophy, Karen
2010-05-17
Abstract Background Recent whole genome analysis and follow-up studies have identified many new risk variants for coeliac disease (CD, gluten intolerance). The majority of newly associated regions encode candidate genes with a clear functional role in T-cell regulation. Furthermore, the newly discovered risk loci, together with the well established HLA locus, account for less than 50% of the heritability of CD, suggesting that numerous additional loci remain undiscovered. Linkage studies have identified some well-replicated risk regions, most notably chromosome 5q31 and 11q23. Methods We have evaluated six candidate genes in one of these regions (11q23), namely CD3E, CD3D, CD3G, IL10RA, THY1 and IL18, as risk factors for CD using a 2-phase candidate gene approach directed at chromosome 11q. 377 CD cases and 349 ethnically matched controls were used in the initial screening, followed by an extended sample of 171 additional coeliac cases and 536 additional controls. Results Promotor SNPs (-607, -137) in the IL18 gene, which has shown association with several autoimmune diseases, initially suggested association with CD (P < 0.05). Follow-up analyses of an extended sample supported the same, moderate effect (P < 0.05) for one of these. Haplotype analysis of IL18-137\\/-607 also supported this effect, primarily due to one relatively rare haplotype IL18-607C\\/-137C (P < 0.0001), which was independently associated in two case-control comparisons. This same haplotype has been noted in rheumatoid arthritis. Conclusion Haplotypes of the IL18 promotor region may contribute to CD risk, consistent with this cytokine\\'s role in maintaining inflammation in active CD.
Directory of Open Access Journals (Sweden)
Xuefeng Ren
Full Text Available Rat strains differ dramatically in their susceptibility to mammary carcinogenesis. On the assumption that susceptibility genes are conserved across mammalian species and hence inform human carcinogenesis, numerous investigators have used genetic linkage studies in rats to identify genes responsible for differential susceptibility to carcinogenesis. Using a genetic backcross between the resistant Copenhagen (Cop and susceptible Fischer 344 (F344 strains, we mapped a novel mammary carcinoma susceptibility (Mcs30 locus to the centromeric region on chromosome 12 (LOD score of ∼8.6 at the D12Rat59 marker. The Mcs30 locus comprises approximately 12 Mbp on the long arm of rat RNO12 whose synteny is conserved on human chromosome 13q12 to 13q13. After analyzing numerous genes comprising this locus, we identified Fry, the rat ortholog of the furry gene of Drosophila melanogaster, as a candidate Mcs gene. We cloned and determined the complete nucleotide sequence of the 13 kbp Fry mRNA. Sequence analysis indicated that the Fry gene was highly conserved across evolution, with 90% similarity of the predicted amino acid sequence among eutherian mammals. Comparison of the Fry sequence in the Cop and F344 strains identified two non-synonymous single nucleotide polymorphisms (SNPs, one of which creates a putative, de novo phosphorylation site. Further analysis showed that the expression of the Fry gene is reduced in a majority of rat mammary tumors. Our results also suggested that FRY activity was reduced in human breast carcinoma cell lines as a result of reduced levels or mutation. This study is the first to identify the Fry gene as a candidate Mcs gene. Our data suggest that the SNPs within the Fry gene contribute to the genetic susceptibility of the F344 rat strain to mammary carcinogenesis. These results provide the foundation for analyzing the role of the human FRY gene in cancer susceptibility and progression.
Directory of Open Access Journals (Sweden)
Anahit Nazari-Ghadikolaei
2018-04-01
Full Text Available The Markhoz goat provides an opportunity to study the genetics underlying coat color and mohair traits of an Angora type goat using genome-wide association studies (GWAS. This indigenous Iranian breed is valued for its quality mohair used in ceremonial garments and has the distinction of exhibiting an array of coat colors including black, brown, and white. Here, we performed 16 GWAS for different fleece (mohair traits and coat color in 228 Markhoz goats sampled from the Markhoz Goat Research Station in Sanandaj, Kurdistan province, located in western Iran using the Illumina Caprine 50K beadchip. The Efficient Mixed Model Linear analysis was used to identify genomic regions with potential candidate genes contributing to coat color and mohair characteristics while correcting for population structure. Significant associations to coat color were found within or near the ASIP, ITCH, AHCY, and RALY genes on chromosome 13 for black and brown coat color and the KIT and PDGFRA genes on chromosome 6 for white coat color. Individual mohair traits were analyzed for genetic association along with principal components that allowed for a broader perspective of combined traits reflecting overall mohair quality and volume. A multitude of markers demonstrated significant association to mohair traits highlighting potential candidate genes of POU1F1 on chromosome 1 for mohair quality, MREG on chromosome 2 for mohair volume, DUOX1 on chromosome 10 for yearling fleece weight, and ADGRV1 on chromosome 7 for grease percentage. Variation in allele frequencies and haplotypes were identified for coat color and differentiated common markers associated with both brown and black coat color. This demonstrates the potential for genetic markers to be used in future breeding programs to improve selection for coat color and mohair traits. Putative candidate genes, both novel and previously identified in other species or breeds, require further investigation to confirm phenotypic
Houston, Kelly; Burton, Rachel A.; Sznajder, Beata; Rafalski, Antoni J.; Dhugga, Kanwarpal S.; Mather, Diane E.; Taylor, Jillian; Steffenson, Brian J.; Waugh, Robbie; Fincher, Geoffrey B.
2015-01-01
Cellulose is a fundamentally important component of cell walls of higher plants. It provides a scaffold that allows the development and growth of the plant to occur in an ordered fashion. Cellulose also provides mechanical strength, which is crucial for both normal development and to enable the plant to withstand both abiotic and biotic stresses. We quantified the cellulose concentration in the culm of 288 two – rowed and 288 six – rowed spring type barley accessions that were part of the USDA funded barley Coordinated Agricultural Project (CAP) program in the USA. When the population structure of these accessions was analysed we identified six distinct populations, four of which we considered to be comprised of a sufficient number of accessions to be suitable for genome-wide association studies (GWAS). These lines had been genotyped with 3072 SNPs so we combined the trait and genetic data to carry out GWAS. The analysis allowed us to identify regions of the genome containing significant associations between molecular markers and cellulose concentration data, including one region cross-validated in multiple populations. To identify candidate genes we assembled the gene content of these regions and used these to query a comprehensive RNA-seq based gene expression atlas. This provided us with gene annotations and associated expression data across multiple tissues, which allowed us to formulate a supported list of candidate genes that regulate cellulose biosynthesis. Several regions identified by our analysis contain genes that are co-expressed with CELLULOSE SYNTHASE A (HvCesA) across a range of tissues and developmental stages. These genes are involved in both primary and secondary cell wall development. In addition, genes that have been previously linked with cellulose synthesis by biochemical methods, such as HvCOBRA, a gene of unknown function, were also associated with cellulose levels in the association panel. Our analyses provide new insights into the
DEFF Research Database (Denmark)
Rao, R Shyama Prasad; Andersen, Jeppe Reitan; Dionisio, Giuseppe
2011-01-01
Poa pratensis, a type species for the grass family (Poaceae), is an important cool season grass that accumulates fructans as a polysaccharide reserve. We studied fructan contents and expression of candidate fructan metabolism genes during cold acclimation in three varieties of P. pratensis adapted...... to different environments: Northern Norway, Denmark, and the Netherlands. Fructan content increased significantly during cold acclimation and varieties showed significant differences in the level of fructan accumulation. cDNA sequences of putative fructosyltransferase (FT), fructan exohydrolase (FEH), and cold...... acclimation protein (CAP) genes were identified and cloned. In agreement with a function in fructan biosynthesis, transcription of a putative sucrose:fructan 6-fructosyltransferase (Pp6-SFT) gene was induced during cold acclimation and fructan accumulation in all three P. pratensis varieties. Transcription...
In silico approach to identification of a novel gene responsive to ...
African Journals Online (AJOL)
Submergence is one of the major constraints to rice production. Bioinformatics approach has been widely used to identify candidate genes on many biological aspects. In the present study, a novel gene involved in submergence stress in rice, Os07g47670 was identified by in silico approach. The amino acid sequence of ...
Directory of Open Access Journals (Sweden)
David Bittner
2011-06-01
Full Text Available In 2000, fishermen reported the appearance of deformed reproductive organs in whitefish (Coregonus spp. from Lake Thun, Switzerland. Despite intensive investigations, the causes of these abnormalities remain unknown. Using gene expression profiling, we sought to identify candidate genes and physiological processes possibly associated with the observed gonadal deformations, in order to gain insights into potential causes. Using in situ-synthesized oligonucleotide arrays, we compared the expression levels at 21,492 unique transcript probes in liver and head kidney tissue of male whitefish with deformed and normally developed gonads, respectively. The fish had been collected on spawning sites of two genetically distinct whitefish forms of Lake Thun. We contrasted the gene expression profiles of 56 individuals, i.e., 14 individuals of each phenotype and of each population. Gene-by-gene analysis revealed weak expression differences between normal and deformed fish, and only one gene, ictacalcin, was found to be up-regulated in head kidney tissue of deformed fish from both whitefish forms, However, this difference could not be confirmed with quantitative real-time qPCR. Enrichment analysis on the level of physiological processes revealed (i the involvement of immune response genes in both tissues, particularly those linked to complement activation in the liver, (ii proteolysis in the liver and (iii GTPase activity and Ras protein signal transduction in the head kidney. In comparison with current literature, this gene expression pattern signals a chronic autoimmune disease in the testes. Based on the recent observations that gonad deformations are induced through feeding of zooplankton from Lake Thun we hypothesize that a xenobiotic accumulated in whitefish via the plankton triggering autoimmunity as the likely cause of gonad deformations. We propose several experimental strategies to verify or reject this hypothesis.
Ramos, Geovana Brotto; Salomão, Heloisa; Francio, Angela Schneider; Fava, Vinícius Medeiros; Werneck, Renata Iani; Mira, Marcelo Távora
2016-08-01
Genetic studies have identified several genes and genomic regions contributing to the control of host susceptibility to leprosy. Here, we test variants of the positional and functional candidate gene SOD2 for association with leprosy in 2 independent population samples. Family-based analysis revealed an association between leprosy and allele G of marker rs295340 (P = .042) and borderline evidence of an association between leprosy and alleles C and A of markers rs4880 (P = .077) and rs5746136 (P = .071), respectively. Findings were validated in an independent case-control sample for markers rs295340 (P = .049) and rs4880 (P = .038). These results suggest SOD2 as a newly identified gene conferring susceptibility to leprosy. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.
Effect of some candidate genes on meat characteristics of three cattle breeds
Directory of Open Access Journals (Sweden)
Alessio Valentini
2010-01-01
Full Text Available With the aim to assess if some molecular markers can help to select animals for meat characteristics, we studied 84 individuals equally representing the Marchigiana, Maremmana, and Holstein Friesian cattle breeds genotyped at 288 SNPs located within candidate genes. Several SNPs were found associated with meat quality parameters but with P which was higher than the Bonferroni threshold. However, several SNPs had a low P at different times during meat maturation, suggesting their involvement in the meat quality variation. Of particular interest for the biological role and potential for selection were: cathepsin G affecting MFI, IGF1R affecting pH and collagen XVIII affecting colour.
DEFF Research Database (Denmark)
Esen, Meral; Mordmüller, Benjamin; de Salazar, Pablo Martinez
2012-01-01
BACKGROUND: Helminth infections are highly prevalent in the tropics and may have an effect on immune responses to vaccines due to their immunomodulatory effect. The prevalence of helminth infections in young children, the target group for malaria and most other vaccines, is high. Therefore we...... assessed the influence of helminth infection on vaccine-induced immune responses in a phase I clinical trial of the malaria vaccine candidate GMZ2. METHODS: Twenty Gabonese preschool-age children were vaccinated with GMZ2, a blood stage malaria vaccine candidate. Humoral immune response against the vaccine...... antigens and parasitological status were assessed. Vaccine-specific antibody concentrations and memory B-cell numbers were compared in worm infected and non-infected participants. RESULTS: Antibody response to GMZ2 was 3.4-fold (95% confidence interval: 1.6, 7.4) higher in Trichuris trichiura negative...
Agung, Muhammad Budi; Budiarsa, I. Made; Suwastika, I. Nengah
2017-02-01
Cocoa bean is one of the main commodities from Indonesia for the world, which still have problem regarding yield degradation due to pathogens and disease attack. Developing robust cacao plant that genetically resistant to pathogen and disease attack is an ideal solution in over taking on this problem. The aim of this study was to identify Theobroma cacao genes on database of cacao genome that homolog to response genes of pathogen and disease attack in other plant, through in silico analysis. Basic information survey and gene identification were performed in GenBank and The Arabidopsis Information Resource database. The In silico analysis contains protein BLAST, homology test of each gene's protein candidates, and identification of homologue gene in Cacao Genome Database using data source "Theobroma cacao cv. Matina 1-6 v1.1" genome. Identification found that Thecc1EG011959t1 (EDS1), Thecc1EG006803t1 (EDS5), Thecc1EG013842t1 (ICS1), and Thecc1EG015614t1 (BG_PPAP) gene of Cacao Genome Database were Theobroma cacao genes that homolog to plant's resistance genes which highly possible to have similar functions of each gene's homologue gene.
Gene expression responses of HeLa cells to chemical species generated by an atmospheric plasma flow
International Nuclear Information System (INIS)
Yokoyama, Mayo; Johkura, Kohei; Sato, Takehiko
2014-01-01
Highlights: • Response of HeLa cells to a plasma-irradiated medium was revealed by DNA microarray. • Gene expression pattern was basically different from that in a H 2 O 2 -added medium. • Prominently up-/down-regulated genes were partly shared by the two media. • Gene ontology analysis showed both similar and different responses in the two media. • Candidate genes involved in response to ROS were detected in each medium. - Abstract: Plasma irradiation generates many factors able to affect the cellular condition, and this feature has been studied for its application in the field of medicine. We previously reported that hydrogen peroxide (H 2 O 2 ) was the major cause of HeLa cell death among the chemical species generated by high level irradiation of a culture medium by atmospheric plasma. To assess the effect of plasma-induced factors on the response of live cells, HeLa cells were exposed to a medium irradiated by a non-lethal plasma flow level, and their gene expression was broadly analyzed by DNA microarray in comparison with that in a corresponding concentration of 51 μM H 2 O 2 . As a result, though the cell viability was sufficiently maintained at more than 90% in both cases, the plasma-medium had a greater impact on it than the H 2 O 2 -medium. Hierarchical clustering analysis revealed fundamentally different cellular responses between these two media. A larger population of genes was upregulated in the plasma-medium, whereas genes were downregulated in the H 2 O 2 -medium. However, a part of the genes that showed prominent differential expression was shared by them, including an immediate early gene ID2. In gene ontology analysis of upregulated genes, the plasma-medium showed more diverse ontologies than the H 2 O 2 -medium, whereas ontologies such as “response to stimulus” were common, and several genes corresponded to “response to reactive oxygen species.” Genes of AP-1 proteins, e.g., JUN and FOS, were detected and notably elevated in
Gene expression responses of HeLa cells to chemical species generated by an atmospheric plasma flow
Energy Technology Data Exchange (ETDEWEB)
Yokoyama, Mayo, E-mail: yokoyama@plasma.ifs.tohoku.ac.jp [Institute of Fluid Science, Tohoku University, 2-1-1 Katahira, Aoba-ku, Sendai 980-8577 (Japan); Johkura, Kohei, E-mail: kohei@shinshu-u.ac.jp [Department of Histology and Embryology, Shinshu University School of Medicine, 3-1-1 Asahi, Matsumoto 390-8621 (Japan); Sato, Takehiko, E-mail: sato@ifs.tohoku.ac.jp [Institute of Fluid Science, Tohoku University, 2-1-1 Katahira, Aoba-ku, Sendai 980-8577 (Japan)
2014-08-08
Highlights: • Response of HeLa cells to a plasma-irradiated medium was revealed by DNA microarray. • Gene expression pattern was basically different from that in a H{sub 2}O{sub 2}-added medium. • Prominently up-/down-regulated genes were partly shared by the two media. • Gene ontology analysis showed both similar and different responses in the two media. • Candidate genes involved in response to ROS were detected in each medium. - Abstract: Plasma irradiation generates many factors able to affect the cellular condition, and this feature has been studied for its application in the field of medicine. We previously reported that hydrogen peroxide (H{sub 2}O{sub 2}) was the major cause of HeLa cell death among the chemical species generated by high level irradiation of a culture medium by atmospheric plasma. To assess the effect of plasma-induced factors on the response of live cells, HeLa cells were exposed to a medium irradiated by a non-lethal plasma flow level, and their gene expression was broadly analyzed by DNA microarray in comparison with that in a corresponding concentration of 51 μM H{sub 2}O{sub 2}. As a result, though the cell viability was sufficiently maintained at more than 90% in both cases, the plasma-medium had a greater impact on it than the H{sub 2}O{sub 2}-medium. Hierarchical clustering analysis revealed fundamentally different cellular responses between these two media. A larger population of genes was upregulated in the plasma-medium, whereas genes were downregulated in the H{sub 2}O{sub 2}-medium. However, a part of the genes that showed prominent differential expression was shared by them, including an immediate early gene ID2. In gene ontology analysis of upregulated genes, the plasma-medium showed more diverse ontologies than the H{sub 2}O{sub 2}-medium, whereas ontologies such as “response to stimulus” were common, and several genes corresponded to “response to reactive oxygen species.” Genes of AP-1 proteins, e.g., JUN
Directory of Open Access Journals (Sweden)
Eviatar Nevo
2013-10-01
Full Text Available Wild barley eibi1 mutant with HvABCG31 gene mutation has low capacity to retain leaf water, a phenotype associated with reduced cutin deposition and a thin cuticle. To better understand how such a mutant plant survives, we performed a genome-wide gene expression analysis. The leaf transcriptomes between the near-isogenic lines eibi1 and the wild type were compared using the 22-k Barley1 Affymetrix microarray. We found that the pleiotropic effect of the single gene HvABCG31 mutation was linked to the co-regulation of metabolic processes and stress-related system. The cuticle development involved cytochrome P450 family members and fatty acid metabolism pathways were significantly up-regulated by the HvABCG31 mutation, which might be anticipated to reduce the levels of cutin monomers or wax and display conspicuous cuticle defects. The candidate genes for responses to stress were induced by eibi1 mutant through activating the jasmonate pathway. The down-regulation of co-expressed enzyme genes responsible for DNA methylation and histone deacetylation also suggested that HvABCG31 mutation may affect the epigenetic regulation for barley development. Comparison of transcriptomic profiling of barley under biotic and abiotic stresses revealed that the functions of HvABCG31 gene to high-water loss rate might be different from other osmotic stresses of gene mutations in barley. The transcriptional profiling of the HvABCG31 mutation provided candidate genes for further investigation of the physiological and developmental changes caused by the mutant.
Directory of Open Access Journals (Sweden)
Barrak F Alobeidy
Full Text Available Previous genome-wide association studies (GWAS in multiple populations identified several genetic loci for coronary heart diseases (CHD. Here we utilized a 2-stage candidate gene association strategy in Chinese Han population to shed light on the putative association between several metabolic-related candidate genes and CHD. At the 1(st stage, 190 patients with CHD and 190 controls were genotyped through the MassARRAY platform. At the 2(nd stage, a larger sample including 400 patients and 392 controls was genotyped by the High Resolution Melt (HRM method to confirm or rule out the associations with CHD. MLXIP expression level was quantified by the real time PCR in 65 peripheral blood samples. From the 21 studied single nucleotide polymorphisms (SNPs of seven candidate genes: MLXIPL, MLXIP, MLX, ADIPOR1, VDR, SREBF1 and NR1H3, only one tag SNP rs4758685 (T→C was found to be statistically associated with CHD (P-value = 0.02, Odds ratio (OR of 0.83. After adjustment for the age, sex, lipid levels and diabetes, the association remained significant (P-value = 0.03. After adjustment for the hypertension, P-value became 0.20 although there was a significant difference in the allele distribution between the CHD patients with hypertension and the controls (P-value = 0.04, 406 vs 582. In conclusion, among the 21 tested SNPs, we identified a novel association between rs4758685 of MLXIP gene and CHD. The C allele of common variant rs4758685 interacted with hypertension, and was found to be protective against CHD in both allelic and genotypic models in Chinese Han population.
Gene prioritization for livestock diseases by data integration
DEFF Research Database (Denmark)
Jiang, Li; Sørensen, Peter; Thomsen, Bo Stjerne
2012-01-01
in bovine mastitis. Gene-associated phenome profile and transcriptome profile in response to Escherichia coli infection in the mammary gland were integrated to make a global inference of bovine genes involved in mastitis. The top ranked genes were highly enriched for pathways and biological processes...... underlying inflammation and immune responses, which supports the validity of our approach for identifying genes that are relevant to animal health and disease. These gene-associated phenotypes were used for a local prioritization of candidate genes located in a QTL affecting the susceptibility to mastitis...
KBERG: KnowledgeBase for Estrogen Responsive Genes
DEFF Research Database (Denmark)
Tang, Suisheng; Zhang, Zhuo; Tan, Sin Lam
2007-01-01
Estrogen has a profound impact on human physiology affecting transcription of numerous genes. To decipher functional characteristics of estrogen responsive genes, we developed KnowledgeBase for Estrogen Responsive Genes (KBERG). Genes in KBERG were derived from Estrogen Responsive Gene Database...... (ERGDB) and were analyzed from multiple aspects. We explored the possible transcription regulation mechanism by capturing highly conserved promoter motifs across orthologous genes, using promoter regions that cover the range of [-1200, +500] relative to the transcription start sites. The motif detection...... is based on ab initio discovery of common cis-elements from the orthologous gene cluster from human, mouse and rat, thus reflecting a degree of promoter sequence preservation during evolution. The identified motifs are linked to transcription factor binding sites based on the TRANSFAC database. In addition...
Candidate gene analyses of 3-dimensional dentoalveolar phenotypes in subjects with malocclusion.
Weaver, Cole A; Miller, Steven F; da Fontoura, Clarissa S G; Wehby, George L; Amendt, Brad A; Holton, Nathan E; Allareddy, Veeratrishul; Southard, Thomas E; Moreno Uribe, Lina M
2017-03-01
Genetic studies of malocclusion etiology have identified 4 deleterious mutations in genes DUSP6,ARHGAP21, FGF23, and ADAMTS1 in familial Class III cases. Although these variants may have large impacts on Class III phenotypic expression, their low frequency (common genetic variations in craniofacial candidate genes and 3-dimensional dentoalveolar phenotypes in patients with malocclusion. Pretreatment dental casts or cone-beam computed tomographic images from 300 healthy subjects were digitized with 48 landmarks. The 3-dimensional coordinate data were submitted to a geometric morphometric approach along with principal component analysis to generate continuous phenotypes including symmetric and asymmetric components of dentoalveolar shape variation, fluctuating asymmetry, and size. The subjects were genotyped for 222 single-nucleotide polymorphisms in 82 genes/loci, and phenotpye-genotype associations were tested via multivariate linear regression. Principal component analysis of symmetric variation identified 4 components that explained 68% of the total variance and depicted anteroposterior, vertical, and transverse dentoalveolar discrepancies. Suggestive associations (P centroid size, a proxy for dentoalveolar size variation with 4p16.1 and SNAI1. Specific genetic pathways associated with 3-dimensional dentoalveolar phenotypic variation in malocclusions were identified. Copyright © 2016 American Association of Orthodontists. Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Montserrat García-Closas
2007-02-01
Full Text Available Common genetic variation could alter the risk for developing bladder cancer. We conducted a large-scale evaluation of single nucleotide polymorphisms (SNPs in candidate genes for cancer to identify common variants that influence bladder cancer risk. An Illumina GoldenGate assay was used to genotype 1,433 SNPs within or near 386 genes in 1,086 cases and 1,033 controls in Spain. The most significant finding was in the 5' UTR of VEGF (rs25648, p for likelihood ratio test, 2 degrees of freedom = 1 x 10(-5. To further investigate the region, we analyzed 29 additional SNPs in VEGF, selected to saturate the promoter and 5' UTR and to tag common genetic variation in this gene. Three additional SNPs in the promoter region (rs833052, rs1109324, and rs1547651 were associated with increased risk for bladder cancer: odds ratio (95% confidence interval: 2.52 (1.06-5.97, 2.74 (1.26-5.98, and 3.02 (1.36-6.63, respectively; and a polymorphism in intron 2 (rs3024994 was associated with reduced risk: 0.65 (0.46-0.91. Two of the promoter SNPs and the intron 2 SNP showed linkage disequilibrium with rs25648. Haplotype analyses revealed three blocks of linkage disequilibrium with significant associations for two blocks including the promoter and 5' UTR (global p = 0.02 and 0.009, respectively. These findings are biologically plausible since VEGF is critical in angiogenesis, which is important for tumor growth, its elevated expression in bladder tumors correlates with tumor progression, and specific 5' UTR haplotypes have been shown to influence promoter activity. Associations between bladder cancer risk and other genes in this report were not robust based on false discovery rate calculations. In conclusion, this large-scale evaluation of candidate cancer genes has identified common genetic variants in the regulatory regions of VEGF that could be associated with bladder cancer risk.
