WorldWideScience
1

Cadmium Ion Biosorption by the Thermophilic Bacteria Geobacillus stearothermophilus and G. thermocatenulatus  

OpenAIRE

This study reports surface complexation models (SCMs) for quantifying metal ion adsorption by thermophilic microorganisms. In initial cadmium ion toxicity tests, members of the genus Geobacillus displayed the highest tolerance to CdCl2 (as high as 400 to 3,200 ?M). The thermophilic, gram-positive bacteria Geobacillus stearothermophilus and G. thermocatenulatus were selected for further electrophoretic mobility, potentiometric titration, and Cd2+ adsorption experiments to characterize Cd2+ co...

Hetzer, Adrian; Daughney, Christopher J.; Morgan, Hugh W.

2006-01-01

2

Biosynthesis of omega-alicyclic fatty acids induced by cyclic precursors and change of membrane fluidity in thermophilic bacteria Geobacillus stearothermophilus and Meiothermus ruber.  

Czech Academy of Sciences Publication Activity Database

Ro?. 15, ?. 3 (2011), 423-429. ISSN 1431-0651 Institutional research plan: CEZ:AV0Z50200510 Keywords : Thermophilic bacteria * Geobacillus * Meiothermus Subject RIV: EE - Microbiology, Virology Impact factor: 2.941, year: 2011

Si?iš?ová, L.; Luhový, R.; Sigler, Karel; ?ezanka, Tomáš

2011-01-01

3

Structural Basis of Substrate Binding in WsaF, a Rhamnosyltransferase from Geobacillus stearothermophilus  

OpenAIRE

Carbohydrate polymers are medically and industrially important. The S-layer of many Gram-positive organisms comprises protein and carbohydrate polymers and forms an almost paracrystalline array on the cell surface. Not only is this array important for the bacteria but it has potential application in the manufacture of commercially important polysaccharides and glycoconjugates as well. The S-layer glycoprotein glycan from Geobacillus stearothermophilus NRS 2004/3a is mainly composed of repeati...

Steiner, Kerstin; Hagelueken, Gregor; Messner, Paul; Scha?ffer, Christina; Naismith, James H.

2010-01-01

4

The l-Arabinan Utilization System of Geobacillus stearothermophilus?  

OpenAIRE

Geobacillus stearothermophilus T-6 is a thermophilic soil bacterium that has a 38-kb gene cluster for the utilization of arabinan, a branched polysaccharide that is part of the plant cell wall. The bacterium encodes a unique three-component regulatory system (araPST) that includes a sugar-binding lipoprotein (AraP), a histidine sensor kinase (AraS), and a response regulator (AraT) and lies adjacent to an ATP-binding cassette (ABC) arabinose transport system (araEGH). The lipoprotein (AraP) sp...

Shulami, Smadar; Raz-pasteur, Ayelet; Tabachnikov, Orly; Gilead-gropper, Sarah; Shner, Itzhak; Shoham, Yuval

2011-01-01

5

Substrate-Ligand Interactions in Geobacillus Stearothermophilus Nitric Oxide Synthase†  

OpenAIRE

Ntric oxide synthase (NOS) generates NO via a sequential two-step reaction, L-arginine (L-Arg) ? N-hydroxy-L-arginine (NOHA) ? L-citrulline + NO. Each step of the reaction follows a distinct mechanism defined by the chemical environment introduced by each substrate bound to the heme active site. The dioxygen complex of the NOS enzyme from a thermophilic bacterium, Geobacillus stearothermophilus (gsNOS), is unusually stable; hence it provides a unique model for the studies of the mechanist...

Kabir, Mariam; Sudhamsu, Jawahar; Crane, Brian R.; Yeh, Syun-ru; Rousseau, Denis L.

2008-01-01

6

Genotypic and phenotypic characterization of foodborne Geobacillus stearothermophilus.  

Science.gov (United States)

Geobacillus stearothermophilus is the main thermophilic spore former involved in flat sour spoilage of canned foods. Three typing methods were tested and applied to differentiate strains at intra-species level: panC sequence analysis, REP-PCR and M13-PCR. panC gene was highly conserved within the studied strains, suggesting a low intra-specific diversity. This was supported by REP-PCR primary assays and M13-PCR results. M13-PCR profile analysis succeeded in differentiating six closely related groups (at 79% threshold similarity) among 127 strains from a range of spoiled canned food products and from different canneries. Phenotypic traits were investigated among 20 selected strains representing groups and origins. Ranges of growth under different temperatures (from 40 °C to 70 °C), pH (from 5.0 to 6.5), NaCl concentrations (from 1 to 5%) and sporulation conditions poorly differed between strains, but wet heat resistance of spores showed a 20-fold variation between strains. Furthermore, in this study, strains that belonged to the same M13-PCR genetic group did not share phenotypic characteristics or common origin. The work emphasizes a low diversity within the G. stearothermophilus species but data from this study may contribute to a better control of G. stearothermophilus spoilage in canned food. PMID:25481066

Durand, Loïc; Planchon, Stella; Guinebretiere, Marie-Hélène; Carlin, Frédéric; Remize, Fabienne

2015-02-01

7

FORMALDEHYDE GAS INACTIVATION OF BACILLUS ANTHRACIS, BACILLUS SUBTILIS AND GEOBACILLUS STEAROTHERMOPHILUS SPORES ON INDOOR SURFACE MATERIALS.  

Science.gov (United States)

Research evaluated the decontamination of Bacillus anthracis, Bacillus subtilis, and Geobacillus stearothermophilus spores on indoor surface material using formaldehyde gas. Spores were dried on seven types of indoor surfaces and exposed to 1100 ppm formaldehyde gas for 10 hr. Fo...

8

DECONTAMINATION ASSESSMENT OF BACILLUS ANTHRACIS, BACILLUS SUBTILIS, AND GEOBACILLUS STEAROTHERMOPHILUS SPORES ON INDOOR SURFACTS USING A HYDROGEN PERIOXIDE GAS GENERATOR  

Science.gov (United States)

Aims: To evaluate the decontamination of Bacillus anthracis, Bacillus subtilis, and Geobacillus stearothermophilus spores on indoor surface materials using hydrogen peroxide gas. Methods and Results: B. anthracis, B. subtilis, and G. Stearothermophilus spores were dried on seven...

9

Safety evaluation of a thermolysin enzyme produced from Geobacillus stearothermophilus.  

Science.gov (United States)

Thermolysin is a zinc metalloprotease that has potential uses in the food industry. The safety of thermolysin has not been demonstrated before, and therefore a series of standard toxicological tests to assess its potential toxicity was undertaken. The thermolysin used in this study was derived from the thermophilic bacterium Geobacillus stearothermophilus, which had undergone chemical mutagenesis to generate strains with increased thermolysin production. Acute toxicity studies in rats and mice showed that thermolysin powder is not acutely toxic with an oral LD?? of more than 18,000 mg/kg (2520 mg/kg thermolysin protein) in rats and more than 24,000 mg/kg (3360 mg/kg protein) in mice. Subchronic feeding studies in rats for 91 days at doses up to 1000 mg/kg (390 mg/kg protein) revealed no significant differences between treated and non-treated groups and a No Observed Effect Level (NOEL) of 1000 mg/kg (390 mg/kg protein) per day was established. Results from genotoxicity tests such as in vitro chromosomal aberration assay and in vivo mouse micronucleus were negative. Allergenicity sequence analysis revealed no evidence suggesting that thermolysin is an allergen. The data presented in this study support the conclusion that thermolysin is safe for use in food production. PMID:23831195

Ke, Qingdong; Chen, Alice; Minoda, Masashi; Yoshida, Hiromichi

2013-09-01

10

Isolation of Lipase Gene of the Thermophilic Geobacillus stearothermophilus Strain-5  

Directory of Open Access Journals (Sweden)

Full Text Available In earlier study a new thermophilic strain Geobacillus stearothermophilus strain-5 producing thermostable lipase was isolated and identified based on 16S rRNA sequencing. Phylogenetic analysis revealed its closeness to geobacilli especially the thermophilic Geobacillus stearothermophilus with optimal growth and lipolytic enzyme activity at 60°C and pH 7.0. In this study thermostable lipase gene from this bacterium was isolated by PCR using degenerate primers. The DNA fragment coding for lipase gene was cloned in the pCR 4-TOPO plasmid and the ligation products were transformed into Escherichia coli XL1-blue cells. Partial sequencing of the gene was carried out (accession number DQ923401. Analysis by BLAST program showed some sequence similarity to that, of several lipase genes from thermophilic Geobacillus and Bacillus submitted to Genbank.

M. Sifour

2010-01-01

11

Taxonomic revision of the genus Geobacillus: emendation of Geobacillus, G. stearothermophilus, G. jurassicus, G. toebii, G. thermodenitrificans and G. thermoglucosidans (nom. corrig., formerly 'thermoglucosidasius'); transfer of Bacillus thermantarcticus to the genus as G. thermantarcticus comb. nov.; proposal of Caldibacillus debilis gen. nov., comb. nov.; transfer of G. tepidamans to Anoxybacillus as A. tepidamans comb. nov.; and proposal of Anoxybacillus caldiproteolyticus sp. nov.  

Science.gov (United States)

Sixty-two strains of thermophilic aerobic endospore-forming bacteria were subjected to polyphasic taxonomic study including 16S rRNA gene sequence analysis, polar lipid and fatty acid analysis, phenotypic characterization, and DNA-DNA hybridization experiments. Distinct clusters of the species Geobacillus stearothermophilus, Geobacillus thermodenitrificans, Geobacillus toebii and Geobacillus thermoglucosidasius were formed, allowing their descriptions to be emended, and the distinctiveness of the poorly represented species Geobacillus jurassicus, Geobacillus subterraneus and Geobacillus caldoxylosilyticus was confirmed. It is proposed that the name Geobacillus thermoglucosidasius be corrected to Geobacillus thermoglucosidans nom. corrig. Bacillus thermantarcticus clustered between Geobacillus species on the basis of 16S rRNA gene sequence analysis, and its transfer to the genus Geobacillus as Geobacillus thermantarcticus comb. nov. (type strain LMG 23032(T)=DSM 9572(T)=strain M1(T)=R-35644(T)) is proposed. The above-mentioned species, together with Geobacillus thermoleovorans and Geobacillus thermocatenulatus, form a monophyletic cluster representing the genus Geobacillus. The distinctiveness of 'Geobacillus caldoproteolyticus' was confirmed and it is proposed that it be accommodated, along with Geobacillus tepidamans, in the genus Anoxybacillus as Anoxybacillus caldiproteolyticus sp. nov. (type strain DSM 15730(T)=ATCC BAA-818(T)=LMG 26209(T)=R-35652(T)) and Anoxybacillus tepidamans comb. nov. (type strain LMG 26208(T)=ATCC BAA-942(T)=DSM 16325(T)=R-35643(T)), respectively. The type strain of Geobacillus debilis was not closely related to any members of the genera Anoxybacillus and Geobacillus, and it is proposed that this species be placed in the new genus Caldibacillus as Caldibacillus debilis gen. nov. comb. nov. The type strain of the type species, Caldibacillus debilis, is LMG 23386(T) (=DSM 16016(T)=NCIMB 13995(T)=Tf(T)=R-35653(T)). PMID:21856988

Coorevits, An; Dinsdale, Anna E; Halket, Gillian; Lebbe, Liesbeth; De Vos, Paul; Van Landschoot, Anita; Logan, Niall A

2012-07-01

12

Substrate-ligand interactions in Geobacillus stearothermophilus nitric oxide synthase.  

Science.gov (United States)

Nitric oxide synthase (NOS) generates NO via a sequential two-step reaction [l-arginine (l-Arg) --> N-hydroxy-l-arginine (NOHA) --> l-citrulline + NO]. Each step of the reaction follows a distinct mechanism defined by the chemical environment introduced by each substrate bound to the heme active site. The dioxygen complex of the NOS enzyme from a thermophilic bacterium, Geobacillus stearothermophilus (gsNOS), is unusually stable; hence, it provides a unique model for the studies of the mechanistic differences between the two steps of the NOS reaction. By using CO as a structural probe, we found that gsNOS exhibits two conformations in the absence of substrate, as indicated by the presence of two sets of nu(Fe-CO)/nu(C-O) modes in the resonance Raman spectra. In the nu(Fe-CO) versus nu(C-O) inverse correlation plot, one set of data falls on the correlation line characterized by mammalian NOSs (mNOS), whereas the other set of data lies on a new correlation line defined by a bacterial NOS from Bacillus subtilis (bsNOS), reflecting a difference in the proximal Fe-Cys bond strength in the two conformers of gsNOS. The addition of l-Arg stabilizes the conformer associated with the mNOS correlation line, whereas NOHA stabilizes the conformer associated with the bsNOS correlation line, although both substrates introduce a positive electrostatic potential into the distal heme pocket. To assess how substrate binding affects Fe-Cys bond strength, the frequency of the Fe-Cys stretching mode of gsNOS was monitored by resonance Raman spectroscopy with 363.8 nm excitation. In the substrate-free form, the Fe-Cys stretching mode was detected at 342.5 cm(-1), similar to that of bsNOS. The binding of l-Arg and NOHA brings about a small decrease and increase in the Fe-Cys stretching frequency, respectively. The implication of these unique structural features with respect to the oxygen chemistry of NOS is discussed. PMID:18956884

Kabir, Mariam; Sudhamsu, Jawahar; Crane, Brian R; Yeh, Syun-Ru; Rousseau, Denis L

2008-11-25

13

Structural Analysis of Xylanase from Marine Thermophilic Geobacillus stearothermophilus in Tanjung Api, Poso, Indonesia  

OpenAIRE

A xylanase gene, xynA, has been cloned from thermophilic strain Geobacillus stearothermophilus, which was isolated from marine Tanjung Api, Indonesia. The polymerase chain reaction product of 1266 bp of xynA gene consisted of 1221 bp open reading frame and encoded 407 amino acids including 30 residues of signal peptide. The sequence exhibited highest identity of 98.7% in the level of amino acid, with an extracellular endo-1,4-?-xylanase from G. stearothermophilus T-6 (E-GSX T-6) of the glyco...

BUDI SAKSONO; LINDA SUKMARINI

2010-01-01

14

Kinetics of Germination of Individual Spores of Geobacillus stearothermophilus as Measured by Raman Spectroscopy and Differential Interference Contrast Microscopy  

OpenAIRE

Geobacillus stearothermophilus is a gram-positive, thermophilic bacterium, spores of which are very heat resistant. Raman spectroscopy and differential interference contrast microscopy were used to monitor the kinetics of germination of individual spores of G. stearothermophilus at different temperatures, and major conclusions from this work were as follows. 1) The CaDPA level of individual G. stearothermophilus spores was similar to that of Bacillus spores. However, the Raman spectra of prot...

Zhou, Tingting; Dong, Zhiyang; Setlow, Peter; Li, Yong-qing

2013-01-01

15

Isolation of Glucocardiolipins from Geobacillus stearothermophilus NRS 2004/3a  

OpenAIRE

Glucose-substituted cardiolipins account for about 4 mol% of total phospholipid extracted from exponentially grown cells of Geobacillus stearothermophilus NRS 2004/3a. Individual glucocardiolipin species exhibited differences in fatty acid substitution, with iso-C15:0 and anteiso-C17:0 prevailing. The compounds were purified to homogeneity by a novel protocol and precharacterized by matrix-assisted laser desorption ionization time-of-flight mass spectrometry.

Scha?ffer, Christina; Beckedorf, Anke I.; Scheberl, Andrea; Zayni, Sonja; Peter-katalinic?, Jasna; Messner, Paul

2002-01-01

16

Inactivation of Geobacillus stearothermophilus Spores by High-Pressure Carbon Dioxide Treatment  

OpenAIRE

High-pressure CO2 treatment has been studied as a promising method for inactivating bacterial spores. In the present study, we compared this method with other sterilization techniques, including heat and pressure treatment. Spores of Bacillus coagulans, Bacillus subtilis, Bacillus cereus, Bacillus licheniformis, and Geobacillus stearothermophilus were subjected to CO2 treatment at 30 MPa and 35°C, to high-hydrostatic-pressure treatment at 200 MPa and 65°C, or to heat treatment at 0.1 MPa an...

Watanabe, Taisuke; Furukawa, Soichi; Hirata, Junichi; Koyama, Tetsuya; Ogihara, Hirokazu; Yamasaki, Makari

2003-01-01

17

Crystal Structure of the Geobacillus stearothermophilus Carboxylesterase Est55 and Its Activation of Prodrug CPT-11  

OpenAIRE

Several mammalian carboxylesterases were shown to activate the prodrug irinotecan (CPT-11) to produce SN-38, a topoisomerase inhibitor used in cancer therapy. However, the potential use of bacterial carboxylesterases, which have the advantage of high stability, has not been explored. We present the crystal structure of the carboxyesterase Est55 from Geobacillus stearothermophilus and evaluation of its enzyme activity on CPT-11. Crystal structures were determined at pH 6.2 and 6.8 and resoluti...

Liu, Ping; Ewis, Hosam E.; Tai, Phang C.; Lu, Chung-dar; Weber, Irene T.

2006-01-01

18

Evolved ?-Galactosidases from Geobacillus stearothermophilus with Improved Transgalactosylation Yield for Galacto-Oligosaccharide Production? †  

OpenAIRE

A mutagenesis approach was applied to the ?-galactosidase BgaB from Geobacillus stearothermophilus KVE39 in order to improve its enzymatic transglycosylation of lactose into oligosaccharides. A simple screening strategy, which was based on the reduction of the hydrolysis of a potential transglycosylation product (lactosucrose), provided mutant enzymes possessing improved synthetic properties for the autocondensation product from nitrophenyl-galactoside and galacto-oligosaccharides (GOS) from...

Placier, Gae?l; Watzlawick, Hildegard; Rabiller, Claude; Mattes, Ralf

2009-01-01

19

Properties of Geobacillus stearothermophilus levansucrase as potential biocatalyst for the synthesis of levan and fructooligosaccharides.  

Science.gov (United States)

The production of levansucrase (LS) by thermophilic Geobacillus stearothermophilus was investigated. LS production was more effective in the presence of sucrose (1%, w/v) than fructose, glucose, glycerol or raffinose. The results (Top 57°C; stable for 6 h at 47°C) indicate the high stability of the transfructosylation activity of G. stearothermophilus LS as compared with LSs from other microbial sources. Contrary to temperature, the pH had a significant effect on the selectivity of G. stearothermophilus LS-catalyzed reaction, favoring the transfructosylation reaction in the pH range of 6.0-6.5. The kinetic parameter study revealed that the catalytic efficiency of transfructosylation activity was higher as compared with the hydrolytic one. In addition to levan, G. stearothermophilus LS synthesized fructooligosaccharides in the presence of sucrose as the sole substrate. The results also demonstrated the wide acceptor specificity of G. stearothermophilus LS with maltose being the best fructosyl acceptor. This study is the first on the catalytic properties and the acceptor specificity of LS from G. stearothermophilus. PMID:23926090

Inthanavong, Lotthida; Tian, Feng; Khodadadi, Maryam; Karboune, Salwa

2013-01-01

20

Modeling the behavior of Geobacillus stearothermophilus ATCC 12980 throughout its life cycle as vegetative cells or spores using growth boundaries.  

Science.gov (United States)

Geobacillus stearothermophilus is recognized as one of the most prevalent micro-organism responsible for flat sour in the canned food industry. To control these highly resistant spore-forming bacteria, the heat treatment intensity could be associated with detrimental conditions for germination and outgrowth. The purpose of this work was to study successively the impact of temperature and pH on the growth rate of G. stearothermophilus ATCC 12980, its sporulation ability, its heat resistance in response to various sporulation conditions, and its recovery ability after a heat treatment. The phenotypic investigation was carried out at different temperatures and pHs on nutrient agar and the heat resistance was estimated at 115 °C. The greatest spore production and the highest heat resistances were obtained at conditions of temperature and pH allowing maximal growth rate. The current observations also revealed that growth, sporulation and recovery boundaries are close. Models using growth boundaries as main parameters were extended to describe and quantify the effect of temperature and pH throughout the life cycle of G. stearothermophilus as vegetative cells or as spore after a heat treatment and during recovery. PMID:25791003

Mtimet, Narjes; Trunet, Clément; Mathot, Anne-Gabrielle; Venaille, Laurent; Leguérinel, Ivan; Coroller, Louis; Couvert, Olivier

2015-06-01

21

Thermal adaptation of dihydrofolate reductase from the moderate thermophile Geobacillus stearothermophilus.  

Science.gov (United States)

The thermal melting temperature of dihydrofolate reductase from Geobacillus stearothermophilus (BsDHFR) is ~30 °C higher than that of its homologue from the psychrophile Moritella profunda. Additional proline residues in the loop regions of BsDHFR have been proposed to enhance the thermostability of BsDHFR, but site-directed mutagenesis studies reveal that these proline residues contribute only minimally. Instead, the high thermal stability of BsDHFR is partly due to removal of water-accessible thermolabile residues such as glutamine and methionine, which are prone to hydrolysis or oxidation at high temperatures. The extra thermostability of BsDHFR can be obtained by ligand binding, or in the presence of salts or cosolvents such as glycerol and sucrose. The sum of all these incremental factors allows BsDHFR to function efficiently in the natural habitat of G. stearothermophilus, which is characterized by temperatures that can reach 75 °C. PMID:24730604

Guo, Jiannan; Luk, Louis Y P; Loveridge, E Joel; Allemann, Rudolf K

2014-05-01

22

Transformable facultative thermophile Geobacillus stearothermophilus NUB3621 as a host strain for metabolic engineering.  

Science.gov (United States)

Metabolic engineers develop inexpensive enantioselective syntheses of high-value compounds, but their designs are sometimes confounded by the misfolding of heterologously expressed proteins. Geobacillus stearothermophilus NUB3621 is a readily transformable facultative thermophile. It could be used to express and properly fold proteins derived from its many mesophilic or thermophilic Bacillaceae relatives or to direct the evolution of thermophilic variants of mesophilic proteins. Moreover, its capacity for high-temperature growth should accelerate chemical transformation rates in accordance with the Arrhenius equation and reduce the risks of microbial contamination. Its tendency to sporulate in response to nutrient depletion lowers the costs of storage and transportation. Here, we present a draft genome sequence of G. stearothermophilus NUB3621 and describe inducible and constitutive expression plasmids that function in this organism. These tools will help us and others to exploit the natural advantages of this system for metabolic engineering applications. PMID:24788326

Blanchard, Kristen; Robic, Srebrenka; Matsumura, Ichiro

2014-08-01

23

Kinetics of CO Recombination to the Heme in Geobacillus Stearothermophilus Nitric Oxide Synthase†  

OpenAIRE

We report the kinetics of CO rebinding to the heme in His134Ser, Ile223Val and His134Ser/Ile223Ser mutants of Geobacillus stearothermophilus nitric oxide synthase (gsNOS). The amplitudes of the two observed kinetics phases, which are insensitive to CO concentration, depend on enzyme concentration. We suggest that two forms of gsNOS are in equilibrium under the conditions employed (6.1–27 µM gsNOS with 20 or 100% CO atmosphere). The kinetics of CO rebinding to the heme do not depend on the ...

Whited, Charlotte A.; Warren, Jeffrey J.; Lavoie, Katherine D.; Winkler, Jay R.; Gray, Harry B.

2012-01-01

24

Kinetics of CO Recombination to the Heme in Geobacillus Stearothermophilus Nitric Oxide Synthase.  

Science.gov (United States)

We report the kinetics of CO rebinding to the heme in His134Ser, Ile223Val and His134Ser/Ile223Ser mutants of Geobacillus stearothermophilus nitric oxide synthase (gsNOS). The amplitudes of the two observed kinetics phases, which are insensitive to CO concentration, depend on enzyme concentration. We suggest that two forms of gsNOS are in equilibrium under the conditions employed (6.1-27 µM gsNOS with 20 or 100% CO atmosphere). The kinetics of CO rebinding to the heme do not depend on the identity of the NO-gate residues at positions 134 and 223. PMID:23976816

Whited, Charlotte A; Warren, Jeffrey J; Lavoie, Katherine D; Winkler, Jay R; Gray, Harry B

2013-07-13

25

Analysis of the tryptophanase expression in Symbiobacterium thermophilum in a coculture with Geobacillus stearothermophilus.  

Science.gov (United States)

The tryptophanase-positive Symbiobacterium thermophilum is a free-living syntrophic bacterium that grows effectively in a coculture with Geobacillus stearothermophilus. Our studies have shown that S. thermophilum growth depends on the high CO2 and low O2 condition established by the precedent growth of G. stearothermophilus. The use of an anoxic atmosphere containing high CO2 allows S. thermophilum to grow independently of G. stearothermophilus, but the cellular yield is ten times lower than that achieved in the coculture. In this study, we characterized the coculture-dependent expression and activity of tryptophanase in S. thermophilum. S. thermophilum cells accumulated a marked amount of indole in a coculture with G. stearothermophilus, but not in the bacterium's pure culture irrespective of the addition of tryptophan. S. thermophilum cells accumulated indole in its pure culture consisting of conditioned medium (medium supplied with culture supernatant of G. stearothermophilus). Proteomic analysis identified the protein specifically produced in the S. thermophilum cells grown in conditioned medium, which was a tryptophanase encoded by tna2 (STH439). An attempt to isolate the tryptophanase-inducing component from the culture supernatant of G. stearothermophilus was unsuccessful, but we did discover that the indole accumulation occurs when 10 mM bicarbonate is added to the medium. RT-PCR analysis showed that the addition of bicarbonate stimulated transcription of tna2. The transcriptional start site, identified within the tna2 promoter, was preceded by the -24 and -12 consensus sequences specified by an alternative sigma factor, ?(54). The evidence suggests that the transcription of some genes involved in amino acid metabolism is ?(54)-dependent, and that a bacterial enhancer-binding protein containing a PAS domain controls the transcription under the presence of high levels of bicarbonate. PMID:25200839

Watsuji, Tomo-O; Takano, Hideaki; Yamabe, Tomoya; Tamazawa, Satoshi; Ikemura, Hiroka; Ohishi, Takanori; Matsuda, Tohyo; Shiratori-Takano, Hatsumi; Beppu, Teruhiko; Ueda, Kenji

2014-12-01

26

A Group IIC-Type Intron Interrupts the rRNA Methylase Gene of Geobacillus stearothermophilus Strain 10?  

OpenAIRE

Group IIC introns insert next to the stem-loop structure of rho-independent transcription terminators, thus avoiding intact genes. The insertion sites of 17 copies of the G.st.I1 intron from Geobacillus stearothermophilus were compared. One copy of the intron was found to interrupt an open reading frame (ORF) encoding an rRNA methylase.

Moretz, Samuel E.; Lampson, Bert C.

2010-01-01

27

Structural Analysis of Xylanase from Marine Thermophilic Geobacillus stearothermophilus in Tanjung Api, Poso, Indonesia  

Directory of Open Access Journals (Sweden)

Full Text Available A xylanase gene, xynA, has been cloned from thermophilic strain Geobacillus stearothermophilus, which was isolated from marine Tanjung Api, Indonesia. The polymerase chain reaction product of 1266 bp of xynA gene consisted of 1221 bp open reading frame and encoded 407 amino acids including 30 residues of signal peptide. The sequence exhibited highest identity of 98.7% in the level of amino acid, with an extracellular endo-1,4-?-xylanase from G. stearothermophilus T-6 (E-GSX T-6 of the glycoside hydrolase family 10 (GH10. A comparative study between the local strain G. stearothermophilus (GSX L and E-GSX T-6 on homology of amino acid sequence indicated five differents amino acids in the gene. They were Threonine/Alanine (T/A, Asparagine/Aspartate (N/D, Lysine/Asparagine (K/N, Isoleucine/Methionine (I/M, Serine/Threonine (S/T at the position 220, 227, 228, 233, and 245, respectively. Protein structural analysis of those differences suggested that those amino acids may play role in biochemical properties such as enzyme stability, in particular its thermostability.

BUDI SAKSONO

2010-12-01

28

Quantitative assessment of the risk of microbial spoilage in foods. Prediction of non-stability at 55 °C caused by Geobacillus stearothermophilus in canned green beans.  

Science.gov (United States)

Microbial spoilage of canned foods by thermophilic and highly heat-resistant spore-forming bacteria, such as Geobacillus stearothermophilus, is a persistent problem in the food industry. An incubation test at 55 °C for 7 days, then validation of biological stability, is used as an indicator of compliance with good manufacturing practices. We propose a microbial risk assessment model predicting the percentage of non-stability due to G. stearothermophilus in canned green beans manufactured by a French company. The model accounts for initial microbial contaminations of fresh unprocessed green beans with G. stearothermophilus, cross-contaminations in the processing chain, inactivation processes and probability of survival and growth. The sterilization process is modeled by an equivalent heating time depending on sterilization value F? and on G. stearothermophilus resistance parameter z(T). Following the recommendations of international organizations, second order Monte-Carlo simulations are used, separately propagating uncertainty and variability on parameters. As a result of the model, the mean predicted non-stability rate is of 0.5%, with a 95% uncertainty interval of [0.1%; 1.2%], which is highly similar to data communicated by the French industry. A sensitivity analysis based on Sobol indices and some scenario tests underline the importance of cross-contamination at the blanching step, in addition to inactivation due to the sterilization process. PMID:24334097

Rigaux, Clémence; André, Stéphane; Albert, Isabelle; Carlin, Frédéric

2014-02-01

29

Keratinous waste decomposition and peptide production by keratinase from Geobacillus stearothermophilus AD-11.  

Science.gov (United States)

A keratinolytic proteinase was cloned from thermophilic bacterium Geobacillus stearothermophilus AD-11 and was expressed in Escherichia coli BL21(DE3). Recombinant keratinolytic proteinase (RecGEOker) with an estimated molecular weight of 57kDa was purified and keratinase activity was measured. RecGEOker showed optimal activity at pH 9 and 60°C. Recombinant keratinolytic proteinase showed the highest substrate specificity toward keratin from wool>collagen>sodium caseinate>gelatin>and BSA in descending order. RecGEOker is applicable for efficient keratin waste biodegradation and can replace conventional non-biological hydrolysis processes. High-value small peptides obtained from enzymatic biodegradation by RecGEOker are suitable for industrial application in white and/or green biotechnology for use as major additives in various products. PMID:25625783

Gegeckas, Audrius; Gudiukait?, Renata; Debski, Janusz; Citavicius, Donaldas

2015-04-01

30

In situ investigation of Geobacillus stearothermophilus spore germination and inactivation mechanisms under moderate high pressure.  

Science.gov (United States)

Bacterial spores are a major concern for food safety due to their high resistance to conventional preservation hurdles. Innovative hurdles can trigger bacterial spore germination or inactivate them. In this work, Geobacillus stearothermophilus spore high pressure (HP) germination and inactivation mechanisms were investigated by in situ infrared spectroscopy (FT-IR) and fluorometry. G. stearothermophilus spores' inner membrane (IM) was stained with Laurdan fluorescent dye. Time-dependent FT-IR and fluorescence spectra were recorded in situ under pressure at different temperatures. The Laurdan spectrum is affected by the lipid packing and level of hydration, and provided information on the IM state through the Laurdan generalized polarization. Changes in the -CH2 and -CH3 asymmetric stretching bands, characteristic of lipids, and in the amide I' band region, characteristic of proteins' secondary structure elements, enabled evaluation of the impact of HP on endospores lipid and protein structures. These studies were complemented by ex situ analyses (plate counts and microscopy). The methods applied showed high potential to identify germination mechanisms, particularly associated to the IM. Germination up to 3 log10 was achieved at 200 MPa and 55 °C. A molecular-level understanding of these mechanisms is important for the development and validation of multi-hurdle approaches to achieve commercial sterility. PMID:24750808

Georget, Erika; Kapoor, Shobhna; Winter, Roland; Reineke, Kai; Song, Youye; Callanan, Michael; Ananta, Edwin; Heinz, Volker; Mathys, Alexander

2014-08-01

31

Tryptophan Oxidative Metabolism Catalyzed by Geobacillus Stearothermophilus: A Thermophile Isolated from Kuwait Soil Contaminated with Petroleum Hydrocarbons  

OpenAIRE

Tryptophan metabolism has been extensively studied in humans as well as in soil. Its metabolism takes place mainly through kynurenine pathway yielding hydroxylated, deaminated and many other products of physiological significance. However, tryptophan metabolism has not been studied in an isolated thermophilic bacterium. Geobacillus stearothermophilus is a local thermophile isolated from Kuwait desert soil contaminated with petroleum hydrocarbons. The bacterium grows well at 65 °C in 0.05 M p...

Al-hassan, Jassim M.; Samira Al-Awadi; Sosamma Oommen; Abdulaziz Alkhamis; Mohammad Afzal

2011-01-01

32

Purification and characterization of cloned alkaline protease gene of Geobacillus stearothermophilus.  

Science.gov (United States)

Thermostable alkaline serine protease gene of Geobacillus stearothermophilus B-1172 was cloned and expressed in Escherichia coli BL21 (DE3) using pET-22b(+), as an expression vector. The growth conditions were optimized for maximal production of the protease using variable fermentation parameters, i.e., pH, temperature, and addition of an inducer. Protease, thus produced, was purified by ammonium sulfate precipitation followed by ion exchange chromatography with 13.7-fold purification, with specific activity of 97.5?U?mg(-1) , and a recovery of 23.6%. Molecular weight of the purified protease, 39?kDa, was determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). The enzyme was stable at 90?°C at pH 9. The enzyme activity was steady in the presence of EDTA indicating that the protease was not a metalloprotease. No significant change in the activity of protease after addition of various metal ions further strengthened this fact. However, an addition of 1% Triton X-100 or SDS surfactants constrained the enzyme specific activity to 34 and 19%, respectively. Among organic solvents, an addition of 1-butanol (20%) augmented the enzyme activity by 29% of the original activity. With casein as a substrate, the enzyme activity under optimized conditions was found to be 73.8?U?mg(-1) . The effect of protease expression on the host cells growth was also studied and found to negatively affect E. coli cells to certain extent. Catalytic domains of serine proteases from eight important thermostable organisms were analyzed through WebLogo and found to be conserved in all serine protease sequences suggesting that protease of G. stearothermophilus could be beneficially used as a biocontrol agent and in many industries including detergent industry. PMID:25224381

Iqbal, Irfana; Aftab, Muhammad Nauman; Afzal, Mohammed; Ur-Rehman, Asad; Aftab, Saima; Zafar, Asma; Ud-Din, Zia; Khuharo, Ateeque Rahman; Iqbal, Jawad; Ul-Haq, Ikram

2015-02-01

33

Crystal structure and ligand binding properties of the truncated hemoglobin from Geobacillus stearothermophilus.  

Science.gov (United States)

A novel truncated hemoglobin has been identified in the thermophilic bacterium Geobacillus stearothermophilus (Gs-trHb). The protein has been expressed in Escherichia coli, the 3D crystal structure (at 1.5 Angstroms resolution) and the ligand binding properties have been determined. The distal heme pocket displays an array of hydrogen bonding donors to the iron-bound ligands, including Tyr-B10 on one side of the heme pocket and Trp-G8 indole nitrogen on the opposite side. At variance with the highly similar Bacillus subtilis hemoglobin, Gs-trHb is dimeric both in the crystal and in solution and displays several unique structural properties. In the crystal cell, the iron-bound ligand is not homogeneously distributed within each distal site such that oxygen and an acetate anion can be resolved with relative occupancies of 50% each. Accordingly, equilibrium titrations of the oxygenated derivative in solution with acetate anion yield a partially saturated ferric acetate adduct. Moreover, the asymmetric unit contains two subunits and sedimentation velocity ultracentrifugation data confirm that the protein is dimeric. PMID:17126283

Ilari, Andrea; Kjelgaard, Peter; von Wachenfeldt, Claes; Catacchio, Bruno; Chiancone, Emilia; Boffi, Alberto

2007-01-01

34

Structure of a His170Tyr mutant of thermostable pNPPase from Geobacillus stearothermophilus.  

Science.gov (United States)

Using directed evolution based on random mutagenesis and heat-treated selection, a thermostable His170Tyr mutant of Geobacillus stearothermophilus thermostable p-nitrophenylphosphatase (TpNPPase) was obtained. The temperature at which the His170Tyr mutant lost 50% of its activity (T1/2) was found to be 4.40?K higher than that of wild-type TpNPPase, and the melting temperature of the His170Tyr mutant increased by 2.39?K. The crystal structure of the His170Tyr mutant was then determined at 2.0?Å resolution in the presence of a sodium ion and a sulfate ion in the active site. The cap domain of chain B shows a half-closed conformation. The hydrophobic side chain of the mutated residue, the hydroxyphenyl group, forms a hydrophobic contact with the methyl group of Ala166. This hydrophobic interaction was found using the Protein Interactions Calculator (PIC) web server with an interaction distance of 4.6?Å, and might be a key factor in the thermostabilization of the His170Tyr mutant. This study potentially offers a molecular basis for both investigation of the catalytic mechanism and thermostable protein engineering. PMID:24915075

Shen, Tiantian; Guo, Zheng; Ji, Chaoneng

2014-06-01

35

Structure-Specificity Relationships of an Intracellular Xylanase from Geobacillus stearothermophilus  

Energy Technology Data Exchange (ETDEWEB)

Geobacillus stearothermophilus T-6 is a thermophilic Gram-positive bacterium that produces two selective family 10 xylanases which both take part in the complete degradation and utilization of the xylan polymer. The two xylanases exhibit significantly different substrate specificities. While the extracellular xylanase (XT6; MW 43.8 kDa) hydrolyzes the long and branched native xylan polymer, the intracellular xylanase (IXT6; MW 38.6 kDa) preferentially hydrolyzes only short xylo-oligosaccharides. In this study, the detailed three-dimensional structure of IXT6 is reported, as determined by X-ray crystallography. It was initially solved by molecular replacement and then refined at 1.45 {angstrom} resolution to a final R factor of 15.0% and an R{sub free} of 19.0%. As expected, the structure forms the classical ({alpha}/{beta}){sub 8} fold, in which the two catalytic residues (Glu134 and Glu241) are located on the inner surface of the central cavity. The structure of IXT6 was compared with the highly homologous extracellular xylanase XT6, revealing a number of structural differences between the active sites of the two enzymes. In particular, structural differences derived from the unique subdomain in the carboxy-terminal region of XT6, which is completely absent in IXT6. These structural modifications may account for the significant differences in the substrate specificities of these otherwise very similar enzymes.

Solomon,V.; Teplitsky, A.; Shulami, S.; Zolotnitsky, G.; Shoham, Y.; Shoham, G.

2007-01-01

36

The Geobacillus stearothermophilus V iscS Gene, Encoding Cysteine Desulfurase, Confers Resistance to Potassium Tellurite in Escherichia coli K-12  

OpenAIRE

Many eubacteria are resistant to the toxic oxidizing agent potassium tellurite, and tellurite resistance involves diverse biochemical mechanisms. Expression of the iscS gene from Geobacillus stearothermophilus V, which is naturally resistant to tellurite, confers tellurite resistance in Escherichia coli K-12, which is naturally sensitive to tellurite. The G. stearothermophilus iscS gene encodes a cysteine desulfurase. A site-directed mutation in iscS that prevents binding of its pyridoxal pho...

Tantalea?n, Juan C.; Araya, Manuel A.; Saavedra, Claudia P.; Fuentes, Derie E.; Pe?rez, Jose? M.; Caldero?n, Iva?n L.; Youderian, Philip; Va?squez, Claudio C.

2003-01-01

37

A Two-Component System Regulates the Expression of an ABC Transporter for Xylo-Oligosaccharides in Geobacillus stearothermophilus?  

OpenAIRE

Geobacillus stearothermophilus T-6 utilizes an extensive and highly regulated hemicellulolytic system. The genes comprising the xylanolytic system are clustered in a 39.7-kb chromosomal segment. This segment contains a 6-kb transcriptional unit (xynDCEFG) coding for a potential two-component system (xynDC) and an ATP-binding cassette (ABC) transport system (xynEFG). The xynD promoter region contains a 16-bp inverted repeat resembling the operator site for the xylose repressor, XylR. XylR was ...

Shulami, Smadar; Zaide, Galia; Zolotnitsky, Gennady; Langut, Yael; Feld, Geoff; Sonenshein, Abraham L.; Shoham, Yuval

2006-01-01

38

Draft Genome Sequences of Geobacillus stearothermophilus Strains 22 and 53, Isolated from the Garga Hot Spring in the Barguzin River Valley of the Russian Federation.  

Science.gov (United States)

Geobacillus stearothermophilus strains 22 and 53 were isolated from sediment samples isolated from the Garga hot spring (72°C) located in the valley of the river Barguzin (the Baikal region, Russian Federation) (54°19'3.72?N, 110°59'38.4?E). PMID:25414504

Rozanov, Aleksey S; Logacheva, Maria D; Peltek, Sergey E

2014-01-01

39

Draft Genome Sequences of Geobacillus stearothermophilus Strains 22 and 53, Isolated from the Garga Hot Spring in the Barguzin River Valley of the Russian Federation  

OpenAIRE

Geobacillus stearothermophilus strains 22 and 53 were isolated from sediment samples isolated from the Garga hot spring (72°C) located in the valley of the river Barguzin (the Baikal region, Russian Federation) (54°19?3.72?N, 110°59?38.4?E).

Rozanov, Aleksey S.; Logacheva, Maria D.; Peltek, Sergey E.

2014-01-01

40

Development of a Multiplex-PCR assay for the rapid identification of Geobacillus stearothermophilus and Anoxybacillus flavithermus.  

Science.gov (United States)

The presence of thermophilic bacilli in dairy products is indicator of poor hygiene. Their rapid detection and identification is fundamental to improve the industrial reactivity in the implementation of corrective and preventive actions. In this study a rapid and reliable identification of Geobacillus stearothermophilus and Anoxybacillus flavithermus was achieved by species-specific PCR assays. Two primer sets, targeting the ITS 16S-23S rRNA region and the rpoB gene sequence of the target species respectively, were employed. Species-specificity of both primer sets was evaluated by using 53 reference strains of DSMZ collection; among them, 13 species of the genus Geobacillus and 15 of the genus Anoxybacillus were represented. Moreover, 99 wild strains and 23 bulk cells collected from 24 infant formula powders gathered from several countries worldwide were included in the analyses. Both primer sets were highly specific and the expected PCR fragments were obtained only when DNA from G. stearothermophilus or A. flavithermus was used. After testing their specificity, they were combined in a Multiplex-PCR assay for the simultaneous identification of the two target species. The specificity of the Multiplex-PCR was evaluated by using both wild strains and bulk cells. Every analysis confirmed the reliable identification results provided by the single species-specific PCR methodology. The easiness, the rapidity (about 4 h from DNA isolation to results) and the reliability of the PCR procedures developed in this study highlight the advantage of their application for the specific detection and identification of the thermophilic species G. stearothermophilus and A. flavithermus. PMID:24929881

Pennacchia, Carmela; Breeuwer, Pieter; Meyer, Rolf

2014-10-01

41

A unique octameric structure of Axe2, an intracellular acetyl-xylooligosaccharide esterase from Geobacillus stearothermophilus.  

Science.gov (United States)

Geobacillus stearothermophilus T6 is a thermophilic, Gram-positive soil bacterium that possesses an extensive and highly regulated hemicellulolytic system, allowing the bacterium to efficiently degrade high-molecular-weight polysaccharides such as xylan, arabinan and galactan. As part of the xylan-degradation system, the bacterium uses a number of side-chain-cleaving enzymes, one of which is Axe2, a 219-amino-acid intracellular serine acetylxylan esterase that removes acetyl side groups from xylooligosaccharides. Bioinformatic analyses suggest that Axe2 belongs to the lipase GDSL family and represents a new family of carbohydrate esterases. In the current study, the detailed three-dimensional structure of Axe2 is reported, as determined by X-ray crystallography. The structure of the selenomethionine derivative Axe2-Se was initially determined by single-wavelength anomalous diffraction techniques at 1.70?Å resolution and was used for the structure determination of wild-type Axe2 (Axe2-WT) and the catalytic mutant Axe2-S15A at 1.85 and 1.90?Å resolution, respectively. These structures demonstrate that the three-dimensional structure of the Axe2 monomer generally corresponds to the SGNH hydrolase fold, consisting of five central parallel ?-sheets flanked by two layers of helices (eight ?-helices and five 310-helices). The catalytic triad residues, Ser15, His194 and Asp191, are lined up along a substrate channel situated on the concave surface of the monomer. Interestingly, the Axe2 monomers are assembled as a `doughnut-shaped' homo-octamer, presenting a unique quaternary structure built of two staggered tetrameric rings. The eight active sites are organized in four closely situated pairs, which face the relatively wide internal cavity. The biological relevance of this octameric structure is supported by independent results obtained from gel-filtration, TEM and SAXS experiments. These data and their comparison to the structural data of related hydrolases are used for a more general discussion focusing on the structure-function relationships of enzymes of this category. PMID:24531461

Lansky, Shifra; Alalouf, Onit; Solomon, Hodaya Vered; Alhassid, Anat; Govada, Lata; Chayen, Naomi E; Belrhali, Hassan; Shoham, Yuval; Shoham, Gil

2014-02-01

42

Plasma sterilization of Geobacillus Stearothermophilus by O{mathsf2}:N{mathsf2} RF inductively coupled plasma  

Science.gov (United States)

The aim of this work is to identify the main process responsible for sterilization of Geobacillus Stearothermophilus spores in O{2}:N{2} RF inductively coupled plasma. In order to meet this objective the sterilization efficiencies of discharges in mixtures differing in the initial O{2}/N{2} ratios are compared with plasma properties and with scanning electron microscopy images of treated spores. According to the obtained results it can be concluded that under our experimental conditions the time needed to reach complete sterilization is more related to O atom density than UV radiation intensity, i.e. complete sterilization is not related only to DNA damage as in UV sterilization but more likely to the etching of the spore.

Kylián, O.; Sasaki, T.; Rossi, F.

2006-05-01

43

Cloning of araA Gene Encoding L-Arabinose Isomerase from Marine Geobacillus stearothermophilus Isolated from Tanjung Api, Poso, Indonesia  

OpenAIRE

L-arabinose isomerase is an enzyme converting D-galactose to D-tagatose. D-tagatose is a potential sweetener-sucrose substitute which has low calorie. This research was to clone and sequence araA gene from marine bacterial strain Geobacillus stearothermophilus isolated from Tanjung Api Poso Indonesia. The amplified araA gene consisted of 1494 bp nucleotides encoding 497 amino acids. DNA alignment analysis showed that the gene had high homology with that of G. stearothermophilus T6. The enzyme...

DEWI FITRIANI; BUDI SAKSONO

2010-01-01

44

Cloning of araA Gene Encoding L-Arabinose Isomerase from Marine Geobacillus stearothermophilus Isolated from Tanjung Api, Poso, Indonesia  

Directory of Open Access Journals (Sweden)

Full Text Available L-arabinose isomerase is an enzyme converting D-galactose to D-tagatose. D-tagatose is a potential sweetener-sucrose substitute which has low calorie. This research was to clone and sequence araA gene from marine bacterial strain Geobacillus stearothermophilus isolated from Tanjung Api Poso Indonesia. The amplified araA gene consisted of 1494 bp nucleotides encoding 497 amino acids. DNA alignment analysis showed that the gene had high homology with that of G. stearothermophilus T6. The enzyme had optimum activity at high temperature and alkalin condition.

DEWI FITRIANI

2010-06-01

45

Geobacillus stearothermophilus LV cadA gene mediates resistance to cadmium, lead and zinc in zntA mutants of Salmonella entérica serovar Typhimurium  

OpenAIRE

Salmonella entérica serovar Typhimurium cells expressing the cadA gene of Geobacillus stearothermophilus LV exhibit a hypersensitive phenotype to cadmium chloride. Deletion of the ORF STM3576 from the Salmonella genome resulted in cadmium, lead and zinc sensitivity, confirming that this ORF is a homologue of the zntA gene. The observed sensitivity was reverted upon expression of the G. stearothermophilus LV cadA gene. These results indicate that the cadA gene product is involved in Cd, Pb an...

Pe?rez, Jose? M.; Praden?as, Gonzalo A.; Navarro, Claudio A.; Henri?quez, Daniel R.; Pichuantes, Sergio E.; Va?squez, Claudio C.

2006-01-01

46

Three-dimensional structure of a variant `Termamyl-like' Geobacillus stearothermophilus ?-amylase at 1.9?Å resolution.  

Science.gov (United States)

The enzyme-catalysed degradation of starch is central to many industrial processes, including sugar manufacture and first-generation biofuels. Classical biotechnological platforms involve steam explosion of starch followed by the action of endo-acting glycoside hydrolases termed ?-amylases and then exo-acting ?-glucosidases (glucoamylases) to yield glucose, which is subsequently processed. A key enzymatic player in this pipeline is the `Termamyl' class of bacterial ?-amylases and designed/evolved variants thereof. Here, the three-dimensional structure of one such Termamyl ?-amylase variant based upon the parent Geobacillus stearothermophilus ?-amylase is presented. The structure has been solved at 1.9?Å resolution, revealing the classical three-domain fold stabilized by Ca2+ and a Ca2+-Na+-Ca2+ triad. As expected, the structure is similar to the G. stearothermophilus ?-amylase but with main-chain deviations of up to 3?Å in some regions, reflecting both the mutations and differing crystal-packing environments. PMID:25615972

Offen, Wendy A; Viksoe-Nielsen, Anders; Borchert, Torben V; Wilson, Keith S; Davies, Gideon J

2015-01-01

47

Effect of Dimer Dissociation on Activity and Thermostability of the ?-Glucuronidase from Geobacillus stearothermophilus: Dissecting the Different Oligomeric Forms of Family 67 Glycoside Hydrolases  

OpenAIRE

The oligomeric organization of enzymes plays an important role in many biological processes, such as allosteric regulation, conformational stability and thermal stability. ?-Glucuronidases are family 67 glycosidases that cleave the ?-1,2-glycosidic bond between 4-O-methyl-d-glucuronic acid and xylose units as part of an array of hemicellulose-hydrolyzing enzymes. Currently, two crystal structures of ?-glucuronidases are available, those from Geobacillus stearothermophilus (AguA) and from C...

Shallom, Dalia; Golan, Gali; Shoham, Gil; Shoham, Yuval

2004-01-01

48

Highly Stable l-Lysine 6-Dehydrogenase from the Thermophile Geobacillus stearothermophilus Isolated from a Japanese Hot Spring: Characterization, Gene Cloning and Sequencing, and Expression  

OpenAIRE

l-Lysine dehydrogenase, which catalyzes the oxidative deamination of l-lysine in the presence of NAD, was found in the thermophilic bacterium Geobacillus stearothermophilus UTB 1103 and then purified about 3,040-fold from a crude extract of the organism by using four successive column chromatography steps. This is the first report showing the presence of a thermophilic NAD-dependent lysine dehydrogenase. The product of the enzyme catalytic activity was determined to be ?1-piperideine-6-carbo...

Heydari, Mojgan; Ohshima, Toshihisa; Nunoura-kominato, Naoki; Sakuraba, Haruhiko

2004-01-01

49

Taxonomic study of aerobic thermophilic bacilli: descriptions of Geobacillus subterraneus gen. nov., sp. nov. and Geobacillus uzenensis sp. nov. from petroleum reservoirs and transfer of Bacillus stearothermophilus, Bacillus thermocatenulatus, Bacillus thermoleovorans, Bacillus kaustophilus, Bacillus thermodenitrificans to Geobacillus as the new combinations G. stearothermophilus, G. th.  

Science.gov (United States)

Five hydrocarbon-oxidizing strains were isolated from formation waters of oilfields in Russia, Kazakhstan and China. These strains were moderately thermophilic, neutrophilic, motile, spore-forming rods, aerobic or facultatively anaerobic. The G+C content of their DNA ranged from 49.7 to 52.3 mol%. The major isoprenoid quinone was menaquinone-7; cellular fatty acid profiles consisted of significant amounts of iso-15:0, iso-16:0 and iso-17:0 fatty acids (61.7-86.8% of the total). Based on data from 16S rDNA analysis and DNA-DNA hybridization, the subsurface isolates could be divided into two groups, one of which consisted of strains UT and X and the other of which consisted of strains K, Sam and 34T. The new strains exhibited a close phylogenetic relationship to thermophilic bacilli of 'Group 5' of Ash et al. [Ash, C., Farrow, J. A. E., Wallbanks, S. & Collins, M. D. (1991). Lett Appl Microbiol 13, 202-206] and a set of corresponding signature positions of 16S rRNA. Comparative analysis of the 16S rDNA sequences and fatty acid compositions of the novel isolates and established species of thermophilic bacilli indicated that the subsurface strains represent two new species within a new genus, for which the names Geobacillus subterraneus gen. nov., sp. nov., and Geobacillus uzenensis sp. nov. are proposed. It is also proposed that Bacillus stearothermophilus, Bacillus thermoleovorans, Bacillus thermocatenulatus, Bacillus kaustophilus, Bacillus thermoglucosidasius and Bacillus thermodenitrificans be transferred to this new genus, with Geobacillus stearothermophilus (formerly Bacillus stearothermophilus) as the type species. PMID:11321089

Nazina, T N; Tourova, T P; Poltaraus, A B; Novikova, E V; Grigoryan, A A; Ivanova, A E; Lysenko, A M; Petrunyaka, V V; Osipov, G A; Belyaev, S S; Ivanov, M V

2001-03-01

50

Crystallization and preliminary crystallographic analysis of GanB, a GH42 intracellular ?-galactosidase from Geobacillus stearothermophilus.  

Science.gov (United States)

Geobacillus stearothermophilus T-6 is a Gram-positive thermophilic soil bacterium that contains a multi-enzyme system for the utilization of plant cell-wall polysaccharides, including xylan, arabinan and galactan. The bacterium uses a number of endo-acting extracellular enzymes that break down the high-molecular-weight polysaccharides into decorated oligosaccharides. These oligosaccharides enter the cell and are further hydrolyzed into sugar monomers by a set of intracellular glycoside hydrolases. One of these intracellular degrading enzymes is GanB, a glycoside hydrolase family 42 ?-galactosidase capable of hydrolyzing short ?-1,4-galactosaccharides to galactose. GanB and related enzymes therefore play an important part in the hemicellulolytic utilization system of many microorganisms which use plant biomass for growth. The interest in the biochemical characterization and structural analysis of these enzymes stems from their potential biotechnological applications. GanB from G. stearothermophilus T-6 has recently been cloned, overexpressed, purified, biochemically characterized and crystallized in our laboratory as part of its complete structure-function study. The best crystals obtained for this enzyme belong to the primitive orthorhombic space group P2?2?2?, with average crystallographic unit-cell parameters of a=71.84, b=181.35, c=196.57?Å. Full diffraction data sets to 2.45 and 2.50?Å resolution have been collected for both the wild-type enzyme and its E323A nucleophile catalytic mutant, respectively, as measured from flash-cooled crystals at 100?K using synchrotron radiation. These data are currently being used for the full three-dimensional crystal structure determination of GanB. PMID:24100561

Solomon, Hodaya V; Tabachnikov, Orly; Feinberg, Hadar; Govada, Lata; Chayen, Naomi E; Shoham, Yuval; Shoham, Gil

2013-10-01

51

Protein isotope effects in dihydrofolate reductase from Geobacillus stearothermophilus show entropic-enthalpic compensatory effects on the rate constant.  

Science.gov (United States)

Catalysis by dihydrofolate reductase from the moderately thermophilic bacterium Geobacillus stearothermophilus (BsDHFR) was investigated by isotope substitution of the enzyme. The enzyme kinetic isotope effect for hydride transfer was close to unity at physiological temperatures but increased with decreasing temperatures to a value of 1.65 at 5 °C. This behavior is opposite to that observed for DHFR from Escherichia coli (EcDHFR), where the enzyme kinetic isotope effect increased slightly with increasing temperature. These experimental results were reproduced in the framework of variational transition-state theory that includes a dynamical recrossing coefficient that varies with the mass of the protein. Our simulations indicate that BsDHFR has greater flexibility than EcDHFR on the ps-ns time scale, which affects the coupling of the environmental motions of the protein to the chemical coordinate and consequently to the recrossing trajectories on the reaction barrier. The intensity of the dynamic coupling in DHFRs is influenced by compensatory temperature-dependent factors, namely the enthalpic barrier needed to achieve an ideal transition-state configuration with minimal nonproductive trajectories and the protein disorder that disrupts the electrostatic preorganization required to stabilize the transition state. Together with our previous studies of other DHFRs, the results presented here provide a general explanation why protein dynamic effects vary between enzymes. Our theoretical treatment demonstrates that these effects can be satisfactorily reproduced by including a transmission coefficient in the rate constant calculation, whose dependence on temperature is affected by the protein flexibility. PMID:25396728

Luk, Louis Y P; Ruiz-Pernía, J Javier; Dawson, William M; Loveridge, E Joel; Tuñón, Iñaki; Moliner, Vicent; Allemann, Rudolf K

2014-12-10

52

How to Switch Off a Histidine Kinase: Crystal Structure of Geobacillus Stearothermophilus KinB with the Inhibitor Sda  

Energy Technology Data Exchange (ETDEWEB)

Entry to sporulation in bacilli is governed by a histidine kinase phosphorelay, a variation of the predominant signal transduction mechanism in prokaryotes. Sda directly inhibits sporulation histidine kinases in response to DNA damage and replication defects. We determined a 2.0-Angstroms-resolution X-ray crystal structure of the intact cytoplasmic catalytic core [comprising the dimerization and histidine phosphotransfer domain (DHp domain), connected to the ATP binding catalytic domain] of the Geobacillus stearothermophilus sporulation kinase KinB complexed with Sda. Structural and biochemical analyses reveal that Sda binds to the base of the DHp domain and prevents molecular transactions with the DHp domain to which it is bound by acting as a simple molecular barricade. Sda acts to sterically block communication between the catalytic domain and the DHp domain, which is required for autophosphorylation, as well as to sterically block communication between the response regulator Spo0F and the DHp domain, which is required for phosphotransfer and phosphatase activities.

Bick, M.; Lamour, V; Rajashankar, K; Gordiyenko, Y; Robinson, C; Darst, S

2009-01-01

53

Improving catalytic efficiency of endo-?-1, 4-xylanase from Geobacillus stearothermophilus by directed evolution and H179 saturation mutagenesis.  

Science.gov (United States)

Endo-?-1, 4-xylanase was cloned from Geobacillus stearothermophilus 1A05583 by PCR. Enzymes with improved catalytic efficiency were obtained using error-prone PCR and a 96-well plate high-throughout screening system. Two variants 1-B8 and 2-H6 were screened from the mutant library containing 9000 colonies, which, when compared with the wild-type enzyme increased the catalytic efficiency (kcat/Km) by 25% and 89%, respectively, acting on beechwood xylan. By sequencing 1-B8 and 2-H6, an identical mutation point H179Y was detected and found to overlap in the active site cleft. Following the introduction of the remaining 19 amino acids into position 179 by site-saturation mutagenesis, the catalytic efficiency of H179F was found to be 3.46-fold that of the wild-type. When Whistidine was substituted by tryptophan, arginine, methionine or proline, the enzyme lost activity. Therefore, the position 179 site may play an important role in regulating the catalytic efficiency. PMID:24157442

Wang, Yan; Feng, Shiyu; Zhan, Tao; Huang, Zongqing; Wu, Guojie; Liu, Ziduo

2013-12-01

54

Geobacillus stearothermophilus LV cadA gene mediates resistance to cadmium, lead and zinc in zntA mutants of Salmonella entérica serovar Typhimurium  

Directory of Open Access Journals (Sweden)

Full Text Available Salmonella ent?rica serovar Typhimurium cells expressing the cadA gene of Geobacillus stearothermophilus LV exhibit a hypersensitive phenotype to cadmium chloride. Deletion of the ORF STM3576 from the Salmonella genome resulted in cadmium, lead and zinc sensitivity, confirming that this ORF is a homologue of the zntA gene. The observed sensitivity was reverted upon expression of the G. stearothermophilus LV cadA gene. These results indicate that the cadA gene product is involved in Cd, Pb and Zn resistance as a classical P-type ATPase and strongly suggest that the observed hypersensitive phenotype to these metals can be related to the function of the host ·zntA gene product

JOSÉ M PÉREZ

2006-01-01

55

Functional Characterization of the Initiation Enzyme of S-Layer Glycoprotein Glycan Biosynthesis in Geobacillus stearothermophilus NRS 2004/3a?  

