WorldWideScience
1

?????? ???????????? ??????????? ???? Geobacillus Stearothermophilus  

OpenAIRE

Ištirtas chemini? ir fizikini? veiksni? poveikis Geobacillus stearothermophilus spor? sudygimui agaro terp?je. Tyrimams panaudotos šios chemin?s medžiagos: angliavandeniai, aminor?gštys, neorganin?s druskos, adenozinas ir lizocimas. Nustatyta, kad t? pa?i? angliavandeni? ?vairios koncentracijos terp?je tur?jo skirting? ?tak? spor? sudygimui. G. stearothermophilus spor? sudygim? skatino 1 % laktoz?s, 1 % tirpaus krakmolo ir 0,5–1,0 % sacharoz?s. ?vairios amino...

S?alomskiene?, Joana; Jurks?taite?, D.

2006-01-01

2

Cadmium Ion Biosorption by the Thermophilic Bacteria Geobacillus stearothermophilus and G. thermocatenulatus  

OpenAIRE

This study reports surface complexation models (SCMs) for quantifying metal ion adsorption by thermophilic microorganisms. In initial cadmium ion toxicity tests, members of the genus Geobacillus displayed the highest tolerance to CdCl2 (as high as 400 to 3,200 ?M). The thermophilic, gram-positive bacteria Geobacillus stearothermophilus and G. thermocatenulatus were selected for further electrophoretic mobility, potentiometric titration, and Cd2+ adsorption experiments to characterize Cd2+ co...

Hetzer, Adrian; Daughney, Christopher J.; Morgan, Hugh W.

2006-01-01

3

Substrate-Ligand Interactions in Geobacillus Stearothermophilus Nitric Oxide Synthase†  

OpenAIRE

Ntric oxide synthase (NOS) generates NO via a sequential two-step reaction, L-arginine (L-Arg) ? N-hydroxy-L-arginine (NOHA) ? L-citrulline + NO. Each step of the reaction follows a distinct mechanism defined by the chemical environment introduced by each substrate bound to the heme active site. The dioxygen complex of the NOS enzyme from a thermophilic bacterium, Geobacillus stearothermophilus (gsNOS), is unusually stable; hence it provides a unique model for the studies of the mechanist...

Kabir, Mariam; Sudhamsu, Jawahar; Crane, Brian R.; Yeh, Syun-ru; Rousseau, Denis L.

2008-01-01

4

Genotypic and phenotypic characterization of foodborne Geobacillus stearothermophilus.  

Science.gov (United States)

Geobacillus stearothermophilus is the main thermophilic spore former involved in flat sour spoilage of canned foods. Three typing methods were tested and applied to differentiate strains at intra-species level: panC sequence analysis, REP-PCR and M13-PCR. panC gene was highly conserved within the studied strains, suggesting a low intra-specific diversity. This was supported by REP-PCR primary assays and M13-PCR results. M13-PCR profile analysis succeeded in differentiating six closely related groups (at 79% threshold similarity) among 127 strains from a range of spoiled canned food products and from different canneries. Phenotypic traits were investigated among 20 selected strains representing groups and origins. Ranges of growth under different temperatures (from 40 °C to 70 °C), pH (from 5.0 to 6.5), NaCl concentrations (from 1 to 5%) and sporulation conditions poorly differed between strains, but wet heat resistance of spores showed a 20-fold variation between strains. Furthermore, in this study, strains that belonged to the same M13-PCR genetic group did not share phenotypic characteristics or common origin. The work emphasizes a low diversity within the G. stearothermophilus species but data from this study may contribute to a better control of G. stearothermophilus spoilage in canned food. PMID:25481066

Durand, Loïc; Planchon, Stella; Guinebretiere, Marie-Hélène; Carlin, Frédéric; Remize, Fabienne

2015-02-01

5

FORMALDEHYDE GAS INACTIVATION OF BACILLUS ANTHRACIS, BACILLUS SUBTILIS AND GEOBACILLUS STEAROTHERMOPHILUS SPORES ON INDOOR SURFACE MATERIALS.  

Science.gov (United States)

Research evaluated the decontamination of Bacillus anthracis, Bacillus subtilis, and Geobacillus stearothermophilus spores on indoor surface material using formaldehyde gas. Spores were dried on seven types of indoor surfaces and exposed to 1100 ppm formaldehyde gas for 10 hr. Fo...

6

Safety evaluation of a thermolysin enzyme produced from Geobacillus stearothermophilus.  

Science.gov (United States)

Thermolysin is a zinc metalloprotease that has potential uses in the food industry. The safety of thermolysin has not been demonstrated before, and therefore a series of standard toxicological tests to assess its potential toxicity was undertaken. The thermolysin used in this study was derived from the thermophilic bacterium Geobacillus stearothermophilus, which had undergone chemical mutagenesis to generate strains with increased thermolysin production. Acute toxicity studies in rats and mice showed that thermolysin powder is not acutely toxic with an oral LD?? of more than 18,000 mg/kg (2520 mg/kg thermolysin protein) in rats and more than 24,000 mg/kg (3360 mg/kg protein) in mice. Subchronic feeding studies in rats for 91 days at doses up to 1000 mg/kg (390 mg/kg protein) revealed no significant differences between treated and non-treated groups and a No Observed Effect Level (NOEL) of 1000 mg/kg (390 mg/kg protein) per day was established. Results from genotoxicity tests such as in vitro chromosomal aberration assay and in vivo mouse micronucleus were negative. Allergenicity sequence analysis revealed no evidence suggesting that thermolysin is an allergen. The data presented in this study support the conclusion that thermolysin is safe for use in food production. PMID:23831195

Ke, Qingdong; Chen, Alice; Minoda, Masashi; Yoshida, Hiromichi

2013-09-01

7

Kinetics of Germination of Individual Spores of Geobacillus stearothermophilus as Measured by Raman Spectroscopy and Differential Interference Contrast Microscopy  

OpenAIRE

Geobacillus stearothermophilus is a gram-positive, thermophilic bacterium, spores of which are very heat resistant. Raman spectroscopy and differential interference contrast microscopy were used to monitor the kinetics of germination of individual spores of G. stearothermophilus at different temperatures, and major conclusions from this work were as follows. 1) The CaDPA level of individual G. stearothermophilus spores was similar to that of Bacillus spores. However, the Raman spectra of prot...

Zhou, Tingting; Dong, Zhiyang; Setlow, Peter; Li, Yong-qing

2013-01-01

8

Structural Analysis of Xylanase from Marine Thermophilic Geobacillus stearothermophilus in Tanjung Api, Poso, Indonesia  

OpenAIRE

A xylanase gene, xynA, has been cloned from thermophilic strain Geobacillus stearothermophilus, which was isolated from marine Tanjung Api, Indonesia. The polymerase chain reaction product of 1266 bp of xynA gene consisted of 1221 bp open reading frame and encoded 407 amino acids including 30 residues of signal peptide. The sequence exhibited highest identity of 98.7% in the level of amino acid, with an extracellular endo-1,4-?-xylanase from G. stearothermophilus T-6 (E-GSX T-6) of the glyco...

BUDI SAKSONO; LINDA SUKMARINI

2010-01-01

9

Evolved ?-Galactosidases from Geobacillus stearothermophilus with Improved Transgalactosylation Yield for Galacto-Oligosaccharide Production? †  

OpenAIRE

A mutagenesis approach was applied to the ?-galactosidase BgaB from Geobacillus stearothermophilus KVE39 in order to improve its enzymatic transglycosylation of lactose into oligosaccharides. A simple screening strategy, which was based on the reduction of the hydrolysis of a potential transglycosylation product (lactosucrose), provided mutant enzymes possessing improved synthetic properties for the autocondensation product from nitrophenyl-galactoside and galacto-oligosaccharides (GOS) from...

Placier, Gae?l; Watzlawick, Hildegard; Rabiller, Claude; Mattes, Ralf

2009-01-01

10

Isolation of Glucocardiolipins from Geobacillus stearothermophilus NRS 2004/3a  

OpenAIRE

Glucose-substituted cardiolipins account for about 4 mol% of total phospholipid extracted from exponentially grown cells of Geobacillus stearothermophilus NRS 2004/3a. Individual glucocardiolipin species exhibited differences in fatty acid substitution, with iso-C15:0 and anteiso-C17:0 prevailing. The compounds were purified to homogeneity by a novel protocol and precharacterized by matrix-assisted laser desorption ionization time-of-flight mass spectrometry.

Scha?ffer, Christina; Beckedorf, Anke I.; Scheberl, Andrea; Zayni, Sonja; Peter-katalinic?, Jasna; Messner, Paul

2002-01-01

11

Inactivation of Geobacillus stearothermophilus Spores by High-Pressure Carbon Dioxide Treatment  

OpenAIRE

High-pressure CO2 treatment has been studied as a promising method for inactivating bacterial spores. In the present study, we compared this method with other sterilization techniques, including heat and pressure treatment. Spores of Bacillus coagulans, Bacillus subtilis, Bacillus cereus, Bacillus licheniformis, and Geobacillus stearothermophilus were subjected to CO2 treatment at 30 MPa and 35°C, to high-hydrostatic-pressure treatment at 200 MPa and 65°C, or to heat treatment at 0.1 MPa an...

Watanabe, Taisuke; Furukawa, Soichi; Hirata, Junichi; Koyama, Tetsuya; Ogihara, Hirokazu; Yamasaki, Makari

2003-01-01

12

Thermal adaptation of dihydrofolate reductase from the moderate thermophile Geobacillus stearothermophilus.  

Science.gov (United States)

The thermal melting temperature of dihydrofolate reductase from Geobacillus stearothermophilus (BsDHFR) is ~30 °C higher than that of its homologue from the psychrophile Moritella profunda. Additional proline residues in the loop regions of BsDHFR have been proposed to enhance the thermostability of BsDHFR, but site-directed mutagenesis studies reveal that these proline residues contribute only minimally. Instead, the high thermal stability of BsDHFR is partly due to removal of water-accessible thermolabile residues such as glutamine and methionine, which are prone to hydrolysis or oxidation at high temperatures. The extra thermostability of BsDHFR can be obtained by ligand binding, or in the presence of salts or cosolvents such as glycerol and sucrose. The sum of all these incremental factors allows BsDHFR to function efficiently in the natural habitat of G. stearothermophilus, which is characterized by temperatures that can reach 75 °C. PMID:24730604

Guo, Jiannan; Luk, Louis Y P; Loveridge, E Joel; Allemann, Rudolf K

2014-05-01

13

Transformable facultative thermophile Geobacillus stearothermophilus NUB3621 as a host strain for metabolic engineering.  

Science.gov (United States)

Metabolic engineers develop inexpensive enantioselective syntheses of high-value compounds, but their designs are sometimes confounded by the misfolding of heterologously expressed proteins. Geobacillus stearothermophilus NUB3621 is a readily transformable facultative thermophile. It could be used to express and properly fold proteins derived from its many mesophilic or thermophilic Bacillaceae relatives or to direct the evolution of thermophilic variants of mesophilic proteins. Moreover, its capacity for high-temperature growth should accelerate chemical transformation rates in accordance with the Arrhenius equation and reduce the risks of microbial contamination. Its tendency to sporulate in response to nutrient depletion lowers the costs of storage and transportation. Here, we present a draft genome sequence of G. stearothermophilus NUB3621 and describe inducible and constitutive expression plasmids that function in this organism. These tools will help us and others to exploit the natural advantages of this system for metabolic engineering applications. PMID:24788326

Blanchard, Kristen; Robic, Srebrenka; Matsumura, Ichiro

2014-08-01

14

Analysis of the tryptophanase expression in Symbiobacterium thermophilum in a coculture with Geobacillus stearothermophilus.  

Science.gov (United States)

The tryptophanase-positive Symbiobacterium thermophilum is a free-living syntrophic bacterium that grows effectively in a coculture with Geobacillus stearothermophilus. Our studies have shown that S. thermophilum growth depends on the high CO2 and low O2 condition established by the precedent growth of G. stearothermophilus. The use of an anoxic atmosphere containing high CO2 allows S. thermophilum to grow independently of G. stearothermophilus, but the cellular yield is ten times lower than that achieved in the coculture. In this study, we characterized the coculture-dependent expression and activity of tryptophanase in S. thermophilum. S. thermophilum cells accumulated a marked amount of indole in a coculture with G. stearothermophilus, but not in the bacterium's pure culture irrespective of the addition of tryptophan. S. thermophilum cells accumulated indole in its pure culture consisting of conditioned medium (medium supplied with culture supernatant of G. stearothermophilus). Proteomic analysis identified the protein specifically produced in the S. thermophilum cells grown in conditioned medium, which was a tryptophanase encoded by tna2 (STH439). An attempt to isolate the tryptophanase-inducing component from the culture supernatant of G. stearothermophilus was unsuccessful, but we did discover that the indole accumulation occurs when 10 mM bicarbonate is added to the medium. RT-PCR analysis showed that the addition of bicarbonate stimulated transcription of tna2. The transcriptional start site, identified within the tna2 promoter, was preceded by the -24 and -12 consensus sequences specified by an alternative sigma factor, ?(54). The evidence suggests that the transcription of some genes involved in amino acid metabolism is ?(54)-dependent, and that a bacterial enhancer-binding protein containing a PAS domain controls the transcription under the presence of high levels of bicarbonate. PMID:25200839

Watsuji, Tomo-O; Takano, Hideaki; Yamabe, Tomoya; Tamazawa, Satoshi; Ikemura, Hiroka; Ohishi, Takanori; Matsuda, Tohyo; Shiratori-Takano, Hatsumi; Beppu, Teruhiko; Ueda, Kenji

2014-12-01

15

Molecular Basis of S-layer Glycoprotein Glycan Biosynthesis in Geobacillus stearothermophilus*S?  

OpenAIRE

The Gram-positive bacterium Geobacillus stearothermophilus NRS 2004/3a possesses a cell wall containing an oblique surface layer (S-layer) composed of glycoprotein subunits. O-Glycans with the structure [?2)-?-l-Rhap-(1?3)-?-l-Rhap-(1?2)-?-l-Rhap-(1?]n = 13-18, a2-O-methyl group capping the terminal repeating unit at the nonreducing end and a ?2)-?-l-Rhap-[(1?3)-?-l-Rhap]n = 1-2(1?3)- adaptor are linked via a ?-d-Galp residue to distinct sit...

Steiner, Kerstin; Novotny, Rene?; Werz, Daniel B.; Zarschler, Kristof; Seeberger, Peter H.; Hofinger, Andreas; Kosma, Paul; Scha?ffer, Christina; Messner, Paul

2008-01-01

16

Etude de la transcétolase de Geobacillus stearothermophilus et modification de son énantiosélectivité par ingénierie enzymatique  

OpenAIRE

Transketolase (TK, EC 2.2.1.1) catalyzes the formation of D-threo ketoses from (2R)-?-hydroxyaldehydes by the stereospecific formation of a C-C bond. Our aim was to invert the enantioselectivity of TK by protein engineering in order to obtain L-erytho ketoses (sought after for their potential pharmaceutical and/or nutritional applications) from (2S)-?-hydroxyaldehydes. For that purpose, a thermostable TK from thermophilic bacterium Geobacillus stearothermophilus (mTKgst) has been identified...

Abdoul-zabar, Juliane

2014-01-01

17

Kinetics of CO Recombination to the Heme in Geobacillus Stearothermophilus Nitric Oxide Synthase.  

Science.gov (United States)

We report the kinetics of CO rebinding to the heme in His134Ser, Ile223Val and His134Ser/Ile223Ser mutants of Geobacillus stearothermophilus nitric oxide synthase (gsNOS). The amplitudes of the two observed kinetics phases, which are insensitive to CO concentration, depend on enzyme concentration. We suggest that two forms of gsNOS are in equilibrium under the conditions employed (6.1-27 µM gsNOS with 20 or 100% CO atmosphere). The kinetics of CO rebinding to the heme do not depend on the identity of the NO-gate residues at positions 134 and 223. PMID:23976816

Whited, Charlotte A; Warren, Jeffrey J; Lavoie, Katherine D; Winkler, Jay R; Gray, Harry B

2013-07-13

18

A Group IIC-Type Intron Interrupts the rRNA Methylase Gene of Geobacillus stearothermophilus Strain 10?  

OpenAIRE

Group IIC introns insert next to the stem-loop structure of rho-independent transcription terminators, thus avoiding intact genes. The insertion sites of 17 copies of the G.st.I1 intron from Geobacillus stearothermophilus were compared. One copy of the intron was found to interrupt an open reading frame (ORF) encoding an rRNA methylase.

Moretz, Samuel E.; Lampson, Bert C.

2010-01-01

19

Strukturen der beta-D-Xylosidase aus Geobacillus stearothermophilus T-6 in verschiedenen kristallinen und funktionellen Zuständen  

OpenAIRE

In dieser Arbeit wird die Struktur der beta-Xylosidase aus Geobacillus stearothermophilus vorgestellt. Die Xylosidase gehört zur Glykosid-Hydrolase Familie 43. Sie zeigt ein fünf flügelige beta-Propeller Faltung. Darüber hinaus werden die Strukturen von drei katalytisch inaktiven Punktmutanten, jeweils kokristallisiert mit den natürlichen Substrat Xylobiose, beschrieben. Die daraus gewonnenen Erkenntnisse erlauben eine strukturelle Erklärung der Quartärstruktur, Reaktionsmechanismus un...

Bru?x, Christian

2005-01-01

20

Structural Analysis of Xylanase from Marine Thermophilic Geobacillus stearothermophilus in Tanjung Api, Poso, Indonesia  

Directory of Open Access Journals (Sweden)

Full Text Available A xylanase gene, xynA, has been cloned from thermophilic strain Geobacillus stearothermophilus, which was isolated from marine Tanjung Api, Indonesia. The polymerase chain reaction product of 1266 bp of xynA gene consisted of 1221 bp open reading frame and encoded 407 amino acids including 30 residues of signal peptide. The sequence exhibited highest identity of 98.7% in the level of amino acid, with an extracellular endo-1,4-?-xylanase from G. stearothermophilus T-6 (E-GSX T-6 of the glycoside hydrolase family 10 (GH10. A comparative study between the local strain G. stearothermophilus (GSX L and E-GSX T-6 on homology of amino acid sequence indicated five differents amino acids in the gene. They were Threonine/Alanine (T/A, Asparagine/Aspartate (N/D, Lysine/Asparagine (K/N, Isoleucine/Methionine (I/M, Serine/Threonine (S/T at the position 220, 227, 228, 233, and 245, respectively. Protein structural analysis of those differences suggested that those amino acids may play role in biochemical properties such as enzyme stability, in particular its thermostability.

BUDI SAKSONO

2010-12-01

21

Quantitative assessment of the risk of microbial spoilage in foods. Prediction of non-stability at 55 °C caused by Geobacillus stearothermophilus in canned green beans.  

Science.gov (United States)

Microbial spoilage of canned foods by thermophilic and highly heat-resistant spore-forming bacteria, such as Geobacillus stearothermophilus, is a persistent problem in the food industry. An incubation test at 55 °C for 7 days, then validation of biological stability, is used as an indicator of compliance with good manufacturing practices. We propose a microbial risk assessment model predicting the percentage of non-stability due to G. stearothermophilus in canned green beans manufactured by a French company. The model accounts for initial microbial contaminations of fresh unprocessed green beans with G. stearothermophilus, cross-contaminations in the processing chain, inactivation processes and probability of survival and growth. The sterilization process is modeled by an equivalent heating time depending on sterilization value F? and on G. stearothermophilus resistance parameter z(T). Following the recommendations of international organizations, second order Monte-Carlo simulations are used, separately propagating uncertainty and variability on parameters. As a result of the model, the mean predicted non-stability rate is of 0.5%, with a 95% uncertainty interval of [0.1%; 1.2%], which is highly similar to data communicated by the French industry. A sensitivity analysis based on Sobol indices and some scenario tests underline the importance of cross-contamination at the blanching step, in addition to inactivation due to the sterilization process. PMID:24334097

Rigaux, Clémence; André, Stéphane; Albert, Isabelle; Carlin, Frédéric

2014-02-01

22

Physicochemical characteristics of a thermostable gellan lyase from Geobacillus stearothermophilus 98.  

Science.gov (United States)

A purified thermostable gellan lyase, produced by a thermophilic bacterium, Geobacillus stearothermophilus 98, was characterized in relation to its physicochemical properties. The gellan lyase was established to have a molecular weight of 216 kDa, defined by capillary gel electrophoresis. Amino acid analysis revealed high quantities of Lys, His, Ala, Val, Ile, Glx, and Pro residues. The circular dichroism revealed 45% beta-structure and practically lack of a-spiral domains. Kinetic studies showed high affinity of the enzyme to gellan as a substrate (Km = 0.21 microM). The thermal denaturation investigated by cicular dichroism showed a highly cooperative transition with a midpoint (Tm) at about 75 degrees C. A single product was identified after enzyme action on gellan. Large exothermic aggregation near Tm was observed by differential scanning calorimetry. Two types of gellan lyase crystals were reproducibly isolated. PMID:20469643

Derekova, Anna; Atanassova, Miroslava; Christova, Petya; Tchorbanov, Bojidar; Shosheva, Alexandra; Mandeva, Rossitsa; Rodríguez-Alonso, Patricia; Garabal, Jose I; Kambourova, Margarita

2010-01-01

23

In situ investigation of Geobacillus stearothermophilus spore germination and inactivation mechanisms under moderate high pressure.  

Science.gov (United States)

Bacterial spores are a major concern for food safety due to their high resistance to conventional preservation hurdles. Innovative hurdles can trigger bacterial spore germination or inactivate them. In this work, Geobacillus stearothermophilus spore high pressure (HP) germination and inactivation mechanisms were investigated by in situ infrared spectroscopy (FT-IR) and fluorometry. G. stearothermophilus spores' inner membrane (IM) was stained with Laurdan fluorescent dye. Time-dependent FT-IR and fluorescence spectra were recorded in situ under pressure at different temperatures. The Laurdan spectrum is affected by the lipid packing and level of hydration, and provided information on the IM state through the Laurdan generalized polarization. Changes in the -CH2 and -CH3 asymmetric stretching bands, characteristic of lipids, and in the amide I' band region, characteristic of proteins' secondary structure elements, enabled evaluation of the impact of HP on endospores lipid and protein structures. These studies were complemented by ex situ analyses (plate counts and microscopy). The methods applied showed high potential to identify germination mechanisms, particularly associated to the IM. Germination up to 3 log10 was achieved at 200 MPa and 55 °C. A molecular-level understanding of these mechanisms is important for the development and validation of multi-hurdle approaches to achieve commercial sterility. PMID:24750808

Georget, Erika; Kapoor, Shobhna; Winter, Roland; Reineke, Kai; Song, Youye; Callanan, Michael; Ananta, Edwin; Heinz, Volker; Mathys, Alexander

2014-08-01

24

Tryptophan Oxidative Metabolism Catalyzed by Geobacillus Stearothermophilus: A Thermophile Isolated from Kuwait Soil Contaminated with Petroleum Hydrocarbons  

OpenAIRE

Tryptophan metabolism has been extensively studied in humans as well as in soil. Its metabolism takes place mainly through kynurenine pathway yielding hydroxylated, deaminated and many other products of physiological significance. However, tryptophan metabolism has not been studied in an isolated thermophilic bacterium. Geobacillus stearothermophilus is a local thermophile isolated from Kuwait desert soil contaminated with petroleum hydrocarbons. The bacterium grows well at 65 °C in 0.05 M p...

Al-hassan, Jassim M.; Samira Al-Awadi; Sosamma Oommen; Abdulaziz Alkhamis; Mohammad Afzal

2011-01-01

25

Recombinant production and characterisation of phenol oxidising enzymes from Geobacillus stearothermophilus for the evaluation of a biosensor application  

OpenAIRE

In der vorliegenden Arbeit wurde die Organisation der Phenolhydroxylase aus Geobacillus stearothermophilus auf genetischer Ebene genauer aufgeklärt. Es wurden die Einzelkomponenten Phe A1 (Oxygenase-Komponente), Phe A2 (Flavin-Reduktase-Komponente) und ein Tandemkonstrukt aus beiden Komponenten rekombinant mit einem E.coli-Expressionsstamm produziert. Durch das Einfügen eines Hexahistidin-tags konnten alle Enzyme erstmals bis zur Homogenität aufgereinigt werden. Die Phe A2-Komponente konnt...

Ja?ntges, Uwe Konrad

2006-01-01

26

??????? ????????? ???????? ?? ???????? ????????? ?? ??????? Geobacillus stearothermophilus  

OpenAIRE

??????????? ??????????? ????????? ???????? ????????? ??I-1. ? ?????? ???????????? ?????? ?? ???????? ??????? ?????????? ???????, ?????????????? ??????????? ????, ?? ????????? ????? ????????? ?? ????? ??? ????????? ? ???????? ??????. ???????????, ??? ????????? ? ??????...

S?alomskiene?, Joana; Jurks?taite?, Dovile?; Z?virdauskiene?, Renata

2007-01-01

27

Purification and characterization of cloned alkaline protease gene of Geobacillus stearothermophilus.  

Science.gov (United States)

Thermostable alkaline serine protease gene of Geobacillus stearothermophilus B-1172 was cloned and expressed in Escherichia coli BL21 (DE3) using pET-22b(+), as an expression vector. The growth conditions were optimized for maximal production of the protease using variable fermentation parameters, i.e., pH, temperature, and addition of an inducer. Protease, thus produced, was purified by ammonium sulfate precipitation followed by ion exchange chromatography with 13.7-fold purification, with specific activity of 97.5?U?mg(-1) , and a recovery of 23.6%. Molecular weight of the purified protease, 39?kDa, was determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). The enzyme was stable at 90?°C at pH 9. The enzyme activity was steady in the presence of EDTA indicating that the protease was not a metalloprotease. No significant change in the activity of protease after addition of various metal ions further strengthened this fact. However, an addition of 1% Triton X-100 or SDS surfactants constrained the enzyme specific activity to 34 and 19%, respectively. Among organic solvents, an addition of 1-butanol (20%) augmented the enzyme activity by 29% of the original activity. With casein as a substrate, the enzyme activity under optimized conditions was found to be 73.8?U?mg(-1) . The effect of protease expression on the host cells growth was also studied and found to negatively affect E. coli cells to certain extent. Catalytic domains of serine proteases from eight important thermostable organisms were analyzed through WebLogo and found to be conserved in all serine protease sequences suggesting that protease of G. stearothermophilus could be beneficially used as a biocontrol agent and in many industries including detergent industry. PMID:25224381

Iqbal, Irfana; Aftab, Muhammad Nauman; Afzal, Mohammed; Ur-Rehman, Asad; Aftab, Saima; Zafar, Asma; Ud-Din, Zia; Khuharo, Ateeque Rahman; Iqbal, Jawad; Ul-Haq, Ikram

2015-02-01

28

Physicochemical characterization of tensio-active produced by Geobacillus stearothermophilus isolated from petroleum-contaminated soil.  

Science.gov (United States)

Biosurfactants are surface-active agents of microbial origin, and have a property of lowering the interfacial tension between two liquids. They act on the interface and are amphiphathic molecules; in with both hydrophilic and hydrophobic portions are present in the same molecule. However, the economics of producing biosurfactant has limited its commercial applications, and the costs can be reduced using cheap substrates or industrial waste. The present study showed the biosurfactant production using corn steep liquor and palm oil as carbon and nitrogen sources for reduction the costs of production. The biosurfactant production by Geobacillus stearothermophilus UCP 986 was carried out using optimized culture medium constituted by palm oil (7.5%) and corn steep liquor (4.5%) using Bioflo fermentor, at temperature of 45°C, during 32 h and agitation of 300 rpm. The biosurfactant showed a reduction of the water surface tension of 72-31 mN/m and interfacial tension of 0.3 mN/m. The biosurfactant was obtained from the net metabolic liquid by acetone precipitation corresponding to the yield of 2.3g/L. The isolate biosurfactant showed a CMC of 2.5% and non-ionic profile. The best emulsification index (E(24)) obtained was 87% using motor oil burned. The biosurfactant solution (2.5%) used in oil spreading test increases the viscosity of engine burning oil of 149.2% and 138.2% to vegetable fat post-frying, respectively. The gas chromatography-mass spectrometer indicated at 29.52 min a molecular weight of 207 Da and eight peaks by FT-IR identified the chemical structure of the biosurfactant produced by G. stearothermophilus. PMID:23010035

Jara, Alícia M A T; Andrade, Rosileide F S; Campos-Takaki, Galba M

2013-01-01

29

Crystallization and preliminary crystallographic analysis of Abp, a GH27 ?-L-arabinopyranosidase from Geobacillus stearothermophilus.  

Science.gov (United States)

Geobacillus stearothermophilus T-6 is a thermophilic soil bacterium that possesses an extensive system for the utilization of hemicellulose. The bacterium produces a small number of endo-acting extracellular enzymes that cleave high-molecular-weight hemicellulolytic polymers into short decorated oligosaccharides, which are further hydrolysed into the respective sugar monomers by a battery of intracellular glycoside hydrolases. One of these intracellular processing enzymes is ?-L-arabinopyranosidase (Abp), which is capable of removing ?-L-arabinopyranose residues from naturally occurring arabino-polysaccharides. As arabino-polymers constitute a significant part of the hemicellulolytic content of plant biomass, their efficient enzymatic degradation presents an important challenge for many potential biotechnological applications. This aspect has led to an increasing interest in the biochemical characterization and structural analysis of this and related hemicellulases. Abp from G. stearothermophilus T-6 has recently been cloned, overexpressed, purified, biochemically characterized and crystallized in our laboratory, as part of its complete structure-function study. The best crystals obtained for this enzyme belonged to the primitive orthorhombic space group P2(1)2(1)2(1), with average unit-cell parameters a = 107.7, b = 202.2, c = 287.3 Å. Full diffraction data sets to 2.3 Å resolution have been collected for both the wild-type enzyme and its D197A catalytic mutant from flash-cooled crystals at 100 K, using synchrotron radiation. These data are currently being used for a high-resolution three-dimensional structure determination of Abp. PMID:23722857

Lansky, Shifra; Salama, Rachel; Solomon, Vered H; Belrhali, Hassan; Shoham, Yuval; Shoham, Gil

2013-06-01

30

Structure of a His170Tyr mutant of thermostable pNPPase from Geobacillus stearothermophilus.  

Science.gov (United States)

Using directed evolution based on random mutagenesis and heat-treated selection, a thermostable His170Tyr mutant of Geobacillus stearothermophilus thermostable p-nitrophenylphosphatase (TpNPPase) was obtained. The temperature at which the His170Tyr mutant lost 50% of its activity (T1/2) was found to be 4.40?K higher than that of wild-type TpNPPase, and the melting temperature of the His170Tyr mutant increased by 2.39?K. The crystal structure of the His170Tyr mutant was then determined at 2.0?Å resolution in the presence of a sodium ion and a sulfate ion in the active site. The cap domain of chain B shows a half-closed conformation. The hydrophobic side chain of the mutated residue, the hydroxyphenyl group, forms a hydrophobic contact with the methyl group of Ala166. This hydrophobic interaction was found using the Protein Interactions Calculator (PIC) web server with an interaction distance of 4.6?Å, and might be a key factor in the thermostabilization of the His170Tyr mutant. This study potentially offers a molecular basis for both investigation of the catalytic mechanism and thermostable protein engineering. PMID:24915075

Shen, Tiantian; Guo, Zheng; Ji, Chaoneng

2014-06-01

31

Structure-Specificity Relationships of an Intracellular Xylanase from Geobacillus stearothermophilus  

Energy Technology Data Exchange (ETDEWEB)

Geobacillus stearothermophilus T-6 is a thermophilic Gram-positive bacterium that produces two selective family 10 xylanases which both take part in the complete degradation and utilization of the xylan polymer. The two xylanases exhibit significantly different substrate specificities. While the extracellular xylanase (XT6; MW 43.8 kDa) hydrolyzes the long and branched native xylan polymer, the intracellular xylanase (IXT6; MW 38.6 kDa) preferentially hydrolyzes only short xylo-oligosaccharides. In this study, the detailed three-dimensional structure of IXT6 is reported, as determined by X-ray crystallography. It was initially solved by molecular replacement and then refined at 1.45 {angstrom} resolution to a final R factor of 15.0% and an R{sub free} of 19.0%. As expected, the structure forms the classical ({alpha}/{beta}){sub 8} fold, in which the two catalytic residues (Glu134 and Glu241) are located on the inner surface of the central cavity. The structure of IXT6 was compared with the highly homologous extracellular xylanase XT6, revealing a number of structural differences between the active sites of the two enzymes. In particular, structural differences derived from the unique subdomain in the carboxy-terminal region of XT6, which is completely absent in IXT6. These structural modifications may account for the significant differences in the substrate specificities of these otherwise very similar enzymes.

Solomon,V.; Teplitsky, A.; Shulami, S.; Zolotnitsky, G.; Shoham, Y.; Shoham, G.

2007-01-01

32

The Geobacillus stearothermophilus V iscS Gene, Encoding Cysteine Desulfurase, Confers Resistance to Potassium Tellurite in Escherichia coli K-12  

OpenAIRE

Many eubacteria are resistant to the toxic oxidizing agent potassium tellurite, and tellurite resistance involves diverse biochemical mechanisms. Expression of the iscS gene from Geobacillus stearothermophilus V, which is naturally resistant to tellurite, confers tellurite resistance in Escherichia coli K-12, which is naturally sensitive to tellurite. The G. stearothermophilus iscS gene encodes a cysteine desulfurase. A site-directed mutation in iscS that prevents binding of its pyridoxal pho...