Khattak, Naureen Aslam; Mir, Asif
2014-01-01
Mental retardation (MR)/ intellectual disability (ID) is a neuro-developmental disorder characterized by a low intellectual quotient (IQ) and deficits in adaptive behavior related to everyday life tasks such as delayed language acquisition, social skills or self-help skills with onset before age 18. To date, a few genes (PRSS12, CRBN, CC2D1A, GRIK2, TUSC3, TRAPPC9, TECR, ST3GAL3, MED23, MAN1B1, NSUN1) for autosomal-recessive forms of non syndromic MR (NS-ARMR) have been identified and established in various families with ID. The recently reported candidate gene TRAPPC9 was selected for computational analysis to explore its potentially important role in pathology as it is the only gene for ID reported in more than five different familial cases worldwide. YASARA (12.4.1) was utilized to generate three dimensional structures of the candidate gene TRAPPC9. Hybrid structure prediction was employed. Crystal Structure of a Conserved Metalloprotein From Bacillus Cereus (3D19-C) was selected as best suitable template using position-specific iteration-BLAST. Template (3D19-C) parameters were based on E-value, Z-score and resolution and quality score of 0.32, -1.152, 2.30°A and 0.684 respectively. Model reliability showed 93.1% residues placed in the most favored region with 96.684 quality factor, and overall 0.20 G-factor (dihedrals 0.06 and covalent 0.39 respectively). Protein-Protein docking analysis demonstrated that TRAPPC9 showed strong interactions of the amino acid residues S(253), S(251), Y(256), G(243), D(131) with R(105), Q(425), W(226), N(255), S(233), its functional partner 1KBKB. Protein-protein interacting residues could facilitate the exploration of structural and functional outcomes of wild type and mutated TRAPCC9 protein. Actively involved residues can be used to elucidate the binding properties of the protein, and to develop drug therapy for NS-ARMR patients.
QTL-seq for rapid identification of candidate genes for flowering time in broccoli × cabbage.
Shu, Jinshuai; Liu, Yumei; Zhang, Lili; Li, Zhansheng; Fang, Zhiyuan; Yang, Limei; Zhuang, Mu; Zhang, Yangyong; Lv, Honghao
2018-04-01
A major QTL controlling early flowering in broccoli × cabbage was identified by marker analysis and next-generation sequencing, corresponding to GRF6 gene conditioning flowering time in Arabidopsis. Flowering is an important agronomic trait for hybrid production in broccoli and cabbage, but the genetic mechanism underlying this process is unknown. In this study, segregation analysis with BC 1 P1, BC 1 P2, F 2 , and F 2:3 populations derived from a cross between two inbred lines "195" (late-flowering) and "93219" (early flowering) suggested that flowering time is a quantitative trait. Next, employing a next-generation sequencing-based whole-genome QTL-seq strategy, we identified a major genomic region harboring a robust flowering time QTL using an F 2 mapping population, designated Ef2.1 on cabbage chromosome 2 for early flowering. Ef2.1 was further validated by indel (insertion or deletion) marker-based classical QTL mapping, explaining 51.5% (LOD = 37.67) and 54.0% (LOD = 40.5) of the phenotypic variation in F 2 and F 2:3 populations, respectively. Combined QTL-seq and classical QTL analysis narrowed down Ef1.1 to a 228-kb genomic region containing 29 genes. A cabbage gene, Bol024659, was identified in this region, which is a homolog of GRF6, a major gene regulating flowering in Arabidopsis, and was designated BolGRF6. qRT-PCR study of the expression level of BolGRF6 revealed significantly higher expression in the early flowering genotypes. Taken together, our results provide support for BolGRF6 as a possible candidate gene for early flowering in the broccoli line 93219. The identified candidate genomic regions and genes may be useful for molecular breeding to improve broccoli and cabbage flowering times.
TargetMine, an integrated data warehouse for candidate gene prioritisation and target discovery.
Directory of Open Access Journals (Sweden)
Yi-An Chen
Full Text Available Prioritising candidate genes for further experimental characterisation is a non-trivial challenge in drug discovery and biomedical research in general. An integrated approach that combines results from multiple data types is best suited for optimal target selection. We developed TargetMine, a data warehouse for efficient target prioritisation. TargetMine utilises the InterMine framework, with new data models such as protein-DNA interactions integrated in a novel way. It enables complicated searches that are difficult to perform with existing tools and it also offers integration of custom annotations and in-house experimental data. We proposed an objective protocol for target prioritisation using TargetMine and set up a benchmarking procedure to evaluate its performance. The results show that the protocol can identify known disease-associated genes with high precision and coverage. A demonstration version of TargetMine is available at http://targetmine.nibio.go.jp/.
Institute of Scientific and Technical Information of China (English)
熊敏; 王石平; 张启发
2002-01-01
Quantitative disease resistance conferred by quantitative trait loci (QTLs) is presumably of wider spectrum and durable. Forty-four cDNA clones, representing 44 defense-responsive genes, were fine mapped to 56 loci distributed on 9 of the 12 rice chromosomes. The locations of 32 loci detected by 27 cDNA clones were associated with previously identified resistance QTLs for different rice diseases, including blast, bacterial blight, sheath blight and yellow mottle virus. The loci detected by the same multiple-copy cDNA clones were frequently located on similar locations of different chromosomes. Some of the multiple loci detected by the same clones were all associated with resistance QTLs. These results suggest that some of the genes may be important components in regulation of defense responses against pathogen invasion and they may be the candidates for studying the mechanism of quantitative disease resistance in rice.
Directory of Open Access Journals (Sweden)
Scalabrin Simone
2008-06-01
Full Text Available Abstract Background Whole-genome physical maps facilitate genome sequencing, sequence assembly, mapping of candidate genes, and the design of targeted genetic markers. An automated protocol was used to construct a Vitis vinifera 'Cabernet Sauvignon' physical map. The quality of the result was addressed with regard to the effect of high heterozygosity on the accuracy of contig assembly. Its usefulness for the genome-wide mapping of genes for disease resistance, which is an important trait for grapevine, was then assessed. Results The physical map included 29,727 BAC clones assembled into 1,770 contigs, spanning 715,684 kbp, and corresponding to 1.5-fold the genome size. Map inflation was due to high heterozygosity, which caused either the separation of allelic BACs in two different contigs, or local mis-assembly in contigs containing BACs from the two haplotypes. Genetic markers anchored 395 contigs or 255,476 kbp to chromosomes. The fully automated assembly and anchorage procedures were validated by BAC-by-BAC blast of the end sequences against the grape genome sequence, unveiling 7.3% of chimerical contigs. The distribution across the physical map of candidate genes for non-host and host resistance, and for defence signalling pathways was then studied. NBS-LRR and RLK genes for host resistance were found in 424 contigs, 133 of them (32% were assigned to chromosomes, on which they are mostly organised in clusters. Non-host and defence signalling genes were found in 99 contigs dispersed without a discernable pattern across the genome. Conclusion Despite some limitations that interfere with the correct assembly of heterozygous clones into contigs, the 'Cabernet Sauvignon' physical map is a useful and reliable intermediary step between a genetic map and the genome sequence. This tool was successfully exploited for a quick mapping of complex families of genes, and it strengthened previous clues of co-localisation of major NBS-LRR clusters and
Salt and drought stress and ABA responses related to bZIP genes from V. radiata and V. angularis.
Wang, Lanfen; Zhu, Jifeng; Li, Xiaoming; Wang, Shumin; Wu, Jing
2018-04-20
Mung bean and adzuki bean are warm-season legumes widely cultivated in China. However, bean production in major producing regions is limited by biotic and abiotic stress, such as drought and salt stress. Basic leucine zipper (bZIP) genes play key roles in responses to various biotic and abiotic stresses. However, only several bZIP genes involved in drought and salt stress in legumes, especially Vigna radiata and Vigna angularis, have been identified. In this study, we identified 54 and 50 bZIP proteins from whole-genome sequences of V. radiata and V. angularis, respectively. First, we comprehensively surveyed the characteristics of all bZIP genes, including their gene structure, chromosome distribution and motif composition. Phylogenetic trees showed that VrbZIP and VabZIP proteins were divided into ten clades comprising nine known and one unknown subgroup. The results of the nucleotide substitution rate of the orthologous gene pairs showed that bZIP proteins have undergone strong purifying selection: V. radiata and V. angularis diverged 1.25 million years ago (mya) to 9.20 mya (average of 4.95 mya). We also found that many cis-acting regulatory elements (CAREs) involved in abiotic stress and plant hormone responses were detected in the putative promoter regions of the bZIP genes. Finally, using the quantitative real-time PCR (qRT-PCR) method, we performed expression profiling of the bZIP genes in response to drought, salt and abscisic acid (ABA). We identified several bZIP genes that may be involved in drought and salt responses. Generally, our results provided useful and rich resources of VrbZIP and VabZIP genes for the functional characterization and understanding of bZIP transcription factors (TFs) in warm-season legumes. In addition, our results revealed important and interesting data - a subset of VrbZIP and VabZIP gene expression profiles in response to drought, salt and ABA stress. These results provide gene expression evidence for the selection of
Bodescot, M.; Silvie, O.; Siau, A.; Refour, P.; Pino, P.; Franetich, J.F.; Hannoun, L.; Sauerwein, R.W.; Mazier, D.
2004-01-01
The CSP, EMP2/MESA, MSP2, MSP3, MSP5, RAP1, RAP2, RESA1, SERA1 and SSP2/TRAP genes of Plasmodium falciparum are vaccine candidates. The hepatic phase of the infection is of major interest due to the protection induced by immunization with radiation-attenuated sporozoites. We therefore performed
Construction of a trivalent candidate vaccine against Shigella species with DNA recombination
Institute of Scientific and Technical Information of China (English)
王恒樑; 冯尔玲; 林云; 廖翔; 金明; 黄留玉; 苏国富; 黄翠芬
2002-01-01
In this work asd gene of Shigella flexneri 2a strain T32 was replaced by Vibrio cholerae toxin B subunit (ctxB) gene with DNA recombination in vivo and in vitro. The resulting derivative of T32, designed as FWL01, could stably express CtxB, but its growth in LB medium depended on the presence of diaminopimelic acid (DAP). Then form I plasmid of Shigella sonnei strain S7 was labeled with strain T32 asd gene and mobilized into FWL01. Thus a trivalent candidate oral vaccine strain, designed as FSW01, was constructed. In this candidate strain, a balanced-lethal system was constituted between the host strain and the form I plasmid expressing S. sonnei O antigen. Therefore the candidate strain can express stably not only its own O antigen but also CtxB and O antigen of S. sonnei in the absence of any antibiotic. Experiments showed that FSW01 did not invade HeLa cells or cause keratoconjunctivitis in guinea pigs. However, rabbits immunized FSW01 can elicit significant immune responses. In mice and rhesus monkey models, vaccinated animals were protected against the challenges of wild S. flexneri 2a strain 2457T and S. sonnei strain S9.
Paal, Jürgen; Henselewski, Heike; Muth, Jost; Meksem, Khalid; Menéndez, Cristina M; Salamini, Francesco; Ballvora, Agim; Gebhardt, Christiane
2004-04-01
The endoparasitic root cyst nematode Globodera rostochiensis causes considerable damage in potato cultivation. In the past, major genes for nematode resistance have been introgressed from related potato species into cultivars. Elucidating the molecular basis of resistance will contribute to the understanding of nematode-plant interactions and assist in breeding nematode-resistant cultivars. The Gro1 resistance locus to G. rostochiensis on potato chromosome VII co-localized with a resistance-gene-like (RGL) DNA marker. This marker was used to isolate from genomic libraries 15 members of a closely related candidate gene family. Analysis of inheritance, linkage mapping, and sequencing reduced the number of candidate genes to three. Complementation analysis by stable potato transformation showed that the gene Gro1-4 conferred resistance to G. rostochiensis pathotype Ro1. Gro1-4 encodes a protein of 1136 amino acids that contains Toll-interleukin 1 receptor (TIR), nucleotide-binding (NB), leucine-rich repeat (LRR) homology domains and a C-terminal domain with unknown function. The deduced Gro1-4 protein differed by 29 amino acid changes from susceptible members of the Gro1 gene family. Sequence characterization of 13 members of the Gro1 gene family revealed putative regulatory elements and a variable microsatellite in the promoter region, insertion of a retrotransposon-like element in the first intron, and a stop codon in the NB coding region of some genes. Sequence analysis of RT-PCR products showed that Gro1-4 is expressed, among other members of the family including putative pseudogenes, in non-infected roots of nematode-resistant plants. RT-PCR also demonstrated that members of the Gro1 gene family are expressed in most potato tissues.
Directory of Open Access Journals (Sweden)
Christensen Knud
2011-07-01
Full Text Available Abstract Background Bacterial artificial chromosome (BAC libraries continue to be invaluable tools for the genomic analysis of complex organisms. Complemented by the newly and fast growing deep sequencing technologies, they provide an excellent source of information in genomics projects. Results Here, we report the construction and characterization of the CHORI-231 BAC library constructed from a Danish-farmed, male American mink (Neovison vison. The library contains approximately 165,888 clones with an average insert size of 170 kb, representing approximately 10-fold coverage. High-density filters, each consisting of 18,432 clones spotted in duplicate, have been produced for hybridization screening and are publicly available. Overgo probes derived from expressed sequence tags (ESTs, representing 21 candidate genes for traits important for the mink industry, were used to screen the BAC library. These included candidate genes for coat coloring, hair growth and length, coarseness, and some receptors potentially involved in viral diseases in mink. The extensive screening yielded positive results for 19 of these genes. Thirty-five clones corresponding to 19 genes were sequenced using 454 Roche, and large contigs (184 kb in average were assembled. Knowing the complete sequences of these candidate genes will enable confirmation of the association with a phenotype and the finding of causative mutations for the targeted phenotypes. Additionally, 1577 BAC clones were end sequenced; 2505 BAC end sequences (80% of BACs were obtained. An excess of 2 Mb has been analyzed, thus giving a snapshot of the mink genome. Conclusions The availability of the CHORI-321 American mink BAC library will aid in identification of genes and genomic regions of interest. We have demonstrated how the library can be used to identify specific genes of interest, develop genetic markers, and for BAC end sequencing and deep sequencing of selected clones. To our knowledge, this is the
Zhang, Jinfeng; Zhao, Wenjuan; Fu, Rong; Fu, Chenglin; Wang, Lingxia; Liu, Huainian; Li, Shuangcheng; Deng, Qiming; Wang, Shiquan; Zhu, Jun; Liang, Yueyang; Li, Ping; Zheng, Aiping
2018-05-05
Rhizoctonia solani causes rice sheath blight, an important disease affecting the growth of rice (Oryza sativa L.). Attempts to control the disease have met with little success. Based on transcriptional profiling, we previously identified more than 11,947 common differentially expressed genes (TPM > 10) between the rice genotypes TeQing and Lemont. In the current study, we extended these findings by focusing on an analysis of gene co-expression in response to R. solani AG1 IA and identified gene modules within the networks through weighted gene co-expression network analysis (WGCNA). We compared the different genes assigned to each module and the biological interpretations of gene co-expression networks at early and later modules in the two rice genotypes to reveal differential responses to AG1 IA. Our results show that different changes occurred in the two rice genotypes and that the modules in the two groups contain a number of candidate genes possibly involved in pathogenesis, such as the VQ protein. Furthermore, these gene co-expression networks provide comprehensive transcriptional information regarding gene expression in rice in response to AG1 IA. The co-expression networks derived from our data offer ideas for follow-up experimentation that will help advance our understanding of the translational regulation of rice gene expression changes in response to AG1 IA.
Approach of combined cancer gene therapy and radiation: response of promoters to ionizing radiation
International Nuclear Information System (INIS)
Anstett, A.
2005-09-01
Gene therapy is an emerging cancer treatment modality. We are interested in developing a radiation-inducible gene therapy system to sensitize the tumor vasculature to the effects of ionizing radiation (IR) treatment. An expression system based on irradiation-inducible promoters will drive the expression of anti-tumor genes in the tumor vasculature. Solid tumors are dependent on angio genesis, a process in which new blood vessels are formed from the pre-existing vasculature. Vascular endothelial cells are un transformed and genetically stable, thus avoiding the problem of resistance to the treatments. Vascular endothelial cells may therefore represent a suitable target for this therapeutic gene therapy strategy.The identification of IR-inducible promoters native to endothelial cells was performed by gene expression profiling using cDNA micro array technology. We describe the genes modified by clinically relevant doses of IR. The extension to high doses aimed at studying the effects of total radiation delivery to the tumor. The radio-inductiveness of the genes selected for promoter study was confirmed by RT-PCR. Analysis of the activity of promoters in response to IR was also assessed in a reporter plasmid. We found that authentic promoters cloned onto a plasmid are not suitable for cancer gene therapy due to their low induction after IR. In contrast, synthetic promoters containing repeated sequence-specific binding sites for IR-activated transcription factors such as NF-κB are potential candidates for gene therapy. The activity of five tandemly repeated TGGGGACTTTCCGC elements for NF-κB binding in a luciferase reporter was increased in a dose-dependent manner. Interestingly, the response to fractionated low doses was improved in comparison to the total single dose. Thus, we put present evidence that a synthetic promoter for NF-κB specific binding may have application in the radio-therapeutic treatment of cancer. (author)
Wang, Ronghua; Mei, Yi; Xu, Liang; Zhu, Xianwen; Wang, Yan; Guo, Jun; Liu, Liwang
2018-03-01
Heat stress (HS) causes detrimental effects on plant morphology, physiology, and biochemistry that lead to drastic reduction in plant biomass production and economic yield worldwide. To date, little is known about HS-responsive genes involved in thermotolerance mechanism in radish. In this study, a total of 6600 differentially expressed genes (DEGs) from the control and Heat24 cDNA libraries of radish were isolated by high-throughput sequencing. With Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis, some genes including MAPK, DREB, ERF, AP2, GST, Hsf, and Hsp were predominantly assigned in signal transductions, metabolic pathways, and biosynthesis and abiotic stress-responsive pathways. These pathways played significant roles in reducing stress-induced damages and enhancing heat tolerance in radish. Expression patterns of 24 candidate genes were validated by reverse-transcription quantitative PCR (RT-qPCR). Based mainly on the analysis of DEGs combining with the previous miRNAs analysis, the schematic model of HS-responsive regulatory network was proposed. To counter the effects of HS, a rapid response of the plasma membrane leads to the opening of specific calcium channels and cytoskeletal reorganization, after which HS-responsive genes are activated to repair damaged proteins and ultimately facilitate further enhancement of thermotolerance in radish. These results could provide fundamental insight into the regulatory network underlying heat tolerance in radish and facilitate further genetic manipulation of thermotolerance in root vegetable crops.
DEFF Research Database (Denmark)
Do, Duy Ngoc; Strathe, Anders Bjerring; Ostersen, Tage
2014-01-01
Residual feed intake (RFI) is a complex trait that is economically important for livestock production; however, the genetic and biological mechanisms regulating RFI are largely unknown in pigs. Therefore, the study aimed to identify single nucleotide polymorphisms (SNPs), candidate genes and biol...... revealed key genes and genetic variants that control feed efficiency that could potentially be useful for genetic selection of more feed efficient pigs....
Refinement of the NHS locus on chromosome Xp22.13 and analysis of five candidate genes.
Toutain, Annick; Dessay, Benoît; Ronce, Nathalie; Ferrante, Maria-Immacolata; Tranchemontagne, Julie; Newbury-Ecob, Ruth; Wallgren-Pettersson, Carina; Burn, John; Kaplan, Josseline; Rossi, Annick; Russo, Silvia; Walpole, Ian; Hartsfield, James K; Oyen, Nina; Nemeth, Andrea; Bitoun, Pierre; Trump, Dorothy; Moraine, Claude; Franco, Brunella
2002-09-01
Nance-Horan syndrome (NHS) is an X-linked condition characterised by congenital cataracts, dental abnormalities, dysmorphic features, and mental retardation in some cases. Previous studies have mapped the disease gene to a 2 cM interval on Xp22.2 between DXS43 and DXS999. We report additional linkage data resulting from the analysis of eleven independent NHS families. A maximum lod score of 9.94 (theta=0.00) was obtained at the RS1 locus and a recombination with locus DXS1195 on the telomeric side was observed in two families, thus refining the location of the gene to an interval of around 1 Mb on Xp22.13. Direct sequencing or SSCP analysis of the coding exons of five genes (SCML1, SCML2, STK9, RS1 and PPEF1), considered as candidate genes on the basis of their location in the critical interval, failed to detect any mutation in 12 unrelated NHS patients, thus making it highly unlikely that these genes are implicated in NHS.
Tabchy, Adel; Valero, Vicente; Vidaurre, Tatiana; Lluch, Ana; Gomez, Henry; Martin, Miguel; Qi, Yuan; Barajas-Figueroa, Luis Javier; Souchon, Eduardo; Coutant, Charles; Doimi, Franco D; Ibrahim, Nuhad K; Gong, Yun; Hortobagyi, Gabriel N; Hess, Kenneth R; Symmans, W Fraser; Pusztai, Lajos
2010-01-01
Purpose We examined in a prospective, randomized, international clinical trial the performance of a previously defined 30-gene predictor (DLDA-30) of pathologic complete response (pCR) to preoperative weekly paclitaxel and fluorouracil, doxorubicin, cyclophosphamide (T/FAC) chemotherapy, and assessed if DLDA-30 also predicts increased sensitivity to FAC-only chemotherapy. We compared the pCR rates after T/FAC versus FAC×6 preoperative chemotherapy. We also performed an exploratory analysis to identify novel candidate genes that differentially predict response in the two treatment arms. Experimental Design 273 patients were randomly assigned to receive either weekly paclitaxel × 12 followed by FAC × 4 (T/FAC, n=138), or FAC × 6 (n=135) neoadjuvant chemotherapy. All patients underwent a pretreatment FNA biopsy of the tumor for gene expression profiling and treatment response prediction. Results The pCR rates were 19% and 9% in the T/FAC and FAC arms, respectively (pcancers. PMID:20829329
Association between SNPs within candidate genes and compounds related to boar taint and reproduction
DEFF Research Database (Denmark)
Moe, Maren; Lien, Sigbjørn; Aasmundstad, Torunn
2009-01-01
BACKGROUND: Boar taint is an unpleasant odour and flavour of the meat from some uncastrated male pigs primarily caused by elevated levels of androstenone and skatole in adipose tissue. Androstenone is produced in the same biochemical pathway as testosterone and estrogens, which represents...... of this study was to detect SNPs in boar taint candidate genes and to perform association studies for both single SNPs and haplotypes with levels of boar taint compounds and phenotypes related to reproduction. RESULTS: An association study involving 275 SNPs in 121 genes and compounds related to boar taint...... and reproduction were carried out in Duroc and Norwegian Landrace boars. Phenotypes investigated were levels of androstenone, skatole and indole in adipose tissue, levels of androstenone, testosterone, estrone sulphate and 17beta-estradiol in plasma, and length of bulbo urethralis gland. The SNPs were genotyped...