OpenAIRE

The glycan chain of the S-layer glycoprotein of Geobacillus stearothermophilus NRS 2004/3a is composed of repeating units [?2)-?-l-Rhap-(1?3)-?-l-Rhap-(1?2)-?-l-Rhap-(1?], with a 2-O-methyl modification of the terminal trisaccharide at the nonreducing end of the glycan chain, a core saccharide composed of two or three ?-l-rhamnose residues, and a ?-d-galactose residue as a linker to the S-layer protein. In this study, we report the biochemical characterization of WsaP of the S-la...

Steiner, Kerstin; Novotny, Rene?; Patel, Kinnari; Vinogradov, Evgenij; Whitfield, Chris; Valvano, Miguel A.; Messner, Paul; Scha?ffer, Christina

2007-01-01

56

New Insights into the Glycosylation of the Surface Layer Protein SgsE from Geobacillus stearothermophilus NRS 2004/3a?  

OpenAIRE

The surface of Geobacillus stearothermophilus NRS 2004/3a cells is covered by an oblique surface layer (S-layer) composed of glycoprotein subunits. To this S-layer glycoprotein, elongated glycan chains are attached that are composed of [?2)-?-l-Rhap-(1?3)-?-l-Rhap-(1?2)-?-L-Rhap-(1?] repeating units, with a 2-O-methyl modification of the terminal trisaccharide at the nonreducing end of the glycan chain and a core saccharide as linker to the S-layer protein. On sodium dodecyl sulfat...

Steiner, Kerstin; Pohlentz, Gottfried; Dreisewerd, Klaus; Berkenkamp, Stefan; Messner, Paul; Peter-katalinic?, Jasna; Scha?ffer, Christina

2006-01-01

57

Strain Improvement of Bacillus coagulans and Geobacillus stearothermophilus for Enhanced Thermostable Cellulase Production and the Effect of Different Metal Ions on Cellulase Activity  

OpenAIRE

The current study was focused on the strain improvement of Bacillus coagulans and Geobacillus stearothermophilus for thermostable cellulase production with higher enzyme activity. For strain improvement UV radiations, NTG and Sodium azide were used as mutagenic agents.NTG was found to be best mutagenic agent among all in term of highest cellulase activity. Mutant strain C11 exhibited the highest cellulase specific activity at 45 U/mg followed by C15 (39 U/mg) in case of B.coagulans while Muta...

Vikas Sharma; Prakash Kumar Singh

2012-01-01

58

Magnetic circular dichroism spectroscopic characterization of the NOS-like protein from Geobacillus stearothermophilus (gsNOS).  

Science.gov (United States)

Nitric oxide synthase (NOS) catalyzes the NADPH- and O(2)-dependent oxidation of l-arginine (l-Arg) to nitric oxide (NO) and citrulline via an N(G)-hydroxy-l-arginine (NHA) intermediate. Mammalian NOSs have been studied quite extensively; other eukaryotes and some prokaryotes appear to express NOS-like proteins comparable to the oxygenase domain of mammalian NOSs. In this study, a recombinant NOS-like protein from the thermostable bacterium Geobacillus stearothermophilus (gsNOS) has been characterized using magnetic circular dichroism (MCD) and UV-Vis absorption spectroscopic techniques. Spectral comparisons of ligand complexes (with O(2), NO and CO) of substrate-bound (l-Arg or NHA) gsNOS, including the key oxyferrous complex studied at -50 degrees C in cryogenic mixed solvents, with analogous mammalian NOS complexes indicate overall spectroscopic similarities between gsNOS and mammalian NOSs. However, more detailed spectral comparisons reflect subtle structural differences between gsNOS and mammalian NOSs. This may be due to an incomplete tetrahydrobiopterin (BH(4))-binding site and low BH(4)-binding affinity, which may become even lower in the presence of cryosolvent in gsNOS. Although BH(4)-binding may be altered, gsNOS appears to require the pterin for NO production since formation of the stable ferric-NO product complex was only observed when excess BH(4) (>150muM) over gsNOS was present upon single turnover reaction in which O(2) was bubbled into dithionite-reduced NHA-bound protein solution at -35 degrees C or -50 degrees C. PMID:20110129

Kinloch, Ryan D; Sono, Masanori; Sudhamsu, Jawahar; Crane, Brian R; Dawson, John H

2010-03-01

59

Characterization of quinol-dependent nitric oxide reductase from Geobacillus stearothermophilus: enzymatic activity and active site structure.  

Science.gov (United States)

Nitric oxide reductase (NOR) catalyzes the reduction of nitric oxide to generate nitrous oxide. We recently reported on the crystal structure of a quinol-dependent NOR (qNOR) from Geobacillus stearothermophilus [Y. Matsumoto, T. Tosha, A.V. Pisliakov, T. Hino, H. Sugimoto, S. Nagano, Y. Sugita and Y. Shiro, Nat. Struct. Mol. Biol. 19 (2012) 238-246], and suggested that a water channel from the cytoplasm, which is not observed in cytochrome c-dependent NOR (cNOR), functions as a pathway transferring catalytic protons. Here, we further investigated the functional and structural properties of qNOR, and compared the findings with those for cNOR. The pH optimum for the enzymatic reaction of qNOR was in the alkaline range, whereas Pseudomonas aeruginosa cNOR showed a higher activity at an acidic pH. The considerably slower reduction rate, and a correlation of the pH dependence for enzymatic activity and the reduction rate suggest that the reduction process is the rate-determining step for the NO reduction by qNOR, while the reduction rate for cNOR was very fast and therefore is unlikely to be the rate-determining step. A close examination of the heme/non-heme iron binuclear center by resonance Raman spectroscopy indicated that qNOR has a more polar environment at the binuclear center compared with cNOR. It is plausible that a water channel enhances the accessibility of the active site to solvent water, creating a more polar environment in qNOR. This structural feature could control certain properties of the active site, such as redox potential, which could explain the different catalytic properties of the two NORs. This article is part of a Special Issue entitled: 18th European Bioenergetic Conference. PMID:24569054

Terasaka, Erina; Okada, Norihiro; Sato, Nozomi; Sako, Yoshihiko; Shiro, Yoshitsugu; Tosha, Takehiko

2014-07-01

60

Preliminary crystallographic analysis of Xyn52B2, a GH52 ?-D-xylosidase from Geobacillus stearothermophilus T6.  

Science.gov (United States)

Geobacillus stearothermophilus T6 is a thermophilic bacterium that possesses an extensive hemicellulolytic system, including over 40 specific genes that are dedicated to this purpose. For the utilization of xylan, the bacterium uses an extracellular xylanase which degrades xylan to decorated xylo-oligomers that are imported into the cell. These oligomers are hydrolyzed by side-chain-cleaving enzymes such as arabinofuranosidases, acetylesterases and a glucuronidase, and finally by an intracellular xylanase and a number of ?-xylosidases. One of these ?-xylosidases is Xyn52B2, a GH52 enzyme that has already proved to be useful for various glycosynthesis applications. In addition to its demonstrated glycosynthase properties, interest in the structural aspects of Xyn52B2 stems from its special glycoside hydrolase family, GH52, the structures and mechanisms of which are only starting to be resolved. Here, the cloning, overexpression, purification and crystallization of Xyn52B2 are reported. The most suitable crystal form that has been obtained belonged to the orthorhombic P212121 space group, with average unit-cell parameters a = 97.7, b = 119.1, c = 242.3?Å. Several X-ray diffraction data sets have been collected from flash-cooled crystals of this form, including the wild-type enzyme (3.70?Å resolution), the E335G catalytic mutant (2.95?Å resolution), a potential mercury derivative (2.15?Å resolution) and a selenomethionine derivative (3.90?Å resolution). These data are currently being used for detailed three-dimensional structure determination of the Xyn52B2 protein. PMID:25484225

Dann, Roie; Lansky, Shifra; Lavid, Noa; Zehavi, Arie; Belakhov, Valery; Baasov, Timor; Dvir, Hay; Manjasetty, Babu; Belrhali, Hassan; Shoham, Yuval; Shoham, Gil

2014-12-01

61

GH52 xylosidase from Geobacillus stearothermophilus: characterization and introduction of xylanase activity by site?directed mutagenesis of Tyr509.  

Science.gov (United States)

A xylosidase gene, gsxyn, was cloned from the deep-sea thermophilic Geobacillus stearothermophilus, which consisted of 2,118 bp and encoded a protein of 705 amino acids with a calculated molecular mass of 79.8 kDa. The GSxyn of glycoside hydrolase family 52 (GH52) displayed its maximum activity at 70 °C and pH 5.5. The K m and k cat values of GSxyn for ?NPX were 0.48 mM and 36.64 s?1, respectively. Interestingly, a new exo-xylanase activity was introduced into GSxyn by mutating the tyrosine509 into glutamic acid, whereas the resultant enzyme variant, Y509E, retained the xylosidase activity. The optimum xylanase activity of theY509E mutant displayed at pH 6.5 and 50 °C, and retained approximately 45 % of its maximal activity at 55 °C, pH 6.5 for 60 min. The K m and k cat values of the xylanase activity of Y509E mutant for beechwood xylan were 5.10 mg/ml and 22.53 s?1, respectively. The optimum xylosidase activity of theY509E mutant displayed at pH 5.5 and 60 °C. The K m and k cat values of the xylosidase activity of Y509E mutant for ?NPX were 0.51 mM and 22.53 s?1, respectively. This report demonstrated that GH52 xylosidase has provided a platform for generating bifunctional enzymes for industrially significant and complex substrates, such as plant cell wall. PMID:24122394

Huang, Zongqing; Liu, Xiaoshuang; Zhang, Shaowei; Liu, Ziduo

2014-01-01

62

Strain Improvement of Bacillus coagulans and Geobacillus stearothermophilus for Enhanced Thermostable Cellulase Production and the Effect of Different Metal Ions on Cellulase Activity  

Directory of Open Access Journals (Sweden)

Full Text Available The current study was focused on the strain improvement of Bacillus coagulans and Geobacillus stearothermophilus for thermostable cellulase production with higher enzyme activity. For strain improvement UV radiations, NTG and Sodium azide were used as mutagenic agents.NTG was found to be best mutagenic agent among all in term of highest cellulase activity. Mutant strain C11 exhibited the highest cellulase specific activity at 45 U/mg followed by C15 (39 U/mg in case of B.coagulans while Mutant strain S18 exhibited thehighest cellulase specific activity at 69 U/mg followed by S12 (62 U/mg in case of G. stearothermophilus. Specific activity of cellulase was 92 U/mg in case of B.coagulans C11 and 118 U/mg in case of G. stearothermophilus S18. Ag+, Mg+, Se2+,Ca2+,Co2+,Mn2+,K+, Zn2+ ,Fe3+, Hg2+ and Cu2+ showed positive change in specific activity while Na+, Ni2+ negative change in specific activity of cellulase with respect to specific activity of cellulase in absence of any additive in case of B.coagulans C11 and Ag+, Mg+, Se2+,Co2+,Mn2+ andHg2+ showed positive change in specific activity, Na+, K+ showed no change in specific activity while Ca2+, Zn2+, Ni2+, Fe3+ and Cu2+ showed negative change in specific activity of cellulase with respect to specific activity of cellulase in absence of any additive in case of G. stearothermophilus S18.

Vikas Sharma

2012-11-01

63

Phylogenetic, inter, and intraspecific sequence analysis of spo0A gene of the genus Geobacillus.  

Science.gov (United States)

In this work, the variability of spo0A gene in the genus Geobacillus and applicability of this gene for the taxonomy within this genus were evaluated. The protein Spo0A is the master regulator of the endospore-forming process in the all endospore-forming bacteria. Geobacillus genus-specific primers GEOSPO were designed based on the sequences of Geobacillus spo0A gene available through the public databases. Inter and intraspecific variability of Geobacillus spo0A gene was determined after sequencing of the GEOSPO-PCR products. Geobacillus spo0A sequence analysis showed that three species--Geobacillus thermodenitrificans, G. stearothermophilus, and G. jurassicus--could be easily identified. Similarity between the sequences of these species and the other species were in the range of 83.3%-92.0%. In contrast, intraspecific similarity of G. thermodenitrificans and G. stearothermophilus was high--above 99.0%. Similarity of spo0A sequences of G. subterraneus-G. uzenensis species cluster also matched this interval. Intercluster similarity between G. lituanicus-G. thermoleovorans-G. kaustophilus-G. vulcani and G. thermocatenulatus-G. gargensis-G. caldoxylosilyticus-G. toebii-G. thermoglucosidasius species clusters, as well as interspecific similarity within these two clusters was in the range of the intraspecific similarity determined for G. thermodenitrificans and G. stearothermophilus. It was also determined that spo0A cannot be used as the phylogenetic marker for the genus Geobacillus. PMID:19205799

Kuisiene, Nomeda; Raugalas, Juozas; Chitavichius, Donaldas

2009-06-01

64

Structural basis for thermostability revealed through the identification and characterization of a highly thermostable phosphotriesterase-like lactonase from Geobacillus stearothermophilus  

Energy Technology Data Exchange (ETDEWEB)

A new enzyme homologous to phosphotriesterase was identified from the bacterium Geobacillus stearothermophilus (GsP). This enzyme belongs to the amidohydrolase family and possesses the ability to hydrolyze both lactone and organophosphate (OP) compounds, making it a phosphotriesterase-like lactonase (PLL). GsP possesses higher OP-degrading activity than recently characterized PLLs, and it is extremely thermostable. GsP is active up to 100 C with an energy of activation of 8.0 kcal/mol towards ethyl paraoxon, and it can withstand an incubation temperature of 60 C for two days. In an attempt to understand the thermostability of PLLs, the X-ray structure of GsP was determined and compared to those of existing PLLs. Based upon a comparative analysis, a new thermal advantage score and plot was developed and reveals that a number of different factors contribute to the thermostability of PLLs.

Hawwa, Renda; Aikens, John; Turner, Robert J.; Santarsiero, Bernard D.; Mescar, Andrew D.; (Lybradyn Inc.); (UIC)

2009-08-31

65

A temperature-sensitive expression system based on the Geobacillus stearothermophilus NRS 2004/3a sgsE surface-layer gene promoter  

Science.gov (United States)

The sgsE gene coding for the S-layer (surface layer) protein in the thermophilic Gram-positive bacterium Geobacillus stearothermophilus NRS 2004/3a is strongly induced when the culture is shifted from optimal (55 °C) to maximally tolerable growth temperature (67 °C). Here, we investigated the regulation of the sgsE promoter in G. stearothermophilus and tested the function of this promoter in Bacillus subtilis. We used EGFP (enhanced green fluorescent protein) reporter constructs and found that the sgsE promoter has very low basal activity at 28 °C, but is approx. 20-fold induced by elevated growth temperatures (37 and 45 °C). The promoter confers high expression levels, as EGFP mRNA levels at 45 °C were approx. 120-fold more abundant than mRNA levels of the cat (chloramphenicol resistance) gene, which was transcribed from a constitutive promoter on the same plasmid. In fluorescence-microscopic and Western-blot analysis, the EGFP protein was barely detectable at 28 °C, whereas intermediate and high levels were detected at 37 and 45 °C respectively. The potential to tune expression levels of genes driven by the sgsE promoter in B. subtilis by simple temperature adjustments presents a considerable potential for its future use as high-yield protein expression system for B. subtilis. PMID:17576197

Novotny, Rene; Berger, Harald; Schinko, Thorsten; Messner, Paul; Schäffer, Christina; Strauss, Joseph

2015-01-01

66

Purification, crystallization and preliminary crystallographic analysis of Gan1D, a GH1 6-phospho-?-galactosidase from Geobacillus stearothermophilus T1.  

Science.gov (United States)

Geobacillus stearothermophilus T1 is a Gram-positive thermophilic soil bacterium that contains an extensive system for the utilization of plant cell-wall polysaccharides, including xylan, arabinan and galactan. The bacterium uses a number of extracellular enzymes that break down the high-molecular-weight polysaccharides into short oligosaccharides, which enter the cell and are further hydrolyzed into sugar monomers by dedicated intracellular glycoside hydrolases. The interest in the biochemical characterization and structural analysis of these proteins originates mainly from the wide range of their potential biotechnological applications. Studying the different hemicellulolytic utilization systems in G. stearothermophilus T1, a new galactan-utilization gene cluster was recently identified, which encodes a number of proteins, one of which is a GH1 putative 6-phospho-?-galactosidase (Gan1D). Gan1D has recently been cloned, overexpressed, purified and crystallized as part of its comprehensive structure-function study. The best crystals obtained for this enzyme belonged to the triclinic space group P1, with average crystallographic unit-cell parameters of a = 67.0, b = 78.1, c = 92.1 Å, ? = 102.4, ? = 93.5, ? = 91.7°. A full diffraction data set to 1.33 Å resolution has been collected for the wild-type enzyme, as measured from flash-cooled crystals at 100 K, using synchrotron radiation. These data are currently being used for the detailed three-dimensional crystal structure analysis of Gan1D. PMID:24637762

Lansky, Shifra; Zehavi, Arie; Dann, Roie; Dvir, Hay; Belrhali, Hassan; Shoham, Yuval; Shoham, Gil

2014-02-01

67

The structure of DinB from Geobacillus stearothermophilus: a representative of a unique four-helix-bundle superfamily  

OpenAIRE

The structure of DinB from G. stearothermophilus is described and compared with a number of recently reported structures of this unusual fold. Structural similarities are revealed that unite several distant protein families.

Cooper, David R.; Grelewska, Katarzyna; Kim, Chang-yub; Joachimiak, Andrzej; Derewenda, Zygmunt S.

2010-01-01

68

Expression of the ubiE Gene of Geobacillus stearothermophilus V in Escherichia coli K-12 Mediates the Evolution of Selenium Compounds into the Headspace of Selenite- and Selenate-Amended Cultures  

OpenAIRE

The ubiE gene of Geobacillus stearothermophilus V, with its own promoter, was cloned and introduced into Escherichia coli. The cloned gene complemented the ubiE gene deficiency of E. coli AN70. In addition, the expression of this gene in E. coli JM109 resulted in the evolution of volatile selenium compounds when these cells were grown in selenite- or selenate-amended media. These compounds were dimethyl selenide and dimethyl diselenide.

Swearingen, J. W.; Fuentes, D. E.; Araya, M. A.; Plishker, M. F.; Saavedra, C. P.; Chasteen, T. G.; Va?squez, C. C.

2006-01-01

69

Genetics of thermophilic bacteria. [Bacillus stearothermophilus:a2  

Energy Technology Data Exchange (ETDEWEB)

Organisms adapted to high temperature have evolved a variety of unique solutions to the biochemical problems imposed by this environment. Adaptation is commonly used to describe the biochemical properties of organisms which have become adapted to their environment (genetic adaptation). It can also mean the direct response-at the cellular level-of an organism to changes in temperature (physiological adaptation). Thermophilic bacilli (strains of Bacillus stearothermophilus) can exhibit a variety of biochemical adaptations in response to changes in temperature. These include changes in the composition and stability of the membrane, metabolic potential, the transport of amino acids, regulatory mechanisms, ribose methylation of tRNA, protein thermostability, and nutritional requirements. The objectives of the research were to develop efficient and reliable genetic systems to analyze and manipulate B. Stearothermophilus, and to use these systems initiate a biochemical, molecular, and genetic investigations of genes that are required for growth at high temperature.

Welker, N.E.

1991-01-01

70

Gene cloning, functional expression and secretion of the S-layer protein SgsE from Geobacillus stearothermophilus NRS 2004/3a in Lactococcus lactis.  

Science.gov (United States)

The ~93-kDa surface layer protein SgsE of Geobacillus stearothermophilus NRS 2004/3a forms a regular crystalline array providing a nanopatterned matrix for the future display of biologically relevant molecules. Lactococcus lactis NZ9000 was established as a safe expression host for the controlled targeted production of SgsE based on the broad host-range plasmid pNZ124Sph, into which the nisA promoter was introduced. SgsE devoid of its signal peptide-encoding sequence was cloned into the new vector and purified from the cytoplasm at a yield of 220 mg l- of expression culture. Secretion constructs were based on the signal peptide of the Lactobacillus brevis SlpA protein or the L. lactis Usp45 protein, allowing isolation of 95 mg of secreted rSgsE l-1. N-terminal sequencing confirmed correct processing of SgsE in L. lactis NZ9000. The ability of rSgsE to self-assemble in suspension and to recrystallize on solid supports was demonstrated by electron and atomic force microscopy. PMID:15675069

Novotny, René; Scheberl, Andrea; Giry-Laterriere, Marc; Messner, Paul; Schäffer, Christina

2005-01-01

71

Novel Biocatalysts Based on S-Layer Self-Assembly of Geobacillus Stearothermophilus NRS 2004/3a: A Nanobiotechnological Approach  

Science.gov (United States)

The crystalline cell-surface (S) layer sgsE of Geobacillus stearothermophilus NRS 2004/3a represents a natural protein self-assembly system with nanometer-scale periodicity that is evaluated as a combined carrier/patterning element for the conception of novel types of biocatalyst aiming at the controllable display of biocatalytic epitopes, storage stability, and reuse. The glucose-1-phosphate thymidylyltransferase RmlA is used as a model enzyme and chimeric proteins are constructed by translational fusion of rmlA to the C-terminus of truncated forms of sgsE (rSgsE 131–903, rSgsE331–903) and used for the construction of three principal types of biocatalysts: soluble (monomeric), self-assembled in aqueous solution, and recrystallized on negatively charged liposomes. Enzyme activity of the biocatalysts reaches up to 100% compared to sole RmlA cloned from the same bacterium. The S-layer portion of the biocatalysts confers significantly improved shelf life to the fused enzyme without loss of activity over more than three months, and also enables biocatalyst recycling. These nanopatterned composites may open up new functional concepts for biocatalytic applications in nanobiotechnology. PMID:17786898

Schäffer, Christina; Novotny, René; Küpcü, Seta; Zayni, Sonja; Scheberl, Andrea; Friedmann, Jacqueline; Sleytr, Uwe B.; Messner, Paul

2015-01-01

72

A differentially conserved residue (Ile42) of GH42 ?-galactosidase from Geobacillus stearothermophilus BgaB is involved in both catalysis and thermostability.  

Science.gov (United States)

The glycoside hydrolase family 42 (GH42) of thermophilic microorganisms consists of thermostable ?-galactosidases that display significant variations in their temperature optima and stabilities. In this study, we compared the substrate binding modes of 2 GH42 ?-galactosidases, BgaB from Geobacillus stearothermophilus and A4-?-Gal from Thermus thermophilus A4. The A4-?-Gal has a catalytic triad (Glu312-Arg32-Glu35) with an extended hydrogen bond network that has not been observed in BgaB. In this study, we performed site-saturation mutagenesis of Ile42 in BgaB (equivalent to Glu312 in A4-?-Gal) to study the effects of different residues on thermostability, catalytic function, and the extended hydrogen bond network. Our experimental results suggest that substitution of Ile42 with polar AA enhanced the thermostability but decreased the catalytic efficiency of BgaB. Polar AA substitution for Ile42 simultaneously affected thermostability, catalytic efficiency, and the hydrogen bond network, suggesting that Ile42 is responsible for functional discrimination between members of the GH42 family. These observations could lead to a novel strategy for investigating the functional evolution of the GH42 ?-galactosidases. PMID:25682138

Dong, Yi-Ning; Chen, Hai-Qin; Sun, Yan-Hui; Zhang, Hao; Chen, Wei

2015-04-01

73

Crystallization and preliminary crystallographic analysis of a family 43 ?-d-xylosidase from Geobacillus stearothermophilus T-6  

OpenAIRE

The crystallization and preliminary X-ray analysis of a ?-d-xylosidase from G. stearothermophilus T-6, a family 43 glycoside hydrolase, is described. Native and catalytic inactive mutants of the enzymes were crystallized in two different space groups, orthorhombic P21212 and tetragonal P41212 (or the enantiomorphic space group P43212), using a sensitive cryoprotocol. The latter crystal form diffracted X-rays to a resolution of 2.2?Å.

Bru?x, Christian; Niefind, Karsten; Ben-david, Alon; Leon, Maya; Shoham, Gil; Shoham, Yuval; Schomburg, Dietmar

2005-01-01

74

HIV-1 Gag p17 presented as virus-like particles on the E2 scaffold from Geobacillus stearothermophilus induces sustained humoral and cellular immune responses in the absence of IFN? production by CD4+ T cells  

OpenAIRE

We have constructed stable virus-like particles displaying the HIV-1 Gag(p17) protein as an N-terminal fusion with an engineered protein domain from the Geobacillus stearothermophilus pyruvate dehydrogenase subunit E2. Mice immunized with the Gag(p17)-E2 60-mer scaffold particles mounted a strong and sustained antibody response. Antibodies directed to Gag(p17) were boosted significantly with additional immunizations, while anti-E2 responses reached a plateau. The isotype of the induced antibo...

Caivano, Antonella; Doria-rose, Nicole A.; Buelow, Benjamin; Sartorius, Rossella; Trovato, Maria; D’apice, Luciana; Domingo, Gonzalo J.; Sutton, William F.; Haigwood, Nancy L.; Berardinis, Piergiuseppe

2010-01-01

75

High-Affinity Interaction between the S-Layer Protein SbsC and the Secondary Cell Wall Polymer of Geobacillus stearothermophilus ATCC 12980 Determined by Surface Plasmon Resonance Technology? †  

OpenAIRE

Surface plasmon resonance studies using C-terminal truncation forms of the S-layer protein SbsC (recombinant SbsC consisting of amino acids 31 to 270 [rSbsC31-270] and rSbsC31-443) and the secondary cell wall polymer (SCWP) isolated from Geobacillus stearothermophilus ATCC 12980 confirmed the exclusive responsibility of the N-terminal region comprising amino acids 31 to 270 for SCWP binding. Quantitative analyses indicated binding behavior demonstrating low, medium, and high affinities.

Ferner-ortner, Judith; Mader, Christoph; Ilk, Nicola; Sleytr, Uwe B.; Egelseer, Eva M.

2007-01-01

76

Interaction of the Crystalline Bacterial Cell Surface Layer Protein SbsB and the Secondary Cell Wall Polymer of Geobacillus stearothermophilus PV72 Assessed by Real-Time Surface Plasmon Resonance Biosensor Technology  

OpenAIRE

The interaction between S-layer protein SbsB and the secondary cell wall polymer (SCWP) of Geobacillus stearothermophilus PV72/p2 was investigated by real-time surface plasmon resonance biosensor technology. The SCWP is an acidic polysaccharide that contains N-acetylglucosamine, N-acetylmannosamine, and pyruvic acid. For interaction studies, recombinant SbsB (rSbsB) and two truncated forms consisting of either the S-layer-like homology (SLH) domain (3SLH) or the residual part of SbsB were use...

Mader, Christoph; Huber, Carina; Moll, Dieter; Sleytr, Uwe B.; Sa?ra, Margit

2004-01-01

77

Protein engineering by random mutagenesis and structure-guided consensus of Geobacillus stearothermophilus Lipase T6 for enhanced stability in methanol.  

Science.gov (United States)

The abilities of enzymes to catalyze reactions in nonnatural environments of organic solvents have opened new opportunities for enzyme-based industrial processes. However, the main drawback of such processes is that most enzymes have a limited stability in polar organic solvents. In this study, we employed protein engineering methods to generate a lipase for enhanced stability in methanol, which is important for biodiesel production. Two protein engineering approaches, random mutagenesis (error-prone PCR) and structure-guided consensus, were applied in parallel on an unexplored lipase gene from Geobacillus stearothermophilus T6. A high-throughput colorimetric screening assay was used to evaluate lipase activity after an incubation period in high methanol concentrations. Both protein engineering approaches were successful in producing variants with elevated half-life values in 70% methanol. The best variant of the random mutagenesis library, Q185L, exhibited 23-fold-improved stability, yet its methanolysis activity was decreased by one-half compared to the wild type. The best variant from the consensus library, H86Y/A269T, exhibited 66-fold-improved stability in methanol along with elevated thermostability (+4.3°C) and a 2-fold-higher fatty acid methyl ester yield from soybean oil. Based on in silico modeling, we suggest that the Q185L substitution facilitates a closed lid conformation that limits access for both the methanol and substrate excess into the active site. The enhanced stability of H86Y/A269T was a result of formation of new hydrogen bonds. These improved characteristics make this variant a potential biocatalyst for biodiesel production. PMID:24362426

Dror, Adi; Shemesh, Einav; Dayan, Natali; Fishman, Ayelet

2014-02-01

78

EPR and ENDOR characterization of the reactive intermediates in the generation of NO by cryoreduced oxy-nitric oxide synthase from Geobacillus stearothermophilus.  

Science.gov (United States)

Cryoreduction EPR/ENDOR/step-annealing measurements with substrate complexes of oxy-gsNOS (3; gsNOS is nitric oxide synthase from Geobacillus stearothermophilus) confirm that Compound I (6) is the reactive heme species that carries out the gsNOS-catalyzed (Stage I) oxidation of L-arginine to N-hydroxy-L-arginine (NOHA), whereas the active species in the (Stage II) oxidation of NOHA to citrulline and HNO/NO(-) is the hydroperoxy-ferric form (5). When 3 is reduced by tetrahydrobiopterin (BH4), instead of an externally supplied electron, the resulting BH4(+) radical oxidizes HNO/NO(-) to NO. In this report, radiolytic one-electron reduction of 3 and its complexes with Arg, Me-Arg, and NO(2)Arg was shown by EPR and (1)H and (14,15)N ENDOR spectroscopies to generate 5; in contrast, during cryoreduction of 3/NOHA, the peroxo-ferric-gsNOS intermediate (4/NOHA) was trapped. During annealing at 145 K, ENDOR shows that 5/Arg and 5/Me-Arg (but not 5/NO(2)Arg) generate a Stage I primary product species in which the OH group of the hydroxylated substrate is coordinated to Fe(III), characteristic of 6 as the active heme center. Analysis shows that hydroxylation of Arg and Me-Arg is quantitative. Annealing of 4/NOHA at 160 K converts it first to 5/NOHA and then to the Stage II primary enzymatic product. The latter contains Fe(III) coordinated by water, characteristic of 5 as the active heme center. It further contains quantitative amounts of citrulline and HNO/NO(-); the latter reacts with the ferriheme to form the NO-ferroheme upon further annealing. Stage I delivery of the first proton of catalysis to the (unobserved) 4 formed by cryoreduction of 3 involves a bound water that may convey a proton from L-Arg, while the second proton likely derives from the carboxyl side chain of Glu 248 or the heme carboxylates; the process also involves proton delivery by water(s). In the Stage II oxidation of NOHA, the proton that converts 4/NOHA to 5/NOHA likely is derived from NOHA itself, a conclusion supported by the pH invariance of the process. The present results illustrate how the substrate itself modulates the nature and reactivity of intermediates along the monooxygenase reaction pathway. PMID:19754116

Davydov, Roman; Sudhamsu, Jawahar; Lees, Nicholas S; Crane, Brian R; Hoffman, Brian M

2009-10-14

79

Cloning, purification and preliminary crystallographic analysis of Ara127N, a GH127 ?-L-arabinofuranosidase from Geobacillus stearothermophilus T6.  

Science.gov (United States)

The L-arabinan utilization system of Geobacillus stearothermophilus T6 is composed of five transcriptional units that are clustered within a 38?kb DNA segment. One of the transcriptional units contains 11 genes, the last gene of which (araN) encodes a protein, Ara127N, that belongs to the newly established GH127 family. Ara127N shares 44% sequence identity with the recently characterized HypBA1 protein from Bifidobacterium longum and thus is likely to function similarly as a ?-L-arabinofuranosidase. ?-L-Arabinofuranosidases are enzymes that hydrolyze ?-L-arabinofuranoside linkages, the less common form of such linkages, a unique enzymatic activity that has been identified only recently. The interest in the structure and mode of action of Ara127N therefore stems from its special catalytic activity as well as its membership of the new GH127 family, the structure and mechanism of which are only starting to be resolved. Ara127N has recently been cloned, overexpressed, purified and crystallized. Two suitable crystal forms have been obtained: one (CTP form) belongs to the monoclinic space group P21, with unit-cell parameters a = 104.0, b = 131.2, c = 107.6?Å, ? = 112.0°, and the other (RB form) belongs to the orthorhombic space group P212121, with unit-cell parameters a = 65.5, b = 118.1, c = 175.0?Å. A complete X-ray diffraction data set has been collected to 2.3?Å resolution from flash-cooled crystals of the wild-type enzyme (RB form) at -173°C using synchrotron radiation. A selenomethionine derivative of Ara127N has also been prepared and crystallized for multi-wavelength anomalous diffraction (MAD) experiments. Crystals of selenomethionine Ara127N appeared to be isomorphous to those of the wild type (CTP form) and enabled the measurement of a three-wavelength MAD diffraction data set at the selenium absorption edge. These data are currently being used for detailed three-dimensional structure determination of the Ara127N protein. PMID:25084377

Lansky, Shifra; Salama, Rachel; Dann, Roie; Shner, Izhak; Manjasetty, Babu A; Belrhali, Hassan; Shoham, Yuval; Shoham, Gil

2014-08-01

80

ISOLATION AND CHARACTERIZATION OF MANNANOLYTIC THERMOPHILIC BACTERIA FROM PALM OIL SHELL AND THEIR MANNANASE ENZYME PRODUCTION PROPERTIES  

OpenAIRE

A mannanolytic thermophilic bacterium (L-07) was isolated from palm oil shell after 2 days of enrichment in liquid medium supplemented with 1% palm kernel meal as mannan source. Sequence analysis of 16S-rRNA indicated that L-07 was similar (98%) to Geobacillus stearothermophilus, a species of thermophilic aerobi c bacteria. We found that G. stearothermophilus L-07 produced extracellular ? -1,4-mannanases, but no ? -manosidase and ? -galactosidase activities. The growth of L-07 reached it...

Urwadaria, T. Resnawati P.; ANTONIUS SUWANTO; SUMARDI; Henawidjaja, Maggy T.

2005-01-01

81

HIV-1 Gag p17 presented as virus-like particles on the E2 scaffold from Geobacillus stearothermophilus induces sustained humoral and cellular immune responses in the absence of IFN? production by CD4+ T cells  

International Nuclear Information System (INIS)

We have constructed stable virus-like particles displaying the HIV-1 Gag(p17) protein as an N-terminal fusion with an engineered protein domain from the Geobacillus stearothermophilus pyruvate dehydrogenase subunit E2. Mice immunized with the Gag(p17)-E2 60-mer scaffold particles mounted a strong and sustained antibody response. Antibodies directed to Gag(p17) were boosted significantly with additional immunizations, while anti-E2 responses reached a plateau. The isotype of the induced antibodies was biased towards IgG1, and the E2-primed CD4+ T cells did not secrete IFN?. Using transgenic mouse model systems, we demonstrated that CD8+ T cells primed with E2 particles were able to exert lytic activity and produce IFN?. These results show that the E2 scaffold represents a powerful vaccine delivery system for whole antigenic proteins or polyepitope engineered proteins, evoking antibody production and antigen specific CTL activity even in the absence of IFN?-producing CD4+ T cells.

82

Geobacillus jurassicus sp. nov., a new thermophilic bacterium isolated from a high-temperature petroleum reservoir, and the validation of the Geobacillus species.  

Science.gov (United States)

Four thermophilic, spore-forming bacterial strains, DS1(T), DS2, 46 and 49, were isolated from the high-temperature Dagang oilfield, located in China. The strains were identified by using the polyphasic taxonomy approach. These were aerobic, gram-positive, rod-shaped, moderately thermophilic (with an optimum growth temperature of 60-65 degrees C), chemoorganotrophic bacteria capable of growing on various sugars, carboxylic acids and crude oil. Two strains, DS1(T) and DS2, were capable of growing on individual saturated hydrocarbons. The G + C content of the DNA of strains DS1(T) and DS2 was 54.5 and 53.8 mol%, respectively. The phylogenetic analysis of the 16S rDNA of strains DS1(T) and DS2 showed that they form a separate cluster within the genus Geobacillus. The cellular fatty acids of the isolates were dominated by iso-15:0, iso-16:0 and iso-17:0 acids, which are the typical fatty acids of bacteria from the genus Geobacillus. The DNA-DNA hybridization study and the comparative analysis of the morphological and chemotaxonomic characteristics of strains DS1(T) and DS2 showed that they differ from the previously described Geobacillus species and belong to a new species, which was called Geobacillus jurassicus. DS1(T) (=VKM B2301(T), = DSM 15726(T)) is the type strain of this species. According to both DNA-DNA reassociation studies and 16S rDNA sequence analysis, two other strains, 46 and 49, were assigned to the species G. stearothermophilus. In this paper, we provide evidence that the new combinations G. stearothermophilus, G. thermoleovorans, G. kaustophilus, G. thermoglucosidasius and G. thermodenitrificans may be considered to be valid. PMID:15709364

Nazina, Tamara N; Sokolova, Diana Sh; Grigoryan, Alexander A; Shestakova, Nataliya M; Mikhailova, Ekaterina M; Poltaraus, Andrei B; Tourova, Tatiyana P; Lysenko, Anatolii M; Osipov, George A; Belyaev, Sergey S

2005-01-01

83

Characterization of two novel plasmids from Geobacillus sp. 610 and 1121 strains.  

Science.gov (United States)

We describe two cryptic low molecular weight plasmids, pGTD7 (3279bp) and pGTG5 (1540bp), isolated from Geobacillus sp. 610 and 1121 strains, respectively. Homology analysis of the replication protein (Rep) sequences and detection of ssDNA indicate that both of them replicate via rolling circle mechanism. As revealed by sequence similarities of dso region and Rep protein, plasmid pGTD7 belongs to pC194/pUB110 plasmid family. The replicon of pGTD7 was proved to be functional in another Geobacillus host. For this purpose, a construct pUCK7, containing a replicon of the analyzed plasmid, was created and transferred to G. stearothermophilus NUB3621R strain by electroporation. Plasmid pGTG5, based on Rep protein sequence similarity, was found to be related mostly to some poorly characterized bacterial plasmids. Rep proteins encoded by these plasmids contain conservative motifs that are most similar to those of Microviridae phages. This feature suggests that pGTG5, together with other plasmids containing the same motifs, could constitute a new family of bacterial plasmids. To date, pGTG5 is the smallest plasmid identified in bacteria belonging to the genus Geobacillus. The two plasmids described in this study can be used for the construction of new vectors suitable for biotechnologically important bacteria of the genus Geobacillus. PMID:24177015

Kananavi?i?t?, R?ta; Butait?, Elena; Citavi?ius, Donaldas

2014-01-01

84

CHARACTERIZATION OF CARBOXYMETHYLCELLULASE ACTIVITY FROM GEOBACILLUS STEAROTHERMOPHILUS  

Science.gov (United States)

One of the technological impediments to widespread utilization of lignocellulosic biomass as a fermentation feedstock is the efficient and economical depolymerization of the polysaccharides found in cellulose and hemicellulose. A rational strategy toward overcoming this hurdle is the isolation of h...

85

Application of pheB as a Reporter Gene for Geobacillus spp., Enabling Qualitative Colony Screening and Quantitative Analysis of Promoter Strength  

OpenAIRE

The pheB gene from Geobacillus stearothermophilus DSM6285 has been exploited as a reporter gene for Geobacillus spp. The gene product, catechol 2,3-dioxygenase (C23O), catalyzes the formation of 2-hydroxymuconic semialdehyde, which can be readily assayed. The reporter was used to examine expression from the ldh promoter associated with fermentative metabolism.

Bartosiak-jentys, Jeremy; Eley, Kirstin; Leak, David J.

2012-01-01

86

Draft Genome Sequence of Geobacillus sp. Strain FW23, Isolated from a Formation Water Sample.  

Science.gov (United States)

The thermophilic Geobacillus sp. strain FW23 was isolated from the Mehsana oil wells in Gujrat, India, during a screening for oil-degrading bacteria. Here, we report the draft genome sequence of Geobacillus sp. FW23, which may help reveal the genomic differences between this strain and the earlier reported species of the genus Geobacillus. PMID:24812215

Pore, Soham D; Arora, Preeti; Dhakephalkar, Prashant K

2014-01-01

87

Draft Genome Sequence of Geobacillus sp. Strain FW23, Isolated from a Formation Water Sample  

OpenAIRE

The thermophilic Geobacillus sp. strain FW23 was isolated from the Mehsana oil wells in Gujrat, India, during a screening for oil-degrading bacteria. Here, we report the draft genome sequence of Geobacillus sp. FW23, which may help reveal the genomic differences between this strain and the earlier reported species of the genus Geobacillus.

Pore, Soham D.; Arora, Preeti; Dhakephalkar, Prashant K.

2014-01-01

88

Reclassification of Saccharococcus caldoxylosilyticus as Geobacillus caldoxylosilyticus (Ahmad et al. 2000) comb. nov.  

Science.gov (United States)

A polyphasic study was performed on five thermophilic strains belonging to the genus Bacillus, isolated from soil of different geographical areas. 16S rRNA gene sequence analysis placed these isolates in RNA group 5, with Saccharococcus caldoxylosilyticus and [Bacillus] thermoglucosidasius being the closest phylogenetic neighbours. The type species of Saccharococcus, Saccharococcus thermophilus, was only moderately related to these two species and the novel isolates. DNA-DNA hybridization studies and comparison of morphological, chemotaxonomic and phenotypic features supported the close relationship between the novel isolates and Saccharococcus caldoxylosilyticus. These data justify the reclassification of Saccharococcus caldoxylosilyticus. Following the transfer of the validly described Bacillus species of group 5 into the genus Geobacillus, the reclassification of Saccharococcus caldoxylosilyticus as Geobacillus caldoxylosilyticus comb. nov. is proposed. This species can be distinguished genomically from Geobacillus thermoglucosidasius, Geobacillus stearothermophilus, Geobacillus thermodenitrificans and Saccharococcus thermophilus by a specific PCR-RFLP assay targeting the 16S rDNA. PMID:11760948

Fortina, M G; Mora, D; Schumann, P; Parini, C; Manachini, P L; Stackebrandt, E

2001-11-01

89

[Isolation and properties of BstBSI restriction endonuclease from the thermophilic soil bacteria Bacillus stearothermophilus BS].  

Science.gov (United States)

A new restriction endonuclease BstBSI was isolated and purified from the thermophilic soil bacterium Bacillus stearothermophilus BS by the blue sepharose and hydroxyapatite chromatographies. The enzyme is an isoschizomer of SnaI from Sphaerotilus natans C. It recognizes the hexanucleotide GTATAC and cleaves DNA in the center of the sequence. The maximal catalytic activity of the endonuclease is registered in 50 mM tris-HCl (pH 9.0) buffer with the high ionic strength (100 mM NaCl) in the presence of 10 mM MgCl2 at 45 degrees C. Glucosylated DNA of the phage T4 is not cleaved by the enzyme. PMID:8350878

Kovalevskaia, N P; Ivanov, L Iu; Zheleznaia, L A; Matvienko, N I

1993-01-01

90

[The phylogenetic diversity of aerobic organotrophic bacteria from the Dagan high-temperature oil field].  

Science.gov (United States)

The distribution and species diversity of aerobic organotrophic bacteria in the Dagan high-temperature oil field (China), which is exploited via flooding, have been studied. Twenty-two strains of the most characteristic thermophilic and mesophilic aerobic organotrophic bacteria have been isolated from the oil stratum. It has been found that, in a laboratory, the mesophilic and thermophilic isolates grow in the temperature, pH, and salinity ranges characteristic of the injection well near-bottom zones or of the oil stratum, respectively, and assimilate a wide range of hydrocarbons, fatty acids, lower alcohols, and crude oil, thus exhibiting adaptation to the environment. Using comparative phylogenetic 16S rRNA analysis, the taxonomic affiliation of the isolates has been established. The aerobic microbial community includes gram-positive bacteria with a high and low G+C content of DNA, and gamma and beta subclasses of Proteobacteria. The thermophilic bacteria belong to the genera Geobacillus and Thermoactinomyces, and the mesophilic strains belong to the genera Bacillus, Micrococcus, Cellulomonas, Pseudomonas, and Acinetobacter. The microbial community of the oil stratum is dominated by known species of the genus Geobacillus (G. subterraneus, G. stearothermophilus, and G. thermoglucosidasius) and a novel species "Geobacillus jurassicus." A number of novel thermophilic oil-oxidizing bacilli have been isolated. PMID:16119855

Nazina, T N; Sokolova, D Sh; Shestakova, N M; Grigor'ian, A A; Mikha?lova, E M; Babich, T L; Lysenko, A M; Turova, T P; Poltaraus, A B; Feng, Tsin'syan; Ni, Fangtian; Beliaev, S S

2005-01-01

91

Geobacillus sp., a thermophilic soil bacterium producing volatile antibiotics.  

Science.gov (United States)

Geobacillus, a bacterial genus, is represented by over 25 species of Gram-positive isolates from various man-made and natural thermophilic areas around the world. An isolate of this genus (M-7) has been acquired from a thermal area near Yellowstone National Park, MT and partially characterized. The cells of this organism are globose (ca. 0.5 mu diameter), and they are covered in a matrix capsule which gives rise to elongate multicelled bacilliform structures (ranging from 3 to 12 mum) as seen by light and atomic force microscopy, respectively. The organism produces unique petal-shaped colonies (undulating margins) on nutrient agar, and it has an optimum pH of 7.0 and an optimum temperature range of 55-65 degrees C. The partial 16S rRNA sequence of this organism has 97% similarity with Geobacillus stearothermophilus, one of its closest relatives genetically. However, uniquely among all members of this genus, Geobacillus sp. (M-7) produces volatile organic substances (VOCs) that possess potent antibiotic activities. Some of the more notable components of the VOCs are benzaldehyde, acetic acid, butanal, 3-methyl-butanoic acid, 2-methyl-butanoic acid, propanoic acid, 2-methyl-, and benzeneacetaldehyde. An exposure of test organisms such as Aspergillus fumigatus, Botrytis cinerea, Verticillium dahliae, and Geotrichum candidum produced total inhibition of growth on a 48-h exposure to Geobacillus sp.(M-7) cells (ca.10(7)) and killing at a 72-h exposure at higher bacterial cell concentrations. A synthetic mixture of those available volatile compounds, at the ratios occurring in Geobacillus sp. (M-7), mimicked the bioactivity of this organism. PMID:20091406

Ren, Yuhao; Strobel, Gary; Sears, Joe; Park, Melina

2010-07-01

92

Preconditioning with Cations Increases the Attachment of Anoxybacillus flavithermus and Geobacillus Species to Stainless Steel  

OpenAIRE

Preconditioning of Anoxybacillus flavithermus E16 and Geobacillus sp. strain F75 with cations prior to attachment often significantly increased (P ? 0.05) the number of viable cells that attached to stainless steel (by up to 1.5 log CFU/cm2) compared with unconditioned bacteria. It is proposed that the transition of A. flavithermus and Geobacillus spp. from milk formulations to stainless steel product contact surfaces in milk powder manufacturing plants is mediated predominantly by bacteria...

Somerton, Ben; Flint, Steve; Palmer, Jon; Brooks, John; Lindsay, Denise

2013-01-01

93

Modelling of the acid base properties of two thermophilic bacteria at different growth times  

Science.gov (United States)

Acid-base titrations and electrophoretic mobility measurements were conducted on the thermophilic bacteria Anoxybacillus flavithermus and Geobacillus stearothermophilus at two different growth times corresponding to exponential and stationary/death phase. The data showed significant differences between the two investigated growth times for both bacterial species. In stationary/death phase samples, cells were disrupted and their buffering capacity was lower than that of exponential phase cells. For G. stearothermophilus the electrophoretic mobility profiles changed dramatically. Chemical equilibrium models were developed to simultaneously describe the data from the titrations and the electrophoretic mobility measurements. A simple approach was developed to determine confidence intervals for the overall variance between the model and the experimental data, in order to identify statistically significant changes in model fit and thereby select the simplest model that was able to adequately describe each data set. Exponential phase cells of the investigated thermophiles had a higher total site concentration than the average found for mesophilic bacteria (based on a previously published generalised model for the acid-base behaviour of mesophiles), whereas the opposite was true for cells in stationary/death phase. The results of this study indicate that growth phase is an important parameter that can affect ion binding by bacteria, that growth phase should be considered when developing or employing chemical models for bacteria-bearing systems.

Heinrich, Hannah T. M.; Bremer, Phil J.; McQuillan, A. James; Daughney, Christopher J.

2008-09-01

94

Influence of temperature and organic load on chemical disinfection of Geobacillus steareothermophilus spores, a surrogate for Bacillus anthracis  

OpenAIRE

This study evaluated the influence of temperature and organic load on the effectiveness of domestic bleach (DB), Surface Decontamination Foam (SDF), and Virkon in inactivating Geobacillus stearothermophilus spores, which are a surrogate for Bacillus anthracis spores. The spores were suspended in light or heavy organic preparations and the suspension was applied to stainless steel carrier disks. The dried spore inoculum was covered with the disinfectants and the disks were then incubated at va...

Guan, Jiewen; Chan, Maria; Brooks, Brian W.; Rohonczy, Liz

2013-01-01

95

Lantibiotics from Geobacillus thermodenitrificans  

OpenAIRE

The lantibiotic nisin has been used as an effective food preservative to combat food-borne pathogens for over 40 y. Despite this successful use, nisin’s stability at pH 7 is limited. Herein, we describe a nisin analog encoded on the genome of the thermophilic bacterium Geobacillus thermodenitrificans NG80-2. This analog termed geobacillin I was obtained by heterologous expression in Escherichia coli and subsequent purification. Extensive NMR characterization demonstrated that geobacillin...

Garg, Neha; Tang, Weixin; Goto, Yuki; Nair, Satish K.; Donk, Wilfred A.

2012-01-01

96

Preconditioning with Cations Increases the Attachment of Anoxybacillus flavithermus and Geobacillus Species to Stainless Steel  

Science.gov (United States)

Preconditioning of Anoxybacillus flavithermus E16 and Geobacillus sp. strain F75 with cations prior to attachment often significantly increased (P ? 0.05) the number of viable cells that attached to stainless steel (by up to 1.5 log CFU/cm2) compared with unconditioned bacteria. It is proposed that the transition of A. flavithermus and Geobacillus spp. from milk formulations to stainless steel product contact surfaces in milk powder manufacturing plants is mediated predominantly by bacterial physiological factors (e.g., surface-exposed adhesins) rather than the concentrations of cations in milk formulations surrounding bacteria. PMID:23645192

Flint, Steve; Palmer, Jon; Brooks, John; Lindsay, Denise

2013-01-01

97

Tracking spore-forming bacteria in food: from natural biodiversity to selection by processes.  

Science.gov (United States)

Sporeforming bacteria are ubiquitous in the environment and exhibit a wide range of diversity leading to their natural prevalence in foodstuff. The state of the art of sporeformer prevalence in ingredients and food was investigated using a multiparametric PCR-based tool that enables simultaneous detection and identification of various genera and species mostly encountered in food, i.e., Alicyclobacillus, Anoxybacillus flavithermus, Bacillus, B. cereus group, B. licheniformis, B. pumilus, B. sporothermodurans, B. subtilis, Brevibacillus laterosporus, Clostridium, Geobacillus stearothermophilus, Moorella and Paenibacillus species. In addition, 16S rDNA sequencing was used to extend identification to other possibly present contaminants. A total of 90 food products, with or without visible trace of spoilage were analysed, i.e., 30 egg-based products, 30 milk and dairy products and 30 canned food and ingredients. Results indicated that most samples contained one or several of the targeted genera and species. For all three tested food categories, 30 to 40% of products were contaminated with both Bacillus and Clostridium. The percentage of contaminations associated with Clostridium or Bacillus represented 100% in raw materials, 72% in dehydrated ingredients and 80% in processed foods. In the last two product types, additional thermophilic contaminants were identified (A. flavithermus, Geobacillus spp., Thermoanaerobacterium spp. and Moorella spp.). These results suggest that selection, and therefore the observed (re)-emergence of unexpected sporeforming contaminants in food might be favoured by the use of given food ingredients and food processing technologies. PMID:22795797

Postollec, Florence; Mathot, Anne-Gabrielle; Bernard, Muriel; Divanac'h, Marie-Laure; Pavan, Sonia; Sohier, Danièle

2012-08-01

98

ISOLATION AND CHARACTERIZATION OF MANNANOLYTIC THERMOPHILIC BACTERIA FROM PALM OIL SHELL AND THEIR MANNANASE ENZYME PRODUCTION PROPERTIES  

Directory of Open Access Journals (Sweden)

Full Text Available A mannanolytic thermophilic bacterium (L-07 was isolated from palm oil shell after 2 days of enrichment in liquid medium supplemented with 1% palm kernel meal as mannan source. Sequence analysis of 16S-rRNA indicated that L-07 was similar (98% to Geobacillus stearothermophilus, a species of thermophilic aerobi c bacteria. We found that G. stearothermophilus L-07 produced extracellular ? -1,4-mannanases, but no ? -manosidase and ? -galactosidase activities. The growth of L-07 reached its maximum (3.0 x 106 cell/ml at 12-20 hours, while the highest ? -mannanase activity (0.52 U/ml was observed in culture medium after 36 hours of cultivation at 60oC. The medium containing locust bean gum was the best for producing extracellular ? -1,4-mannanases compared with kolang kaling , konjak , and palm kernel meal. SDS-PAGE and zymogram analysis demonstrated that crude mannanase complex of L-07 from locust bean gum containing medium comprised three active bands with molecular weight of 85, 73 and 50 kDa.

T RESNAWATI P URWADARIA

2005-01-01

99

Heterologous expression of pyruvate decarboxylase in Geobacillus thermoglucosidasius.  

Science.gov (United States)

Expression of a pyruvate decarboxylase (Pdc) pathway in metabolically versatile thermophilic bacteria could create novel ethanologenic organisms, but no suitable thermostable Pdc is available. We have demonstrated that Pdc from Zymomonas mobilis can be expressed in an active form in Geobacillus thermoglucosidasius at up to 52 degrees C, while expression of Pdc polypeptides up to 54 degrees C was evident from Western blotting. By using an unstable lactate dehydrogenase (ldh) mutant of G. thermoglucosidasius, indirect evidence of Pdc activity in vivo was also obtained. PMID:18368298

Thompson, Ann H; Studholme, David J; Green, Edward M; Leak, David J

2008-08-01

100

Development of a versatile shuttle vector for gene expression in Geobacillus spp.  

Science.gov (United States)

An improved, versatile shuttle vector has been created for the metabolic engineering of Geobacillus spp. As kanamycin is the most thermo-tolerant of commonly used antibiotics, the gene encoding a thermostable kanamycin nucleotidyltransferase, together with the origin of replication from the G. stearothermophilus plasmid pBST1 were cloned into the Escherichia coli cloning vector pUC18. The resulting vector, named pUCG18, replicated in both organisms and could be transformed with an efficiency of 1 x 10(4) transformants per microg of DNA in G. thermoglucosidasius and was stable up to 68 degrees C with antibiotic selection. It was used to demonstrate expression of the pyruvate decarboxylase (pdc) gene from Zymomonas palmae in G. thermoglucosidasius at 45 degrees C. Sequence analysis of the pBST1 derived origin of replication revealed homology with a family of theta replicons that have previously only been found in strains of Bacillus megaterium. PMID:18501964

Taylor, Mark P; Esteban, Carlos D; Leak, David J

2008-07-01

101

Complete genome sequence of Geobacillus thermoglucosidans TNO-09.020, a thermophilic sporeformer associated with a dairy-processing environment  

OpenAIRE

Thermophilic spore-forming bacteria are a common cause of contamination in dairy products. We isolated the thermophilic strain Geobacillus thermoglucosidans TNO-09.020 from a milk processing plant and report the complete genome of a dairy plant isolate consisting of a single chromosome of 3.75 Mb.

Zhao, Y.; Caspers, M. P.; Abee, T.; Siezen, R. J.; Kort, R.

2012-01-01

102

Contamination pathways of spore-forming bacteria in a vegetable cannery.  

Science.gov (United States)

Spoilage of low-acid canned food during prolonged storage at high temperatures is caused by heat resistant thermophilic spores of strict or facultative bacteria. Here, we performed a bacterial survey over two consecutive years on the processing line of a French company manufacturing canned mixed green peas and carrots. In total, 341 samples were collected, including raw vegetables, green peas and carrots at different steps of processing, cover brine, and process environment samples. Thermophilic and highly-heat-resistant thermophilic spores growing anaerobically were counted. During vegetable preparation, anaerobic spore counts were significantly decreased, and tended to remain unchanged further downstream in the process. Large variation of spore levels in products immediately before the sterilization process could be explained by occasionally high spore levels on surfaces and in debris of vegetable combined with long residence times in conditions suitable for growth and sporulation. Vegetable processing was also associated with an increase in the prevalence of highly-heat-resistant species, probably due to cross-contamination of peas via blanching water. Geobacillus stearothermophilus M13-PCR genotypic profiling on 112 isolates determined 23 profile-types and confirmed process-driven cross-contamination. Taken together, these findings clarify the scheme of contamination pathway by thermophilic spore-forming bacteria in a vegetable cannery. PMID:25755080

Durand, Loïc; Planchon, Stella; Guinebretiere, Marie-Hélène; André, Stéphane; Carlin, Frédéric; Remize, Fabienne

2015-06-01

103

Isolation and Characterization of a Bacteriocin-Like Substance Produced by Geobacillus toebii Strain HBB-247  

OpenAIRE

A total of 201 thermophilic bacteria isolated from various thermal spring, mud and soil were tested for their antibacterial activity. Among the mostly active isolates, Geobacillus toebii HBB-247 was further examined. Bacteriocin-like inhibitory substance (BLIS) produced by strain HBB-247 was found to be stable up to 60°C, sensitive to proteolytic enzymes and effective against Enterococcus faecalis, Listeria sp., E. avium, Clostridium pasteurianum, Cellulomonas fimi and some thermophilic stra...

Bas?bu?lbu?l O?zdemir, Gamze; Biyik, Haci Halil

2011-01-01

104

Isobutanol production at elevated temperatures in thermophilic Geobacillus thermoglucosidasius.  

Science.gov (United States)

The potential advantages of biological production of chemicals or fuels from biomass at high temperatures include reduced enzyme loading for cellulose degradation, decreased chance of contamination, and lower product separation cost. In general, high temperature production of compounds that are not native to the thermophilic hosts is limited by enzyme stability and the lack of suitable expression systems. Further complications can arise when the pathway includes a volatile intermediate. Here we report the engineering of Geobacillus thermoglucosidasius to produce isobutanol at 50°C. We prospected various enzymes in the isobutanol synthesis pathway and characterized their thermostabilities. We also constructed an expression system based on the lactate dehydrogenase promoter from Geobacillus thermodenitrificans. With the best enzyme combination and the expression system, 3.3g/l of isobutanol was produced from glucose and 0.6g/l of isobutanol from cellobiose in G. thermoglucosidasius within 48h at 50°C. This is the first demonstration of isobutanol production in recombinant bacteria at an elevated temperature. PMID:24721011

Lin, Paul P; Rabe, Kersten S; Takasumi, Jennifer L; Kadisch, Marvin; Arnold, Frances H; Liao, James C

2014-07-01

105

Alkane inducible proteins in Geobacillus thermoleovorans B23  

Directory of Open Access Journals (Sweden)

Full Text Available Abstract Background Initial step of ?-oxidation is catalyzed by acyl-CoA dehydrogenase in prokaryotes and mitochondria, while acyl-CoA oxidase primarily functions in the peroxisomes of eukaryotes. Oxidase reaction accompanies emission of toxic by-product reactive oxygen molecules including superoxide anion, and superoxide dismutase and catalase activities are essential to detoxify them in the peroxisomes. Although there is an argument about whether primitive life was born and evolved under high temperature conditions, thermophilic archaea apparently share living systems with both bacteria and eukaryotes. We hypothesized that alkane degradation pathways in thermophilic microorganisms could be premature and useful to understand their evolution. Results An extremely thermophilic and alkane degrading Geobacillus thermoleovorans B23 was previously isolated from a deep subsurface oil reservoir in Japan. In the present study, we identified novel membrane proteins (P16, P21 and superoxide dismutase (P24 whose production levels were significantly increased upon alkane degradation. Unlike other bacteria acyl-CoA oxidase and catalase activities were also increased in strain B23 by addition of alkane. Conclusion We first suggested that peroxisomal ?-oxidation system exists in bacteria. This eukaryotic-type alkane degradation pathway in thermophilic bacterial cells might be a vestige of primitive living cell systems that had evolved into eukaryotes.

