WorldWideScience
 
 
1

Transformation of chenodeoxycholic acid by thermophilic Geobacillus stearothermophilus.  

Science.gov (United States)

We performed a series of experiments with Geobacillus stearothermophilus, a thermophile isolated from oil-contaminated soil in the Kuwaiti desert. The organism has a good potential for the transformation of a broad spectrum of organic molecules such as steroids, amino acids, and aromatic hydrocarbons. In the present study, we tested its potential for the transformation of a bile component, chenodeoxycholic acid (CDCA). Five transformed products, namely, cholic acid, methylcholate, methylchenodeoxycholate, 3?-hydroxy-7-oxo-5?-cholanic acid, and 7?-hydroxy-3-oxo-5?-cholanic acid, were the major transformation products catalyzed by G. stearothermophilus. Under aerobic conditions, no evidence of side chain degradation, ring cleavage, or dehydrogenation was found among the metabolites of CDCA. CDCA transformation by a thermophile is reported for the first time. PMID:21838799

Afzal, Mohammad; Oommen, Sosamma; Al-Awadi, Samira

2011-01-01

2

DECONTAMINATION ASSESSMENT OF BACILLUS ANTHRACIS, BACILLUS SUBTILIS, AND GEOBACILLUS STEAROTHERMOPHILUS SPORES ON INDOOR SURFACTS USING A HYDROGEN PERIOXIDE GAS GENERATOR  

Science.gov (United States)

Aims: To evaluate the decontamination of Bacillus anthracis, Bacillus subtilis, and Geobacillus stearothermophilus spores on indoor surface materials using hydrogen peroxide gas. Methods and Results: B. anthracis, B. subtilis, and G. Stearothermophilus spores were dried on seven...

3

Geobacillus stearothermophilus 6-phosphogluconate dehydrogenase complexed with 6-phosphogluconate.  

Science.gov (United States)

Two crystal structures of recombinant Geobacillus stearothermophilus 6-phosphogluconate dehydrogenase (Gs6PDH) in complex with the substrate 6-phosphogluconate have been determined at medium resolution. Gs6PDH shares significant sequence identity and structural similarity with the enzymes from Lactococcus lactis, sheep liver and the protozoan parasite Trypanosoma brucei, for which a range of structures have previously been reported. Comparisons indicate that amino-acid sequence conservation is more pronounced in the two domains that contribute to the architecture of the active site, namely the N-terminal and C-terminal domains, compared with the central domain, which is primarily involved in the subunit-subunit associations required to form a stable dimer. The active-site residues are highly conserved, as are the interactions with the 6-phosphogluconate. There is interest in 6PDH as a potential drug target for the protozoan parasite T. brucei, the pathogen responsible for African sleeping sickness. The recombinant T. brucei enzyme has proven to be recalcitrant to enzyme-ligand studies and a surrogate protein might offer new opportunities to investigate and characterize 6PDH inhibitors. The high degree of structural similarity, efficient level of expression and straightforward crystallization conditions mean that Gs6PDH may prove to be an appropriate model system for structure-based inhibitor design targeting the enzyme from Trypanosoma species. PMID:19407374

Cameron, Scott; Martini, Viviane P; Iulek, Jorge; Hunter, William N

2009-05-01

4

Isolation of Lipase Gene of the Thermophilic Geobacillus stearothermophilus Strain-5  

Directory of Open Access Journals (Sweden)

Full Text Available In earlier study a new thermophilic strain Geobacillus stearothermophilus strain-5 producing thermostable lipase was isolated and identified based on 16S rRNA sequencing. Phylogenetic analysis revealed its closeness to geobacilli especially the thermophilic Geobacillus stearothermophilus with optimal growth and lipolytic enzyme activity at 60°C and pH 7.0. In this study thermostable lipase gene from this bacterium was isolated by PCR using degenerate primers. The DNA fragment coding for lipase gene was cloned in the pCR 4-TOPO plasmid and the ligation products were transformed into Escherichia coli XL1-blue cells. Partial sequencing of the gene was carried out (accession number DQ923401. Analysis by BLAST program showed some sequence similarity to that, of several lipase genes from thermophilic Geobacillus and Bacillus submitted to Genbank.

M. Sifour

2010-01-01

5

Properties of Geobacillus stearothermophilus levansucrase as potential biocatalyst for the synthesis of levan and fructooligosaccharides.  

Science.gov (United States)

The production of levansucrase (LS) by thermophilic Geobacillus stearothermophilus was investigated. LS production was more effective in the presence of sucrose (1%, w/v) than fructose, glucose, glycerol or raffinose. The results (Top 57°C; stable for 6 h at 47°C) indicate the high stability of the transfructosylation activity of G. stearothermophilus LS as compared with LSs from other microbial sources. Contrary to temperature, the pH had a significant effect on the selectivity of G. stearothermophilus LS-catalyzed reaction, favoring the transfructosylation reaction in the pH range of 6.0-6.5. The kinetic parameter study revealed that the catalytic efficiency of transfructosylation activity was higher as compared with the hydrolytic one. In addition to levan, G. stearothermophilus LS synthesized fructooligosaccharides in the presence of sucrose as the sole substrate. The results also demonstrated the wide acceptor specificity of G. stearothermophilus LS with maltose being the best fructosyl acceptor. This study is the first on the catalytic properties and the acceptor specificity of LS from G. stearothermophilus. PMID:23926090

Inthanavong, Lotthida; Tian, Feng; Khodadadi, Maryam; Karboune, Salwa

2013-01-01

6

Analysis of the tryptophanase expression in Symbiobacterium thermophilum in a coculture with Geobacillus stearothermophilus.  

Science.gov (United States)

The tryptophanase-positive Symbiobacterium thermophilum is a free-living syntrophic bacterium that grows effectively in a coculture with Geobacillus stearothermophilus. Our studies have shown that S. thermophilum growth depends on the high CO2 and low O2 condition established by the precedent growth of G. stearothermophilus. The use of an anoxic atmosphere containing high CO2 allows S. thermophilum to grow independently of G. stearothermophilus, but the cellular yield is ten times lower than that achieved in the coculture. In this study, we characterized the coculture-dependent expression and activity of tryptophanase in S. thermophilum. S. thermophilum cells accumulated a marked amount of indole in a coculture with G. stearothermophilus, but not in the bacterium's pure culture irrespective of the addition of tryptophan. S. thermophilum cells accumulated indole in its pure culture consisting of conditioned medium (medium supplied with culture supernatant of G. stearothermophilus). Proteomic analysis identified the protein specifically produced in the S. thermophilum cells grown in conditioned medium, which was a tryptophanase encoded by tna2 (STH439). An attempt to isolate the tryptophanase-inducing component from the culture supernatant of G. stearothermophilus was unsuccessful, but we did discover that the indole accumulation occurs when 10 mM bicarbonate is added to the medium. RT-PCR analysis showed that the addition of bicarbonate stimulated transcription of tna2. The transcriptional start site, identified within the tna2 promoter, was preceded by the -24 and -12 consensus sequences specified by an alternative sigma factor, ?(54). The evidence suggests that the transcription of some genes involved in amino acid metabolism is ?(54)-dependent, and that a bacterial enhancer-binding protein containing a PAS domain controls the transcription under the presence of high levels of bicarbonate. PMID:25200839

Watsuji, Tomo-O; Takano, Hideaki; Yamabe, Tomoya; Tamazawa, Satoshi; Ikemura, Hiroka; Ohishi, Takanori; Matsuda, Tohyo; Shiratori-Takano, Hatsumi; Beppu, Teruhiko; Ueda, Kenji

2014-12-01

7

Inactivation of Geobacillus stearothermophilus in canned food and coconut milk samples by addition of enterocin AS-48.  

Science.gov (United States)

The cyclic bacteriocin enterocin AS-48 was tested on a cocktail of two Geobacillus stearothermophilus strains in canned food samples (corn and peas), and in coconut milk. AS-48 (7 microg/g) reduced viable cell counts below detection levels in samples from canned corn and peas stored at 45 degrees C for 30 days. In coconut milk, bacterial inactivation by AS-48 (1.75 microg/ml) was even faster. In all canned food and drink samples inoculated with intact G. stearothermophilus endospores, bacteriocin addition (1.75 microg per g or ml of food sample) rapidly reduced viable cell counts below detection levels and avoided regrowth during storage. After a short-time bacteriocin treatment of endospores, trypsin addition markedly increased G. stearothermophilus survival, supporting the effect of residual bacteriocin on the observed loss of viability for endospores. Results from this study support the potential of enterocin AS-48 as a biopreservative against G. stearothermophilus. PMID:19269571

Viedma, Pilar Martínez; Abriouel, Hikmate; Ben Omar, Nabil; López, Rosario Lucas; Valdivia, Eva; Gálvez, Antonio

2009-05-01

8

Gene cloning, expression, and crystallization of a thermostable exo-inulinase from Geobacillus stearothermophilus KP1289.  

Science.gov (United States)

The gene ( inuA) encoding exo-inulinase (EC 3.2.1.80) was cloned from the thermophilic Geobacillus stearothermophilus ( Bacillus stearothermophilus) KP 1289 growing at between 41 degrees C and 69 degrees C. The inuA gene consisted of 1,482 bp encoding a protein of 493 amino acids. The deduced polypeptide of molecular mass ( M) 56,744 Da showed strong sequence similarity to Pseudomonas mucidolens exo-inulinase, Bacillus subtilis levanase, Paenibacillus polymyxa ( Bacillus polymyxa) fructosyltransferase, and so on, indicating that the enzyme belonged to glycosyl hydrolase family 32. The M of the purified exo-inulinase, expressed in Escherichia coli HB101, was estimated as approximately 54,000 Da by both SDS-PAGE and gel filtration. These results suggested that the active form of the enzyme is a monomer. The enzyme was active between 30 and 75 degrees C with an optimum at 60 degrees C. The properties were identical to those of the native enzyme. Additionally, for the first time for a prokaryotic GH32 protein, crystals of the recombinant enzyme were obtained. PMID:12883863

Tsujimoto, Y; Watanabe, A; Nakano, K; Watanabe, K; Matsui, H; Tsuji, K; Tsukihara, T; Suzuki, Y

2003-08-01

9

Multiple regulatory mechanisms control the expression of the Geobacillus stearothermophilus gene for extracellular xylanase.  

Science.gov (United States)

Geobacillus stearothermophilus T-6 produces a single extracellular xylanase (Xyn10A) capable of producing short, decorated xylo-oligosaccharides from the naturally branched polysaccharide, xylan. Gel retardation assays indicated that the master negative regulator, XylR, binds specifically to xylR operators in the promoters of xylose and xylan-utilization genes. This binding is efficiently prevented in vitro by xylose, the most likely molecular inducer. Expression of the extracellular xylanase is repressed in medium containing either glucose or casamino acids, suggesting that carbon catabolite repression plays a role in regulating xynA. The global transcriptional regulator CodY was shown to bind specifically to the xynA promoter region in vitro, suggesting that CodY is a repressor of xynA. The xynA gene is located next to an uncharacterized gene, xynX, that has similarity to the NIF3 (Ngg1p interacting factor 3)-like protein family. XynX binds specifically to a 72-bp fragment in the promoter region of xynA, and the expression of xynA in a xynX null mutant appeared to be higher, indicating that XynX regulates xynA. The specific activity of the extracellular xylanase increases over 50-fold during early exponential growth, suggesting cell density regulation (quorum sensing). Addition of conditioned medium to fresh and low cell density cultures resulted in high expression of xynA, indicating that a diffusible extracellular xynA density factor is present in the medium. The xynA density factor is heat-stable, sensitive to proteases, and was partially purified using reverse phase liquid chromatography. Taken together, these results suggest that xynA is regulated by quorum-sensing at low cell densities. PMID:25070894

Shulami, Smadar; Shenker, Ofer; Langut, Yael; Lavid, Noa; Gat, Orit; Zaide, Galia; Zehavi, Arie; Sonenshein, Abraham L; Shoham, Yuval

2014-09-12

10

Geobacillus stearothermophilus LV cadA gene mediates resistance to cadmium, lead and zinc in zntA mutants of Salmonella entérica serovar Typhimurium  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Salmonella entérica serovar Typhimurium cells expressing the cadA gene of Geobacillus stearothermophilus LV exhibit a hypersensitive phenotype to cadmium chloride. Deletion of the ORF STM3576 from the Salmonella genome resulted in cadmium, lead and zinc sensitivity, confirming that this ORF is a homologue of the zntA gene. The observed sensitivity was reverted upon expression of the G. stearothermophilus LV cadA gene. These results indicate that the cadA gene product is involved in Cd, Pb an...

Pe?rez, Jose? M.; Praden?as, Gonzalo A.; Navarro, Claudio A.; Henri?quez, Daniel R.; Pichuantes, Sergio E.; Va?squez, Claudio C.

2006-01-01

11

Geobacillus stearothermophilus LV cadA gene mediates resistance to cadmium, lead and zinc in zntA mutants of Salmonella entérica serovar Typhimurium  

Directory of Open Access Journals (Sweden)

Full Text Available Salmonella entérica serovar Typhimurium cells expressing the cadA gene of Geobacillus stearothermophilus LV exhibit a hypersensitive phenotype to cadmium chloride. Deletion of the ORF STM3576 from the Salmonella genome resulted in cadmium, lead and zinc sensitivity, confirming that this ORF is a homologue of the zntA gene. The observed sensitivity was reverted upon expression of the G. stearothermophilus LV cadA gene. These results indicate that the cadA gene product is involved in Cd, Pb and Zn resistance as a classical P-type ATPase and strongly suggest that the observed hypersensitive phenotype to these metals can be related to the function of the host ·zntA gene product

JOSÉ M PÉREZ

2006-01-01

12

Geobacillus stearothermophilus LV cadA gene mediates resistance to cadmium, lead and zinc in zntA mutants of Salmonella entérica serovar Typhimurium  

Scientific Electronic Library Online (English)

Full Text Available SciELO Chile | Language: English Abstract in english Salmonella entérica serovar Typhimurium cells expressing the cadA gene of Geobacillus stearothermophilus LV exhibit a hypersensitive phenotype to cadmium chloride. Deletion of the ORF STM3576 from the Salmonella genome resulted in cadmium, lead and zinc sensitivity, confirming that this ORF is a hom [...] ologue of the zntA gene. The observed sensitivity was reverted upon expression of the G. stearothermophilus LV cadA gene. These results indicate that the cadA gene product is involved in Cd, Pb and Zn resistance as a classical P-type ATPase and strongly suggest that the observed hypersensitive phenotype to these metals can be related to the function of the host ·zntA gene product

JOSÉ M, PÉREZ; GONZALO A, PRADEÑAS; CLAUDIO A, NAVARRO; DANIEL R, HENRÍQUEZ; SERGIO E, PICHUANTES; CLAUDIO C, VÁSQUEZ.

13

Strain Improvement of Bacillus coagulans and Geobacillus stearothermophilus for Enhanced Thermostable Cellulase Production and the Effect of Different Metal Ions on Cellulase Activity  

Digital Repository Infrastructure Vision for European Research (DRIVER)

The current study was focused on the strain improvement of Bacillus coagulans and Geobacillus stearothermophilus for thermostable cellulase production with higher enzyme activity. For strain improvement UV radiations, NTG and Sodium azide were used as mutagenic agents.NTG was found to be best mutagenic agent among all in term of highest cellulase activity. Mutant strain C11 exhibited the highest cellulase specific activity at 45 U/mg followed by C15 (39 U/mg) in case of B.coagulans while Muta...

Vikas Sharma; Prakash Kumar Singh

2012-01-01

14

Structure-specificity relationships in Abp, a GH27 ?-L-arabinopyranosidase from Geobacillus stearothermophilus T6.  

Science.gov (United States)

L-Arabinose sugar residues are relatively abundant in plants and are found mainly in arabinan polysaccharides and in other arabinose-containing polysaccharides such as arabinoxylans and pectic arabinogalactans. The majority of the arabinose units in plants are present in the furanose form and only a small fraction of them are present in the pyranose form. The L-arabinan-utilization system in Geobacillus stearothermophilus T6, a Gram-positive thermophilic soil bacterium, has recently been characterized, and one of the key enzymes was found to be an intracellular ?-L-arabinopyranosidase (Abp). Abp, a GH27 enzyme, was shown to remove ?-L-arabinopyranose residues from synthetic substrates and from the native substrates sugar beet arabinan and larch arabinogalactan. The Abp monomer is made up of 448 amino acids, and based on sequence homology it was suggested that Asp197 is the catalytic nucleophile and Asp255 is the catalytic acid/base. In the current study, the detailed three-dimensional structure of wild-type Abp (at 2.28?Å resolution) and its catalytic mutant Abp-D197A with (at 2.20?Å resolution) and without (at 2.30?Å resolution) a bound L-arabinose product are reported as determined by X-ray crystallography. These structures demonstrate that the three-dimensional structure of the Abp monomer correlates with the general fold observed for GH27 proteins, consisting of two main domains: an N-terminal TIM-barrel domain and a C-terminal all-? domain. The two catalytic residues are located in the TIM-barrel domain, such that their carboxylic functional groups are about 5.9?Å from each other, consistent with a retaining mechanism. An isoleucine residue (Ile67) located at a key position in the active site is shown to play a critical role in the substrate specificity of Abp, providing a structural basis for the high preference of the enzyme towards arabinopyranoside over galactopyranoside substrates. The crystal structure demonstrates that Abp is a tetramer made up of two `open-pincers' dimers, which clamp around each other to form a central cavity. The four active sites of the Abp tetramer are situated on the inner surface of this cavity, all opening into the central space of the cavity. The biological relevance of this tetrameric structure is supported by independent results obtained from size-exclusion chromatography (SEC), dynamic light-scattering (DLS) and small-angle X-ray scattering (SAXS) experiments. These data and their comparison to the structural data of related GH27 enzymes are used for a more general discussion concerning structure-selectivity aspects in this glycoside hydrolase (GH) family. PMID:25372689

Lansky, Shifra; Salama, Rachel; Solomon, Hodaya V; Feinberg, Hadar; Belrhali, Hassan; Shoham, Yuval; Shoham, Gil

2014-11-01

15

Strain Improvement of Bacillus coagulans and Geobacillus stearothermophilus for Enhanced Thermostable Cellulase Production and the Effect of Different Metal Ions on Cellulase Activity  

Directory of Open Access Journals (Sweden)

Full Text Available The current study was focused on the strain improvement of Bacillus coagulans and Geobacillus stearothermophilus for thermostable cellulase production with higher enzyme activity. For strain improvement UV radiations, NTG and Sodium azide were used as mutagenic agents.NTG was found to be best mutagenic agent among all in term of highest cellulase activity. Mutant strain C11 exhibited the highest cellulase specific activity at 45 U/mg followed by C15 (39 U/mg in case of B.coagulans while Mutant strain S18 exhibited thehighest cellulase specific activity at 69 U/mg followed by S12 (62 U/mg in case of G. stearothermophilus. Specific activity of cellulase was 92 U/mg in case of B.coagulans C11 and 118 U/mg in case of G. stearothermophilus S18. Ag+, Mg+, Se2+,Ca2+,Co2+,Mn2+,K+, Zn2+ ,Fe3+, Hg2+ and Cu2+ showed positive change in specific activity while Na+, Ni2+ negative change in specific activity of cellulase with respect to specific activity of cellulase in absence of any additive in case of B.coagulans C11 and Ag+, Mg+, Se2+,Co2+,Mn2+ andHg2+ showed positive change in specific activity, Na+, K+ showed no change in specific activity while Ca2+, Zn2+, Ni2+, Fe3+ and Cu2+ showed negative change in specific activity of cellulase with respect to specific activity of cellulase in absence of any additive in case of G. stearothermophilus S18.

Vikas Sharma

2012-11-01

16

High-Affinity Interaction between the S-Layer Protein SbsC and the Secondary Cell Wall Polymer of Geobacillus stearothermophilus ATCC 12980 Determined by Surface Plasmon Resonance Technology? †  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Surface plasmon resonance studies using C-terminal truncation forms of the S-layer protein SbsC (recombinant SbsC consisting of amino acids 31 to 270 [rSbsC31-270] and rSbsC31-443) and the secondary cell wall polymer (SCWP) isolated from Geobacillus stearothermophilus ATCC 12980 confirmed the exclusive responsibility of the N-terminal region comprising amino acids 31 to 270 for SCWP binding. Quantitative analyses indicated binding behavior demonstrating low, medium, and high affinities.

Ferner-ortner, Judith; Mader, Christoph; Ilk, Nicola; Sleytr, Uwe B.; Egelseer, Eva M.

2007-01-01

17

Protein engineering by random mutagenesis and structure-guided consensus of Geobacillus stearothermophilus Lipase T6 for enhanced stability in methanol.  

Science.gov (United States)

The abilities of enzymes to catalyze reactions in nonnatural environments of organic solvents have opened new opportunities for enzyme-based industrial processes. However, the main drawback of such processes is that most enzymes have a limited stability in polar organic solvents. In this study, we employed protein engineering methods to generate a lipase for enhanced stability in methanol, which is important for biodiesel production. Two protein engineering approaches, random mutagenesis (error-prone PCR) and structure-guided consensus, were applied in parallel on an unexplored lipase gene from Geobacillus stearothermophilus T6. A high-throughput colorimetric screening assay was used to evaluate lipase activity after an incubation period in high methanol concentrations. Both protein engineering approaches were successful in producing variants with elevated half-life values in 70% methanol. The best variant of the random mutagenesis library, Q185L, exhibited 23-fold-improved stability, yet its methanolysis activity was decreased by one-half compared to the wild type. The best variant from the consensus library, H86Y/A269T, exhibited 66-fold-improved stability in methanol along with elevated thermostability (+4.3°C) and a 2-fold-higher fatty acid methyl ester yield from soybean oil. Based on in silico modeling, we suggest that the Q185L substitution facilitates a closed lid conformation that limits access for both the methanol and substrate excess into the active site. The enhanced stability of H86Y/A269T was a result of formation of new hydrogen bonds. These improved characteristics make this variant a potential biocatalyst for biodiesel production. PMID:24362426

Dror, Adi; Shemesh, Einav; Dayan, Natali; Fishman, Ayelet

2014-02-01

18

Effect of mercaptoethylamine on DNA degradation in thermophilic bacteria Bac. stearothermophilus exposed to ?-, UV-radiation or methylnitrosourea  

International Nuclear Information System (INIS)

The effect of mercaptoethylamine (MEA) on degradation of DNA in thermophilic bacteria Bac. stear. exposed to ?-, UV-rays or methylnitrosourea (MNU) was studied. Using centrifugation on alkaline and neutral sucrose gradients, it was shown that MEA inhibits the accumulation of breaks in the DNA of Bac. stear. It also lowers the level of DNA degradation in toluene-treated cells of Bac. stear. under the action of the intrinsic nuclease, reduces the activity of the endonuclease specific for apurinic DNA, as well as that of S1-nuclease and DNase-I in vitro. The inhibition in the accumulation of DNA breaks is assumed to be due to a decrease of the endonuclease activity in the cells of thermophilic bacteria. (orig.)

19

Crystallization and preliminary X-ray study of alpha-glucosidase from Geobacillus sp strain HTA-462, one of the deepest sea bacteria.  

Science.gov (United States)

An alpha-glucosidase (EC 3.2.1.20) was purified from Geobacillus sp. strain HTA-462 cells and crystallized using the hanging-drop vapour-diffusion technique. The Geobacillus strain is a thermophilic and high-pressure-resistant bacterium found at the bottom of the Challenger Deep in the Mariana Trench. The crystal was characterized by X-ray diffraction and belongs to space group C2, with unit-cell parameters a = 104.0, b = 91.5, c = 72.9 A, beta = 109.4 degrees. Diffraction data to 2.5 A resolution were collected and processed. PMID:12832785

Shirai, Tsuyoshi; Hung, Vo Si; Akita, Masatake; Hatada, Yuji; Ito, Susumu; Horikoshi, Koki

2003-07-01

20

Enhancing the cellulose-degrading activity of cellulolytic bacteria CTL-6 (Clostridium thermocellum) by co-culture with non-cellulolytic bacteria W2-10 (Geobacillus sp.).  

Science.gov (United States)

The effect of a non-cellulolytic bacterium W2-10 (Geobacillus sp.) on the cellulose-degrading activity of a cellulolytic bacterium CTL-6 (Clostridium thermocellum) was determined using cellulose materials (paper and straw) in peptone cellulose solution (PCS) medium under aerobic conditions. The results indicated that in the co-culture, addition of W2-10 resulted in a balanced medium pH, and may provide the required anaerobic environment for CTL-6. Overall, addition of W2-10 was beneficial to CTL-6 growth in the adverse environment of the PCS medium. In co-culture with W2-10, the CTL-6 cellulose degradation efficiency of filter paper and alkaline-treated wheat straw significantly increased up to 72.45 and 37.79 %, respectively. The CMCase activity and biomass of CTL-6 also increased from 0.23 U ml(-1) and 45.1 ?g ml(-1) (DNA content) up to 0.47 U ml(-1) and 112.2 ?g ml(-1), respectively. In addition, co-culture resulted in accumulation of acetate and propionate up to 4.26 and 2.76 mg ml(-1). This was a respective increase of 2.58 and 4.45 times, in comparison to the monoculture with CTL-6. PMID:23975281

Lü, Yucai; Li, Ning; Yuan, Xufeng; Hua, Binbin; Wang, Jungang; Ishii, Masaharu; Igarashi, Yasuo; Cui, Zongjun

2013-12-01

 
 
 
 
21

Genomic characterization of thermophilic Geobacillus species isolated from the deepest sea mud of the Mariana Trench.  

Science.gov (United States)

The thermophilic strains HTA426 and HTA462 isolated from the Mariana Trench were identified as Geobacillus kaustophilus and G. stearothermophilus, respectively, based on physiologic and phylogenetic analyses using 16S rDNA sequences and DNA-DNA relatedness. The genome size of HTA426 and HTA462 was estimated at 3.23-3.49 Mb and 3.7-4.49 Mb, respectively. The nucleotide sequences of three independent lambda-phage inserts of G. stearothermophilus HTA462 have been determined. The organization of protein coding sequences (CDSs) in the two lambda-phage inserts was found to differ from that in the contigs corresponding to each lambda insert assembled by the shotgun clones of the G. kaustophilus HTA426 genome, although the CDS organization in another lambda insert is identical to that in the HTA426 genome. PMID:15168170

Takami, Hideto; Nishi, Shinro; Lu, Jei; Shimamura, Shigeru; Takaki, Yoshihiro

2004-10-01

22

Cloning and Expression of Thermostable ?-Amylase Gene from Bacillus stearothermophilus in Bacillus stearothermophilus and Bacillus subtilis  

Digital Repository Infrastructure Vision for European Research (DRIVER)

The structural gene for a thermostable ?-amylase from Bacillus stearothermophilus was cloned in plasmids pTB90 and pTB53. It was expressed in both B. stearothermophilus and Bacillus subtilis. B. stearothermophilus carrying the recombinant plasmid produced about fivefold more ?-amylase (20.9 U/mg of dry cells) than did the wild-type strain of B. stearothermophilus. Some properties of the ?-amylases that were purified from the transformants of B. stearothermophilus and B. subtilis were exami...

Aiba, Shuichi; Kitai, Kazuo; Imanaka, Tadayuki

1983-01-01

23

Development of a versatile shuttle vector for gene expression in Geobacillus spp.  

Science.gov (United States)

An improved, versatile shuttle vector has been created for the metabolic engineering of Geobacillus spp. As kanamycin is the most thermo-tolerant of commonly used antibiotics, the gene encoding a thermostable kanamycin nucleotidyltransferase, together with the origin of replication from the G. stearothermophilus plasmid pBST1 were cloned into the Escherichia coli cloning vector pUC18. The resulting vector, named pUCG18, replicated in both organisms and could be transformed with an efficiency of 1 x 10(4) transformants per microg of DNA in G. thermoglucosidasius and was stable up to 68 degrees C with antibiotic selection. It was used to demonstrate expression of the pyruvate decarboxylase (pdc) gene from Zymomonas palmae in G. thermoglucosidasius at 45 degrees C. Sequence analysis of the pBST1 derived origin of replication revealed homology with a family of theta replicons that have previously only been found in strains of Bacillus megaterium. PMID:18501964

Taylor, Mark P; Esteban, Carlos D; Leak, David J

2008-07-01

24

PCR detection of thermophilic spore-forming bacteria involved in canned food spoilage.  

Science.gov (United States)

Thermophilic bacteria that form highly heat-resistant spores constitute an important group of spoilage bacteria of low-acid canned food. A PCR assay was developed in order to rapidly trace these bacteria. Three PCR primer pairs were designed from rRNA gene sequences. These primers were evaluated for the specificity and the sensitivity of detection. Two primer pairs allowed detection at the species level of Geobacillus stearothermophilus and Moorella thermoacetica/thermoautrophica. The other pair allowed group-specific detection of anaerobic thermophilic bacteria of the genera Thermoanaerobacterium, Thermoanaerobacter, Caldanerobium and Caldanaerobacter. After a single enrichment step, these PCR assays allowed the detection of 28 thermophiles from 34 cans of spoiled low-acid food. In addition, 13 ingredients were screened for the presence of these bacteria. This PCR assay serves as a detection method for strains able to spoil low-acid canned food treated at 55°C. It will lead to better reactivity in the canning industry. Raw materials and ingredients might be qualified not only for quantitative spore contamination, but also for qualitative contamination by highly heat-resistant spores. PMID:20397018

Prevost, S; Andre, S; Remize, F

2010-12-01

25

ISOLATION AND CHARACTERIZATION OF MANNANOLYTIC THERMOPHILIC BACTERIA FROM PALM OIL SHELL AND THEIR MANNANASE ENZYME PRODUCTION PROPERTIES  

Directory of Open Access Journals (Sweden)

Full Text Available A mannanolytic thermophilic bacterium (L-07 was isolated from palm oil shell after 2 days of enrichment in liquid medium supplemented with 1% palm kernel meal as mannan source. Sequence analysis of 16S-rRNA indicated that L-07 was similar (98% to Geobacillus stearothermophilus, a species of thermophilic aerobi c bacteria. We found that G. stearothermophilus L-07 produced extracellular ? -1,4-mannanases, but no ? -manosidase and ? -galactosidase activities. The growth of L-07 reached its maximum (3.0 x 106 cell/ml at 12-20 hours, while the highest ? -mannanase activity (0.52 U/ml was observed in culture medium after 36 hours of cultivation at 60oC. The medium containing locust bean gum was the best for producing extracellular ? -1,4-mannanases compared with kolang kaling , konjak , and palm kernel meal. SDS-PAGE and zymogram analysis demonstrated that crude mannanase complex of L-07 from locust bean gum containing medium comprised three active bands with molecular weight of 85, 73 and 50 kDa.

T RESNAWATI P URWADARIA

2005-01-01

26

Molecular characterization of the alkB gene in the thermophilic Geobacillus sp. strain MH-1.  

Science.gov (United States)

An extremely thermophilic alkane-degrading bacterium, strain MH-1, was isolated from the deep subterranean petroleum reservoir in Shengli oil field, PR China. Based on its physiological characteristics and analysis of its 16S rRNA gene sequence, strain MH-1 was identified as Geobacillus stearothermophilus. Strain MH-1 was able to grow at temperatures ranging from 50 to 72 degrees C and effectively degraded hexadecane as the sole carbon source at 70 degrees C. Strain MH-1 degraded alkanes with different length chains (C(12)-C(31)) in crude oil, but it preferentially degraded middle chain-alkanes. The alkane hydroxylase system of G. stearothermophilus MH-1 was characterized. It contained at least three alkane monooxygenase gene homologs (alkB-geo1, alkB-geo4, and alkB-geo6). The AlkB-geo6 cluster, which had a high sequence similarity to the alkB2 cluster of Rhodococcus strains NRRL B-16531 and Q15, contained alkB-geo6, two rubredoxins and a putative transcriptional regulatory protein. PMID:19733653

Liu, Yi-Chen; Zhou, Tian-Tian; Zhang, Jian; Xu, Lian; Zhang, Zhen-Hua; Shen, Qi-Rong; Shen, Biao

2009-10-01

27

The mannitol phosptransferase system of Bacillus stearothermophilus  

Digital Repository Infrastructure Vision for European Research (DRIVER)

This thesis describes the mannitol-specific PTS of the thermophilic organism B. stearothermophilus. The mannitol operon of B. stearothermophilus was cloned and the properties of the proteins involved in mannitol uptake and the regulation of the expression of the mtl operon were studied. The operon consists of four genes: mtlA, mtlR, mtlF and mtlD coding for the mannitol transporter IICBmtl, the transcriptional regulator MtrlR, the phosphotransferase IIAmtl and the mannitol-l-phosphate dehydro...

Henstra, Sytse Anton

2000-01-01

28

Heterologous expression of the alcohol dehydrogenase (adhI) gene from Geobacillus thermoglucosidasius strain M10EXG.  

Science.gov (United States)

A thermostable alcohol dehydrogenase (ADH-I) isolated from the potential thermophilic ethanologen Geobacillus thermoglucosidasius strain M10EXG has been characterised. Inverse PCR showed that the gene (adhI) was localised with 3-hexulose-6-phosphate synthase (HPS) and 6-phospho-3 hexuloisomerase (PHI) on its genome. The deduced peptide sequence of the 1020-bp M10EXG adhI, which corresponds to 340 amino acids, shows 96% and 89% similarity to ADH-hT and ADH-T from Geobacillus stearothermophilus strains LLD-R and NCA 1503, respectively. Over-expression of M10EXG ADH-I in Escherichia coli DH5alpha (pNF303) was confirmed using an ADH activity assay and SDS-PAGE analysis. The specific ADH activity in the extract from this recombinant strain was 9.7(+/-0.3) U mg(-1) protein, compared to 0.1(+/-0.01) U mg(-1) protein in the control strain. The recombinant E. coli showed enzymatic activity towards ethanol, 1-butanol, 1-pentanol, 1-heptanol, 1-hexanol, 1-octanol and 2-propanol, but not methanol. In silico analysis, including phylogenetic reconstruction and protein modeling, confirmed that the thermostable enzyme from G. thermoglucosidasius is likely to belong to the NAD-Zn-dependent family of alcohol dehydrogenases. PMID:18436321

Jeon, Young Jae; Fong, Jiunn C N; Riyanti, Eny I; Neilan, Brett A; Rogers, Peter L; Svenson, Charles J

2008-06-01

29

Alkane inducible proteins in Geobacillus thermoleovorans B23  

Directory of Open Access Journals (Sweden)

Full Text Available Abstract Background Initial step of ?-oxidation is catalyzed by acyl-CoA dehydrogenase in prokaryotes and mitochondria, while acyl-CoA oxidase primarily functions in the peroxisomes of eukaryotes. Oxidase reaction accompanies emission of toxic by-product reactive oxygen molecules including superoxide anion, and superoxide dismutase and catalase activities are essential to detoxify them in the peroxisomes. Although there is an argument about whether primitive life was born and evolved under high temperature conditions, thermophilic archaea apparently share living systems with both bacteria and eukaryotes. We hypothesized that alkane degradation pathways in thermophilic microorganisms could be premature and useful to understand their evolution. Results An extremely thermophilic and alkane degrading Geobacillus thermoleovorans B23 was previously isolated from a deep subsurface oil reservoir in Japan. In the present study, we identified novel membrane proteins (P16, P21 and superoxide dismutase (P24 whose production levels were significantly increased upon alkane degradation. Unlike other bacteria acyl-CoA oxidase and catalase activities were also increased in strain B23 by addition of alkane. Conclusion We first suggested that peroxisomal ?-oxidation system exists in bacteria. This eukaryotic-type alkane degradation pathway in thermophilic bacterial cells might be a vestige of primitive living cell systems that had evolved into eukaryotes.

Kato Tomohisa

2009-03-01

30

Hypervariable Pili and Flagella Genes Provide Suitable New Targets for DNA High-Resolution Melt-Based Genotyping of Dairy Geobacillus spp.  

Science.gov (United States)

Although nonpathogenic in nature, spores of Geobacillus are able to attach to surfaces, germinate, and form biofilms, allowing rapid multiplication and persistence within milk powder processing plants, causing final product contamination, and eventually leading to a loss of revenue in terms of downgraded product quality. As a result, Geobacillus spp. have been found to be common contaminants of milk powder worldwide. Genotyping methods can help in gaining insight into the ecology and transmission of these thermophilic bacteria within and between dairy processing plants. The objective of this study was to use the assembled draft genomes of two Geobacillus spp. to identify and test new hypervariable genotyping targets for differentiating closely related dairy Geobacillus isolates. The two Geobacillus spp. strains obtained from high spore count powders were obtained in 2010 (isolate 7E) and in 1995 (isolate 126) and were previously shown to be of same genotype based on a variable number tandem repeat genotyping method. Significant nucleotide sequence variation was found in genes encoding pili and flagella, which were further investigated as suitable loci for a new high-resolution melt analysis (HRMA)-based genotyping method. Three genes encoding pulG (containing prepilin-type N-terminal cleavage domain), pilT (pili retraction protein), and fliW (flagellar assembly protein) were selected as targets for the new pili/flagella gene (PilFla) HRMA genotyping method. The three-gene-based PilFla-HRMA genotyping method differentiated 35 milk powder Geobacillus spp. isolates into 19 different genotype groups (D = 0.93), which compared favorably to the previous method (which used four variable number tandem repeat loci) that generated 16 different genotype groups (D = 0.90). In conclusion, through comparative genomics of two closely related dairy Geobacillus strains, we have identified new hypervariable regions that prove to be useful targets for highly discriminatory genotyping. PMID:25285488

Chauhan, Kanika; Seale, R Brent; Deeth, Hilton C; Turner, Mark S

2014-10-01

31

Application of a recN sequence similarity analysis to the identification of species within the bacterial genus Geobacillus.  

Science.gov (United States)

Full-length recN and 16S rRNA gene sequences were determined for a collection of 68 strains from the thermophilic Gram-positive genus Geobacillus, members of which have been isolated from geographically and ecologically diverse locations. Phylogenetic treeing methods clustered the isolates into nine sequence similarity groups, regardless of which gene was used for analysis. Several of these groups corresponded unambiguously to known Geobacillus species, whereas others contained two or more type strains from species with validly published names, highlighting a need for a re-assessment of the taxonomy for this genus. For taxonomic analysis of bacteria related at a genus, species or subspecies level, recN sequence comparisons had a resolving power nearly an order or magnitude greater than 16S rRNA gene comparisons. Mutational saturation rendered recN comparisons much less powerful than 16S rRNA gene comparisons for analysis of higher taxa, however. Analysis of recN sequences should prove a powerful tool for assigning strains to species within Geobacillus, and perhaps within other genera as well. PMID:15879251

Zeigler, Daniel R

2005-05-01

32

21 CFR 184.1012 - ?-Amylase enzyme preparation from Bacillus stearothermophilus.  

Science.gov (United States)

...2010-04-01 2009-04-01 true α-Amylase enzyme preparation from Bacillus stearothermophilus...Affirmed as GRAS § 184.1012 ?-Amylase enzyme preparation from Bacillus stearothermophilus. (a) ?-Amylase enzyme preparation is obtained...

2010-04-01

33

Preliminary Characterization of the Probiotic Properties of Candida Famata and Geobacillus Thermoleovorans  

Directory of Open Access Journals (Sweden)

Full Text Available Background and Objective: Probiotics are live microbial feed supplements which beneficially affect the host animal by improving its intestinal microbial balance, producing metabolites which inhibit the colonization or growth of other microorganisms or by competing with them for resources such as nutrients or space. The aim of this study was to investigate the probiotic properties of Candida famata and Geobacillus thermoleovorans.Material and Methods: In this study, yeast and bacterial strains isolated from pure oil waste were identified using Api 50 CHB and Api Candida Systems and their probiotic properties were studied through antimicrobial activity, biofilm production, adherence assay and enzymatic characterization.Results and Conclusion: According to biochemical analyses, these strains corresponded to Geobacillus thermoleovorans and Candida famata. Antagonism assay results showed that the tested strains have an inhibitory effect against tested pathogenic bacteria. The yeast Candida famata was unable to produce biofilm on Congo Red Agar (CRA, while the bacterial strain was a slime producer. Adherence assays to abiotic surfaces revealed that the investigated strains were fairly adhesive to polystyrene with values ranging from 0.18 to 0.34 at 595 nm. The enzymatic characterization revealed that the tested strains expressed enzymes such as phosphatase alkaline, esterase lipase (C8, amylase, lipase, lecitenase and caseinase. The obtained results may allow the isolated strains to be considered as having the potential to be candidate probiotics.

A Bakhrouf

2011-12-01

34

Isolation and Characterization of a Bacteriocin-Like Substance Produced by Geobacillus toebii Strain HBB-247.  

Science.gov (United States)

A total of 201 thermophilic bacteria isolated from various thermal spring, mud and soil were tested for their antibacterial activity. Among the mostly active isolates, Geobacillus toebii HBB-247 was further examined. Bacteriocin-like inhibitory substance (BLIS) produced by strain HBB-247 was found to be stable up to 60°C, sensitive to proteolytic enzymes and effective against Enterococcus faecalis, Listeria sp., E. avium, Clostridium pasteurianum, Cellulomonas fimi and some thermophilic strains isolated and identified in this study. As a result of Tricine-SDS-PAGE molecular weight of BLIS was estimated about 38 kDa. Production studies showed that G. toebii HBB-247 starts to produce antibacterial substance at early logarithmic phase of growth and maximum production was detected at the end of the logarithmic phase. PMID:23448995

Ba?bülbül Özdemir, Gamze; Biyik, Haci Halil

2012-03-01

35

Effect of DNA damaging agents on Bac. stearothermophilus  

International Nuclear Information System (INIS)

A thermophilic micro-organism Bac. stearothermophilus showes a high resistance to the effect of such DNA damaging agents as NMM, UV- and ?-radiation. Due to adaptation to high temperatures, at which intensive depurinization and depyrimidinization of DNA take place, thermophilic micro-organisms are suggested to acquire evolutionary a powerful system of repair of DNA damages, particularly, of apurine and apyrimidine sites

36

Pattern of action of Bacillus stearothermophilus neopullulanase on pullulan.  

Digital Repository Infrastructure Vision for European Research (DRIVER)

The action of neopullulanase from Bacillus stearothermophilus on many oligosaccharides was tested. The enzyme hydrolyzed not only alpha-(1----4)-glucosidic linkages but also specific alpha-(1----6)-glucosidic linkages of several branched oligosaccharides. When pullulan was used as a substrate, panose, maltose, and glucose, in that order, were produced as final products at a final molar ratio of 3:1:1. According to these results, we proposed a model for the pattern of action of neopullulanase ...

Imanaka, T.; Kuriki, T.

1989-01-01

37

Analysis of the active center of Bacillus stearothermophilus neopullulanase.  

Digital Repository Infrastructure Vision for European Research (DRIVER)

The active center of the neopullulanase from Bacillus stearothermophilus was analyzed by means of site-directed mutagenesis. The amino acid residues located in the active center of the neopullulanase were tentatively identified according to a molecular model of Taka-amylase A and homology analysis of the amino acid sequences of neopullulanse, Taka-amylase A, and other amylolytic enzymes. When amino acid residues Glu and Asp, corresponding to the putative catalytic sites, were replaced by the ...

Kuriki, T.; Takata, H.; Okada, S.; Imanaka, T.

1991-01-01

38

Influence of temperature and organic load on chemical disinfection of Geobacillus steareothermophilus spores, a surrogate for Bacillus anthracis.  

Science.gov (United States)

This study evaluated the influence of temperature and organic load on the effectiveness of domestic bleach (DB), Surface Decontamination Foam (SDF), and Virkon in inactivating Geobacillus stearothermophilus spores, which are a surrogate for Bacillus anthracis spores. The spores were suspended in light or heavy organic preparations and the suspension was applied to stainless steel carrier disks. The dried spore inoculum was covered with the disinfectants and the disks were then incubated at various temperatures. At -20°C, the 3 disinfectants caused less than a 2.0 log10 reduction of spores in both organic preparations during a 24-h test period. At 4°C, the DB caused a 4.4 log10 reduction of spores in light organic preparations within 2 h, which was about 3 log10 higher than what was achieved with SDF or Virkon. In heavy organic preparations, after 24 h at 4°C the SDF had reduced the spore count by 4.5 log10, which was about 2 log10 higher than for DB or Virkon. In general, the disinfectants were most effective at 23°C but a 24-h contact time was required for SDF and Virkon to reduce spore counts in both organic preparations by at least 5.5 log10. Comparable disinfecting activity with DB only occurred with the light organic load. In summary, at temperatures as low as 4°C, DB was the most effective disinfectant, inactivating spores within 2 h on surfaces with a light organic load, whereas SDF produced the greatest reduction of spores within 24 h on surfaces with a heavy organic load. PMID:24082400

Guan, Jiewen; Chan, Maria; Brooks, Brian W; Rohonczy, Liz

2013-04-01

39

PRODUCTION AND CHARACTERIZATION OF AN ALKALOTHERMOSTABLE, ORGANIC SOLVENT TOLERANT AND SURFACTANT TOLERANT ESTERASE PRODUCED BY A THERMOPHILIC BACTERIUM GEOBACILLUS SP. AGP-04, ISOLATED FROM BAKRESHWAR HOT SPRING, INDIA  

Directory of Open Access Journals (Sweden)

Full Text Available A thermophilic bacteria, Geobacillus sp. AGP-04, isolated from Surya Kund hot spring, Bakreshwar, West Bengal, India was studied in terms of capability of tributyrin hydrolysis and characterization of its thermostable esterase activity using p-nitrophenyl butyrate (PNPB as substrate. The extracellular crude preparation was characterized in terms of pH and temperature optima and stability, organic solvent tolerance capacity and stability, substrate specificity, surfactant tolerance capacity, kinetic parameters and activation/inhibition behavior towards some metal ions and chemicals. Tributyrin agar assay exhibited that Geobacillus sp. AGP-04 secretes an extracellular esterase. The Vmax and Km values of the esterase were found to be 5099 U/Land 103.5µM, respectively in the presence of PNPB as substrate. The optimum temperature and pH, for Geobacillus sp. AGP-04 esterase was 60oC and 8.0, respectively. Although the enzyme activity was not significantly altered by incubating crude extract solution at 20-70oC for 1 hour, the enzyme activity was fully lost at 90oC for same incubation period. The pH stability profile showed that original crude esterase activity is stable at a broad range (pH 5.0-10.0. Moreover, the enzyme was highly organic solvent and surfactant tolerant. The effect of some chemical on crude esterase activity indicated that Geobacillus sp. AGP-04 produce an esterase which contains a serine residue in active site and for its activity -SH groups are essential. Besides, enzyme production was highly induced if fermentation medium contain polysaccharides and oil as carbon source.

Amit Ghati

2013-10-01

40

Crystal Structure of Bacillus stearothermophilus UvrA Provides Insight into ATP-modulated Dimerization, UvrB Interaction and DNA Binding  

Digital Repository Infrastructure Vision for European Research (DRIVER)

The nucleotide excision repair pathway corrects many structurally unrelated DNA lesions. Damage recognition in bacteria is performed by UvrA, a member of the ABC ATPase superfamily whose functional form is a dimer with four nucleotide-binding domains (NBD), two per protomer. In the 3.2-Å structure of UvrA from Bacillus stearothermophilus, we observe that the nucleotide-binding sites are formed in an intramolecular fashion and are not at the dimer interface as is typically found in other ABC ...

Pakotiprapha, Danaya; Inuzuka, Yoshihiko; Bowman, Brian R.; Moolenaar, Geri F.; Goosen, Nora; Jeruzalmi, David; Verdine, Gregory L.

2008-01-01

 
 
 
 
41

ANTIBACTERIAL ACTIVITY OF PAPAYA LEAF EXTRACTS AGAINST PATHOGENIC BACTERIA  

Directory of Open Access Journals (Sweden)

Full Text Available It was reported that the extracts of papaya leaves could inhibit the growth of Rhizopus stolonifer. Antibacterial activity of Carica papaya leaf extracts on pathogenic bacteria was observed in this study. Papaya leaves were extracted by using maceration method and three kinds of solvents: ethanol, ethyl acetate, and hexane. Papaya leaf extracts were tested against Bacillus stearothermophilus, Listeria monocytogenes, Pseudomonas sp., and Escherichia coli by agar diffusion method. The objectives of this study were to determine extract ability against pathogenic bacteria, to observe the influence of pH, NaCl, and heat on extracts ability, and to observe extract ability against B. stearothermophilus spores. The data showed that ethyl acetate extract could inhibit B. stearothermophilus, L. monocytogenes, Pseudomonas sp., and E. coli. The extract activity was influenced by pH, and it was more effective in low pH. The extract activity was influenced by NaCl against B. stearothermophillus and E. coli. However, it was not influenced by NaCl in bioassay against L. monocytogenes and Pseudomonas sp. The extract activity was influenced by heating process against all the bacteria tested. The extracts inhibited B. stearothermophilus spores as well. Papaya leaves are potential natural anti-bacteria, which might be used in certain kinds of food.

Adolf Jan Nexson Parhusip

2011-11-01

42

Characterization of a thermophilic bacteriophage of Geobacillus kaustophilus.  

Science.gov (United States)

GBK2 is a bacteriophage, isolated from a backyard compost pile, that infects the thermophile Geobacillus kaustophilus. GBK2 has a circularly permuted genome of 39,078 bp with a G+C content of 43 %. Annotation of the genome reveals 62 putative open reading frames (ORFs), 25 of which (40.3 %) show homology to known proteins and 37 of which (59.7 %) are proteins with unknown functions. Twelve of the identified ORFs had the greatest homology to genes from the phage SPP1, a phage that infects the mesophile Bacillus subtilis. The overall genomic arrangement of GBK2 is similar to that of SPP1, with the majority of GBK2 SPP1-like genes coding for proteins involved in DNA replication and metabolism. PMID:24796554

Marks, Timothy J; Hamilton, Paul T

2014-10-01

43

Cloning and DNA sequence of the gene coding for Bacillus stearothermophilus T-6 xylanase.  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Bacillus stearothermophilus T-6 produces an extracellular thermostable xylanase. Affinity-purified polyclonal serum raised against the enzyme was used to screen a genomic library of B. stearothermophilus T-6 constructed in lambda-EMBL3. Two positive phages were isolated, both containing similar 13-kb inserts, and their lysates exhibited xylanase activity. A 3,696-bp SalI-BamHI fragment containing the xylanase gene was subcloned in Escherichia coli and subsequently sequenced. The open reading ...

Gat, O.; Lapidot, A.; Alchanati, I.; Regueros, C.; Shoham, Y.

1994-01-01

44

[Characterization of a thermophilic Geobacillus strain DM-2 degrading hydrocarbons].  

Science.gov (United States)

A thermophilic Geobacillus strain DM-2 from a deep-subsurface oil reservoir was investigated on its capability of degrading crude oil under various conditions as well as its characters on degrading hydrocarbons in optimal conditions. The results showed that Geobacillus strain DM-2 was able to degrade crude oil under anoxic wide-range conditions with pH ranging from 4.0 to 10.0, high temperature in the range of 45-70 degrees C and saline concentration ranging from 0.2% to 3.0%. Furthermore, the optimal temperature and pH value for utilizing hydrocarbons by the strain were 60 degrees C and 7.0, respectively. Under such optimal conditions, the strain utilized liquid paraffine emulsified by itself as its carbon source for growth; further analysis by gas chromatography (GC) and infrared absorption spectroscopy demonstrated that it was able to degrade n-alkanes (C14-C30), branched-chain alkanes and aromatic hydrocarbons in crude oil and could also utilize long-chain n-alkanes from C16 to C36, among of which the degradation efficiency of C28 was the highest, up to 88.95%. One metabolite of the strain oxidizing alkanes is fatty acid.While utilizing C16 as carbon source for 5 d, only one fatty acid-acetic acid was detected by HPLC and MS as the product, with the amount of 0.312 g/L, which indicated that it degraded n-alkanes with pathway of inferior terminal oxidation,and then followed by a beta-oxidation pathway. Due to its characters of efficient emulsification, high-performance degradation of hydrocarbons and fatty-acid production under high temperature and anoxic condition, the strain DM-2 may be potentially applied to oil-waste treatment and microbial enhanced heavy oil recovery in extreme conditions. PMID:19256400

Liu, Qing-kun; Wang, Jun; Li, Guo-qiang; Ma, Ting; Liang, Feng-lai; Liu, Ru-lin

2008-12-01

45

Transglycosylation of neohesperidin dihydrochalcone by Bacillus stearothermophilus maltogenic amylase.  

Science.gov (United States)

Neohesperidin dihydrochalcone (NHDC), a sweet compound derived from citrus fruits, was modified to a series of its oligosaccharides by transglycosylation activity of Bacillus stearothermophilus maltogenic amylase (BSMA). Maltotriose as a donor was reacted with NHDC as an acceptor to glycosylate for the purpose of increasing the solubility of NHDC. Maltosyl-NHDC was a major transglycosylation product among the several transfer products by TLC analysis. The structure of the major transglycosylation product was determined to be maltosyl-alpha-(1,6)-neohesperidin dihydrochalcone by MALDI-TOF/MS and (1)H and (13)C NMR. Maltosyl-NHDC was 700 times more soluble in water and 7 times less sweet than NHDC. PMID:10691608

Cho, J S; Yoo, S S; Cheong, T K; Kim, M J; Kim, Y; Park, K H

2000-02-01

46

Geobacillus zalihae sp. nov., a thermophilic lipolytic bacterium isolated from palm oil mill effluent in Malaysia  

Directory of Open Access Journals (Sweden)

Full Text Available Abstract Background Thermophilic Bacillus strains of phylogenetic Bacillus rRNA group 5 were described as a new genus Geobacillus. Their geographical distribution included oilfields, hay compost, hydrothermal vent or soils. The members from the genus Geobacillus have a growth temperatures ranging from 35 to 78°C and contained iso-branched saturated fatty acids (iso-15:0, iso-16:0 and iso-17:0 as the major fatty acids. The members of Geobacillus have similarity in their 16S rRNA gene sequences (96.5–99.2%. Thermophiles harboring intrinsically stable enzymes are suitable for industrial applications. The quest for intrinsically thermostable lipases from thermophiles is a prominent task due to the laborious processes via genetic modification. Results Twenty-nine putative lipase producers were screened and isolated from palm oil mill effluent in Malaysia. Of these, isolate T1T was chosen for further study as relatively higher lipase activity was detected quantitatively. The crude T1 lipase showed high optimum temperature of 70°C and was also stable up to 60°C without significant loss of crude enzyme activity. Strain T1T was a Gram-positive, rod-shaped, endospore forming bacterium. On the basic of 16S rDNA analysis, strain T1T was shown to belong to the Bacillus rRNA group 5 related to Geobacillus thermoleovorans (DSM 5366T and Geobacillus kaustophilus (DSM 7263T. Chemotaxonomic data of cellular fatty acids supported the affiliation of strain T1T to the genus Geobacillus. The results of physiological and biochemical tests, DNA/DNA hybridization, RiboPrint analysis, the length of lipase gene and protein pattern allowed genotypic and phenotypic differentiation of strain T1T from its validly published closest phylogenetic neighbors. Strain T1T therefore represents a novel species, for which the name Geobacillus zalihae sp. nov. is proposed, with the type strain T1T (=DSM 18318T; NBRC 101842T. Conclusion Strain T1T was able to secrete extracellular thermostable lipase into culture medium. The strain T1T was identified as Geobacillus zalihae T1T as it differs from its type strains Geobacillus kaustophilus (DSM 7263T and Geobacillus thermoleovorans (DSM 5366T on some physiological studies, cellular fatty acids composition, RiboPrint analysis, length of lipase gene and protein profile.

Salleh Abu

2007-08-01

47

Enzymatic and Cryoreduction EPR Studies of the Hydroxylation of Methylated N(?)-Hydroxy-l-arginine Analogues by Nitric Oxide Synthase from Geobacillus stearothermophilus.  