Directory of Open Access Journals (Sweden)
Ehlers Jeffrey D
2011-01-01
Full Text Available Abstract Background Macrophomina phaseolina is an emerging and devastating fungal pathogen that causes significant losses in crop production under high temperatures and drought stress. An increasing number of disease incidence reports highlight the wide prevalence of the pathogen around the world and its contribution toward crop yield suppression. In cowpea [Vigna unguiculata (L Walp.], limited sources of low-level host resistance have been identified, the genetic basis of which is unknown. In this study we report on the identification of strong sources of host resistance to M. phaseolina and the genetic mapping of putative resistance loci on a cowpea genetic map comprised of gene-derived single nucleotide polymorphisms (SNPs and amplified fragment length polymorphisms (AFLPs. Results Nine quantitative trait loci (QTLs, accounting for between 6.1 and 40.0% of the phenotypic variance (R2, were identified using plant mortality data taken over three years in field experiments and disease severity scores taken from two greenhouse experiments. Based on annotated genic SNPs as well as synteny with soybean (Glycine max and Medicago truncatula, candidate resistance genes were found within mapped QTL intervals. QTL Mac-2 explained the largest percent R2 and was identified in three field and one greenhouse experiments where the QTL peak co-located with a SNP marker derived from a pectin esterase inhibitor encoding gene. Maturity effects on the expression of resistance were indicated by the co-location of Mac-6 and Mac-7 QTLs with maturity-related senescence QTLs Mat-2 and Mat-1, respectively. Homologs of the ELF4 and FLK flowering genes were found in corresponding syntenic soybean regions. Only three Macrophomina resistance QTLs co-located with delayed drought-induced premature senescence QTLs previously mapped in the same population, suggesting that largely different genetic mechanisms mediate cowpea response to drought stress and Macrophomina infection
Giesbers, Anne K J; Pelgrom, Alexandra J E; Visser, Richard G F; Niks, Rients E; Van den Ackerveken, Guido; Jeuken, Marieke J W
2017-11-01
Candidate effectors from lettuce downy mildew (Bremia lactucae) enable high-throughput germplasm screening for the presence of resistance (R) genes. The nonhost species Lactuca saligna comprises a source of B. lactucae R genes that has hardly been exploited in lettuce breeding. Its cross-compatibility with the host species L. sativa enables the study of inheritance of nonhost resistance (NHR). We performed transient expression of candidate RXLR effector genes from B. lactucae in a diverse Lactuca germplasm set. Responses to two candidate effectors (BLR31 and BLN08) were genetically mapped and tested for co-segregation with disease resistance. BLN08 induced a hypersensitive response (HR) in 55% of the L. saligna accessions, but responsiveness did not co-segregate with resistance to Bl:24. BLR31 triggered an HR in 5% of the L. saligna accessions, and revealed a novel R gene providing complete B. lactucae race Bl:24 resistance. Resistant hybrid plants that were BLR31 nonresponsive indicated other unlinked R genes and/or nonhost QTLs. We have identified a candidate avirulence effector of B. lactucae (BLR31) and its cognate R gene in L. saligna. Concurrently, our results suggest that R genes are not required for NHR of L. saligna. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.
Gene expression signature analysis identifies vorinostat as a candidate therapy for gastric cancer.
Directory of Open Access Journals (Sweden)
Sofie Claerhout
Full Text Available Gastric cancer continues to be one of the deadliest cancers in the world and therefore identification of new drugs targeting this type of cancer is thus of significant importance. The purpose of this study was to identify and validate a therapeutic agent which might improve the outcomes for gastric cancer patients in the future.Using microarray technology, we generated a gene expression profile of human gastric cancer-specific genes from human gastric cancer tissue samples. We used this profile in the Broad Institute's Connectivity Map analysis to identify candidate therapeutic compounds for gastric cancer. We found the histone deacetylase inhibitor vorinostat as the lead compound and thus a potential therapeutic drug for gastric cancer. Vorinostat induced both apoptosis and autophagy in gastric cancer cell lines. Pharmacological and genetic inhibition of autophagy however, increased the therapeutic efficacy of vorinostat, indicating that a combination of vorinostat with autophagy inhibitors may therapeutically be more beneficial. Moreover, gene expression analysis of gastric cancer identified a collection of genes (ITGB5, TYMS, MYB, APOC1, CBX5, PLA2G2A, and KIF20A whose expression was elevated in gastric tumor tissue and downregulated more than 2-fold by vorinostat treatment in gastric cancer cell lines. In contrast, SCGB2A1, TCN1, CFD, APLP1, and NQO1 manifested a reversed pattern.We showed that analysis of gene expression signature may represent an emerging approach to discover therapeutic agents for gastric cancer, such as vorinostat. The observation of altered gene expression after vorinostat treatment may provide the clue to identify the molecular mechanism of vorinostat and those patients likely to benefit from vorinostat treatment.
Developing Potential Candidates of Preclinical Preeclampsia
Directory of Open Access Journals (Sweden)
Sandra Founds
2015-11-01
Full Text Available The potential for developing molecules of interest in preclinical preeclampsia from candidate genes that were discovered on gene expression microarray analysis has been challenged by limited access to additional first trimester trophoblast and decidual tissues. The question of whether these candidates encode secreted proteins that may be detected in maternal circulation early in pregnancy has been investigated using various proteomic methods. Pilot studies utilizing mass spectrometry based proteomic assays, along with enzyme linked immunosorbent assays (ELISAs, and Western immunoblotting in first trimester samples are reported. The novel targeted mass spectrometry methods led to robust multiple reaction monitoring assays. Despite detection of several candidates in early gestation, challenges persist. Future antibody-based studies may lead to a novel multiplex protein panel for screening or detection to prevent or mitigate preeclampsia.
Spanagel, Rainer
2013-01-01
Convergent functional genomics (CFG) is a translational methodology that integrates in a Bayesian fashion multiple lines of evidence from studies in human and animal models to get a better understanding of the genetics of a disease or pathological behavior. Here the integration of data sets that derive from forward genetics in animals and genetic association studies including genome wide association studies (GWAS) in humans is described for addictive behavior. The aim of forward genetics in animals and association studies in humans is to identify mutations (e.g. SNPs) that produce a certain phenotype; i.e. "from phenotype to genotype". Most powerful in terms of forward genetics is combined quantitative trait loci (QTL) analysis and gene expression profiling in recombinant inbreed rodent lines or genetically selected animals for a specific phenotype, e.g. high vs. low drug consumption. By Bayesian scoring genomic information from forward genetics in animals is then combined with human GWAS data on a similar addiction-relevant phenotype. This integrative approach generates a robust candidate gene list that has to be functionally validated by means of reverse genetics in animals; i.e. "from genotype to phenotype". It is proposed that studying addiction relevant phenotypes and endophenotypes by this CFG approach will allow a better determination of the genetics of addictive behavior.
Liu, Chuan-He; Fan, Chao
2016-01-01
A remarkable characteristic of pineapple is its ability to undergo floral induction in response to external ethylene stimulation. However, little information is available regarding the molecular mechanism underlying this process. In this study, the differentially expressed genes (DEGs) in plants exposed to 1.80 mL·L−1 (T1) or 2.40 mL·L−1 ethephon (T2) compared with Ct plants (control, cleaning water) were identified using RNA-seq and gene expression profiling. Illumina sequencing generated 65,825,224 high-quality reads that were assembled into 129,594 unigenes with an average sequence length of 1173 bp. Of these unigenes, 24,775 were assigned to specific KEGG pathways, of which metabolic pathways and biosynthesis of secondary metabolites were the most highly represented. Gene Ontology (GO) analysis of the annotated unigenes revealed that the majority were involved in metabolic and cellular processes, cell and cell part, catalytic activity and binding. Gene expression profiling analysis revealed 3788, 3062, and 758 DEGs in the comparisons of T1 with Ct, T2 with Ct, and T2 with T1, respectively. GO analysis indicated that these DEGs were predominantly annotated to metabolic and cellular processes, cell and cell part, catalytic activity, and binding. KEGG pathway analysis revealed the enrichment of several important pathways among the DEGs, including metabolic pathways, biosynthesis of secondary metabolites and plant hormone signal transduction. Thirteen DEGs were identified as candidate genes associated with the process of floral induction by ethephon, including three ERF-like genes, one ETR-like gene, one LTI-like gene, one FT-like gene, one VRN1-like gene, three FRI-like genes, one AP1-like gene, one CAL-like gene, and one AG-like gene. qPCR analysis indicated that the changes in the expression of these 13 candidate genes were consistent with the alterations in the corresponding RPKM values, confirming the accuracy and credibility of the RNA-seq and gene
Xiong, Huaqi; Chen, Yongxiong; Yi, Yajun; Tsuchiya, Karen; Moeckel, Gilbert; Cheung, Joseph; Liang, Dan; Tham, Kyi; Xu, Xiaohu; Chen, Xing-Zhen; Pei, York; Zhao, Zhizhuang Jeo; Wu, Guanqing
2002-07-01
Autosomal recessive polycystic kidney disease (ARPKD) is a common hereditary renal cystic disease in infants and children. By genetic linkage analyses, the gene responsible for this disease, termed polycystic kidney and hepatic disease 1 (PKHD1), was mapped on human chromosome 6p21.1-p12, and has been further localized to a 1-cM genetic interval flanked by the D6S1714/D6S243 (telomeric) and D6S1024 (centromeric) markers. We recently identified a novel gene in this genetic interval from kidney cDNA, using cloning strategies. The gene PKHD1 (PKHD1-tentative) encodes a novel 3396-amino-acid protein with no apparent homology with any known proteins. We named its gene product "tigmin" because it contains multiple TIG domains, which usually are seen in proteins containing immunoglobulin-like folds. PKHD1 encodes an 11.6-kb transcript and is composed of 61 exons spanning an approximately 365-kb genomic region on chromosome 6p12-p11.2 adjacent to the marker D6S1714. Northern blot analyses demonstrated that the gene has discrete bands with one peak signal at approximately 11 kb, indicating that PKHD1 is likely to have multiple alternative transcripts. PKHD1 is highly expressed in adult and infant kidneys and weakly expressed in liver in northern blot analysis. This expression pattern parallels the tissue involvement observed in ARPKD. In situ hybridization analysis further revealed that the expression of PKHD1 in the kidney is mainly localized to the epithelial cells of the collecting duct, the specific tubular segment involved in cyst formation in ARPKD. These features of PKHD1 make it a strong positional candidate gene for ARPKD.
Richards, Jennifer S; Arias Vásquez, Alejandro; van Rooij, Daan; van der Meer, Dennis; Franke, Barbara; Hoekstra, Pieter J; Heslenfeld, Dirk J; Oosterlaan, Jaap; Faraone, Stephen V; Hartman, Catharina A; Buitelaar, Jan K
2017-06-01
Impaired inhibitory control is a key feature of attention-deficit/hyperactivity disorder (ADHD). We investigated gene-environment interaction (GxE) as a possible contributing factor to response inhibition variation in context of the differential susceptibility theory. This states individuals carrying plasticity gene variants will be more disadvantaged in negative, but more advantaged in positive environments. Behavioural and neural measures of response inhibition were assessed during a Stop-signal task in participants with (N = 197) and without (N = 295) ADHD, from N = 278 families (age M = 17.18, SD =3.65). We examined GxE between candidate plasticity genes (DAT1, 5-HTT, DRD4) and social environments (maternal expressed emotion, peer affiliation). A DRD4 × Positive peer affiliation interaction was found on the right fusiform gyrus (rFG) activation during successful inhibition. Further, 5-HTT short allele carriers showed increased rFG activation during failed inhibitions. Maternal warmth and positive peer affiliation were positively associated with right inferior frontal cortex activation during successful inhibition. Deviant peer affiliation was positively related to the error rate. While a pattern of differential genetic susceptibility was found, more clarity on the role of the FG during response inhibition is warranted before firm conclusions can be made. Positive and negative social environments were related to inhibitory control. This extends previous research emphasizing adverse environments.
Directory of Open Access Journals (Sweden)
Akira Ishikawa
Full Text Available Although growth and body composition traits are quantitative traits of medical and agricultural importance, the genetic and molecular basis of those traits remains elusive. Our previous genome-wide quantitative trait locus (QTL analyses in an intersubspecific backcross population between C57BL/6JJcl (B6 and wild Mus musculus castaneus mice revealed a major growth QTL (named Pbwg1 on a proximal region of mouse chromosome 2. Using the B6.Cg-Pbwg1 intersubspecific congenic strain created, we revealed 12 closely linked QTLs for body weight and body composition traits on an approximately 44.1-Mb wild-derived congenic region. In this study, we narrowed down genomic regions harboring three (Pbwg1.12, Pbwg1.3 and Pbwg1.5 of the 12 linked QTLs and searched for possible candidate genes for the QTLs. By phenotypic analyses of F2 intercross populations between B6 and each of four B6.Cg-Pbwg1 subcongenic strains with overlapping and non-overlapping introgressed regions, we physically defined Pbwg1.12 affecting body weight to a 3.8-Mb interval (61.5-65.3 Mb on chromosome 2. We fine-mapped Pbwg1.3 for body length to an 8.0-Mb interval (57.3-65.3 and Pbwg1.5 for abdominal white fat weight to a 2.1-Mb interval (59.4-61.5. The wild-derived allele at Pbwg1.12 and Pbwg1.3 uniquely increased body weight and length despite the fact that the wild mouse has a smaller body size than that of B6, whereas it decreased fat weight at Pbwg1.5. Exome sequencing and candidate gene prioritization suggested that Gcg and Grb14 are putative candidate genes for Pbwg1.12 and that Ly75 and Itgb6 are putative candidate genes for Pbwg1.5. These genes had nonsynonymous SNPs, but the SNPs were predicted to be not harmful to protein functions. These results provide information helpful to identify wild-derived quantitative trait genes causing enhanced growth and resistance to obesity.
Dieterich, Christine; Puey, Angela; Lyn, Sylvia; Swezey, Robert; Furimsky, Anna; Fairchild, David; Mirsalis, Jon C.; Ng, Hanna H.
2008-01-01
Vancomycin, one of few effective treatments against methicillin-resistant Staphylococcus aureus, is nephrotoxic. The goals of this study were to (1) gain insights into molecular mechanisms of nephrotoxicity at the genomic level, (2) evaluate gene markers of vancomycin-induced kidney injury, and (3) compare gene expression responses after iv and ip administration. Groups of six female BALB/c mice were treated with seven daily iv or ip doses of vancomycin (50, 200, and 400 mg/kg) or saline, and...
Genomic dissection and prioritizing of candidate genes of QTL for ...
Indian Academy of Sciences (India)
of Anatomy and Neurobiology, University of Tennessee Health Science Center, Memphis, TN 38163, USA. 5Mudanjiang ..... Fragile X mental retardation gene 1,. −2.1 ... stimulus/stress and signalling associated with acute-phase response were .... This work was supported by the Center of Genomics and Bioinfor- matics and ...
A candidate multimodal functional genetic network for thermal adaptation
Directory of Open Access Journals (Sweden)
Katharina C. Wollenberg Valero
2014-09-01
Full Text Available Vertebrate ectotherms such as reptiles provide ideal organisms for the study of adaptation to environmental thermal change. Comparative genomic and exomic studies can recover markers that diverge between warm and cold adapted lineages, but the genes that are functionally related to thermal adaptation may be difficult to identify. We here used a bioinformatics genome-mining approach to predict and identify functions for suitable candidate markers for thermal adaptation in the chicken. We first established a framework of candidate functions for such markers, and then compiled the literature on genes known to adapt to the thermal environment in different lineages of vertebrates. We then identified them in the genomes of human, chicken, and the lizard Anolis carolinensis, and established a functional genetic interaction network in the chicken. Surprisingly, markers initially identified from diverse lineages of vertebrates such as human and fish were all in close functional relationship with each other and more associated than expected by chance. This indicates that the general genetic functional network for thermoregulation and/or thermal adaptation to the environment might be regulated via similar evolutionarily conserved pathways in different vertebrate lineages. We were able to identify seven functions that were statistically overrepresented in this network, corresponding to four of our originally predicted functions plus three unpredicted functions. We describe this network as multimodal: central regulator genes with the function of relaying thermal signal (1, affect genes with different cellular functions, namely (2 lipoprotein metabolism, (3 membrane channels, (4 stress response, (5 response to oxidative stress, (6 muscle contraction and relaxation, and (7 vasodilation, vasoconstriction and regulation of blood pressure. This network constitutes a novel resource for the study of thermal adaptation in the closely related nonavian reptiles and
Back to the sea twice: identifying candidate plant genes for molecular evolution to marine life
Directory of Open Access Journals (Sweden)
Reusch Thorsten BH
2011-01-01
Full Text Available Abstract Background Seagrasses are a polyphyletic group of monocotyledonous angiosperms that have adapted to a completely submerged lifestyle in marine waters. Here, we exploit two collections of expressed sequence tags (ESTs of two wide-spread and ecologically important seagrass species, the Mediterranean seagrass Posidonia oceanica (L. Delile and the eelgrass Zostera marina L., which have independently evolved from aquatic ancestors. This replicated, yet independent evolutionary history facilitates the identification of traits that may have evolved in parallel and are possible instrumental candidates for adaptation to a marine habitat. Results In our study, we provide the first quantitative perspective on molecular adaptations in two seagrass species. By constructing orthologous gene clusters shared between two seagrasses (Z. marina and P. oceanica and eight distantly related terrestrial angiosperm species, 51 genes could be identified with detection of positive selection along the seagrass branches of the phylogenetic tree. Characterization of these positively selected genes using KEGG pathways and the Gene Ontology uncovered that these genes are mostly involved in translation, metabolism, and photosynthesis. Conclusions These results provide first insights into which seagrass genes have diverged from their terrestrial counterparts via an initial aquatic stage characteristic of the order and to the derived fully-marine stage characteristic of seagrasses. We discuss how adaptive changes in these processes may have contributed to the evolution towards an aquatic and marine existence.
Back to the sea twice: identifying candidate plant genes for molecular evolution to marine life.
Wissler, Lothar; Codoñer, Francisco M; Gu, Jenny; Reusch, Thorsten B H; Olsen, Jeanine L; Procaccini, Gabriele; Bornberg-Bauer, Erich
2011-01-12
Seagrasses are a polyphyletic group of monocotyledonous angiosperms that have adapted to a completely submerged lifestyle in marine waters. Here, we exploit two collections of expressed sequence tags (ESTs) of two wide-spread and ecologically important seagrass species, the Mediterranean seagrass Posidonia oceanica (L.) Delile and the eelgrass Zostera marina L., which have independently evolved from aquatic ancestors. This replicated, yet independent evolutionary history facilitates the identification of traits that may have evolved in parallel and are possible instrumental candidates for adaptation to a marine habitat. In our study, we provide the first quantitative perspective on molecular adaptations in two seagrass species. By constructing orthologous gene clusters shared between two seagrasses (Z. marina and P. oceanica) and eight distantly related terrestrial angiosperm species, 51 genes could be identified with detection of positive selection along the seagrass branches of the phylogenetic tree. Characterization of these positively selected genes using KEGG pathways and the Gene Ontology uncovered that these genes are mostly involved in translation, metabolism, and photosynthesis. These results provide first insights into which seagrass genes have diverged from their terrestrial counterparts via an initial aquatic stage characteristic of the order and to the derived fully-marine stage characteristic of seagrasses. We discuss how adaptive changes in these processes may have contributed to the evolution towards an aquatic and marine existence.
Novak, Rachel L; Harper, David P; Caudell, David; Slape, Christopher; Beachy, Sarah H; Aplan, Peter D
2012-12-01
NUP98-HOXD13 (NHD13) and CALM-AF10 (CA10) are oncogenic fusion proteins produced by recurrent chromosomal translocations in patients with acute myeloid leukemia (AML). Transgenic mice that express these fusions develop AML with a long latency and incomplete penetrance, suggesting that collaborating genetic events are required for leukemic transformation. We employed genetic techniques to identify both preleukemic abnormalities in healthy transgenic mice as well as collaborating events leading to leukemic transformation. Candidate gene resequencing revealed that 6 of 27 (22%) CA10 AMLs spontaneously acquired a Ras pathway mutation and 8 of 27 (30%) acquired an Flt3 mutation. Two CA10 AMLs acquired an Flt3 internal-tandem duplication, demonstrating that these mutations can be acquired in murine as well as human AML. Gene expression profiles revealed a marked upregulation of Hox genes, particularly Hoxa5, Hoxa9, and Hoxa10 in both NHD13 and CA10 mice. Furthermore, mir196b, which is embedded within the Hoxa locus, was overexpressed in both CA10 and NHD13 samples. In contrast, the Hox cofactors Meis1 and Pbx3 were differentially expressed; Meis1 was increased in CA10 AMLs but not NHD13 AMLs, whereas Pbx3 was consistently increased in NHD13 but not CA10 AMLs. Silencing of Pbx3 in NHD13 cells led to decreased proliferation, increased apoptosis, and decreased colony formation in vitro, suggesting a previously unexpected role for Pbx3 in leukemic transformation. Published by Elsevier Inc.
DEFF Research Database (Denmark)
Wittig, Rainer; Salowsky, Rüdiger; Blaich, Stephanie
2005-01-01
Combining multiplex reverse transcription-polymerase chain reaction (mRT-PCR) with microfluidic amplicon analysis, we developed an assay for the rapid and reliable semiquantitative expression screening of 11 candidate genes for drug resistance in human malignant melanoma. The functionality of thi...
Gene expression profiling in respond to TBT exposure in small abalone Haliotis diversicolor.
Jia, Xiwei; Zou, Zhihua; Wang, Guodong; Wang, Shuhong; Wang, Yilei; Zhang, Ziping
2011-10-01
In this study, we investigated the gene expression profiling of small abalone, Haliotis diversicolor by tributyltin (TBT) exposure using a cDNA microarray containing 2473 unique transcripts. Totally, 107 up-regulated genes and 41 down-regulated genes were found. For further investigation of candidate genes from microarray data and EST analysis, quantitative real-time PCR was performed at 6 h, 24 h, 48 h, 96 h and 192 h TBT exposure. 26 genes were found to be significantly differentially expressed in different time course, 3 of them were unknown. Some gene homologues like cellulose, endo-beta-1,4-glucanase, ferritin subunit 1 and thiolester containing protein II CG7052-PB might be the good biomarker candidate for TBT monitor. The identification of stress response genes and their expression profiles will permit detailed investigation of the defense responses of small abalone genes. Published by Elsevier Ltd.
Norheim, Katrine Brække; Le Hellard, Stephanie; Nordmark, Gunnel; Harboe, Erna; Gøransson, Lasse; Brun, Johan G; Wahren-Herlenius, Marie; Jonsson, Roland; Omdal, Roald
2014-02-01
Fatigue is prevalent and disabling in primary Sjögren's syndrome (pSS). Results from studies in chronic fatigue syndrome (CFS) indicate that genetic variation may influence fatigue. The aim of this study was to investigate single nucleotide polymorphism (SNP) variations in pSS patients with high and low fatigue. A panel of 85 SNPs in 12 genes was selected based on previous studies in CFS. A total of 207 pSS patients and 376 healthy controls were genotyped. One-hundred and ninety-three patients and 70 SNPs in 11 genes were available for analysis after quality control. Patients were dichotomized based on fatigue visual analogue scale (VAS) scores, with VAS fatigue" (n = 53) and VAS ≥50 denominated "high fatigue" (n = 140). We detected signals of association with pSS for one SNP in SLC25A40 (unadjusted p = 0.007) and two SNPs in PKN1 (both p = 0.03) in our pSS case versus control analysis. The association with SLC25A40 was stronger when only pSS high fatigue patients were analysed versus controls (p = 0.002). One SNP in PKN1 displayed an association in the case-only analysis of pSS high fatigue versus pSS low fatigue (p = 0.005). This candidate gene study in pSS did reveal a trend for associations between genetic variation in candidate genes and fatigue. The results will need to be replicated. More research on genetic associations with fatigue is warranted, and future trials should include larger cohorts and multicentre collaborations with sharing of genetic material to increase the statistical power.
Isolation of Resistance Gene Candidates (RGCs) and characterization of an RGC cluster in cassava.
López, C E; Zuluaga, A P; Cooke, R; Delseny, M; Tohme, J; Verdier, V
2003-08-01
Plant disease resistance genes (R genes) show significant similarity amongst themselves in terms of both their DNA sequences and structural motifs present in their protein products. Oligonucleotide primers designed from NBS (Nucleotide Binding Site) domains encoded by several R-genes have been used to amplify NBS sequences from the genomic DNA of various plant species, which have been called Resistance Gene Analogues (RGAs) or Resistance Gene Candidates (RGCs). Using specific primers from the NBS and TIR (Toll/Interleukin-1 Receptor) regions, we identified twelve classes of RGCs in cassava (Manihot esculenta Crantz). Two classes were obtained from the PCR-amplification of the TIR domain. The other 10 classes correspond to the NBS sequences and were grouped into two subfamilies. Classes RCa1 to RCa5 are part of the first subfamily and were linked to a TIR domain in the N terminus. Classes RCa6 to RCa10 corresponded to non-TIR NBS-LRR encoding sequences. BAC library screening with the 12 RGC classes as probes allowed the identification of 42 BAC clones that were assembled into 10 contigs and 19 singletons. Members of the two TIR and non-TIR NBS-LRR subfamilies occurred together within individual BAC clones. The BAC screening and Southern hybridization analyses showed that all RGCs were single copy sequences except RCa6 that represented a large and diverse gene family. One BAC contained five NBS sequences and sequence analysis allowed the identification of two complete RGCs encoding two highly similar proteins. This BAC was located on linkage group J with three other RGC-containing BACs. At least one of these genes, RGC2, is expressed constitutively in cassava tissues.