Kato Tomohisa

2009-03-01

106

Heterologous expression of the alcohol dehydrogenase (adhI) gene from Geobacillus thermoglucosidasius strain M10EXG.  

Science.gov (United States)

A thermostable alcohol dehydrogenase (ADH-I) isolated from the potential thermophilic ethanologen Geobacillus thermoglucosidasius strain M10EXG has been characterised. Inverse PCR showed that the gene (adhI) was localised with 3-hexulose-6-phosphate synthase (HPS) and 6-phospho-3 hexuloisomerase (PHI) on its genome. The deduced peptide sequence of the 1020-bp M10EXG adhI, which corresponds to 340 amino acids, shows 96% and 89% similarity to ADH-hT and ADH-T from Geobacillus stearothermophilus strains LLD-R and NCA 1503, respectively. Over-expression of M10EXG ADH-I in Escherichia coli DH5alpha (pNF303) was confirmed using an ADH activity assay and SDS-PAGE analysis. The specific ADH activity in the extract from this recombinant strain was 9.7(+/-0.3) U mg(-1) protein, compared to 0.1(+/-0.01) U mg(-1) protein in the control strain. The recombinant E. coli showed enzymatic activity towards ethanol, 1-butanol, 1-pentanol, 1-heptanol, 1-hexanol, 1-octanol and 2-propanol, but not methanol. In silico analysis, including phylogenetic reconstruction and protein modeling, confirmed that the thermostable enzyme from G. thermoglucosidasius is likely to belong to the NAD-Zn-dependent family of alcohol dehydrogenases. PMID:18436321

Jeon, Young Jae; Fong, Jiunn C N; Riyanti, Eny I; Neilan, Brett A; Rogers, Peter L; Svenson, Charles J

2008-06-01

107

The mannitol phosptransferase system of Bacillus stearothermophilus  

OpenAIRE

This thesis describes the mannitol-specific PTS of the thermophilic organism B. stearothermophilus. The mannitol operon of B. stearothermophilus was cloned and the properties of the proteins involved in mannitol uptake and the regulation of the expression of the mtl operon were studied. The operon consists of four genes: mtlA, mtlR, mtlF and mtlD coding for the mannitol transporter IICBmtl, the transcriptional regulator MtrlR, the phosphotransferase IIAmtl and the mannitol-l-phosphate dehydro...

Henstra, Sytse Anton

2000-01-01

108

Hypervariable pili and flagella genes provide suitable new targets for DNA high-resolution melt-based genotyping of dairy Geobacillus spp.  

Science.gov (United States)

Although nonpathogenic in nature, spores of Geobacillus are able to attach to surfaces, germinate, and form biofilms, allowing rapid multiplication and persistence within milk powder processing plants, causing final product contamination, and eventually leading to a loss of revenue in terms of downgraded product quality. As a result, Geobacillus spp. have been found to be common contaminants of milk powder worldwide. Genotyping methods can help in gaining insight into the ecology and transmission of these thermophilic bacteria within and between dairy processing plants. The objective of this study was to use the assembled draft genomes of two Geobacillus spp. to identify and test new hypervariable genotyping targets for differentiating closely related dairy Geobacillus isolates. The two Geobacillus spp. strains obtained from high spore count powders were obtained in 2010 (isolate 7E) and in 1995 (isolate 126) and were previously shown to be of same genotype based on a variable number tandem repeat genotyping method. Significant nucleotide sequence variation was found in genes encoding pili and flagella, which were further investigated as suitable loci for a new high-resolution melt analysis (HRMA)-based genotyping method. Three genes encoding pulG (containing prepilin-type N-terminal cleavage domain), pilT (pili retraction protein), and fliW (flagellar assembly protein) were selected as targets for the new pili/flagella gene (PilFla) HRMA genotyping method. The three-gene-based PilFla-HRMA genotyping method differentiated 35 milk powder Geobacillus spp. isolates into 19 different genotype groups (D = 0.93), which compared favorably to the previous method (which used four variable number tandem repeat loci) that generated 16 different genotype groups (D = 0.90). In conclusion, through comparative genomics of two closely related dairy Geobacillus strains, we have identified new hypervariable regions that prove to be useful targets for highly discriminatory genotyping. PMID:25285488

Chauhan, Kanika; Seale, R Brent; Deeth, Hilton C; Turner, Mark S

2014-10-01

109

Geobacillus sp. protokatechuato 3,4-dioksigenaz?  

OpenAIRE

Protocatechuate 3,4-dioxygenase ( EC 1.13.11.3 ) catalyses the ring cleavage step in catabolism of aromatic compounds through the protocatechuate branch of the b-ketoadipate pathway. The protocatechuate 3,4-dioxygenase was purified to homogeneity from the thermophilic Geobacillus strain grown on naphthalene for the first time. The enzyme was purified about 24-fold with a specific activity of 34.2 U mg of protein-1 by a purification procedure including ammonium sulfate fractionation and column...

Bubinas, A.; Giedraityte?, G.; Kale?diene?, L.

2007-01-01

110

Cloning, overexpression, and characterization of a novel alkali-thermostable xylanase from Geobacillus sp. WBI.  

Science.gov (United States)

An endo-?-1,4-xylanase gene xynA of a thermophilic Geobacillus sp. WBI from "hot" compost was isolated by PCR amplification. The gene encoding 407 residues were overexpressed in E. coli and purified by Ni-NTA chromatography. The purified enzyme (47?kDa) had a broad pH optimum of 6.0 to 9.0, and was active between 50 and 90?°C. The enzyme retained 100% of its activity when incubated at 65?°C for 1?h under alkaline condition (pH 10.0) and retained 75% activity at pH 11.0. The Km and Vmax of the enzyme were 0.9?mg?ml(-1) and 0.8?µmol?ml(-1) ?min(-1) , respectively. In molecular dynamics simulation at 338?K (65?°C), the enzyme was found to be stable. At an elevated temperature (450?K) specific ?-helix and ?-turns of the proteins were most denatured. The denaturation was less in WBI compared with its highest homolog G. stearothermophilus T-6 xylanase with difference of six residues. The results predict that these regions are responsible for the improved thermostability observed over related enzymes. The present work encourages further experimental demonstration to understand how these regions contribute thermostability to WBI xylanase. The study noted that WBI produces a xylanase with unique characteristics, specifically alkali-thermostability. PMID:25404211

Mitra, Suranjita; Mukhopadhyay, Bidhan Chandra; Mandal, Anisur Rahaman; Arukha, Ananta Prasad; Chakrabarty, Kuheli; Das, Gourab Kanti; Chakrabartty, Pran Krishna; Biswas, Swadesh Ranjan

2015-04-01

111

Cloning and characterization of a glutamine transport operon of Bacillus stearothermophilus NUB36: effect of temperature on regulation of transcription.  

OpenAIRE

We cloned and sequenced a fragment of the Bacillus stearothermophilus NUB36 chromosome that contains two open reading frames (ORFs) whose products were detected only in cells of cultures grown in complex medium at high temperature. The nucleotide sequence of the two ORFs exhibited significant identity to the sequence of the glnQ and glnH loci of the glutamine transport system in enteric bacteria. In addition, growth response to glutamine, sensitivity to the toxic glutamine analog gamma-L-glut...

Wu, L.; Welker, N. E.

1991-01-01

112

Draft Genome Sequences of Geobacillus sp. Strains CAMR5420 and CAMR12739.  

Science.gov (United States)

Thermophilic Geobacillus spp. can efficiently hydrolyze hemicellulose polymers and are therefore of interest in biotechnological applications. Here we report the genome sequences of two hemicellulolytic strains, Geobacillus sp. CAMR12739 and CAMR5420. PMID:24903881

De Maayer, Pieter; Williamson, Carolyn E; Vennard, Christopher T; Danson, Michael J; Cowan, Don A

2014-01-01

113

Draft Genome Sequences of Geobacillus sp. Strains CAMR5420 and CAMR12739  

OpenAIRE

Thermophilic Geobacillus spp. can efficiently hydrolyze hemicellulose polymers and are therefore of interest in biotechnological applications. Here we report the genome sequences of two hemicellulolytic strains, Geobacillus sp. CAMR12739 and CAMR5420.

Maayer, Pieter; Williamson, Carolyn E.; Vennard, Christopher T.; Danson, Michael J.; Cowan, Don A.

2014-01-01

114

Characterization of aerobic spore-forming bacteria associated with industrial dairy processing environments and product spoilage.  

Science.gov (United States)

Due to changes in the design of industrial food processing and increasing international trade, highly thermoresistant spore-forming bacteria are an emerging problem in food production. Minimally processed foods and products with extended shelf life, such as milk products, are at special risk for contamination and subsequent product damages, but information about origin and food quality related properties of highly heat-resistant spore-formers is still limited. Therefore, the aim of this study was to determine the biodiversity, heat resistance, and food quality and safety affecting characteristics of aerobic spore-formers in the dairy sector. Thus, a comprehensive panel of strains (n=467), which originated from dairy processing environments, raw materials and processed foods, was compiled. The set included isolates associated with recent food spoilage cases and product damages as well as isolates not linked to product spoilage. Identification of the isolates by means of Fourier-transform infrared spectroscopy and molecular methods revealed a large biodiversity of spore-formers, especially among the spoilage associated isolates. These could be assigned to 43 species, representing 11 genera, with Bacillus cereus s.l. and Bacillus licheniformis being predominant. A screening for isolates forming thermoresistant spores (TRS, surviving 100°C, 20 min) showed that about one third of the tested spore-formers was heat-resistant, with Bacillus subtilis and Geobacillus stearothermophilus being the prevalent species. Strains producing highly thermoresistant spores (HTRS, surviving 125°C, 30 min) were found among mesophilic as well as among thermophilic species. B. subtilis and Bacillus amyloliquefaciens were dominating the group of mesophilic HTRS, while Bacillus smithii and Geobacillus pallidus were dominating the group of thermophilic HTRS. Analysis of spoilage-related enzymes of the TRS isolates showed that mesophilic strains, belonging to the B. subtilis and B. cereus groups, were strongly proteolytic, whereas thermophilic strains displayed generally a low enzymatic activity and thus spoilage potential. Cytotoxicity was only detected in B. cereus, suggesting that the risk of food poisoning by aerobic, thermoresistant spore-formers outside of the B. cereus group is rather low. PMID:23973839

Lücking, Genia; Stoeckel, Marina; Atamer, Zeynep; Hinrichs, Jörg; Ehling-Schulz, Monika

2013-09-01

115

Surface topography of the Bacillus stearothermophilus ribosome  

International Nuclear Information System (INIS)

The surface topography of the intact 70S ribosome and free 30S and 50S subunits from Bacillus stearothermophilus strain 2,184 was investigated by lactoperoxidase-catalyzed iodination. Two-dimensional polyacrylamide gel electrophoresis was employed to separate ribosomal proteins for analysis of their reactivity. Free 50S subunits incorporated about 18% more 125I than did 50S subunits derived from 70S ribosomes, whereas free 30S subunits and 30S subunits derived from 70S ribosomes incorporated similar amounts of 125I. Iodinated 70S ribosomes and subunits retained 62-78% of the protein synthesis activity of untreated particles and sedimentation profiles showed no gross conformational changes due to iodination. The proteins most reactive to enzymatic iodination were S4, S7, S10 and Sa of the small subunit and L2, L4, L5/9, L6 and L36 of the large subunit. Proteins S2, S3, S7, S13, Sa, L5/9, L10, L11 and L24/25 were labeled substantially more in the free subunits than in the 70S ribosome. Other proteins, including S5, S9, S12, S15/16, S18 and L36 were more extensively iodinated in the 70S ribosome than in the free subunits. The locations of tyrosine residues in some homologus ribosomal proteins from B. stearothermophilus and E. coli are compared. (orig.)

116

PRODUCTION AND CHARACTERIZATION OF AN ALKALOTHERMOSTABLE, ORGANIC SOLVENT TOLERANT AND SURFACTANT TOLERANT ESTERASE PRODUCED BY A THERMOPHILIC BACTERIUM GEOBACILLUS SP. AGP-04, ISOLATED FROM BAKRESHWAR HOT SPRING, INDIA  

OpenAIRE

A thermophilic bacteria, Geobacillus sp. AGP-04, isolated from Surya Kund hot spring, Bakreshwar, West Bengal, India was studied in terms of capability of tributyrin hydrolysis and characterization of its thermostable esterase activity using p-nitrophenyl butyrate (PNPB) as substrate. The extracellular crude preparation was characterized in terms of pH and temperature optima and stability, organic solvent tolerance capacity and stability, substrate specificity, surfactant tolerance capacity, ...

Amit Ghati; Kaushik Sarkar; Goutam Paul

2013-01-01

117

Preliminary Characterization of the Probiotic Properties of Candida Famata and Geobacillus Thermoleovorans  

Directory of Open Access Journals (Sweden)

Full Text Available Background and Objective: Probiotics are live microbial feed supplements which beneficially affect the host animal by improving its intestinal microbial balance, producing metabolites which inhibit the colonization or growth of other microorganisms or by competing with them for resources such as nutrients or space. The aim of this study was to investigate the probiotic properties of Candida famata and Geobacillus thermoleovorans.Material and Methods: In this study, yeast and bacterial strains isolated from pure oil waste were identified using Api 50 CHB and Api Candida Systems and their probiotic properties were studied through antimicrobial activity, biofilm production, adherence assay and enzymatic characterization.Results and Conclusion: According to biochemical analyses, these strains corresponded to Geobacillus thermoleovorans and Candida famata. Antagonism assay results showed that the tested strains have an inhibitory effect against tested pathogenic bacteria. The yeast Candida famata was unable to produce biofilm on Congo Red Agar (CRA, while the bacterial strain was a slime producer. Adherence assays to abiotic surfaces revealed that the investigated strains were fairly adhesive to polystyrene with values ranging from 0.18 to 0.34 at 595 nm. The enzymatic characterization revealed that the tested strains expressed enzymes such as phosphatase alkaline, esterase lipase (C8, amylase, lipase, lecitenase and caseinase. The obtained results may allow the isolated strains to be considered as having the potential to be candidate probiotics.

A Bakhrouf

2011-12-01

118

Genetic map of the Bacillus stearothermophilus NUB36 chromosome.  

OpenAIRE

A circular genetic map of Bacillus stearothermophilus NUB36 was constructed by transduction with bacteriophage TP-42C and protoplast fusion. Sixty-four genes were tentatively assigned a cognate Bacillus subtilis gene based on growth response to intermediates or end products of metabolism, cross-feeding, accumulation of intermediates, or their relative order in a linkage group. Although the relative position of many genes on the Bacillus stearothermophilus and Bacillus subtilis genetic map app...

Vallier, H.; Welker, N. E.

1990-01-01

119

Cloning and sequence analysis of the heat-stable acrylamidase from a newly isolated thermophilic bacterium, Geobacillus thermoglucosidasius AUT-01.  

Science.gov (United States)

A thermophilic bacterium capable of degrading acrylamide, AUT-01, was isolated from soil collected from a hot spring area in Montana, USA. The thermophilic strain grew with 0.2 % glucose as the sole carbon source and 1.4 mM acrylamide as the sole nitrogen source. The isolate AUT-01 was identified as Geobacillus thermoglucosidasius based on 16S rDNA sequence. An enzyme from the strain capable of transforming acrylamide to acrylic acid was purified by a series of chromatographic columns. The molecular weight of the enzyme was estimated to be 38 kDa by SDS-PAGE. The enzyme activity had pH and temperature optima of 6.2 and 70 ºC, respectively. The influence of different metals and amino acids on the ability of the purified protein to transform acrylamide to acrylic acid was evaluated. The gene from G. thermoglucosidasius encoding the acrylamidase was cloned, sequenced, and compared to aliphatic amidases from other bacterial strains. The G. thermoglucosidasius gene, amiE, encoded a 38 kDa, monomeric, heat-stable amidase that catalysed the cleavage of carbon-nitrogen bonds in acrylamide. Comparison of the amino acid sequence to other bacterial amidases revealed 99 and 82 % similarity to the amino acid sequences of Bacillus stearothermophilus and Pseudomonas aeruginosa, respectively. PMID:22639115

Cha, Minseok; Chambliss, Glenn H

2013-02-01

120

Use of soybean vinasses as a germinant medium for a Geobacillus stearothermophilus ATCC 7953 sterilization biological indicator.  

Science.gov (United States)

A novel low-cost medium was developed from by-products and wastes from the ethanol agro-industry to replace commercial media in the production of a steam sterilization biological indicator (BI). Various recovery media were developed using soybean or sugarcane molasses and vinasse to prepare a self-contained BI. Media performance was evaluated by viability and heat resistance (D(121 °C) value) according to regulatory standards. A medium produced with a soybean vinasse ratio of 1:70 (1.4%) (w/v) produced the results, with D(121 °C)=2.9±0.5 min and Usk=12.7±2.1 min. The addition of 0.8% (w/v) yeast extract improved the germination of heat-damaged spores. The pH variation from 6.0 to 7.3 resulted in a gradual increase in the D(121 °C) value. The absence of calcium chloride resulted in a decrease in germination, while no significant differences were observed with starch addition. Soybean vinasses may thus be used as the main component of a culture medium to substitute for commercial media in the production of self-contained biological indicators. The use of ethanol production waste in this biotechnological process realized a reliable performance, minimized the environmental impact, and decreased BI production costs while producing a high quality product. PMID:21336685

Dlugokenski, Regina E F; Sella, Sandra R B R; Guizelini, Belquis P; Vandenberghe, Luciana P S; Woiciechowski, Adenise L; Soccol, Carlos R; Minozzo, João C

2011-04-01

121

How to Switch Off a Histidine Kinase: Crystal Structure of Geobacillus stearothermophilus KinB with the inhibitor Sda  

OpenAIRE

Entry to sporulation in bacilli is governed by a histidine kinase phosphorelay, a variation of the predominant signal transduction mechanism in prokaryotes. Sda directly inhibits sporulation histidine kinases in response to DNA damage and replication defects. We determined a 2.0-A-resolution X-ray crystal structure of the intact cytoplasmic catalytic core [comprising the dimerization and histidine phosphotransfer domain (DHp domain), connected to the ATP binding catalytic domain] of the Geoba...

Bick, Mj; Lamour, V.; Rajashankar, Kr; Gordiyenko, Y.; Robinson, Cv; Darst, Sa

2008-01-01

122

Identifying critical unrecognized sugar-protein interactions in GH10 xylanases from Geobacillus stearothermophilus using STD NMR.  

Science.gov (United States)

(1)H solution NMR spectroscopy is used synergistically with 3D crystallographic structures to map experimentally significant hydrophobic interactions upon substrate binding in solution under thermodynamic equilibrium. Using saturation transfer difference spectroscopy (STD NMR), a comparison is made between wild-type xylanase XT6 and its acid/base catalytic mutant E159Q--a non-active, single-heteroatom alteration that has been previously utilized to measure binding thermodynamics across a series of xylooligosaccharide-xylanase complexes [Zolotnitsky et al. (2004) Proc Natl Acad Sci USA 101, 11275-11280). In this study, performing STD NMR of one substrate screens binding interactions to two proteins, avoiding many disadvantages inherent to the technique and clearly revealing subtle changes in binding induced upon mutation of the catalytic Glu. To visualize and compare the binding epitopes of xylobiose-xylanase complexes, a 'SASSY' plot (saturation difference transfer spectroscopy) is used. Two extraordinarily strong, but previously unrecognized, non-covalent interactions with H2-5 of xylobiose were observed in the wild-type enzyme but not in the E159Q mutant. Based on the crystal structure, these interactions were assigned to tryptophan residues at the -1 subsite. The mutant selectively binds only the ?-xylobiose anomer. The (1)H solution NMR spectrum of a xylotriose-E159Q complex displays non-uniform broadening of the NMR signals. Differential broadening provides a unique subsite assignment tool based on structural knowledge of face-to-face stacking with a conserved tyrosine residue at the +1 subsite. The results obtained herein by substrate-observed NMR spectroscopy are discussed further in terms of methodological contributions and mechanistic understanding of substrate-binding adjustments upon a charge change in the E159Q construct. PMID:23863045

Balazs, Yael S; Lisitsin, Elina; Carmiel, Oshrat; Shoham, Gil; Shoham, Yuval; Schmidt, Asher

2013-09-01

123

21 CFR 184.1012 - ?-Amylase enzyme preparation from Bacillus stearothermophilus.  

Science.gov (United States)

...2010-04-01 2009-04-01 true α-Amylase enzyme preparation from Bacillus stearothermophilus...Affirmed as GRAS § 184.1012 ?-Amylase enzyme preparation from Bacillus stearothermophilus. (a) ?-Amylase enzyme preparation is obtained...

2010-04-01

124

Isolation and Characterization of a Bacteriocin-Like Substance Produced by Geobacillus toebii Strain HBB-247.  

Science.gov (United States)

A total of 201 thermophilic bacteria isolated from various thermal spring, mud and soil were tested for their antibacterial activity. Among the mostly active isolates, Geobacillus toebii HBB-247 was further examined. Bacteriocin-like inhibitory substance (BLIS) produced by strain HBB-247 was found to be stable up to 60°C, sensitive to proteolytic enzymes and effective against Enterococcus faecalis, Listeria sp., E. avium, Clostridium pasteurianum, Cellulomonas fimi and some thermophilic strains isolated and identified in this study. As a result of Tricine-SDS-PAGE molecular weight of BLIS was estimated about 38 kDa. Production studies showed that G. toebii HBB-247 starts to produce antibacterial substance at early logarithmic phase of growth and maximum production was detected at the end of the logarithmic phase. PMID:23448995

Ba?bülbül Özdemir, Gamze; Biyik, Haci Halil

2012-03-01

125

Draft Genome Sequence of Geobacillus thermopakistaniensis Strain MAS1.  

Science.gov (United States)

Geobacillus thermopakistaniensis strain MAS1 was isolated from a hot spring located in the Northern Areas of Pakistan. The draft genome sequence was 3.5 Mb and identified a number of genes of potential industrial importance, including genes encoding glycoside hydrolases, pullulanase, amylopullulanase, glycosidase, and alcohol dehydrogenases. PMID:24903880

Siddiqui, Masood Ahmed; Rashid, Naeem; Ayyampalayam, Saravanaraj; Whitman, William B

2014-01-01

126

Draft Genome Sequence of Geobacillus thermopakistaniensis Strain MAS1  

OpenAIRE

Geobacillus thermopakistaniensis strain MAS1 was isolated from a hot spring located in the Northern Areas of Pakistan. The draft genome sequence was 3.5 Mb and identified a number of genes of potential industrial importance, including genes encoding glycoside hydrolases, pullulanase, amylopullulanase, glycosidase, and alcohol dehydrogenases.

Siddiqui, Masood Ahmed; Rashid, Naeem; Ayyampalayam, Saravanaraj; Whitman, William B.

2014-01-01

127

Organophosphonate Utilization by the Thermophile Geobacillus caldoxylosilyticus T20  

OpenAIRE

A strain of Geobacillus caldoxylosilyticus from central heating system water could utilize a number of organophosphonates as the sole phosphorus source for growth at 60°C. During growth on glyphosate, aminomethylphosphonate release to the medium was observed, and in cell extracts, a glyphosate oxidoreductase-type activity, producing stoichiometric amounts of aminomethylphosphonate and glyoxylate from glyphosate, was detectable.

Obojska, Agnieszka; Ternan, Nigel G.; Lejczak, Barbara; Kafarski, Pawel; Mcmullan, Geoff

2002-01-01

128

Draft Genome Sequence of Geobacillus thermoleovorans Strain B23  

OpenAIRE

Here, we report the draft genome sequence of Geobacillus thermoleovorans strain B23, which was isolated from a deep subterranean petroleum reservoir in Japan. An array of genes related to unique long-chain alkane degradation pathways in G. thermoleovorans B23 has been identified by whole-genome analyses of this strain.

Boonmak, Chanita; Takahasi, Yasunori; Morikawa, Masaaki

2013-01-01

129

Genome Sequence of a Thermophilic Bacillus, Geobacillus thermodenitrificans DSM465  

OpenAIRE

Geobacillus thermodenitrificans NG80-2 encodes a LadA-mediated alkane degradation pathway, while G. thermodenitrificans DSM465 cannot utilize alkanes. Here, we report the draft genome sequence of G. thermodenitrificans DSM465, which may help reveal the genomic differences between these two strains in regards to the biodegradation of alkanes.

Yao, Nana; Ren, Yi; Wang, Wei

2013-01-01

130

Small-Angle X-Ray Scattering for Imaging of Surface Layers on Intact Bacteria in the Native Environment  

OpenAIRE

Crystalline cell surface layers (S-layers) represent a natural two-dimensional (2D) protein self-assembly system with nanometer-scale periodicity that decorate many prokaryotic cells. Here, we analyze the S-layer on intact bacterial cells of the Gram-positive organism Geobacillus stearothermophilus ATCC 12980 and the Gram-negative organism Aquaspirillum serpens MW5 by small-angle X-ray scattering (SAXS) and relate it to the structure obtained by transmission electron microscopy (TEM) after pl...

Sekot, Gerhard; Schuster, David; Messner, Paul; Pum, Dietmar; Peterlik, Herwig; Scha?ffer, Christina

2013-01-01

131

Functional and Structural Characterization of Thermostable d-Amino Acid Aminotransferases from Geobacillus spp.†  

OpenAIRE

d-Amino acid aminotransferases (d-AATs) from Geobacillus toebii SK1 and Geobacillus sp. strain KLS1 were cloned and characterized from a genetic, catalytic, and structural aspect. Although the enzymes were highly thermostable, their catalytic capability was approximately one-third of that of highly active Bacilli enzymes, with respective turnover rates of 47 and 55 s?1 at 50°C. The Geobacillus enzymes were unique and shared limited sequence identities of below 45% with d-AATs from mesophil...

Lee, Seung-goo; Hong, Seung-pyo; Song, Jae Jun; Kim, Su-jin; Kwak, Mi-sun; Sung, Moon-hee

2006-01-01

132

ANTIBACTERIAL ACTIVITY OF PAPAYA LEAF EXTRACTS AGAINST PATHOGENIC BACTERIA  

Directory of Open Access Journals (Sweden)

Full Text Available It was reported that the extracts of papaya leaves could inhibit the growth of Rhizopus stolonifer. Antibacterial activity of Carica papaya leaf extracts on pathogenic bacteria was observed in this study. Papaya leaves were extracted by using maceration method and three kinds of solvents: ethanol, ethyl acetate, and hexane. Papaya leaf extracts were tested against Bacillus stearothermophilus, Listeria monocytogenes, Pseudomonas sp., and Escherichia coli by agar diffusion method. The objectives of this study were to determine extract ability against pathogenic bacteria, to observe the influence of pH, NaCl, and heat on extracts ability, and to observe extract ability against B. stearothermophilus spores. The data showed that ethyl acetate extract could inhibit B. stearothermophilus, L. monocytogenes, Pseudomonas sp., and E. coli. The extract activity was influenced by pH, and it was more effective in low pH. The extract activity was influenced by NaCl against B. stearothermophillus and E. coli. However, it was not influenced by NaCl in bioassay against L. monocytogenes and Pseudomonas sp. The extract activity was influenced by heating process against all the bacteria tested. The extracts inhibited B. stearothermophilus spores as well. Papaya leaves are potential natural anti-bacteria, which might be used in certain kinds of food.

Adolf Jan Nexson Parhusip

2011-11-01

133

Freezing/thawing pretreatment coupled with biological process of thermophilic Geobacillus sp. G1: Acceleration on waste activated sludge hydrolysis and acidification.  

Science.gov (United States)

A novel pretreatment method combining freezing/thawing with Geobacillus sp. G1 was employed to pretreat waste activated sludge (WAS) for enhancing the WAS hydrolysis and subsequent short-chain fatty acids (SCFAs) production. Results showed that freezing/thawing combined with Geobacillus sp. G1 pretreatment achieved the maximal concentrations of soluble protein from 40±6mg COD/L (non-pretreated) to 1226±24mg COD/L (pretreated), and accumulated SCFAs concentration increased from 248±81mg COD/L to 3032±53mg COD/L. Excitation emission matrix (EEM) fluorescence spectroscopy revealed the highest fluorescence intensity (FI) of protein-like substances, which was the dominant fluorescent organic matters, indicating the synergistic effect of freezing/thawing and Geobacillus sp. G1 pretreatment on organics hydrolysis. High-throughput pyrosequencing analysis investigated that the abundance of bacteria responsible for WAS hydrolysis (such as Clostridium and Caloramator) and SCFAs production (such as Parabacteroides and Bacterodies) was greatly enhanced due to the novel pretreatment method used. PMID:25459862

Yang, Chunxue; Liu, Wenzong; He, Zhangwei; Thangavel, Sangeetha; Wang, Ling; Zhou, Aijuan; Wang, Aijie

2014-11-01

134

PRODUCTION AND CHARACTERIZATION OF AN ALKALOTHERMOSTABLE, ORGANIC SOLVENT TOLERANT AND SURFACTANT TOLERANT ESTERASE PRODUCED BY A THERMOPHILIC BACTERIUM GEOBACILLUS SP. AGP-04, ISOLATED FROM BAKRESHWAR HOT SPRING, INDIA  

Directory of Open Access Journals (Sweden)

Full Text Available A thermophilic bacteria, Geobacillus sp. AGP-04, isolated from Surya Kund hot spring, Bakreshwar, West Bengal, India was studied in terms of capability of tributyrin hydrolysis and characterization of its thermostable esterase activity using p-nitrophenyl butyrate (PNPB as substrate. The extracellular crude preparation was characterized in terms of pH and temperature optima and stability, organic solvent tolerance capacity and stability, substrate specificity, surfactant tolerance capacity, kinetic parameters and activation/inhibition behavior towards some metal ions and chemicals. Tributyrin agar assay exhibited that Geobacillus sp. AGP-04 secretes an extracellular esterase. The Vmax and Km values of the esterase were found to be 5099 U/Land 103.5µM, respectively in the presence of PNPB as substrate. The optimum temperature and pH, for Geobacillus sp. AGP-04 esterase was 60oC and 8.0, respectively. Although the enzyme activity was not significantly altered by incubating crude extract solution at 20-70oC for 1 hour, the enzyme activity was fully lost at 90oC for same incubation period. The pH stability profile showed that original crude esterase activity is stable at a broad range (pH 5.0-10.0. Moreover, the enzyme was highly organic solvent and surfactant tolerant. The effect of some chemical on crude esterase activity indicated that Geobacillus sp. AGP-04 produce an esterase which contains a serine residue in active site and for its activity -SH groups are essential. Besides, enzyme production was highly induced if fermentation medium contain polysaccharides and oil as carbon source.

Amit Ghati

2013-10-01

135

Complete Genome Sequence of the Thermophilic Bacterium Geobacillus thermoleovorans CCB_US3_UF5  

OpenAIRE

Geobacillus thermoleovorans CCB_US3_UF5 is a thermophilic bacterium isolated from a hot spring in Malaysia. Here, we report the complete genome of G. thermoleovorans CCB_US3_UF5, which shows high similarity to the genome of Geobacillus kaustophilus HTA 426 in terms of synteny and orthologous genes.

Muhd Sakaff, Muhd Khairul Luqman; Abdul Rahman, Ahmad Yamin; Saito, Jennifer A.; Hou, Shaobin; Alam, Maqsudul

2012-01-01

136

Studies on variants of Bacillus stearothermophilus strain NCA 1518.  

Science.gov (United States)

The heat resistance, fermentation reactions, nutritional requirements, and phage sensitivity of 18 selected morphological variants of Bacillus stearothermophilus NCA 1518 were studied. It was found that when smooth variants mutated to rough colonial morphology, there was no concurrent change in fermentation reactions, nutritional requirements, or heat resistance. The smooth variant, and the rough mutants derived directly from it, presented a uniform pattern of biochemical capabilities which differed from the pattern presented by the rough variants isolated from the same stock culture. This led to the conclusion that the smooth and rough types previously observed in stocks of B. stearothermophilus NCA 1518 either were carried in the stock since the original isolation or represent a very profound and uncommon mutation, or that one of the variants has been introduced into the stock culture from an extraneous source sometime in the past. PMID:4553138

Humbert, R D; DeGuzman, A; Fields, M L

1972-04-01

137

Effects of iron-reducing bacteria on carbon steel corrosion induced by thermophilic sulfate-reducing consortia.  

Science.gov (United States)

Four thermophilic bacterial species, including the iron-reducing bacterium Geobacillus sp. G2 and the sulfate-reducing bacterium Desulfotomaculum sp. SRB-M, were employed to integrate a bacterial consortium. A second consortium was integrated with the same bacteria, except for Geobacillus sp. G2. Carbon steel coupons were subjected to batch cultures of both consortia. The corrosion induced by the complete consortium was 10 times higher than that induced by the second consortium, and the ferrous ion concentration was consistently higher in iron-reducing consortia. Scanning electronic microscopy analysis of the carbon steel surface showed mineral films colonized by bacteria. The complete consortium caused profuse fracturing of the mineral film, whereas the non-iron-reducing consortium did not generate fractures. These data show that the iron-reducing activity of Geobacillus sp. G2 promotes fracturing of mineral films, thereby increasing steel corrosion. PMID:24225375

Valencia-Cantero, Eduardo; Peña-Cabriales, Juan José

2014-02-28

138

Crystallization and preliminary crystallographic analysis of the phosphotriesterase-like lactonase from Geobacillus kaustophilus  

OpenAIRE

Recombinant GK1506 from the thermophilic bacterium Geobacillus kaustophilus has been expressed, purified and crystallized. A 2.6?Å resolution native data set was collected from a single flash-cooled crystal.

Zheng, Baisong; Yu, Shanshan; Zhang, Yu; Feng, Yan; Lou, Zhiyong

2011-01-01

139

A commensal symbiotic interrelationship for the growth of Symbiobacterium toebii with its partner bacterium, Geobacillus toebii  

Directory of Open Access Journals (Sweden)

Full Text Available Abstract Background Symbiobacterium toebii is a commensal symbiotic thermophile that absolutely requires its partner bacterium Geobacillus toebii for growth. Despite development of an independent cultivation method using cell-free extracts, the growth of Symbiobacterium remains unknown due to our poor understanding of the symbiotic relationship with its partner bacterium. Here, we investigated the interrelationship between these two bacteria for growth of S. toebii using different cell-free extracts of G. toebii. Results Symbiobacterium toebii growth-supporting factors were constitutively produced through almost all growth phases and under different oxygen tensions in G. toebii, indicating that the factor may be essential components for growth of G. toebii as well as S. toebii. The growing conditions of G. toebii under different oxygen tension dramatically affected to the initial growth of S. toebii and the retarded lag phase was completely shortened by reducing agent, L-cysteine indicating an evidence of commensal interaction of microaerobic and anaerobic bacterium S. toebii with a facultative aerobic bacterium G. toebii. In addition, the growth curve of S. toebii showed a dependency on the protein concentration of cell-free extracts of G. toebii, demonstrating that the G. toebii-derived factors have nutrient-like characters but not quorum-sensing characters. Conclusions Not only the consistent existence of the factor in G. toebii during all growth stages and under different oxygen tensions but also the concentration dependency of the factor for proliferation and optimal growth of S. toebii, suggests that an important biosynthetic machinery lacks in S. toebii during evolution. The commensal symbiotic bacterium, S. toebii uptakes certain ubiquitous and essential compound for its growth from environment or neighboring bacteria that shares the equivalent compounds. Moreover, G. toebii grown under aerobic condition shortened the lag phase of S. toebii under anaerobic and microaerobic conditions, suggests a possible commensal interaction that G. toebii scavengers ROS/RNS species and helps the initial growth of S. toebii.

Masui Ryoji

2011-10-01

140

Cloning and characterization of a 4-Hydroxyphenylacetate 3-Hydroxylase from the Thermophile Geobacillus sp. PA-9  

OpenAIRE

A 4-hydroxyphenylacetic acid (4-HPA) hydroxylase-encoding gene, on a 2.7-kb genomic DNA fragment, was cloned from the thermophile Geobacillus sp. PA-9. The Geobacillus sp. PA-9 4-HPA hydroxylase gene, designated hpaH, encodes a protein of 494 amino acids with a predicted molecular mass of 56.269 Da. The deduced amino-acid sequence of the hpaH gene product displayed

Hawumba, J. F.; Brozel, V. S.; Theron, Jacques

2007-01-01

141

Heat shock affects permeability and resistance of Bacillus stearothermophilus spores.  

OpenAIRE

Heat shock of dormant spores of Bacillus stearothermophilus ATCC 7953 at 100 or 80 degrees C for short times, the so-called activation or breaking of dormancy, was investigated by separating the resulting spores by buoyant density centrifugation into a band at 1.240 g/ml that was distinct from another band at 1.340 g/ml, the same density as the original spores. The proportion of spores at 1.240 g/ml became larger when the original dormant spores were heated for a longer period of time, but in...

1988-01-01

142

Metabolic engineering of Geobacillus thermoglucosidasius for high yield ethanol production.  

Science.gov (United States)

We describe the metabolic engineering of two strains of Geobacillus thermoglucosidasius to divert their fermentative carbon flux from a mixed acid pathway, to one in which ethanol becomes the major product. This involved elimination of the lactate dehydrogenase and pyruvate formate lyase pathways by disruption of the ldh and pflB genes, respectively, together with upregulation of expression of pyruvate dehydrogenase. Unlike the situation in Escherichia coli, pyruvate dehydrogenase is active under anaerobic conditions in thermophilic bacilli, but expressed sub-optimally for a role as the primary fermentation pathway. Mutants were initially characterised in batch culture using glucose as carbon substrate and strains with all three modifications shown to form ethanol efficiently and rapidly at temperatures in excess of 60 degrees C in yields in excess of 90% of theoretical. The strain containing the 3 modifications, TM242, was also shown to efficiently ferment cellobiose and a mixed hexose and pentose feed. PMID:19703579

Cripps, R E; Eley, K; Leak, D J; Rudd, B; Taylor, M; Todd, M; Boakes, S; Martin, S; Atkinson, T

2009-11-01

143

Permanent draft genome sequence of Geobacillus thermocatenulatus strain GS-1.  

Science.gov (United States)

Geobacillus thermocatenulatus strain GS-1 is a thermophilic bacillus having a growth optimum at 60°C, capable of degrading alkanes. It was isolated from the formation water of a high-temperature deep oil reservoir in Qinghai oilfield, China. Here, we report the draft genome sequence with an estimated assembly size of 3.5Mb. A total of 3371 protein-coding sequences, including monooxygenase, alcohol dehydrogenase, aldehyde dehydrogenase, fatty acid-CoA ligase, acyl-CoA dehydrogenase, enoyl-CoA hydrogenase, hydroxyacyl-CoA dehydrogenase and thiolase, were detected in the genome, which are involved in the alkane degradation pathway. Our results may provide insights into the genetic basis of the adaptation of this strain to high-temperature oilfield ecosystems. PMID:25280889

Zheng, Beiwen; Zhang, Fan; Chai, Lujun; Yu, Gaoming; Shu, Fuchang; Wang, Zhengliang; Su, Sanbao; Xiang, Tingsheng; Zhang, Zhongzhi; Hou, DuJie; She, Yuehui

2014-10-01

144

Characterization of a thermophilic bacteriophage of Geobacillus kaustophilus.  

Science.gov (United States)

GBK2 is a bacteriophage, isolated from a backyard compost pile, that infects the thermophile Geobacillus kaustophilus. GBK2 has a circularly permuted genome of 39,078 bp with a G+C content of 43 %. Annotation of the genome reveals 62 putative open reading frames (ORFs), 25 of which (40.3 %) show homology to known proteins and 37 of which (59.7 %) are proteins with unknown functions. Twelve of the identified ORFs had the greatest homology to genes from the phage SPP1, a phage that infects the mesophile Bacillus subtilis. The overall genomic arrangement of GBK2 is similar to that of SPP1, with the majority of GBK2 SPP1-like genes coding for proteins involved in DNA replication and metabolism. PMID:24796554

Marks, Timothy J; Hamilton, Paul T

2014-10-01

145

Geobacillus zalihae sp. nov., a thermophilic lipolytic bacterium isolated from palm oil mill effluent in Malaysia  

Directory of Open Access Journals (Sweden)

Full Text Available Abstract Background Thermophilic Bacillus strains of phylogenetic Bacillus rRNA group 5 were described as a new genus Geobacillus. Their geographical distribution included oilfields, hay compost, hydrothermal vent or soils. The members from the genus Geobacillus have a growth temperatures ranging from 35 to 78°C and contained iso-branched saturated fatty acids (iso-15:0, iso-16:0 and iso-17:0 as the major fatty acids. The members of Geobacillus have similarity in their 16S rRNA gene sequences (96.5–99.2%. Thermophiles harboring intrinsically stable enzymes are suitable for industrial applications. The quest for intrinsically thermostable lipases from thermophiles is a prominent task due to the laborious processes via genetic modification. Results Twenty-nine putative lipase producers were screened and isolated from palm oil mill effluent in Malaysia. Of these, isolate T1T was chosen for further study as relatively higher lipase activity was detected quantitatively. The crude T1 lipase showed high optimum temperature of 70°C and was also stable up to 60°C without significant loss of crude enzyme activity. Strain T1T was a Gram-positive, rod-shaped, endospore forming bacterium. On the basic of 16S rDNA analysis, strain T1T was shown to belong to the Bacillus rRNA group 5 related to Geobacillus thermoleovorans (DSM 5366T and Geobacillus kaustophilus (DSM 7263T. Chemotaxonomic data of cellular fatty acids supported the affiliation of strain T1T to the genus Geobacillus. The results of physiological and biochemical tests, DNA/DNA hybridization, RiboPrint analysis, the length of lipase gene and protein pattern allowed genotypic and phenotypic differentiation of strain T1T from its validly published closest phylogenetic neighbors. Strain T1T therefore represents a novel species, for which the name Geobacillus zalihae sp. nov. is proposed, with the type strain T1T (=DSM 18318T; NBRC 101842T. Conclusion Strain T1T was able to secrete extracellular thermostable lipase into culture medium. The strain T1T was identified as Geobacillus zalihae T1T as it differs from its type strains Geobacillus kaustophilus (DSM 7263T and Geobacillus thermoleovorans (DSM 5366T on some physiological studies, cellular fatty acids composition, RiboPrint analysis, length of lipase gene and protein profile.

Salleh Abu

2007-08-01

146

[Infrared spectra of extreme and obligate thermophilic bacteria of the genus Thermus].  

Science.gov (United States)

A recording double-beam spectrophotometer UR-10 was used to obtain IR spectra of the extreme thermophilic non-sporeforming bacterium Thermus flavus, the obligate thermophilic non-sporeforming bacterium Thermus ruber, the thermotolerant bacterium Pseudomonas thermophilus, the sporeforming bacterium Bacillus stearothermophilus, and the mesophilic bacteria Pseudomonas aeruginosa, Ps. denitrificans, Flavobacterium breve, Flavobact. arborescens. No significant differences have been found in the IR spectra of these bacteria. PMID:814383

Egorova, L A; Loginova, L G

1975-01-01

147

Construction of Geobacillus thermoglucosidasius cDNA library and analysis of genes expressed in response to heat stress.  

Science.gov (United States)

Thermophiles exhibit various kinds of molecular mechanisms to survive in extreme environment, but their behavioral responses to long duration stress is poorly understood until date. In the present study, we have prospected for the genes differentially expressed in response to long duration heat stress in thermophilic bacteria. A cDNA library was constructed from Geobacillus thermoglucosidasius grown with a temperature upshift of 10 °C from optimum growth temperature of 45 °C for 16 h. A total of 451 clones from the library were sequenced with accurate base calling that generated 257 high quality sequences with an average read length of 350 bp. We queried our collection of single pass sequences against the NCBI non-redundant database using the BLASTX algorithm and obtained sequences that showed significant similarity (>60%) with heat shock proteins, metabolic proteins and hypothetical proteins. The expressed sequence tags (ESTs) expressed in response to heat stress were annotated that further commuted a strong interaction network among one another. The ESTs based on the best hits were validated by RT-PCR. Di- and tri-nucleotide repeat motifs were also found to be associated with 17 genes involved in heat shock response, metabolism, transport and transcriptional regulation. The present results provide the novel identification of the putative genes responsible for imparting tolerance to bacteria under heat stress and unveil their role for survival of life in environmental extremes. PMID:24398554

Tripathy, S; Maiti, N K

2014-03-01

148

1H, 13C, and 15N backbone and side chain resonance assignments of thermophilic Geobacillus kaustophilus cyclophilin-A  

Energy Technology Data Exchange (ETDEWEB)

Cyclophilins catalyze the reversible peptidyl-prolyl isomerization of their substrates and are present across all kingdoms of life from humans to bacteria. Although numerous biological roles have now been discovered for cyclophilins, their function was initially ascribed to their chaperone-like activity in protein folding where they catalyze the often rate-limiting step of proline isomerization. This chaperone-like activity may be especially important under extreme conditions where cyclophilins are often over expressed, such as in tumors for human cyclophilins {Lee, 2010 #1167}, but also in organisms that thrive under extreme conditions, such as theromophilic bacteria. Moreover, the reversible nature of the peptidyl-prolyl isomerization reaction catalyzed by cyclophilins has allowed these enzymes to serve as model systems for probing the role of conformational changes during catalytic turnover {Eisenmesser, 2002 #20;Eisenmesser, 2005 #203}. Thus, we present here the resonance assignments of a thermophilic cyclophilin from Geobacillus kaustophilus derived from deep-sea sediment {Takami, 2004 #1384}. This thermophilic cyclophilin may now be studied at a variety of temperatures to provide insight into the comparative structure, dynamics, and catalytic mechanism of cyclophilins.

Holliday, Michael; Zhang, Fengli; Isern, Nancy G.; Armstrong, Geoffrey S.; Eisenmesser, Elan Z.

2014-04-01

149

Structural genes encoding the thermophilic alpha-amylases of Bacillus stearothermophilus and Bacillus licheniformis.  

OpenAIRE

The genes encoding the thermostable alpha-amylases of Bacillus stearothermophilus and B. licheniformis were cloned in Escherichia coli, and their DNA sequences were determined. The coding and deduced polypeptide sequences are 59 and 62% homologous to each other, respectively. The B. stearothermophilus protein differs most significantly from that of B. licheniformis in that it possesses a 32-residue COOH-terminal tail. Transformation of E. coli with vectors containing either gene resulted in t...

Gray, G. L.; Mainzer, S. E.; Rey, M. W.; Lamsa, M. H.; Kindle, K. L.; Carmona, C.; Requadt, C.

1986-01-01

150

Cloning and DNA sequence of the gene coding for Bacillus stearothermophilus T-6 xylanase.  

OpenAIRE

Bacillus stearothermophilus T-6 produces an extracellular thermostable xylanase. Affinity-purified polyclonal serum raised against the enzyme was used to screen a genomic library of B. stearothermophilus T-6 constructed in lambda-EMBL3. Two positive phages were isolated, both containing similar 13-kb inserts, and their lysates exhibited xylanase activity. A 3,696-bp SalI-BamHI fragment containing the xylanase gene was subcloned in Escherichia coli and subsequently sequenced. The open reading ...

Gat, O.; Lapidot, A.; Alchanati, I.; Regueros, C.; Shoham, Y.

1994-01-01

151

Material Conformity and Bactericidal Characteristics of High-Density Ozone Disinfection in Vinyl Polysiloxane Impression and PMMA Dentistry Fillings  

OpenAIRE

Disinfection was investigated in high-density ozone produced by dielectric barrier discharge under atmospheric pressure. Disinfection was studied on three-dimensional carriers made of hydrophilic vinyl-polysiloxane impression material and granular acrylic resin used for oral surgery. Experimental results indicate disinfection of spore-forming bacteria: Geobacillus stearothermophilus and Bacillus atrophaeus, and selected species of opportunistic pathogens: Aspergillus ni...

Hiroshi Ohkawa; Tetsuya Akitsu

2014-01-01

152

Enzymatic and cryoreduction EPR studies of the hydroxylation of methylated N(?)-hydroxy-L-arginine analogues by nitric oxide synthase from Geobacillus stearothermophilus.  

Science.gov (United States)

Nitric oxide synthase (NOS) catalyzes the conversion of L-arginine to L-citrulline and NO in a two-step process involving the intermediate N(?)-hydroxy-L-arginine (NHA). It was shown that Cpd I is the oxygenating species for L-arginine; the hydroperoxo ferric intermediate is the reactive intermediate with NHA. Methylation of the N(?)-OH and N(?)-H of NHA significantly inhibits the conversion of NHA into NO and L-citrulline by mammalian NOS. Kinetic studies now show that N(?)-methylation of NHA has a qualitatively similar effect on H?O?-dependent catalysis by bacterial gsNOS. To elucidate the effect of methylating N(?)-hydroxy L-arginine on the properties and reactivity of the one-electron-reduced oxy-heme center of NOS, we have applied cryoreduction/annealing/EPR/ENDOR techniques. Measurements of solvent kinetic isotope effects during 160 K cryoannealing cryoreduced oxy-gsNOS/NHA confirm the hydroperoxo ferric intermediate as the catalytically active species of step two. Product analysis for cryoreduced samples with methylated NHA's, NHMA, NMOA, and NMMA, annealed to 273 K, show a correlation of yields of L-citrulline with the intensity of the g 2.26 EPR signal of the peroxo ferric species trapped at 77 K, which converts to the reactive hydroperoxo ferric state. There is also a correlation between the yield of L-citrulline in these experiments and k(obs) for the H?O?-dependent conversion of the substrates by gsNOS. Correspondingly, no detectable amount of cyanoornithine, formed when Cpd I is the reactive species, was found in the samples. Methylation of the NHA guanidinium N(?)-OH and N(?)-H inhibits the second NO-producing reaction by favoring protonation of the ferric-peroxo to form unreactive conformers of the ferric-hydroperoxo state. It is suggested that this is caused by modification of the distal-pocket hydrogen-bonding network of oxy gsNOS and introduction of an ordered water molecule that facilitates delivery of the proton(s) to the one-electron-reduced oxy-heme moiety. These results illustrate how variations in the properties of the substrate can modulate the reactivity of a monooxygenase. PMID:25251261

Davydov, Roman; Labby, Kristin Jansen; Chobot, Sarah E; Lukoyanov, Dmitriy A; Crane, Brian R; Silverman, Richard B; Hoffman, Brian M

2014-10-21

153

A Group II Intron-Type Open Reading Frame from the Thermophile Bacillus (Geobacillus) stearothermophilus Encodes a Heat-Stable Reverse Transcriptase  

OpenAIRE

The production of a stable cDNA copy of an unstable RNA molecule by reverse transcription is a widely used and essential technology for many important applications, such as the construction of gene libraries, production of DNA probes, and analysis of gene expression by reverse transcriptase PCR (RT-PCR). However, the synthesis of full-length cDNAs is frequently inefficient, because the RT commonly used often produces truncated cDNAs. Synthesizing cDNA at higher temperatures, on the other hand...

Vellore, Jaishree; Moretz, Samuel E.; Lampson, Bert C.

2004-01-01

154

Protein Engineering by Random Mutagenesis and Structure-Guided Consensus of Geobacillus stearothermophilus Lipase T6 for Enhanced Stability in Methanol  

OpenAIRE

The abilities of enzymes to catalyze reactions in nonnatural environments of organic solvents have opened new opportunities for enzyme-based industrial processes. However, the main drawback of such processes is that most enzymes have a limited stability in polar organic solvents. In this study, we employed protein engineering methods to generate a lipase for enhanced stability in methanol, which is important for biodiesel production. Two protein engineering approaches, random mutagenesis (err...

Dror, Adi; Shemesh, Einav; Dayan, Natali; Fishman, Ayelet

2014-01-01

155

Detection and characterization of chlorinated-dioxin ether cleavage function in the bacterium geobacillus midousuji SH2B-J2  

Energy Technology Data Exchange (ETDEWEB)

As of now, there are no dioxin degrading microorganism reported that can be applied to bioremediation. The reasons for this are that degrading function acquired from comprehensive screening of bacteria that can be grown with a single carbon source using non-chlorinated dioxin does not function against highly chlorinated dioxins, and that although white rot fungus capable of degrading lignin, a plant polyphenol substance, have been reported to reduce chlorinated dioxins, degrading enzyme remain unclear. Geobacillus midousuji SH2B-J2 (J2 strain) that have been separated by Hoshina et al. have shown to reduce highly chlorinated dioxins in incineration fly ash, as well as octa-chlorinated dioxins (OCDD). However, details of its degrading mechanisms remain unclear. Since the J2 strain is capable of reducing even OCDD, it was hypothesized that the initial degradation reaction is intramolecular ether bond cleavage, so J2 strain dioxin degradation mechanism was analyzed for verification.

Otsuka, Y.; Hoshina, S. [Jikei Univ. School of Medicine, Tokyo (Japan). Dept. of Laboratory Medicine; Nakamura, M.; Hishiyama, S. [Forestry and Forest Products Research Institute, Ibaraki (Japan); Katayama, Y. [Tokyo Univ. of Agriculture and Technology, Koganei (Japan)

2004-09-15

156

Genome shuffling enhances lipase production of thermophilic Geobacillus sp.  

Science.gov (United States)

Thermostable lipases are potential enzymes for biocatalytic application. In this study, the lipase production of Geobacillus sp. CF03 (WT) was improved by genome shuffling. After two rounds of genome shuffling, one fusant strain (FB1) achieved increase lipase activity from the populations generated by ultraviolet irradiation and ethyl methylsulfonate (EMS) mutagenesis. The growth rate and lipase production of FB1 increased highest by 150 and 238 %, respectively, in comparison to the wild type. The fusant enzyme had a significant change in substrate specificity but still prefers the long-chain length substrates. It had an optimum activity at 60 °C, pH at 7.0-8.0, with p-nitrophenyl palmitate (C16) as a substrate and retained about 50 % of their activity after 15 min at 70 °C, pH 8.0. Furthermore, the fusant lipase showed the preference of sesame oil, waste palm oil, and canola oil. Therefore, the genome shuffling strategy has been successful to strain improvement and selecting strain with multiple desirable characteristics. PMID:25119547

Chalopagorn, Pornchanok; Charoenpanich, Jittima; Choowongkomon, Kiattawee

2014-10-01

157

Purification and Characterization of a Thermostable Lipase from Geobacillus thermodenitrificans IBRL-nra  

OpenAIRE

Thermostable lipase from Geobacillus thermodenitrificans IBRL-nra was purified and characterized. The production of thermostable lipase from Geobacillus thermodenitrificans IBRL-nra was carried out in a shake-flask system at 65°C in cultivation medium containing; glucose 1.0% (w/v); yeast extract 1.25% (w/v); NaCl 0.45% (w/v) olive oil 0.1% (v/v) with agitation of 200?rpm for 24 hours. The extracted extracellular crude thermostable lipase was purified to homogeneity by using ultrafiltratio...

Anuradha Balan; Darah Ibrahim; Rashidah Abdul Rahim; Fatimah Azzahra Ahmad Rashid

2012-01-01

158

Geobacillus icigianus sp. nov., a thermophilic bacterium isolated from a hot spring.  

Science.gov (United States)

A Gram-reaction-positive, motile, thermophilic spore-forming strain, G1w1(T), was isolated from a hot spring of the Valley of Geysers, Kamchatka (Russia). Based on data from the present polyphasic taxonomic study, including phylogenetic analysis of 16S rRNA and spo0A gene sequences, the strain is considered to represent a novel species of the genus Geobacillus, for which the name Geobacillus icigianus sp. nov. is proposed. The type strain is G1w1(T) (?=?VKM B-2853(T)?=?DSM 28325(T)). PMID:25514918

Bryanskaya, Alla V; Rozanov, Alexey S; Slynko, Nikolay M; Shekhovtsov, Sergey V; Peltek, Sergey E

2015-03-01

159

Modification of rock/fluid and fluid/fluid interfaces during MEOR processes, using two biosurfactant producing strains of Bacillus stearothermophilus SUCPM#14 and Enterobacter cloacae: a mechanistic study.  

Science.gov (United States)

During any microbial enhanced oil recovery process, both cells and the metabolic products of bacteria govern the tertiary oil recovery efficiency. However, very accurate examination is needed to find the functionality of these tiny creatures at different reservoir conditions. In this regard, the effect of cell structure on ultimate microbial recovery efficiency which is the most dominant mechanism based on the microorganism types (gram-negative or gram-positive) was systematically investigated. At the first stage, possible different active mechanisms using Bacillus stearothermophilus SUCPM#14 strain were tested using specially designed injection protocol, in situ and ex situ core flooding experiments, interfacial tension, viscosity, pH and Amott wettability index measurements. At the second stage, comparing functionality of B. stearothermophilus SUCPM#14 (a gram-positive type) with the previously examined strain namely Enterobacter cloacae as a gram-negative type, proposed this hypothesis that the cell structure significantly affects the interfacial behaviors. New designed protocols were utilized to check the individual effects of cells, bioproducts and interaction of these together on the oil/water and also fluids/rock interfaces. The final results showed that the cells of B. stearothermophilus SUCPM#14 adhere more into the oil/water interface compared to E. cloacae and change its rheological properties; e.g. its elastic properties which affect the ultimate microbial oil recovery efficiency. Eventually, contradicting results revealed that biosurfactant produced by E. cloacae was able to considerably reduce the interfacial tension and alter the wettability of the rock (to neutral conditions) while biosurfactant produced by B. stearothermophilus SUCPM#14 was not very effective. PMID:24373916

Sarafzadeh, Pegah; Zeinolabedini Hezave, Ali; Mohammadi, Sahar; Niazi, Ali; Ayatollahi, Shahab

2014-05-01

160

Effectiveness of sealed dental prophylaxis angles inoculated with Bacillus stearothermophilus in preventing leakage.  

Science.gov (United States)

It was the purpose of this in vitro investigation to evaluate the effectiveness of several brands of sealed, reusable prophylaxis angles to keep internal materials within the internal portions of the head of the prophylaxis angle, and not allowing contaminates to leak out. Three brands of sealed, reusable dental prophylaxis angles were autoclaved and then taken apart under a biocontainment flow hood. Testing conditions were designed to prevent a "worst case scenario" by inoculating dental prophylaxis angles with 10(6) of the heat resistant spores of Bacillus stearothermophilus and 20% bovine serum albumin to simulate the presence of human serum. The concentration of Bacillus stearothermophilus spores was verified before testing procedures were initiated. The internal portions of the sterile prophylaxis angles were inoculated with a 1:1 mixture of the Bacillus stearothermophilus spores and bovine serum albumin, at a concentration of 1.15 x 10(6) spores/inoculation. The prophylaxis angles were reassembled under sterile conditions, and a sterile rubber cup was inserted into each of the prophylaxis angles. The prophylaxis angles were attached to a sterile dental handpiece and then submerged in a 50 ml tube containing sterile trypticase soy broth and run at 3000 rpm for 30 seconds. The tube of medium was incubated for 7 days. No growth of Bacillus stearothermophilus spores could be cultured from one of the brands of prophylaxis angles at any time during the incubation period. The other two brands of prophylaxis angles did produce some leakage of the Bacillus stearothermophilus spores. PMID:7999287

Barnes, C M; Anderson, N A; Michalek, S M; Russell, C M

1994-01-01

161

A new process for obtaining hydroxytyrosol using transformed Escherichia coli whole cells with phenol hydroxylase gene from Geobacillus thermoglucosidasius.  