Tantalea?n, Juan C.; Araya, Manuel A.; Saavedra, Claudia P.; Fuentes, Derie E.; Pe?rez, Jose? M.; Caldero?n, Iva?n L.; Youderian, Philip; Va?squez, Claudio C.

2003-01-01

33

A Two-Component System Regulates the Expression of an ABC Transporter for Xylo-Oligosaccharides in Geobacillus stearothermophilus?  

OpenAIRE

Geobacillus stearothermophilus T-6 utilizes an extensive and highly regulated hemicellulolytic system. The genes comprising the xylanolytic system are clustered in a 39.7-kb chromosomal segment. This segment contains a 6-kb transcriptional unit (xynDCEFG) coding for a potential two-component system (xynDC) and an ATP-binding cassette (ABC) transport system (xynEFG). The xynD promoter region contains a 16-bp inverted repeat resembling the operator site for the xylose repressor, XylR. XylR was ...

Shulami, Smadar; Zaide, Galia; Zolotnitsky, Gennady; Langut, Yael; Feld, Geoff; Sonenshein, Abraham L.; Shoham, Yuval

2007-01-01

34

Multiple regulatory mechanisms control the expression of the Geobacillus stearothermophilus gene for extracellular xylanase.  

Science.gov (United States)

Geobacillus stearothermophilus T-6 produces a single extracellular xylanase (Xyn10A) capable of producing short, decorated xylo-oligosaccharides from the naturally branched polysaccharide, xylan. Gel retardation assays indicated that the master negative regulator, XylR, binds specifically to xylR operators in the promoters of xylose and xylan-utilization genes. This binding is efficiently prevented in vitro by xylose, the most likely molecular inducer. Expression of the extracellular xylanase is repressed in medium containing either glucose or casamino acids, suggesting that carbon catabolite repression plays a role in regulating xynA. The global transcriptional regulator CodY was shown to bind specifically to the xynA promoter region in vitro, suggesting that CodY is a repressor of xynA. The xynA gene is located next to an uncharacterized gene, xynX, that has similarity to the NIF3 (Ngg1p interacting factor 3)-like protein family. XynX binds specifically to a 72-bp fragment in the promoter region of xynA, and the expression of xynA in a xynX null mutant appeared to be higher, indicating that XynX regulates xynA. The specific activity of the extracellular xylanase increases over 50-fold during early exponential growth, suggesting cell density regulation (quorum sensing). Addition of conditioned medium to fresh and low cell density cultures resulted in high expression of xynA, indicating that a diffusible extracellular xynA density factor is present in the medium. The xynA density factor is heat-stable, sensitive to proteases, and was partially purified using reverse phase liquid chromatography. Taken together, these results suggest that xynA is regulated by quorum-sensing at low cell densities. PMID:25070894

Shulami, Smadar; Shenker, Ofer; Langut, Yael; Lavid, Noa; Gat, Orit; Zaide, Galia; Zehavi, Arie; Sonenshein, Abraham L; Shoham, Yuval

2014-09-12

35

Draft Genome Sequences of Geobacillus stearothermophilus Strains 22 and 53, Isolated from the Garga Hot Spring in the Barguzin River Valley of the Russian Federation.  

Science.gov (United States)

Geobacillus stearothermophilus strains 22 and 53 were isolated from sediment samples isolated from the Garga hot spring (72°C) located in the valley of the river Barguzin (the Baikal region, Russian Federation) (54°19'3.72?N, 110°59'38.4?E). PMID:25414504

Rozanov, Aleksey S; Logacheva, Maria D; Peltek, Sergey E

2014-01-01

36

A unique octameric structure of Axe2, an intracellular acetyl-xylooligosaccharide esterase from Geobacillus stearothermophilus.  

Science.gov (United States)

Geobacillus stearothermophilus T6 is a thermophilic, Gram-positive soil bacterium that possesses an extensive and highly regulated hemicellulolytic system, allowing the bacterium to efficiently degrade high-molecular-weight polysaccharides such as xylan, arabinan and galactan. As part of the xylan-degradation system, the bacterium uses a number of side-chain-cleaving enzymes, one of which is Axe2, a 219-amino-acid intracellular serine acetylxylan esterase that removes acetyl side groups from xylooligosaccharides. Bioinformatic analyses suggest that Axe2 belongs to the lipase GDSL family and represents a new family of carbohydrate esterases. In the current study, the detailed three-dimensional structure of Axe2 is reported, as determined by X-ray crystallography. The structure of the selenomethionine derivative Axe2-Se was initially determined by single-wavelength anomalous diffraction techniques at 1.70?Å resolution and was used for the structure determination of wild-type Axe2 (Axe2-WT) and the catalytic mutant Axe2-S15A at 1.85 and 1.90?Å resolution, respectively. These structures demonstrate that the three-dimensional structure of the Axe2 monomer generally corresponds to the SGNH hydrolase fold, consisting of five central parallel ?-sheets flanked by two layers of helices (eight ?-helices and five 310-helices). The catalytic triad residues, Ser15, His194 and Asp191, are lined up along a substrate channel situated on the concave surface of the monomer. Interestingly, the Axe2 monomers are assembled as a `doughnut-shaped' homo-octamer, presenting a unique quaternary structure built of two staggered tetrameric rings. The eight active sites are organized in four closely situated pairs, which face the relatively wide internal cavity. The biological relevance of this octameric structure is supported by independent results obtained from gel-filtration, TEM and SAXS experiments. These data and their comparison to the structural data of related hydrolases are used for a more general discussion focusing on the structure-function relationships of enzymes of this category. PMID:24531461

Lansky, Shifra; Alalouf, Onit; Solomon, Hodaya Vered; Alhassid, Anat; Govada, Lata; Chayen, Naomi E; Belrhali, Hassan; Shoham, Yuval; Shoham, Gil

2014-02-01

37

Plasma sterilization of Geobacillus Stearothermophilus by O{mathsf2}:N{mathsf2} RF inductively coupled plasma  

Science.gov (United States)

The aim of this work is to identify the main process responsible for sterilization of Geobacillus Stearothermophilus spores in O{2}:N{2} RF inductively coupled plasma. In order to meet this objective the sterilization efficiencies of discharges in mixtures differing in the initial O{2}/N{2} ratios are compared with plasma properties and with scanning electron microscopy images of treated spores. According to the obtained results it can be concluded that under our experimental conditions the time needed to reach complete sterilization is more related to O atom density than UV radiation intensity, i.e. complete sterilization is not related only to DNA damage as in UV sterilization but more likely to the etching of the spore.

Kylián, O.; Sasaki, T.; Rossi, F.

2006-05-01

38

Cloning of araA Gene Encoding L-Arabinose Isomerase from Marine Geobacillus stearothermophilus Isolated from Tanjung Api, Poso, Indonesia  

Directory of Open Access Journals (Sweden)

Full Text Available L-arabinose isomerase is an enzyme converting D-galactose to D-tagatose. D-tagatose is a potential sweetener-sucrose substitute which has low calorie. This research was to clone and sequence araA gene from marine bacterial strain Geobacillus stearothermophilus isolated from Tanjung Api Poso Indonesia. The amplified araA gene consisted of 1494 bp nucleotides encoding 497 amino acids. DNA alignment analysis showed that the gene had high homology with that of G. stearothermophilus T6. The enzyme had optimum activity at high temperature and alkalin condition.

DEWI FITRIANI

2010-06-01

39

Cloning of araA Gene Encoding L-Arabinose Isomerase from Marine Geobacillus stearothermophilus Isolated from Tanjung Api, Poso, Indonesia  

OpenAIRE

L-arabinose isomerase is an enzyme converting D-galactose to D-tagatose. D-tagatose is a potential sweetener-sucrose substitute which has low calorie. This research was to clone and sequence araA gene from marine bacterial strain Geobacillus stearothermophilus isolated from Tanjung Api Poso Indonesia. The amplified araA gene consisted of 1494 bp nucleotides encoding 497 amino acids. DNA alignment analysis showed that the gene had high homology with that of G. stearothermophilus T6. The enzyme...

DEWI FITRIANI; BUDI SAKSONO

2010-01-01

40

Geobacillus stearothermophilus LV cadA gene mediates resistance to cadmium, lead and zinc in zntA mutants of Salmonella entérica serovar Typhimurium  

OpenAIRE

Salmonella entérica serovar Typhimurium cells expressing the cadA gene of Geobacillus stearothermophilus LV exhibit a hypersensitive phenotype to cadmium chloride. Deletion of the ORF STM3576 from the Salmonella genome resulted in cadmium, lead and zinc sensitivity, confirming that this ORF is a homologue of the zntA gene. The observed sensitivity was reverted upon expression of the G. stearothermophilus LV cadA gene. These results indicate that the cadA gene product is involved in Cd, Pb an...

Pe?rez, Jose? M.; Praden?as, Gonzalo A.; Navarro, Claudio A.; Henri?quez, Daniel R.; Pichuantes, Sergio E.; Va?squez, Claudio C.

2006-01-01

41

A meta-analysis accounting for sources of variability to estimate heat resistance reference parameters of bacteria using hierarchical Bayesian modeling: Estimation of D at 121.1 °C and pH 7, zT and zpH of Geobacillus stearothermophilus.  

Science.gov (United States)

Predicting microbial survival requires reference parameters for each micro-organism of concern. When data are abundant and publicly available, a meta-analysis is a useful approach for assessment of these parameters, which can be performed with hierarchical Bayesian modeling. Geobacillus stearothermophilus is a major agent of microbial spoilage of canned foods and is therefore a persistent problem in the food industry. The thermal inactivation parameters of G. stearothermophilus (D(ref), i.e.the decimal reduction time D at the reference temperature 121.1°C and pH 7.0, z(T) and z(pH)) were estimated from a large set of 430 D values mainly collected from scientific literature. Between-study variability hypotheses on the inactivation parameters D(ref), z(T) and z(pH) were explored, using three different hierarchical Bayesian models. Parameter estimations were made using Bayesian inference and the models were compared with a graphical and a Bayesian criterion. Results show the necessity to account for random effects associated with between-study variability. Assuming variability on D(ref), z(T) and z(pH), the resulting distributions for D(ref), z(T) and z(pH) led to a mean of 3.3 min for D(ref) (95% Credible Interval CI=[0.8; 9.6]), to a mean of 9.1°C for z(T) (CI=[5.4; 13.1]) and to a mean of 4.3 pH units for z(pH) (CI=[2.9; 6.3]), in the range pH 3 to pH 7.5. Results are also given separating variability and uncertainty in these distributions, as well as adjusted parametric distributions to facilitate further use of these results in aqueous canned foods such as canned vegetables. PMID:23279820

Rigaux, Clémence; Denis, Jean-Baptiste; Albert, Isabelle; Carlin, Frédéric

2013-02-01

42

Highly Stable l-Lysine 6-Dehydrogenase from the Thermophile Geobacillus stearothermophilus Isolated from a Japanese Hot Spring: Characterization, Gene Cloning and Sequencing, and Expression  

OpenAIRE

l-Lysine dehydrogenase, which catalyzes the oxidative deamination of l-lysine in the presence of NAD, was found in the thermophilic bacterium Geobacillus stearothermophilus UTB 1103 and then purified about 3,040-fold from a crude extract of the organism by using four successive column chromatography steps. This is the first report showing the presence of a thermophilic NAD-dependent lysine dehydrogenase. The product of the enzyme catalytic activity was determined to be ?1-piperideine-6-carbo...

Heydari, Mojgan; Ohshima, Toshihisa; Nunoura-kominato, Naoki; Sakuraba, Haruhiko

2004-01-01

43

Estudio del Sinergismo entre Sulfamidas en Leche y Trimetropin en un Bioensayo que Utiliza Geobacillus Stearothermophilus (Recibido: 12-02-2009 / Aceptado: 11-05-2009)  

OpenAIRE

Las sulfamidas son utilizadas frecuentemente en medicina veterinaria, y sus residuos en leche no siempre son detectados a nivel de sus Limites Máximos de Residuos por medio de métodos de inhibición microbiológica. El objetivo del trabajo fue evaluar el efecto de diferentes niveles de trimetoprim (TMP) en un bioensayo que utiliza Geobacillus stearothermophilus sobre la especificidad y los límites de detección de sulfamidas (SAs) en leche. Para ello, se prepararon 84 microplacas ELISA con...

Nagel, O. G.; Zapata, M. L.; Basilico, J. C.; Gapel, C.; Molina, P.; Althaus, R.

2010-01-01

44

Effect of Dimer Dissociation on Activity and Thermostability of the ?-Glucuronidase from Geobacillus stearothermophilus: Dissecting the Different Oligomeric Forms of Family 67 Glycoside Hydrolases  

OpenAIRE

The oligomeric organization of enzymes plays an important role in many biological processes, such as allosteric regulation, conformational stability and thermal stability. ?-Glucuronidases are family 67 glycosidases that cleave the ?-1,2-glycosidic bond between 4-O-methyl-d-glucuronic acid and xylose units as part of an array of hemicellulose-hydrolyzing enzymes. Currently, two crystal structures of ?-glucuronidases are available, those from Geobacillus stearothermophilus (AguA) and from C...

Shallom, Dalia; Golan, Gali; Shoham, Gil; Shoham, Yuval

2004-01-01

45

How to Switch Off a Histidine Kinase: Crystal Structure of Geobacillus Stearothermophilus KinB with the Inhibitor Sda  

Energy Technology Data Exchange (ETDEWEB)

Entry to sporulation in bacilli is governed by a histidine kinase phosphorelay, a variation of the predominant signal transduction mechanism in prokaryotes. Sda directly inhibits sporulation histidine kinases in response to DNA damage and replication defects. We determined a 2.0-Angstroms-resolution X-ray crystal structure of the intact cytoplasmic catalytic core [comprising the dimerization and histidine phosphotransfer domain (DHp domain), connected to the ATP binding catalytic domain] of the Geobacillus stearothermophilus sporulation kinase KinB complexed with Sda. Structural and biochemical analyses reveal that Sda binds to the base of the DHp domain and prevents molecular transactions with the DHp domain to which it is bound by acting as a simple molecular barricade. Sda acts to sterically block communication between the catalytic domain and the DHp domain, which is required for autophosphorylation, as well as to sterically block communication between the response regulator Spo0F and the DHp domain, which is required for phosphotransfer and phosphatase activities.

Bick, M.; Lamour, V; Rajashankar, K; Gordiyenko, Y; Robinson, C; Darst, S

2009-01-01

46

Protein Isotope Effects in Dihydrofolate Reductase From Geobacillus stearothermophilus Show Entropic-Enthalpic Compensatory Effects on the Rate Constant.  

Science.gov (United States)

Catalysis by dihydrofolate reductase from the moderately thermophilic bacterium Geobacillus stearothermophilus (BsDHFR) was investigated by isotope substitution of the enzyme. The enzyme kinetic isotope effect for hydride transfer was close to unity at physiological temperatures but increased with decreasing temperatures to a value of 1.65 at 5 °C. This behavior is opposite to that observed for DHFR from Escherichia coli (EcDHFR), where the enzyme kinetic isotope effect increased slightly with increasing temperature. These experimental results were reproduced in the framework of variational transition-state theory that includes a dynamical recrossing coefficient that varies with the mass of the protein. Our simulations indicate that BsDHFR has greater flexibility than EcDHFR on the ps-ns time scale, which affects the coupling of the environmental motions of the protein to the chemical coordinate and consequently to the recrossing trajectories on the reaction barrier. The intensity of the dynamic coupling in DHFRs is influenced by compensatory temperature-dependent factors, namely the enthalpic barrier needed to achieve an ideal transition-state configuration with minimal nonproductive trajectories and the protein disorder that disrupts the electrostatic preorganization required to stabilize the transition state. Together with our previous studies of other DHFRs, the results presented here provide a general explanation why protein dynamic effects vary between enzymes. Our theoretical treatment demonstrates that these effects can be satisfactorily reproduced by including a transmission coefficient in the rate constant calculation, whose dependence on temperature is affected by the protein flexibility. PMID:25396728

Luk, Louis Y P; Ruiz-Pernía, J Javier; Dawson, William M; Loveridge, E Joel; Tuñón, Iñaki; Moliner, Vicent; Allemann, Rudolf K

2014-12-10

47

Improving catalytic efficiency of endo-?-1, 4-xylanase from Geobacillus stearothermophilus by directed evolution and H179 saturation mutagenesis.  

Science.gov (United States)

Endo-?-1, 4-xylanase was cloned from Geobacillus stearothermophilus 1A05583 by PCR. Enzymes with improved catalytic efficiency were obtained using error-prone PCR and a 96-well plate high-throughout screening system. Two variants 1-B8 and 2-H6 were screened from the mutant library containing 9000 colonies, which, when compared with the wild-type enzyme increased the catalytic efficiency (kcat/Km) by 25% and 89%, respectively, acting on beechwood xylan. By sequencing 1-B8 and 2-H6, an identical mutation point H179Y was detected and found to overlap in the active site cleft. Following the introduction of the remaining 19 amino acids into position 179 by site-saturation mutagenesis, the catalytic efficiency of H179F was found to be 3.46-fold that of the wild-type. When Whistidine was substituted by tryptophan, arginine, methionine or proline, the enzyme lost activity. Therefore, the position 179 site may play an important role in regulating the catalytic efficiency. PMID:24157442

Wang, Yan; Feng, Shiyu; Zhan, Tao; Huang, Zongqing; Wu, Guojie; Liu, Ziduo

2013-12-01

48

Geobacillus stearothermophilus LV cadA gene mediates resistance to cadmium, lead and zinc in zntA mutants of Salmonella entérica serovar Typhimurium  

Scientific Electronic Library Online (English)

Full Text Available SciELO Chile | Language: English Abstract in english Salmonella entérica serovar Typhimurium cells expressing the cadA gene of Geobacillus stearothermophilus LV exhibit a hypersensitive phenotype to cadmium chloride. Deletion of the ORF STM3576 from the Salmonella genome resulted in cadmium, lead and zinc sensitivity, confirming that this ORF is a hom [...] ologue of the zntA gene. The observed sensitivity was reverted upon expression of the G. stearothermophilus LV cadA gene. These results indicate that the cadA gene product is involved in Cd, Pb and Zn resistance as a classical P-type ATPase and strongly suggest that the observed hypersensitive phenotype to these metals can be related to the function of the host ·zntA gene product

JOSÉ M, PÉREZ; GONZALO A, PRADEÑAS; CLAUDIO A, NAVARRO; DANIEL R, HENRÍQUEZ; SERGIO E, PICHUANTES; CLAUDIO C, VÁSQUEZ.

49

Geobacillus stearothermophilus LV cadA gene mediates resistance to cadmium, lead and zinc in zntA mutants of Salmonella entérica serovar Typhimurium  

Directory of Open Access Journals (Sweden)

Full Text Available Salmonella entérica serovar Typhimurium cells expressing the cadA gene of Geobacillus stearothermophilus LV exhibit a hypersensitive phenotype to cadmium chloride. Deletion of the ORF STM3576 from the Salmonella genome resulted in cadmium, lead and zinc sensitivity, confirming that this ORF is a homologue of the zntA gene. The observed sensitivity was reverted upon expression of the G. stearothermophilus LV cadA gene. These results indicate that the cadA gene product is involved in Cd, Pb and Zn resistance as a classical P-type ATPase and strongly suggest that the observed hypersensitive phenotype to these metals can be related to the function of the host ·zntA gene product

JOSÉ M PÉREZ

2006-01-01

50

Functional Characterization of the Initiation Enzyme of S-Layer Glycoprotein Glycan Biosynthesis in Geobacillus stearothermophilus NRS 2004/3a?  

OpenAIRE

The glycan chain of the S-layer glycoprotein of Geobacillus stearothermophilus NRS 2004/3a is composed of repeating units [?2)-?-l-Rhap-(1?3)-?-l-Rhap-(1?2)-?-l-Rhap-(1?], with a 2-O-methyl modification of the terminal trisaccharide at the nonreducing end of the glycan chain, a core saccharide composed of two or three ?-l-rhamnose residues, and a ?-d-galactose residue as a linker to the S-layer protein. In this study, we report the biochemical characterization of WsaP of the S-la...

Steiner, Kerstin; Novotny, Rene?; Patel, Kinnari; Vinogradov, Evgenij; Whitfield, Chris; Valvano, Miguel A.; Messner, Paul; Scha?ffer, Christina

2007-01-01

51

Strain Improvement of Bacillus coagulans and Geobacillus stearothermophilus for Enhanced Thermostable Cellulase Production and the Effect of Different Metal Ions on Cellulase Activity  

OpenAIRE

The current study was focused on the strain improvement of Bacillus coagulans and Geobacillus stearothermophilus for thermostable cellulase production with higher enzyme activity. For strain improvement UV radiations, NTG and Sodium azide were used as mutagenic agents.NTG was found to be best mutagenic agent among all in term of highest cellulase activity. Mutant strain C11 exhibited the highest cellulase specific activity at 45 U/mg followed by C15 (39 U/mg) in case of B.coagulans while Muta...

Vikas Sharma; Prakash Kumar Singh

2012-01-01

52

New Insights into the Glycosylation of the Surface Layer Protein SgsE from Geobacillus stearothermophilus NRS 2004/3a?  

OpenAIRE

The surface of Geobacillus stearothermophilus NRS 2004/3a cells is covered by an oblique surface layer (S-layer) composed of glycoprotein subunits. To this S-layer glycoprotein, elongated glycan chains are attached that are composed of [?2)-?-l-Rhap-(1?3)-?-l-Rhap-(1?2)-?-L-Rhap-(1?] repeating units, with a 2-O-methyl modification of the terminal trisaccharide at the nonreducing end of the glycan chain and a core saccharide as linker to the S-layer protein. On sodium dodecyl sulfat...

Steiner, Kerstin; Pohlentz, Gottfried; Dreisewerd, Klaus; Berkenkamp, Stefan; Messner, Paul; Peter-katalinic?, Jasna; Scha?ffer, Christina

2006-01-01

53

Preliminary crystallographic analysis of Xyn52B2, a GH52 ?-D-xylosidase from Geobacillus stearothermophilus T6.  

Science.gov (United States)

Geobacillus stearothermophilus T6 is a thermophilic bacterium that possesses an extensive hemicellulolytic system, including over 40 specific genes that are dedicated to this purpose. For the utilization of xylan, the bacterium uses an extracellular xylanase which degrades xylan to decorated xylo-oligomers that are imported into the cell. These oligomers are hydrolyzed by side-chain-cleaving enzymes such as arabinofuranosidases, acetylesterases and a glucuronidase, and finally by an intracellular xylanase and a number of ?-xylosidases. One of these ?-xylosidases is Xyn52B2, a GH52 enzyme that has already proved to be useful for various glycosynthesis applications. In addition to its demonstrated glycosynthase properties, interest in the structural aspects of Xyn52B2 stems from its special glycoside hydrolase family, GH52, the structures and mechanisms of which are only starting to be resolved. Here, the cloning, overexpression, purification and crystallization of Xyn52B2 are reported. The most suitable crystal form that has been obtained belonged to the orthorhombic P212121 space group, with average unit-cell parameters a = 97.7, b = 119.1, c = 242.3?Å. Several X-ray diffraction data sets have been collected from flash-cooled crystals of this form, including the wild-type enzyme (3.70?Å resolution), the E335G catalytic mutant (2.95?Å resolution), a potential mercury derivative (2.15?Å resolution) and a selenomethionine derivative (3.90?Å resolution). These data are currently being used for detailed three-dimensional structure determination of the Xyn52B2 protein. PMID:25484225

Dann, Roie; Lansky, Shifra; Lavid, Noa; Zehavi, Arie; Belakhov, Valery; Baasov, Timor; Dvir, Hay; Manjasetty, Babu; Belrhali, Hassan; Shoham, Yuval; Shoham, Gil

2014-12-01

54

A two-component system regulates the expression of an ABC transporter for xylo-oligosaccharides in Geobacillus stearothermophilus.  

Science.gov (United States)

Geobacillus stearothermophilus T-6 utilizes an extensive and highly regulated hemicellulolytic system. The genes comprising the xylanolytic system are clustered in a 39.7-kb chromosomal segment. This segment contains a 6-kb transcriptional unit (xynDCEFG) coding for a potential two-component system (xynDC) and an ATP-binding cassette (ABC) transport system (xynEFG). The xynD promoter region contains a 16-bp inverted repeat resembling the operator site for the xylose repressor, XylR. XylR was found to bind specifically to this sequence, and binding was efficiently prevented in vitro in the presence of xylose. The ABC transport system was shown to comprise an operon of three genes (xynEFG) that is transcribed from its own promoter. The nonphosphorylated fused response regulator, His6-XynC, bound to a 220-bp fragment corresponding to the xynE operator. DNase I footprinting analysis showed four protected zones that cover the -53 and the +34 regions and revealed direct repeat sequences of a GAAA-like motif. In vitro transcriptional assays and quantitative reverse transcription-PCR demonstrated that xynE transcription is activated 140-fold in the presence of 1.5 microM XynC. The His6-tagged sugar-binding lipoprotein (XynE) of the ABC transporter interacted with different xylosaccharides, as demonstrated by isothermal titration calorimetry. The change in the heat capacity of binding (DeltaCp) for XynE with xylotriose suggests a stacking interaction in the binding site that can be provided by a single Trp residue and a sugar moiety. Taken together, our data show that XynEFG constitutes an ABC transport system for xylo-oligosaccharides and that its transcription is negatively regulated by XylR and activated by the response regulator XynC, which is part of a two-component sensing system. PMID:17142383

Shulami, Smadar; Zaide, Galia; Zolotnitsky, Gennady; Langut, Yael; Feld, Geoff; Sonenshein, Abraham L; Shoham, Yuval

2007-02-01

55

Characterization of quinol-dependent nitric oxide reductase from Geobacillus stearothermophilus: enzymatic activity and active site structure.  

Science.gov (United States)

Nitric oxide reductase (NOR) catalyzes the reduction of nitric oxide to generate nitrous oxide. We recently reported on the crystal structure of a quinol-dependent NOR (qNOR) from Geobacillus stearothermophilus [Y. Matsumoto, T. Tosha, A.V. Pisliakov, T. Hino, H. Sugimoto, S. Nagano, Y. Sugita and Y. Shiro, Nat. Struct. Mol. Biol. 19 (2012) 238-246], and suggested that a water channel from the cytoplasm, which is not observed in cytochrome c-dependent NOR (cNOR), functions as a pathway transferring catalytic protons. Here, we further investigated the functional and structural properties of qNOR, and compared the findings with those for cNOR. The pH optimum for the enzymatic reaction of qNOR was in the alkaline range, whereas Pseudomonas aeruginosa cNOR showed a higher activity at an acidic pH. The considerably slower reduction rate, and a correlation of the pH dependence for enzymatic activity and the reduction rate suggest that the reduction process is the rate-determining step for the NO reduction by qNOR, while the reduction rate for cNOR was very fast and therefore is unlikely to be the rate-determining step. A close examination of the heme/non-heme iron binuclear center by resonance Raman spectroscopy indicated that qNOR has a more polar environment at the binuclear center compared with cNOR. It is plausible that a water channel enhances the accessibility of the active site to solvent water, creating a more polar environment in qNOR. This structural feature could control certain properties of the active site, such as redox potential, which could explain the different catalytic properties of the two NORs. This article is part of a Special Issue entitled: 18th European Bioenergetic Conference. PMID:24569054

Terasaka, Erina; Okada, Norihiro; Sato, Nozomi; Sako, Yoshihiko; Shiro, Yoshitsugu; Tosha, Takehiko

2014-07-01

56

GH52 xylosidase from Geobacillus stearothermophilus: characterization and introduction of xylanase activity by site?directed mutagenesis of Tyr509.  

Science.gov (United States)

A xylosidase gene, gsxyn, was cloned from the deep-sea thermophilic Geobacillus stearothermophilus, which consisted of 2,118 bp and encoded a protein of 705 amino acids with a calculated molecular mass of 79.8 kDa. The GSxyn of glycoside hydrolase family 52 (GH52) displayed its maximum activity at 70 °C and pH 5.5. The K m and k cat values of GSxyn for ?NPX were 0.48 mM and 36.64 s?1, respectively. Interestingly, a new exo-xylanase activity was introduced into GSxyn by mutating the tyrosine509 into glutamic acid, whereas the resultant enzyme variant, Y509E, retained the xylosidase activity. The optimum xylanase activity of theY509E mutant displayed at pH 6.5 and 50 °C, and retained approximately 45 % of its maximal activity at 55 °C, pH 6.5 for 60 min. The K m and k cat values of the xylanase activity of Y509E mutant for beechwood xylan were 5.10 mg/ml and 22.53 s?1, respectively. The optimum xylosidase activity of theY509E mutant displayed at pH 5.5 and 60 °C. The K m and k cat values of the xylosidase activity of Y509E mutant for ?NPX were 0.51 mM and 22.53 s?1, respectively. This report demonstrated that GH52 xylosidase has provided a platform for generating bifunctional enzymes for industrially significant and complex substrates, such as plant cell wall. PMID:24122394

Huang, Zongqing; Liu, Xiaoshuang; Zhang, Shaowei; Liu, Ziduo

2014-01-01

57

Structure-specificity relationships in Abp, a GH27 ?-L-arabinopyranosidase from Geobacillus stearothermophilus T6.  

Science.gov (United States)

L-Arabinose sugar residues are relatively abundant in plants and are found mainly in arabinan polysaccharides and in other arabinose-containing polysaccharides such as arabinoxylans and pectic arabinogalactans. The majority of the arabinose units in plants are present in the furanose form and only a small fraction of them are present in the pyranose form. The L-arabinan-utilization system in Geobacillus stearothermophilus T6, a Gram-positive thermophilic soil bacterium, has recently been characterized, and one of the key enzymes was found to be an intracellular ?-L-arabinopyranosidase (Abp). Abp, a GH27 enzyme, was shown to remove ?-L-arabinopyranose residues from synthetic substrates and from the native substrates sugar beet arabinan and larch arabinogalactan. The Abp monomer is made up of 448 amino acids, and based on sequence homology it was suggested that Asp197 is the catalytic nucleophile and Asp255 is the catalytic acid/base. In the current study, the detailed three-dimensional structure of wild-type Abp (at 2.28?Å resolution) and its catalytic mutant Abp-D197A with (at 2.20?Å resolution) and without (at 2.30?Å resolution) a bound L-arabinose product are reported as determined by X-ray crystallography. These structures demonstrate that the three-dimensional structure of the Abp monomer correlates with the general fold observed for GH27 proteins, consisting of two main domains: an N-terminal TIM-barrel domain and a C-terminal all-? domain. The two catalytic residues are located in the TIM-barrel domain, such that their carboxylic functional groups are about 5.9?Å from each other, consistent with a retaining mechanism. An isoleucine residue (Ile67) located at a key position in the active site is shown to play a critical role in the substrate specificity of Abp, providing a structural basis for the high preference of the enzyme towards arabinopyranoside over galactopyranoside substrates. The crystal structure demonstrates that Abp is a tetramer made up of two `open-pincers' dimers, which clamp around each other to form a central cavity. The four active sites of the Abp tetramer are situated on the inner surface of this cavity, all opening into the central space of the cavity. The biological relevance of this tetrameric structure is supported by independent results obtained from size-exclusion chromatography (SEC), dynamic light-scattering (DLS) and small-angle X-ray scattering (SAXS) experiments. These data and their comparison to the structural data of related GH27 enzymes are used for a more general discussion concerning structure-selectivity aspects in this glycoside hydrolase (GH) family. PMID:25372689

Lansky, Shifra; Salama, Rachel; Solomon, Hodaya V; Feinberg, Hadar; Belrhali, Hassan; Shoham, Yuval; Shoham, Gil

2014-11-01

58

Structural basis for thermostability revealed through the identification and characterization of a highly thermostable phosphotriesterase-like lactonase from Geobacillus stearothermophilus  

Energy Technology Data Exchange (ETDEWEB)

A new enzyme homologous to phosphotriesterase was identified from the bacterium Geobacillus stearothermophilus (GsP). This enzyme belongs to the amidohydrolase family and possesses the ability to hydrolyze both lactone and organophosphate (OP) compounds, making it a phosphotriesterase-like lactonase (PLL). GsP possesses higher OP-degrading activity than recently characterized PLLs, and it is extremely thermostable. GsP is active up to 100 C with an energy of activation of 8.0 kcal/mol towards ethyl paraoxon, and it can withstand an incubation temperature of 60 C for two days. In an attempt to understand the thermostability of PLLs, the X-ray structure of GsP was determined and compared to those of existing PLLs. Based upon a comparative analysis, a new thermal advantage score and plot was developed and reveals that a number of different factors contribute to the thermostability of PLLs.

Hawwa, Renda; Aikens, John; Turner, Robert J.; Santarsiero, Bernard D.; Mescar, Andrew D.; (Lybradyn Inc.); (UIC)

2009-08-31

59

Purification, crystallization and preliminary crystallographic analysis of Gan1D, a GH1 6-phospho-?-galactosidase from Geobacillus stearothermophilus T1.  