Directory of Open Access Journals (Sweden)
Molenaar Douwe
2010-11-01
Full Text Available Abstract Background Modulation of the immune system is one of the most plausible mechanisms underlying the beneficial effects of probiotic bacteria on human health. Presently, the specific probiotic cell products responsible for immunomodulation are largely unknown. In this study, the genetic and phenotypic diversity of strains of the Lactobacillus plantarum species were investigated to identify genes of L. plantarum with the potential to influence the amounts of cytokines interleukin 10 (IL-10 and IL-12 and the ratio of IL-10/IL-12 produced by peripheral blood mononuclear cells (PBMCs. Results A total of 42 Lactobacillus plantarum strains isolated from diverse environmental and human sources were evaluated for their capacity to stimulate cytokine production in PBMCs. The L. plantarum strains induced the secretion of the anti-inflammatory cytokine IL-10 over an average 14-fold range and secretion of the pro-inflammatory cytokine IL-12 over an average 16-fold range. Comparisons of the strain-specific cytokine responses of PBMCs to comparative genome hybridization profiles obtained with L. plantarum WCFS1 DNA microarrays (also termed gene-trait matching resulted in the identification of 6 candidate genetic loci with immunomodulatory capacities. These loci included genes encoding an N-acetyl-glucosamine/galactosamine phosphotransferase system, the LamBDCA quorum sensing system, and components of the plantaricin (bacteriocin biosynthesis and transport pathway. Deletion of these genes in L. plantarum WCFS1 resulted in growth phase-dependent changes in the PBMC IL-10 and IL-12 cytokine profiles compared with wild-type cells. Conclusions The altered PBMC cytokine profiles obtained with the L. plantarum WCFS1 mutants were in good agreement with the predictions made by gene-trait matching for the 42 L. plantarum strains. This study therefore resulted in the identification of genes present in certain strains of L. plantarum which might be responsible for
Gene Expression Signature Analysis Identifies Vorinostat as a Candidate Therapy for Gastric Cancer
Choi, Woonyoung; Park, Yun-Yong; Kim, KyoungHyun; Kim, Sang-Bae; Lee, Ju-Seog; Mills, Gordon B.; Cho, Jae Yong
2011-01-01
Background Gastric cancer continues to be one of the deadliest cancers in the world and therefore identification of new drugs targeting this type of cancer is thus of significant importance. The purpose of this study was to identify and validate a therapeutic agent which might improve the outcomes for gastric cancer patients in the future. Methodology/Principal Findings Using microarray technology, we generated a gene expression profile of human gastric cancer–specific genes from human gastric cancer tissue samples. We used this profile in the Broad Institute's Connectivity Map analysis to identify candidate therapeutic compounds for gastric cancer. We found the histone deacetylase inhibitor vorinostat as the lead compound and thus a potential therapeutic drug for gastric cancer. Vorinostat induced both apoptosis and autophagy in gastric cancer cell lines. Pharmacological and genetic inhibition of autophagy however, increased the therapeutic efficacy of vorinostat, indicating that a combination of vorinostat with autophagy inhibitors may therapeutically be more beneficial. Moreover, gene expression analysis of gastric cancer identified a collection of genes (ITGB5, TYMS, MYB, APOC1, CBX5, PLA2G2A, and KIF20A) whose expression was elevated in gastric tumor tissue and downregulated more than 2-fold by vorinostat treatment in gastric cancer cell lines. In contrast, SCGB2A1, TCN1, CFD, APLP1, and NQO1 manifested a reversed pattern. Conclusions/Significance We showed that analysis of gene expression signature may represent an emerging approach to discover therapeutic agents for gastric cancer, such as vorinostat. The observation of altered gene expression after vorinostat treatment may provide the clue to identify the molecular mechanism of vorinostat and those patients likely to benefit from vorinostat treatment. PMID:21931799
HRGFish: A database of hypoxia responsive genes in fishes
Rashid, Iliyas; Nagpure, Naresh Sahebrao; Srivastava, Prachi; Kumar, Ravindra; Pathak, Ajey Kumar; Singh, Mahender; Kushwaha, Basdeo
2017-02-01
Several studies have highlighted the changes in the gene expression due to the hypoxia response in fishes, but the systematic organization of the information and the analytical platform for such genes are lacking. In the present study, an attempt was made to develop a database of hypoxia responsive genes in fishes (HRGFish), integrated with analytical tools, using LAMPP technology. Genes reported in hypoxia response for fishes were compiled through literature survey and the database presently covers 818 gene sequences and 35 gene types from 38 fishes. The upstream fragments (3,000 bp), covered in this database, enables to compute CG dinucleotides frequencies, motif finding of the hypoxia response element, identification of CpG island and mapping with the reference promoter of zebrafish. The database also includes functional annotation of genes and provides tools for analyzing sequences and designing primers for selected gene fragments. This may be the first database on the hypoxia response genes in fishes that provides a workbench to the scientific community involved in studying the evolution and ecological adaptation of the fish species in relation to hypoxia.
DEFF Research Database (Denmark)
Gylvin, T; Nolsøe, R; Hansen, T
2004-01-01
Beta cell loss in Type 1 and Type 2 diabetes mellitus may result from apoptosis and necrosis induced by inflammatory mediators. The suppressor of cytokine signalling (SOCS)-3 is a natural inhibitor of cytokine signalling and also influences insulin signalling. SOCS3 could therefore be a candidate...... gene in the development of Type 1 and Type 2 diabetes mellitus....
Energy Technology Data Exchange (ETDEWEB)
Jarett, Jessica; Stepanauskas, Ramunas; Kieft, Thomas; Onstott, Tullis; Woyke, Tanja
2014-03-17
The Microbial Dark Matter project has sequenced genomes from over 200 single cells from candidate phyla, greatly expanding our knowledge of the ecology, inferred metabolism, and evolution of these widely distributed, yet poorly understood lineages. The second phase of this project aims to sequence an additional 800 single cells from known as well as potentially novel candidate phyla derived from a variety of environments. In order to identify whole genome amplified single cells, screening based on phylogenetic placement of 16S rRNA gene sequences is being conducted. Briefly, derived 16S rRNA gene sequences are aligned to a custom version of the Greengenes reference database and added to a reference tree in ARB using parsimony. In multiple samples from deep subsurface habitats but not from other habitats, a large number of sequences proved difficult to align and therefore to place in the tree. Based on comparisons to reference sequences and structural alignments using SSU-ALIGN, many of these ?difficult? sequences appear to originate from candidate phyla, and contain intervening sequences (IVSs) within the 16S rRNA genes. These IVSs are short (39 - 79 nt) and do not appear to be self-splicing or to contain open reading frames. IVSs were found in the loop regions of stem-loop structures in several different taxonomic groups. Phylogenetic placement of sequences is strongly affected by IVSs; two out of three groups investigated were classified as different phyla after their removal. Based on data from samples screened in this project, IVSs appear to be more common in microbes occurring in deep subsurface habitats, although the reasons for this remain elusive.
Noar, Roslyn D; Daub, Margaret E
2016-08-30
Mycosphaerella fijiensis, causative agent of the black Sigatoka disease of banana, is considered the most economically damaging banana disease. Despite its importance, the genetics of pathogenicity are poorly understood. Previous studies have characterized polyketide pathways with possible roles in pathogenicity. To identify additional candidate pathogenicity genes, we compared the transcriptome of this fungus during the necrotrophic phase of infection with that during saprophytic growth in medium. Transcriptome analysis was conducted, and the functions of differentially expressed genes were predicted by identifying conserved domains, Gene Ontology (GO) annotation and GO enrichment analysis, Carbohydrate-Active EnZymes (CAZy) annotation, and identification of genes encoding effector-like proteins. The analysis showed that genes commonly involved in secondary metabolism have higher expression in infected leaf tissue, including genes encoding cytochrome P450s, short-chain dehydrogenases, and oxidoreductases in the 2-oxoglutarate and Fe(II)-dependent oxygenase superfamily. Other pathogenicity-related genes with higher expression in infected leaf tissue include genes encoding salicylate hydroxylase-like proteins, hydrophobic surface binding proteins, CFEM domain-containing proteins, and genes encoding secreted cysteine-rich proteins characteristic of effectors. More genes encoding amino acid transporters, oligopeptide transporters, peptidases, proteases, proteinases, sugar transporters, and proteins containing Domain of Unknown Function (DUF) 3328 had higher expression in infected leaf tissue, while more genes encoding inhibitors of peptidases and proteinases had higher expression in medium. Sixteen gene clusters with higher expression in leaf tissue were identified including clusters for the synthesis of a non-ribosomal peptide. A cluster encoding a novel fusicoccane was also identified. Two putative dispensable scaffolds were identified with a large proportion of
Directory of Open Access Journals (Sweden)
Manoj Kulkarni
2017-12-01
Full Text Available Abiotic stresses such as, drought, heat, salinity, and flooding threaten global food security. Crop genetic improvement with increased resilience to abiotic stresses is a critical component of crop breeding strategies. Wheat is an important cereal crop and a staple food source globally. Enhanced drought tolerance in wheat is critical for sustainable food production and global food security. Recent advances in drought tolerance research have uncovered many key genes and transcription regulators governing morpho-physiological traits. Genes controlling root architecture and stomatal development play an important role in soil moisture extraction and its retention, and therefore have been targets of molecular breeding strategies for improving drought tolerance. In this systematic review, we have summarized evidence of beneficial contributions of root and stomatal traits to plant adaptation to drought stress. Specifically, we discuss a few key genes such as, DRO1 in rice and ERECTA in Arabidopsis and rice that were identified to be the enhancers of drought tolerance via regulation of root traits and transpiration efficiency. Additionally, we highlight several transcription factor families, such as, ERF (ethylene response factors, DREB (dehydration responsive element binding, ZFP (zinc finger proteins, WRKY, and MYB that were identified to be both positive and negative regulators of drought responses in wheat, rice, maize, and/or Arabidopsis. The overall aim of this review is to provide an overview of candidate genes that have been identified as regulators of drought response in plants. The lack of a reference genome sequence for wheat and non-transgenic approaches for manipulation of gene functions in wheat in the past had impeded high-resolution interrogation of functional elements, including genes and QTLs, and their application in cultivar improvement. The recent developments in wheat genomics and reverse genetics, including the availability of a
Kulkarni, Manoj; Soolanayakanahally, Raju; Ogawa, Satoshi; Uga, Yusaku; Selvaraj, Michael G.; Kagale, Sateesh
2017-12-01
Abiotic stresses such as drought, heat, salinity and flooding threaten global food security. Crop genetic improvement with increased resilience to abiotic stresses is a critical component of crop breeding strategies. Wheat is an important cereal crop and a staple food source globally. Enhanced drought tolerance in wheat is critical for sustainable food production and global food security. Recent advances in drought tolerance research have uncovered many key genes and transcription regulators governing morpho-physiological traits. Genes controlling root architecture and stomatal development play an important role in soil moisture extraction and its retention, and therefore have been targets of molecular breeding strategies for improving drought tolerance. In this systematic review, we have summarized evidence of beneficial contributions of root and stomatal traits to plant adaptation to drought stress. Specifically, we discuss a few key genes such as DRO1 in rice and ERECTA in Arabidopsis and rice that were identified to be the enhancers of drought tolerance via regulation of root traits and transpiration efficiency. Additionally, we highlight several transcription factor families, such as ERF (ethylene response factors), DREB (dehydration responsive element binding), ZFP (zinc finger proteins), WRKY and MYB that were identified to be both positive and negative regulators of drought responses in wheat, rice, maize and/or Arabidopsis. The overall aim of this review was to provide an overview of candidate genes that have been tested as regulators of drought response in plants. The lack of a reference genome sequence for wheat and nontransgenic approaches for manipulation of gene functions in the past had impeded high-resolution interrogation of functional elements, including genes and QTLs, and their application in cultivar improvement. The recent developments in wheat genomics and reverse genetics, including the availability of a gold-standard reference genome
Patterns of population differentiation of candidate genes for cardiovascular disease
Directory of Open Access Journals (Sweden)
Ding Keyue
2007-07-01
Full Text Available Abstract Background The basis for ethnic differences in cardiovascular disease (CVD susceptibility is not fully understood. We investigated patterns of population differentiation (FST of a set of genes in etiologic pathways of CVD among 3 ethnic groups: Yoruba in Nigeria (YRI, Utah residents with European ancestry (CEU, and Han Chinese (CHB + Japanese (JPT. We identified 37 pathways implicated in CVD based on the PANTHER classification and 416 genes in these pathways were further studied; these genes belonged to 6 biological processes (apoptosis, blood circulation and gas exchange, blood clotting, homeostasis, immune response, and lipoprotein metabolism. Genotype data were obtained from the HapMap database. Results We calculated FST for 15,559 common SNPs (minor allele frequency ≥ 0.10 in at least one population in genes that co-segregated among the populations, as well as an average-weighted FST for each gene. SNPs were classified as putatively functional (non-synonymous and untranslated regions or non-functional (intronic and synonymous sites. Mean FST values for common putatively functional variants were significantly higher than FST values for nonfunctional variants. A significant variation in FST was also seen based on biological processes; the processes of 'apoptosis' and 'lipoprotein metabolism' showed an excess of genes with high FST. Thus, putative functional SNPs in genes in etiologic pathways for CVD show greater population differentiation than non-functional SNPs and a significant variance of FST values was noted among pairwise population comparisons for different biological processes. Conclusion These results suggest a possible basis for varying susceptibility to CVD among ethnic groups.
Directory of Open Access Journals (Sweden)
Yuji Sekiguchi
2015-01-01
Full Text Available Filamentous cells belonging to the candidate bacterial phylum KSB3 were previously identified as the causative agent of fatal filament overgrowth (bulking in a high-rate industrial anaerobic wastewater treatment bioreactor. Here, we obtained near complete genomes from two KSB3 populations in the bioreactor, including the dominant bulking filament, using differential coverage binning of metagenomic data. Fluorescence in situ hybridization with 16S rRNA-targeted probes specific for the two populations confirmed that both are filamentous organisms. Genome-based metabolic reconstruction and microscopic observation of the KSB3 filaments in the presence of sugar gradients indicate that both filament types are Gram-negative, strictly anaerobic fermenters capable of non-flagellar based gliding motility, and have a strikingly large number of sensory and response regulator genes. We propose that the KSB3 filaments are highly sensitive to their surroundings and that cellular processes, including those causing bulking, are controlled by external stimuli. The obtained genomes lay the foundation for a more detailed understanding of environmental cues used by KSB3 filaments, which may lead to more robust treatment options to prevent bulking.
Gupta, Vikas; Estrada, April D; Blakley, Ivory; Reid, Rob; Patel, Ketan; Meyer, Mason D; Andersen, Stig Uggerhøj; Brown, Allan F; Lila, Mary Ann; Loraine, Ann E
2015-01-01
Blueberries are a rich source of antioxidants and other beneficial compounds that can protect against disease. Identifying genes involved in synthesis of bioactive compounds could enable the breeding of berry varieties with enhanced health benefits. Toward this end, we annotated a previously sequenced draft blueberry genome assembly using RNA-Seq data from five stages of berry fruit development and ripening. Genome-guided assembly of RNA-Seq read alignments combined with output from ab initio gene finders produced around 60,000 gene models, of which more than half were similar to proteins from other species, typically the grape Vitis vinifera. Comparison of gene models to the PlantCyc database of metabolic pathway enzymes identified candidate genes involved in synthesis of bioactive compounds, including bixin, an apocarotenoid with potential disease-fighting properties, and defense-related cyanogenic glycosides, which are toxic. Cyanogenic glycoside (CG) biosynthetic enzymes were highly expressed in green fruit, and a candidate CG detoxification enzyme was up-regulated during fruit ripening. Candidate genes for ethylene, anthocyanin, and 400 other biosynthetic pathways were also identified. Homology-based annotation using Blast2GO and InterPro assigned Gene Ontology terms to around 15,000 genes. RNA-Seq expression profiling showed that blueberry growth, maturation, and ripening involve dynamic gene expression changes, including coordinated up- and down-regulation of metabolic pathway enzymes and transcriptional regulators. Analysis of RNA-seq alignments identified developmentally regulated alternative splicing, promoter use, and 3' end formation. We report genome sequence, gene models, functional annotations, and RNA-Seq expression data that provide an important new resource enabling high throughput studies in blueberry.
Candidate gene analyses of 3-dimensional dentoalveolar phenotypes in subjects with malocclusion
Weaver, Cole A.; Miller, Steven F.; da Fontoura, Clarissa S. G.; Wehby, George L.; Amendt, Brad A.; Holton, Nathan E.; Allareddy, Veeratrishul; Southard, Thomas E.; Moreno Uribe, Lina M.
2017-01-01
Introduction Genetic studies of malocclusion etiology have identified 4 deleterious mutations in genes, DUSP6, ARHGAP21, FGF23, and ADAMTS1 in familial Class III cases. Although these variants may have large impacts on Class III phenotypic expression, their low frequency (malocclusions. Thus, much of the genetic variation underlying the dentofacial phenotypic variation associated with malocclusion remains unknown. In this study, we evaluated associations between common genetic variations in craniofacial candidate genes and 3-dimensional dentoalveolar phenotypes in patients with malocclusion. Methods Pretreatment dental casts or cone-beam computed tomographic images from 300 healthy subjects were digitized with 48 landmarks. The 3-dimensional coordinate data were submitted to a geometric morphometric approach along with principal component analysis to generate continuous phenotypes including symmetric and asymmetric components of dentoalveolar shape variation, fluctuating asymmetry, and size. The subjects were genotyped for 222 single-nucleotide polymorphisms in 82 genes/loci, and phenotpye-genotype associations were tested via multivariate linear regression. Results Principal component analysis of symmetric variation identified 4 components that explained 68% of the total variance and depicted anteroposterior, vertical, and transverse dentoalveolar discrepancies. Suggestive associations (P eruptions. Suggestive associations were found with TBX1 AJUBA, SNAI3 SATB2, TP63, and 1p22.1. Fluctuating asymmetry was associated with BMP3 and LATS1. Associations for SATB2 and BMP3 with asymmetric variations remained significant after the Bonferroni correction (P malocclusions were identified. PMID:28257739
Winchester, Catherine L; Ohzeki, Hiromitsu; Vouyiouklis, Demetrius A; Thompson, Rhiannon; Penninger, Josef M; Yamagami, Keiji; Norrie, John D; Hunter, Robert; Pratt, Judith A; Morris, Brian J
2012-11-15
Schizophrenia is a debilitating psychiatric disease with a strong genetic contribution, potentially linked to altered glutamatergic function in brain regions such as the prefrontal cortex (PFC). Here, we report converging evidence to support a functional candidate gene for schizophrenia. In post-mortem PFC from patients with schizophrenia, we detected decreased expression of MKK7/MAP2K7-a kinase activated by glutamatergic activity. While mice lacking one copy of the Map2k7 gene were overtly normal in a variety of behavioural tests, these mice showed a schizophrenia-like cognitive phenotype of impaired working memory. Additional support for MAP2K7 as a candidate gene came from a genetic association study. A substantial effect size (odds ratios: ~1.9) was observed for a common variant in a cohort of case and control samples collected in the Glasgow area and also in a replication cohort of samples of Northern European descent (most significant P-value: 3 × 10(-4)). While some caution is warranted until these association data are further replicated, these results are the first to implicate the candidate gene MAP2K7 in genetic risk for schizophrenia. Complete sequencing of all MAP2K7 exons did not reveal any non-synonymous mutations. However, the MAP2K7 haplotype appeared to have functional effects, in that it influenced the level of expression of MAP2K7 mRNA in human PFC. Taken together, the results imply that reduced function of the MAP2K7-c-Jun N-terminal kinase (JNK) signalling cascade may underlie some of the neurochemical changes and core symptoms in schizophrenia.
2010-05-01
Screening in Diabetes : Candidate Gene Analysis for Diabetic Retinopathy PRINCIPAL INVESTIGATOR: Robert A. Vigersky, COL MC CONTRACTING ORGANIZATION... Diabetes Institute of the Walter Reed Health Care System Genetic Screening in Diabetes : Candidate Gene Analysis for Diabetic Retinopathy 5c. PROGRAM... diabetic neuropathy, and diabetic retinopathy . This was an observational study in which the investigators obtained DNA samples from the blood of
Whole genome sequencing resource identifies 18 new candidate genes for autism spectrum disorder
Yuen, Ryan KC; Merico, Daniele; Bookman, Matt; Howe, Jennifer L; Thiruvahindrapuram, Bhooma; Patel, Rohan V; Whitney, Joe; Deflaux, Nicole; Bingham, Jonathan; Wang, Zhuozhi; Pellecchia, Giovanna; Buchanan, Janet A; Walker, Susan; Marshall, Christian R; Uddin, Mohammed; Zarrei, Mehdi; Deneault, Eric; D’Abate, Lia; Chan, Ada JS; Koyanagi, Stephanie; Paton, Tara; Pereira, Sergio L; Hoang, Ny; Engchuan, Worrawat; Higginbotham, Edward J; Ho, Karen; Lamoureux, Sylvia; Li, Weili; MacDonald, Jeffrey R; Nalpathamkalam, Thomas; Sung, Wilson WL; Tsoi, Fiona J; Wei, John; Xu, Lizhen; Tasse, Anne-Marie; Kirby, Emily; Van Etten, William; Twigger, Simon; Roberts, Wendy; Drmic, Irene; Jilderda, Sanne; Modi, Bonnie MacKinnon; Kellam, Barbara; Szego, Michael; Cytrynbaum, Cheryl; Weksberg, Rosanna; Zwaigenbaum, Lonnie; Woodbury-Smith, Marc; Brian, Jessica; Senman, Lili; Iaboni, Alana; Doyle-Thomas, Krissy; Thompson, Ann; Chrysler, Christina; Leef, Jonathan; Savion-Lemieux, Tal; Smith, Isabel M; Liu, Xudong; Nicolson, Rob; Seifer, Vicki; Fedele, Angie; Cook, Edwin H; Dager, Stephen; Estes, Annette; Gallagher, Louise; Malow, Beth A; Parr, Jeremy R; Spence, Sarah J; Vorstman, Jacob; Frey, Brendan J; Robinson, James T; Strug, Lisa J; Fernandez, Bridget A; Elsabbagh, Mayada; Carter, Melissa T; Hallmayer, Joachim; Knoppers, Bartha M; Anagnostou, Evdokia; Szatmari, Peter; Ring, Robert H; Glazer, David; Pletcher, Mathew T; Scherer, Stephen W
2017-01-01
We are performing whole genome sequencing (WGS) of families with Autism Spectrum Disorder (ASD) to build a resource, named MSSNG, to enable the sub-categorization of phenotypes and underlying genetic factors involved. Here, we report WGS of 5,205 samples from families with ASD, accompanied by clinical information, creating a database accessible in a cloud platform, and through an internet portal with controlled access. We found an average of 73.8 de novo single nucleotide variants and 12.6 de novo insertion/deletions (indels) or copy number variations (CNVs) per ASD subject. We identified 18 new candidate ASD-risk genes such as MED13 and PHF3, and found that participants bearing mutations in susceptibility genes had significantly lower adaptive ability (p=6×10−4). In 294/2,620 (11.2%) of ASD cases, a molecular basis could be determined and 7.2% of these carried CNV/chromosomal abnormalities, emphasizing the importance of detecting all forms of genetic variation as diagnostic and therapeutic targets in ASD. PMID:28263302
Haughey, Heather M; Kaiser, Alan L; Johnson, Thomas E; Bennett, Beth; Sikela, James M; Zahniser, Nancy R
2005-10-01
Altered noradrenergic neurotransmission is associated with depression and may contribute to drug abuse and alcoholism. Differential initial sensitivity to ethanol is an important predictor of risk for future alcoholism, making the inbred long-sleep (ILS) and inbred short-sleep (ISS) mice a useful model for identifying genes that may contribute to alcoholism. In this study, molecular biological, neurochemical, and behavioral approaches were used to test the hypothesis that the norepinephrine transporter (NET) contributes to the differences in ethanol-induced loss of righting reflex (LORR) in ILS and ISS mice. We used these mice to investigate the NET as a candidate gene contributing to this phenotype. The ILS and ISS mice carry different DNA haplotypes for NET, showing eight silent differences between allelic coding regions. Only the ILS haplotype is found in other mouse strains thus far sequenced. Brain regional analyses revealed that ILS mice have 30 to 50% lower [3H]NE uptake, NET binding, and NET mRNA levels than ISS mice. Maximal [3H]NE uptake and NET number were reduced, with no change in affinity, in the ILS mice. These neurobiological changes were associated with significant influences on the behavioral phenotype of these mice, as demonstrated by (1) a differential response in the duration of ethanol-induced LORR in ILS and ISS mice pretreated with a NET inhibitor and (2) increased ethanol-induced LORR in LXS recombinant inbred (RI) strains, homozygous for ILS in the NET chromosomal region (44-47 cM), compared with ISS homozygous strains. This is the first report to suggest that the NET gene is one of many possible genetic factors influencing ethanol sensitivity in ILS, ISS, and LXS RI mouse strains.