Science.gov (United States)

Phenol hydroxylase gene cloning from the thermophilic bacteria Geobacillus thermoglucosidasius was used to develop an effective method to convert tyrosol into the high-added-value compound hydroxytyrosol by hydroxylation. Phenol hydroxylase is a two-component enzyme encoded by pheA1 and pheA2 genes and strictly dependent on NADH and FAD. These two genes were subcloned together as a 2 kb fragment into Escherichia coli Rosetta cells, and the transformants were able to grow and effectively transform up to 5 mM of phenol and tyrosol using IPTG (isopropyl-?-D-thiogalactopyranoside) as inducer. In addition, when a new fragment with a 340 pb upstream pheA1 gene was subcloned, a similar biotransformation rate was attained without IPTG, confirming that this fragment encodes for a phenol hydroxylase promoter that can be recognised by E. coli. Both transformants brought about the total bioconversion of monophenols at a high concentration (5 mM), which represents an increase, both in concentration and in yield, compared with that previously described in the bibliography. The use of the transformant with its constitutive promoter was more interesting from a biotechnological point of view, since it is not necessary to use IPTG. It also gave rise to greater operational stability. PMID:23561120

Orenes-Piñero, Esteban; García-Carmona, Francisco; Sánchez-Ferrer, Alvaro

2013-08-15

162

Catalytic Biomineralization of Fluorescent Calcite by the Thermophilic Bacterium Geobacillus thermoglucosidasius?  

Science.gov (United States)

The thermophilic Geobacillus bacterium catalyzed the formation of 100-?m hexagonal crystals at 60°C in a hydrogel containing sodium acetate, calcium chloride, and magnesium sulfate. Under fluorescence microscopy, crystals fluoresced upon excitation at 365 ± 5, 480 ± 20, or 545 ± 15 nm. X-ray diffraction indicated that the crystals were magnesium-calcite in calcite-type calcium carbonate. PMID:20851984

Yoshida, Naoto; Higashimura, Eiji; Saeki, Yuichi

2010-01-01

163

Catalytic biomineralization of fluorescent calcite by the thermophilic bacterium Geobacillus thermoglucosidasius.  

Science.gov (United States)

The thermophilic Geobacillus bacterium catalyzed the formation of 100-?m hexagonal crystals at 60°C in a hydrogel containing sodium acetate, calcium chloride, and magnesium sulfate. Under fluorescence microscopy, crystals fluoresced upon excitation at 365 ± 5, 480 ± 20, or 545 ± 15 nm. X-ray diffraction indicated that the crystals were magnesium-calcite in calcite-type calcium carbonate. PMID:20851984

Yoshida, Naoto; Higashimura, Eiji; Saeki, Yuichi

2010-11-01

164

Catalytic Biomineralization of Fluorescent Calcite by the Thermophilic Bacterium Geobacillus thermoglucosidasius?  

OpenAIRE

The thermophilic Geobacillus bacterium catalyzed the formation of 100-?m hexagonal crystals at 60°C in a hydrogel containing sodium acetate, calcium chloride, and magnesium sulfate. Under fluorescence microscopy, crystals fluoresced upon excitation at 365 ± 5, 480 ± 20, or 545 ± 15 nm. X-ray diffraction indicated that the crystals were magnesium-calcite in calcite-type calcium carbonate.

Yoshida, Naoto; Higashimura, Eiji; Saeki, Yuichi

2010-01-01

165

PURIFICATION AND CHARACTERIZATION OF A HIGHLY THERMOSTABLE ALPHA-L-ARABINOFURANOSIDASE FROM GEOBACILLUS CALDOXYLOLYTICUS TK4  

Science.gov (United States)

The gene encoding an alpha-L-arabinofuranosidase from Geobacillus caldoxylolyticus TK4, AbfATK4, was isolated, cloned, and sequenced. The deduced protein had a molecular mass of about 58 kDa, and analysis of its amino acid sequence revealed significant homology and conservation of different catalyt...

166

Complete Genome Sequence of the Thermophilic Polychlorinated Biphenyl Degrader Geobacillus sp. Strain JF8 (NBRC 109937)  

OpenAIRE

Geobacillus sp. strain JF8 (NBRC 109937) utilizes biphenyl and naphthalene as sole carbon sources and degrades polychlorinated biphenyl (PCB) at 60°C. Here, we report the complete nucleotide sequence of the JF8 genome (a 3,446,630-bp chromosome and a 39,678-bp plasmid). JF8 has the smallest genome among the known PCB degraders.

Shintani, Masaki; Ohtsubo, Yoshiyuki; Fukuda, Kohei; Hosoyama, Akira; Ohji, Shoko; Yamazoe, Atsushi; Fujita, Nobuyuki; Nagata, Yuji; Tsuda, Masataka; Hatta, Takashi; Kimbara, Kazuhide

2014-01-01

167

Complete Genome Sequence of Geobacillus sp. Strain GHH01, a Thermophilic Lipase-Secreting Bacterium  

OpenAIRE

Geobacillus sp. strain GHH01 was isolated during a screening for producers of extracellular thermostable lipases. The completely sequenced and annotated 3.6-Mb genome encodes 3,478 proteins. The strain is genetically equipped to utilize a broad range of different substrates and might develop natural competence.

Wiegand, Sandra; Rabausch, Ulrich; Chow, Jennifer; Daniel, Rolf; Streit, Wolfgang R.; Liesegang, Heiko

2013-01-01

168

Draft Genome Sequence of Geobacillus kaustophilus GBlys, a Lysogenic Strain with Bacteriophage ?OH2  

OpenAIRE

Geobacillus kaustophilus strain GBlys was isolated along with the bacteriophage ?OH2, which infects G. kaustophilus NBRC 102445T. Here we present a draft sequence of this strain’s genome, which consists of 216 contigs for a total of 3,541,481 bp, 3,679 predicted coding sequences, and a G+C content of 52.1%.

Doi, Katsumi; Mori, Kazuki; Martono, Hindra; Nagayoshi, Yuko; Fujino, Yasuhiro; Tashiro, Kosuke; Kuhara, Satoru; Ohshima, Toshihisa

2013-01-01

169

BOGUS BACTERIA...  

Science.gov (United States)

Here are some websites to get you started... Just click on the links and start searching! microbe world- bacteria Bacteria Rule Quiz! Bacteria.... Harmful Bacteria Bacteria Museum Bacteria! Microbes- all sorts of info... When you are finished looking at the sites or when you have enough information concerning bacteria, ask Mrs. Deaton for some books that can give you even more DETAIL!!! *Don\\'t forget to keep track of your information on your I-CHARTS... ...

Mrs. Deaton

2007-01-24

170

Isolation of phenol-degrading Bacillus stearothermophilus and partial characterization of the phenol hydroxylase.  

OpenAIRE

Bacillus stearothermophilus BR219, isolated from river sediment, degraded phenol at levels to 15 mM at a rate of 0.85 mumol/h (4 x 10(6) cells). The solubilized phenol hydroxylase was NADH dependent, exhibited a 55 degrees C temperature optimum for activity, and was not inhibited by 0.5 mM phenol.

Gurujeyalakshmi, G.; Oriel, P.

1989-01-01

171

Evidence for an S-layer protein pool in the peptidoglycan of Bacillus stearothermophilus.  

Science.gov (United States)

Intact cells of Bacillus stearothermophilus PV72 revealed, after conventional thin-sectioning procedures, the typical cell wall profile of S-layer-carrying gram-positive eubacteria consisting of a ca. 10-nm-thick peptidoglycan-containing layer and a ca. 10-nm-thick S layer. Cell wall preparations obtained by breaking the cells and removing the cytoplasmic membrane by treatment with Triton X-100 revealed a triple-layer structure, with an additional S layer on the inner surface of the peptidoglycan. This profile is characteristic for cell wall preparations of many S-layer-carrying gram-positive eubacteria. Among several variants of strain PV72 obtained upon single colony isolation, we investigated the variant PV72 86-I, which does not exhibit an inner S layer on isolated cell walls but instead possesses a profile identical to that observed for intact cells. In the course of a controlled mild autolysis of isolated cell walls, S-layer subunits were released from the peptidoglycan of the variant and assembled into an additional S layer on the inner surface of the walls, leading to a three-layer cell wall profile as observed for cell wall preparations of the parent strain. In comparison to conventionally processed bacteria, freeze-substituted cells of strain PV72 and the variant strain revealed in thin sections a ca. 18-nm-wide electron-dense peptidoglycan-containing layer closely associated with the S layer. The demonstration of a pool of S-layer subunits in such a thin peptidoglycan layer in an amount at least sufficient for generating one coherent lattice on the cell surface indicated that the subunits must have occupied much of the free space in the wall fabric of both the parent strain and the variant. It can even be speculated that the rate of synthesis and translation of the S-layer protein is influenced by the packing density of the S-layer subunits in the periplasm of the cell wall delineated by the outer S layer and the cytoplasmic membrane. Our data indicate that the matrix of the rigid wall layer inhibits the assembly of the S-layer subunits which are in transit to the outside. PMID:1459950

Breitwieser, A; Gruber, K; Sleytr, U B

1992-12-01

172

Geobacillus thermoglucosidasius Endospores Function as Nuclei for the Formation of Single Calcite Crystals  

OpenAIRE

Geobacillus thermoglucosidasius colonies were placed on an agar hydrogel containing acetate, calcium ions, and magnesium ions, resulting in the formation of single calcite crystals (calcites) within and peripheral to the plating area or parent colony. Microscopic observation of purified calcites placed on the surface of soybean casein digest (SCD) nutrient medium revealed interior crevices from which bacterial colonies originated. Calcites formed on the gel contained [1-13C]- and [2-13C]aceta...

Murai, Rie; Yoshida, Naoto

2013-01-01

173

Geobacillus toebii sp. nov., a novel thermophilic bacterium isolated from hay compost.  

Science.gov (United States)

A thermophilic, spore-forming rod isolated from hay compost in Korea was subjected to a taxonomic study. The micro-organism, designated strain SK-1(T), was identified as being aerobic, Gram-positive, motile and rod-shaped. Growth of the isolate was observed at 45-70 degrees C (optimum 60 degrees C) and pH 6.0-9.0 (optimum pH 7.5). The G+C content of the genomic DNA was 43.9 mol%. Chemotaxonomic characteristics of the isolate included the presence of mesodiaminopimelic acid in the cell wall and iso-C15:0 and iso-C17:0 as the major cellular fatty acids. The predominant isoprenoid quinone was MK-7. The chemotaxonomic characteristics of strain SK-1(T) were the same as those of the genus Geobacillus. Phylogenetic analysis based on 16S rDNA sequences showed that strain SK-1(T) is most closely related to Geobacillus thermoglucosidasius. However, the phenotypic properties of strain SK-1(T) were clearly different from those of G. thermoglucosidasius. The level of DNA-DNA relatedness between strain SK-1(T) and the type strain of G. thermoglucosidasius was 27%. On the basis of the phenotypic traits and molecular systematic data, strain SK-1(T) represents a novel species within the genus Geobacillus, for which the name Geobacillus toebii sp. nov. is proposed. The type strain is strain SK-1(T) (= KCTC 0306BP(T) - DSM 14590(T)). PMID:12508894

Sung, M H; Kim, H; Bae, J W; Rhee, S K; Jeon, C O; Kim, K; Kim, J J; Hong, S P; Lee, S G; Yoon, J H; Park, Y H; Baek, D H

2002-11-01

174

Homologi Gen Seleno Metiltransferase (smt) pada Geobacillus sp. 20k dengan smt Astragalus bisulcatus  

OpenAIRE

Methylselenocysteine (MSC) is the most effective form of selenium against cancer. The synthesis of MSC is catalyzed by seleno methyltransferase (smt) through selenium methylation as its detoxification mechanism. Gene of smt has been characterized in selenium rich plant, Astragalus bisulcatus. This experimental laboratoric study was done on Geobacillus sp. 20k. at Lembaga Ilmu Pengetahuan Indonesia (LIPI), Cibinong, Bogor, November 2008–June 2009.Target gene was detected by polymerase chain ...

Evi Triana; Imam Supardi; Sunarjati Soedigdoadi; Novik Nurhidayat

2010-01-01

175

Draft Genome Sequence of Lignocellulose-Degrading Thermophilic Bacterium Geobacillus sp. Strain WSUCF1  

OpenAIRE

Geobacillus sp. strain WSUCF1 is a thermophilic spore-forming member of the phylum Firmicutes, isolated from a soil sample collected from the compost facility. We report the draft genome sequence of this isolate with an estimated genome size of 3.4 Mb. The genome sequence of this isolate revealed several genes encoding glycoside hydrolases, making it a potential candidate for plant biomass degradation.

Bhalla, Aditya; Kainth, Amoldeep Singh; Sani, Rajesh K.

2013-01-01

176

Polysaccharide-Degrading Thermophiles Generated by Heterologous Gene Expression in Geobacillus kaustophilus HTA426  

OpenAIRE

Thermophiles have important advantages over mesophiles as host organisms for high-temperature bioprocesses, functional production of thermostable enzymes, and efficient expression of enzymatic activities in vivo. To capitalize on these advantages of thermophiles, we describe here a new inducible gene expression system in the thermophile Geobacillus kaustophilus HTA426. Six promoter regions in the HTA426 genome were identified and analyzed for expression profiles using ?-galactosidase reporte...

Suzuki, Hirokazu; Yoshida, Ken-ichi; Ohshima, Toshihisa

2013-01-01

177

Preliminary characterization of the probiotic properties of Candida famata and Geobacillus thermoleovorans  

OpenAIRE

Background and Objective: Probiotics are live microbial feed supplements which beneficially affect the host animal by improving its intestinal microbial balance, producing metabolites which inhibit the colonization or growth of other microorganisms or by competing with them for resources such as nutrients or space. The aim of this study was to investigate the probiotic properties of Candida famata and Geobacillus thermoleovorans.Material and Methods: In this study, yeast and bacterial strains...

Bakhrouf, A.; Behi, A.; Hmila, Z.; Mahdhi, A.

2011-01-01

178

Cloning, purification and characterization of an alkali-stable endoxylanase from thermophilic Geobacillus sp. 71.  

Science.gov (United States)

The gene encoding a xylanase from Geobacillus sp. 71 was isolated, cloned, and sequenced. Purification of the Geobacillus sp 7.1 xylanase, XyzGeo71, following overexpression in E. coli produced an enzyme of 47 kDa with an optimum temperature of 75°C. The optimum pH of the enzyme is 8.0, but it is active over a broad pH range. This protein showed the highest sequence identity (93%) with the xylanase from Geobacillus thermodenitrificans NG80-2. XyzGeo71 contains a catalytic domain that belongs to the glycoside hydrolase family 10 (GH10). XyzGeo71 exhibited good pH stability, remaining stable after treatment with buffers ranging from pH 7.0 to 11.0 for 6 h. Its activity was partially inhibited by Al(3+) and Cu(2+) but strongly inhibited by Hg(2+). The enzyme follows Michaelis-Menten kinetics, with K(m) and V(max) values of 0.425 mg xylan/ml and 500 ?mol/min.mg, respectively. The enzyme was free from cellulase activity and degraded xylan in an endo fashion. The action of the enzyme on oat spelt xylan produced xylobiose and xylotetrose. PMID:22806019

Canakc?, Sabriye; Cevher, Zeliha; Inan, Kadriye; Tokgoz, Muslum; Bahar, Fatmagul; Kacagan, Murat; Sal, Fulya Ay; Belduz, Ali Osman

2012-05-01

179

Characterisation of a new thermoalkaliphilic bacterium for the production of high-quality hemp fibres, Geobacillus thermoglucosidasius strain PB94A.  

Science.gov (United States)

Novel thermophilic and alkaliphilic bacteria for the processing of bast fibres were isolated using hemp pectin as substrate. The strain PB94A, which showed the highest growth rate (micro = 0.5/h) was identified as Geobacillus thermoglucosidasius (DSM 21625). The strain grew optimally at 60 degrees C and pH 8.5. During growth on citrus pectin, the strain produced pectinolytic lyases, which were excreted into the medium. In contrast to the commercially available pectinase Bioprep 3000 L, the enzymes from G. thermoglucosidasius PB94A converted pectin isolated from hemp fibres. In addition to hemp pectin, the culture supernatant also degraded citrus, sugar beet and apple pectin and polygalacturonic acid. When hemp fibres were incubated with the cell-free fermentation broth of G. thermoglucosidasius PB94A, the fineness of the fibres increased. The strain did not produce any cellulases, which is important in order to avoid damaging the fibres during incubation. Therefore, these bacteria or their enzymes can be used to produce fine high-quality hemp fibres. PMID:19333594

Valladares Juárez, A G; Dreyer, J; Göpel, P K; Koschke, N; Frank, D; Märkl, H; Müller, R

2009-06-01

180

A comparative study of fatty acid profile and formation of biofilm in Geobacillus gargensis exposed to variable abiotic stress.  

Science.gov (United States)

Understanding bacterial fatty acid (FA) profile has a great taxonomic significance as well as clinical importance for diagnosis issues. Both the composition and nature of membrane FAs change under different nutritional, biotic and (or) abiotic stresses, and environmental stress. Bacteria produce both odd-carbon as well as branched-chain fatty acids (BCFAs). This study was designed to examine the effect of abiotic pressure, including salinity, temperature, pH, and oxinic stress on the growth, development, and FA profile in thermophilic Geobacillus gargensis. Under these stresses, 3 parametric ratios, 2-methyl fatty acids/3-methyl fatty acids (iso-/anteiso-FAs), BCFAs/straight-chain saturated fatty acids (SCSFA), and SCSFAs/straight-chain unsaturated fatty acids (SCUFA), in addition to total lipids affected by variable stresses were measured. Our results indicate that the ratio of total iso-/anteiso-FAs increased at the acidic pH range of 4.1-5.2 and decreased with increasing pH. The reverse was true for salt stress when iso-/anteiso-FAs ratio increased with salt concentration. The BCFAs/SCSFAs and SCSFAs/SCUFAs ratios increased at neutral and alkaline pH and high salt concentration, reduced incubation time, and comparatively high temperature (55-65 °C) of the growth medium. The bacterial total lipid percentage deceased with increasing salt concentration, incubation period, but it increased with temperature. The formation of extracellular polymeric substances was observed under all stress conditions and with the addition of sodium dodecyl sulfate (2 and 5 mmol/L) to the growth medium. The membrane phospholipid composition of the bacterium was analyzed by thin-layer chromatography. PMID:25496258

Al-Beloshei, Noor Essa; Al-Awadhi, Husain; Al-Khalaf, Rania A; Afzal, Mohammad

2015-01-01

181

Bacteria Museum  

Science.gov (United States)

Who knew that bacteria had their own virtual museum? Here, visitors will "learn that not all bacteria are harmful, how they are used in industry, that they belong to the oldest living creatures on Earth", and many more interesting facts to discover about the diverse world of bacteria. The "Bacterial Species Files" tab at the top of the page, allows visitors to look up information on 40 different specific bacteria, from Anthrax to Yersinia enterocolitica. The information provided for each bacterium includes photographs, consumer guides, fact sheets, and scientific links. Visitors will find that the "Main Exhibits" tab addresses the basics about bacteria, as well as "Pathogenic Bacteria", "Evolution", "How We Fight Bacteria", and "Food and Water Safety". Visitors will surely enjoy the "Good Bacteria in Food" link found in the Food and Water Safety section, as it explains how some foods benefit from good bacteria, such as Swiss cheese, sausage, sauerkraut, chocolate, and coffee.

182

Production and Characterization of a Mesophilic Lipase Isolated from Bacillus stearothermophilus AB-1  

Directory of Open Access Journals (Sweden)

Full Text Available Using Bacillus stearothermophilus AB-1 isolated from air, the production of lipase was attempted along with its purification and characterization studies. When different carbon and nitrogen sources were supplemented in the culture medium, xylose, tryptophan, alanine, phenylalanine and potassium nitrate were found to be the best. During cultivation, the strain secreted most of its lipase content after 48 h. In particular, the lipase produced in the culture broth showed 300 U mL-1 when cultivated at optimal temperature and pH of 35 °C and 7.5, respectively. The enzyme was purified using 60% ammonium sulfate precipitation and sephadex G200 column chromatography. The enzyme was stable up to 40 °C and in the range of pH 7-8. This research reports for the first time the characterization of mesophilic lipase from Bacillus stearothermophilus AB-1 isolated from air.

Emad Abd El-moniem Abada

2008-01-01

183

Production and characterization of a mesophilic lipase isolated from Bacillus stearothermophilus AB-1.  

Science.gov (United States)

Using Bacillus stearothermophilus AB-1 isolated from air, the production of lipase was attempted along with its purification and characterization studies. When different carbon and nitrogen sources were supplemented in the culture medium, xylose, tryptophan, alanine, phenylalanine and potassium nitrate were found to be the best. During cultivation, the strain secreted most of its lipase content after 48 h. In particular, the lipase produced in the culture broth showed 300 U mL(-1) when cultivated at optimal temperature and pH of 35 degrees C and 7.5, respectively. The enzyme was purified using 60% ammonium sulfate precipitation and sephadex G200 column chromatography. The enzyme was stable up to 40 degrees C and in the range of pH 7-8. This research reports for the first time the characterization of mesophilic lipase from Bacillus stearothermophilus AB-1 isolated from air. PMID:18819547

Abada, Emad Abd El-Moniem

2008-04-15

184

Redefining the Role of the Quaternary Shift in Bacillus stearothermophilus Phosphofructokinase  

OpenAIRE

Bacillus stearothermophilus PFK (BsPFK) is a homotetramer that is allosterically inhibited by phosphoenolpyruvate (PEP), which binds along one dimer-dimer interface. The substrate, fructose 6-phosphate (Fru-6-P), binds along the other dimer-dimer interface. Evans et al., observed that the inhibitor, phosphoglycolate, bound structure, when compared to the substrate and activator bound structure of wild-type BsPFK, exhibits a 7° rotation about the substrate-binding interface, termed the quater...

Mosser, Rockann; Reddy, Manchi C. M.; Bruning, John B.; Sacchettini, James C.; Reinhart, Gregory D.

2013-01-01

185

The Glucuronic Acid Utilization Gene Cluster from Bacillus stearothermophilus T-6  

OpenAIRE

A ?-EMBL3 genomic library of Bacillus stearothermophilus T-6 was screened for hemicellulolytic activities, and five independent clones exhibiting ?-xylosidase activity were isolated. The clones overlap each other and together represent a 23.5-kb chromosomal segment. The segment contains a cluster of xylan utilization genes, which are organized in at least three transcriptional units. These include the gene for the extracellular xylanase, xylanase T-6; part of an operon ...

Shulami, Smadar; Gat, Orit; Sonenshein, Abraham L.; Shoham, Yuval

1999-01-01

186

Structural genes encoding the thermophilic alpha-amylases of Bacillus stearothermophilus and Bacillus licheniformis.  

Science.gov (United States)

The genes encoding the thermostable alpha-amylases of Bacillus stearothermophilus and B. licheniformis were cloned in Escherichia coli, and their DNA sequences were determined. The coding and deduced polypeptide sequences are 59 and 62% homologous to each other, respectively. The B. stearothermophilus protein differs most significantly from that of B. licheniformis in that it possesses a 32-residue COOH-terminal tail. Transformation of E. coli with vectors containing either gene resulted in the synthesis and secretion of active enzymes similar to those produced by the parental organisms. A plasmid was constructed in which the promoter and the NH2-terminal two-thirds of the B. stearothermophilus coding sequence was fused out of frame to the entire mature coding sequence of the B. licheniformis gene. Approximately 1 in 5,000 colonies transformed with this plasmid was found to secrete an active amylase. Hybridization analysis of plasmids isolated from these amylase-positive colonies indicated that the parental coding sequences had recombined by homologous recombination. DNA sequence analysis of selected hybrid genes revealed symmetrical, nonrandom distribution of loci at which the crossovers had resolved. Several purified hybrid alpha-amylases were characterized and found to differ with respect to thermostability and specific activity. PMID:3009417

Gray, G L; Mainzer, S E; Rey, M W; Lamsa, M H; Kindle, K L; Carmona, C; Requadt, C

1986-05-01

187

Structure based protein engineering of Bacillus stearothermophilus ?-amylase: toward a new substrate specificity  

International Nuclear Information System (INIS)

Full text. Structural similarity is observed in all members of ?-amylase family but different products are generated during hydrolysis of starch due to different affinities for intermediate dextrins. In order to understand the structural determinants for this property and to introduce different specificity to ?-amylase of Bacillus stearothermophilus we intend to solve the three dimensional structure by X-ray crystallography of the native protein by using synchrotron radiation at Brazilian National Synchrotron Light Laboratory (LNLS). Protein was over expressed in E. coli, purified and crystallization experiments were carried out by using sparse matrix Crystal Screen and Crystal Screen II from Hampton Research (Laguna Hills, CA, USA). Several condition have produced crystals with some defined characteristic: MDP seems to be important to the crystallization: the preferential pH is around 7.5 with organic buffer (HEPES); organic solvent as 2-propanol seems to be also important for the crystallization. On those condition crystals appeared as cluster of needles or small crystals with high number of nucleation. New conditions are being prepared to improve the site and quality of crystals. Data collection of native of Bacillus stearothermophilus ?-amylase will e done at Protein Crystallography Station at LNLS. Crystal structure of mutated ?-amylase bu site direct mutagenesis of residues suggested by the native crystal structure will be obtained. Co-crystallization of Bacbe obtained. Co-crystallization of Bacillus stearothermophilus ?-amylase and oligosaccharide will be carried out to identify residues involved in the binding site to plan new mutation. In another series of mutation the putative binding site residues, once identified, will be mutated to residues observed in TAKA amylase to confer different specificity to ?-amylase. Based on the available TAKA amylase structure, in the primary sequence homology and in the three dimensional model of Bacillus stearothermophilus ?-amylase (using Bacillus licheniformis crystal structure as initial model) it seems that Bacillus stearothermophilus ?-amylase binding site is more complex with and insertion of 40 residues. Therefore the three dimensional structure is crucial to understand the specificity of the substrate of this enzyme which will be used to drive the design of mutation to introduce new properties for industrial purpose. (author)

188

Influence of Cations on Growth of Thermophilic Geobacillus spp. and Anoxybacillus flavithermus in Planktonic Culture  

OpenAIRE

Free ions of Na+, K+, Ca2+, and Mg2+ influenced the optical density of planktonic cultures of thermophilic bacilli. Anoxybacillus flavithermus E16 and Geobacillus sp. strain F75 (milk powder manufacturing plant isolates) and A. flavithermus DSM 2641 and G. thermoleovorans DSM 5366 were studied. Ca2+ and Mg2+ were associated with increases in optical density more so than Na+ and K+. Overall, it appeared that Ca2+ and/or Mg2+ was required for the production of protein in thermophilic bacilli, a...

Somerton, Ben; Palmer, Jon; Brooks, John; Smolinski, Edward; Lindsay, Denise; Flint, Steve

2012-01-01

189

Thermoadaptation trait revealed by the genome sequence of thermophilic Geobacillus kaustophilus  

OpenAIRE

We present herein the first complete genome sequence of a thermophilic Bacillus-related species, Geobacillus kaustophilus HTA426, which is composed of a 3.54 Mb chromosome and a 47.9 kb plasmid, along with a comparative analysis with five other mesophilic bacillar genomes. Upon orthologous grouping of the six bacillar sequenced genomes, it was found that 1257 common orthologous groups composed of 1308 genes (37%) are shared by all the bacilli, whereas 839 genes (24%) in the G.kaustophilus gen...

Takami, Hideto; Takaki, Yoshihiro; Chee, Gab-joo; Nishi, Shinro; Shimamura, Shigeru; Suzuki, Hiroko; Matsui, Satomi; Uchiyama, Ikuo

2004-01-01

190

Influence of Cations on Growth of Thermophilic Geobacillus spp. and Anoxybacillus flavithermus in Planktonic Culture  

Science.gov (United States)

Free ions of Na+, K+, Ca2+, and Mg2+ influenced the optical density of planktonic cultures of thermophilic bacilli. Anoxybacillus flavithermus E16 and Geobacillus sp. strain F75 (milk powder manufacturing plant isolates) and A. flavithermus DSM 2641 and G. thermoleovorans DSM 5366 were studied. Ca2+ and Mg2+ were associated with increases in optical density more so than Na+ and K+. Overall, it appeared that Ca2+ and/or Mg2+ was required for the production of protein in thermophilic bacilli, as shown by results obtained with A. flavithermus E16, which was selected for further study. PMID:22287005

Palmer, Jon; Brooks, John; Smolinski, Edward; Lindsay, Denise; Flint, Steve

2012-01-01

191

Thermostable hemicellulases of a bacterium, Geobacillus sp. DC3, isolated from the former Homestake Gold Mine in Lead, South Dakota  

Science.gov (United States)

A thermophilic strain, Geobacillus sp. DC3, capable of producing hemicellulolytic enzymes was isolated from the 1.5-km depth of the former Homestake gold mine in Lead, South Dakota. The DC3 strain expressed a high level of extracellular endoxylanase at 39.5 U/mg protein with additional hemicellulase...

192

Engineering pyruvate decarboxylase-mediated ethanol production in the thermophilic host Geobacillus thermoglucosidasius.  

Science.gov (United States)

This study reports the expression, purification, and kinetic characterization of a pyruvate decarboxylase (PDC) from Gluconobacter oxydans. Kinetic analyses showed the enzyme to have high affinity for pyruvate (120 ?M at pH 5), high catalytic efficiency (4.75?×?10(5) M(-1) s(-1) at pH 5), a pHopt of approximately 4.5 and an in vitro temperature optimum at approximately 55 °C. Due to in vitro thermostablity (approximately 40 % enzyme activity retained after 30 min at 65 °C), this PDC was considered to be a suitable candidate for heterologous expression in the thermophile Geobacillus thermoglucosidasius for ethanol production. Initial studies using a variety of methods failed to detect activity at any growth temperature (45-55 °C). However, the application of codon harmonization (i.e., mimicry of the heterogeneous host's transcription and translational rhythm) yielded a protein that was fully functional in the thermophilic strain at 45 °C (as determined by enzyme activity, Western blot, mRNA detection, and ethanol productivity). Here, we describe the first successful expression of PDC in a true thermophile. Yields as high as 0.35?±?0.04 g/g ethanol per gram of glucose consumed were detected, highly competitive to those reported in ethanologenic thermophilic mutants. Although activities could not be detected at temperatures approaching the growth optimum for the strain, this study highlights the possibility that previously unsuccessful expression of pdcs in Geobacillus spp. may be the result of ineffective transcription/translation coupling. PMID:24276622

Van Zyl, L J; Taylor, M P; Eley, K; Tuffin, M; Cowan, D A

2014-02-01

193

Homologi Gen Seleno Metiltransferase (smt pada Geobacillus sp. 20k dengan smt Astragalus bisulcatus  

Directory of Open Access Journals (Sweden)

Full Text Available Methylselenocysteine (MSC is the most effective form of selenium against cancer. The synthesis of MSC is catalyzed by seleno methyltransferase (smt through selenium methylation as its detoxification mechanism. Gene of smt has been characterized in selenium rich plant, Astragalus bisulcatus. This experimental laboratoric study was done on Geobacillus sp. 20k. at Lembaga Ilmu Pengetahuan Indonesia (LIPI, Cibinong, Bogor, November 2008–June 2009.Target gene was detected by polymerase chain reaction and sequencing. DNA sequence was analyzed by the basic local alignment search tool (BLAST. The results showed that smt gene and its homolog were generally found on selenium rich plants, such as A. bisulcatus, C. sinensis, and A. thaliana, with similarity more than 85%. Designed primers for amplification of smt are CAAGCCACCATTCAAGGTTT and CCCTACTGATCCCGCAATTA. Amplification of DNA fragments obtained at approximately 190 base pair. DNA sequence and its protein translation were identified as part of the thermophilic enzyme and smt of A. bisulcatus, with 83% similarity for smt genes and 88–90% for protein. In conclusion, Geobacillus sp. 20k have smt genes similar with that of A. bisulcatus, therefore further development of this isolate as a non toxic selenium source for cancer therapy could be taken into consideration.

Evi Triana

2010-09-01

194

Use of a Mixture of Surrogates for Infectious Bioagents in a Standard Approach to Assessing Disinfection of Environmental Surfaces ?  

OpenAIRE

We used a mixture of surrogates (Acinetobacter baumannii, Mycobacterium terrae, hepatitis A virus, and spores of Geobacillus stearothermophilus) for bioagents in a standardized approach to test environmental surface disinfectants. Each carrier containing 10 ?l of mixture received 50 ?l of a test chemical or saline at 22 ± 2°C. Disinfectant efficacy criteria were ?6 log10 reduction for the bacteria and the spores and ?3 log10 reduction for the virus. Peracetic acid (1,000 ppm) was effe...

Sabbah, Safaa; Springthorpe, Susan; Sattar, Syed A.

2010-01-01

195

Geobacillus toebii subsp. decanicus subsp. nov., a hydrocarbon-degrading, heavy metal resistant bacterium from hot compost.  

Science.gov (United States)

A thermophilic, spore-forming bacterial strain L1(T) was isolated from hot compost "Pomigliano Environment" s.p.a., Pomigliano, Naples, Italy. The strain was identified by using a polyphasic taxonomic approach. L1(T) resulted in an aerobic, gram-positive, rod-shaped, thermophilic with an optimum growth temperature of 68 degrees C chemorganotrophic bacterium which grew on hydrocarbons as unique carbon and energy sources and was resistant to heavy metals. The G+C DNA content was 43.5 mol%. Phylogenetic analysis of 16S rRNA gene sequence and Random Amplified Polymorphic DNA-PCR (RAPD-PCR) analysis of L1(T) and related strains showed that it forms within Geobacillus toebii, a separate cluster in the Geobacillus genus. The composition of cellular fatty acids analyses by Gas-Mass Spectroscopy differed from that typical for the genus Geobacillus in that it is lacking in iso-C15 fatty acid, while iso-C16 and iso-C17 were predominant. Isolates grew on a rich complex medium at temperatures between 55-75 degrees C and presented a doubling time (t(d)) of 2 h and 6 h using complex media and hydrocarbon media, respectively. Among hydrocarbons tested, n-decane (2%) was the more effective to support the growth (1 g/L of wet cells). The microorganism showed resistance to heavy metal tested during the growth. Furthermore, intracellular alpha-galactosidase and alpha-glucosidase enzymatic activities were detectable in the L1(T) strain. Based on phenotypic, phylogenetic, fatty acid analysis and results from DNA-DNA hybridization, we propose assigning a novel subspecies of Geobacillus toebii, to be named Geobacillus toebii subsp. decanicus subsp. nov., with the type strain L1(T) (=DSM 17041=ATCC BAA 1004). PMID:17116971

Poli, Annarita; Romano, Ida; Caliendo, Gaetano; Nicolaus, Giancarlo; Orlando, Pierangelo; Falco, Antonio de; Lama, Licia; Gambacorta, Agata; Nicolaus, Barbara

2006-08-01

196

Molecular characterization of the Bacillus stearothermophilus PV72 S-layer gene sbsB induced by oxidative stress.  

OpenAIRE

S-layer protein variation from a hexagonally ordered (SbsA; 130 kDa) to a obliquely ordered (SbsB; 98 kDa) protein in Bacillus stearothermophilus PV72 is mediated by an increased oxygen supply. To elucidate the molecular basis of S-layer protein variation in B. stearothermophilus PV72, the sbsB gene, coding for the 98-kDa protein, was cloned by means of inverse PCR technology and sequenced. The sbsB coding region cloned in pUC18 was expressed in Escherichia coli, without its own regulatory up...

Kuen, B.; Koch, A.; Asenbauer, E.; Sara?, M.; Lubitz, W.

1997-01-01

197

Pathways of glucose metabolism by rough and smooth variants of Bacillus stearothermophilus.  

Science.gov (United States)

The radiorespirometric method was used to study the pathways of glucose metabolism in the rough and smooth variants of Bacillus stearothermophilus NCA 1518. The Embden-Meyerhof (EM) pathway was more active in the smooth variant than in the rough variant. The participation of the hexose monophosphate shunt (HMP) and EM pathways in the smooth variant was calculated as 4.2 and 95.8%, respectively. The rough variant utilized glucose via the EM pathway exclusively or in combination with a pathway other than the HMP pathway. The estimated efficiency of the tricarboxylic acid system in the rough and smooth variants was 81.3 and 4.9%, respectively. PMID:6035046

Hill, W M; Fields, M L; Tweedy, B G

1967-05-01

198

Evidence for an S-layer protein pool in the peptidoglycan of Bacillus stearothermophilus.  

OpenAIRE

Intact cells of Bacillus stearothermophilus PV72 revealed, after conventional thin-sectioning procedures, the typical cell wall profile of S-layer-carrying gram-positive eubacteria consisting of a ca. 10-nm-thick peptidoglycan-containing layer and a ca. 10-nm-thick S layer. Cell wall preparations obtained by breaking the cells and removing the cytoplasmic membrane by treatment with Triton X-100 revealed a triple-layer structure, with an additional S layer on the inner surface of the peptidogl...

Breitwieser, A.; Gruber, K.; Sleytr, U. B.

1992-01-01

199

Production of alpha-amylase in batch and chemostat culture by bacillus stearothermophilus  

Energy Technology Data Exchange (ETDEWEB)

The production of alpha-amylase by a strain of B.stearothermophilus isolated from leaf litter was investigated in a tryptone-maltose medium at 55 degrees in batch and chemostat culture. Amylase production was growth-limited and restricted to the exponential phase in batch culture. The enzyme yield was reduced by 40% when the culture pH was maintained at pH 7.2. Amylase production in chemostat culture was influenced by the growth rate throughout the dilution rate range used.

Davis, P.E.; Cohen, D.L.; Whitaker, A.

1980-01-01

200

Bacteria Transformation  

Science.gov (United States)

Students construct paper recombinant plasmids to simulate the methods genetic engineers use to create modified bacteria. They learn what role enzymes, DNA and genes play in the modification of organisms. For the particular model they work on, they isolate a mammal insulin gene and combine it with a bacteria's gene sequence (plasmid DNA) for production of the protein insulin.

National Science Foundation GK-12 and Research Experience for Teachers (RET) Programs,

201

Modular system for assessment of glycosyl hydrolase secretion in Geobacillus thermoglucosidasius.  

Science.gov (United States)

The facultatively anaerobic, thermophilic bacterium Geobacillus thermoglucosidasius is being developed as an industrial micro-organism for cellulosic bioethanol production. Process improvement would be gained by enhanced secretion of glycosyl hydrolases. Here we report the construction of a modular system for combining promoters, signal peptide encoding regions and glycosyl hydrolase genes to facilitate selection of the optimal combination in G. thermoglucosidasius. Initially, a minimal three-part E. coli-Geobacillus sp. shuttle vector pUCG3.8 was constructed using Gibson isothermal DNA assembly. The three PCR amplicons contained the pMB1 E. coli origin of replication and multiple cloning site (MCS) of pUC18, the Geobacillus sp. origin of replication pBST1 and the thermostable kanamycin nucleotidyltransferase gene (knt), respectively. G. thermoglucosidasius could be transformed with pUCG3.8 at an increased efficiency [2.8×10(5) c.f.u. (µg DNA)(-1)] compared to a previously reported shuttle vector, pUCG18. A modular cassette for the inducible expression and secretion of proteins in G. thermoglucosidasius, designed to allow the simple interchange of parts, was demonstrated using the endoglucanase Cel5A from Thermotoga maritima as a secretion target. Expression of cel5A was placed under the control of a cellobiose-inducible promoter (P?glu) together with a signal peptide encoding sequence from a G. thermoglucosidasius C56-YS93 endo-?-1,4-xylanase. The interchange of parts was demonstrated by exchanging the cel5A gene with the 3' region of a gene with homology to celA from Caldicellulosiruptor saccharolyticus and substituting P?glu for the synthetic, constitutive promoter PUp2n38, which increased Cel5A activity five-fold. Cel5A and CelA activities were detected in culture supernatants indicating successful expression and secretion. N-terminal protein sequencing of Cel5A carrying a C-terminal FLAG epitope confirmed processing of the signal peptide sequence. PMID:23704786

Bartosiak-Jentys, Jeremy; Hussein, Ali H; Lewis, Claire J; Leak, David J

2013-07-01

202

C-terminal truncations of a thermostable Bacillus stearothermophilus alpha-amylase.  

Science.gov (United States)

A series of truncated proteins from a thermostable Bacillus stearothermophilus alpha-amylase was prepared to study the importance of the extension in the C-terminus compared with other liquefying Bacillus alpha-amylases. The mutations introducing new translation termination sites shortened the 515 amino acid residue-long wild type enzyme by 17, 32, 47, 73 or 93 residues. The longer the truncation, the lower the specific activity of the enzyme. Only the two longest mutant proteins were active: the specific activity of the 498 residue variant was 97% and protein 483 was 36% that of the parental enzyme. The Km values of starch hydrolysis changed from 1.09 for wild type enzyme to 0.35 and 0.21 for mutants 498 and 483, respectively, indicating altered substrate binding. The mutant enzymes had almost identical pH and temperature optima with the wild type amylase, but enhanced thermal stability and altered end product profile. The consequences of the truncation to the structure and function of the enzymes were explored with molecular modeling. The liquefying amylases seem to require approximately 480 residues to be active, whereas the C-terminal end of B.stearothermophilus amylase is required for increased activity. PMID:7855141

Vihinen, M; Peltonen, T; Iitiä, A; Suominen, I; Mäntsälä, P

1994-10-01

203

Effect of ionization and nisin on the Bacillus strains and Salmonella Enteritidis inoculated Stearothermophilus  

International Nuclear Information System (INIS)

The antimicrobial effect of nisin (at 1000UI/g), and irradiation (at 1, 3 and 5kGy), against the growth of Salmonella enteritidis (106 ufc/ml) and Bacillus Stearothermophilus (106 ufc/ml), inoculated in turkey salami, was studied during storage at 4 degree for 21 days. Treatment of turkey salami with nisin at 1000UI/g did not show any antimicrobial activity against S. Enteritidis with 6.7 pour cent and 0.8 pour cent of reduction after 0 and 21 days of storage respectively, and seems to be insufficient to inhibit B. Stearothermophilus with 23 pour cent and 21 pour cent of reduction after 0 and 21 days of storage respectively. Antimicrobial activities of irradiation were better and proportional to irradiation doses; it shows a reduction of 27 pour cent, 55 pour cent and 67 pour cent by D1, D2 and D3 respectively. The combination of nisin with irradiation at 5kGy showed stronger antimicrobial activities than those obtained by its combination with the first and the second irradiation dose.

204

Bacillus stearothermophilus disk assay for detection of residual penicillins in milk: collaborative study.  

Science.gov (United States)

A collaborative study was performed on a Bacillus stearothermophilus paper disk method designed to detect residual levels of 4 antibiotic drugs in whole market milk. This method is a modification of an earlier procedure developed for the International Dairy Federation. Whole milk samples spiked at low levels with ampicillin, cephapirin, cloxacillin, and penicillin G were sent frozen to 11 collaborating laboratories with instructions to assay them promptly according to the method provided. Five of the laboratories reported inconclusive results due to technical difficulties encountered with the method. The 6 remaining laboratories all detected levels of 0.005-0.008 microgram or unit/mL for penicillin G, ampicillin, and cephapirin and 0.05-0.08 microgram/mL for cloxacillin. The most commonly used official methods, the Sarcina lutea (Micrococcus luteus) cylinder plate method and the Bacillus subtilis paper disk method, can detect levels of 0.01 and 0.05 unit penicillin G/mL, respectively. The B. stearothermophilus method is rapid, simple to perform, and more sensitive than present official methods. The method has been adopted as official first action for the detection of penicillins in milk. PMID:528474

Ouderkirk, L A

1979-09-01

205

Use ofBacillus stearothermophilus as a model to study tamoxifen-membrane interactions.  

Science.gov (United States)

A strain ofBacillus stearothermophilus was used as a model to study the interaction of tamoxifen (TAM) with the cell membrane and the cytostatic antiproliferative effects not related to oestrogen binding. The bacterial growth in the presence of TAM was evaluated turbidimetrically and by viable cell counting. In parallel, partition coefficients of TAM in bacterial polar lipid bilayers were determined. Additionally, studies with fluorescent probes were carried out to investigate TAM effects on the physical state of the membrane lipid bilayer. TAM inhibits growth ofB. stearothermophilus and induces loss of cell viability as a function of concentration and the growth temperature. High partitioning of this drug in the bacterial lipid membranes was observed, reaching maximal values in the temperature range of the phase transition. Fluorescence polarizations of 1,6-diphenyl-1,3,5-hexatriene (DPH) and of its propionic acid derivative (DPH-PA) report significant structural disorder of the lipid bilayer induced by the cytostatic, particularly in the phase transition range. A putative relationship between growth impairment by TAM and the TAM-induced perturbation of the physical behaviour of bacterial membrane lipids is suggested. PMID:20650227

Luxo, C; Jurado, A S; Custo Dio, J B; Madeira, V M

1996-08-01

206

Crystal structure of ATP-binding subunit of an ABC transporter from Geobacillus kaustophilus.  

Science.gov (United States)

The ATP binding cassette (ABC) transporters, represent one of the largest superfamilies of primary transporters, which are very essential for various biological functions. The crystal structure of ATP-binding subunit of an ABC transporter from Geobacillus kaustophilus has been determined at 1.77 Å resolution. The crystal structure revealed that the protomer has two thick arms, (arm I and II), which resemble 'L' shape. The ATP-binding pocket is located close to the end of arm I. ATP molecule is docked into the active site of the protein. The dimeric crystal structure of ATP-binding subunit of ABC transporter from G. kaustophilus has been compared with the previously reported crystal structure of ATP-binding subunit of ABC transporter from Salmonella typhimurium. PMID:25724946

Manjula, M; Pampa, K J; Kumar, S M; Mukherjee, S; Kunishima, N; Rangappa, K S; Lokanath, N K

2015-03-27

207

Determination of thermobacteriological parameters and size of Bacillus stearothermophilus ATCC 7953 spores / Determinação dos parâmetros de destruição térmica e dimensões de esporos de Bacillus stearothermophilus ATCC 7953  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Este experimento objetivou determinar os parâmetros de destruição térmica de esporos de Bacillus stearothermophilus ATCC 7953 e a estimativa de suas dimensões. Os esporos foram suspensos em solução salina e em mistura de grãos de milho e soja moídos, distribuídos em tubos TDT, e submetidos ao calor [...] por tempo variável, seguido de incubação e contagem direta. Determinou-se o valor D (tempo necessário para redução da viabilidade do micro-organismo em 1 ciclo logarítmico sob determinada temperatura) e o valor z (intervalo de temperatura que ocasiona variação de 10 vezes no valor D). Os esporos suspensos em solução salina foram observados em microscópio eletrônico de varredura, para estimativa das dimensões. Os valores de D121,1 ºC e z para os esporos suspensos em solução salina foram 8,8 minutos e 12,8 ºC, respectivamente. Para aqueles suspensos em mistura milho e soja, D121,1 ºC e z foram 14,2 minutos e 23,7 ºC, respectivamente. As micrografias indicaram que os esporos apresentam-se como bastonetes, homogêneos em forma e dimensão, com comprimento e diâmetro estimados em 2 e 1 µm, respectivamente. Os resultados confirmam a elevada resistência térmica do esporo e indicam que este é um bom indicador biológico para avaliação do processo de extrusão como esterilizante de alimentos. Abstract in english In order to determine thermobacteriological parameters for B. stearothermophilus spores, they were diluted in a saline solution medium and in ground corn-soybean mix, distributed in TDT tube, and submitted to heat for a specific period of time. The D value (time to reduce 1 log cycle of microbial co [...] unt under a certain temperature) and z value (variation of temperature to cause 10-fold change in D value) were estimated. To estimate their dimensions, the spores were visualized by using a scanning electron microscope. D121.1 ºC and z values for these spores, as determined in the saline solution, were 8.8 minutes and 12.8 ºC, respectively. D121,1 ºC and z values determined in the corn-soy mix were 14.2 minutes and 23.7 ºC, respectively. The micrographs indicated that the spores have homogeneous shape and size, with length and diameter of 2 and 1 µm, respectively. These results confirm that the spore is highly thermal-resistant, and it is a good biological indicator to evaluate the extrusion process as a feed sterilizer.

Marcos, Fraiha; Antonio Carlos de Oliveira, Ferraz; João Domingos, Biagi.

1041-10-01

208

Determination of thermobacteriological parameters and size of Bacillus stearothermophilus ATCC 7953 spores Determinação dos parâmetros de destruição térmica e dimensões de esporos de Bacillus stearothermophilus ATCC 7953  

Directory of Open Access Journals (Sweden)

Full Text Available In order to determine thermobacteriological parameters for B. stearothermophilus spores, they were diluted in a saline solution medium and in ground corn-soybean mix, distributed in TDT tube, and submitted to heat for a specific period of time. The D value (time to reduce 1 log cycle of microbial count under a certain temperature and z value (variation of temperature to cause 10-fold change in D value were estimated. To estimate their dimensions, the spores were visualized by using a scanning electron microscope. D121.1 ºC and z values for these spores, as determined in the saline solution, were 8.8 minutes and 12.8 ºC, respectively. D121,1 ºC and z values determined in the corn-soy mix were 14.2 minutes and 23.7 ºC, respectively. The micrographs indicated that the spores have homogeneous shape and size, with length and diameter of 2 and 1 µm, respectively. These results confirm that the spore is highly thermal-resistant, and it is a good biological indicator to evaluate the extrusion process as a feed sterilizer.Este experimento objetivou determinar os parâmetros de destruição térmica de esporos de Bacillus stearothermophilus ATCC 7953 e a estimativa de suas dimensões. Os esporos foram suspensos em solução salina e em mistura de grãos de milho e soja moídos, distribuídos em tubos TDT, e submetidos ao calor por tempo variável, seguido de incubação e contagem direta. Determinou-se o valor D (tempo necessário para redução da viabilidade do micro-organismo em 1 ciclo logarítmico sob determinada temperatura e o valor z (intervalo de temperatura que ocasiona variação de 10 vezes no valor D. Os esporos suspensos em solução salina foram observados em microscópio eletrônico de varredura, para estimativa das dimensões. Os valores de D121,1 ºC e z para os esporos suspensos em solução salina foram 8,8 minutos e 12,8 ºC, respectivamente. Para aqueles suspensos em mistura milho e soja, D121,1 ºC e z foram 14,2 minutos e 23,7 ºC, respectivamente. As micrografias indicaram que os esporos apresentam-se como bastonetes, homogêneos em forma e dimensão, com comprimento e diâmetro estimados em 2 e 1 µm, respectivamente. Os resultados confirmam a elevada resistência térmica do esporo e indicam que este é um bom indicador biológico para avaliação do processo de extrusão como esterilizante de alimentos.

Marcos Fraiha

2010-12-01

209

Thermophilic fermentation of acetoin and 2,3-butanediol by a novel Geobacillus strain  

OpenAIRE

Abstract Background Acetoin and 2,3-butanediol are two important biorefinery platform chemicals. They are currently fermented below 40°C using mesophilic strains, but the processes often suffer from bacterial contamination. Results This work reports the isolation and identification of a novel aerobic Geobacillus strain XT15 capable of producing both of these chemicals under elevated temperatures, thus reducing the risk of bacterial contamination. The optimum growth temperature was found to b...

Xiao Zijun; Wang Xiangming; Huang Yunling; Huo Fangfang; Zhu Xiankun; Xi Lijun; Lu Jian R

2012-01-01

210

Experimental fossilisation of the thermophilic Gram-positive bacterium Geobacillus SP7A: a long duration preservation study.  

OpenAIRE

Recent experiments to fossilise microorganisms using silica have shown that the fossilisation process is far more complex than originally thought; microorganisms not only play an active role in silica precipitation but may also remain alive while silica is precipitating on their cell wall. In order to better understand the mechanisms that lead to the preservation of fossilised microbes in recent and ancient rocks, we experimentally silicified a Gram-positive bacterium, Geobacillus SP7A, over ...

Orange, Franc?ois; Dupont, Samuel; Le Goff, Olivier; Bienvenu, Nade?ge; Disnar, Jean-robert; Westall, Frances; Le Romancer, Marc

2014-01-01

211

Cloning and characterization of a new manganese superoxide dismutase from deep-sea thermophile Geobacillus sp. EPT3.  

Science.gov (United States)

A new gene encoding a superoxide dismutase (SOD) was identified from a thermophile Geobacillus sp. EPT3 isolated from a deep-sea hydrothermal field in east Pacific. The open reading frame of this gene encoded 437 amino acid residues. It was cloned, overexpressed in Escherichia coli (DE3), and the recombinant protein was purified to homogeneity. Geobacillus sp. EPT3 SOD was of the manganese-containing SOD type, as judged by the insensitivity of the recombinant enzyme to both KCN and H?O?, and the activity analysis of Fe or Mn reconstituted SODs by polyacrylamide gel electrophoresis. The recombinant SOD was determined to be a homodimer with monomeric molecular mass of 59.0 kDa. In comparison with other Mn-SODs, the manganese-binding sites are conserved in the sequence (His260, His308, Asp392, His396). The recombinant enzyme had high thermostability at 50 °C. It retained 57 % residual activity after incubation at 90 °C for 1 h, which indicated that this SOD was thermostable. The enzyme also showed striking stability over a wide range of pH 5.0-11.0. At tested conditions, the recombinant SOD from Geobacillus sp. EPT3 showed a relatively good tolerance to some inhibitors, detergents, and denaturants, such as ?-mercaptoethanol, dithiothreitol, phenylmethylsulfonyl fluoride, Chaps, Triton X-100, urea, and guanidine hydrochloride. PMID:24242973

Zhu, Yanbing; Wang, Guohong; Ni, Hui; Xiao, Anfeng; Cai, Huinong

2014-04-01

212

Kasugamycin resistant mutants of Bacillus stearothermophilus lacking the enzyme for the methylation of two adjacent adenosines in 16S ribosomal RNA.  

Science.gov (United States)

Several mutants of B. stearothermophilus have been isolated that are resistant to the antibiotic kasugamycin. One of these is shown to lack dimethylation of two adjacent adenosines in the 16S ribosomal RNA. All mutants that were analyzed biochemically lack the enzyme that is able to methylate this site. Ribosomal sensitivity and resistance to kasugamycin in B. stearothermophilus is therefore, like in E. coli, closely connected with dimethylation of the adenosines. PMID:6575236

Van Buul, C P; Damm, J B; Van Knippenberg, P H

1983-01-01

213

Detection of residual penicillins in milk by using a Bacillus stearothermophilus disk assay.  

Science.gov (United States)

A paper disk method based on a procedure described by the International Dairy Federation is presented for the detection of 4 beta-lactam antibiotics (penicillin G, ampicillin, cephapirin, and cloxacillin) in whole milk. Bacillus stearothermophilus var. calidolactis, prepared as a stable spore suspension, was used as the test organism. Levels of 0.005 unit penicillin G/ml, 0.005 microgram ampicillin or cephapirin/ml, and 0.05 microgram cloxacillin/ml were readily detected in whole milk. Results were produced in 3-4 hr. The method offers several advantages, including greater simplicity, sensitivity, and rapidity, over methods now commonly used to detect residual levels of these drugs in milk. PMID:893331

Ouderkirk, L A

1977-09-01

214

Thermophilic fermentation of acetoin and 2,3-butanediol by a novel Geobacillus strain  

Directory of Open Access Journals (Sweden)

Full Text Available Abstract Background Acetoin and 2,3-butanediol are two important biorefinery platform chemicals. They are currently fermented below 40°C using mesophilic strains, but the processes often suffer from bacterial contamination. Results This work reports the isolation and identification of a novel aerobic Geobacillus strain XT15 capable of producing both of these chemicals under elevated temperatures, thus reducing the risk of bacterial contamination. The optimum growth temperature was found to be between 45 and 55°C and the medium initial pH to be 8.0. In addition to glucose, galactose, mannitol, arabionose, and xylose were all acceptable substrates, enabling the potential use of cellulosic biomass as the feedstock. XT15 preferred organic nitrogen sources including corn steep liquor powder, a cheap by-product from corn wet-milling. At 55°C, 7.7?g/L of acetoin and 14.5?g/L of 2,3-butanediol could be obtained using corn steep liquor powder as a nitrogen source. Thirteen volatile products from the cultivation broth of XT15 were identified by gas chromatography–mass spectrometry. Acetoin, 2,3-butanediol, and their derivatives including a novel metabolite 2,3-dihydroxy-3-methylheptan-4-one, accounted for a total of about 96% of all the volatile products. In contrast, organic acids and other products were minor by-products. ?-Acetolactate decarboxylase and acetoin:2,6-dichlorophenolindophenol oxidoreductase in XT15, the two key enzymes in acetoin metabolic pathway, were found to be both moderately thermophilic with the identical optimum temperature of 45°C. Conclusions Geobacillus sp. XT15 is the first naturally occurring thermophile excreting acetoin and/or 2,3-butanediol. This work has demonstrated the attractive prospect of developing it as an industrial strain in the thermophilic fermentation of acetoin and 2,3-butanediol with improved anti-contamination performance. The novel metabolites and enzymes identified in XT15 also indicated its strong promise as a precious biological resource. Thermophilic fermentation also offers great prospect for improving its yields and efficiencies. This remains a core aim for future work.

Xiao Zijun

2012-12-01

215

Circular permutation within the coenzyme binding domain of the tetrameric glyceraldehyde-3-phosphate dehydrogenase from Bacillus stearothermophilus.  

OpenAIRE

A circularly permuted (cp) variant of the phosphorylating NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (GAPDH) from Bacillus stearothermophilus has been constructed with N- and C-termini created within the coenzyme binding domain. The cp variant has a kcat value equal to 40% of the wild-type value, whereas Km and KD values for NAD show a threefold decrease compared to wild type. These results indicate that the folding process and the conformational changes that accompany NAD binding...

Vignais, M. L.; Corbier, C.; Mulliert, G.; Branlant, C.; Branlant, G.

1995-01-01

216

Active Site Loop Conformation Regulates Promiscuous Activity in a Lactonase from Geobacillus kaustophilus HTA426  

Science.gov (United States)

Enzyme promiscuity is a prerequisite for fast divergent evolution of biocatalysts. A phosphotriesterase-like lactonase (PLL) from Geobacillus kaustophilus HTA426 (GkaP) exhibits main lactonase and promiscuous phosphotriesterase activities. To understand its catalytic and evolutionary mechanisms, we investigated a “hot spot” in the active site by saturation mutagenesis as well as X-ray crystallographic analyses. We found that position 99 in the active site was involved in substrate discrimination. One mutant, Y99L, exhibited 11-fold improvement over wild-type in reactivity (kcat/Km) toward the phosphotriesterase substrate ethyl-paraoxon, but showed 15-fold decrease toward the lactonase substrate ?-decanolactone, resulting in a 157-fold inversion of the substrate specificity. Structural analysis of Y99L revealed that the mutation causes a ?6.6 Å outward shift of adjacent loop 7, which may cause increased flexibility of the active site and facilitate accommodation and/or catalysis of organophosphate substrate. This study provides for the PLL family an example of how the evolutionary route from promiscuity to specificity can derive from very few mutations, which promotes alteration in the conformational adjustment of the active site loops, in turn draws the capacity of substrate binding and activity. PMID:25706379

Zhang, Yu; An, Jiao; Yang, Guang-Yu; Bai, Aixi; Zheng, Baisong; Lou, Zhiyong; Wu, Geng; Ye, Wei; Chen, Hai-Feng; Feng, Yan; Manco, Giuseppe

2015-01-01

217

Geobacillus thermoglucosidasius endospores function as nuclei for the formation of single calcite crystals.  

Science.gov (United States)

Geobacillus thermoglucosidasius colonies were placed on an agar hydrogel containing acetate, calcium ions, and magnesium ions, resulting in the formation of single calcite crystals (calcites) within and peripheral to the plating area or parent colony. Microscopic observation of purified calcites placed on the surface of soybean casein digest (SCD) nutrient medium revealed interior crevices from which bacterial colonies originated. Calcites formed on the gel contained [1-(13)C]- and [2-(13)C]acetate, demonstrating that G. thermoglucosidasius utilizes carbon derived from acetate for calcite formation. During calcite formation, vegetative cells swam away from the parent colony in the hydrogel. Hard-agar hydrogel inhibited the formation of calcites peripheral to the parent colony. The calcite dissolved completely in 1 M HCl, with production of bubbles, and the remaining endospore-like particles were easily stained with Brilliant green dye. The presence of DNA and protein in calcites was demonstrated by electrophoresis. We propose that endospores initiate the nucleation of calcites. Endospores of G. thermoglucosidasius remain alive and encapsulated in calcites. PMID:23455343

Murai, Rie; Yoshida, Naoto

2013-05-01

218

Structure of a bifunctional alcohol dehydrogenase involved in bioethanol generation in Geobacillus thermoglucosidasius.  