Science.gov (United States)

Geobacillus stearothermophilus T1 is a Gram-positive thermophilic soil bacterium that contains an extensive system for the utilization of plant cell-wall polysaccharides, including xylan, arabinan and galactan. The bacterium uses a number of extracellular enzymes that break down the high-molecular-weight polysaccharides into short oligosaccharides, which enter the cell and are further hydrolyzed into sugar monomers by dedicated intracellular glycoside hydrolases. The interest in the biochemical characterization and structural analysis of these proteins originates mainly from the wide range of their potential biotechnological applications. Studying the different hemicellulolytic utilization systems in G. stearothermophilus T1, a new galactan-utilization gene cluster was recently identified, which encodes a number of proteins, one of which is a GH1 putative 6-phospho-?-galactosidase (Gan1D). Gan1D has recently been cloned, overexpressed, purified and crystallized as part of its comprehensive structure-function study. The best crystals obtained for this enzyme belonged to the triclinic space group P1, with average crystallographic unit-cell parameters of a = 67.0, b = 78.1, c = 92.1 Å, ? = 102.4, ? = 93.5, ? = 91.7°. A full diffraction data set to 1.33 Å resolution has been collected for the wild-type enzyme, as measured from flash-cooled crystals at 100 K, using synchrotron radiation. These data are currently being used for the detailed three-dimensional crystal structure analysis of Gan1D. PMID:24637762

Lansky, Shifra; Zehavi, Arie; Dann, Roie; Dvir, Hay; Belrhali, Hassan; Shoham, Yuval; Shoham, Gil

2014-02-01

60

The structure of DinB from Geobacillus stearothermophilus: a representative of a unique four-helix-bundle superfamily  

OpenAIRE

The structure of DinB from G. stearothermophilus is described and compared with a number of recently reported structures of this unusual fold. Structural similarities are revealed that unite several distant protein families.

Cooper, David R.; Grelewska, Katarzyna; Kim, Chang-yub; Joachimiak, Andrzej; Derewenda, Zygmunt S.

2010-01-01

61

Expression of the ubiE Gene of Geobacillus stearothermophilus V in Escherichia coli K-12 Mediates the Evolution of Selenium Compounds into the Headspace of Selenite- and Selenate-Amended Cultures  

OpenAIRE

The ubiE gene of Geobacillus stearothermophilus V, with its own promoter, was cloned and introduced into Escherichia coli. The cloned gene complemented the ubiE gene deficiency of E. coli AN70. In addition, the expression of this gene in E. coli JM109 resulted in the evolution of volatile selenium compounds when these cells were grown in selenite- or selenate-amended media. These compounds were dimethyl selenide and dimethyl diselenide.

Swearingen, J. W.; Fuentes, D. E.; Araya, M. A.; Plishker, M. F.; Saavedra, C. P.; Chasteen, T. G.; Va?squez, C. C.

2006-01-01

62

Crystallization and preliminary crystallographic analysis of a family 43 ?-d-xylosidase from Geobacillus stearothermophilus T-6  

OpenAIRE

The crystallization and preliminary X-ray analysis of a ?-d-xylosidase from G. stearothermophilus T-6, a family 43 glycoside hydrolase, is described. Native and catalytic inactive mutants of the enzymes were crystallized in two different space groups, orthorhombic P21212 and tetragonal P41212 (or the enantiomorphic space group P43212), using a sensitive cryoprotocol. The latter crystal form diffracted X-rays to a resolution of 2.2?Å.

Bru?x, Christian; Niefind, Karsten; Ben-david, Alon; Leon, Maya; Shoham, Gil; Shoham, Yuval; Schomburg, Dietmar

2005-01-01

63

High-Affinity Interaction between the S-Layer Protein SbsC and the Secondary Cell Wall Polymer of Geobacillus stearothermophilus ATCC 12980 Determined by Surface Plasmon Resonance Technology? †  

OpenAIRE

Surface plasmon resonance studies using C-terminal truncation forms of the S-layer protein SbsC (recombinant SbsC consisting of amino acids 31 to 270 [rSbsC31-270] and rSbsC31-443) and the secondary cell wall polymer (SCWP) isolated from Geobacillus stearothermophilus ATCC 12980 confirmed the exclusive responsibility of the N-terminal region comprising amino acids 31 to 270 for SCWP binding. Quantitative analyses indicated binding behavior demonstrating low, medium, and high affinities.

Ferner-ortner, Judith; Mader, Christoph; Ilk, Nicola; Sleytr, Uwe B.; Egelseer, Eva M.

2007-01-01

64

HIV-1 Gag p17 presented as virus-like particles on the E2 scaffold from Geobacillus stearothermophilus induces sustained humoral and cellular immune responses in the absence of IFN? production by CD4+ T cells  

OpenAIRE

We have constructed stable virus-like particles displaying the HIV-1 Gag(p17) protein as an N-terminal fusion with an engineered protein domain from the Geobacillus stearothermophilus pyruvate dehydrogenase subunit E2. Mice immunized with the Gag(p17)-E2 60-mer scaffold particles mounted a strong and sustained antibody response. Antibodies directed to Gag(p17) were boosted significantly with additional immunizations, while anti-E2 responses reached a plateau. The isotype of the induced antibo...

Caivano, Antonella; Doria-rose, Nicole A.; Buelow, Benjamin; Sartorius, Rossella; Trovato, Maria; D’apice, Luciana; Domingo, Gonzalo J.; Sutton, William F.; Haigwood, Nancy L.; Berardinis, Piergiuseppe

2010-01-01

65

Interaction of the Crystalline Bacterial Cell Surface Layer Protein SbsB and the Secondary Cell Wall Polymer of Geobacillus stearothermophilus PV72 Assessed by Real-Time Surface Plasmon Resonance Biosensor Technology  

OpenAIRE

The interaction between S-layer protein SbsB and the secondary cell wall polymer (SCWP) of Geobacillus stearothermophilus PV72/p2 was investigated by real-time surface plasmon resonance biosensor technology. The SCWP is an acidic polysaccharide that contains N-acetylglucosamine, N-acetylmannosamine, and pyruvic acid. For interaction studies, recombinant SbsB (rSbsB) and two truncated forms consisting of either the S-layer-like homology (SLH) domain (3SLH) or the residual part of SbsB were use...

Mader, Christoph; Huber, Carina; Moll, Dieter; Sleytr, Uwe B.; Sa?ra, Margit

2004-01-01

66

Protein engineering by random mutagenesis and structure-guided consensus of Geobacillus stearothermophilus Lipase T6 for enhanced stability in methanol.  

Science.gov (United States)

The abilities of enzymes to catalyze reactions in nonnatural environments of organic solvents have opened new opportunities for enzyme-based industrial processes. However, the main drawback of such processes is that most enzymes have a limited stability in polar organic solvents. In this study, we employed protein engineering methods to generate a lipase for enhanced stability in methanol, which is important for biodiesel production. Two protein engineering approaches, random mutagenesis (error-prone PCR) and structure-guided consensus, were applied in parallel on an unexplored lipase gene from Geobacillus stearothermophilus T6. A high-throughput colorimetric screening assay was used to evaluate lipase activity after an incubation period in high methanol concentrations. Both protein engineering approaches were successful in producing variants with elevated half-life values in 70% methanol. The best variant of the random mutagenesis library, Q185L, exhibited 23-fold-improved stability, yet its methanolysis activity was decreased by one-half compared to the wild type. The best variant from the consensus library, H86Y/A269T, exhibited 66-fold-improved stability in methanol along with elevated thermostability (+4.3°C) and a 2-fold-higher fatty acid methyl ester yield from soybean oil. Based on in silico modeling, we suggest that the Q185L substitution facilitates a closed lid conformation that limits access for both the methanol and substrate excess into the active site. The enhanced stability of H86Y/A269T was a result of formation of new hydrogen bonds. These improved characteristics make this variant a potential biocatalyst for biodiesel production. PMID:24362426

Dror, Adi; Shemesh, Einav; Dayan, Natali; Fishman, Ayelet

2014-02-01

67

Cloning, purification and preliminary crystallographic analysis of Ara127N, a GH127 ?-L-arabinofuranosidase from Geobacillus stearothermophilus T6.  

Science.gov (United States)

The L-arabinan utilization system of Geobacillus stearothermophilus T6 is composed of five transcriptional units that are clustered within a 38?kb DNA segment. One of the transcriptional units contains 11 genes, the last gene of which (araN) encodes a protein, Ara127N, that belongs to the newly established GH127 family. Ara127N shares 44% sequence identity with the recently characterized HypBA1 protein from Bifidobacterium longum and thus is likely to function similarly as a ?-L-arabinofuranosidase. ?-L-Arabinofuranosidases are enzymes that hydrolyze ?-L-arabinofuranoside linkages, the less common form of such linkages, a unique enzymatic activity that has been identified only recently. The interest in the structure and mode of action of Ara127N therefore stems from its special catalytic activity as well as its membership of the new GH127 family, the structure and mechanism of which are only starting to be resolved. Ara127N has recently been cloned, overexpressed, purified and crystallized. Two suitable crystal forms have been obtained: one (CTP form) belongs to the monoclinic space group P21, with unit-cell parameters a = 104.0, b = 131.2, c = 107.6?Å, ? = 112.0°, and the other (RB form) belongs to the orthorhombic space group P212121, with unit-cell parameters a = 65.5, b = 118.1, c = 175.0?Å. A complete X-ray diffraction data set has been collected to 2.3?Å resolution from flash-cooled crystals of the wild-type enzyme (RB form) at -173°C using synchrotron radiation. A selenomethionine derivative of Ara127N has also been prepared and crystallized for multi-wavelength anomalous diffraction (MAD) experiments. Crystals of selenomethionine Ara127N appeared to be isomorphous to those of the wild type (CTP form) and enabled the measurement of a three-wavelength MAD diffraction data set at the selenium absorption edge. These data are currently being used for detailed three-dimensional structure determination of the Ara127N protein. PMID:25084377

Lansky, Shifra; Salama, Rachel; Dann, Roie; Shner, Izhak; Manjasetty, Babu A; Belrhali, Hassan; Shoham, Yuval; Shoham, Gil

2014-08-01

68

ISOLATION AND CHARACTERIZATION OF MANNANOLYTIC THERMOPHILIC BACTERIA FROM PALM OIL SHELL AND THEIR MANNANASE ENZYME PRODUCTION PROPERTIES  

OpenAIRE

A mannanolytic thermophilic bacterium (L-07) was isolated from palm oil shell after 2 days of enrichment in liquid medium supplemented with 1% palm kernel meal as mannan source. Sequence analysis of 16S-rRNA indicated that L-07 was similar (98%) to Geobacillus stearothermophilus, a species of thermophilic aerobi c bacteria. We found that G. stearothermophilus L-07 produced extracellular ? -1,4-mannanases, but no ? -manosidase and ? -galactosidase activities. The growth of L-07 reached it...

Urwadaria, T. Resnawati P.; ANTONIUS SUWANTO; SUMARDI; Henawidjaja, Maggy T.

2005-01-01

69

HIV-1 Gag p17 presented as virus-like particles on the E2 scaffold from Geobacillus stearothermophilus induces sustained humoral and cellular immune responses in the absence of IFN? production by CD4+ T cells  

International Nuclear Information System (INIS)

We have constructed stable virus-like particles displaying the HIV-1 Gag(p17) protein as an N-terminal fusion with an engineered protein domain from the Geobacillus stearothermophilus pyruvate dehydrogenase subunit E2. Mice immunized with the Gag(p17)-E2 60-mer scaffold particles mounted a strong and sustained antibody response. Antibodies directed to Gag(p17) were boosted significantly with additional immunizations, while anti-E2 responses reached a plateau. The isotype of the induced antibodies was biased towards IgG1, and the E2-primed CD4+ T cells did not secrete IFN?. Using transgenic mouse model systems, we demonstrated that CD8+ T cells primed with E2 particles were able to exert lytic activity and produce IFN?. These results show that the E2 scaffold represents a powerful vaccine delivery system for whole antigenic proteins or polyepitope engineered proteins, evoking antibody production and antigen specific CTL activity even in the absence of IFN?-producing CD4+ T cells.

70

Characterization of two novel plasmids from Geobacillus sp. 610 and 1121 strains.  

Science.gov (United States)

We describe two cryptic low molecular weight plasmids, pGTD7 (3279bp) and pGTG5 (1540bp), isolated from Geobacillus sp. 610 and 1121 strains, respectively. Homology analysis of the replication protein (Rep) sequences and detection of ssDNA indicate that both of them replicate via rolling circle mechanism. As revealed by sequence similarities of dso region and Rep protein, plasmid pGTD7 belongs to pC194/pUB110 plasmid family. The replicon of pGTD7 was proved to be functional in another Geobacillus host. For this purpose, a construct pUCK7, containing a replicon of the analyzed plasmid, was created and transferred to G. stearothermophilus NUB3621R strain by electroporation. Plasmid pGTG5, based on Rep protein sequence similarity, was found to be related mostly to some poorly characterized bacterial plasmids. Rep proteins encoded by these plasmids contain conservative motifs that are most similar to those of Microviridae phages. This feature suggests that pGTG5, together with other plasmids containing the same motifs, could constitute a new family of bacterial plasmids. To date, pGTG5 is the smallest plasmid identified in bacteria belonging to the genus Geobacillus. The two plasmids described in this study can be used for the construction of new vectors suitable for biotechnologically important bacteria of the genus Geobacillus. PMID:24177015

Kananavi?i?t?, R?ta; Butait?, Elena; Citavi?ius, Donaldas

2014-01-01

71

Characterization of a Novel Thermostable Carboxylesterase from Geobacillus kaustophilus HTA426 Shows the Existence of a New Carboxylesterase Family?  

OpenAIRE

The gene GK3045 (741 bp) from Geobacillus kaustophilus HTA426 was cloned, sequenced, and overexpressed into Escherichia coli Rosetta (DE3). The deduced protein was a 30-kDa monomeric esterase with high homology to carboxylesterases from Geobacillus thermoleovorans NY (99% identity) and Geobacillus stearothermophilus (97% identity). This protein suffered a proteolytic cut in E. coli, and the problem was overcome by introducing a mutation in the gene (K212R) without affecting the activity. The ...

Montoro-garci?a, Silvia; Marti?nez-marti?nez, Irene; Navarro-ferna?ndez, Jose?; Takami, Hideto; Garci?a-carmona, Francisco; Sa?nchez-ferrer, A?lvaro

2009-01-01

72

Application of pheB as a Reporter Gene for Geobacillus spp., Enabling Qualitative Colony Screening and Quantitative Analysis of Promoter Strength  

OpenAIRE

The pheB gene from Geobacillus stearothermophilus DSM6285 has been exploited as a reporter gene for Geobacillus spp. The gene product, catechol 2,3-dioxygenase (C23O), catalyzes the formation of 2-hydroxymuconic semialdehyde, which can be readily assayed. The reporter was used to examine expression from the ldh promoter associated with fermentative metabolism.

Bartosiak-jentys, Jeremy; Eley, Kirstin; Leak, David J.

2012-01-01

73

Isolation and characterization of aerobic thermophilic bacteria from the savusavu hot springs in fiji.  

Science.gov (United States)

The relative isolation and unique physical properties of the Savusavu Hot Springs in Fiji may yield unique thermophiles. This study was conducted to determine the presence of aerobic thermophilic bacteria in these hot springs. A total of 104 thermophilic bacterial isolates were characterized and using Thermus and Bacillus strains as controls, 58% of the isolates were identified as Anoxybacillus flavithermus, 19% as Geobacillus stearothermophilus/Bacillus licheniformis, 10% as Thermus sp. TG153 and 10% as Thermus sp. TG206. Four isolates were unique in their molecular patterns suggesting there may be novel bacteria in the Savusavu hot springs. PMID:21558730

Narayan, Vinay V; Hatha, Mohamed A; Morgan, Hugh W; Rao, Dhana

2008-01-01

74

Draft Genome Sequence of Geobacillus sp. Strain FW23, Isolated from a Formation Water Sample.  

Science.gov (United States)

The thermophilic Geobacillus sp. strain FW23 was isolated from the Mehsana oil wells in Gujrat, India, during a screening for oil-degrading bacteria. Here, we report the draft genome sequence of Geobacillus sp. FW23, which may help reveal the genomic differences between this strain and the earlier reported species of the genus Geobacillus. PMID:24812215

Pore, Soham D; Arora, Preeti; Dhakephalkar, Prashant K

2014-01-01

75

Characterization of thermophilic bacteria using surface-enhanced Raman scattering.  

Science.gov (United States)

Surface-enhanced Raman scattering (SERS) can provide molecular-level information about the molecules and molecular structures in the vicinity of nanostructured noble metal surfaces such as gold and silver. The three thermophilic bacteria Bacillus licheniformis, Geobacillus stearothermophilus, and Geobacillus pallidus, a Gram-negative bacterium E. coli, and a Gram-positive bacterium B. megaterium are comparatively characterized using SERS. The SERS spectra of thermophilic bacteria are similar, while they show significant differences compared to E. coli and B. megaterium. The findings indicate that a higher number of thiol residues and possible S-S bridges are present in the cell wall structure of thermophilic bacteria, providing their stability at elevated temperatures. Incubating the thermophilic bacteria with colloidal silver suspension at longer times improved the bacteria-silver nanoparticle interaction kinetics, while increased temperature does not have a pronounced effect on spectral features. A tentative assignment of the SERS bands was attempted for thermophilic bacteria. The results indicate that SERS can be a useful tool to study bacterial cell wall molecular differences. PMID:19007464

Culha, Mustafa; Adigüzel, Ahmet; Yazici, M Müge; Kahraman, Mehmet; Sahin, Fikrettin; Güllüce, Medine

2008-11-01

76

Modelling of the acid base properties of two thermophilic bacteria at different growth times  

Science.gov (United States)

Acid-base titrations and electrophoretic mobility measurements were conducted on the thermophilic bacteria Anoxybacillus flavithermus and Geobacillus stearothermophilus at two different growth times corresponding to exponential and stationary/death phase. The data showed significant differences between the two investigated growth times for both bacterial species. In stationary/death phase samples, cells were disrupted and their buffering capacity was lower than that of exponential phase cells. For G. stearothermophilus the electrophoretic mobility profiles changed dramatically. Chemical equilibrium models were developed to simultaneously describe the data from the titrations and the electrophoretic mobility measurements. A simple approach was developed to determine confidence intervals for the overall variance between the model and the experimental data, in order to identify statistically significant changes in model fit and thereby select the simplest model that was able to adequately describe each data set. Exponential phase cells of the investigated thermophiles had a higher total site concentration than the average found for mesophilic bacteria (based on a previously published generalised model for the acid-base behaviour of mesophiles), whereas the opposite was true for cells in stationary/death phase. The results of this study indicate that growth phase is an important parameter that can affect ion binding by bacteria, that growth phase should be considered when developing or employing chemical models for bacteria-bearing systems.

Heinrich, Hannah T. M.; Bremer, Phil J.; McQuillan, A. James; Daughney, Christopher J.

2008-09-01

77

Lantibiotics from Geobacillus thermodenitrificans  

OpenAIRE

The lantibiotic nisin has been used as an effective food preservative to combat food-borne pathogens for over 40 y. Despite this successful use, nisin’s stability at pH 7 is limited. Herein, we describe a nisin analog encoded on the genome of the thermophilic bacterium Geobacillus thermodenitrificans NG80-2. This analog termed geobacillin I was obtained by heterologous expression in Escherichia coli and subsequent purification. Extensive NMR characterization demonstrated that geobacillin...

Garg, Neha; Tang, Weixin; Goto, Yuki; Nair, Satish K.; Donk, Wilfred A.

2012-01-01

78

Tracking spore-forming bacteria in food: from natural biodiversity to selection by processes.  

Science.gov (United States)

Sporeforming bacteria are ubiquitous in the environment and exhibit a wide range of diversity leading to their natural prevalence in foodstuff. The state of the art of sporeformer prevalence in ingredients and food was investigated using a multiparametric PCR-based tool that enables simultaneous detection and identification of various genera and species mostly encountered in food, i.e., Alicyclobacillus, Anoxybacillus flavithermus, Bacillus, B. cereus group, B. licheniformis, B. pumilus, B. sporothermodurans, B. subtilis, Brevibacillus laterosporus, Clostridium, Geobacillus stearothermophilus, Moorella and Paenibacillus species. In addition, 16S rDNA sequencing was used to extend identification to other possibly present contaminants. A total of 90 food products, with or without visible trace of spoilage were analysed, i.e., 30 egg-based products, 30 milk and dairy products and 30 canned food and ingredients. Results indicated that most samples contained one or several of the targeted genera and species. For all three tested food categories, 30 to 40% of products were contaminated with both Bacillus and Clostridium. The percentage of contaminations associated with Clostridium or Bacillus represented 100% in raw materials, 72% in dehydrated ingredients and 80% in processed foods. In the last two product types, additional thermophilic contaminants were identified (A. flavithermus, Geobacillus spp., Thermoanaerobacterium spp. and Moorella spp.). These results suggest that selection, and therefore the observed (re)-emergence of unexpected sporeforming contaminants in food might be favoured by the use of given food ingredients and food processing technologies. PMID:22795797

Postollec, Florence; Mathot, Anne-Gabrielle; Bernard, Muriel; Divanac'h, Marie-Laure; Pavan, Sonia; Sohier, Danièle

2012-08-01

79

Preconditioning with cations increases the attachment of Anoxybacillus flavithermus and Geobacillus species to stainless steel.  

Science.gov (United States)

Preconditioning of Anoxybacillus flavithermus E16 and Geobacillus sp. strain F75 with cations prior to attachment often significantly increased (P ? 0.05) the number of viable cells that attached to stainless steel (by up to 1.5 log CFU/cm(2)) compared with unconditioned bacteria. It is proposed that the transition of A. flavithermus and Geobacillus spp. from milk formulations to stainless steel product contact surfaces in milk powder manufacturing plants is mediated predominantly by bacterial physiological factors (e.g., surface-exposed adhesins) rather than the concentrations of cations in milk formulations surrounding bacteria. PMID:23645192

Somerton, Ben; Flint, Steve; Palmer, Jon; Brooks, John; Lindsay, Denise

2013-07-01

80

ISOLATION AND CHARACTERIZATION OF MANNANOLYTIC THERMOPHILIC BACTERIA FROM PALM OIL SHELL AND THEIR MANNANASE ENZYME PRODUCTION PROPERTIES  

Directory of Open Access Journals (Sweden)

Full Text Available A mannanolytic thermophilic bacterium (L-07 was isolated from palm oil shell after 2 days of enrichment in liquid medium supplemented with 1% palm kernel meal as mannan source. Sequence analysis of 16S-rRNA indicated that L-07 was similar (98% to Geobacillus stearothermophilus, a species of thermophilic aerobi c bacteria. We found that G. stearothermophilus L-07 produced extracellular ? -1,4-mannanases, but no ? -manosidase and ? -galactosidase activities. The growth of L-07 reached its maximum (3.0 x 106 cell/ml at 12-20 hours, while the highest ? -mannanase activity (0.52 U/ml was observed in culture medium after 36 hours of cultivation at 60oC. The medium containing locust bean gum was the best for producing extracellular ? -1,4-mannanases compared with kolang kaling , konjak , and palm kernel meal. SDS-PAGE and zymogram analysis demonstrated that crude mannanase complex of L-07 from locust bean gum containing medium comprised three active bands with molecular weight of 85, 73 and 50 kDa.

T RESNAWATI P URWADARIA

2005-01-01

81

Development of a versatile shuttle vector for gene expression in Geobacillus spp.  

Science.gov (United States)

An improved, versatile shuttle vector has been created for the metabolic engineering of Geobacillus spp. As kanamycin is the most thermo-tolerant of commonly used antibiotics, the gene encoding a thermostable kanamycin nucleotidyltransferase, together with the origin of replication from the G. stearothermophilus plasmid pBST1 were cloned into the Escherichia coli cloning vector pUC18. The resulting vector, named pUCG18, replicated in both organisms and could be transformed with an efficiency of 1 x 10(4) transformants per microg of DNA in G. thermoglucosidasius and was stable up to 68 degrees C with antibiotic selection. It was used to demonstrate expression of the pyruvate decarboxylase (pdc) gene from Zymomonas palmae in G. thermoglucosidasius at 45 degrees C. Sequence analysis of the pBST1 derived origin of replication revealed homology with a family of theta replicons that have previously only been found in strains of Bacillus megaterium. PMID:18501964

Taylor, Mark P; Esteban, Carlos D; Leak, David J

2008-07-01

82

Extraction of Copper from Malanjkhand Low-Grade Ore by Bacillus stearothermophilus  

OpenAIRE

Thermophilic bacteria are actively prevalent in hot water springs. Their potential to grow and sustain at higher temperatures makes them exceptional compare to other microorganism. The present study was initiated to isolate, identify and determine the feasibility of extraction of copper using thermophilic heterotrophic bacterial strain. Bacillus stearothermophilus is a thermophilic heterotrophic bacterium isolated from hot water spring, Atri, Orissa, India. This bacterium was adapted to low-g...

Singh, Sradhanjali; Sukla, Lala Behari; Mishra, Baroda Kanta

2011-01-01

83

Isolation of the phe-operon from G. stearothermophilus comprising the phenol degradative meta-pathway genes and a novel transcriptional regulator  

Directory of Open Access Journals (Sweden)

Full Text Available Abstract Background Geobacillus stearothermophilus is able to utilize phenol as a sole carbon source. A DNA fragment encoding a phenol hydroxylase catalyzing the first step in the meta-pathway has been isolated previously. Based on these findings a PCR-based DNA walk was performed initially to isolate a catechol 2,3-dioxygenase for biosensoric applications but was continued to elucidate the organisation of the genes encoding the proteins for the metabolization of phenol. Results A 20.2 kb DNA fragment was isolated as a result of the DNA walk. Fifteen open reading frames residing on a low-copy megaplasmid were identified. Eleven genes are co-transcribed in one polycistronic mRNA as shown by reverse transcription-PCR. Ten genes encode proteins, that are directly linked with the meta-cleavage pathway. The deduced amino acid sequences display similarities to a two-component phenol hydroxylase, a catechol 2,3-dioxygenase, a 4-oxalocrotonate tautomerase, a 2-oxopent-4-dienoate hydratase, a 4-oxalocrotonate decarboxylase, a 4-hydroxy-2-oxovalerate aldolase, an acetaldehyde dehydrogenase, a plant-type ferredoxin involved in the reactivation of extradiol dioxygenases and a novel regulatory protein. The only enzymes missing for the complete mineralization of phenol are a 2-hydroxymuconic acid-6-semialdehyde hydrolase and/or 2-hydroxymuconic acid-6-semialdehyde dehydrogenase. Conclusion Research on the bacterial degradation of aromatic compounds on a sub-cellular level has been more intensively studied in gram-negative organisms than in gram-positive bacteria. Especially regulatory mechanisms in gram-positive (thermophilic prokaryotes remain mostly unknown. We isolated the first complete sequence of an operon from a thermophilic bacterium encoding the meta-pathway genes and analyzed the genetic organization. Moreover, the first transcriptional regulator of the phenol metabolism in gram-positive bacteria was identified. This is a first step to elucidate regulatory mechanisms that are likely to be distinct from modes described for gram-negative bacteria.

Reiss Monika

2008-11-01

84

The mannitol phosptransferase system of Bacillus stearothermophilus  

OpenAIRE

This thesis describes the mannitol-specific PTS of the thermophilic organism B. stearothermophilus. The mannitol operon of B. stearothermophilus was cloned and the properties of the proteins involved in mannitol uptake and the regulation of the expression of the mtl operon were studied. The operon consists of four genes: mtlA, mtlR, mtlF and mtlD coding for the mannitol transporter IICBmtl, the transcriptional regulator MtrlR, the phosphotransferase IIAmtl and the mannitol-l-phosphate dehydro...

Henstra, Sytse Anton

2000-01-01

85

Complete genome sequence of Geobacillus thermoglucosidans TNO-09.020, a thermophilic sporeformer associated with a dairy-processing environment  

OpenAIRE

Thermophilic spore-forming bacteria are a common cause of contamination in dairy products. We isolated the thermophilic strain Geobacillus thermoglucosidans TNO-09.020 from a milk processing plant and report the complete genome of a dairy plant isolate consisting of a single chromosome of 3.75 Mb.

Zhao, Y.; Caspers, M. P.; Abee, T.; Siezen, R. J.; Kort, R.

2012-01-01

86

Isolation and Characterization of a Bacteriocin-Like Substance Produced by Geobacillus toebii Strain HBB-247  

OpenAIRE

A total of 201 thermophilic bacteria isolated from various thermal spring, mud and soil were tested for their antibacterial activity. Among the mostly active isolates, Geobacillus toebii HBB-247 was further examined. Bacteriocin-like inhibitory substance (BLIS) produced by strain HBB-247 was found to be stable up to 60°C, sensitive to proteolytic enzymes and effective against Enterococcus faecalis, Listeria sp., E. avium, Clostridium pasteurianum, Cellulomonas fimi and some thermophilic stra...

Bas?bu?lbu?l O?zdemir, Gamze; Biyik, Haci Halil

2011-01-01

87

Isobutanol production at elevated temperatures in thermophilic Geobacillus thermoglucosidasius.  

Science.gov (United States)

The potential advantages of biological production of chemicals or fuels from biomass at high temperatures include reduced enzyme loading for cellulose degradation, decreased chance of contamination, and lower product separation cost. In general, high temperature production of compounds that are not native to the thermophilic hosts is limited by enzyme stability and the lack of suitable expression systems. Further complications can arise when the pathway includes a volatile intermediate. Here we report the engineering of Geobacillus thermoglucosidasius to produce isobutanol at 50°C. We prospected various enzymes in the isobutanol synthesis pathway and characterized their thermostabilities. We also constructed an expression system based on the lactate dehydrogenase promoter from Geobacillus thermodenitrificans. With the best enzyme combination and the expression system, 3.3g/l of isobutanol was produced from glucose and 0.6g/l of isobutanol from cellobiose in G. thermoglucosidasius within 48h at 50°C. This is the first demonstration of isobutanol production in recombinant bacteria at an elevated temperature. PMID:24721011

Lin, Paul P; Rabe, Kersten S; Takasumi, Jennifer L; Kadisch, Marvin; Arnold, Frances H; Liao, James C

2014-07-01

88

Extraction of Copper from Malanjkhand Low-Grade Ore by Bacillus stearothermophilus.  

Science.gov (United States)

Thermophilic bacteria are actively prevalent in hot water springs. Their potential to grow and sustain at higher temperatures makes them exceptional compare to other microorganism. The present study was initiated to isolate, identify and determine the feasibility of extraction of copper using thermophilic heterotrophic bacterial strain. Bacillus stearothermophilus is a thermophilic heterotrophic bacterium isolated from hot water spring, Atri, Orissa, India. This bacterium was adapted to low-grade chalcopyrite ore and its efficiency to solubilize copper from Malanjkhand low-grade ore was determined. The low-grade copper ore contains 0.27% Cu, in which the major copper-bearing mineral is chalcopyrite associated with other minerals present as minor phase. Variation in parameters such as pulp-density and temperatures were studied. After 30 days of incubation, it was found that Bacillus stearothermophilus solubilize copper up to 81.25% at pH 6.8 at 60°C. PMID:23024410

Singh, Sradhanjali; Sukla, Lala Behari; Mishra, Baroda Kanta

2011-10-01

89

Hypervariable pili and flagella genes provide suitable new targets for DNA high-resolution melt-based genotyping of dairy Geobacillus spp.  

Science.gov (United States)

Although nonpathogenic in nature, spores of Geobacillus are able to attach to surfaces, germinate, and form biofilms, allowing rapid multiplication and persistence within milk powder processing plants, causing final product contamination, and eventually leading to a loss of revenue in terms of downgraded product quality. As a result, Geobacillus spp. have been found to be common contaminants of milk powder worldwide. Genotyping methods can help in gaining insight into the ecology and transmission of these thermophilic bacteria within and between dairy processing plants. The objective of this study was to use the assembled draft genomes of two Geobacillus spp. to identify and test new hypervariable genotyping targets for differentiating closely related dairy Geobacillus isolates. The two Geobacillus spp. strains obtained from high spore count powders were obtained in 2010 (isolate 7E) and in 1995 (isolate 126) and were previously shown to be of same genotype based on a variable number tandem repeat genotyping method. Significant nucleotide sequence variation was found in genes encoding pili and flagella, which were further investigated as suitable loci for a new high-resolution melt analysis (HRMA)-based genotyping method. Three genes encoding pulG (containing prepilin-type N-terminal cleavage domain), pilT (pili retraction protein), and fliW (flagellar assembly protein) were selected as targets for the new pili/flagella gene (PilFla) HRMA genotyping method. The three-gene-based PilFla-HRMA genotyping method differentiated 35 milk powder Geobacillus spp. isolates into 19 different genotype groups (D = 0.93), which compared favorably to the previous method (which used four variable number tandem repeat loci) that generated 16 different genotype groups (D = 0.90). In conclusion, through comparative genomics of two closely related dairy Geobacillus strains, we have identified new hypervariable regions that prove to be useful targets for highly discriminatory genotyping. PMID:25285488

Chauhan, Kanika; Seale, R Brent; Deeth, Hilton C; Turner, Mark S

2014-10-01

90

Geobacillus sp. protokatechuato 3,4-dioksigenaz?  