T-cell activation and early gene response in dogs.
Directory of Open Access Journals (Sweden)
Sally-Anne Mortlock
Full Text Available T-cells play a crucial role in canine immunoregulation and defence against invading pathogens. Proliferation is fundamental to T-cell differentiation, homeostasis and immune response. Initiation of proliferation following receptor mediated stimuli requires a temporally programmed gene response that can be identified as immediate-early, mid- and late phases. The immediate-early response genes in T-cell activation engage the cell cycle machinery and promote subsequent gene activation events. Genes involved in this immediate-early response in dogs are yet to be identified. The present study was undertaken to characterise the early T-cell gene response in dogs to improve understanding of the genetic mechanisms regulating immune function. Gene expression profiles were characterised using canine gene expression microarrays and quantitative reverse transcription PCR (qRT-PCR, and paired samples from eleven dogs. Significant functional annotation clusters were identified following stimulation with phytohemagluttinin (PHA (5μg/ml, including the Toll-like receptor signaling pathway and phosphorylation pathways. Using strict statistical criteria, 13 individual genes were found to be differentially expressed, nine of which have ontologies that relate to proliferation and cell cycle control. These included, prostaglandin-endoperoxide synthase 2 (PTGS2/COX2, early growth response 1 (EGR1, growth arrest and DNA damage-inducible gene (GADD45B, phorbol-12-myristate-13-acetate-induced protein 1 (PMAIP1, V-FOS FBJ murine osteosarcoma viral oncogene homolog (FOS, early growth response 2 (EGR2, hemogen (HEMGN, polo-like kinase 2 (PLK2 and polo-like kinase 3 (PLK3. Differential gene expression was re-examined using qRT-PCR, which confirmed that EGR1, EGR2, PMAIP1, PTGS2, FOS and GADD45B were significantly upregulated in stimulated cells and ALAS2 downregulated. PTGS2 and EGR1 showed the highest levels of response in these dogs. Both of these genes are involved in
Findeisen, Peter; Röckel, Matthias; Nees, Matthias; Röder, Christian; Kienle, Peter; Von Knebel Doeberitz, Magnus; Kalthoff, Holger; Neumaier, Michael
2008-11-01
The presence of tumor cells in peripheral blood is being regarded increasingly as a clinically relevant prognostic factor for colorectal cancer patients. Current molecular methods are very sensitive but due to low specificity their diagnostic value is limited. This study was undertaken in order to systematically identify and validate new colorectal cancer (CRC) marker genes for improved detection of minimal residual disease in peripheral blood mononuclear cells of colorectal cancer patients. Marker genes with upregulated gene expression in colorectal cancer tissue and cell lines were identified using microarray experiments and publicly available gene expression data. A systematic iterative approach was used to reduce a set of 346 candidate genes, reportedly associated with CRC to a selection of candidate genes that were then further validated by relative quantitative real-time RT-PCR. Analytical sensitivity of RT-PCR assays was determined by spiking experiments with CRC cells. Diagnostic sensitivity as well as specificity was tested on a control group consisting of 18 CRC patients compared to 12 individuals without malignant disease. From a total of 346-screened genes only serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 5 (SERPINB5) showed significantly elevated transcript levels in peripheral venous blood specimens of tumor patients when compared to the nonmalignant control group. These results were confirmed by analysis of an enlarged collective consisting of 63 CRC patients and 36 control individuals without malignant disease. In conclusion SERPINB5 seems to be a promising marker for detection of circulating tumor cells in peripheral blood of colorectal cancer patients.
Directory of Open Access Journals (Sweden)
Teramura Kouhei
2011-06-01
Full Text Available Abstract Background Temperature adaptation is one of the most important determinants of distribution and population size of organisms in nature. Recently, quantitative trait loci (QTL mapping and gene expression profiling approaches have been used for detecting candidate genes for heat resistance. However, the resolution of QTL mapping is not high enough to examine the individual effects of various genes in each QTL. Heat stress-responsive genes, characterized by gene expression profiling studies, are not necessarily responsible for heat resistance. Some of these genes may be regulated in association with the heat stress response of other genes. Results To evaluate which heat-responsive genes are potential candidates for heat resistance with higher resolution than previous QTL mapping studies, we performed genome-wide deficiency screen for QTL for heat resistance. We screened 439 isogenic deficiency strains from the DrosDel project, covering 65.6% of the Drosophila melanogaster genome in order to map QTL for thermal resistance. As a result, we found 19 QTL for heat resistance, including 3 novel QTL outside the QTL found in previous studies. Conclusion The QTL found in this study encompassed 19 heat-responsive genes found in the previous gene expression profiling studies, suggesting that they were strong candidates for heat resistance. This result provides new insights into the genetic architecture of heat resistance. It also emphasizes the advantages of genome-wide deficiency screen using isogenic deficiency libraries.
Effects of bovine prolactin gene polymorphism within exon 4 on milk ...
African Journals Online (AJOL)
In this study, polymorphism of prolactin gene was analyzed as a candidate gene responsible for variation and genetic trends in milk yield and composition traits. Genomic DNAs were extracted from 268 semen samples belonged to Iranian Holstein bulls. Genotyping for the prolactin gene using PCRRFLP technique and RsaI ...
Al-Hebshi, Nezar Noor; Li, Shiyong; Nasher, Akram Thabet; El-Setouhy, Maged; Alsanosi, Rashad; Blancato, Jan; Loffredo, Christopher
2016-07-15
The study sought to identify genetic aberrations driving oral squamous cell carcinoma (OSCC) development among users of shammah, an Arabian preparation of smokeless tobacco. Twenty archival OSCC samples, 15 of which with a history of shammah exposure, were whole-exome sequenced at an average depth of 127×. Somatic mutations were identified using a novel, matched controls-independent filtration algorithm. CODEX and Exomedepth coupled with a novel, Database of Genomic Variant-based filter were employed to call somatic gene-copy number variations. Significantly mutated genes were identified with Oncodrive FM and the Youn and Simon's method. Candidate driver genes were nominated based on Gene Set Enrichment Analysis. The observed mutational spectrum was similar to that reported by the TCGA project. In addition to confirming known genes of OSCC (TP53, CDKNA2, CASP8, PIK3CA, HRAS, FAT1, TP63, CCND1 and FADD) the analysis identified several candidate novel driver events including mutations of NOTCH3, CSMD3, CRB1, CLTCL1, OSMR and TRPM2, amplification of the proto-oncogenes FOSL1, RELA, TRAF6, MDM2, FRS2 and BAG1, and deletion of the recently described tumor suppressor SMARCC1. Analysis also revealed significantly altered pathways not previously implicated in OSCC including Oncostatin-M signalling pathway, AP-1 and C-MYB transcription networks and endocytosis. There was a trend for higher number of mutations, amplifications and driver events in samples with history of shammah exposure particularly those that tested EBV positive, suggesting an interaction between tobacco exposure and EBV. The work provides further evidence for the genetic heterogeneity of oral cancer and suggests shammah-associated OSCC is characterized by extensive amplification of oncogenes. © 2016 UICC.
Li, Yukuo; Fang, Jinbao; Qi, Xiujuan; Lin, Miaomiao; Zhong, Yunpeng; Sun, Leiming; Cui, Wen
2018-05-15
To assess the interrelation between the change of metabolites and the change of fruit color, we performed a combined metabolome and transcriptome analysis of the flesh in two different Actinidia arguta cultivars: "HB" ("Hongbaoshixing") and "YF" ("Yongfengyihao") at two different fruit developmental stages: 70d (days after full bloom) and 100d (days after full bloom). Metabolite and transcript profiling was obtained by ultra-performance liquid chromatography quadrupole time-of-flight tandem mass spectrometer and high-throughput RNA sequencing, respectively. The identification and quantification results of metabolites showed that a total of 28,837 metabolites had been obtained, of which 13,715 were annotated. In comparison of HB100 vs. HB70, 41 metabolites were identified as being flavonoids, 7 of which, with significant difference, were identified as bracteatin, luteolin, dihydromyricetin, cyanidin, pelargonidin, delphinidin and (-)-epigallocatechin. Association analysis between metabolome and transcriptome revealed that there were two metabolic pathways presenting significant differences during fruit development, one of which was flavonoid biosynthesis, in which 14 structural genes were selected to conduct expression analysis, as well as 5 transcription factor genes obtained by transcriptome analysis. RT-qPCR results and cluster analysis revealed that AaF3H , AaLDOX , AaUFGT , AaMYB , AabHLH , and AaHB2 showed the best possibility of being candidate genes. A regulatory network of flavonoid biosynthesis was established to illustrate differentially expressed candidate genes involved in accumulation of metabolites with significant differences, inducing red coloring during fruit development. Such a regulatory network linking genes and flavonoids revealed a system involved in the pigmentation of all-red-fleshed and all-green-fleshed A. arguta , suggesting this conjunct analysis approach is not only useful in understanding the relationship between genotype and phenotype
Bogdanova, Vera S.; Zaytseva, Olga O.; Mglinets, Anatoliy V.; Shatskaya, Natalia V.; Kosterin, Oleg E.; Vasiliev, Gennadiy V.
2015-01-01
In crosses of wild and cultivated peas (Pisum sativum L.), nuclear-cytoplasmic incompatibility frequently occurs manifested as decreased pollen fertility, male gametophyte lethality, sporophyte lethality. High-throughput sequencing of plastid genomes of one cultivated and four wild pea accessions differing in cross-compatibility was performed. Candidate genes for involvement in the nuclear-plastid conflict were searched in the reconstructed plastid genomes. In the annotated Medicago truncatula genome, nuclear candidate genes were searched in the portion syntenic to the pea chromosome region known to harbor a locus involved in the conflict. In the plastid genomes, a substantial variability of the accD locus represented by nucleotide substitutions and indels was found to correspond to the pattern of cross-compatibility among the accessions analyzed. Amino acid substitutions in the polypeptides encoded by the alleles of a nuclear locus, designated as Bccp3, with a complementary function to accD, fitted the compatibility pattern. The accD locus in the plastid genome encoding beta subunit of the carboxyltransferase of acetyl-coA carboxylase and the nuclear locus Bccp3 encoding biotin carboxyl carrier protein of the same multi-subunit enzyme were nominated as candidate genes for main contribution to nuclear-cytoplasmic incompatibility in peas. Existence of another nuclear locus involved in the accD-mediated conflict is hypothesized. PMID:25789472
Directory of Open Access Journals (Sweden)
Vera S Bogdanova
Full Text Available In crosses of wild and cultivated peas (Pisum sativum L., nuclear-cytoplasmic incompatibility frequently occurs manifested as decreased pollen fertility, male gametophyte lethality, sporophyte lethality. High-throughput sequencing of plastid genomes of one cultivated and four wild pea accessions differing in cross-compatibility was performed. Candidate genes for involvement in the nuclear-plastid conflict were searched in the reconstructed plastid genomes. In the annotated Medicago truncatula genome, nuclear candidate genes were searched in the portion syntenic to the pea chromosome region known to harbor a locus involved in the conflict. In the plastid genomes, a substantial variability of the accD locus represented by nucleotide substitutions and indels was found to correspond to the pattern of cross-compatibility among the accessions analyzed. Amino acid substitutions in the polypeptides encoded by the alleles of a nuclear locus, designated as Bccp3, with a complementary function to accD, fitted the compatibility pattern. The accD locus in the plastid genome encoding beta subunit of the carboxyltransferase of acetyl-coA carboxylase and the nuclear locus Bccp3 encoding biotin carboxyl carrier protein of the same multi-subunit enzyme were nominated as candidate genes for main contribution to nuclear-cytoplasmic incompatibility in peas. Existence of another nuclear locus involved in the accD-mediated conflict is hypothesized.
Tao, Jian-Jun; Wei, Wei; Pan, Wen-Jia; Lu, Long; Li, Qing-Tian; Ma, Jin-Biao; Zhang, Wan-Ke; Ma, Biao; Chen, Shou-Yi; Zhang, Jin-Song
2018-02-09
Alfin-like (AL) is a small plant-specific gene family with prominent roles in root growth and abiotic stress response. Here, we aimed to identify novel stress tolerance AL genes from the stress-tolerant species Atriplex hortensis. Totally, we isolated four AhAL genes, all encoding nuclear-localized proteins with cis-element-binding and transrepression activities. Constitutive expression of AhAL1 in Arabidopsis facilitated plants to survive under saline condition, while expressing anyone of the other three AhAL genes led to salt-hypersensitive response, indicating functional divergence of AhAL family. AhAL1 also conferred enhanced drought tolerance, as judged from enhanced survival, improved growth, decreased malonaldehyde (MDA) content and reduced water loss in AhAL1-expressing plants compared to WT. In addition, abscisic acid (ABA)-mediated stomatal closure and inhibition of seed germination and primary root elongation were enhanced in AhAL1-transgenic plants. Further analysis demonstrated that AhAL1 could bind to promoter regions of GRF7, DREB1C and several group-A PP2C genes and repress their expression. Correspondingly, the expression levels of positive stress regulator genes DREB1A, DREB2A and three ABFs were all increased in AhAL1-expressing plants. Based on these results, AhAL1 was identified as a novel candidate gene for improving abiotic stress tolerance of crop plants.
DEFF Research Database (Denmark)
Druley, Todd E; Wang, Lihua; Lin, Shiow J
2016-01-01
from six pedigrees. OBFC1 (chromosome 10) is involved in telomere maintenance, and falls within a linkage peak recently reported from an analysis of telomere length in LLFS families. Two different algorithms for single gene associations identified three genes with an enrichment of variation......BACKGROUND: The Long Life Family Study (LLFS) is an international study to identify the genetic components of various healthy aging phenotypes. We hypothesized that pedigree-specific rare variants at longevity-associated genes could have a similar functional impact on healthy phenotypes. METHODS......: We performed custom hybridization capture sequencing to identify the functional variants in 464 candidate genes for longevity or the major diseases of aging in 615 pedigrees (4,953 individuals) from the LLFS, using a multiplexed, custom hybridization capture. Variants were analyzed individually...
Candidate gene investigation of spinal degenerative osteoarthritis in Greek population.
Liva, Eleni; Panagiotou, Irene; Palikyras, Spyros; Parpa, Efi; Tsilika, Eleni; Paschou, Peristera; Mystakidou, Kyriaki
2017-12-01
Few data exist concerning the natural history of degenerative osteoarthritis (OA) of the spine and its associated gene investigation. Degenerative spinal OA demonstrates an international prevalence of 15% in the general population. The aim of this Greek case-control study is to examine gene polymorphisms that have been previously shown or hypothesized to be correlated to degenerative OA. Gene polymorphisms, especially for OA, have never been previously studied in the Greek population. The study was conducted from May 2009 to December 2012. Eligible subjects who agreed to take part in the study were Greek adults from all of Greece, referred for consultation to the Palliative Care and Pain Relief Unit of Aretaieion University Hospital, in Athens, Greece. A total of 601 matched pairs (cases and controls) participated in the study, 258 patients (188 women and 70 men) with clinically and radiologically confirmed degenerative OA and 243 control subjects (138 women and 105 men). All patients presented with chronic pain at the spine (cervical, thoracic or lumbar) caused by sympomatic osteophytes or disc narrowing, whereas clinical diagnosis of OA was based on the presence of both joint symptoms and evidence of structural changes seen on plain conventional X-rays. We investigated genetic variation across candidate OA gene GDF5, CDMP1, CDMP2, Asporin, SMAD3, and chromosomal region 7q22, in a sample of 258 patients with clinically and radiologically confirmed degenerative OA, and 243 control subjects from the Greek population. All subjects (patients and controls) were subsequently matched for the epidemiologic, demographic, and clinical risk factors, to prevent selection biases. A tagging single nucleotide polymorphism (SNP) approach was pursued to cover variation across all targeted loci. Single marker tests as well as haplotypic tests of association were performed. There is no conflict of interest, and also, there are no study funding sources. We found significant
Directory of Open Access Journals (Sweden)
Faten A Taki
Full Text Available Gender and hormonal differences are often correlated with alcohol dependence and related complications like addiction and breast cancer. Estrogen (E2 is an important sex hormone because it serves as a key protein involved in organism level signaling pathways. Alcoholism has been reported to affect estrogen receptor signaling; however, identifying the players involved in such multi-faceted syndrome is complex and requires an interdisciplinary approach. In many situations, preliminary investigations included a straight forward, yet informative biotechniques such as gene expression analyses using quantitative real time PCR (qRT-PCR. The validity of qRT-PCR-based conclusions is affected by the choice of reliable internal controls. With this in mind, we compiled a list of 15 commonly used housekeeping genes (HKGs as potential reference gene candidates in rat biological models. A comprehensive comparison among 5 statistical approaches (geNorm, dCt method, NormFinder, BestKeeper, and RefFinder was performed to identify the minimal number as well the most stable reference genes required for reliable normalization in experimental rat groups that comprised sham operated (SO, ovariectomized rats in the absence (OVX or presence of E2 (OVXE2. These rat groups were subdivided into subgroups that received alcohol in liquid diet or isocalroic control liquid diet for 12 weeks. Our results showed that U87, 5S rRNA, GAPDH, and U5a were the most reliable gene candidates for reference genes in heart and brain tissue. However, different gene stability ranking was specific for each tissue input combination. The present preliminary findings highlight the variability in reference gene rankings across different experimental conditions and analytic methods and constitute a fundamental step for gene expression assays.
Wise, Alexandra; Tenezaca, Luis; Fernandez, Robert W.; Schatoff, Emma; Flores, Julian; Ueda, Atsushi; Zhong, Xiaotian; Wu, Chun-Fang; Simon, Anne F.; Venkatesh, Tadmiri
2015-01-01
Autism spectrum disorder (ASD) is a neurodevelopmental disorder in humans characterized by complex behavioral deficits, including intellectual disability, impaired social interactions and hyperactivity. ASD exhibits a strong genetic component with underlying multi-gene interactions. Candidate gene studies have shown that the neurobeachin gene is disrupted in human patients with idiopathic autism (Castermans et al., 2003). The gene for neurobeachin (NBEA) spans the common fragile site FRA 13A ...
DEFF Research Database (Denmark)
Uzarowska, Anna; Dionisio, Giuseppe; Sarholz, Barbara
2009-01-01
Background The potyviruses sugarcane mosaic virus (SCMV) and maize dwarf mosaic virus (MDMV) are major pathogens of maize worldwide. Two loci, Scmv1 and Scmv2, have ealier been shown to confer complete resistance to SCMV. Custom-made microarrays containing previously identified SCMV resistance...... the effectiveness and reliability of the combination of different expression profiling approaches for the identification and validation of candidate genes. Genes identified in this study represent possible future targets for manipulation of SCMV resistance in maize....
Fan, Xinqi; Guo, Qi; Xu, Peng; Gong, YuanYong; Shu, Hongmei; Yang, Yang; Ni, Wanchao; Zhang, Xianggui; Shen, Xinlian
2015-01-01
WRKY transcription factors are plant-specific, zinc finger-type transcription factors. The WRKY superfamily is involved in abiotic stress responses in many crops including cotton, a major fiber crop that is widely cultivated and consumed throughout the world. Salinity is an important abiotic stress that results in considerable yield losses. In this study, we identified 109 WRKY genes (GarWRKYs) in a salt-tolerant wild cotton species Gossypium aridum from transcriptome sequencing data to elucidate the roles of these factors in cotton salt tolerance. According to their structural features, the predicted members were divided into three groups (Groups I-III), as previously described for Arabidopsis. Furthermore, 28 salt-responsive GarWRKY genes were identified from digital gene expression data and subjected to real-time quantitative RT-PCR analysis. The expression patterns of most GarWRKY genes revealed by this analysis are in good agreement with those revealed by RNA-Seq analysis. RT-PCR analysis revealed that 27 GarWRKY genes were expressed in roots and one was exclusively expressed in roots. Analysis of gene orthology and motif compositions indicated that WRKY members from Arabidopsis, rice and soybean generally shared the similar motifs within the same subgroup, suggesting they have the similar function. Overexpression-GarWRKY17 and -GarWRKY104 in Arabidopsis revealed that they could positively regulate salt tolerance of transgenic Arabidopsis during different development stages. The comprehensive data generated in this study provide a platform for elucidating the functions of WRKY transcription factors in salt tolerance of G. aridum. In addition, GarWRKYs related to salt tolerance identified in this study will be potential candidates for genetic improvement of cultivated cotton salt stress tolerance.
Directory of Open Access Journals (Sweden)
Xinqi Fan
Full Text Available WRKY transcription factors are plant-specific, zinc finger-type transcription factors. The WRKY superfamily is involved in abiotic stress responses in many crops including cotton, a major fiber crop that is widely cultivated and consumed throughout the world. Salinity is an important abiotic stress that results in considerable yield losses. In this study, we identified 109 WRKY genes (GarWRKYs in a salt-tolerant wild cotton species Gossypium aridum from transcriptome sequencing data to elucidate the roles of these factors in cotton salt tolerance. According to their structural features, the predicted members were divided into three groups (Groups I-III, as previously described for Arabidopsis. Furthermore, 28 salt-responsive GarWRKY genes were identified from digital gene expression data and subjected to real-time quantitative RT-PCR analysis. The expression patterns of most GarWRKY genes revealed by this analysis are in good agreement with those revealed by RNA-Seq analysis. RT-PCR analysis revealed that 27 GarWRKY genes were expressed in roots and one was exclusively expressed in roots. Analysis of gene orthology and motif compositions indicated that WRKY members from Arabidopsis, rice and soybean generally shared the similar motifs within the same subgroup, suggesting they have the similar function. Overexpression-GarWRKY17 and -GarWRKY104 in Arabidopsis revealed that they could positively regulate salt tolerance of transgenic Arabidopsis during different development stages. The comprehensive data generated in this study provide a platform for elucidating the functions of WRKY transcription factors in salt tolerance of G. aridum. In addition, GarWRKYs related to salt tolerance identified in this study will be potential candidates for genetic improvement of cultivated cotton salt stress tolerance.
Directory of Open Access Journals (Sweden)
Shinozuka Hiroshi
2012-11-01
Full Text Available Abstract Background In crop species, QTL analysis is commonly used for identification of factors contributing to variation of agronomically important traits. As an important pasture species, a large number of QTLs have been reported for perennial ryegrass based on analysis of biparental mapping populations. Further characterisation of those QTLs is, however, essential for utilisation in varietal improvement programs. Results A bibliographic survey of perennial ryegrass trait-dissection studies identified a total of 560 QTLs from previously published papers, of which 189, 270 and 101 were classified as morphology-, physiology- and resistance/tolerance-related loci, respectively. The collected dataset permitted a subsequent meta-QTL study and implementation of a cross-species candidate gene identification approach. A meta-QTL analysis based on use of the BioMercator software was performed to identify two consensus regions for pathogen resistance traits. Genes that are candidates for causal polymorphism underpinning perennial ryegrass QTLs were identified through in silico comparative mapping using rice databases, and 7 genes were assigned to the p150/112 reference map. Markers linked to the LpDGL1, LpPh1 and LpPIPK1 genes were located close to plant size, leaf extension time and heading date-related QTLs, respectively, suggesting that these genes may be functionally associated with important agronomic traits in perennial ryegrass. Conclusions Functional markers are valuable for QTL meta-analysis and comparative genomics. Enrichment of such genetic markers may permit further detailed characterisation of QTLs. The outcomes of QTL meta-analysis and comparative genomics studies may be useful for accelerated development of novel perennial ryegrass cultivars with desirable traits.