Science.gov (United States)

Nitric oxide synthase (NOS) catalyzes the conversion of l-arginine to l-citrulline and NO in a two-step process involving the intermediate N(?)-hydroxy-l-arginine (NHA). It was shown that Cpd I is the oxygenating species for l-arginine; the hydroperoxo ferric intermediate is the reactive intermediate with NHA. Methylation of the N(?)-OH and N(?)-H of NHA significantly inhibits the conversion of NHA into NO and l-citrulline by mammalian NOS. Kinetic studies now show that N(?)-methylation of NHA has a qualitatively similar effect on H2O2-dependent catalysis by bacterial gsNOS. To elucidate the effect of methylating N(?)-hydroxy l-arginine on the properties and reactivity of the one-electron-reduced oxy-heme center of NOS, we have applied cryoreduction/annealing/EPR/ENDOR techniques. Measurements of solvent kinetic isotope effects during 160 K cryoannealing cryoreduced oxy-gsNOS/NHA confirm the hydroperoxo ferric intermediate as the catalytically active species of step two. Product analysis for cryoreduced samples with methylated NHA's, NHMA, NMOA, and NMMA, annealed to 273 K, show a correlation of yields of l-citrulline with the intensity of the g 2.26 EPR signal of the peroxo ferric species trapped at 77 K, which converts to the reactive hydroperoxo ferric state. There is also a correlation between the yield of l-citrulline in these experiments and kobs for the H2O2-dependent conversion of the substrates by gsNOS. Correspondingly, no detectable amount of cyanoornithine, formed when Cpd I is the reactive species, was found in the samples. Methylation of the NHA guanidinium N(?)-OH and N(?)-H inhibits the second NO-producing reaction by favoring protonation of the ferric-peroxo to form unreactive conformers of the ferric-hydroperoxo state. It is suggested that this is caused by modification of the distal-pocket hydrogen-bonding network of oxy gsNOS and introduction of an ordered water molecule that facilitates delivery of the proton(s) to the one-electron-reduced oxy-heme moiety. These results illustrate how variations in the properties of the substrate can modulate the reactivity of a monooxygenase. PMID:25251261

Davydov, Roman; Labby, Kristin Jansen; Chobot, Sarah E; Lukoyanov, Dmitriy A; Crane, Brian R; Silverman, Richard B; Hoffman, Brian M

2014-10-21

48

Effects of iron-reducing bacteria on carbon steel corrosion induced by thermophilic sulfate-reducing consortia.  

Science.gov (United States)

Four thermophilic bacterial species, including the iron-reducing bacterium Geobacillus sp. G2 and the sulfate-reducing bacterium Desulfotomaculum sp. SRB-M, were employed to integrate a bacterial consortium. A second consortium was integrated with the same bacteria, except for Geobacillus sp. G2. Carbon steel coupons were subjected to batch cultures of both consortia. The corrosion induced by the complete consortium was 10 times higher than that induced by the second consortium, and the ferrous ion concentration was consistently higher in iron-reducing consortia. Scanning electronic microscopy analysis of the carbon steel surface showed mineral films colonized by bacteria. The complete consortium caused profuse fracturing of the mineral film, whereas the non-iron-reducing consortium did not generate fractures. These data show that the iron-reducing activity of Geobacillus sp. G2 promotes fracturing of mineral films, thereby increasing steel corrosion. PMID:24225375

Valencia-Cantero, Eduardo; Peña-Cabriales, Juan José

2014-02-28

49

Cloning and expression of three ladA-type alkane monooxygenase genes from an extremely thermophilic alkane-degrading bacterium Geobacillus thermoleovorans B23.  

Science.gov (United States)

An extremely thermophilic bacterium, Geobacillus thermoleovorans B23, is capable of degrading a broad range of alkanes (with carbon chain lengths ranging between C11 and C32) at 70 °C. Whole-genome sequence analysis revealed that unlike most alkane-degrading bacteria, strain B23 does not possess an alkB-type alkane monooxygenase gene. Instead, it possesses a cluster of three ladA-type genes, ladA?B23, ladA?B23, and ladB B23, on its chromosome, whose protein products share significant amino acid sequence identities, 49.8, 34.4, and 22.7 %, respectively, with that of ladA alkane monooxygenase gene found on a plasmid of Geobacillus thermodetrificans NG 80-2. Each of the three genes, ladA?B23, ladA?B23, and ladB B23, was heterologously expressed individually in an alkB1 deletion mutant strain, Pseudomonas fluorescens KOB2?1. It was found that all three genes were functional in P. fluorescens KOB2?1, and partially restored alkane degradation activity. In this study, we suggest that G. thermoleovorans B23 utilizes multiple LadA-type alkane monooxygenases for the degradation of a broad range of alkanes. PMID:24682607

Boonmak, Chanita; Takahashi, Yasunori; Morikawa, Masaaki

2014-05-01

50

1H, 13C, and 15N backbone and side chain resonance assignments of thermophilic Geobacillus kaustophilus cyclophilin-A  

Energy Technology Data Exchange (ETDEWEB)

Cyclophilins catalyze the reversible peptidyl-prolyl isomerization of their substrates and are present across all kingdoms of life from humans to bacteria. Although numerous biological roles have now been discovered for cyclophilins, their function was initially ascribed to their chaperone-like activity in protein folding where they catalyze the often rate-limiting step of proline isomerization. This chaperone-like activity may be especially important under extreme conditions where cyclophilins are often over expressed, such as in tumors for human cyclophilins {Lee, 2010 #1167}, but also in organisms that thrive under extreme conditions, such as theromophilic bacteria. Moreover, the reversible nature of the peptidyl-prolyl isomerization reaction catalyzed by cyclophilins has allowed these enzymes to serve as model systems for probing the role of conformational changes during catalytic turnover {Eisenmesser, 2002 #20;Eisenmesser, 2005 #203}. Thus, we present here the resonance assignments of a thermophilic cyclophilin from Geobacillus kaustophilus derived from deep-sea sediment {Takami, 2004 #1384}. This thermophilic cyclophilin may now be studied at a variety of temperatures to provide insight into the comparative structure, dynamics, and catalytic mechanism of cyclophilins.

Holliday, Michael; Zhang, Fengli; Isern, Nancy G.; Armstrong, Geoffrey S.; Eisenmesser, Elan Z.

2014-04-01

51

Genome Shuffling Enhances Lipase Production of Thermophilic Geobacillus sp.  

Science.gov (United States)

Thermostable lipases are potential enzymes for biocatalytic application. In this study, the lipase production of Geobacillus sp. CF03 (WT) was improved by genome shuffling. After two rounds of genome shuffling, one fusant strain (FB1) achieved increase lipase activity from the populations generated by ultraviolet irradiation and ethyl methylsulfonate (EMS) mutagenesis. The growth rate and lipase production of FB1 increased highest by 150 and 238 %, respectively, in comparison to the wild type. The fusant enzyme had a significant change in substrate specificity but still prefers the long-chain length substrates. It had an optimum activity at 60 °C, pH at 7.0-8.0, with p-nitrophenyl palmitate (C16) as a substrate and retained about 50 % of their activity after 15 min at 70 °C, pH 8.0. Furthermore, the fusant lipase showed the preference of sesame oil, waste palm oil, and canola oil. Therefore, the genome shuffling strategy has been successful to strain improvement and selecting strain with multiple desirable characteristics. PMID:25119547

Chalopagorn, Pornchanok; Charoenpanich, Jittima; Choowongkomon, Kiattawee

2014-10-01

52

Detection and characterization of chlorinated-dioxin ether cleavage function in the bacterium geobacillus midousuji SH2B-J2  

Energy Technology Data Exchange (ETDEWEB)

As of now, there are no dioxin degrading microorganism reported that can be applied to bioremediation. The reasons for this are that degrading function acquired from comprehensive screening of bacteria that can be grown with a single carbon source using non-chlorinated dioxin does not function against highly chlorinated dioxins, and that although white rot fungus capable of degrading lignin, a plant polyphenol substance, have been reported to reduce chlorinated dioxins, degrading enzyme remain unclear. Geobacillus midousuji SH2B-J2 (J2 strain) that have been separated by Hoshina et al. have shown to reduce highly chlorinated dioxins in incineration fly ash, as well as octa-chlorinated dioxins (OCDD). However, details of its degrading mechanisms remain unclear. Since the J2 strain is capable of reducing even OCDD, it was hypothesized that the initial degradation reaction is intramolecular ether bond cleavage, so J2 strain dioxin degradation mechanism was analyzed for verification.

Otsuka, Y.; Hoshina, S. [Jikei Univ. School of Medicine, Tokyo (Japan). Dept. of Laboratory Medicine; Nakamura, M.; Hishiyama, S. [Forestry and Forest Products Research Institute, Ibaraki (Japan); Katayama, Y. [Tokyo Univ. of Agriculture and Technology, Koganei (Japan)

2004-09-15

53

alpha-Glucosidase from a strain of deep-sea Geobacillus: a potential enzyme for the biosynthesis of complex carbohydrates.  

Science.gov (United States)

An alpha-glucosidase from Geobacillus sp. strain HTA-462, one of the deepest sea bacteria isolated from the sediment of the Mariana Trench, was purified to homogeneity and estimated to be a 65-kDa protein by SDS-PAGE. At low ion strength, the enzyme exists in the homodimeric form (130 kDa). It is a thermo- and alkaline-stable enzyme with a half-life of 13.4 h and a maximum hydrolytic activity at 60 degrees C and pH 9.0 in 15 mM glycine-NaOH buffer. The enzyme exclusively hydrolyzed alpha-1,4-glycosidic linkages of oligosaccharides in an exo-type manner. The enzyme had an overwhelming transglycosylation activity and glycosylated various non-sugar molecules when maltose was used as a sugar donor. It converted maltose to isomaltose. The gene encoding the enzyme was cloned and sequenced. The recombinant enzyme could be extracellularly overproduced by Bacillus subtilis harboring its gene and preserved the primary properties of the native enzyme. Site-directed mutagenesis experiments showed that Asp98 is essential for the enzyme activity in addition to Asp199, Asp326, and Glu256. PMID:15940457

Hung, Vo Si; Hatada, Yuji; Goda, Saori; Lu, Jie; Hidaka, Yuko; Li, Zhijun; Akita, Masatake; Ohta, Yukari; Watanabe, Kenji; Matsui, Hirokazu; Ito, Susumu; Horikoshi, Koki

2005-10-01

54

ANTIBACTERIAL ACTIVITY OF PAPAYA LEAF EXTRACTS AGAINST PATHOGENIC BACTERIA  

Digital Repository Infrastructure Vision for European Research (DRIVER)

It was reported that the extracts of papaya leaves could inhibit the growth of Rhizopus stolonifer. Antibacterial activity of Carica papaya leaf extracts on pathogenic bacteria was observed in this study. Papaya leaves were extracted by using maceration method and three kinds of solvents: ethanol, ethyl acetate, and hexane. Papaya leaf extracts were tested against Bacillus stearothermophilus, Listeria monocytogenes, Pseudomonas sp., and Escherichia coli by agar diffusion method. The objective...

Adolf Jan Nexson Parhusip; Jessica Karina; Elisa Friska Romasi

2011-01-01

55

Cloning and sequencing of a cellobiose phosphotransferase system operon from Bacillus stearothermophilus XL-65-6 and functional expression in Escherichia coli.  

Science.gov (United States)

Cellulolytic strains of Bacillus stearothermophilus were isolated from nature and screened for the presence of activities associated with the degradation of plant cell walls. One isolate (strain XL-65-6) which exhibited strong activities with 4-methylumbelliferyl-beta-D-glucopyranoside (MUG) and 4-methylumbelliferyl-beta-D-cellobiopyranoside (MUC) was used to construct a gene library in Escherichia coli. Clones degrading these model substrates were found to encode the cellobiose-specific genes of the phosphoenolpyruvate-dependent phosphotransferase system (PTS). Both MUG and MUC activities were present together, and both activities were lost concurrently during subcloning experiments. A functional E. coli ptsI gene was required for MUC and MUG activities (presumably a ptsH gene also). The DNA fragment from B. stearothermophilus contained four open reading frames which appear to form a cel operon. Intergenic stop codons for celA, celB, and celC overlapped the ribosomal binding sites of the respective downstream genes. Frameshift mutations or deletions in celA, celB, and celD were individually shown to result in a loss of MUC and MUG activities. On the basis of amino acid sequence homology and hydropathy plots of translated sequences, celA and celB were identified as encoding PTS enzyme II and celD was identified as encoding PTS enzyme III. These translated sequences were remarkably similar to their respective E. coli homologs for cellobiose transport. No reported sequences exhibited a high level of homology with the celC gene product. The predicted carboxy-terminal region for celC was similar to the corresponding region of E. coli celF, a phospho-beta-glucosidase. An incomplete regulatory gene (celR) and proposed promoter sequence were located 5' to the proposed cel operon. A stem-loop resembling a rho-independent terminator was present immediately downstream from celD. These results indicate that B. stearothermophilus XL-65-6 contains a cellobiose-specific PTS for cellobiose uptake. Similar systems may be present in other gram-positive bacteria. PMID:8407820

Lai, X; Ingram, L O

1993-10-01

56

Biotransformation of eugenol via protocatechuic acid by thermophilic Geobacillus sp. AY 946034 strain.  

Science.gov (United States)

The metabolic pathway of eugenol degradation by thermophilic Geobacillus sp. AY 946034 strain was analyzed based on the lack of data about eugenol degradation by thermophiles. TLC, GC-MS, and biotransformation with resting cells showed that eugenol was oxidized through coniferyl alcohol, and ferulic and vanillic acids to protocatechuic acid before the aromatic ring was cleaved. The cell-free extract of Geobacillus sp. AY 946034 strain grown on eugenol showed a high activity of eugenol hydroxylase, feruloyl-CoA synthetase, vanillate-O-demethylase, and protocatechuate 3,4-dioxygenase. The key enzyme, protocatechuate 3,4- dioxygenase, which plays a crucial role in the degradation of various aromatic compounds, was purified 135-fold to homogeneity with a 34% overall recovery from Geobacillus sp. AY 946034. The relative molecular mass of the native enzyme was about 450 ± 10 kDa and was composed of the non-identical subunits. The pH and temperature optima for enzyme activity were 8 and 60°C, respectively. The half-life of protocatechuate 3,4-dioxygenase at the optimum temperature was 50 min. PMID:24375415

Giedraityte, Gražina; Kal?dien?, Lilija

2014-04-01

57

Production and Characterization of a Mesophilic Lipase Isolated from Bacillus stearothermophilus AB-1  

Directory of Open Access Journals (Sweden)

Full Text Available Using Bacillus stearothermophilus AB-1 isolated from air, the production of lipase was attempted along with its purification and characterization studies. When different carbon and nitrogen sources were supplemented in the culture medium, xylose, tryptophan, alanine, phenylalanine and potassium nitrate were found to be the best. During cultivation, the strain secreted most of its lipase content after 48 h. In particular, the lipase produced in the culture broth showed 300 U mL-1 when cultivated at optimal temperature and pH of 35 °C and 7.5, respectively. The enzyme was purified using 60% ammonium sulfate precipitation and sephadex G200 column chromatography. The enzyme was stable up to 40 °C and in the range of pH 7-8. This research reports for the first time the characterization of mesophilic lipase from Bacillus stearothermophilus AB-1 isolated from air.

Emad Abd El-moniem Abada

2008-01-01

58

A novel levansucrase-levanase gene cluster in Bacillus stearothermophilus ATCC12980.  

Science.gov (United States)

A 3.1 kb fragment of Bacillus stearothermophilus ATCC12980 DNA permitted growth of Escherichia coli on sucrose. The fragment encoded genes for a levansucrase (surB) and also a levanase (surC). SurB and SurC shared 97% and 43% amino acid identity with the corresponding SacB and SacC proteins of Bacillus subtilis, whose sacB and sacC genes are organised very differently. PMID:9349714

Li, Y; Triccas, J A; Ferenci, T

1997-09-12

59

Tyrosine quenching of tryptophan phosphorescence in glyceraldehyde-3-phosphate dehydrogenase from Bacillus stearothermophilus.  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Tyrosine is known to quench the phosphorescence of free tryptophan derivatives in solution, but the interaction between tryptophan residues in proteins and neighboring tyrosine side chains has not yet been demonstrated. This report examines the potential role of Y283 in quenching the phosphorescence emission of W310 of glyceraldehyde-3-phosphate dehydrogenase from Bacillus stearothermophilus by comparing the phosphorescence characteristics of the wild-type enzyme to that of appositely designe...

Strambini, G. B.; Gabellieri, E.; Gonnelli, M.; Rahuel-clermont, S.; Branlant, G.

1998-01-01

60

Evaluation of a Bacillus stearothermophilus tube test as a screening tool for anticoccidial residues in poultry  

Digital Repository Infrastructure Vision for European Research (DRIVER)

A Bacillus stearothermophilus var. calidolactis C953 tube test was evaluated for its ability in detecting the residue of selected anticoccidial drugs in poultry, specically sulfamethazine, furazolidone, and amprolium. Various concentrations of each drug were injected into chicken liver and kidney tissues and these tissues were tested to determine the drug detection limits for each drug. The detection limit was defined as the drug concentration at which 95% of the test results were interpreted...

Shitandi, Anakalo; Oketch, Aila; Mahungu, Symon

2006-01-01

 
 
 
 
61

Bacillus stearothermophilus Neopullulanase Selective Hydrolysis of Amylose to Maltose in the Presence of Amylopectin  

Digital Repository Infrastructure Vision for European Research (DRIVER)

The specificity of Bacillus stearothermophilus TRS40 neopullulanase toward amylose and amylopectin was analyzed. Although this neopullulanase completely hydrolyzed amylose to produce maltose as the main product, it scarcely hydrolyzed amylopectin. The molecular mass of amylopectin was decreased by only one order of magnitude, from approximately 108 to 107 Da. Furthermore, this neopullulanase selectively hydrolyzed amylose when starch was used as a substrate. This phenomenon, efficient hydroly...

Kamasaka, Hiroshi; Sugimoto, Kazuhisa; Takata, Hiroki; Nishimura, Takahisa; Kuriki, Takashi

2002-01-01

62

Overexpression and characterization of dimeric and tetrameric forms of recombinant serine hydroxymethyltransferase from Bacillus stearothermophilus  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Serine hydroxymethyltransferase (SHMT), a pyridoxal-5'-phosphate (PLP) dependent enzyme catalyzes the interconversion of L-Ser and Gly using tetrahydrofolate as a substrate. The gene encoding for SHMT was amplified by PCR from genomic DNA of Bacillus stearothermophilus and the PCR product was cloned and overexpressed in Escherichia coli. The purified recombinant enzyme was isolated as a mixture of dimer (90%) and tetramer (10%). This is the first report demonstrating the existence of SHMT as ...

Jala, Venkatakrishna R.; Prakash, V.; Rao, Appaji N.; Savithri, Hs

2002-01-01

63

Reproduction of Bacillus stearothermophilus as a Function of Temperature and Pressure  

Digital Repository Infrastructure Vision for European Research (DRIVER)

The colony-forming ability and the rate of reproduction of Bacillus stearothermophilus were determined as a function of temperature and pressure. Colonies were formed between 39 and 70°C at atmospheric pressure and between 54 and 67°C at 45 MPa. Colonies did not form at 55.9 MPa. The rate of reproduction in broth cultures decreased with increasing pressure at all temperatures. The rate of reproduction diminished rapidly with pressure above 10.4 MPa. Therefore, increased hydrostatic pressure...

Yayanos, A. Aristides; Boxtel, R.; Dietz, Allan S.

1983-01-01

64

Influence of Bacillus Stearothermophilus generations in the production of its spores  

Directory of Open Access Journals (Sweden)

Full Text Available The validation of sterilization processes in food and pharmaceutical industries is a major tool for quality assurance, making the products safe, effective and reliable. Biological indicators, formed by spores of Bacillus stearothermophilus microorganisms considered at higher thermal resistance, are used to evaluate and monitor the physical parameters of a cycle of steam sterilization. In this way this study aimed to cultivate and characterize the microorganism Bacillus stearothermophilus generations, assessing the influence of these generations in the parameters of resistance, formation and concentration of its spores to be used in the production of biological indicators. The experiments were conducted cultivating the 1st, 2nd and 3rd generations of B. stearothermophilus in suitable culture media for sporulation, in Roux bottles, for a period of 15 days of incubation. During these 15 days, the sporulation process was evaluated by microscopy, according to Wirtz-Conklin's method, every 24 hours of incubation. The results showed that the generations do influence the sporulation process, indicating that the 3rd generation is the most suitable for the production of formed spores, in concentration and thermal resistance appropriate characteristics to the needs of a biological indicator to efficiently validate and monitor steam sterilization cycles.

Heron Oliveira dos Santos Lima

2011-04-01

65

Cloning, sequencing, and overexpression of genes for ribosomal proteins from Bacillus stearothermophilus.  

Science.gov (United States)

Although a low resolution model for the arrangement of the proteins of the small and large ribosomal subunits is known, a detailed mechanistic understanding of the function of the ribosome awaits a high resolution structure of its components. While crystals have been obtained of several ribosomal proteins from Bacillus stearothermophilus, determination of atomic resolution structures of these proteins is impeded by the difficulty of obtaining large amounts of native proteins for crystallographic or NMR studies. We describe here the cloning and overexpression in Escherichia coli of the genes for ribosomal proteins S5, L6, L9, and L18 from B. stearothermophilus. S5 is extremely toxic to E. coli when overexpressed, and we have taken advantage of a new tightly regulated expression system to obtain high yields (more than 100 mg of pure protein/liter of culture) of this protein. The B. stearothermophilus S5 produced in E. coli crystallizes, and the crystals are identical to those obtained from the native protein. The crystals diffract to 2-A resolution. PMID:1985969

Ramakrishnan, V; Gerchman, S E

1991-01-15

66

Structure based protein engineering of Bacillus stearothermophilus {alpha}-amylase: toward a new substrate specificity  

Energy Technology Data Exchange (ETDEWEB)

Full text. Structural similarity is observed in all members of {alpha}-amylase family but different products are generated during hydrolysis of starch due to different affinities for intermediate dextrins. In order to understand the structural determinants for this property and to introduce different specificity to {alpha}-amylase of Bacillus stearothermophilus we intend to solve the three dimensional structure by X-ray crystallography of the native protein by using synchrotron radiation at Brazilian National Synchrotron Light Laboratory (LNLS). Protein was over expressed in E. coli, purified and crystallization experiments were carried out by using sparse matrix Crystal Screen and Crystal Screen II from Hampton Research (Laguna Hills, CA, USA). Several condition have produced crystals with some defined characteristic: MDP seems to be important to the crystallization: the preferential pH is around 7.5 with organic buffer (HEPES); organic solvent as 2-propanol seems to be also important for the crystallization. On those condition crystals appeared as cluster of needles or small crystals with high number of nucleation. New conditions are being prepared to improve the site and quality of crystals. Data collection of native of Bacillus stearothermophilus {alpha}-amylase will e done at Protein Crystallography Station at LNLS. Crystal structure of mutated {alpha}-amylase bu site direct mutagenesis of residues suggested by the native crystal structure will be obtained. Co-crystallization of Bacillus stearothermophilus {alpha}-amylase and oligosaccharide will be carried out to identify residues involved in the binding site to plan new mutation. In another series of mutation the putative binding site residues, once identified, will be mutated to residues observed in TAKA amylase to confer different specificity to {alpha}-amylase. Based on the available TAKA amylase structure, in the primary sequence homology and in the three dimensional model of Bacillus stearothermophilus {alpha}-amylase (using Bacillus licheniformis crystal structure as initial model) it seems that Bacillus stearothermophilus {alpha}-amylase binding site is more complex with and insertion of 40 residues. Therefore the three dimensional structure is crucial to understand the specificity of the substrate of this enzyme which will be used to drive the design of mutation to introduce new properties for industrial purpose. (author)

Rasera, Ana Claudia [Sao Paulo Univ., SP (Brazil). Inst. de Ciencias Biomedicas; Iulek, Jorge [Universidade Estadual de Ponta Grossa, PR (Brazil). Inst. de Quimica; Delboni, Luis Fernando; Barbosa, Valma Martins Barbosa [Parana Univ., Curitiba, PR (Brazil). Dept. de Bioquimica

1997-12-31

67

Cloning, expression, purification, crystallization and preliminary X-ray crystallographic study of DHNA synthetase from Geobacillus kaustophilus  

Science.gov (United States)

The aerobic Gram-positive bacterium Geobacillus kaustophilus is a bacillus species that was isolated from deep-sea sediment from the Mariana Trench. 1,4-­Dihydroxy-2-naphthoate (DHNA) synthetase plays a vital role in the biosynthesis of menaquinone (vitamin K2) in this bacterium. DHNA synthetase from Geobacillus kaustophilus was crystallized in the orthorhombic space group C2221, with unit-cell parameters a = 77.01, b = 130.66, c = 131.69?Å. The crystal diffracted to a resolution of 2.2?Å. Preliminary studies and molecular-replacement calculations reveal the presence of three monomers in the asymmetric unit. PMID:17277450

Kanaujia, Shankar Prasad; Ranjani, Chellamuthu Vasuki; Jeyakanthan, Jeyaraman; Baba, Seiki; Kuroishi, Chizu; Ebihara, Akio; Shinkai, Akeo; Kuramitsu, Seiki; Shiro, Yoshitsugu; Sekar, Kanagaraj; Yokoyama, Shigeyuki

2007-01-01

68

Cloning, expression, purification, crystallization and preliminary X-ray crystallographic study of DHNA synthetase from Geobacillus kaustophilus.  

Science.gov (United States)

The aerobic Gram-positive bacterium Geobacillus kaustophilus is a bacillus species that was isolated from deep-sea sediment from the Mariana Trench. 1,4-Dihydroxy-2-naphthoate (DHNA) synthetase plays a vital role in the biosynthesis of menaquinone (vitamin K(2)) in this bacterium. DHNA synthetase from Geobacillus kaustophilus was crystallized in the orthorhombic space group C222(1), with unit-cell parameters a = 77.01, b = 130.66, c = 131.69 A. The crystal diffracted to a resolution of 2.2 A. Preliminary studies and molecular-replacement calculations reveal the presence of three monomers in the asymmetric unit. PMID:17277450

Kanaujia, Shankar Prasad; Ranjani, Chellamuthu Vasuki; Jeyakanthan, Jeyaraman; Baba, Seiki; Kuroishi, Chizu; Ebihara, Akio; Shinkai, Akeo; Kuramitsu, Seiki; Shiro, Yoshitsugu; Sekar, Kanagaraj; Yokoyama, Shigeyuki

2007-02-01

69

Purification and characterization of a thermostable phytate resistant alpha-amylase from Geobacillus sp. LH8.  

Science.gov (United States)

A thermophilic and amylolytic bacterium (LH8) was isolated from the hot spring of Larijan in Iran at 65 degrees C. Identification of strain LH8 by 16S rDNA sequence analysis showed that LH8 strain belongs to the Geobacillus sp. with 99% sequence similarity with the 16S rDNA of Geobacillus thermodenitrificans. A new alpha-amylase (GA) was extracted from this strain and purified by ion-exchange chromatography. SDS-PAGE showed a single band with an apparent molecular mass of 52kDa. The optimum temperature and pH were 80 degrees C and 5-7, respectively. In the presence of Mn2+, Ca2+, K+, Cr3+ and Al3+, the enzyme activity was stimulated while Mg2+, Ba2+, Ni2+, Zn2+, Fe3+, Cu2+ and EDTA reduced the activity. The K(m) and V(max) values for starch were 3 mg ml(-1) and 6.5 micromol min(-1), respectively. The gene encoding alpha-amylase was isolated and the amino acid sequence was deduced. Comparison of GA and other alpha-amylase amino acid sequences suggested that GA has conserved regions that were previously identified in alpha-amylase family but GA exhibited some substitutions in the sequence. Its phytate resistant is an important property of this enzyme. 5 and 10 mM phytic acid did not inhibit this enzyme. Therefore, features of phytate resistant alpha-amylase from Geobacillus sp. LH8 are discussed. PMID:19874846

Mollania, Nasrin; Khajeh, Khosro; Hosseinkhani, Saman; Dabirmanesh, Bahareh

2010-01-01

70

Structure of the hypothetical DUF1811-family protein GK0453 from Geobacillus kaustophilus HTA426  

Science.gov (United States)

The crystal structure of a conserved hypothetical protein, GK0453, from Geobacillus kaustophilus has been determined to 2.2?Å resolution. The crystal belonged to space group P43212, with unit-cell parameters a = b = 75.69, c = 64.18?Å. The structure was determined by the molecular-replacement method and was refined to a final R factor of 22.6% (R free = 26.3%). Based on structural homology, the GK0453 protein possesses two independent binding sites and hence it may simultaneously interact with two proteins or with a protein and a nucleic acid. PMID:23545635

Padmanabhan, Balasundaram; Nakamura, Yoshihiro; Antonyuk, Svetlana V.; Strange, Richard W.; Hasnain, S. Samar; Yokoyama, Shigeyuki; Bessho, Yoshitaka

2013-01-01

71

Molecular characterization of the Bacillus stearothermophilus PV72 S-layer gene sbsB induced by oxidative stress.  

Digital Repository Infrastructure Vision for European Research (DRIVER)

S-layer protein variation from a hexagonally ordered (SbsA; 130 kDa) to a obliquely ordered (SbsB; 98 kDa) protein in Bacillus stearothermophilus PV72 is mediated by an increased oxygen supply. To elucidate the molecular basis of S-layer protein variation in B. stearothermophilus PV72, the sbsB gene, coding for the 98-kDa protein, was cloned by means of inverse PCR technology and sequenced. The sbsB coding region cloned in pUC18 was expressed in Escherichia coli, without its own regulatory up...

Kuen, B.; Koch, A.; Asenbauer, E.; Sara?, M.; Lubitz, W.

1997-01-01

72

Electron transfer kinetics of caa3 oxidase from Bacillus stearothermophilus: a hypothesis for thermophilicity.  

Digital Repository Infrastructure Vision for European Research (DRIVER)

The O2 reaction and the reverse electron transfer of the thermophilic caa3 terminal oxidase of Bacillus stearothermophilus have been studied by laser flash-photolysis. The results show that both reactions, although studied at a temperature of 20 degreesC, far from the optimal temperature of > 60 degreesC for caa3, follow a kinetic behavior essentially identical to that observed with the electrostatic complex between mammalian cyt c and cyt c oxidase. In the O2 reaction cyt a and cyt a3 are ve...

Giuffre?, A.; Watmough, N. J.; Giannini, S.; Brunori, M.; Konings, W. N.; Greenwood, C.

1999-01-01

73

Highly active metallocarboxypeptidase from newly isolated Geobacillus strain SBS-4S: cloning and characterization.  

Science.gov (United States)

The carboxypeptidase gene from Geobacillus SBS-4S was cloned and sequenced. The sequence analysis displayed the gene consists of an open reading frame of 1503 nucleotides encoding a protein of 500 amino acids (CBP(SBS)). The amino acid sequence comparison revealed that CBP(SBS) exhibited a highest homology of 41.6% (identity) with carboxypeptidase Taq from Thermus aquaticus among the characterized proteases. CBP(SBS) contained an active site motif (265)HEXXH(269) which is conserved in family-M32 of carboxypeptidases. The gene was expressed with His-Tag utilizing Escherichia coli expression system and purified to apparent homogeneity. The purified CBP(SBS) showed highest activity at pH 7.5 and 70°C. The enzyme activity was metal ion dependent. Among metal ions highest activity was found in the presence of Co(2+). Thermostability studies of CBP(SBS) by circular dichroism spectroscopy demonstrated the melting temperature of the protein around 77°C. The enzyme exhibited K(m) and V(max) values of 14 mM and 10526 ?mol min(-1) mg(-1) when carbobenzoxy-alanine-arginine was used as substrate. k(cat) and k(cat)/K(m) valves were 10175 s(-1) and 726 mM(-1) s(-1). To our knowledge this is the highest ever reported enzyme activity of a metallocarboxypeptidase and the first characterization of a metallocarboxypeptidase from genus Geobacillus. PMID:21126910

Tayyab, Muhammad; Rashid, Naeem; Angkawidjaja, Clement; Kanaya, Shigenori; Akhtar, Muhammad

2011-03-01

74

Homologi Gen Seleno Metiltransferase (smt pada Geobacillus sp. 20k dengan smt Astragalus bisulcatus  

Directory of Open Access Journals (Sweden)

Full Text Available Methylselenocysteine (MSC is the most effective form of selenium against cancer. The synthesis of MSC is catalyzed by seleno methyltransferase (smt through selenium methylation as its detoxification mechanism. Gene of smt has been characterized in selenium rich plant, Astragalus bisulcatus. This experimental laboratoric study was done on Geobacillus sp. 20k. at Lembaga Ilmu Pengetahuan Indonesia (LIPI, Cibinong, Bogor, November 2008–June 2009.Target gene was detected by polymerase chain reaction and sequencing. DNA sequence was analyzed by the basic local alignment search tool (BLAST. The results showed that smt gene and its homolog were generally found on selenium rich plants, such as A. bisulcatus, C. sinensis, and A. thaliana, with similarity more than 85%. Designed primers for amplification of smt are CAAGCCACCATTCAAGGTTT and CCCTACTGATCCCGCAATTA. Amplification of DNA fragments obtained at approximately 190 base pair. DNA sequence and its protein translation were identified as part of the thermophilic enzyme and smt of A. bisulcatus, with 83% similarity for smt genes and 88–90% for protein. In conclusion, Geobacillus sp. 20k have smt genes similar with that of A. bisulcatus, therefore further development of this isolate as a non toxic selenium source for cancer therapy could be taken into consideration.

Evi Triana

2010-09-01

75

Effect of ionization and nisin on the Bacillus strains and Salmonella Enteritidis inoculated Stearothermophilus  

International Nuclear Information System (INIS)

The antimicrobial effect of nisin (at 1000UI/g), and irradiation (at 1, 3 and 5kGy), against the growth of Salmonella enteritidis (106 ufc/ml) and Bacillus Stearothermophilus (106 ufc/ml), inoculated in turkey salami, was studied during storage at 4 degree for 21 days. Treatment of turkey salami with nisin at 1000UI/g did not show any antimicrobial activity against S. Enteritidis with 6.7 pour cent and 0.8 pour cent of reduction after 0 and 21 days of storage respectively, and seems to be insufficient to inhibit B. Stearothermophilus with 23 pour cent and 21 pour cent of reduction after 0 and 21 days of storage respectively. Antimicrobial activities of irradiation were better and proportional to irradiation doses; it shows a reduction of 27 pour cent, 55 pour cent and 67 pour cent by D1, D2 and D3 respectively. The combination of nisin with irradiation at 5kGy showed stronger antimicrobial activities than those obtained by its combination with the first and the second irradiation dose.

76

Characterization of two long-chain fatty acid CoA ligases in the Gram-positive bacterium Geobacillus thermodenitrificans NG80-2.  

Science.gov (United States)

The functions of two long-chain fatty acid CoA ligase genes (facl) in crude oil-degrading Geobacillus thermodenitrificans NG80-2 were characterized. Facl1 and Facl2 encoded by GTNG_0892 and GTNG_1447 were expressed in Escherichia coli and purified as His-tagged fusion proteins. Both enzymes utilized a broad range of fatty acids ranging from acetic acid (C(2)) to melissic acid (C(30)). The most preferred substrates were capric acid (C(10)) for Facl1 and palmitic acid (C(16)) for Facl2, respectively. Both enzymes had an optimal temperature of 60°C, an optimal pH of 7.5, and required ATP as a cofactor. Thermostability of the enzymes and effects of metal ions, EDTA, SDS and Triton X-100 on the enzyme activity were also investigated. When NG80-2 was cultured with crude oil rather than sucrose as the sole carbon source, upregulation of facl1 and facl2 mRNA was observed by real time RT-PCR. This is the first time that the activity of fatty acid CoA ligases toward long-chain fatty acids up to at least C(30) has been demonstrated in bacteria. PMID:22694860

Dong, Yanpeng; Du, Huiqian; Gao, Chunxu; Ma, Ting; Feng, Lu

2012-12-20

77

Determination of thermobacteriological parameters and size of Bacillus stearothermophilus ATCC 7953 spores / Determinação dos parâmetros de destruição térmica e dimensões de esporos de Bacillus stearothermophilus ATCC 7953  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Este experimento objetivou determinar os parâmetros de destruição térmica de esporos de Bacillus stearothermophilus ATCC 7953 e a estimativa de suas dimensões. Os esporos foram suspensos em solução salina e em mistura de grãos de milho e soja moídos, distribuídos em tubos TDT, e submetidos ao calor [...] por tempo variável, seguido de incubação e contagem direta. Determinou-se o valor D (tempo necessário para redução da viabilidade do micro-organismo em 1 ciclo logarítmico sob determinada temperatura) e o valor z (intervalo de temperatura que ocasiona variação de 10 vezes no valor D). Os esporos suspensos em solução salina foram observados em microscópio eletrônico de varredura, para estimativa das dimensões. Os valores de D121,1 ºC e z para os esporos suspensos em solução salina foram 8,8 minutos e 12,8 ºC, respectivamente. Para aqueles suspensos em mistura milho e soja, D121,1 ºC e z foram 14,2 minutos e 23,7 ºC, respectivamente. As micrografias indicaram que os esporos apresentam-se como bastonetes, homogêneos em forma e dimensão, com comprimento e diâmetro estimados em 2 e 1 µm, respectivamente. Os resultados confirmam a elevada resistência térmica do esporo e indicam que este é um bom indicador biológico para avaliação do processo de extrusão como esterilizante de alimentos. Abstract in english In order to determine thermobacteriological parameters for B. stearothermophilus spores, they were diluted in a saline solution medium and in ground corn-soybean mix, distributed in TDT tube, and submitted to heat for a specific period of time. The D value (time to reduce 1 log cycle of microbial co [...] unt under a certain temperature) and z value (variation of temperature to cause 10-fold change in D value) were estimated. To estimate their dimensions, the spores were visualized by using a scanning electron microscope. D121.1 ºC and z values for these spores, as determined in the saline solution, were 8.8 minutes and 12.8 ºC, respectively. D121,1 ºC and z values determined in the corn-soy mix were 14.2 minutes and 23.7 ºC, respectively. The micrographs indicated that the spores have homogeneous shape and size, with length and diameter of 2 and 1 µm, respectively. These results confirm that the spore is highly thermal-resistant, and it is a good biological indicator to evaluate the extrusion process as a feed sterilizer.

Marcos, Fraiha; Antonio Carlos de Oliveira, Ferraz; João Domingos, Biagi.

1041-10-01

78

Modular system for assessment of glycosyl hydrolase secretion in Geobacillus thermoglucosidasius.  

Science.gov (United States)

The facultatively anaerobic, thermophilic bacterium Geobacillus thermoglucosidasius is being developed as an industrial micro-organism for cellulosic bioethanol production. Process improvement would be gained by enhanced secretion of glycosyl hydrolases. Here we report the construction of a modular system for combining promoters, signal peptide encoding regions and glycosyl hydrolase genes to facilitate selection of the optimal combination in G. thermoglucosidasius. Initially, a minimal three-part E. coli-Geobacillus sp. shuttle vector pUCG3.8 was constructed using Gibson isothermal DNA assembly. The three PCR amplicons contained the pMB1 E. coli origin of replication and multiple cloning site (MCS) of pUC18, the Geobacillus sp. origin of replication pBST1 and the thermostable kanamycin nucleotidyltransferase gene (knt), respectively. G. thermoglucosidasius could be transformed with pUCG3.8 at an increased efficiency [2.8×10(5) c.f.u. (µg DNA)(-1)] compared to a previously reported shuttle vector, pUCG18. A modular cassette for the inducible expression and secretion of proteins in G. thermoglucosidasius, designed to allow the simple interchange of parts, was demonstrated using the endoglucanase Cel5A from Thermotoga maritima as a secretion target. Expression of cel5A was placed under the control of a cellobiose-inducible promoter (P?glu) together with a signal peptide encoding sequence from a G. thermoglucosidasius C56-YS93 endo-?-1,4-xylanase. The interchange of parts was demonstrated by exchanging the cel5A gene with the 3' region of a gene with homology to celA from Caldicellulosiruptor saccharolyticus and substituting P?glu for the synthetic, constitutive promoter PUp2n38, which increased Cel5A activity five-fold. Cel5A and CelA activities were detected in culture supernatants indicating successful expression and secretion. N-terminal protein sequencing of Cel5A carrying a C-terminal FLAG epitope confirmed processing of the signal peptide sequence. PMID:23704786

Bartosiak-Jentys, Jeremy; Hussein, Ali H; Lewis, Claire J; Leak, David J

2013-07-01

79

Kasugamycin resistant mutants of Bacillus stearothermophilus lacking the enzyme for the methylation of two adjacent adenosines in 16S ribosomal RNA.  

Science.gov (United States)

Several mutants of B. stearothermophilus have been isolated that are resistant to the antibiotic kasugamycin. One of these is shown to lack dimethylation of two adjacent adenosines in the 16S ribosomal RNA. All mutants that were analyzed biochemically lack the enzyme that is able to methylate this site. Ribosomal sensitivity and resistance to kasugamycin in B. stearothermophilus is therefore, like in E. coli, closely connected with dimethylation of the adenosines. PMID:6575236

Van Buul, C P; Damm, J B; Van Knippenberg, P H

1983-01-01

80

Bacillus stearothermophilus neopullulanase selective hydrolysis of amylose to maltose in the presence of amylopectin.  

Science.gov (United States)

The specificity of Bacillus stearothermophilus TRS40 neopullulanase toward amylose and amylopectin was analyzed. Although this neopullulanase completely hydrolyzed amylose to produce maltose as the main product, it scarcely hydrolyzed amylopectin. The molecular mass of amylopectin was decreased by only one order of magnitude, from approximately 10(8) to 10(7) Da. Furthermore, this neopullulanase selectively hydrolyzed amylose when starch was used as a substrate. This phenomenon, efficient hydrolysis of amylose but not amylopectin, was also observed with cyclomaltodextrinase from alkaliphilic Bacillus sp. strain A2-5a and maltogenic amylase from Bacillus licheniformis ATCC 27811. These three enzymes hydrolyzed cyclomaltodextrins and amylose much faster than pullulan. Other amylolytic enzymes, such as bacterial saccharifying alpha-amylase, bacterial liquefying alpha-amylase, beta-amylase, and neopullulanase from Bacillus megaterium, did not exhibit this distinct substrate specificity at all, i.e., the preference of amylose to amylopectin. PMID:11916682

Kamasaka, Hiroshi; Sugimoto, Kazuhisa; Takata, Hiroki; Nishimura, Takahisa; Kuriki, Takashi

2002-04-01

 
 
 
 
81

Preliminary X-ray crystallographic analysis of a novel maltogenic amylase from Bacillus stearothermophilus ET1.  

Science.gov (United States)

A novel maltogenic amylase from Bacillus stearothermophilus ET1, which has a dual activity of alpha-1,4- and alpha-1,6-glycosidic bond cleavages and alpha-1,6-glycosidic bond formation, was crystallized by using the hanging-drop vapor-diffusion method. The best crystals were obtained by employing a high concentration of protein (56 mg ml-1) and a precipitant containing 22% glycerol, 1.6 M ammonium sulfate in 0.1 M Tris-HCl (pH 8.5). Native diffraction data to 2.66 A resolution have been obtained from crystals flash-frozen at 110 K. The crystals belong to the space group P212121 with unit-cell dimensions of a = 77.62, b = 121.23, c = 244. 29 A, and contain three or four protomers per asymmetric unit. Structure determination by multiple isomorphous replacement is in progress. PMID:9761914

Cho, M J; Cha, S S; Park, J H; Cha, H J; Lee, H S; Park, K H; Oh, B H

1998-05-01

82

Transglycosylation of naringin by Bacillus stearothermophilusMaltogenic amylase to give glycosylated naringin.  

Science.gov (United States)

Naringin, a bitter compound in citrus fruits, was transglycosylated by Bacillus stearothermophilus maltogenic amylase reaction with maltotriose to give a series of mono-, di-, and triglycosylnaringins. Glycosylation products of naringin were observed by TLC and HPLC. The major glycosylation product was purified by using a Sephadex LH-20 column. The sturcture was determined by using MALDI-TOF MS, methylation analysis, and (1)H and (13)C NMR. The major transglycosylation product was maltosylnaringin, in which the maltose unit was attached by an alpha-1-->6 glycosidic linkage to the D-glucose moiety of naringin. This product was 250 times more soluble in water and 10 times less bitter than naringin. PMID:10552702

Lee, S J; Kim, J C; Kim, M J; Kitaoka, M; Park, C S; Lee, S Y; Ra, M J; Moon, T W; Robyt, J F; Park, K H

1999-09-01

83

Bleach-boosting effect of crude xylanase from Bacillus stearothermophilus SDX on wheat straw pulp.  

Science.gov (United States)

Pretreatment of wheat straw pulp using cellulase-free xylanase produced from Bacillus stearothermophilus SDX at 60°C for 120min resulted in 4.75% and 22.31% increase in brightness and whiteness, respectively. Enzyme dose of 10U/g of oven dried pulp at pH 9 decreased the kappa number and permanganate number by 7.14% and 5.31%, respectively. Further chlorine dioxide and alkaline bleaching sequences (CDED(1)D(2)) resulted in 1.76% and 3.63% increase in brightness and whiteness, respectively. Enzymatic prebleaching of pulp decreased 20% of chlorine consumption without any decrease in brightness. Improvement in various pulp properties like viscosity, burst factor, burstness, breaking length, double fold, gurley porosity, tear factor, and tearness were also observed after bleaching of xylanase treated wheat straw pulp. PMID:20709630

Garg, Gaurav; Dhiman, Saurabh Sudha; Mahajan, Ritu; Kaur, Amanjot; Sharma, Jitender

2011-01-31

84

[Isolation, purification and properties of restrictase and methylase BstN1 from Bacillus stearothermophilus].  

Science.gov (United States)

Restriction-methylation enzymes BstN1 from Bacillus stearothermophilus were isolated and purified. These enzymes are related to a new class of restriction-methylation enzymes of the second type, whose modifying component is N4-cytosine-DNA-methylase. Both enzymes recognize the DNA sequence CC(A/T)GG. Restrictase BstN1 is a protein made up of one subunit with a molecular mass of 25 kDa. The molecular mass of native DNA-methylase BstN1 is about 55 kDa. The temperature optima for restrictase and methylase BstN1 are around 60 degrees C. Possible uses of BstN1 restriction-methylation enzymes for the analysis of cytosine methylation in bacterial and higher plant DNA are discussed. PMID:2627557

Baryshev, M M; Bur'ianov, Ia I; Kosykh, V G; Baev, A A

1989-11-01

85

The solution structure of ribosomal protein L18 from Bacillus stearothermophilus.  

Science.gov (United States)

A medium resolution solution structure has been obtained for L18 from Bacillus stearothermophilus (BstL18), a ribosomal protein that stabilizes the tertiary structure of 5S rRNA and mediates its interaction with the rest of the large subunit. The N-terminal 22 amino acid residues of BstL18 are unstructured in solution. Its remaining 98 residues form a globular domain that has the same topology as the globular domains of other L18s, but the orientation of helices is different. This conformational peculiarity should not prevent BstL18 from functioning in the ribosome the same way as other L18s. PMID:14687565

Turner, Catherine F; Moore, Peter B

2004-01-16

86

Graphical Procedure for Comparing Thermal Death of Bacillus stearothermophilus Spores in Saturated and Superheated Steam  

Science.gov (United States)

The thermal death curve of dried spores of Bacillus stearothermophilus in saturated steam was characterized by three phases: (i) a sharp initial rise in viable count; (ii) a low rate of death which gradually increased; and (iii) logarithmic death at maximal rate. The first phase was a reflection of inadequate heat activation of the spore population. The second and third phases represented the characteristic thermal death curve of the spores in saturated steam. A jacketed steam sterilizer, equipped with a system for initial evacuation of the chamber, was examined for superheat during normal operation. Measurements of spore inactivation and temperature revealed superheat in surface layers of fabrics being processed in steam at 121 C. The high temperature of the fabric surfaces was attributed to absorption of excess heat energy from superheated steam. The superheated steam was produced at the beginning of the normal sterilizing cycle by transfer of heat from the steam-heated jacket to saturated steam entering the vessel. PMID:13988774

Shull, James J.; Ernst, Robert R.

1962-01-01

87

New type of pullulanase from Bacillus stearothermophilus and molecular cloning and expression of the gene in Bacillus subtilis.  

Digital Repository Infrastructure Vision for European Research (DRIVER)

A new type of pullulanase which mainly produced panose from pullulan was found in Bacillus stearothermophilus and purified. The enzyme can hydrolyze pullulan efficiently and only hydrolyzes a small amount of starch. When pullulan was used as a substrate, the main product was panose and small amounts of glucose and maltose were simultaneously produced. By using pTB522 as a vector plasmid, the enzyme gene was cloned and expressed in Bacillus subtilis. Since the enzyme from the recombinant plasm...

Kuriki, T.; Okada, S.; Imanaka, T.

1988-01-01

88

Purification and Characterization of Thermostable Pullulanase from Bacillus stearothermophilus and Molecular Cloning and Expression of the Gene in Bacillus subtilis  

Digital Repository Infrastructure Vision for European Research (DRIVER)

A thermostable pullulanase (?-dextrin 6-glucanohydrolase [EC 3.2.1.41]) from a newly isolated Bacillus stearothermophilus strain (TRS128) was purified and characterized. The enzyme hydrolyzed (1?6)-?-d-glucosidic linkages of pullulan to produce maltotriose, and the optimum temperature was 65°C. About 90% of the enzyme activity was retained after treatment at 65°C for 60 min. By using pTB522 as a vector plasmid, the pullulanase gene was cloned and expressed in Bacillus subtilis.

Kuriki, Takashi; Park, Jong-hyun; Okada, Shigetaka; Imanaka, Tadayuki

1988-01-01

89

BOGUS BACTERIA...  

Science.gov (United States)

Here are some websites to get you started... Just click on the links and start searching! microbe world- bacteria Bacteria Rule Quiz! Bacteria.... Harmful Bacteria Bacteria Museum Bacteria! Microbes- all sorts of info... When you are finished looking at the sites or when you have enough information concerning bacteria, ask Mrs. Deaton for some books that can give you even more DETAIL!!! *Don\\'t forget to keep track of your information on your I-CHARTS... ...

Deaton, Mrs.

2007-01-24

90

Thermophilic fermentation of acetoin and 2,3-butanediol by a novel Geobacillus strain  

Directory of Open Access Journals (Sweden)

Full Text Available Abstract Background Acetoin and 2,3-butanediol are two important biorefinery platform chemicals. They are currently fermented below 40°C using mesophilic strains, but the processes often suffer from bacterial contamination. Results This work reports the isolation and identification of a novel aerobic Geobacillus strain XT15 capable of producing both of these chemicals under elevated temperatures, thus reducing the risk of bacterial contamination. The optimum growth temperature was found to be between 45 and 55°C and the medium initial pH to be 8.0. In addition to glucose, galactose, mannitol, arabionose, and xylose were all acceptable substrates, enabling the potential use of cellulosic biomass as the feedstock. XT15 preferred organic nitrogen sources including corn steep liquor powder, a cheap by-product from corn wet-milling. At 55°C, 7.7?g/L of acetoin and 14.5?g/L of 2,3-butanediol could be obtained using corn steep liquor powder as a nitrogen source. Thirteen volatile products from the cultivation broth of XT15 were identified by gas chromatography–mass spectrometry. Acetoin, 2,3-butanediol, and their derivatives including a novel metabolite 2,3-dihydroxy-3-methylheptan-4-one, accounted for a total of about 96% of all the volatile products. In contrast, organic acids and other products were minor by-products. ?-Acetolactate decarboxylase and acetoin:2,6-dichlorophenolindophenol oxidoreductase in XT15, the two key enzymes in acetoin metabolic pathway, were found to be both moderately thermophilic with the identical optimum temperature of 45°C. Conclusions Geobacillus sp. XT15 is the first naturally occurring thermophile excreting acetoin and/or 2,3-butanediol. This work has demonstrated the attractive prospect of developing it as an industrial strain in the thermophilic fermentation of acetoin and 2,3-butanediol with improved anti-contamination performance. The novel metabolites and enzymes identified in XT15 also indicated its strong promise as a precious biological resource. Thermophilic fermentation also offers great prospect for improving its yields and efficiencies. This remains a core aim for future work.

Xiao Zijun

2012-12-01

91

Novel thermostable endo-xylanase cloned and expressed from bacterium Geobacillus sp. WSUCF1.  

Science.gov (United States)

A gene encoding a GH10 endo-xylanase from Geobacillus sp. WSUCF1 was cloned and expressed in Escherichia coli. Recombinant endo-xylanase (37kDa) exhibited high specific activity of 461.0U/mg of protein. Endo-xylanase was optimally active on birchwood xylan at 70°C and pH 6.5. The endo-xylanase was found to be highly thermostable at 50 and 60°C, retaining 82% and 50% of its original activity, respectively, after 60h. High xylan conversions (92%) were obtained with oat-spelt xylan hydrolysis. Higher glucan and xylan conversions were obtained on AFEX-treated corn stover with an enzyme cocktail containing WSUCF1 endo-xylanase (71% and 47%) as compared to enzyme cocktail containing commercial fungal endo-xylanase (64% and 41%). High specific activity, active at high pH's, wide substrate specificity, and higher hydrolytic activity on recalcitrant lignocellulose, make this endo-xylanase a suitable candidate for biofuel and bioprocess industries. PMID:24725385

Bhalla, Aditya; Bischoff, Kenneth M; Uppugundla, Nirmal; Balan, Venkatesh; Sani, Rajesh K

2014-08-01

92

Thermostable lipase from Geobacillus sp. Iso5: bioseparation, characterization and native structural studies.  

Science.gov (United States)

The extracellular thermoalkaline lipase from Geobacillus sp. Iso5 was purified to homogeneity by ultrafiltration, 6% cross-linked agarose and Phenyl spehrose HIC column chromatography. The final purified lipase resulted in 8.7-fold with 6.2% yield. The relative molecular weight of the enzyme was determined to be a monomer of 47?kDa by SDS-PAGE and MALDI-TOF MS/MS spectroscopy. The purified enzyme exhibit optimum activity at 70?°C and pH 8.0. The enzyme retained above 90% activity at temperatures of 70?°C and about 35% activity at 85?°C for 2?h. However, the stability of the enzyme decreased at the temperature over 90?°C. The enzyme activity was promoted in the presence of Ca(2+) and Mg(2+) and strongly inhibited by HgCl2 , PMSF, DTT, K(+) , Co(2+) , and Zn (2+) . EDTA did not affect the enzyme activity. The secondary structure of purified lipase contains 36% ?-helix and 64% ?-sheet which was determined by Circular dichromism, FTIR, and Raman Spectroscopy. PMID:23775834

Mahadevan, Gurumurthy D; Neelagund, Shivayogeeswar E

2014-05-01

93

Applicability of recombinant ?-xylosidase from the extremely thermophilic bacterium Geobacillus thermodenitrificans in synthesizing alkylxylosides.  

Science.gov (United States)

The ?-xylosidase encoding gene (XsidB) of the extremely thermophilic bacterium Geobacillus thermodenitrificans has been cloned and expressed in Escherichia coli. The homotrimeric recombinant XsidB is of 204.0kDa, which is optimally active at 60°C and pH 7.0 with T1/2 of 58min at 70°C. The ?-xylosidase remains unaffected in the presence of most metal ions and organic solvents. The Km [p-nitrophenyl ?-xyloside (pNPX)], Vmax and kcat values of the enzyme are 2×10(-3)M, 1250?molesmg(-1)min(-1) and 13.20×10(5)min(-1), respectively. The enzyme catalyzes transxylosylation reactions in the presence of alcohols as acceptors. The pharmaceutically important ?-methyl-d-xylosides could be produced using pNPX as the donor and methanol as acceptor. The products of transxylosylation were identified by TLC and HPLC, and the structure was confirmed by (1)H NMR analysis. The enzyme is also useful in synthesizing transxylosylation products from the wheat bran hydrolysate. PMID:25164338

Jain, Ira; Kumar, Vikash; Satyanarayana, T

2014-10-01

94

Production, Partial Characterization and Cloning of Thermostable ?-amylase of a Thermophile Geobacillus thermoleovorans YN  

Directory of Open Access Journals (Sweden)

Full Text Available In a molecular screening program to select a potent thermostable amylase from a previously isolated thermophiles, a locally isolated, thermophilic lipase-producing Geobacillus thermoleovorans YN (accession number AF385083, was shown to secrete a thermostable ?-amylase constitutively. The optimal enzyme activity was measured at 75°C, where 90% of the activity was retained at 80°C after one hour of incubation. A catabolite repression due to the addition of glucose to the basal salt medium was demonstrated, while 4 folds increase in volumetric production was achieved in LB and starch-supplemented basal salt media and presented in SDS-PAGE and zymogram. A blunt end PCR fragment (2146 bp was amplified from genomic DNA using a designed set of primers and ligated to Bluescript —II KS(+ vector, transformed to E. coli DH5-? competent cells by electroporation and screened on LB-agar plates induced with IPTG. Nucleotide sequencing of selected clone revealed two ORFs, the first was (GTG with a molecular size 1649 nucleotides encoding 549aa residues of a predicted molecular weight 62.592 kD and the second (ATG with a molecular size 1613 nucleotides encoding 537aa residues of a predicted molecular weight 61.04 kD.