OpenAIRE

Protocatechuate 3,4-dioxygenase ( EC 1.13.11.3 ) catalyses the ring cleavage step in catabolism of aromatic compounds through the protocatechuate branch of the b-ketoadipate pathway. The protocatechuate 3,4-dioxygenase was purified to homogeneity from the thermophilic Geobacillus strain grown on naphthalene for the first time. The enzyme was purified about 24-fold with a specific activity of 34.2 U mg of protein-1 by a purification procedure including ammonium sulfate fractionation and column...

Bubinas, A.; Giedraityte?, G.; Kale?diene?, L.

2007-01-01

91

Cloning, overexpression, and characterization of a novel alkali-thermostable xylanase from Geobacillus sp. WBI.  

Science.gov (United States)

An endo-?-1,4-xylanase gene xynA of a thermophilic Geobacillus sp. WBI from "hot" compost was isolated by PCR amplification. The gene encoding 407 residues were overexpressed in E. coli and purified by Ni-NTA chromatography. The purified enzyme (47?kDa) had a broad pH optimum of 6.0 to 9.0, and was active between 50 and 90?°C. The enzyme retained 100% of its activity when incubated at 65?°C for 1?h under alkaline condition (pH 10.0) and retained 75% activity at pH 11.0. The Km and Vmax of the enzyme were 0.9?mg?ml(-1) and 0.8?µmol?ml(-1) ?min(-1) , respectively. In molecular dynamics simulation at 338?K (65?°C), the enzyme was found to be stable. At an elevated temperature (450?K) specific ?-helix and ?-turns of the proteins were most denatured. The denaturation was less in WBI compared with its highest homolog G. stearothermophilus T-6 xylanase with difference of six residues. The results predict that these regions are responsible for the improved thermostability observed over related enzymes. The present work encourages further experimental demonstration to understand how these regions contribute thermostability to WBI xylanase. The study noted that WBI produces a xylanase with unique characteristics, specifically alkali-thermostability. PMID:25404211

Mitra, Suranjita; Mukhopadhyay, Bidhan Chandra; Mandal, Anisur Rahaman; Arukha, Ananta Prasad; Chakrabarty, Kuheli; Das, Gourab Kanti; Chakrabartty, Pran Krishna; Biswas, Swadesh Ranjan

2014-11-18

92

Genetic map of the Bacillus stearothermophilus NUB36 chromosome.  

OpenAIRE

A circular genetic map of Bacillus stearothermophilus NUB36 was constructed by transduction with bacteriophage TP-42C and protoplast fusion. Sixty-four genes were tentatively assigned a cognate Bacillus subtilis gene based on growth response to intermediates or end products of metabolism, cross-feeding, accumulation of intermediates, or their relative order in a linkage group. Although the relative position of many genes on the Bacillus stearothermophilus and Bacillus subtilis genetic map app...

Vallier, H.; Welker, N. E.

1990-01-01

93

Inactivation of chemical and heat-resistant spores of Bacillus and Geobacillus by nitrogen cold atmospheric plasma evokes distinct changes in morphology and integrity of spores.  

Science.gov (United States)

Bacterial spores are resistant to severe conditions and form a challenge to eradicate from food or food packaging material. Cold atmospheric plasma (CAP) treatment is receiving more attention as potential sterilization method at relatively mild conditions but the exact mechanism of inactivation is still not fully understood. In this study, the biocidal effect by nitrogen CAP was determined for chemical (hypochlorite and hydrogen peroxide), physical (UV) and heat-resistant spores. The three different sporeformers used are Bacillus cereus a food-borne pathogen, and Bacillus atrophaeus and Geobacillus stearothermophilus that are used as biological indicators for validation of chemical sterilization and thermal processes, respectively. The different spores showed variation in their degree of inactivation by applied heat, hypochlorite, hydrogen peroxide, and UV treatments, whereas similar inactivation results were obtained with the different spores treated with nitrogen CAP. G. stearothermophilus spores displayed high resistance to heat, hypochlorite, hydrogen peroxide, while for UV treatment B. atrophaeus spores are most tolerant. Scanning electron microscopy analysis revealed distinct morphological changes for nitrogen CAP-treated B. cereus spores including etching effects and the appearance of rough spore surfaces, whereas morphology of spores treated with heat or disinfectants showed no such changes. Moreover, microscopy analysis revealed CAP-exposed B. cereus spores to turn phase grey conceivably because of water influx indicating damage of the spores, a phenomenon that was not observed for non-treated spores. In addition, data are supplied that exclude UV radiation as determinant of antimicrobial activity of nitrogen CAP. Overall, this study shows that nitrogen CAP treatment has a biocidal effect on selected Bacillus and Geobacillus spores associated with alterations in spore surface morphology and loss of spore integrity. PMID:25481059

van Bokhorst-van de Veen, Hermien; Xie, Houyu; Esveld, Erik; Abee, Tjakko; Mastwijk, Hennie; Nierop Groot, Masja

2015-02-01

94

Characterization of aerobic spore-forming bacteria associated with industrial dairy processing environments and product spoilage.  

Science.gov (United States)

Due to changes in the design of industrial food processing and increasing international trade, highly thermoresistant spore-forming bacteria are an emerging problem in food production. Minimally processed foods and products with extended shelf life, such as milk products, are at special risk for contamination and subsequent product damages, but information about origin and food quality related properties of highly heat-resistant spore-formers is still limited. Therefore, the aim of this study was to determine the biodiversity, heat resistance, and food quality and safety affecting characteristics of aerobic spore-formers in the dairy sector. Thus, a comprehensive panel of strains (n=467), which originated from dairy processing environments, raw materials and processed foods, was compiled. The set included isolates associated with recent food spoilage cases and product damages as well as isolates not linked to product spoilage. Identification of the isolates by means of Fourier-transform infrared spectroscopy and molecular methods revealed a large biodiversity of spore-formers, especially among the spoilage associated isolates. These could be assigned to 43 species, representing 11 genera, with Bacillus cereus s.l. and Bacillus licheniformis being predominant. A screening for isolates forming thermoresistant spores (TRS, surviving 100°C, 20 min) showed that about one third of the tested spore-formers was heat-resistant, with Bacillus subtilis and Geobacillus stearothermophilus being the prevalent species. Strains producing highly thermoresistant spores (HTRS, surviving 125°C, 30 min) were found among mesophilic as well as among thermophilic species. B. subtilis and Bacillus amyloliquefaciens were dominating the group of mesophilic HTRS, while Bacillus smithii and Geobacillus pallidus were dominating the group of thermophilic HTRS. Analysis of spoilage-related enzymes of the TRS isolates showed that mesophilic strains, belonging to the B. subtilis and B. cereus groups, were strongly proteolytic, whereas thermophilic strains displayed generally a low enzymatic activity and thus spoilage potential. Cytotoxicity was only detected in B. cereus, suggesting that the risk of food poisoning by aerobic, thermoresistant spore-formers outside of the B. cereus group is rather low. PMID:23973839

Lücking, Genia; Stoeckel, Marina; Atamer, Zeynep; Hinrichs, Jörg; Ehling-Schulz, Monika

2013-09-01

95

Draft Genome Sequences of Geobacillus sp. Strains CAMR5420 and CAMR12739.  

Science.gov (United States)

Thermophilic Geobacillus spp. can efficiently hydrolyze hemicellulose polymers and are therefore of interest in biotechnological applications. Here we report the genome sequences of two hemicellulolytic strains, Geobacillus sp. CAMR12739 and CAMR5420. PMID:24903881

De Maayer, Pieter; Williamson, Carolyn E; Vennard, Christopher T; Danson, Michael J; Cowan, Don A

2014-01-01

96

Identifying critical unrecognized sugar-protein interactions in GH10 xylanases from Geobacillus stearothermophilus using STD NMR.  

Science.gov (United States)

(1)H solution NMR spectroscopy is used synergistically with 3D crystallographic structures to map experimentally significant hydrophobic interactions upon substrate binding in solution under thermodynamic equilibrium. Using saturation transfer difference spectroscopy (STD NMR), a comparison is made between wild-type xylanase XT6 and its acid/base catalytic mutant E159Q--a non-active, single-heteroatom alteration that has been previously utilized to measure binding thermodynamics across a series of xylooligosaccharide-xylanase complexes [Zolotnitsky et al. (2004) Proc Natl Acad Sci USA 101, 11275-11280). In this study, performing STD NMR of one substrate screens binding interactions to two proteins, avoiding many disadvantages inherent to the technique and clearly revealing subtle changes in binding induced upon mutation of the catalytic Glu. To visualize and compare the binding epitopes of xylobiose-xylanase complexes, a 'SASSY' plot (saturation difference transfer spectroscopy) is used. Two extraordinarily strong, but previously unrecognized, non-covalent interactions with H2-5 of xylobiose were observed in the wild-type enzyme but not in the E159Q mutant. Based on the crystal structure, these interactions were assigned to tryptophan residues at the -1 subsite. The mutant selectively binds only the ?-xylobiose anomer. The (1)H solution NMR spectrum of a xylotriose-E159Q complex displays non-uniform broadening of the NMR signals. Differential broadening provides a unique subsite assignment tool based on structural knowledge of face-to-face stacking with a conserved tyrosine residue at the +1 subsite. The results obtained herein by substrate-observed NMR spectroscopy are discussed further in terms of methodological contributions and mechanistic understanding of substrate-binding adjustments upon a charge change in the E159Q construct. PMID:23863045

Balazs, Yael S; Lisitsin, Elina; Carmiel, Oshrat; Shoham, Gil; Shoham, Yuval; Schmidt, Asher

2013-09-01

97

How to switch off a histidine kinase: crystal structure of Geobacillus stearothermophilus KinB with the inhibitor Sda.  

OpenAIRE

Entry to sporulation in bacilli is governed by a histidine kinase phosphorelay, a variation of the predominant signal transduction mechanism in prokaryotes. Sda directly inhibits sporulation histidine kinases in response to DNA damage and replication defects. We determined a 2.0-A-resolution X-ray crystal structure of the intact cytoplasmic catalytic core [comprising the dimerization and histidine phosphotransfer domain (DHp domain), connected to the ATP binding catalytic domain] of the Geoba...

Bick, Mj; Lamour, V.; Rajashankar, Kr; Gordiyenko, Y.; Robinson, Cv; Darst, Sa

2009-01-01

98

PRODUCTION AND CHARACTERIZATION OF AN ALKALOTHERMOSTABLE, ORGANIC SOLVENT TOLERANT AND SURFACTANT TOLERANT ESTERASE PRODUCED BY A THERMOPHILIC BACTERIUM GEOBACILLUS SP. AGP-04, ISOLATED FROM BAKRESHWAR HOT SPRING, INDIA  

OpenAIRE

A thermophilic bacteria, Geobacillus sp. AGP-04, isolated from Surya Kund hot spring, Bakreshwar, West Bengal, India was studied in terms of capability of tributyrin hydrolysis and characterization of its thermostable esterase activity using p-nitrophenyl butyrate (PNPB) as substrate. The extracellular crude preparation was characterized in terms of pH and temperature optima and stability, organic solvent tolerance capacity and stability, substrate specificity, surfactant tolerance capacity, ...

Amit Ghati; Kaushik Sarkar; Goutam Paul

2013-01-01

99

Preliminary Characterization of the Probiotic Properties of Candida Famata and Geobacillus Thermoleovorans  

Directory of Open Access Journals (Sweden)

Full Text Available Background and Objective: Probiotics are live microbial feed supplements which beneficially affect the host animal by improving its intestinal microbial balance, producing metabolites which inhibit the colonization or growth of other microorganisms or by competing with them for resources such as nutrients or space. The aim of this study was to investigate the probiotic properties of Candida famata and Geobacillus thermoleovorans.Material and Methods: In this study, yeast and bacterial strains isolated from pure oil waste were identified using Api 50 CHB and Api Candida Systems and their probiotic properties were studied through antimicrobial activity, biofilm production, adherence assay and enzymatic characterization.Results and Conclusion: According to biochemical analyses, these strains corresponded to Geobacillus thermoleovorans and Candida famata. Antagonism assay results showed that the tested strains have an inhibitory effect against tested pathogenic bacteria. The yeast Candida famata was unable to produce biofilm on Congo Red Agar (CRA, while the bacterial strain was a slime producer. Adherence assays to abiotic surfaces revealed that the investigated strains were fairly adhesive to polystyrene with values ranging from 0.18 to 0.34 at 595 nm. The enzymatic characterization revealed that the tested strains expressed enzymes such as phosphatase alkaline, esterase lipase (C8, amylase, lipase, lecitenase and caseinase. The obtained results may allow the isolated strains to be considered as having the potential to be candidate probiotics.

A Bakhrouf

2011-12-01

100

Characterization and identification of Geobacillus spp. isolated from Soldhar hot spring site of Garhwal Himalaya, India.  

Science.gov (United States)

13 morphologically distinct strains of thermophilic bacteria isolated from a hot spring site in Garhwal region of Indian Himalaya have been characterized and identified using phenotypic and genotypic characters. All the strains developed circular to irregular colonies between 2-3 mm on Tryptone Yeast extract (TY) agar plates at 65 degrees C following 24-36 h incubation. In TY broth, facultative bacterial growth was observed within 12-16 h of incubation at 65 degrees C. The bacterial strains could tolerate a temperature range between 40-45 degrees C to 85-90 degrees C (optimum 65-70 degrees C) and pH between 4-11 (optimum 6-8). The cell morphology varied from short to long rods arranged in single, diplobacilli (in V or L shape) or short or long spiral chains with coiling. The bacterial strains varied in respect of their biochemical tests conducted for various enzymes, fermentation of sugars, tolerance to antibiotics and salt. Based on the 16S rRNA analysis, 11 strains showed maximum similarity with Geobacillus stereothermophilus, one strain with G. kaustophilus and one with Geobacillus sp. PMID:19025872

Sharma, Avinash; Pandey, Anita; Shouche, Yogesh S; Kumar, Bhavesh; Kulkarni, Girish

2009-04-01

101

Organophosphonate Utilization by the Thermophile Geobacillus caldoxylosilyticus T20  

OpenAIRE

A strain of Geobacillus caldoxylosilyticus from central heating system water could utilize a number of organophosphonates as the sole phosphorus source for growth at 60°C. During growth on glyphosate, aminomethylphosphonate release to the medium was observed, and in cell extracts, a glyphosate oxidoreductase-type activity, producing stoichiometric amounts of aminomethylphosphonate and glyoxylate from glyphosate, was detectable.

Obojska, Agnieszka; Ternan, Nigel G.; Lejczak, Barbara; Kafarski, Pawel; Mcmullan, Geoff

2002-01-01

102

Draft Genome Sequence of Geobacillus thermopakistaniensis Strain MAS1.  

Science.gov (United States)

Geobacillus thermopakistaniensis strain MAS1 was isolated from a hot spring located in the Northern Areas of Pakistan. The draft genome sequence was 3.5 Mb and identified a number of genes of potential industrial importance, including genes encoding glycoside hydrolases, pullulanase, amylopullulanase, glycosidase, and alcohol dehydrogenases. PMID:24903880

Siddiqui, Masood Ahmed; Rashid, Naeem; Ayyampalayam, Saravanaraj; Whitman, William B

2014-01-01

103

Analysis of the active center of Bacillus stearothermophilus neopullulanase.  

OpenAIRE

The active center of the neopullulanase from Bacillus stearothermophilus was analyzed by means of site-directed mutagenesis. The amino acid residues located in the active center of the neopullulanase were tentatively identified according to a molecular model of Taka-amylase A and homology analysis of the amino acid sequences of neopullulanse, Taka-amylase A, and other amylolytic enzymes. When amino acid residues Glu and Asp, corresponding to the putative catalytic sites, were replaced by the ...

Kuriki, T.; Takata, H.; Okada, S.; Imanaka, T.

1991-01-01

104

Strong and consistently synergistic inactivation of spores of spoilage-associated Bacillus and Geobacillus spp. by high pressure and heat compared with inactivation by heat alone.  

Science.gov (United States)

The inactivation of spores of four low-acid food spoilage organisms by high pressure thermal (HPT) and thermal-only processing was compared on the basis of equivalent thermal lethality calculated at a reference temperature of 121.1°C (F(z)(121.1)(°)(C, 0.1 MPa or 600 MPa)) and characterized as synergistic, not different or protective. In addition, the relative resistances of spores of the different spoilage microorganisms to HPT processing were compared. Processing was performed and inactivation was compared in both laboratory and pilot scale systems and in model (diluted) and actual food products. Where statistical comparisons could be made, at least 4 times and up to around 190 times more inactivation (log(10) reduction/minute at F(T)(z)(121.1)(°)(C)) of spores of Bacillus amyloliquefaciens, Bacillus sporothermodurans, and Geobacillus stearothermophilus was achieved using HPT, indicating a strong synergistic effect of high pressure and heat. Bacillus coagulans spores were also synergistically inactivated in diluted and undiluted Bolognese sauce but were protected by pressure against thermal inactivation in undiluted cream sauce. Irrespective of the response characterization, B. coagulans and B. sporothermodurans were identified as the most HPT-resistant isolates in the pilot scale and laboratory scale studies, respectively, and G. stearothermophilus as the least in both studies and all products. This is the first study to comprehensively quantitatively characterize the responses of a range of spores of spoilage microorganisms as synergistic (or otherwise) using an integrated thermal-lethality approach (F(T)(z)). The use of the F(T)(z) approach is ultimately important for the translation of commercial minimum microbiologically safe and stable thermal processes to HPT processes. PMID:21278265

Olivier, S A; Bull, M K; Stone, G; van Diepenbeek, R J; Kormelink, F; Jacops, L; Chapman, B

2011-04-01

105

Strong and Consistently Synergistic Inactivation of Spores of Spoilage-Associated Bacillus and Geobacillus spp. by High Pressure and Heat Compared with Inactivation by Heat Alone ? †  

Science.gov (United States)

The inactivation of spores of four low-acid food spoilage organisms by high pressure thermal (HPT) and thermal-only processing was compared on the basis of equivalent thermal lethality calculated at a reference temperature of 121.1°C (Fz121.1°C, 0.1 MPa or 600 MPa) and characterized as synergistic, not different or protective. In addition, the relative resistances of spores of the different spoilage microorganisms to HPT processing were compared. Processing was performed and inactivation was compared in both laboratory and pilot scale systems and in model (diluted) and actual food products. Where statistical comparisons could be made, at least 4 times and up to around 190 times more inactivation (log10 reduction/minute at FTz121.1°C) of spores of Bacillus amyloliquefaciens, Bacillus sporothermodurans, and Geobacillus stearothermophilus was achieved using HPT, indicating a strong synergistic effect of high pressure and heat. Bacillus coagulans spores were also synergistically inactivated in diluted and undiluted Bolognese sauce but were protected by pressure against thermal inactivation in undiluted cream sauce. Irrespective of the response characterization, B. coagulans and B. sporothermodurans were identified as the most HPT-resistant isolates in the pilot scale and laboratory scale studies, respectively, and G. stearothermophilus as the least in both studies and all products. This is the first study to comprehensively quantitatively characterize the responses of a range of spores of spoilage microorganisms as synergistic (or otherwise) using an integrated thermal-lethality approach (FTz). The use of the FTz approach is ultimately important for the translation of commercial minimum microbiologically safe and stable thermal processes to HPT processes. PMID:21278265

Olivier, S. A.; Bull, M. K.; Stone, G.; van Diepenbeek, R. J.; Kormelink, F.; Jacops, L.; Chapman, B.

2011-01-01

106

Functional and Structural Characterization of Thermostable d-Amino Acid Aminotransferases from Geobacillus spp.†  

OpenAIRE

d-Amino acid aminotransferases (d-AATs) from Geobacillus toebii SK1 and Geobacillus sp. strain KLS1 were cloned and characterized from a genetic, catalytic, and structural aspect. Although the enzymes were highly thermostable, their catalytic capability was approximately one-third of that of highly active Bacilli enzymes, with respective turnover rates of 47 and 55 s?1 at 50°C. The Geobacillus enzymes were unique and shared limited sequence identities of below 45% with d-AATs from mesophil...

Lee, Seung-goo; Hong, Seung-pyo; Song, Jae Jun; Kim, Su-jin; Kwak, Mi-sun; Sung, Moon-hee

2006-01-01

107

Freezing/thawing pretreatment coupled with biological process of thermophilic Geobacillus sp. G1: Acceleration on waste activated sludge hydrolysis and acidification.  

Science.gov (United States)

A novel pretreatment method combining freezing/thawing with Geobacillus sp. G1 was employed to pretreat waste activated sludge (WAS) for enhancing the WAS hydrolysis and subsequent short-chain fatty acids (SCFAs) production. Results showed that freezing/thawing combined with Geobacillus sp. G1 pretreatment achieved the maximal concentrations of soluble protein from 40±6mg COD/L (non-pretreated) to 1226±24mg COD/L (pretreated), and accumulated SCFAs concentration increased from 248±81mg COD/L to 3032±53mg COD/L. Excitation emission matrix (EEM) fluorescence spectroscopy revealed the highest fluorescence intensity (FI) of protein-like substances, which was the dominant fluorescent organic matters, indicating the synergistic effect of freezing/thawing and Geobacillus sp. G1 pretreatment on organics hydrolysis. High-throughput pyrosequencing analysis investigated that the abundance of bacteria responsible for WAS hydrolysis (such as Clostridium and Caloramator) and SCFAs production (such as Parabacteroides and Bacterodies) was greatly enhanced due to the novel pretreatment method used. PMID:25459862

Yang, Chunxue; Liu, Wenzong; He, Zhangwei; Thangavel, Sangeetha; Wang, Ling; Zhou, Aijuan; Wang, Aijie

2014-11-01

108

Influence of temperature and organic load on chemical disinfection of Geobacillus steareothermophilus spores, a surrogate for Bacillus anthracis.  

Science.gov (United States)

This study evaluated the influence of temperature and organic load on the effectiveness of domestic bleach (DB), Surface Decontamination Foam (SDF), and Virkon in inactivating Geobacillus stearothermophilus spores, which are a surrogate for Bacillus anthracis spores. The spores were suspended in light or heavy organic preparations and the suspension was applied to stainless steel carrier disks. The dried spore inoculum was covered with the disinfectants and the disks were then incubated at various temperatures. At -20°C, the 3 disinfectants caused less than a 2.0 log10 reduction of spores in both organic preparations during a 24-h test period. At 4°C, the DB caused a 4.4 log10 reduction of spores in light organic preparations within 2 h, which was about 3 log10 higher than what was achieved with SDF or Virkon. In heavy organic preparations, after 24 h at 4°C the SDF had reduced the spore count by 4.5 log10, which was about 2 log10 higher than for DB or Virkon. In general, the disinfectants were most effective at 23°C but a 24-h contact time was required for SDF and Virkon to reduce spore counts in both organic preparations by at least 5.5 log10. Comparable disinfecting activity with DB only occurred with the light organic load. In summary, at temperatures as low as 4°C, DB was the most effective disinfectant, inactivating spores within 2 h on surfaces with a light organic load, whereas SDF produced the greatest reduction of spores within 24 h on surfaces with a heavy organic load. PMID:24082400

Guan, Jiewen; Chan, Maria; Brooks, Brian W; Rohonczy, Liz

2013-04-01

109

PRODUCTION AND CHARACTERIZATION OF AN ALKALOTHERMOSTABLE, ORGANIC SOLVENT TOLERANT AND SURFACTANT TOLERANT ESTERASE PRODUCED BY A THERMOPHILIC BACTERIUM GEOBACILLUS SP. AGP-04, ISOLATED FROM BAKRESHWAR HOT SPRING, INDIA  

Directory of Open Access Journals (Sweden)

Full Text Available A thermophilic bacteria, Geobacillus sp. AGP-04, isolated from Surya Kund hot spring, Bakreshwar, West Bengal, India was studied in terms of capability of tributyrin hydrolysis and characterization of its thermostable esterase activity using p-nitrophenyl butyrate (PNPB as substrate. The extracellular crude preparation was characterized in terms of pH and temperature optima and stability, organic solvent tolerance capacity and stability, substrate specificity, surfactant tolerance capacity, kinetic parameters and activation/inhibition behavior towards some metal ions and chemicals. Tributyrin agar assay exhibited that Geobacillus sp. AGP-04 secretes an extracellular esterase. The Vmax and Km values of the esterase were found to be 5099 U/Land 103.5µM, respectively in the presence of PNPB as substrate. The optimum temperature and pH, for Geobacillus sp. AGP-04 esterase was 60oC and 8.0, respectively. Although the enzyme activity was not significantly altered by incubating crude extract solution at 20-70oC for 1 hour, the enzyme activity was fully lost at 90oC for same incubation period. The pH stability profile showed that original crude esterase activity is stable at a broad range (pH 5.0-10.0. Moreover, the enzyme was highly organic solvent and surfactant tolerant. The effect of some chemical on crude esterase activity indicated that Geobacillus sp. AGP-04 produce an esterase which contains a serine residue in active site and for its activity -SH groups are essential. Besides, enzyme production was highly induced if fermentation medium contain polysaccharides and oil as carbon source.

Amit Ghati

2013-10-01

110

Complete Genome Sequence of the Thermophilic Bacterium Geobacillus thermoleovorans CCB_US3_UF5  

OpenAIRE

Geobacillus thermoleovorans CCB_US3_UF5 is a thermophilic bacterium isolated from a hot spring in Malaysia. Here, we report the complete genome of G. thermoleovorans CCB_US3_UF5, which shows high similarity to the genome of Geobacillus kaustophilus HTA 426 in terms of synteny and orthologous genes.

Muhd Sakaff, Muhd Khairul Luqman; Abdul Rahman, Ahmad Yamin; Saito, Jennifer A.; Hou, Shaobin; Alam, Maqsudul

2012-01-01

111

Influence of Bacillus Stearothermophilus generations in the production of its spores  

OpenAIRE

The validation of sterilization processes in food and pharmaceutical industries is a major tool for quality assurance, making the products safe, effective and reliable. Biological indicators, formed by spores of Bacillus stearothermophilus microorganisms considered at higher thermal resistance, are used to evaluate and monitor the physical parameters of a cycle of steam sterilization. In this way this study aimed to cultivate and characterize the microorganism Bacillus stearothermophilus gene...

Heron de Oliveira dos Santos Lima; Roselene Ferreira Oliveira; Mirela Vanin dos Santos Lima

2011-01-01

112

Structural genes encoding the thermophilic alpha-amylases of Bacillus stearothermophilus and Bacillus licheniformis.  

OpenAIRE

The genes encoding the thermostable alpha-amylases of Bacillus stearothermophilus and B. licheniformis were cloned in Escherichia coli, and their DNA sequences were determined. The coding and deduced polypeptide sequences are 59 and 62% homologous to each other, respectively. The B. stearothermophilus protein differs most significantly from that of B. licheniformis in that it possesses a 32-residue COOH-terminal tail. Transformation of E. coli with vectors containing either gene resulted in t...

Gray, G. L.; Mainzer, S. E.; Rey, M. W.; Lamsa, M. H.; Kindle, K. L.; Carmona, C.; Requadt, C.

1986-01-01

113

Nucleotide sequence of the neopullulanase gene from Bacillus stearothermophilus.  

Science.gov (United States)

The gene (nplT) for a new type of pullulan-hydrolysing enzyme, neopullulanase, from Bacillus stearothermophilus TRS40 was sequenced. The DNA sequence revealed only one large open reading frame, composed of 1764 bases and 588 amino acid residues (Mr 69144). Although the thermostable neopullulanase contained eight cysteine residues, they did not provide conformational stability by disulphide bonds. A comparison was made of the amino acid sequences of alpha-amylase, neopullulanase, isoamylase, pullulanase and cyclodextrin glucanotransferase. All the enzymes examined contained four highly conserved regions which probably constitute the active centres of the enzymes. The amino acid residues required for the specificity of neopullulanase are compared with those of alpha-amylase and other amylolytic enzymes. PMID:2482332

Kuriki, T; Imanaka, T

1989-06-01

114

Antimicrobial effects of green tea polyphenols on thermophilic spore-forming bacteria.  

Science.gov (United States)

The inhibitory action of tea polyphenols towards the development and growth of bacterial spores was examined. Among the tested Bacillus bacteria, tea polyphenols showed antibacterial effects towards Bacillus stearothermophilus, which is a thermophilic spore-forming bacterium. The heat resistance of B. stearothermophilus spores was reduced by the addition of tea polyphenols. Clostridium thermoaceticum, an anaerobic spore-forming bacterium, also exhibited reduced heat resistance of its spores in the presence of tea polyphenols. (-)-Epigallocatechin gallate, which is the main component of tea polyphenols, showed strong activity against both B. stearothermophilus and C. thermoaceticum. The heat resistance of these bacterial spores was more rapidly decreased by the addition of tea polyphenols at high temperatures. PMID:16232822

Sakanaka, S; Juneja, L R; Taniguchi, M

2000-01-01

115

Crystallization and preliminary crystallographic analysis of the phosphotriesterase-like lactonase from Geobacillus kaustophilus  

OpenAIRE

Recombinant GK1506 from the thermophilic bacterium Geobacillus kaustophilus has been expressed, purified and crystallized. A 2.6?Å resolution native data set was collected from a single flash-cooled crystal.

Zheng, Baisong; Yu, Shanshan; Zhang, Yu; Feng, Yan; Lou, Zhiyong

2011-01-01

116

Modification of rock/fluid and fluid/fluid interfaces during MEOR processes, using two biosurfactant producing strains of Bacillus stearothermophilus SUCPM#14 and Enterobacter cloacae: a mechanistic study.  

Science.gov (United States)

During any microbial enhanced oil recovery process, both cells and the metabolic products of bacteria govern the tertiary oil recovery efficiency. However, very accurate examination is needed to find the functionality of these tiny creatures at different reservoir conditions. In this regard, the effect of cell structure on ultimate microbial recovery efficiency which is the most dominant mechanism based on the microorganism types (gram-negative or gram-positive) was systematically investigated. At the first stage, possible different active mechanisms using Bacillus stearothermophilus SUCPM#14 strain were tested using specially designed injection protocol, in situ and ex situ core flooding experiments, interfacial tension, viscosity, pH and Amott wettability index measurements. At the second stage, comparing functionality of B. stearothermophilus SUCPM#14 (a gram-positive type) with the previously examined strain namely Enterobacter cloacae as a gram-negative type, proposed this hypothesis that the cell structure significantly affects the interfacial behaviors. New designed protocols were utilized to check the individual effects of cells, bioproducts and interaction of these together on the oil/water and also fluids/rock interfaces. The final results showed that the cells of B. stearothermophilus SUCPM#14 adhere more into the oil/water interface compared to E. cloacae and change its rheological properties; e.g. its elastic properties which affect the ultimate microbial oil recovery efficiency. Eventually, contradicting results revealed that biosurfactant produced by E. cloacae was able to considerably reduce the interfacial tension and alter the wettability of the rock (to neutral conditions) while biosurfactant produced by B. stearothermophilus SUCPM#14 was not very effective. PMID:24373916

Sarafzadeh, Pegah; Zeinolabedini Hezave, Ali; Mohammadi, Sahar; Niazi, Ali; Ayatollahi, Shahab

2014-05-01

117

A Group II Intron-Type Open Reading Frame from the Thermophile Bacillus (Geobacillus) stearothermophilus Encodes a Heat-Stable Reverse Transcriptase  

OpenAIRE

The production of a stable cDNA copy of an unstable RNA molecule by reverse transcription is a widely used and essential technology for many important applications, such as the construction of gene libraries, production of DNA probes, and analysis of gene expression by reverse transcriptase PCR (RT-PCR). However, the synthesis of full-length cDNAs is frequently inefficient, because the RT commonly used often produces truncated cDNAs. Synthesizing cDNA at higher temperatures, on the other hand...

Vellore, Jaishree; Moretz, Samuel E.; Lampson, Bert C.

2004-01-01

118

Emprego de resíduo agroindustrial na germinação de esporos de Geobacillus Stearothermophilus AtCC 7953 danificados pelo calor úmido sob pressão  

OpenAIRE

Resumo: O uso de esporos termorresistentes como indicadores biológicos da efetividade dos processos de esterilização é fundamental para a segurança dos usuários dos serviços de saúde. Para tanto é necessário que se confirme a destruição ou não dos esporos após o término do ciclo de esterilização. Indicadores biológicos de segunda geração (auto-contidos) consistem de uma suspensão padronizada de esporos em um meio de cultivo capaz de proporcionar condições para a germin...

Dlugokenski, Regina Elizabete Ferreira

2010-01-01

119

Enzymatic and cryoreduction EPR studies of the hydroxylation of methylated N(?)-hydroxy-L-arginine analogues by nitric oxide synthase from Geobacillus stearothermophilus.  