Science.gov (United States)

Bifunctional alcohol/aldehyde dehydrogenase (ADHE) enzymes are found within many fermentative microorganisms. They catalyse the conversion of an acyl-coenzyme A to an alcohol via an aldehyde intermediate; this is coupled to the oxidation of two NADH molecules to maintain the NAD(+) pool during fermentative metabolism. The structure of the alcohol dehydrogenase (ADH) domain of an ADHE protein from the ethanol-producing thermophile Geobacillus thermoglucosidasius has been determined to 2.5?Å resolution. This is the first structure to be reported for such a domain. In silico modelling has been carried out to generate a homology model of the aldehyde dehydrogenase domain, and this was subsequently docked with the ADH-domain structure to model the structure of the complete ADHE protein. This model suggests, for the first time, a structural mechanism for the formation of the large multimeric assemblies or `spirosomes' that are observed for this ADHE protein and which have previously been reported for ADHEs from other organisms. PMID:24100328

Extance, Jonathan; Crennell, Susan J; Eley, Kirstin; Cripps, Roger; Hough, David W; Danson, Michael J

2013-10-01

219

Active Site Loop Conformation Regulates Promiscuous Activity in a Lactonase from Geobacillus kaustophilus HTA426.  

Science.gov (United States)

Enzyme promiscuity is a prerequisite for fast divergent evolution of biocatalysts. A phosphotriesterase-like lactonase (PLL) from Geobacillus kaustophilus HTA426 (GkaP) exhibits main lactonase and promiscuous phosphotriesterase activities. To understand its catalytic and evolutionary mechanisms, we investigated a "hot spot" in the active site by saturation mutagenesis as well as X-ray crystallographic analyses. We found that position 99 in the active site was involved in substrate discrimination. One mutant, Y99L, exhibited 11-fold improvement over wild-type in reactivity (kcat/Km) toward the phosphotriesterase substrate ethyl-paraoxon, but showed 15-fold decrease toward the lactonase substrate ?-decanolactone, resulting in a 157-fold inversion of the substrate specificity. Structural analysis of Y99L revealed that the mutation causes a ?6.6 Å outward shift of adjacent loop 7, which may cause increased flexibility of the active site and facilitate accommodation and/or catalysis of organophosphate substrate. This study provides for the PLL family an example of how the evolutionary route from promiscuity to specificity can derive from very few mutations, which promotes alteration in the conformational adjustment of the active site loops, in turn draws the capacity of substrate binding and activity. PMID:25706379

Zhang, Yu; An, Jiao; Yang, Guang-Yu; Bai, Aixi; Zheng, Baisong; Lou, Zhiyong; Wu, Geng; Ye, Wei; Chen, Hai-Feng; Feng, Yan; Manco, Giuseppe

2015-01-01

220

Production, Partial Characterization and Cloning of Thermostable ?-amylase of a Thermophile Geobacillus thermoleovorans YN  

Directory of Open Access Journals (Sweden)

Full Text Available In a molecular screening program to select a potent thermostable amylase from a previously isolated thermophiles, a locally isolated, thermophilic lipase-producing Geobacillus thermoleovorans YN (accession number AF385083, was shown to secrete a thermostable ?-amylase constitutively. The optimal enzyme activity was measured at 75°C, where 90% of the activity was retained at 80°C after one hour of incubation. A catabolite repression due to the addition of glucose to the basal salt medium was demonstrated, while 4 folds increase in volumetric production was achieved in LB and starch-supplemented basal salt media and presented in SDS-PAGE and zymogram. A blunt end PCR fragment (2146 bp was amplified from genomic DNA using a designed set of primers and ligated to Bluescript —II KS(+ vector, transformed to E. coli DH5-? competent cells by electroporation and screened on LB-agar plates induced with IPTG. Nucleotide sequencing of selected clone revealed two ORFs, the first was (GTG with a molecular size 1649 nucleotides encoding 549aa residues of a predicted molecular weight 62.592 kD and the second (ATG with a molecular size 1613 nucleotides encoding 537aa residues of a predicted molecular weight 61.04 kD.

Mahmoud M. Berekaa

2007-01-01

221

Characterization of a recombinant thermostable xylanase from hot spring thermophilic Geobacillus sp. TC-W7.  

Science.gov (United States)

A xylanase-producing thermophilic strain, Geobacillus sp. TC-W7, was isolated from a hot spring in Yongtai (Fuzhou, China). Subsequently, the xylanase gene that encoded 407 amino acids was cloned and expressed. The recombinant xylanase was purified by GST affinity chromatography and exhibited maximum activity at 75 degrees C and a pH of 8.2. The enzyme was active up to 95 degrees C and showed activity over a wide pH range of 5.2 to 10.2. Additionally, the recombinant xylanase showed high thermostability and pH stability. More than 85% of the enzyme's activity was retained after incubation at 70 degrees C for 90 min at a pH of 8.2. The activity of the recombinant xylanase was enhanced by treatment with 10 mM enzyme inhibitors (DDT, Tween-20, 2-Me, or TritonX-100) and was inhibited by EDTA or PMSF. Its functionality was stable in the presence of Li+, Na+, and K+, but inhibited by Hg2+, Ni2+, Co2+, Cu2+, Zn2+, Pb2+, Fe3+, and Al3+. The functionality of the crude xylanase had similar properties to the recombinant xylanase except for when it was treated with Al2+ or Fe2+. The enzyme might be a promising candidate for various industrial applications such as the biofuel, food, and paper and pulp industries. PMID:23075790

Liu, Bin; Zhang, Ningning; Zhao, Chao; Lin, Baixue; Xie, Lianhui; Huang, Yifan

2012-10-01

222

Novel thermostable endo-xylanase cloned and expressed from bacterium Geobacillus sp. WSUCF1.  

Science.gov (United States)

A gene encoding a GH10 endo-xylanase from Geobacillus sp. WSUCF1 was cloned and expressed in Escherichia coli. Recombinant endo-xylanase (37kDa) exhibited high specific activity of 461.0U/mg of protein. Endo-xylanase was optimally active on birchwood xylan at 70°C and pH 6.5. The endo-xylanase was found to be highly thermostable at 50 and 60°C, retaining 82% and 50% of its original activity, respectively, after 60h. High xylan conversions (92%) were obtained with oat-spelt xylan hydrolysis. Higher glucan and xylan conversions were obtained on AFEX-treated corn stover with an enzyme cocktail containing WSUCF1 endo-xylanase (71% and 47%) as compared to enzyme cocktail containing commercial fungal endo-xylanase (64% and 41%). High specific activity, active at high pH's, wide substrate specificity, and higher hydrolytic activity on recalcitrant lignocellulose, make this endo-xylanase a suitable candidate for biofuel and bioprocess industries. PMID:24725385

Bhalla, Aditya; Bischoff, Kenneth M; Uppugundla, Nirmal; Balan, Venkatesh; Sani, Rajesh K

2014-08-01

223

Applicability of recombinant ?-xylosidase from the extremely thermophilic bacterium Geobacillus thermodenitrificans in synthesizing alkylxylosides.  

Science.gov (United States)

The ?-xylosidase encoding gene (XsidB) of the extremely thermophilic bacterium Geobacillus thermodenitrificans has been cloned and expressed in Escherichia coli. The homotrimeric recombinant XsidB is of 204.0kDa, which is optimally active at 60°C and pH 7.0 with T1/2 of 58min at 70°C. The ?-xylosidase remains unaffected in the presence of most metal ions and organic solvents. The Km [p-nitrophenyl ?-xyloside (pNPX)], Vmax and kcat values of the enzyme are 2×10(-3)M, 1250?molesmg(-1)min(-1) and 13.20×10(5)min(-1), respectively. The enzyme catalyzes transxylosylation reactions in the presence of alcohols as acceptors. The pharmaceutically important ?-methyl-d-xylosides could be produced using pNPX as the donor and methanol as acceptor. The products of transxylosylation were identified by TLC and HPLC, and the structure was confirmed by (1)H NMR analysis. The enzyme is also useful in synthesizing transxylosylation products from the wheat bran hydrolysate. PMID:25164338

Jain, Ira; Kumar, Vikash; Satyanarayana, T

2014-10-01

224

Rumen bacteria  

International Nuclear Information System (INIS)

The rumen is the most extensively studied gut community and is characterized by its high population density, wide diversity and complexity of interactions. This complex, mixed microbial culture is comprised of prokaryote organisms including methane-producing archaebacteria, eukaryote organisms, such as ciliate and flagellate protozoa, anaerobic phycomycete fungi and bacteriophage. Bacteria are predominant (up to 1011 viable cells per g comprising 200 species) but a variety of ciliate protozoa occur widely (104-106/g distributed over 25 genera). The anaerobic fungi are also widely distributed (zoospore population densities of 102-104/g distributed over 5 genera). The occurrence of bacteriophage is well documented (107-109 particles/g). This section focuses primarily on the widely used methods for the cultivation and the enumeration of rumen microbes, especially bacteria, which grow under anaerobic conditions. Methods that can be used to measure hydrolytic enzymes (cellulases, xylanases, amylases and proteinases) are also described, along with cell harvesting and fractionation procedures. Brief reference is also made to fungi and protozoa, but detailed explanations for culturing and enumerating these microbes is presented in Chapters 2.4 and 2.5

225

[Isolation of endophytic bacteria in potato and test of antagonistic action to bacterial ring rot of potato].  

Science.gov (United States)

In this study, two hundred and forty bacterial strains were isolated from inner tissue of potato tubers collected from DaTong, TaiYuan and Inner Mongolia Autonomous regions. On the basis of antagonistic examination in vitro, fifty and five bacteria strains were characterized for antagonistic bacteria to ring rot of potato. It was 22.9 percentage of all bacteria strains. The biggest radius of suppression circle was 13 mm. Nine strains were chosen for their suppression of bacterial ring rot, blackleg and dry rot of potato. These strains were bacteriologically ideatified. Strain 118 was Pseudomonas fluorescens biovar V. Strain 110 was Bacillus pumilus. Strain 085 was Bacillus stearothermophilus. Strain 069 was Erwinia herbicola. Strain 043 was Xanthomomas fragariae. Strain 116 was Curtobacterium. Strains A-10' and T3 were Bacillus. Strain H1-6 was Pseudomonas fluorescens. PMID:15346992

Cui, Lin; Sun, Zhen; Tian, Hong Xian; Wang, Li Qin; Xu, Huei Yuen; Sun, Fu Zai; Yuan, Jun

2002-12-01

226

Isolation and Characterization of Thermophilic Cellulase-Producing Bacteria from Empty Fruit Bunches-Palm Oil Mill Effluent Compost  

Directory of Open Access Journals (Sweden)

Full Text Available Problems statement: Lack of information on locally isolated cellulase-producing bacterium in thermophilic compost using a mixture of Empty Fruit Bunch (EFB and Palm Oil Mill Effluent (POME as composting materials. Approach: The isolation of microbes from compost heap was conducted at day 7 of composting process where the mixture of composting materials consisted of 45.8% cellulose, 17.1% hemicellulose and 28.3% lignin content. The temperature, pH and moisture content of the composting pile at day 7 treatment were 58.3, 8.1 and 65.5°C, respectively. The morphological analysis of the isolated microbes was conducted using Scanning Electron Microscope (SEM and Gram stain method. The congo red test was conducted in order to detect 1% CMC agar degradation activities. Total genomic DNAs were extracted from approximately 1.0 g of mixed compost and amplified by using PCR primers. The PCR product was sequent to identify the nearest relatives of 16S rRNA genes. The localization of bacteria chromosomes was determined by Fluorescence In Situ Hybridization (FISH analysis. Results: Single isolated bacteria species was successfully isolated from Empty Fruit Bunch (EFB-Palm Oil Mill Effluent (POME compost at thermophilic stage. Restriction fragment length polymorphism profiles of the DNAs coding for the 16S rRNAs with the phylogenetic analysis showed that the isolated bacteria from EFB-POME thermophilic compost gave the highest homology (99% with similarity to Geobacillus pallidus. The strain was spore forming bacteria and able to grow at 60°C with pH 7. Conclusion: Thermophilic bacteria strain, Geobacillus pallidus was successfully isolated from Empty Fruit Bunch (EFB and Palm Oil Mil Effluent (POME compost and characterized.

Azhari S. Baharuddin

2010-01-01

227

The importance of arginine 171 in substrate binding by Bacillus stearothermophilus lactate dehydrogenase.  

Science.gov (United States)

A variant of lactate dehydrogenase from Bacillus stearothermophilus has been engineered by site-directed mutagenesis in which an active-site arginine residue at position 171 in the protein sequence is replaced by lysine. Replacement of this arginine by lysine has no effect on co-enzyme binding, a relatively small effect on the rate of turnover of the enzyme, but causes a 2000-fold increase in the Michaelis constant for pyruvate, a 6000-fold increase in the dissociation constant for oxamate and results in a Michaelis constant for lactate which is too high to measure. The decrease in binding energy for these carboxylate-containing substrates caused by this mutation is very large, around 5.5 kcal.mol-1 and in part, is explained by the small increase in the distance of a lysine-substrate carboxylate interaction at this site and the absence of the additional hydrogen bond from a two-point arginine-carboxylate interaction. Consistent with this last observation, the ability of this mutant enzyme to stabilize an NAD+-sulphite compound in its active site (an alternative enzyme-substrate complex which does not involve bifurcated bonding to arginine) is only reduced 14-fold. PMID:3606622

Hart, K W; Clarke, A R; Wigley, D B; Chia, W N; Barstow, D A; Atkinson, T; Holbrook, J J

1987-07-15

228

The HPr Proteins from the Thermophile Bacillus stearothermophilus Can Form Domain-swapped Dimers  

Energy Technology Data Exchange (ETDEWEB)

The study of proteins from extremophilic organisms continues to generate interest in the field of protein folding because paradigms explaining the enhanced stability of these proteins still elude us and such studies have the potential to further our knowledge of the forces stabilizing proteins. We have undertaken such a study with our model protein HPr from a mesophile, Bacillus subtilis, and a thermophile, Bacillus stearothermophilus. We report here the high-resolution structures of the wild-type HPr protein from the thermophile and a variant, F29W. The variant proved to crystallize in two forms: a monomeric form with a structure very similar to the wild-type protein as well as a domain-swapped dimer. Interestingly, the structure of the domain-swapped dimer for HPr is very different from that observed for a homologous protein, Crh, from B. subtilis. The existence of a domain-swapped dimer has implications for amyloid formation and is consistent with recent results showing that the HPr proteins can form amyloid fibrils. We also characterized the conformational stability of the thermophilic HPr proteins using thermal and solvent denaturation methods and have used the high-resolution structures in an attempt to explain the differences in stability between the different HPr proteins. Finally, we present a detailed analysis of the solution properties of the HPr proteins using a variety of biochemical and biophysical methods.

Sridharan, Sudharsan; Razvi, Abbas; Scholtz, J. Martin; Sacchettini, James C. (TAM)

2010-07-20

229

The HPr proteins from the thermophile Bacillus stearothermophilus can form domain-swapped dimers.  

Science.gov (United States)

The study of proteins from extremophilic organisms continues to generate interest in the field of protein folding because paradigms explaining the enhanced stability of these proteins still elude us and such studies have the potential to further our knowledge of the forces stabilizing proteins. We have undertaken such a study with our model protein HPr from a mesophile, Bacillus subtilis, and a thermophile, Bacillus stearothermophilus. We report here the high-resolution structures of the wild-type HPr protein from the thermophile and a variant, F29W. The variant proved to crystallize in two forms: a monomeric form with a structure very similar to the wild-type protein as well as a domain-swapped dimer. Interestingly, the structure of the domain-swapped dimer for HPr is very different from that observed for a homologous protein, Crh, from B.subtilis. The existence of a domain-swapped dimer has implications for amyloid formation and is consistent with recent results showing that the HPr proteins can form amyloid fibrils. We also characterized the conformational stability of the thermophilic HPr proteins using thermal and solvent denaturation methods and have used the high-resolution structures in an attempt to explain the differences in stability between the different HPr proteins. Finally, we present a detailed analysis of the solution properties of the HPr proteins using a variety of biochemical and biophysical methods. PMID:15713472

Sridharan, Sudharsan; Razvi, Abbas; Scholtz, J Martin; Sacchettini, James C

2005-02-25

230

Effect of heat on spores of rough and smooth variants of Bacillus stearothermophilus.  

Science.gov (United States)

Spores of variants of Bacillus stearothermophilus were subjected to activating and lethal temperatures. Spore suspensions which were incubated longer contained a higher percentage of spores of the rough variant. The effect of sublethal heat on spore suspensions containing mixed variants (rough and smooth) was difficult to measure at sublethal temperatures (110 C), since the rough variant was not as heat-resistant. While the rough variant was activated in a shorter time, the smooth variant was not activated; when the smooth variant was activated, the rough was killed. A higher percentage of the smooth variant was forced into dormancy after being held at 50 C for 30 hr than the rough variant. When mixed populations were subjected to a lethal temperature (120 C), the curves only reflected the smooth variant. Since the curves which represented the smooth variant or mixtures containing the smooth variant were not linear, this was thought to be due to activation overbalancing the lethal effect. This research emphasized the importance of variants in explaining differences in spore resistance among spore suspensions of the same strain. PMID:13945072

FIELDS, M L

1963-03-01

231

Racemization of alanine by the alanine racemases from Salmonella typhimurium and Bacillus stearothermophilus: energetic reaction profiles  

International Nuclear Information System (INIS)

Alanine racemases are bacterial pyridoxal 5'-phosphate (PLP) dependent enzymes providing D-alanine as an essential building block for biosynthesis of the peptidoglycan layer of the cell wall. Two isozymic alanine racemases, encoded by the dadB gene and the alr gene, from the Gram-negative mesophilic Salmonella typhimurium and one from the Gram-positive thermophilic Bacillus stearothermophilus have been examined for the racemization mechanism. Substrate deuterium isotope effects and solvent deuterium isotope effects have been measured in both L ? D and D? L directions for all three enzymes to assess the degree to which abstraction of the ?-proton or protonation of substrate PLP carbanion is limiting in catalysis. Additionally, experiments measuring internal return of ?-3H from substrate to product and solvent exchange/substrate conversion experiments in 3H2O have been used with each enzyme to examine the partitioning of substrate PLP carbanion intermediates and to obtain the relative heights of kinetically significant energy barriers in alanine racemase catalysis

232

A pulse-radiolysis study of the manganese-containing superoxide dismutase from Bacillus stearothermophilus  

International Nuclear Information System (INIS)

The mechanism of catalysis of the manganese-containing superoxide dismutase from Bacillus stearothermophilus has been shown to involve a 'fast cycle' and a 'slow cycle' (McAdam, M.E., Fox, R.A., Lavelle, F., and Fielden, E.M., Biochem. J.; 165:71 (1977)). Further properties of the enzyme are now considered. Pulse-radiolysis studies, under conditions of low substrate concentration to enzyme concentration (i.e. when the fast cycle predominates), showed that enzyme activity decreases as pH increases (6.5 to 10.2). Activity was unaffected by the addition of H2O2 or NaN3 but slightly decreased by KCN. Both H2O2 and the reducing radical anion CO2sup(-.) caused a decrease in A480 of the native enzyme. The rate of the fast catalytic cycle was independent of temperature (5 to 550C), and as temperature increased the slow catalytic cycle became relatively more important. Arrhenius parameters of the rate constants were estimated. The possible identity of the various forms of the enzyme is considered. (author)

233

Thermoactive extracellular proteases of Geobacillus caldoproteolyticus, sp. nov., from sewage sludge.  

Science.gov (United States)

A proteolytic thermophilic bacterial strain, designated as strain SF03, was isolated from sewage sludge in Singapore. Strain SF03 is a strictly aerobic, Gram stain-positive, catalase-positive, oxidase-positive, and endospore-forming rod. It grows at temperatures ranging from 35 to 65 degrees C, pH ranging from 6.0 to 9.0, and salinities ranging from 0 to 2.5%. Phylogenetic analyses revealed that strain SF03 was most similar to Saccharococcus thermophilus, Geobacillus caldoxylosilyticus, and G. thermoglucosidasius, with 16S rRNA gene sequence identities of 97.6, 97.5 and 97.2%, respectively. Based on taxonomic and 16S rRNA analyses, strain SF03 was named G. caldoproteolyticus sp. nov. Production of extracellular protease from strain SF03 was observed on a basal peptone medium supplemented with different carbon and nitrogen sources. Protease production was repressed by glucose, lactose, and casamino acids but was enhanced by sucrose and NH4Cl. The cell growth and protease production were significantly improved when strain SF03 was cultivated on a 10% skim-milk culture medium, suggesting that the presence of protein induced the synthesis of protease. The protease produced by strain SF03 remained active over a pH range of 6.0-11.0 and a temperature range of 40-90 degrees C, with an optimal pH of 8.0-9.0 and an optimal temperature of 70-80 degrees C, respectively. The protease was stable over the temperature range of 40-70 degrees C and retained 57 and 38% of its activity at 80 and 90 degrees C, respectively, after 1 h. PMID:15322950

Chen, Xiao-Ge; Stabnikova, Olena; Tay, Joo-Hwa; Wang, Jing-Yuan; Tay, Stephen Tiong-Lee

2004-12-01

234

Molecular cloning, over expression and characterization of thermoalkalophilic esterases isolated from Geobacillus sp.  

Science.gov (United States)

Due to potential use for variety of biotechnological applications, genes encoding thermoalkalophilic esterase from three different Geobacillus strains isolated from thermal environmental samples in Balçova (Agamemnon) geothermal site were cloned and respective proteins were expressed in Escherichia coli (E.coli) and characterized in detail. Three esterases (Est1, Est2, Est3) were cloned directly by PCR amplification using consensus degenerate primers from genomic DNA of the strains Est1, Est2 and Est3 which were from mud, reinjection water and uncontrolled thermal leak, respectively. The genes contained an open reading frame (ORF) consisting of 741 bp for Est1 and Est2, which encoded 246 amino acids and ORF of Est3 was 729 bp encoded 242 amino acids. The esterase genes were expressed in E. coli and purified using His-Select HF nickel affinity gel. The molecular mass of the recombinant enzyme for each esterase was approximately 27.5 kDa. The three esterases showed high specific activity toward short chain p-NP esters. Recombinant Est1, Est2, Est3 have exhibited similar activity and the highest esterase activity of 1,100 U/mg with p-nitrophenyl acetate (pNPC(2)) as substrate was observed with Est1. All three esterase were most active around 65°C and pH 9.5-10.0. The effect of organic solvents, several metal ions, inhibitors and detergents on enzyme activity for purified Est1, Est2, Est3 were determined separately and compared. PMID:21181486

Tekedar, Hasan Cihad; Sanl?-Mohamed, Gül?ah

2011-03-01

235

Domain C of thermostable ?-amylase of Geobacillus thermoleovorans mediates raw starch adsorption.  

Science.gov (United States)

The gene (1,542 bp) encoding thermostable Ca(2+)-independent and raw starch hydrolyzing ?-amylase of the extremely thermophilic bacterium Geobacillus thermoleovorans encodes for a protein of 50 kDa (Gt-amyII) with 488 amino acids. The enzyme is optimally active at pH 7.0 and 60 °C with a t 1/2 of 19.4 h at 60 and 4 h at 70 °C. Gt-amyII hydrolyses corn and tapioca raw starches efficiently and therefore finds application in starch saccharification at industrial sub-gelatinisation temperatures. The starch hydrolysis is facilitated following adsorption of the enzyme to starch at the C-terminal domain, as confirmed by the truncation analysis. The adsorption rate constant of Gt-amyII to raw corn starch is 37.6-fold greater than that for the C-terminus truncated enzyme (Gt-amyII-T). Langmuir-Hinshelwood kinetic analysis in terms of equilibrium parameter (K R) suggested that the adsorption of Gt-amyII to corn starch is more favourable than that of Gt-amyII-T. Thermodynamics of temperature inactivation indicated a decrease in thermostabilisation of Gt-amyII upon truncation of its C-terminus. The addition of raw corn starch increased t 1/2 of Gt-amyII, but it has no such effect on Gt-amyII-T. It can, therefore, be stated that Gt-amyII binds to raw corn starch via C-terminal region that contributes to its thermostability. Phylogenetic analysis confirmed that starch binding region of Gt-amyII is, in fact, the non-catalytic domain C, and not the typical SBD of CBM families. The role of domain C in raw starch binding throws light on the evolutionary path of the known SBDs. PMID:24413972

Mehta, Deepika; Satyanarayana, T

2014-05-01

236

Molecular cloning and characterization of a thermostable lipase from deep-sea thermophile Geobacillus sp. EPT9.  

Science.gov (United States)

A gene (1,254 bp) encoding a lipase was identified from a deep-sea hydrothermal field thermophile Geobacillus sp. EPT9. The open reading frame of this gene encoded 417 amino acid residues. The gene was cloned, overexpressed in Escherichia coli, and the target protein was purified to homogeneity. The purified recombinant enzyme presented a molecular mass of 44.8 kDa. When p-nitrophenyl palmitate was used as a substrate, the recombinant lipase was optimally active at 55 °C and pH 8.5. The recombinant enzyme retained 44 % residual activity after incubation at 80 °C for 1 h, which indicated that Geobacillus sp. EPT9 lipase was thermostable. Homology modeling of strain EPT9 lipase was developed with the lipase from Bacillus sp. L2 as a template. The core structure exhibits an ?/?-hydrolase fold and the typical catalytic triad might consist of Ser142, Asp346, and His387. The enzymatic activity of EPT9 lipase was inhibited by addition of phenylmethylsulfonyl fluoride, indicating that it contains serine residue, which plays an important role in the catalytic mechanism. PMID:25388475

Zhu, Yanbing; Li, Hebin; Ni, Hui; Xiao, Anfeng; Li, Lijun; Cai, Huinong

2015-02-01

237

S-Layer Variation in Bacillus stearothermophilus PV72 Is Based on DNA Rearrangements between the Chromosome and the Naturally Occurring Megaplasmids  

OpenAIRE

Bacillus stearothermophilus PV72 expresses different S-layer genes (sbsA and sbsB) under different growth conditions. No stretches of significant sequence identity between sbsA and sbsB were detected. In order to investigate S-layer gene regulation in B. stearothermophilus PV72, we characterized the upstream regulatory region of sbsA and sbsB by sequencing and primer extension analysis. Both genes are transcribed from unique but different promoters, independently of the growth phase. Localiza...

Scholz, Holger C.; Riedmann, Eva; Witte, Angela; Lubitz, Werner; Kuen, Beatrix

2001-01-01

238

Refolding of the non-specific neutral protease from Bacillus stearothermophilus proceeds via an autoproteolytically sensitive intermediate  

OpenAIRE

Abstract A very thermostable variant of the thermolysin-like protease from Bacillus stearothermophilus (G8C/N60C) was previously created by introduction of a disulfide bond into the cysteine-free pseudo-wild type variant (pWT) and thus fixing the unfolding region 56-69. In the present paper, we show that G8C/N60C and pWT can be reactivated from the completely unfolded states, accessible at ?7.5M guanidine hydrochloride, and analyze the kinetics of folding, autoproteolytic degrada...

2010-01-01

239

Transglycosylation reactions of Bacillus stearothermophilus maltogenic amylase with acarbose and various acceptors  

International Nuclear Information System (INIS)

It was observed that Bacillus stearothermophilus maltogenic amylase cleaved the first glycosidic bond of acarbose to produce glucose and a pseudotrisaccharide (PTS) that was transferred to C-6 of the glucose to give an ?-(1-6) glycosidic linkage and the formation of isoacarbose. The addition of a number of different carbohydrates to the digest gave transfer products in which PTS was primarily attached ?-(1-6) to d-glucose, d-mannose, d-galactose, and methyl ?-d-glucopyranoside. With d-fructopyranose and d-xylopyranose, PTS was linked ?-(1-5) and ?-(1-4), respectively. PTS was primarily transferred to C-6 of the nonreducing residue of maltose, cellobiose, lactose, and gentiobiose. Lesser amounts of ?-(1-3) and/or ?-(1-4) transfer products were also observed for these carbohydrate acceptors. The major transfer product to sucrose gave PTS linked ?-(1-4) to the glucose residue. ?,?-Trehalose gave two major products with PTS linked ?-(1-6) and ?-(1-4). Maltitol gave two major products with PTS linked ?-(1-6) and ?-(1-4) to the glucopyranose residue. Raffinose gave two major products with PTS linked ?-(1-6) and ?-(1-4) to the d-galactopyranose residue. Maltotriose gave two major products with PTS linked ?-(1-6) and ?-(1-4) to the nonreducing end glucopyranose residue. Xylitol gave PTS linked ?-(1-5) as the major product and d-glucitol gave PTS linked ?-(1-6) as the only product. The structures of the transfer products were determined using thin layer-chrd using thin layer-chromatography, high-performance ion chromatography, enzyme hydrolysis, methylation analysis and 13C NMR spectroscopy. The best acceptor was gentiobiose, followed closely by maltose and cellobiose, and the weakest acceptor was d-glucitol. (Copyright (c) 1998 Elsevier Science B.V., Amsterdam. All rights reserved.)

240

Effect on pH heating medium on the thermal resistance of Bacillus stearothermophilus spores.  

Science.gov (United States)

The influence of the pH of heating medium on heat resistance of Bacillus stearothermophilus spores (ATCC 7953, 12980, 15951 and 15952) were studied. The pH values tested were: 4.0, 5.0, 6.0 and 7.0 at temperatures of 115, 120, 125, 130 and 135 degrees C. It was found that at low treatment temperatures (115 degrees C) D-values decreased between 7- and 10-fold with 7953, 12980 and 15951 strains and about 23-fold with 15952 strain when pH dropped from 7.0 to 4.0. At highest treatment temperatures (135 degrees C) D-values obtained with pH 6.0 and 7.0 did not show any significant statistical differences (p > 0.05). z-Values appeared to be higher when the medium was acidified, ranging from 7.58 to 8.20 and 9.43 10.0 for spores suspended in McIlvaine buffer pH 7.0 and pH 4.0, respectively, although the difference was not statistically significant. Heat resistance of strain ATCC 7953 at 120, 128, and 135 degrees C in asparagus purée and tomato purée at pH 5.0 under continuous monitoring of pH was also determined. D-values obtained in asparagus purée were similar to those obtained in buffer at the same pH, whereas those observed in tomato purée were found to be lower. PMID:8652348

López, M; González, I; Condón, S; Bernardo, A

1996-01-01

241

The Museum of Bacteria  

Science.gov (United States)

The Museum of Bacteria serves as a clearinghouse of Web links on bacteria and bacteriology and also provides "crystal-clear information about many aspects of bacteria." The Museum of Bacteria is provided by the Foundation of Bacteria, a non-profit organization dedicated to promoting the field of bacteriology. Links are selected for a general audience, although one section is geared toward professionals in the field. Some of the latest features of the Museum are an "exhibit" on the good bacteria found in food and a Student Hall where students can present their own bacteria-related projects.

242

Redefining the role of the quaternary shift in Bacillus stearothermophilus phosphofructokinase.  

Science.gov (United States)

Bacillus stearothermophilus phosphofructokinase (BsPFK) is a homotetramer that is allosterically inhibited by phosphoenolpyruvate (PEP), which binds along one dimer-dimer interface. The substrate, fructose 6-phosphate (Fru-6-P), binds along the other dimer-dimer interface. Evans et al. observed that the structure with inhibitor (phosphoglycolate) bound, compared to the structure of wild-type BsPFK with substrate and activator bound, exhibits a 7° rotation about the substrate-binding interface, termed the quaternary shift [Schirmer, T., and Evans, P. R. (1990) Nature 343, 140-145]. We report that the variant D12A BsPFK exhibits a 100-fold increase in its binding affinity for PEP, a 50-fold decrease in its binding affinity for Fru-6-P, but an inhibitory coupling comparable to that of the wild type. Crystal structures of the apo and PEP-bound forms of D12A BsPFK have been determined (Protein Data Bank entries 4I36 and 4I7E , respectively), and both indicate a shifted structure similar to the inhibitor-bound structure of the wild type. D12 does not directly bind to either substrate or inhibitor and is located along the substrate-binding interface. A conserved hydrogen bond between D12 and T156 forms across the substrate-binding subunit-subunit interface in the substrate-bound form of BsPFK. The variant T156A BsPFK, when compared to the wild type, shows a 30-fold increase in PEP binding affinity, a 17-fold decrease in Fru-6-P binding affinity, and an estimated coupling that is also approximately equal to that of the wild type. In addition, the T156A BsPFK crystal structure bound to PEP is reported (Protein Data Bank entry 4I4I ), and it exhibits a shifted structure similar to that of D12A BsPFK and the inhibitor-bound structure of the wild type. The results suggest that the main role of the quaternary shift may be to influence ligand binding and not to cause the heterotropic allosteric inhibition per se. PMID:23859543

Mosser, Rockann; Reddy, Manchi C M; Bruning, John B; Sacchettini, James C; Reinhart, Gregory D

2013-08-13

243

Genotyping of Present-Day and Historical Geobacillus Species Isolates from Milk Powders by High-Resolution Melt Analysis of Multiple Variable-Number Tandem-Repeat Loci  

OpenAIRE

Spores of thermophilic Geobacillus species are a common contaminant of milk powder worldwide due to their ability to form biofilms within processing plants. Genotyping methods can provide information regarding the source and monitoring of contamination. A new genotyping method was developed based on multilocus variable-number tandem-repeat (VNTR) analysis (MLVA) in conjunction with high-resolution melt analysis (MLV-HRMA) and compared to the currently used method, randomized amplified polymor...

Seale, R. Brent; Dhakal, Rajat; Chauhan, Kanika; Craven, Heather M.; Deeth, Hilton C.; Pillidge, Christopher J.; Powell, Ian B.; Turner, Mark S.

2012-01-01

244

l-Ribose Production from l-Arabinose by Using Purified l-Arabinose Isomerase and Mannose-6-Phosphate Isomerase from Geobacillus thermodenitrificans?  

OpenAIRE

Two enzymes, l-arabinose isomerase and mannose-6-phosphate isomerase, from Geobacillus thermodenitrificans produced 118 g/liter l-ribose from 500 g/liter l-arabinose at pH 7.0, 70°C, and 1 mM Co2+ for 3 h, with a conversion yield of 23.6% and a volumetric productivity of 39.3 g liter?1 h?1.

Yeom, Soo-jin; Kim, Nam-hee; Park, Chang-su; Oh, Deok-kun

2009-01-01

245

Draft Genome Sequence of Geobacillus icigianus Strain G1w1T Isolated from Hot Springs in the Valley of Geysers, Kamchatka (Russian Federation)  

OpenAIRE

The Geobacillus icigianus G1w1T strain was isolated from sludge samples of unnamed vaporing hydrothermal (97°?) outlets situated in a geyser in the Troinoy region (Valley of Geysers, Kronotsky Nature Reserve, Kamchatka, Russian Federation; 54°25?51.40?N, 160°7?41.40?E). The sequenced and annotated genome is 3,457,810 bp and encodes 3,342 genes.

Bryanskaya, Alla V.; Rozanov, Aleksey S.; Logacheva, Maria D.; Kotenko, Anastasia V.; Peltek, Sergey E.

2014-01-01

246

Draft Genome Sequence of Geobacillus icigianus Strain G1w1T Isolated from Hot Springs in the Valley of Geysers, Kamchatka (Russian Federation).  

Science.gov (United States)

The Geobacillus icigianus G1w1(T) strain was isolated from sludge samples of unnamed vaporing hydrothermal (97°?) outlets situated in a geyser in the Troinoy region (Valley of Geysers, Kronotsky Nature Reserve, Kamchatka, Russian Federation; 54°25'51.40?N, 160°7'41.40?E). The sequenced and annotated genome is 3,457,810 bp and encodes 3,342 genes. PMID:25342695

Bryanskaya, Alla V; Rozanov, Aleksey S; Logacheva, Maria D; Kotenko, Anastasia V; Peltek, Sergey E

2014-01-01

247

Bleach vs. Bacteria  

Science.gov (United States)

... Articles | Inside Life Science Home Page Bleach vs. Bacteria By Sharon Reynolds Posted April 2, 2014 Your ... hypochlorous acid to help kill invading microbes, including bacteria. Researchers funded by the National Institutes of Health ...

248

Surface plasmon resonance-enabled antibacterial digital versatile discs  

Science.gov (United States)

We report the achievement of effective sterilization of exemplary bacteria including Escherichia coli and Geobacillus stearothermophilus spores on a digital versatile disc (DVD). The spiral arrangement of aluminum-covered pits generates strong surface plasmon resonance (SPR) absorption of near-infrared light, leading to high surface temperature that could even damage the DVD plastics. Localized protein denaturation and high sterilization efficiency have been demonstrated by using a fluorescence microscope and cell cultures. Numerical simulations have also been conducted to model the SPR properties and the surface temperature distribution of DVDs under laser illumination. The theoretical predictions agree reasonably well with the experimental results.

Dou, Xuan; Chung, Pei-Yu; Jiang, Peng; Dai, Jianli

2012-02-01

249

Lactic Acid Bacteria  

Science.gov (United States)

This on-line exercise is focused on lactic acid bacteria, a group of related bacteria that produce lactic acid as a result of carbohydrate fermentation. It includes a protocol for the enrichment of lactic acid bacteria from enriched samples (like yogurt, sauerkraut, decaying plant matter, and tooth plaque). Three parameters are measured: growth, culture diversity, and pH. The exercise also includes instructions for the isolation of some of these bacteria by using the streak-plate method.

250

Conformational and thermodynamic effects of naturally occurring base methylations in a ribosomal RNA hairpin of Bacillus stearothermophilus.  

Science.gov (United States)

The 3'-terminal colicin fragments of 16S ribosomal RNA were isolated from Bacillus stearothermophilus and from its kasugamycin-resistant (ksgA) derivative lacking N6-dimethylation of the two adjacent adenosines in a hairpin loop. The fragment from the ksgA strain still contains a naturally occurring N2-methylguanosine in the loop. An RNA molecule resembling the B. stearothermophilus colicin fragment but without modified nucleosides was synthesized in vitro using a DNA template and bacteriophage T7 RNA polymerase. Proton-NMR spectra of the RNAs were recorded at 500 MHz. The imino-proton resonances of base-paired G and U residues could be assigned on the basis of previous NMR studies of the colicin fragment of Escherichia coli and by a combination of methylation-induced shifts and thermal melting of base pairs. The assignments were partly confirmed by NOE measurements. Adenosine dimethylation in the loop has a distinct conformational effect on the base pairs adjoining the loop. The thermal denaturation melting curve of the enzymatically synthesized RNA fragment was also determined and the transition midpoint (tm) was found to be 73 degrees C at 15 mM Na+. A comparison with previously determined thermodynamic parameters for various colicin fragments demonstrates that base methylations in the loop lead to a relatively strong destabilization of the hairpin helix. In terms of free energy the positive contribution of the methylations are in the order of the deletion of one base pair from the stem. Other data show that recently published free-energy parameters do not apply for certain RNA hairpins. PMID:1690648

Heus, H A; Formenoy, L J; Van Knippenberg, P H

1990-03-10

251

Bacteria Are Everywhere!  

Science.gov (United States)

Students are introduced to the concept of engineering biological organisms and studying their growth to be able to identify periods of fast and slow growth. They learn that bacteria are found everywhere, including on the surfaces of our hands. Student groups study three different conditions under which bacteria are found and compare the growth of the individual bacteria from each source. In addition to monitoring the quantity of bacteria from differ conditions, they record the growth of bacteria over time, which is an excellent tool to study binary fission and the reproduction of unicellular organisms.

AMPS GK-12 Program,

252

Isolation of two physiologically induced variant strains of Bacillus stearothermophilus NRS 2004/3a and characterization of their S-layer lattices.  

OpenAIRE

During growth of Bacillus stearothermophilus NRS 2004/3a in continuous culture on complex medium, the chemical properties of the S-layer glycoprotein and the characteristic oblique lattice were maintained only if glucose was used as the sole carbon source. With increased aeration, amino acids were also metabolized, accompanied by liberation of ammonium and by changes in the S-layer protein. Depending on the stage of fermentation at which oxygen limitation was relieved, two different variants,...

Sa?ra, M.; Pum, D.; Ku?pcu?, S.; Messner, P.; Sleytr, U. B.

1994-01-01

253

Characterization of the Bacillus stearothermophilus manganese superoxide dismutase gene and its ability to complement copper/zinc superoxide dismutase deficiency in Saccharomyces cerevisiae.  

OpenAIRE

Recombinant clones containing the manganese superoxide dismutase (MnSOD) gene of Bacillus stearothermophilus were isolated with an oligonucleotide probe designed to match a part of the previously determined amino acid sequence. Complementation analyses, performed by introducing each plasmid into a superoxide dismutase-deficient mutant of Escherichia coli, allowed us to define the region of DNA which encodes the MnSOD structural gene and to identify a promoter region immediately upstream from ...

Bowler, C.; Kaer, L.; Camp, W.; Montagu, M.; Inze?, D.; Dhaese, P.

1990-01-01

254

Darwin y las bacterias / Darwin and bacteria  

Scientific Electronic Library Online (English)

Full Text Available SciELO Chile | Language: Spanish Abstract in spanish Con motivo de cumplirse 200 años del natalicio de Darwin y 150 desde la publicación de El Origen de las Especies, se revisa su obra buscando alguna mención de las bacterias, a las cuales el gran naturalista parece, o bien no haber conocido, algo muy difícil en un momento en que causaban sensación en [...] el mundo científico, o bien haber ignorado deliberadamente, porque no encontraba para ellas lugar en su teoría de la evolución. Las bacterias, por su parte, afectaron malamente su vida familiar, falleciendo uno de sus hijos de escarlatina y su hija favorita, Arme, de una tuberculosis agravada por el mismo mal que mató a su hermano. El propio Darwin, desde el regreso del Beagle afectado por una enfermedad crónica hasta ahora no dilucidada, podría haber sufrido de la enfermedad de Chagas, cuyo agente etiológico, si bien no es una bacteria, tiene un similar nivel en la escala evolutiva. Abstract in english As in 2009 the scientific world celebrates two hundreds years from the birthday of Charles Darwin and one hundred and fifty from the publication of The Origin of Species, an analysis of his complete work is performed, looking for any mention of bacteria. But it seems that the great naturahst never t [...] ook knowledge about its existence, something rather improbable in a time when the discovery of bacteria shook the medical world, or he deliberately ignored them, not finding a place for such microscopic beings into his theory of evolution. But the bacteria badly affected his familiar life, killing scarlet fever one of his children and worsening to death the evolution of tuberculosis of his favourite Annie. Darwin himself could suffer the sickness of Chagas, whose etiological agent has a similar level to bacteria in the scale of evolution.

Walter, Ledermann D.

2009-02-01

255

Deciphering the flexibility and dynamics of Geobacillus zalihae strain T1 lipase at high temperatures by molecular dynamics simulation.  

Science.gov (United States)

The stability of biocatalysts is an important criterion for a sustainable industrial operation economically. T1 lipase is a thermoalkalophilic enzyme derived from Geobacillus zalihae strain T1 (T1 lipase) that was isolated from palm oil mill effluent (POME) in Malaysia. We report here the results of high temperatures molecular dynamics (MD) simulations of T1 lipase in explicit solvent. We found that the N-terminal moiety of this enzyme was accompanied by a large flexibility and dynamics during temperature-induced unfolding simulations which preceded and followed by clear structural changes in two specific regions; the small domain (consisting of helices alpha3 and alpha5, strands beta1 and beta2, and connecting loops) and the main catalytic domain or core domain (consisting of helices alpha6- alpha9 and connecting loops which located above the active site) of the enzyme. The results suggest that the small domain of model enzyme is a critical region to the thermostability of this organism. PMID:20001926

Abdul Rahman, Mohd Basyaruddin; Karjiban, Roghayeh Abedi; Salleh, Abu Bakar; Jacobs, Donald; Basri, Mahiran; Thean Chor, Adam Leow; Abdul Wahab, Habibah; Rahman, Raja Noor Zaliha Raja Abd

2009-01-01

256

Characterization and multiple applications of a highly thermostable and Ca²?-independent amylopullulanase of the extreme thermophile Geobacillus thermoleovorans.  

Science.gov (United States)

The amylopullulanase of Geobacillus thermoleovorans NP33 (apu105) is Ca(2+)-independent with a molecular mass of 105 kDa and optimum activity at 80 °C and pH 7.0. The apu105 is extremely thermostable with T 1/2 of 7.8 h at 90 °C and hydrolyzes starch, pullulan, and malto-oligosaccharides, but not panose and cyclodextrins. The low K m values of apu105 (starch, pullulan, amylose, and amylopectin) indicates higher affinity of apu105 than others. The action of the enzyme on mixed substrates (starch and pullulan) confirmed the presence of only one active site for cleaving both ?-1,4- and ?-1,6- glycosidic linkages. The raw starches are efficiently hydrolyzed into glucose, maltose, and malto-oligosaccharides. Two-step starch saccharification involving pretreatment with apu105 followed by glucoamylase enhanced glucose yield. The supplementation of whole wheat dough with apu105 markedly enhanced the loaf volume, shelf-life, and the texture of bread. The enzyme is compatible with detergents and useful in desizing of cotton fabrics. PMID:25267353

Nisha, M; Satyanarayana, T

2014-12-01

257

Screening of plant growth-promoting traits in arsenic-resistant bacteria isolated from agricultural soil and their potential implication for arsenic bioremediation.  

Science.gov (United States)

Twelve arsenic (As)-resistant bacteria (minimum inhibitory concentration ranging from 10 to 30mM and 150 to 320mM for As(III) and As(V), respectively) were isolated from the agricultural soil of the Chianan Plain in southwestern Taiwan using enrichment techniques. Eight isolates capable of oxidizing As(III) (rate of oxidation from 0.029 to 0.059?Mh(-1) 10(-9) cell) and exhibiting As(III)-oxidase enzyme activity belong to Pseudomonas, Acinetobacter, Klebsiella and Comamonas genera, whereas four isolates that did not show As(III)-oxidizing activity belong to Geobacillus, Bacillus, Paenibacillus, and Enterobacter genera. Assessment of the parameters of plant growth promotion revealed that Pseudomonas sp. ASR1, ASR2 and ASR3, Geobacillus sp. ASR4, Bacillus sp. ASR5, Paenibacillus sp. ASR6, Enterobacter sp. ASR10 and Comamonas sp. ASR11, and ASR12 possessed some or all of the studied plant growth-promoting traits, including phosphate-solubilization, siderophore, IAA-like molecules and ACC deaminase production. In addition, the ability of As-resistant isolates to grow over wide ranges of pH and temperatures signify their potential application for sustainable bioremediation of As in the environment. PMID:24685527

Das, Suvendu; Jean, Jiin-Shuh; Kar, Sandeep; Chou, Mon-Lin; Chen, Chien-Yen

2014-05-15

258

[Physiological and phylogenetic diversity of thermophilic spore-forming hydrocarbon-oxidizing bacteria from oil fields].  

Science.gov (United States)

The distribution and population density of aerobic hydrocarbon-oxidizing bacteria in the high-temperature oil fields of Western Siberia, Kazakhstan, and China were studied. Seven strains of aerobic thermophilic spore-forming bacteria were isolated from the oil fields and studied by microbiological and molecular biological methods. Based on the 16S rRNA gene sequences, phenotypic characteristics, and the results of DNA-DNA hybridization, the taxonomic affiliation of the isolates was tentatively established. The strains were assigned to the first and fifth subgroups of the genus Bacillus on the phylogenetic branch of the gram-positive bacteria. Strains B and 421 were classified as B. licheniformis. Strains X and U, located between B. stearothermophilus and B. thermocatenulatus on the phylogenetic tree, and strains K, Sam, and 34, related but not identical to B. thermodenitrificans and B. thermoleovorans, undoubtedly represent two new species. Phylogenetically and metabolically related representatives of thermophilic bacilli were found to occur in geographically distant oil fields. PMID:10808498

Nazina, T N; Turova, T P; Poltaraus, A B; Novikova, E V; Ivanova, A E; Grigor'ian, A A; Lysenko, A M; Beliaev, S S

2000-01-01

259

Bacteria: Fossil Record  

Science.gov (United States)

This description of the fossil record of bacteria focuses on one particular group of bacteria, the cyanobacteria or blue-green algae, which have left a fossil record that extends far back into the Precambrian. The oldest cyanobacteria-like fossils known are nearly 3.5 billion years old and are among the oldest fossils currently known. Cyanobacteria are larger than most bacteria and may secrete a thick cell wall. More importantly, cyanobacteria may form large layered structures, called stromatolites (if more or less dome-shaped) or oncolites (if round). The site also refers to pseudomorphs of pyrite and siderite, and a group of bacteria known as endolithic. Two links are available for more information. One provides information on the discovery of possible remains of bacteria-like organisms on a meteorite from Mars and the other has a research report on fossilized filamentous bacteria and other microbes, found in Cretaceous amber.

260

Inactivation factors of spore-forming bacteria using low-pressure microwave plasmas in an N2 and O2 gas mixture  

Science.gov (United States)

In this study, we investigated the inactivation characteristics of Geobacillus stearothermophilus spores under different plasma exposure conditions using low-pressure microwave plasma in nitrogen, oxygen and an air-simulated (N2:O2=4:1) gas mixture. The microwave-excited surface-wave plasma discharges were produced at low pressure by a large volume device. The directly plasma-exposed spores, up to 106 populations, were successfully inactivated within 15, 10 and 5 min of surface-wave plasma treatment using nitrogen, oxygen and an air-simulated gas mixture, respectively, as working gases within the temperature of 75 °C. The contribution of different inactivation factors was evaluated by placing different filters (e.g. a LiF plate, a quartz plate and a Tyvek® sheet) as indirect exposure of spores to the plasma. It was observed that optical emissions (including vacuum UV (VUV)/UV) play an important role in the inactivation process. To further evaluate the effect of VUV/UV photons, we placed an evacuated isolated chamber, inside which spores were set, into the main plasma chamber. The experimental results show that the inactivation time by VUV/UV photons alone, without working gas in the immediate vicinity of the spores, is longer than that with working gas. This suggests that the VUV/UV emission is responsible not only for direct UV inactivation of spores but also for generation of reactive neutral species by photoexcitation. The scanning electron microscopy images revealed significant changes in the morphology of directly plasma-exposed spores but no change in the spores irradiated by VUV/UV photons only.

Singh, M. K.; Ogino, A.; Nagatsu, M.

2009-11-01

261

Inactivation factors of spore-forming bacteria using low-pressure microwave plasmas in an N2 and O2 gas mixture  

International Nuclear Information System (INIS)

In this study, we investigated the inactivation characteristics of Geobacillus stearothermophilus spores under different plasma exposure conditions using low-pressure microwave plasma in nitrogen, oxygen and an air-simulated (N2:O2=4:1) gas mixture. The microwave-excited surface-wave plasma discharges were produced at low pressure by a large volume device. The directly plasma-exposed spores, up to 106 populations, were successfully inactivated within 15, 10 and 5 min of surface-wave plasma treatment using nitrogen, oxygen and an air-simulated gas mixture, respectively, as working gases within the temperature of 75 deg. C. The contribution of different inactivation factors was evaluated by placing different filters (e.g. a LiF plate, a quartz plate and a Tyvek (registered) sheet) as indirect exposure of spores to the plasma. It was observed that optical emissions (including vacuum UV (VUV)/UV) play an important role in the inactivation process. To further evaluate the effect of VUV/UV photons, we placed an evacuated isolated chamber, inside which spores were set, into the main plasma chamber. The experimental results show that the inactivation time by VUV/UV photons alone, without working gas in the immediate vicinity of the spores, is longer than that with working gas. This suggests that the VUV/UV emission is responsible not only for direct UV inactivation of spores but also for generation of reactive neutral species by photoexcitatioreactive neutral species by photoexcitation. The scanning electron microscopy images revealed significant changes in the morphology of directly plasma-exposed spores but no change in the spores irradiated by VUV/UV photons only.

262

Inactivation factors of spore-forming bacteria using low-pressure microwave plasmas in an N{sub 2} and O{sub 2} gas mixture  

Energy Technology Data Exchange (ETDEWEB)

In this study, we investigated the inactivation characteristics of Geobacillus stearothermophilus spores under different plasma exposure conditions using low-pressure microwave plasma in nitrogen, oxygen and an air-simulated (N{sub 2}:O{sub 2}=4:1) gas mixture. The microwave-excited surface-wave plasma discharges were produced at low pressure by a large volume device. The directly plasma-exposed spores, up to 10{sup 6} populations, were successfully inactivated within 15, 10 and 5 min of surface-wave plasma treatment using nitrogen, oxygen and an air-simulated gas mixture, respectively, as working gases within the temperature of 75 deg. C. The contribution of different inactivation factors was evaluated by placing different filters (e.g. a LiF plate, a quartz plate and a Tyvek (registered) sheet) as indirect exposure of spores to the plasma. It was observed that optical emissions (including vacuum UV (VUV)/UV) play an important role in the inactivation process. To further evaluate the effect of VUV/UV photons, we placed an evacuated isolated chamber, inside which spores were set, into the main plasma chamber. The experimental results show that the inactivation time by VUV/UV photons alone, without working gas in the immediate vicinity of the spores, is longer than that with working gas. This suggests that the VUV/UV emission is responsible not only for direct UV inactivation of spores but also for generation of reactive neutral species by photoexcitation. The scanning electron microscopy images revealed significant changes in the morphology of directly plasma-exposed spores but no change in the spores irradiated by VUV/UV photons only.

Singh, M K; Ogino, A; Nagatsu, M [Graduate School of Science and Technology, Shizuoka University, Johoku 3-5-1, Hamamatsu 432-8561 (Japan)], E-mail: tmnagat@ipc.shizuoka.ac.jp

2009-11-15

263

Introduction to Bacteria  

Science.gov (United States)

This science site has students research how bacteria move, where they live, and how they reproduce; learn how bacteria can be helpful or harmful; and create a design illustrating what they have learned about bacteria. Included in the lesson plan are the objectives, needed materials and Web sites, procedures, discussion questions, evaluation, extensions, suggested reading, and vocabulary. Teachers can link to Teaching Tools to create custom worksheets, puzzles, and quizzes. A printable version of the lesson plan can be downloaded. The video Bacteria, Viruses and Allergies can be purchased and comprehension questions and answers can be downloaded.

DiscoverySchool.com

2007-12-12

264

Bacteria-Antagonists  

International Science & Technology Center (ISTC)

Development of Biological Control Agents Through Use of Recombinant Antagonistic Bacteria Possessing Variable Mechanisms of Antagonisms, High Colonizing Capacity and Marker Traits for their Monitoring in Nature

265

Genotyping of present-day and historical Geobacillus species isolates from milk powders by high-resolution melt analysis of multiple variable-number tandem-repeat loci.  

Science.gov (United States)

Spores of thermophilic Geobacillus species are a common contaminant of milk powder worldwide due to their ability to form biofilms within processing plants. Genotyping methods can provide information regarding the source and monitoring of contamination. A new genotyping method was developed based on multilocus variable-number tandem-repeat (VNTR) analysis (MLVA) in conjunction with high-resolution melt analysis (MLV-HRMA) and compared to the currently used method, randomized amplified polymorphic DNA PCR (RAPD-PCR). Four VNTR loci were identified and used to genotype 46 Geobacillus isolates obtained from retailed powder and samples from 2 different milk powder processing plants. These 46 isolates were differentiated into 16 different groups using MLV-HRMA (D = 0.89). In contrast, only 13 RAPD-PCR genotypes were identified among the 46 isolates (D = 0.79). This new method was then used to analyze 35 isolates obtained from powders with high spore counts (>10(4) spores · g(-1)) from a single processing plant together with 27 historical isolates obtained from powder samples processed in the same region of Australia 17 years ago. Results showed that three genotypes can coexist in a single processing run, while the same genotypes observed 17 years ago are present today. While certain genotypes could be responsible for powders with high spore counts, there was no correlation to specific genotypes being present in powder plants and retailed samples. In conclusion, the MLV-HRMA method is useful for genotyping Geobacillus spp. to provide insight into the prevalence and persistence of certain genotypes within milk powder processing plants. PMID:22865061

Seale, R Brent; Dhakal, Rajat; Chauhan, Kanika; Craven, Heather M; Deeth, Hilton C; Pillidge, Christopher J; Powell, Ian B; Turner, Mark S

2012-10-01

266

Production of l-Ribose from l-Ribulose by a Triple-Site Variant of Mannose-6-Phosphate Isomerase from Geobacillus thermodenitrificans  

OpenAIRE

A triple-site variant (W17Q N90A L129F) of mannose-6-phosphate isomerase from Geobacillus thermodenitrificans was obtained by combining variants with residue substitutions at different positions after random and site-directed mutagenesis. The specific activity and catalytic efficiency (kcat/Km) for l-ribulose isomerization of this variant were 3.1- and 7.1-fold higher, respectively, than those of the wild-type enzyme at pH 7.0 and 70°C in the presence of 1 mM Co2+. The triple-site variant pr...

Lim, Yu-ri; Yeom, Soo-jin; Oh, Deok-kun

2012-01-01

267

Genome and proteome of long-chain alkane degrading Geobacillus thermodenitrificans NG80-2 isolated from a deep-subsurface oil reservoir  

OpenAIRE

The complete genome sequence of Geobacillus thermodenitrificans NG80-2, a thermophilic bacillus isolated from a deep oil reservoir in Northern China, consists of a 3,550,319-bp chromosome and a 57,693-bp plasmid. The genome reveals that NG80-2 is well equipped for adaptation into a wide variety of environmental niches, including oil reservoirs, by possessing genes for utilization of a broad range of energy sources, genes encoding various transporters for efficient nutrient uptake and detoxifi...

Feng, Lu; Wang, Wei; Cheng, Jiansong; Ren, Yi; Zhao, Guang; Gao, Chunxu; Tang, Yun; Liu, Xueqian; Han, Weiqing; Peng, Xia; Liu, Rulin; Wang, Lei

2007-01-01

268

Improvement of Thermal Stability via Outer-Loop Ion Pair Interaction of Mutated T1 Lipase from Geobacillus zalihae Strain T1  

OpenAIRE

Mutant D311E and K344R were constructed using site-directed mutagenesis to introduce an additional ion pair at the inter-loop and the intra-loop, respectively, to determine the effect of ion pairs on the stability of T1 lipase isolated from Geobacillus zalihae. A series of purification steps was applied, and the pure lipases of T1, D311E and K344R were obtained. The wild-type and mutant lipases were analyzed using circular dichroism. The Tm for T1 lipase, D311E lipase and K344R lipase were ap...

Mahiran Basri; Rudzanna Ruslan; Raja Noor Zaliha Raja Abd Rahman; Mohd. Shukuri Mohamad Ali; Thean Chor Leow; Abu Bakar Salleh

2012-01-01

269

Biotransformation of Acetamide to Acetohydroxamic Acid at Bench Scale Using Acyl Transferase Activity of Amidase of Geobacillus pallidus BTP-5x MTCC 9225  

OpenAIRE

The bioprocess employing acyl transferase activity of intracellular amidase of Geobacillus pallidus BTP-5x MTCC 9225 was harnessed for the synthesis of pharmaceutically important acetohydroxamic acid. G. pallidus BTP-5x exhibited highest acyl transferase activity with acetamide: hydroxylamine in ratio of 1:5 in 0.1 M NaH2PO4/Na2HPO4 buffer (pH 7.5) at 65°C. In one liter fed-batch reaction containing 1:5 ratio of two substrates total of eight feedings of 0.05 M/20 min of acetamide were mad...

Sharma, Monica; Sharma, Nitya Nand; Bhalla, Tek Chand

2011-01-01

270

Reduction of Bacillus subtilis, Bacillus stearothermophilus and Streptococcus faecalis in meat batters by temperature-high hydrostatic pressure pasteurization.  