Mahmoud M. Berekaa

2007-01-01

95

High level expression of thermostable lipase from Geobacillus sp. strain T1.  

Science.gov (United States)

A thermostable extracellular lipase of Geobacillus sp. strain T1 was cloned in a prokaryotic system. Sequence analysis revealed an open reading frame of 1,251 bp in length which codes for a polypeptide of 416 amino acid residues. The polypeptide was composed of a signal peptide (28 amino acids) and a mature protein of 388 amino acids. Instead of Gly, Ala was substituted as the first residue of the conserved pentapeptide Gly-X-Ser-X-Gly. Successful gene expression was obtained with pBAD, pRSET, pET, and pGEX as under the control of araBAD, T7, T7 lac, and tac promoters, respectively. Among them, pGEX had a specific activity of 30.19 Umg(-1) which corresponds to 2927.15 Ug(-1) of wet cells after optimization. The recombinant lipase had an optimum temperature and pH of 65 degrees C and pH 9, respectively. It was stable up to 65 degrees C at pH 7 and active over a wide pH range (pH 6-11). This study presents a rapid cloning and overexpression, aimed at improving the enzyme yield for successful industrial application. PMID:14745170

Leow, Thean Chor; Rahman, Raja Noor Zaliha Raja Abdul; Basri, Mahiran; Salleh, Abu Bakar

2004-01-01

96

Thermophilic protease-producing Geobacillus from Buranga hot springs in Western Uganda.  

Science.gov (United States)

Two proteolytic thermophilic aerobic bacterial strains, PA-9 and PA-5, were isolated from Buranga hot springs in western Uganda. The cells were rods, approximately 10-12 microm in length and 3 microm in width. Isolate PA-9 grew at between 38 degrees C and 68 degrees C (optimum, 62 degrees C), and PA-5 grew at between 37 degrees C and 72 degrees C (optimum, 60 degrees C). Both isolates grew optimally at pH 7.5-8.5. Their 16S rRNA gene sequences indicated that they belong to the newly described genus Geobacillus. Zymogram analysis of the crude enzyme extracts revealed the presence of two extracellular proteases for isolate PA-5, and at least eight for isolate PA-9. The optimum temperature and pH for casein-degrading activity were 70 degrees C, pH 6.5 for isolate PA-9, but caseinolytic activity could also be observed at 2 degrees C. In the case of isolate PA-5, optimal activity was observed over a temperature and pH range of 50-70 degrees C and pH 5-10, respectively. PMID:12070695

Hawumba, Joseph F; Theron, Jacques; Brözel, Volker S

2002-08-01

97

Maltosyl-erythritol, a major transglycosylation product of erythritol by Bacillus stearothermophilus maltogenic amylase.  

Science.gov (United States)

This study was done to modify erythritol to change its physicochemical and sensory properties. Erythritol, a four-carbon sugar alcohol, was transglycosylated by Bacillus stearothermophilus maltogenic amylase with maltotriose as a donor molecule. The presence of various transglycosylation products of erythritol was confirmed by TLC and high performance ion exchange chromatography (HPIC). The major transfer product was purified by gel filtration chromatography on Bio-Gel P-2. Examination by LC-MS, matrix-assisted laser desorption ionisation-time of flight mass spectrometry (MALDI-TOF-MS), and 13C NMR showed that the major transfer product was maltosyl-erythritol. Results of 13C NMR of maltosyl-erythritol suggested that linkage was formed between the C1 carbon of glucose unit in maltose and either one of the two carbon atoms of the terminal hydroxyl groups of erythritol, so that a mixture of 1-O- and 4-O-alpha-maltosyl-erythritol was produced. The sweetness of maltosyl-erythritol was about 40% that of sucrose, and its negative sensory properties were less than those of erythritol. PMID:12723599

Yoon, Jong-Won; Jeon, Eun-Joo; Jung, Il-Hun; Min, Mee-Jung; Lee, Hye-Young; Kim, Myo-Jeong; Baek, Jin-Sook; Lee, Hee-Seob; Park, Cheon-Seok; Oh, Sangsuk; Park, Kwan-Hwa; Moon, Tae-Wha

2003-03-01

98

S-Layer Variation in Bacillus stearothermophilus PV72 Is Based on DNA Rearrangements between the Chromosome and the Naturally Occurring Megaplasmids  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Bacillus stearothermophilus PV72 expresses different S-layer genes (sbsA and sbsB) under different growth conditions. No stretches of significant sequence identity between sbsA and sbsB were detected. In order to investigate S-layer gene regulation in B. stearothermophilus PV72, we characterized the upstream regulatory region of sbsA and sbsB by sequencing and primer extension analysis. Both genes are transcribed from unique but different promoters, independently of the growth phase. Localiza...

Riedmann, Eva; Witte, Angela; Lubitz, Werner; Kuen, Beatrix

2001-01-01

99

[Absorption of nitric oxide by a strain of Bacillus stearothermophilus and its use in a bioreactor for purifying air].  

Science.gov (United States)

A new Bacillus stearothermophilus strain, INMI 50, was isolated and identified. Cells of this strain immobilized on a ceramic carrier demonstrated a high NO uptake in a bioreactor. The bioreactor volume was 4 l; air flow, 100 l/h; initial NO concentration, 5 ppm; and temperature, 60 degrees C. Glycerol or 1,2-propanediol was used as carbon and energy source. The uptake of NO was 60-90% of the initial concentration over six months of continuous operation of the bioreactor. The developed procedure can be used for removal of nitrogen oxide from products of combustion of diesel fuel or from air in production areas. PMID:9929891

Lebedeva, E V; Stepanov, A L; L'vpv, N P; Hinz, M; Bock, E

1998-01-01

100

Escherichia coli ribosomal protein L3 stimulates the helicase activity of the Bacillus stearothermophilus PcrA helicase.  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Escherichia coli ribosomal protein L3 stimulates the in vitro helicase activity of Bacillus stearothermophilus PcrA helicase upon a variety of different substrates. L3 has no intrinsic helicase or ATPase activity nor is it able to stimulate the ATPase activity of PcrA. Gel mobility shift assays revealed that the affinity of PcrA for a variety of different DNA species (single-stranded, nicked and 3'-tailed) was enhanced in the presence of L3. We suggest that the stimulatory effect of L3 upon t...

Soultanas, P.; Dillingham, M. S.; Wigley, D. B.

1998-01-01

 
 
 
 
101

Substrate preference of a Geobacillus maltogenic amylase: a kinetic and thermodynamic analysis.  

Science.gov (United States)

The gene encoding a maltogenic amylase (MAase) from a newly isolated strain of thermophilic Geobacillus has been isolated, cloned and expressed. Following purification, biochemical and structural characterization have been performed. The enzyme exhibited maximal activity at a broad temperature range between 55 and 65 °C, clearly higher than that of other dimeric MAses. The optimum pH was 6.0 and catalytic activity increased by of Li(+) and K(+). A noticeable preference was demonstrated for ?-, ?- and ?-cyclodextrin (CD) compared to polymeric substrates (amylose, amylopectin, glycogen and starch) possibly due to steric interference. The affinity for CD substrates increased in the order of ?-CD>?-CD>?-CD, but k(cat)/K(m) increased as ?-CD>?-CD>?-CD, implying that increased substrate specificities are mainly attribute to kcat. Thermodynamic analysis of the activation process showed that improved activity (decrease in ?G(#)) is accompanied by increases in activation entropy (?S(#)) for aforementioned substrates. Molecular docking on the binding interactions between substrates and active site residues revealed a considerably higher accessible surface area for the active site residues in the presence of ?-CD than ?-CD, indicating that interactions in the transition state are stronger in the presence of ?-CD. This result explains the increased ?H(#) of the activation process and increased K(m) of the enzyme in the presence of ?-CD, compared to that of ?-CD. This study, which presents the first detailed comparative analysis on the substrate preference of dimeric MAases for different substrates, may shed some lights into the molecular mechanism of these enzymes. PMID:23639697

Nasrollahi, Samira; Golalizadeh, Leila; Sajedi, Reza H; Taghdir, Majid; Asghari, S Mohsen; Rassa, Mehdi

2013-09-01

102

Domain C of thermostable ?-amylase of Geobacillus thermoleovorans mediates raw starch adsorption.  

Science.gov (United States)

The gene (1,542 bp) encoding thermostable Ca(2+)-independent and raw starch hydrolyzing ?-amylase of the extremely thermophilic bacterium Geobacillus thermoleovorans encodes for a protein of 50 kDa (Gt-amyII) with 488 amino acids. The enzyme is optimally active at pH 7.0 and 60 °C with a t 1/2 of 19.4 h at 60 and 4 h at 70 °C. Gt-amyII hydrolyses corn and tapioca raw starches efficiently and therefore finds application in starch saccharification at industrial sub-gelatinisation temperatures. The starch hydrolysis is facilitated following adsorption of the enzyme to starch at the C-terminal domain, as confirmed by the truncation analysis. The adsorption rate constant of Gt-amyII to raw corn starch is 37.6-fold greater than that for the C-terminus truncated enzyme (Gt-amyII-T). Langmuir-Hinshelwood kinetic analysis in terms of equilibrium parameter (K R) suggested that the adsorption of Gt-amyII to corn starch is more favourable than that of Gt-amyII-T. Thermodynamics of temperature inactivation indicated a decrease in thermostabilisation of Gt-amyII upon truncation of its C-terminus. The addition of raw corn starch increased t 1/2 of Gt-amyII, but it has no such effect on Gt-amyII-T. It can, therefore, be stated that Gt-amyII binds to raw corn starch via C-terminal region that contributes to its thermostability. Phylogenetic analysis confirmed that starch binding region of Gt-amyII is, in fact, the non-catalytic domain C, and not the typical SBD of CBM families. The role of domain C in raw starch binding throws light on the evolutionary path of the known SBDs. PMID:24413972

Mehta, Deepika; Satyanarayana, T

2014-05-01

103

Transglycosylation reactions of Bacillus stearothermophilus maltogenic amylase with acarbose and various acceptors.  

Science.gov (United States)

It was observed that Bacillus stearothermophilus maltogenic amylase cleaved the first glycosidic bond of acarbose to produce glucose and a pseudotrisaccharide (PTS) that was transferred to C-6 of the glucose to give an alpha-(1-->6) glycosidic linkage and the formation of isoacarbose. The addition of a number of different carbohydrates to the digest gave transfer products in which PTS was primarily attached alpha-(1-->6) to D-glucose, D-mannose, D-galactose, and methyl alpha-D-glucopyranoside. With D-fructopyranose and D-xylopyranose, PTS was linked alpha-(1-->5) and alpha-(1-->4), respectively. PTS was primarily transferred to C-6 of the nonreducing residue of maltose, cellobiose, lactose, and gentiobiose. Lesser amounts of alpha-(1-->3) and/or alpha-(1-->4) transfer products were also observed for these carbohydrate acceptors. The major transfer product to sucrose gave PTS linked alpha-(1-->4) to the glucose residue. alpha,alpha-Trehalose gave two major products with PTS linked alpha-(1-->6) and alpha-(1-->4). Maltitol gave two major products with PTS linked alpha-(1-->6) and alpha-(1-->4) to the glucopyranose residue. Raffinose gave two major products with PTS linked alpha-(1-->6) and alpha-(1-->4) to the D-galactopyranose residue. Maltotriose gave two major products with PTS linked alpha-(1-->6) and alpha-(1-->4) to the nonreducing end glucopyranose residue. Xylitol gave PTS linked alpha-(1-->5) as the major product and D-glucitol gave PTS linked alpha-(1-->6) as the only product. The structures of the transfer products were determined using thin-layer chromatography, high-performance ion chromatography, enzyme hydrolysis, methylation analysis and 13C NMR spectroscopy. The best acceptor was gentiobiose, followed closely by maltose and cellobiose, and the weakest acceptor was D-glucitol. PMID:10209866

Park, K H; Kim, M J; Lee, H S; Han, N S; Kim, D; Robyt, J F

1998-12-15

104

Transglycosylation reactions of Bacillus stearothermophilus maltogenic amylase with acarbose and various acceptors  

International Nuclear Information System (INIS)

It was observed that Bacillus stearothermophilus maltogenic amylase cleaved the first glycosidic bond of acarbose to produce glucose and a pseudotrisaccharide (PTS) that was transferred to C-6 of the glucose to give an ?-(1-6) glycosidic linkage and the formation of isoacarbose. The addition of a number of different carbohydrates to the digest gave transfer products in which PTS was primarily attached ?-(1-6) to d-glucose, d-mannose, d-galactose, and methyl ?-d-glucopyranoside. With d-fructopyranose and d-xylopyranose, PTS was linked ?-(1-5) and ?-(1-4), respectively. PTS was primarily transferred to C-6 of the nonreducing residue of maltose, cellobiose, lactose, and gentiobiose. Lesser amounts of ?-(1-3) and/or ?-(1-4) transfer products were also observed for these carbohydrate acceptors. The major transfer product to sucrose gave PTS linked ?-(1-4) to the glucose residue. ?,?-Trehalose gave two major products with PTS linked ?-(1-6) and ?-(1-4). Maltitol gave two major products with PTS linked ?-(1-6) and ?-(1-4) to the glucopyranose residue. Raffinose gave two major products with PTS linked ?-(1-6) and ?-(1-4) to the d-galactopyranose residue. Maltotriose gave two major products with PTS linked ?-(1-6) and ?-(1-4) to the nonreducing end glucopyranose residue. Xylitol gave PTS linked ?-(1-5) as the major product and d-glucitol gave PTS linked ?-(1-6) as the only product. The structures of the transfer products were determined using thin layer-chrd using thin layer-chromatography, high-performance ion chromatography, enzyme hydrolysis, methylation analysis and 13C NMR spectroscopy. The best acceptor was gentiobiose, followed closely by maltose and cellobiose, and the weakest acceptor was d-glucitol. (Copyright (c) 1998 Elsevier Science B.V., Amsterdam. All rights reserved.)

105

Bacteria Museum  

Science.gov (United States)

Who knew that bacteria had their own virtual museum? Here, visitors will "learn that not all bacteria are harmful, how they are used in industry, that they belong to the oldest living creatures on Earth", and many more interesting facts to discover about the diverse world of bacteria. The "Bacterial Species Files" tab at the top of the page, allows visitors to look up information on 40 different specific bacteria, from Anthrax to Yersinia enterocolitica. The information provided for each bacterium includes photographs, consumer guides, fact sheets, and scientific links. Visitors will find that the "Main Exhibits" tab addresses the basics about bacteria, as well as "Pathogenic Bacteria", "Evolution", "How We Fight Bacteria", and "Food and Water Safety". Visitors will surely enjoy the "Good Bacteria in Food" link found in the Food and Water Safety section, as it explains how some foods benefit from good bacteria, such as Swiss cheese, sausage, sauerkraut, chocolate, and coffee.

106

Taguchi's experimental design for optimizing the production of novel thermostable polypeptide antibiotic from Geobacillus pallidus SAT4.  

Science.gov (United States)

Polypeptide antimicrobials used against topical infections are reported to obtain from mesophilic bacterial species. A thermophilic Geobacillus pallidus SAT4 was isolated from hot climate of Sindh Dessert, Pakistan and found it active against Micrococcus luteus ATCC 10240, Staphylococcus aureus ATCC 6538, Bacillus subtilis NCTC 10400 and Pseudomonas aeruginosa ATCC 49189. The current experiment was designed to optimize the production of novel thermostable polypeptide by applying the Taguchi statistical approach at various conditions including the time of incubation, temperature, pH, aeration rate, nitrogen, and carbon concentrations. There were two most important factors that affect the production of antibiotic including time of incubation and nitrogen concentration and two interactions including the time of incubation/pH and time of incubation/nitrogen concentration. Activity was evaluated by well diffusion assay. The antimicrobial produced was stable and active even at 55°C. Ammonium sulphate (AS) was used for antibiotic recovery and it was desalted by dialysis techniques. The resulted protein was evaluated through SDS-PAGE. It was concluded that novel thermostable protein produced by Geobacillus pallidus SAT4 is stable at higher temperature and its production level can be improved statistically at optimum values of pH, time of incubation and nitrogen concentration the most important factors for antibiotic production. PMID:24374431

Muhammad, Syed Aun; Ahmed, Safia; Ismail, Tariq; Hameed, Abdul

2014-01-01

107

Transglycosylation reactions of Bacillus stearothermophilus maltogenic amylase with acarbose and various acceptors  

Energy Technology Data Exchange (ETDEWEB)

It was observed that Bacillus stearothermophilus maltogenic amylase cleaved the first glycosidic bond of acarbose to produce glucose and a pseudotrisaccharide (PTS) that was transferred to C-6 of the glucose to give an {alpha}-(1-6) glycosidic linkage and the formation of isoacarbose. The addition of a number of different carbohydrates to the digest gave transfer products in which PTS was primarily attached {alpha}-(1-6) to d-glucose, d-mannose, d-galactose, and methyl {alpha}-d-glucopyranoside. With d-fructopyranose and d-xylopyranose, PTS was linked {alpha}-(1-5) and {alpha}-(1-4), respectively. PTS was primarily transferred to C-6 of the nonreducing residue of maltose, cellobiose, lactose, and gentiobiose. Lesser amounts of {alpha}-(1-3) and/or {alpha}-(1-4) transfer products were also observed for these carbohydrate acceptors. The major transfer product to sucrose gave PTS linked {alpha}-(1-4) to the glucose residue. {alpha},{alpha}-Trehalose gave two major products with PTS linked {alpha}-(1-6) and {alpha}-(1-4). Maltitol gave two major products with PTS linked {alpha}-(1-6) and {alpha}-(1-4) to the glucopyranose residue. Raffinose gave two major products with PTS linked {alpha}-(1-6) and {alpha}-(1-4) to the d-galactopyranose residue. Maltotriose gave two major products with PTS linked {alpha}-(1-6) and {alpha}-(1-4) to the nonreducing end glucopyranose residue. Xylitol gave PTS linked {alpha}-(1-5) as the major product and d-glucitol gave PTS linked {alpha}-(1-6) as the only product. The structures of the transfer products were determined using thin layer-chromatography, high-performance ion chromatography, enzyme hydrolysis, methylation analysis and {sup 13}C NMR spectroscopy. The best acceptor was gentiobiose, followed closely by maltose and cellobiose, and the weakest acceptor was d-glucitol. (Copyright (c) 1998 Elsevier Science B.V., Amsterdam. All rights reserved.)

Hwa Park, K.; Jeong Kim, M.; Seob Lee, H.; Kim, D. [Department of Food Science and Technology and Research Center for New Bio-Materials in Agriculture, Seoul National University, Suwon (Korea, Republic of); Soo Han, N.; Robyt, J.F. [Laboratory for Carbohydrate Chemistry and Enzymology, Department of Biochemistry and Biophysics, Iowa State University, Ames, IA (United States)

1998-12-15

108

Discovery of a ptsHI operon, which includes a third gene (ptsT), in the thermophile Bacillus stearothermophilus.  

Science.gov (United States)

The discovery of ptsHI operon in Bacillus stearothermophilus XL-65-6 coupled with our previous report of a cel operon (Lai & Ingram, J Bacteriol 175, 6441-6450, 1993) demonstrates that this thermophilic organism contains all of the genes required for cellobiose uptake by the phosphoenolpyruvate-dependent phosphotransferase system (PTS). Genes encoding the two general PTS proteins, HPr (ptsH) and enzyme I (ptsI), were cloned and sequenced. These form an operon which includes a third small gene (ptsT) of unknown function (encoded product M(r) 18428). Both ptsH and ptsI were expressed at high levels from a single plasmid in Escherichia coli and complemented corresponding host mutations. Although the translated sequences for these genes were similar to homologues from Gram-positive mesophiles (64-77% identity), the B. stearothermophilus gene products were unusual in having a higher predicted pI and fewer negatively charged amino acid residues. Enzyme I also contained more alanine and leucine than mesophilic counterparts. Interestingly, ptsT inhibited the growth of E. coli ptsI mutants at 37 degrees C. No such inhibition was observed during incubation at a lower temperature (30 degrees C) or in E. coli DH5 alpha, which is wild-type for ptsI. The predicted translation product from ptsT contained a high proportion of basic amino acids (27%) and had a high predicted pI (pH 11.7), properties similar to bacterial histone-like proteins, but did not exhibit homology to any sequences in the current database. Regions upstream and downstream from the ptsHI operon contain genes with homology to Bacillus subtilis ptsG and wapA (wall-associated protein), respectively. PMID:7670643

Lai, X; Ingram, L O

1995-06-01

109

Conformational and thermodynamic effects of naturally occurring base methylations in a ribosomal RNA hairpin of Bacillus stearothermophilus.  

Science.gov (United States)

The 3'-terminal colicin fragments of 16S ribosomal RNA were isolated from Bacillus stearothermophilus and from its kasugamycin-resistant (ksgA) derivative lacking N6-dimethylation of the two adjacent adenosines in a hairpin loop. The fragment from the ksgA strain still contains a naturally occurring N2-methylguanosine in the loop. An RNA molecule resembling the B. stearothermophilus colicin fragment but without modified nucleosides was synthesized in vitro using a DNA template and bacteriophage T7 RNA polymerase. Proton-NMR spectra of the RNAs were recorded at 500 MHz. The imino-proton resonances of base-paired G and U residues could be assigned on the basis of previous NMR studies of the colicin fragment of Escherichia coli and by a combination of methylation-induced shifts and thermal melting of base pairs. The assignments were partly confirmed by NOE measurements. Adenosine dimethylation in the loop has a distinct conformational effect on the base pairs adjoining the loop. The thermal denaturation melting curve of the enzymatically synthesized RNA fragment was also determined and the transition midpoint (tm) was found to be 73 degrees C at 15 mM Na+. A comparison with previously determined thermodynamic parameters for various colicin fragments demonstrates that base methylations in the loop lead to a relatively strong destabilization of the hairpin helix. In terms of free energy the positive contribution of the methylations are in the order of the deletion of one base pair from the stem. Other data show that recently published free-energy parameters do not apply for certain RNA hairpins. PMID:1690648

Heus, H A; Formenoy, L J; Van Knippenberg, P H

1990-03-10

110

Bacteria Transformation  

Science.gov (United States)

Students construct paper recombinant plasmids to simulate the methods genetic engineers use to create modified bacteria. They learn what role enzymes, DNA and genes play in the modification of organisms. For the particular model they work on, they isolate a mammal insulin gene and combine it with a bacteria's gene sequence (plasmid DNA) for production of the protein insulin.

National Science Foundation GK-12 and Research Experience for Teachers (RET) Programs,

111

Isolation and Characterization of Thermophilic Cellulase-Producing Bacteria from Empty Fruit Bunches-Palm Oil Mill Effluent Compost  

Directory of Open Access Journals (Sweden)

Full Text Available Problems statement: Lack of information on locally isolated cellulase-producing bacterium in thermophilic compost using a mixture of Empty Fruit Bunch (EFB and Palm Oil Mill Effluent (POME as composting materials. Approach: The isolation of microbes from compost heap was conducted at day 7 of composting process where the mixture of composting materials consisted of 45.8% cellulose, 17.1% hemicellulose and 28.3% lignin content. The temperature, pH and moisture content of the composting pile at day 7 treatment were 58.3, 8.1 and 65.5°C, respectively. The morphological analysis of the isolated microbes was conducted using Scanning Electron Microscope (SEM and Gram stain method. The congo red test was conducted in order to detect 1% CMC agar degradation activities. Total genomic DNAs were extracted from approximately 1.0 g of mixed compost and amplified by using PCR primers. The PCR product was sequent to identify the nearest relatives of 16S rRNA genes. The localization of bacteria chromosomes was determined by Fluorescence In Situ Hybridization (FISH analysis. Results: Single isolated bacteria species was successfully isolated from Empty Fruit Bunch (EFB-Palm Oil Mill Effluent (POME compost at thermophilic stage. Restriction fragment length polymorphism profiles of the DNAs coding for the 16S rRNAs with the phylogenetic analysis showed that the isolated bacteria from EFB-POME thermophilic compost gave the highest homology (99% with similarity to Geobacillus pallidus. The strain was spore forming bacteria and able to grow at 60°C with pH 7. Conclusion: Thermophilic bacteria strain, Geobacillus pallidus was successfully isolated from Empty Fruit Bunch (EFB and Palm Oil Mil Effluent (POME compost and characterized.

Azhari S. Baharuddin

2010-01-01

112

Effect of codon-optimized E. coli signal peptides on recombinant Bacillus stearothermophilus maltogenic amylase periplasmic localization, yield and activity.  

Science.gov (United States)

Recombinant proteins can be targeted to the Escherichia coli periplasm by fusing them to signal peptides. The popular pET vectors facilitate fusion of target proteins to the PelB signal. A systematic comparison of the PelB signal with native E. coli signal peptides for recombinant protein expression and periplasmic localization is not reported. We chose the Bacillus stearothermophilus maltogenic amylase (MA), an industrial enzyme widely used in the baking and brewing industry, as a model protein and analyzed the competence of seven, codon-optimized, E. coli signal sequences to translocate MA to the E. coli periplasm compared to PelB. MA fusions to three of the signals facilitated enhanced periplasmic localization of MA compared to the PelB fusion. Interestingly, these three fusions showed greatly improved MA yields and between 18- and 50-fold improved amylase activities compared to the PelB fusion. Previously, non-optimal codon usage in native E. coli signal peptide sequences has been reported to be important for protein stability and activity. Our results suggest that E. coli signal peptides with optimal codon usage could also be beneficial for heterologous protein secretion to the periplasm. Moreover, such fusions could even enhance activity rather than diminish it. This effect, to our knowledge has not been previously documented. In addition, the seven vector platform reported here could also be used as a screen to identify the best signal peptide partner for other recombinant targets of interest. PMID:25038884

Samant, Shalaka; Gupta, Gunja; Karthikeyan, Subbulakshmi; Haq, Saiful F; Nair, Ayyappan; Sambasivam, Ganesh; Sukumaran, Sunilkumar

2014-09-01

113

Modification of ascorbic acid using transglycosylation activity of Bacillus stearothermophilus maltogenic amylase to enhance its oxidative stability.  

Science.gov (United States)

Ascorbic acid (1), a natural antioxidant, was modified by employing transglycosylation activity of Bacillus stearothermophilus maltogenic amylase with maltotriose and acarbose as donor molecules to enhance its oxidative stability. The transglycosylation reaction with maltotriose as donor created mono- and di-glycosyl transfer products with an alpha-(1,6)-glycosidic linkage. In addition, two acarviosine-glucosyl transfer products were generated when transglycosylation was performed with acarbose as a donor. All transfer products were observed by TLC and HPLC, and purified by Q-sepharose anion exchange and Biogel P-2 gel permeation chromatographies. LC/MS and (13)C NMR analyses revealed that the structures of the transfer products were 6-O-alpha-D-glucosyl- (2) and 6-O-alpha-D-maltosyl-ascorbic acids (3) in the reaction of maltotriose, and 6-O-alpha-acarviosine-D-glucosyl- (4) and 2-O-alpha-acarviosine-D-glucosyl ascorbic acids (5) in the reaction of acarbose. The stability of the transglycosylated ascorbic acid derivatives was greatly enhanced against oxidation by Cu(2+) ion and ascorbate oxidase. Among them, compound 3 proved to be the most stable against in vitro oxidation. The antioxidant effects of glycosyl-derivatives of ascorbic acid on the lipid oxidation in cooked chicken breast meat patties indicated that they had antioxidant activities similar to that of ascorbic acid. It is suggested that the transglycosylated ascorbic acids can possibly be applied as effective antioxidants with improved stability in food, cosmetic, and other applications. PMID:12010003

Bae, Hee-Kyung; Lee, Soo-Bok; Park, Cheon-Seok; Shim, Jae-Hoon; Lee, Hye-Young; Kim, Myo-Jeong; Baek, Jin-Sook; Roh, Hoe-Jin; Choi, Jin-Hwan; Choe, Eun-Ok; Ahn, Dong-Uk; Park, Kwan-Hwa

2002-05-22

114

Aptamer biosensor for sensitive detection of toxin A of Clostridium difficile using gold nanoparticles synthesized by Bacillus stearothermophilus.  

Science.gov (United States)

A sensitive electrochemical biosensor was developed to detect toxin A (TOA) of Clostridium difficile based on an aptamer selected by the systematic evolution of ligands using exponential enrichment and gold nanoparticles (GNPS) synthesized by Bacillus stearothermophilus. The thiolated single-stranded DNA used as the capture probe (CP) was first self-assembled on a Nafion-thionine-GNPS-modified screen-printed electrode (SPE) through an Au-thiol interaction. The horseradish peroxidase (HRP)-labeled aptamer probe (AP) was then hybridized to the complementary oligonucleotide of CP to form an aptamer-DNA duplex. In the absence of TOA, the aptamer-DNA duplex modified the electrode surface with HRP, so that an amperometric response was induced based on the electrocatalytic properties of thionine. This was mediated by the electrons that were generated in the enzymatic reaction of hydrogen peroxide under HRP catalysis. After the specific recognition of TOA, an aptamer-TOA complex was produced rather than the aptamer-DNA duplex, forcing the HRP-labeled AP to dissociate from the electrode surface, which reduced the catalytic capacity of HRP and reduced the response current. The reduction in the response current correlated linearly with the concentration of TOA in the range of 0-200 ng/mL. The detection limit was shown to be 1 nM for TOA. This biosensor was applied to the analysis of TOA and showed good selectivity, reproducibility, stability, and accuracy. PMID:24287407

Luo, Peng; Liu, Yi; Xia, Yun; Xu, Huajian; Xie, Guoming

2014-04-15

115

Surface plasmon resonance-enabled antibacterial digital versatile discs  

Science.gov (United States)

We report the achievement of effective sterilization of exemplary bacteria including Escherichia coli and Geobacillus stearothermophilus spores on a digital versatile disc (DVD). The spiral arrangement of aluminum-covered pits generates strong surface plasmon resonance (SPR) absorption of near-infrared light, leading to high surface temperature that could even damage the DVD plastics. Localized protein denaturation and high sterilization efficiency have been demonstrated by using a fluorescence microscope and cell cultures. Numerical simulations have also been conducted to model the SPR properties and the surface temperature distribution of DVDs under laser illumination. The theoretical predictions agree reasonably well with the experimental results.

Dou, Xuan; Chung, Pei-Yu; Jiang, Peng; Dai, Jianli

2012-02-01

116

Purification and characterization of a hyperthermostable and high maltogenic alpha-amylase of an extreme thermophile Geobacillus thermoleovorans.  

Science.gov (United States)

The purified alpha-amylase of Geobacillus thermoleovorans had a molecular mass of 26 kDa with a pI of 5.4, and it was optimally active at 100 degrees C and pH 8.0. The T 1/2 of alpha-amylase at 100 degrees C increased from 3.6 to 5.6 h in the presence of cholic acid. The activation energy and temperature quotient (Q 10) of the enzyme were 84.10 kJ/mol and 1.31, respectively. The activity of the enzyme was enhanced strongly by Co2+ and Fe2+; enhanced slightly by Ba2+, Mn2+, Ni2+, and Mg2+; inhibited strongly by Sn2+, Hg2+, and Pb2+, and inhibited slightly by EDTA, phenyl methyl sulfonyl fluoride, N-ethylmaleimide, and dithiothreitol. The enzyme activity was not affected by Ca2+ and ethylene glycol-bis (beta-amino ethyl ether)-N,N,N,N-tetra acetic acid. Among different additives and detergents, polyethylene glycol 8000 and Tween 20, 40, and 80 stabilized the enzyme activity, whereas Triton X-100, glycerol, glycine, dextrin, and sodium dodecyl sulfate inhibited to a varied extent. alpha-Amylase exhibited activity on several starch substrates and their derivatives. The K m and K cat values (soluble starch) were 1.10 mg/ml and 5.9 x 10(3)/min, respectively. The enzyme hydrolyzed raw starch of pearl millet (Pennisetum typhoides) efficiently. PMID:18025579

Uma Maheswar Rao, J L; Satyanarayana, T

2007-08-01

117

Isolation and characterization of a thermotolerant ene reductase from Geobacillus sp. 30 and its heterologous expression in Rhodococcus opacus.  

Science.gov (United States)

Rhodococcus opacus B-4 cells are adhesive to and even dispersible in water-immiscible hydrocarbons owing to their highly lipophilic nature. In this study, we focused on the high operational stability of thermophilic enzymes and applied them to a biocatalytic conversion in an organic reaction medium using R. opacus B-4 as a lipophilic capsule of enzymes to deliver them into the organic medium. A novel thermo- and organic-solvent-tolerant ene reductase, which can catalyze the enantioselective reduction of ketoisophorone to (6R)-levodione, was isolated from Geobacillus sp. 30, and the gene encoding the enzyme was heterologously expressed in R. opacus B-4. Another thermophilic enzyme which catalyzes NAD(+)-dependent dehydrogenation of cyclohexanol was identified from the gene-expression library of Thermus thermophilus and the gene was coexpressed in R. opacus B-4 for cofactor regeneration. While the recombinant cells were not viable in the mixture due to high reaction temperature, 634 mM of (6R)-levodione could be produced with an enantiopurity of 89.2 % ee by directly mixing the wet cells of the recombinant R. opacus with a mixture of ketoisophorone and cyclohexanol at 50 °C. The conversion rate observed with the heat-killed recombinant cells was considerably higher than that obtained with a cell-free enzyme solution, demonstrating that the accessibility between the substrates and enzymes could be improved by employing R. opacus cells as a lipophilic enzyme capsule. These results imply that a combination of thermophilic enzymes and lipophilic cells can be a promising approach for the biocatalytic production of water-insoluble chemicals. PMID:24927695

Tsuji, Naoto; Honda, Kohsuke; Wada, Mayumi; Okano, Kenji; Ohtake, Hisao

2014-07-01

118

Analysis of Metabolic Pathways and Fluxes in a Newly Discovered Thermophilic and Ethanol-Tolerant Geobacillus Strain  

Energy Technology Data Exchange (ETDEWEB)

A recently discovered thermophilic bacterium, Geobacillus thermoglucosidasius M10EXG, ferments a range of C5 (e.g., xylose) and C6 sugars (e.g., glucose) and istolerant to high ethanol concentrations (10percent, v/v). We have investigated the central metabolism of this bacterium using both in vitro enzyme assays and 13C-based flux analysis to provide insights into the physiological properties of this extremophile and explore its metabolism for bio-ethanol or other bioprocess applications. Our findings show that glucose metabolism in G. thermoglucosidasius M10EXG proceeds via glycolysis, the pentose phosphate pathway, and the TCA cycle; the Entner?Doudoroff pathway and transhydrogenase activity were not detected. Anaplerotic reactions (including the glyoxylate shunt, pyruvate carboxylase, and phosphoenolpyruvate carboxykinase) were active, but fluxes through those pathways could not be accuratelydetermined using amino acid labeling. When growth conditions were switched from aerobic to micro-aerobic conditions, fluxes (based on a normalized glucose uptake rate of 100 units (g DCW)-1 h-1) through the TCA cycle and oxidative pentose phosphate pathway were reduced from 64+-3 to 25+-2 and from 30+-2 to 19+-2, respectively. The carbon flux under micro-aerobic growth was directed formate. Under fully anerobic conditions, G. thermoglucosidasius M10EXG used a mixed acid fermentation process and exhibited a maximum ethanol yield of 0.38+-0.07 mol mol-1 glucose. In silico flux balance modeling demonstrates that lactate and acetate production from G. thermoglucosidasius M10EXG reduces the maximum ethanol yieldby approximately threefold, thus indicating that both pathways should be modified to maximize ethanol production.

Tang, Yinjie J.; Sapra, Rajat; Joyner, Dominique; Hazen, Terry C.; Myers, Samuel; Reichmuth, David; Blanch, Harvey; Keasling, Jay D.

2009-01-20

119

Structure of holo-glyceraldehyde-3-phosphate dehydrogenase from Bacillus stearothermophilus at 1.8 A resolution.  

Science.gov (United States)

The structure of holo-glyceraldehyde-3-phosphate dehydrogenase from Bacillus stearothermophilus has been crystallographically refined at 1.8 A resolution using restrained least-squares refinement methods. The final crystallographic R-factor for 93,120 reflexions with F greater than 3 sigma (F) is 0.177. The asymmetric unit of the crystal contains a complete tetramer, the final model of which incorporates a total of 10,272 unique protein and coenzyme atoms together with 677 bound solvent molecules. The structure has been analysed with respect to molecular symmetry, intersubunit contacts, coenzyme binding and active site geometry. The refined model shows the four independent subunits to be remarkable similar apart from local deviations due to intermolecular contacts within the crystal lattice. A number of features are revealed that had previously been misinterpreted from an earlier 2.7 A electron density map. Arginine at position 195 (previously thought to be a glycine) contributes to the formation of the anion binding sites in the active site pocket, which are involved in binding of the substrate and inorganic phosphates during catalysis. This residue seems to be structurally equivalent to the conserved Arg194 in the enzyme from other sources. In the crystal both of the anion binding sites are occupied by sulphate ions. The ND atom of the catalytically important His176 is hydrogen-bonded to the main-chain carbonyl oxygen of Ser177, thus fixing the plane of the histidine imidazole ring and preventing rotation. The analysis has revealed the presence of several internal salt-bridges stabilizing the tertiary and quaternary structure. A significant number of buried water molecules have been found that play an important role in the structural integrity of the molecule. PMID:3586018

Skarzy?ski, T; Moody, P C; Wonacott, A J

1987-01-01

120

Rumen bacteria  

International Nuclear Information System (INIS)

The rumen is the most extensively studied gut community and is characterized by its high population density, wide diversity and complexity of interactions. This complex, mixed microbial culture is comprised of prokaryote organisms including methane-producing archaebacteria, eukaryote organisms, such as ciliate and flagellate protozoa, anaerobic phycomycete fungi and bacteriophage. Bacteria are predominant (up to 1011 viable cells per g comprising 200 species) but a variety of ciliate protozoa occur widely (104-106/g distributed over 25 genera). The anaerobic fungi are also widely distributed (zoospore population densities of 102-104/g distributed over 5 genera). The occurrence of bacteriophage is well documented (107-109 particles/g). This section focuses primarily on the widely used methods for the cultivation and the enumeration of rumen microbes, especially bacteria, which grow under anaerobic conditions. Methods that can be used to measure hydrolytic enzymes (cellulases, xylanases, amylases and proteinases) are also described, along with cell harvesting and fractionation procedures. Brief reference is also made to fungi and protozoa, but detailed explanations for culturing and enumerating these microbes is presented in Chapters 2.4 and 2.5

 
 
 
 
121

Characterization of the Bacillus stearothermophilus manganese superoxide dismutase gene and its ability to complement copper/zinc superoxide dismutase deficiency in Saccharomyces cerevisiae  

Energy Technology Data Exchange (ETDEWEB)

Recombinant clones containing the manganese superoxide dismutase (MnSOD) gene of Bacillus stearothermophilus were isolated with an oligonucleotide probe designed to match a part of the previously determined amino acid sequence. Complementation analyses, performed by introducing each plasmid into a superoxide dismutase-deficient mutant of Escherichia coli, allowed us to define the region of DNA which encodes the MnSOD structural gene and to identify a promoter region immediately upstream from the gene. These data were subsequently confirmed by DNA sequencing. Since MnSOD is normally restricted to the mitochondria in eucaryotes, we were interested (i) in determining whether B. stearothermophilus MnSOD could function in eucaryotic cytosol and (ii) in determining whether MnSOD could replace the structurally unrelated copper/zinc superoxide dismutase (Cu/ZnSOD) which is normally found there. To test this, the sequence encoding bacterial MnSOD was cloned into a yeast expression vector and subsequently introduced into a Cu/ZnSOD-deficient mutant of the yeast Saccharomyces cerevisiae. Functional expression of the protein was demonstrated, and complementation tests revealed that the protein was able to provide tolerance at wild-type levels to conditions which are normally restrictive for this mutant. Thus, in spite of the evolutionary unrelatedness of these two enzymes, Cu/ZnSOD can be functionally replaced by MnSOD in yeast cytosol.

Bowler, C.; Inze, D.; Van Camp, W.; Kaer, L.V.; Dhaese, P. (Rijksuniversiteit Gent (Belgium))

1990-03-01

122

Use of extremophilic bacteria for second generation bioethanol production  

DEFF Research Database (Denmark)

The pursuit of ways to obtain viable alternatives to fossil fuels has been one of the main subjects in microbial biotechnology research in the last decade. Of all the possible fuel candidates, bioethanol is one of the most relevant, especially when considered for the transport sector. Its production from food crops, such as corn (starch) or sugar cane (sucrose) is already an established process, with the USA and Brazil supplying 86% of the market. The major challenge remains in the use of different waste sources – agricultural, forestry, animal and household waste - as a feedstock. The recalcitrance of these materials and their diverse sugar composition make the industrial yeast strains currently used unsuitable for a second generation bioethanol production process. One of the alternative strategies is the use of extreme thermophilic microorganisms. Currently, selected members from the genera Clostridium, Thermoanaerobacter, Geobacillus and Thermoanaerobacterium are among the best candidates. A new strain of Thermoanaerobacter, closely related to T. italicus and T. mathranii, has achieved 0.43 gethanol/gxylose, which is 83% of the theoretical yield of ethanol based on xylose and the highest value for a wild type strain reported so far. However, productivity and titer values comparable to a first generation process are yet to be achieved. Metabolic engineering to redirect the metabolism from mixed-product fermentation to ethanol production is one of the solutions proposed to improve the performance of extreme thermophilic bacteria.

Tomás, Ana Faria; Karakashev, Dimitar Borisov

123

Inactivation factors of spore-forming bacteria using low-pressure microwave plasmas in an N2 and O2 gas mixture  

International Nuclear Information System (INIS)

In this study, we investigated the inactivation characteristics of Geobacillus stearothermophilus spores under different plasma exposure conditions using low-pressure microwave plasma in nitrogen, oxygen and an air-simulated (N2:O2=4:1) gas mixture. The microwave-excited surface-wave plasma discharges were produced at low pressure by a large volume device. The directly plasma-exposed spores, up to 106 populations, were successfully inactivated within 15, 10 and 5 min of surface-wave plasma treatment using nitrogen, oxygen and an air-simulated gas mixture, respectively, as working gases within the temperature of 75 deg. C. The contribution of different inactivation factors was evaluated by placing different filters (e.g. a LiF plate, a quartz plate and a Tyvek (registered) sheet) as indirect exposure of spores to the plasma. It was observed that optical emissions (including vacuum UV (VUV)/UV) play an important role in the inactivation process. To further evaluate the effect of VUV/UV photons, we placed an evacuated isolated chamber, inside which spores were set, into the main plasma chamber. The experimental results show that the inactivation time by VUV/UV photons alone, without working gas in the immediate vicinity of the spores, is longer than that with working gas. This suggests that the VUV/UV emission is responsible not only for direct UV inactivation of spores but also for generation of reactive neutral species by photoexcitation. The scanning electron microscopy images revealed significant changes in the morphology of directly plasma-exposed spores but no change in the spores irradiated by VUV/UV photons only.

124

Decontamination effects of low-temperature plasma generated by corona discharge. Part II: new insights.  

Science.gov (United States)

The second part of our paper presents the results of experiments with the decontamination of surfaces by low-temperature plasma generated by corona discharge in air at atmospheric pressure. A simple device is described and the effects of the corona discharge on model microorganisms, viz. the yeast Candida albicans, Gram-negative bacteria Escherichia coli, Enterobacter aerogenes, Neisseria sicca, Stenotrophomonas maltophilia, Gram-positive bacteria Deinococcus radiodurans, Enterococcus faecium, Staphylococcus epidermidis, Streptococcus sanguinis, and vegetative and spore forms of Geobacillus stearothermophilus are discussed. A similar microbicidal effect after about one-minute exposure was observed in all vegetative forms of the microorganisms. Measurement in growth inhibition zones on a semisolid medium was used to determine the dependence of the microbicidal effect on exposure time and the distance between electrodes. Counting of colonies served to assess the microbicidal effect of the discharge on contaminated inert surfaces observable after more than 1 min exposure. Geobacillus stearothermophilus spores were found to have several times lower susceptibility to the action of the discharge and the microbicidal effect was observed only after an 8 min exposure. Reaction with the iodide reagent did not unambiguously demonstrate the difference between ozone and singlet oxygen as presumed active components of the corona. The area distribution of reactive oxygen species was determined; it was found to differ from the Wartburg law depending on exposure time. Qualitative evidence was obtained on the penetration of the reactive oxygen species into the semisolid medium. PMID:18225640

Scholtz, V; Julák, J; Kríha, V; Mosinger, J; Kopecká, S

2007-01-01

125

Purification, crystallization and preliminary X-ray analysis of a thermostable glycoside hydrolase family 43 ?-xylosidase from Geobacillus thermoleovorans IT-08  

Science.gov (United States)

The main enzymes involved in xylan-backbone hydrolysis are endo-1,4-?-­xylanase and ?-xylosidase. ?-Xylosidase converts the xylo-oligosaccharides produced by endo-1,4-?-xylanase into xylose monomers. The ?-xylosidase from the thermophilic Geobacillus thermoleovorans IT-08, a member of glycoside hydrolase family 43, was crystallized at room temperature using the hanging-drop vapour-diffusion method. Two crystal forms were observed. Bipyramid-shaped crystals belonging to space group P43212, with unit-cell parameters a = b = 62.53, c = 277.4?Å diffracted to 1.55?Å resolution. The rectangular crystals belonged to space group P21, with unit-cell parameters a = 57.94, b = 142.1, c = 153.9?Å, ? = 90.5°, and diffracted to 1.80?Å resolution. PMID:18007043

Rohman, Ali; van Oosterwijk, Niels; Kralj, Slavko; Dijkhuizen, Lubbert; Dijkstra, Bauke W.; Puspaningsih, Ni Nyoman Tri

2007-01-01

126

Purification, crystallization and preliminary X-ray analysis of a thermostable glycoside hydrolase family 43 beta-xylosidase from Geobacillus thermoleovorans IT-08.  

Science.gov (United States)

The main enzymes involved in xylan-backbone hydrolysis are endo-1,4-beta-xylanase and beta-xylosidase. beta-Xylosidase converts the xylo-oligosaccharides produced by endo-1,4-beta-xylanase into xylose monomers. The beta-xylosidase from the thermophilic Geobacillus thermoleovorans IT-08, a member of glycoside hydrolase family 43, was crystallized at room temperature using the hanging-drop vapour-diffusion method. Two crystal forms were observed. Bipyramid-shaped crystals belonging to space group P4(3)2(1)2, with unit-cell parameters a = b = 62.53, c = 277.4 A diffracted to 1.55 A resolution. The rectangular crystals belonged to space group P2(1), with unit-cell parameters a = 57.94, b = 142.1, c = 153.9 A, beta = 90.5 degrees , and diffracted to 1.80 A resolution. PMID:18007043

Rohman, Ali; van Oosterwijk, Niels; Kralj, Slavko; Dijkhuizen, Lubbert; Dijkstra, Bauke W; Puspaningsih, Ni Nyoman Tri

2007-11-01

127

Abiotic and microbiotic factors controlling biofilm formation by thermophilic sporeformers.  

Science.gov (United States)

One of the major concerns in the production of dairy concentrates is the risk of contamination by heat-resistant spores from thermophilic bacteria. In order to acquire more insight in the composition of microbial communities occurring in the dairy concentrate industry, a bar-coded 16S amplicon sequencing analysis was carried out on milk, final products, and fouling samples taken from dairy concentrate production lines. The analysis of these samples revealed the presence of DNA from a broad range of bacterial taxa, including a majority of mesophiles and a minority of (thermophilic) spore-forming bacteria. Enrichments of fouling samples at 55°C showed the accumulation of predominantly Brevibacillus and Bacillus, whereas enrichments at 65°C led to the accumulation of Anoxybacillus and Geobacillus species. Bacterial population analysis of biofilms grown using fouling samples as an inoculum indicated that both Anoxybacillus and Geobacillus preferentially form biofilms on surfaces at air-liquid interfaces rather than on submerged surfaces. Three of the most potent biofilm-forming strains isolated from the dairy factory industrial samples, including Geobacillus thermoglucosidans, Geobacillus stearothermophilus, and Anoxybacillus flavithermus, have been characterized in detail with respect to their growth conditions and spore resistance. Strikingly, Geobacillus thermoglucosidans, which forms the most thermostable spores of these three species, is not able to grow in dairy intermediates as a pure culture but appears to be dependent for growth on other spoilage organisms present, probably as a result of their proteolytic activity. These results underscore the importance of abiotic and microbiotic factors in niche colonization in dairy factories, where the presence of thermophilic sporeformers can affect the quality of end products. PMID:23851093

Zhao, Yu; Caspers, Martien P M; Metselaar, Karin I; de Boer, Paulo; Roeselers, Guus; Moezelaar, Roy; Nierop Groot, Masja; Montijn, Roy C; Abee, Tjakko; Kort, Remco

2013-09-01

128

The complete amino acid sequences of the 5 S rRNA binding proteins L5 and L18 from the moderate thermophile Bacillus stearothermophilus ribosome.  

Science.gov (United States)

The complete amino acid sequences of the 5 S rRNA binding proteins L5 and L18 isolated from ribosomes of the moderate thermophile Bacillus stearothermophilus are presented. This has been achieved by the sequence analysis of peptides derived by enzymatic digestions with trypsin, chymotrypsin, pepsin, and Staphylococcus aureus protease, as well as by chemical cleavage with cyanogen bromide. The proteins L5 and L18 consist of 179 and 120 amino acid residues, and have Mr values of 20,163 and 13,473, respectively. A comparison of the sequences with their counterparts from the Escherichia coli ribosome reveals 59% identical residues for L5, and 53% for L18. For both proteins, the distribution of conserved regions is not random along the protein chains: some regions are highly conserved while others are not. The regions which are conserved during evolution may be important for the interaction with the 5 S rRNA molecule. PMID:3542562

Kimura, J; Kimura, M

1987-01-01

129

The Museum of Bacteria  

Science.gov (United States)

The Museum of Bacteria serves as a clearinghouse of Web links on bacteria and bacteriology and also provides "crystal-clear information about many aspects of bacteria." The Museum of Bacteria is provided by the Foundation of Bacteria, a non-profit organization dedicated to promoting the field of bacteriology. Links are selected for a general audience, although one section is geared toward professionals in the field. Some of the latest features of the Museum are an "exhibit" on the good bacteria found in food and a Student Hall where students can present their own bacteria-related projects.

130

Sequencing of O-glycopeptides derived from an S-layer glycoprotein of Geobacillus stearothermophilus NRS 2004/3a containing up to 51 monosaccharide residues at a single glycosylation site by fourier transform ion cyclotron resonance infrared multiphoton dissociation mass spectrometry.  

Science.gov (United States)

The microheterogeneity of large sugar chains in glycopeptides from S-layer glycoproteins containing up to 51 monosaccharide residues at a single O-attachment site on a 12 amino acid peptide backbone was investigated by Fourier transform ion cyclotron resonance mass spectrometry (FTICR MS). Structural elucidation of glycopeptides with the same amino acid sequence and different glycoforms, having such a high saccharide-to-peptide ratio, was achieved by applying infrared multiphoton dissociation (IRMPD) MS/MS for the first time. A 100% sequence coverage of the glycan chain and a 50% coverage of the peptide backbone fragmentation were obtained. The microheterogeneity of carbohydrate chains at the same glycosylation site, containing largely rhamnose, could have been reliably assessed. PMID:17378537

Bindila, Laura; Steiner, Kerstin; Schäffer, Christina; Messner, Paul; Mormann, Michael; Peter-Katalini?, Jasna

2007-05-01

131

Evaluation of peracetic acid sanitizers efficiency against spores isolated from spoiled cans in suspension and on stainless steel surfaces.  

Science.gov (United States)

The aim of this study was to determine the inactivation effect of industrial formulations of peracetic acid biocides on bacterial spores adhering to stainless steel surfaces. A standardized protocol was used to validate biocide activity against spores in suspension. To validate sporicidal activity under practical conditions, we developed an additional protocol to simulate industrial sanitization of stainless steel surfaces with a foam sanitizer. Spores of three spore-forming bacteria, Clostridium sporogenes PA3679, Geobacillus stearothermophilus, and Moorella thermoacetica/thermoautotrophica, were sprayed onto stainless steel as bioaerosols. Sporicidal activity was high against the C. sporogenes spore suspension, with more than 5 log CFU ml(-1) destroyed at all liquid biocide contact times. Sporicidal activity also was high against G. stearothermophilus and M. thermoacetica/thermoautotrophica spores after 30 min of contact, but we found no population reduction at the 5-min contact time for the highest sporicide concentration tested. The foam biocide effectively inactivated C. sporogenes spores adhered to stainless steel but had a reduced decontamination effect on other species. For G. stearothermophilus spores, sanitization with the foam sporicide was more efficient on horizontal steel than on vertical steel, but foam sanitization was ineffective against M. thermoacetica/thermoautotrophica whatever the position. These results highlight that decontamination efficiency may differ depending on whether spores are suspended in an aqueous solution or adhered to a stainless steel surface. Biocide efficiency must be validated using relevant protocols and bacteria representative of the microbiological challenges and issues affecting each food industry. PMID:22289600

André, S; Hédin, S; Remize, F; Zuber, F

2012-02-01

132

Cellular viability of Saccharomyces cerevisiae cultivated in association with contaminates bacteria of alcoholic fermentation  

International Nuclear Information System (INIS)

The aim of this work was to study the influence of the bacteria Bacillus and Lactobacillus, as well as their metabolic products, in reduction of cellular viability of Saccharomyces cerevisiae, when in mixed culture of yeast and active and treated bacteria. Also was to evaluated an alternative medium (MCC) for the cultivation of bacteria and yeast, constituted of sugarcane juice diluted to 5 deg Brix and supplemented with yeast extract and peptone. The bacteria Bacillus subtilis, Bacillus coagulans, Bacillus stearothermophilus, Lactobacillus fermentum and Lactobacillus plantarum were cultivated in association with yeast Saccharomyces cerevisiae (strain Y-904) for 72 h on 32 deg C, under agitation. The cellular viability, budding rate and population of S. cerevisiae, the total acidity, volatile acidity and pH of culture were determined from 0, 24, 48 e 72 h of mixed culture. Also were determined the initial and final of microorganism population across the pour plate method, in traditional culture medium (PCA for Bacillus, MRS-agar for Lactobacillus and YEPD-agar for yeast S. cerevisiae) and in medium constituted of sugarcane juice. The bacteria cultures were treated by heat sterilization (120 deg C for 20 minutes), antibacterial agent (Kamoran HJ in concentration 3,0 ppm) or irradiation (radiation gamma, with doses of 5,0 kGy for Lactobacillus and 15,0 kGy for Bacillus). The results of the present research showed that just the culture mediums more acids (with higher concentrations of total and volatile acidity, and smaller values of pH), contaminated with active bacteria L. fermentum and B. subtilis, caused reduction on yeast cellular viability. Except the bacteria B. subtilis treated with radiation, the others bacteria treated by different procedures (heat, radiation e antibacterial) did not cause reduction on yeast cellular viability and population, indicating that the isolated presence of the cellular metabolic of theses bacteria was not enough to reduce the percentage of the yeast live cells and a density population. For all microorganisms, the counts obtained with the cultivation medium constituted of sugarcane juice were similar obtained in traditional mediums, probably because the alternative medium simulate the composition of sugarcane must, that the bacteria were isolated in industrial process of ethanol yield. However, the culture medium constituted of sugarcane juice could be replacing traditional culture mediums of yeast and bacteria tested in this work. (author)

133

Lactic Acid Bacteria  

Science.gov (United States)

This on-line exercise is focused on lactic acid bacteria, a group of related bacteria that produce lactic acid as a result of carbohydrate fermentation. It includes a protocol for the enrichment of lactic acid bacteria from enriched samples (like yogurt, sauerkraut, decaying plant matter, and tooth plaque). Three parameters are measured: growth, culture diversity, and pH. The exercise also includes instructions for the isolation of some of these bacteria by using the streak-plate method.