Science.gov (United States)

Nitric oxide synthase (NOS) catalyzes the conversion of L-arginine to L-citrulline and NO in a two-step process involving the intermediate N(?)-hydroxy-L-arginine (NHA). It was shown that Cpd I is the oxygenating species for L-arginine; the hydroperoxo ferric intermediate is the reactive intermediate with NHA. Methylation of the N(?)-OH and N(?)-H of NHA significantly inhibits the conversion of NHA into NO and L-citrulline by mammalian NOS. Kinetic studies now show that N(?)-methylation of NHA has a qualitatively similar effect on H?O?-dependent catalysis by bacterial gsNOS. To elucidate the effect of methylating N(?)-hydroxy L-arginine on the properties and reactivity of the one-electron-reduced oxy-heme center of NOS, we have applied cryoreduction/annealing/EPR/ENDOR techniques. Measurements of solvent kinetic isotope effects during 160 K cryoannealing cryoreduced oxy-gsNOS/NHA confirm the hydroperoxo ferric intermediate as the catalytically active species of step two. Product analysis for cryoreduced samples with methylated NHA's, NHMA, NMOA, and NMMA, annealed to 273 K, show a correlation of yields of L-citrulline with the intensity of the g 2.26 EPR signal of the peroxo ferric species trapped at 77 K, which converts to the reactive hydroperoxo ferric state. There is also a correlation between the yield of L-citrulline in these experiments and k(obs) for the H?O?-dependent conversion of the substrates by gsNOS. Correspondingly, no detectable amount of cyanoornithine, formed when Cpd I is the reactive species, was found in the samples. Methylation of the NHA guanidinium N(?)-OH and N(?)-H inhibits the second NO-producing reaction by favoring protonation of the ferric-peroxo to form unreactive conformers of the ferric-hydroperoxo state. It is suggested that this is caused by modification of the distal-pocket hydrogen-bonding network of oxy gsNOS and introduction of an ordered water molecule that facilitates delivery of the proton(s) to the one-electron-reduced oxy-heme moiety. These results illustrate how variations in the properties of the substrate can modulate the reactivity of a monooxygenase. PMID:25251261

Davydov, Roman; Labby, Kristin Jansen; Chobot, Sarah E; Lukoyanov, Dmitriy A; Crane, Brian R; Silverman, Richard B; Hoffman, Brian M

2014-10-21

120

Geobacillus zalihae sp. nov., a thermophilic lipolytic bacterium isolated from palm oil mill effluent in Malaysia  

Directory of Open Access Journals (Sweden)

Full Text Available Abstract Background Thermophilic Bacillus strains of phylogenetic Bacillus rRNA group 5 were described as a new genus Geobacillus. Their geographical distribution included oilfields, hay compost, hydrothermal vent or soils. The members from the genus Geobacillus have a growth temperatures ranging from 35 to 78°C and contained iso-branched saturated fatty acids (iso-15:0, iso-16:0 and iso-17:0 as the major fatty acids. The members of Geobacillus have similarity in their 16S rRNA gene sequences (96.5–99.2%. Thermophiles harboring intrinsically stable enzymes are suitable for industrial applications. The quest for intrinsically thermostable lipases from thermophiles is a prominent task due to the laborious processes via genetic modification. Results Twenty-nine putative lipase producers were screened and isolated from palm oil mill effluent in Malaysia. Of these, isolate T1T was chosen for further study as relatively higher lipase activity was detected quantitatively. The crude T1 lipase showed high optimum temperature of 70°C and was also stable up to 60°C without significant loss of crude enzyme activity. Strain T1T was a Gram-positive, rod-shaped, endospore forming bacterium. On the basic of 16S rDNA analysis, strain T1T was shown to belong to the Bacillus rRNA group 5 related to Geobacillus thermoleovorans (DSM 5366T and Geobacillus kaustophilus (DSM 7263T. Chemotaxonomic data of cellular fatty acids supported the affiliation of strain T1T to the genus Geobacillus. The results of physiological and biochemical tests, DNA/DNA hybridization, RiboPrint analysis, the length of lipase gene and protein pattern allowed genotypic and phenotypic differentiation of strain T1T from its validly published closest phylogenetic neighbors. Strain T1T therefore represents a novel species, for which the name Geobacillus zalihae sp. nov. is proposed, with the type strain T1T (=DSM 18318T; NBRC 101842T. Conclusion Strain T1T was able to secrete extracellular thermostable lipase into culture medium. The strain T1T was identified as Geobacillus zalihae T1T as it differs from its type strains Geobacillus kaustophilus (DSM 7263T and Geobacillus thermoleovorans (DSM 5366T on some physiological studies, cellular fatty acids composition, RiboPrint analysis, length of lipase gene and protein profile.

Salleh Abu

2007-08-01

121

Permanent draft genome sequence of Geobacillus thermocatenulatus strain GS-1.  

Science.gov (United States)

Geobacillus thermocatenulatus strain GS-1 is a thermophilic bacillus having a growth optimum at 60°C, capable of degrading alkanes. It was isolated from the formation water of a high-temperature deep oil reservoir in Qinghai oilfield, China. Here, we report the draft genome sequence with an estimated assembly size of 3.5Mb. A total of 3371 protein-coding sequences, including monooxygenase, alcohol dehydrogenase, aldehyde dehydrogenase, fatty acid-CoA ligase, acyl-CoA dehydrogenase, enoyl-CoA hydrogenase, hydroxyacyl-CoA dehydrogenase and thiolase, were detected in the genome, which are involved in the alkane degradation pathway. Our results may provide insights into the genetic basis of the adaptation of this strain to high-temperature oilfield ecosystems. PMID:25280889

Zheng, Beiwen; Zhang, Fan; Chai, Lujun; Yu, Gaoming; Shu, Fuchang; Wang, Zhengliang; Su, Sanbao; Xiang, Tingsheng; Zhang, Zhongzhi; Hou, DuJie; She, Yuehui

2014-10-01

122

Characterization of a thermophilic bacteriophage of Geobacillus kaustophilus.  

Science.gov (United States)

GBK2 is a bacteriophage, isolated from a backyard compost pile, that infects the thermophile Geobacillus kaustophilus. GBK2 has a circularly permuted genome of 39,078 bp with a G+C content of 43 %. Annotation of the genome reveals 62 putative open reading frames (ORFs), 25 of which (40.3 %) show homology to known proteins and 37 of which (59.7 %) are proteins with unknown functions. Twelve of the identified ORFs had the greatest homology to genes from the phage SPP1, a phage that infects the mesophile Bacillus subtilis. The overall genomic arrangement of GBK2 is similar to that of SPP1, with the majority of GBK2 SPP1-like genes coding for proteins involved in DNA replication and metabolism. PMID:24796554

Marks, Timothy J; Hamilton, Paul T

2014-10-01

123

Cloning and expression of three ladA-type alkane monooxygenase genes from an extremely thermophilic alkane-degrading bacterium Geobacillus thermoleovorans B23.  

Science.gov (United States)

An extremely thermophilic bacterium, Geobacillus thermoleovorans B23, is capable of degrading a broad range of alkanes (with carbon chain lengths ranging between C11 and C32) at 70 °C. Whole-genome sequence analysis revealed that unlike most alkane-degrading bacteria, strain B23 does not possess an alkB-type alkane monooxygenase gene. Instead, it possesses a cluster of three ladA-type genes, ladA?B23, ladA?B23, and ladB B23, on its chromosome, whose protein products share significant amino acid sequence identities, 49.8, 34.4, and 22.7 %, respectively, with that of ladA alkane monooxygenase gene found on a plasmid of Geobacillus thermodetrificans NG 80-2. Each of the three genes, ladA?B23, ladA?B23, and ladB B23, was heterologously expressed individually in an alkB1 deletion mutant strain, Pseudomonas fluorescens KOB2?1. It was found that all three genes were functional in P. fluorescens KOB2?1, and partially restored alkane degradation activity. In this study, we suggest that G. thermoleovorans B23 utilizes multiple LadA-type alkane monooxygenases for the degradation of a broad range of alkanes. PMID:24682607

Boonmak, Chanita; Takahashi, Yasunori; Morikawa, Masaaki

2014-05-01

124

1H, 13C, and 15N backbone and side chain resonance assignments of thermophilic Geobacillus kaustophilus cyclophilin-A.  

Science.gov (United States)

Cyclophilins catalyze the reversible peptidyl-prolyl isomerization of their substrates and are present across all kingdoms of life from humans to bacteria. Although numerous biological roles have now been discovered for cyclophilins, their function was initially ascribed to their chaperone-like activity in protein folding where they catalyze the often rate-limiting step of proline isomerization. This chaperone-like activity may be especially important under extreme conditions where cyclophilins are often over expressed, such as in tumors for human cyclophilins (Lee Archiv Pharm Res 33(2): 181-187, 2010), but also in organisms that thrive under extreme conditions, such as theromophilic bacteria. Moreover, the reversible nature of the peptidyl-prolyl isomerization reaction catalyzed by cyclophilins has allowed these enzymes to serve as model systems for probing the role of conformational changes during catalytic turnover (Eisenmesser et al. Science 295(5559): 1520-1523, 2002; Eisenmesser et al. Nature 438(7064): 117-121, 2005). Thus, we present here the resonance assignments of a thermophilic cyclophilin from Geobacillus kaustophilus derived from deep-sea sediment (Takami et al. Extremophiles 8(5): 351-356, 2004). This thermophilic cyclophilin may now be studied at a variety of temperatures to provide insight into the comparative structure, dynamics, and catalytic mechanism of cyclophilins. PMID:23138858

Holliday, Michael J; Zhang, Fengli; Isern, Nancy G; Armstrong, Geoffrey S; Eisenmesser, Elan Z

2014-04-01

125

1H, 13C, and 15N backbone and side chain resonance assignments of thermophilic Geobacillus kaustophilus cyclophilin-A  

Energy Technology Data Exchange (ETDEWEB)

Cyclophilins catalyze the reversible peptidyl-prolyl isomerization of their substrates and are present across all kingdoms of life from humans to bacteria. Although numerous biological roles have now been discovered for cyclophilins, their function was initially ascribed to their chaperone-like activity in protein folding where they catalyze the often rate-limiting step of proline isomerization. This chaperone-like activity may be especially important under extreme conditions where cyclophilins are often over expressed, such as in tumors for human cyclophilins {Lee, 2010 #1167}, but also in organisms that thrive under extreme conditions, such as theromophilic bacteria. Moreover, the reversible nature of the peptidyl-prolyl isomerization reaction catalyzed by cyclophilins has allowed these enzymes to serve as model systems for probing the role of conformational changes during catalytic turnover {Eisenmesser, 2002 #20;Eisenmesser, 2005 #203}. Thus, we present here the resonance assignments of a thermophilic cyclophilin from Geobacillus kaustophilus derived from deep-sea sediment {Takami, 2004 #1384}. This thermophilic cyclophilin may now be studied at a variety of temperatures to provide insight into the comparative structure, dynamics, and catalytic mechanism of cyclophilins.

Holliday, Michael; Zhang, Fengli; Isern, Nancy G.; Armstrong, Geoffrey S.; Eisenmesser, Elan Z.

2014-04-01

126

Isolation of phenol-degrading Bacillus stearothermophilus and partial characterization of the phenol hydroxylase.  

OpenAIRE

Bacillus stearothermophilus BR219, isolated from river sediment, degraded phenol at levels to 15 mM at a rate of 0.85 mumol/h (4 x 10(6) cells). The solubilized phenol hydroxylase was NADH dependent, exhibited a 55 degrees C temperature optimum for activity, and was not inhibited by 0.5 mM phenol.

Gurujeyalakshmi, G.; Oriel, P.

1989-01-01

127

Cell-free amino acid-incorporating systems from Bacillus licheniformis and Bacillus stearothermophilus 10.  

Science.gov (United States)

Cell-free amino acid-incorporating systems were prepared from log-phase cells of Bacillus licheniformis and B. stearothermophilus 10. No differences were observed between the two systems with respect to the types and relative amounts of the ribosomes, the time dependence of incorporation, and the optimal magnesium ion concentration (4 mm). The B. licheniformis system showed greater dependence on added transfer ribonucleic acid (tRNA) and was less stimulated by polyuridylic acid (poly U) than the B. stearothermophilus 10 system. Neither system was saturated at a level of 450 mug of poly U per incubation mixture. The S-100 fraction and the isolated tRNA inhibited incorporation in the B. stearothermophilus 10 system at 55 C but not at 37 C. No such inhibition was observed in the B. licheniformis system at either temperature. The tRNA prepared from B. subtilis, B. licheniformis, or B. stearothermophilus 10 could be used interchangeably in the two cell-free systems. PMID:5788703

Stenesh, J; Schechter, N

1969-06-01

128

Detection and characterization of chlorinated-dioxin ether cleavage function in the bacterium geobacillus midousuji SH2B-J2  

Energy Technology Data Exchange (ETDEWEB)

As of now, there are no dioxin degrading microorganism reported that can be applied to bioremediation. The reasons for this are that degrading function acquired from comprehensive screening of bacteria that can be grown with a single carbon source using non-chlorinated dioxin does not function against highly chlorinated dioxins, and that although white rot fungus capable of degrading lignin, a plant polyphenol substance, have been reported to reduce chlorinated dioxins, degrading enzyme remain unclear. Geobacillus midousuji SH2B-J2 (J2 strain) that have been separated by Hoshina et al. have shown to reduce highly chlorinated dioxins in incineration fly ash, as well as octa-chlorinated dioxins (OCDD). However, details of its degrading mechanisms remain unclear. Since the J2 strain is capable of reducing even OCDD, it was hypothesized that the initial degradation reaction is intramolecular ether bond cleavage, so J2 strain dioxin degradation mechanism was analyzed for verification.

Otsuka, Y.; Hoshina, S. [Jikei Univ. School of Medicine, Tokyo (Japan). Dept. of Laboratory Medicine; Nakamura, M.; Hishiyama, S. [Forestry and Forest Products Research Institute, Ibaraki (Japan); Katayama, Y. [Tokyo Univ. of Agriculture and Technology, Koganei (Japan)

2004-09-15

129

Cloning and characterization of a 4-Hydroxyphenylacetate 3-Hydroxylase from the Thermophile Geobacillus sp. PA-9  

OpenAIRE

A 4-hydroxyphenylacetic acid (4-HPA) hydroxylase-encoding gene, on a 2.7-kb genomic DNA fragment, was cloned from the thermophile Geobacillus sp. PA-9. The Geobacillus sp. PA-9 4-HPA hydroxylase gene, designated hpaH, encodes a protein of 494 amino acids with a predicted molecular mass of 56.269 Da. The deduced amino-acid sequence of the hpaH gene product displayed <30% amino-acid sequence identity with the larger monooxygenase components of the previously characterized two-component 4-HPA 3-...

Hawumba, J. F.; Brozel, V. S.; Theron, Jacques

2007-01-01

130

Purification and Characterization of a Thermostable Lipase from Geobacillus thermodenitrificans IBRL-nra  

OpenAIRE

Thermostable lipase from Geobacillus thermodenitrificans IBRL-nra was purified and characterized. The production of thermostable lipase from Geobacillus thermodenitrificans IBRL-nra was carried out in a shake-flask system at 65°C in cultivation medium containing; glucose 1.0% (w/v); yeast extract 1.25% (w/v); NaCl 0.45% (w/v) olive oil 0.1% (v/v) with agitation of 200?rpm for 24 hours. The extracted extracellular crude thermostable lipase was purified to homogeneity by using ultrafiltratio...

Anuradha Balan; Darah Ibrahim; Rashidah Abdul Rahim; Fatimah Azzahra Ahmad Rashid

2012-01-01

131

Genome shuffling enhances lipase production of thermophilic Geobacillus sp.  

Science.gov (United States)

Thermostable lipases are potential enzymes for biocatalytic application. In this study, the lipase production of Geobacillus sp. CF03 (WT) was improved by genome shuffling. After two rounds of genome shuffling, one fusant strain (FB1) achieved increase lipase activity from the populations generated by ultraviolet irradiation and ethyl methylsulfonate (EMS) mutagenesis. The growth rate and lipase production of FB1 increased highest by 150 and 238 %, respectively, in comparison to the wild type. The fusant enzyme had a significant change in substrate specificity but still prefers the long-chain length substrates. It had an optimum activity at 60 °C, pH at 7.0-8.0, with p-nitrophenyl palmitate (C16) as a substrate and retained about 50 % of their activity after 15 min at 70 °C, pH 8.0. Furthermore, the fusant lipase showed the preference of sesame oil, waste palm oil, and canola oil. Therefore, the genome shuffling strategy has been successful to strain improvement and selecting strain with multiple desirable characteristics. PMID:25119547

Chalopagorn, Pornchanok; Charoenpanich, Jittima; Choowongkomon, Kiattawee

2014-10-01

132

Catalytic Biomineralization of Fluorescent Calcite by the Thermophilic Bacterium Geobacillus thermoglucosidasius?  

Science.gov (United States)

The thermophilic Geobacillus bacterium catalyzed the formation of 100-?m hexagonal crystals at 60°C in a hydrogel containing sodium acetate, calcium chloride, and magnesium sulfate. Under fluorescence microscopy, crystals fluoresced upon excitation at 365 ± 5, 480 ± 20, or 545 ± 15 nm. X-ray diffraction indicated that the crystals were magnesium-calcite in calcite-type calcium carbonate. PMID:20851984

Yoshida, Naoto; Higashimura, Eiji; Saeki, Yuichi

2010-01-01

133

Catalytic Biomineralization of Fluorescent Calcite by the Thermophilic Bacterium Geobacillus thermoglucosidasius?  

OpenAIRE

The thermophilic Geobacillus bacterium catalyzed the formation of 100-?m hexagonal crystals at 60°C in a hydrogel containing sodium acetate, calcium chloride, and magnesium sulfate. Under fluorescence microscopy, crystals fluoresced upon excitation at 365 ± 5, 480 ± 20, or 545 ± 15 nm. X-ray diffraction indicated that the crystals were magnesium-calcite in calcite-type calcium carbonate.

Yoshida, Naoto; Higashimura, Eiji; Saeki, Yuichi

2010-01-01

134

Complete Genome Sequence of Geobacillus sp. Strain GHH01, a Thermophilic Lipase-Secreting Bacterium  

OpenAIRE

Geobacillus sp. strain GHH01 was isolated during a screening for producers of extracellular thermostable lipases. The completely sequenced and annotated 3.6-Mb genome encodes 3,478 proteins. The strain is genetically equipped to utilize a broad range of different substrates and might develop natural competence.

Wiegand, Sandra; Rabausch, Ulrich; Chow, Jennifer; Daniel, Rolf; Streit, Wolfgang R.; Liesegang, Heiko

2013-01-01

135

Gene cloning, sequence analysis, purification, and characterization of a thermostable aminoacylase from Bacillus stearothermophilus.  

OpenAIRE

A genomic DNA fragment encoding aminoacylase activity of the eubacterium Bacillus stearothermophilus was cloned into Escherichia coli. Transformants expressing aminoacylase activity were selected by their ability to complement E. coli mutants defective in acetylornithine deacetylase activity, the enzyme that converts N-acetylornithine to ornithine in the arginine biosynthetic pathway. The 2.3-kb cloned fragment has been entirely sequenced. Analysis of the sequence revealed two open reading fr...

Sakanyan, V.; Desmarez, L.; Legrain, C.; Charlier, D.; Mett, I.; Kochikyan, A.; Savchenko, A.; Boyen, A.; Falmagne, P.; Pierard, A.

1993-01-01

136

Toxic effects of tamoxifen on the growth and respiratory activity of Bacillus stearothermophilus  

OpenAIRE

The anticancer drug tamoxifen (TAM) is used as first line therapy in breast cancer. Although tamoxifen is usually considered an estrogen antagonist, several studies suggest alternative mechanisms of action. Bacillus stearothermophilus has been used as a model to clarify the antiproliferative action of tamoxifen putatively related with drug-membrane interaction. According to previous data, TAM induces perturbation of membrane structure along with impairment of bacterial growth. The aim of this...

Luxo, C.; Jurado, A. S.; Custo?dio, J. B. A.; Madeira, V. M. C.

2001-01-01

137

Reproduction of Bacillus stearothermophilus as a Function of Temperature and Pressure  

OpenAIRE

The colony-forming ability and the rate of reproduction of Bacillus stearothermophilus were determined as a function of temperature and pressure. Colonies were formed between 39 and 70°C at atmospheric pressure and between 54 and 67°C at 45 MPa. Colonies did not form at 55.9 MPa. The rate of reproduction in broth cultures decreased with increasing pressure at all temperatures. The rate of reproduction diminished rapidly with pressure above 10.4 MPa. Therefore, increased hydrostatic pressure...

Yayanos, A. Aristides; Boxtel, R.; Dietz, Allan S.

1983-01-01

138

Enhancement of proteolytic enzyme activity excreted from Bacillus stearothermophilus for a thermophilic aerobic digestion process.  

Science.gov (United States)

Proteolysis is one of the main enzymatic reactions involved in waste activated sludge (WAS) digestion. In this study, proteases excreted from Bacillus stearothermophilus (ATCC 31197) were classified, and an enhancement of protease activity was achieved using economical chemical additives for WAS digestion. Proteases excreted from B. stearothermophilus were classified into two families: serine and metallo-proteases. Various metal ions were investigated as additives which could potentially enhance protease activity. It was observed that Ca2+ and Fe2+ could markedly activate these enzymes. These results were applied to thermophilic aerobic digestion (TAD) of industrial WAS using B. stearothermophilus. The addition of these divalent ions enhanced the degradation performance of the TAD process in terms of reducing the total suspended solids (TSSs), the dissolved organic carbon (DOC) content, and the intracellular and extracellular protein concentrations. The best result, with respect to protein reduction in a digestion experiment, was obtained by the addition of 2 mM Ca2+. Therefore, a proposed TAD process activated by calcium addition can be successfully used for industrial and municipal WAS digestion to the upgrading of TAD process performance. PMID:12003317

Kim, Young-Kee; Bae, Jin-Hye; Oh, Byung-Keun; Lee, Won Hong; Choi, Jeong-Woo

2002-04-01

139

Structure based protein engineering of Bacillus stearothermophilus ?-amylase: toward a new substrate specificity  

International Nuclear Information System (INIS)

Full text. Structural similarity is observed in all members of ?-amylase family but different products are generated during hydrolysis of starch due to different affinities for intermediate dextrins. In order to understand the structural determinants for this property and to introduce different specificity to ?-amylase of Bacillus stearothermophilus we intend to solve the three dimensional structure by X-ray crystallography of the native protein by using synchrotron radiation at Brazilian National Synchrotron Light Laboratory (LNLS). Protein was over expressed in E. coli, purified and crystallization experiments were carried out by using sparse matrix Crystal Screen and Crystal Screen II from Hampton Research (Laguna Hills, CA, USA). Several condition have produced crystals with some defined characteristic: MDP seems to be important to the crystallization: the preferential pH is around 7.5 with organic buffer (HEPES); organic solvent as 2-propanol seems to be also important for the crystallization. On those condition crystals appeared as cluster of needles or small crystals with high number of nucleation. New conditions are being prepared to improve the site and quality of crystals. Data collection of native of Bacillus stearothermophilus ?-amylase will e done at Protein Crystallography Station at LNLS. Crystal structure of mutated ?-amylase bu site direct mutagenesis of residues suggested by the native crystal structure will be obtained. Co-crystallization of Bacbe obtained. Co-crystallization of Bacillus stearothermophilus ?-amylase and oligosaccharide will be carried out to identify residues involved in the binding site to plan new mutation. In another series of mutation the putative binding site residues, once identified, will be mutated to residues observed in TAKA amylase to confer different specificity to ?-amylase. Based on the available TAKA amylase structure, in the primary sequence homology and in the three dimensional model of Bacillus stearothermophilus ?-amylase (using Bacillus licheniformis crystal structure as initial model) it seems that Bacillus stearothermophilus ?-amylase binding site is more complex with and insertion of 40 residues. Therefore the three dimensional structure is crucial to understand the specificity of the substrate of this enzyme which will be used to drive the design of mutation to introduce new properties for industrial purpose. (author)

140

Structure based protein engineering of Bacillus stearothermophilus {alpha}-amylase: toward a new substrate specificity  

Energy Technology Data Exchange (ETDEWEB)

Full text. Structural similarity is observed in all members of {alpha}-amylase family but different products are generated during hydrolysis of starch due to different affinities for intermediate dextrins. In order to understand the structural determinants for this property and to introduce different specificity to {alpha}-amylase of Bacillus stearothermophilus we intend to solve the three dimensional structure by X-ray crystallography of the native protein by using synchrotron radiation at Brazilian National Synchrotron Light Laboratory (LNLS). Protein was over expressed in E. coli, purified and crystallization experiments were carried out by using sparse matrix Crystal Screen and Crystal Screen II from Hampton Research (Laguna Hills, CA, USA). Several condition have produced crystals with some defined characteristic: MDP seems to be important to the crystallization: the preferential pH is around 7.5 with organic buffer (HEPES); organic solvent as 2-propanol seems to be also important for the crystallization. On those condition crystals appeared as cluster of needles or small crystals with high number of nucleation. New conditions are being prepared to improve the site and quality of crystals. Data collection of native of Bacillus stearothermophilus {alpha}-amylase will e done at Protein Crystallography Station at LNLS. Crystal structure of mutated {alpha}-amylase bu site direct mutagenesis of residues suggested by the native crystal structure will be obtained. Co-crystallization of Bacillus stearothermophilus {alpha}-amylase and oligosaccharide will be carried out to identify residues involved in the binding site to plan new mutation. In another series of mutation the putative binding site residues, once identified, will be mutated to residues observed in TAKA amylase to confer different specificity to {alpha}-amylase. Based on the available TAKA amylase structure, in the primary sequence homology and in the three dimensional model of Bacillus stearothermophilus {alpha}-amylase (using Bacillus licheniformis crystal structure as initial model) it seems that Bacillus stearothermophilus {alpha}-amylase binding site is more complex with and insertion of 40 residues. Therefore the three dimensional structure is crucial to understand the specificity of the substrate of this enzyme which will be used to drive the design of mutation to introduce new properties for industrial purpose. (author)

Rasera, Ana Claudia [Sao Paulo Univ., SP (Brazil). Inst. de Ciencias Biomedicas; Iulek, Jorge [Universidade Estadual de Ponta Grossa, PR (Brazil). Inst. de Quimica; Delboni, Luis Fernando; Barbosa, Valma Martins Barbosa [Parana Univ., Curitiba, PR (Brazil). Dept. de Bioquimica

1997-12-31

141

BOGUS BACTERIA...  

Science.gov (United States)

Here are some websites to get you started... Just click on the links and start searching! microbe world- bacteria Bacteria Rule Quiz! Bacteria.... Harmful Bacteria Bacteria Museum Bacteria! Microbes- all sorts of info... When you are finished looking at the sites or when you have enough information concerning bacteria, ask Mrs. Deaton for some books that can give you even more DETAIL!!! *Don\\'t forget to keep track of your information on your I-CHARTS... ...

Deaton, Mrs.

2007-01-24

142

Anaerobic bacteria  

Science.gov (United States)

Anaerobic bacteria are bacteria that do not live or grow in the presence of oxygen. In humans, ... Goldstein EJ. Diseases caused by non-spore forming anaerobic bacteria. In: Goldman L, Schafer AI, eds. Goldman's ...

143

Preliminary characterization of the probiotic properties of Candida famata and Geobacillus thermoleovorans  

OpenAIRE

Background and Objective: Probiotics are live microbial feed supplements which beneficially affect the host animal by improving its intestinal microbial balance, producing metabolites which inhibit the colonization or growth of other microorganisms or by competing with them for resources such as nutrients or space. The aim of this study was to investigate the probiotic properties of Candida famata and Geobacillus thermoleovorans.Material and Methods: In this study, yeast and bacterial strains...

Bakhrouf, A.; Behi, A.; Hmila, Z.; Mahdhi, A.

2011-01-01

144

Homologi Gen Seleno Metiltransferase (smt) pada Geobacillus sp. 20k dengan smt Astragalus bisulcatus  

OpenAIRE

Methylselenocysteine (MSC) is the most effective form of selenium against cancer. The synthesis of MSC is catalyzed by seleno methyltransferase (smt) through selenium methylation as its detoxification mechanism. Gene of smt has been characterized in selenium rich plant, Astragalus bisulcatus. This experimental laboratoric study was done on Geobacillus sp. 20k. at Lembaga Ilmu Pengetahuan Indonesia (LIPI), Cibinong, Bogor, November 2008–June 2009.Target gene was detected by polymerase chain ...

Evi Triana; Imam Supardi; Sunarjati Soedigdoadi; Novik Nurhidayat

2010-01-01

145

Cloning, expression and biochemical characterization of the thermostable xylanase from geobacillus thermodenitrificans strain jk1  

OpenAIRE

Geobacillus thermodenitrificans JK1 kamieno termostabilios ksilanaz?s geno klonavimas, ekspresija ir fermento savybi? analiz? Ksilanas - pagrindinis hemiceliulioz?s komponentas ir antras pagal paplitim? polisacharidas gamtoje. Šis biologinis polimeras yra chemiškai heterogeniška bei kompleksiška medžiaga, kurios efektyviam degradavimui reikalingos multifermentin?s sistemos. Tokios sistemos yra pla?iai paplitusios tarp ?vairi? prokariotini? ir eukariotini? mikroorganizm?. Pagr...

Gerasimova, Julija

2014-01-01

146

Biotransformation of eugenol via protocatechuic acid by thermophilic Geobacillus sp. AY 946034 strain.  

Science.gov (United States)

The metabolic pathway of eugenol degradation by thermophilic Geobacillus sp. AY 946034 strain was analyzed based on the lack of data about eugenol degradation by thermophiles. TLC, GC-MS, and biotransformation with resting cells showed that eugenol was oxidized through coniferyl alcohol, and ferulic and vanillic acids to protocatechuic acid before the aromatic ring was cleaved. The cell-free extract of Geobacillus sp. AY 946034 strain grown on eugenol showed a high activity of eugenol hydroxylase, feruloyl-CoA synthetase, vanillate-O-demethylase, and protocatechuate 3,4-dioxygenase. The key enzyme, protocatechuate 3,4- dioxygenase, which plays a crucial role in the degradation of various aromatic compounds, was purified 135-fold to homogeneity with a 34% overall recovery from Geobacillus sp. AY 946034. The relative molecular mass of the native enzyme was about 450 ± 10 kDa and was composed of the non-identical subunits. The pH and temperature optima for enzyme activity were 8 and 60°C, respectively. The half-life of protocatechuate 3,4-dioxygenase at the optimum temperature was 50 min. PMID:24375415

Giedraityte, Gražina; Kal?dien?, Lilija

2014-04-01

147

A comparative study of fatty acid profile and formation of biofilm in Geobacillus gargensis exposed to variable abiotic stress.  

Science.gov (United States)

Understanding bacterial fatty acid (FA) profile has a great taxonomic significance as well as clinical importance for diagnosis issues. Both the composition and nature of membrane FAs change under different nutritional, biotic and (or) abiotic stresses, and environmental stress. Bacteria produce both odd-carbon as well as branched-chain fatty acids (BCFAs). This study was designed to examine the effect of abiotic pressure, including salinity, temperature, pH, and oxinic stress on the growth, development, and FA profile in thermophilic Geobacillus gargensis. Under these stresses, 3 parametric ratios, 2-methyl fatty acids/3-methyl fatty acids (iso-/anteiso-FAs), BCFAs/straight-chain saturated fatty acids (SCSFA), and SCSFAs/straight-chain unsaturated fatty acids (SCUFA), in addition to total lipids affected by variable stresses were measured. Our results indicate that the ratio of total iso-/anteiso-FAs increased at the acidic pH range of 4.1-5.2 and decreased with increasing pH. The reverse was true for salt stress when iso-/anteiso-FAs ratio increased with salt concentration. The BCFAs/SCSFAs and SCSFAs/SCUFAs ratios increased at neutral and alkaline pH and high salt concentration, reduced incubation time, and comparatively high temperature (55-65 °C) of the growth medium. The bacterial total lipid percentage deceased with increasing salt concentration, incubation period, but it increased with temperature. The formation of extracellular polymeric substances was observed under all stress conditions and with the addition of sodium dodecyl sulfate (2 and 5 mmol/L) to the growth medium. The membrane phospholipid composition of the bacterium was analyzed by thin-layer chromatography. PMID:25496258

Al-Beloshei, Noor Essa; Al-Awadhi, Husain; Al-Khalaf, Rania A; Afzal, Mohammad

2015-01-01

148

Analysis of mutations in cyclodextrin glucanotransferase from Bacillus stearothermophilus which affect cyclization characteristics and thermostability.  

OpenAIRE

Cyclodextrin glucanotransferase (CGTase; EC 2.4.1.19) produces cyclodextrin from starch. The CGTase molecule is composed of four globular domains, A, B, C, and D. In order to gain better understanding of the amylolytic and cyclization mechanisms of CGTase, mutant CGTases were constructed from a CGTase gene (cgt1) of Bacillus stearothermophilus NO2. Cgt1-F191Y (Phe at position 191 was replaced by Tyr), Cgt1-F191Y-F255Y, Cgt1-W254V-F255I, Cgt1-W254V, and Cgt1-F255I were constructed for the anal...

Fujiwara, S.; Kakihara, H.; Sakaguchi, K.; Imanaka, T.

1992-01-01

149

Biophysical characterization of a recombinant aminopeptidase II from the thermophilic bacterium Bacillus stearothermophilus  

OpenAIRE

In the present study, the biophysical properties of His6-tagged Bacillus stearothermophilus aminopeptidase II (His6-tagged BsAmpII) are characterized in detail by gel-filtration, analytical ultracentrifugation, and various spectroscopic techniques. Using size-exclusion chromatography and analytical ultracentrifugation, we demonstrate that His6-tagged BsAmpII exists predominantly as a dimer in solution. The enzyme is active and stable at pHs ranging from 6.5 to 8.5. Far-UV circular dichroism a...