Science.gov (United States)

People have a growing preference for fresh, healthy, palatable and nutritious meals and drinks. However, as food deterioration is a constant threat along the entire food chain, food preservation remains as necessary now as in the past. High pressure processing is one of the emerging technologies being studied as an alternative to the classical pasteurization and sterilization treatments of food. Samples of fried minced pork meat were inoculated with strains of Streptococcus faecalis and with sporulating microorganisms like Bacillus subtilis and stearothermophilus. The samples were subjected to several combined temperature-high pressure treatments predicted by the mathematical model applied in Response Surface Methodology. Using the "Box-Behnken" concept, the number of tests for a whole area of pressure-temperature-time-combinations (pressure variation: 50-400 MPa, temperature variation 20-80°C, time variation 1-60 min) could be limited to 15. In the center point of the model, the experimental combination was performed in triple to estimate the experimental variance. All the tests were executed in a randomized order to exclude the disturbing effect of environmental factors. Microbial analysis revealed for each microorganism an important reduction in total plate count, demonstrating a superior pressure resistance of the sporulating microorganisms in comparison with the most pressure resistant vegetative species Streptococcus faecalis. The effect of the medium composition could be neglected, showing little protective effect of, e.g. the fat fraction as seen in heat preservation techniques. PMID:22062669

Moerman, F; Mertens, B; Demey, L; Huyghebaert, A

2001-10-01

271

Examination of MgATP binding in a tryptophan-shift mutant of phosphofructokinase from Bacillus stearothermophilus.  

Science.gov (United States)

A tryptophan-shift variant of Bacillus stearothermophilus phosphofructokinase (BsPFK), W179F/F76W, was constructed to evaluate the binding and allosteric characteristics associated with MgATP. W179F/F76W BsPFK has a specific activity of 77+/-1 U/mg at pH 7 and 25 degrees C, which is a 35% decrease compared to the wild-type enzyme. The K(m) for MgATP increases from 43+/-3 microM for wild-type BsPFK to 160+/-7 microM in the variant. Binding and allosteric interaction between Fru-6-P and PEP for the variant are similar to those of the wild-type enzyme. W179F/F76W BsPFK has distinct fluorescence properties relative to wild-type or other tryptophan-shifted mutants of BsPFK. The binding of MgATP produces an 80% decrease in the fluorescence intensity while MgADP causes a 70% decrease. Capitalizing on these fluorescence changes, dissociation constants of 30+/-1 microM and 0.53+/-0.02 mM were measured for MgATP and MgADP, respectively. In addition, PEP was shown to enhance MgATP binding by 2.6-fold. PMID:15752723

Riley-Lovingshimer, Michelle R; Reinhart, Gregory D

2005-04-01

272

Circular permutation within the coenzyme binding domain of the tetrameric glyceraldehyde-3-phosphate dehydrogenase from Bacillus stearothermophilus.  

Science.gov (United States)

A circularly permuted (cp) variant of the phosphorylating NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (GAPDH) from Bacillus stearothermophilus has been constructed with N- and C-termini created within the coenzyme binding domain. The cp variant has a kcat value equal to 40% of the wild-type value, whereas Km and KD values for NAD show a threefold decrease compared to wild type. These results indicate that the folding process and the conformational changes that accompany NAD binding during the catalytic event occur efficiently in the permuted variant and that NAD binding is tighter. Reversible denaturation experiments show that the stability of the variant is only reduced by 0.7 kcal/mol compared to the wild-type enzyme. These experiments confirm and extend results obtained recently on other permuted proteins. For multimeric proteins, such as GAPDH, which harbor subunits with two structural domains, the natural location of the N- and C-termini is not a prerequisite for optimal folding and biological activity. PMID:7663355

Vignais, M L; Corbier, C; Mulliert, G; Branlant, C; Branlant, G

1995-05-01

273

Refolding of the non-specific neutral protease from Bacillus stearothermophilus proceeds via an autoproteolytically sensitive intermediate.  

Science.gov (United States)

A very thermostable variant of the thermolysin-like protease from Bacillus stearothermophilus (G8C/N60C) was previously created by introduction of a disulfide bond into the cysteine-free pseudo-wild type variant (pWT) and thus fixing the unfolding region 56-69. In the present paper, we show that G8C/N60C and pWT can be reactivated from the completely unfolded states, accessible at >or=7.5M guanidine hydrochloride, and analyze the kinetics of folding, autoproteolytic degradation and aggregation. From changes in the fluorescence spectra with time of renaturation, it can be concluded that a folding intermediate with native-like structure, but which is still inactive and sensitive to autoproteolysis, is rapidly formed after renaturation has initiated. The critical region 56-69 of pWT is involved in the autoproteolytic sensitivity of the intermediate as we conclude from the differences in the chevron plots of the first-order rate constants of reactivation and the fragmentation patterns in SDS-PAGE of pWT and G8C/N60C. PMID:20096501

Dürrschmidt, Peter; Mansfeld, Johanna; Ulbrich-Hofmann, Renate

2010-03-01

274

Analysis of Metabolic Pathways and Fluxes in a Newly Discovered Thermophilic and Ethanol-Tolerant Geobacillus Strain  

Energy Technology Data Exchange (ETDEWEB)

A recently discovered thermophilic bacterium, Geobacillus thermoglucosidasius M10EXG, ferments a range of C5 (e.g., xylose) and C6 sugars (e.g., glucose) and istolerant to high ethanol concentrations (10percent, v/v). We have investigated the central metabolism of this bacterium using both in vitro enzyme assays and 13C-based flux analysis to provide insights into the physiological properties of this extremophile and explore its metabolism for bio-ethanol or other bioprocess applications. Our findings show that glucose metabolism in G. thermoglucosidasius M10EXG proceeds via glycolysis, the pentose phosphate pathway, and the TCA cycle; the Entner?Doudoroff pathway and transhydrogenase activity were not detected. Anaplerotic reactions (including the glyoxylate shunt, pyruvate carboxylase, and phosphoenolpyruvate carboxykinase) were active, but fluxes through those pathways could not be accuratelydetermined using amino acid labeling. When growth conditions were switched from aerobic to micro-aerobic conditions, fluxes (based on a normalized glucose uptake rate of 100 units (g DCW)-1 h-1) through the TCA cycle and oxidative pentose phosphate pathway were reduced from 64+-3 to 25+-2 and from 30+-2 to 19+-2, respectively. The carbon flux under micro-aerobic growth was directed formate. Under fully anerobic conditions, G. thermoglucosidasius M10EXG used a mixed acid fermentation process and exhibited a maximum ethanol yield of 0.38+-0.07 mol mol-1 glucose. In silico flux balance modeling demonstrates that lactate and acetate production from G. thermoglucosidasius M10EXG reduces the maximum ethanol yieldby approximately threefold, thus indicating that both pathways should be modified to maximize ethanol production.

Tang, Yinjie J.; Sapra, Rajat; Joyner, Dominique; Hazen, Terry C.; Myers, Samuel; Reichmuth, David; Blanch, Harvey; Keasling, Jay D.

2009-01-20

275

Analysis of metabolic pathways and fluxes in a newly discovered thermophilic and ethanol-tolerant Geobacillus strain.  

Science.gov (United States)

A recently discovered thermophilic bacterium, Geobacillus thermoglucosidasius M10EXG, ferments a range of C5 (e.g., xylose) and C6 sugars (e.g., glucose) and is tolerant to high ethanol concentrations (10%, v/v). We have investigated the central metabolism of this bacterium using both in vitro enzyme assays and 13C-based flux analysis to provide insights into the physiological properties of this extremophile and explore its metabolism for bio-ethanol or other bioprocess applications. Our findings show that glucose metabolism in G. thermoglucosidasius M10EXG proceeds via glycolysis, the pentose phosphate pathway, and the TCA cycle; the Entner-Doudoroff pathway and transhydrogenase activity were not detected. Anaplerotic reactions (including the glyoxylate shunt, pyruvate carboxylase, and phosphoenolpyruvate carboxykinase) were active, but fluxes through those pathways could not be accurately determined using amino acid labeling. When growth conditions were switched from aerobic to micro-aerobic conditions, fluxes (based on a normalized glucose uptake rate of 100 units (g DCW)(-1) h(-1)) through the TCA cycle and oxidative pentose phosphate pathway were reduced from 64 +/- 3 to 25 +/- 2 and from 30 +/- 2 to 19 +/- 2, respectively. The carbon flux under micro-aerobic growth was directed to ethanol, L-lactate (> 99% optical purity), acetate, and formate. Under fully anerobic conditions, G. thermoglucosidasius M10EXG used a mixed acid fermentation process and exhibited a maximum ethanol yield of 0.38 +/- 0.07 mol mol(-1) glucose. In silico flux balance modeling demonstrates that lactate and acetate production from G. thermoglucosidasius M10EXG reduces the maximum ethanol yield by approximately threefold, thus indicating that both pathways should be modified to maximize ethanol production. PMID:19016470

Tang, Yinjie J; Sapra, Rajat; Joyner, Dominique; Hazen, Terry C; Myers, Samuel; Reichmuth, David; Blanch, Harvey; Keasling, Jay D

2009-04-01

276

Properties of an alkali-thermo stable xylanase from Geobacillus thermodenitrificans A333 and applicability in xylooligosaccharides generation.  

Science.gov (United States)

An extracellular thermo-alkali-stable and cellulase-free xylanase from Geobacillus thermodenitrificans A333 was purified to homogeneity by ion exchange and size exclusion chromatography. Its molecular mass was 44 kDa as estimated in native and denaturing conditions by gel filtration and SDS-PAGE analysis, respectively. The xylanase (GtXyn) exhibited maximum activity at 70 °C and pH 7.5. It was stable over broad ranges of temperature and pH retaining 88 % of activity at 60 °C and up to 97 % in the pH range 7.5-10.0 after 24 h. Moreover, the enzyme was active up to 3.0 M sodium chloride concentration, exhibiting at that value 70 % residual activity after 1 h. The presence of other metal ions did not affect the activity with the sole exceptions of K(+) that showed a stimulating effect, and Fe(2+), Co(2+) and Hg(2+), which inhibited the enzyme. The xylanase was activated by non-ionic surfactants and was stable in organic solvents remaining fully active over 24 h of incubation in 40 % ethanol at 25 °C. Furthermore, the enzyme was resistant to most of the neutral and alkaline proteases tested. The enzyme was active only on xylan, showing no marked preference towards xylans from different origins. The hydrolysis of beechwood xylan and agriculture-based biomass materials yielded xylooligosaccharides with a polymerization degree ranging from 2 to 6 units and xylobiose and xylotriose as main products. These properties indicate G. thermodenitrificans A333 xylanase as a promising candidate for several biotechnological applications, such as xylooligosaccharides preparation. PMID:25687227

Marcolongo, Loredana; La Cara, Francesco; Morana, Alessandra; Di Salle, Anna; Del Monaco, Giovanni; Paixão, Susana M; Alves, Luis; Ionata, Elena

2015-04-01

277

Isolation and characterization of a thermotolerant ene reductase from Geobacillus sp. 30 and its heterologous expression in Rhodococcus opacus.  

Science.gov (United States)

Rhodococcus opacus B-4 cells are adhesive to and even dispersible in water-immiscible hydrocarbons owing to their highly lipophilic nature. In this study, we focused on the high operational stability of thermophilic enzymes and applied them to a biocatalytic conversion in an organic reaction medium using R. opacus B-4 as a lipophilic capsule of enzymes to deliver them into the organic medium. A novel thermo- and organic-solvent-tolerant ene reductase, which can catalyze the enantioselective reduction of ketoisophorone to (6R)-levodione, was isolated from Geobacillus sp. 30, and the gene encoding the enzyme was heterologously expressed in R. opacus B-4. Another thermophilic enzyme which catalyzes NAD(+)-dependent dehydrogenation of cyclohexanol was identified from the gene-expression library of Thermus thermophilus and the gene was coexpressed in R. opacus B-4 for cofactor regeneration. While the recombinant cells were not viable in the mixture due to high reaction temperature, 634 mM of (6R)-levodione could be produced with an enantiopurity of 89.2 % ee by directly mixing the wet cells of the recombinant R. opacus with a mixture of ketoisophorone and cyclohexanol at 50 °C. The conversion rate observed with the heat-killed recombinant cells was considerably higher than that obtained with a cell-free enzyme solution, demonstrating that the accessibility between the substrates and enzymes could be improved by employing R. opacus cells as a lipophilic enzyme capsule. These results imply that a combination of thermophilic enzymes and lipophilic cells can be a promising approach for the biocatalytic production of water-insoluble chemicals. PMID:24927695

Tsuji, Naoto; Honda, Kohsuke; Wada, Mayumi; Okano, Kenji; Ohtake, Hisao

2014-07-01

278

Thermoadaptation-directed enzyme evolution in an error-prone thermophile derived from Geobacillus kaustophilus HTA426.  

Science.gov (United States)

Thermostability is an important property of enzymes utilized for practical applications because it allows long-term storage and use as catalysts. In this study, we constructed an error-prone strain of the thermophile Geobacillus kaustophilus HTA426 and investigated thermoadaptation-directed enzyme evolution using the strain. A mutation frequency assay using the antibiotics rifampin and streptomycin revealed that G. kaustophilus had substantially higher mutability than Escherichia coli and Bacillus subtilis. The predominant mutations in G. kaustophilus were A · T?G · C and C · G?T · A transitions, implying that the high mutability of G. kaustophilus was attributable in part to high-temperature-associated DNA damage during growth. Among the genes that may be involved in DNA repair in G. kaustophilus, deletions of the mutSL, mutY, ung, and mfd genes markedly enhanced mutability. These genes were subsequently deleted to construct an error-prone thermophile that showed much higher (700- to 9,000-fold) mutability than the parent strain. The error-prone strain was auxotrophic for uracil owing to the fact that the strain was deficient in the intrinsic pyrF gene. Although the strain harboring Bacillus subtilis pyrF was also essentially auxotrophic, cells became prototrophic after 2 days of culture under uracil starvation, generating B. subtilis PyrF variants with an enhanced half-denaturation temperature of >10°C. These data suggest that this error-prone strain is a promising host for thermoadaptation-directed evolution to generate thermostable variants from thermolabile enzymes. PMID:25326311

Suzuki, Hirokazu; Kobayashi, Jyumpei; Wada, Keisuke; Furukawa, Megumi; Doi, Katsumi

2015-01-01

279

Indigenous cellulolytic and hemicellulolytic bacteria enhanced rapid co-composting of lignocellulose oil palm empty fruit bunch with palm oil mill effluent anaerobic sludge.  

Science.gov (United States)

The composting of lignocellulosic oil palm empty fruit bunch (OPEFB) with continuous addition of palm oil mill (POME) anaerobic sludge which contained nutrients and indigenous microbes was studied. In comparison to the conventional OPEFB composting which took 60-90 days, the rapid composting in this study can be completed in 40 days with final C/N ratio of 12.4 and nitrogen (2.5%), phosphorus (1.4%), and potassium (2.8%), respectively. Twenty-seven cellulolytic bacterial strains of which 23 strains were closely related to Bacillus subtilis, Bacillus firmus, Thermobifida fusca, Thermomonospora spp., Cellulomonas sp., Ureibacillus thermosphaericus, Paenibacillus barengoltzii, Paenibacillus campinasensis, Geobacillus thermodenitrificans, Pseudoxanthomonas byssovorax which were known as lignocellulose degrading bacteria and commonly involved in lignocellulose degradation. Four isolated strains related to Exiguobacterium acetylicum and Rhizobium sp., with cellulolytic and hemicellulolytic activities. The rapid composting period achieved in this study can thus be attributed to the naturally occurring cellulolytic and hemicellulolytic strains identified. PMID:24012093

Zainudin, Mohd Huzairi Mohd; Hassan, Mohd Ali; Tokura, Mitsunori; Shirai, Yoshihito

2013-11-01

280

Identificación de genes codificantes de enzimas de interés industrial en una cepa de bacteria termofílica aislada de aguas termanles de Salta (Argentina  

Directory of Open Access Journals (Sweden)

Full Text Available Se aislaron dos bacterias termofílicas a partir de aguas termales de la provincia de Salta, Argentina. Estudios filogenéticos permitieron caracterizar los aislamientos como pertenecientes a los géneros Thermus y Geobacillus. Se determinó la secuencia nucleotídica parcial del genoma de Thermus sp. 2.9 con un equipo de secuenciación masiva de ADN de tecnología Roche 454. Se generaron 215.557 lecturas que proveen una cobertura aproximada de 40 veces el tamaño del genoma. Se realizó un análisis preliminar de las secuencias obtenidas para la identificación de regiones codificantes. Mediante el mismo se identificaron y caracterizaron genes que codifican enzimas utilizadas en procesos de transformación de alimentos y relacionadas con la degradación de polímeros, tales como xilanasas, proteasas, esterasas, lipasas, catalasas y galactosidasas. Este primer paso indica que este microorganismo es un potencial productor de enzimas termofílicas que podrían ser aplicadas en la industria alimentaria.

Navas, L.E.

2014-04-01

281

Biology of anaerobic bacteria  

OpenAIRE

Sulfate reducing bacteria of the genus DESULFOVIBRIO and homoacetogenic bacteria of the genus SPOROMUSA were sensitive to changes of hydrogen concentrations during the growth on an organic substrate. Increase of hydrogen concentrations competitively inhibited the organic substrate degradation and decrease of hydrogen concentration inhibited the respiration and the reduction of the external electron acceptor. Such hydrogen sensitive strains which seem to intermediarily produce and consume hydr...

Cord-ruwisch, Ralf; Dubourguier, H. C.

1986-01-01

282

Abiotic and microbiotic factors controlling biofilm formation by thermophilic sporeformers.  

Science.gov (United States)

One of the major concerns in the production of dairy concentrates is the risk of contamination by heat-resistant spores from thermophilic bacteria. In order to acquire more insight in the composition of microbial communities occurring in the dairy concentrate industry, a bar-coded 16S amplicon sequencing analysis was carried out on milk, final products, and fouling samples taken from dairy concentrate production lines. The analysis of these samples revealed the presence of DNA from a broad range of bacterial taxa, including a majority of mesophiles and a minority of (thermophilic) spore-forming bacteria. Enrichments of fouling samples at 55°C showed the accumulation of predominantly Brevibacillus and Bacillus, whereas enrichments at 65°C led to the accumulation of Anoxybacillus and Geobacillus species. Bacterial population analysis of biofilms grown using fouling samples as an inoculum indicated that both Anoxybacillus and Geobacillus preferentially form biofilms on surfaces at air-liquid interfaces rather than on submerged surfaces. Three of the most potent biofilm-forming strains isolated from the dairy factory industrial samples, including Geobacillus thermoglucosidans, Geobacillus stearothermophilus, and Anoxybacillus flavithermus, have been characterized in detail with respect to their growth conditions and spore resistance. Strikingly, Geobacillus thermoglucosidans, which forms the most thermostable spores of these three species, is not able to grow in dairy intermediates as a pure culture but appears to be dependent for growth on other spoilage organisms present, probably as a result of their proteolytic activity. These results underscore the importance of abiotic and microbiotic factors in niche colonization in dairy factories, where the presence of thermophilic sporeformers can affect the quality of end products. PMID:23851093

Zhao, Yu; Caspers, Martien P M; Metselaar, Karin I; de Boer, Paulo; Roeselers, Guus; Moezelaar, Roy; Nierop Groot, Masja; Montijn, Roy C; Abee, Tjakko; Kort, Remco

2013-09-01

283

Aerobic anoxygenic phototrophic bacteria.  

Science.gov (United States)

The aerobic anoxygenic phototrophic bacteria are a relatively recently discovered bacterial group. Although taxonomically and phylogenetically heterogeneous, these bacteria share the following distinguishing features: the presence of bacteriochlorophyll a incorporated into reaction center and light-harvesting complexes, low levels of the photosynthetic unit in cells, an abundance of carotenoids, a strong inhibition by light of bacteriochlorophyll synthesis, and the inability to grow photosynthetically under anaerobic conditions. Aerobic anoxygenic phototrophic bacteria are classified in two marine (Erythrobacter and Roseobacter) and six freshwater (Acidiphilium, Erythromicrobium, Erythromonas, Porphyrobacter, Roseococcus, and Sandaracinobacter) genera, which phylogenetically belong to the alpha-1, alpha-3, and alpha-4 subclasses of the class Proteobacteria. Despite this phylogenetic information, the evolution and ancestry of their photosynthetic properties are unclear. We discuss several current proposals for the evolutionary origin of aerobic phototrophic bacteria. The closest phylogenetic relatives of aerobic phototrophic bacteria include facultatively anaerobic purple nonsulfur phototrophic bacteria. Since these two bacterial groups share many properties, yet have significant differences, we compare and contrast their physiology, with an emphasis on morphology and photosynthetic and other metabolic processes. PMID:9729607

Yurkov, V V; Beatty, J T

1998-09-01

284

Viabilidade celular de Saccharomyces cerevisiae cultivada em associação com bactérias contaminantes da fermentação alcoólica / Cellular viability of Saccharomyces cerevisiae cultivated in association with contaminant bacteria of alcoholic fermentation  

Scientific Electronic Library Online (English)

Full Text Available O objetivo deste trabalho foi estudar a influência de bactérias dos gêneros Bacillus e Lactobacillus, bem como de seus produtos metabólicos, na redução da viabilidade celular de leveduras Saccharomyces cerevisiae. As bactérias Bacillus subtilis, Bacillus coagulans, Bacillus stearothermophilus, Lacto [...] bacillus fermentum e Lactobacillus plantarum foram cultivadas em associação com a levedura S. cerevisiae (cepa Y-904) por 72 horas a 32 °C, sob agitação. A viabilidade celular, a taxa de brotamento e a população de células de S. cerevisiae e a acidez total, a acidez volátil e o pH dos meios de cultivos foram determinados às 0, 24, 48 e 72 horas do cultivo misto. As culturas de bactérias foram tratadas através do calor, de agente antimicrobiano e de irradiação. Os resultados mostraram que apenas os meios de cultivo mais acidificados, contaminados com as bactérias ativas L. fermentum e B. subtilis, provocaram redução na viabilidade celular de S. cerevisiae. Excetuando a bactéria B. subtilis tratada com radiação gama, as demais bactérias tratadas pelos diferentes processos (calor, irradiação e antimicrobiano) não causaram diminuição da viabilidade celular e da população de S. cerevisiae, indicando que a presença isolada dos metabólitos celulares dessas bactérias não foi suficiente para reduzir a porcentagem de células vivas de S. cerevisiae. Abstract in english The aim of this project was to study the influence of the bacteria Bacillus and Lactobacillus, as well as their metabolic products to decrease the cellular viability of the yeast Saccharomyces cerevisiae. The bacteria Bacillus subtilis, Bacillus coagulans, Bacillus stearothermophilus, Lactobacillus [...] fermentum and Lactobacillus plantarum were cultivated in association with yeast S. cerevisiae (strain Y-904) for 72 hours at 32 ºC under agitation. The cellular viability, budding rate and population of S. Cerevisiae and the total acidity, volatile acidity and pH of culture medium were determined at 0, 24, 48 and 72 hours of incubation of the mixed culture. The bacteria cultures were treated by heat sterilization, antibacterial agent and irradiation. The results showed that only the more acidified culture medium, contaminated with active bacteria L. fermentum and B. subtilis, caused a reduction in the yeast cellular viability. Except for the bacteria B. subtilis treated for radiation, the other bacteria treated by the different procedures (heat, radiation and antibacterial) did not cause a reduction in the cellular viability of S. cerevisiae, indicating that the isolated presence of the cellular metabolic of these bacteria was not enough to reduce the percentage of the living yeast cells.

Thais de Paula, Nobre; Jorge, Horii; André Ricardo, Alcarde.

2007-03-01

285

Cellular viability of Saccharomyces cerevisiae cultivated in association with contaminates bacteria of alcoholic fermentation;Viabilidade celular de Saccharomyces cerevisiae cultivada em associacao com bacterias contaminantes da fermentacao alcoolica  

Energy Technology Data Exchange (ETDEWEB)

The aim of this work was to study the influence of the bacteria Bacillus and Lactobacillus, as well as their metabolic products, in reduction of cellular viability of Saccharomyces cerevisiae, when in mixed culture of yeast and active and treated bacteria. Also was to evaluated an alternative medium (MCC) for the cultivation of bacteria and yeast, constituted of sugarcane juice diluted to 5 deg Brix and supplemented with yeast extract and peptone. The bacteria Bacillus subtilis, Bacillus coagulans, Bacillus stearothermophilus, Lactobacillus fermentum and Lactobacillus plantarum were cultivated in association with yeast Saccharomyces cerevisiae (strain Y-904) for 72 h on 32 deg C, under agitation. The cellular viability, budding rate and population of S. cerevisiae, the total acidity, volatile acidity and pH of culture were determined from 0, 24, 48 e 72 h of mixed culture. Also were determined the initial and final of microorganism population across the pour plate method, in traditional culture medium (PCA for Bacillus, MRS-agar for Lactobacillus and YEPD-agar for yeast S. cerevisiae) and in medium constituted of sugarcane juice. The bacteria cultures were treated by heat sterilization (120 deg C for 20 minutes), antibacterial agent (Kamoran HJ in concentration 3,0 ppm) or irradiation (radiation gamma, with doses of 5,0 kGy for Lactobacillus and 15,0 kGy for Bacillus). The results of the present research showed that just the culture mediums more acids (with higher concentrations of total and volatile acidity, and smaller values of pH), contaminated with active bacteria L. fermentum and B. subtilis, caused reduction on yeast cellular viability. Except the bacteria B. subtilis treated with radiation, the others bacteria treated by different procedures (heat, radiation e antibacterial) did not cause reduction on yeast cellular viability and population, indicating that the isolated presence of the cellular metabolic of theses bacteria was not enough to reduce the percentage of the yeast live cells and a density population. For all microorganisms, the counts obtained with the cultivation medium constituted of sugarcane juice were similar obtained in traditional mediums, probably because the alternative medium simulate the composition of sugarcane must, that the bacteria were isolated in industrial process of ethanol yield. However, the culture medium constituted of sugarcane juice could be replacing traditional culture mediums of yeast and bacteria tested in this work. (author)

Nobre, Thais de Paula

2005-07-01

286

Dimerization Mediates Thermo-Adaptation, Substrate Affinity and Transglycosylation in a Highly Thermostable Maltogenic Amylase of Geobacillus thermoleovorans  

Science.gov (United States)

Background Maltogenic amylases belong to a subclass of cyclodextrin-hydrolyzing enzymes and hydrolyze cyclodextrins more efficiently than starch unlike typical ?-amylases. Several bacterial malto-genic amylases with temperature optima of 40–60°C have been previously characterized. The thermo-adaption, substrate preferences and transglycosylation aspects of extremely thermostable bacterial maltogenic amylases have not yet been reported. Methodology/Principal Findings The recombinant monomeric and dimeric forms of maltogenic ?-amylase (Gt-Mamy) of the extremely thermophilic bacterium Geobacillus thermoleovorans are of 72.5 and 145 kDa, which are active optimally at 80°C. Extreme thermostability of this enzyme has been explained by analyzing far-UV CD spectra. Dimerization increases T1/2 of Gt-Mamy from 8.2 h to 12.63 h at 90°C and mediates its enthalpy-driven conformational thermostabilization. Furthermore, dime-rization regulates preferential substrate binding of the enzyme. The substrate preference switching of Gt-Mamy upon dimerization has been confirmed from the substrate-binding affinities of the enzyme for various high and low molecular weight substrates. There is an alteration in Km and substrate hydrolysis efficiency (Vmax/Km) of the enzyme (for cyclodex-trins/starch) upon dimerization. N-terminal truncation indicated the role of N-terminal 128 amino acids in the thermostabilization and modulation of substrate-binding affinity. This has been confirmed by molecular docking of ?-cyclodextrin to Gt-Mamy that indicated the requirement of homodimer formation by the interaction of a few N-terminal residues of chain A with the catalytic residues of (?/?)8 barrel of chain B and vice-versa for stable cyclodextrin binding. Site directed mutagenesis provided evidence for the role of N-terminal D109 at the dimeric interface in substrate affinity modulation and thermostabilization. The dimeric Gt-Mamy transglycosylates hydrolytic products of G4/G5 and acarbose, while the truncated form does not because of the lack of extra sugar-binding space formed due to dimerization. Conclusion/Significance N-terminal domain controls enthalpy-driven thermostabilization, substrate-binding affinity and transglycosylation activity of Gt-Mamy by homodimer formation. PMID:24069213

Mehta, Deepika; Satyanarayana, Tulasi

2013-01-01

287

Characterization of the Bacillus stearothermophilus manganese superoxide dismutase gene and its ability to complement copper/zinc superoxide dismutase deficiency in Saccharomyces cerevisiae.  

Science.gov (United States)

Recombinant clones containing the manganese superoxide dismutase (MnSOD) gene of Bacillus stearothermophilus were isolated with an oligonucleotide probe designed to match a part of the previously determined amino acid sequence. Complementation analyses, performed by introducing each plasmid into a superoxide dismutase-deficient mutant of Escherichia coli, allowed us to define the region of DNA which encodes the MnSOD structural gene and to identify a promoter region immediately upstream from the gene. These data were subsequently confirmed by DNA sequencing. Since MnSOD is normally restricted to the mitochondria in eucaryotes, we were interested (i) in determining whether B. stearothermophilus MnSOD could function in eucaryotic cytosol and (ii) in determining whether MnSOD could replace the structurally unrelated copper/zinc superoxide dismutase (Cu/ZnSOD) which is normally found there. To test this, the sequence encoding bacterial MnSOD was cloned into a yeast expression vector and subsequently introduced into a Cu/ZnSOD-deficient mutant of the yeast Saccharomyces cerevisiae. Functional expression of the protein was demonstrated, and complementation tests revealed that the protein was able to provide tolerance at wild-type levels to conditions which are normally restrictive for this mutant. Thus, in spite of the evolutionary unrelatedness of these two enzymes, Cu/ZnSOD can be functionally replaced by MnSOD in yeast cytosol. PMID:2407726

Bowler, C; Van Kaer, L; Van Camp, W; Van Montagu, M; Inzé, D; Dhaese, P

1990-03-01

288

S-layer variation in Bacillus stearothermophilus PV72 is based on DNA rearrangements between the chromosome and the naturally occurring megaplasmids.  

Science.gov (United States)

Bacillus stearothermophilus PV72 expresses different S-layer genes (sbsA and sbsB) under different growth conditions. No stretches of significant sequence identity between sbsA and sbsB were detected. In order to investigate S-layer gene regulation in B. stearothermophilus PV72, we characterized the upstream regulatory region of sbsA and sbsB by sequencing and primer extension analysis. Both genes are transcribed from unique but different promoters, independently of the growth phase. Localization of sbsB in the sbsA-expressing strain PV72/p6 revealed that the coding region of the second S-layer gene sbsB is located not on the chromosome but on a natural megaplasmid of the strain, whereas the upstream regulatory region of sbsB was exclusively detected on the chromosome of PV72/p6. For sbsB expression, the coding region has to be integrated into the chromosomally located expression site. After the switch to sbsB expression, the sbsA coding region was removed from the chromosome but could still be detected on the plasmid of the sbsB-expressing strain PV72/p2. The sbsA upstream regulatory region, however, remained on the chromosome. This is the first report of S-layer variation not caused by intrachromosomal DNA rearrangements, but where variant formation depends on recombinational events between the plasmid and the chromosome. PMID:11160098

Scholz, H C; Riedmann, E; Witte, A; Lubitz, W; Kuen, B

2001-03-01

289

Predictive model to describe the combined effect of pH and NaCl on apparent heat resistance of Bacillus stearothermophilus.  

Science.gov (United States)

The combined effect of pH and NaCl on the apparent thermal resistance of Bacillus stearothermophilus ATCC 12980 spores was studied. Spores were heated at different temperatures (115-125 degrees C) in mushroom substrate, acidified using glucono-delta-lactone to different pH levels (from 5.75 to 6.7), which contained concentrations of NaCl that ranged from 0.5 to 3% (w/v). The recovery medium was acidified to the same pH level and contained the same NaCl concentration as the heating menstruum. A factorial experimental design allowed a predictive model to be developed, which described the combined effect of heating temperature, pH and NaCl on the thermal resistance of B. stearothermophilus spores. Predictions from the model provided a valid description of the data used to generate the model, and agreed with observations from the literature and from an independent experiment performed using asparagus and bean substrates. PMID:9849781

Periago, P M; Fernández, P S; Salmerón, M C; Martínez, A

1998-10-20

290

Presence and potential role of thermophilic bacteria in temperate terrestrial environments  

Science.gov (United States)

Organic sulfur and nitrogen are major reservoirs of these elements in terrestrial systems, although their cycling remains to be fully understood. Both sulfur and nitrogen mineralization are directly related to microbial metabolism. Mesophiles and thermophiles were isolated from temperate environments. Thermophilic isolates were classified within the Firmicutes, belonging to the Geobacillus, Brevibacillus, and Ureibacillus genera, and showed optimum growth temperatures between 50°C and 60°C. Sulfate and ammonium produced were higher during growth of thermophiles both for isolated strains and natural bacterial assemblages. They were positively related to organic nutrient load. Temperature also affected the release of sulfate and ammonium by thermophiles. Quantitative, real-time reverse-transcription polymerase chain reaction on environmental samples indicated that the examined thermophilic Firmicutes represented up to 3.4% of the total bacterial community RNA. Temperature measurements during summer days showed values above 40°C for more than 10 h a day in soils from southern Spain. These results support a potential role of thermophilic bacteria in temperate terrestrial environments by mineralizing organic sulfur and nitrogen ruled by the existence and length of warm periods.

Portillo, M. C.; Santana, M.; Gonzalez, J. M.

2012-01-01

291

Backbone resonance assignments of the homotetrameric (48 kD) copper sensor CsoR from Geobacillus thermodenitrificans in the apo- and Cu(I)-bound states: Insights into copper-mediated allostery  

OpenAIRE

Prokaryotes are highly susceptible to exogenous copper and employ metalloregulatory proteins to control the intracellular concentration. CsoR (copper-sensitive operon repressor) is one such protein that represses transcription of a Cu(I)-effluxing ATPase in its apo form. Cu(I)-binding leads to transcriptional derepression and cellular copper resistance. Herein, we present substantially complete backbone (HN, N, C’, C , C ) resonance assignments of tetrameric (48 kD) Geobacillus thermodenitr...

Coyne, H. Jerome; Giedroc, David P.

2012-01-01

292

Can bacteria save the planet?  

OpenAIRE

Bacteria might just hold the key to preserving the environment for our great grandchildren. Philip Hunter explores some of the novel ways in which systems biology and biotechnology are harnessing bacteria to produce renewable energy and clean up pollution.

Hunter, Philip

2010-01-01

293

Mechanistic Diversity in the RuBisCO Superfamily: The Enolase in the Methionine Salvage Pathway in Geobacillus kaustophilus  

International Nuclear Information System (INIS)

D-Ribulose 1,5-bisphosphate carboxylase/oxygenase (RuBisCO), the most abundant enzyme, is the paradigm member of the recently recognized mechanistically diverse RuBisCO superfamily. The RuBisCO reaction is initiated by abstraction of the proton from C3 of the D-ribulose 1,5-bisphosphate substrate by a carbamate oxygen of carboxylated Lys 201 (spinach enzyme). Heterofunctional homologues of RuBisCO found in species of Bacilli catalyze the tautomerization ('enolization') of 2,3-diketo-5-methylthiopentane 1-phosphate (DK-MTP 1-P) in the methionine salvage pathway in which 5-methylthio-D-ribose (MTR) derived from 5'-methylthioadenosine is converted to methionine (Ashida, H., Saito, Y., Kojima, C., Kobayashi, K., Ogasawara, N., and Yokota, A. (2003) A functional link between RuBisCO-like protein of Bacillus and photosynthetic RuBisCO, Science 302, 286-290]. The reaction catalyzed by this 'enolase' is accomplished by abstraction of a proton from C1 of the DK-MTP 1-P substrate to form the tautomerized product, a conjugated enol. Because the RuBisCO- and 'enolase'-catalyzed reactions differ in the regiochemistry of proton abstraction but are expected to share stabilization of an enolate anion intermediate by coordination to an active site Mg2+, we sought to establish structure-function relationships for the 'enolase' reaction so that the structural basis for the functional diversity could be established. We determined the stereochemical course of the reaction cataltereochemical course of the reaction catalyzed by the 'enolases' from Bacillus subtilis and Geobacillus kaustophilus. Using stereospecifically deuterated samples of an alternate substrate derived from D-ribose (5-OH group instead of the 5-methylthio group in MTR) as well as of the natural DK-MTP 1-P substrate, we determined that the 'enolase'-catalyzed reaction involves abstraction of the 1-proS proton. We also determined the structure of the activated 'enolase' from G. kaustophilus (carboxylated on Lys 173) liganded with Mg2+ and 2,3-diketohexane 1-phosphate, a stable alternate substrate. The stereospecificity of proton abstraction restricts the location of the general base to the N-terminal ?+ ? domain instead of the C-terminal (?/?)8-barrel domain that contains the carboxylated Lys 173. Lys 98 in the N-terminal domain, conserved in all 'enolases', is positioned to abstract the 1-proS proton. Consistent with this proposed function, the K98A mutant of the G. kaustophilus 'enolase' is unable to catalyze the 'enolase' reaction. Thus, we conclude that this functionally divergent member of the RuBisCO superfamily uses the same structural strategy as RuBisCO for stabilizing the enolate anion intermediate, i.e., coordination to an essential Mg2+, but the proton abstraction is catalyzed by a different general base

294

Three Activities: Bacteria Study, Micro Study, and Bacteria Killers  

Science.gov (United States)

This resource provides a problem-based activity on risk assessment of environmental health issues. The lesson consists of three related activities: Bacteria Study, Micro Study and Bacteria Killers. "Bacteria Study" gives students hands-on experience with the concepts of epidemiology. "Micro Study" has students sketch, observe, and compare different types of bacteria that can grow in moist conditions. "Bacteria Killers" has students determine what kills bateria, especially in common household products. Detailed instructions are provided for each activity. This resource is free to download. Users must first create a login with ATEEC's website to access the file.

295

Denitrification by extremely halophilic bacteria  

Science.gov (United States)

Extremely halophilic bacteria were isolated from widely separated sites by anaerobic enrichment in the presence of nitrate. The anaerobic growth of several of these isolates was accompanied by the production of nitrite, nitrous oxide, and dinitrogen. These results are a direct confirmation of the existence of extremely halophilic denitrifying bacteria, and suggest that such bacteria may be common inhabitants of hypersaline environments.

Hochstein, L. I.; Tomlinson, G. A.

1985-01-01

296

Exopolysaccharides from marine bacteria  

Science.gov (United States)

Microbial polysaccharides represent a class of important products of growing interest for many sectors of industry. In recent years, there has been a growing interest in isolating new exopolysaccharides (EPSs)-producing bacteria from marine environments, particularly from various extreme marine environments. Many new marine microbial EPSs with novel chemical compositions, properties and structures have been found to have potential applications in fields such as adhesives, textiles, Pharmaceuticals and medicine for anti-cancer, food additives, oil recovery and metal removal in mining and industrial waste treatments, etc This paper gives a brief summary of the information about the EPSs produced by marine bacteria, including their chemical compositions, properties and structures, together with their potential applications in industry.

Chi, Zhenming; Fang, Yan

2005-01-01

297

Lipoprotein sorting in bacteria.  

Science.gov (United States)

Bacterial lipoproteins are synthesized as precursors in the cytoplasm and processed into mature forms on the cytoplasmic membrane. A lipid moiety attached to the N terminus anchors these proteins to the membrane surface. Many bacteria are predicted to express more than 100 lipoproteins, which play diverse functions on the cell surface. The Lol system, composed of five proteins, catalyzes the localization of Escherichia coli lipoproteins to the outer membrane. Some lipoproteins play vital roles in the sorting of other lipoproteins, lipopolysaccharides, and ?-barrel proteins to the outer membrane. On the basis of results from biochemical, genetic, and structural studies, we discuss the biogenesis of lipoproteins in bacteria, their importance in cellular functions, and the molecular mechanisms underlying efficient sorting of hydrophobic lipoproteins to the outer membrane through the hydrophilic periplasm. PMID:21663440

Okuda, Suguru; Tokuda, Hajime

2011-01-01

298

Communication among Oral Bacteria  

OpenAIRE

Human oral bacteria interact with their environment by attaching to surfaces and establishing mixed-species communities. As each bacterial cell attaches, it forms a new surface to which other cells can adhere. Adherence and community development are spatiotemporal; such order requires communication. The discovery of soluble signals, such as autoinducer-2, that may be exchanged within multispecies communities to convey information between organisms has emerged as a new research direction. Dire...

Kolenbrander, Paul E.; Andersen, Roxanna N.; Blehert, David S.; Egland, Paul G.; Foster, Jamie S.; Palmer, Robert J.

2002-01-01

299

Surface layers of bacteria.  

OpenAIRE

Since bacteria are so small, microscopy has traditionally been used to study them as individual cells. To this end, electron microscopy has been a most powerful tool for studying bacterial surfaces; the viewing of macromolecular arrangements of some surfaces is now possible. This review compares older conventional electron-microscopic methods with new cryotechniques currently available and the results each has produced. Emphasis is not placed on the methodology but, rather, on the importance ...

Beveridge, T. J.; Graham, L. L.

1991-01-01

300

Glacial Lake Hides Bacteria  

Science.gov (United States)

This article highlights the published work of a geomicrobiology research team led by Eric Gaidos from the University of Hawaii and Brian Lanoil, from the University of California, Riverside. This group reports the identification of bacteria from an Icelandic sub-glacial lake, and how the collection and description of these microorganisms immured within glacial ice and sub-surface water serve as a model in the search for extra-terrestrial life.

2010-03-01

301

Glacial lake hides bacteria  

Science.gov (United States)

This article highlights the published work of a geomicrobiology research team led by Eric Gaidos from the University of Hawaii and Brian Lanoil, from the University of California, Riverside. This group reports the identification of bacteria from an Icelandic sub-glacial lake, and how the collection and description of these microorganisms immured within glacial ice and sub-surface water serve as a model in the search for extra-terrestrial life.

Mark Peplow

302

Growing Unculturable Bacteria  

OpenAIRE

The bacteria that can be grown in the laboratory are only a small fraction of the total diversity that exists in nature. At all levels of bacterial phylogeny, uncultured clades that do not grow on standard media are playing critical roles in cycling carbon, nitrogen, and other elements, synthesizing novel natural products, and impacting the surrounding organisms and environment. While molecular techniques, such as metagenomic sequencing, can provide some information independent of our ability...

Stewart, Eric J.

2012-01-01

303

How honey kills bacteria.  

Science.gov (United States)

With the rise in prevalence of antibiotic-resistant bacteria, honey is increasingly valued for its antibacterial activity. To characterize all bactericidal factors in a medical-grade honey, we used a novel approach of successive neutralization of individual honey bactericidal factors. All bacteria tested, including Bacillus subtilis, methicillin-resistant Staphylococcus aureus, extended-spectrum beta-lactamase producing Escherichia coli, ciprofloxacin-resistant Pseudomonas aeruginosa, and vancomycin-resistant Enterococcus faecium, were killed by 10-20% (v/v) honey, whereas > or = 40% (v/v) of a honey-equivalent sugar solution was required for similar activity. Honey accumulated up to 5.62 +/- 0.54 mM H(2)O(2) and contained 0.25 +/- 0.01 mM methylglyoxal (MGO). After enzymatic neutralization of these two compounds, honey retained substantial activity. Using B. subtilis for activity-guided isolation of the additional antimicrobial factors, we discovered bee defensin-1 in honey. After combined neutralization of H(2)O(2), MGO, and bee defensin-1, 20% honey had only minimal activity left, and subsequent adjustment of the pH of this honey from 3.3 to 7.0 reduced the activity to that of sugar alone. Activity against all other bacteria tested depended on sugar, H(2)O(2), MGO, and bee defensin-1. Thus, we fully characterized the antibacterial activity of medical-grade honey. PMID:20228250

Kwakman, Paulus H S; te Velde, Anje A; de Boer, Leonie; Speijer, Dave; Vandenbroucke-Grauls, Christina M J E; Zaat, Sebastian A J

2010-07-01

304

Interactions of Escherichia coli SO-187 tRNA(IVal) with Bacillus stearothermophilus valine-tRNA synthetase studied by 13C-NMR.  

Science.gov (United States)

Uracil isotopically labelled with 13C at C4 and C5 has been incorporated into nucleic acids of the Escherichia coli uracil auxotroph, SO-187. [4,5-13C]uracil-labeled tRNA(IVal) was isolated and purified. 13C longitudinal relaxation times measured at 67.8 MHz demonstrated that the C5 dipole caused a 20-50% increase in the C4 relaxation. Interactions of this tRNA with valine-tRNA synthetase (VTS) purified from Bacillus stearothermophilus were established by 13C-NMR. Specific spectral changes were seen at 4-thiouridine, ribothymidine and pseudouridine of the 'bend' in the three-dimensional structure, and particularly at the uridine-5-oxyacetic acid in the wobble position of the anticodon. Thus, the protein seems to be in contact along the entire tRNA molecule, including the anticodon loop. PMID:2667642

Schweizer, M P; Olsen, J I; Stolk, J A; Lee, Y C; Reeves, P M; Perry, C; De, N

1989-08-14

305

Biochemical properties of recombinant leucine aminopeptidase II from Bacillus stearothermophilus and potential applications in the hydrolysis of Chinese anchovy (Engraulis japonicus) proteins.  

Science.gov (United States)

The effects of various factors on the activity and conformation of recombinant leucine aminopeptidase II (rLAP II) from Bacillus stearothermophilus and its potential utilization in the hydrolysis of anchovy proteins were investigated. The optimal temperature and pH of rLAP II were 55 °C and 8.0 in phosphate buffer, and its activity was strongly stimulated by Co(2+). Conformational studies indicated that maintaining the ?-helical structure had a critical effect on rLAP II activity. rLAP II was used to hydrolyze anchovy proteins, and it exhibited high specificity for peptides with molecular weight between 6000 and 1000 Da and positive coordination with endogenous enzymes and commercial Flavourzyme. Its use will enhance protein hydrolysis in species of aquatic animals. rLAP II could potentially be used to remove bitterness in the protein hydrolysis industry. PMID:22148180

Wang, Fanghua; Ning, Zhengxiang; Lan, Dongming; Liu, Yuanyuan; Yang, Bo; Wang, Yonghua

2012-01-11

306

Pepsin homologues in bacteria  

Directory of Open Access Journals (Sweden)

Full Text Available Abstract Background Peptidase family A1, to which pepsin belongs, had been assumed to be restricted to eukaryotes. The tertiary structure of pepsin shows two lobes with similar folds and it has been suggested that the gene has arisen from an ancient duplication and fusion event. The only sequence similarity between the lobes is restricted to the motif around the active site aspartate and a hydrophobic-hydrophobic-Gly motif. Together, these contribute to an essential structural feature known as a psi-loop. There is one such psi-loop in each lobe, and so each lobe presents an active Asp. The human immunodeficiency virus peptidase, retropepsin, from peptidase family A2 also has a similar fold but consists of one lobe only and has to dimerize to be active. All known members of family A1 show the bilobed structure, but it is unclear if the ancestor of family A1 was similar to an A2 peptidase, or if the ancestral retropepsin was derived from a half-pepsin gene. The presence of a pepsin homologue in a prokaryote might give insights into the evolution of the pepsin family. Results Homologues of the aspartic peptidase pepsin have been found in the completed genomic sequences from seven species of bacteria. The bacterial homologues, unlike those from eukaryotes, do not possess signal peptides, and would therefore be intracellular acting at neutral pH. The bacterial homologues have Thr218 replaced by Asp, a change which in renin has been shown to confer activity at neutral pH. No pepsin homologues could be detected in any archaean genome. Conclusion The peptidase family A1 is found in some species of bacteria as well as eukaryotes. The bacterial homologues fall into two groups, one from oceanic bacteria and one from plant symbionts. The bacterial homologues are all predicted to be intracellular proteins, unlike the eukaryotic enzymes. The bacterial homologues are bilobed like pepsin, implying that if no horizontal gene transfer has occurred the duplication and fusion event might be very ancient indeed, preceding the divergence of bacteria and eukaryotes. It is unclear whether all the bacterial homologues are derived from horizontal gene transfer, but those from the plant symbionts probably are. The homologues from oceanic bacteria are most closely related to memapsins (or BACE-1 and BACE-2, but are so divergent that they are close to the root of the phylogenetic tree and to the division of the A1 family into two subfamilies.

Bateman Alex

2009-09-01

307

ISBst12, a novel type of insertion-sequence element causing loss of S-layer-gene expression in Bacillus stearothermophilus ATCC 12980.  

Science.gov (United States)

The cell surface of the surface layer (S-layer)-carrying strain of Bacillus stearothermophilus ATCC 12980 is completely covered with an oblique lattice composed of the S-layer protein SbsC. In the S-layer-deficient strain, theS-layer gene sbsC was still present but was interrupted by a novel type of insertion sequence (IS) element designated ISBst12. The insertion site was found to be located within the coding region of the sbsC gene, 199 bp downstream from the translation start of SbsC. ISBst12 is 1612 bp long, bounded by 16 bp imperfect inverted repeats and flanked by a directly repeated 8 bp target sequence. ISBst12 contains an ORF of 1446 bp and is predicted to encode a putative transposase of 482 aa with a calculated theoretical molecular mass of 55562 Da and an isoelectric point of 9.13. The putative transposase does not exhibit a typical DDE motif but displays aHis-Arg-Tyr triad characteristic of the active site of integrases from the bacteriophage lambda Int family. Furthermore, two overlapping leucine-zipper motifs were identified at the N-terminal part of the putative transposase. As revealed by Southern blotting, ISBst12 was present in multiple copies in the S-layer-deficient strain as well as in the S-layer-carrying strain. Northern blotting indicated that S-layer gene expression is already inhibited at the transcriptional level, since no sbsC-specific transcript could be identified in the S-layer-deficient strain. By using PCR, ISBst12 was also detected in B. stearothermophilus PV72/p6, in its oxygen-induced strain variant PV72/p2 and in the S-layer-deficient strain PV72/T5. PMID:10974105

Egelseer, E M; Idris, R; Jarosch, M; Danhorn, T; Sleytr, U B; Sára, M

2000-09-01

308

Expression of genes encoding the E2 and E3 components of the Bacillus stearothermophilus pyruvate dehydrogenase complex and the stoichiometry of subunit interaction in assembly in vitro.  

Science.gov (United States)

Genes encoding the dihydrolipoyl acetyltransferase (E2) and dihydrolipoyl dehydrogenase (E3) components of the pyruvate dehydrogenase (PDH) multienzyme complex from Bacillus stearothermophilus were overexpressed in Escherichia coli. The E2 component was purified as a large soluble aggregate (molecular mass > 1 x 10(6) Da) with the characteristic 532 symmetry of an icosahedral (60-mer) structure, and the E3 as a homodimer with a molecular mass of 110 kDa. The recombinant E2 component in vitro was capable of binding either 60 E3(alpha2) dimers or 60 heterotetramers (alpha2beta2) of the pyruvate decarboxylase (E1) component (also the product of B. stearothermophilus genes overexpressed in E. coli). Assembling the E2 polypeptide chain into the icosahedral E2 core did not impose any restriction on the binding of E1 or E3 to the peripheral subunit-binding domain in each E2 chain. This has important consequences for the stoichiometry of the assembled complex in vivo. The lipoyl domain of the recombinant E2 protein was found to be unlipoylated, but it could be correctly post-translationally modified in vitro using a recombinant lipoate protein ligase from E. coli. The lipoylated E2 component was able to bind recombinant E1 and E3 components in vitro to generate a PDH complex with a catalytic activity comparable with that of the wild-type enzyme. Reversible unfolding of the recombinant E2 and E3 components in 6 M guanidine hydrochloride was possible in the absence of chaperonins, with recoveries of enzymic activities of 95% and 85%, respectively. However, only 26% of the E1 enzyme activity was recovered under the same conditions as a result of irreversible denaturation of both E1alpha and E1beta. This represents the first complete post-translational modification and assembly of a fully active PDH complex from recombinant proteins in vitro. PMID:9874216

Lessard, I A; Domingo, G J; Borges, A; Perham, R N

1998-12-01

309

Sequencing of O-Glycopeptides Derived from an S-Layer Glycoprotein of Geobacillus stearothermophilus NRS 2004/3a Containing up to 51 Monosaccharide Residues at a Single Glycosylation Site by Fourier Transform Ion Cyclotron Resonance Infrared Multiphoton Dissociation Mass Spectrometry  

Science.gov (United States)

The microheterogeneity of large sugar chains in glycopeptides from S-layer glycoproteins containing up to 51 monosaccharide residues at a single O-attachment site on a 12 amino acid peptide backbone was investigated by Fourier transform ion cyclotron resonance mass spectrometry (FTICR MS). Structural elucidation of glycopeptides with the same amino acid sequence and different glycoforms, having such a high saccharide-to-peptide ratio, was achieved by applying infrared multiphoton dissociation (IRMPD) MS/MS for the first time. A 100% sequence coverage of the glycan chain and a 50% coverage of the peptide backbone fragmentation were obtained. The microheterogeneity of carbohydrate chains at the same glycosylation site, containing largely rhamnose, could have been reliably assessed. PMID:17378537

Schaffer, Christina; Messner, Paul; Mormann, Michael; Peter-Katalini?, Jasna

2015-01-01

310

Geobacillus thermoleovorans immobilized on Amberlite XAD-4 resin as a biosorbent for solid phase extraction of uranium (VI) prior to its spectrophotometric determination  

International Nuclear Information System (INIS)

Geobacillus thermoleovorans subsp stromboliensis, was immobilized on an Amberlite XAD-4 ion exchanger and used as a solid phase extractant for the preconcentration of U(VI) ions prior to their determination by UV-VIS spectrophotometry. Parameters affecting the preconcentration (such as the pH value of the sample solution, the concentration of U(VI), the volume and type of eluent, the flow rate and the effect of potentially interfering ions) were studied. The optimum pH for the sorption of U(VI) was found to be pH 5.0. 5.0 mL of 1 M hydrochloric acid were used to eluate the U(VI) from the column. The loading capacity is 11 mg g-1. The limits of detection and quantification are 2.7 and 9.0 ?g L-1, respectively, and relative standard deviations are <10 %. The method was applied to the determination of U(VI) in a certified reference sample (NCS ZC-73014; tea leaves) and in natural water samples. (author)

311

A novel ?-xylosidase structure from Geobacillus thermoglucosidasius: the first crystal structure of a glycoside hydrolase family GH52 enzyme reveals unpredicted similarity to other glycoside hydrolase folds.  

Science.gov (United States)

Geobacillus thermoglucosidasius is a thermophilic bacterium that is able to ferment both C6 and C5 sugars to produce ethanol. During growth on hemicellulose biomass, an intracellular ?-xylosidase catalyses the hydrolysis of xylo-oligosaccharides to the monosaccharide xylose, which can then enter the pathways of central metabolism. The gene encoding a G. thermoglucosidasius ?-xylosidase belonging to CAZy glycoside hydrolase family GH52 has been cloned and expressed in Escherichia coli. The recombinant enzyme has been characterized and a high-resolution (1.7 Å) crystal structure has been determined, resulting in the first reported structure of a GH52 family member. A lower resolution (2.6 Å) structure of the enzyme-substrate complex shows the positioning of the xylobiose substrate to be consistent with the proposed retaining mechanism of the family; additionally, the deep cleft of the active-site pocket, plus the proximity of the neighbouring subunit, afford an explanation for the lack of catalytic activity towards the polymer xylan. Whilst the fold of the G. thermoglucosidasius ?-xylosidase is completely different from xylosidases in other CAZy families, the enzyme surprisingly shares structural similarities with other glycoside hydrolases, despite having no more than 13% sequence identity. PMID:24816105

Espina, Giannina; Eley, Kirstin; Pompidor, Guillaume; Schneider, Thomas R; Crennell, Susan J; Danson, Michael J

2014-05-01

312

Production of L-ribose from L-ribulose by a triple-site variant of mannose-6-phosphate isomerase from Geobacillus thermodenitrificans.  

Science.gov (United States)

A triple-site variant (W17Q N90A L129F) of mannose-6-phosphate isomerase from Geobacillus thermodenitrificans was obtained by combining variants with residue substitutions at different positions after random and site-directed mutagenesis. The specific activity and catalytic efficiency (k(cat)/K(m)) for L-ribulose isomerization of this variant were 3.1- and 7.1-fold higher, respectively, than those of the wild-type enzyme at pH 7.0 and 70°C in the presence of 1 mM Co(2+). The triple-site variant produced 213 g/liter l-ribose from 300 g/liter L-ribulose for 60 min, with a volumetric productivity of 213 g liter(-1) h(-1), which was 4.5-fold higher than that of the wild-type enzyme. The k(cat)/K(m) and productivity of the triple-site variant were approximately 2-fold higher than those of the Thermus thermophilus R142N variant of mannose-6-phosphate isomerase, which exhibited the highest values previously reported. PMID:22447612

Lim, Yu-Ri; Yeom, Soo-Jin; Oh, Deok-Kun

2012-06-01

313

Purification, crystallization and preliminary X-ray diffraction studies of the ATP-binding subunit of an ABC transporter from Geobacillus kaustophilus.  

Science.gov (United States)

ATP-binding cassette (ABC) transporters, also known as traffic ATPases, form a large family of integral membrane proteins responsible for the translocation of a variety of chemically diverse substrates across the lipid bilayers of cellular membranes of both prokaryotes and eukaryotes by the hydrolysis of ATP. The ATP-binding subunit of an ABC transporter from Geobacillus kaustophilus, a homodimeric enzyme, was overexpressed in Escherichia coli and purified. Crystals were obtained using the microbatch-under-oil method at 291?K. X-ray diffraction data to 1.6?Å resolution were collected on SPring-8 beamline BL26B1. The crystals belonged to the orthorhombic space group I222, with unit-cell parameters a=54.94, b=78.63, c=112.96?Å. Assuming the presence of a dimer in the asymmetric unit gave a crystal volume per protein weight (VM) of 2.32?Å3?Da(-1) and a solvent content of 47%; this was consistent with the results of a dynamic light-scattering experiment, which showed a dimeric state of the protein in solution. Molecular-replacement trials using the crystal structure of HisP from the Salmonella typhimurium ATP-binding subunit of an ABC transporter as a search model did not provide a satisfactory solution, indicating that the two ATP-binding subunits of ABC transporters have substantially different structures. PMID:23143260

Manjula, Mallappa; Pampa, Kudigana J; Madan Kumar, Shankar; Kunishima, Naoki; Lokanath, Neratur K

2012-11-01

314

Extracellular communication in bacteria  

DEFF Research Database (Denmark)

Populations of bacterial cells often coordinate their responses to changes in their local environmental conditions through "quorum sensing", a cell-to-cell communication system employing small diffusible signal molecules. While there is considerable diversity in the chemistry of such signal molecules, in different Gram-positive and Gram-negative bacteria they control pathogenicity, secondary metabolite production, biofilm differentiation, DNA transfer and bioluminescence. The development of biosensors for the detection of these signal molecules has greatly facilitated their subsequent chemical analysis which in turn has resulted in significant progress in understanding the molecular basis of quorum sensing-dependent gene expression. Consequently, the discovery and characterisation of natural molecules which antagonize quorum sensing-mediated responses has created new opportunities for the design of novel anti-infective agents which control infection through the attenuation of bacterial virulence.

Chhabra, S.R.; Philipp, B.

2005-01-01

315

Bacteria Growth Inquiry: Bodily Bacteria and Healthy Hygiene Habits  

Science.gov (United States)

In this inquiry activity, students generate investigable questions to explore the link between hygiene/cleanliness and bacteria growth/population. The students will present their conclusions, and video clips containing additional information will be discussed.

316

Sampling bacteria with a laser  

Science.gov (United States)

Water quality is a topic of high interest and it's getting more and more important due to climate change and the implementation of European Water Framework Directive (WFD). One point of interest here is the inflow of bacteria into a river caused by combined sewer overflows which lead untreated wastewater including bacteria directly into a river. These bacteria remain in the river for a certain time, they settle down and can be remobilised again. In our study we want to investigate these processes of sedimentation and resuspension and use the results for the development of a software module coupled with the software Flow3D. Thereby we should be able to simulate and therefore predict the water quality influenced by combined sewer overflows. Hence we need to get information about the bacteria transport and fate. We need to know about the size of the bacteria or of the bacteria clumps and the size of the particles the bacteria are attached to. The agglomerates lead to different characteristics and velocities of settlement. The timespan during this bacteria can be detected in the bulk phase depends on many factors like the intensity of UV light, turbidity of the water, the temperature of the water, if there are grazers and a lot more. The size, density and composition of the agglomerates is just a part of all these influencing factors, but it is extremely difficult to differ between the other effects if we have no information about the simple sedimentation in default of these basic information. However we have a big problem getting the data. The chaining between bacteria or bacteria and particles is not too strong, so filtering the water to get a sieving curve may destroy these connections. We did some experiments similar to PIV (particle image velocimetry) measurements and evaluated the pictures with a macro written for the software ImageJ. Doing so we were able to get the concentration of bacteria in the water and collect information about the size of the bacteria. We also compared these data to samples of usual collection and filtering. The results of these laser measurements are very promising.