2010-03-01

134

Indigenous cellulolytic and hemicellulolytic bacteria enhanced rapid co-composting of lignocellulose oil palm empty fruit bunch with palm oil mill effluent anaerobic sludge.  

Science.gov (United States)

The composting of lignocellulosic oil palm empty fruit bunch (OPEFB) with continuous addition of palm oil mill (POME) anaerobic sludge which contained nutrients and indigenous microbes was studied. In comparison to the conventional OPEFB composting which took 60-90 days, the rapid composting in this study can be completed in 40 days with final C/N ratio of 12.4 and nitrogen (2.5%), phosphorus (1.4%), and potassium (2.8%), respectively. Twenty-seven cellulolytic bacterial strains of which 23 strains were closely related to Bacillus subtilis, Bacillus firmus, Thermobifida fusca, Thermomonospora spp., Cellulomonas sp., Ureibacillus thermosphaericus, Paenibacillus barengoltzii, Paenibacillus campinasensis, Geobacillus thermodenitrificans, Pseudoxanthomonas byssovorax which were known as lignocellulose degrading bacteria and commonly involved in lignocellulose degradation. Four isolated strains related to Exiguobacterium acetylicum and Rhizobium sp., with cellulolytic and hemicellulolytic activities. The rapid composting period achieved in this study can thus be attributed to the naturally occurring cellulolytic and hemicellulolytic strains identified. PMID:24012093

Zainudin, Mohd Huzairi Mohd; Hassan, Mohd Ali; Tokura, Mitsunori; Shirai, Yoshihito

2013-11-01

135

Bacteria: Friend or Foe?  

Science.gov (United States)

This lesson explores "good" and "bad" bacteria. Students can draw "Wanted!" bacteria mug shots, create composting trials and designs, produce a skit involving a boastful virus and bacterium, experiment with soil and ordinary objects in the lab, write a news story about an outbreak, complete a multiple-choice bacteria quiz and more!

David Brock (Roland Park Public School;)

2003-01-10

136

Identificación de genes codificantes de enzimas de interés industrial en una cepa de bacteria termofílica aislada de aguas termales de Salta (Argentina)  

Scientific Electronic Library Online (English)

Full Text Available SciELO Argentina | Language: Spanish Abstract in spanish Se aislaron dos bacterias termofílicas a partir de aguas termales de la provincia de Salta, Argentina. Estudios filogenéticos permitieron caracterizar los aislamientos como pertenecientes a los géneros Thermus y Geobacillus. Se determinó la secuencia nucleotídica parcial del genoma de Thermus sp. 2. [...] 9 con un equipo de secuenciación masiva de ADN de tecnología Roche 454. Se generaron 215.557 lecturas que proveen una cobertura aproximada de 40 veces el tamaño del genoma. Se realizó un análisis preliminar de las secuencias obtenidas para la identificación de regiones codificantes. Mediante el mismo se identificaron y caracterizaron genes que codifican enzimas utilizadas en procesos de transformación de alimentos y relacionadas con la degradación de polímeros, tales como xilanasas, proteasas, esterasas, lipasas, catalasas y galactosidasas. Este primer paso indica que este microorganismo es un potencial productor de enzimas termofílicas que podrían ser aplicadas en la industria alimentaria. Abstract in english Two thermophilic bacteria were isolated from a hot spring in Salta, northwest Argentina. Phylogenic analysis indicates that the isolates belong to the Thermus and Geobacillus genera. We have undertaken the DNA sequencing of the complete genome from the isolate Thermus sp. 2.9 using Roche 454 technol [...] ogy. Two hundred and fifteen thousand readings were obtained providing approximately 40 fold coverage of the genome. A first round of analysis of the contigs was made to identify proteins coded in the genome. We report the identification and characterization of several genes coding for enzymes related to the degradation of polymers such as xylanases, proteases, esterases, lipases, catalase and galactosidases. These enzymes may be useful in processes to transform commodities from agriculture and valuable tools in the food industry.

L.E, Navas; A.F, Amadío; I, Fuxan; R.O, Zandomeni.

2014-04-01

137

Bacteria Are Everywhere!  

Science.gov (United States)

Students are introduced to the concept of engineering biological organisms and studying their growth to be able to identify periods of fast and slow growth. They learn that bacteria are found everywhere, including on the surfaces of our hands. Student groups study three different conditions under which bacteria are found and compare the growth of the individual bacteria from each source. In addition to monitoring the quantity of bacteria from differ conditions, they record the growth of bacteria over time, which is an excellent tool to study binary fission and the reproduction of unicellular organisms.

AMPS GK-12 Program,

138

Geobacillus thermoleovorans immobilized on Amberlite XAD-4 resin as a biosorbent for solid phase extraction of uranium (VI) prior to its spectrophotometric determination  

International Nuclear Information System (INIS)

Geobacillus thermoleovorans subsp stromboliensis, was immobilized on an Amberlite XAD-4 ion exchanger and used as a solid phase extractant for the preconcentration of U(VI) ions prior to their determination by UV-VIS spectrophotometry. Parameters affecting the preconcentration (such as the pH value of the sample solution, the concentration of U(VI), the volume and type of eluent, the flow rate and the effect of potentially interfering ions) were studied. The optimum pH for the sorption of U(VI) was found to be pH 5.0. 5.0 mL of 1 M hydrochloric acid were used to eluate the U(VI) from the column. The loading capacity is 11 mg g-1. The limits of detection and quantification are 2.7 and 9.0 ?g L-1, respectively, and relative standard deviations are <10 %. The method was applied to the determination of U(VI) in a certified reference sample (NCS ZC-73014; tea leaves) and in natural water samples. (author)

139

Crystallization and preliminary X-ray characterization of an NAD(P)-dependent butanol dehydrogenase A from Geobacillus thermodenitrificans NG80-2.  

Science.gov (United States)

Geobacillus thermodenitrificans NG80-2 encodes two long-chain NAD(P)-dependent alcohol dehydrogenases, gtADH1 and gtADH2, in the terminal oxidation pathway of long-chain n-alkanes for the conversion of long-chain alkyl alcohols to their corresponding aldehydes. Both gtADH1 and gtADH2 are thermostable enzymes and oxidize long-chain alkyl alcohols up to at least C(30). In order to understand the structural basis for their role in long-chain alkane degradation, we have crystallized gtADH2. Single, colourless crystals were obtained from a recombinant preparation of ADH2 overexpressed in Escherichia coli. The crystals belong to space group C222(1), with unit-cell parameters a = 56.0, b = 99.6, c = 123.1 Å. Diffraction data were collected in-house to 1.79 Å resolution. The crystals contain one monomer in the asymmetric unit, with a V(M) value of 2.17 Å(3) Da(-1) and an estimated solvent content of 43%. PMID:23385764

Ji, Yurui; Mao, Guannan; Wang, Yingying; Bartlam, Mark

2013-02-01

140

Improving production of hyperthermostable and high maltose-forming alpha-amylase by an extreme thermophile Geobacillus thermoleovorans using response surface methodology and its applications.  

Science.gov (United States)

By cultivating Geobacillus thermoleovorans in shake flasks containing cane molasses medium at 70 degrees C, the fermentation variables were optimized by 'one variable at a time' approach followed by response surface methodology (RSM). The statistical model was obtained by central composite design (CCD) using three variables (cane-molasses, urea and inoculum density). An overall 1.6- and 2.1-fold increase in enzyme production was achieved in the optimized medium in shake flasks and fermenter, respectively. The alpha-amylase titre increased significantly in cane-molasses medium (60 U ml(-1)) as compared to that in the synthetic medium (26 U ml(-1)). Thus the cost of enzyme produced in cane molasses medium (0.823 euros per million U) was much lower than that produced in the synthetic starch-yeast extract-tryptone medium (18.52 euros per million U). The shelf life of bread was improved by supplementing dough with alpha-amylase, and thus, the enzyme was found to be useful in preventing the staling of bread. Reducing sugars liberated from 20% and 30% raw pearl millet starch were fermented to ethanol; ethanol production levels attained were 35.40 and 28.0 g l(-1), respectively. PMID:16473003

Uma Maheswar Rao, J L; Satyanarayana, T

2007-01-01

 
 
 
 
141

X-ray structure of Novamyl, the five-domain "maltogenic" alpha-amylase from Bacillus stearothermophilus: maltose and acarbose complexes at 1.7A resolution.  

Science.gov (United States)

The three-dimensional structure of the Bacillus stearothermophilus "maltogenic" alpha-amylase, Novamyl, has been determined by X-ray crystallography at a resolution of 1.7 A. Unlike conventional alpha-amylases from glycoside hydrolase family 13, Novamyl exhibits the five-domain structure more usually associated with cyclodextrin glycosyltransferase. Complexes of the enzyme with both maltose and the inhibitor acarbose have been characterized. In the maltose complex, two molecules of maltose are found in the -1 to -2 and +2 to +3 subsites of the active site, with two more on the C and E domains. The C-domain maltose occupies a position identical to one previously observed in the Bacillus circulans CGTase structure [Lawson, C. L., et al. (1994) J. Mol. Biol. 236, 590-600], suggesting that the C-domain plays a genuine biological role in saccharide binding. In the acarbose-maltose complex, the tetrasaccharide inhibitor acarbose is found as an extended hexasaccharide species, bound in the -3 to +3 subsites. The transition state mimicking pseudosaccharide is bound in the -1 subsite of the enzyme in a 2H3 half-chair conformation, as expected. The active site of Novamyl lies in an open gully, fully consistent with its ability to perform internal cleavage via an endo as opposed to an exo activity. PMID:10387084

Dauter, Z; Dauter, M; Brzozowski, A M; Christensen, S; Borchert, T V; Beier, L; Wilson, K S; Davies, G J

1999-06-29

142

Viabilidade celular de Saccharomyces cerevisiae cultivada em associação com bactérias contaminantes da fermentação alcoólica / Cellular viability of Saccharomyces cerevisiae cultivated in association with contaminant bacteria of alcoholic fermentation  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: Portuguese Abstract in portuguese O objetivo deste trabalho foi estudar a influência de bactérias dos gêneros Bacillus e Lactobacillus, bem como de seus produtos metabólicos, na redução da viabilidade celular de leveduras Saccharomyces cerevisiae. As bactérias Bacillus subtilis, Bacillus coagulans, Bacillus stearothermophilus, Lacto [...] bacillus fermentum e Lactobacillus plantarum foram cultivadas em associação com a levedura S. cerevisiae (cepa Y-904) por 72 horas a 32 °C, sob agitação. A viabilidade celular, a taxa de brotamento e a população de células de S. cerevisiae e a acidez total, a acidez volátil e o pH dos meios de cultivos foram determinados às 0, 24, 48 e 72 horas do cultivo misto. As culturas de bactérias foram tratadas através do calor, de agente antimicrobiano e de irradiação. Os resultados mostraram que apenas os meios de cultivo mais acidificados, contaminados com as bactérias ativas L. fermentum e B. subtilis, provocaram redução na viabilidade celular de S. cerevisiae. Excetuando a bactéria B. subtilis tratada com radiação gama, as demais bactérias tratadas pelos diferentes processos (calor, irradiação e antimicrobiano) não causaram diminuição da viabilidade celular e da população de S. cerevisiae, indicando que a presença isolada dos metabólitos celulares dessas bactérias não foi suficiente para reduzir a porcentagem de células vivas de S. cerevisiae. Abstract in english The aim of this project was to study the influence of the bacteria Bacillus and Lactobacillus, as well as their metabolic products to decrease the cellular viability of the yeast Saccharomyces cerevisiae. The bacteria Bacillus subtilis, Bacillus coagulans, Bacillus stearothermophilus, Lactobacillus [...] fermentum and Lactobacillus plantarum were cultivated in association with yeast S. cerevisiae (strain Y-904) for 72 hours at 32 ºC under agitation. The cellular viability, budding rate and population of S. Cerevisiae and the total acidity, volatile acidity and pH of culture medium were determined at 0, 24, 48 and 72 hours of incubation of the mixed culture. The bacteria cultures were treated by heat sterilization, antibacterial agent and irradiation. The results showed that only the more acidified culture medium, contaminated with active bacteria L. fermentum and B. subtilis, caused a reduction in the yeast cellular viability. Except for the bacteria B. subtilis treated for radiation, the other bacteria treated by the different procedures (heat, radiation and antibacterial) did not cause a reduction in the cellular viability of S. cerevisiae, indicating that the isolated presence of the cellular metabolic of these bacteria was not enough to reduce the percentage of the living yeast cells.

Thais de Paula, Nobre; Jorge, Horii; André Ricardo, Alcarde.

2007-03-01

143

Viabilidade celular de Saccharomyces cerevisiae cultivada em associação com bactérias contaminantes da fermentação alcoólica Cellular viability of Saccharomyces cerevisiae cultivated in association with contaminant bacteria of alcoholic fermentation  

Directory of Open Access Journals (Sweden)

Full Text Available O objetivo deste trabalho foi estudar a influência de bactérias dos gêneros Bacillus e Lactobacillus, bem como de seus produtos metabólicos, na redução da viabilidade celular de leveduras Saccharomyces cerevisiae. As bactérias Bacillus subtilis, Bacillus coagulans, Bacillus stearothermophilus, Lactobacillus fermentum e Lactobacillus plantarum foram cultivadas em associação com a levedura S. cerevisiae (cepa Y-904 por 72 horas a 32 °C, sob agitação. A viabilidade celular, a taxa de brotamento e a população de células de S. cerevisiae e a acidez total, a acidez volátil e o pH dos meios de cultivos foram determinados às 0, 24, 48 e 72 horas do cultivo misto. As culturas de bactérias foram tratadas através do calor, de agente antimicrobiano e de irradiação. Os resultados mostraram que apenas os meios de cultivo mais acidificados, contaminados com as bactérias ativas L. fermentum e B. subtilis, provocaram redução na viabilidade celular de S. cerevisiae. Excetuando a bactéria B. subtilis tratada com radiação gama, as demais bactérias tratadas pelos diferentes processos (calor, irradiação e antimicrobiano não causaram diminuição da viabilidade celular e da população de S. cerevisiae, indicando que a presença isolada dos metabólitos celulares dessas bactérias não foi suficiente para reduzir a porcentagem de células vivas de S. cerevisiae.The aim of this project was to study the influence of the bacteria Bacillus and Lactobacillus, as well as their metabolic products to decrease the cellular viability of the yeast Saccharomyces cerevisiae. The bacteria Bacillus subtilis, Bacillus coagulans, Bacillus stearothermophilus, Lactobacillus fermentum and Lactobacillus plantarum were cultivated in association with yeast S. cerevisiae (strain Y-904 for 72 hours at 32 ºC under agitation. The cellular viability, budding rate and population of S. Cerevisiae and the total acidity, volatile acidity and pH of culture medium were determined at 0, 24, 48 and 72 hours of incubation of the mixed culture. The bacteria cultures were treated by heat sterilization, antibacterial agent and irradiation. The results showed that only the more acidified culture medium, contaminated with active bacteria L. fermentum and B. subtilis, caused a reduction in the yeast cellular viability. Except for the bacteria B. subtilis treated for radiation, the other bacteria treated by the different procedures (heat, radiation and antibacterial did not cause a reduction in the cellular viability of S. cerevisiae, indicating that the isolated presence of the cellular metabolic of these bacteria was not enough to reduce the percentage of the living yeast cells.

Thais de Paula Nobre

2007-03-01

144

Darwin y las bacterias / Darwin and bacteria  

Scientific Electronic Library Online (English)

Full Text Available SciELO Chile | Language: Spanish Abstract in spanish Con motivo de cumplirse 200 años del natalicio de Darwin y 150 desde la publicación de El Origen de las Especies, se revisa su obra buscando alguna mención de las bacterias, a las cuales el gran naturalista parece, o bien no haber conocido, algo muy difícil en un momento en que causaban sensación en [...] el mundo científico, o bien haber ignorado deliberadamente, porque no encontraba para ellas lugar en su teoría de la evolución. Las bacterias, por su parte, afectaron malamente su vida familiar, falleciendo uno de sus hijos de escarlatina y su hija favorita, Arme, de una tuberculosis agravada por el mismo mal que mató a su hermano. El propio Darwin, desde el regreso del Beagle afectado por una enfermedad crónica hasta ahora no dilucidada, podría haber sufrido de la enfermedad de Chagas, cuyo agente etiológico, si bien no es una bacteria, tiene un similar nivel en la escala evolutiva. Abstract in english As in 2009 the scientific world celebrates two hundreds years from the birthday of Charles Darwin and one hundred and fifty from the publication of The Origin of Species, an analysis of his complete work is performed, looking for any mention of bacteria. But it seems that the great naturahst never t [...] ook knowledge about its existence, something rather improbable in a time when the discovery of bacteria shook the medical world, or he deliberately ignored them, not finding a place for such microscopic beings into his theory of evolution. But the bacteria badly affected his familiar life, killing scarlet fever one of his children and worsening to death the evolution of tuberculosis of his favourite Annie. Darwin himself could suffer the sickness of Chagas, whose etiological agent has a similar level to bacteria in the scale of evolution.

Walter, Ledermann D.

145

Darwin y las bacterias Darwin and bacteria  

Directory of Open Access Journals (Sweden)

Full Text Available Con motivo de cumplirse 200 años del natalicio de Darwin y 150 desde la publicación de El Origen de las Especies, se revisa su obra buscando alguna mención de las bacterias, a las cuales el gran naturalista parece, o bien no haber conocido, algo muy difícil en un momento en que causaban sensación en el mundo científico, o bien haber ignorado deliberadamente, porque no encontraba para ellas lugar en su teoría de la evolución. Las bacterias, por su parte, afectaron malamente su vida familiar, falleciendo uno de sus hijos de escarlatina y su hija favorita, Arme, de una tuberculosis agravada por el mismo mal que mató a su hermano. El propio Darwin, desde el regreso del Beagle afectado por una enfermedad crónica hasta ahora no dilucidada, podría haber sufrido de la enfermedad de Chagas, cuyo agente etiológico, si bien no es una bacteria, tiene un similar nivel en la escala evolutiva.As in 2009 the scientific world celebrates two hundreds years from the birthday of Charles Darwin and one hundred and fifty from the publication of The Origin of Species, an analysis of his complete work is performed, looking for any mention of bacteria. But it seems that the great naturahst never took knowledge about its existence, something rather improbable in a time when the discovery of bacteria shook the medical world, or he deliberately ignored them, not finding a place for such microscopic beings into his theory of evolution. But the bacteria badly affected his familiar life, killing scarlet fever one of his children and worsening to death the evolution of tuberculosis of his favourite Annie. Darwin himself could suffer the sickness of Chagas, whose etiological agent has a similar level to bacteria in the scale of evolution.

Walter Ledermann D

2009-02-01

146

Darwin y las bacterias / Darwin and bacteria  

Scientific Electronic Library Online (English)

Full Text Available SciELO Chile | Language: Spanish Abstract in spanish Con motivo de cumplirse 200 años del natalicio de Darwin y 150 desde la publicación de El Origen de las Especies, se revisa su obra buscando alguna mención de las bacterias, a las cuales el gran naturalista parece, o bien no haber conocido, algo muy difícil en un momento en que causaban sensación en [...] el mundo científico, o bien haber ignorado deliberadamente, porque no encontraba para ellas lugar en su teoría de la evolución. Las bacterias, por su parte, afectaron malamente su vida familiar, falleciendo uno de sus hijos de escarlatina y su hija favorita, Arme, de una tuberculosis agravada por el mismo mal que mató a su hermano. El propio Darwin, desde el regreso del Beagle afectado por una enfermedad crónica hasta ahora no dilucidada, podría haber sufrido de la enfermedad de Chagas, cuyo agente etiológico, si bien no es una bacteria, tiene un similar nivel en la escala evolutiva. Abstract in english As in 2009 the scientific world celebrates two hundreds years from the birthday of Charles Darwin and one hundred and fifty from the publication of The Origin of Species, an analysis of his complete work is performed, looking for any mention of bacteria. But it seems that the great naturahst never t [...] ook knowledge about its existence, something rather improbable in a time when the discovery of bacteria shook the medical world, or he deliberately ignored them, not finding a place for such microscopic beings into his theory of evolution. But the bacteria badly affected his familiar life, killing scarlet fever one of his children and worsening to death the evolution of tuberculosis of his favourite Annie. Darwin himself could suffer the sickness of Chagas, whose etiological agent has a similar level to bacteria in the scale of evolution.

Walter, Ledermann D.

2009-02-01

147

Bacteria: Fossil Record  

Science.gov (United States)

This description of the fossil record of bacteria focuses on one particular group of bacteria, the cyanobacteria or blue-green algae, which have left a fossil record that extends far back into the Precambrian. The oldest cyanobacteria-like fossils known are nearly 3.5 billion years old and are among the oldest fossils currently known. Cyanobacteria are larger than most bacteria and may secrete a thick cell wall. More importantly, cyanobacteria may form large layered structures, called stromatolites (if more or less dome-shaped) or oncolites (if round). The site also refers to pseudomorphs of pyrite and siderite, and a group of bacteria known as endolithic. Two links are available for more information. One provides information on the discovery of possible remains of bacteria-like organisms on a meteorite from Mars and the other has a research report on fossilized filamentous bacteria and other microbes, found in Cretaceous amber.

148

Introduction to Bacteria  

Science.gov (United States)

This science site has students research how bacteria move, where they live, and how they reproduce; learn how bacteria can be helpful or harmful; and create a design illustrating what they have learned about bacteria. Included in the lesson plan are the objectives, needed materials and Web sites, procedures, discussion questions, evaluation, extensions, suggested reading, and vocabulary. Teachers can link to Teaching Tools to create custom worksheets, puzzles, and quizzes. A printable version of the lesson plan can be downloaded. The video Bacteria, Viruses and Allergies can be purchased and comprehension questions and answers can be downloaded.

Discoveryschool.com; Fenichel, Marilyn

2007-12-12

149

Bacteria-Antagonists  

International Science & Technology Center (ISTC)

Development of Biological Control Agents Through Use of Recombinant Antagonistic Bacteria Possessing Variable Mechanisms of Antagonisms, High Colonizing Capacity and Marker Traits for their Monitoring in Nature

150

Use of a mixture of surrogates for infectious bioagents in a standard approach to assessing disinfection of environmental surfaces.  

Science.gov (United States)

We used a mixture of surrogates (Acinetobacter baumannii, Mycobacterium terrae, hepatitis A virus, and spores of Geobacillus stearothermophilus) for bioagents in a standardized approach to test environmental surface disinfectants. Each carrier containing 10 microl of mixture received 50 microl of a test chemical or saline at 22 +/- 2 degrees C. Disinfectant efficacy criteria were > or = 6 log(10) reduction for the bacteria and the spores and > or = 3 log(10) reduction for the virus. Peracetic acid (1,000 ppm) was effective in 5 min against the two bacteria and the spores but not against the virus. Chlorine dioxide (CD; 500 and 1,000 ppm) and domestic bleach (DB; 2,500, 3,500, and 5,000 ppm) were effective in 5 min, except for sporicidal activity, which needed 20 min of contact with either 1,000 ppm of CD or the two higher concentrations of DB. PMID:20639366

Sabbah, Safaa; Springthorpe, Susan; Sattar, Syed A

2010-09-01

151

Improvement of Thermal Stability via Outer-Loop Ion Pair Interaction of Mutated T1 Lipase from Geobacillus zalihae Strain T1  

Directory of Open Access Journals (Sweden)

Full Text Available Mutant D311E and K344R were constructed using site-directed mutagenesis to introduce an additional ion pair at the inter-loop and the intra-loop, respectively, to determine the effect of ion pairs on the stability of T1 lipase isolated from Geobacillus zalihae. A series of purification steps was applied, and the pure lipases of T1, D311E and K344R were obtained. The wild-type and mutant lipases were analyzed using circular dichroism. The Tm for T1 lipase, D311E lipase and K344R lipase were approximately 68.52 °C, 70.59 °C and 68.54 °C, respectively. Mutation at D311 increases the stability of T1 lipase and exhibited higher Tm as compared to the wild-type and K344R. Based on the above, D311E lipase was chosen for further study. D311E lipase was successfully crystallized using the sitting drop vapor diffusion method. The crystal was diffracted at 2.1 Å using an in-house X-ray beam and belonged to the monoclinic space group C2 with the unit cell parameters a = 117.32 Å, b = 81.16 Å and c = 100.14 Å. Structural analysis showed the existence of an additional ion pair around E311 in the structure of D311E. The additional ion pair in D311E may regulate the stability of this mutant lipase at high temperatures as predicted in silico and spectroscopically.

Mahiran Basri

2012-01-01

152

Immobilization of BSA, enzymes and cells of Bacillus stearothermophilus onto cellulose polygalacturonic acid and starch based graft copolymers containing maleic arhydride  

Energy Technology Data Exchange (ETDEWEB)

Poly(maleic anhydride styrene) graft copolymers of cellulose, pectin polygalacturonic acid salt, calcium polygalacturonate, and starch were prepared and used to immobilize proteins. The cellulose grafts coupled quite appreciable quantities of acid phosphatase, glucose oxidase, and trypsin. However, the general retention of activity was somewhat disappointing. Further investigation with acid phosphatase showed that the amount of enzyme immobilized increased as the amount of anhydride in the graft copolymer increased but no such relationship existed for the enzymic activity. The cellulose graft copolymers were hydrolyzed and it appeared that the carboxyl group aided adsorption of the enzyme. Attempts to couple acid phosphatase using CMC through the free carboxyl groups, created by hydrolysis, gave only a small increase in the extent of protein coupling. However, the unhydrolyzed system gave a useful degree of immobilization of cells of Bacillus stearothermophilus, as did a poly(maleic anhydride/styrene)-cocellulose system. Attempts to improve the activity by using grafts based on other polysaccharide supports met with mixed success. Pectin products were soluble. Polygalacturonic acid products were partially soluble and extremely high levels of enzymic activity were obtained. This was probably due in part to the hydrophilic nature of the system, which also encouraged absorption of the enzyme. Attempts were made to reduce the solubility by using the calcium pectinate salt. Immobilization of acid phosphatase and trypsin resulted in increased protein coupling but relatively poor activities were attained. Calcium polygalacturonate was used to prepare an insoluble graft copolymeric system containing acrylonitrile-comaleic anhydride. The resulting gels gave excellent coupling with acid phosphatase which had a very good retention of activity.

Beddows, C.G.; Gil, M.H.; Guthrie, J.T.

1986-01-01

153

Presence and potential role of thermophilic bacteria in temperate terrestrial environments  

Science.gov (United States)

Organic sulfur and nitrogen are major reservoirs of these elements in terrestrial systems, although their cycling remains to be fully understood. Both sulfur and nitrogen mineralization are directly related to microbial metabolism. Mesophiles and thermophiles were isolated from temperate environments. Thermophilic isolates were classified within the Firmicutes, belonging to the Geobacillus, Brevibacillus, and Ureibacillus genera, and showed optimum growth temperatures between 50°C and 60°C. Sulfate and ammonium produced were higher during growth of thermophiles both for isolated strains and natural bacterial assemblages. They were positively related to organic nutrient load. Temperature also affected the release of sulfate and ammonium by thermophiles. Quantitative, real-time reverse-transcription polymerase chain reaction on environmental samples indicated that the examined thermophilic Firmicutes represented up to 3.4% of the total bacterial community RNA. Temperature measurements during summer days showed values above 40°C for more than 10 h a day in soils from southern Spain. These results support a potential role of thermophilic bacteria in temperate terrestrial environments by mineralizing organic sulfur and nitrogen ruled by the existence and length of warm periods.

Portillo, M. C.; Santana, M.; Gonzalez, J. M.

2012-01-01

154

Bacteria-virus coevolution.  

Science.gov (United States)

Phages, viruses of bacteria, are ubiquitous. Many phages require host cell death to successfully complete their life cycle, resulting in reciprocal evolution of bacterial resistance and phage infectivity (antagonistic coevolution). Such coevolution can have profound consequences at all levels of biological organisation. Here, we review genetic and ecological factors that contribute to determining coevolutionary dynamics between bacteria and phages. We also consider some of the consequences of bacteria-phage coevolution, such as determining rates of molecular evolution and structuring communities, and how these in turn feedback into driving coevolutionary dynamics. PMID:22821466

Buckling, Angus; Brockhurst, Michael

2012-01-01

155

Crystal structures of Bacillus stearothermophilus adenylate kinase with bound Ap5A, Mg2+ Ap5A, and Mn2+ Ap5A reveal an intermediate lid position and six coordinate octahedral geometry for bound Mg2+ and Mn2+.  

Science.gov (United States)

Crystal structures of Bacillus stearothermophilus adenylate kinase with bound Ap5A, Mn2+ Ap5A, and Mg2+ Ap5A have been determined by X-ray crystallography to resolutions of 1.6 A, 1.85 A, and 1.96 A, respectively. The protein's lid domain is partially open, being both rotated and translated away from bound Ap5A. The flexibility of the lid domain in the ternary state and its ability to transfer force directly to the the active site is discussed in light of our proposed entropic mechanism for catalytic turnover. The bound Zn2+ atom is demonstrably structural in nature, with no contacts other than its ligating cysteine residues within 5 A. The B. stearothermophilus adenylate kinase lid appears to be a truncated zinc finger domain, lacking the DNA binding finger, which we have termed a zinc knuckle domain. In the Mg2+ Ap5A and Mn2+ Ap5A structures, Mg2+ and Mn2+ demonstrate six coordinate octahedral geometry. The interactions of the Mg2+-coordinated water molecules with the protein and Ap5A phosphate chain demonstrate their involvement in catalyzing phosphate transfer. The protein selects for beta-y (preferred by Mg2+) rather than alpha-gamma (preferred by Mn2+) metal ion coordination by forcing the ATP phosphate chain to have an extended conformation. PMID:9715904

Berry, M B; Phillips, G N

1998-08-15

156

Cultivation Media for Bacteria  

Science.gov (United States)

Common bacteriological culture media (tryptic soy agar, chocolate agar, Thayer-Martin agar, MacConkey agar, eosin-methylene blue agar, hektoen agar, mannitol salt agar, and sheep blood agar) are shown uninoculated and inoculated with bacteria.

American Society For Microbiology;

2009-12-08

157

Bacteria subsisting on antibiotics.  

DEFF Research Database (Denmark)

Antibiotics are a crucial line of defense against bacterial infections. Nevertheless, several antibiotics are natural products of microorganisms that have as yet poorly appreciated ecological roles in the wider environment. We isolated hundreds of soil bacteria with the capacity to grow on antibiotics as a sole carbon source. Of 18 antibiotics tested, representing eight major classes of natural and synthetic origin, 13 to 17 supported the growth of clonal bacteria from each of 11 diverse soils. Bacteria subsisting on antibiotics are surprisingly phylogenetically diverse, and many are closely related to human pathogens. Furthermore, each antibiotic-consuming isolate was resistant to multiple antibiotics at clinically relevant concentrations. This phenomenon suggests that this unappreciated reservoir of antibiotic-resistance determinants can contribute to the increasing levels of multiple antibiotic resistance in pathogenic bacteria.

Dantas, Gautam; Sommer, Morten O A

2008-01-01

158

A modeling study by response surface methodology and artificial neural network on culture parameters optimization for thermostable lipase production from a newly isolated thermophilic Geobacillus sp. strain ARM  

Directory of Open Access Journals (Sweden)

Full Text Available Abstract Background Thermostable bacterial lipases occupy a place of prominence among biocatalysts owing to their novel, multifold applications and resistance to high temperature and other operational conditions. The capability of lipases to catalyze a variety of novel reactions in both aqueous and nonaqueous media presents a fascinating field for research, creating interest to isolate novel lipase producers and optimize lipase production. The most important stages in a biological process are modeling and optimization to improve a system and increase the efficiency of the process without increasing the cost. Results Different production media were tested for lipase production by a newly isolated thermophilic Geobacillus sp. strain ARM (DSM 21496 = NCIMB 41583. The maximum production was obtained in the presence of peptone and yeast extract as organic nitrogen sources, olive oil as carbon source and lipase production inducer, sodium and calcium as metal ions, and gum arabic as emulsifier and lipase production inducer. The best models for optimization of culture parameters were achieved by multilayer full feedforward incremental back propagation network and modified response surface model using backward elimination, where the optimum condition was: growth temperature (52.3°C, medium volume (50 ml, inoculum size (1%, agitation rate (static condition, incubation period (24 h and initial pH (5.8. The experimental lipase activity was 0.47 Uml-1 at optimum condition (4.7-fold increase, which compared well to the maximum predicted values by ANN (0.47 Uml-1 and RSM (0.476 Uml-1, whereas R2 and AAD were determined as 0.989 and 0.059% for ANN, and 0.95 and 0.078% for RSM respectively. Conclusion Lipase production is the result of a synergistic combination of effective parameters interactions. These parameters are in equilibrium and the change of one parameter can be compensated by changes of other parameters to give the same results. Though both RSM and ANN models provided good quality predictions in this study, yet the ANN showed a clear superiority over RSM for both data fitting and estimation capabilities. On the other hand, ANN has the disadvantage of requiring large amounts of training data in comparison with RSM. This problem was solved by using statistical experimental design, to reduce the number of experiments.

Basri Mahiran

2008-12-01

159

Purification, characterization, and synergistic action of phytate-resistant alpha-amylase and alpha-glucosidase from Geobacillus thermodenitrificans HRO10.  

Science.gov (United States)

The alpha-amylase (1, 4-alpha-d-glucanohydrolase; EC 3.2.1.1) and alpha-glucosidase (alpha-d-glucoside glucohydrolase; EC 3.2.1.20) secreted by Geobacillus thermodenitrificans HRO10 were purified to homogeneity (13.6-fold; 11.5% yield and 25.4-fold; 32.0% yield, respectively) through a series of steps. The molecular weight of alpha-amylase was 58kDa, as estimated by sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE). The alpha-amylase activity on potato starch was optimal at pH 5.5 and 80 degrees Celsius. In the presence of Ca(2+), the alpha-amylase had residual activity of more than 92% after 1h of incubation at 70 degrees Celsius. The alpha-amylase did not lose any activity in the presence of phytate (a selective alpha-amylase inhibitor) at concentrations as high as 10mM, rather it retained 90% maximal activity after 1h of incubation at 70 degrees Celsius. EGTA and EDTA were strong inhibitory substances of the enzyme. The alpha-amylase hydrolyzed soluble starch at 80 degrees Celsius, with a K(m) of 3.05mgml(-1) and a V(max) of 7.35Uml(-1). The molecular weight of alpha-glucosidase was approximately 45kDa, as determined by SDS-PAGE. The enzyme activity was optimal at pH 6.5-7.5 and 55 degrees Celsius. Phytate did not inhibit G. thermodenitrificans HRO10 alpha-glucosidase activity, whereas pCMB was a potent inhibitor of the enzyme. The alpha-glucosidase exhibited Michaelis-Menten kinetics with maltose at 55 degrees Celsius (K(m): 17mM; V(max): 23micromolmin(-1)mg(-1)). Thin-layer chromatography studies with G. thermodenitrificans HRO10 alpha-amylase and alpha-glucosidase showed an excellent synergistic action and did not reveal any transglycosylation catalyzed reaction by the alpha-glucosidase. PMID:16581150

Ezeji, Thaddeus C; Bahl, Hubert

2006-08-20

160

Bistability in bacteria.  

Science.gov (United States)

Gene expression in bacteria is traditionally studied from the average behaviour of cells in a population, which has led to the assumption that under a particular set of conditions all cells express genes in an approximately uniform manner. The advent of methods for visualizing gene expression in individual cells reveals, however, that populations of genetically identical bacteria are sometimes heterogeneous, with certain genes being expressed in a non-uniform manner across the population. In some cases, heterogeneity is manifested by the bifurcation into distinct subpopulations, and we adopt the common usage, referring to this phenomenon as bistability. Here we consider four cases of bistability, three from Bacillus subtilis and one from Escherichia coli, with an emphasis on random switching mechanisms that generate alternative cell states and the biological significance of phenotypic heterogeneity. A review describing additional examples of bistability in bacteria has been published recently. PMID:16879639

Dubnau, David; Losick, Richard

2006-08-01

 
 
 
 
161

Enteric bacteria mandibular osteomyelitis.  

Science.gov (United States)

Osteomyelitis of the mandible is a relatively rare inflammatory disease that usually stems from the odontogenic polymicrobial flora of the oral cavity. We are reporting 2 unusual cases of mandibular osteomyelitis resulting from enteric bacteria infection. In one patient, abundant clinical evidence suggested a diagnosis of a chronic factitious disease, whereas in the second patient no obvious etiology was found. PMID:15897844

Scolozzi, Paolo; Lombardi, Tommaso; Edney, Timothy; Jaques, Bertrand

2005-06-01

162

Immunity to intracellular bacteria  

Directory of Open Access Journals (Sweden)

Full Text Available Immunity to intracellular bacteria including Mycobacterium tuberculosis. Mycobacterium leprae, and Listeria monocytogenes depends on specific T cells. Evidence to be described suggests that CD4 (alpha/betaT cells which interact with each other and with macrophages contribute to acquired resistence against as well as pathogenesis of intracellular bacterial infections.

Stefan H. E. Kaufmann

1992-01-01

163

Immunity to intracellular bacteria  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in english Immunity to intracellular bacteria including Mycobacterium tuberculosis. Mycobacterium leprae, and Listeria monocytogenes depends on specific T cells. Evidence to be described suggests that CD4 (alpha/beta)T cells which interact with each other and with macrophages contribute to acquired resistence [...] against as well as pathogenesis of intracellular bacterial infections.

Stefan H. E., Kaufmann; George A., Follows; Martin E., Munik.

164

Can bacteria save the planet?  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Bacteria might just hold the key to preserving the environment for our great grandchildren. Philip Hunter explores some of the novel ways in which systems biology and biotechnology are harnessing bacteria to produce renewable energy and clean up pollution.

Hunter, Philip

2010-01-01

165

Reanimation of Ancient Bacteria  

Energy Technology Data Exchange (ETDEWEB)

Recent highly publicized experiments conducted on salt crystals taken from the Permian Salado Formation in Southeastern New Mexico have shown that some ancient crystals contain viable microorganisms trapped within fluid inclusions. Stringent geological and microbiological selection criteria were used to select crystals and conduct all sampling. This talk will focus on how each of these lines of data support the conclusion that such isolated bacteria are as old as the rock in which they are trapped. In this case, the isolated microbes are salt tolerant bacilli that grow best in media containing 8% NaCl, and respond to concentrated brines by forming spores. One of the organisms is phylogenetically related to several bacilli, but does have several unique characteristics. This talk will trace the interdisciplinary data and procedures supporting these discoveries, and describe the various isolated bacteria.

Vreeland, Russell H. (West Chester University)

2002-01-09

166

Genomics of cellulolytic bacteria.  

Science.gov (United States)

The heterogeneous plant biomass is efficiently decomposed by the interplay of a great number of different enzymes. The enzyme systems in cellulolytic bacteria have been investigated by sequencing and bioinformatic analysis of genomes from plant biomass degrading microorganisms with valuable insights into the variety of the involved enzymes. This broadened our understanding of the biochemical mechanisms of plant polymer degradation and made the enzymes applicable for modern biotechnology. A list of the truly cellulolytic bacteria described and the available genomic information was examined for proteins with cellulolytic and hemicellulolytic capability. The importance of the isolation, characterization and genomic sequencing of cellulolytic microorganisms and their usage for sustainable energy production from biomass and other residues, is emphasized. PMID:25104562

Koeck, Daniela E; Pechtl, Alexander; Zverlov, Vladimir V; Schwarz, Wolfgang H

2014-10-01

167

Glacial lake hides bacteria  

Science.gov (United States)

This article highlights the published work of a geomicrobiology research team led by Eric Gaidos from the University of Hawaii and Brian Lanoil, from the University of California, Riverside. This group reports the identification of bacteria from an Icelandic sub-glacial lake, and how the collection and description of these microorganisms immured within glacial ice and sub-surface water serve as a model in the search for extra-terrestrial life.

Peplow, Mark; Online, Bioed

168

Cheek Cells and Bacteria  

Science.gov (United States)

Dr. Brett Finlay enlists a student volunteer to show the surprisingly high amount of bacteria found in his own mouth. This resource is also featured on the DVD 2000 and Beyond: Confronting the Microbe Menace, available free from HHMI. This video is one minute and 27 seconds in length, and available in MOV (8 MB) and WMV (12 MB). All Infectious Disease videos are located at: http://www.hhmi.org/biointeractive/disease/video.html.

Dr. Brett Finlay (Howard Hughes Medical Institute;)

2007-03-27

169

Pepsin homologues in bacteria  

Directory of Open Access Journals (Sweden)

Full Text Available Abstract Background Peptidase family A1, to which pepsin belongs, had been assumed to be restricted to eukaryotes. The tertiary structure of pepsin shows two lobes with similar folds and it has been suggested that the gene has arisen from an ancient duplication and fusion event. The only sequence similarity between the lobes is restricted to the motif around the active site aspartate and a hydrophobic-hydrophobic-Gly motif. Together, these contribute to an essential structural feature known as a psi-loop. There is one such psi-loop in each lobe, and so each lobe presents an active Asp. The human immunodeficiency virus peptidase, retropepsin, from peptidase family A2 also has a similar fold but consists of one lobe only and has to dimerize to be active. All known members of family A1 show the bilobed structure, but it is unclear if the ancestor of family A1 was similar to an A2 peptidase, or if the ancestral retropepsin was derived from a half-pepsin gene. The presence of a pepsin homologue in a prokaryote might give insights into the evolution of the pepsin family. Results Homologues of the aspartic peptidase pepsin have been found in the completed genomic sequences from seven species of bacteria. The bacterial homologues, unlike those from eukaryotes, do not possess signal peptides, and would therefore be intracellular acting at neutral pH. The bacterial homologues have Thr218 replaced by Asp, a change which in renin has been shown to confer activity at neutral pH. No pepsin homologues could be detected in any archaean genome. Conclusion The peptidase family A1 is found in some species of bacteria as well as eukaryotes. The bacterial homologues fall into two groups, one from oceanic bacteria and one from plant symbionts. The bacterial homologues are all predicted to be intracellular proteins, unlike the eukaryotic enzymes. The bacterial homologues are bilobed like pepsin, implying that if no horizontal gene transfer has occurred the duplication and fusion event might be very ancient indeed, preceding the divergence of bacteria and eukaryotes. It is unclear whether all the bacterial homologues are derived from horizontal gene transfer, but those from the plant symbionts probably are. The homologues from oceanic bacteria are most closely related to memapsins (or BACE-1 and BACE-2, but are so divergent that they are close to the root of the phylogenetic tree and to the division of the A1 family into two subfamilies.

Bateman Alex

2009-09-01

170

Global transport of thermophilic bacteria in atmospheric dust.  

Science.gov (United States)

Aerosols from dust storms generated in the Sahara-Sahel desert area of Africa are transported north over Europe and periodically result in dry dust precipitation in the Mediterranean region. Samples of dust collected in Turkey and Greece following two distinct desert storm events contained viable thermophilic organisms of the genus Geobacillus, namely G. thermoglucosidasius and G. thermodenitrificans, and the recently reclassified Aeribacillus pallidus (formerly Geobacillus pallidus). We present here evidence that African dust storms create an atmospheric bridge between distant geographical regions and that they are also probably the source of thermophilic geobacilli later deposited over northern Europe by rainfall or dust plumes themselves. The same organisms (99% similarity in the 16S rDNA sequence) were found in dust collected in the Mediterranean region and inhabiting cool soils in Northern Ireland. This study also contributes new insights to the taxonomic identification of Geobacillus sp. Attempts to identify these organisms using 16S rRNA gene sequences have revealed that they contain multiple and diverse copies of the ribosomal RNA operon (up to 10 copies with nine different sequences), which dictates care in interpreting data about the systematics of this genus. PMID:23766086

Perfumo, Amedea; Marchant, Roger

2010-04-01

171

Protein uptake by bacteria  

Science.gov (United States)

Endocytosis is a fundamental process of membrane-trafficking in eukaryotes, but has not been known to occur in bacteria or archaea. The origin of endocytosis is central to the understanding of evolution of the first eukaryotes and their endomembrane systems. In a recent study we have established that an endocytosis-like process for uptake of proteins into cells occurs in a bacterium, Gemmata obscuriglobus, a member of the distinctive phylum Planctomycetes of peptidoglycan-less budding bacteria. Members of this phylum characteristically possess cells divided into compartments separated by internal membranes and in the case of G. obscuriglobus these compartments include one where a double membrane envelope surrounds its nucleoid DNA, as well as an outer ribosome- free region of cytoplasm. Proteins can be internalized by cells from the external milieu and collected into this ribosome-free compartment, and this process is energy-dependent and appears to be receptor-mediated. As in eukaryote endocytosis, internalized proteins are associated with vesicles, and can be subjected to proteolytic degradation. The discovery of this process in a bacterium has significant implications for our understanding of the origins of endocytosis in eukaryotes. PMID:21331243

Sagulenko, Evgeny

2010-01-01

172

Fuzzy species among recombinogenic bacteria  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Abstract Background It is a matter of ongoing debate whether a universal species concept is possible for bacteria. Indeed, it is not clear whether closely related isolates of bacteria typically form discrete genotypic clusters that can be assigned as species. The most challenging test of whether species can be clearly delineated is provided by analysis of large populations of closely-related, highly recombinogenic, bacteria that colonise the same body site. We have used conca...

Fraser Christophe; Hanage William P

2005-01-01

173

Ecophysiology of the anammox bacteria  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Anaerobic ammonium oxidizing (anammox) bacteria oxidize ammonium to dinitrogen gas with nitrite as the electron acceptor. These bacteria are the key players in the global nitrogen cycle, responsible for the most of nitrogen production in natural ecosystems. The anammox process is also a cost-effective and environment-friendly alternative to conventional ammonium removal from wastewater streams. Still, little is known about the metabolism and niche differentiation of anammox bacteria. The inte...

Kartal, Mustafa Boran

2008-01-01

174

Sterilization of single-use helical stone baskets: an experimental study  

Directory of Open Access Journals (Sweden)

Full Text Available Objectives: To experimentally evaluate the efficacy of a standard sterilization protocol employed during reuse of disposable helical stone baskets. Methods: Study performed on 20 helical stone baskets: 10 were used in the initial validation process, contaminated with Escherichia coli ATCC 25922 and imprinted on Müeller-Hinton media; 10 catheters were contaminated with Geobacillus stearothermophilus ATCC 7953, processed, inoculated in TSB and incubated in a water bath at a temperature of 55ºC. Bacterial growth was evaluated after 1, 3, 5 and 7 days. After sterilization, stone baskets were also opened and closed 40 times to check for functional problems. All plastic and basket parts were carefully checked for damages. Results: After the 72-hour incubation period, there was growth of E. coli ATCC 25922 in 100% of imprints. After the sterilization process and up to 7 days incubation period on a blood agar plate, there was no growth of G. stearothermophilus ATCC 7953 or any other bacteria. There were no functional problems or damage to baskets after the sterilization process. Conclusion: The ethylene oxide system is efficacious and safe for sterilization of disposable helical stone baskets. However, further clinical studies are required and should provide more safety information.

Cely Barreto da Silva

2011-03-01

175

Bacteriophages of methanotrophic bacteria  

Energy Technology Data Exchange (ETDEWEB)

Bacteriophages of methanotrophic bacteria have been found in 16 out of 88 studied samples (underground waters, pond water, soil, gas and oil installation waters, fermentor cultural fluids, bacterial paste, and rumen of cattle) taken in different geographic zones of the Soviet Union. Altogether, 23 phage strains were isolated. By fine structure, the phages were divided into two types (with very short or long noncontractile tails); by host range and serological properties, they fell into three types. All phages had guanine- and cytosine-rich double-stranded deoxyribonucleic acid consisting of common nitrogen bases. By all of the above-mentioned properties, all phages within each of the groups were completely identical to one another, but differed from phages of other groups.

Tyutikow, F.M. (All-Union Research Inst. for Genetics and Selection of Industrial Microorganisms, Moscow, USSR); Bespalova, I.A.; Rebentish, B.A.; Aleksandrushkina, N.N.; Krivisky, A.S.

1980-10-01

176

Extracellular communication in bacteria  

DEFF Research Database (Denmark)

Populations of bacterial cells often coordinate their responses to changes in their local environmental conditions through "quorum sensing", a cell-to-cell communication system employing small diffusible signal molecules. While there is considerable diversity in the chemistry of such signal molecules, in different Gram-positive and Gram-negative bacteria they control pathogenicity, secondary metabolite production, biofilm differentiation, DNA transfer and bioluminescence. The development of biosensors for the detection of these signal molecules has greatly facilitated their subsequent chemical analysis which in turn has resulted in significant progress in understanding the molecular basis of quorum sensing-dependent gene expression. Consequently, the discovery and characterisation of natural molecules which antagonize quorum sensing-mediated responses has created new opportunities for the design of novel anti-infective agents which control infection through the attenuation of bacterial virulence.

Givskov, Michael Christian

2005-01-01

177

Interactions between Diatoms and Bacteria  

Science.gov (United States)

Summary: Diatoms and bacteria have cooccurred in common habitats for hundreds of millions of years, thus fostering specific associations and interactions with global biogeochemical consequences. Diatoms are responsible for one-fifth of the photosynthesis on Earth, while bacteria remineralize a large portion of this fixed carbon in the oceans. Through their coexistence, diatoms and bacteria cycle nutrients between oxidized and reduced states, impacting bioavailability and ultimately feeding higher trophic levels. Here we present an overview of how diatoms and bacteria interact and the implications of these interactions. We emphasize that heterotrophic bacteria in the oceans that are consistently associated with diatoms are confined to two phyla. These consistent bacterial associations result from encounter mechanisms that occur within a microscale environment surrounding a diatom cell. We review signaling mechanisms that occur in this microenvironment to pave the way for specific interactions. Finally, we discuss known interactions between diatoms and bacteria and exciting new directions and research opportunities in this field. Throughout the review, we emphasize new technological advances that will help in the discovery of new interactions. Deciphering the languages of diatoms and bacteria and how they interact will inform our understanding of the role these organisms have in shaping the ocean and how these interactions may change in future oceans. PMID:22933565

Amin, Shady A.; Parker, Micaela S.

2012-01-01

178

Bacteria Growth Inquiry: Bodily Bacteria and Healthy Hygiene Habits  

Science.gov (United States)

In this inquiry activity, students generate investigable questions to explore the link between hygiene/cleanliness and bacteria growth/population. The students will present their conclusions, and video clips containing additional information will be discussed.

179

Thymidine kinase diversity in bacteria  

DEFF Research Database (Denmark)

Thymidine kinases (TKs) appear to be almost ubiquitous and are found in nearly all prokaryotes, eukaryotes, and several viruses. They are the key enzymes in thymidine salvage and activation of several anti-cancer and antiviral drugs. We show that bacterial TKs can be subdivided into 2 groups. The TKs from Gram-positive bacteria are more closely related to the eukaryotic TK1 enzymes than are TKs from Gram-negative bacteria.

Sandrini, Michael; Piskur, Jure

2006-01-01

180

Activation of D-tyrosine by Bacillus stearothermophilus tyrosyl-tRNA synthetase: 1. Pre-steady-state kinetic analysis reveals the mechanistic basis for the recognition of D-tyrosine.  

Science.gov (United States)

Tyrosyl-tRNA synthetase (TyrRS) is able to catalyze the transfer of both l- and d-tyrosine to the 3' end of tRNA(Tyr). Activation of either stereoisomer by ATP results in formation of an enzyme-bound tyrosyl-adenylate intermediate and is accompanied by a blue shift in the intrinsic fluorescence of the protein. Single turnover kinetics for the aminoacylation of tRNA(Tyr) by D-tyrosine were monitored using stopped-flow fluorescence spectroscopy. Bacillus stearothermophilus tyrosyl-tRNA synthetase binds d-tyrosine with an 8.5-fold lower affinity than that of l-tyrosine (K (D-Tyr)(d) = 102 microm) and exhibits a 3-fold decrease in the forward rate constant for the activation reaction (k (D-Tyr)(3) = 13 s(-1)). Furthermore, as is the case for l-tyrosine, tyrosyl-tRNA synthetase exhibits "half-of-the-sites" reactivity with respect to the binding and activation of D-tyrosine. Surprisingly, pyrophosphate binds to the TyrRS.d-Tyr-AMP intermediate with a 14-fold higher affinity than it binds to the TyrRS.l-Tyr-AMP intermediate (K (PPi)(d) = 0.043 for TyrRS.d-Tyr-AMP.PP(i)). tRNA(Tyr) binds with a slightly (2.3-fold) lower affinity to the TyrRS.d-Tyr-AMP intermediate than it does to the TyrRS.l-Tyr-AMP intermediate. The observation that the K (Tyr)(d) and k(3) values are similar for l- and d-tyrosine suggests that their side chains bind to tyrosyl-tRNA synthetase in similar orientations and that at least one of the carboxylate oxygen atoms in d-tyrosine is properly positioned for attack on the alpha-phosphate of ATP. PMID:18319247

Sheoran, Anita; Sharma, Gyanesh; First, Eric A

2008-05-01

 
 
 
 
181

Horizontal gene transfer between bacteria.  

Science.gov (United States)

Horizontal gene transfer (HGT) refers to the acquisition of foreign genes by organisms. The occurrence of HGT among bacteria in the environment is assumed to have implications in the risk assessment of genetically modified bacteria which are released into the environment. First, introduced genetic sequences from a genetically modified bacterium could be transferred to indigenous micro-organisms and alter their genome and subsequently their ecological niche. Second, the genetically modified bacterium released into the environment might capture mobile genetic elements (MGE) from indigenous micro-organisms which could extend its ecological potential. Thus, for a risk assessment it is important to understand the extent of HGT and genome plasticity of bacteria in the environment. This review summarizes the present state of knowledge on HGT between bacteria as a crucial mechanism contributing to bacterial adaptability and diversity. In view of the use of GM crops and microbes in agricultural settings, in this mini-review we focus particularly on the presence and role of MGE in soil and plant-associated bacteria and the factors affecting gene transfer. PMID:17961477

Heuer, Holger; Smalla, Kornelia

2007-01-01

182

Nitrate-reducing bacteria on rat tongues.  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Nitrite-producing bacteria (NPB) were isolated from tongues of laboratory rats. The most commonly found nitrite-producing organism was Staphylococcus sciuri, followed by Staphylococcus intermedius, Pasteurella spp., and finally Streptococcus spp. Both morphometric quantification of bacteria on tongue sections and enumeration of culturable bacteria (CFU) showed an increase in the density of bacteria towards the posterior tongue. Up to 65% of bacteria were located in the deep clefts on the post...

Li, H.; Duncan, C.; Townend, J.; Killham, K.; Smith, L. M.; Johnston, P.; Dykhuizen, R.; Kelly, D.; Golden, M.; Benjamin, N.; Leifert, C.

1997-01-01

183

Automated radiometric detection of bacteria  

International Nuclear Information System (INIS)

A new radiometric method called BACTEC, used for the detection of bacteria in cultures or in supposedly sterile samples, was discussed from the standpoint of methodology, both automated and semi-automated. Some of the results obtained so far were reported and some future applications and development possibilities were described. In this new method, the test sample is incubated in a sealed vial with a liquid culture medium containing a 14C-labeled substrate. If bacteria are present, they break down the substrate, producing 14CO2 which is periodically extracted from the vial as a gas and is tested for radioactivity. If this gaseous radioactivity exceeds a threshold level, it is evidence of bacterial presence and growth in the test vial. The first application was for the detection of bacteria in the blood cultures of hospital patients. Data were presented showing typical results. Also discussed were future applications, such as rapid screening for bacteria in urine industrial sterility testing and the disposal of used 14C substrates. (Mukohata, S.)