Wang, Tzu-fan; Lin, Min-guan; Lo, Huei-fen; Chi, Meng-chun; Lin, Long-liu

2013-01-01

150

Effect of ionization and nisin on the Bacillus strains and Salmonella Enteritidis inoculated Stearothermophilus  

International Nuclear Information System (INIS)

The antimicrobial effect of nisin (at 1000UI/g), and irradiation (at 1, 3 and 5kGy), against the growth of Salmonella enteritidis (106 ufc/ml) and Bacillus Stearothermophilus (106 ufc/ml), inoculated in turkey salami, was studied during storage at 4 degree for 21 days. Treatment of turkey salami with nisin at 1000UI/g did not show any antimicrobial activity against S. Enteritidis with 6.7 pour cent and 0.8 pour cent of reduction after 0 and 21 days of storage respectively, and seems to be insufficient to inhibit B. Stearothermophilus with 23 pour cent and 21 pour cent of reduction after 0 and 21 days of storage respectively. Antimicrobial activities of irradiation were better and proportional to irradiation doses; it shows a reduction of 27 pour cent, 55 pour cent and 67 pour cent by D1, D2 and D3 respectively. The combination of nisin with irradiation at 5kGy showed stronger antimicrobial activities than those obtained by its combination with the first and the second irradiation dose.

151

Fluorimetric Detection of a Bacillus stearothermophilus Spore-Bound Enzyme, ?-d-Glucosidase, for Rapid Indication of Flash Sterilization Failure  

OpenAIRE

A biological indicator based on fluorimetric detection within 60 min of a Bacillus stearothermophilus spore-bound enzyme, ?-d-glucosidase, has been developed. Results indicate that the enzyme survived slightly longer than spores observed after 24 h of incubation. The new system shows promise for evaluating flash sterilization cycles within 60 min compared with conventional 24-h systems.

Vesley, Donald; Langholz, Ann C.; Rohlfing, Stephen R.; Foltz, William E.

1992-01-01

152

Bacteria Museum  

Science.gov (United States)

Who knew that bacteria had their own virtual museum? Here, visitors will "learn that not all bacteria are harmful, how they are used in industry, that they belong to the oldest living creatures on Earth", and many more interesting facts to discover about the diverse world of bacteria. The "Bacterial Species Files" tab at the top of the page, allows visitors to look up information on 40 different specific bacteria, from Anthrax to Yersinia enterocolitica. The information provided for each bacterium includes photographs, consumer guides, fact sheets, and scientific links. Visitors will find that the "Main Exhibits" tab addresses the basics about bacteria, as well as "Pathogenic Bacteria", "Evolution", "How We Fight Bacteria", and "Food and Water Safety". Visitors will surely enjoy the "Good Bacteria in Food" link found in the Food and Water Safety section, as it explains how some foods benefit from good bacteria, such as Swiss cheese, sausage, sauerkraut, chocolate, and coffee.

153

Determination of thermobacteriological parameters and size of Bacillus stearothermophilus ATCC 7953 spores / Determinação dos parâmetros de destruição térmica e dimensões de esporos de Bacillus stearothermophilus ATCC 7953  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in portuguese Este experimento objetivou determinar os parâmetros de destruição térmica de esporos de Bacillus stearothermophilus ATCC 7953 e a estimativa de suas dimensões. Os esporos foram suspensos em solução salina e em mistura de grãos de milho e soja moídos, distribuídos em tubos TDT, e submetidos ao calor [...] por tempo variável, seguido de incubação e contagem direta. Determinou-se o valor D (tempo necessário para redução da viabilidade do micro-organismo em 1 ciclo logarítmico sob determinada temperatura) e o valor z (intervalo de temperatura que ocasiona variação de 10 vezes no valor D). Os esporos suspensos em solução salina foram observados em microscópio eletrônico de varredura, para estimativa das dimensões. Os valores de D121,1 ºC e z para os esporos suspensos em solução salina foram 8,8 minutos e 12,8 ºC, respectivamente. Para aqueles suspensos em mistura milho e soja, D121,1 ºC e z foram 14,2 minutos e 23,7 ºC, respectivamente. As micrografias indicaram que os esporos apresentam-se como bastonetes, homogêneos em forma e dimensão, com comprimento e diâmetro estimados em 2 e 1 µm, respectivamente. Os resultados confirmam a elevada resistência térmica do esporo e indicam que este é um bom indicador biológico para avaliação do processo de extrusão como esterilizante de alimentos. Abstract in english In order to determine thermobacteriological parameters for B. stearothermophilus spores, they were diluted in a saline solution medium and in ground corn-soybean mix, distributed in TDT tube, and submitted to heat for a specific period of time. The D value (time to reduce 1 log cycle of microbial co [...] unt under a certain temperature) and z value (variation of temperature to cause 10-fold change in D value) were estimated. To estimate their dimensions, the spores were visualized by using a scanning electron microscope. D121.1 ºC and z values for these spores, as determined in the saline solution, were 8.8 minutes and 12.8 ºC, respectively. D121,1 ºC and z values determined in the corn-soy mix were 14.2 minutes and 23.7 ºC, respectively. The micrographs indicated that the spores have homogeneous shape and size, with length and diameter of 2 and 1 µm, respectively. These results confirm that the spore is highly thermal-resistant, and it is a good biological indicator to evaluate the extrusion process as a feed sterilizer.

Marcos, Fraiha; Antonio Carlos de Oliveira, Ferraz; João Domingos, Biagi.

1041-10-01

154

Use of a Mixture of Surrogates for Infectious Bioagents in a Standard Approach to Assessing Disinfection of Environmental Surfaces ?  

OpenAIRE

We used a mixture of surrogates (Acinetobacter baumannii, Mycobacterium terrae, hepatitis A virus, and spores of Geobacillus stearothermophilus) for bioagents in a standardized approach to test environmental surface disinfectants. Each carrier containing 10 ?l of mixture received 50 ?l of a test chemical or saline at 22 ± 2°C. Disinfectant efficacy criteria were ?6 log10 reduction for the bacteria and the spores and ?3 log10 reduction for the virus. Peracetic acid (1,000 ppm) was effe...

Sabbah, Safaa; Springthorpe, Susan; Sattar, Syed A.

2010-01-01

155

Second order Monte Carlo and Bayesian inference methods for assessing microbiological risks and nutritional benefits in transformation of vegetable  

OpenAIRE

The aim of this work is to set up microbiological risk and nutritional benefit assessment methods in the transformation of vegetables, in view of a risk-benefit analysis. The considered (industrial) risk is the alteration of green bean cans due to thermophilic bacteria Geobacillus stearothermophilus, and the nutritional benefit is the vitamin C content in appertized green beans. Reference parameters have first been acquired, by a meta-analysis using Bayesian inference for the risk part. Therm...

Rigaux, Cle?mence

2013-01-01

156

Influence of Cations on Growth of Thermophilic Geobacillus spp. and Anoxybacillus flavithermus in Planktonic Culture  

OpenAIRE

Free ions of Na+, K+, Ca2+, and Mg2+ influenced the optical density of planktonic cultures of thermophilic bacilli. Anoxybacillus flavithermus E16 and Geobacillus sp. strain F75 (milk powder manufacturing plant isolates) and A. flavithermus DSM 2641 and G. thermoleovorans DSM 5366 were studied. Ca2+ and Mg2+ were associated with increases in optical density more so than Na+ and K+. Overall, it appeared that Ca2+ and/or Mg2+ was required for the production of protein in thermophilic bacilli, a...

Somerton, Ben; Palmer, Jon; Brooks, John; Smolinski, Edward; Lindsay, Denise; Flint, Steve

2012-01-01

157

Influence of cations on growth of thermophilic Geobacillus spp. and Anoxybacillus flavithermus in planktonic culture.  

Science.gov (United States)

Free ions of Na(+), K(+), Ca(2+), and Mg(2+) influenced the optical density of planktonic cultures of thermophilic bacilli. Anoxybacillus flavithermus E16 and Geobacillus sp. strain F75 (milk powder manufacturing plant isolates) and A. flavithermus DSM 2641 and G. thermoleovorans DSM 5366 were studied. Ca(2+) and Mg(2+) were associated with increases in optical density more so than Na(+) and K(+). Overall, it appeared that Ca(2+) and/or Mg(2+) was required for the production of protein in thermophilic bacilli, as shown by results obtained with A. flavithermus E16, which was selected for further study. PMID:22287005

Somerton, Ben; Palmer, Jon; Brooks, John; Smolinski, Edward; Lindsay, Denise; Flint, Steve

2012-04-01

158

Thermoadaptation trait revealed by the genome sequence of thermophilic Geobacillus kaustophilus  

OpenAIRE

We present herein the first complete genome sequence of a thermophilic Bacillus-related species, Geobacillus kaustophilus HTA426, which is composed of a 3.54 Mb chromosome and a 47.9 kb plasmid, along with a comparative analysis with five other mesophilic bacillar genomes. Upon orthologous grouping of the six bacillar sequenced genomes, it was found that 1257 common orthologous groups composed of 1308 genes (37%) are shared by all the bacilli, whereas 839 genes (24%) in the G.kaustophilus gen...

Takami, Hideto; Takaki, Yoshihiro; Chee, Gab-joo; Nishi, Shinro; Shimamura, Shigeru; Suzuki, Hiroko; Matsui, Satomi; Uchiyama, Ikuo

2004-01-01

159

Thermal resistance of Bacillus stearothermophilus spores in different heating systems containing some approved food additives.  

Science.gov (United States)

The effects of different heating systems on the heat resistance of Bacillus stearothermophilus spores (ATCC 7953, 12980, 15951 and 15952) were investigated. Spores were heated in distilled water, Sorensen buffer (0.18 mol 1-1), McIlvaine buffer (0.0025-0.18 mol 1-1), and several solutions containing sodium chloride (0.06-12%), sodium nitrite (125 ppm), potassium sorbate (0.1%) and sodium benzoate (0.1%) over a wide range of temperatures (115-140 degrees C). D-values obtained for McIlvaine and Sorensen buffers, at the same molarities, were not significantly different (P > 0.05), but decimal reduction times increased as phosphate concentrations in the solutions decreased. The concentrations, in which statistically significant differences (P salt and buffers (180 mol 1-1) were slightly higher than obtained in the other conditions assayed, the difference was not statistically significant (P > 0.05). PMID:8862025

López, M; Mazas, M; González, I; González, J; Bernardo, A

1996-09-01

160

Graphical procedure for comparing thermal death of Bacillus stearothermophilus spores in saturated and superheated steam.  

Science.gov (United States)

The thermal death curve of dried spores of Bacillus stearothermophilus in saturated steam was characterized by three phases: (i) a sharp initial rise in viable count; (ii) a low rate of death which gradually increased; and (iii) logarithmic death at maximal rate. The first phase was a reflection of inadequate heat activation of the spore population. The second and third phases represented the characteristic thermal death curve of the spores in saturated steam. A jacketed steam sterilizer, equipped with a system for initial evacuation of the chamber, was examined for superheat during normal operation. Measurements of spore inactivation and temperature revealed superheat in surface layers of fabrics being processed in steam at 121 C. The high temperature of the fabric surfaces was attributed to absorption of excess heat energy from superheated steam. The superheated steam was produced at the beginning of the normal sterilizing cycle by transfer of heat from the steam-heated jacket to saturated steam entering the vessel. PMID:13988774

SHULL, J J; ERNST, R R

1962-09-01

161

Genetic transformation of Geobacillus kaustophilus HTA426 by conjugative transfer of host-mimicking plasmids.  

Science.gov (United States)

We established an efficient transformation method for thermophile Geobacillus kaustophilus HTA426 using conjugative transfer from Escherichia coli of host-mimicking plasmids that imitate DNA methylation of strain HTA426 to circumvent its DNA restriction barriers. Two conjugative plasmids, pSTE33T and pUCG18T, capable of shuttling between E. coli and Geobacillus spp., were constructed. The plasmids were first introduced into E. coli BR408, which expressed one inherent DNA methylase gene (dam) and two heterologous methylase genes from strain HTA426 (GK1380-GK1381 and GK0343-GK0344). The plasmids were then directly transferred from E. coli cells to strain HTA426 by conjugative transfer using pUB307 or pRK2013 as a helper plasmid. pUCG18T was introduced very efficiently (transfer efficiency, 10(-5)-10(-3) recipient(-1)). pSTE33T showed lower efficiency (10(-7)-10(-6) recipient(-1)) but had a high copy number and high segregational stability. Methylase genes in the donor substantially affected the transfer efficiency, demonstrating that the host-mimicking strategy contributes to efficient transformation. The transformation method, along with the two distinguishing plasmids, increases the potential of G. kaustophilus HTA426 as a thermophilic host to be used in various applications and as a model for biological studies of this genus. Our results also demonstrate that conjugative transfer is a promising approach for introducing exogenous DNA into thermophiles. PMID:22814504

Suzuki, Hirokazu; Yoshida, Ken-ichi

2012-09-01

162

Homologi Gen Seleno Metiltransferase (smt pada Geobacillus sp. 20k dengan smt Astragalus bisulcatus  

Directory of Open Access Journals (Sweden)

Full Text Available Methylselenocysteine (MSC is the most effective form of selenium against cancer. The synthesis of MSC is catalyzed by seleno methyltransferase (smt through selenium methylation as its detoxification mechanism. Gene of smt has been characterized in selenium rich plant, Astragalus bisulcatus. This experimental laboratoric study was done on Geobacillus sp. 20k. at Lembaga Ilmu Pengetahuan Indonesia (LIPI, Cibinong, Bogor, November 2008–June 2009.Target gene was detected by polymerase chain reaction and sequencing. DNA sequence was analyzed by the basic local alignment search tool (BLAST. The results showed that smt gene and its homolog were generally found on selenium rich plants, such as A. bisulcatus, C. sinensis, and A. thaliana, with similarity more than 85%. Designed primers for amplification of smt are CAAGCCACCATTCAAGGTTT and CCCTACTGATCCCGCAATTA. Amplification of DNA fragments obtained at approximately 190 base pair. DNA sequence and its protein translation were identified as part of the thermophilic enzyme and smt of A. bisulcatus, with 83% similarity for smt genes and 88–90% for protein. In conclusion, Geobacillus sp. 20k have smt genes similar with that of A. bisulcatus, therefore further development of this isolate as a non toxic selenium source for cancer therapy could be taken into consideration.

Evi Triana

2010-09-01

163

Use of the microorganism Bacillus stearothermophilus as a model to evaluate toxicity of the lipophilic environmental pollutant endosulfan  

OpenAIRE

Microorganisms are very powerful tools for the supply of information about the toxic effects of lipophilic compounds, since an impairment of cell growth usually occurs as a result of perturbations related, in most cases, with the partition of toxicants in membranes. The thermophilic eubacterium Bacillus stearothermophilus has been used as a model system to identify [alpha]- and [beta]-endosulfan interactions with the membrane possibly related with the insecticide toxicity. Two approaches have...

Martins, J. D.; Monteiro, J. P.; Antunes-madeira, M. C.; Jurado, A. S.; Madeira, V. M. C.

2003-01-01

164

Bacteria Transformation  

Science.gov (United States)

Students construct paper recombinant plasmids to simulate the methods genetic engineers use to create modified bacteria. They learn what role enzymes, DNA and genes play in the modification of organisms. For the particular model they work on, they isolate a mammal insulin gene and combine it with a bacteria's gene sequence (plasmid DNA) for production of the protein insulin.

National Science Foundation GK-12 and Research Experience for Teachers (RET) Programs,

165

Modular system for assessment of glycosyl hydrolase secretion in Geobacillus thermoglucosidasius.  

Science.gov (United States)

The facultatively anaerobic, thermophilic bacterium Geobacillus thermoglucosidasius is being developed as an industrial micro-organism for cellulosic bioethanol production. Process improvement would be gained by enhanced secretion of glycosyl hydrolases. Here we report the construction of a modular system for combining promoters, signal peptide encoding regions and glycosyl hydrolase genes to facilitate selection of the optimal combination in G. thermoglucosidasius. Initially, a minimal three-part E. coli-Geobacillus sp. shuttle vector pUCG3.8 was constructed using Gibson isothermal DNA assembly. The three PCR amplicons contained the pMB1 E. coli origin of replication and multiple cloning site (MCS) of pUC18, the Geobacillus sp. origin of replication pBST1 and the thermostable kanamycin nucleotidyltransferase gene (knt), respectively. G. thermoglucosidasius could be transformed with pUCG3.8 at an increased efficiency [2.8×10(5) c.f.u. (µg DNA)(-1)] compared to a previously reported shuttle vector, pUCG18. A modular cassette for the inducible expression and secretion of proteins in G. thermoglucosidasius, designed to allow the simple interchange of parts, was demonstrated using the endoglucanase Cel5A from Thermotoga maritima as a secretion target. Expression of cel5A was placed under the control of a cellobiose-inducible promoter (P?glu) together with a signal peptide encoding sequence from a G. thermoglucosidasius C56-YS93 endo-?-1,4-xylanase. The interchange of parts was demonstrated by exchanging the cel5A gene with the 3' region of a gene with homology to celA from Caldicellulosiruptor saccharolyticus and substituting P?glu for the synthetic, constitutive promoter PUp2n38, which increased Cel5A activity five-fold. Cel5A and CelA activities were detected in culture supernatants indicating successful expression and secretion. N-terminal protein sequencing of Cel5A carrying a C-terminal FLAG epitope confirmed processing of the signal peptide sequence. PMID:23704786

Bartosiak-Jentys, Jeremy; Hussein, Ali H; Lewis, Claire J; Leak, David J

2013-07-01

166

Crystal structure of the single-stranded RNA binding protein HutP from Geobacillus thermodenitrificans.  

Science.gov (United States)

RNA binding proteins control gene expression by the attenuation/antitermination mechanism. HutP is an RNA binding antitermination protein. It regulates the expression of hut operon when it binds with RNA by modulating the secondary structure of single-stranded hut mRNA. HutP necessitates the presence of l-histidine and divalent metal ion to bind with RNA. Herein, we report the crystal structures of ternary complex (HutP-l-histidine-Mg(2+)) and EDTA (0.5 M) treated ternary complex (HutP-l-histidine-Mg(2+)), solved at 1.9 Å and 2.5 Å resolutions, respectively, from Geobacillus thermodenitrificans. The addition of 0.5 M EDTA does not affect the overall metal-ion mediated ternary complex structure and however, the metal ions at the non-specific binding sites are chelated, as evidenced from the results of structural features. PMID:24650662

Thiruselvam, Viswanathan; Sivaraman, Padavattan; Kumarevel, Thirumananseri; Ponnuswamy, Mondikalipudur Nanjappagounder

2014-04-18

167

A pulse-radiolysis study of the manganese-containing superoxide dismutase from Bacillus stearothermophilus  

International Nuclear Information System (INIS)

The enzymic reaction mechanism of a manganese-containing superoxide dismutase from Bacillus stearothermophilus was studied by using pulse radiolysis. During catalysis (pH 8.9; 250C), changes occurring in the kinetics of substrate disappearance and in the visible absorption of the enzyme at 480 nm established that the simple two-step mechanism found for copper- and iron-containing superoxide dismutases was not involved. At a low ratio (2sup(-.) was close to exponential, whereas at much higher ratios (> 100) the observed decay was predominantly zero-order. The simplest interpretation of the results invokes a rapid one-electron oxidation-reduction cycle ('the fast cycle') and, concurrently, a slower reaction giving a form of the enzyme that is essentially unreactive towards O2sup(-.) but which undergoes a first-order decay to yield fully active native enzyme ('the slow cycle'). The fast cycle involved the native enzyme Esub(A) and a form of the enzyme Esub(B) which could be obtained also be treating the form Esub(A) with H2O2. Computer calculations made with such a simple model predicted behaviour in excellent agreement with the observed results. (author)

168

A pulse-radiolysis study of the manganese-containing superoxide dismutase from Bacillus stearothermophilus  

International Nuclear Information System (INIS)

The mechanism of catalysis of the manganese-containing superoxide dismutase from Bacillus stearothermophilus has been shown to involve a 'fast cycle' and a 'slow cycle' (McAdam, M.E., Fox, R.A., Lavelle, F., and Fielden, E.M., Biochem. J.; 165:71 (1977)). Further properties of the enzyme are now considered. Pulse-radiolysis studies, under conditions of low substrate concentration to enzyme concentration (i.e. when the fast cycle predominates), showed that enzyme activity decreases as pH increases (6.5 to 10.2). Activity was unaffected by the addition of H2O2 or NaN3 but slightly decreased by KCN. Both H2O2 and the reducing radical anion CO2sup(-.) caused a decrease in A480 of the native enzyme. The rate of the fast catalytic cycle was independent of temperature (5 to 550C), and as temperature increased the slow catalytic cycle became relatively more important. Arrhenius parameters of the rate constants were estimated. The possible identity of the various forms of the enzyme is considered. (author)

169

Biophysical characterization of a recombinant aminopeptidase II from the thermophilic bacterium Bacillus stearothermophilus.  

Science.gov (United States)

In the present study, the biophysical properties of His6-tagged Bacillus stearothermophilus aminopeptidase II (His6-tagged BsAmpII) are characterized in detail by gel-filtration, analytical ultracentrifugation, and various spectroscopic techniques. Using size-exclusion chromatography and analytical ultracentrifugation, we demonstrate that His6-tagged BsAmpII exists predominantly as a dimer in solution. The enzyme is active and stable at pHs ranging from 6.5 to 8.5. Far-UV circular dichroism analysis reveals that the secondary structures of His6-tagged BsAmpII are significantly altered in the presence of SDS, whereas the presence of 5-10% acetone and ethanol was harmless to the folding of the enzyme. Thermal unfolding of His6-tagged BsAmpII was found to be irreversible and led to the formation of aggregates. The native enzyme started to unfold beyond 0.6 M guanidine hydrochloride and had a midpoint of denaturation at 1.34 M. This protein remained active at concentrations of urea below 2.7 M but experienced an irreversible unfolding by >5 M denaturant. Taken together, this work lays a foundation for potential biotechnological applications of His6-tagged BsAmpII. PMID:24165863

Wang, Tzu-Fan; Lin, Min-Guan; Lo, Huei-Fen; Chi, Meng-Chun; Lin, Long-Liu

2014-01-01

170

Analysis of mutations in cyclodextrin glucanotransferase from Bacillus stearothermophilus which affect cyclization characteristics and thermostability.  

Science.gov (United States)

Cyclodextrin glucanotransferase (CGTase; EC 2.4.1.19) produces cyclodextrin from starch. The CGTase molecule is composed of four globular domains, A, B, C, and D. In order to gain better understanding of the amylolytic and cyclization mechanisms of CGTase, mutant CGTases were constructed from a CGTase gene (cgt1) of Bacillus stearothermophilus NO2. Cgt1-F191Y (Phe at position 191 was replaced by Tyr), Cgt1-F191Y-F255Y, Cgt1-W254V-F255I, Cgt1-W254V, and Cgt1-F255I were constructed for the analysis of the NH2-terminal region. It was revealed that amino acids surrounding a spiral amylose are important for cyclization characteristics and that hydrophobic amino acids just after the Glu catalytic site play an important role in the hydrolysis characteristics of the enzyme. Mutant CGTases Cgt1-T591F and Cgt1-W629F were also constructed to study the role of a second substrate-binding site in domain D, and it was suggested that substrate binding at both domains A and D stabilized the enzyme and optimized cyclodextrin production. PMID:1429471

Fujiwara, S; Kakihara, H; Sakaguchi, K; Imanaka, T

1992-01-01

171

Experimental fossilisation of the thermophilic Gram-positive bacterium Geobacillus SP7A: a long duration preservation study.  

OpenAIRE

Recent experiments to fossilise microorganisms using silica have shown that the fossilisation process is far more complex than originally thought; microorganisms not only play an active role in silica precipitation but may also remain alive while silica is precipitating on their cell wall. In order to better understand the mechanisms that lead to the preservation of fossilised microbes in recent and ancient rocks, we experimentally silicified a Gram-positive bacterium, Geobacillus SP7A, over ...

Orange, Franc?ois; Dupont, Samuel; Le Goff, Olivier; Bienvenu, Nade?ge; Disnar, Jean-robert; Westall, Frances; Le Romancer, Marc

2014-01-01

172

Thermophilic fermentation of acetoin and 2,3-butanediol by a novel Geobacillus strain  

OpenAIRE

Abstract Background Acetoin and 2,3-butanediol are two important biorefinery platform chemicals. They are currently fermented below 40°C using mesophilic strains, but the processes often suffer from bacterial contamination. Results This work reports the isolation and identification of a novel aerobic Geobacillus strain XT15 capable of producing both of these chemicals under elevated temperatures, thus reducing the risk of bacterial contamination. The o...

Xiao Zijun; Wang Xiangming; Huang Yunling; Huo Fangfang; Zhu Xiankun; Xi Lijun; Lu Jian R

2012-01-01

173

Two Thimet Oligopeptidase-Like Pz Peptidases Produced by a Collagen- Degrading Thermophile, Geobacillus collagenovorans MO-1  

OpenAIRE

A collagen-degrading thermophile, Geobacillus collagenovorans MO-1, was found to produce two metallopeptidases that hydrolyze the synthetic substrate 4-phenylazobenzyloxycarbonyl-Pro-Leu-Gly-Pro-d-Arg (Pz-PLGPR), containing the collagen-specific sequence -Gly-Pro-X-. The peptidases, named Pz peptidases A and B, were purified to homogeneity and confirmed to hydrolyze collagen-derived oligopeptides but not collagen itself, indicating that Pz peptidases A and B contribute to collagen degradation...

Miyake, Ryoma; Shigeri, Yasushi; Tatsu, Yoshiro; Yumoto, Noboru; Umekawa, Midori; Tsujimoto, Yoshiyuki; Matsui, Hiroshi; Watanabe, Kunihiko

2005-01-01

174

Counterselection System for Geobacillus kaustophilus HTA426 through Disruption of pyrF and pyrR  

OpenAIRE

Counterselection systems facilitate marker-free genetic modifications in microbes by enabling positive selections for both the introduction of a marker gene into the microbe and elimination of the marker from the microbe. Here we report a counterselection system for Geobacillus kaustophilus HTA426, established through simultaneous disruption of the pyrF and pyrR genes. The pyrF gene, essential for pyrimidine biosynthesis and metabolization of 5-fluoroorotic acid (5-FOA) to toxic metabolites, ...

Suzuki, Hirokazu; Murakami, Ayano; Yoshida, Ken-ichi

2012-01-01

175

Cloning and characterization of a new manganese superoxide dismutase from deep-sea thermophile Geobacillus sp. EPT3.  

Science.gov (United States)

A new gene encoding a superoxide dismutase (SOD) was identified from a thermophile Geobacillus sp. EPT3 isolated from a deep-sea hydrothermal field in east Pacific. The open reading frame of this gene encoded 437 amino acid residues. It was cloned, overexpressed in Escherichia coli (DE3), and the recombinant protein was purified to homogeneity. Geobacillus sp. EPT3 SOD was of the manganese-containing SOD type, as judged by the insensitivity of the recombinant enzyme to both KCN and H?O?, and the activity analysis of Fe or Mn reconstituted SODs by polyacrylamide gel electrophoresis. The recombinant SOD was determined to be a homodimer with monomeric molecular mass of 59.0 kDa. In comparison with other Mn-SODs, the manganese-binding sites are conserved in the sequence (His260, His308, Asp392, His396). The recombinant enzyme had high thermostability at 50 °C. It retained 57 % residual activity after incubation at 90 °C for 1 h, which indicated that this SOD was thermostable. The enzyme also showed striking stability over a wide range of pH 5.0-11.0. At tested conditions, the recombinant SOD from Geobacillus sp. EPT3 showed a relatively good tolerance to some inhibitors, detergents, and denaturants, such as ?-mercaptoethanol, dithiothreitol, phenylmethylsulfonyl fluoride, Chaps, Triton X-100, urea, and guanidine hydrochloride. PMID:24242973

Zhu, Yanbing; Wang, Guohong; Ni, Hui; Xiao, Anfeng; Cai, Huinong

2014-04-01

176

The S-layer from Bacillus stearothermophilus DSM 2358 functions as an adhesion site for a high-molecular-weight amylase.  

OpenAIRE

The S-layer lattice from Bacillus stearothermophilus DSM 2358 completely covers the cell surface and exhibits oblique symmetry. During growth of B. stearothermophilus DSM 2358 on starch medium, three amylases with molecular weights of 58,000, 98,000, and 184,000 were secreted into the culture fluid, but only the high-molecular-weight enzyme was found to be cell associated. Studies of interactions between cell wall components and amylases revealed no affinity of the high-molecular-weight amyla...

Egelseer, E.; Schocher, I.; Sa?ra, M.; Sleytr, U. B.

1995-01-01

177

Cloning, nucleotide sequence, and expression in Escherichia coli of the Bacillus stearothermophilus peroxidase gene (perA).  

OpenAIRE

The gene encoding a thermostable peroxidase was cloned from the chromosomal DNA of Bacillus stearothermophilus IAM11001 in Escherichia coli. The nucleotide sequence of the 3.1-kilobase EcoRI fragment containing the peroxidase gene (perA) and its flanking region was determined. A 2,193-base-pair open reading frame encoding a peroxidase of 731 amino acid residues (Mr, 82,963) was observed. A Shine-Dalgarno sequence was found 9 base pairs upstream from the translational starting site. The deduce...

Loprasert, S.; Negoro, S.; Okada, H.

1989-01-01

178

Mutational analysis of the conserved cationic residues of Bacillus stearothermophilus 6-phosphoglucose isomerase.  

Science.gov (United States)

The importance in catalysis of the conserved arginine (R207) and lysine residues (K144, K294, K356, and K425) of 6-phosphoglucose isomerase from Bacillus stearothermophilus was assessed by site-directed mutagenesis and kinetic analysis. In general mutations had minor effects on the Km for fructose 6-phosphate. More dramatic effects were seen on kcat. The R207A mutant had a five orders of magnitude decrease in kcat relative to the wild-type enzyme. There was a significant recovery, by three orders of magnitude, in the kcat for the R207K mutant. The results suggest that the positive charge provided by R207 plays a critical role in the isomerization reaction. K425 was substituted with alanine, valine, phenylalanine, tryptophan and aspartate. All mutant enzymes at position 425 had kcat decreased in the range of several-hundred-fold. For the other mutants, K294A and K144A, the kcat values were 3.5% and 27% of the wild-type enzyme, respectively. No effects on catalysis were observed for the K356A mutant. The results suggest that R207, K144, K294, and K425 are located in the active site of the enzyme. The active-site location and the catalytic roles of K425 and K294 are supported further by the inhibitory effects of pyridoxal 5'-phosphate on enzymatic activities. The data also confirm the importance of K425 and K144 anticipated by the affinity labeling studies of the corresponding residues by pyridoxal 5'-phosphate in pig muscle phosphoglucose isomerase. PMID:9826199

Meng, M; Chen, Y T; Hsiao, Y Y; Itoh, Y; Bagdasarian, M

1998-10-15

179

Transglycosylation reactions of Bacillus stearothermophilus maltogenic amylase with acarbose and various acceptors  

International Nuclear Information System (INIS)

It was observed that Bacillus stearothermophilus maltogenic amylase cleaved the first glycosidic bond of acarbose to produce glucose and a pseudotrisaccharide (PTS) that was transferred to C-6 of the glucose to give an ?-(1-6) glycosidic linkage and the formation of isoacarbose. The addition of a number of different carbohydrates to the digest gave transfer products in which PTS was primarily attached ?-(1-6) to d-glucose, d-mannose, d-galactose, and methyl ?-d-glucopyranoside. With d-fructopyranose and d-xylopyranose, PTS was linked ?-(1-5) and ?-(1-4), respectively. PTS was primarily transferred to C-6 of the nonreducing residue of maltose, cellobiose, lactose, and gentiobiose. Lesser amounts of ?-(1-3) and/or ?-(1-4) transfer products were also observed for these carbohydrate acceptors. The major transfer product to sucrose gave PTS linked ?-(1-4) to the glucose residue. ?,?-Trehalose gave two major products with PTS linked ?-(1-6) and ?-(1-4). Maltitol gave two major products with PTS linked ?-(1-6) and ?-(1-4) to the glucopyranose residue. Raffinose gave two major products with PTS linked ?-(1-6) and ?-(1-4) to the d-galactopyranose residue. Maltotriose gave two major products with PTS linked ?-(1-6) and ?-(1-4) to the nonreducing end glucopyranose residue. Xylitol gave PTS linked ?-(1-5) as the major product and d-glucitol gave PTS linked ?-(1-6) as the only product. The structures of the transfer products were determined using thin layer-chrd using thin layer-chromatography, high-performance ion chromatography, enzyme hydrolysis, methylation analysis and 13C NMR spectroscopy. The best acceptor was gentiobiose, followed closely by maltose and cellobiose, and the weakest acceptor was d-glucitol. (Copyright (c) 1998 Elsevier Science B.V., Amsterdam. All rights reserved.)