Directory of Open Access Journals (Sweden)
Govindarajan Gowthaman
2010-11-01
Full Text Available Abstract Background Diabetic retinopathy (DR is classically defined as a microvasculopathy that primarily affects the small blood vessels of the inner retina as a complication of diabetes mellitus (DM.It is a multifactorial disease with a strong genetic component. The aim of this study is to investigate the association of a set of nine candidate genes with the development of diabetic retinopathy in a South Indian cohort who have type 2 diabetes mellitus (T2DM. Methods Seven candidate genes (RAGE, PEDF, AKR1B1, EPO, HTRA1, ICAM and HFE were chosen based on reported association with DR in the literature. Two more, CFH and ARMS2, were chosen based on their roles in biological pathways previously implicated in DR. Fourteen single nucleotide polymorphisms (SNPs and one dinucleotide repeat polymorphism, previously reported to show association with DR or other related diseases, were genotyped in 345 DR and 356 diabetic patients without retinopathy (DNR. The genes which showed positive association in this screening set were tested further in additional sets of 100 DR and 90 DNR additional patients from the Aravind Eye Hospital. Those which showed association in the secondary screen were subjected to a combined analysis with the 100 DR and 100 DNR subjects previously recruited and genotyped through the Sankara Nethralaya Hospital, India. Genotypes were evaluated using a combination of direct sequencing, TaqMan SNP genotyping, RFLP analysis, and SNaPshot PCR assays. Chi-square and Fisher exact tests were used to analyze the genotype and allele frequencies. Results Among the nine loci (15 polymorphisms screened, SNP rs2070600 (G82S in the RAGE gene, showed significant association with DR (allelic P = 0.016, dominant model P = 0.012, compared to DNR. SNP rs2070600 further showed significant association with DR in the confirmation cohort (P = 0.035, dominant model P = 0.032. Combining the two cohorts gave an allelic P HTRA1, rs11200638 (G>A, showed marginal
Directory of Open Access Journals (Sweden)
Daniel Boloc
Full Text Available Retinitis pigmentosa (RP is a highly heterogeneous genetic visual disorder with more than 70 known causative genes, some of them shared with other non-syndromic retinal dystrophies (e.g. Leber congenital amaurosis, LCA. The identification of RP genes has increased steadily during the last decade, and the 30% of the cases that still remain unassigned will soon decrease after the advent of exome/genome sequencing. A considerable amount of genetic and functional data on single RD genes and mutations has been gathered, but a comprehensive view of the RP genes and their interacting partners is still very fragmentary. This is the main gap that needs to be filled in order to understand how mutations relate to progressive blinding disorders and devise effective therapies.We have built an RP-specific network (RPGeNet by merging data from different sources: high-throughput data from BioGRID and STRING databases, manually curated data for interactions retrieved from iHOP, as well as interactions filtered out by syntactical parsing from up-to-date abstracts and full-text papers related to the RP research field. The paths emerging when known RP genes were used as baits over the whole interactome have been analysed, and the minimal number of connections among the RP genes and their close neighbors were distilled in order to simplify the search space.In contrast to the analysis of single isolated genes, finding the networks linking disease genes renders powerful etiopathological insights. We here provide an interactive interface, RPGeNet, for the molecular biologist to explore the network centered on the non-syndromic and syndromic RP and LCA causative genes. By integrating tissue-specific expression levels and phenotypic data on top of that network, a more comprehensive biological view will highlight key molecular players of retinal degeneration and unveil new RP disease candidates.
Directory of Open Access Journals (Sweden)
Dingfeng Wang
Full Text Available Isaria cateniannulata is a very important and virulent entomopathogenic fungus that infects many insect pest species. Although I. cateniannulata is commonly exposed to extreme environmental temperature conditions, little is known about its molecular response mechanism to temperature stress. Here, we sequenced and de novo assembled the transcriptome of I. cateniannulata in response to high and low temperature stresses using Illumina RNA-Seq technology. Our assembly encompassed 17,514 unigenes (mean length = 1,197 bp, in which 11,445 unigenes (65.34% showed significant similarities to known sequences in NCBI non-redundant protein sequences (Nr database. Using digital gene expression analysis, 4,483 differentially expressed genes (DEGs were identified after heat treatment, including 2,905 up-regulated genes and 1,578 down-regulated genes. Under cold stress, 1,927 DEGs were identified, including 1,245 up-regulated genes and 682 down-regulated genes. The expression patterns of 18 randomly selected candidate DEGs resulting from quantitative real-time PCR (qRT-PCR were consistent with their transcriptome analysis results. Although DEGs were involved in many pathways, we focused on the genes that were involved in endocytosis: In heat stress, the pathway of clathrin-dependent endocytosis (CDE was active; however at low temperature stresses, the pathway of clathrin-independent endocytosis (CIE was active. Besides, four categories of DEGs acting as temperature sensors were observed, including cell-wall-major-components-metabolism-related (CWMCMR genes, heat shock protein (Hsp genes, intracellular-compatible-solutes-metabolism-related (ICSMR genes and glutathione S-transferase (GST. These results enhance our understanding of the molecular mechanisms of I. cateniannulata in response to temperature stresses and provide a valuable resource for the future investigations.
Kim, Seon-Hee; Bae, Young-An; Seoh, Ju-Young; Yang, Hyun-Jong
2017-06-01
Malaria is an infectious disease affecting humans, which is transmitted by the bite of Anopheles mosquitoes harboring sporozoites of parasitic protozoans belonging to the genus Plasmodium . Despite past achievements to control the protozoan disease, malaria still remains a significant health threat up to now. In this study, we cloned and characterized the full-unit Plasmodium yoelii genes encoding merozoite surface protein 1 (MSP1), circumsporozoite protein (CSP), and Duffy-binding protein (DBP), each of which can be applied for investigations to obtain potent protective vaccines in the rodent malaria model, due to their specific expression patterns during the parasite life cycle. Recombinant fragments corresponding to the middle and C-terminal regions of PyMSP1 and PyCSP, respectively, displayed strong reactivity against P. yoelii -infected mice sera. Specific native antigens invoking strong humoral immune response during the primary and secondary infections of P. yoelii were also abundantly detected in experimental ICR mice. The low or negligible parasitemia observed in the secondary infected mice was likely to result from the neutralizing action of the protective antibodies. Identification of these antigenic proteins might provide the necessary information and means to characterize additional vaccine candidate antigens, selected solely on their ability to produce the protective antibodies.
Are TMEM genes potential candidate genes for panic disorder?
DEFF Research Database (Denmark)
NO, Gregersen; Buttenschøn, Henriette Nørmølle; Hedemand, Anne
2014-01-01
We analysed single nucleotide polymorphisms in two transmembrane genes (TMEM98 and TMEM132E) in panic disorder (PD) patients and control individuals from the Faroe Islands, Denmark and Germany. The genes encode single-pass membrane proteins and are located within chromosome 17q11.2-q12...
Emmanuel, Catherine; Gava, Natalie; Kennedy, Catherine; Balleine, Rosemary L.; Sharma, Raghwa; Wain, Gerard; Brand, Alison; Hogg, Russell; Etemadmoghadam, Dariush; George, Joshy; Birrer, Michael J.; Clarke, Christine L.; Chenevix-Trench, Georgia; Bowtell, David D. L.; Harnett, Paul R.; deFazio, Anna
2011-01-01
Molecular events leading to epithelial ovarian cancer are poorly understood but ovulatory hormones and a high number of life-time ovulations with concomitant proliferation, apoptosis, and inflammation, increases risk. We identified genes that are regulated during the estrous cycle in murine ovarian surface epithelium and analysed these profiles to identify genes dysregulated in human ovarian cancer, using publically available datasets. We identified 338 genes that are regulated in murine ovarian surface epithelium during the estrous cycle and dysregulated in ovarian cancer. Six of seven candidates selected for immunohistochemical validation were expressed in serous ovarian cancer, inclusion cysts, ovarian surface epithelium and in fallopian tube epithelium. Most were overexpressed in ovarian cancer compared with ovarian surface epithelium and/or inclusion cysts (EpCAM, EZH2, BIRC5) although BIRC5 and EZH2 were expressed as highly in fallopian tube epithelium as in ovarian cancer. We prioritised the 338 genes for those likely to be important for ovarian cancer development by in silico analyses of copy number aberration and mutation using publically available datasets and identified genes with established roles in ovarian cancer as well as novel genes for which we have evidence for involvement in ovarian cancer. Chromosome segregation emerged as an important process in which genes from our list of 338 were over-represented including two (BUB1, NCAPD2) for which there is evidence of amplification and mutation. NUAK2, upregulated in ovarian surface epithelium in proestrus and predicted to have a driver mutation in ovarian cancer, was examined in a larger cohort of serous ovarian cancer where patients with lower NUAK2 expression had shorter overall survival. In conclusion, defining genes that are activated in normal epithelium in the course of ovulation that are also dysregulated in cancer has identified a number of pathways and novel candidate genes that may contribute
2014-01-01
Background The cultivated bread wheat (Triticum aestivum L.) possesses unique flour quality, which can be processed into many end-use food products such as bread, pasta, chapatti (unleavened flat bread), biscuit, etc. The present wheat varieties require improvement in processing quality to meet the increasing demand of better quality food products. However, processing quality is very complex and controlled by many genes, which have not been completely explored. To identify the candidate genes whose expressions changed due to variation in processing quality and interaction (quality x development), genome-wide transcriptome studies were performed in two sets of diverse Indian wheat varieties differing for chapatti quality. It is also important to understand the temporal and spatial distributions of their expressions for designing tissue and growth specific functional genomics experiments. Results Gene-specific two-way ANOVA analysis of expression of about 55 K transcripts in two diverse sets of Indian wheat varieties for chapatti quality at three seed developmental stages identified 236 differentially expressed probe sets (10-fold). Out of 236, 110 probe sets were identified for chapatti quality. Many processing quality related key genes such as glutenin and gliadins, puroindolines, grain softness protein, alpha and beta amylases, proteases, were identified, and many other candidate genes related to cellular and molecular functions were also identified. The ANOVA analysis revealed that the expression of 56 of 110 probe sets was involved in interaction (quality x development). Majority of the probe sets showed differential expression at early stage of seed development i.e. temporal expression. Meta-analysis revealed that the majority of the genes expressed in one or a few growth stages indicating spatial distribution of their expressions. The differential expressions of a few candidate genes such as pre-alpha/beta-gliadin and gamma gliadin were validated by RT
Singh, Anuradha; Mantri, Shrikant; Sharma, Monica; Chaudhury, Ashok; Tuli, Rakesh; Roy, Joy
2014-01-16
The cultivated bread wheat (Triticum aestivum L.) possesses unique flour quality, which can be processed into many end-use food products such as bread, pasta, chapatti (unleavened flat bread), biscuit, etc. The present wheat varieties require improvement in processing quality to meet the increasing demand of better quality food products. However, processing quality is very complex and controlled by many genes, which have not been completely explored. To identify the candidate genes whose expressions changed due to variation in processing quality and interaction (quality x development), genome-wide transcriptome studies were performed in two sets of diverse Indian wheat varieties differing for chapatti quality. It is also important to understand the temporal and spatial distributions of their expressions for designing tissue and growth specific functional genomics experiments. Gene-specific two-way ANOVA analysis of expression of about 55 K transcripts in two diverse sets of Indian wheat varieties for chapatti quality at three seed developmental stages identified 236 differentially expressed probe sets (10-fold). Out of 236, 110 probe sets were identified for chapatti quality. Many processing quality related key genes such as glutenin and gliadins, puroindolines, grain softness protein, alpha and beta amylases, proteases, were identified, and many other candidate genes related to cellular and molecular functions were also identified. The ANOVA analysis revealed that the expression of 56 of 110 probe sets was involved in interaction (quality x development). Majority of the probe sets showed differential expression at early stage of seed development i.e. temporal expression. Meta-analysis revealed that the majority of the genes expressed in one or a few growth stages indicating spatial distribution of their expressions. The differential expressions of a few candidate genes such as pre-alpha/beta-gliadin and gamma gliadin were validated by RT-PCR. Therefore, this study
Xiao, Zhiliang; Hu, Yang; Zhang, Xiaoli; Xue, Yuqian; Fang, Zhiyuan; Yang, Limei; Zhang, Yangyong; Liu, Yumei; Li, Zhansheng; Liu, Xing; Liu, Zezhou; Lv, Honghao; Zhuang, Mu
2017-06-05
Hybrid lethality is a deleterious phenotype that is vital to species evolution. We previously reported hybrid lethality in cabbage ( Brassica oleracea ) and performed preliminary mapping of related genes. In the present study, the fine mapping of hybrid lethal genes revealed that BoHL1 was located on chromosome C1 between BoHLTO124 and BoHLTO130, with an interval of 101 kb. BoHL2 was confirmed to be between insertion-deletion (InDels) markers HL234 and HL235 on C4, with a marker interval of 70 kb. Twenty-eight and nine annotated genes were found within the two intervals of BoHL1 and BoHL2 , respectively. We also applied RNA-Seq to analyze hybrid lethality in cabbage. In the region of BoHL1 , seven differentially expressed genes (DEGs) and five resistance (R)-related genes (two in common, i.e., Bo1g153320 and Bo1g153380 ) were found, whereas in the region of BoHL2 , two DEGs and four R-related genes (two in common, i.e., Bo4g173780 and Bo4g173810 ) were found. Along with studies in which R genes were frequently involved in hybrid lethality in other plants, these interesting R-DEGs may be good candidates associated with hybrid lethality. We also used SNP/InDel analyses and quantitative real-time PCR to confirm the results. This work provides new insight into the mechanisms of hybrid lethality in cabbage.
Kouzai, Yusuke; Kimura, Mamiko; Yamanaka, Yurie; Watanabe, Megumi; Matsui, Hidenori; Yamamoto, Mikihiro; Ichinose, Yuki; Toyoda, Kazuhiro; Onda, Yoshihiko; Mochida, Keiichi; Noutoshi, Yoshiteru
2016-03-02
Brachypodium distachyon is a promising model plants for grasses. Infections of Brachypodium by various pathogens that severely impair crop production have been reported, and the species accordingly provides an alternative platform for investigating molecular mechanisms of pathogen virulence and plant disease resistance. To date, we have a broad picture of plant immunity only in Arabidopsis and rice; therefore, Brachypodium may constitute a counterpart that displays the commonality and uniqueness of defence systems among plant species. Phytohormones play key roles in plant biotic stress responses, and hormone-responsive genes are used to qualitatively and quantitatively evaluate disease resistance responses during pathogen infection. For these purposes, defence-related phytohormone marker genes expressed at time points suitable for defence-response monitoring are needed. Information about their expression profiles over time as well as their response specificity is also helpful. However, useful marker genes are still rare in Brachypodium. We selected 34 candidates for Brachypodium marker genes on the basis of protein-sequence similarity to known marker genes used in Arabidopsis and rice. Brachypodium plants were treated with the defence-related phytohormones salicylic acid, jasmonic acid and ethylene, and their transcription levels were measured 24 and 48 h after treatment. Two genes for salicylic acid, 7 for jasmonic acid and 2 for ethylene were significantly induced at either or both time points. We then focused on 11 genes encoding pathogenesis-related (PR) 1 protein and compared their expression patterns with those of Arabidopsis and rice. Phylogenetic analysis suggested that Brachypodium contains several PR1-family genes similar to rice genes. Our expression profiling revealed that regulation patterns of some PR1 genes as well as of markers identified for defence-related phytohormones are closely related to those in rice. We propose that the Brachypodium immune
Liu, P N; Miao, H; Lu, H W; Cui, J Y; Tian, G L; Wehner, T C; Gu, X F; Zhang, S P
2017-08-31
Powdery mildew (PM) of cucumber (Cucumis sativus), caused by Podosphaera xanthii, is a major foliar disease worldwide and resistance is one of the main objectives in cucumber breeding programs. The resistance to PM in cucumber stem is important to the resistance for the whole plant. In this study, genetic analysis and gene mapping were implemented with cucumber inbred lines NCG-122 (with resistance to PM in the stem) and NCG-121 (with susceptibility in the stem). Genetic analysis showed that resistance to PM in the stem of NCG-122 was qualitative and controlled by a single-recessive nuclear gene (pm-s). Susceptibility was dominant to resistance. In the initial genetic mapping of the pm-s gene, 10 SSR markers were discovered to be linked to pm-s, which was mapped to chromosome 5 (Chr.5) of cucumber. The pm-s gene's closest flanking markers were SSR20486 and SSR06184/SSR13237 with genetic distances of 0.9 and 1.8 cM, respectively. One hundred and fifty-seven pairs of new SSR primers were exploited by the sequence information in the initial mapping region of pm-s. The analysis on the F 2 mapping population using the new molecular markers showed that 17 SSR markers were confirmed to be linked to the pm-s gene. The two closest flanking markers, pmSSR27and pmSSR17, were 0.1 and 0.7 cM from pm-s, respectively, confirming the location of this gene on Chr.5. The physical length of the genomic region containing pm-s was 135.7 kb harboring 21 predicted genes. Among these genes, the gene Csa5G623470 annotated as encoding Mlo-related protein was defined as the most probable candidate gene for the pm-s. The results of this study will provide a basis for marker-assisted selection, and make the benefit for the cloning of the resistance gene.
A candidate-gene association study for berry colour and anthocyanin content in Vitis vinifera L.
Directory of Open Access Journals (Sweden)
Silvana Cardoso
Full Text Available Anthocyanin content is a trait of major interest in Vitis vinifera L. These compounds affect grape and wine quality, and have beneficial effects on human health. A candidate-gene approach was used to identify genetic variants associated with anthocyanin content in grape berries. A total of 445 polymorphisms were identified in 5 genes encoding transcription factors and 10 genes involved in either the biosynthetic pathway or transport of anthocyanins. A total of 124 SNPs were selected to examine association with a wide range of phenotypes based on RP-HPLC analysis and visual characterization. The phenotypes were total skin anthocyanin (TSA concentration but also specific types of anthocyanins and relative abundance. The visual assessment was based on OIV (Organisation Internationale de la Vigne et du Vin descriptors for berry and skin colour. The genes encoding the transcription factors MYB11, MYBCC and MYC(B were significantly associated with TSA concentration. UFGT and MRP were associated with several different types of anthocyanins. Skin and pulp colour were associated with nine genes (MYB11, MYBCC, MYC(B, UFGT, MRP, DFR, LDOX, CHI and GST. Pulp colour was associated with a similar group of 11 genes (MYB11, MYBCC, MYC(B, MYC(A, UFGT, MRP, GST, DFR, LDOX, CHI and CHS(A. Statistical interactions were observed between SNPs within the transcription factors MYB11, MYBCC and MYC(B. SNPs within LDOX interacted with MYB11 and MYC(B, while SNPs within CHI interacted with MYB11 only. Together, these findings suggest the involvement of these genes in anthocyanin content and on the regulation of anthocyanin biosynthesis. This work forms a benchmark for replication and functional studies.
Directory of Open Access Journals (Sweden)
Fabyano Fonseca e Silva
Full Text Available ABSTRACT: Genome association analyses have been successful in identifying quantitative trait loci (QTLs for pig body weights measured at a single age. However, when considering the whole weight trajectories over time in the context of genome association analyses, it is important to look at the markers that affect growth curve parameters. The easiest way to consider them is via the two-step method, in which the growth curve parameters and marker effects are estimated separately, thereby resulting in a reduction of the statistical power and the precision of estimates. One efficient solution is to adopt nonlinear mixed models (NMM, which enables a joint modeling of the individual growth curves and marker effects. Our aim was to propose a genome association analysis for growth curves in pigs based on NMM as well as to compare it with the traditional two-step method. In addition, we also aimed to identify the nearest candidate genes related to significant SNP (single nucleotide polymorphism markers. The NMM presented a higher number of significant SNPs for adult weight (A and maturity rate (K, and provided a direct way to test SNP significance simultaneously for both the A and K parameters. Furthermore, all significant SNPs from the two-step method were also reported in the NMM analysis. The ontology of the three candidate genes (SH3BGRL2, MAPK14, and MYL9 derived from significant SNPs (simultaneously affecting A and K allows us to make inferences with regards to their contribution to the pig growth process in the population studied.
Development of a radiation-responsive gene expression system
International Nuclear Information System (INIS)
Ogawa, Ryohei; Morii, Akihiro; Watanabe, Akihiko
2013-01-01
We have obtained a promoter enhancing expression of a gene of our interest connected downstream after activation in response to radiation stimulation and it could be used in radiogenetic therapy, a combination between radiotherapy and gene therapy. The promoter has been chosen out of a library of DNA fragments constructed by connecting the TATA box to randomly combined binding sequences of transcription factors that are activated in response to radiation. Although it was shown that the promoter activation was cell type specific, it turned out that radiation responsive promoters could be obtained for a different type of cells by using another set of transcription factor binding sequences, suggesting that the method would be feasible to obtain promoters functioning in any type of cells. Radiation reactivity of obtained promoters could be improved by techniques such as random introduction of point mutations. The improved promoters significantly enhanced expression of the luciferase gene connected downstream in response to radiation even in vivo, in addition, a gene cassette composed of one such promoter and the fcy::fur gene was confirmed useful for suicide gene therapy as shown in vitro simulation experiment, suggesting possible clinical application. (author)
Evaluation of Lethal Giant Larvae as a Schistosomiasis Vaccine Candidate
Directory of Open Access Journals (Sweden)
Yufan Cao
2016-01-01
Full Text Available Schistosomiasis is a neglected tropical disease of humans, and it is considered to be the second most devastating parasitic disease after malaria. Eggs produced by normally developed female worms are important in the transmission of the parasite, and they responsible for the pathogenesis of schistosomiasis. The tumor suppressor gene lethal giant larvae (lgl has an essential function in establishing apical-basal cell polarity, cell proliferation, differentiation, and tissue organization. In our earlier study, downregulation of the lgl gene induced a significant reduction in the egg hatching rate of Schistosoma japonicum (Sj eggs. In this study, the Sjlgl gene was used as a vaccine candidate against schistosomiasis, and vaccination achieved and maintained a stable reduction of the egg hatching rate, which is consistent with previous studies, in addition to reducing the worm burden and liver egg burden in some trials.
High-density polymorphisms analysis of 23 candidate genes for association with bone mineral density.
Giroux, Sylvie; Elfassihi, Latifa; Clément, Valérie; Bussières, Johanne; Bureau, Alexandre; Cole, David E C; Rousseau, François
2010-11-01
Osteoporosis is a bone disease characterized by low bone mineral density (BMD), a highly heritable and polygenic trait. Women are more prone than men to develop osteoporosis due to a lower peak bone mass and accelerated bone loss at menopause. Peak bone mass has been convincingly shown to be due to genetic factors with heritability up to 80%. Menopausal bone loss has been shown to have around 38% to 49% heritability depending on the site studied. To have more statistical power to detect small genetic effects we focused on premenopausal women. We studied 23 candidate genes, some involved in calcium and vitamin-D regulation and others because estrogens strongly induced their gene expression in mice where it was correlated with humerus trabecular bone density. High-density polymorphisms were selected to cover the entire gene variability and 231 polymorphisms were genotyped in a first sample of 709 premenopausal women. Positive associations were retested in a second, independent, sample of 673 premenopausal women. Ten polymorphisms remained associated with BMD in the combined samples and one was further associated in a large sample of postmenopausal women (1401 women). This associated polymorphism was located in the gene CSF3R (granulocyte colony stimulating factor receptor) that had never been associated with BMD before. The results reported in this study suggest a role for CSF3R in the determination of bone density in women. Copyright © 2010 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Wan Hongjian
2010-08-01
Full Text Available Abstract Background Due to the variation and mutation of the races of Pseudoperonospora cubensis, downy mildew has in recent years become the most devastating leaf disease of cucumber worldwide. Novel resistance to downy mildew has been identified in the wild Cucumis species, C. hystrix Chakr. After the successful hybridization between C. hystrix and cultivated cucumber (C. sativus L., an introgression line (IL5211S was identified as highly resistant to downy mildew. Nucleotide-binding site and leucine-rich repeat (NBS-LRR genes are the largest class of disease resistance genes cloned from plant with highly conserved domains, which can be used to facilitate the isolation of candidate genes associated with downy mildew resistance in IL5211S. Results Degenerate primers that were designed based on the conserved motifs in the NBS domain of resistance (R proteins were used to isolate NBS-type sequences from IL5211S. A total of 28 sequences were identified and named as cucumber (C. sativus = CS resistance gene analogs as CSRGAs. Polygenetic analyses separated these sequences into four different classes. Quantitative real-time polymerase chain reaction (qRT-PCR analysis showed that these CSRGAs expressed at different levels in leaves, roots, and stems. In addition, introgression from C. hystrix induced expression of the partial CSRGAs in cultivated cucumber, especially CSRGA23, increased four-fold when compared to the backcross parent CC3. Furthermore, the expression of CSRGA23 under P. cubensis infection and abiotic stresses was also analyzed at different time points. Results showed that the P. cubensis treatment and four tested abiotic stimuli, MeJA, SA, ABA, and H2O2, triggered a significant induction of CSRGA23 within 72 h of inoculation. The results indicate that CSRGA23 may play a critical role in protecting cucumber against P. cubensis through a signaling the pathway triggered by these molecules. Conclusions Four classes of NBS-type RGAs were
Directory of Open Access Journals (Sweden)
Minghui Zheng
Full Text Available One of the reasons for the progressive yield decline observed in cereals production is the rapid build-up of populations of the cereal cyst nematode (CCN, Heterodera avenae. These nematodes secrete so-call effectors into their host plant to suppress the plant defense responses, alter plant signaling pathways and then induce the formation of syncytium after infection. However, little is known about its molecular mechanism and parasitism during incompatible infection. To gain insight into its repertoire of parasitism genes, we investigated the transcriptome of the early parasitic second-stage (30 hours, 3 days and 9 days post infection juveniles of the CCN as well as the CCN infected tissue of the host Aegilops variabilis by Illumina sequencing. Among all assembled unigenes, 681 putative genes of parasitic nematode were found, in which 56 putative effectors were identified, including novel pioneer genes and genes corresponding to previously reported effectors. All the 681 CCN unigenes were mapped to 229 GO terms and 200 KEGG pathways, including growth, development and several stimulus-related signaling pathways. Sixteen clusters were involved in the CCN unigene expression atlas at the early stages during infection process, and three of which were significantly gene-enriched. Besides, the protein-protein interaction network analysis revealed 35 node unigenes which may play an important role in the plant-CCN interaction. Moreover, in a comparison of differentially expressed genes between the pre-parasitic juveniles and the early parasitic juveniles, we found that hydrolase activity was up-regulated in pre J2s whereas binding activity was upregulated in infective J2s. RT-qPCR analysis on some selected genes showed detectable expression, indicating possible secretion of the proteins and putative role in infection. This study provided better insights into the incompatible interaction between H. avenae and the host plant Ae. varabilis. Moreover, RNAi
Listeria arpJ gene modifies T helper type 2 subset differentiation.