Schwarzwälder, Kordula; Rutschmann, Peter

2014-05-01

317

[A novel type of phase variation regarding integrated and free states of plasmid pFDX163 in Bacillus stearothermophilus CU21].  

Science.gov (United States)

pFDX1 is a recombinant plasmid which carries a foreign gene xylE. By selecting for kanamycin-resistant mutants of Bacillus stearothermophilus CU21(pFDX1) at higher temperature, a variant strain CU21-163 was obtained. This strain harbors a mutant plasmid pFDX163, which was formed by insertion of a 2.0kb H-fragment from the CU21 genome onto the plasmid pFDX1. pFDX163 was supposed to be integrated into the CU21 chromosome via homologous recombination of H-fragments. The CU21-163 strain consists of two cell types, i.e. y-cell and w-cell. The expression level of xylE gene in the former is higher than that in the latter. The progeny of a y-cell always contains some w-cells, while that of a w-cell contains y-cells. This is supposed to be due to a phase variation of CU21-163. Analysis on the amount of free and integrated plasmid DNA in different DNA samples of CU21-163 cells allows us to draw the conclusion that there are both free and integrated plasmids in the y-cells, whereas only integrated ones in the w-cells. PMID:2252599

He, X S; Shen, R Q; Sheng, Z J

1990-01-01

318

Synthesis of cinnamyl alcohol from cinnamaldehyde with Bacillus stearothermophilus alcohol dehydrogenase as the isolated enzyme and in recombinant E. coli cells.  

Science.gov (United States)

The synthesis of the aroma chemical cinnamyl alcohol (CMO) by means of enzymatic reduction of cinnamaldehyde (CMA) was investigated using NADH-dependent alcohol dehydrogenase from Bacillus stearothermophilus both as an isolated enzyme, and in recombinant Escherichia coli whole cells. The influence of parameters such as reaction time and cofactor, substrate, co-substrate 2-propanol and biocatalyst concentrations on the bioreduction reaction was investigated and an efficient and sustainable one-phase system developed. The reduction of CMA (0.5 g/L, 3.8 mmol/L) by the isolated enzyme occurred in 3 h at 50 °C with 97% conversion, and yielded high purity CMO (?98%) with a yield of 88% and a productivity of 50 g/genzyme. The reduction of 12.5 g/L (94 mmol/L) CMA by whole cells in 6 h, at 37 °C and no requirement of external cofactor occurred with 97% conversion, 82% yield of 98% pure alcohol and a productivity of 34 mg/gwet cell weight. The results demonstrate the microbial system as a practical and efficient method for larger-scale synthesis of CMO. PMID:23686507

Pennacchio, Angela; Rossi, Mosè; Raia, Carlo A

2013-07-01

319

Lys13 plays a crucial role in the functional adaptation of the thermophilic triose-phosphate isomerase from Bacillus stearothermophilus to high temperatures.  

Science.gov (United States)

The thermophilic triose-phosphate isomerases (TIMs) of Bacillus stearothermophilus (bTIM) and Thermotoga maritima (tTIM) have been found to possess a His12-Lys13 pair instead of the Asn12-Gly13 pair normally present in mesophilic TIMs. His12 in bTIM was proposed to prevent deamidation at high temperature, while the precise role of Lys13 is unknown. To investigate the role of the His12 and Lys13 pair in the enzyme's thermoadaptation, we reintroduced the "mesophilic residues" Asn and Gly into both thermophilic TIMs. Neither double mutant displayed diminished structural stability, but the bTIM double mutant showed drastically reduced catalytic activity. No similar behavior was observed with the tTIM double mutant, suggesting that the presence of the His12 and Lys13 cannot be systematically correlated to thermoadaptation in TIMs. We determined the crystal structure of the bTIM double mutant complexed with 2-phosphoglycolate to 2.4-A resolution. A molecular dynamics simulation showed that upon substitution of Lys13 to Gly an increase of the flexibility of loop 1 is observed, causing an incorrect orientation of the catalytic Lys10. This suggests that Lys13 in bTIM plays a crucial role in the functional adaptation of this enzyme to high temperature. Analysis of bTIM single mutants supports this assumption. PMID:10383424

Alvarez, M; Wouters, J; Maes, D; Mainfroid, V; Rentier-Delrue, F; Wyns, L; Depiereux, E; Martial, J A

1999-07-01

320

Where Bacteria and Languages Concur  

Science.gov (United States)

Access to the article is free, however registration and sign-in are required. Genetic data from human gastric bacteria provide independent support for a linguistic analysis of Pacific population dispersals.

Colin Renfrew (University of Cambridge; McDonald Institute for Archaeological Research)

2009-01-23

321

Superoxide dismutase in ruminal bacteria.  

OpenAIRE

Of 13 species of anaerobic ruminal bacteria examined, 11 were found to contain measurable levels of superoxide dismutase activity. Four of five other strict anaerobic species studied for comparison were found to contain superoxide dismutase activity.

Fulghum, R. S.; Worthington, J. M.

1984-01-01

322

Improvement of Thermal Stability via Outer-Loop Ion Pair Interaction of Mutated T1 Lipase from Geobacillus zalihae Strain T1  

Directory of Open Access Journals (Sweden)

Full Text Available Mutant D311E and K344R were constructed using site-directed mutagenesis to introduce an additional ion pair at the inter-loop and the intra-loop, respectively, to determine the effect of ion pairs on the stability of T1 lipase isolated from Geobacillus zalihae. A series of purification steps was applied, and the pure lipases of T1, D311E and K344R were obtained. The wild-type and mutant lipases were analyzed using circular dichroism. The Tm for T1 lipase, D311E lipase and K344R lipase were approximately 68.52 °C, 70.59 °C and 68.54 °C, respectively. Mutation at D311 increases the stability of T1 lipase and exhibited higher Tm as compared to the wild-type and K344R. Based on the above, D311E lipase was chosen for further study. D311E lipase was successfully crystallized using the sitting drop vapor diffusion method. The crystal was diffracted at 2.1 Å using an in-house X-ray beam and belonged to the monoclinic space group C2 with the unit cell parameters a = 117.32 Å, b = 81.16 Å and c = 100.14 Å. Structural analysis showed the existence of an additional ion pair around E311 in the structure of D311E. The additional ion pair in D311E may regulate the stability of this mutant lipase at high temperatures as predicted in silico and spectroscopically.

Mahiran Basri

2012-01-01

323

Characteristic Features in the Structure and Collagen-Binding Ability of a Thermophilic Collagenolytic Protease from the Thermophile Geobacillus collagenovorans MO-1  

Science.gov (United States)

A collagen-degrading thermophile, Geobacillus collagenovorans MO-1, extracellularly produces a collagenolytic protease with a large molecular mass. Complete nucleotide sequencing of this gene after gene cloning revealed that the collagenolytic protease is a member of the subtilisin family of serine proteases and consists of a signal sequence for secretion, a prosequence for maturation, a catalytic region, 14 direct repeats of 20 amino acids at the C terminus, and a region with unknown function intervening between the catalytic region and the numerous repeats. Since the unusual repeats are most likely to be cleaved in the secreted form of the enzyme, the intervening region was investigated to determine whether it participates in collagen binding to facilitate collagen degradation. It was found that the mature collagenolytic protease containing the intervening region at the C terminus bound collagen but not the other insoluble proteins, elastin and keratin. Furthermore, the intervening region fused with glutathione S-transferase showed a collagen-binding ability comparable to that of the mature collagenolytic protease. The collagen-binding ability was finally attributed to two-thirds of the intervening region which is rich in ?-strands and is approximately 35 kDa in molecular mass. In the collagenolytic protease from strain MO-1, hydrogen bonds most likely predominate over the hydrophobic interaction for collagen binding, since a higher concentration of NaCl released collagen from the enzyme surface but a nonionic detergent could not. To the best of our knowledge, this is the first report of a thermophilic collagenolytic protease containing the collagen-binding segment. PMID:16952949

Itoi, Yuichi; Horinaka, Mano; Tsujimoto, Yoshiyuki; Matsui, Hiroshi; Watanabe, Kunihiko

2006-01-01

324

Characterization of a F280N variant of L-arabinose isomerase from Geobacillus thermodenitrificans identified as a D-galactose isomerase.  

Science.gov (United States)

The double-site variant (C450S-N475K) L-arabinose isomerase (L-AI) from Geobacillus thermodenitrificans catalyzes the isomerization of D-galactose to D-tagatose, a functional sweetener. Using a substrate-docking homology model, the residues near to D-galactose O6 were identified as Met186, Phe280, and Ile371. Several variants obtained by site-directed mutagenesis of these three residues were analyzed, and a triple-site (F280N) variant enzyme exhibited the highest activity for D-galactose isomerization. The k cat/K m of the triple-site variant enzyme for D-galactose was 2.1-fold higher than for L-arabinose, whereas the k cat/K m of the double-site variant enzyme for L-arabinose was 43.9-fold higher than for D-galactose. These results suggest that the triple-site variant enzyme is a D-galactose isomerase. The conversion rate of D-galactose to D-tagatose by the triple-site variant enzyme was approximately 3-fold higher than that of the double-site variant enzyme for 30 min. However, the conversion yields of L-arabinose to L-ribulose by the triple-site and double-site variant enzymes were 10.6 and 16.0 % after 20 min, respectively. The triple-site variant enzyme exhibited increased specific activity, turnover number, catalytic efficiency, and conversion rate for D-galactose isomerization compared to the double-site variant enzyme. Therefore, the amino acid at position 280 determines the substrate specificity for D-galactose and L-arabinose, and the triple-site variant enzyme has the potential to produce D-tagatose on an industrial scale. PMID:24880627

Kim, Baek-Joong; Hong, Seung-Hye; Shin, Kyung-Chul; Jo, Ye-Seul; Oh, Deok-Kun

2014-11-01

325

Comparative study on disinfection potency of spore forming bacteria by electron-beam irradiation and gamma-ray irradiation  

Energy Technology Data Exchange (ETDEWEB)

Along with gamma-ray irradiation, electron-beam irradiation (EB) is a method to disinfect microorganisms which cause food decomposition and food-poisoning. The present study was undertaken to compare sterilization efficacy of EB and gamma-ray irradiation on bacterial spores and vegetative cells under various conditions. Spores of Bacillus pumilus, a marker strain for irradiation study, and Bacillus stearothermophilus known as a thermophilic bacteria were irradiated by electron-beam and gamma-ray separately at irradiation dose of 0 to 10 kGy on combination of wet/dry and aerobic/anaerobic conditions. Sterilization effect of irradiation on spores was evaluated by colony counting on agar plates. Results showed that both EB and gamma-ray irradiation gave sufficient sterilization effect on spores, and the sterilization effect increased exponentially with irradiation dose. The sterilization effect of gamma-ray irradiation was higher than that of EB in all cases. Higher disinfection effect was observed under aerobic condition. The present study suggests that oxygen supply in EB is more important than gamma-ray irradiation. No results suggesting that chlorine ion at 0.1 ppm (as available chlorine concentration) enhanced the sterilization efficacy of either EB or gamma-ray irradiation was obtained under any conditions examined. (author).

Takizawa, Hironobu; Suzuki, Satoru; Suzuki, Tetsuya; Takama, Kozo (Hokkaido Univ., Hakodate (Japan). Faculty of Fisheries); Hayashi, Toru; Yasumoto, Kyoden

1990-10-01

326

Comparative study on disinfection potency of spore forming bacteria by electron-beam irradiation and gamma-ray irradiation  

International Nuclear Information System (INIS)

Along with gamma-ray irradiation, electron-beam irradiation (EB) is a method to disinfect microorganisms which cause food decomposition and food-poisoning. The present study was undertaken to compare sterilization efficacy of EB and gamma-ray irradiation on bacterial spores and vegetative cells under various conditions. Spores of Bacillus pumilus, a marker strain for irradiation study, and Bacillus stearothermophilus known as a thermophilic bacteria were irradiated by electron-beam and gamma-ray separately at irradiation dose of 0 to 10 kGy on combination of wet/dry and aerobic/anaerobic conditions. Sterilization effect of irradiation on spores was evaluated by colony counting on agar plates. Results showed that both EB and gamma-ray irradiation gave sufficient sterilization effect on spores, and the sterilization effect increased exponentially with irradiation dose. The sterilization effect of gamma-ray irradiation was higher than that of EB in all cases. Higher disinfection effect was observed under aerobic condition. The present study suggests that oxygen supply in EB is more important than gamma-ray irradiation. No results suggesting that chlorine ion at 0.1 ppm (as available chlorine concentration) enhanced the sterilization efficacy of either EB or gamma-ray irradiation was obtained under any conditions examined. (author)

327

Dissipative Shocks behind Bacteria Gliding  

OpenAIRE

Gliding is a means of locomotion on rigid substrates utilized by a number of bacteria includingmyxobacteria and cyanobacteria. One of the hypotheses advanced to explain this motility mechanism hinges on the role played by the slime filaments continuously extruded from gliding bacteria. This paper solves in full a non-linear mechanical theory that treats as dissipative shocks both the point where the extruded slime filament comes in contact with the substrate, called the fila...

Virga, Epifanio G.

2014-01-01

328

Magnetotactic bacteria for cancer therapy.  

Science.gov (United States)

Cancer is characterized by anomalous cell growth. Conventional therapies face many challenges and hence alternative treatment methods are in great demand. In addition, nature offers the best inspiration and recently many therapies of natural origin have proved multi-targeted, multi-staged, and a multi-component mode of action against cancer. Magnetotactic bacteria and magnetosomes-based treatment methods are among them. Present paper reviews various routes by which magnetotactic bacteria and magnetosomes contribute to cancer therapy. PMID:25388453

Mathuriya, Abhilasha S

2015-03-01

329

Inducible bacteriophages from ruminal bacteria.  

OpenAIRE

The incidence of temperate bacteriophage in a wide range of ruminal bacteria was investigated by means of induction with mitomycin C. Supernatant liquid from treated cultures was examined for phagelike particles by using transmission electron microscopy. Of 38 ruminal bacteria studied, nine organisms (23.7%) representing five genera (Eubacteria, Bacteroides, Butyrivibrio, Ruminococcus, and Streptococcus) produced phagelike particles. Filamentous particles from Butyrivibrio fibrisolvens are th...

Klieve, A. V.; Hudman, J. F.; Bauchop, T.

1989-01-01

330

Global transport of thermophilic bacteria in atmospheric dust.  

Science.gov (United States)

Aerosols from dust storms generated in the Sahara-Sahel desert area of Africa are transported north over Europe and periodically result in dry dust precipitation in the Mediterranean region. Samples of dust collected in Turkey and Greece following two distinct desert storm events contained viable thermophilic organisms of the genus Geobacillus, namely G. thermoglucosidasius and G. thermodenitrificans, and the recently reclassified Aeribacillus pallidus (formerly Geobacillus pallidus). We present here evidence that African dust storms create an atmospheric bridge between distant geographical regions and that they are also probably the source of thermophilic geobacilli later deposited over northern Europe by rainfall or dust plumes themselves. The same organisms (99% similarity in the 16S rDNA sequence) were found in dust collected in the Mediterranean region and inhabiting cool soils in Northern Ireland. This study also contributes new insights to the taxonomic identification of Geobacillus sp. Attempts to identify these organisms using 16S rRNA gene sequences have revealed that they contain multiple and diverse copies of the ribosomal RNA operon (up to 10 copies with nine different sequences), which dictates care in interpreting data about the systematics of this genus. PMID:23766086

Perfumo, Amedea; Marchant, Roger

2010-04-01

331

Receptor-transporter interactions of canonical ATP-binding cassette import systems in prokaryotes.  

Science.gov (United States)

ATP-binding cassette (ABC) transport systems mediate the translocation of solutes across biological membranes at the expense of ATP. They share a common modular architecture comprising two pore-forming transmembrane domains and two nucleotide binding domains. In prokaryotes, ABC transporters are involved in the uptake of a large variety of chemicals, including nutrients, osmoprotectants and signal molecules. In pathogenic bacteria, some ABC importers are virulence factors. Canonical ABC import systems require an additional component, a substrate-specific receptor or binding protein for function. Interaction of the liganded receptor with extracytoplasmic loop regions of the transmembrane domains initiate the transport cycle. In this review we summarize the current knowledge on receptor-transporter interplay provided by crystal structures as well as by biochemical and biophysical means. In particular, we focus on the maltose/maltodextrin transporter of enterobacteria and the transporters for positively charged amino acids from the thermophile Geobacillus stearothermophilus and Salmonella enterica serovar Typhimurium. PMID:21561685

Schneider, Erwin; Eckey, Viola; Weidlich, Daniela; Wiesemann, Nicole; Vahedi-Faridi, Ardeshir; Thaben, Paul; Saenger, Wolfram

2012-04-01

332

Dynamics in oxygen-induced changes in S-layer protein synthesis from Bacillus stearothermophilus PV72 and the S-layer-deficient variant T5 in continuous culture and studies of the cell wall composition.  

OpenAIRE

Stable synthesis of the hexagonally ordered (p6) S-layer protein from the wild-type strain of Bacillus stearothermophilus PV72 could be achieved in continuous culture on complex medium only under oxygen-limited conditions when glucose was used as the sole carbon source. Depending on the adaptation of the wild-type strain to low oxygen supply, the dynamics in oxygen-induced changes in S-layer protein synthesis was different when the rate of aeration was increased to a level that allowed dissim...

Sa?ra, M.; Kuen, B.; Mayer, H. F.; Mandl, F.; Schuster, K. C.; Sleytr, U. B.

1996-01-01

333

Evidence that an N-terminal S-layer protein fragment triggers the release of a cell-associated high-molecular-weight amylase in Bacillus stearothermophilus ATCC 12980.  

OpenAIRE

During growth on starch medium, the S-layer-carrying Bacillus stearothermophilus ATCC 12980 and an S-layer-deficient variant each secreted three amylases, with identical molecular weights of 58,000, 122,000, and 184,000, into the culture fluid. Only the high-molecular-weight amylase (hmwA) was also identified as cell associated. Extraction and reassociation experiments showed that the hmwA had a high-level affinity to the peptidoglycan-containing layer and to the S-layer surface, but the inte...

Egelseer, E. M.; Schocher, I.; Sleytr, U. B.; Sa?ra, M.

1996-01-01

334

Stereospecific production of the herbicide phosphinothricin (glufosinate): purification of aspartate transaminase from Bacillus stearothermophilus, cloning of the corresponding gene, aspC, and application in a coupled transaminase process.  

OpenAIRE

We have isolated and characterized an aspartate transaminase (glutamate:oxalacetate transaminase, EC 2.6.1.1) from the thermophilic microorganism Bacillus stearothermophilus. The purified enzyme has a molecular mass of 40.5 kDa by sodium dodecyl sulfate gel analysis, a temperature optimum of 95 degrees C, and a pH optimum of 8.0. The corresponding gene, aspC, was cloned and overexpressed in Escherichia coli. The recombinant glutamate:oxalacetate transaminase protein was used in immobilized fo...

Bartsch, K.; Schneider, R.; Schulz, A.

1996-01-01

335

Bacteria foraging in turbulent waters  

Science.gov (United States)

Marine bacteria are the Ocean's recyclers, contributing to as much as 50% of the productivity of the marine food web. Bacteria forage on patches of dissolved nutrients using chemotaxis, the ability to swim up chemical gradients. As turbulence is ubiquitous in the Ocean, it is important to understand how turbulent flow conditions affect bacterial foraging. We used three-dimensional, isotropic direct numerical simulations coupled with a bacterial transport equation to address this problem. After the flow is continuously forced until it reaches a steady state, microscale nutrient patches are injected into the turbulent flow, and stirring produces thin nutrient filaments. Two populations of bacteria compete against each other: one population is motile and chemotactic (`active'), the other is non-motile (`passive'). The distribution of both populations is initially uniform. Chemotaxis allows active bacteria to cluster near the center of the nutrient filaments, increasing their nutrient uptake relative to passive bacteria. Increasing the turbulence intensity increases the short-term chemotactic advantage by quickly producing large gradients in the nutrient concentration, but also leads to rapid mixing of the nutrient field, which makes the chemotactic advantage short-lived. The results suggest that the evolutionary advantage of chemotaxis, based on the increase in nutrient uptake relative to the energetic cost of swimming, strongly depends on the turbulence level.

Taylor, John; Tang, Wenbo; Stocker, Roman

2009-11-01

336

Inducible bacteriophages from ruminal bacteria.  

Science.gov (United States)

The incidence of temperate bacteriophage in a wide range of ruminal bacteria was investigated by means of induction with mitomycin C. Supernatant liquid from treated cultures was examined for phagelike particles by using transmission electron microscopy. Of 38 ruminal bacteria studied, nine organisms (23.7%) representing five genera (Eubacteria, Bacteroides, Butyrivibrio, Ruminococcus, and Streptococcus) produced phagelike particles. Filamentous particles from Butyrivibrio fibrisolvens are the first of this morphological type reported from ruminal bacteria. All of the other particles obtained possessed polyhedral heads and long, noncontractile tails (group B-type phage). The limited range of morphological types produced by mitomycin C induction cannot yet account for the much wider range of types found in ruminal contents by direct examination. The presence of viral genetic material in a significant percentage of the bacteria tested, as well as in a range of different genera, indicates that viral genetic material may be a normal constituent of the genome of appreciable numbers of ruminal bacteria. PMID:2504111

Klieve, A V; Hudman, J F; Bauchop, T

1989-06-01

337

Immobilization of BSA, enzymes and cells of Bacillus stearothermophilus onto cellulose polygalacturonic acid and starch based graft copolymers containing maleic arhydride  

Energy Technology Data Exchange (ETDEWEB)

Poly(maleic anhydride styrene) graft copolymers of cellulose, pectin polygalacturonic acid salt, calcium polygalacturonate, and starch were prepared and used to immobilize proteins. The cellulose grafts coupled quite appreciable quantities of acid phosphatase, glucose oxidase, and trypsin. However, the general retention of activity was somewhat disappointing. Further investigation with acid phosphatase showed that the amount of enzyme immobilized increased as the amount of anhydride in the graft copolymer increased but no such relationship existed for the enzymic activity. The cellulose graft copolymers were hydrolyzed and it appeared that the carboxyl group aided adsorption of the enzyme. Attempts to couple acid phosphatase using CMC through the free carboxyl groups, created by hydrolysis, gave only a small increase in the extent of protein coupling. However, the unhydrolyzed system gave a useful degree of immobilization of cells of Bacillus stearothermophilus, as did a poly(maleic anhydride/styrene)-cocellulose system. Attempts to improve the activity by using grafts based on other polysaccharide supports met with mixed success. Pectin products were soluble. Polygalacturonic acid products were partially soluble and extremely high levels of enzymic activity were obtained. This was probably due in part to the hydrophilic nature of the system, which also encouraged absorption of the enzyme. Attempts were made to reduce the solubility by using the calcium pectinate salt. Immobilization of acid phosphatase and trypsin resulted in increased protein coupling but relatively poor activities were attained. Calcium polygalacturonate was used to prepare an insoluble graft copolymeric system containing acrylonitrile-comaleic anhydride. The resulting gels gave excellent coupling with acid phosphatase which had a very good retention of activity.

Beddows, C.G.; Gil, M.H.; Guthrie, J.T.

1986-01-01

338

Isolation of two physiologically induced variant strains of Bacillus stearothermophilus NRS 2004/3a and characterization of their S-layer lattices.  

Science.gov (United States)

During growth of Bacillus stearothermophilus NRS 2004/3a in continuous culture on complex medium, the chemical properties of the S-layer glycoprotein and the characteristic oblique lattice were maintained only if glucose was used as the sole carbon source. With increased aeration, amino acids were also metabolized, accompanied by liberation of ammonium and by changes in the S-layer protein. Depending on the stage of fermentation at which oxygen limitation was relieved, two different variants, one with a more delicate oblique S-layer lattice (variant 3a/V1) and one with a square S-layer lattice (variant 3a/V2), were isolated. During the switch from the wild-type strain to a variant or from variant 3a/V2 to variant 3a/V1, monolayers of two types of S-layer lattices could be demonstrated on the surfaces of single cells. S-layer proteins from variants had different molecular sizes and a significantly lower carbohydrate content than S-layer proteins from the wild-type strain did. Although the S-layer lattices from the wild-type and variant strains showed quite different protein mass distributions in two- and three-dimensional reconstructions, neither the amino acid composition nor the pore size, as determined by permeability studies, was significantly changed. Peptide mapping and N-terminal sequencing results strongly indicated that the three S-layer proteins are encoded by different genes and are not derived from a universal precursor form. PMID:8300538

Sára, M; Pum, D; Küpcü, S; Messner, P; Sleytr, U B

1994-02-01

339

Activation of D-tyrosine by Bacillus stearothermophilus tyrosyl-tRNA synthetase: 2. Cooperative binding of ATP is limited to the initial turnover of the enzyme.  

Science.gov (United States)

The activation of D-tyrosine by tyrosyl-tRNA synthetase has been investigated using single and multiple turnover kinetic methods. In the presence of saturating concentrations of D-tyrosine, the activation reaction displays sigmoidal kinetics with respect to ATP concentration under single turnover conditions. In contrast, when the kinetics for the activation reaction are monitored using a steady-state (multiple turnover) pyrophosphate exchange assay, Michaelis-Menten kinetics are observed. Previous investigations indicated that activation of l-tyrosine by the K233A variant of Bacillus stearothermophilus tyrosyl-tRNA synthetase displays sigmoidal kinetics similar to those observed for activation of d-tyrosine by the wild-type enzyme. Kinetic analyses indicate that the sigmoidal behavior of the d-tyrosine activation reaction is not enhanced when Lys-233 is replaced by alanine. This supports the hypothesis that the mechanistic basis for the sigmoidal behavior is the same for both d-tyrosine activation by wild-type tyrosyl-tRNA synthetase and activation of l-tyrosine by the K233A variant. The observed sigmoidal behavior presents a paradox, as tyrosyl-tRNA synthetase displays an extreme form of negative cooperativity, known as "half-of-the-sites reactivity," with respect to tyrosine binding and tyrosyl-adenylate formation. We propose that the binding of D-tyrosine weakens the affinity with which ATP binds to the functional subunit in tyrosyl-tRNA synthetase. This allows ATP to bind initially to the nonfunctional subunit, inducing a conformational change in the enzyme that enhances the affinity of the functional subunit for ATP. The observation that sigmoidal kinetics are observed only under single turnover conditions suggests that this conformational change is stable over multiple rounds of catalysis. PMID:18319246

Sheoran, Anita; First, Eric A

2008-05-01

340

Interactions of the peripheral subunit-binding domain of the dihydrolipoyl acetyltransferase component in the assembly of the pyruvate dehydrogenase multienzyme complex of Bacillus stearothermophilus.  

Science.gov (United States)

The enzymes pyruvate decarboxylase (E1) and dihydrolipoyl dehydrogenase (E3) bind tightly but in a mutually exclusive manner to the peripheral subunit-binding domain (PSBD) of dihydrolipoyl acetyltransferase in the pyruvate dehydrogenase multienzyme complex of Bacillus stearothermophilus. The use of directed mutagenesis, surface plasmon resonance detection and isothermal titration microcalorimetry revealed that several positively charged residues of the PSBD, most notably Arg135, play an important part in the interaction with both E1 and E3, whereas Met131 makes a significant contribution to the binding of E1 only. This indicates that the binding sites for E1 and E3 on the PSBD are overlapping but probably significantly different, and that additional hydrophobic interactions may be involved in binding E1 compared with E3. Arg135 of the PSBD was also replaced with cysteine (R135C), which was then modified chemically by alkylation with increasingly large aliphatic groups (R135C -methyl, -ethyl, -propyl and -butyl). The pattern of changes in the values of DeltaG degrees, DeltaH degrees and TDeltaS degrees that were found to accompany the interaction with the variant PSBDs differed between E1 and E3 despite the similarities in the free energies of their binding to the wild-type. The importance of a positive charge on the side-chain at position 135 for the interaction of the PSBD with E3 and E1 was apparent, although lysine was found to be an imperfect substitute for arginine. The results offer further evidence of entropy-enthalpy compensation ('thermodynamic homeostasis') - a feature of systems involving a multiplicity of weak interactions. PMID:14622277

Jung, Hyo-Il; Cooper, Alan; Perham, Richard N

2003-11-01

341

Bacillus stearothermophilus qcr operon encoding rieske FeS protein, cytochrome b6, and a novel-type cytochrome c1 of quinol-cytochrome c reductase.  

Science.gov (United States)

The gcr of Bacillus stearothermophilus K1041 encoding three subunits of the quinol-cytochrome c oxidoreductase (cytochrome reductase, b6c1 complex) was cloned and sequenced. The gene (qcrA) for a Rieske FeS protein of 19,144 Da with 169 amino acid residues, and the gene (qcrC) for cytochrome c1 of 27,342 Da with 250 amino acid residues were found at adjacent upstream and downstream sides of the previously reported qcrB (petB) for cytochrome b6 of subunit 25,425 Da with 224 residues (Sone, N., Sawa, G., Sone, T., and Noguchi, S. (1995) J. Biol. Chem. 270, 10612-10617). The three structural genes for thermophilic Bacillus cytochrome reductase form a transcriptional unit. In the deduced amino acid sequence for the FeS protein, the domain including four cysteines and two histidines binding the 2Fe-2S cluster was conserved. Its N-terminal part more closely resembled the cyanobacteria-plastid type than the proteobacteria-mitochondria type when their sequences were compared. The amino acid sequence of cytochrome c1 was not similar to either type; the thermophilic Bacillus cytochrome c1 is composed of an N-terminal part corresponding to subunit IV with three membrane-spanning segments, and a C-terminal part of cytochrome c reminiscent of cytochrome c-551 of thermophilic Bacillus. The subunit IV in the enzyme of cyanobacteria and plastids is the counterpart of C-terminal part of cytochrome b of proteobacteria and mitochondria. These characteristics indicate that Bacillus cytochrome b6c1 complex is unique. PMID:8647852

Sone, N; Tsuchiya, N; Inoue, M; Noguchi, S

1996-05-24

342

Antifungal activity of rhizospheric bacteria.  

Science.gov (United States)

Fluorescent Pseudomonad spp. were isolated from the rhizosphere of potato plants (Algeria) by serial dilutions of rhizosphere soils on Kings B medium and were tested for their antifungal activity. The antifungal activity of the Pseudomonas isolated from Potatoes rhizosphere was tested against Pythium ultimum, Rhizoctonia solani and Fusarium oxysporum in dual culture with bacteria on PDA. The Petri dish was divided into tow, on one the bacteria was spread and on the opposite side fungal plugs were inoculated and incubated for one week. Fourteen bacteria were isolated; only one isolate inhibited the growth of Pythium ultimum, Rhizoctonia solani, Fusarium solani; Fusarium oxysporum f.sp. albedinis and Fusarium oxysporum f. sp. Lycopersici with inhibition zones of 39.9, 33.7, 30.8, 19.9 and 22.5 mm respectively. PMID:21534477

Mezaache, S; Guechi, A; Zerroug, M M; Strange, R N; Nicklin, J

2010-01-01

343

A modeling study by response surface methodology and artificial neural network on culture parameters optimization for thermostable lipase production from a newly isolated thermophilic Geobacillus sp. strain ARM  

Directory of Open Access Journals (Sweden)

Full Text Available Abstract Background Thermostable bacterial lipases occupy a place of prominence among biocatalysts owing to their novel, multifold applications and resistance to high temperature and other operational conditions. The capability of lipases to catalyze a variety of novel reactions in both aqueous and nonaqueous media presents a fascinating field for research, creating interest to isolate novel lipase producers and optimize lipase production. The most important stages in a biological process are modeling and optimization to improve a system and increase the efficiency of the process without increasing the cost. Results Different production media were tested for lipase production by a newly isolated thermophilic Geobacillus sp. strain ARM (DSM 21496 = NCIMB 41583. The maximum production was obtained in the presence of peptone and yeast extract as organic nitrogen sources, olive oil as carbon source and lipase production inducer, sodium and calcium as metal ions, and gum arabic as emulsifier and lipase production inducer. The best models for optimization of culture parameters were achieved by multilayer full feedforward incremental back propagation network and modified response surface model using backward elimination, where the optimum condition was: growth temperature (52.3°C, medium volume (50 ml, inoculum size (1%, agitation rate (static condition, incubation period (24 h and initial pH (5.8. The experimental lipase activity was 0.47 Uml-1 at optimum condition (4.7-fold increase, which compared well to the maximum predicted values by ANN (0.47 Uml-1 and RSM (0.476 Uml-1, whereas R2 and AAD were determined as 0.989 and 0.059% for ANN, and 0.95 and 0.078% for RSM respectively. Conclusion Lipase production is the result of a synergistic combination of effective parameters interactions. These parameters are in equilibrium and the change of one parameter can be compensated by changes of other parameters to give the same results. Though both RSM and ANN models provided good quality predictions in this study, yet the ANN showed a clear superiority over RSM for both data fitting and estimation capabilities. On the other hand, ANN has the disadvantage of requiring large amounts of training data in comparison with RSM. This problem was solved by using statistical experimental design, to reduce the number of experiments.

Basri Mahiran

2008-12-01

344

Are extreme halophiles actually 'bacteria'  

Science.gov (United States)

Comparative cataloging of the 16S rRNA of Halobacterium halobium indicates that the organism did not arise, as a halophilic adaptation, from some typical bacterium. Rather, H. halobium is a member of the Archaebacteria, an ancient group of organisms that are no more related to typical bacteria than they are to eucaryotes.

Magrum, L. J.; Luehrsen, K. R.; Woese, C. R.

1978-01-01

345

Fuzzy species among recombinogenic bacteria  

Directory of Open Access Journals (Sweden)

Full Text Available Abstract Background It is a matter of ongoing debate whether a universal species concept is possible for bacteria. Indeed, it is not clear whether closely related isolates of bacteria typically form discrete genotypic clusters that can be assigned as species. The most challenging test of whether species can be clearly delineated is provided by analysis of large populations of closely-related, highly recombinogenic, bacteria that colonise the same body site. We have used concatenated sequences of seven house-keeping loci from 770 strains of 11 named Neisseria species, and phylogenetic trees, to investigate whether genotypic clusters can be resolved among these recombinogenic bacteria and, if so, the extent to which they correspond to named species. Results Alleles at individual loci were widely distributed among the named species but this distorting effect of recombination was largely buffered by using concatenated sequences, which resolved clusters corresponding to the three species most numerous in the sample, N. meningitidis, N. lactamica and N. gonorrhoeae. A few isolates arose from the branch that separated N. meningitidis from N. lactamica leading us to describe these species as 'fuzzy'. Conclusion A multilocus approach using large samples of closely related isolates delineates species even in the highly recombinogenic human Neisseria where individual loci are inadequate for the task. This approach should be applied by taxonomists to large samples of other groups of closely-related bacteria, and especially to those where species delineation has historically been difficult, to determine whether genotypic clusters can be delineated, and to guide the definition of species.

Fraser Christophe

2005-03-01

346

Bacteria, Yeast and Chemicals on Human Skin  

Medline Plus

Full Text Available ... the lower right-hand corner of the player. Bacteria, Yeast and Chemicals on Human Skin HealthDay April ... the distribution and quantity of metabolites, peptides, lipids, bacteria, yeast, proteins, chemicals and more. As expected, many ...

347

New Antibiotic May Combat Resistant Bacteria  

Science.gov (United States)

... please enable JavaScript. New Antibiotic May Combat Resistant Bacteria Teixobactin shows promise in early experiments, researchers say (* ... that could prove valuable in fighting disease-causing bacteria that no longer respond to older, more frequently ...

348

Oligotrophic bacteria isolated from clinical materials.  

OpenAIRE

Oligotrophic bacteria (oligotrophs) are microorganisms that grow in extremely nutritionally deficient conditions in which the concentrations of organic substances are low. Many oligotrophic bacteria were isolated from clinical materials including urine, sputum, swabbings of the throat, vaginal discharges, and others. Seventy-seven strains of oligotrophic bacteria from 871 samples of clinical material were isolated. A relatively higher frequency of isolation of oligotrophic bacteria was shown ...

Tada, Y.; Ihmori, M.; Yamaguchi, J.

1995-01-01

349

Re-engineering bacteria for ethanol production  

Energy Technology Data Exchange (ETDEWEB)

The invention provides recombinant bacteria, which comprise a full complement of heterologous ethanol production genes. Expression of the full complement of heterologous ethanol production genes causes the recombinant bacteria to produce ethanol as the primary fermentation product when grown in mineral salts medium, without the addition of complex nutrients. Methods for producing the recombinant bacteria and methods for producing ethanol using the recombinant bacteria are also disclosed.

Yomano, Lorraine P; York, Sean W; Zhou, Shengde; Shanmugam, Keelnatham; Ingram, Lonnie O

2014-05-06

350

Urine Isn't Free of Bacteria  

Science.gov (United States)

... please enable JavaScript. Urine Isn't Free of Bacteria New study links bacteria found in urine in bladder to urinary incontinence (* ... News) -- Though it's commonly believed that urine is bacteria-free, normal urine is not sterile, a new ...

351

Laser-Based Identification of Pathogenic Bacteria  

Science.gov (United States)

Bacteria are ubiquitous in our world. From our homes, to our work environment, to our own bodies, bacteria are the omnipresent although often unobserved companions to human life. Physicists are typically untroubled professionally by the presence of these bacteria, as their study usually falls safely outside the realm of our typical domain. In the…

Rehse, Steven J.

2009-01-01

352

Effect of Nitric Oxide on Anammox Bacteria?  

OpenAIRE

The effects of nitrogen oxides on anammox bacteria are not well known. Therefore, anammox bacteria were exposed to 3,500 ppm nitric oxide (NO) in the gas phase. The anammox bacteria were not inhibited by the high NO concentration but rather used it to oxidize additional ammonium to dinitrogen gas under conditions relevant to wastewater treatment.

Kartal, Boran; Tan, Nico C. G.; Biezen, Erwin; Kampschreur, Marlies J.; Van Loosdrecht, Mark C.M.; Jetten, Mike S. M.

2010-01-01

353

Effect of Nitric Oxide on Anammox Bacteria?  

Science.gov (United States)

The effects of nitrogen oxides on anammox bacteria are not well known. Therefore, anammox bacteria were exposed to 3,500 ppm nitric oxide (NO) in the gas phase. The anammox bacteria were not inhibited by the high NO concentration but rather used it to oxidize additional ammonium to dinitrogen gas under conditions relevant to wastewater treatment. PMID:20675452

Kartal, Boran; Tan, Nico C. G.; Van de Biezen, Erwin; Kampschreur, Marlies J.; Van Loosdrecht, Mark C. M.; Jetten, Mike S. M.

2010-01-01

354

Pericarditis caused by anaerobic bacteria.  

Science.gov (United States)

This review describes the microbiology, diagnosis and management of pericarditis due to anaerobic bacteria. The predominant anaerobes isolated from patients with pericarditis are Gram-negative bacilli (mostly Bacteroides fragilis group) as well as Peptostreptococcus, Clostridium, Fusobacterium, Bifidobacterium and Actinomyces spp. Anaerobic bacteria can be recovered from pericarditis resulting from the following mechanisms: (i) spread from a contiguous site of infection, either de novo or following surgery or trauma (pleuropulmonary, oesophageal fistula or perforation, and odontogenic); (ii) spread from a site of infection within the heart, most commonly from endocarditis; (iii) haematogenous infection; and (iv) direct inoculation resulting from a penetrating injury or cardiothoracic surgery. Anaerobic Gram-negative bacilli have increased their resistance to penicillins and other antimicrobial agents in the last two decades. Identification of pathogens and determination of their antimicrobial susceptibility and beta-lactamase production are essential for adequate selection of antibiotic therapy effective against these organisms. PMID:18789852

Brook, Itzhak

2009-04-01

355

Synergetic effect in bacteria radiobiology  

International Nuclear Information System (INIS)

Synergetic effect in bacteria radiobiology is considered on the example of combined thermoradiation and magneto-radiation effect. When considering leading mechanisms of synergetic effects the main role is played by the violation of DNA repair processes. The formation of complex non-repair genome damages proceeds under conditions of inhibition of fermentative complexes providing stability of genetic cell information. In the case of combined radiation effect and other bactericide factors additional damages of membranes and energy supply systems of cells are very important in the formation of the final radiobiologic effect. An important role in the synergetic intensification of bacteria death is played by violations in the balance of DNA and protein synthesis reducing the effectiveness of processes of cell restoration

356

Dissipative Shocks behind Bacteria Gliding  

CERN Document Server

Gliding is a means of locomotion on rigid substrates utilized by a number of bacteria includingmyxobacteria and cyanobacteria. One of the hypotheses advanced to explain this motility mechanism hinges on the role played by the slime filaments continuously extruded from gliding bacteria. This paper solves in full a non-linear mechanical theory that treats as dissipative shocks both the point where the extruded slime filament comes in contact with the substrate, called the filament's foot, and the pore on the bacterium outer surface from where the filament is ejected. We prove that kinematic compatibility for shock propagation requires that the bacterium uniform gliding velocity (relative to the substrate) and the slime ejecting velocity (relative to the bacterium) must be equal, a coincidence that seems to have already been observed.

Virga, Epifanio G

2014-01-01

357

F-LE Bacteria Populations  

Science.gov (United States)

This is a task from the Illustrative Mathematics website that is one part of a complete illustration of the standard to which it is aligned. Each task has at least one solution and some commentary that addresses important asects of the task and its potential use. Here are the first few lines of the commentary for this task: A hospital is conducting a study to see how different environmental conditions influence the growth of streptococcus pneumonia, one of the bacteria whi...

358

Lima Bean Bacteria DNA Extraction  

Science.gov (United States)

This laboratory exercise is designed to show learners how DNA can easily be extracted from lima bean bacteria. This experiment requires the use of a centrifuge (not included in cost of materials). Use this experiment to supplement any unit on genetics and to demonstrate how scientists study DNA. Adult supervision is recommended. This resource guide includes tips and suggestions for instructors as well as other DNA extraction experiments and a chart for learners to answer questions.

Lana Hays

2009-01-01

359

Box-shaped halophilic bacteria.  

OpenAIRE

Three morphologically similar strains of halophilic, box-shaped procaryotes have been isolated from brines collected in the Sinai, Baja California (Mexico), and southern California (United States). Although the isolates in their morphology resemble Walsby's square bacteria, which are a dominant morphological type in the Red Sea and Baja California brines, they are probably not identical to them. The cells show the general characteristics of extreme halophiles and archaebacteria. They contain ...

Javor, B.; Requadt, C.; Stoeckenius, W.

1982-01-01

360

Anaerobic bacteria from hypersaline environments  

OpenAIRE

Strictly anaerobic halophiles, namely fermentative, sulfate-reducing, homoacetogenic, phototrophic, and methanogenic bacteria are involved in the oxidation of organic carbon in hypersaline environments. To date, six anaerobic fermentative genera, containing nine species, have been described. Two of them are homoacetogens. Six species belong to the family Haloanaerobiaceae, as indicated by their unique 16S rRNA oligonucleotide sequences. Desulfohalobium retbaense and Desulfovibrio halophilus r...

Ollivier, B.; Caumette, P.; Garcia, J. L.; Mah, R. A.

1994-01-01

361

Folate Production by Probiotic Bacteria  

OpenAIRE

Probiotic bacteria, mostly belonging to the genera Lactobacillus and Bifidobacterium, confer a number of health benefits to the host, including vitamin production. With the aim to produce folate-enriched fermented products and/or develop probiotic supplements that accomplish folate biosynthesis in vivo within the colon, bifidobacteria and lactobacilli have been extensively studied for their capability to produce this vitamin. On the basis of physiological studies and genome analysis, wild-typ...

Stefano Raimondi; Alberto Amaretti; Maddalena Rossi

2011-01-01

362

Antibiotic resistance in probiotic bacteria  

OpenAIRE

Probiotics are live microorganisms which when administered in adequate amounts confer a health benefit on the host. The main probiotic bacteria are strains belonging to the genera Lactobacillus and Bifidobacterium, although other representatives, such as Bacillus or Escherichia coli strains, have also been used. Lactobacillus and Bifidobacterium are two common inhabitants of the human intestinal microbiota. Also, some species are used in food fermentation processes as starters, or as adjunct ...

AbelardoMargolles

2013-01-01

363

Bacteria Allocation Using Monte Carlo  

Science.gov (United States)

This applet, created by David Hill and Lila Roberts, uses the Monte Carlo technique to simulate a count of bacteria that are present as a result of a certain sampling process. This simulation could be modified to perform other experiments. This experiment is geared towards high school calculus students or probability courses for mathematics majors in college. Students must possess a basic understanding of probability concepts before performing this experiment. Overall, it is a nice activity for a mathematics classroom.

Hill, David R.

364

Extremophilic Bacteria and Microbial Diversity  

Science.gov (United States)

This online enhancement chapter of Raven and Johnson's Biology, a textbook for undergraduate majors, examines the many prokaryotic organisms that inhabit "extreme environments"–habitats in which some chemical or physical variable(s) differ significantly from that found in habitats that support plant and animal life. Topics include using new molecular techniques to discover more about bacteria; life at high temperatures, low temperatures, extreme pH levels and in a brine; and extremophiles in the evolution of life.

Madigan, Michael T.

365

Chemical signature of magnetotactic bacteria.  

Science.gov (United States)

There are longstanding and ongoing controversies about the abiotic or biological origin of nanocrystals of magnetite. On Earth, magnetotactic bacteria perform biomineralization of intracellular magnetite nanoparticles under a controlled pathway. These bacteria are ubiquitous in modern natural environments. However, their identification in ancient geological material remains challenging. Together with physical and mineralogical properties, the chemical composition of magnetite was proposed as a promising tracer for bacterial magnetofossil identification, but this had never been explored quantitatively and systematically for many trace elements. Here, we determine the incorporation of 34 trace elements in magnetite in both cases of abiotic aqueous precipitation and of production by the magnetotactic bacterium Magnetospirillum magneticum strain AMB-1. We show that, in biomagnetite, most elements are at least 100 times less concentrated than in abiotic magnetite and we provide a quantitative pattern of this depletion. Furthermore, we propose a previously unidentified method based on strontium and calcium incorporation to identify magnetite produced by magnetotactic bacteria in the geological record. PMID:25624469

Amor, Matthieu; Busigny, Vincent; Durand-Dubief, Mickaël; Tharaud, Mickaël; Ona-Nguema, Georges; Gélabert, Alexandre; Alphandéry, Edouard; Menguy, Nicolas; Benedetti, Marc F; Chebbi, Imène; Guyot, François

2015-02-10

366

Potential role of bacteria packaging by protozoa in the persistence and transmission of pathogenic bacteria  

OpenAIRE

Many pathogenic bacteria live in close association with protozoa. These unicellular eukaryotic microorganisms are ubiquitous in various environments. A number of protozoa such as amoebae and ciliates ingest pathogenic bacteria, package them usually in membrane structures, and then release them into the environment. Packaged bacteria are more resistant to various stresses and are more apt to survive than free bacteria. New evidence indicates that protozoa and not bacteria control the packaging...

SteveJCharette

2014-01-01

367

Arsenic-tolerant, arsenite-oxidising bacterial strains in the contaminated soils of West Bengal, India.  

Science.gov (United States)

As biological agents represent an affordable alternative to costly metal decontamination technologies, we isolated arsenic (As) oxidising bacteria from the As-contaminated soils of West Bengal, India. These strains were closely related to various species of Bacillus and Geobacillus based on their 16S rRNA gene sequences. They were found to be hyper-resistant to both As(V) (167-400 mM) and As(III) (16-47 mM). Elevated rates of As(III) oxidation (278-1250 ?M h(-1)) and arsenite oxidase activity (2.1-12.5 nM min(-1) mg(-1) protein) were observed in these isolates. Screening identified four strains as superior As-oxidisers. Among them, AMO-10 completely (100%) oxidised 30 mM of As(III) within 24 h. The presence of the aoxB gene was confirmed in the screened isolates. Phylogenetic tree construction based on the aoxB sequence revealed that two strains, AGO-S5 and AGH-02, clustered with Achromobacter and Variovorax, whereas the other two (AMO-10 and ADP-25) remained unclustered. The increased rate of As(III) oxidation by these native strains might be exploited for the remediation of As in contaminated environments. Notably, this study presents the first correlation regarding the presence of the aoxB gene and As(III) oxidation ability in Geobacillus stearothermophilus. PMID:23876545

Majumder, Aparajita; Bhattacharyya, K; Bhattacharyya, S; Kole, S C

2013-10-01

368

Sterilization of single-use helical stone baskets: an experimental study  

Directory of Open Access Journals (Sweden)

Full Text Available Objectives: To experimentally evaluate the efficacy of a standard sterilization protocol employed during reuse of disposable helical stone baskets. Methods: Study performed on 20 helical stone baskets: 10 were used in the initial validation process, contaminated with Escherichia coli ATCC 25922 and imprinted on Müeller-Hinton media; 10 catheters were contaminated with Geobacillus stearothermophilus ATCC 7953, processed, inoculated in TSB and incubated in a water bath at a temperature of 55ºC. Bacterial growth was evaluated after 1, 3, 5 and 7 days. After sterilization, stone baskets were also opened and closed 40 times to check for functional problems. All plastic and basket parts were carefully checked for damages. Results: After the 72-hour incubation period, there was growth of E. coli ATCC 25922 in 100% of imprints. After the sterilization process and up to 7 days incubation period on a blood agar plate, there was no growth of G. stearothermophilus ATCC 7953 or any other bacteria. There were no functional problems or damage to baskets after the sterilization process. Conclusion: The ethylene oxide system is efficacious and safe for sterilization of disposable helical stone baskets. However, further clinical studies are required and should provide more safety information.

Cely Barreto da Silva

2011-03-01

369

Bacteria and vampirism in cinema.  

Science.gov (United States)

A vampire is a non-dead and non-alive chimerical creature, which, according to various folklores and popular superstitions, feeds on blood of the living to draw vital force. Vampires do not reproduce by copulation, but by bite. Vampirism is thus similar to a contagious disease contracted by intravascular inoculation with a suspected microbial origin. In several vampire films, two real bacteria were staged, better integrated than others in popular imagination: Yersinia pestis and Treponema pallidum. Bacillus vampiris was created for science-fiction. These films are attempts to better define humans through one of their greatest fears: infectious disease. PMID:23916557

Castel, O; Bourry, A; Thévenot, S; Burucoa, C

2013-09-01

370

The Cyclic Antibacterial Peptide Enterocin AS-48: Isolation, Mode of Action, and Possible Food Applications  

Directory of Open Access Journals (Sweden)

Full Text Available Enterocin AS-48 is a circular bacteriocin produced by Enterococcus. It contains a 70 amino acid-residue chain circularized by a head-to-tail peptide bond. The conformation of enterocin AS-48 is arranged into five alpha-helices with a compact globular structure. Enterocin AS-48 has a wide inhibitory spectrum on Gram-positive bacteria. Sensitivity of Gram-negative bacteria increases in combination with outer-membrane permeabilizing treatments. Eukaryotic cells are bacteriocin-resistant. This cationic peptide inserts into bacterial membranes and causes membrane permeabilization, leading ultimately to cell death. Microarray analysis revealed sets of up-regulated and down-regulated genes in Bacillus cereus cells treated with sublethal bacteriocin concentration. Enterocin AS-48 can be purified in two steps or prepared as lyophilized powder from cultures in whey-based substrates. The potential applications of enterocin AS-48 as a food biopreservative have been corroborated against foodborne pathogens and/or toxigenic bacteria (Listeria monocytogenes, Bacillus cereus, Staphylococcus aureus, Escherichia coli, Salmonella enterica and spoilage bacteria (Alicyclobacillus acidoterrestris, Bacillus spp., Paenibacillus spp., Geobacillus stearothermophilus, Brochothrix thermosphacta, Staphylococcus carnosus, Lactobacillus sakei and other spoilage lactic acid bacteria. The efficacy of enterocin AS-48 in food systems increases greatly in combination with chemical preservatives, essential oils, phenolic compounds, and physico-chemical treatments such as sublethal heat, high-intensity pulsed-electric fields or high hydrostatic pressure.

María José Grande Burgos

2014-12-01

371

DMTB: the magnetotactic bacteria database  

Science.gov (United States)

Magnetotactic bacteria (MTB) are of interest in biogeomagnetism, rock magnetism, microbiology, biomineralization, and advanced magnetic materials because of their ability to synthesize highly ordered intracellular nano-sized magnetic minerals, magnetite or greigite. Great strides for MTB studies have been made in the past few decades. More than 600 articles concerning MTB have been published. These rapidly growing data are stimulating cross disciplinary studies in such field as biogeomagnetism. We have compiled the first online database for MTB, i.e., Database of Magnestotactic Bacteria (DMTB, http://database.biomnsl.com). It contains useful information of 16S rRNA gene sequences, oligonucleotides, and magnetic properties of MTB, and corresponding ecological metadata of sampling sites. The 16S rRNA gene sequences are collected from the GenBank database, while all other data are collected from the scientific literature. Rock magnetic properties for both uncultivated and cultivated MTB species are also included. In the DMTB database, data are accessible through four main interfaces: Site Sort, Phylo Sort, Oligonucleotides, and Magnetic Properties. References in each entry serve as links to specific pages within public databases. The online comprehensive DMTB will provide a very useful data resource for researchers from various disciplines, e.g., microbiology, rock magnetism and paleomagnetism, biogeomagnetism, magnetic material sciences and others.

Pan, Y.; Lin, W.

2012-12-01

372

DNA fingerprinting of oral bacteria.  

Science.gov (United States)

This elective study was conducted at the Dental School, University of Wales College of Medicine and at the University of Wales College of Cardiff School of Pure and Applied Biology. The student's interest in oral microbiology and desire to contribute to the work being performed in the field of oral microbiology, led him to concentrate his study on developing a DNA fingerprinting method to evaluate the putative new species of the genus Capnocytophaga. The genus Capnocytophaga, which contains Gram-negative, capnophilic fusiform-shaped bacteria, has been implicated in juvenile periodontitis and prepubertal gingivitis. However, the genus is also part of the normal oral flora. The student believed that there was an implication of the existence of both pathogenic and non-pathogenic strains of Capnocytophaga and developed a method of DNA fingerprinting to distinguish Capnocytophaga strains from clusters identified by Khwaja et al. The student felt that the study allowed insight into the tremendous potential of molecular techniques for furthering the understanding of dental disease and confirmed his ambition to pursue a career in academic oral microbiology. This area of study allows new associations to be made between specific bacteria and diseases, aiding the possibility of rapid and early diagnosis. PMID:1739503

Lancashire, P

1992-01-25

373

Endophytic bacteria in Coffea arabica L.  

Science.gov (United States)

Eighty-seven culturable endophytic bacterial isolates in 19 genera were obtained from coffee plants collected in Colombia (n = 67), Hawaii (n = 17), and Mexico (n = 3). Both Gram positive and Gram negative bacteria were isolated, with a greater percentage (68%) being Gram negative. Tissues yielding bacterial endophytes included adult plant leaves, various parts of the berry (e.g., crown, pulp, peduncle and seed), and leaves, stems, and roots of seedlings. Some of the bacteria also occurred as epiphytes. The highest number of bacteria among the berry tissues sampled was isolated from the seed, and includes Bacillus , Burkholderia , Clavibacter , Curtobacterium , Escherichia , Micrococcus , Pantoea , Pseudomonas , Serratia , and Stenotrophomonas . This is the first survey of the endophytic bacteria diversity in various coffee tissues, and the first study reporting endophytic bacteria in coffee seeds. The possible role for these bacteria in the biology of the coffee plant remains unknown. PMID:16187260

Vega, Fernando E; Pava-Ripoll, Monica; Posada, Francisco; Buyer, Jeffrey S

2005-01-01

374

Distribution of thermophilic aerobic sporeforming bacteria in food ingredients.  

Science.gov (United States)

Samples of sugar, starch, spices, and miscellaneous products were tested for thermophilic sporeformers of Bacillus to determine the dominant species present. Surface colonies selected at random were identified. Six species of Bacillus were isolated: B. stearothermophilus, B. coagulans, B. licheniformis, B. subtilis, B. circulans, and B. pumilus. Samples of starch and pepper were tested for thermophilic sporeformers of Bacillus to determine the distribution of rough and smooth variants. Colonies were classified as rough or smooth variants by colonial characteristics. The distribution of variant forms in these two products was significantly different. Starch samples showed predominantly rough variants; pepper samples showed predominantly smooth variants. PMID:4959078

Richmond, B; Fields, M L

1966-07-01

375

Molecular Communication Between Two Populations of Bacteria  

OpenAIRE

Molecular communication is an expanding body of research. Recent advances in biology have encouraged using genetically engineered bacteria as the main component in the molecular communication. This has stimulated a new line of research that attempts to study molecular communication among bacteria from an information-theoretic point of view. Due to high randomness in the individual behavior of the bacterium, reliable communication between two bacteria is almost impossible. Th...

Einolghozati, Arash; Sardari, Mohsen; Fekr, Faramarz

2012-01-01

376

Bioremoval of rare earth elements by bacteria  

International Nuclear Information System (INIS)

Forty nine bacterial isolates (17 gram positive bacteria and 32 gram negative bacteria) from soil and water were screened for resistance to rare earth elements, namely, Lanthanum, Praseodymium, Samarium, Gadolinium and Dysprosium. Neodymium was found to be the most tolerant metal. Maximum sensitivity among the isolates was observed for lanthanum and samarium. Praseodymium was used to test the removal capabilities of the bacteria. Gram-positive bacteria exhibited higher capacity for accumulating Pr. The highest removal capacity of 125 ig/ml Pr was observed for strain WB01 in 17 days. (author)

377

Coryneform bacteria associated with canine otitis externa  

DEFF Research Database (Denmark)

This study aims to investigate the occurrence of coryneform bacteria in canine otitis externa. A combined case series and case-control study was carried out to improve the current knowledge on frequency and clinical significance of coryneform bacteria in samples from canine otitis externa. A total of 16 cases of otitis externa with involvement of coryneform bacteria were recorded at two referral veterinary hospitals in Denmark and the US, respectively. Coryneform bacteria were identified by partial 16S rRNA gene sequencing. Corynebacterium auriscanis was the most common coryneform species (10 cases). Small colony variants of this species were also observed. Other coryneform isolates were identified as Corynebacterium amycolatum (3 cases), Corynebacterium freneyi (2 cases) and an Arcanobacterium-like species (1 case). The coryneform bacteria were in all cases isolated together with other bacteria, mainly Staphylococcus pseudintermedius alone (n=5) or in combination with Malassezia pachydermatis (n=5). Some coryneform isolates displayed resistance to fusidic acid or enrofloxacin, two antimicrobial agents commonly used for the treatment of otitis externa in dogs. The frequency of isolation of coryneform bacteria was 16% among 55 cases of canine otitis externa examined at the Danish hospital during 2007. In contrast, detectable levels of coryneform bacteria were not demonstrated in samples from the acustic meatus of 35 dogs with apparently healthy ears, attending the hospital during the same year. On basis of the current knowledge, these coryneform bacteria should be regarded as potential secondary pathogens able to proliferate in the environment of an inflamed ear canal.

Aalbæk, Bent; Bemis, David A.

2010-01-01

378

A thermostable transketolase evolved for aliphatic aldehyde acceptors.  

Science.gov (United States)

Directed evolution of the thermostable transketolase from Geobacillus stearothermophilus based on a pH-based colorimetric screening of smart libraries yielded several mutants with up to 16-fold higher activity for aliphatic aldehydes and high enantioselectivity (>95% ee) in the asymmetric carboligation step. PMID:25415647

Yi, Dong; Saravanan, Thangavelu; Devamani, Titu; Charmantray, Franck; Hecquet, Laurence; Fessner, Wolf-Dieter

2015-01-11

379

Crystallization and preliminary X-ray diffraction studies of two thermostable ?-galactosidases from glycoside hydrolase family 36  

OpenAIRE

The ?-galactosidases AgaA, AgaB and AgaA A355E mutant from Geobacillus stearothermophilus have been overexpressed in Escherichia coli. Crystals of AgaB and AgaA A355E have been obtained by the vapour-diffusion method and synchrotron data have been collected to 2.0 and 2.8?Å resolution, respectively.