184

Fuzzy species among recombinogenic bacteria  

Directory of Open Access Journals (Sweden)

Full Text Available Abstract Background It is a matter of ongoing debate whether a universal species concept is possible for bacteria. Indeed, it is not clear whether closely related isolates of bacteria typically form discrete genotypic clusters that can be assigned as species. The most challenging test of whether species can be clearly delineated is provided by analysis of large populations of closely-related, highly recombinogenic, bacteria that colonise the same body site. We have used concatenated sequences of seven house-keeping loci from 770 strains of 11 named Neisseria species, and phylogenetic trees, to investigate whether genotypic clusters can be resolved among these recombinogenic bacteria and, if so, the extent to which they correspond to named species. Results Alleles at individual loci were widely distributed among the named species but this distorting effect of recombination was largely buffered by using concatenated sequences, which resolved clusters corresponding to the three species most numerous in the sample, N. meningitidis, N. lactamica and N. gonorrhoeae. A few isolates arose from the branch that separated N. meningitidis from N. lactamica leading us to describe these species as 'fuzzy'. Conclusion A multilocus approach using large samples of closely related isolates delineates species even in the highly recombinogenic human Neisseria where individual loci are inadequate for the task. This approach should be applied by taxonomists to large samples of other groups of closely-related bacteria, and especially to those where species delineation has historically been difficult, to determine whether genotypic clusters can be delineated, and to guide the definition of species.

Fraser Christophe

2005-03-01

185

Oligotrophic bacteria isolated from clinical materials.  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Oligotrophic bacteria (oligotrophs) are microorganisms that grow in extremely nutritionally deficient conditions in which the concentrations of organic substances are low. Many oligotrophic bacteria were isolated from clinical materials including urine, sputum, swabbings of the throat, vaginal discharges, and others. Seventy-seven strains of oligotrophic bacteria from 871 samples of clinical material were isolated. A relatively higher frequency of isolation of oligotrophic bacteria was shown ...

Tada, Y.; Ihmori, M.; Yamaguchi, J.

1995-01-01

186

Re-engineering bacteria for ethanol production  

Energy Technology Data Exchange (ETDEWEB)

The invention provides recombinant bacteria, which comprise a full complement of heterologous ethanol production genes. Expression of the full complement of heterologous ethanol production genes causes the recombinant bacteria to produce ethanol as the primary fermentation product when grown in mineral salts medium, without the addition of complex nutrients. Methods for producing the recombinant bacteria and methods for producing ethanol using the recombinant bacteria are also disclosed.

Yomano, Lorraine P; York, Sean W; Zhou, Shengde; Shanmugam, Keelnatham; Ingram, Lonnie O

2014-05-06

187

Dissipative Shocks behind Bacteria Gliding  

CERN Document Server

Gliding is a means of locomotion on rigid substrates utilized by a number of bacteria includingmyxobacteria and cyanobacteria. One of the hypotheses advanced to explain this motility mechanism hinges on the role played by the slime filaments continuously extruded from gliding bacteria. This paper solves in full a non-linear mechanical theory that treats as dissipative shocks both the point where the extruded slime filament comes in contact with the substrate, called the filament's foot, and the pore on the bacterium outer surface from where the filament is ejected. We prove that kinematic compatibility for shock propagation requires that the bacterium uniform gliding velocity (relative to the substrate) and the slime ejecting velocity (relative to the bacterium) must be equal, a coincidence that seems to have already been observed.

Virga, Epifanio G

2014-01-01

188

Aggregation Patterns in Stressed Bacteria  

CERN Document Server

We study the formation of spot patterns seen in a variety of bacterial species when the bacteria are subjected to oxidative stress due to hazardous byproducts of respiration. Our approach consists of coupling the cell density field to a chemoattractant concentration as well as to nutrient and waste fields. The latter serves as a triggering field for emission of chemoattractant. Important elements in the proposed model include the propagation of a front of motile bacteria radially outward form an initial site, a Turing instability of the uniformly dense state and a reduction of motility for cells sufficiently far behind the front. The wide variety of patterns seen in the experiments is explained as being due the variation of the details of the initiation of the chemoattractant emission as well as the transition to a non-motile phase.

Tsimring, L S; Aranson, I S; Ben-Jacob, E; Cohen, I; Shochet, O; Tsimring, Lev; Levine, Herbert; Aranson, Igor; Ben-Jacob, Eshel; Cohen, Inon; Shochet, Ofer

1995-01-01

189

Enteropathogenic bacteria in frozen chicken.  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Eighty-two samples of frozen chicken from retail stores were examined for the presence of Campylobacter, Yersinia enterocolitica, and salmonellae. Aerobic plate counts and numbers of coliform bacteria at 37 degrees C were determined. Campylobacter fetus subsp. jejuni was found in 22% of the samples, Y. enterocolitica was found in 24.5% and Salmonella typhimurium was found in one sample (1.2%). The isolated strains of Y. enterocolitica belonged to serotypes 4, 5b, 6, and 8. Aerobic plate count...

Norberg, P.

1981-01-01

190

Bacteria Allocation Using Monte Carlo  

Science.gov (United States)

This applet, created by David Hill and Lila Roberts, uses the Monte Carlo technique to simulate a count of bacteria that are present as a result of a certain sampling process. This simulation could be modified to perform other experiments. This experiment is geared towards high school calculus students or probability courses for mathematics majors in college. Students must possess a basic understanding of probability concepts before performing this experiment. Overall, it is a nice activity for a mathematics classroom.

Hill, David R.; Roberts, Lila F.

2009-11-24

191

High Pressure Inactivation of Bacteria  

Digital Repository Infrastructure Vision for European Research (DRIVER)

The aim of this thesis was to study the effect of temperature-co-solvent or combined pressure-temperature-co-solvent induced inactivation behaviour of bacteria. Therefore, the focus was set on the fermentative organism Lactococcus lactis ssp. cremoris MG 1363, which should be characterised on its physiological behaviour under extreme conditions. In addition, previously measured data sets were used (Molina-Höppner, 2002) to the pressure-temperature-co-solvent dependent inactivation kinetics t...

Kilimann, Klaus Valentin

2006-01-01

192

F-LE Bacteria Populations  

Science.gov (United States)

This is a task from the Illustrative Mathematics website that is one part of a complete illustration of the standard to which it is aligned. Each task has at least one solution and some commentary that addresses important asects of the task and its potential use. Here are the first few lines of the commentary for this task: A hospital is conducting a study to see how different environmental conditions influence the growth of streptococcus pneumonia, one of the bacteria whi...

193

Compartmentalization of bacteria in microcapsules.  

Science.gov (United States)

Lactobacillus plantarum strain 423 was encapsulated in hollow poly(organosiloxane) microcapsules by templating water-in-oil Pickering emulsion droplets via the interfacial reaction of alkylchlorosilanes. The bacteria were suspended in growth medium or buffer to protect the cells against pH changes during the interfacial reactions with alkylchlorosilanes. The results of this work open up novel avenues for the encapsulation of microbial cells. PMID:25351443

van Wijk, Judith; Heunis, Tiaan; Harmzen, Elrika; Dicks, Leon M T; Meuldijk, Jan; Klumperman, Bert

2014-12-18

194

Thermophilic spore-forming bacteria isolated from spoiled canned food and their heat resistance. Results of a French ten-year survey.  

Science.gov (United States)

Thermal processing of Low Acid Canned Foods (LACF), which are safe and shelf-stable at ambient temperature for several years, results in heat inactivation of all vegetative microorganisms and the partial or total inactivation of spores. Good Manufacturing Hygienic Practices include stability tests for managing the pathogen risk related to surviving mesophilic bacterial spores. LACF are also often submitted to additional incubation conditions, typically 55 °C for 7 days, to monitor spoilage by thermophiles. In this study we identified the bacterial species responsible for non-stability after prolonged at 55 °C of incubation of LACF from 455 samples collected from 122 French canneries over 10 years. Bacteria were identified by microsequencing or a recent developed tool for group-specific PCR detection (SporeTraQ™). A single species was identified for 93% of examined samples. Three genera were responsible for more than 80% of all non-stability cases: mostly Moorella (36%) and Geobacillus (35%), and less frequently Thermoanaerobacterium (10%). The other most frequent bacterial genera identified were Bacillus, Thermoanaerobacter, Caldanaerobius, Anoxybacillus, Paenibacillus and Clostridium. Species frequency was dependent on food category, i.e. vegetables, ready-made meals containing meat, seafood or other recipes, products containing fatty duck, and related to the intensity of the thermal treatment applied in these food categories. The spore heat resistance parameters (D or ? and z values) from 36 strains isolated in this study were determined. Taken together, our results single out the species most suitable for use as indicators for thermal process settings. This extensively-documented survey of the species that cause non-stability at 55 °C in LACF will help canneries to improve the management of microbial contamination. PMID:23728430

André, S; Zuber, F; Remize, F

2013-07-15

195

Taxonomy of Bacteria Nodulating Legumes  

Directory of Open Access Journals (Sweden)

Full Text Available Over the years, the term “rhizobia” has come to be used for all the bacteria that are capable of nodulation and nitrogen fixation in association with legumes but the taxonomy of rhizobia has changed considerably over the last 30 year. Recently, several non- rhizobial species belonging to alpha and beta subgroup of Proteobacteria have been identified as nitrogen-fixing legume symbionts. Here we provide an overview of the history of the rhizobia and the widespread phylogenetic diversity of nitrogen-fixing legume symbionts.

Raúl Rivas

2009-09-01

196

Medicinal smoke reduces airborne bacteria.  

Science.gov (United States)

This study represents a comprehensive analysis and scientific validation of our ancient knowledge about the effect of ethnopharmacological aspects of natural products' smoke for therapy and health care on airborne bacterial composition and dynamics, using the Biolog microplate panels and Microlog database. We have observed that 1h treatment of medicinal smoke emanated by burning wood and a mixture of odoriferous and medicinal herbs (havan sámagri=material used in oblation to fire all over India), on aerial bacterial population caused over 94% reduction of bacterial counts by 60 min and the ability of the smoke to purify or disinfect the air and to make the environment cleaner was maintained up to 24h in the closed room. Absence of pathogenic bacteria Corynebacterium urealyticum, Curtobacterium flaccumfaciens, Enterobacter aerogenes (Klebsiella mobilis), Kocuria rosea, Pseudomonas syringae pv. persicae, Staphylococcus lentus, and Xanthomonas campestris pv. tardicrescens in the open room even after 30 days is indicative of the bactericidal potential of the medicinal smoke treatment. We have demonstrated that using medicinal smoke it is possible to completely eliminate diverse plant and human pathogenic bacteria of the air within confined space. PMID:17913417

Nautiyal, Chandra Shekhar; Chauhan, Puneet Singh; Nene, Yeshwant Laxman

2007-12-01

197

Money and transmission of bacteria  

Science.gov (United States)

Money is one of the most frequently passed items in the world. The aim of this study was to ascertain the survival status of bacteria including Staphylococcus aureus, Escherichia coli, and Vancomycin- Resistant Enterococci (VRE) on banknotes from different countries and the transmission of bacteria to people who come in contact with the banknotes. The survival rate was highest for the Romanian Leu yielding all three microorganisms used after both three and six hours of drying. Furthermore, the Leu was the only banknote to yield VRE after one day of drying. Other currencies either enabled the survival of Extended-Spectrum Beta-Lactamases (ESBL) and VRE (e.g. Euro), but not of MRSA, or the other way round (e.g. US Dollar). While a variety of factors such as community hygiene levels, people’s behaviour, and antimicrobial resistance rates at community level obviously have influence on the transmission of resistant microorganisms, the type of banknote-paper may be an additional variable to consider. PMID:23985137

2013-01-01

198

Relevant factors affecting microbial surface decontamination by pulsed light.  

Science.gov (United States)

Pulsed Light (PL) uses intense flashes of white light rich in ultraviolet (UV) light for decontamination. A log-reduction higher than 5 was obtained in one flash and at fluences lower than 1.8J/cm(2) on spores of a range of spore-forming bacteria, of vegetative cells of non-spore-forming bacteria and on yeasts spread on agar media. Vegetative cells were more sensitive than spores. The inactivation by PL of Bacillus subtilis, B. atrophaeus, B. cereus, Geobacillus stearothermophilus, and Aspergillus niger spores sprayed on polystyrene was similar. The inactivation by PL of B. subtilis and A. niger spores sprayed on glass was slightly lower than on polystyrene. No alteration of the spore structures was detected by scanning electron microscopy for both PL treated B. subtilis and A. niger spores. The inactivation of spores of B. subtilis, B. atrophaeus, B. cereus and B. pumilus by PL or by continuous UV-C at identical fluences was not different, and was much higher by PL for A. niger spores. The increase in the input voltage of the lamps (which also increases the UV-C %) resulted in a higher inactivation. There was no correlation between the resistance to heat and the resistance to PL. The relative effect of UV-C radiations and light thermal energy on PL inactivation was discussed. PMID:21924512

Levy, Caroline; Aubert, Xavier; Lacour, Bernard; Carlin, Frédéric

2012-01-16

199

Molecular Communication Between Two Populations of Bacteria  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Molecular communication is an expanding body of research. Recent advances in biology have encouraged using genetically engineered bacteria as the main component in the molecular communication. This has stimulated a new line of research that attempts to study molecular communication among bacteria from an information-theoretic point of view. Due to high randomness in the individual behavior of the bacterium, reliable communication between two bacteria is almost impossible. Th...

Einolghozati, Arash; Sardari, Mohsen; Fekr, Faramarz

2012-01-01

200

Selection-Driven Gene Loss in Bacteria  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Gene loss by deletion is a common evolutionary process in bacteria, as exemplified by bacteria with small genomes that have evolved from bacteria with larger genomes by reductive processes. The driving force(s) for genome reduction remains unclear, and here we examined the hypothesis that gene loss is selected because carriage of superfluous genes confers a fitness cost to the bacterium. In the bacterium Salmonella enterica, we measured deletion rates at 11 chromosomal positions and the fitne...

Koskiniemi, Sanna; Sun, Song; Berg, Otto G.; Andersson, Dan I.

2012-01-01

 
 
 
 
201

Selection-driven genome reduction in bacteria  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Gene loss by deletion is a common evolutionary process in bacteria, as exemplified by bacteria with small genomes that have evolved from bacteria with larger genomes by reductive processes. The driving force(s) for genome reduction remains unclear, and here we examined the hypothesis that gene loss is selected because carriage of superfluous genes confers a fitness cost to the bacterium. In the bacterium Salmonella enterica, we measured deletion rates at 11 chromosomal positions and the fitne...

Koskiniemi, Sanna; Sun, Song; Berg, Otto; Andersson, Dan I.

2012-01-01

202

Transformation of gram positive bacteria by sonoporation  

Energy Technology Data Exchange (ETDEWEB)

The present invention provides a sonoporation-based method that can be universally applied for delivery of compounds into Gram positive bacteria. Gram positive bacteria which can be transformed by sonoporation include, for example, Bacillus, Streptococcus, Acetobacterium, and Clostridium. Compounds which can be delivered into Gram positive bacteria via sonoporation include nucleic acids (DNA or RNA), proteins, lipids, carbohydrates, viruses, small organic and inorganic molecules, and nano-particles.

Yang, Yunfeng; Li, Yongchao

2014-03-11

203

Release of bacteria during the purge cycles of steam-jacketed sterilizers.  

Science.gov (United States)

The design of the steam-jacketed sterilizer includes an exterior air-gap fixture through which purged chamber aerosols potentially could escape into the ambient environment. Studies of the purge cycle in two sterilizer models tested the potential release of a genetically marked Enterococcus faecalis, together with Bacillus stearothermophilus spores introduced as exposed cultures. Direct plate counts, broth enrichment and polymerase chain reaction analysis were used to confirm any released organisms trapped in an all-glass impinger. From the retrieval of both bacterial strains, an estimated 10(3) organisms can be released from uncontained bacterial loads of 10(11) E. faecalis and 10(7) B. stearothermophilus, even from properly functioning autoclaves. The release of an opportunistic pathogen from sterilizer purge exhausts emphasises the importance of proper sterilizer location, ventilation, containment of heavily contaminated loads, and adequate sterilizer maintenance. PMID:10795367

Marshall, B M; Shin-Kim, H; Perlov, D; Levy, S B

1999-01-01

204

Bacterias, fuente de energía para el futuro  

Directory of Open Access Journals (Sweden)

Full Text Available This paper presents a family of bacteria called Geobacter that have the ability to produce power as a renewable source in a microbial fuel cell. These bacteria can completely oxidize organic compounds using different elements or substances as electron acceptors. The paper addresses key features of the bacteria, the mechanisms used to harness the electricity generated and an approximation of the system required to become a competitive source of renewable energy. The results show a comparative analysis of sources of conventional and unconventional energy with respect to the Geobacter family of bacteria.

Alba Ayde Romero Mejía

2012-06-01

205

Lactic acid bacteria as probiotics.  

Science.gov (United States)

A number of Lactobacillus species, Bifidobacterium sp, Saccharomyces boulardii, and some other microbes have been proposed as and are used as probiotic strains, i.e. live microorganisms as food supplement in order to benefit health. The health claims range from rather vague as regulation of bowel activity and increasing of well-being to more specific, such as exerting antagonistic effect on the gastroenteric pathogens Clostridium difficile, Campylobacter jejuni, Helicobacter pylori and rotavirus, neutralising food mutagens produced in colon, shifting the immune response towards a Th2 response, and thereby alleviating allergic reactions, and lowering serum cholesterol (Tannock, 2002). Unfortunately, most publications are case reports, uncontrolled studies in humans, or reports of animal or in vitro studies. Whether or not the probiotic strains employed shall be of human origin is a matter of debate but this is not a matter of concern, as long as the strains can be shown to survive the transport in the human gastrointestinal (GI) tract and to colonise the human large intestine. This includes survival in the stressful environment of the stomach - acidic pH and bile - with induction of new genes encoding a number of stress proteins. Since the availability of antioxidants decreases rostrally in the GI tract production of antioxidants by colonic bacteria provides a beneficial effect in scavenging free radicals. LAB strains commonly produce antimicrobial substance(s) with activity against the homologous strain, but LAB strains also often produce microbicidal substances with effect against gastric and intestinal pathogens and other microbes, or compete for cell surface and mucin binding sites. This could be the mechanism behind reports that some probiotic strains inhibit or decrease translocation of bacteria from the gut to the liver. A protective effect against cancer development can be ascribed to binding of mutagens by intestinal bacteria, reduction of the enzymes beta-glucuronidase and beta-glucosidase, and deconjugation of bile acids, or merely by enhancing the immune system of the host. The latter has attracted considerable interest, and LAB have been tested in several clinical trials in allergic diseases. Characteristics ascribed to a probiotic strain are in general strain specific, and individual strains have to be tested for each property. Survival of strains during production, packing and storage of a viable cell mass has to be tested and declared. PMID:16875422

Ljungh, Asa; Wadström, Torkel

2006-09-01

206

MICROBIOLOGY: How Bacteria Change Gear  

Science.gov (United States)

Access to the article is free, however registration and sign-in are required. Many species of bacteria form biofilms, slimy carpets a fraction of a millimeter thick that appear on rocks, leaves, pipes, teeth--pretty much any place that has a supply of nutrients and water. Cells must first attach to a surface, which in many species requires swimming propelled by rotating helical flagella (1). Two things typically happen next. Cells stop expressing genes that encode components of the flagellum, and they secrete a sticky matrix of polysaccharides that holds them together on the surface (2). Once at a surface, swimming may be a hindrance rather than a help, and an inverse relationship between swimming and attachment has been seen in many diverse species (3). Bacterial motility is arrested when a protein that acts as a clutch disables rotation of the flagellar motor.

Richard M. Berry (University of Oxford;Department of Physics, Clarendon Lab); Judith P. Armitage (University of Oxford;Department of Biochemistry & Oxford Centre for Integrative Systems Biology)

2008-06-20

207

Cell Size Regulation in Bacteria  

Science.gov (United States)

Various bacteria such as the canonical gram negative Escherichia coli or the well-studied gram positive Bacillus subtilis divide symmetrically after they approximately double their volume. Their size at division is not constant, but is typically distributed over a narrow range. Here, we propose an analytically tractable model for cell size control, and calculate the cell size and interdivision time distributions, as well as the correlations between these variables. We suggest ways of extracting the model parameters from experimental data, and show that existing data for E. coli supports partial size control, and a particular explanation: a cell attempts to add a constant volume from the time of initiation of DNA replication to the next initiation event. This hypothesis accounts for the experimentally observed correlations between mother and daughter cells as well as the exponential dependence of size on growth rate.

Amir, Ariel

2014-05-01

208

Resuscitation effects of catalase on airborne bacteria.  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Catalase incorporation into enumeration media caused a significant increase (greater than 63%) in the colony-forming abilities of airborne bacteria. Incubation for 30 to 60 min of airborne bacteria in collection fluid containing catalase caused a greater than 95% increase in colony-forming ability. However, catalase did not have any effects on enumeration at high relative humidities (80 to 90%).

Marthi, B.; Shaffer, B. T.; Lighthart, B.; Ganio, L.

1991-01-01

209

Characterization of (per)chlorate-reducing bacteria  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Some bacteria can use (per)chlorateas terminal electron acceptor for growth. These bacteria convert perchlorate via chlorate and chlorite into chloride and molecular oxygen. Oxygen formation in microbial respiration is unique. In this study two chlorate-reducing strains belonging to the species Pseudomonas chloritidismutans and a (per)chlorate-reducing strain Dechloromonas hortensis were isolated. The characterization of the chlorate-reducing ...

Wolterink, A. F. W. M.

2004-01-01

210

Catabolism of lysine by mixed rumen bacteria  

International Nuclear Information System (INIS)

Metabolites arising from the catabolism of lysine by the mixed rumen bacteria were chromatographically examined by using radioactive lysine. After 6 hr incubation, 241 nmole/ml of lysine was decomposed to give ether-soluble substances and CO2 by the bacteria and 90 nmole/ml of lysine was incorporated unchanged into the bacteria. delta-Aminovalerate, cadaverine or pipecolate did not seem to be produced from lysine even after incubation of the bacteria with addition of those three amino compounds to trap besides lysine and radioactive lysine. Most of the ether-soluble substances produced from radioactive lysine was volatile fatty acids (VFAs). Fractionation of VFAs revealed that the peaks of butyric and acetic acids coincided with the strong radioactive peaks. Small amounts of radioactivities were detected in propionic acid peak and a peak assumed to be caproic acid. The rumen bacteria appeared to decompose much larger amounts of lysine than the rumen ciliate protozoa did. (auth.)

211

Chemotactic selection of pollutant degrading soil bacteria  

Science.gov (United States)

A method is described for identifying soil microbial strains which may be bacterial degraders of pollutants. This method includes: Placing a concentration of a pollutant in a substantially closed container; placing the container in a sample of soil for a period of time ranging from one minute to several hours; retrieving the container and collecting its contents; microscopically determining the identity of the bacteria present. Different concentrations of the pollutant can be used to determine which bacteria respond to each concentration. The method can be used for characterizing a polluted site or for looking for naturally occurring biological degraders of the pollutant. Then bacteria identified as degraders of the pollutant and as chemotactically attracted to the pollutant are used to innoculate contaminated soil. To enhance the effect of the bacteria on the pollutant, nutrients are cyclicly provided to the bacteria then withheld to alternately build up the size of the bacterial colony or community and then allow it to degrade the pollutant.

Hazen, T.C.

1991-03-04

212

Hydrocarbon Degrading Bacteria: Isolation and Identification  

Directory of Open Access Journals (Sweden)

Full Text Available There is little information how to identify hydrocarbon degrading bacteria for bioremediation of marine oil spills. We have used gravel which contaminated oil mousse from Beach Simulator Tank, in Marine Biotechnology Institute, Kamaishi, Japan, and grown on enrichment culture. Biostimulation with nutrients (N and P was done to analyze biodegradation of hydrocarbon compounds: Naphthalene, Phenanthrene, Trichlorodibenzofuran and Benzo[a]pyrene. Community of bacteria from enrichment culture was determined by DGGE. Isolating and screening the bacteria on inorganic medium contain hydrocarbon compounds and determination of bacteria by DAPI (number of cells and CFU. DNA was extracted from colonies of bacteria and sequence determination of the 16S rDNA was amplified by primers U515f and U1492r. Twenty nine strains had been sequence and have similarity about 90-99% to their closest taxa by homology Blast search and few of them have suspected as new species.

Lies Indah Sutiknowati

2007-11-01

213

Predator vs aliens: bacteria interactions with Acanthamoeba.  

Science.gov (United States)

By interactions with other microbes, free-living amoebae play a significant role in microbiology, environmental biology, physiology, cellular interactions, ecology and evolution. Here, we discuss astonishing interactions of bacteria and amoebae, in the light of evolution and functional aspects impacting human health. In favourable environmental conditions, the interaction of Acanthamoeba with non-virulent bacteria results in lysis of the bacteria. However, the interaction with weak-virulent bacteria results in a symbiotic relationship or amoebal lysis may occur. The microbial survival of amoebae in harsh environments, ability to interact with bacteria, and their ability to aid transmission to susceptible hosts is of great concern to human, animal and ecosystem health. PMID:24512693

Khan, Naveed Ahmed; Siddiqui, Ruqaiyyah

2014-06-01

214

Antimicrobial activity and Characterization of Marine bacteria  

Directory of Open Access Journals (Sweden)

Full Text Available Marine bacteria were isolated from seawater was collected from different coastal areas of the Tamilnadu Sea. The antimicrobial activities of these bacteria were investigated. Ethyl acetate extracts of marine bacterial fermentation were screened for antimicrobial activities using the method of agar diffusion. The results showed that 25 strains of the isolates have antimicrobial activity. The proportion of active bacteria associated with isolated from seawater. The active marine bacteria were assigned to the genera Alteromonas, Pseudomonas, Bacillus and Marinobacter. The TLC autobiographic overlay assay implied that the antimicrobial metabolites produced by four strains with wide antimicrobial spectrum were different. These marine bacteria were expected to be potential resources of natural antibiotic products. It can be concluded that isolation of Marine bacterial samples can offer a numbers of microbial strains for sources of new biomolecules from Marine sources.

P.Jeganathan*

2013-12-01

215

HYDROCARBON-DEGRADING BACTERIA AND SURFACTANT ACTIVITY  

Energy Technology Data Exchange (ETDEWEB)

Fate of benzene ethylbenzene toluene xylenes (BTEX) compounds through biodegradation was investigated using two different bacteria, Ralstonia picketti (BP-20) and Alcaligenes piechaudii (CZOR L-1B). These bacteria were isolated from extremely polluted petroleum hydrocarbon contaminated soils. PCR and Fatty Acid Methyl Ester (FAME) were used to identify the isolates. Biodegradation was measured using each organism individually and in combination. Both bacteria were shown to degrade each of the BTEX compounds. Alcaligenes piechaudii biodegraded BTEXs more efficiently while mixed with BP-20 and individually. Biosurfactant production was observed by culture techniques. In addition 3-hydroxy fatty acids, important in biosurfactant production, was observed by FAME analysis. In the all experiments toluene and m+p- xylenes were better growth substrates for both bacteria than the other BTEX compounds. In addition, the test results indicate that the bacteria could contribute to bioremediation of aromatic hydrocarbons (BTEX) pollution increase biodegradation through the action by biosurfactants.

Brigmon, R; Topher Berry, T; Grazyna A. Plaza, G; jacek Wypych, j

2006-08-15

216

Chryseobacterium indologenes, novel mannanase-producing bacteria  

Directory of Open Access Journals (Sweden)

Full Text Available Mannanase is a mannan degrading enzyme which is produced by microorganisms, including bacteria. This enzyme can be used in many industrial processes as well as for improving the quality of animal feeds. The aim of the present study was toscreen and characterize the mannanase-producing bacteria. Two genera of bacteria were isolated from Thai soil samples,fermented coconut, and fertilizer. Screening was carried out on agar plates containing mannan stained with iodine solution.The bacteria were identified by partial 16S rRNA gene sequence, biochemical test and morphology, respectively. The mannanase activity was determined by zymogram and DNS method. Two strains of bacteria with mannanase activity were identified as Bacillus and Chryseobacterium. This is the first report of mannanase-producing Chryseobacterium.

Surachai Rattanasuk

2009-10-01

217

Expression and cytosolic assembly of the S-layer fusion protein mSbsC-EGFP in eukaryotic cells  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Abstract Background Native as well as recombinant bacterial cell surface layer (S-layer) protein of Geobacillus (G.) stearothermophilus ATCC 12980 assembles to supramolecular structures with an oblique symmetry. Upon expression in E. coli, S-layer self assembly products are formed in the cytosol. We tested the expression and assembly of a fusion protein, consisting of the mature part (aa 31–1099) of the S-layer protein and EGFP (enhanced green fluorescent ...

Veenhuis Marten; Sjollema Klaas A; Zarschler Kristof; Blecha Andreas; Rödel Gerhard

2005-01-01

218

Potential role of bacteria packaging by protozoa in the persistence and transmission of pathogenic bacteria  

Directory of Open Access Journals (Sweden)

Full Text Available Many pathogenic bacteria live in close association with protozoa. These unicellular eukaryotic microorganisms are ubiquitous in various environments. A number of protozoa such as amoebae and ciliates ingest pathogenic bacteria, package them usually in membrane structures, and then release them into the environment. Packaged bacteria are more resistant to various stresses and are more apt to survive than free bacteria. New evidence indicates that protozoa and not bacteria control the packaging process. It is possible that packaging is more common than suspected and may play a major role in the persistence and transmission of pathogenic bacteria. To confirm the role of packaging in the propagation of infections, it is vital that the molecular mechanisms governing the packaging of bacteria by protozoa be identified as well as elements related to the ecology of this process in order to determine whether packaging acts as a Trojan Horse.

SteveJCharette

2014-05-01

219

Antibiotic resistance in probiotic bacteria  

Directory of Open Access Journals (Sweden)

Full Text Available Probiotics are live microorganisms which when administered in adequate amounts confer a health benefit on the host. The main probiotic bacteria are strains belonging to the genera Lactobacillus and Bifidobacterium, although other representatives, such as Bacillus or Escherichia coli strains, have also been used. Lactobacillus and Bifidobacterium are two common inhabitants of the human intestinal microbiota. Also, some species are used in food fermentation processes as starters, or as adjunct cultures in the food industry. With some exceptions, antibiotic resistance in these beneficial microbes does not constitute a safety concern in itself, when mutations or intrinsic resistance mechanisms are responsible for the resistance phenotype. In fact, some probiotic strains with intrinsic antibiotic resistance could be useful for restoring the gut microbiota after antibiotic treatment. However, specific antibiotic resistance determinants carried on mobile genetic elements, such as tetracycline resistance genes, are often detected in the typical probiotic genera, and constitute a reservoir of resistance for potential food or gut pathogens, thus representing a serious safety issue.

AbelardoMargolles

2013-07-01

220

Mycelial bacteria of saline soils  

Science.gov (United States)

The actinomycetal complexes of saline soils comprise the representatives of the Streptomyces and Micromonospora genera, the number of which are hundreds and thousands of CFU/g soil. Complexes of mycelial bacteria in saline soils are poorer in terms of number (by 1-3 orders of magnitude) and taxonomic composition than the complexes of the zonal soil types. A specific feature of the actinomycetal complexes of saline soils is the predominance of halophilic, alkaliphilic, and haloalkaliphilic streptomycetes that well grow at pH 8-9 and concentrations of NaCl close to 5%. Actinomycetes in saline soils grow actively, and the length of their mycelium reaches 140 m in 1 gram of soil. The haloalkaliphilic streptomycetes grow fast and inhibit the formation of spores at pH 9 and high concentrations of salts (Na2SO4 and MgCl2, 5%) as compared to their behavior on a neutral medium with a salt concentration of 0.02%. They are characterized by the maximal radial growth rate of colonies on an alkaline medium with 5% NaCl.

Zvyagintsev, D. G.; Zenova, G. M.; Oborotov, G. V.

2008-10-01

 
 
 
 
221

Therapeutic Properties of Probiotic Bacteria  

Directory of Open Access Journals (Sweden)

Full Text Available In spite of its long history, public consciousness of probiotics has shifted dramatically in recent years. This is due to a number of factors, including an increased concern about the potential generation of antibiotic resistant bacterial strains due to widespread antibacterial use, and also to the spreading realization that one`s health can be, not simply maintained, but actually improved with proper nutrition. Combined, these factors have stimulated a surge in probiotic research in the past decade, resulting in increasingly refined studies. Indeed, after Elie Metchnikov first printed his work suggesting a positive correlation between human longevity and the consumption of fermented milk, information on probiotics is leaving the realm of the anecdotal as recent, double-blind, placebo controlled randomized tests support beneficial probiotic activity. Concurrently, more is being learned about their activities in vivo. While much work remains to be done before a detailed understanding of probiotics can be achieved, there is mounting evidence that probiotics, when used in proper conditions, may indeed have prophylactic or preventative effects on a broad array of human and animal diseases. This article briefly surveys probiotic history and discusses recent research with a special emphasis on lactic acid bacteria probiotics. Finally, it discusses the inherent difficulties of their study and suggestions for standards for future work.

Nathanon Trachoo

2006-01-01

222

Decreased bacteria density on nanostructured polyurethane.  

Science.gov (United States)

As is well known, medical device infections are a growing clinical problem with no clear solution due to previous failed attempts of using antibiotics to decrease bacteria functions for which bacteria quickly develop a resistance toward. Because of their altered surface energetics, the objective of the present in vitro study was to create nanoscale surface features on polyurethane (PU) by soaking PU films in HNO3 and to determine bacteria (specifically, S. epidermidis, E. coli, and P. mirabilis) colony forming units after 1 h. Such bacteria frequently infect numerous medical devices. Results provided the first evidence that without using antibiotics, S. epidermidis density decreased by 5 and 13 times, E. coli density decreased by 6 and 20 times, and P. mirabilis density decreased by 8 and 35 times compared to conventional PU and a tissue engineering control small intestine submucosa (SIS), respectively. Material characterization studies revealed significantly greater nanoscale roughness and hydrophobicity for the HNO3-treated nanostructured PU compared to conventional PU (albeit, still hydrophilic) which may provide a rationale for the observed decreased bacteria responses. In addition, significantly greater amounts of fibronectin adsorption from serum were measured on nanorough compared conventional PU which may explain the decreased bacteria growth. In summary, this study provides significant promise for the use of nanostructured PU to decrease bacteria functions without the use of antibiotics, clearly addressing the wide spread problem of increased medical device infections observed today. PMID:23784968

Yao, Chang; Webster, Thomas J; Hedrick, Matthew

2014-06-01

223

Presence of bacteria in dentinal tubules  

Directory of Open Access Journals (Sweden)

Full Text Available This study demonstrated that a significant number of bacteria is present in the radicular dentinal tubules of periodontally diseased human teeth. Ten periodontally diseased teeth were prepared and stained by Brown and Brenn technique for histological examination. Bacteria were detected in all teeth. It is suggested that bacteria may invade dentinal tubules exposed to periodontal pocket and are very hard to be eliminated by conventional mechanical and chemical periodontal therapy. Contaminated dentinal tubules of periodontally diseased teeth can thus act as active bacterial reservoirs to promote recolonization of mechanically treated root surfaces, which could interfere with the periodontal healing and progression of the disease.

José Ricardo Kina

2008-06-01

224

Magnetotactic Bacteria from Extreme Environments  

Directory of Open Access Journals (Sweden)

Full Text Available Magnetotactic bacteria (MTB represent a diverse collection of motile prokaryotes that biomineralize intracellular, membrane-bounded, tens-of-nanometer-sized crystals of a magnetic mineral called magnetosomes. Magnetosome minerals consist of either magnetite (Fe3O4 or greigite (Fe3S4 and cause cells to align along the Earth’s geomagnetic field lines as they swim, a trait called magnetotaxis. MTB are known to mainly inhabit the oxic–anoxic interface (OAI in water columns or sediments of aquatic habitats and it is currently thought that magnetosomes function as a means of making chemotaxis more efficient in locating and maintaining an optimal position for growth and survival at the OAI. Known cultured and uncultured MTB are phylogenetically associated with the Alpha-, Gamma- and Deltaproteobacteria classes of the phylum Proteobacteria, the Nitrospirae phylum and the candidate division OP3, part of the Planctomycetes-Verrucomicrobia-Chlamydiae (PVC bacterial superphylum. MTB are generally thought to be ubiquitous in aquatic environments as they are cosmopolitan in distribution and have been found in every continent although for years MTB were thought to be restricted to habitats with pH values near neutral and at ambient temperature. Recently, however, moderate thermophilic and alkaliphilic MTB have been described including: an uncultured, moderately thermophilic magnetotactic bacterium present in hot springs in northern Nevada with a probable upper growth limit of about 63 °C; and several strains of obligately alkaliphilic MTB isolated in pure culture from different aquatic habitats in California, including the hypersaline, extremely alkaline Mono Lake, with an optimal growth pH of >9.0.

Christopher T. Lefèvre

2013-03-01

225

Folate Production by Probiotic Bacteria  

Directory of Open Access Journals (Sweden)

Full Text Available Probiotic bacteria, mostly belonging to the genera Lactobacillus and Bifidobacterium, confer a number of health benefits to the host, including vitamin production. With the aim to produce folate-enriched fermented products and/or develop probiotic supplements that accomplish folate biosynthesis in vivo within the colon, bifidobacteria and lactobacilli have been extensively studied for their capability to produce this vitamin. On the basis of physiological studies and genome analysis, wild-type lactobacilli cannot synthesize folate, generally require it for growth, and provide a negative contribution to folate levels in fermented dairy products. Lactobacillus plantarum constitutes an exception among lactobacilli, since it is capable of folate production in presence of para-aminobenzoic acid (pABA and deserves to be used in animal trials to validate its ability to produce the vitamin in vivo. On the other hand, several folate-producing strains have been selected within the genus Bifidobacterium, with a great variability in the extent of vitamin released in the medium. Most of them belong to the species B. adolescentis and B. pseudocatenulatum, but few folate producing strains are found in the other species as well. Rats fed a probiotic formulation of folate-producing bifidobacteria exhibited increased plasma folate level, confirming that the vitamin is produced in vivo and absorbed. In a human trial, the same supplement raised folate concentration in feces. The use of folate-producing probiotic strains can be regarded as a new perspective in the specific use of probiotics. They could more efficiently confer protection against inflammation and cancer, both exerting the beneficial effects of probiotics and preventing the folate deficiency that is associated with premalignant changes in the colonic epithelia.

Stefano Raimondi

2011-01-01

226

Effect of leukocyte hydrolases on bacteria  

International Nuclear Information System (INIS)

Leukocyte extracts, trypsin, and lysozyme are all capable of releasing the bulk of the LPS from S. typhi, S. typhimurium, and E. coli. Bacteria which have been killed by heat, ultraviolet irradiation, or by a variety of metabolic inhibitors and antibiotics which affect protein, DNA, RNA, and cell wall synthesis no longer yield soluble LPS following treatment with the releasing agents. On the other hand, bacteria which are resistant to certain of the antibiotics yield nearly the full amount of soluble LPS following treatment, suggesting that certain heatabile endogenous metabolic pathways collaborate with the releasing agents in the release of LPS from the bacteria. It is suggested that some of the beneficial effects of antibiotics on infections with gram-negative bacteria may be the prevention of massive release of endotoxin by leukocyte enzymes in inflammatory sites

227

[Regulation of chitinase genes expression in bacteria].  

Science.gov (United States)

Chitinases, which can hydrolyze chitin, occur in a wide range of microorganisms including viruses, bacteria, and fungi. The derivatives of chitin are potentially useful in several areas such as food processing, medicines, and biological control in agriculture. Some bacteria can uptake and utilize chitin as carbon source by secreting chitinase. The chitin is degraded into chito-oligosaccharides [(GlcNAc)n] or N-acetylglucosamine (GlcNAc) by chitinases, and then the chitin derivatives are transferred into cells by specific transport systems of bacteria. The intracellular chitin derivatives activate or suppress the transcription of a series of chi genes and affect the amount of chitinase. The expression of chitinase genes are strictly regulated by various regulatory factors and responsive cis-acting elements. The present review will focus on the transport system and the regulation of chitinase genes expression in bacteria. PMID:21993277

Xie, Chi-Chu; Jia, Hai-Yun; Chen, Yue-Hua

2011-10-01

228

Magnetotaxis and magnetic particles in bacteria  

International Nuclear Information System (INIS)

Magnetotactic bacteria contain magnetic particles that constitute a permanent magnetic dipole and cause each cell to orient and migrate along geomagnetic field lines. Recent results relevant to the biomineralization process and to the function of magnetotaxis are discussed. (orig.)

229

Corrosion inhibition of steel by bacteria  

Energy Technology Data Exchange (ETDEWEB)

Mild steel was exposed to Pseudomonas sp. S9 or Serratia marcescens in synthetic seawater. An increase in corrosion resistance over that i natural seawater was monitored by electrochemical techniques. Biological analyses were performed to characterize the system. The inhibition effect also was observed when mild steel was coated with bacteria and then immersed in synthetic seawater. When specimens coated with bacteria were transferred to a natural seawater flow system, the inhibition effect disappeared during the first 2 weeks.

Hernandez, G.; Kucera, V.; Thierry, D.; Pedersen, A. (Swedish Corrosion Inst., Stockholm (Sweden)); Hermansson, M. (Univ. of Gothenburg (Sweden). Dept. of General and Marine Microbiology)

1994-08-01

230

Glucose Biosensor Using Selected Indonesian Bacteria  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Microbial glucose sensors have been developed using Escherichia coli bacterial strains from Japan. However, there is interest in developing local bacteria as glucose sensors in Indonesia. In this research, the stability and the potential of a selected number of Indonesian bacteria as glucose biosensors was explored. Results of this study indicate that three of them, E. coli, Bacillus subtilis, and Thermus filiformis exhibit properties of high viability and stability at high temperature (30...

DYAH ISWANTINI; NOVIK; TRIVADILA

2011-01-01

231

Hydrocarbon Degrading Bacteria: Isolation and Identification  

Digital Repository Infrastructure Vision for European Research (DRIVER)

There is little information how to identify hydrocarbon degrading bacteria for bioremediation of marine oil spills. We have used gravel which contaminated oil mousse from Beach Simulator Tank, in Marine Biotechnology Institute, Kamaishi, Japan, and grown on enrichment culture. Biostimulation with nutrients (N and P) was done to analyze biodegradation of hydrocarbon compounds: Naphthalene, Phenanthrene, Trichlorodibenzofuran and Benzo[a]pyrene. Community of bacteria from enrichment culture was...

Lies Indah Sutiknowati

2007-01-01

232

Bacteria in goat meat: Biological danger  

Digital Repository Infrastructure Vision for European Research (DRIVER)

In the world, especially in China, India, P?kist?n and Nigeria goat meat represents an important foodstuff in nutrition of people. Goat meat is being increasingly consumed in Serbia owing to its distinctive taste and desirable chemical composition. As many other types of meat, goat meat can be the source of pathogenic bacteria. Bacteria can find their way into meat of healthy goats or goats with no clinical symptoms premortally (infection) or postmortally...

Ivanovi? S.; Pavlovi? I.; Žujovi? M.; Tomi? Z.; Memiši N.

2011-01-01

233

Distribution of coliform bacteria in waste water  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Biological activity of water can be apparently judged by the colonization of bacteria (microbes). In order to find out the extent of pollution and the relationship between inorganic matters and microbiota, a quantitative and qualitative analysis of bacteria in various types of sewage waters, namely sewage water by the residential colonies (group I), industrial waste water (group II), sewage treatment hub (group III), unorganized collected waste water (group IV) and old residential waste colle...

Chandan Kumar Bahura; Dau Lal Bohra; Vikas Modasiya

2012-01-01

234

Molecular genetic studies on obligate anaerobic bacteria  

International Nuclear Information System (INIS)

Molecular genetic studies on obligate anaerobic bacteria have lagged behind similar studies in aerobes. However, the current interest in biotechnology, the involvement of anaerobes in disease and the emergence of antibioticresistant strains have focused attention on the genetics of anaerobes. This article reviews molecular genetic studies in Bacteroides spp., Clostridium spp. and methanogens. Certain genetic systems in some anaerobes differ from those in aerobes and illustrate the genetic diversity among bacteria

235

Biocompatible nanoparticles trigger rapid bacteria clustering.  

Science.gov (United States)

This study reveals an exciting phenomenon of stimulated bacteria clustering. Rapid aggregation and microbial arrest are shown to occur in Escherichia coli solutions of neutral pH when chitosan nanoparticles with positive zeta potential are added. Because chitosan nanoparticles can easily be dispersed in aqueous buffers, the rapid clustering phenomenon requires only minuscule nanoparticle concentrations and will be critical in developing new methods for extricating bacterial pathogens. This work establishes the dominant role of electrostatic attraction in bacteria-nanoparticle interactions by varying the nanoparticle zeta potential from highly positive to strongly negative values, and by exploring concentration effects. For strongly negative nanoparticles, no clusters form, while aggregates are small and loose at intermediate conditions. In addition, optical density measurements indicate that over 90% of the suspended bacteria flocculate within seconds of being mixed with chitosan nanoparticles of a highly positive surface charge. Finally, the nanoparticles are significantly more efficient as a clustering agent compared to an equal mass of molecular chitosan in solution, as the bacteria-nanoparticle clusters formed are substantially larger. The bacteria-nanoparticle aggregation effect demonstrated here promises a rapid separation method for aiding pathogen detection and for flocculation of bacteria in fermentation processes. PMID:19565661

Larsen, Mona Utne; Seward, Matthew; Tripathi, Anubhav; Shapley, Nina C

2009-01-01

236

Molecular probe technology detects bacteria without culture  

Directory of Open Access Journals (Sweden)

Full Text Available Abstract Background Our ultimate goal is to detect the entire human microbiome, in health and in disease, in a single reaction tube, and employing only commercially available reagents. To that end, we adapted molecular inversion probes to detect bacteria using solely a massively multiplex molecular technology. This molecular probe technology does not require growth of the bacteria in culture. Rather, the molecular probe technology requires only a sequence of forty sequential bases unique to the genome of the bacterium of interest. In this communication, we report the first results of employing our molecular probes to detect bacteria in clinical samples. Results While the assay on Affymetrix GenFlex Tag16K arrays allows the multiplexing of the detection of the bacteria in each clinical sample, one Affymetrix GenFlex Tag16K array must be used for each clinical sample. To multiplex the clinical samples, we introduce a second, independent assay for the molecular probes employing Sequencing by Oligonucleotide Ligation and Detection. By adding one unique oligonucleotide barcode for each clinical sample, we combine the samples after processing, but before sequencing, and sequence them together. Conclusions Overall, we have employed 192 molecular probes representing 40 bacteria to detect the bacteria in twenty-one vaginal swabs as assessed by the Affymetrix GenFlex Tag16K assay and fourteen of those by the Sequencing by Oligonucleotide Ligation and Detection assay. The correlations among the assays were excellent.

Hyman Richard W

2012-03-01

237

Faecal indicator bacteria in river biofilms.  

Science.gov (United States)

Biofilms in surface waters primarily consist of allochthonous microorganisms. Under conditions of pollution faecally derived bacteria may interact with these biofilms. Total coliform bacteria, Escherichia coli and intestinal enterococci are used to monitor source water quality, indicating faecal pollution and the possible presence of enteric pathogens. In the present study the occurrence of faecal indicators was investigated in biofilms (epilithic biofilms, sediments) of German rivers. All of the biofilms contained significant concentrations of these bacteria, which were several orders of magnitude lower compared with the total cell number and the number of culturable heterotrophic plate count bacteria indicating that faecal indicator bacteria represented a minor fraction of the whole biofilm communities. The biofilms displayed approximately two orders of magnitude higher concentrations of total coliforms, E. coli and enterococci compared with the overlying water. Identification of coliform and enterococcal isolates from the biofilms revealed the presence of species which are known to be opportunistic pathogens. Overall, the results of the present study show that faecal indicator bacteria can survive in the presence of high cell densities of the authochthonous microflora in epilithic biofilms and sediments, suggesting that these biofilms may act as a reservoir for bacterial pathogens in polluted rivers. PMID:20220231

Balzer, M; Witt, N; Flemming, H-C; Wingender, J

2010-01-01

238

Cyclic lipodepsipeptides produced by Pseudomonas spp. naturally present in raw milk induce inhibitory effects on microbiological inhibitor assays for antibiotic residue screening.  

Science.gov (United States)

Two Pseudomonas strains, identified as closely related to Pseudomonas tolaasii, were isolated from milk of a farm with frequent false-positive Delvotest results for screening putative antibiotic residues in raw milk executed as part of the regulatory quality programme. Growth at 5 to 7°C of these isolates in milk resulted in high lipolysis and the production of bacterial inhibitors. The two main bacterial inhibitors have a molecular weight of 1168.7 and 1140.7 Da respectively, are heat-tolerant and inhibit Geobacillus stearothermophilus var. calidolactis, the test strain of most of the commercially available microbiological inhibitor tests for screening of antibiotic residues in milk. Furthermore, these bacterial inhibitors show antimicrobial activity against Staphylococcus aureus, Bacillus cereus and B. subtilis and also interfere negatively with yoghurt production. Following their isolation and purification with RP-HPLC, the inhibitors were identified by NMR analysis as cyclic lipodepsipeptides of the viscosin group. Our findings bring to light a new challenge for quality control in the dairy industry. By prolonging the refrigerated storage of raw milk, the keeping quality of milk is influenced by growth and metabolic activities of psychrotrophic bacteria such as pseudomonads. Besides an increased risk of possible spoilage of long shelf-life milk, the production at low temperature of natural bacterial inhibitors may also result in false-positive results for antibiotic residue screening tests based on microbial inhibitor assays thus leading to undue production loss. PMID:24853676

Reybroeck, Wim; De Vleeschouwer, Matthias; Marchand, Sophie; Sinnaeve, Davy; Heylen, Kim; De Block, Jan; Madder, Annemieke; Martins, José C; Heyndrickx, Marc

2014-01-01

239

RAPD-based screening for spore-forming bacterial populations in Uruguayan commercial powdered milk.  

Science.gov (United States)

The occurrence of spore-forming bacteria in powdered milk is of concern to the dairy industry due to potential deleterious effects including those resulting from proteolytic and lipolytic activities. Twenty-two powdered milk samples representative of spring and summer production obtained from Uruguayan retail stores were analyzed for type and number of thermophilic and spore-forming bacterial species. Bacillus licheniformis isolates were found to be the most prominent milk powder contaminant followed by Anoxybacillus flavithermus representing 71.5 to 84% of the total microflora. Geobacillus stearothermophilus, however, was not found. B. licheniformis strains F and G were both found in this study but strain F was the prevalent isolate representing 98.9% of the total isolates of this species. A. flavithermus isolates corresponded to strain C in accordance with 16S rRNA gene sequence analysis, however, in contrast with other reports, the RAPD profiles showed three characteristic bands at approximately 650, 1000 and 1650 bp, but lacking a band at 1250 bp. A third group of isolates was identified corresponding to members of a Bacillus subtilis group and Bacillus megaterium. Isolates designated B. licheniformis, A. flavithermus, B. megaterium and the B. subtilis group represented 89.1 to 93.6% of those analyzed, and depended on previous heat treatment and incubation temperatures of the plates. The remaining isolates were Bacillus pumilus and unidentified spore-formers. PMID:21565415

Reginensi, Stella M; González, Marcela J; Olivera, Jorge A; Sosa, Mariela; Juliano, Pablo; Bermúdez, Jorge

2011-07-15

240

Cold Atmospheric Air Plasma Sterilization against Spores and Other Microorganisms of Clinical Interest  

Science.gov (United States)

Physical cold atmospheric surface microdischarge (SMD) plasma operating in ambient air has promising properties for the sterilization of sensitive medical devices where conventional methods are not applicable. Furthermore, SMD plasma could revolutionize the field of disinfection at health care facilities. The antimicrobial effects on Gram-negative and Gram-positive bacteria of clinical relevance, as well as the fungus Candida albicans, were tested. Thirty seconds of plasma treatment led to a 4 to 6 log10 CFU reduction on agar plates. C. albicans was the hardest to inactivate. The sterilizing effect on standard bioindicators (bacterial endospores) was evaluated on dry test specimens that were wrapped in Tyvek coupons. The experimental D23°C values for Bacillus subtilis, Bacillus pumilus, Bacillus atrophaeus, and Geobacillus stearothermophilus were determined as 0.3 min, 0.5 min, 0.6 min, and 0.9 min, respectively. These decimal reduction times (D values) are distinctly lower than D values obtained with other reference methods. Importantly, the high inactivation rate was independent of the material of the test specimen. Possible inactivation mechanisms for relevant microorganisms are briefly discussed, emphasizing the important role of neutral reactive plasma species and pointing to recent diagnostic methods that will contribute to a better understanding of the strong biocidal effect of SMD air plasma. PMID:22582068

Isbary, Georg; Shimizu, Tetsuji; Li, Yang-Fang; Zimmermann, Julia L.; Stolz, Wilhelm; Schlegel, Jurgen; Morfill, Gregor E.; Schmidt, Hans-Ulrich

2012-01-01

 
 
 
 
241

Identification of biogenic dimethyl selenodisulfide in the headspace gases above genetically modified Escherichia coli.  

Science.gov (United States)

Escherichia coli JM109 cells were modified to express the genes encoded in a 3.8-kb chromosomal DNA fragment from a metalloid-resistant thermophile, Geobacillus stearothermophilus V. Manual headspace extraction was used to collect the gases for gas chromatography with fluorine-induced sulfur chemiluminescence analysis while solid-phase microextraction was used for sample collection in gas chromatography/mass spectrometry (GC/MS) analysis. When grown in the presence of selenate or selenite, these bacteria produced both organo-sulfur and organo-selenium in the headspace gases above the cultures. Organo-sulfur compounds detected were methanethiol, dimethyl sulfide, dimethyl disulfide, and dimethyl trisulfide. Organo-selenium compounds detected were dimethyl selenide and dimethyl diselenide. Two mixed sulfur-selenium compounds, dimethyl selenenyl sulfide and a chromatographically late-eluting compound, were detected. Dimethyl selenodisulfide, CH(3)SeSSCH(3), and dimethyl bis(thio)selenide, CH(3)SSeSCH(3), were synthesized and analyzed by GC/MS and fluorine-induced chemiluminescence to determine which corresponded to the late-eluting compound that was bacterially produced. CH(3)SeSSCH(3) was positively identified as the compound detected in bacterial headspace above Se-amended cultures. Using GC retention times, the boiling point of CH(3)SeSSCH(3) was estimated to be approximately 192 degrees C. This is the first report of CH(3)SeSSCH(3) produced by bacterial cultures. PMID:16289446

Swearingen, Jerry W; Frankel, Danielle P; Fuentes, Derie E; Saavedra, Claudia P; Vásquez, Claudio C; Chasteen, Thomas G

2006-01-01

242

Chemically enhanced sunlight for killing bacteria  

International Nuclear Information System (INIS)

Solar ultraviolet (UV) photocatalyzed oxidation of chemicals with titanium dioxide (TiO2) has received considerable attention. Much less recognized, however, is the ability of the same system to destroy bacteria. This study examined this phenomenon and the conditions that affect it. Bacteria in aqueous solution were given solar exposure with titanium dioxide and their survival with time was determined. Lamps with a predominantly solar ultraviolet spectrum were also used in the experiments. Without exposure to UV light, TiO2 had no deleterious effect on the bacteria. However, several common bacteria on solar exposure in the presence of TiO2 were killed in just a few minutes, whereas without TiO2 it took over an hour to destroy them. A concentration of 0.01% TiO2 was most effective in killing bacteria and 10-fold concentrations lower or higher were successively less effective. Inorganic and organic compounds in solution, even in small amounts, interfered with the efficiency of killing. Alkaline solution also reduced the bactericidal activity. Circulation and agitation provided by stirring to keep the TiO2 particles suspended reduced the time necessary to kill the bacteria. Time-intensity curves for killing bacteria were the same general shape with or without TiO2, indicating that TiO2 served merely as a catalyst to increase the rate of the reaction but that the mechanism of action was not changed. The shape of the curves show that the organisms are sensitized with a minimum intensity of radiation and that an increase doesn't greatly increase the rate of kill. Below this critical intensity, however, the time required for killing markedly increases as the intensity is decreased

243

Nutritional Interdependence Among Rumen Bacteria During Cellulose Digestion In Vitro  

Digital Repository Infrastructure Vision for European Research (DRIVER)

A study has been made of the promoting effect of starch on cellulose digestion by mixed rumen bacteria in a cellulose-urea medium. Starch supplementation of the medium promoted the growth of bacteria that required neither amino acids (AA) nor branched-chain fatty acids (BrFA). The growth of these bacteria was followed by the growth of AA-dependent bacteria, AA- or BrFA-dependent bacteria, BrFA-producing bacteria, and finally, BrFA-dependent cellulolytic bacteria. Population changes of these b...