Kanoh, Makoto; Maruyama, Saho; Shen, Hua; Matsumoto, Akira; Shinomiya, Hiroto; Przybilla, Karin; Gouin, Edith; Cossart, Pascale; Goebel, Werner; Asano, Yoshihiro
2015-07-15
Although the T-cell subset differentiation pathway has been characterized extensively from the view of host gene regulation, the effects of genes of the pathogen on T-cell subset differentiation during infection have yet to be elucidated. Especially, the bacterial genes that are responsible for this shift have not yet been determined. Utilizing a single-gene-mutation Listeria panel, we investigated genes involved in the host-pathogen interaction that are required for the initiation of T-cell subset differentiation in the early phase of pathogen infection. We demonstrate that the induction of T helper types 1 and 2 (Th1 and Th2) subsets are separate phenomena and are mediated by distinct Listeria genes. We identified several candidate Listeria genes that appear to be involved in the host-Listeria interaction. Among them, arpJ is the strongest candidate gene for inhibiting Th2 subset induction. Furthermore, the analysis utilizing arpJ-deficient Listeria monocytogenes (Lm) revealed that the tumor necrosis factor (TNF) superfamily (Tnfsf) 9-TNF receptor superfamily (Tnfrsf) 9 interaction inhibits the Th2 response during Lm infection. arpJ is the candidate gene for inhibiting Th2 T-cell subset induction. The arpJ gene product influences the expression of Tnfsf/Tnfrsf on antigen-presenting cells and inhibits the Th2 T-cell subset differentiation during Listeria infection. © The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Sarzynski, M A; Rankinen, T; Sternfeld, B; Fornage, M; Sidney, S; Bouchard, C
2011-08-01
The association of single nucleotide polymorphisms (SNPs) from seven candidate genes, including genotype-by-baseline fitness and genotype-by-baseline body mass index (BMI) interactions, with incident hypertension over 20 years was investigated in 2663 participants (1301 blacks, 1362 whites) of the Coronary Artery Risk Development in Young Adults Study (CARDIA). Baseline cardiorespiratory fitness was determined from duration of a modified Balke treadmill test. A total of 98 SNPs in blacks and 89 SNPs in whites from seven candidate genes were genotyped. Participants that became hypertensive (295 blacks and 146 whites) had significantly higher blood pressure and BMI (both races), and lower fitness (blacks only) at baseline than those who remained normotensive. Markers at the peroxisome proliferative activated receptor gamma coactivator 1α (PPARGC1A) and bradykinin β2 receptor (BDKRB2) genes were nominally associated with greater risk of hypertension, although one marker each at the BDKRB2 and endothelial nitric oxide synthase-3 (NOS3) genes were nominally associated with lower risk. The association of baseline fitness with risk of hypertension was nominally modified by genotype at markers within the angiotensin converting enzyme, angiotensinogen, BDKRB2 and NOS3 genes in blacks and the BDKRB2, endothelin-1 and PPARGC1A genes in whites. BDKRB2 rs4900318 showed nominal interactions with baseline fitness on the risk of hypertension in both races. The association of baseline BMI with risk of hypertension was nominally modified by GNB3 rs2301339 genotype in whites. None of the above associations were statistically significant after correcting for multiple testing. We found that SNPs in these candidate genes did not modify the association between baseline fitness or BMI and risk of hypertension in CARDIA participants.
Effects of bovine prolactin gene polymorphism within exon 4 on milk ...
African Journals Online (AJOL)
STORAGESEVER
2009-10-05
Oct 5, 2009 ... In this study, polymorphism of prolactin gene was analyzed as a candidate gene responsible for ... studied. Based on important role of prolactin gene in milk related traits and their genetic trends in dairy cattle, the aims of this study were, to screen ..... isolation and selection towards high fat and protein per-.
Energy Technology Data Exchange (ETDEWEB)
Sunden, S.L.F.; Nichols, B.E.; Alward, W.L.M. [Univ. of Iowa, Iowa City, IA (United States)] [and others
1994-09-01
Juvenile onset primary open angle glaucoma has been mapped by linkage to 1q21-q31. Several candidate genes were evaluated in the same family used to identify the primary linkage. Atrionatriuretic peptide receptor A (NPR1) and laminin C1 (LAMC1) have been previously mapped to this region and could putatively play a role in the pathogenesis of glaucoma. A third gene, the peripheral cannabis receptor (CNR2) was not initially mapped in humans but was a candidate because of the relief that cannabis affords some patients with primary open angle glaucoma. Microsatellites associated with NPR1 and LAMC1 revealed multiple recombinations in affected members of this pedigree. CNR2 was shown to be on chromosome 1 by PCR amplification of a 150 bp fragment of the 3{prime} untranslated region in monochromosomal somatic cell hybrids (NIGMS panel No. 2). These primers also revealed a two allele single strand conformation polymorphism which showed multiple recombinants with juvenile onset primary open angle glaucoma in large pedigrees, segregating this disorder. The marker was then mapped to 1p34-p36 by linkage, with the most likely location between liver alkaline phosphatase (ALPL) and alpha-L-1 fucosidase (FUCA1).
Characterization of Genes for Beef Marbling Based on Applying Gene Coexpression Network
Directory of Open Access Journals (Sweden)
Dajeong Lim
2014-01-01
Full Text Available Marbling is an important trait in characterization beef quality and a major factor for determining the price of beef in the Korean beef market. In particular, marbling is a complex trait and needs a system-level approach for identifying candidate genes related to the trait. To find the candidate gene associated with marbling, we used a weighted gene coexpression network analysis from the expression value of bovine genes. Hub genes were identified; they were topologically centered with large degree and BC values in the global network. We performed gene expression analysis to detect candidate genes in M. longissimus with divergent marbling phenotype (marbling scores 2 to 7 using qRT-PCR. The results demonstrate that transmembrane protein 60 (TMEM60 and dihydropyrimidine dehydrogenase (DPYD are associated with increasing marbling fat. We suggest that the network-based approach in livestock may be an important method for analyzing the complex effects of candidate genes associated with complex traits like marbling or tenderness.
Identification and characterization of nuclear genes involved in photosynthesis in Populus
2014-01-01
Background The gap between the real and potential photosynthetic rate under field conditions suggests that photosynthesis could potentially be improved. Nuclear genes provide possible targets for improving photosynthetic efficiency. Hence, genome-wide identification and characterization of the nuclear genes affecting photosynthetic traits in woody plants would provide key insights on genetic regulation of photosynthesis and identify candidate processes for improvement of photosynthesis. Results Using microarray and bulked segregant analysis strategies, we identified differentially expressed nuclear genes for photosynthesis traits in a segregating population of poplar. We identified 515 differentially expressed genes in this population (FC ≥ 2 or FC ≤ 0.5, P photosynthesis by the nuclear genome mainly involves transport, metabolism and response to stimulus functions. Conclusions This study provides new genome-scale strategies for the discovery of potential candidate genes affecting photosynthesis in Populus, and for identification of the functions of genes involved in regulation of photosynthesis. This work also suggests that improving photosynthetic efficiency under field conditions will require the consideration of multiple factors, such as stress responses. PMID:24673936
Li, Bojiang; Dong, Chao; Li, Pinghua; Ren, Zhuqing; Wang, Han; Yu, Fengxiang; Ning, Caibo; Liu, Kaiqing; Wei, Wei; Huang, Ruihua; Chen, Jie; Wu, Wangjun; Liu, Honglin
2016-10-17
Meat color is considered to be the most important indicator of meat quality, however, the molecular mechanisms underlying traits related to meat color remain mostly unknown. In this study, to elucidate the molecular basis of meat color, we constructed six cDNA libraries from biceps femoris (Bf) and soleus (Sol), which exhibit obvious differences in meat color, and analyzed the whole-transcriptome differences between Bf (white muscle) and Sol (red muscle) using high-throughput sequencing technology. Using DEseq2 method, we identified 138 differentially expressed genes (DEGs) between Bf and Sol. Using DEGseq method, we identified 770, 810, and 476 DEGs in comparisons between Bf and Sol in three separate animals. Of these DEGs, 52 were overlapping DEGs. Using these data, we determined the enriched GO terms, metabolic pathways and candidate genes associated with meat color traits. Additionally, we mapped 114 non-redundant DEGs to the meat color QTLs via a comparative analysis with the porcine quantitative trait loci (QTL) database. Overall, our data serve as a valuable resource for identifying genes whose functions are critical for meat color traits and can accelerate studies of the molecular mechanisms of meat color formation.
Danesh Mesgaran, Sadjad; Sharbati, Jutta; Einspanier, Ralf; Gabler, Christoph
2016-08-15
The mammalian oviduct provides the optimal environment for gamete maturation including sperm capacitation, fertilization, and development of the early embryo. Various cell culture models for primary bovine oviductal epithelial cells (BOEC) were established to reveal such physiological events. The aim of this study was to evaluate 17 candidate mRNA expression patterns in oviductal epithelial cells (1) in transition from in vivo cells to in vitro cells; (2) during three consecutive cell culture passages; (3) affected by the impact of LOW or HIGH glucose content media; and (4) influenced by different phases of the estrous cycle in vivo and in vitro. In addition, the release of a metabolite and proteins from BOEC at two distinct cell culture passage numbers was estimated to monitor the functionality. BOEC from 8 animals were isolated and cultured for three consecutive passages. Total RNA was extracted from in vivo and in vitro samples and subjected to reverse transcription quantitative polymerase chain reaction to reveal mRNA expression of selected candidate genes. The release of prostaglandin E2 (PGE2), oviduct-specific glycoprotein 1 (OVGP1) and interleukin 8 (IL8) by BOEC was measured by EIA or ELISA after 24 h. Almost all candidate genes (prostaglandin synthases, enzymes of cellular metabolism and mucins) mRNA expression pattern differed compared in vivo with in vitro state. In addition, transcription of most candidate genes was influenced by the number of cell culture passages. Different glucose medium content did not affect mRNA expression of most candidate genes. The phase of the estrous cycle altered some candidate mRNA expression in BOEC in vitro at later passages. The release of PGE2 and OVGP1 between passages did not differ. However, BOEC in passage 3 released significantly higher amount of IL8 compared with cells in passage 0. This study supports the hypothesis that candidate mRNA expression in BOEC was influenced by transition from the in vivo situation
Laffin, Jennifer J S; Raca, Gordana; Jackson, Craig A; Strand, Edythe A; Jakielski, Kathy J; Shriberg, Lawrence D
2012-11-01
The goal of this study was to identify new candidate genes and genomic copy-number variations associated with a rare, severe, and persistent speech disorder termed childhood apraxia of speech. Childhood apraxia of speech is the speech disorder segregating with a mutation in FOXP2 in a multigenerational London pedigree widely studied for its role in the development of speech-language in humans. A total of 24 participants who were suspected to have childhood apraxia of speech were assessed using a comprehensive protocol that samples speech in challenging contexts. All participants met clinical-research criteria for childhood apraxia of speech. Array comparative genomic hybridization analyses were completed using a customized 385K Nimblegen array (Roche Nimblegen, Madison, WI) with increased coverage of genes and regions previously associated with childhood apraxia of speech. A total of 16 copy-number variations with potential consequences for speech-language development were detected in 12 or half of the 24 participants. The copy-number variations occurred on 10 chromosomes, 3 of which had two to four candidate regions. Several participants were identified with copy-number variations in two to three regions. In addition, one participant had a heterozygous FOXP2 mutation and a copy-number variation on chromosome 2, and one participant had a 16p11.2 microdeletion and copy-number variations on chromosomes 13 and 14. Findings support the likelihood of heterogeneous genomic pathways associated with childhood apraxia of speech.
Directory of Open Access Journals (Sweden)
Charles Meunier
Full Text Available The Ccs3 locus on mouse chromosome 3 regulates differential susceptibility of A/J (A, susceptible and C57BL/6J (B6, resistant mouse strains to chemically-induced colorectal cancer (CRC. Here, we report the high-resolution positional mapping of the gene underlying the Ccs3 effect. Using phenotype/genotype correlation in a series of 33 AcB/BcA recombinant congenic mouse strains, as well as in groups of backcross populations bearing unique recombinant chromosomes for the interval, and in subcongenic strains, we have delineated the maximum size of the Ccs3 physical interval to a ∼2.15 Mb segment. This interval contains 12 annotated transcripts. Sequencing of positional candidates in A and B6 identified many either low-priority coding changes or non-protein coding variants. We found a unique copy number variant (CNV in intron 15 of the Nfkb1 gene. The CNV consists of two copies of a 54 bp sequence immediately adjacent to the exon 15 splice site, while only one copy is found in CRC-susceptible A. The Nfkb1 protein (p105/p50 expression is much reduced in A tumors compared to normal A colonic epithelium as analyzed by immunohistochemistry. Studies in primary macrophages from A and B6 mice demonstrate a marked differential activation of the NfκB pathway by lipopolysaccharide (kinetics of stimulation and maximum levels of phosphorylated IκBα, with a more robust activation being associated with resistance to CRC. NfκB has been previously implicated in regulating homeostasis and inflammatory response in the intestinal mucosa. The interval contains another positional candidate Slc39a8 that is differentially expressed in A vs B6 colons, and that has recently been associated in CRC tumor aggressiveness in humans.
Dunaway, Keith W; Islam, M Saharul; Coulson, Rochelle L; Lopez, S Jesse; Vogel Ciernia, Annie; Chu, Roy G; Yasui, Dag H; Pessah, Isaac N; Lott, Paul; Mordaunt, Charles; Meguro-Horike, Makiko; Horike, Shin-Ichi; Korf, Ian; LaSalle, Janine M
2016-12-13
Rare variants enriched for functions in chromatin regulation and neuronal synapses have been linked to autism. How chromatin and DNA methylation interact with environmental exposures at synaptic genes in autism etiologies is currently unclear. Using whole-genome bisulfite sequencing in brain tissue and a neuronal cell culture model carrying a 15q11.2-q13.3 maternal duplication, we find that significant global DNA hypomethylation is enriched over autism candidate genes and affects gene expression. The cumulative effect of multiple chromosomal duplications and exposure to the pervasive persistent organic pollutant PCB 95 altered methylation of more than 1,000 genes. Hypomethylated genes were enriched for H2A.Z, increased maternal UBE3A in Dup15q corresponded to reduced levels of RING1B, and bivalently modified H2A.Z was altered by PCB 95 and duplication. These results demonstrate the compounding effects of genetic and environmental insults on the neuronal methylome that converge upon dysregulation of chromatin and synaptic genes. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.
Asha, Srinivasan; Soniya, Eppurath V
2016-01-01
Small RNAs derived from transfer RNAs were recently assigned as potential gene regulatory candidates for various stress responses in eukaryotes. In this study, we report on the cloning and identification of tRNA derived small RNAs from black pepper plants in response to the infection of the quick wilt pathogen, Phytophthora capsici. 5'tRFs cloned from black pepper were validated as highly expressed during P. capsici infection. A high-throughput systematic analysis of the small RNAome (sRNAome) revealed the predominance of 5'tRFs in the infected leaf and root. The abundance of 5'tRFs in the sRNAome and the defense responsive genes as their potential targets indicated their regulatory role during stress response in black pepper. The 5'Ala(CGC) tRF mediated cleavage was experimentally mapped at the tRF binding sites on the mRNA targets of Non-expresser of pathogenesis related protein (NPR1), which was down-regulated during pathogen infection. Comparative sRNAome further demonstrated sequence conservation of 5'Ala tRFs across the angiosperm plant groups, and many important genes in the defense response were identified in silico as their potential targets. Our findings uncovered the diversity, differential expression and stress responsive functional role of tRNA-derived small RNAs during Phytophthora infection in black pepper.
Stridh, Pernilla; Thessen Hedreul, Melanie; Beyeen, Amennai Daniel; Adzemovic, Milena Z.; Laaksonen, Hannes; Gillett, Alan; ?ckinger, Johan; Marta, Monica; Lassmann, Hans; Becanovic, Kristina; Jagodic, Maja; Olsson, Tomas
2010-01-01
BACKGROUND: To elucidate mechanisms involved in multiple sclerosis (MS), we studied genetic regulation of experimental autoimmune encephalomyelitis (EAE) in rats, assuming a conservation of pathogenic pathways. In this study, we focused on Eae23, originally identified to regulate EAE in a (LEW.1AV1xPVG.1AV1)F2 cross. Our aim was to determine whether one or more genes within the 67 Mb region regulate EAE and to define candidate risk genes. METHODOLOGY/PRINCIPAL FINDINGS: We used high resolutio...
Directory of Open Access Journals (Sweden)
Azam Moshtaghi
2016-10-01
Full Text Available Background Understanding the genomic basis of osmoregulation (candidate genes and/or molecular mechanisms controlling the phenotype addresses one of the fundamental questions in evolutionary ecology. Species distributions and adaptive radiations are thought to be controlled by environmental salinity levels, and efficient osmoregulatory (ionic balance ability is the main mechanism to overcome the problems related to environmental salinity gradients. Methods To better understand how osmoregulatory performance in freshwater (FW crustaceans allow individuals to acclimate and adapt to raised salinity conditions, here we (i, reviewed the literature on genes that have been identified to be associated with osmoregulation in FW crustaceans, and (ii, performed a transcriptomic analysis using cDNA libraries developed from mRNA isolated from three important osmoregulatory tissues (gill, antennal gland, hepatopancreas and total mRNA from post larvae taken from the freshwater prawn, Macrobrachium australiense using Illumina deep sequencing technology. This species was targeted because it can complete its life cycle totally in freshwater but, like many Macrobrachium sp., can also tolerate brackish water conditions and hence should have genes associated with tolerance of both FW and saline conditions. Results We obtained between 55.4 and 65.2 million Illumina read pairs from four cDNA libraries. Overall, paired end sequences assembled into a total of 125,196 non-redundant contigs (≥200 bp with an N50 length of 2,282 bp and an average contig length of 968 bp. Transcriptomic analysis of M. australiense identified 32 different gene families that were potentially involved with osmoregulatory capacity. A total of 32,597 transcripts were specified with gene ontology (GO terms identified on the basis of GO categories. Abundance estimation of expressed genes based on TPM (transcript per million ≥20 showed 1625 transcripts commonly expressed in all four libraries
Directory of Open Access Journals (Sweden)
Markus G Stetter
Full Text Available Plant root hairs increase the root surface to enhance the uptake of sparingly soluble and immobile nutrients, such as the essential nutrient phosphorus, from the soil. Here, root hair traits and the response to scarce local phosphorus concentration were studied in 166 accessions of Arabidopsis thaliana using split plates. Root hair density and length were correlated, but highly variable among accessions. Surprisingly, the well-known increase in root hair density under low phosphorus was mostly restricted to genotypes that had less and shorter root hairs under P sufficient conditions. By contrast, several accessions with dense and long root hairs even had lower hair density or shorter hairs in local scarce phosphorus. Furthermore, accessions with whole-genome duplications developed more dense but phosphorus-insensitive root hairs. The impact of genome duplication on root hair density was confirmed by comparing tetraploid accessions with their diploid ancestors. Genome-wide association mapping identified candidate genes potentially involved in root hair responses tp scarce local phosphate. Knock-out mutants in identified candidate genes (CYR1, At1g32360 and RLP48 were isolated and differences in root hair traits in the mutants were confirmed. The large diversity in root hair traits among accessions and the diverse response when local phosphorus is scarce is a rich resource for further functional analyses.
Directory of Open Access Journals (Sweden)
Clint L. Miller, PhD
2016-12-01
Full Text Available Nonalcoholic steatohepatitis is a common disease involving chronic accumulation of fat and inflammation in the liver, often leading to advanced fibrosis, cirrhosis, and cancer. It is known that nonalcoholic steatohepatitis shares many features with atherosclerosis; however, there are still no effective therapeutics. In a recent study published in Nature, investigators demonstrated that mice lacking a high-density lipoprotein–associated gene were surprisingly protected from both steatohepatitis and atherosclerosis through the stabilization of the liver X receptor. This work reveals a timely candidate target for 2 highly prevalent cardiovascular diseases.
Wang, Haiying; Molina, Julian; Jiang, John; Ferber, Matthew; Pruthi, Sandhya; Jatkoe, Timothy; Derecho, Carlo; Rajpurohit, Yashoda; Zheng, Jian; Wang, Yixin
2013-11-01
Circulating tumor cells (CTCs) have recently attracted attention due to their potential as prognostic and predictive markers for the clinical management of metastatic breast cancer patients. The isolation of CTCs from patients may enable the molecular characterization of these cells, which may help establish a minimally invasive assay for the prediction of metastasis and further optimization of treatment. Molecular markers of proven clinical value may therefore be useful in predicting disease aggressiveness and response to treatment. In our earlier study, we identified a gene signature in breast cancer that appears to be significantly associated with bone metastasis. Among the genes that constitute this signature, trefoil factor 1 (TFF1) was identified as the most differentially expressed gene associated with bone metastasis. In this study, we investigated 25 candidate gene markers in the CTCs of metastatic breast cancer patients with different metastatic sites. The panel of the 25 markers was investigated in 80 baseline samples (first blood draw of CTCs) and 30 follow-up samples. In addition, 40 healthy blood donors (HBDs) were analyzed as controls. The assay was performed using quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) with RNA extracted from CTCs captured by the CellSearch system. Our study indicated that 12 of the genes were uniquely expressed in CTCs and 10 were highly expressed in the CTCs obtained from patients compared to those obtained from HBDs. Among these genes, the expression of keratin 19 was highly correlated with the CTC count. The TFF1 expression in CTCs was a strong predictor of bone metastasis and the patients with a high expression of estrogen receptor β in CTCs exhibited a better response to hormonal treatment. Molecular characterization of these genes in CTCs may provide a better understanding of the mechanism underlying tumor metastasis and identify gene markers in CTCs for predicting disease progression and
Directory of Open Access Journals (Sweden)
Yuqing Niu
2018-01-01
Full Text Available Banana Fusarium wilt caused by Fusarium oxysporum f. sp. cubense (Foc is one of the most destructive soil-borne diseases. In this study, young tissue-cultured plantlets of banana (Musa spp. AAA cultivars differing in Foc susceptibility were used to reveal their differential responses to this pathogen using digital gene expression (DGE. Data were evaluated by various bioinformatic tools (Venn diagrams, gene ontology (GO annotation and Kyoto encyclopedia of genes and genomes (KEGG pathway analyses and immunofluorescence labelling method to support the identification of gene candidates determining the resistance of banana against Foc. Interestingly, we have identified MaWRKY50 as an important gene involved in both constitutive and induced resistance. We also identified new genes involved in the resistance of banana to Foc, including several other transcription factors (TFs, pathogenesis-related (PR genes and some genes related to the plant cell wall biosynthesis or degradation (e.g., pectinesterases, β-glucosidases, xyloglucan endotransglucosylase/hydrolase and endoglucanase. The resistant banana cultivar shows activation of PR-3 and PR-4 genes as well as formation of different constitutive cell barriers to restrict spreading of the pathogen. These data suggest new mechanisms of banana resistance to Foc.