Foucault, M.; Watzlawick, H.; Mattes, R.; Haser, R.; Gouet, P.

2006-01-01

380

Cell Size Regulation in Bacteria  

Science.gov (United States)

Various bacteria such as the canonical gram negative Escherichia coli or the well-studied gram positive Bacillus subtilis divide symmetrically after they approximately double their volume. Their size at division is not constant, but is typically distributed over a narrow range. Here, we propose an analytically tractable model for cell size control, and calculate the cell size and interdivision time distributions, as well as the correlations between these variables. We suggest ways of extracting the model parameters from experimental data, and show that existing data for E. coli supports partial size control, and a particular explanation: a cell attempts to add a constant volume from the time of initiation of DNA replication to the next initiation event. This hypothesis accounts for the experimentally observed correlations between mother and daughter cells as well as the exponential dependence of size on growth rate.

Amir, Ariel

2014-05-01

381

MICROBIOLOGY: How Bacteria Change Gear  

Science.gov (United States)

Access to the article is free, however registration and sign-in are required. Many species of bacteria form biofilms, slimy carpets a fraction of a millimeter thick that appear on rocks, leaves, pipes, teeth--pretty much any place that has a supply of nutrients and water. Cells must first attach to a surface, which in many species requires swimming propelled by rotating helical flagella (1). Two things typically happen next. Cells stop expressing genes that encode components of the flagellum, and they secrete a sticky matrix of polysaccharides that holds them together on the surface (2). Once at a surface, swimming may be a hindrance rather than a help, and an inverse relationship between swimming and attachment has been seen in many diverse species (3). Bacterial motility is arrested when a protein that acts as a clutch disables rotation of the flagellar motor.

Richard M. Berry (University of Oxford; Department of Physics, Clarendon Lab)

2008-06-20

382

Mitochondria: A target for bacteria.  

Science.gov (United States)

Eukaryotic cells developed strategies to detect and eradicate infections. The innate immune system, which is the first line of defence against invading pathogens, relies on the recognition of molecular patterns conserved among pathogens. Pathogen associated molecular pattern binding to pattern recognition receptor triggers the activation of several signalling pathways leading to the establishment of a pro-inflammatory state required to control the infection. In addition, pathogens evolved to subvert those responses (with passive and active strategies) allowing their entry and persistence in the host cells and tissues. Indeed, several bacteria actively manipulate immune system or interfere with the cell fate for their own benefit. One can imagine that bacterial effectors can potentially manipulate every single organelle in the cell. However, the multiple functions fulfilled by mitochondria especially their involvement in the regulation of innate immune response, make mitochondria a target of choice for bacterial pathogens as they are not only a key component of the central metabolism through ATP production and synthesis of various biomolecules but they also take part to cell signalling through ROS production and control of calcium homeostasis as well as the control of cell survival/programmed cell death. Furthermore, considering that mitochondria derived from an ancestral bacterial endosymbiosis, it is not surprising that a special connection does exist between this organelle and bacteria. In this review, we will discuss different mitochondrial functions that are affected during bacterial infection as well as different strategies developed by bacterial pathogens to subvert functions related to calcium homeostasis, maintenance of redox status and mitochondrial morphology. PMID:25707982

Lobet, Elodie; Letesson, Jean-Jacques; Arnould, Thierry

2015-04-01

383

Resuscitation effects of catalase on airborne bacteria.  

OpenAIRE

Catalase incorporation into enumeration media caused a significant increase (greater than 63%) in the colony-forming abilities of airborne bacteria. Incubation for 30 to 60 min of airborne bacteria in collection fluid containing catalase caused a greater than 95% increase in colony-forming ability. However, catalase did not have any effects on enumeration at high relative humidities (80 to 90%).

Marthi, B.; Shaffer, B. T.; Lighthart, B.; Ganio, L.

1991-01-01

384

Filamentous bacteria existence in aerobic granular reactors.  

Science.gov (United States)

Filamentous bacteria are associated to biomass settling problems in wastewater treatment plants. In systems based on aerobic granular biomass they have been proposed to contribute to the initial biomass aggregation process. However, their development on mature aerobic granular systems has not been sufficiently studied. In the present research work, filamentous bacteria were studied for the first time after long-term operation (up to 300 days) of aerobic granular systems. Chloroflexi and Sphaerotilus natans have been observed in a reactor fed with synthetic wastewater. These filamentous bacteria could only come from the inoculated sludge. Thiothrix and Chloroflexi bacteria were observed in aerobic granular biomass treating wastewater from a fish canning industry. Meganema perideroedes was detected in a reactor treating wastewater from a plant processing marine products. As a conclusion, the source of filamentous bacteria in these mature aerobic granular systems fed with industrial effluents was the incoming wastewater. PMID:25533039

Figueroa, M; Val Del Río, A; Campos, J L; Méndez, R; Mosquera-Corral, A

2015-05-01

385

Structural Features of Manganese Precipitating Bacteria  

Science.gov (United States)

Studies of biological communities of the past (and their associated activities) are usually dependent upon preservation of fossil material. With bacteria this rarely occurs because of the absence of sufficient fossilizable cellular material. However, some bacteria deposit metabolic products that can, conditions allowing, be preserved indefinitely. In particular, manganese and iron depositing bacteria have the capacity to form preservable microfossils. In order to better understand these microfossils of the past, we have examined present day morphologies of manganese oxidizing bacteria. These bacteria are highly pleomorphic, depending on the growth medium, the age of the culture, and the extent of manganese oxidation. Transmission electron microscopy indicates that manganese may be deposited either intra-or extra-cellularly. The prognosis of the use of morphological information for the interpretation of ancient and modern manganese deposits is discussed.

Nealson, Kenneth H.; Tebo, Bradley

1980-06-01

386

HYDROCARBON-DEGRADING BACTERIA AND SURFACTANT ACTIVITY  

Energy Technology Data Exchange (ETDEWEB)

Fate of benzene ethylbenzene toluene xylenes (BTEX) compounds through biodegradation was investigated using two different bacteria, Ralstonia picketti (BP-20) and Alcaligenes piechaudii (CZOR L-1B). These bacteria were isolated from extremely polluted petroleum hydrocarbon contaminated soils. PCR and Fatty Acid Methyl Ester (FAME) were used to identify the isolates. Biodegradation was measured using each organism individually and in combination. Both bacteria were shown to degrade each of the BTEX compounds. Alcaligenes piechaudii biodegraded BTEXs more efficiently while mixed with BP-20 and individually. Biosurfactant production was observed by culture techniques. In addition 3-hydroxy fatty acids, important in biosurfactant production, was observed by FAME analysis. In the all experiments toluene and m+p- xylenes were better growth substrates for both bacteria than the other BTEX compounds. In addition, the test results indicate that the bacteria could contribute to bioremediation of aromatic hydrocarbons (BTEX) pollution increase biodegradation through the action by biosurfactants.

Brigmon, R; Topher Berry, T; Grazyna A. Plaza, G; jacek Wypych, j

2006-08-15

387

Chemotactic selection of pollutant degrading soil bacteria  

Energy Technology Data Exchange (ETDEWEB)

A method is described for identifying soil microbial strains which may be bacterial degraders of pollutants. This method includes: Placing a concentration of a pollutant in a substantially closed container; placing the container in a sample of soil for a period of time ranging from one minute to several hours; retrieving the container and collecting its contents; microscopically determining the identity of the bacteria present. Different concentrations of the pollutant can be used to determine which bacteria respond to each concentration. The method can be used for characterizing a polluted site or for looking for naturally occurring biological degraders of the pollutant. Then bacteria identified as degraders of the pollutant and as chemotactically attracted to the pollutant are used to innoculate contaminated soil. To enhance the effect of the bacteria on the pollutant, nutrients are cyclicly provided to the bacteria then withheld to alternately build up the size of the bacterial colony or community and then allow it to degrade the pollutant.

Hazen, T.C.

1991-03-04

388

Oxidized magnetosomes in magnetotactic bacteria  

Energy Technology Data Exchange (ETDEWEB)

Single domain magnetite particles formed in chain assemblies by magnetotactic bacteria (MTB) are taken as proxy in inferring environmental and Earth's magnetism. The reliable use of magnetosomes in MTB, or their fossil remains (magnetofossils), requires that they are unaffected by oxidation. Here we present experimental data from saturation isothermal remanent magnetization (SIRM) and ferromagnetic resonance spectroscopy (FMR) between room temperature and 10 K, which were applied to detect oxidation in intact MTB. The distinction of non-oxidized from oxidized MTB-assemblies is based mainly on two different characteristic physical properties: (i) the intrinsic Verwey transition in pure magnetite, and (ii) blocking of spins of nano-sized products formed during oxidation at the surface or the interior of the magnetosomes. Suppression of the Verwey transition due to oxidation prevents the shift of the anisotropy axes, which in turn conserves the anisotropic properties at room temperature down to low temperature. The presented methodology assures a distinction between non- and oxidized magnetite assemblies, with pronounced certainty, unlike standard dc methods.

Gehring, Andreas U., E-mail: agehring@erdw.ethz.ch [Institute of Geophysics, ETH Zurich, 8092 Zurich (Switzerland); Charilaou, Michalis, E-mail: michalis.charilaou@erdw.ethz.ch [Institute of Geophysics, ETH Zurich, 8092 Zurich (Switzerland); Garcia-Rubio, Ines, E-mail: garciarubio@phys.chem.ethz.ch [Laboratory of Physical Chemistry, ETH Zurich, 8093 Zurich (Switzerland)

2012-04-15

389

Antibiotic resistance in probiotic bacteria  

Directory of Open Access Journals (Sweden)

Full Text Available Probiotics are live microorganisms which when administered in adequate amounts confer a health benefit on the host. The main probiotic bacteria are strains belonging to the genera Lactobacillus and Bifidobacterium, although other representatives, such as Bacillus or Escherichia coli strains, have also been used. Lactobacillus and Bifidobacterium are two common inhabitants of the human intestinal microbiota. Also, some species are used in food fermentation processes as starters, or as adjunct cultures in the food industry. With some exceptions, antibiotic resistance in these beneficial microbes does not constitute a safety concern in itself, when mutations or intrinsic resistance mechanisms are responsible for the resistance phenotype. In fact, some probiotic strains with intrinsic antibiotic resistance could be useful for restoring the gut microbiota after antibiotic treatment. However, specific antibiotic resistance determinants carried on mobile genetic elements, such as tetracycline resistance genes, are often detected in the typical probiotic genera, and constitute a reservoir of resistance for potential food or gut pathogens, thus representing a serious safety issue.

AbelardoMargolles

2013-07-01

390

Antibiotic resistance in probiotic bacteria.  

Science.gov (United States)

Probiotics are live microorganisms which when administered in adequate amounts confer a health benefit on the host. The main probiotic bacteria are strains belonging to the genera Lactobacillus and Bifidobacterium, although other representatives, such as Bacillus or Escherichia coli strains, have also been used. Lactobacillus and Bifidobacterium are two common inhabitants of the human intestinal microbiota. Also, some species are used in food fermentation processes as starters, or as adjunct cultures in the food industry. With some exceptions, antibiotic resistance in these beneficial microbes does not constitute a safety concern in itself, when mutations or intrinsic resistance mechanisms are responsible for the resistance phenotype. In fact, some probiotic strains with intrinsic antibiotic resistance could be useful for restoring the gut microbiota after antibiotic treatment. However, specific antibiotic resistance determinants carried on mobile genetic elements, such as tetracycline resistance genes, are often detected in the typical probiotic genera, and constitute a reservoir of resistance for potential food or gut pathogens, thus representing a serious safety issue. PMID:23882264

Gueimonde, Miguel; Sánchez, Borja; G de Los Reyes-Gavilán, Clara; Margolles, Abelardo

2013-01-01

391

Tape Cassette Bacteria Detection System  

Science.gov (United States)

The design, fabrication, and testing of an automatic bacteria detection system with a zero-g capability and based on the filter-capsule approach is described. This system is intended for monitoring the sterility of regenerated water in a spacecraft. The principle of detection is based on measuring the increase in chemiluminescence produced by the action of bacterial porphyrins (i.e., catalase, cytochromes, etc.) on a luminol-hydrogen peroxide mixture. Since viable as well as nonviable organisms initiate this luminescence, viable organisms are detected by comparing the signal of an incubated water sample with an unincubated control. Higher signals for the former indicate the presence of viable organisms. System features include disposable sealed sterile capsules, each containing a filter membrane, for processing discrete water samples and a tape transport for moving these capsules through a processing sequence which involves sample concentration, nutrient addition, incubation, a 4 Molar Urea wash and reaction with luminol-hydrogen peroxide in front of a photomultiplier tube. Liquids are introduced by means of a syringe needle which pierces a rubber septum contained in the wall of the capsule. Detection thresholds obtained with this unit towards E. coli and S. marcescens assuming a 400 ml water sample are indicated.

1973-01-01

392

Membrane damage of bacteria by silanols treatment  

Scientific Electronic Library Online (English)

Full Text Available SciELO Chile | Language: English Abstract in english Antimicrobial action of silanols, a new class of antimicrobials, was investigated by transmission electron microscopy and fluorescent dye studies. Gram-negative bacteria, Escherichia coli and Pseudomonas aeruginosa and Gram-positive bacteria, Staphylococcus aureus and Enterococcus faecalis were trea [...] ted by silanols at concentration of less than 0.2 wt% for one hour. Membrane damage of the bacteria by the silanol treatment was clearly observed by transmission electron microscopy. Separation of the cytoplasmic membrane from the outer membrane for E. coli and disorganized cytoplasmic membrane of the Gram-positive bacteria were observed when compared to the control. Fluorescent dyes, green-fluorescent nucleic acid stain (Syto 9) and the red-fluorescent nucleic acid stain (Propidium iodide), were used to monitor membrane damage of the bacteria by Confocal microscopy and Spectrophotometer. A reduction of the green fluorescent emission was detected for silanol treated bacteria indicating membrane damage of the bacteria and supporting the hypothesis that their viability loss may be due to their membrane damage analogus to alcohols

Yun-mi, Kim; Samuel, Farrah; Ronald H, Baney.

2007-04-15

393

Bacteria classification using Cyranose 320 electronic nose  

Directory of Open Access Journals (Sweden)

Full Text Available Abstract Background An electronic nose (e-nose, the Cyrano Sciences' Cyranose 320, comprising an array of thirty-two polymer carbon black composite sensors has been used to identify six species of bacteria responsible for eye infections when present at a range of concentrations in saline solutions. Readings were taken from the headspace of the samples by manually introducing the portable e-nose system into a sterile glass containing a fixed volume of bacteria in suspension. Gathered data were a very complex mixture of different chemical compounds. Method Linear Principal Component Analysis (PCA method was able to classify four classes of bacteria out of six classes though in reality other two classes were not better evident from PCA analysis and we got 74% classification accuracy from PCA. An innovative data clustering approach was investigated for these bacteria data by combining the 3-dimensional scatter plot, Fuzzy C Means (FCM and Self Organizing Map (SOM network. Using these three data clustering algorithms simultaneously better 'classification' of six eye bacteria classes were represented. Then three supervised classifiers, namely Multi Layer Perceptron (MLP, Probabilistic Neural network (PNN and Radial basis function network (RBF, were used to classify the six bacteria classes. Results A [6 × 1] SOM network gave 96% accuracy for bacteria classification which was best accuracy. A comparative evaluation of the classifiers was conducted for this application. The best results suggest that we are able to predict six classes of bacteria with up to 98% accuracy with the application of the RBF network. Conclusion This type of bacteria data analysis and feature extraction is very difficult. But we can conclude that this combined use of three nonlinear methods can solve the feature extraction problem with very complex data and enhance the performance of Cyranose 320.

Gardner Julian W

2002-10-01

394

The Microworld of Marine-Bacteria  

DEFF Research Database (Denmark)

Microsensor studies show that the marine environment in the size scale of bacteria is physically and chemically very different from the macroenvironment. The microbial world of the sediment-water interface is thus dominated by water viscosity and steep diffusion gradients. Because of the diverse metabolism types, bacteria in the mostly anoxic sea floor play an important role in the major element cycles of the ocean. The communities of giant, filamentous sulfur bacteria that live in the deep-sea hydrothermal vents or along the Pacific coast of South America are presented here as examples.

JØRGENSEN, BB

1995-01-01

395

Ecology of mycophagous collimonas bacteria in soil  

OpenAIRE

Bacteria belonging to the genus Collimonas consist of soil bacteria that can grow at expense of living fungal hyphae i.e. they are mycophagous. This PhD studies deals with the ecology of mycophagous bacteria in soil using collimonads as model organisms. Collimonads were found to be widely distributed in different types of soils albeit at low densities. Highest numbers were present in fungal-rich grassland soils and lowest numbers in fungal-poor arable soils. Yet, no significant positive c...

Ho?ppener-ogawa, Sachie

2008-01-01

396

Characterization of an S-layer glycoprotein produced in the course of S-layer variation of Bacillus stearothermophilus ATCC 12980 and sequencing and cloning of the sbsD gene encoding the protein moiety.  

Science.gov (United States)

The cell surface of Bacillus stearothermophilus ATCC 12980 is completely covered by an oblique lattice which consists of the S-layer protein SbsC. On SDS-polyacrylamide gels, the mature S-layer protein migrates as a single band with an apparent molecular mass of 122 kDa. During cultivation of B. stearothermophilus ATCC 12980 at 67 degrees C instead of 55 degrees C, a variant developed that had a secondary cell wall polymer identical to that of the wild-type strain, but it carried an S-layer glycoprotein that could be separated on SDS-polyacrylamide gels into four bands with apparent molecular masses of 92, 118, 150 and 175 kDa. After deglycosylation, only a single protein band with a molecular mass of 92 kDa remained. The complete nucleotide sequence encoding the protein moiety of this S-layer glycoprotein, termed SbsD, was established by PCR and inverse PCR. The sbsD gene of 2,709 bp is predicted to encode a protein of 96.2 kDa with a 30-amino-acid signal peptide. Within the 807 bp encoding the signal peptide and the N-terminal sequence (amino acids 31-269), different nucleotides for sbsD and sbsC were observed in 46 positions, but 70% of these mutations were silent, thus leading to a level of identity of 95% for the N-terminal parts. The level of identity of the remaining parts of SbsD and SbsC was below 10%, indicating that the lysine-, tyrosine- and arginine-rich N-terminal region in combination with a distinct type of secondary cell wall polymer remained conserved upon S-layer variation. The sbsD sequence encoding the mature S-layer protein cloned into the pET28a vector led to stable expression in Escherichia coli HMS174(DE3). This is the first example demonstrating that S-layer variation leads to the synthesis of an S-layer glycoprotein. PMID:11797047

Egelseer, E M; Danhorn, T; Pleschberger, M; Hotzy, C; Sleytr, U B; Sára, M

2001-12-01

397

Magnetotactic Bacteria from Extreme Environments  

Directory of Open Access Journals (Sweden)

Full Text Available Magnetotactic bacteria (MTB represent a diverse collection of motile prokaryotes that biomineralize intracellular, membrane-bounded, tens-of-nanometer-sized crystals of a magnetic mineral called magnetosomes. Magnetosome minerals consist of either magnetite (Fe3O4 or greigite (Fe3S4 and cause cells to align along the Earth’s geomagnetic field lines as they swim, a trait called magnetotaxis. MTB are known to mainly inhabit the oxic–anoxic interface (OAI in water columns or sediments of aquatic habitats and it is currently thought that magnetosomes function as a means of making chemotaxis more efficient in locating and maintaining an optimal position for growth and survival at the OAI. Known cultured and uncultured MTB are phylogenetically associated with the Alpha-, Gamma- and Deltaproteobacteria classes of the phylum Proteobacteria, the Nitrospirae phylum and the candidate division OP3, part of the Planctomycetes-Verrucomicrobia-Chlamydiae (PVC bacterial superphylum. MTB are generally thought to be ubiquitous in aquatic environments as they are cosmopolitan in distribution and have been found in every continent although for years MTB were thought to be restricted to habitats with pH values near neutral and at ambient temperature. Recently, however, moderate thermophilic and alkaliphilic MTB have been described including: an uncultured, moderately thermophilic magnetotactic bacterium present in hot springs in northern Nevada with a probable upper growth limit of about 63 °C; and several strains of obligately alkaliphilic MTB isolated in pure culture from different aquatic habitats in California, including the hypersaline, extremely alkaline Mono Lake, with an optimal growth pH of >9.0.

Christopher T. Lefèvre

2013-03-01

398

Folate Production by Probiotic Bacteria  

Directory of Open Access Journals (Sweden)

Full Text Available Probiotic bacteria, mostly belonging to the genera Lactobacillus and Bifidobacterium, confer a number of health benefits to the host, including vitamin production. With the aim to produce folate-enriched fermented products and/or develop probiotic supplements that accomplish folate biosynthesis in vivo within the colon, bifidobacteria and lactobacilli have been extensively studied for their capability to produce this vitamin. On the basis of physiological studies and genome analysis, wild-type lactobacilli cannot synthesize folate, generally require it for growth, and provide a negative contribution to folate levels in fermented dairy products. Lactobacillus plantarum constitutes an exception among lactobacilli, since it is capable of folate production in presence of para-aminobenzoic acid (pABA and deserves to be used in animal trials to validate its ability to produce the vitamin in vivo. On the other hand, several folate-producing strains have been selected within the genus Bifidobacterium, with a great variability in the extent of vitamin released in the medium. Most of them belong to the species B. adolescentis and B. pseudocatenulatum, but few folate producing strains are found in the other species as well. Rats fed a probiotic formulation of folate-producing bifidobacteria exhibited increased plasma folate level, confirming that the vitamin is produced in vivo and absorbed. In a human trial, the same supplement raised folate concentration in feces. The use of folate-producing probiotic strains can be regarded as a new perspective in the specific use of probiotics. They could more efficiently confer protection against inflammation and cancer, both exerting the beneficial effects of probiotics and preventing the folate deficiency that is associated with premalignant changes in the colonic epithelia.

Stefano Raimondi

2011-01-01

399

Folate production by probiotic bacteria.  

Science.gov (United States)

Probiotic bacteria, mostly belonging to the genera Lactobacillus and Bifidobacterium, confer a number of health benefits to the host, including vitamin production. With the aim to produce folate-enriched fermented products and/or develop probiotic supplements that accomplish folate biosynthesis in vivo within the colon, bifidobacteria and lactobacilli have been extensively studied for their capability to produce this vitamin. On the basis of physiological studies and genome analysis, wild-type lactobacilli cannot synthesize folate, generally require it for growth, and provide a negative contribution to folate levels in fermented dairy products. Lactobacillus plantarum constitutes an exception among lactobacilli, since it is capable of folate production in presence of para-aminobenzoic acid (pABA) and deserves to be used in animal trials to validate its ability to produce the vitamin in vivo. On the other hand, several folate-producing strains have been selected within the genus Bifidobacterium, with a great variability in the extent of vitamin released in the medium. Most of them belong to the species B. adolescentis and B. pseudocatenulatum, but few folate producing strains are found in the other species as well. Rats fed a probiotic formulation of folate-producing bifidobacteria exhibited increased plasma folate level, confirming that the vitamin is produced in vivo and absorbed. In a human trial, the same supplement raised folate concentration in feces. The use of folate-producing probiotic strains can be regarded as a new perspective in the specific use of probiotics. They could more efficiently confer protection against inflammation and cancer, both exerting the beneficial effects of probiotics and preventing the folate deficiency that is associated with premalignant changes in the colonic epithelia. PMID:22254078

Rossi, Maddalena; Amaretti, Alberto; Raimondi, Stefano

2011-01-01

400

Bacteria, Yeast and Chemicals on Human Skin  

Medline Plus

Full Text Available ... the player. Bacteria, Yeast and Chemicals on Human Skin HealthDay April 1, 2015 Related MedlinePlus Pages Cosmetics Skin Conditions Transcript How does your daily routine affect ...

401

Mixed Messages: How Bacteria Resolve Conflicting Signals  

OpenAIRE

An elegant new study by Bollenbach and Kishony (2011) in this issue of Molecular Cell shows how bacteria resolve the apparent conflicts created when they face two signals with opposite effects on gene expression.

Young, Jonathan W.; Elowitz, Michael B.

2011-01-01

402

Bacteria, Yeast and Chemicals on Human Skin  

Medline Plus

Full Text Available ... Bacteria, Yeast and Chemicals on Human Skin HealthDay April 1, 2015 Related MedlinePlus Pages Cosmetics Skin Conditions ... Institutes of Health Page last updated on 4 April 2015

403

Role of bacteria in oral carcinogenesis  

Science.gov (United States)

Oral cancer appears to be increasing in incidence, and mortality has hardly improved over the past 25 years. Better understanding of the etiopathogenesis should lead to more accurate and earlier diagnosis and more effective treatments with fewer adverse effects. Despite increasing interest in the possible relationships between bacteria and the different stages of cancer development, the association of bacteria with cancer of the oral cavity has yet to be adequately examined. Different bacteria have been proposed to induce carcinogenesis, either through induction of chronic inflammation or by interference, either directly or indirectly, with eukaryotic cell cycle and signaling pathways or by metabolism of potentially carcinogenic substances like acetaldehyde, causing mutagenesis. This review presents the possible carcinogenesis pathway involved in bacterial carcinogenesis, commonly implicated bacteria in oral carcinogenesis and their role in cancer therapeutics as well.

Khajuria, Nidhi; Metgud, Rashmi

2015-01-01

404

Bacteria, Yeast and Chemicals on Human Skin  

Science.gov (United States)

... samples from about 400 different sites on their skin using cotton and foam swabs. The results were turned into topographical models that showed the distribution and quantity of metabolites, peptides, lipids, bacteria, yeast, proteins, chemicals and more. As expected, ...

405

Comparative genomics of the lactic acid bacteria  

Energy Technology Data Exchange (ETDEWEB)

Lactic acid-producing bacteria are associated with various plant and animal niches and play a key role in the production of fermented foods and beverages. We report nine genome sequences representing the phylogenetic and functional diversity of these bacteria. The small genomes of lactic acid bacteria encode a broad repertoire of transporters for efficient carbon and nitrogen acquisition from the nutritionally rich environments they inhabit and reflect a limited range of biosynthetic capabilities that indicate both prototrophic and auxotrophic strains. Phylogenetic analyses, comparison of gene content across the group, and reconstruction of ancestral gene sets indicate a combination of extensive gene loss and key gene acquisitions via horizontal gene transfer during the coevolution of lactic acid bacteria with their habitats.

Makarova, K.; Slesarev, A.; Wolf, Y.; Sorokin, A.; Mirkin, B.; Koonin, E.; Pavlov, A.; Pavlova, N.; Karamychev, V.; Polouchine, N.; Shakhova, V.; Grigoriev, I.; Lou, Y.; Rokhsar, D.; Lucas, S.; Huang, K.; Goodstein, D. M.; Hawkins, T.; Plengvidhya, V.; Welker, D.; Hughes, J.; Goh, Y.; Benson, A.; Baldwin, K.; Lee, J. -H.; Diaz-Muniz, I.; Dosti, B.; Smeianov, V; Wechter, W.; Barabote, R.; Lorca, G.; Altermann, E.; Barrangou, R.; Ganesan, B.; Xie, Y.; Rawsthorne, H.; Tamir, D.; Parker, C.; Breidt, F.; Broadbent, J.; Hutkins, R.; O' Sullivan, D.; Steele, J.; Unlu, G.; Saier, M.; Klaenhammer, T.; Richardson, P.; Kozyavkin, S.; Weimer, B.; Mills, D.

2006-06-01

406

Diversity of Rumen Bacteria in Canadian Cervids  

OpenAIRE

Interest in the bacteria responsible for the breakdown of lignocellulosic feedstuffs within the rumen has increased due to their potential utility in industrial applications. To date, most studies have focused on bacteria from domesticated ruminants. We have expanded the knowledge of the microbial ecology of ruminants by examining the bacterial populations found in the rumen of non-domesticated ruminants found in Canada. Next-generation sequencing of 16S rDNA was employed to characterize the ...

Gruninger, Robert J.; Sensen, Christoph W.; Mcallister, Timothy A.; Forster, Robert J.

2014-01-01

407

Molecular genetic studies on obligate anaerobic bacteria  

International Nuclear Information System (INIS)

Molecular genetic studies on obligate anaerobic bacteria have lagged behind similar studies in aerobes. However, the current interest in biotechnology, the involvement of anaerobes in disease and the emergence of antibioticresistant strains have focused attention on the genetics of anaerobes. This article reviews molecular genetic studies in Bacteroides spp., Clostridium spp. and methanogens. Certain genetic systems in some anaerobes differ from those in aerobes and illustrate the genetic diversity among bacteria

408

Characterization of (per)chlorate-reducing bacteria  

OpenAIRE

Some bacteria can use (per)chlorateas terminal electron acceptor for growth. These bacteria convert perchlorate via chlorate and chlorite into chloride and molecular oxygen. Oxygen formation in microbial respiration is unique. In this study two chlorate-reducing strains belonging to the species Pseudomonas chloritidismutans and a (per)chlorate-reducing strain Dechloromonas hortensis were isolated. The characterization of the chlorate-reducing strain AW-1, which was isolated from a bioreactor ...

Wolterink, A. F. W. M.

2004-01-01

409

Biotechnology Curriculum Freshman Exploratory: Growing Bacteria  

Science.gov (United States)

Bacteria are everywhere in the environment. To prove this in this activity, students will take samples of different surfaces around the classroom, and nearby places, as well as their own fingers. To detect bacteria, students will need to provide food for them to grow on. Students will be using the nutrient agar plates that have already been prepared. This lesson plan document may be downloaded in Microsoft Word file format.

Kurtz, Mary Jane

410

Investigating the Uses of Backyard Bacteria  

Science.gov (United States)

The purpose of this lab is to recognize that the answers to some of society's industrial challenges may lie right in our own backyards. Learners discover how to select protein-digesting bacteria from various soil samples. After isolating the colonies, learners are then encouraged to investigate ways to test the effectiveness of their specimens in breaking down protein stains on clothing. This activity demonstrates how bacteria with specific enzymatic capabilities can be isolated with a simple microbiology technique. Adult supervision recommended.

Elisa Brako

2009-01-01

411

Bacteria classification using Cyranose 320 electronic nose  

OpenAIRE

Abstract Background An electronic nose (e-nose), the Cyrano Sciences' Cyranose 320, comprising an array of thirty-two polymer carbon black composite sensors has been used to identify six species of bacteria responsible for eye infections when present at a range of concentrations in saline solutions. Readings were taken from the headspace of the samples by manually introducing the portable e-nose system into a sterile glass containing a fixed volume of bacteria in suspension. Gathered data wer...

Gardner Julian W; Hines Evor L; Dutta Ritaban; Boilot Pascal

2002-01-01

412

Characterization of rat cecum cellulolytic bacteria.  

OpenAIRE

Cellulose-degrading bacteria previously isolated from the ceca of rats have been characterized and identified. The most commonly isolated type was rods identified as Bacteroides succinogenes. These bacteria fermented only cellulose (e.g., pebble-milled Whatman no. 1 filter paper), cellobiose, and in 43 of 47 strains, glucose, with succinic and acetic acids as the major products. The only organic growth factors found to be required by selected strains were p-aminobenzoic acid, cyanocobalamine,...

Montgomery, L.; Macy, J. M.

1982-01-01

413

Molecular probe technology detects bacteria without culture  

Directory of Open Access Journals (Sweden)

Full Text Available Abstract Background Our ultimate goal is to detect the entire human microbiome, in health and in disease, in a single reaction tube, and employing only commercially available reagents. To that end, we adapted molecular inversion probes to detect bacteria using solely a massively multiplex molecular technology. This molecular probe technology does not require growth of the bacteria in culture. Rather, the molecular probe technology requires only a sequence of forty sequential bases unique to the genome of the bacterium of interest. In this communication, we report the first results of employing our molecular probes to detect bacteria in clinical samples. Results While the assay on Affymetrix GenFlex Tag16K arrays allows the multiplexing of the detection of the bacteria in each clinical sample, one Affymetrix GenFlex Tag16K array must be used for each clinical sample. To multiplex the clinical samples, we introduce a second, independent assay for the molecular probes employing Sequencing by Oligonucleotide Ligation and Detection. By adding one unique oligonucleotide barcode for each clinical sample, we combine the samples after processing, but before sequencing, and sequence them together. Conclusions Overall, we have employed 192 molecular probes representing 40 bacteria to detect the bacteria in twenty-one vaginal swabs as assessed by the Affymetrix GenFlex Tag16K assay and fourteen of those by the Sequencing by Oligonucleotide Ligation and Detection assay. The correlations among the assays were excellent.

Hyman Richard W

2012-03-01

414

Chemically enhanced sunlight for killing bacteria  

International Nuclear Information System (INIS)

Solar ultraviolet (UV) photocatalyzed oxidation of chemicals with titanium dioxide (TiO2) has received considerable attention. Much less recognized, however, is the ability of the same system to destroy bacteria. This study examined this phenomenon and the conditions that affect it. Bacteria in aqueous solution were given solar exposure with titanium dioxide and their survival with time was determined. Lamps with a predominantly solar ultraviolet spectrum were also used in the experiments. Without exposure to UV light, TiO2 had no deleterious effect on the bacteria. However, several common bacteria on solar exposure in the presence of TiO2 were killed in just a few minutes, whereas without TiO2 it took over an hour to destroy them. A concentration of 0.01% TiO2 was most effective in killing bacteria and 10-fold concentrations lower or higher were successively less effective. Inorganic and organic compounds in solution, even in small amounts, interfered with the efficiency of killing. Alkaline solution also reduced the bactericidal activity. Circulation and agitation provided by stirring to keep the TiO2 particles suspended reduced the time necessary to kill the bacteria. Time-intensity curves for killing bacteria were the same general shape with or without TiO2, indicating that TiO2 served merely as a catalyst to increase the rate of the reaction but that the mechanism of action waaction but that the mechanism of action was not changed. The shape of the curves show that the organisms are sensitized with a minimum intensity of radiation and that an increase doesn't greatly increase the rate of kill. Below this critical intensity, however, the time required for killing markedly increases as the intensity is decreased

415

Platelets and Infections – Complex Interactions with Bacteria  

Science.gov (United States)

Platelets can be considered sentinels of vascular system due to their high number in the circulation and to the range of functional immunoreceptors they express. Platelets express a wide range of potential bacterial receptors, including complement receptors, Fc?RII, Toll-like receptors but also integrins conventionally described in the hemostatic response, such as GPIIb–IIIa or GPIb. Bacteria bind these receptors either directly, or indirectly via fibrinogen, fibronectin, the first complement C1q, the von Willebrand Factor, etc. The fate of platelet-bound bacteria is questioned. Several studies reported the ability of activated platelets to internalize bacteria such as Staphylococcus aureus or Porphyromonas gingivalis, though there is no clue on what happens thereafter. Are they sheltered from the immune system in the cytoplasm of platelets or are they lysed? Indeed, while the presence of phagolysosome has not been demonstrated in platelets, they contain antimicrobial peptides that were shown to be efficient on S. aureus. Besides, the fact that bacteria can bind to platelets via receptors involved in hemostasis suggests that they may induce aggregation; this has indeed been described for Streptococcus sanguinis, S. epidermidis, or C. pneumoniae. On the other hand, platelets are able to display an inflammatory response to an infectious triggering. We, and others, have shown that platelet release soluble immunomodulatory factors upon stimulation by bacterial components. Moreover, interactions between bacteria and platelets are not limited to only these two partners. Indeed, platelets are also essential for the formation of neutrophil extracellular traps by neutrophils, resulting in bacterial clearance by trapping bacteria and concentrating antibacterial factors but in enhancing thrombosis. In conclusion, the platelet–bacteria interplay is a complex game; its fine analysis is complicated by the fact that the inflammatory component adds to the aggregation response.

Hamzeh-Cognasse, Hind; Damien, Pauline; Chabert, Adrien; Pozzetto, Bruno; Cognasse, Fabrice; Garraud, Olivier

2015-01-01

416

Nutritional Interdependence Among Rumen Bacteria During Cellulose Digestion In Vitro  

OpenAIRE

A study has been made of the promoting effect of starch on cellulose digestion by mixed rumen bacteria in a cellulose-urea medium. Starch supplementation of the medium promoted the growth of bacteria that required neither amino acids (AA) nor branched-chain fatty acids (BrFA). The growth of these bacteria was followed by the growth of AA-dependent bacteria, AA- or BrFA-dependent bacteria, BrFA-producing bacteria, and finally, BrFA-dependent cellulolytic bacteria. Population changes of these b...

Miura, Hideki; Horiguchi, Masaaki; Ogimoto, Keiji; Matsumoto, Tatsuro

1983-01-01

417

Bacterias, fuente de energía para el futuro / Bacteria, source of energy for the future  

Scientific Electronic Library Online (English)

Full Text Available En el presente trabajo expone una familia de bacterias denominadas Geobacter que tienen la capacidad de producir energía eléctrica como fuente renovable en una celda de combustible microbiana. Estas bacterias pueden oxidar totalmente compuestos orgánicos empleando diferentes elementos o sustancias c [...] omo aceptores de electrones. El trabajo aborda características principales de la bacteria, como los mecanismos utilizados para aprovechar la electricidad que genera y una aproximación sobre el sistema requerido para convertirla en una fuente de energía renovable competitiva. Los resultados muestran un análisis comparativo de fuentes de energía convencionales y no convencionales con respecto a la familia de bacterias Geobacter. Abstract in english This paper presents a family of bacteria called Geobacter that have the ability to produce power as a renewable source in a microbial fuel cell. These bacteria can completely oxidize organic compounds using different elements or substances as electron acceptors. The paper addresses key features of t [...] he bacteria, the mechanisms used to harness the electricity generated and an approximation of the system required to become a competitive source of renewable energy. The results show a comparative analysis of sources of conventional and unconventional energy with respect to the Geobacter family of bacteria.

Alba Ayde, Romero Mejía; Jorge Adrian, Vásquez; Armando, Lugo González.

2012-04-01

418

Using Fluorescent Viruses for Detecting Bacteria in Water  

Science.gov (United States)

A method of detecting water-borne pathogenic bacteria is based partly on established molecular-recognition and fluorescent-labeling concepts, according to which bacteria of a species of interest are labeled with fluorescent reporter molecules and the bacteria can then be detected by fluorescence spectroscopy. The novelty of the present method lies in the use of bacteriophages (viruses that infect bacteria) to deliver the fluorescent reporter molecules to the bacteria of the species of interest.

Tabacco, Mary Beth; Qian, Xiaohua; Russo, Jaimie A.

2009-01-01

419

Test-kits for thiosulfate-reducing bacteria  

Energy Technology Data Exchange (ETDEWEB)

API or proprietary test-kits presently used for the detection of bacteria involved in microbial corrosion are designed for specific detection of sulfate-reducing bacteria (SRB). It was recently shown that other sulfidogenic bacteria such as thiosulfate-reducing bacteria (TRB) are also involved in the corrosion of carbon steel. Since these bacteria cannot be detected by SRB test-kits, a new kit was developed for TRB detection, and validated in field trials.

Crolet, J.L. [Elf Aquitaine Production, Pau (France); Magot, M. [Elf Aquitaine Group, Labege (France); Brazy, J.L. [Elf Congo, Pointe Noire (Congo)

1997-08-01

420

Single bacteria identification by Raman spectroscopy.  

Science.gov (United States)

We report on rapid identification of single bacteria using a low-cost, compact, Raman spectroscope. We demonstrate that a 60-s procedure is sufficient to acquire a comprehensive Raman spectrum in the range of 600 to 3300 cm?¹. This time includes localization of small bacteria aggregates, alignment on a single individual, and spontaneous Raman scattering signal collection. Fast localization of small bacteria aggregates, typically composed of less than a dozen individuals, is achieved by lensfree imaging over a large field of view of 24 mm². The lensfree image also allows precise alignment of a single bacteria with the probing beam without the need for a standard microscope. Raman scattered light from a 34-mW continuous laser at 532 nm was fed to a customized spectrometer (prototype Tornado Spectral Systems). Owing to the high light throughput of this spectrometer, integration times as low as 10 s were found acceptable. We have recorded a total of 1200 spectra over seven bacterial species. Using this database and an optimized preprocessing, classification rates of ~90% were obtained. The speed and sensitivity of our Raman spectrometer pave the way for high-throughput and nondestructive real-time bacteria identification assays. This compact and low-cost technology can benefit biomedical, clinical diagnostic, and environmental applications. PMID:25028774

Strola, Samy Andrea; Baritaux, Jean-Charles; Schultz, Emmanuelle; Simon, Anne Catherine; Allier, Cédric; Espagnon, Isabelle; Jary, Dorothée; Dinten, Jean-Marc

2014-01-01

421

Bacteria dispersal by hitchhiking on zooplankton  

DEFF Research Database (Denmark)

Microorganisms and zooplankton are both important components of aquatic food webs. Although both inhabit the same environment, they are often regarded as separate functional units that are indirectly connected through nutrient cycling and trophic cascade. However, research on pathogenic and nonpathogenic bacteria has shown that direct association with zooplankton has significant influences on the bacteria's physiology and ecology. We used stratified migration columns to study vertical dispersal of hitchhiking bacteria through migrating zooplankton across a density gradient that was otherwise impenetrable for bacteria in both upward and downward directions (conveyor-belt hypothesis). The strength of our experiments is to permit quantitative estimation of transport and release of associated bacteria: vertical migration of Daphnia magna yielded an average dispersal rate of 1.3 x 10(5) x cells x Daphnia(-1) x migration cycle(-1) for the lake bacterium Brevundimonas sp. Bidirectional vertical dispersal by migrating D. magna was also shown for two other bacterial species, albeit at lower rates. The prediction that diurnally migrating zooplankton acquire different attached bacterial communities from hypolimnion and epilimnion between day and night was subsequently confirmed in our field study. In mesotrophic Lake Nehmitz, D. hyalina showed pronounced diel vertical migration along with significant diurnal changes in attached bacterial community composition. These results confirm that hitchhiking on migrating animals can be an important mechanism for rapidly relocating microorganisms, including pathogens, allowing them to access otherwise inaccessible resources.

Grossart, Hans-Peter; Dziallas, Claudia

2010-01-01

422

Bacteria and plutonium in marine environments  

International Nuclear Information System (INIS)

Microbes are important in geochemical cycling of many elements. Recent reports emphasize biogenous particulates and bacterial exometabolites as controlling oceanic distribution of plutonium. Bacteria perform oxidation/reduction reactions on metals such as mercury, nickel, lead, copper, and cadmium. Redox transformations or uptake of Pu by marine bacteria may well proceed by similar mechanisms. Profiles of water samples and sediment cores were obtained along the continental shelf off Nova Scotia and in the Gulf of St. Lawrence. Profiles of water samples, and sediment cores were obtained. Epifluorescent microscopy was used to view bacteria (from water or sediment) after concentration on membrane filters and staining with acridine orange. Radiochemical analyses measured Pu in sediments and water samples. Studies of 237Pu uptake used a strain of Leucothrix mucor isolated from a macroalga. Enumeration shows bacteria to range 104 to 105 cells/ml in seawater or 107 to 108 cells/gram of sediment. These numbers are related to the levels and distrbution of Pu in the samples. In cultures of L. mucor amended with Pu atom concentrations approximating those present in open ocean environments, bacterial cells concentrated 237Pu slower and to lower levels than did clay minerals, glass beads, or phytoplankton. These data further clarify the role of marine bacteria in Pu biogeochemistryemistry

423

Diversity of endophytic bacteria in Brazilian sugarcane.  

Science.gov (United States)

Endophytic bacteria live inside plant tissues without causing disease. Studies of endophytes in sugarcane have focused on the isolation of diazotrophic bacteria. We examined the diversity of endophytic bacteria in the internal tissues of sugarcane stems and leaves, using molecular and biochemical methods. Potato-agar medium was used to cultivate the endophytes; 32 isolates were selected for analysis. DNA was extracted and the 16S rRNA gene was partially sequenced and used for molecular identification. Gram staining, catalase and oxidase tests, and the API-20E system were used to characterize the isolates. The strains were divided into five groups, based on the 16S rRNA sequences. Group I comprised 14 representatives of the Enterobacteriaceae; group II was composed of Bacilli; group III contained one representative, Curtobacterium sp; group IV contained representatives of the Pseudomonadaceae family, and group V had one isolate with an uncultured bacterium. Four isolates were able to reduce acetylene to ethylene. Most of the bacteria isolated from the sugarcane stem and leaf tissues belonged to Enterobacteriaceae and Pseudomonaceae, respectively, demonstrating niche specificity. Overall, we found the endophytic bacteria in sugarcane to be more diverse than previously reported. PMID:20198580

Magnani, G S; Didonet, C M; Cruz, L M; Picheth, C F; Pedrosa, F O; Souza, E M

2010-01-01

424

Single bacteria identification by Raman spectroscopy  

Science.gov (United States)

We report on rapid identification of single bacteria using a low-cost, compact, Raman spectroscope. We demonstrate that a 60-s procedure is sufficient to acquire a comprehensive Raman spectrum in the range of 600 to 3300. This time includes localization of small bacteria aggregates, alignment on a single individual, and spontaneous Raman scattering signal collection. Fast localization of small bacteria aggregates, typically composed of less than a dozen individuals, is achieved by lensfree imaging over a large field of view of 24. The lensfree image also allows precise alignment of a single bacteria with the probing beam without the need for a standard microscope. Raman scattered light from a 34-mW continuous laser at 532 nm was fed to a customized spectrometer (prototype Tornado Spectral Systems). Owing to the high light throughput of this spectrometer, integration times as low as 10 s were found acceptable. We have recorded a total of 1200 spectra over seven bacterial species. Using this database and an optimized preprocessing, classification rates of ˜90% were obtained. The speed and sensitivity of our Raman spectrometer pave the way for high-throughput and nondestructive real-time bacteria identification assays. This compact and low-cost technology can benefit biomedical, clinical diagnostic, and environmental applications.

Strola, Samy Andrea; Baritaux, Jean-Charles; Schultz, Emmanuelle; Simon, Anne Catherine; Allier, Cédric; Espagnon, Isabelle; Jary, Dorothée; Dinten, Jean-Marc

2014-11-01

425

Molecular analysis of deep subsurface bacteria  

International Nuclear Information System (INIS)

Deep sediments samples from site C10a, in Appleton, and sites, P24, P28, and P29, at the Savannah River Site (SRS), near Aiken, South Carolina were studied to determine their microbial community composition, DNA homology and mol %G+C. Different geological formations with great variability in hydrogeological parameters were found across the depth profile. Phenotypic identification of deep subsurface bacteria underestimated the bacterial diversity at the three SRS sites, since bacteria with the same phenotype have different DNA composition and less than 70% DNA homology. Total DNA hybridization and mol %G+C analysis of deep sediment bacterial isolates suggested that each formation is comprised of different microbial communities. Depositional environment was more important than site and geological formation on the DNA relatedness between deep subsurface bacteria, since more 70% of bacteria with 20% or more of DNA homology came from the same depositional environments. Based on phenotypic and genotypic tests Pseudomonas spp. and Acinetobacter spp.-like bacteria were identified in 85 million years old sediments. This suggests that these microbial communities might have been adapted during a long period of time to the environmental conditions of the deep subsurface

426

Genetics of thermophilic bacteria. Final progress report, May 1, 1984--April 30, 1991  

Energy Technology Data Exchange (ETDEWEB)

Organisms adapted to high temperature have evolved a variety of unique solutions to the biochemical problems imposed by this environment. Adaptation is commonly used to describe the biochemical properties of organisms which have become adapted to their environment (genetic adaptation). It can also mean the direct response-at the cellular level-of an organism to changes in temperature (physiological adaptation). Thermophilic bacilli (strains of Bacillus stearothermophilus) can exhibit a variety of biochemical adaptations in response to changes in temperature. These include changes in the composition and stability of the membrane, metabolic potential, the transport of amino acids, regulatory mechanisms, ribose methylation of tRNA, protein thermostability, and nutritional requirements. The objectives of the research were to develop efficient and reliable genetic systems to analyze and manipulate B. Stearothermophilus, and to use these systems initiate a biochemical, molecular, and genetic investigations of genes that are required for growth at high temperature.

Welker, N.E.

1991-12-31

427

[Role of lactic acid bacteria in the spread of antibiotic resistant bacteria among healthy persons].  

Science.gov (United States)

The wide use of antibiotics in livestock raising has contributed to the selection and accumulation of representatives of commensal microflora, as well as pathogenic bacteria, colonizing livestock and poultry. For this reason the problem of the possible transfer of antibiotic-resistance genes along the chain from bacteria, autochthonous for agricultural animals, to bacteria used for the production of foodstuffs, which are incorporated into normal microflora and may thus participate in the exchange of these genes with bacteria, enteropathogenic for humans, is a highly important task of medical microbiology. The article deals with the review of experimental data, indicative the possibility of the appearance of antibiotic-resistant pathogenic bacteria due to the transfer of antibiotic-resistance genes via alimentary chains. PMID:16758911

Zigangirova, N A; Tokarskaia, E A; Narodnitski?, B S; Gintsburg, A L; Tugel'ian, V A

2006-01-01

428

Antimicrobial activity of lysozyme against bacteria involved in food spoilage and food-borne disease.  

OpenAIRE

Egg white lysozyme was demonstrated to have antibacterial activity against organisms of concern in food safety, including Listeria monocytogenes and certain strains of Clostridium botulinum. We also found that the food spoilage thermophile Clostridium thermosaccharolyticum was highly susceptible to lysozyme and confirmed that the spoilage organisms Bacillus stearothermophilus and Clostridium tyrobutyricum were also extremely sensitive. Several gram-positive and gram-negative pathogens isolate...

Hughey, V. L.; Johnson, E. A.

1987-01-01

429

Bacteria?Triggered Release of Antimicrobial Agents  

DEFF Research Database (Denmark)

Medical devices employed in healthcare practice are often susceptible to microbial contamination. Pathogenic bacteria may attach themselves to device surfaces of catheters or implants by formation of chemically complex biofilms, which may be the direct cause of device failure. Extracellular bacterial lipases are particularly abundant at sites of infection. Herein it is shown how active or proactive compounds attached to polymeric surfaces using lipase?sensitive linkages, such as fatty acid esters or anhydrides, may be released in response to infection. Proof?of?concept of the responsive material is demonstrated by the bacteria?triggered release of antibiotics to control bacterial populations and signaling molecules to modulate quorum sensing. The self?regulating system provides the basis for the development of device?relevant polymeric materials, which only release antibiotics in dependency of the titer of bacteria surrounding the medical device.

Komnatnyy, Vitaly V.; Chiang, Wen?Chi

2014-01-01

430

[Sorption of humic acids by bacteria].  

Science.gov (United States)

Capacity for sorption of humic acid (HA) from water solutions was shown for 38 bacterial strains. Isotherms of HA sorption were determined for the cells of 10 strains. The bonding strength between the cells and HA (k) and the terminal adsorption (Q(max)) determined from the Langmuir equation for gram-positive and gram-negative bacteria were reliably different. Gram-positive bacteria sorbed greater amounts of HA than gram-negative ones (Q(max) = 23 ± 10 and 5.6 ± 1.2 mg/m2, respectively). The bonding strength between HA and the cells was higher in gram-negative bacteria than in gram-positive: k = 9 ± 5 and 3.3 ± 1.1 mL/mg, respectively. PMID:25509407

Tikhonov, V V; Orlov, D S; Lisovitskaia, O V; Zavgorodniaia, Iu A; Byzov, B A; Demin, V V

2013-01-01

431

Bacteria-Triggered Release of Antimicrobial Agents  

DEFF Research Database (Denmark)

Medical devices employed in healthcare practice are often susceptible to microbial contamination. Pathogenic bacteria may attach themselves to device surfaces of catheters or implants by formation of chemically complex biofilms, which may be the direct cause of device failure. Extracellular bacterial lipases are particularly abundant at sites of infection. Herein it is shown how active or proactive compounds attached to polymeric surfaces using lipase?sensitive linkages, such as fatty acid esters or anhydrides, may be released in response to infection. Proof?of?concept of the responsive material is demonstrated by the bacteria?triggered release of antibiotics to control bacterial populations and signaling molecules to modulate quorum sensing. The self?regulating system provides the basis for the development of device?relevant polymeric materials, which only release antibiotics in dependency of the titer of bacteria surrounding the medical device.

Komnatnyy, Vitaly V.; Chiang, Wen-Chi

2014-01-01

432

Chemotaxis When Bacteria Remember: Drift versus Diffusion  

CERN Document Server

Escherichia coli (E. coli) bacteria govern their trajectories by switching between running and tumbling modes as a function of the nutrient concentration they experienced in the past. At short time one observes a drift of the bacterial population, while at long time one observes accumulation in high-nutrient regions. Recent work has pointed to an apparent theoretical contradiction between drift toward favorable regions and accumulation in favorable regions. A number of such earlier studies assume that a bacterium resets its memory at tumbles -- a fact not borne out by experiment -- and make use of approximate coarse-grained descriptions. Here, we revisit the problem of chemotaxis without resorting to any memory resets. We find that when bacteria respond to the environment in a non-adaptive manner, chemotaxis is generally dominated by diffusion, whereas when bacteria respond in an adaptive manner, chemotaxis is dominated by a bias in the motion. In all cases, the apparent contradiction between favorable drift ...

Chatterjee, Sakuntala; Kafri, Yariv

2011-01-01

433

Bacterial biofilms. Bacteria Quorum sensing in biofilms  

Directory of Open Access Journals (Sweden)

Full Text Available Data on biofilms, their structure and properties, peculiarities of formation and interaction between microorganisms in the film are presented. Information on discovery and study of biofilms, importance of biofilms in the medical and clinical microbiology are offered. The data allow to interpret biofilm as a form of existence of human normal microflora. For the exchange of information within the biofilm between the individual cells of the same or different species bacteria use the signal molecules of the Quorum sensing system. Coordination of bacterial cells activity in the biofilms gives them significant advantages: in the biofilms bacteria are protected from the influence of the host protective factors and the antibacterial drugs.

E. S. Vorobey

2012-03-01

434

Scanning electron microscopy of bacteria Tetrasphaera duodecadis.  

Science.gov (United States)

This study reports the characterization of the Tetrasphaera duodecadis bacteria and the techniques used therein. In order to evaluate the morphological characteristics of the T. duodecadis bacteria scanning electron microscope (SEM) was used throughout its different growth stages. These microorganisms were grown in vitamin B12 broths with 1% tryptone, 0.2% yeast extract, and 0.1% glucose. The turbidimetric method was employed for the determination of bacterial concentration and growth curve. The SEM results show small agglomerates of 0.8?±?0.05?µm during the lag phase, and rod-like shapes during the exponential phase with similar shapes in the stationary phase. PMID:25156672

Arroyo, E; Enríquez, L; Sánchez, A; Ovalle, M; Olivas, A

2014-01-01

435

Flavones with antibacterial activity against cariogenic bacteria.  

Science.gov (United States)

Methanolic extracts obtained from 13 plants were studied for their antibacterial activity against cariogenic bacteria. Among them, the extract from Artocarpus heterophyllus showed the most intensive activity. Serial chromatographic purifications offered two active compounds which were identified as 6-(3-methyl-1-butenyl)-5,2',4'-trihydroxy-3-isoprenyl-7-methoxy flavone and 5,7,2',4'-tetrahydroxy-6-isoprenylflavone. Both isolates completely inhibited the growth of primary cariogenic bacteria at 3.13-12.5 micrograms/ml. They also exhibited the growth inhibitory effects on plaque-forming streptococci. These phytochemical isoprenylflavones would be potent compounds for the prevention of dental caries. PMID:8953432

Sato, M; Fujiwara, S; Tsuchiya, H; Fujii, T; Iinuma, M; Tosa, H; Ohkawa, Y

1996-11-01

436

Bacteria Provide Cleanup of Oil Spills, Wastewater  

Science.gov (United States)

Through Small Business Innovation Research (SBIR) contracts with Marshall Space Flight Center, Micro-Bac International Inc., of Round Rock, Texas, developed a phototrophic cell for water purification in space. Inside the cell: millions of photosynthetic bacteria. Micro-Bac proceeded to commercialize the bacterial formulation it developed for the SBIR project. The formulation is now used for the remediation of wastewater systems and waste from livestock farms and food manufacturers. Strains of the SBIR-derived bacteria also feature in microbial solutions that treat environmentally damaging oil spills, such as that resulting from the catastrophic 2010 Deepwater Horizon oil rig explosion in the Gulf of Mexico.

2010-01-01

437

CHARACTERIZATION OF NATURAL MICROCOSMS OF ESTUARINE MAGNETOTACTIC BACTERIA / CARACTERIZACIÓN DE MICROCOSMOS NATURALES DE BACTERIAS MAGNETOTÁCTICAS ESTUARINAS  

Scientific Electronic Library Online (English)

Full Text Available SciELO Colombia | Language: English Abstract in spanish No se ha reportado ningún estudio completo sobre microcosmos naturales de bacterias magnetotácticas (MTB) en estuarios o ambientes tropicales. Además, casi todos los estudios sobre las bacterias magnetotácticas se han desarrollado en aguas dulces alejadas del ecuador. Este trabajo se desarrolla sobr [...] e el ecuador y reporta una caracterización mineralógica y fisicoquímica detallada de dos microcosmos bacterianos estuarinos. Los resultados muestran que la lixiviación de minerales en los sedimentos puede ser un factor importante en la solubilización de elementos requeridos por las bacterias magnetotácticas. Específicamente, que el clinocloro, flogopita, nontronita y haloisita pueden estar entre los minerales más importantes en la lixiviación de hierro a los microcosmos estuarinos. Se concluye que la concentración de nitrato en el agua no debe ser tan baja como se ha reportado para lograr un crecimiento bacteriano óptimo. Las bacterias magnetotácticas no necesitan grandes cantidades de hierro disuelto para su crecimiento ni para la síntesis de magnetosomas. Abstract in english To date, no complete study of magnetotactic bacteria's (MTB) natural microcosms in estuarine or tropical environments has been reported. Besides, almost all the studies around magnetotactic bacteria have been based on fresh waters away from the Equator. In this work, we focused the experimental regi [...] on at the Equator and present a comprehensive mineralogical and physicochemical characterization of two estuarine bacterial microcosms. The results show that mineral lixiviation in the sediments may be an important factor in the solubilization of elements required by magnetotactic bacteria. Specifically, we show that clinochlore, phlogopite, nontronite, and halloysite could be among the main minerals that lixiviate iron to the estuarine microcosms. We conclude that nitrate concentration in the water should not be as low as those that have been reported for other authors to achieve optimal bacteria growth. It is confirmed that magnetotactic bacteria do not need large amounts of dissolved iron to grow or to synthesize magnetosomes.

ALEJANDRO, SALAZAR; ALVARO, MORALES; MARCO, MÁRQUEZ.

2011-08-01

438

The role of bacteria in periodontal diseases*  

OpenAIRE

The dental literature contains ample scientific data supporting the concept that periodontal diseases are infectious diseases. The formation of plaque on and around the teeth represents a massive accumulation of bacteria that are usually present in the oral cavity. This bacterial colonization is relatively independent of food intake, degree of salivation, mastication, or malocclusion.

Lo?e, Harald

1981-01-01

439

DISTRIBUTION OF PLASMIDS IN GROUNDWATER BACTERIA  

Science.gov (United States)

Bacteria isolated from groundwater aquifer core materials of pristine aquifers at Lula and Pickett, Oklahoma, and from a site with a history of aromatic hydrocarbon contamination and natural renovation located at Conroe, Texas, were screened for the presence of plasmid Deoxyribon...

440

ACETOGENIC BACTERIA ASSOCIATED WITH SEAGRASS ROOTS  

Science.gov (United States)

Seagrasses are adapted to being rooted in reduced, anoxic sediments with high rates of sulfate reduction. During the day, an oxygen gradient is generated around the roots, becoming anoxic at night. Thus, obligate anaerobic bacteria in the rhizosphere have to tolerate elevated oxy...