180

Thermophilic fermentation of acetoin and 2,3-butanediol by a novel Geobacillus strain  

Directory of Open Access Journals (Sweden)

Full Text Available Abstract Background Acetoin and 2,3-butanediol are two important biorefinery platform chemicals. They are currently fermented below 40°C using mesophilic strains, but the processes often suffer from bacterial contamination. Results This work reports the isolation and identification of a novel aerobic Geobacillus strain XT15 capable of producing both of these chemicals under elevated temperatures, thus reducing the risk of bacterial contamination. The optimum growth temperature was found to be between 45 and 55°C and the medium initial pH to be 8.0. In addition to glucose, galactose, mannitol, arabionose, and xylose were all acceptable substrates, enabling the potential use of cellulosic biomass as the feedstock. XT15 preferred organic nitrogen sources including corn steep liquor powder, a cheap by-product from corn wet-milling. At 55°C, 7.7?g/L of acetoin and 14.5?g/L of 2,3-butanediol could be obtained using corn steep liquor powder as a nitrogen source. Thirteen volatile products from the cultivation broth of XT15 were identified by gas chromatography–mass spectrometry. Acetoin, 2,3-butanediol, and their derivatives including a novel metabolite 2,3-dihydroxy-3-methylheptan-4-one, accounted for a total of about 96% of all the volatile products. In contrast, organic acids and other products were minor by-products. ?-Acetolactate decarboxylase and acetoin:2,6-dichlorophenolindophenol oxidoreductase in XT15, the two key enzymes in acetoin metabolic pathway, were found to be both moderately thermophilic with the identical optimum temperature of 45°C. Conclusions Geobacillus sp. XT15 is the first naturally occurring thermophile excreting acetoin and/or 2,3-butanediol. This work has demonstrated the attractive prospect of developing it as an industrial strain in the thermophilic fermentation of acetoin and 2,3-butanediol with improved anti-contamination performance. The novel metabolites and enzymes identified in XT15 also indicated its strong promise as a precious biological resource. Thermophilic fermentation also offers great prospect for improving its yields and efficiencies. This remains a core aim for future work.

Xiao Zijun

2012-12-01

181

Characterization of a recombinant thermostable xylanase from hot spring thermophilic Geobacillus sp. TC-W7.  

Science.gov (United States)

A xylanase-producing thermophilic strain, Geobacillus sp. TC-W7, was isolated from a hot spring in Yongtai (Fuzhou, China). Subsequently, the xylanase gene that encoded 407 amino acids was cloned and expressed. The recombinant xylanase was purified by GST affinity chromatography and exhibited maximum activity at 75 degrees C and a pH of 8.2. The enzyme was active up to 95 degrees C and showed activity over a wide pH range of 5.2 to 10.2. Additionally, the recombinant xylanase showed high thermostability and pH stability. More than 85% of the enzyme's activity was retained after incubation at 70 degrees C for 90 min at a pH of 8.2. The activity of the recombinant xylanase was enhanced by treatment with 10 mM enzyme inhibitors (DDT, Tween-20, 2-Me, or TritonX-100) and was inhibited by EDTA or PMSF. Its functionality was stable in the presence of Li+, Na+, and K+, but inhibited by Hg2+, Ni2+, Co2+, Cu2+, Zn2+, Pb2+, Fe3+, and Al3+. The functionality of the crude xylanase had similar properties to the recombinant xylanase except for when it was treated with Al2+ or Fe2+. The enzyme might be a promising candidate for various industrial applications such as the biofuel, food, and paper and pulp industries. PMID:23075790

Liu, Bin; Zhang, Ningning; Zhao, Chao; Lin, Baixue; Xie, Lianhui; Huang, Yifan

2012-10-01

182

Structural and biochemical characterization of a nitrilase from the thermophilic bacterium, Geobacillus pallidus RAPc8.  

Science.gov (United States)

Geobacillus pallidus RAPc8 (NRRL: B-59396) is a moderately thermophilic gram-positive bacterium, originally isolated from Australian lake sediment. The G. pallidus RAPc8 gene encoding an inducible nitrilase was located and cloned using degenerate primers coding for well-conserved nitrilase sequences, coupled with inverse PCR. The nitrilase open reading frame was cloned into an expression plasmid and the expressed recombinant enzyme purified and characterized. The protein had a monomer molecular weight of 35,790 Da, and the purified functional enzyme had an apparent molecular weight of approximately 600 kDa by size exclusion chromatography. Similar to several plant nitrilases and some bacterial nitrilases, the recombinant G. pallidus RAPc8 enzyme produced both acid and amide products from nitrile substrates. The ratios of acid to amide produced from the substrates we tested are significantly different to those reported for other enzymes, and this has implications for our understanding of the mechanism of the nitrilases which may assist with rational design of these enzymes. Electron microscopy and image classification showed complexes having crescent-like, "c-shaped", circular and "figure-8" shapes. Protein models suggested that the various complexes were composed of 6, 8, 10 and 20 subunits, respectively. PMID:20607233

Williamson, Dael S; Dent, Kyle C; Weber, Brandon W; Varsani, Arvind; Frederick, Joni; Thuku, Robert N; Cameron, Rory A; van Heerden, Johan H; Cowan, Donald A; Sewell, B Trevor

2010-09-01

183

Geobacillus thermoglucosidasius Endospores Function as Nuclei for the Formation of Single Calcite Crystals  

Science.gov (United States)

Geobacillus thermoglucosidasius colonies were placed on an agar hydrogel containing acetate, calcium ions, and magnesium ions, resulting in the formation of single calcite crystals (calcites) within and peripheral to the plating area or parent colony. Microscopic observation of purified calcites placed on the surface of soybean casein digest (SCD) nutrient medium revealed interior crevices from which bacterial colonies originated. Calcites formed on the gel contained [1-13C]- and [2-13C]acetate, demonstrating that G. thermoglucosidasius utilizes carbon derived from acetate for calcite formation. During calcite formation, vegetative cells swam away from the parent colony in the hydrogel. Hard-agar hydrogel inhibited the formation of calcites peripheral to the parent colony. The calcite dissolved completely in 1 M HCl, with production of bubbles, and the remaining endospore-like particles were easily stained with Brilliant green dye. The presence of DNA and protein in calcites was demonstrated by electrophoresis. We propose that endospores initiate the nucleation of calcites. Endospores of G. thermoglucosidasius remain alive and encapsulated in calcites. PMID:23455343

Murai, Rie

2013-01-01

184

Novel thermostable endo-xylanase cloned and expressed from bacterium Geobacillus sp. WSUCF1.  

Science.gov (United States)

A gene encoding a GH10 endo-xylanase from Geobacillus sp. WSUCF1 was cloned and expressed in Escherichia coli. Recombinant endo-xylanase (37kDa) exhibited high specific activity of 461.0U/mg of protein. Endo-xylanase was optimally active on birchwood xylan at 70°C and pH 6.5. The endo-xylanase was found to be highly thermostable at 50 and 60°C, retaining 82% and 50% of its original activity, respectively, after 60h. High xylan conversions (92%) were obtained with oat-spelt xylan hydrolysis. Higher glucan and xylan conversions were obtained on AFEX-treated corn stover with an enzyme cocktail containing WSUCF1 endo-xylanase (71% and 47%) as compared to enzyme cocktail containing commercial fungal endo-xylanase (64% and 41%). High specific activity, active at high pH's, wide substrate specificity, and higher hydrolytic activity on recalcitrant lignocellulose, make this endo-xylanase a suitable candidate for biofuel and bioprocess industries. PMID:24725385

Bhalla, Aditya; Bischoff, Kenneth M; Uppugundla, Nirmal; Balan, Venkatesh; Sani, Rajesh K

2014-08-01

185

Thermostable lipase from Geobacillus sp. Iso5: bioseparation, characterization and native structural studies.  

Science.gov (United States)

The extracellular thermoalkaline lipase from Geobacillus sp. Iso5 was purified to homogeneity by ultrafiltration, 6% cross-linked agarose and Phenyl spehrose HIC column chromatography. The final purified lipase resulted in 8.7-fold with 6.2% yield. The relative molecular weight of the enzyme was determined to be a monomer of 47?kDa by SDS-PAGE and MALDI-TOF MS/MS spectroscopy. The purified enzyme exhibit optimum activity at 70?°C and pH 8.0. The enzyme retained above 90% activity at temperatures of 70?°C and about 35% activity at 85?°C for 2?h. However, the stability of the enzyme decreased at the temperature over 90?°C. The enzyme activity was promoted in the presence of Ca(2+) and Mg(2+) and strongly inhibited by HgCl2 , PMSF, DTT, K(+) , Co(2+) , and Zn (2+) . EDTA did not affect the enzyme activity. The secondary structure of purified lipase contains 36% ?-helix and 64% ?-sheet which was determined by Circular dichromism, FTIR, and Raman Spectroscopy. PMID:23775834

Mahadevan, Gurumurthy D; Neelagund, Shivayogeeswar E

2014-05-01

186

Applicability of recombinant ?-xylosidase from the extremely thermophilic bacterium Geobacillus thermodenitrificans in synthesizing alkylxylosides.  

Science.gov (United States)

The ?-xylosidase encoding gene (XsidB) of the extremely thermophilic bacterium Geobacillus thermodenitrificans has been cloned and expressed in Escherichia coli. The homotrimeric recombinant XsidB is of 204.0kDa, which is optimally active at 60°C and pH 7.0 with T1/2 of 58min at 70°C. The ?-xylosidase remains unaffected in the presence of most metal ions and organic solvents. The Km [p-nitrophenyl ?-xyloside (pNPX)], Vmax and kcat values of the enzyme are 2×10(-3)M, 1250?molesmg(-1)min(-1) and 13.20×10(5)min(-1), respectively. The enzyme catalyzes transxylosylation reactions in the presence of alcohols as acceptors. The pharmaceutically important ?-methyl-d-xylosides could be produced using pNPX as the donor and methanol as acceptor. The products of transxylosylation were identified by TLC and HPLC, and the structure was confirmed by (1)H NMR analysis. The enzyme is also useful in synthesizing transxylosylation products from the wheat bran hydrolysate. PMID:25164338

Jain, Ira; Kumar, Vikash; Satyanarayana, T

2014-10-01

187

Structural and functional characterization of the Geobacillus copper nitrite reductase: involvement of the unique N-terminal region in the interprotein electron transfer with its redox partner.  

Science.gov (United States)

The crystal structures of copper-containing nitrite reductase (CuNiR) from the thermophilic Gram-positive bacterium Geobacillus kaustophilus HTA426 and the amino (N)-terminal 68 residue-deleted mutant were determined at resolutions of 1.3Å and 1.8Å, respectively. Both structures show a striking resemblance with the overall structure of the well-known CuNiRs composed of two Greek key ?-barrel domains; however, a remarkable structural difference was found in the N-terminal region. The unique region has one ?-strand and one ?-helix extended to the northern surface of the type-1 copper site. The superposition of the Geobacillus CuNiR model on the electron-transfer complex structure of CuNiR with the redox partner cytochrome c551 in other denitrifier system led us to infer that this region contributes to the transient binding with the partner protein during the interprotein electron transfer reaction in the Geobacillus system. Furthermore, electron-transfer kinetics experiments using N-terminal residue-deleted mutant and the redox partner, Geobacillus cytochrome c551, were carried out. These structural and kinetics studies demonstrate that the region is directly involved in the specific partner recognition. PMID:24440558

Fukuda, Yohta; Koteishi, Hiroyasu; Yoneda, Ryohei; Tamada, Taro; Takami, Hideto; Inoue, Tsuyoshi; Nojiri, Masaki

2014-03-01

188

Biochemical and conformational characterization of a leucine aminopeptidase from Geobacillus thermodenitrificans NG80-2.  

Science.gov (United States)

In order to search for valuable and extremely thermo-stable enzymes that could be used in the protein hydrolysis industry, the gene corresponding to a leucine aminopeptidase from Geobacillus thermodenitrificans NG80-2 (GtLAP) was cloned and expressed in E. coli. The recombinant enzyme was purified, and its characteristics were examined. Meanwhile, potential applications of GtLAP in the hydrolysis of anchovy proteins were also investigated. GtLAP was overexpressed in IPTG-induced E. coli BL21 (pET28a-LAP) as a soluble protein, and was purified to homogeneity by nickel-chelate chromatography to a specific activity of 125 ± 8.75 U/mg proteins. The molecular mass of GtLAP was estimated to be 55 kDa by SDS-PAGE analysis. The optimal reaction temperature and pH of GtLAP were 70 °C and 8.0, respectively. Under optimal conditions, GtLAP showed a marked preference for Leu-p-nitroanilide, followed by Met- and Phe-derivatives. Activity of GtLAP was strongly stimulated by Ni²? ions, but was strongly inhibited by Hg²?. Conformational studies via circular dichroism spectroscopy indicated that various factors could influence the secondary structure of GtLAP to various extents and further induce changes in enzymatic activity. Results of hydrolytic experiment showed that combining GtLAP with endogenous enzymes could significantly increase the degree of hydrolysis to anchovy proteins and concentrations of free amino acids in hydrolysates. In this regard, GtLAP could potentially be used in the protein hydrolysis industry. PMID:22927012

Wang, Fanghua; Guo, Shaohua; Liu, Yuanyuan; Lan, Dongming; Yang, Bo; Wang, Yonghua

2012-11-01

189

Domain C of thermostable ?-amylase of Geobacillus thermoleovorans mediates raw starch adsorption.  

Science.gov (United States)

The gene (1,542 bp) encoding thermostable Ca(2+)-independent and raw starch hydrolyzing ?-amylase of the extremely thermophilic bacterium Geobacillus thermoleovorans encodes for a protein of 50 kDa (Gt-amyII) with 488 amino acids. The enzyme is optimally active at pH 7.0 and 60 °C with a t 1/2 of 19.4 h at 60 and 4 h at 70 °C. Gt-amyII hydrolyses corn and tapioca raw starches efficiently and therefore finds application in starch saccharification at industrial sub-gelatinisation temperatures. The starch hydrolysis is facilitated following adsorption of the enzyme to starch at the C-terminal domain, as confirmed by the truncation analysis. The adsorption rate constant of Gt-amyII to raw corn starch is 37.6-fold greater than that for the C-terminus truncated enzyme (Gt-amyII-T). Langmuir-Hinshelwood kinetic analysis in terms of equilibrium parameter (K R) suggested that the adsorption of Gt-amyII to corn starch is more favourable than that of Gt-amyII-T. Thermodynamics of temperature inactivation indicated a decrease in thermostabilisation of Gt-amyII upon truncation of its C-terminus. The addition of raw corn starch increased t 1/2 of Gt-amyII, but it has no such effect on Gt-amyII-T. It can, therefore, be stated that Gt-amyII binds to raw corn starch via C-terminal region that contributes to its thermostability. Phylogenetic analysis confirmed that starch binding region of Gt-amyII is, in fact, the non-catalytic domain C, and not the typical SBD of CBM families. The role of domain C in raw starch binding throws light on the evolutionary path of the known SBDs. PMID:24413972

Mehta, Deepika; Satyanarayana, T

2014-05-01

190

Molecular cloning, over expression and characterization of thermoalkalophilic esterases isolated from Geobacillus sp.  

Science.gov (United States)

Due to potential use for variety of biotechnological applications, genes encoding thermoalkalophilic esterase from three different Geobacillus strains isolated from thermal environmental samples in Balçova (Agamemnon) geothermal site were cloned and respective proteins were expressed in Escherichia coli (E.coli) and characterized in detail. Three esterases (Est1, Est2, Est3) were cloned directly by PCR amplification using consensus degenerate primers from genomic DNA of the strains Est1, Est2 and Est3 which were from mud, reinjection water and uncontrolled thermal leak, respectively. The genes contained an open reading frame (ORF) consisting of 741 bp for Est1 and Est2, which encoded 246 amino acids and ORF of Est3 was 729 bp encoded 242 amino acids. The esterase genes were expressed in E. coli and purified using His-Select HF nickel affinity gel. The molecular mass of the recombinant enzyme for each esterase was approximately 27.5 kDa. The three esterases showed high specific activity toward short chain p-NP esters. Recombinant Est1, Est2, Est3 have exhibited similar activity and the highest esterase activity of 1,100 U/mg with p-nitrophenyl acetate (pNPC(2)) as substrate was observed with Est1. All three esterase were most active around 65°C and pH 9.5-10.0. The effect of organic solvents, several metal ions, inhibitors and detergents on enzyme activity for purified Est1, Est2, Est3 were determined separately and compared. PMID:21181486

Tekedar, Hasan Cihad; Sanl?-Mohamed, Gül?ah

2011-03-01

191

Thermostable hemicellulases of a bacterium, Geobacillus sp. DC3, isolated from the former Homestake gold mine in Lead, South Dakota.  

Science.gov (United States)

A thermophilic strain, Geobacillus sp. DC3, capable of producing hemicellulolytic enzymes was isolated from the 1.5-km depth of the former Homestake gold mine in Lead, South Dakota. The DC3 strain expressed a high level of extracellular endoxylanase at 39.5 U/mg protein with additional hemicellulases including ?-xylosidase (0.209 U/mg) and arabinofuranosidase (0.230 U/mg), after the bacterium was grown in xylan for 24 h. Partially purified DC3 endoxylanase exhibited a molecular mass of approximately 43 kDa according to zymography with an optimal pH of 7 and optimal temperature of 70 °C. The kinetic constants, K m and V max, were 13.8 mg/mL and 77.5 ?mol xylose/min·mg xylan, respectively. The endoxylanase was highly stable and maintained 70 % of its original activity after 16 h incubation at 70 °C. The thermostable properties and presence of three different hemicellulases of Geobacillus sp. DC3 strain support its potential application for industrial hydrolysis of renewable biomass such as lignocelluloses. PMID:24549802

Bergdale, Terran E; Hughes, Stephen R; Bang, Sookie S

2014-04-01

192

Molecular cloning and characterization of a thermostable lipase from deep-sea thermophile Geobacillus sp. EPT9.  

Science.gov (United States)

A gene (1,254 bp) encoding a lipase was identified from a deep-sea hydrothermal field thermophile Geobacillus sp. EPT9. The open reading frame of this gene encoded 417 amino acid residues. The gene was cloned, overexpressed in Escherichia coli, and the target protein was purified to homogeneity. The purified recombinant enzyme presented a molecular mass of 44.8 kDa. When p-nitrophenyl palmitate was used as a substrate, the recombinant lipase was optimally active at 55 °C and pH 8.5. The recombinant enzyme retained 44 % residual activity after incubation at 80 °C for 1 h, which indicated that Geobacillus sp. EPT9 lipase was thermostable. Homology modeling of strain EPT9 lipase was developed with the lipase from Bacillus sp. L2 as a template. The core structure exhibits an ?/?-hydrolase fold and the typical catalytic triad might consist of Ser142, Asp346, and His387. The enzymatic activity of EPT9 lipase was inhibited by addition of phenylmethylsulfonyl fluoride, indicating that it contains serine residue, which plays an important role in the catalytic mechanism. PMID:25388475

Zhu, Yanbing; Li, Hebin; Ni, Hui; Xiao, Anfeng; Li, Lijun; Cai, Huinong

2014-11-12

193

Screening and distributing features of bacteria with hydantoinase and carbamoylase.  

Science.gov (United States)

Hydantoinase and carbamoylase are key biocatalysts for the production of optically pure amino acids from dl-5-substituted hydantoins (SSH). Out of 364 isolated strains with hydantoinase and carbamoylase at 45 degrees C, 24 strains showed efficient hydantoinase and carbamoylase activities. Among them, 17 produced l-amino acids, and 7 produced d-amino acids from both aromatic dl-5-benzylhydantoin and aliphatic dl-5-isopropylhydantoin. Most of the strains that were able to form l-amino acid belonged to genera Bacillus, Geobacillus, Brevibacillus, Aneurinibacillus, Microbacterium, and Kurthia. Phylogenetic relationships were investigated based on 16S rRNA from the hydantoinase-producing bacteria. Distinct tendencies toward certain genera were observed between most of the strains forming l-amino acids and d-amino acids from SSH. The results from this study can be utilized to develop new isolation technology of hydantoinase-producing microorganisms, and to understand metabolism and evolutionary origins of hydantoinase and carbamoylase among different bacteria. PMID:17498938

Mei, Yanzhen; He, Bingfang; Liu, Nina; Ouyang, Pingkai

2009-01-01

194

A mixed-species microarray for identification of food spoilage bacilli.  

Science.gov (United States)

Failure of food preservation is frequently caused by thermostable spores of members of the Bacillaceae family, which show a wide spectrum of resistance to cleaning and preservation treatments. We constructed and validated a mixed-species genotyping array for 6 Bacillus species, including Bacillus subtilis, Bacillus licheniformis, Bacillus pumilus, Bacillus sporothermodurans, Bacillus cereus and Bacillus coagulans, and 4 Geobacillus species, including Geobacillus stearothermophilus, Geobacillus thermocatenulatus, Geobacillus toebii and Geobacillus sp., in order to track food spoilage isolates from ingredient to product. The discriminating power of the array was evaluated with sets of 42 reference and 20 test strains. Bacterial isolates contain a within-species-conserved core genome comprising 68-88% of the entire genome and a non-conserved accessory genome comprising 7-22%. The majority of the core genome markers do not hybridise between species, thus they allow for efficient discrimination at the species level. The accessory genome array markers provide high-resolution discrimination at the level of individual isolates from a single species. In conclusion, the reported mixed-species microarray contains discriminating markers that allow rapid and cost-effective typing of Bacillus food spoilage bacteria in a wide variety of food products. PMID:21315980

Caspers, Martien P M; Schuren, Frank H J; van Zuijlen, Andre C M; Brul, Stanley; Montijn, Roy C; Abee, Tjakko; Kort, Remco

2011-04-01

195

Mathematical Models for the Effects of pH, Temperature, and Sodium Chloride on the Growth of Bacillus stearothermophilus in Salty Carrots.  

Science.gov (United States)

Estimating the shelf life and safety of any food product is an important part of food product development. Predictive food microbiology reduces the time and expense associated with conventional challenge and shelf life testing. The purpose of this study was to characterize and model germination, outgrowth, and lag (GOL) time and the exponential growth rate (EGR) of Bacillus stearothermophilus in salty carrot medium (SCM) as a function of pH, temperature, and NaCl concentration. B. stearothermophilus is a spore-forming thermophilic organism associated with flat sour spoilage of canned foods. A split-split plot design was used to measure the effects and interactions of pH (5.5 to 7.0), temperature (45 to 60(deg)C), and NaCl (0 to 1%) on the growth kinetics of B. stearothermophilus in SCM. A total of 96 experiments were analyzed, with individual curve parameters determined by using the Gompertz equation. Quadratic polynomial models for GOL time and EGR of B. stearothermophilus in terms of temperature, pH, and NaCl were generated by response surface analysis. The r(sup2) values for the GOL time and EGR models were 0.917 and 0.916, respectively. These models provide an estimate of bacterial growth in response to combinations of the variables studied within the specified ranges. The models were used to predict GOL times and EGRs for additional experimental conditions. The accuracy of these predictions validated the model's predictive ability in SCM. PMID:16535566

Ng, T M; Schaffner, D W

1997-04-01

196

Isolation of two physiologically induced variant strains of Bacillus stearothermophilus NRS 2004/3a and characterization of their S-layer lattices.  

OpenAIRE

During growth of Bacillus stearothermophilus NRS 2004/3a in continuous culture on complex medium, the chemical properties of the S-layer glycoprotein and the characteristic oblique lattice were maintained only if glucose was used as the sole carbon source. With increased aeration, amino acids were also metabolized, accompanied by liberation of ammonium and by changes in the S-layer protein. Depending on the stage of fermentation at which oxygen limitation was relieved, two different variants,...

Sa?ra, M.; Pum, D.; Ku?pcu?, S.; Messner, P.; Sleytr, U. B.

1994-01-01

197

Identification and characterization of clustered genes for thermostable xylan-degrading enzymes, beta-xylosidase and xylanase, of Bacillus stearothermophilus 21.  

OpenAIRE

Bacillus stearothermophilus 21 is a gram-positive, facultative thermophilic aerobe that can utilize xylan as a sole source of carbon. We isolated this strain from soil, purified its extracellular xylanase and beta-xylosidase, and analyzed the two-step degradation of xylan by these enzymes (T. Nanmori, T. Watanabe, R. Shinke, A. Kohno, and Y. Kawamura, J. Bacteriol. 172:6669-6672, 1990). An Escherichia coli transformant carrying a 4.2-kbp chromosomal segment of this bacterium as a recombinant ...

Baba, T.; Shinke, R.; Nanmori, T.

1994-01-01

198

Surface plasmon resonance-enabled antibacterial digital versatile discs  

Science.gov (United States)

We report the achievement of effective sterilization of exemplary bacteria including Escherichia coli and Geobacillus stearothermophilus spores on a digital versatile disc (DVD). The spiral arrangement of aluminum-covered pits generates strong surface plasmon resonance (SPR) absorption of near-infrared light, leading to high surface temperature that could even damage the DVD plastics. Localized protein denaturation and high sterilization efficiency have been demonstrated by using a fluorescence microscope and cell cultures. Numerical simulations have also been conducted to model the SPR properties and the surface temperature distribution of DVDs under laser illumination. The theoretical predictions agree reasonably well with the experimental results.

Dou, Xuan; Chung, Pei-Yu; Jiang, Peng; Dai, Jianli

2012-02-01

199

The Museum of Bacteria  

Science.gov (United States)

The Museum of Bacteria serves as a clearinghouse of Web links on bacteria and bacteriology and also provides "crystal-clear information about many aspects of bacteria." The Museum of Bacteria is provided by the Foundation of Bacteria, a non-profit organization dedicated to promoting the field of bacteriology. Links are selected for a general audience, although one section is geared toward professionals in the field. Some of the latest features of the Museum are an "exhibit" on the good bacteria found in food and a Student Hall where students can present their own bacteria-related projects.

200

l-Ribose Production from l-Arabinose by Using Purified l-Arabinose Isomerase and Mannose-6-Phosphate Isomerase from Geobacillus thermodenitrificans?  

OpenAIRE

Two enzymes, l-arabinose isomerase and mannose-6-phosphate isomerase, from Geobacillus thermodenitrificans produced 118 g/liter l-ribose from 500 g/liter l-arabinose at pH 7.0, 70°C, and 1 mM Co2+ for 3 h, with a conversion yield of 23.6% and a volumetric productivity of 39.3 g liter?1 h?1.

Yeom, Soo-jin; Kim, Nam-hee; Park, Chang-su; Oh, Deok-kun

2009-01-01

201

Genotyping of Present-Day and Historical Geobacillus Species Isolates from Milk Powders by High-Resolution Melt Analysis of Multiple Variable-Number Tandem-Repeat Loci  

OpenAIRE

Spores of thermophilic Geobacillus species are a common contaminant of milk powder worldwide due to their ability to form biofilms within processing plants. Genotyping methods can provide information regarding the source and monitoring of contamination. A new genotyping method was developed based on multilocus variable-number tandem-repeat (VNTR) analysis (MLVA) in conjunction with high-resolution melt analysis (MLV-HRMA) and compared to the currently used method, randomized amplified polymor...

Seale, R. Brent; Dhakal, Rajat; Chauhan, Kanika; Craven, Heather M.; Deeth, Hilton C.; Pillidge, Christopher J.; Powell, Ian B.; Turner, Mark S.

2012-01-01

202

Draft Genome Sequence of Geobacillus icigianus Strain G1w1T Isolated from Hot Springs in the Valley of Geysers, Kamchatka (Russian Federation).  

Science.gov (United States)

The Geobacillus icigianus G1w1(T) strain was isolated from sludge samples of unnamed vaporing hydrothermal (97°?) outlets situated in a geyser in the Troinoy region (Valley of Geysers, Kronotsky Nature Reserve, Kamchatka, Russian Federation; 54°25'51.40?N, 160°7'41.40?E). The sequenced and annotated genome is 3,457,810 bp and encodes 3,342 genes. PMID:25342695

Bryanskaya, Alla V; Rozanov, Aleksey S; Logacheva, Maria D; Kotenko, Anastasia V; Peltek, Sergey E

2014-01-01

203

Characteristic Features in the Structure and Collagen-Binding Ability of a Thermophilic Collagenolytic Protease from the Thermophile Geobacillus collagenovorans MO-1  

OpenAIRE

A collagen-degrading thermophile, Geobacillus collagenovorans MO-1, extracellularly produces a collagenolytic protease with a large molecular mass. Complete nucleotide sequencing of this gene after gene cloning revealed that the collagenolytic protease is a member of the subtilisin family of serine proteases and consists of a signal sequence for secretion, a prosequence for maturation, a catalytic region, 14 direct repeats of 20 amino acids at the C terminus, and a region with unknown functio...

Itoi, Yuichi; Horinaka, Mano; Tsujimoto, Yoshiyuki; Matsui, Hiroshi; Watanabe, Kunihiko

2006-01-01

204

Draft Genome Sequence of Geobacillus icigianus Strain G1w1T Isolated from Hot Springs in the Valley of Geysers, Kamchatka (Russian Federation)  

Science.gov (United States)

The Geobacillus icigianus G1w1T strain was isolated from sludge samples of unnamed vaporing hydrothermal (97°?) outlets situated in a geyser in the Troinoy region (Valley of Geysers, Kronotsky Nature Reserve, Kamchatka, Russian Federation; 54°25?51.40?N, 160°7?41.40?E). The sequenced and annotated genome is 3,457,810 bp and encodes 3,342 genes. PMID:25342695

Bryanskaya, Alla V.; Logacheva, Maria D.; Kotenko, Anastasia V.; Peltek, Sergey E.

2014-01-01

205

Combined impact of Bacillus stearothermophilus maltogenic alpha-amylase and surfactants on starch pasting and gelation properties.  

Science.gov (United States)

In baking applications involving starch gelatinisation, surfactants such as sodium stearoyl lactylate (SSL) and monoacylglycerols (MAG) and Bacillus stearothermophilus maltogenic alpha-amylase (BStA) can be used jointly. We here showed that SSL but not MAG delays wheat starch hydrolysis by BStA. The effects were explained in terms of different degrees of adsorption of the surfactants on the starch granule surface, retarded and/or decreased water uptake and delayed availability of gelatinised starch for hydrolysis by BStA. Additional experiments with waxy maize starch led to the conclusion that SSL impacts swelling power and carbohydrate leaching more by covering the starch granule surface than by forming amylose-lipid complexes. SSL postponed starch hydrolysis by BStA, but this did not influence subsequent starch gelation. Finally, when adding SSL or MAG on top of BStA to starch suspensions, the effect of the surfactants on gel strength predominated over that of BStA. PMID:23561216

Van Steertegem, Bénédicte; Pareyt, Bram; Brijs, Kristof; Delcour, Jan A

2013-08-15

206

Aptamer biosensor for sensitive detection of toxin A of Clostridium difficile using gold nanoparticles synthesized by Bacillus stearothermophilus.  

Science.gov (United States)

A sensitive electrochemical biosensor was developed to detect toxin A (TOA) of Clostridium difficile based on an aptamer selected by the systematic evolution of ligands using exponential enrichment and gold nanoparticles (GNPS) synthesized by Bacillus stearothermophilus. The thiolated single-stranded DNA used as the capture probe (CP) was first self-assembled on a Nafion-thionine-GNPS-modified screen-printed electrode (SPE) through an Au-thiol interaction. The horseradish peroxidase (HRP)-labeled aptamer probe (AP) was then hybridized to the complementary oligonucleotide of CP to form an aptamer-DNA duplex. In the absence of TOA, the aptamer-DNA duplex modified the electrode surface with HRP, so that an amperometric response was induced based on the electrocatalytic properties of thionine. This was mediated by the electrons that were generated in the enzymatic reaction of hydrogen peroxide under HRP catalysis. After the specific recognition of TOA, an aptamer-TOA complex was produced rather than the aptamer-DNA duplex, forcing the HRP-labeled AP to dissociate from the electrode surface, which reduced the catalytic capacity of HRP and reduced the response current. The reduction in the response current correlated linearly with the concentration of TOA in the range of 0-200 ng/mL. The detection limit was shown to be 1 nM for TOA. This biosensor was applied to the analysis of TOA and showed good selectivity, reproducibility, stability, and accuracy. PMID:24287407

Luo, Peng; Liu, Yi; Xia, Yun; Xu, Huajian; Xie, Guoming

2014-04-15

207

Effect of codon-optimized E. coli signal peptides on recombinant Bacillus stearothermophilus maltogenic amylase periplasmic localization, yield and activity.  

Science.gov (United States)

Recombinant proteins can be targeted to the Escherichia coli periplasm by fusing them to signal peptides. The popular pET vectors facilitate fusion of target proteins to the PelB signal. A systematic comparison of the PelB signal with native E. coli signal peptides for recombinant protein expression and periplasmic localization is not reported. We chose the Bacillus stearothermophilus maltogenic amylase (MA), an industrial enzyme widely used in the baking and brewing industry, as a model protein and analyzed the competence of seven, codon-optimized, E. coli signal sequences to translocate MA to the E. coli periplasm compared to PelB. MA fusions to three of the signals facilitated enhanced periplasmic localization of MA compared to the PelB fusion. Interestingly, these three fusions showed greatly improved MA yields and between 18- and 50-fold improved amylase activities compared to the PelB fusion. Previously, non-optimal codon usage in native E. coli signal peptide sequences has been reported to be important for protein stability and activity. Our results suggest that E. coli signal peptides with optimal codon usage could also be beneficial for heterologous protein secretion to the periplasm. Moreover, such fusions could even enhance activity rather than diminish it. This effect, to our knowledge has not been previously documented. In addition, the seven vector platform reported here could also be used as a screen to identify the best signal peptide partner for other recombinant targets of interest. PMID:25038884

Samant, Shalaka; Gupta, Gunja; Karthikeyan, Subbulakshmi; Haq, Saiful F; Nair, Ayyappan; Sambasivam, Ganesh; Sukumaran, Sunilkumar

2014-09-01

208

Simplified technique for identification of the aerobic spore-forming bacteria by phenotype.  