Directory of Open Access Journals (Sweden)
M.C. Barros Filho
2010-12-01
Full Text Available In breast cancer patients submitted to neoadjuvant chemotherapy (4 cycles of doxorubicin and cyclophosphamide, AC, expression of groups of three genes (gene trio signatures could distinguish responsive from non-responsive tumors, as demonstrated by cDNA microarray profiling in a previous study by our group. In the current study, we determined if the expression of the same genes would retain the predictive strength, when analyzed by a more accessible technique (real-time RT-PCR. We evaluated 28 samples already analyzed by cDNA microarray, as a technical validation procedure, and 14 tumors, as an independent biological validation set. All patients received neoadjuvant chemotherapy (4 AC. Among five trio combinations previously identified, defined by nine genes individually investigated (BZRP, CLPTM1,MTSS1, NOTCH1, NUP210, PRSS11, RPL37A, SMYD2, and XLHSRF-1, the most accurate were established by RPL37A, XLHSRF-1based trios, with NOTCH1 or NUP210. Both trios correctly separated 86% of tumors (87% sensitivity and 80% specificity for predicting response, according to their response to chemotherapy (82% in a leave-one-out cross-validation method. Using the pre-established features obtained by linear discriminant analysis, 71% samples from the biological validation set were also correctly classified by both trios (72% sensitivity; 66% specificity. Furthermore, we explored other gene combinations to achieve a higher accuracy in the technical validation group (as a training set. A new trio, MTSS1, RPL37 and SMYD2, correctly classified 93% of samples from the technical validation group (95% sensitivity and 80% specificity; 86% accuracy by the cross-validation method and 79% from the biological validation group (72% sensitivity and 100% specificity. Therefore, the combined expression of MTSS1, RPL37 and SMYD2, as evaluated by real-time RT-PCR, is a potential candidate to predict response to neoadjuvant doxorubicin and cyclophosphamide in breast cancer
Porcine Is a Positional Candidate Gene Associated with Growth and Fat Deposition
Directory of Open Access Journals (Sweden)
Bong Hwan Choi
2012-12-01
Full Text Available Crosses between Korean and Landrace pigs have revealed a large quantitative trait loci (QTL region for fat deposition in a region (89 cM of porcine chromosome 4 (SSC4. To more finely map this QTL region and identify candidate genes for this trait, comparative mapping of pig and human chromosomes was performed in the present study. A region in the human genome that corresponds to the porcine QTL region was identified in HSA1q21. Furthermore, the LMNA gene, which is tightly associated with fat augmentation in humans, was localized to this region. Radiation hybrid (RH mapping using a Sus scrofa RH panel localized LMNA to a region of 90.3 cM in the porcine genome, distinct from microsatellite marker S0214 (87.3 cM. Two-point analysis showed that LMNA was linked to S0214, SW1996, and S0073 on SSC4 with logarithm (base 10 of odds scores of 20.98, 17.78, and 16.73, respectively. To clone the porcine LMNA gene and to delineate the genomic structure and sequences, including the 3′untranslated region (UTR, rapid amplification of cDNA ends was performed. The coding sequence of porcine LMNA consisted of 1,719 bp, flanked by a 5’UTR and a 3’UTR. Two synonymous single nucleotide polymorphisms (SNPs were identified in exons 3 and 7. Association tests showed that the SNP located in exon 3 (A193A was significantly associated with weight at 30 wks (p<0.01 and crude fat content (p<0.05. This association suggests that SNPs located in LMNA could be used for marker-assisted selection in pigs.
Luijk, Maartje P. C. M.; Roisman, Glenn I.; Haltigan, John D.; Tiemeier, Henning; Booth-LaForce, Cathryn; van IJzendoorn, Marinus H.; Belsky, Jay; Uitterlinden, Andre G.; Jaddoe, Vincent W. V.; Hofman, Albert; Verhulst, Frank C.; Tharner, Anne; Bakermans-Kranenburg, Marian J.
2011-01-01
Background and methods: In two birth cohort studies with genetic, sensitive parenting, and attachment data of more than 1,000 infants in total, we tested main and interaction effects of candidate genes involved in the dopamine, serotonin, and oxytocin systems ("DRD4", "DRD2", "COMT", "5-HTT", "OXTR") on attachment security and disorganization.…
Transcriptional Regulatory Network Analysis of MYB Transcription Factor Family Genes in Rice
Directory of Open Access Journals (Sweden)
Shuchi eSmita
2015-12-01
Full Text Available MYB transcription factor (TF is one of the largest TF families and regulates defense responses to various stresses, hormone signaling as well as many metabolic and developmental processes in plants. Understanding these regulatory hierarchies of gene expression networks in response to developmental and environmental cues is a major challenge due to the complex interactions between the genetic elements. Correlation analyses are useful to unravel co-regulated gene pairs governing biological process as well as identification of new candidate hub genes in response to these complex processes. High throughput expression profiling data are highly useful for construction of co-expression networks. In the present study, we utilized transcriptome data for comprehensive regulatory network studies of MYB TFs by top down and guide gene approaches. More than 50% of OsMYBs were strongly correlated under fifty experimental conditions with 51 hub genes via top down approach. Further, clusters were identified using Markov Clustering (MCL. To maximize the clustering performance, parameter evaluation of the MCL inflation score (I was performed in terms of enriched GO categories by measuring F-score. Comparison of co-expressed cluster and clads analyzed from phylogenetic analysis signifies their evolutionarily conserved co-regulatory role. We utilized compendium of known interaction and biological role with Gene Ontology enrichment analysis to hypothesize function of coexpressed OsMYBs. In the other part, the transcriptional regulatory network analysis by guide gene approach revealed 40 putative targets of 26 OsMYB TF hubs with high correlation value utilizing 815 microarray data. The putative targets with MYB-binding cis-elements enrichment in their promoter region, functional co-occurrence as well as nuclear localization supports our finding. Specially, enrichment of MYB binding regions involved in drought-inducibility implying their regulatory role in drought
Directory of Open Access Journals (Sweden)
Walker M Andrew
2010-07-01
Full Text Available Abstract Background Plant cytochrome P450 monooxygenases (CYP mediate synthesis and metabolism of many physiologically important primary and secondary compounds that are related to plant defense against a range of pathogenic microbes and insects. To determine if cytochrome P450 monooxygenases are involved in defense response to Xylella fastidiosa (Xf infection, we investigated expression and regulatory mechanisms of the cytochrome P450 monooxygenase CYP736B gene in both disease resistant and susceptible grapevines. Results Cloning of genomic DNA and cDNA revealed that the CYP736B gene was composed of two exons and one intron with GT as a donor site and AG as an acceptor site. CYP736B transcript was up-regulated in PD-resistant plants and down-regulated in PD-susceptible plants 6 weeks after Xf inoculation. However, CYP736B expression was very low in stem tissues at all evaluated time points. 5'RACE and 3'RACE sequence analyses revealed that there were three candidate transcription start sites (TSS in the upstream region and three candidate polyadenylation (PolyA sites in the downstream region of CYP736B. Usage frequencies of each transcription initiation site and each polyadenylation site varied depending on plant genotype, developmental stage, tissue, and treatment. These results demonstrate that expression of CYP736B is regulated developmentally and in response to Xf infection at both transcriptional and post-transcriptional levels. Multiple transcription start and polyadenylation sites contribute to regulation of CYP736B expression. Conclusions This report provides evidence that the cytochrome P450 monooxygenase CYP736B gene is involved in defense response at a specific stage of Xf infection in grapevines; multiple transcription initiation and polyadenylation sites exist for CYP736B in grapevine; and coordinative and selective use of transcription initiation and polyadenylation sites play an important role in regulation of CYP736B expression
Jin, Hee; Jeon, Seulgi; Kang, Ga-Young; Lee, Hae-June; Cho, Jaeho; Lee, Yun-Sil
2017-02-01
The molecular effects of focal exposure of limited lung volumes to high-dose per fraction irradiation (HDFR) such as stereotactic body radiotherapy (SBRT) have not been fully characterized. In this study, we used such an irradiation system and identified the genes and proteins after HDFR to mouse lung, similar to those associated with human therapy. High focal radiation (90 Gy) was applied to a 3-mm volume of the left lung of C57BL6 mice using a small-animal stereotactic irradiator. As well as histological examination for lungs, a cDNA micro array using irradiated lung tissues and a protein array of sera were performed until 4 weeks after irradiation, and radiation-responsive genes and proteins were identified. For comparison, the long-term effects (12 months) of 20 Gy radiation wide-field dose to the left lung were also investigated. The genes ermap, epb4.2, cd200r3 (up regulation) and krt15, hoxc4, gdf2, cst9, cidec, and bnc1 (down-regulation) and the proteins of AIF, laminin, bNOS, HSP27, β-amyloid (upregulation), and calponin (downregulation) were identified as being responsive to 90 Gy HDFR. The gdf2, cst9, and cidec genes also responded to 20 Gy, suggesting that they are universal responsive genes in irradiated lungs. No universal proteins were identified in both 90 Gy and 20 Gy. Calponin, which was downregulated in protein antibody array analysis, showed a similar pattern in microarray data, suggesting a possible HDFR responsive serum biomarker that reflects gene alteration of irradiated lung tissue. These genes and proteins also responded to the lower doses of 20 Gy and 50 Gy HDFR. These results suggest that identified candidate genes and proteins are HDFR-specifically expressed in lung damage induced by HDFR relevant to SBRT in humans.
Wang, Yinliang; Chen, Qi; Zhao, Hanbo; Ren, Bingzhong
2016-01-01
The leaf beetle Ambrostoma quadriimpressum (Coleoptera: Chrysomelidae) is a predominant forest pest that causes substantial damage to the lumber industry and city management. However, no effective and environmentally friendly chemical method has been discovered to control this pest. Until recently, the molecular basis of the olfactory system in A. quadriimpressum was completely unknown. In this study, antennae and leg transcriptomes were analyzed and compared using deep sequencing data to identify the olfactory genes in A. quadriimpressum. Moreover, the expression profiles of both male and female candidate olfactory genes were analyzed and validated by bioinformatics, motif analysis, homology analysis, semi-quantitative RT-PCR and RT-qPCR experiments in antennal and non-olfactory organs to explore the candidate olfactory genes that might play key roles in the life cycle of A. quadriimpressum. As a result, approximately 102.9 million and 97.3 million clean reads were obtained from the libraries created from the antennas and legs, respectively. Annotation led to 34344 Unigenes, which were matched to known proteins. Annotation data revealed that the number of genes in antenna with binding functions and receptor activity was greater than that of legs. Furthermore, many pathway genes were differentially expressed in the two organs. Sixteen candidate odorant binding proteins (OBPs), 10 chemosensory proteins (CSPs), 34 odorant receptors (ORs), 20 inotropic receptors [1] and 2 sensory neuron membrane proteins (SNMPs) and their isoforms were identified. Additionally, 15 OBPs, 9 CSPs, 18 ORs, 6 IRs and 2 SNMPs were predicted to be complete ORFs. Using RT-PCR, RT-qPCR and homology analysis, AquaOBP1/2/4/7/C1/C6, AquaCSP3/9, AquaOR8/9/10/14/15/18/20/26/29/33, AquaIR8a/13/25a showed olfactory-specific expression, indicating that these genes might play a key role in olfaction-related behaviors in A. quadriimpressum such as foraging and seeking. AquaOBP4/C5, AquaOBP4/C5, AquaCSP7
Directory of Open Access Journals (Sweden)
Yinliang Wang
Full Text Available The leaf beetle Ambrostoma quadriimpressum (Coleoptera: Chrysomelidae is a predominant forest pest that causes substantial damage to the lumber industry and city management. However, no effective and environmentally friendly chemical method has been discovered to control this pest. Until recently, the molecular basis of the olfactory system in A. quadriimpressum was completely unknown. In this study, antennae and leg transcriptomes were analyzed and compared using deep sequencing data to identify the olfactory genes in A. quadriimpressum. Moreover, the expression profiles of both male and female candidate olfactory genes were analyzed and validated by bioinformatics, motif analysis, homology analysis, semi-quantitative RT-PCR and RT-qPCR experiments in antennal and non-olfactory organs to explore the candidate olfactory genes that might play key roles in the life cycle of A. quadriimpressum. As a result, approximately 102.9 million and 97.3 million clean reads were obtained from the libraries created from the antennas and legs, respectively. Annotation led to 34344 Unigenes, which were matched to known proteins. Annotation data revealed that the number of genes in antenna with binding functions and receptor activity was greater than that of legs. Furthermore, many pathway genes were differentially expressed in the two organs. Sixteen candidate odorant binding proteins (OBPs, 10 chemosensory proteins (CSPs, 34 odorant receptors (ORs, 20 inotropic receptors [1] and 2 sensory neuron membrane proteins (SNMPs and their isoforms were identified. Additionally, 15 OBPs, 9 CSPs, 18 ORs, 6 IRs and 2 SNMPs were predicted to be complete ORFs. Using RT-PCR, RT-qPCR and homology analysis, AquaOBP1/2/4/7/C1/C6, AquaCSP3/9, AquaOR8/9/10/14/15/18/20/26/29/33, AquaIR8a/13/25a showed olfactory-specific expression, indicating that these genes might play a key role in olfaction-related behaviors in A. quadriimpressum such as foraging and seeking. AquaOBP4/C5, Aqua
Bossé, Yohan
2012-01-01
A genetic contribution to develop chronic obstructive pulmonary disease (COPD) is well established. However, the specific genes responsible for enhanced risk or host differences in susceptibility to smoke exposure remain poorly understood. The goal of this review is to provide a comprehensive literature overview on the genetics of COPD, highlight the most promising findings during the last few years, and ultimately provide an updated COPD gene list. Candidate gene studies on COPD and related phenotypes indexed in PubMed before January 5, 2012 are tabulated. An exhaustive list of publications for any given gene was looked for. This well-documented COPD candidate-gene list is expected to serve many purposes for future replication studies and meta-analyses as well as for reanalyzing collected genomic data in the field. In addition, this review summarizes recent genetic loci identified by genome-wide association studies on COPD, lung function, and related complications. Assembling resources, integrative genomic approaches, and large sample sizes of well-phenotyped subjects is part of the path forward to elucidate the genetic basis of this debilitating disease. PMID:23055711
Directory of Open Access Journals (Sweden)
Valentino Ruggieri
2015-07-01
Full Text Available Tomato ( is a crucial component of the human diet because of its high nutritional value and the antioxidant content of its fruit. As a member of the Solanaceae family, it is considered a model species for genomic studies in this family, especially since its genome has been completely sequenced. Among genomic resources available, introgression lines represent a valuable tool to mine the genetic diversity present in wild species. One introgression line, IL12-4, was previously selected for high ascorbic acid (AsA content, and a transcriptomic analysis indicated the involvement of genes controlling pectin degradation in AsA accumulation. In this study the integration of data from different “omics” platforms has been exploited to identify candidate genes that increase AsA belonging to the wild region 12-4. Thirty-two genes potentially involved in pathways controlling AsA levels were analyzed with bioinformatic tools. Two hundred-fifty nonsynonymous polymorphisms were detected in their coding regions, and 11.6% revealed deleterious effects on predicted protein function. To reduce the number of genes that had to be functionally validated, introgression sublines of the region 12–4 were selected using species-specific polymorphic markers between the two species. Four sublines were obtained and we demonstrated that a subregion of around 1 Mbp includes 12 candidate genes potentially involved in AsA accumulation. Among these, only five exhibited structural deleterious variants, and one of the 12 was differentially expressed between the two species. We have highlighted the role of three polymorphic pectinesterases and inhibitors of pectinesterases that merit further investigation.
DEFF Research Database (Denmark)
Jouffe, Vincent; Rowe, Suzanne; Liaubet, Laurence
2009-01-01
this with information on published QTL. The starting point is a set of 237 differentially expressed cDNA clones in adrenal tissue from two pig breeds, before and after treatment with adrenocorticotropic hormone (ACTH) Results: Different approaches to localize the differentially expressed (DE) genes to the pig genome....... Different approaches to localize the differentially expressed (DE) genes to the pig genome showed different levels of success and a clear lack of concordance for some genes between the various approaches. For a focused analysis on 12 genes, overlapping QTL from the public domain were presented. Also...
Li-Tempel, Ting; Larra, Mauro F; Winnikes, Ulrike; Tempel, Tobias; DeRijk, Roel H; Schulz, André; Schächinger, Hartmut; Meyer, Jobst; Schote, Andrea B
2016-09-01
The hypothalamus-pituitary-adrenal (HPA) axis is a crucial endocrine system for coping with stress. A reliable and stable marker for the basal state of that system is the cortisol awakening response (CAR). We examined the influence of variants of four relevant candidate genes; the mineralocorticoid receptor gene (MR), the glucocorticoid receptor gene (GR), the serotonin transporter gene (5-HTT) and the gene encoding the brain-derived neurotrophic factor (BDNF) on CAR and self-perceived stress in 217 healthy subjects. We found that polymorphisms of GR influenced both, the basal state of the HPA axis as well as self-perceived stress. MR only associated with self-perceived stress and 5-HTT only with CAR. BDNF did not affected any of the investigated indices. In summary, we suggest that GR variants together with the CAR and supplemented with self reports on perceived stress might be useful indicators for the basal HPA axis activity. Copyright © 2016 Elsevier B.V. All rights reserved.
Pradhan, Seema; Kant, Chandra; Verma, Subodh; Bhatia, Sabhyata
2017-01-01
The CCCH zinc finger is a group of proteins characterised by a typical motif consisting of three cysteine residues and one histidine residue. These proteins have been reported to play important roles in regulation of plant growth, developmental processes and environmental responses. In the present study, genome wide analysis of the CCCH zinc finger gene family was carried out in the available chickpea genome. Various bioinformatics tools were employed to predict 58 CCCH zinc finger genes in chickpea (designated CarC3H1-58), which were analysed for their physio-chemical properties. Phylogenetic analysis classified the proteins into 12 groups in which members of a particular group had similar structural organization. Further, the numbers as well as the types of CCCH motifs present in the CarC3H proteins were compared with those from Arabidopsis and Medicago truncatula. Synteny analysis revealed valuable information regarding the evolution of this gene family. Tandem and segmental duplication events were identified and their Ka/Ks values revealed that the CarC3H gene family in chickpea had undergone purifying selection. Digital, as well as real time qRT-PCR expression analysis was performed which helped in identification of several CarC3H members that expressed preferentially in specific chickpea tissues as well as during abiotic stresses (desiccation, cold, salinity). Moreover, molecular characterization of an important member CarC3H45 was carried out. This study provides comprehensive genomic information about the important CCCH zinc finger gene family in chickpea. The identified tissue specific and abiotic stress specific CCCH genes could be potential candidates for further characterization to delineate their functional roles in development and stress.
Clark, Jo-Anna B J; Tully, Sara J; Dawn Marshall, H
2014-12-01
Hereditary hyperplastic gingivitis (HHG) is an autosomal recessive disease that presents with progressive gingival proliferation in farmed silver foxes. Hereditary gingival fibromatosis (HGF) is an analogous condition in humans that is genetically heterogeneous with several known autosomal dominant loci. For one locus the causative mutation is in the Son of sevenless homologue 1 (SOS1) gene. For the remaining loci, the molecular mechanisms are unknown but Ras pathway involvement is suspected. Here we compare sequences for the SOS1 gene, and two adjacent genes in the Ras pathway, growth receptor bound protein 2 (GRB2) and epidermal growth factor receptor (EGFR), between HHG-affected and unaffected foxes. We conclude that the known HGF causative mutation does not cause HHG in foxes, nor do the coding regions or intron-exon boundaries of these three genes contain any candidate mutations for fox gum disease. Patterns of molecular evolution among foxes and other mammals reflect high conservation and strong functional constraints for SOS1 and GRB2 but reveal a lineage-specific pattern of variability in EGFR consistent with mutational rate differences, relaxed functional constraints, and possibly positive selection.
Directory of Open Access Journals (Sweden)
Alfonso Leopoldo
2005-07-01
Full Text Available Abstract This article investigates the application of meta-analysis on livestock candidate gene effects. The PvuII polymorphism of the ESR gene is used as an example. The association among ESR PvuII alleles with the number of piglets born alive and total born in the first (NBA1, TNB1 and later parities (NBA, TNB is reviewed by conducting a meta-analysis of 15 published studies including 9329 sows. Under a fixed effects model, litter size values were significantly lower in the "AA" genotype groups when compared with "AB" and "BB" homozygotes. Under the random effects model, the results were similar although differences between "AA" and "AB" genotype groups were not clearly significant for NBA and TNB. Nevertheless, the most noticeable result was the high and significant heterogeneity estimated among studies. This heterogeneity could be assigned to error sampling, genotype by environment interaction, linkage or epistasis, as referred to in the literature, but also to the hypothesis of population admixture/stratification. It is concluded that meta-analysis can be considered as a helpful analytical tool to synthesise and discuss livestock candidate gene effects. The main difficulty found was the insufficient information on the standard errors of the estimated genotype effects in several publications. Consequently, the convenience of publishing the standard errors or the concrete P-values instead of the test significance level should be recommended to guarantee the quality of candidate gene effect meta-analyses.
Yan, H; Guo, Y; Yang, T-L; Zhao, L-J; Deng, H-W
2012-08-06
The cytochrome P450c17α gene (CYP17) encodes a key biosynthesis enzyme of estrogen, which is critical in regulating adipogenesis and adipocyte development in humans. We therefore hypothesized that CYP17 is a candidate gene for predicting obesity. In order to test this hypothesis, we performed a family-based association test to investigate the relationship between the CYP17 gene and obesity phenotypes in a large sample comprising 1873 subjects from 405 Caucasian nuclear families of European origin recruited by the Osteoporosis Research Center of Creighton University, USA. Both single SNPs and haplotypes were tested for associations with obesity-related phenotypes, including body mass index (BMI) and fat mass. We identified three SNPs to be significantly associated with BMI, including rs3740397, rs6163, and rs619824. We further characterized the linkage disequilibrium structure for CYP17 and found that the whole CYP17 gene was located in a single-linkage disequilibrium block. This block was observed to be significantly associated with BMI. A major haplotype in this block was significantly associated with both BMI and fat mass. In conclusion, we suggest that the CYP17 gene has an effect on obesity in the Caucasian population. Further independent studies will be needed to confirm our findings.
DNA sequence responsible for the amplification of adjacent genes.
Pasion, S G; Hartigan, J A; Kumar, V; Biswas, D K
1987-10-01
A 10.3-kb DNA fragment in the 5'-flanking region of the rat prolactin (rPRL) gene was isolated from F1BGH(1)2C1, a strain of rat pituitary tumor cells (GH cells) that produces prolactin in response to 5-bromodeoxyuridine (BrdU). Following transfection and integration into genomic DNA of recipient mouse L cells, this DNA induced amplification of the adjacent thymidine kinase gene from Herpes simplex virus type 1 (HSV1TK). We confirmed the ability of this "Amplicon" sequence to induce amplification of other linked or unlinked genes in DNA-mediated gene transfer studies. When transferred into the mouse L cells with the 10.3-5'rPRL gene sequence of BrdU-responsive cells, both the human growth hormone and the HSV1TK genes are amplified in response to 5-bromodeoxyuridine. This observation is substantiated by BrdU-induced amplification of the cotransferred bacterial Neo gene. Cotransfection studies reveal that the BrdU-induced amplification capability is associated with a 4-kb DNA sequence in the 5'-flanking region of the rPRL gene of BrdU-responsive cells. These results demonstrate that genes of heterologous origin, linked or unlinked, and selected or unselected, can be coamplified when located within the amplification boundary of the Amplicon sequence.
De La Rosa, Vanessa Y; Asfaha, Jonathan; Fasullo, Michael; Loguinov, Alex; Li, Peng; Moore, Lee E; Rothman, Nathaniel; Nakamura, Jun; Swenberg, James A; Scelo, Ghislaine; Zhang, Luoping; Smith, Martyn T; Vulpe, Chris D
2017-11-01
Trichloroethylene (TCE), an industrial chemical and environmental contaminant, is a human carcinogen. Reactive metabolites are implicated in renal carcinogenesis associated with TCE exposure, yet the toxicity mechanisms of these metabolites and their contribution to cancer and other adverse effects remain unclear. We employed an integrated functional genomics approach that combined functional profiling studies in yeast and avian DT40 cell models to provide new insights into the specific mechanisms contributing to toxicity associated with TCE metabolites. Genome-wide profiling studies in yeast identified the error-prone translesion synthesis (TLS) pathway as an import mechanism in response to TCE metabolites. The role of TLS DNA repair was further confirmed by functional profiling in DT40 avian cell lines, but also revealed that TLS and homologous recombination DNA repair likely play competing roles in cellular susceptibility to TCE metabolites in higher eukaryotes. These DNA repair pathways are highly conserved between yeast, DT40, and humans. We propose that in humans, mutagenic TLS is favored over homologous recombination repair in response to TCE metabolites. The results of these studies contribute to the body of evidence supporting a mutagenic mode of action for TCE-induced renal carcinogenesis mediated by reactive metabolites in humans. Our approach illustrates the potential for high-throughput in vitro functional profiling in yeast to elucidate toxicity pathways (molecular initiating events, key events) and candidate susceptibility genes for focused study. © The Author 2017. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.