Miura, Hideki; Horiguchi, Masaaki; Ogimoto, Keiji; Matsumoto, Tatsuro

1983-01-01

244

Bacterias, fuente de energía para el futuro / Bacteria, source of energy for the future  

Scientific Electronic Library Online (English)

Full Text Available SciELO Colombia | Language: Spanish Abstract in spanish En el presente trabajo expone una familia de bacterias denominadas Geobacter que tienen la capacidad de producir energía eléctrica como fuente renovable en una celda de combustible microbiana. Estas bacterias pueden oxidar totalmente compuestos orgánicos empleando diferentes elementos o sustancias c [...] omo aceptores de electrones. El trabajo aborda características principales de la bacteria, como los mecanismos utilizados para aprovechar la electricidad que genera y una aproximación sobre el sistema requerido para convertirla en una fuente de energía renovable competitiva. Los resultados muestran un análisis comparativo de fuentes de energía convencionales y no convencionales con respecto a la familia de bacterias Geobacter. Abstract in english This paper presents a family of bacteria called Geobacter that have the ability to produce power as a renewable source in a microbial fuel cell. These bacteria can completely oxidize organic compounds using different elements or substances as electron acceptors. The paper addresses key features of t [...] he bacteria, the mechanisms used to harness the electricity generated and an approximation of the system required to become a competitive source of renewable energy. The results show a comparative analysis of sources of conventional and unconventional energy with respect to the Geobacter family of bacteria.

Alba Ayde, Romero Mejía; Jorge Adrian, Vásquez; Armando, Lugo González.

2012-04-01

245

Bacterias, fuente de energía para el futuro / Bacteria, source of energy for the future  

Scientific Electronic Library Online (English)

Full Text Available SciELO Colombia | Language: Spanish Abstract in spanish En el presente trabajo expone una familia de bacterias denominadas Geobacter que tienen la capacidad de producir energía eléctrica como fuente renovable en una celda de combustible microbiana. Estas bacterias pueden oxidar totalmente compuestos orgánicos empleando diferentes elementos o sustancias c [...] omo aceptores de electrones. El trabajo aborda características principales de la bacteria, como los mecanismos utilizados para aprovechar la electricidad que genera y una aproximación sobre el sistema requerido para convertirla en una fuente de energía renovable competitiva. Los resultados muestran un análisis comparativo de fuentes de energía convencionales y no convencionales con respecto a la familia de bacterias Geobacter. Abstract in english This paper presents a family of bacteria called Geobacter that have the ability to produce power as a renewable source in a microbial fuel cell. These bacteria can completely oxidize organic compounds using different elements or substances as electron acceptors. The paper addresses key features of t [...] he bacteria, the mechanisms used to harness the electricity generated and an approximation of the system required to become a competitive source of renewable energy. The results show a comparative analysis of sources of conventional and unconventional energy with respect to the Geobacter family of bacteria.

Alba Ayde, Romero Mejía; Jorge Adrian, Vásquez; Armando, Lugo González.

246

Marine bacteria: potential candidates for enhanced bioremediation.  

Science.gov (United States)

Bacteria are widespread in nature as they can adapt to any extreme environmental conditions and perform various physiological activities. Marine environments are one of the most adverse environments owing to their varying nature of temperature, pH, salinity, sea surface temperature, currents, precipitation regimes and wind patterns. Due to the constant variation of environmental conditions, the microorganisms present in that environment are more suitably adapted to the adverse conditions, hence, possessing complex characteristic features of adaptation. Therefore, the bacteria isolated from the marine environments are supposed to be better utilized in bioremediation of heavy metals, hydrocarbon and many other recalcitrant compounds and xenobiotics through biofilm formation and production of extracellular polymeric substances. Many marine bacteria have been reported to have bioremediation potential. The advantage of using marine bacteria for bioremediation in situ is the direct use of organisms in any adverse conditions without any genetic manipulation. This review emphasizes the utilization of marine bacteria in the field of bioremediation and understanding the mechanism behind acquiring the characteristic feature of adaptive responses. PMID:23212672

Dash, Hirak R; Mangwani, Neelam; Chakraborty, Jaya; Kumari, Supriya; Das, Surajit

2013-01-01

247

Biodegradation of 17?-ethinylestradiol by heterotrophic bacteria  

International Nuclear Information System (INIS)

The presence of the synthetic estrogen 17?-ethinylestradiol (EE2) in the environment is of increasing concern due to the endocrine disruption of aquatic organisms. Incomplete removal from wastewater (WW) is one of the main sources of EE2 in aquatic ecosystems, thus improving processes like biological WW treatment/activated sludge (AS) is becoming significantly important. There are opposing results regarding EE2 biodegradability by AS; one discrepancy is the efficacy of heterotrophic bacteria. This research demonstrated the ability of heterotrophs commonly present in AS (B. subtilis, P. aeruginosa, P. putida, R. equi, R. erythropolis, R. rhodochrous, R. zopfii) to remove EE2. R. rhodochrous was the most successful with no detectable EE2 after 48 h; the other bacteria achieved 21%–61% EE2 removal. No additive or synergistic effects were observed due to the combination of the bacterial cultures with maximum EE2 removals of 43% after 300 h. - Highlights: ? Seven species of heterotrophic bacteria demonstrated the ability to degrade EE2. ? Rhodococcus species (especially R. rhodochrous) were the most successful. ? EE2 degradation by individual bacteria does not represent the capability of mixtures. ? Slight differences in bacterial mixture composition impact degradation trends. - Heterotrophic bacteria, especially Rhodococcus species, are capable of successfully degrading 17?-ethinylestradiol (EE2).

248

Bacteria dispersal by hitchhiking on zooplankton  

DEFF Research Database (Denmark)

Microorganisms and zooplankton are both important components of aquatic food webs. Although both inhabit the same environment, they are often regarded as separate functional units that are indirectly connected through nutrient cycling and trophic cascade. However, research on pathogenic and nonpathogenic bacteria has shown that direct association with zooplankton has significant influences on the bacteria's physiology and ecology. We used stratified migration columns to study vertical dispersal of hitchhiking bacteria through migrating zooplankton across a density gradient that was otherwise impenetrable for bacteria in both upward and downward directions (conveyor-belt hypothesis). The strength of our experiments is to permit quantitative estimation of transport and release of associated bacteria: vertical migration of Daphnia magna yielded an average dispersal rate of 1.3 x 10(5) x cells x Daphnia(-1) x migration cycle(-1) for the lake bacterium Brevundimonas sp. Bidirectional vertical dispersal by migrating D. magna was also shown for two other bacterial species, albeit at lower rates. The prediction that diurnally migrating zooplankton acquire different attached bacterial communities from hypolimnion and epilimnion between day and night was subsequently confirmed in our field study. In mesotrophic Lake Nehmitz, D. hyalina showed pronounced diel vertical migration along with significant diurnal changes in attached bacterial community composition. These results confirm that hitchhiking on migrating animals can be an important mechanism for rapidly relocating microorganisms, including pathogens, allowing them to access otherwise inaccessible resources.

Grossart, Hans-Peter; Dziallas, Claudia

2010-01-01

249

Test-kits for thiosulfate-reducing bacteria  

Energy Technology Data Exchange (ETDEWEB)

API or proprietary test-kits presently used for the detection of bacteria involved in microbial corrosion are designed for specific detection of sulfate-reducing bacteria (SRB). It was recently shown that other sulfidogenic bacteria such as thiosulfate-reducing bacteria (TRB) are also involved in the corrosion of carbon steel. Since these bacteria cannot be detected by SRB test-kits, a new kit was developed for TRB detection, and validated in field trials.

Crolet, J.L. [Elf Aquitaine Production, Pau (France); Magot, M. [Elf Aquitaine Group, Labege (France); Brazy, J.L. [Elf Congo, Pointe Noire (Congo)

1997-08-01

250

Manipulation and effectiveness of bacteria filtration with particle track microfilters  

International Nuclear Information System (INIS)

A study has been carried out on the filtration of bacteria having different shapes and sizes using particle track microfilters. The filtration of spherical shaped bacteria (staphylococci), rod-like bacteria (colon bacilli) and mixed miscellaneous bacteria living in pool water in the countryside shows quantitatively that particle track microfilters are a reliable tool to remove various bacteria from liquid substances. The study convinces us that in future particle track microfilters will play an important role in medical sciences and daily life. (author)

251

Antioxidant and Antimicrobial Potential of the Bifurcaria bifurcata Epiphytic Bacteria  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Surface-associated marine bacteria are an interesting source of new secondary metabolites. The aim of this study was the isolation and identification of epiphytic bacteria from the marine brown alga, Bifurcaria bifurcata, and the evaluation of the antioxidant and antimicrobial activity of bacteria extracts. The identification of epiphytic bacteria was determined by 16S rRNA gene sequencing. Bacteria extracts were obtained with methanol and dichloromethane (1:1) extraction. The antioxidant act...

André Horta; Susete Pinteus; Celso Alves; Nádia Fino; Joana Silva; Sara Fernandez; Américo Rodrigues; Rui Pedrosa

2014-01-01

252

The role of anaerobic bacteria in mediastinitis.  

Science.gov (United States)

The management of mediastinitis involves directing appropriate antibacterial therapy against the potential bacterial pathogens. The increased recovery of anaerobic bacteria from mediastinal infections has led to a greater appreciation of their role in this condition and to re-evaluation of the proper treatment of this condition. Mediastinitis caused by anaerobic bacteria generally emerges following perforation of the oesophagus, extension of retropharyngeal abscess, suppurative parotitis, cervical cellulitis or abscess of dental origin. The bacteria recovered from these infections are often of oral origin and involve mixed aerobic-anaerobic oral flora. The predominant anaerobic isolates include Bacteroides spp., Peptostreptococcus spp., pigmented Prevotella and Porphyromonas spp. and Fusobacterium spp. Treatment includes surgical intervention, antibacterial therapy and supportive measures. Appropriate management of mediastinal infections due to aerobic and anaerobic infections requires the administration of antibacterials that are effective against both the aerobic and anaerobic components of the infection. Selection of antibacterials for the treatment of mediastinitis is determined by bacteriological studies. PMID:16526820

Brook, Itzhak

2006-01-01

253

Chemotaxis When Bacteria Remember: Drift versus Diffusion  

CERN Document Server

Escherichia coli (E. coli) bacteria govern their trajectories by switching between running and tumbling modes as a function of the nutrient concentration they experienced in the past. At short time one observes a drift of the bacterial population, while at long time one observes accumulation in high-nutrient regions. Recent work has pointed to an apparent theoretical contradiction between drift toward favorable regions and accumulation in favorable regions. A number of such earlier studies assume that a bacterium resets its memory at tumbles -- a fact not borne out by experiment -- and make use of approximate coarse-grained descriptions. Here, we revisit the problem of chemotaxis without resorting to any memory resets. We find that when bacteria respond to the environment in a non-adaptive manner, chemotaxis is generally dominated by diffusion, whereas when bacteria respond in an adaptive manner, chemotaxis is dominated by a bias in the motion. In all cases, the apparent contradiction between favorable drift ...

Chatterjee, Sakuntala; Kafri, Yariv

2011-01-01

254

Presence of bacteria in dentinal tubules  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in english This study demonstrated that a significant number of bacteria is present in the radicular dentinal tubules of periodontally diseased human teeth. Ten periodontally diseased teeth were prepared and stained by Brown and Brenn technique for histological examination. Bacteria were detected in all teeth. [...] It is suggested that bacteria may invade dentinal tubules exposed to periodontal pocket and are very hard to be eliminated by conventional mechanical and chemical periodontal therapy. Contaminated dentinal tubules of periodontally diseased teeth can thus act as active bacterial reservoirs to promote recolonization of mechanically treated root surfaces, which could interfere with the periodontal healing and progression of the disease.

José Ricardo, Kina; Juliana, Kina; Eunice Fumico Umeda, Kina; Mônica, Kina; Ana Maria Pires, Soubhia.

255

Lethal photosensitization of biofilm-grown bacteria  

Science.gov (United States)

Antibacterial agents are increasingly being used for the prophylaxis and treatment of oral diseases. As these agents can be rendered ineffective by resistance development in the target organisms there is a need to develop alternative antimicrobial approaches. Light-activated antimicrobial agents release singlet oxygen and free radicals which can kill adjacent bacteria and a wide range of cariogenic and periodontopathogenic bacteria has been shown to be susceptible to such agents. In the oral cavity these organisms are present as biofilms (dental plaques) which are less susceptible to traditional antimicrobial agents than bacterial suspensions. The results of these studies have shown that biofilm-grown oral bacteria are also susceptible to lethal photosensitization although the light energy doses required are grater than those needed to kill the organisms when they are grown as aqueous suspensions.

Wilson, Michael

1997-12-01

256

Bacteria?Triggered Release of Antimicrobial Agents  

DEFF Research Database (Denmark)

Medical devices employed in healthcare practice are often susceptible to microbial contamination. Pathogenic bacteria may attach themselves to device surfaces of catheters or implants by formation of chemically complex biofilms, which may be the direct cause of device failure. Extracellular bacterial lipases are particularly abundant at sites of infection. Herein it is shown how active or proactive compounds attached to polymeric surfaces using lipase?sensitive linkages, such as fatty acid esters or anhydrides, may be released in response to infection. Proof?of?concept of the responsive material is demonstrated by the bacteria?triggered release of antibiotics to control bacterial populations and signaling molecules to modulate quorum sensing. The self?regulating system provides the basis for the development of device?relevant polymeric materials, which only release antibiotics in dependency of the titer of bacteria surrounding the medical device.

Komnatnyy, Vitaly V.; Nielsen, Thomas Eiland

2014-01-01

257

Bacteria-Triggered Release of Antimicrobial Agents  

DEFF Research Database (Denmark)

Medical devices employed in healthcare practice are often susceptible to microbial contamination. Pathogenic bacteria may attach themselves to device surfaces of catheters or implants by formation of chemically complex biofilms, which may be the direct cause of device failure. Extracellular bacterial lipases are particularly abundant at sites of infection. Herein it is shown how active or proactive compounds attached to polymeric surfaces using lipase?sensitive linkages, such as fatty acid esters or anhydrides, may be released in response to infection. Proof?of?concept of the responsive material is demonstrated by the bacteria?triggered release of antibiotics to control bacterial populations and signaling molecules to modulate quorum sensing. The self?regulating system provides the basis for the development of device?relevant polymeric materials, which only release antibiotics in dependency of the titer of bacteria surrounding the medical device.

Komnatnyy, Vitaly V.; Nielsen, Thomas Eiland

2014-01-01

258

The effects of ionizing radiation on bacteria  

International Nuclear Information System (INIS)

The differences of radiosensitivities among bacteria in addition to the dependence upon the species or strains also depends on the environmental condition during irradiation (temperature, medium, the presence of protective or sensitizing agents, the gas phase or atmosphere, and water activity, or degree of hydration) and on the effects of the environmental condition before and after irradiation treatment (temperature of incubation, age of culture and growth medium). In general, spores are more resistant to radiation than vegetatic bacteria, with the exception that a few cocci are the most radiation resistant bacteria (Micrococcus and Streptococcus). The application of ionizing radiation in the fields of microbiology supports the radiation sterilization of medical and pharmaceutical products. In addition, microbiological aspects of food preservation, especially radurization, radicidation, and immunization studies by using irradiated microorganisms, are also important. (author)

259

Microgravity effects on pathogenicity of bacteria  

Directory of Open Access Journals (Sweden)

Full Text Available Microgravity is one of the important environmental conditions during spaceflight. A series of studies have shown that many kinds of bacteria could be detected in space station and space shuttle. Space environment or simulated microgravity may throw a certain influence on those opportunistic pathogens and lead to some changes on their virulence, biofilm formation and drug tolerance. The mechanism of bacteria response to space environment or simulated microgravity has not been defined. However, the conserved RNA-binding protein Hfq has been identified as a likely global regulator involved in the bacteria response to this environment. In addition, microgravity effects on bacterial pathogenicity may threaten astronauts' health. The present paper will focus on microgravity-induced alterations of pathogenicity and relative mechanism in various opportunistic pathogens.

Ya-juan WANG

2013-01-01

260

Gastric spiral bacteria in small felids.  

Science.gov (United States)

Nine small cats, including one bobcat (Felis rufus), one Pallas cat (F. manul), one Canada lynx (F. lynx canadensis), two fishing cats (F. viverrina), two margays (F. wiedii), and two sand cats (F. margarita), necropsied between June 1995 and March 1997 had large numbers of gastric spiral bacteria, whereas five large cats, including one African lion (Panthera leo), two snow leopards (P. uncia), one Siberian tiger (P. tigris altaica), and one jaguar (P. onca), necropsied during the same period had none. All of the spiral organisms from the nine small cats were histologically and ultrastructurally similar. Histologically, the spiral bacteria were 5-14 microm long with five to nine coils per organism and were located both extracellularly within gastric glands and surface mucus, and intracellularly in parietal cells. Spiral bacteria in gastric mucosal scrapings from the Canada lynx, one fishing cat, and the two sand cats were gram negative and had corkscrewlike to tumbling motility when viewed with phase contrast microscopy. The bacteria were 0.5-0.7 microm wide, with a periodicity of 0.65-1.1 microm in all cats. Bipolar sheathed flagella were occasionally observed, and no periplasmic fibrils were seen. The bacteria were extracellular in parietal cell canaliculi and intracellular within parietal cells. Culture of mucosal scrapings from the Canada lynx and sand cats was unsuccessful. Based on morphology, motility, and cellular tropism, the bacteria were probably Helicobacter-like organisms. Although the two margays had moderate lymphoplasmacytic gastritis, the other cats lacked or had only mild gastric lymphoid infiltrates, suggesting that these organisms are either commensals or opportunistic pathogens. PMID:9732040

Kinsel, M J; Kovarik, P; Murnane, R D

1998-06-01

 
 
 
 
261

Basic Laboratory Culture Methods for Anaerobic Bacteria  

Science.gov (United States)

Oxygen is either limiting or absent in many ecosystems. Anaerobic bacteria are often key players in such environments and these organisms have important roles in geo-elemental cycling, agriculture, and medicine. The metabolic versatility of anaerobes is exploited in a variety of industrial processes including fermented food production, biochemical synthesis, and bioremediation. There has been recent considerable interest in developing and enhancing technologies that employ anaerobes as biocatalysts. The study of anaerobic bacteria requires specialized techniques, and specific methods are described for the culture and manipulation of these microbes.

Strobel, Herbert J.

262

Degradation of monomethylhydrazine by two soil bacteria  

International Nuclear Information System (INIS)

It has been reported that three heterotrophic soil bacteria had the capacity to degrade hydrazine. One of these organisms, Achromobacter sp., degraded hydrazine to N2 gas. Furthermore, it was reported that monomethylhydrazine (MMH) in Arredondo fine sand was mineralized to CO2, and that such degradation is microbial. However, microorganisms that degrade MMH have not been reported. MMH and hydrazine are chemically similar to one another. Therefore, this study was initiated to test the capacity of the two hydrazine-degrading bacteria, Achromobacter sp. and Pseudomonas sp., to degrade MMH

263

Linking genome content to biofuel production yields: a meta-analysis of major catabolic pathways among select H2 and ethanol-producing bacteria  

Directory of Open Access Journals (Sweden)

Full Text Available Abstract Background Fermentative bacteria offer the potential to convert lignocellulosic waste-streams into biofuels such as hydrogen (H2 and ethanol. Current fermentative H2 and ethanol yields, however, are below theoretical maxima, vary greatly among organisms, and depend on the extent of metabolic pathways utilized. For fermentative H2 and/or ethanol production to become practical, biofuel yields must be increased. We performed a comparative meta-analysis of (i reported end-product yields, and (ii genes encoding pyruvate metabolism and end-product synthesis pathways to identify suitable biomarkers for screening a microorganism’s potential of H2 and/or ethanol production, and to identify targets for metabolic engineering to improve biofuel yields. Our interest in H2 and/or ethanol optimization restricted our meta-analysis to organisms with sequenced genomes and limited branched end-product pathways. These included members of the Firmicutes, Euryarchaeota, and Thermotogae. Results Bioinformatic analysis revealed that the absence of genes encoding acetaldehyde dehydrogenase and bifunctional acetaldehyde/alcohol dehydrogenase (AdhE in Caldicellulosiruptor, Thermococcus, Pyrococcus, and Thermotoga species coincide with high H2 yields and low ethanol production. Organisms containing genes (or activities for both ethanol and H2 synthesis pathways (i.e. Caldanaerobacter subterraneus subsp. tengcongensis, Ethanoligenens harbinense, and Clostridium species had relatively uniform mixed product patterns. The absence of hydrogenases in Geobacillus and Bacillus species did not confer high ethanol production, but rather high lactate production. Only Thermoanaerobacter pseudethanolicus produced relatively high ethanol and low H2 yields. This may be attributed to the presence of genes encoding proteins that promote NADH production. Lactate dehydrogenase and pyruvate:formate lyase are not conducive for ethanol and/or H2 production. While the type(s of encoded hydrogenases appear to have little impact on H2 production in organisms that do not encode ethanol producing pathways, they do influence reduced end-product yields in those that do. Conclusions Here we show that composition of genes encoding pathways involved in pyruvate catabolism and end-product synthesis pathways can be used to approximate potential end-product distribution patterns. We have identified a number of genetic biomarkers for streamlining ethanol and H2 producing capabilities. By linking genome content, reaction thermodynamics, and end-product yields, we offer potential targets for optimization of either ethanol or H2 yields through metabolic engineering.

Carere Carlo R

2012-12-01

264

CHARACTERIZATION OF NATURAL MICROCOSMS OF ESTUARINE MAGNETOTACTIC BACTERIA / CARACTERIZACIÓN DE MICROCOSMOS NATURALES DE BACTERIAS MAGNETOTÁCTICAS ESTUARINAS  

Scientific Electronic Library Online (English)

Full Text Available SciELO Colombia | Language: English Abstract in spanish No se ha reportado ningún estudio completo sobre microcosmos naturales de bacterias magnetotácticas (MTB) en estuarios o ambientes tropicales. Además, casi todos los estudios sobre las bacterias magnetotácticas se han desarrollado en aguas dulces alejadas del ecuador. Este trabajo se desarrolla sobr [...] e el ecuador y reporta una caracterización mineralógica y fisicoquímica detallada de dos microcosmos bacterianos estuarinos. Los resultados muestran que la lixiviación de minerales en los sedimentos puede ser un factor importante en la solubilización de elementos requeridos por las bacterias magnetotácticas. Específicamente, que el clinocloro, flogopita, nontronita y haloisita pueden estar entre los minerales más importantes en la lixiviación de hierro a los microcosmos estuarinos. Se concluye que la concentración de nitrato en el agua no debe ser tan baja como se ha reportado para lograr un crecimiento bacteriano óptimo. Las bacterias magnetotácticas no necesitan grandes cantidades de hierro disuelto para su crecimiento ni para la síntesis de magnetosomas. Abstract in english To date, no complete study of magnetotactic bacteria's (MTB) natural microcosms in estuarine or tropical environments has been reported. Besides, almost all the studies around magnetotactic bacteria have been based on fresh waters away from the Equator. In this work, we focused the experimental regi [...] on at the Equator and present a comprehensive mineralogical and physicochemical characterization of two estuarine bacterial microcosms. The results show that mineral lixiviation in the sediments may be an important factor in the solubilization of elements required by magnetotactic bacteria. Specifically, we show that clinochlore, phlogopite, nontronite, and halloysite could be among the main minerals that lixiviate iron to the estuarine microcosms. We conclude that nitrate concentration in the water should not be as low as those that have been reported for other authors to achieve optimal bacteria growth. It is confirmed that magnetotactic bacteria do not need large amounts of dissolved iron to grow or to synthesize magnetosomes.

ALEJANDRO, SALAZAR; ALVARO, MORALES; MARCO, MÁRQUEZ.

2011-08-01

265

Molecular evolution in bacteria: cell division  

Directory of Open Access Journals (Sweden)

Full Text Available Molecular evolution in bacteria is examined with an emphasis on the self-assembly of cells capable of primitive division and growth during early molecular evolution. Also, the possibility that some type of encapsulation structure preceeded biochemical pathways and the assembly of genetic material is examined. These aspects will be considered from an evolutionary perspective.

Trevors J.T.

1998-01-01

266

Molecular evolution in bacteria: cell division  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Molecular evolution in bacteria is examined with an emphasis on the self-assembly of cells capable of primitive division and growth during early molecular evolution. Also, the possibility that some type of encapsulation structure preceeded biochemical pathways and the assembly of genetic material is examined. These aspects will be considered from an evolutionary perspective.

Trevors J.T.

1998-01-01

267

Magnetic properties of heterotrophic bacteria (abstract)  

Science.gov (United States)

The magnetic properties (magnetic susceptibility and saturation magnetization) of six species of heterotrophic bacteria were studied: alcaligenes faecalis 81, arthrobacter globiformis BKM 685, bacillus cereus 8, leptothrix pseudo-ochracea D-405, proteus vulgaris 14, and seliberia stellata. It has been shown that the magnetic properties of bacteria depend on (1) the peculiarity of the micro-organism (species-specific and connected with cultivation conditions); (2) the source of the iron in the media. Most of the bacteria are diamagnetic in media with a minimum of iron (??=-7.2-0.3×10-6 sm3/g). The spore forming species (bacillus cereus) has increased diamagnetism. Usually the bacteria are paramagnetic in iron-containing media because they concentrate into Fe compounds. The paramagnetism of the iron-concentrating species (anthrobacter globiformis -?par=2.4×10-6, leptothrix pseudo-ochtracea ?par=11.0×10-6 and seliberia stellata ?par=3.2×10-6 sm3/g) depends, in general, on magnetically ordered compounds. Iron compounds not accumulated by proteus vulgaris and these species are always diamagnetic .

Verkhovceva, Nadezda V.; Glebova, Irina N.; Romanuk, Anatoly V.

1994-05-01

268

Interactions between phototrophic bacteria in marine sediments  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Phototrophic bacteria are the most consicious organisms occuring in laminated microbial sediment ecosystems (microbial mats). In the Waddensea area ecosystems consisting of a toplayer of the cyanobacterium Microleus chthonoplastes overlying a red layer of the purple sulfur bacterium Thiocapsa roseopersicina, commonly occur on sandy sediments which are located above mean high water leven (MHW). ... Zie: Summary

Wit, Rutger

1989-01-01

269

ACETOGENIC BACTERIA ASSOCIATED WITH SEAGRASS ROOTS  

Science.gov (United States)

Seagrasses are adapted to being rooted in reduced, anoxic sediments with high rates of sulfate reduction. During the day, an oxygen gradient is generated around the roots, becoming anoxic at night. Thus, obligate anaerobic bacteria in the rhizosphere have to tolerate elevated oxy...

270

Flow cytometry, fluorescent probes, and flashing bacteria  

Digital Repository Infrastructure Vision for European Research (DRIVER)

 Key words: fluorescent probes, flow cytometry, CSLM, viability, survival, microbial physiology, lactic acid bacteria, Lactococcus lactis , Lactobacillus plantarum , cheese, milk, probiotic In food industry there is a perceived need for rapid methods for detection and viability assessment of microbes. Fluorescent staining and flow cytometry provide excellent tools for microbial analysis. This thesis describes fluorescent techniques for assessment of the physiological sta...

Bunthof, C. J.

2002-01-01

271

Tolerance of Anaerobic Bacteria to Chlorinated Solvents  

Science.gov (United States)

The aim of this research was to evaluate the effects of four chlorinated aliphatic hydrocarbons (CAHs), perchloroethene (PCE), carbon tetrachloride (CT), chloroform (CF) and 1,2-dichloroethane (1,2-DCA), on the growth of eight anaerobic bacteria: four fermentative species (Escherichia coli, Klebsiella sp., Clostridium sp. and Paenibacillus sp.) and four respiring species (Pseudomonas aeruginosa, Geobacter sulfurreducens, Shewanella oneidensis and Desulfovibrio vulgaris). Effective concentrations of solvents which inhibited growth rates by 50% (EC50) were determined. The octanol-water partition coefficient or log Po/w of a CAH proved a generally satisfactory measure of its toxicity. Most species tolerated approximately 3-fold and 10-fold higher concentrations of the two relatively more polar CAHs CF and 1,2-DCA, respectively, than the two relatively less polar compounds PCE and CT. EC50 values correlated well with growth rates observed in solvent-free cultures, with fast-growing organisms displaying higher tolerance levels. Overall, fermentative bacteria were more tolerant to CAHs than respiring species, with iron- and sulfate-reducing bacteria in particular appearing highly sensitive to CAHs. These data extend the current understanding of the impact of CAHs on a range of anaerobic bacteria, which will benefit the field of bioremediation. PMID:24441515

Koenig, Joanna C.; Groissmeier, Kathrin D.; Manefield, Mike J.

2014-01-01

272

Tolerance of anaerobic bacteria to chlorinated solvents.  

Science.gov (United States)

The aim of this research was to evaluate the effects of four chlorinated aliphatic hydrocarbons (CAHs), perchloroethene (PCE), carbon tetrachloride (CT), chloroform (CF) and 1,2-dichloroethane (1,2-DCA), on the growth of eight anaerobic bacteria: four fermentative species (Escherichia coli, Klebsiella sp., Clostridium sp. and Paenibacillus sp.) and four respiring species (Pseudomonas aeruginosa, Geobacter sulfurreducens, Shewanella oneidensis and Desulfovibrio vulgaris). Effective concentrations of solvents which inhibited growth rates by 50% (EC50) were determined. The octanol-water partition coefficient or log Po/w of a CAH proved a generally satisfactory measure of its toxicity. Most species tolerated approximately 3-fold and 10-fold higher concentrations of the two relatively more polar CAHs CF and 1,2-DCA, respectively, than the two relatively less polar compounds PCE and CT. EC50 values correlated well with growth rates observed in solvent-free cultures, with fast-growing organisms displaying higher tolerance levels. Overall, fermentative bacteria were more tolerant to CAHs than respiring species, with iron- and sulfate-reducing bacteria in particular appearing highly sensitive to CAHs. These data extend the current understanding of the impact of CAHs on a range of anaerobic bacteria, which will benefit the field of bioremediation. PMID:24441515

Koenig, Joanna C; Groissmeier, Kathrin D; Manefield, Mike J

2014-01-01

273

Salt Tolerance of Bacteria in Estuarine Sediments.  

Science.gov (United States)

This study was designed to determine sea salt requirements of bacteria found in marine sediments of coastal waters. Questions dealt with are: (1) Are there any obligate halophiles present and (2) what salt requirements are there for other organisms in the...

M. D. Prickett

1980-01-01

274

Probiotics Bacteria in Fermented Dairy Products  

Directory of Open Access Journals (Sweden)

Full Text Available The nutritional value of diary based product that contains probiotic bacteria on the gastrointestinal health and functions have been investigated in this study. Both probiotic Lactobacillus bulgaricus and Streptococcus thermophilus species, contribute to the formation of yogurt as a result of anaerobic fermentation of lactic acid in the milk. The benefits of yogurt consumption on the gastrointestinal function mediated through the gut micro flora, bowel transit and the enhancement of gastrointestinal immune responses. Numerous studies suggested beneficial therapeutic effect of probiotic bacteria in the yogurt and other fermented dairy products on the gut health. Certain disease with gastrointestinal tract such as, lactose intolerance, diarrhea, colon Cancer, inflammatory bowel disease and other bacterial infection were inhibited through high consumption of yogurt. Probiotic bacteria can protect against enteric infection and inhibit chemically Carcinogens induce tumorization in the gastrointestinal tract. Modulation of the gut microflora and the enhancement of mucosal immunity of the gut are both mechanisms of probiotic function potentially influence gut function. Combination of Probiotic active culture and prebiotics non digestible food ingredient, beneficially affect the host by improving the survival of live microbial dietary supplement through its transit in the gut and by stimulating the activity of colon bacteria, specially Bifidobacteria and Lactobacilli genera. Further well-designed, controlled animal studies are needed to confirm the effects of different sources of probiotic strains used in the diary products, on gut health and function.

Omer Turki Mamdoh Ershidat

2009-01-01

275

Bacteria Isolated from Post-Partum Infections  

Directory of Open Access Journals (Sweden)

Full Text Available Objective: This study was undertaken with an aim to determine bacterial species involved in post partum infections and also their abundance in patients admitted to at Khanevadeh hospital. In this study out of three different kinds of postpartum infections (i.e. genital, breast and urinary tract, only genital infection is considered."nMaterials and Methods: Post partum infection among 6077 patients (inpatients and re-admitted patients of Khanevadeh hospital from 2003 till 2008 was studied in this descriptive study. Samples were collected from patients for laboratory diagnosis to find out the causative organisms."nResults: Follow up of mothers after delivery revealed 7.59% (461 patients had post partum infection, out of which 1.03% (63 patients were re-hospitalized. "nInfection was more often among younger mothers. Bacteria isolated and identified were both aerobic and anaerobic cocci and bacilli, majority of which were normal flora of the site of infection. Though, some pathogenic bacteria like Staphylococcus aureus, Neisseria gonorrhea, Chlamydia trachomatis,were also the causative agents. The commonest infection was infection at the site of episiotomy. "nConclusion: Puerperal infection was detected in of 7.59% mothers. Bacteria isolated were both aerobic and anaerobic cocci and bacilli, majority of which were normal flora. However; some pathogenic bacteria were isolated.

Aghdas Safari

2009-06-01

276

Bacteria-mediated bisphenol A degradation.  

Science.gov (United States)

Bisphenol A (BPA) is an important monomer in the manufacture of polycarbonate plastics, food cans, and other daily used chemicals. Daily and worldwide usage of BPA and BPA-contained products led to its ubiquitous distribution in water, sediment/soil, and atmosphere. Moreover, BPA has been identified as an environmental endocrine disruptor for its estrogenic and genotoxic activity. Thus, BPA contamination in the environment is an increasingly worldwide concern, and methods to efficiently remove BPA from the environment are urgently recommended. Although many factors affect the fate of BPA in the environment, BPA degradation is mainly depended on the metabolism of bacteria. Many BPA-degrading bacteria have been identified from water, sediment/soil, and wastewater treatment plants. Metabolic pathways of BPA degradation in specific bacterial strains were proposed, based on the metabolic intermediates detected during the degradation process. In this review, the BPA-degrading bacteria were summarized, and the (proposed) BPA degradation pathway mediated by bacteria were referred. PMID:23681588

Zhang, Weiwei; Yin, Kun; Chen, Lingxin

2013-07-01

277

MICROBIOLOGICAL CHARACTERIZATION OF BACTERIA INHABITING A WATER DISTRIBUTION SYSTEM SIMULATOR  

Science.gov (United States)

The impact of chlorination and chloramination treatments on heterotrophic bacteria (HB) and ammonia oxidizing bacteria (AOB) inhabiting a water distribution system simulator was investigated. Notable changes in bacterial densities were observed during this monitoring study. For e...

278

Molecular clue links bacteria to the origin of animals  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Bacteria have a role in the formation of colonies by a species of single-celled organisms whose ancestors gave rise to the animals, which suggests that bacteria might also have influenced the origin of multicellularity in animals.

Hadfield, Michael G.

2012-01-01

279

Researchers Discover How Bacteria Resist Antibiotics in Hospitals  

Science.gov (United States)

... please enable JavaScript. Researchers Discover How Bacteria Resist Antibiotics in Hospitals Spotting infected patients, disinfecting hospitals key ... have uncovered a key factor to explain why antibiotic-resistant bacteria can thrive in a hospital setting. ...

280

Genes May Determine Body Weight by Shaping Gut Bacteria  

Science.gov (United States)

... Genes May Determine Body Weight by Shaping Gut Bacteria Study finds certain family of microbes more common ... person's body weight by determining the types of bacteria that live in the intestines, a new study ...

 
 
 
 
281

DISINFECTION OF BACTERIA ATTACHED TO GRANULAR ACTIVATED CARBON  

Science.gov (United States)

Heterotrophic plate count bacteria, coliform organisms, and pathogenic microorganisms attached to granular activated carbon (GAC) particles were examined for their susceptibility to chlorine disinfection. When these bacteria were grown on carbon particles and then disinfected wit...

282

Probiotic bacteria in prevention and treatment of diarrhea  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Probiotic bacteria have beneficial effects in prevention and treatment of different diseases. The results of preventive and therapeutic effect of probiotic bacteria on diarrhea during last ten years are shown in this paper. The greatest preventive and therapeutic effect of probiotic bacteria was identified for acute diarrhea in children caused by rotaviruses. Significant, but slightly lower effect of probiotic bacteria was proved for antibiotic associated diarrhea. Positive effect in preventi...

Jasmina Havranek; Šimun Zamberlin; Iva Dolen?i? Špehar; Tamara Prtilo; Milna Tudor; Dubravka Samaržija

2009-01-01

283

Effect of radiation on activity of sulphate reducing bacteria  

International Nuclear Information System (INIS)

The effect of ?-radiation on activity of sulphate reducing bacteria has been studied. Concentration of biogenic hydrogen, generated in the medium, is the main criterion, characterizing corrosion activity of the bacteria studied. The developed method of suppression of active development of sulfate reducing bacteria considerably reduces, and at lethal doses of ?-radiation eliminates altogether the bacteria activity and formation of the main corrosion agent-hydrogen sulphide-in the medium and that, in its turn, liquidates hydrogen sulphide corrosion

284

Influence of uranium ores constituent on bacteria leaching  

International Nuclear Information System (INIS)

Bacteria column leaching and the domesticed incubation of bacteria test of ores from different uranium mines have been discussed in the paper. The results show that the 5%-10% acid comsuption was reduced by bacteria leaching, that the uranium-tolerance of bacteria had been raised to 2.0 g/L, and that its fluoride-tolerance had been raised from 0.28 g/L to 0.83 g/L. (authors)

285

Comparative genomics of green sulfur bacteria.  

Science.gov (United States)

Eleven completely sequenced Chlorobi genomes were compared in oligonucleotide usage, gene contents, and synteny. The green sulfur bacteria (GSB) are equipped with a core genome that sustains their anoxygenic phototrophic lifestyle by photosynthesis, sulfur oxidation, and CO(2) fixation. Whole-genome gene family and single gene sequence comparisons yielded similar phylogenetic trees of the sequenced chromosomes indicating a concerted vertical evolution of large gene sets. Chromosomal synteny of genes is not preserved in the phylum Chlorobi. The accessory genome is characterized by anomalous oligonucleotide usage and endows the strains with individual features for transport, secretion, cell wall, extracellular constituents, and a few elements of the biosynthetic apparatus. Giant genes are a peculiar feature of the genera Chlorobium and Prosthecochloris. The predicted proteins have a huge molecular weight of 10(6), and are probably instrumental for the bacteria to generate their own intimate (micro)environment. PMID:20099081

Davenport, Colin; Ussery, David W; Tümmler, Burkhard

2010-06-01

286

[Synthesis of reserve polyhydroxyalkanoates by luminescent bacteria].  

Science.gov (United States)

The ability of marine luminescent bacteria to synthesize polyesters of hydroxycarboxylic acids (polyhydroxyalkanoates, PHA) as reserve macromolecules was studied. Twenty strains from the collection of the luminescent bacteria CCIBSO (WDSM839) of the Institute of Biophysics, Siberian Branch, Russian Academy of Sciences, assigned to different taxa (Photobacterium leiognathi, Ph. phosphoreum, Vibrio harveyi, and V. fischeri) were analyzed. The most productive strains were identified, and the conditions ensuring high polymer yields in batch culture (40-70% of the cell dry mass weight) were determined. The capacity of synthesizing two- and three-component polymers containing hydroxybutyric acid as the main monomer and hydroxyvaleric and hydroxyhexanoic acids was revealed in Ph. leiognathi and V. harveyi strains. The results allow luminescent microorganisms to be regarded as new producers of multicomponent polyhydroxyalkanoates. PMID:18683654

Boiandin, A N; Kalacheva, G S; Rodicheva, E K; Volova, T G

2008-01-01

287

HERBASPIRILLUM-LIKE BACTERIA IN BANANA PLANTS  

Directory of Open Access Journals (Sweden)

Full Text Available Diazotrophic bacteria isolated from banana plants were characterized by morphological and physiological aspects. Three different groups of these plant-bacteria could be established. Two of them showed similarity to species of the Herbaspirillum genus. The third one was different because used only a few carbon substrates and produced water diffusible compounds that fluoresced under UV light. All three bacterial groups were thin rods with mono or bipolar flagella, presented negative reaction in Gram stain, showed catalase activity, were able to reduce nitrate and grew better in semi-solid JNFb medium at 31ºC. The nitrogenase activity was detected in semi-solid N-free JNFb medium and expressed higher values when pH ranged from 6.5 to 7.0 (groups I and II and 6.0 to 6.5 (group III. The diazotrophs isolated from banana plants were distinct from species of Herbaspirillum previously identified in gramineous plants.

Weber Olmar B.

2001-01-01

288

Biotechnological potential of Clostridium butyricum bacteria  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in english In response to demand from industry for microorganisms with auspicious biotechnological potential, a worldwide interest has developed in bacteria and fungi isolation. Microorganisms of interesting metabolic properties include non-pathogenic bacteria of the genus Clostridium, particularly C. acetobut [...] ylicum, C. butyricum and C. pasteurianum. A well-known property of C. butyricum is their ability to produce butyric acid, as well as effectively convert glycerol to 1,3-propanediol (38.2 g/L). A conversion rate of 0.66 mol 1,3-propanediol/mol of glycerol has been obtained. Results of the studies described in the present paper broaden our knowledge of characteristic features of C. butyricum specific isolates in terms of their phylogenetic affiliation, fermentation capacity and antibacterial properties.

Daria, Szymanowska-Powa& #322; owska; Dorota, Orczyk; Katarzyna, Leja.

2014-09-01

289

On Ants, Bacteria and Dynamic Environments  

CERN Document Server

Wasps, bees, ants and termites all make effective use of their environment and resources by displaying collective swarm intelligence. Termite colonies - for instance - build nests with a complexity far beyond the comprehension of the individual termite, while ant colonies dynamically allocate labor to various vital tasks such as foraging or defense without any central decision-making ability. Recent research suggests that microbial life can be even richer: highly social, intricately networked, and teeming with interactions, as found in bacteria. What strikes from these observations is that both ant colonies and bacteria have similar natural mechanisms based on Stigmergy and Self-Organization in order to emerge coherent and sophisticated patterns of global behaviour. Keeping in mind the above characteristics we will present a simple model to tackle the collective adaptation of a social swarm based on real ant colony behaviors (SSA algorithm) for tracking extrema in dynamic environments and highly multimodal co...

Ramos, V; Rosa, A C; Ramos, Vitorino; Fernandes, Carlos; Rosa, Agostinho C.

2005-01-01

290

Seeing Streptococcus pneumoniae, a Common Killer Bacteria  

DEFF Research Database (Denmark)

Look around you. The diversity and complexity of life on earth is overwhelming and data continues to grow. In our desire to understand and explain everything scientifically from molecular evolution to supernovas we depend on visual representations. This paper investigates visual representations of the bacteria Streptococcus pneumoniae by use of ink, watercolours and computer graphics. We propose a novel artistic visual rendering of Streptococcus pneumoniae and ask what the value of these kind of representations are compared to traditional scientific data. We ask if drawings and computer-assisted representations can add to our scientific knowledge about this dangerous bacteria. Is there still a role for the scientific illustrator in the scientific process and synthesis of scientific knowledge?

Kjærgaard, Rikke Schmidt; Andersen, Ebbe Sloth

2014-01-01

291

Pattern Formation in Growing Polar Bacteria  

Science.gov (United States)

We analyze a continuum model of a bacterial suspension that includes motility suppression from steric repulsion, polar alignment, and bacteria reproduction and death. Using a combination of linear stability analysis and numerical solution of the nonlinear equations, we demonstrate that the model exhibits a rich variety of emergent structures, corresponding to generic patterns seen in experiments. Motility suppression in a crowded environment gives rise to a density phase separation, regulated by the growth/death of the bacteria, as demonstrated earlier by Cates et al. [PNAS 107, 11715--11720(2010)], with spherically symmetric patterns similar to those observed in S. typhimurium. The addition of polar alignment yields new ring/band and swirl/spiral structures resembling those observed in E.coli colonies. The stationary/traveling nature of the patterns and their symmetry is classified and summarized in a phase diagram.

Yang, Xingbo; Marchetti, M. Cristina; Marenduzzo, Davide

2013-03-01

292

Evidence for metabolic activity of airborne bacteria  

Science.gov (United States)

Aerosols of the bacterium Serratia marcescens, and of uniformly labeled C-14 glucose were produced simultaneously and mixed in tubing leading to an aerosol chamber. During a subsequent period of about 5 hrs, carbon dioxide was produced metabolically within the chamber, and labeled material incorporated within the suspended particles first increased then decreased. This constitutes the first direct evidence of microbial metabolism of bacteria suspended in the air.

Chatigny, M. A.; Wolochow, H.

1974-01-01

293

Marine bacteria exhibit a bipolar distribution.  

Science.gov (United States)

The microbial cosmopolitan dispersion hypothesis often invoked to explain distribution patterns driven by high connectivity of oceanographic water masses and widespread dispersal ability has never been rigorously tested. By using a global marine bacterial dataset and iterative matrix randomization simulation, we show that marine bacteria exhibit a significantly greater dispersal limitation than predicted by our null model using the "everything is everywhere" tenet with no dispersal limitation scenario. Specifically, marine bacteria displayed bipolar distributions (i.e., species occurring exclusively at both poles and nowhere else) significantly less often than in the null model. Furthermore, we observed fewer taxa present in both hemispheres but more taxa present only in a single hemisphere than expected under the null model. Each of these trends diverged further from the null expectation as the compared habitats became more geographically distant but more environmentally similar. Our meta-analysis supported a latitudinal gradient in bacterial diversity with higher richness at lower latitudes, but decreased richness toward the poles. Bacteria in the tropics also demonstrated narrower latitudinal ranges at lower latitudes and relatively larger ranges in higher latitudes, conforming to the controversial macroecological pattern of the "Rapoport rule." Collectively, our findings suggest that bacteria follow biogeographic patterns more typical of macroscopic organisms, and that dispersal limitation, not just environmental selection, likely plays an important role. Distributions of microbes that deliver critical ecosystem services, particularly those in polar regions, may be vulnerable to the same impacts that environmental stressors, climate warming, and degradation in habitat quality are having on biodiversity in animal and plant species. PMID:23324742

Sul, Woo Jun; Oliver, Thomas A; Ducklow, Hugh W; Amaral-Zettler, Linda A; Sogin, Mitchell L

2013-02-01

294

Adenoid Reservoir for Pathogenic Biofilm Bacteria?  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Biofilms of pathogenic bacteria are present on the middle ear mucosa of children with chronic otitis media (COM) and may contribute to the persistence of pathogens and the recalcitrance of COM to antibiotic treatment. Controlled studies indicate that adenoidectomy is effective in the treatment of COM, suggesting that the adenoids may act as a reservoir for COM pathogens. To investigate the bacterial community in the adenoid, samples were obtained from 35 children undergoing adenoidectomy for ...

Nistico, L.; Kreft, R.; Gieseke, A.; Coticchia, J. M.; Burrows, A.; Khampang, P.; Liu, Y.; Kerschner, J. E.; Post, J. C.; Lonergan, S.; Sampath, R.; Hu, F. Z.; Ehrlich, G. D.; Stoodley, P.; Hall-stoodley, L.

2011-01-01

295

Solvent-tolerant bacteria in biocatalysis.  

Digital Repository Infrastructure Vision for European Research (DRIVER)

The toxicity of fine chemicals to the producer organism is a problem in several biotechnological production processes. In several instances, an organic phase can be used to extract the toxic product from the aqueous phase during a fermentation. With the discovery of solvent-tolerant bacteria, more solvents can now be used in such two-liquid water-solvent systems. We are gaining new insights into the mechanisms of bacterial solvent tolerance, such as the active efflux of solvents from the cyto...

Bont, J. A. M.

1998-01-01

296

Proteomic Insights: Cryoadaption of Permafrost Bacteria  

Energy Technology Data Exchange (ETDEWEB)

The permafrost microbial community has been described as 'a community of survivors' (Friedman 1994). Because of the permanently cold condition and the long term isolation of the permafrost sediments, the permafrost microorganisms have acquired various adaptive features in the membrane, enzymes, and macromolecular synthesis. This chapter reviews the different adaptive mechanisms used by permafrost microorganisms with a focus on the proteomic level of cryoadaptation that have recently been identified during the low temperature growth in permafrost bacteria.

Qiu, Yinghua [University of Michigan; Vishnivetskaya, Tatiana A [ORNL; Lubman, David M [University of Michigan

2009-01-01

297

Polycations sensitize enteric bacteria to antibiotics.  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Polymyxin B nonapeptide, a polymyxin B derivative which lacks the fatty acyl part and the bactericidal activity of polymyxin, was shown to sensitize smooth encapsulated Escherichia coli (O18:K1) and smooth Salmonella typhimurium to hydrophobic antibiotics (novobiocin, fusidic acid, erythromycin, clindamycin, nafcillin, and cloxacillin). The polymyxin B nonapeptide-treated bacteria were as sensitive to these antibiotics as are deep rough mutants. A lysine polymer with 20 lysine residues (lysin...

Vaara, M.; Vaara, T.

1983-01-01

298

Purple bacteria and quantum Fourier transform  

Digital Repository Infrastructure Vision for European Research (DRIVER)

The LH-II of purple bacteria Rhodospirillum (Rs.) molischianum and Rhodopseudomonas (Rps.) acidophila adopts a highly symmetrical ring shape, with a radius of about 7 nm. In the case of Rps. acidophila the ring has a ninefold symmetry axis, and in LH-II from Rs. molischianum the ring has an eightfold symmetry axis. These rings are found to exibit two bands of excitons. A simplified mathematical description of the exciton states is given in Hu, X. & Schulten, K. (1997) Physic...

Lipovaca, Samir

2007-01-01

299

Dynamics of swimming bacteria at complex interfaces  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Flagellated bacteria exploiting helical propulsion are known to swim along circular trajectories near surfaces. Fluid dynamics predicts this circular motion to be clockwise (CW) above a rigid surface (when viewed from inside the fluid) and counter-clockwise (CCW) below a free surface. Recent experimental investigations showed that complex physicochemical processes at the nearby surface could lead to a change in the direction of rotation, both at solid surfaces absorbing slip...

Lopez, Diego; Lauga, Eric

2014-01-01

300

Antifungal activity of lactic acid bacteria  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Enrichment culture techniques produced more than 1200 isolates of lactic acid bacteria (LAB) that were screened for antifungal activity against the indicator mould Aspergillus fumigatus. Approximately 10% of the LAB were active, but only 4% had medium or strong activity in an agar plate assay. The majority of isolates with strong antifungal activity were Lactobacillus coryniformis strains, but Lactobacillus plantarum and Pediococcus pentosaceus were also frequently identified. Some of the iso...

Magnusson, Jesper

2003-01-01

 
 
 
 
301

[Phylogenetic analysis of bacteria of extreme ecosystems].  

Science.gov (United States)

Phylogenetic analysis of aerobic chemoorganotrophic bacteria of the two extreme regions (Dead Sea and West Antarctic) was performed on the basis of the nucleotide sequences of the 16S rRNA gene. Thermotolerant and halotolerant spore-forming bacteria 7t1 and 7t3 of terrestrial ecosystems Dead Sea identified as Bacillus licheniformis and B. subtilis subsp. subtilis, respectively. Taking into account remote location of thermotolerant strain 6t1 from closely related strains in the cluster Staphylococcus, 6t1 strain can be regarded as Staphylococcus sp. In terrestrial ecosystems, Galindez Island (Antarctic) detected taxonomically diverse psychrotolerant bacteria. From ornithogenic soil were isolated Micrococcus luteus O-1 and Microbacterium trichothecenolyticum O-3. Strains 4r5, 5r5 and 40r5, isolated from grass and lichens, can be referred to the genus Frondihabitans. These strains are taxonomically and ecologically isolated and on the tree diagram form the joint cluster with three isolates Frondihabitans sp., isolated from the lichen Austrian Alps, and psychrotolerant associated with plants F. cladoniiphilus CafT13(T). Isolates from black lichen in the different stationary observation points on the south side of a vertical cliff identified as: Rhodococcus fascians 181n3, Sporosarcina aquimarina O-7, Staphylococcus sp. 0-10. From orange biofilm of fouling on top of the vertical cliff isolated Arthrobacter sp. 28r5g1, from the moss-- Serratia sp. 6r1g. According to the results, Frondihabitans strains most frequently encountered among chemoorganotrophic aerobic bacteria in the Antarctic phytocenoses. PMID:25007437

Romanovskaia, V A; Parfenova, V V; Bel'kova, N L; Sukhanova, E V; Gladka, G V; Tashireva, A A

2014-01-01

302

Signals of Growth Regulation in Bacteria  

Digital Repository Infrastructure Vision for European Research (DRIVER)

A fundamental characteristic of cells is their ability to regulate growth in response to changing environmental conditions. This review focuses on recent progress towards understanding the mechanisms by which bacterial growth is regulated. These phenomena include the “viable but not culturable” state (VBNC), in which bacterial growth becomes conditional; and “persistence”, which confers antibiotic resistance to a small fraction of bacteria in a population. Notably, at least one form o...

Hayes, Christopher S.; Low, David A.

2009-01-01

303

Tumour targeting with systemically administered bacteria.  

LENUS (Irish Health Repository)

Challenges for oncology practitioners and researchers include specific treatment and detection of tumours. The ideal anti-cancer therapy would selectively eradicate tumour cells, whilst minimising side effects to normal tissue. Bacteria have emerged as biological gene vectors with natural tumour specificity, capable of homing to tumours and replicating locally to high levels when systemically administered. This property enables targeting of both the primary tumour and secondary metastases. In the case of invasive pathogenic species, this targeting strategy can be used to deliver genes intracellularly for tumour cell expression, while non-invasive species transformed with plasmids suitable for bacterial expression of heterologous genes can secrete therapeutic proteins locally within the tumour environment (cell therapy approach). Many bacterial genera have been demonstrated to localise to and replicate to high levels within tumour tissue when intravenously (IV) administered in rodent models and reporter gene tagging of bacteria has permitted real-time visualisation of this phenomenon. Live imaging of tumour colonising bacteria also presents diagnostic potential for this approach. The nature of tumour selective bacterial colonisation appears to be tumour origin- and bacterial species- independent. While originally a correlation was drawn between anaerobic bacterial colonisation and the hypoxic nature of solid tumours, it is recently becoming apparent that other elements of the unique microenvironment within solid tumours, including aberrant neovasculature and local immune suppression, may be responsible. Here, we consider the pre-clinical data supporting the use of bacteria as a tumour-targeting tool, recent advances in the area, and future work required to develop it into a beneficial clinical tool.

Morrissey, David

2012-01-31

304

Physiology of Haloalkaliphilic Sulfur-oxidizing Bacteria:  

Digital Repository Infrastructure Vision for European Research (DRIVER)

The inorganic sulfur oxidation by obligate haloalkaliphilic chemolithoautotrophs was only recently discovered and investigated. These autotrophic sulfur oxidizing bacteria (SOB), capable of oxidation of inorganic sulfur compounds at moderate to high salt concentration and at high pH, can be divided into three genera belonging to the γ subdivision of the Proteobacteria: Thioalkalimicrobium, Thioalkalivibrio and Thioalkalispira. Their taxonomy, metabolic diversity and the potential applicati...

Banciu, H. L.

2004-01-01

305

Effect of phenolic monomers on ruminal bacteria.  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Ruminal bacteria were subjected to a series of phenolic compounds in various concentrations to acquire fundamental information on the influence on growth and the potential limits to forage utilization by phenolic monomers. Ruminococcus albus 7, Ruminococcus flavefaciens FD-1, Butyrivibrio fibrisolvens 49, and Lachnospira multiparus D-32 were tested against 1, 5, and 10 mM concentrations of sinapic acid, syringaldehyde, syringic acid, ferulic acid, vanillin, vanillic acid, p-coumaric acid, p-h...

Borneman, W. S.; Akin, D. E.; Vaneseltine, W. P.

1986-01-01

306

Bacteriophytochrome controls photosystem synthesis in anoxygenic bacteria.  

Science.gov (United States)

Plants use a set of light sensors to control their growth and development in response to changes in ambient light. In particular, phytochromes exert their regulatory activity by switching between a biologically inactive red-light-absorbing form (Pr) and an active far-red-light absorbing form (Pfr). Recently, biochemical and genetic studies have demonstrated the occurrence of phytochrome-like proteins in photosynthetic and non-photosynthetic bacteria--but little is known about their functions. Here we report the discovery of a bacteriophytochrome located downstream from the photosynthesis gene cluster in a Bradyrhizobium strain symbiont of Aeschynomene. The synthesis of the complete photosynthetic apparatus is totally under the control of this bacteriophytochrome. A similar behaviour is observed for the closely related species Rhodopseudomonas palustris, but not for the more distant anoxygenic photosynthetic bacteria of the genus Rhodobacter, Rubrivivax or Rhodospirillum. Unlike other (bacterio)phytochromes, the carboxy-terminal domain of this bacteriophytochrome contains no histidine kinase features. This suggests a light signalling pathway involving direct protein-protein interaction with no phosphorelay cascade. This specific mechanism of regulation may represent an important ecological adaptation to optimize the plant-bacteria interaction. PMID:12000965

Giraud, Eric; Fardoux, Joël; Fourrier, Nicolas; Hannibal, Laure; Genty, Bernard; Bouyer, Pierre; Dreyfus, Bernard; Verméglio, André

2002-05-01

307

Fecal indicator bacteria at Havana Bay  

International Nuclear Information System (INIS)

Aims: Fecal indicator bacteria concentrations were evaluated in Havana Bay. Methods: Concentrations of traditional fecal indicator bacteria were calculated between April 2010 and February 2011, by MPN methods. Concentrations of thermo tolerant coliform (CTT), Escherichia coli, fecal streptococci (EF), intestinal enterococci (ENT) in seawater, and Clostridium perfringens in sediment surface, were determined. Results: CTT and E. coli levels were far above Cuban water quality standard for indirect contact with water, showing the negative influence of sewage and rivers on the bay. The EF and ENT were measured during sewage spills at the discharge site and they were suitable indicators of fecal contamination, but these indicators didn't show the same behavior in other selected sites. This result comes from its well-known inactivation by solar light in tropical zones and the presumable presence of humid acids in the waters of the bay. Conclusion: Fecal indicator bacteria and its statistical relationships reflect recent and chronic fecal contamination at the bay and near shores.

308

Soil bacteria for remediation of polluted soils  

Energy Technology Data Exchange (ETDEWEB)

Soil bacteria, specifically adapted to contaminated soils, may be used for the remediation of polluted soils. The Flemish research institute VITO has established a collection of bacteria, which were isolated from contaminated areas. This collection includes microbacteria degrading mineral oils (Pseudomonas sp., Acinetobacter sp. and others), microbacteria degrading polycyclic aromatic hydrocarbons (genera Sphingomonas and Mycobacterium), microbacteria degrading polychlorobiphenyls (genus Ralstonia and strains related to beta-Proteobacteria), and metal resistant bacteria with plasmid borne resistances to Cd, Zn, Ni, Co, Cu, Hg, and Cr. Bench-scale reactors were developed to investigate the industrial feasibility of bioremediation. Batch Stirred Tank Reactors were used to evaluate the efficiency of oil degraders. Soils, contaminated with non-ferrous metals, were treated using a Bacterial Metal Slurry Reactor. It was found that the reduction of the Cd concentration may vary strongly from sample to sample: reduction factors vary from 95 to 50%. Is was shown that Cd contained in metallic sinter and biologically unavailable Cd could not be removed.

Springael, D.; Bastiaens, L.; Carpels, M.; Mergaey, M.; Diels, L.

1996-09-18

309

Dynamics of swimming bacteria at complex interfaces  

Science.gov (United States)

Flagellated bacteria exploiting helical propulsion are known to swim along circular trajectories near surfaces. Fluid dynamics predicts this circular motion to be clockwise (CW) above a rigid surface (when viewed from inside the fluid) and counter-clockwise (CCW) below a free surface. Recent experimental investigations showed that complex physicochemical processes at the nearby surface could lead to a change in the direction of rotation, both at solid surfaces absorbing slip-inducing polymers and interfaces covered with surfactants. Motivated by these results, we use a far-field hydrodynamic model to predict the kinematics of swimming near three types of interfaces: clean fluid-fluid interface, slipping rigid wall, and a fluid interface covered by incompressible surfactants. Representing the helical swimmer by a superposition of hydrodynamic singularities, we first show that in all cases the surfaces reorient the swimmer parallel to the surface and attract it, both of which are a consequence of the Stokes dipole component of the swimmer flow field. We then show that circular motion is induced by a higher-order singularity, namely, a rotlet dipole, and that its rotation direction (CW vs. CCW) is strongly affected by the boundary conditions at the interface and the bacteria shape. Our results suggest thus that the hydrodynamics of complex interfaces provide a mechanism to selectively stir bacteria.

Lopez, Diego; Lauga, Eric

2014-07-01

310

Commensal Bacteria Regulate Thymic Aire Expression  

Science.gov (United States)

Commensal bacteria in gastrointestinal tracts are reported to function as an environmental factor to regulate intestinal inflammation and immune responses. However, it remains largely unknown whether such bacterial function exerts any effect on other immune organs distant from the intestine. In this study, the influence of commensal bacteria in the thymus, where T cell lineages develop into mature type to form proper repertoires, was investigated using germ-free (GF) mice and Nod1-deficient mice lacking an intracellular recognition receptor for certain bacterial components, in which a commensal bacterial effect is predicted to be less. In both mice, there was no significant difference in the numbers and subset ratios of thymocytes. Interestingly, however, autoimmune regulator (Aire) expression in thymic epithelial cells (TECs), main components of the thymic microenvironment, was decreased in comparison to specific pathogen-free (SPF) mice and Nod1 wild-type (WT) mice, respectively. In vitro analysis using a fetal thymus organ culture (FTOC) system showed that Aire expression in TECs was increased in the presence of a bacterial component or a bacterial product. These results suggest that through their products, commensal bacteria have the potential to have some effect on epithelial cells of the thymus in tissues distant from the intestine where they are originally harbored. PMID:25157574

Nakajima, Akihito; Negishi, Naoko; Tsurui, Hiromichi; Kadowaki-Ohtsuji, Naomi; Maeda, Keiko; Nanno, Masanobu; Yamaguchi, Yoshitaka; Shimizu, Nobuyoshi; Yagita, Hideo; Okumura, Ko; Habu, Sonoko

2014-01-01

311

Distribution of coliform bacteria in waste water  

Directory of Open Access Journals (Sweden)

Full Text Available Biological activity of water can be apparently judged by the colonization of bacteria (microbes. In order to find out the extent of pollution and the relationship between inorganic matters and microbiota, a quantitative and qualitative analysis of bacteria in various types of sewage waters, namely sewage water by the residential colonies (group I, industrial waste water (group II, sewage treatment hub (group III, unorganized collected waste water (group IV and old residential waste collection center (group V, of Bikaner city (Rajasthan, India was carried out from February, 2010 to May, 2010. Water samples were taken from surface only owing to low depth and investigated for various abiotic factors (viz. transparency, pH, carbonate, bicarbonate, total alkalinity, total hardness, salinity, chloride, calcium, magnesium, sulphate, nitrate, silica, and inorganic phosphorous and biotic factors (viz. number and diversity of bacteria. The domestic sewage water causes major water borne diseases basing upon Total Bacterial Count (TBC and coliform Count (CC. The coliform count in the present study ranged from 2.5 to 5.12 MPN/mL. Comparision of microbial population in sewage water from all different Groups was done and the higher values of TBC and CC were recorded only in Sewage treatement hub (Group III.

Chandan Kumar Bahura

2012-01-01

312

Bacteria-powered battery on paper.  

Science.gov (United States)

Paper-based devices have recently emerged as simple and low-cost paradigms for fluid manipulation and analytical/clinical testing. However, there are significant challenges in developing paper-based devices at the system level, which contain integrated paper-based power sources. Here, we report a microfabricated paper-based bacteria-powered battery that is capable of generating power from microbial metabolism. The battery on paper showed a very short start-up time relative to conventional microbial fuel cells (MFCs); paper substrates eliminated the time traditional MFCs required to accumulate and acclimate bacteria on the anode. Only four batteries connected in series provided desired values of current and potential to power an LED for more than 30 minutes. The battery featured (i) a low-cost paper-based proton exchange membrane directly patterned on commercially available parchment paper and (ii) paper reservoirs for holding the anolyte and the catholyte for an extended period of time. Based on this concept, we also demonstrate the use of paper-based test platforms for the rapid characterization of electricity-generating bacteria. This paper-based microbial screening tool does not require external pumps/tubings and represents the most rapid test platform (<50 min) compared with the time needed by using traditional screening tools (up to 103 days) and even recently proposed MEMS arrays (< 2 days). PMID:25363848

Fraiwan, Arwa; Choi, Seokheun

2014-12-21

313

Bacteria-Targeting Nanoparticles for Managing Infections  

Science.gov (United States)

Bacterial infections continue to be a significant concern particularly in healthcare settings and in the developing world. Current challenges include the increasing spread of drug resistant (DR) organisms, the side effects of antibiotic therapy, the negative consequences of clearing the commensal bacterial flora, and difficulties in developing prophylactic vaccines. This thesis was an investigation of the potential of a class of polymeric nanoparticles (NP) to contribute to the management of bacterial infections. More specifically, steps were taken towards using these NPs (1) to achieve greater spatiotemporal control over drug therapy by more targeted antibiotic delivery to bacteria, and (2) to develop a prophylactic vaccine formulation against the common bacterial sexually transmitted disease (STD) caused by Chlamydia trachomatis. In the first part, we synthesized polymeric NPs containing poly(lactic-co-glycolic acid)-block-poly(L-histidine)-block-poly(ethylene glycol) (PLGA-PLH-PEG). We show that these NPs are able to bind to bacteria under model acidic infection conditions and are able to encapsulate and deliver vancomycin to inhibit the growth of Staphylococcus aureus bacteria in vitro. Further work showed that the PLGA-PLH-PEG-based NPs demonstrated the potential for competition for binding bacteria at a site of infection from soluble protein and model phagocytic and tissue-resident cells in a NP composition dependent manner. The NPs demonstrated low toxicity in vitro, were well tolerated by mice in vivo, and circulated in the blood on timescales comparable to control PLGA-PEG NPs. In the second part, we used PLGA-PLH-PEG-based NPs to design a prophylactic vaccine against the obligate intracellular bacterium Chlamydia trachomatis, the most common cause of bacterial STD in the world. Currently, no vaccines against this pathogen are approved for use in humans. We first formulated NPs encapsulating the TLR7 agonist R848 conjugated to poly(lactic acid) (R848-PLA) in PLGA-PLH-PEG-based NPs, then incubated these R848-NPs with UV-inactivated C. trachomatis bacteria in acidity, forming a construct. Mice immunized with this vaccine via genital or intranasal routes demonstrated protection from genital infection post immunization in a primarily CD4+ T cell-dependent manner. These results may suggest avenues for future work in designing and developing more targeted drug therapies or vaccine formulations for managing bacterial infections using polymeric nanoparticles. (Copies available exclusively from MIT Libraries, libraries.mit.edu/docs - docs mit.edu)

Radovic-Moreno, Aleksandar Filip

314

Bacteria-Mineral Interactions on the Surfaces of Metal-Resistant Bacteria  

International Nuclear Information System (INIS)

The extraordinary ability of indigenous microorganisms, like metal-resistant bacteria, for biotransformation of toxic compounds is of considerable interest for the emerging area of environmental bioremediation. However, the underlying mechanisms by which metal-resistant bacteria transform toxic compounds are currently unknown and await elucidation. The project's objective was to study stress-induced responses of metal-resistant bacteria to environmental changes and chemical stimulants. This project involved a multi-institutional collaboration of our LLNL group with the group of Dr. H.-Y. Holman (Lawrence Berkeley National Laboratory). In this project, we have utilized metal-resistant bacteria Arthrobacter oxydans as a model bacterial system. We have utilized atomic force microscopy (AFM) to visualize for the first time at the nanometer scale formation of stress-induced structures on bacterial surfaces in response to Cr (VI) exposure. We have demonstrated that structure, assembly, and composition of these stress-induced structures are dependent on Cr (VI) concentrations. Our AFM observations of the appearance and development of stress-induced layers on the surfaces of Arthrobacter oxydans bacteria exposed to Cr (VI) were confirmed by Dr. Holman's biochemical, electron microscopy, and synchrotron infrared spectromicroscopy studies. In general, in vitro imaging of live microbial and cellular systems represents one of the most challenging issues in application of AFM. Varllenging issues in application of AFM. Various approaches for immobilization of bacteria on the substrate for in vitro imaging were tested in this project. Imaging of live bacteria was achieved, however further optimization of experimental methods are needed for high-resolution visualization of the cellular environmental structural dynamics by AFM. This project enhanced the current insight into molecular architecture, structural and environmental variability of bacterial systems. The project partially funded research for two book chapters (1,2), and we anticipate one more publication (3). The publications describe development of methods and results of studies of structural dynamics of metal-resistant bacteria that contribute to more comprehensive understanding of the architecture, function, and environmental dynamics of bacterial and cellular systems. The results of this LDRD were presented in invited talks and contributed presentations at five national and international conferences and five seminar presentations at the external institutions. These included invited talks at the conferences of Gordon Research, Materials Research and American Chemical Societies. Our scientific results and methodologies developed in this project enabled us to receive new funding for the multiyear project 'Chromium transformation pathways in metal-reducing bacteria' funded by the University of California Lab Fees Program ($500,000, 5/1/09 - 4/30/2012), with our proposal being ranked 1st from a total of 138 in the Earth, Energy, Environmental and Space Sciences panel.

315

Assessment of the Levels of Airborne Bacteria, Gram-Negative Bacteria, and Fungi in Hospital Lobbies  

Directory of Open Access Journals (Sweden)

Full Text Available Aims: We assessed the levels of airborne bacteria, Gram-negative bacteria (GNB, and fungi in six hospital lobbies, and investigated the environmental and hospital characteristics that affected the airborne microorganism levels. Methods: An Andersen single-stage sampler equipped with appropriate nutrition plate agar was used to collect the samples. The three types of microorganisms were repeatedly collected at a fixed location in each hospital (assumed to be representative of the entire hospital lobby from 08:00 through 24:00, with a sampling time of less than 5 min. Temperature and relative humidity were simultaneously monitored. Results: Multiple regression analysis was used to identify the major factors affecting microorganism levels. The average levels of bacteria (7.2 × 102 CFU/m3, GNB (1.7 × 10 CFU/m3, and fungi (7.7 × 10 CFU/m3 indicated that all hospital lobbies were generally contaminated. Season was the only factor that significantly affected the levels of all microorganisms (p < 0.0001, where contamination was the highest during the summer, significantly higher than during the winter. Other significant factors varied by microorganism, as follows: airborne bacteria (number of people in the lobby, sampling time, GNB (scale of hospital, and fungi (humidity and air temperature. Conclusions: Hospital lobby air was generally contaminated with microorganisms, including bacteria, GNB, and fungi. Environmental factors that may significantly influence the airborne concentrations of these agents should be managed to minimize airborne levels.

Dong-Uk Park

2013-01-01

316

Deposition of bacteria from sessile drops  

Science.gov (United States)

This dissertation reports on the discovery of a new method of patterning bacteria (Pseudomonas aeruginosa PAO1) on a surface using a drying sessile drop. This work identifies bacterial suspension age and the length of time mica is exposed to the laboratory atmosphere as the key parameters which impact the behavior of the sessile drop and the resulting residue. Possible origins of mica aging and bacterial suspension aging are discussed in light of the literature and the experimental conditions. The residue area and the fraction of the residue area on which substantial bacteria and salt deposits remained after the drying of the drop (fill-in fraction) were measured via analysis of optical micrographs. In general, smaller residues are more filled in. For fresh bacterial suspensions, and short mica exposure times, the residue covers the largest area and is characterized by rings formed during discrete depinning events as the solvent evaporates. As the exposure time increases and the mica surface slowly picks up contaminants from the atmosphere, the drop residue shrinks in size and bacteria are deposited in a regular cellular film in the interior of the drop residue. The fraction of the interior area covered by the cellular film is well correlated with the mica exposure time. For sufficiently aged bacterial suspensions, residues are small and more filled-in than residues formed from fresh suspensions on similarly aged mica. In addition, the interior deposition pattern transitions from a cellular film characteristic of fresh suspensions to a cracked carpet pattern for aged suspensions. Suspension aging related changes in the residues are attributed to accumulation of organic materials such as DNA, RNA, proteins, and other bacterial components in the suspension. The suspension aging process is also observed to be at least partially dependent on ventilation of the suspension during aging.

Baughman, Kyle Fisher

317

Freeing Water from Viruses and Bacteria  

Science.gov (United States)

Four years ago, Argonide Corporation, a company focused on the research, production, and marketing of specialty nano materials, was seeking to develop applications for its NanoCeram[R] fibers. Only 2 nanometers in diameter, these nano aluminum oxide fibers possessed unusual bio-adhesive properties. When formulated into a filter material, the electropositive fibers attracted and retained electro-negative particles such as bacteria and viruses in water-based solutions. This technology caught the interest of NASA as a possible solution for improved water filtration in space cabins. NASA's Johnson Space Center awarded Sanford, Florida-based Argonide a Phase I Small Business Innovation Research (SBIR) contract to determine the feasibility of using the company's filter for purifying recycled space cabin water. Since viruses and bacteria can be carried aboard space cabins by space crews, the ability to detect and remove these harmful substances is a concern for NASA. The Space Agency also desired an improved filter to polish the effluent from condensed and waste water, producing potable drinking water. During its Phase I partnership with NASA, Argonide developed a laboratory-size filter capable of removing greater than 99.9999 percent of bacteria and viruses from water at flow rates more than 200 times faster than virus-rated membranes that remove particles by sieving. Since the new filter s pore size is rather large compared to other membranes, it is also less susceptible to clogging by small particles. In September 2002, Argonide began a Phase II SBIR project with Johnson to develop a full-size cartridge capable of serving a full space crew. This effort, which is still ongoing, enabled the company to demonstrate that its filter media is an efficient absorbent for DNA and RNA.

2004-01-01

318

Clay-Bacteria Systems and Biofilm Production  

Science.gov (United States)

Soil clots and the aerosol transport of bacteria and spores are promoted by the formation of biofilms (bacteria cells in an extracellular polymeric matrix). Biofilms protect microorganisms by promoting adhesion to both organic and inorganic surfaces. Time series experiments on bacteria-clay suspensions demonstrate that biofilm growth is catalyzed by the presence of hectorite in minimal growth media for the studied species: Gram negatives (Pseudomonas syringae and Escherichia coli,) and Gram positives (Staphylococcus aureus and Bacillus subtilis). Soil organisms (P. syringae, B. subtilis) and organisms found in the human population (E. coli, S. aureus) are both used to demonstrate the general applicability of clay involvement. Fluorescent images of the biofilms are acquired by staining with propidium iodide, a component of the BacLightTM Live/Dead bacterial viability staining kit (Molecular Probes, Eugene, OR). The evolving polysaccharide-rich biofilm reacts with the clay interlayer site causing a complex substitution of the two-water hectorite interlayer with polysaccharide. The result is often a three-peak composite of the (001) x-ray diffraction maxima resulting from polysaccharide-expanded clays and an organic-driven contraction of a subset of the clays in the reaction medium. X-ray diffractograms reveal that the expanded set creates a broad maximum with clay subsets at 1.84 nm and 1.41 nm interlayer spacings as approximated by a least squares double Lorentzian fit, and a smaller shoulder at larger 2q, deriving from a contraction of the interlayer spacing. Washing with chlorox removes organic material from the contracted clay and creates a 1-water hectorite single peak in place of the double peak. The clay response can be used as an indirect indicator of biofilm in an environmental system.

Steiner, J.; Alimova, A.; Katz, A.; Steiner, N.; Rudolph, E.; Gottlieb, P.

2007-12-01

319

Intestinal barriers to bacteria and their toxins  

Energy Technology Data Exchange (ETDEWEB)

Immunologic and nonimmunologic processes work together to protect the host from the multitude of microorganisms residing within the intestinal lumen. Mechanical integrity of the intestinal epithelium, mucus in combination with secretory antibody, antimicrobial metabolites of indigenous microorganisms, and peristalsis each limit proliferation and systemic dissemination of enteric pathogens. Uptake of microorganisms by Peyer's patches and other intestinal lymphoid structures and translocation circumvent the mucosal barrier, especially in immunosuppressed individuals. Improved understanding of the composition and limitation of the intestinal barrier, coupled with advances in genetic engineering of immunogenic bacteria, development of oral delivery systems, and immunomodulators, now make enhancement of mucosal barriers feasible. 32 references.

Walker, R.I.; Owen, R.L. (Naval Medical Research Institute, Bethesda, MD (USA))

1990-01-01

320

Compartmentalization and organelle formation in bacteria.  

Science.gov (United States)

A number of bacterial species rely on compartmentalization to gain specific functionalities that will provide them with a selective advantage. Here, we will highlight several of these modes of bacterial compartmentalization with an eye toward describing the mechanisms of their formation and their evolutionary origins. Spore formation in Bacillus subtilis, outer membrane biogenesis in Gram-negative bacteria and protein diffusion barriers of Caulobacter crescentus will be used to demonstrate the physical, chemical, and compositional remodeling events that lead to compartmentalization. In addition, magnetosomes and carboxysomes will serve as models to examine the interplay between cytoskeletal systems and the subcellular positioning of organelles. PMID:24440431

Cornejo, Elias; Abreu, Nicole; Komeili, Arash

2014-02-01

 
 
 
 
321

Saudis study native bacteria for MEOR  

Energy Technology Data Exchange (ETDEWEB)

Bacteria isolated from three Saudi crude oils were tested for possible use in enhanced recovery projects in the Safaniya field. The bacterial strain that exhibited the lowest interfacial tension while creating the least permeability damage and the highest oil recovery was isolated from Khafji crude from the Marjan field. Although the use of microorganisms for EOR purposes has been studied and tested for many years, the specific mechanisms involved are not fully understood. MEOR systems must be custom designed for specific reservoir conditions, crude oils and microbial-nutrient systems. This paper reviews the various research going on with the various bacterial strains to be used in MEOR in Saudi Arabia.

Almalik, M.S.; Desouky, S.E.D.M. [King Saud Univ., Riyadh (Saudi Arabia)

1996-06-01

322

Genetics in methylotrophic bacteria: Appendix. Final report  

Energy Technology Data Exchange (ETDEWEB)

This research has focused primarily on promoters in Methylobacterium extorquens AM1 and in methanotrophic bacteria. In Methylobacterium extorquens work continued on the moxF promoter. The author constructed chromosomal lacZ fusions of this promoter to avoid the regulation problems of plasmid-borne fragments and has shown that this is regulated normally in the chromosome. She has constructed lacZ fusions to some of the mox genes involved in the synthesis of the cofactor, PQQ, in order to carry out similar analysis of transcription of PQQ genes. The author has continued to isolate mox genes in methanotrophs for the purpose of studying their promoters and transcriptional regulation.

Lidstrom, M.E.

1998-09-01

323

Are Bacteria more dangerous in space?  

International Nuclear Information System (INIS)

With a mission to Mars and a permanent base on the moon as the ultimate dream, space travel is continually pushing back the frontiers. But long space missions present great challenges for science, for example in the field of microbiology. Together with the European Space Agency (ESA), SCK-CEN is studying the effects of space travel conditions on the behaviour of bacteria. In 2009 the SCK-CEN experts completed four innovative research projects at the cutting edge of microbiology, radiation sciences and space travel.

324

Persistent and susceptible bacteria with individual deaths.  

Science.gov (United States)

The aim of this paper is to study two models for a bacterial population subject to antibiotic treatments. It is known that some bacteria are not sensitive to antibiotics. These bacteria, called persisters, are in a state called persistence and each bacterium can switch from this state to a non-persistent (or susceptible) state and back (with rates b and a respectively). Our models extend those introduced in Garet et al. (2012) by adding a random natural life cycle for each bacterium and by allowing bacteria in the susceptible state to escape the action of the antibiotic with a fixed probability 1-p (while every bacterium in a persistent state survives with probability 1). This last mechanism of survival to the antibiotics differs from the persistent state one (where reproduction is forbidden) since in this case the bacterium can replicate. We study two different models. In the first model we "inject" the antibiotics in the system at fixed, deterministic times while in the second one the time intervals are random. We show that, in order to kill eventually the whole bacterial population, these time intervals cannot be "too large". The maximum admissible length is increasing with respect to p; we see that even when p is close to 1, this interval length can be significantly smaller than in the case p=1. While in the case p=1 switching back and forth to the persistent state is the only chance of surviving for bacteria, when ppersistent state, say dr, is positive then the situation is more complex. In this case our model suggests that if dr and b are positive (and fixed) then for higher values of p there is an interval for the rate a, say (0,ap) where switching to the persistent state is a good strategy while for a>ap the situation is less favorable than a=0. On the other hand, for smaller values of p the best strategy is a=0, that is, not switching. Finally, when dr=0, switching to the susceptible state is always a better strategy, from the bacterial point of view, than staying in the susceptible state all the times. PMID:24270094

Zucca, Fabio

2014-02-21

325

Characterization of cultivable bacteria from brazilian sponges.  

Science.gov (United States)

Among 1,236 colony-forming units (CFU) associated with 11 species of marine sponges collected from a Brazilian coast, a total of 100 morphologically different bacterial strains were analyzed. The phylogenetic diversity of the bacterial isolates was assessed by 16S rRNA gene amplification-restriction fragment length polymorphism (RFLP) analysis, using AluI restriction endonuclease. The RFLP fingerprinting resulted in 21 different patterns with good resolution for the identification of the bacterial isolates at the genus level. The genus Bacillus was the most commonly encountered genus, followed by Kocuria. Regarding the relationship between the morphotypes and species of marine sponges, Mycale microsigmatosa presented major diversity, followed by Dragmacidon reticulatum and Polymastia janeirensis. An antibiotic susceptibility profile of the 100 sponge-associated bacterial strains was determined by the disk diffusion method, and we observed a variable resistance profile, with 15 % of the bacteria being multiresistant. In addition, 71 of 100 strains were able to produce biofilm. These 71 strains were divided into 20 strong biofilm producers, 10 moderate biofilm producers, and 41 weak biofilm producers. The plasmid profile of the 100 bacterial strains was analyzed and 38 (38 %) of these samples possessed one or more plasmids. Studies like this are important to increase the information on these associated bacteria found off the coastline of Brazil, a place which has rich biodiversity that is still unknown. PMID:23925647

Santos-Gandelman, Juliana F; Santos, Olinda C S; Pontes, Paula V M; Andrade, Cleyton Lage; Korenblum, Elisa; Muricy, Guilherme; Giambiagi-Demarval, Marcia; Laport, Marinella S

2013-12-01

326

Is thermophily a transferrable property in bacteria?  

Science.gov (United States)

Bacteria exhibit unique diversity in their ability to grow at different temperatures. Indeed, eubacteria and archaebacteria are the only organisms able to grow above 65 degrees C. The temperature range for a species is generally considered to be a stable character; however, mutants may be isolated that have a Tmin or Tmax below or above the parent organism. Some bacteria may also be coaxed to grow at different temperature by training cultures, through an incremental increase or decrease of temperature. Genetic approaches, for example, the transformation of mesophilic Bacillus to thermophily using DNA from closely related thermophiles, has been very controversial. A major problem has been the lack of stability of the high-temperature phenotype upon subculture, which has not allowed extensive genetic and biochemical characterization of the transformants. The mechanism whereby the thermophilic phenotype is carried is unknown, although it is possible that the adapter genes are plasmid encoded. Studies using phenotypically stable transformants indicated that the thermostability of some cellular components was significantly increased, both in the vegetative cell and spore state. Enzyme thermostability, for example, appeared to be associated with an increased use of hydrophobic amino acids; however, the biochemical mechanisms for these alterations remain unknown. Thermophily is still a challenging problem with some interesting molecular biology. PMID:8845061

Lindsay, J A

1995-01-01

327

Detection of phenols using engineered bacteria  

Science.gov (United States)

Detection of phenols using engineered bacteria. A biosensor can be created by placing a reporter gene under control of an inducible promoter. The reporter gene produces a signal when a cognate transcriptional activator senses the inducing chemical. Creation of bacterial biosensors is currently restricted by limited knowledge of the genetic systems of bacteria that catabolize xenobiotics. By using mutagenic PCR to change the chemical specificity of the Pseudomonas species CF600 DmpR protein, the potential for engineering novel biosensors for detection of phenols has been demonstrated. DmpR, a well-characterized transcriptional activator of the P. CF600's dmp operon mediates growth on simple phenols. Transcription from Po, the promoter heading the dmp operon, is activated when the sensor domain of DmpR interacts with phenol and mono-substituted phenols. By altering the sensor domain of the DmpR, a group of DmpR derivatives that activate transcription of a Po-lacZ fusion in response to eight of the EPA's eleven priority pollutant phenols has been created. The assays and the sensor domain mutations that alter the chemical specificity of DmpR is described.

Wise, Arlene A. (Philadelphia, PA); Kuske, Cheryl R. (Los Alamos, NM); Terwilliger, Thomas C. (Santa Fe, NM)

2007-12-04

328

Glucose Biosensor Using Selected Indonesian Bacteria  

Directory of Open Access Journals (Sweden)

Full Text Available Microbial glucose sensors have been developed using Escherichia coli bacterial strains from Japan. However, there is interest in developing local bacteria as glucose sensors in Indonesia. In this research, the stability and the potential of a selected number of Indonesian bacteria as glucose biosensors was explored. Results of this study indicate that three of them, E. coli, Bacillus subtilis, and Thermus filiformis exhibit properties of high viability and stability at high temperature (30-60 ºC. Spectrophotometrical and electrochemical measurements showed significant absorbance values and highly stable current features for E. coli as indicated by its high capacity to produce glucose dehydrogenase. E. coli, B. subtilis, and T. filiformis produced currents of 3.25 µA, 0.2 µA, and 0.02 µA respectively, and E. coli also produced a much higher activity of glucose dehydrogenase. Electrochemical measurement using E. coli-modified carbon paste electrode allowed the determination of glucose concentration of up to 20 mM. Therefore, Indonesian E. coli has a high stability and can be used as a glucose biosensor

DYAH ISWANTINI

2011-03-01

329

Oxidation of carbon monoxide by bacteria  

Energy Technology Data Exchange (ETDEWEB)

Diverse bacteria that occur in the soil and surface water serve as a major sink for CO in the atmosphere by oxidizing this toxic gas to CO/sub 2/. Most anaerobes that oxidize CO apparently do so (with the exception of R. gelatinosa) in a non-utilitarian way since there is, as yet, no known physiological role for this process. However, in some cases a good deal is known about the system, and the dehydrogenases (at least one of which contains nickel) have in some cases been purified. In contrast to most anaerobes Rhodopseudomonas spp. can apparently use CO to grow either anaerobically in the light (photosynthetically), or in the dark (with hydrogen production from water and oxidation of CO to CO/sub 2/). Aerobes of a variety of Gram-negative genera can oxidize CO to CO/sub 2/ in utilitarian fashion, fixing the resultant CO/sub 2/ by the reductive pentose cycle and presumably using reverse electron transport to obtain reducing power for biosynthesis. Bacteria that oxidize methane are an exception to the utilitarian rule; they perform an apparently fruitless oxidation of CO, by means of methane monoxygenase.

Hegeman, G.

1980-01-01

330

Metabolism of polychlorinated biphenyls by marine bacteria  

International Nuclear Information System (INIS)

There have been no reports of laboratory studies of PCB metabolism by marine organisms. A few workers have analyzed marine animals for products of PCB metabolism. A search for hydroxylated PCBs in marine fish proved inconclusive. Phenolic metabolites of PCBs have been identified in seals and guillemot. PCBs that had been hydroxylated and excreted by marine organisms would most likely be found in the sediments, so in our laboratory we conducted a search for these compounds in marine sediments. Two kilograms of organic-rich surface sediment from Buzzards Bay, Massachusetts, were extracted. The phenolic fraction was isolated and analyzed by gas chromatography-mass spectrometry (GC-MS). Neither wide mass scans nor selected mass searches produced any evidence of hydroxylated PCB derivatives. It was felt that if any marine organisms were capable of metabolism of PCBs, some marine bacteria should have that capability. Thus a series of laboratory experiments was conducted to test this possibility. Reported here is the finding of PCB metabolism by marine bacteria in batch culture

331

Epidemiology of nosocomial bacteria resistant to antimicrobials  

Directory of Open Access Journals (Sweden)

Full Text Available Nosocomial infections are a major challenge for public health because of the high rates of morbidity and mortality generated. It was considered that the excessive or inappropriate use of antibiotics triggers the emergence of resistant strains. Among the clinically important bacteria that most commonly cause nososcomial infections, Gram positive multiresistant pathogens stand out such as methicillin-resistant Staphylococcus aureus (MRSA and vancomycin-resistant Enterococcus spp (VRE, and the Gram negative strains of Klebsiella pneumoniae, Escherichia coli, Pseudomonas spp. and Acinetobacter baumannii producing expanded spectrum b-lactamases (ESbL. This review describes the behavior of the main bacterial pathogens resistant to antibiotics that cause infections in Europe, United States, and Latin America, emphasizing studies of molecular epidemiology on a global scale, including the major epidemiological studies in Colombia. The genetic structure of S. aureus and Enterococcus spp strains shows a clonal characteristic favored by the predominance of a small number of clones with the capacity to spread globally, due probably to cross-infection. However, the introduction of MRSA strains from the community encourages genetic diversity, tending to establish a genetic polyclonal endemic structure in places like the United States. In Gram negative bacteria, the high genetic diversity among isolates, mainly in Latin American countries, indicates that the polyclonal spread is influenced by horizontal transfer of plasmids, by excessive exposure to antibiotics, and prolonged hospital stays. In Colombia, there is information on nosocomial resistant pathogens, but molecular epidemiological information is still scarce.

Cristina E. Cabrera

2011-03-01

332

Magnetotactic Bacteria from Pavilion Lake, British Columbia  

Directory of Open Access Journals (Sweden)

Full Text Available Pavilion Lake is a slightly alkaline, freshwater lake located in British Columbia, Canada (50o51’ N, 121o44’W. It is known for unusual organosedimentary structures, called microbialites that are found along the lake basin. These deposits are complex associations of fossilized microbial communities and detrital- or chemical-sedimentary rocks. During the summer, a sediment sample was collected from near the lake’s shore, approximately 25-50 cm below the water surface. Magnetotactic bacteria (MTB were isolated from this sample using a simple magnetic enrichment protocol. The MTB isolated from Pavilion Lake belonged to the Alphaproteobacteria class as determined by nucleotide sequences of 16S rRNA genes. Transmission electron microscopy (TEM revealed that the bacteria were spirillum-shaped and contained a single chain of cuboctahedral-shaped magnetite (Fe3O4 crystals that were approximately 40 nm in diameter. This discovery of MTB in Pavilion Lake offers an opportunity to better understand the diversity of MTB habitats, the geobiological function of MTB in unique freshwater ecosystems, and search for magnetofossils contained within the lake’s microbialites.

BrianH.Lower

2013-12-01

333

Magnetotactic bacteria from Pavilion Lake, British Columbia  

Science.gov (United States)

Pavilion Lake is a slightly alkaline, freshwater lake located in British Columbia, Canada (50°51'N, 121°44'W). It is known for unusual organosedimentary structures, called microbialites that are found along the lake basin. These deposits are complex associations of fossilized microbial communities and detrital- or chemical-sedimentary rocks. During the summer, a sediment sample was collected from near the lake's shore, approximately 25–50 cm below the water surface. Magnetotactic bacteria (MTB) were isolated from this sample using a simple magnetic enrichment protocol. The MTB isolated from Pavilion Lake belonged to the Alphaproteobacteria class as determined by nucleotide sequences of 16S rRNA genes. Transmission electron microscopy (TEM) revealed that the bacteria were spirillum-shaped and contained a single chain of cuboctahedral-shaped magnetite (Fe3O4) crystals that were approximately 40 nm in diameter. This discovery of MTB in Pavilion Lake offers an opportunity to better understand the diversity of MTB habitats, the geobiological function of MTB in unique freshwater ecosystems, and search for magnetofossils contained within the lake's microbialites. PMID:24391636

Oestreicher, Zachery; Lower, Steven K.; Rees, Eric; Bazylinski, Dennis A.; Lower, Brian H.

2013-01-01

334

Production of cutinolytic esterase by filamentous bacteria.  

Science.gov (United States)

Thirty-eight strains of filamentous bacteria, many of which are thermophilic or thermotolerant and commonly found in composts and mouldy fodders, were examined for their ability to produce cutinolytic esterase (cutinase) in culture media supplemented with cutin, suberin or cutin-containing agricultural by-products. Initially, the ability of culture supernatants to hydrolyse the artificial substrate p-nitrophenyl butyrate was determined by spectrophotometric assays. Only one bacterium, Thermoactinomyces vulgaris NRRL B-16117, exhibited cutinolytic esterase production. The enzyme was highly inducible, was repressed by the presence of glucose in the medium and hydrolysed both apple and tomato cutins. Inducers included apple cutin, apple pomace, tomato peel, potato suberin and commercial cork. Unlike similar fungal enzymes, the T. vulgaris cutinolytic esterase was not inducible by cutin hydrolysate. The cutinolytic esterase exhibited a half-life of over 60 min at 70 degrees C and a pH optimum of >/= 11.0. This study indicates that thermophylic filamentous bacteria may be excellent commercial sources of heat-stable cutin-degrading enzymes that can be produced by fermentation of low cost feedstocks. PMID:10886609

Fett, W F; Wijey, C; Moreau, R A; Osman, S F

2000-07-01

335

Starvation-survival of subsurface bacteria  

International Nuclear Information System (INIS)

The ability of four subsurface isolates to survive starvation was examined and the results were compared to survival curves obtained for Escherichia coli B and Serratia marcescens. To examine the starvation-survival phenomenon further, several experimental parameters including nutritional history, initial cell density, growth phase, temperature of growth and starvation, and aeration. Nutritional history, initial cell density, and growth phases of the cells had some effect on the ability of these bacteria to survive whereas temperature and limited aeration had no effect under the conditions tested. No conditions were found where E. coli B or Serratia marcescens died rapidly or where less than 10% of the original cell number of viable cells remained. Because the apparent survival of these bacteria may be due to cryptic growth, cross-feeding experiments with 14C-labeled cells and unlabeled cells were carried out with E. coli B and Pseudomonas Lula V. Leaked extracellular 14C-compounds were not used for growth or maintenance energy, and were not taken up by either bacterium. Cryptic growth did not occur; the cells were truly starving under the experimental conditions used

336

Co-electrospinning of bacteria and viruses  

Science.gov (United States)

Co-electrospinning provides a novel and highly versatile approach towards composite fibers with diameters ranging from a few hundred nm down to 30 nm with embedded elements. In the present work, co-electrospinning of poly(vinyl alcohol) (PVA) and viruses (T7, T4, ?) or bacteria (Escherichia coli, Staphylococcus albus) was carried out. These preparations should have applications for tissue engineering, gene therapy, phage therapy and biosensing. The average diameter of the co-spun nanofibers was about 300 nm. We found that the encapsulated viruses and bacteria manage to survive the electrospinning process, its pressure buildup in the core of the fiber and the electrostatic field in the co-electrospinning process. Approximately 10% of the Escherichia coli and 20% of Staphylococcus albus cells are viable after spinning. Approximately 5% of the bacterial viruses were also viable after the electrospinning. It should be noted that the encapsulated cells and viruses remain stable for two months without a further decrease in number. These results demonstrate the potential of the co-electrospinning process for the encapsulation and immobilization of bio-objects and the possibility of adapting them to technical applications (e.g., bio-chips).

Salalha, Wael; Kuhn, Jonathan; Chervinsky, Shmuel; Zussman, Eyal

2006-03-01

337

Magneto-aerotaxis in marine coccoid bacteria.  

Science.gov (United States)

Magnetotactic cocci swim persistently along local magnetic field lines in a preferred direction that corresponds to downward migration along geomagnetic field lines. Recently, high cell concentrations of magnetotactic cocci have been found in the water columns of chemically stratified, marine and brackish habitats, and not always in the sediments, as would be expected for persistent, downward-migrating bacteria. Here we report that cells of a pure culture of a marine magnetotactic coccus, designated strain MC-1, formed microaerophilic bands in capillary tubes and used aerotaxis to migrate to a preferred oxygen concentration in an oxygen gradient. Cells were able to swim in either direction along the local magnetic field and used magnetotaxis in conjunction with aerotaxis, i.e., magnetically assisted aerotaxis, or magneto-aerotaxis, to more efficiently migrate to and maintain position at their preferred oxygen concentration. Cells of strain MC-1 had a novel, aerotactic sensory mechanism that appeared to function as a two-way switch, rather than the temporal sensory mechanism used by other bacteria, including Magnetospirillum megnetotacticum, in aerotaxis. The cells also exhibited a response to short-wavelength light (magnetic field during illumination. Images FIGURE 1 FIGURE 2 PMID:9251816

Frankel, R B; Bazylinski, D A; Johnson, M S; Taylor, B L

1997-01-01

338

[Ferrous-manganese oxidizing bacteria from the nature water].  

Science.gov (United States)

Glass slides were hanged into a canal to acquire the ferrous-manganese oxidizing bacteria settled bio-film. Two isolated methods for ferrous-manganese oxidizing bacteria with special iron-manganese oxidizing matrix from the bio-film were tested. Element component of bacteria product and sheath structure of bacteria were analyzed. With two methods, plate cultivation and the novel semi-solid in situ cultivation method, strains belong to Family Leptothrix were isolated. XRF showed that the amorphous iron and manganese were two major metal elements of the precipitation formed by one strain of Leptothrix spp.. Through the microscope observation, one strain of Family Leptothrix was determined to form branch-like structured sheath, while another strain formed spider web-like structured sheath. Those isolated bacteria provide model strains for future testing of FISH probe and PCR primer of ferrous-manganese oxidizing bacteria. PMID:18763517

Qin, Song-yan; Ma, Fang; Huang, Peng

2008-06-01

339

Influence of irradiation of bacteria on their thermoresistance  

Energy Technology Data Exchange (ETDEWEB)

The influence of x-radiation on thermoresistance of bacteria was determined. The studies were carried out on: E. coli, Pr. vulgaris, S. typhimurium, Staph. aureus and Str. faecalis. The bacteria were irradiated in PBS (physiological buffer solution) and in broth (containing about 1% of protein) with x-rays at radium absorbed doses of 100, 1000, 5000 and 10 000, which was followed immediately by heating at temperatures causing death of part of the bacteria. The results obtained indicate that irradiation of bacteria with small x-ray doses distinctly decreases their thermoresistance. Synergetic action of irradiation and heating of bacteria was observed, increasing with increased irradiation dose. The greatest changes of thermoresistance occurred with Pr. vulgaris, the smallest with S. typhimurium. Thermoresistance of bacteria decreased more strongly on their irradiation in protein-free medium (PBS).

Szulc, M.; Stefaniakowa, A.; Tropilo, J.; Stanczak, B.; Peconek, J.; Mierzewska, H.; Bielecka, J. (Szkola Glowna Gospodarstwa Wiejskiego, Warsaw (Poland). Katedra Higieny Produktow Zwierzecych)

1979-01-01

340

The role of adhesins in bacteria motility modification  

Science.gov (United States)

Bacterial biofilms are multicellular communities responsible for a broad range of infections. To investigate the early-stage formation of biofilms, we have developed high-throughput techniques to quantify the motility of surface-associated bacteria. We translate microscopy movies of bacteria into a searchable database of trajectories using tracking algorithms adapted from colloidal physics. By analyzing the motion of both wild-type (WT) and isogenic knockout mutants, we have previously characterized fundamental motility mechanisms in P. aeruginosa. Here, we develop biometric routines to recognize signatures of adhesion and trapping. We find that newly attached bacteria move faster than previously adherent bacteria, and are more likely to be oriented out-of-plane. Motility appendages influence the bacterium's ability to become trapped: WT bacteria exhibit two types of trapped trajectories, whereas flagella-deficient bacteria rarely become trapped. These results suggest that flagella play a key role in adhesion.

Conrad, Jacinta; Gibiansky, Maxsim; Jin, Fan; Gordon, Vernita; Motto, Dominick; Shrout, Joshua; Parsek, Matthew; Wong, Gerard

2010-03-01

 
 
 
 
341

Lipase Activity among Bacteria Isolated from Amazonian Soils  

Digital Repository Infrastructure Vision for European Research (DRIVER)

The objective of this study was to select lipase-producing bacteria collected from different counties of the Amazon region. Of the 440 bacteria strains, 181 were selected for the lipase assay in qualitative tests at Petri dishes, being 75 (41%) lipase positive. The enzymatic index was determined during fifteen days at different temperatures (30°, 35°, 40°, and 45°C). The highest lipase activity was observed within 72 hours at 30°C. Twelve bacteria strains presented an index equal to or g...

Willerding, Andre? Luis; Oliveira, Luiz Antonio; Moreira, Francisco Wesen; Germano, Mariana Gomes; Chagas, Aloi?sio Freitas

2011-01-01

342

Molecular Detection of Endophytic Bacteria on Plantlet Tissue of Sugarcane  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Endophytic bacteria live in plant host tissues without causing any symptoms. The aim of this study was to examine the indigenous endophytic bacteria on sugarcane plantlets produced from the young leaf cells by using tissue culture techniques. To detect the existence of endophytic bacteria in the plantlet tissue, a series of molecular method based on PCR were applied by using ribosomal intergenic spacer (RIS) primer followed by 16S rDNA partial sequence and single strand conformation polymorph...

WIWIK EKO WIDAYATI; JOKO WIDADA; JOEDORO SOEDARSONO

2007-01-01

343

Susceptibility and resistance of ruminal bacteria to antimicrobial feed additives.  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Susceptibility and resistance of ruminal bacterial species to avoparcin, narasin, salinomycin, thiopeptin, tylosin, virginiamycin, and two new ionophore antibiotics, RO22-6924/004 and RO21-6447/009, were determined. Generally, antimicrobial compounds were inhibitory to gram-positive bacteria and those bacteria that have gram-positive-like cell wall structure. MICs ranged from 0.09 to 24.0 micrograms/ml. Gram-negative bacteria were resistant at the highest concentration tested (48.0 micrograms...

Nagaraja, T. G.; Taylor, M. B.

1987-01-01

344

Culturable airborne bacteria in outdoor poultry-slaughtering facility.  

Science.gov (United States)

Airborne bacteria are important biological components of the aerosols and have a close relationship with human health as they can have adverse effects through infection and toxicity; higher concentrations can result in various microbial diseases. Moreover, they have a great influence on air quality in Beijing. In this study, a systematic survey on culturable airborne bacteria was carried out for 1 year at a slaughtering plant in Beijing. Bacterial samples were collected with FA-1 sampler for 3 min, three times each day, for three consecutive days of each month from three sampling sites using BIOLOG identification technology. Results showed that Gram-positive bacteria contributed 80%-85% and were much more prevalent than Gram-negative bacteria. Amongst 47 genera of bacteria, including 31 Gram-positive bacteria and 16 Gram-negative bacteria, Micrococcus, Staphylococcus, Bacillus, Corynebacterium, and Pseudomonas were dominant, and Micrococcus, which contributed 20%-30%, was the most dominant genus. The concentration of airborne bacteria was significantly higher in shed used to stay chicken waiting for slaughtering (SSC) and entrances to personnel and transport vehicles with products (EPV) than in green belt (GB). During the year, bacterial concentrations in summer and autumn were much higher than in winter and spring in SSC and EPV, and there were no significant variations in bacterial concentrations in GB. In different periods, a lower concentration of airborne bacteria was found at 13:00. PMID:23474646

Liang, Ruiping; Xiao, Peng; She, Ruiping; Han, Shiguo; Chang, Lingling; Zheng, Lingxiao

2013-01-01

345

Bacteria-host relationships in the bivalve mollusc Loripes lucinalis.  

Science.gov (United States)

Loripes lucinalis, a lucinid species found in reduced sediments, contains endosymbiotic bacteria within specialized gill cells which contribute to the bivalve's nutrition. An additional bivalve-bacteria association can be seen in the digestive gland where large inclusion bodies filled with rickettsia- or chlamydia-like organisms are observed in the duct and tubule cells. Despite indications of a possible energy parasitism on the part of these endocellular digestive gland bacteria, the digestive epithelium of the host is not significantly damaged by the infection suggesting that this is a generalized and normal bivalve-bacteria association in adults of this species. PMID:7697323

Herry, A; Le Pennec, M; Johnson, M

1994-01-01

346

Antagonistic Effect of Epiphytic Bacteria from Marine Algae, Southeastern India  

Directory of Open Access Journals (Sweden)

Full Text Available Aim of this study was to evaluate the antagonistic potential of epibiotic bacteria from seaweeds, Ulva lactuca, Dictyota dichotoma and Padina tetrastromatica against some potent human pathogens. The epibiotic bacteria of Ulva lactuca shows higher level of inhibition properties than the other species. The strain UL1 shows broad spectrum inhibitory activity against 7 pathogens. The inhibitory level of epibiotic bacteria ranged from low to moderate activity. The present investigation suggests that the epibiotic bacteria are good source for the isolation of antibacterial compounds of biomedical importance. The compounds can further be purified and can used to save mankind from dreadful diseases.

A. Alex John

2013-01-01

347

Malaysian Isolates of Lactic Acid Bacteria with Antibacterial Activity against Gram-Positive and Gram-Negative Pathogenic Bacteria  

Directory of Open Access Journals (Sweden)

Full Text Available Contamination of foodstuff with foodborne and pathogenic bacteria are global issue and it is serious hazard for the health of the human. Lactic acid bacteria are well known for their health properties and their antimicrobial activity against spoilage and pathogenic bacteria. In this study, three isolates Lactobacillus fermentum Te007, Pediococcus pentosaceus Te010, L. pentosus G004 isolated from Malaysian fermented foods and fruits such as (tempeh, tempoyak, guava and banana were evaluated for their antibacterial activity and antibiotic resistant against Gram-positive and Gram-negative bacteria by dual agar overlay method. The three isolates inhibited the growth of indicator bacteria and the activity was varied between weak and strong. All the isolates were resistant to the antibiotic nalidixic acid and vancomycin. The tested bacteria can be added to food as antibacterial agents to prevent the growth of harmful microorganisms.

belal J muhialdin

2012-01-01

348

Origin and fate of repeats in bacteria  

Science.gov (United States)

We investigated 53 complete bacterial chromosomes for intrachromosomal repeats. In previous studies on eukaryote chromosomes, we proposed a model for the dynamics of repeats based on the continuous genesis of tandem repeats, followed by an active process of high deletion rate, counteracted by rearrangement events that may prevent the repeats from being deleted. The present study of long repeats in the genomes of Bacteria and Archaea suggests that our model of interspersed repeats dynamics may apply to them. Thus the duplication process might be a consequence of very ancient mechanisms shared by all three domains. Moreover, we show that there is a strong negative correlation between nucleotide composition bias and the repeat density of genomes. We hypothesise that in highly biased genomes, non-duplicated small repeats arise more frequently by random effects and are used as primers for duplication mechanisms, leading to a higher density of large repeats. PMID:12087185

Achaz, G.; Rocha, E. P. C.; Netter, P.; Coissac, E.

2002-01-01

349

Molecular adaptations in Antarctic fish and bacteria  

Science.gov (United States)

Marine organisms, living in the cold waters of the Southern Ocean, are exposed to high oxygen concentrations. Cold-adapted organisms have developed networks of defence mechanisms to protect themselves against oxidative stress. The dominant suborder Notothenioidei of the Southern Ocean is one of the most interesting models, within vertebrates, to study the evolutionary biological responses to extreme environment. Within bacteria, the psychrophilic Antarctic bacterium Pseudoalteromonas haloplanktis TAC125 gives the opportunity to explore the cellular strategies adopted in vivo by cold-adapted microorganisms to cope with cold and high oxygen concentration. Understanding the molecular mechanisms underlying how a range of Antarctic organisms have responded to climate change in the past will enable predictions as to how they and other species will adapt to global climate change, in terms of physiological function, distribution patterns and ecosystem balance.

Russo, Roberta; Riccio, Alessia; di Prisco, Guido; Verde, Cinzia; Giordano, Daniela

2010-08-01

350

Degradation of multiwall carbon nanotubes by bacteria  

International Nuclear Information System (INIS)

Understanding the environmental transformation of multiwall carbon nanotubes (MWCNTs) is important to their life cycle assessment and potential environmental impacts. We report that a bacterial community is capable of degrading 14C-labeled MWCNTs into 14CO2 in the presence of an external carbon source via co-metabolism. Multiple intermediate products were detected, and genotypic characterization revealed three possible microbial degraders: Burkholderia kururiensis, Delftia acidovorans, and Stenotrophomonas maltophilia. This result suggests that microbe/MWCNTs interaction may impact the long-term fate of MWCNTs. Highlights: •Mineralization of MWCNTs by a bacterial community was observed. •The mineralization required an external carbon source. •Multiple intermediate products were identified in the MWCNT degrading culture. •Three bacterial species were found likely responsible for MWCNT degradation. -- The 14C-labeled multiwall carbon nanotubes can be degraded to 14CO2 and other byproducts by a bacteria community under natural conditions

351

Bacteria and bioremediation of marine oil spills  

International Nuclear Information System (INIS)

Virtually all marine ecosystems harbor indigenous hydrocarbon-degrading bacteria. These hydrocarbon degraders comprise less than one percent of the bacterial community in unpolluted environments, but generally increase to one to ten percent following petroleum contamination. Various hydrocarbons are degraded by these microorganisms at different rates, so there is an evolution in the residual hydrocarbon mixture, and some hydrocarbons and asphaltic petroleum hydrocarbons remain undegraded. Fortunately, these persistent petroleum pollutants are, for the most part, insoluble or are bound to solids; hence they are not biologically available and therefore not toxic to marine organisms. Carbon dioxide, water, and cellular biomass produced by the microorganisms from the degradable hydrocarbons may be consumed by detrital feeders and comprise the end products of the natural biological degradation process. Bioremediation attempts to accelerate the natural hydrocarbon degradation rates by overcoming factors that limit bacterial hydrocarbon degrading activities

352

Uptake of plutonium by immobilized bacteria  

International Nuclear Information System (INIS)

The use of plastic-immobilized bacteria as a system for the concentration of plutonium from aqueous media is investigated. Previous research is reviewed quantifying free cell bacterial concentration of plutonium from solution or suspension. Our research indicates that the species Pseudomonas aeruginosa can be induced to attach firmly to a polymer substrate, while retaining its ability to concentrate plutonium. Melt-blown, filamentous polypropylene is shown to foster cell embedment and uptake capabilities surpassing various other substrates. Oxygen plasma treatment, used to enhance polypropylene wettability, is found to increase the rate of cell embedment significantly. Both embedment and uptake phenomena are found to be dependent upon cell viability. Potential applications for the cell/polymer system are discussed

353

Propolis antimicrobial activity against periodontopathic bacteria  

Directory of Open Access Journals (Sweden)

Full Text Available Propolis extract antimicrobial activity against periodontopathic (ATCC bacteria was investigated "in vitro". Bacterial strains tested were: Prevotella intermedia, Prevotella melaninogenica, Porphyromonas gingivalis, Actinobacillus actinomycetemcomitans, Capnocytophaga gingivalis and Fusobacterium nucleatum. Minimal inhibitory concentration (MIC for the strains tested was determined using the method of broth dilution with the propolis extract in serial concentrations. Results showed MIC of 1 µg/ml for Actinobacillus actinomycetemcomitans and Capnocytophaga gingivalis; and 0.25 µg/ml for Prevotella intermedia, Prevotella melaninogenica, Porphyromonas gingivalis and Fusobacterium nucleatum. Some superinfectant organisms were also tested: Candida albicans susceptibility to propolis ethanolic extract was demonstrated at a concentration of 12 µg/ml. The MIC for Pseudomonas aeruginosa, Escherichia coli and Staphylococcus aureus (wild types was 14 µg/ml. All periodontal pathogens and superinfectants tested were susceptible to the propolis extract. The positive results suggest that the propolis extract should be further tested as an adjuvant to periodontal therapy.

Gebara Elaine C.E.

2002-01-01

354

[Travellers and multi-drug resistance bacteria].  

Science.gov (United States)

The number of international travellers has increased. There is enormous diversity in medical backgrounds, purposes of travel, and travelling styles among travellers. Travellers are hospitalized abroad because of exotic and common diseases via medical tourism. This is one way of transporting and importing human bacteria between countries, including multi-drug resistant organisms. In developing countries, the antimicrobial resistance in Shigella sp. and Salmonella sp. have been a problem, because of this trend, the first choice of antibiotics has changed in some countries. Community acquired infections as well as hospital acquired infections with MRSA, multi-drug resistance (MDR) Pseudomonas aeruginosa, and ESBL have been a problem. This review will discuss the risk of MDR bacterial infectious diseases for travellers. PMID:22413540

Takeshita, Nozomi

2012-02-01

355

Isolation of acetic acid bacteria from honey  

Directory of Open Access Journals (Sweden)

Full Text Available Four thermotolerant acetic acid bacteria designated as CMU1, CMU2, CMU3 and CMU4 were isolated from six honey samples produced by three native bee species in northern Thailand, namely the dwarf honey bee (Apis florea, Asian honey bee (A. cerena and giant honey bee (A. dorsata. All isolates were tested for their tolerance to acetic acid and ethanol at 30?C and 37?C. It was found that they grew only in a medium containing 1% (v/v acetic acid at 30?C. However, isolate CMU4 showed the highest toleration to ethanol, viz. 10% (v/v and 9% (v/v at 30?C and 37?C respectively. Morphological and biochemical examination indicated that all isolates were members of the genus Gluconobacter.

Wasu Pathom-aree

2009-02-01

356

Energy conversion in Purple Bacteria Photosynthesis  

CERN Document Server

The study of how photosynthetic organisms convert light offers insight not only into nature's evolutionary process, but may also give clues as to how best to design and manipulate artificial photosynthetic systems -- and also how far we can drive natural photosynthetic systems beyond normal operating conditions, so that they can harvest energy for us under otherwise extreme conditions. In addition to its interest from a basic scientific perspective, therefore, the goal to develop a deep quantitative understanding of photosynthesis offers the potential payoff of enhancing our current arsenal of alternative energy sources for the future. In the following Chapter, we consider the trade-off between dynamics, structure and function of light harvesting membranes in Rps. Photometricum purple bacteria, as a model to highlight the priorities that arise when photosynthetic organisms adapt to deal with the ever-changing natural environment conditions.

Caycedo-Soler, Felipe; Quiroga, Luis; Zhao, Guannan; Johnson, Neil F

2011-01-01

357

Bioactive proteins against pathogenic and spoilage bacteria  

Directory of Open Access Journals (Sweden)

Full Text Available Background: It is likely that both human nutrition and the nutrition of livestock are benefited by the presence of bioactive proteins within their respective diet regimes. Bioactive proteins have been defined as specific protein fragments that positively impact bodily functions or conditions and may, ultimately, influence overall human health. The ingestion of bioactive proteins may have an effect on the major body systems—namely, the cardiovascular, digestive, immune and nervous systems. According to their functional properties, bioactive proteins may be classified as antimicrobial, antithrombotic, antihypertensive, opioid, immune-modulatory, mineral binding and anti-oxidative. There are many examples of biologically active food proteins and active peptides that can be obtained from various food protein sources. They have a physiological significance beyond the pure nutritional requirements; in other wordsthey have the acquisition of nitrogen for normal growth and maintenance. Objective: This study aims to specify and characterize the extent and mode of action of bioactive proteins in their native form, (glycinin, glycinin basic sub-unit and ?-conglycinin against specific main pathogens (Listeria monocytogenes, Escherichia coli O157:H7 and Salmonella enterica serovar Enteritidis. We will be using standard media while identifying the main constituents responsible for this action. Methods: Glycinin, basic sub-unit and ?-conglycinin were isolated from soybean protein and tested for their antimicrobial action against pathogenic and spoilage bacteria, They were thencompared to the properties of penicillin. Methylated soybean protein and also methylated chickpea protein (MSP and MCP, with isoelectric points around pI 8, were prepared by esterifying. 83 % of their free carboxyl groups and their interactions with Gram positive and Gram negative bacteria were examined. Results: The three divisions of cationic proteins exhibited antibacterial activities equivalent to or higher than the activity of penicillin, with the basic sub-unit exhibiting the highest activity, followed by glycinin.; ?-conglycinin exhibited the lowest level of activity with a MIC of 50, 100 and 1000 ?g/mL, respectively. The IC50% values of the basic subunit, glycinin and ?-conglycinin, against Listeria monocytogenes, were 15, 16 and 695 ?g/mL; against Bacillus subtilis the values were 17, 20, and 612 ?g/mL; and against Salmonella Enteritidis the values were 18, 21 and 526 ?g/mL, respectively. Transmission electron microscopy images of L. monocytogenes and S. Enteritidis exhibited an increase in cell size and a separation of the cell wall from the cell membrane when treated with glycinin or basic sub-unit. The scanning electron microscopy of B. subtilis indicated signs of an irregular, wrinkled outer surface as well as the fragmentation, adhesion, and aggregation of damaged cells or cellular debris when treated with glycinin or the basic subunits; however not with penicillin. The proliferation of L. monocytogenes, S. Enteritidis and Escherichia coli O157:H7-when artificially inoculated in raw milk ,stored at 4 or 25 °C was significantly (P<0·05 reduced by the glycinin sub-unit and nisin (0·5% w/v; but they were only slightly reduced by ?-conglycinin and moderately reduced by lysozyme. The two substances (MSP and MCP exhibited a concentration-dependent inhibitory action against two of the studied bacteria with a minimum inhibitory concentration of approximately 100 µg/mL. The supplementation of raw milk with esterified legume proteins (MSP and MCP has significantly (p < 0.05 reduced the levels of TBC, PBC and PSC in raw milk stored at a temperature of 4 °C. This potentially will delaythe onset of spoilage of by four days. Conclusion: Both glycinin and the basic sub-unit have a more swift antimicrobial action than that of penicillin. Basic sub-units exhibited the highest efficiency at killing bacterial cells, followed by glycinin, penicillin and ?-conglycinin-with the lowest effect; while the bacteria most susceptible to the

Mahmoud Z. Sitohy

2014-10-01

358

Bacteriocins active against plant pathogenic bacteria.  

Science.gov (United States)

Gram-negative phytopathogens cause significant losses in a diverse range of economically important crop plants. The effectiveness of traditional countermeasures, such as the breeding and introduction of resistant cultivars, is often limited by the dearth of available sources of genetic resistance. An alternative strategy to reduce loss to specific bacterial phytopathogens is to use narrow-spectrum protein antibiotics such as colicin-like bacteriocins as biocontrol agents. A number of colicin-like bacteriocins active against phytopathogenic bacteria have been described previously as have strategies for their application to biocontrol. In the present paper, we discuss these strategies and our own recent work on the identification and characterization of candidate bacteriocins and how these potent and selective antimicrobial agents can be effectively applied to the control of economically important plant disease. PMID:23176505

Grinter, Rhys; Milner, Joel; Walker, Daniel

2012-12-01

359

Dynamics of swimming bacteria at complex interfaces  

CERN Document Server

Flagellated bacteria exploiting helical propulsion are known to swim along circular trajectories near surfaces. Fluid dynamics predicts this circular motion to be clockwise (CW) above a rigid surface (when viewed from inside the fluid) and counter-clockwise (CCW) below a free surface. Recent experimental investigations showed that complex physicochemical processes at the nearby surface could lead to a change in the direction of rotation, both at solid surfaces absorbing slip-inducing polymers and interfaces covered with surfactants. Motivated by these results, we use a far-field hydrodynamic model to predict the kinematics of swimming near three types of interfaces: clean fluid-fluid interface, slipping rigid wall, and a fluid interface covered by incompressible surfactants. Representing the helical swimmer by a superposition of hydrodynamic singularities, we first show that in all cases the surfaces reorient the swimmer parallel to the surface and attract it, both of which are a consequence of the Stokes dip...

Lopez, Diego

2014-01-01

360

Metabolism of hibifolin by human intestinal bacteria.  

Science.gov (United States)

Hibifolin, the highest-content bioactive flavonoid of the flowers of Abelmoschus manihot, was incubated with human intestinal bacteria, and four metabolites (1-4) were obtained from the incubated solution by chromatographic methods. The structures of the four metabolites were elucidated as gossypetin 8-O-beta-D-4''-deoxy- Delta(4'')-glucuropyranoside (1), gossypetin (2), quercetin (3), and 8-methoxy-quercetin (4), respectively, on the basis of UV, NMR, and MS data. Metabolite 1 was obtained as a new compound with a specific beta-D-4''-deoxy-Delta(4'')-glucuropyranosyl moiety, which was formed through a unique and novel metabolic pathway that has not been reported previously. PMID:19235125

Xu, Tong-Tong; Yang, Xiu-Wei; Wang, Bin; Xu, Wei; Zhao, Yu-Ying; Zhang, Qing-Ying

2009-04-01

 
 
 
 
361

Genetics of hydrogenase from aerobic lithoautotrophic bacteria.  

Science.gov (United States)

Aerobic facultatively autotrophic hydrogen bacteria are distinguished on the basis of their hydrogen-oxidizing enzyme system (Hox). The major group, represented by Paracoccus denitrificans and Pseudomonas facilis, contains a membrane-bound, electron transport-coupled protein. Species of Nocardia are characterized by the possession of a cytoplasmic NAD-dependent hydrogenase. Both enzymes are present in strains of Alcaligenes. All hydrogenases from lithoautotrophs are H2-consuming nickel-iron-sulfur proteins. Despite these common characteristics, hydrogenases differ in catalytic and molecular properties, in particular in the regulation of enzyme synthesis. Hydrogenase formation is either inducible by H2 (e.g. P. denitrificans strain F1, Alcaligenes hydrogenophilus) or subject to derepression in response to the supply of reductant, temperature, and oxygen (e.g. Alcaligenes eutrophus). The only plasmid-encoded Hox function has been conclusively identified in species of Alcaligenes. Structural and regulatory hox genes reside on megaplasmids, ranging in size between 400 and 500 kilobase pairs (kb). Most of the plasmids are self-transmissible by conjugation. Hox genes of A. eutrophus H16 have been localized by plasmid curing, genetic transfer, molecular cloning and analysis of plasmid deletions and insertions. They seem to be clustered in a DNA sequence of approximately 50 kb, representing several transcriptional units. In addition, a chromosomally encoded regulatory function is required for the expression of plasmid-linked hox genes. Plasmid pHGl of A. eutrophus H16 has been transferred to the non-lithoautotrophic soil bacterium JMP222. Both hydrogenases are expressed in the new host. The current state of hydrogenase genetics in Alcaligenes is discussed in reference to hydrogenase systems of other lithoautotrophic bacteria. PMID:3089306

Friedrich, B; Kortlüke, C; Hogrefe, C; Eberz, G; Silber, B; Warrelmann, J

1986-01-01

362

Enumeration of petroleum hydrocarbon utilizing bacteria  

International Nuclear Information System (INIS)

In-situ biological treatment is one among a number of emerging technologies that may be applied to the remediation of contaminated soils and groundwater. In 1985, a surface spill of 1,500 gallons of dielectric transformer oil at the Sandia National Laboratories (HERMES II facility) resulted in contamination of soil up to depths of 160 feet. The extent of contamination and site characteristics favored the application of in-situ bioremediation as a potential remedial technology. The purpose of this research was to enumerate indigenous microbial populations capable of degrading petroleum hydrocarbons. Microbial enumeration and characterization methods suitably adapted for hydrocarbon utilizing bacteria were used as an indicator of the presence of viable microbial consortia in excavated oil samples with hydrocarbon (TPH) concentrations ranging from 300 to 26,850 ppm. Microbial activity was quantified by direct and streak plating soil samples on silica gel media. Effects of toxicity and temperature were studied using batch cultures of hydrocarbon utilizing bacteria (selectively isolated in an enrichment medium), at temperatures of 20 and 35 C. It was concluded from this study that it is possible to isolate native microorganisms from contaminated soils from depths of 60 to 160 feet, and with oil concentration ranging from 300 to 26,850 ppm. About 62% of the microorganisms isolated form the contaminated soil were capable of using contaminant oil as a substrate for growth and metabolism under aerobic conditions. Growth rates were observed to be 50% higher for the highest contaminant concentration at 20 C. Resistance to toxicity to contaminant oil was also observed to be greater at 20 C than at 35 C

363

Diversity of bacteria contaminating paper machines.  

Science.gov (United States)

Formation of microbial biofilms and slimes is a general and serious problem in the operation of paper machines. Studies of microbial populations in paper machine-derived biofilms have been conducted using standard microbiological procedures; however, the bacterial genera present in this type of samples as well as their diversity are quite poorly known. Here, the bacterial diversity of 38 process water and 22 biofilm samples from four different Finnish paper machines were analyzed by length heterogeneity analysis of PCR-amplified 16S ribosomal DNA (LH-PCR). In addition, sequencing of the amplified 16S rRNA gene from 69 clones was conducted for characterization of the bacterial genera present in biofilm and slime samples. The LH-PCR profiles of both the free-living (process waters) and immobilized (biofilms) bacteria were diverse at all stages of the papermaking process. Out of the 69 sequenced clones, 44 belonged to alpha-Proteobacteria, most of which were close to the nitrogen-fixing root nodule genera Sinorhizobium, Rhizobium and Azorhizobium. Other clones were assigned to beta- and gamma-Proteobacteria and the phylum Bacteroidetes. In addition, eight of the clones were assigned to a yet uncultivated phylum, TM7. Finally, epifluorescence microscopy revealed that Gram-negative bacteria were predominant in both the biofilm (65%) and process water (54%) samples and a small coccoid cell morphology was most common in all samples. Together, our results show that the analysis of microbial samples from paper machines using modern molecular biology techniques adds valuable information and should, therefore, be useful as a more specific and sensitive microbiological method for the paper industry. This information could further be applied, e.g., in the development of more specific and environmental friendly antimicrobial agents for paper mills. PMID:16520979

Lahtinen, Tomi; Kosonen, Mirva; Tiirola, Marja; Vuento, Matti; Oker-Blom, Christian

2006-09-01

364

Bacteria transport and deposition under unsaturated conditions: The role of the matrix grain size and the bacteria surface protein  

Science.gov (United States)

Unsaturated (80% water saturated) packed column experiments were conducted to investigate the influence of grain size distribution and bacteria surface macromolecules on bacteria ( Rhodococcus rhodochrous) transport and deposition mechanisms. Three sizes of silica sands were used in these transport experiments, and their median grain sizes were 607, 567, and 330 ?m. The amount of retained bacteria increased with decreasing sand size, and most of the deposited bacteria were found adjacent to the column inlet. The deposition profiles were not consistent with predictions based on classical filtration theory. The experimental data could be accurately characterized using a mathematical model that accounted for first-order attachment, detachment, and time and depth-dependent straining processes. Visual observations of the bacteria deposition as well as mathematical modelling indicated that straining was the dominant mechanism of deposition in these sands (78-99.6% of the deposited bacteria), which may have been enhanced due to the tendency of this bacterium to form aggregates. An additional unsaturated experiment was conducted to better deduce the role of bacteria surface macromolecules on attachment and straining processes. In this case, the bacteria surface was treated using a proteolitic enzyme. This technique was assessed by examining the Fourier-transform infrared spectrum and hydrophobicity of untreated and enzyme treated cells. Both of these analytical procedures demonstrated that this enzymatic treatment removed the surface proteins and/or associated macromolecules. Transport and modelling studies conducted with the enzyme treated bacteria, revealed a decrease in attachment, but that straining was not significantly affected by this treatment.

Gargiulo, G.; Bradford, S.; Šim?nek, J.; Ustohal, P.; Vereecken, H.; Klumpp, E.

2007-07-01

365

Distribution characteristics of marine bacteria in the China seas  

Directory of Open Access Journals (Sweden)

Full Text Available Objective?To investigate the main species of marine bacteria and their distribution characteristics in China seas. Methods?Seawater samples were obtained from sea water about one meter below the sea level along the navigation course, and then the bacteria therein were enriched, cultured, identified and tested for drug sensitivity. Results?A total of 528 seawater samples were collected from four seas of China, and 759 marine bacteria in 145 species were isolated. The isolates were mainly Vibro, Enterobacteriaceae, Nonfermenter, Fungi, Pasteurella, Gram positive cocci, Eikenella corrodens and Anaerobic bacteria. Vibrio accounted for 52.9% of the 759 strains of marine bacteria, among which Vibrio alginolyticus, Vibrio fluvialis and Vibrio parahaemolyticus accounted for 75%. There was no significant difference in the quantity of Vibrio alginolyticus, Escherichia coli and Vibrio parahaemolyticus between the 4 sea areas (P=0.071. Chi-square test showed that significant differences existed in the distribution of seven species of marine bacteria among the 4 China seas (P=0.0004. The Gram-positive cocci were isolated more often in Bohai than from other seas; Eikenella corrodens were detected mostly in Yellow Sea; Vibrio were the predominant bacteria in East China sea, up to 70.8%; more Fungi were found in South China sea. The main features of specific bacteria isolated from the four sea areas was higher number of species with less quantity. From North to South, Enterococcus faecalis, Flavobacterium, Vibrio carchariae and C. famata were found to constitute the highest number. Conclusions?In China seas, Vibrios are the dominant bacteria, and the numbers of Anaerobic bacteria and Gram-positive cocci are extremely low. There is a significant difference in the distribution of marine bacteria among 4 China seas.

Cong MA

2012-09-01

366

BioNLP Shared Task - The Bacteria Track  

Directory of Open Access Journals (Sweden)

Full Text Available Abstract Background We present the BioNLP 2011 Shared Task Bacteria Track, the first Information Extraction challenge entirely dedicated to bacteria. It includes three tasks that cover different levels of biological knowledge. The Bacteria Gene Renaming supporting task is aimed at extracting gene renaming and gene name synonymy in PubMed abstracts. The Bacteria Gene Interaction is a gene/protein interaction extraction task from individual sentences. The interactions have been categorized into ten different sub-types, thus giving a detailed account of genetic regulations at the molecular level. Finally, the Bacteria Biotopes task focuses on the localization and environment of bacteria mentioned in textbook articles. We describe the process of creation for the three corpora, including document acquisition and manual annotation, as well as the metrics used to evaluate the participants' submissions. Results Three teams submitted to the Bacteria Gene Renaming task; the best team achieved an F-score of 87%. For the Bacteria Gene Interaction task, the only participant's score had reached a global F-score of 77%, although the system efficiency varies significantly from one sub-type to another. Three teams submitted to the Bacteria Biotopes task with very different approaches; the best team achieved an F-score of 45%. However, the detailed study of the participating systems efficiency reveals the strengths and weaknesses of each participating system. Conclusions The three tasks of the Bacteria Track offer participants a chance to address a wide range of issues in Information Extraction, including entity recognition, semantic typing and coreference resolution. We found commond trends in the most efficient systems: the systematic use of syntactic dependencies and machine learning. Nevertheless, the originality of the Bacteria Biotopes task encouraged the use of interesting novel methods and techniques, such as term compositionality, scopes wider than the sentence.

Bossy Robert

2012-06-01

367

Isolation of Crude Oil from Polluted Waters Using Biosurfactants Pseudomonas Bacteria: Assessment of Bacteria Concentration Effects  

Directory of Open Access Journals (Sweden)

Full Text Available Biological decomposition techniques and isolation of environmental pollutions using biosurfactants bacteria are effective methods of environmental protection. Surfactants are amphiphilic compounds that are produced by local microorganisms and are able to reduce the surface and the stresses between surfaces. As a result, they will increase solubility, biological activity, and environmental decomposition of organic compounds. This study analyzes the effects of biosurfactants on crude oil recovery and its isolation using pseudomonas sea bacteria species. Preparation of biosurfactants was done in glass flasks and laboratory conditions. Experiments were carried out to obtain the best concentration of biosurfactants for isolating oil from water and destroying oil-in-water or water-in-oil emulsions in two pH ranges and four saline solutions of different concentrations. The most effective results were gained when a concentration of 0.1% biosurfactants was applied.

A. Khalifeh

2013-04-01

368

Atypical bacteria accompanying the scallop Argopecten purpuratus / Bacterias atípicas en el ostión Argopecten purpuratus  

Scientific Electronic Library Online (English)

Full Text Available SciELO Chile | Language: English Abstract in spanish Se realizó un análisis sencillo de la bacterioflora cultivable acompañante de diferentes regiones del cuerpo del ostión Argopecten purpuratus la cual se mostró compuesta de bacterias atípicas para la columna de agua. Se presentó un número alto de cepas de Vibrio, coccus Gram-positivos y formadoras d [...] e esporas. También fueron aisladas cepas de la familia Enterobacteriaceae Abstract in english A simple bacteriological analysis for accompanying culturable microflora from different regions of the body of Argopecten purpuratus showed a rather atypical bacteria considering that farming is done in the sea-water column. High numbers of Vibrio strains, Gram-positive cocci, and sporeformers were [...] present. Also members of the Enterobacteriaceae family were isolated

Jenny, Llanos; Marianella, Cid; Sara, Navarro; Alejandro, Dinamarca; Patricio, García-Tello.

369

Atypical bacteria accompanying the scallop Argopecten purpuratus Bacterias atípicas en el ostión Argopecten purpuratus  

Directory of Open Access Journals (Sweden)

Full Text Available A simple bacteriological analysis for accompanying culturable microflora from different regions of the body of Argopecten purpuratus showed a rather atypical bacteria considering that farming is done in the sea-water column. High numbers of Vibrio strains, Gram-positive cocci, and sporeformers were present. Also members of the Enterobacteriaceae family were isolatedSe realizó un análisis sencillo de la bacterioflora cultivable acompañante de diferentes regiones del cuerpo del ostión Argopecten purpuratus la cual se mostró compuesta de bacterias atípicas para la columna de agua. Se presentó un número alto de cepas de Vibrio, coccus Gram-positivos y formadoras de esporas. También fueron aisladas cepas de la familia Enterobacteriaceae

Jenny Llanos

2002-01-01

370

Killing Effect of Membrane Vesicles Produced by Gram-negative Bacteria on Other Bacteria  

Directory of Open Access Journals (Sweden)

Full Text Available The gram-negative bacteria Citrobacter freundii, Enterobacter cloacae NCTC10005, Erwinia carotovora NCPPB312, Klebsiella pneumoniae, Proteus vulgaris 1753 and Serratia marcescens HIM 307-2 produced natural outer membrane vesicles under normal growth conditions. The membrane vesicles showed bacteriolytic activities against different gram-positive and gram-negative host bacteria. Different killing potencies were obtained by membrane vesicles of different producing organisms against different recipient host strains. In most of membrane-vesicle-producing strains, the exposure to the ?-lactam antibiotic cefotaxime and the aminoglycoside antibiotic gentamicin induced the formation of cefotaxime membrane vesicles and gentamicin membrane vesicles, respectively, larger in size and with higher lytic activities against the susceptible host bacteria compared to those produced under normal growth conditions. But the transmission electron microscopy and the plate assay showed that cefotaxime inhibited the formation of membrane vesicles by E. cloacae NCTC10005. Natural membrane vesicles produced by Serratia marcescens HIM 307-2 and P. vulgaris 1753 recorded the widest killing spectrum compared to other natural membrane vesicles. Cefotaxime membrane vesicles of K. pneumoniae showed the highest lytic potency, while C. freundii membrane vesicles exhibited the least lytic spectrum. The cefotaxime membrane vesicles produced by K. pneumoniae had the largest size of 200 nm followed by natural membrane vesicles of P. vulgaris 1753 which had a size of 125 nm, while the smallest membrane vesicles were formed by Serratia marcescens HIM 307-2 grown under normal conditions. The membrane vesicles produced by different gram-negative bacteria used in this study had spherical shapes and sizes ranged from 30 to 200 nm.

Essam A. Azab

2005-01-01

371

Las bacterias halófilas y sus aplicaciones biotecnológicas / The halophilic bacteria and their biotechnological applications  

Scientific Electronic Library Online (English)

Full Text Available SciELO Venezuela | Language: Spanish Abstract in spanish Los autores presentan una extensa revisión sobre las bacterias halófilas y sus aplicaciones biotecnológicas. Revisan aspectos relacionados con su ecología en los ambientes hipersalinos y sus características como microorganismos extremófilos y sus diversas e importantes aplicaciones y potencialidades [...] en la industria y en la biotecnología. Estas bacterias son fáciles de cultivar y presentan escasos requerimientos nutricionales; su tolerancia a elevadas concentraciones salinas reduce al mínimo los riesgos de contaminaciones en el laboratorio, lo que permitiría su explotación como fábricas celulares alternativas a Escherichia coli, para la producción de proteínas recombinantes. Son útiles en la producción de enzimas, polímeros, solutos compatibles y en la biodegradación de residuos, así como en la producción de alimentos fermentados. La revisión abarca aspectos relativos a la microbiología de los actinomicetos halófilos, refiriéndose a estudios realizados por los autores en cepas de actinomicetos halófilos aislados en medios hipersalinos de México y España. Abstract in english The authors present an extensive review on the halophilic bacterias and their biotechnological applications, along with some aspects related to their ecological behaviour in hypersaline environments. They also examined their characteristics as extremophilic microorganisms, including their several im [...] portant applications and potential use in the industry and biotechnology. Due to their low nutritional requirements and tolerance to high saline concentrations, these bacteria are easy to be cultivated and the laboratory risks contamination is minimal. These facts allow them to be used as alternative cellular factories instead of Escherichia coli in the production of recombining proteins. They are also useful in the production of enzymes, polymers, compatible solutes, residues biodegradation process, as well as, fermented food production. Finally, this work includes aspects related to halophilic actinomycetes microbiology, discussed in previous studies carried out by the authors in strains of halophilic actinomycetes isolated in hypersaline mediums in Mexico and Spain.

N, Ramírez; AH, Sandoval; JA, Serrano.

372

Las bacterias halófilas y sus aplicaciones biotecnológicas / The halophilic bacteria and their biotechnological applications  

Scientific Electronic Library Online (English)

Full Text Available SciELO Venezuela | Language: Spanish Abstract in spanish Los autores presentan una extensa revisión sobre las bacterias halófilas y sus aplicaciones biotecnológicas. Revisan aspectos relacionados con su ecología en los ambientes hipersalinos y sus características como microorganismos extremófilos y sus diversas e importantes aplicaciones y potencialidades [...] en la industria y en la biotecnología. Estas bacterias son fáciles de cultivar y presentan escasos requerimientos nutricionales; su tolerancia a elevadas concentraciones salinas reduce al mínimo los riesgos de contaminaciones en el laboratorio, lo que permitiría su explotación como fábricas celulares alternativas a Escherichia coli, para la producción de proteínas recombinantes. Son útiles en la producción de enzimas, polímeros, solutos compatibles y en la biodegradación de residuos, así como en la producción de alimentos fermentados. La revisión abarca aspectos relativos a la microbiología de los actinomicetos halófilos, refiriéndose a estudios realizados por los autores en cepas de actinomicetos halófilos aislados en medios hipersalinos de México y España. Abstract in english The authors present an extensive review on the halophilic bacterias and their biotechnological applications, along with some aspects related to their ecological behaviour in hypersaline environments. They also examined their characteristics as extremophilic microorganisms, including their several im [...] portant applications and potential use in the industry and biotechnology. Due to their low nutritional requirements and tolerance to high saline concentrations, these bacteria are easy to be cultivated and the laboratory risks contamination is minimal. These facts allow them to be used as alternative cellular factories instead of Escherichia coli in the production of recombining proteins. They are also useful in the production of enzymes, polymers, compatible solutes, residues biodegradation process, as well as, fermented food production. Finally, this work includes aspects related to halophilic actinomycetes microbiology, discussed in previous studies carried out by the authors in strains of halophilic actinomycetes isolated in hypersaline mediums in Mexico and Spain.

N, Ramírez; AH, Sandoval; JA, Serrano.

2004-01-01

373

Stalking Antibiotic-Resistant Bacteria in Common Vegetables  

Science.gov (United States)

The study developed a simple experimental protocol for studying antibiotic resistant bacteria that will allow students to determine the proportion of such bacteria found on common fruit and vegetable crops. This protocol can open up the world of environmental science and show how human behavior can dramatically alter ecosystems.

Brock, David; Boeke, Caroline; Josowitz, Rebecca; Loya, Katherine

2004-01-01

374

Aerobic culture of anaerobic bacteria using antioxidants: a preliminary report.  

Science.gov (United States)

Antioxidants have been shown to help the growth of anaerobic bacteria. We were able to grow six anaerobe species (including Fusobacterium necrophorum and Ruminococcus gravus) and seven aerobic species all aerobically in Schaedler agar tubes and agar plates with high doses of ascorbic acid and/or glutathione. This may deeply change strategies for culturing bacteria. PMID:24820294

La Scola, B; Khelaifia, S; Lagier, J-C; Raoult, D

2014-10-01

375

Visualizing aquatic bacteria by light and transmission electron microscopy.  

Science.gov (United States)

The understanding of the functional role of aquatic bacteria in microbial food webs is largely dependent on methods applied to the direct visualization and enumeration of these organisms. While the ultrastructure of aquatic bacteria is still poorly known, routine observation of aquatic bacteria by light microscopy requires staining with fluorochromes, followed by filtration and direct counting on filter surfaces. Here, we used a new strategy to visualize and enumerate aquatic bacteria by light microscopy. By spinning water samples from varied tropical ecosystems in a cytocentrifuge, we found that bacteria firmly adhere to regular slides, can be stained by fluorochoromes with no background formation and fast enumerated. Significant correlations were found between the cytocentrifugation and filter-based methods. Moreover, preparations through cytocentrifugation were more adequate for bacterial viability evaluation than filter-based preparations. Transmission electron microscopic analyses revealed a morphological diversity of bacteria with different internal and external structures, such as large variation in the cell envelope and capsule thickness, and presence or not of thylakoid membranes. Our results demonstrate that aquatic bacteria represent an ultrastructurally diverse population and open avenues for easy handling/quantification and better visualization of bacteria by light microscopy without the need of filter membranes. PMID:24132727

Silva, Thiago P; Noyma, Natália P; Duque, Thabata L A; Gamalier, Juliana P; Vidal, Luciana O; Lobão, Lúcia M; Chiarini-Garcia, Hélio; Roland, Fábio; Melo, Rossana C N

2014-01-01

376

Nitrogen acquisition in Agave tequilana from degradation of endophytic bacteria  

Science.gov (United States)

Plants form symbiotic associations with endophytic bacteria within tissues of leaves, stems, and roots. It is unclear whether or how plants obtain nitrogen from these endophytic bacteria. Here we present evidence showing nitrogen flow from endophytic bacteria to plants in a process that appears to involve oxidative degradation of bacteria. In our experiments we employed Agave tequilana and its seed-transmitted endophyte Bacillus tequilensis to elucidate organic nitrogen transfer from 15N-labeled bacteria to plants. Bacillus tequilensis cells grown in a minimal medium with 15NH4Cl as the nitrogen source were watered onto plants growing in sand. We traced incorporation of 15N into tryptophan, deoxynucleosides and pheophytin derived from chlorophyll a. Probes for hydrogen peroxide show its presence during degradation of bacteria in plant tissues, supporting involvement of reactive oxygen in the degradation process. In another experiment to assess nitrogen absorbed as a result of endophytic colonization of plants we demonstrated that endophytic bacteria potentially transfer more nitrogen to plants and stimulate greater biomass in plants than heat-killed bacteria that do not colonize plants but instead degrade in the soil. Findings presented here support the hypothesis that some plants under nutrient limitation may degrade and obtain nitrogen from endophytic microbes. PMID:25374146

Beltran-Garcia, Miguel J.; White, Jr., James F.; Prado, Fernanda M.; Prieto, Katia R.; Yamaguchi, Lydia F.; Torres, Monica S.; Kato, Massuo J.; Medeiros, Marisa H. G.; Di Mascio, Paolo

2014-01-01

377

PLANTS AS AN ECOLOGICAL NICHE FOR HUMAN PATHOGENIC BACTERIA ???????? ??? ????????????? ???? ?????????? ??? ???????? ????????  

Directory of Open Access Journals (Sweden)

Full Text Available The facts related to contamination of plants with pathogenic bacteria being a possible source of human foodborne intestinal diseases are discussed. Data bound up with influence of environment conditions with respect to attachment and penetration of bacteria in plant tissues are described. Exquisite results related to the rate of proliferation and the time of retaining enteropathogens in plant organisms are presented

Markova Y. A.

2012-12-01

378

Killing of bacteria during solar eclipse and its biological implications.  

Science.gov (United States)

Enhanced killing of bacteria was obtained by radiation reaching the earth during total solar eclipse (February 16, 1980) than during the corresponding time of a normal day (February 26, 1980). The killing was not due to the formation of sunlight induced photoproducts of tryptophan. The damage to the bacteria exposed to sunlight could be repaired by photoreactivation. PMID:6359236

Banerjee, S K; Chatterjee, S N

1983-01-01

379

The Effect of Antioxidants on Antibiotic Sensitivity of Bacteria  

Digital Repository Infrastructure Vision for European Research (DRIVER)

Objective: The effect of different concentrations of antioxidants (ascorbic acid, emoxipin, tocopherol acetate and ionol) on antibiotic sensitivity of bacteria was studied. Method: Bacteria belong to different respiration types: Pseudomonas aeruginosa as aerobe and Escherichia coli as facultative anaerobe were used. Antibiotic sensitivity of microorganisms was determined as minimum inhibitory concentration (MIC) by dilution test. Results: Different concentrations of antioxidants increased the...

Attar, Azade; I? Qurbanov, Akif

2007-01-01

380

Use of thermophilic bacteria for bioremediation of petroleum contaminants  

International Nuclear Information System (INIS)

Several strains of thermophilic bacteria were isolated from the environment of the United Arab Emirates. These bacteria show extraordinary resistance to heat and have their maximum growth rate around 60--80 C. This article investigates the potential of using these facultative bacteria for both in situ and ex situ bioremediation of petroleum contaminants. In a series of batch experiments, bacterial growth was observed using a computer image analyzer following a recently developed technique. These experiments showed clearly that the growth rate is enhanced in the presence of crude oil. This is coupled with a rapid degradation of the crude oil. These bacteria were found to be ideal for breaking down long-chain organic molecules at a temperature of 40 C, which is the typical ambient temperature of the Persian Gulf region. The same strains of bacteria are also capable of surviving in the presence of the saline environment that can prevail in both sea water and reservoir connate water. This observation prompted further investigation into the applicability of the bacteria in microbial enhanced oil recovery. In the United Arab Emirates, the reservoirs are typically at a temperature of around 85 C. Finally, the performance of the bacteria is tested in a newly developed bioreactor that uses continuous aeration through a transverse slotted pipe. This reactor also uses mixing without damaging the filamentous bacteria. In this process, the mechanisms of bioremediation are identified

 
 
 
 
381

Glass bead transformation method for gram-positive bacteria  

Digital Repository Infrastructure Vision for European Research (DRIVER)

A simple, inexpensive and reproducible transformation method was developed for Gram-positive bacteria. It was based on agitation of bacterial protoplasts with glass beads in the presence of DNA and polyethylene glycol. By using this method, introduction of pGK12 into protoplasts of several strains of Gram-positive bacteria was achieved.

Pongsak Rattanachaikunsopon; Parichat Phumkhachorn

2009-01-01

382

Glass bead transformation method for gram-positive bacteria  

Directory of Open Access Journals (Sweden)

Full Text Available A simple, inexpensive and reproducible transformation method was developed for Gram-positive bacteria. It was based on agitation of bacterial protoplasts with glass beads in the presence of DNA and polyethylene glycol. By using this method, introduction of pGK12 into protoplasts of several strains of Gram-positive bacteria was achieved.

Pongsak Rattanachaikunsopon

2009-12-01

383

INTERACTIONS BETWEEN HETEROTROPHIC PLATE COUNT BACTERIA AND COLIFORM ORGANISMS  

Science.gov (United States)

Studies were initiated to investigate the interactions between heterotrophic plate count bacteria and coliform organisms. The authors used spiked samples to show that heterotrophic plate count bacteria could reduce coliform densities by more than 3 logs within 8 days. Some hetero...

384

Nitrogen acquisition in Agave tequilana from degradation of endophytic bacteria.  

Science.gov (United States)

Plants form symbiotic associations with endophytic bacteria within tissues of leaves, stems, and roots. It is unclear whether or how plants obtain nitrogen from these endophytic bacteria. Here we present evidence showing nitrogen flow from endophytic bacteria to plants in a process that appears to involve oxidative degradation of bacteria. In our experiments we employed Agave tequilana and its seed-transmitted endophyte Bacillus tequilensis to elucidate organic nitrogen transfer from (15)N-labeled bacteria to plants. Bacillus tequilensis cells grown in a minimal medium with (15)NH4Cl as the nitrogen source were watered onto plants growing in sand. We traced incorporation of (15)N into tryptophan, deoxynucleosides and pheophytin derived from chlorophyll a. Probes for hydrogen peroxide show its presence during degradation of bacteria in plant tissues, supporting involvement of reactive oxygen in the degradation process. In another experiment to assess nitrogen absorbed as a result of endophytic colonization of plants we demonstrated that endophytic bacteria potentially transfer more nitrogen to plants and stimulate greater biomass in plants than heat-killed bacteria that do not colonize plants but instead degrade in the soil. Findings presented here support the hypothesis that some plants under nutrient limitation may degrade and obtain nitrogen from endophytic microbes. PMID:25374146

Beltran-Garcia, Miguel J; White, James F; Prado, Fernanda M; Prieto, Katia R; Yamaguchi, Lydia F; Torres, Monica S; Kato, Massuo J; Medeiros, Marisa H G; Di Mascio, Paolo

2014-01-01

385

In vitro production of thymine dimer by ultroviolet irradiation of DNA from mesophilic and thermophilic bacteria  

International Nuclear Information System (INIS)

Thymine dimer was produced in vitro by ultraviolet irradiation of DNA, isolated from the mesophile Bacillus licheniformis and the thermophile B. stearothermophilus. Irradiation was performed at three different temperaturs (35, 45 and 55 C) and the thymine dimer was isolated and determined. An HPLC procedure was developed that permitted temperature was greater for the thermophile than for the mesophile. Formation of thymine dimer increased with temperature for both organisms but more so for the thermophile; over the temperature range of 35-55 C, the average increase in thymine dimer production for the themrophile was about 4-times that for the mesophile. The melting out temperature, as a function of increasing irradiation temperature, was essentially unchanged for the mesophilic DNA, but decreased progressively for the thermophilic DNA. These results are discussed in terms of the macromolecular theory of to the macromolecular theory of the thermophily. (author). 31 refs.; 4 figs.; 3 tabs

386

Influence of disturbances on bacteria level in an operating room  

DEFF Research Database (Denmark)

In operating rooms great effort is manifested to reduce the bacteria level in order to decrease the risk of infections. The main source of bacteria is the staff and the patient, thus, the resulting bacteria concentration is roughly speaking a combination of the ventilation system and the emission from the occupants. This study investigates the influence of two main disturbances in an operating room namely the door opening during the operation and the activity level of the staff. It is found that the frequent door opening in this case does not cause significant transport of air from outside the operating room to the wound area of the patient. However, a significant influence of the activity level on the bacteria emission and concentration is found. Counting the number of persons in an operating room to estimate the bacteria source strength is not sufficient, the corresponding activity level must be considered, too.

Brohus, Henrik; Hyldig, Mikkel

2008-01-01

387

Sensitivity of certain bacteria to antibiotics and irradiation  

International Nuclear Information System (INIS)

An experiment has been conducted to find vegetative forms of certain bacteria in Indonesia which are resistant to irradiation, the resistance of which will be compared to that of known radioresistant bacteria micrococcus radiodurans. To inactivate the vegetative forms of resistant bacteria to irradiation high doses are needed, while for storage purposes lower doses change the physical and chemical properties of the stored commodity are preferred. For this purpose the bacteria were irradiated in aerobic condition with gamma radiation doses of 0.1, 0.2 and 0.3 kGy, or treated with antibiotics e.g. tetracycline HCl or chloramphenicol with concentrations of 0.1, 0.2 and 0.3 ?g/ml respectively. The results indicated that doses of 0.2 kGy and 0.1 ?g/ml reduced the ability of the bacteria for multiplication. (author)

388

Molecular Detection of Endophytic Bacteria on Plantlet Tissue of Sugarcane  

Directory of Open Access Journals (Sweden)

Full Text Available Endophytic bacteria live in plant host tissues without causing any symptoms. The aim of this study was to examine the indigenous endophytic bacteria on sugarcane plantlets produced from the young leaf cells by using tissue culture techniques. To detect the existence of endophytic bacteria in the plantlet tissue, a series of molecular method based on PCR were applied by using ribosomal intergenic spacer (RIS primer followed by 16S rDNA partial sequence and single strand conformation polymorphism (SCCP. The results showed that the molecular method could detect the existence of bacteria in the tissues. Using the same methods, the bacteria were also found in other developmental stages of sugarcane (explants, differentiated tissues and callus.

WIWIK EKO WIDAYATI

2007-12-01

389

[Central metabolism of anammox bacteria--a review].  

Science.gov (United States)

Anaerobic ammonium oxidation (anammox) is a biological process by which ammonium is oxidized to dinitrogen gas by using nitrite as the electrons acceptor. Anaerobic ammonium-oxidizing bacteria play an important role in nitrogen removal from wastewater and global N-cycle. The study of metabolism of anammox bacteria will help us understand the anammox mechanism and develop anammox biotechnology. Anammox bacteria are chemoautotrophic bacteria that use CO, or HCO3- as carbon source and obtain their energy from the conversion of ammonium and nitrite into dinitrogen gas. Hydrazine has been detected as an intermediate in the anammox pathway, while hydroxylamine and nitric oxide have not been detected yet. The genomic data indicate that anammox bacteria fix carbon dioxide through acetyl-CoA pathway. The proposed anammox pathway is consistent with the available experimental data, thermodynamical calculation and biochemical determination and as well as the Ockham's razor principal. PMID:22097766

Lu, Huifeng; Ding, Shuang; Zheng, Ping

2011-08-01

390

AZF Microdeletions in Human Semen Infected with Bacteria  

Directory of Open Access Journals (Sweden)

Full Text Available Bacterial infections are associated with infertility in men. This study was aimed to investigate microdeletions on Yq chromosome in semen infected with bacteria by using bacteriological, biochemical, and serological assays. The investigation showed that 107 of 300 (84.80% semen samples collected from infertile men with primary or secondary infertility were infected with different species of bacteria. Chlamydia trachomatis and Neisseria gonorrheae were the most frequently diagnosed bacteria in the infected semen samples. The percentages of infections of semen samples with C. trachomatis and N. gonorrhea were 42.31% and 35.28% respectively. Genomic DNA from each semen sample infected with predominant bacteria was analyzed for AZF deletions by using multiplex PCR. Different patterns of AZF microdeletions were obtained. It can be concluded that sexually transmitted bacteria may contribute in microdeletions of Yq chromosome by indirectly producing reactive oxygen species and causing gene defect in AZF regions.

Hayfa H Hassani

2011-11-01

391

Viability of bacteria in dental calculus - A microbiological study  

Directory of Open Access Journals (Sweden)

Full Text Available Aim: The aim of this study was (1 To investigate the viability of bacteria within supragingival and subgingival calculus, (2 To examine motility of bacteria, and (3 To identify bacterial morphotypes in calculus. Materials and Methods: Supra and subgingival calculus were harvested from 30 subjects having clinical evidence of chronic inflammatory periodontal disease and were divided into two groups . Samples from both groups were immediately transported to the Department of Microbiology for gram staining, acridine orange staining, bacterial culture and to the Department of Oral Pathology for dark field microscopy. Results: Gram staining revealed presence of bacteria within the samples. Dark field microscopic examination revealed presence of filamentous organisms, spirochetes, and motile short bacilli. Acridine orange fluorescent stain showed that the viable bacteria appeared apple green. Bacterial culture revealed presence of a variety of aerobic organisms. Conclusion: From the results, it appeared that viable bacteria were present within calculus especially within internal channels and lacunae.

Moolya Nikesh

2010-01-01

392

Methods and Techniques of Sampling, Culturing and Identifying of Subsurface Bacteria  

International Nuclear Information System (INIS)

This report described sampling, culturing and identifying of KURT underground bacteria, which existed as iron-, manganese-, and sulfate-reducing bacteria. The methods of culturing and media preparation were different by bacteria species affecting bacteria growth-rates. It will be possible for the cultured bacteria to be used for various applied experiments and researches in the future

393

Antioxidant and antimicrobial potential of the Bifurcaria bifurcata epiphytic bacteria.  

Science.gov (United States)

Surface-associated marine bacteria are an interesting source of new secondary metabolites. The aim of this study was the isolation and identification of epiphytic bacteria from the marine brown alga, Bifurcaria bifurcata, and the evaluation of the antioxidant and antimicrobial activity of bacteria extracts. The identification of epiphytic bacteria was determined by 16S rRNA gene sequencing. Bacteria extracts were obtained with methanol and dichloromethane (1:1) extraction. The antioxidant activity of extracts was performed by quantification of total phenolic content (TPC), 2,2-diphenyl-1-picrylhydrazyl (DPPH) radical scavenging activity and oxygen radical absorbance capacity (ORAC). Antimicrobial activities were evaluated against Escherichia coli, Pseudomonas aeruginosa, Bacillus subtilis, Salmonella enteritidis, Staphylococcus aureus, Saccharomyces cerevisiae and Candida albicans. A total of 39 Bifurcaria bifurcata-associated bacteria were isolated and 33 were identified as Vibrio sp. (48.72%), Alteromonas sp. (12.82%), Shewanella sp. (12.26%), Serratia sp. (2.56%), Citricoccus sp. (2.56%), Cellulophaga sp. (2.56%), Ruegeria sp. (2.56%) and Staphylococcus sp. (2.56%). Six (15.38%) of the 39 bacteria Bifurcaria bifurcata-associated bacteria presented less than a 90% Basic Local Alignment Search Tool (BLAST) match, and some of those could be new. The highest antioxidant activity and antimicrobial activity (against B. subtilis) was exhibited by strain 16 (Shewanella sp.). Several strains also presented high antimicrobial activity against S. aureus, mainly belonging to Alteromonas sp. and Vibrio sp. There were no positive results against fungi and Gram-negative bacteria. Bifurcaria bifurcata epiphytic bacteria were revealed to be excellent sources of natural antioxidant and antimicrobial compounds. PMID:24663118

Horta, André; Pinteus, Susete; Alves, Celso; Fino, Nádia; Silva, Joana; Fernandez, Sara; Rodrigues, Américo; Pedrosa, Rui

2014-03-01

394

Antioxidant and Antimicrobial Potential of the Bifurcaria bifurcata Epiphytic Bacteria  

Directory of Open Access Journals (Sweden)

Full Text Available Surface-associated marine bacteria are an interesting source of new secondary metabolites. The aim of this study was the isolation and identification of epiphytic bacteria from the marine brown alga, Bifurcaria bifurcata, and the evaluation of the antioxidant and antimicrobial activity of bacteria extracts. The identification of epiphytic bacteria was determined by 16S rRNA gene sequencing. Bacteria extracts were obtained with methanol and dichloromethane (1:1 extraction. The antioxidant activity of extracts was performed by quantification of total phenolic content (TPC, 2,2-diphenyl-1-picrylhydrazyl (DPPH radical scavenging activity and oxygen radical absorbance capacity (ORAC. Antimicrobial activities were evaluated against Escherichia coli, Pseudomonas aeruginosa, Bacillus subtilis, Salmonella enteritidis, Staphylococcus aureus, Saccharomyces cerevisiae and Candida albicans. A total of 39 Bifurcaria bifurcata-associated bacteria were isolated and 33 were identified as Vibrio sp. (48.72%, Alteromonas sp. (12.82%, Shewanella sp. (12.26%, Serratia sp. (2.56%, Citricoccus sp. (2.56%, Cellulophaga sp. (2.56%, Ruegeria sp. (2.56% and Staphylococcus sp. (2.56%. Six (15.38% of the 39 bacteria Bifurcaria bifurcata-associated bacteria presented less than a 90% Basic Local Alignment Search Tool (BLAST match, and some of those could be new. The highest antioxidant activity and antimicrobial activity (against B. subtilis was exhibited by strain 16 (Shewanella sp.. Several strains also presented high antimicrobial activity against S. aureus, mainly belonging to Alteromonas sp. and Vibrio sp. There were no positive results against fungi and Gram-negative bacteria. Bifurcaria bifurcata epiphytic bacteria were revealed to be excellent sources of natural antioxidant and antimicrobial compounds.

André Horta

2014-03-01

395

capillare contra bacterias patógenas de peces  

Directory of Open Access Journals (Sweden)

Full Text Available En el presente estudio se comprobó, in vitro, la capacidad del extracto que se obtuvo a partir del alga verde dulce acuícola, Oedogonium capillare, con el propósito de inhibir el crecimiento de 23 diferentes bacterias, tanto patógenas de humanos como de importancia ictiopatogénica, pertenecientes a las familias Pseudomonadaceae, Enterobacteriaceae, Aeromonadacea y Vibrionaceae. Las diferentes cepas bacterianas silvestres se aislaron a partir de peces Carassius auratus, cultivados en granjas acuícolas en Morelos, México; después de su purifi cación se identifi caron mediante la técnica API-20E y API-20NE. Las algas que se recolectaron de los estanques para su cultivo se instalaron en el Centro de Investigaciones Biológicas y Acuícolas, en Xochimilco. Secas y homegeneizadas, las algas se sometieron a dos extracciones con hexano a temperatura de refl ujo; la segunda extracción se realizó con una columna cromatrográfi ca de sílica gel y cloroformo etílico. Con el fi n de determinar la sensibilidad de las bacterias a la actividad del extracto, se instrumentó el sistema estandarizado de pruebas de difusión discos. Se impregnaron discos de papel fi ltro con el extracto obtenido del alga O. capillare y con antibióticos comerciales de mayor uso en la acuicultura: kanamicina, cloranfenicol y tetraciclina. Se efectuó la técnica de lisis alcalina para la extracción de plásmidos-R a fi n de determinar su presencia en las cepas. Todo el experimento se replicó mediante cepas bacterianas de la American Type Culture Colection. Se comparó el comportamiento como antibacterial de O. capillare con cada uno de los antibióticos comerciales descritos, por medio de un análisis de correlación. Se obtuvieron altos coefi cientes de correlación entre la forma de actuar del extracto del alga y los antibióticos empleados en este estudio. La actividad antibacterial de O. capillare está más relacionada con la kanamicina que con los otros dos antibióticos. En todas las cepas de colección se registró mayor actividad antibacteriana del extracto, el promedio de los diámetros de los halos de inhibición de las especies de las cuatro familias bacterianas de este grupo fue mayor que los del grupo silvestre, posiblemente debido a la presencia de plásmidos-R en este último grupo.

Pilar Negrete Redondo

2006-01-01

396

Antibacterial Activity of Honey on Cariogenic Bacteria  

Directory of Open Access Journals (Sweden)

Full Text Available Objective: Honey has antibacterial activity. The aim of this study was to evaluate the antibacterial activity of honey on Streptococcus mutans and Lactobacillus.Materials and Methods: In this in vitro study, solutions containing 0%, 5%, 10%, 20%, 50% and100%(w/v of natural Hamadan honey were prepared. Each blood (nutrient agar plate was then filled with dilutions of the honey. The strains of bacteria were inoculated in blood agar for 24 hours at 37oC and were adjusted according to the McFarland scale (10×10 cfumcl -1. All assays were repeated 10 times for each of the honey concentrations. Data were analyzed by non parametric Chi-Square test. Statistical significance was set at ?=0.05.Results: Significant antibacterial activity was detected for honey on Streptococcus mutans in concentrations more than 20% and on Lactobacillus in 100% concentration (P<0.05.Conclusion: It seems that antibacterial activity of honey could be used for prevention and reduction of dental caries.

Zahra Khamverdi

2013-01-01

397

Lactic acid bacteria from fermented table olives.  

Science.gov (United States)

Table olives are one of the main fermented vegetables in the world. Olives can be processed as treated or natural. Both have to be fermented but treated green olives have to undergo an alkaline treatment before they are placed in brine to start their fermentation. It has been generally established that lactic acid bacteria (LAB) are responsible for the fermentation of treated olives. However, LAB and yeasts compete for the fermentation of natural olives. Yeasts play a minor role in some cases, contributing to the flavour and aroma of table olives and in LAB development. The main microbial genus isolated in table olives is Lactobacillus. Other genera of LAB have also been isolated but to a lesser extent. Lactobacillus plantarum and Lactobacillus pentosus are the predominant species in most fermentations. Factors influencing the correct development of fermentation and LAB, such as pH, temperature, the amount of NaCl, the polyphenol content or the availability of nutrients are also reviewed. Finally, current research topics on LAB from table olives are reviewed, such as using starters, methods of detection and identification of LAB, their production of bacteriocins, and the possibility of using table olives as probiotics. PMID:22475936

Hurtado, Albert; Reguant, Cristina; Bordons, Albert; Rozès, Nicolas

2012-08-01

398

Antibiotic resistance of lactic acid bacteria  

Directory of Open Access Journals (Sweden)

Full Text Available Knowledge on the antibiotic resistance of lactic acid bacteria is still limited, possibly because of the large numbers of genera and species encountered in this group, as well as variances in their resistance spectra. The EFSA considers antibiotic resistances, especially transferable resistances, an important decision criterion for determining a strain's QPS status. There are no approved standards for the phenotypic or genotypic evaluation of antibiotic resistances in food isolates. Also, the choice of media is problematic, as well as the specification of MIC breakpoint values as a result of the large species variation and the possible resulting variation in MIC values between species and genera. The current investigations in this field showed that we might end up with a range of different species- or genus-specific breakpoint values that may further increase the current complexity. Another problem associated with safety determinations of starter strains is that once a resistance phenotype and an associated resistance determinant have been identified, it becomes difficult to show that this determinant is not transferable, especially if the resistance gene is not located on a plasmid and no standard protocols for showing genetic transfer are available. Encountering those problems, the QPS system should allow leeway for the interpretations of results, especially when these relate to the methodology for resistance phenotype determinations, determinations of MIC breakpoints for certain genera, species, or strains, the nondeterminability of a genetic basis of a resistance phenotype and the transferability of resistance genes.

Bulaji? Snežana

2008-01-01

399

The question of uniqueness of ancient bacteria.  

Science.gov (United States)

Microorganisms are associated with a variety of ancient geological materials. However, conclusive proof that these organisms are as old as the geological material and not more recent introductions has generally been lacking. Over the years, numerous reports of the isolation of ancient bacteria from geological materials have appeared. Most of these have suffered from the fact that the protocol for the surface sterilization of the sample was either poorly defined, inadequate or rarely included data to validate the overall effectiveness of the sterilization protocol. With proper sterility validation and isolation protocol, a legitimate claim for the isolation of an ancient microbe can be made. Biochemical, physiological, or morphological data indicate that these ancient microbes are not significantly different from modern isolates. As the role (decomposition) of modern and ancient microbes has not changed over time, it is probably unreasonable to expect these organisms to be vastly different. A discussion on the reasons for the homogeneity of ancient and modern microbes is presented. PMID:11938469

Vreeland, R H; Rosenzweig, W D

2002-01-01

400

Computational small RNA prediction in bacteria.  

Science.gov (United States)

Bacterial, small RNAs were once regarded as potent regulators of gene expression and are now being considered as essential for their diversified roles. Many small RNAs are now reported to have a wide array of regulatory functions, ranging from environmental sensing to pathogenesis. Traditionally, noncoding transcripts were rarely detected by means of genetic screens. However, the availability of approximately 2200 prokaryotic genome sequences in public databases facilitates the efficient computational search of those molecules, followed by experimental validation. In principle, the following four major computational methods were applied for the prediction of sRNA locations from bacterial genome sequences: (1) comparative genomics, (2) secondary structure and thermodynamic stability, (3) 'Orphan' transcriptional signals and (4) ab initio methods regardless of sequence or structure similarity; most of these tools were applied to locate the putative genomic sRNA locations followed by experimental validation of those transcripts. Therefore, computational screening has simplified the sRNA identification process in bacteria. In this review, a plethora of small RNA prediction methods and tools that have been reported in the past decade are discussed comprehensively and assessed based on their attributes, compatibility, and their prediction accuracy. PMID:23516022

Sridhar, Jayavel; Gunasekaran, Paramasamy

2013-01-01