Science.gov (United States)

The use of modern research approaches of genetics, biochemistry and molecular biology has led to progress in bacterial taxonomy. Systematic study of the aerobic spore-forming bacteria has resulted in the realignment of the genus Bacillus into several new genera. In the meantime, the identification process has become more difficult for the non-specialist in Bacillus taxonomy. This paper presents a key for the simplified phenotypic identification of the mesophilic, aerobic, spore-forming bacteria belonging to the genera Bacillus, Paenibacillus, Brevibacillus, Aneurinibacillus, Geobacillus and Virgibacillus. A total of 81 species were included and 115 morphological and physiological tests were analysed for their discriminative efficiency. This key is practical for rough but quick identification of aerobic spore-forming bacteria isolated from nature. Such preliminary identification will be helpful for the selection of reference strains and methods for more precise identification using the newest techniques. The reliability of the proposed identification key was tested on 100 cultures from the Ukrainian Collection of Microorganisms. The developed identification key is represented in interactive mode on a website (http://www/imv.kiev.ua/key/). PMID:11491334

Reva, O N; Sorokulova, I B; Smirnov, V V

2001-07-01

209

Bleach vs. Bacteria  

Science.gov (United States)

... Articles | Inside Life Science Home Page Bleach vs. Bacteria By Sharon Reynolds Posted April 2, 2014 Your ... hypochlorous acid to help kill invading microbes, including bacteria. Researchers funded by the National Institutes of Health ...

210

Lactic Acid Bacteria  

Science.gov (United States)

This on-line exercise is focused on lactic acid bacteria, a group of related bacteria that produce lactic acid as a result of carbohydrate fermentation. It includes a protocol for the enrichment of lactic acid bacteria from enriched samples (like yogurt, sauerkraut, decaying plant matter, and tooth plaque). Three parameters are measured: growth, culture diversity, and pH. The exercise also includes instructions for the isolation of some of these bacteria by using the streak-plate method.

2010-03-01

211

Immunoelectron microscopic localisation of ribosomal proteins from Bacillus stearothermophilus that are homologous to Escherichia coli L1, L6, L23 and L29.  

Science.gov (United States)

The locations of proteins BL1, BL6, BL23 and BL29 from Bacillus stearothermophilus have been determined on the ribosomal surface by immunoelectron microscopy. All four proteins were localized in the same region of the 50S subunit as their homologous counterparts from Escherichia coli, indicating that the ribosomal architecture is the same in both species. This finding is of great importance as it allows structural data obtained on ribosomes from either organism to be incorporated into a unique ribosome model. PMID:3289923

Hackl, W; Stöffler-Meilicke, M

1988-06-01

212

GenBank blastx search result: AK110738 [KOME  

Lifescience Database Archive (English)

Full Text Available AK110738 002-170-F05 AB103384.1 Geobacillus stearothermophilus ptb, leudh, bk genes for phosphoy ... tansbutyrylase, leucine dehydrogenase, butyrate ... kinase, partial and complete cds.|BCT BCT 2e-23 +2 ...

213

Arabidopsis CDS blastp result: AK068573 [KOME  

Lifescience Database Archive (English)

Full Text Available AK068573 J013155L16 At5g63290.1 coproporphyrinogen oxidase-related low similarity to coproporphy ... rinogen III oxidase from Geobacillus ... stearothermophilus [GI:2104798]; contains Pfam pro ...

214

Arabidopsis CDS blastp result: AK066873 [KOME  

Lifescience Database Archive (English)

Full Text Available AK066873 J013079B12 At5g63290.1 coproporphyrinogen oxidase-related low similarity to coproporphy ... rinogen III oxidase from Geobacillus ... stearothermophilus [GI:2104798]; contains Pfam pro ...

215

Inactivation factors of spore-forming bacteria using low-pressure microwave plasmas in an N2 and O2 gas mixture  

Science.gov (United States)

In this study, we investigated the inactivation characteristics of Geobacillus stearothermophilus spores under different plasma exposure conditions using low-pressure microwave plasma in nitrogen, oxygen and an air-simulated (N2:O2=4:1) gas mixture. The microwave-excited surface-wave plasma discharges were produced at low pressure by a large volume device. The directly plasma-exposed spores, up to 106 populations, were successfully inactivated within 15, 10 and 5 min of surface-wave plasma treatment using nitrogen, oxygen and an air-simulated gas mixture, respectively, as working gases within the temperature of 75 °C. The contribution of different inactivation factors was evaluated by placing different filters (e.g. a LiF plate, a quartz plate and a Tyvek® sheet) as indirect exposure of spores to the plasma. It was observed that optical emissions (including vacuum UV (VUV)/UV) play an important role in the inactivation process. To further evaluate the effect of VUV/UV photons, we placed an evacuated isolated chamber, inside which spores were set, into the main plasma chamber. The experimental results show that the inactivation time by VUV/UV photons alone, without working gas in the immediate vicinity of the spores, is longer than that with working gas. This suggests that the VUV/UV emission is responsible not only for direct UV inactivation of spores but also for generation of reactive neutral species by photoexcitation. The scanning electron microscopy images revealed significant changes in the morphology of directly plasma-exposed spores but no change in the spores irradiated by VUV/UV photons only.

Singh, M. K.; Ogino, A.; Nagatsu, M.

2009-11-01

216

Inactivation factors of spore-forming bacteria using low-pressure microwave plasmas in an N2 and O2 gas mixture  

International Nuclear Information System (INIS)

In this study, we investigated the inactivation characteristics of Geobacillus stearothermophilus spores under different plasma exposure conditions using low-pressure microwave plasma in nitrogen, oxygen and an air-simulated (N2:O2=4:1) gas mixture. The microwave-excited surface-wave plasma discharges were produced at low pressure by a large volume device. The directly plasma-exposed spores, up to 106 populations, were successfully inactivated within 15, 10 and 5 min of surface-wave plasma treatment using nitrogen, oxygen and an air-simulated gas mixture, respectively, as working gases within the temperature of 75 deg. C. The contribution of different inactivation factors was evaluated by placing different filters (e.g. a LiF plate, a quartz plate and a Tyvek (registered) sheet) as indirect exposure of spores to the plasma. It was observed that optical emissions (including vacuum UV (VUV)/UV) play an important role in the inactivation process. To further evaluate the effect of VUV/UV photons, we placed an evacuated isolated chamber, inside which spores were set, into the main plasma chamber. The experimental results show that the inactivation time by VUV/UV photons alone, without working gas in the immediate vicinity of the spores, is longer than that with working gas. This suggests that the VUV/UV emission is responsible not only for direct UV inactivation of spores but also for generation of reactive neutral species by photoexcitatioreactive neutral species by photoexcitation. The scanning electron microscopy images revealed significant changes in the morphology of directly plasma-exposed spores but no change in the spores irradiated by VUV/UV photons only.

217

Inactivation factors of spore-forming bacteria using low-pressure microwave plasmas in an N{sub 2} and O{sub 2} gas mixture  

Energy Technology Data Exchange (ETDEWEB)

In this study, we investigated the inactivation characteristics of Geobacillus stearothermophilus spores under different plasma exposure conditions using low-pressure microwave plasma in nitrogen, oxygen and an air-simulated (N{sub 2}:O{sub 2}=4:1) gas mixture. The microwave-excited surface-wave plasma discharges were produced at low pressure by a large volume device. The directly plasma-exposed spores, up to 10{sup 6} populations, were successfully inactivated within 15, 10 and 5 min of surface-wave plasma treatment using nitrogen, oxygen and an air-simulated gas mixture, respectively, as working gases within the temperature of 75 deg. C. The contribution of different inactivation factors was evaluated by placing different filters (e.g. a LiF plate, a quartz plate and a Tyvek (registered) sheet) as indirect exposure of spores to the plasma. It was observed that optical emissions (including vacuum UV (VUV)/UV) play an important role in the inactivation process. To further evaluate the effect of VUV/UV photons, we placed an evacuated isolated chamber, inside which spores were set, into the main plasma chamber. The experimental results show that the inactivation time by VUV/UV photons alone, without working gas in the immediate vicinity of the spores, is longer than that with working gas. This suggests that the VUV/UV emission is responsible not only for direct UV inactivation of spores but also for generation of reactive neutral species by photoexcitation. The scanning electron microscopy images revealed significant changes in the morphology of directly plasma-exposed spores but no change in the spores irradiated by VUV/UV photons only.

Singh, M K; Ogino, A; Nagatsu, M [Graduate School of Science and Technology, Shizuoka University, Johoku 3-5-1, Hamamatsu 432-8561 (Japan)], E-mail: tmnagat@ipc.shizuoka.ac.jp

2009-11-15

218

Bacteria Are Everywhere!  

Science.gov (United States)

Students are introduced to the concept of engineering biological organisms and studying their growth to be able to identify periods of fast and slow growth. They learn that bacteria are found everywhere, including on the surfaces of our hands. Student groups study three different conditions under which bacteria are found and compare the growth of the individual bacteria from each source. In addition to monitoring the quantity of bacteria from differ conditions, they record the growth of bacteria over time, which is an excellent tool to study binary fission and the reproduction of unicellular organisms.

AMPS GK-12 Program,

219

Cellular viability of Saccharomyces cerevisiae cultivated in association with contaminates bacteria of alcoholic fermentation  

International Nuclear Information System (INIS)

The aim of this work was to study the influence of the bacteria Bacillus and Lactobacillus, as well as their metabolic products, in reduction of cellular viability of Saccharomyces cerevisiae, when in mixed culture of yeast and active and treated bacteria. Also was to evaluated an alternative medium (MCC) for the cultivation of bacteria and yeast, constituted of sugarcane juice diluted to 5 deg Brix and supplemented with yeast extract and peptone. The bacteria Bacillus subtilis, Bacillus coagulans, Bacillus stearothermophilus, Lactobacillus fermentum and Lactobacillus plantarum were cultivated in association with yeast Saccharomyces cerevisiae (strain Y-904) for 72 h on 32 deg C, under agitation. The cellular viability, budding rate and population of S. cerevisiae, the total acidity, volatile acidity and pH of culture were determined from 0, 24, 48 e 72 h of mixed culture. Also were determined the initial and final of microorganism population across the pour plate method, in traditional culture medium (PCA for Bacillus, MRS-agar for Lactobacillus and YEPD-agar for yeast S. cerevisiae) and in medium constituted of sugarcane juice. The bacteria cultures were treated by heat sterilization (120 deg C for 20 minutes), antibacterial agent (Kamoran HJ in concentration 3,0 ppm) or irradiation (radiation gamma, with doses of 5,0 kGy for Lactobacillus and 15,0 kGy for Bacillus). The results of the present research showed that just the culture mediums more acids (with higher conulture mediums more acids (with higher concentrations of total and volatile acidity, and smaller values of pH), contaminated with active bacteria L. fermentum and B. subtilis, caused reduction on yeast cellular viability. Except the bacteria B. subtilis treated with radiation, the others bacteria treated by different procedures (heat, radiation e antibacterial) did not cause reduction on yeast cellular viability and population, indicating that the isolated presence of the cellular metabolic of theses bacteria was not enough to reduce the percentage of the yeast live cells and a density population. For all microorganisms, the counts obtained with the cultivation medium constituted of sugarcane juice were similar obtained in traditional mediums, probably because the alternative medium simulate the composition of sugarcane must, that the bacteria were isolated in industrial process of ethanol yield. However, the culture medium constituted of sugarcane juice could be replacing traditional culture mediums of yeast and bacteria tested in this work. (author)

220

Cloning, expression and applicability of thermo-alkali-stable xylanase of Geobacillus thermoleovorans in generating xylooligosaccharides from agro-residues.  

Science.gov (United States)

A xylanase gene (xyl-gt) of 1.224 kbp was cloned from the extremely thermophilic bacterium Geobacillus thermoleovorans that encodes a protein containing 408 amino acid residues. Eight conserved regions (signature sequences) of GH family 10 xylanases have been found in the xylanase. When the xylanase gene was cloned and expressed in Escherichia coli BL21 (DE3), the recombinant strain produced xylanase titer of 270 U mg(-1) which is 27-fold higher than the wild strain. It is optimally active at 80°C and pH 8.5 with a high thermostability over broad range of pH (6-12) and temperature (40-100°C). The end products of the hydrolysis of birch wood xylan and agro-residues included xylobiose, xylotriose, xylotetraose and xylopentaose. The xylanase of G. thermoleovorans is one of the rare xylanases that exhibits thermo-alkali-stability, and thus, it is a suitable candidate for pre-bleaching of paper pulps and generating xylooligosaccharides from agro-residues for use as prebiotics. PMID:22212694

Verma, Digvijay; Satyanarayana, T

2012-03-01

221

Screening of plant growth-promoting traits in arsenic-resistant bacteria isolated from agricultural soil and their potential implication for arsenic bioremediation.  

Science.gov (United States)

Twelve arsenic (As)-resistant bacteria (minimum inhibitory concentration ranging from 10 to 30mM and 150 to 320mM for As(III) and As(V), respectively) were isolated from the agricultural soil of the Chianan Plain in southwestern Taiwan using enrichment techniques. Eight isolates capable of oxidizing As(III) (rate of oxidation from 0.029 to 0.059?Mh(-1) 10(-9) cell) and exhibiting As(III)-oxidase enzyme activity belong to Pseudomonas, Acinetobacter, Klebsiella and Comamonas genera, whereas four isolates that did not show As(III)-oxidizing activity belong to Geobacillus, Bacillus, Paenibacillus, and Enterobacter genera. Assessment of the parameters of plant growth promotion revealed that Pseudomonas sp. ASR1, ASR2 and ASR3, Geobacillus sp. ASR4, Bacillus sp. ASR5, Paenibacillus sp. ASR6, Enterobacter sp. ASR10 and Comamonas sp. ASR11, and ASR12 possessed some or all of the studied plant growth-promoting traits, including phosphate-solubilization, siderophore, IAA-like molecules and ACC deaminase production. In addition, the ability of As-resistant isolates to grow over wide ranges of pH and temperatures signify their potential application for sustainable bioremediation of As in the environment. PMID:24685527

Das, Suvendu; Jean, Jiin-Shuh; Kar, Sandeep; Chou, Mon-Lin; Chen, Chien-Yen

2014-05-15

222

BseSI, a restriction endonuclease from Bacillus stearothermophilus Jo 10-553, which recognizes the novel hexanucleotide sequence 5'-G(G/T)GC(A/C)C-3'.  

OpenAIRE

A new restriction endonuclease Bse SI has been isolated from Bacillus stearothermophilus Jo10-553. Bse SI recognizes a degenerate hexanucleotide sequence 5'-G(G/T)GC(A/C)C-3' and cleaves DNA to produce 3[prime]-protruding tetranucleotide ends.

Steponaviciene, D.; Maneliene, Z.; Petrusyte, M.; Janulaitis, A.

1999-01-01

223

Darwin y las bacterias Darwin and bacteria  

Directory of Open Access Journals (Sweden)

Full Text Available Con motivo de cumplirse 200 años del natalicio de Darwin y 150 desde la publicación de El Origen de las Especies, se revisa su obra buscando alguna mención de las bacterias, a las cuales el gran naturalista parece, o bien no haber conocido, algo muy difícil en un momento en que causaban sensación en el mundo científico, o bien haber ignorado deliberadamente, porque no encontraba para ellas lugar en su teoría de la evolución. Las bacterias, por su parte, afectaron malamente su vida familiar, falleciendo uno de sus hijos de escarlatina y su hija favorita, Arme, de una tuberculosis agravada por el mismo mal que mató a su hermano. El propio Darwin, desde el regreso del Beagle afectado por una enfermedad crónica hasta ahora no dilucidada, podría haber sufrido de la enfermedad de Chagas, cuyo agente etiológico, si bien no es una bacteria, tiene un similar nivel en la escala evolutiva.As in 2009 the scientific world celebrates two hundreds years from the birthday of Charles Darwin and one hundred and fifty from the publication of The Origin of Species, an analysis of his complete work is performed, looking for any mention of bacteria. But it seems that the great naturahst never took knowledge about its existence, something rather improbable in a time when the discovery of bacteria shook the medical world, or he deliberately ignored them, not finding a place for such microscopic beings into his theory of evolution. But the bacteria badly affected his familiar life, killing scarlet fever one of his children and worsening to death the evolution of tuberculosis of his favourite Annie. Darwin himself could suffer the sickness of Chagas, whose etiological agent has a similar level to bacteria in the scale of evolution.

Walter Ledermann D

2009-02-01

224

Darwin y las bacterias / Darwin and bacteria  

Scientific Electronic Library Online (English)

Full Text Available SciELO Chile | Language: Spanish Abstract in spanish Con motivo de cumplirse 200 años del natalicio de Darwin y 150 desde la publicación de El Origen de las Especies, se revisa su obra buscando alguna mención de las bacterias, a las cuales el gran naturalista parece, o bien no haber conocido, algo muy difícil en un momento en que causaban sensación en [...] el mundo científico, o bien haber ignorado deliberadamente, porque no encontraba para ellas lugar en su teoría de la evolución. Las bacterias, por su parte, afectaron malamente su vida familiar, falleciendo uno de sus hijos de escarlatina y su hija favorita, Arme, de una tuberculosis agravada por el mismo mal que mató a su hermano. El propio Darwin, desde el regreso del Beagle afectado por una enfermedad crónica hasta ahora no dilucidada, podría haber sufrido de la enfermedad de Chagas, cuyo agente etiológico, si bien no es una bacteria, tiene un similar nivel en la escala evolutiva. Abstract in english As in 2009 the scientific world celebrates two hundreds years from the birthday of Charles Darwin and one hundred and fifty from the publication of The Origin of Species, an analysis of his complete work is performed, looking for any mention of bacteria. But it seems that the great naturahst never t [...] ook knowledge about its existence, something rather improbable in a time when the discovery of bacteria shook the medical world, or he deliberately ignored them, not finding a place for such microscopic beings into his theory of evolution. But the bacteria badly affected his familiar life, killing scarlet fever one of his children and worsening to death the evolution of tuberculosis of his favourite Annie. Darwin himself could suffer the sickness of Chagas, whose etiological agent has a similar level to bacteria in the scale of evolution.

Walter, Ledermann D.

2009-02-01

225

Bacteria: Fossil Record  

Science.gov (United States)

This description of the fossil record of bacteria focuses on one particular group of bacteria, the cyanobacteria or blue-green algae, which have left a fossil record that extends far back into the Precambrian. The oldest cyanobacteria-like fossils known are nearly 3.5 billion years old and are among the oldest fossils currently known. Cyanobacteria are larger than most bacteria and may secrete a thick cell wall. More importantly, cyanobacteria may form large layered structures, called stromatolites (if more or less dome-shaped) or oncolites (if round). The site also refers to pseudomorphs of pyrite and siderite, and a group of bacteria known as endolithic. Two links are available for more information. One provides information on the discovery of possible remains of bacteria-like organisms on a meteorite from Mars and the other has a research report on fossilized filamentous bacteria and other microbes, found in Cretaceous amber.

226

Multidrug Resistance in Bacteria  

OpenAIRE

Large amounts of antibiotics used for human therapy, as well as for farm animals and even for fish in aquaculture, resulted in the selection of pathogenic bacteria resistant to multiple drugs. Multidrug resistance in bacteria may be generated by one of two mechanisms. First, these bacteria may accumulate multiple genes, each coding for resistance to a single drug, within a single cell. This accumulation occurs typically on resistance (R) plasmids. Second, multidrug resistance may also occur b...

Nikaido, Hiroshi

2009-01-01

227

Genomics of Probiotic Bacteria  

Science.gov (United States)

Probiotic bacteria from the Lactobacillus and Bifidobacterium species belong to the Firmicutes and the Actinobacteria phylum, respectively. Lactobacilli are members of the lactic acid bacteria (LAB) group, a broadly defined family of microorganisms that ferment various hexoses into primarily lactic acid. Lactobacilli are typically low G + C gram-positive species which are phylogenetically diverse, with over 100 species documented to date. Bifidobacteria are heterofermentative, high G + C content bacteria with about 30 species of bifidobacteria described to date.

O'Flaherty, Sarah; Goh, Yong Jun; Klaenhammer, Todd R.

228

Biotransformation of Acetamide to Acetohydroxamic Acid at Bench Scale Using Acyl Transferase Activity of Amidase of Geobacillus pallidus BTP-5x MTCC 9225  

OpenAIRE

The bioprocess employing acyl transferase activity of intracellular amidase of Geobacillus pallidus BTP-5x MTCC 9225 was harnessed for the synthesis of pharmaceutically important acetohydroxamic acid. G. pallidus BTP-5x exhibited highest acyl transferase activity with acetamide: hydroxylamine in ratio of 1:5 in 0.1 M NaH2PO4/Na2HPO4 buffer (pH 7.5) at 65°C. In one liter fed-batch reaction containing 1:5 ratio of two substrates total of eight feedings of 0.05 M/20 min of acetamide were mad...

Sharma, Monica; Sharma, Nitya Nand; Bhalla, Tek Chand

2011-01-01

229

Production of l-Ribose from l-Ribulose by a Triple-Site Variant of Mannose-6-Phosphate Isomerase from Geobacillus thermodenitrificans  

OpenAIRE

A triple-site variant (W17Q N90A L129F) of mannose-6-phosphate isomerase from Geobacillus thermodenitrificans was obtained by combining variants with residue substitutions at different positions after random and site-directed mutagenesis. The specific activity and catalytic efficiency (kcat/Km) for l-ribulose isomerization of this variant were 3.1- and 7.1-fold higher, respectively, than those of the wild-type enzyme at pH 7.0 and 70°C in the presence of 1 mM Co2+. The triple-site variant pr...

Lim, Yu-ri; Yeom, Soo-jin; Oh, Deok-kun

2012-01-01

230

Improvement of Thermal Stability via Outer-Loop Ion Pair Interaction of Mutated T1 Lipase from Geobacillus zalihae Strain T1  

OpenAIRE

Mutant D311E and K344R were constructed using site-directed mutagenesis to introduce an additional ion pair at the inter-loop and the intra-loop, respectively, to determine the effect of ion pairs on the stability of T1 lipase isolated from Geobacillus zalihae. A series of purification steps was applied, and the pure lipases of T1, D311E and K344R were obtained. The wild-type and mutant lipases were analyzed using circular dichroism. The Tm for T1 lipase, D311E lipase and K344R lipase were ap...

Mahiran Basri; Rudzanna Ruslan; Raja Noor Zaliha Raja Abd. Rahman; Mohd. Shukuri Mohamad Ali; Thean Chor Leow; Abu Bakar Salleh

2012-01-01

231

Genome and proteome of long-chain alkane degrading Geobacillus thermodenitrificans NG80-2 isolated from a deep-subsurface oil reservoir  

OpenAIRE

The complete genome sequence of Geobacillus thermodenitrificans NG80-2, a thermophilic bacillus isolated from a deep oil reservoir in Northern China, consists of a 3,550,319-bp chromosome and a 57,693-bp plasmid. The genome reveals that NG80-2 is well equipped for adaptation into a wide variety of environmental niches, including oil reservoirs, by possessing genes for utilization of a broad range of energy sources, genes encoding various transporters for efficient nutrient uptake and detoxifi...

Feng, Lu; Wang, Wei; Cheng, Jiansong; Ren, Yi; Zhao, Guang; Gao, Chunxu; Tang, Yun; Liu, Xueqian; Han, Weiqing; Peng, Xia; Liu, Rulin; Wang, Lei

2007-01-01

232

Bacteria-Antagonists  

International Science & Technology Center (ISTC)

Development of Biological Control Agents Through Use of Recombinant Antagonistic Bacteria Possessing Variable Mechanisms of Antagonisms, High Colonizing Capacity and Marker Traits for their Monitoring in Nature

233

Introduction to Bacteria  

Science.gov (United States)

This science site has students research how bacteria move, where they live, and how they reproduce; learn how bacteria can be helpful or harmful; and create a design illustrating what they have learned about bacteria. Included in the lesson plan are the objectives, needed materials and Web sites, procedures, discussion questions, evaluation, extensions, suggested reading, and vocabulary. Teachers can link to Teaching Tools to create custom worksheets, puzzles, and quizzes. A printable version of the lesson plan can be downloaded. The video Bacteria, Viruses and Allergies can be purchased and comprehension questions and answers can be downloaded.

Discoveryschool.com; Fenichel, Marilyn

2007-12-12

234

A mixed-species microarray for identification of food spoilage bacilli  

OpenAIRE

Failure of food preservation is frequently caused by thermostable spores of members of the Bacillaceae family, which show a wide spectrum of resistance to cleaning and preservation treatments. We constructed and validated a mixed-species genotyping array for 6 Bacillus species, including Bacillus subtilis, Bacillus licheniformis, Bacillus pumilus, Bacillus sporothermodurans, Bacillus cereus and Bacillus coagulans, and 4 Geobacillus species, including Geobacillus stearothermophilus, Geobacillu...

Caspers, M. P. M.; Schuren, F. H. J.; Zuijlen, A. C. M.; Brul, S.; Montijn, R. C.; Abee, T.; Kort, R.

2011-01-01

235

Abiotic and microbiotic factors controlling biofilm formation by thermophilic sporeformers.  

Science.gov (United States)

One of the major concerns in the production of dairy concentrates is the risk of contamination by heat-resistant spores from thermophilic bacteria. In order to acquire more insight in the composition of microbial communities occurring in the dairy concentrate industry, a bar-coded 16S amplicon sequencing analysis was carried out on milk, final products, and fouling samples taken from dairy concentrate production lines. The analysis of these samples revealed the presence of DNA from a broad range of bacterial taxa, including a majority of mesophiles and a minority of (thermophilic) spore-forming bacteria. Enrichments of fouling samples at 55°C showed the accumulation of predominantly Brevibacillus and Bacillus, whereas enrichments at 65°C led to the accumulation of Anoxybacillus and Geobacillus species. Bacterial population analysis of biofilms grown using fouling samples as an inoculum indicated that both Anoxybacillus and Geobacillus preferentially form biofilms on surfaces at air-liquid interfaces rather than on submerged surfaces. Three of the most potent biofilm-forming strains isolated from the dairy factory industrial samples, including Geobacillus thermoglucosidans, Geobacillus stearothermophilus, and Anoxybacillus flavithermus, have been characterized in detail with respect to their growth conditions and spore resistance. Strikingly, Geobacillus thermoglucosidans, which forms the most thermostable spores of these three species, is not able to grow in dairy intermediates as a pure culture but appears to be dependent for growth on other spoilage organisms present, probably as a result of their proteolytic activity. These results underscore the importance of abiotic and microbiotic factors in niche colonization in dairy factories, where the presence of thermophilic sporeformers can affect the quality of end products. PMID:23851093

Zhao, Yu; Caspers, Martien P M; Metselaar, Karin I; de Boer, Paulo; Roeselers, Guus; Moezelaar, Roy; Nierop Groot, Masja; Montijn, Roy C; Abee, Tjakko; Kort, Remco

2013-09-01

236

Thermoadaptation-Directed Enzyme Evolution in an Error-Prone Thermophile Derived from Geobacillus kaustophilus HTA426.  

Science.gov (United States)

Thermostability is an important property of enzymes utilized for practical applications because it allows long-term storage and use as catalysts. In this study, we constructed an error-prone strain of the thermophile Geobacillus kaustophilus HTA426 and investigated thermoadaptation-directed enzyme evolution using the strain. A mutation frequency assay using the antibiotics rifampin and streptomycin revealed that G. kaustophilus had substantially higher mutability than Escherichia coli and Bacillus subtilis. The predominant mutations in G. kaustophilus were A · T?G · C and C · G?T · A transitions, implying that the high mutability of G. kaustophilus was attributable in part to high-temperature-associated DNA damage during growth. Among the genes that may be involved in DNA repair in G. kaustophilus, deletions of the mutSL, mutY, ung, and mfd genes markedly enhanced mutability. These genes were subsequently deleted to construct an error-prone thermophile that showed much higher (700- to 9,000-fold) mutability than the parent strain. The error-prone strain was auxotrophic for uracil owing to the fact that the strain was deficient in the intrinsic pyrF gene. Although the strain harboring Bacillus subtilis pyrF was also essentially auxotrophic, cells became prototrophic after 2 days of culture under uracil starvation, generating B. subtilis PyrF variants with an enhanced half-denaturation temperature of >10°C. These data suggest that this error-prone strain is a promising host for thermoadaptation-directed evolution to generate thermostable variants from thermolabile enzymes. PMID:25326311

Suzuki, Hirokazu; Kobayashi, Jyumpei; Wada, Keisuke; Furukawa, Megumi; Doi, Katsumi

2015-01-01

237

Isolation and characterization of a thermotolerant ene reductase from Geobacillus sp. 30 and its heterologous expression in Rhodococcus opacus.  

Science.gov (United States)

Rhodococcus opacus B-4 cells are adhesive to and even dispersible in water-immiscible hydrocarbons owing to their highly lipophilic nature. In this study, we focused on the high operational stability of thermophilic enzymes and applied them to a biocatalytic conversion in an organic reaction medium using R. opacus B-4 as a lipophilic capsule of enzymes to deliver them into the organic medium. A novel thermo- and organic-solvent-tolerant ene reductase, which can catalyze the enantioselective reduction of ketoisophorone to (6R)-levodione, was isolated from Geobacillus sp. 30, and the gene encoding the enzyme was heterologously expressed in R. opacus B-4. Another thermophilic enzyme which catalyzes NAD(+)-dependent dehydrogenation of cyclohexanol was identified from the gene-expression library of Thermus thermophilus and the gene was coexpressed in R. opacus B-4 for cofactor regeneration. While the recombinant cells were not viable in the mixture due to high reaction temperature, 634 mM of (6R)-levodione could be produced with an enantiopurity of 89.2 % ee by directly mixing the wet cells of the recombinant R. opacus with a mixture of ketoisophorone and cyclohexanol at 50 °C. The conversion rate observed with the heat-killed recombinant cells was considerably higher than that obtained with a cell-free enzyme solution, demonstrating that the accessibility between the substrates and enzymes could be improved by employing R. opacus cells as a lipophilic enzyme capsule. These results imply that a combination of thermophilic enzymes and lipophilic cells can be a promising approach for the biocatalytic production of water-insoluble chemicals. PMID:24927695

Tsuji, Naoto; Honda, Kohsuke; Wada, Mayumi; Okano, Kenji; Ohtake, Hisao

2014-07-01

238

A novel endo-glucanase from the thermophilic bacterium Geobacillus sp. 70PC53 with high activity and stability over a broad range of temperatures.  

Science.gov (United States)

A thermophilic Geobacillus bacterium secreting high activity of endo-glucanase (EC 3.2.1.4) was isolated from rice straw compost supplemented with pig manure. A full-length gene of 1,104 bp, celA, encoding this glycosyl hydrolase family 5 endo-glucanase of 368 amino acids was isolated. No related gene from Geobacillus has been reported previously. The recombinant CelA expressed in Escherichia coli had an optimal activity at 65 degrees C and pH 5.0, and it exhibited tenfold greater specific activity than the commercially available Trichoderma reesei endo-glucanase. CelA displayed activity over a broad temperature range from 45 to 75 degrees C and was a thermostable enzyme with 90% activity retained after heating at 65 degrees C for 6 h. Interestingly, CelA activity could be enhanced by 100% in the presence of 2 mM MnSO(4). CelA had high specific activity over beta-D-glucan from barley and Lichenan, making it a potentially useful enzyme in biofuel and food industries. PMID:19296197

Ng, I-Son; Li, Chen-Wei; Yeh, Yi-Fang; Chen, Po Ting; Chir, Jiun-Ly; Ma, Chin-Hua; Yu, Su-May; Ho, Tuan-hua David; Tong, Chii-Gong

2009-05-01

239

Indigenous cellulolytic and hemicellulolytic bacteria enhanced rapid co-composting of lignocellulose oil palm empty fruit bunch with palm oil mill effluent anaerobic sludge.  

Science.gov (United States)

The composting of lignocellulosic oil palm empty fruit bunch (OPEFB) with continuous addition of palm oil mill (POME) anaerobic sludge which contained nutrients and indigenous microbes was studied. In comparison to the conventional OPEFB composting which took 60-90 days, the rapid composting in this study can be completed in 40 days with final C/N ratio of 12.4 and nitrogen (2.5%), phosphorus (1.4%), and potassium (2.8%), respectively. Twenty-seven cellulolytic bacterial strains of which 23 strains were closely related to Bacillus subtilis, Bacillus firmus, Thermobifida fusca, Thermomonospora spp., Cellulomonas sp., Ureibacillus thermosphaericus, Paenibacillus barengoltzii, Paenibacillus campinasensis, Geobacillus thermodenitrificans, Pseudoxanthomonas byssovorax which were known as lignocellulose degrading bacteria and commonly involved in lignocellulose degradation. Four isolated strains related to Exiguobacterium acetylicum and Rhizobium sp., with cellulolytic and hemicellulolytic activities. The rapid composting period achieved in this study can thus be attributed to the naturally occurring cellulolytic and hemicellulolytic strains identified. PMID:24012093

Zainudin, Mohd Huzairi Mohd; Hassan, Mohd Ali; Tokura, Mitsunori; Shirai, Yoshihito

2013-11-01

240

Identificación de genes codificantes de enzimas de interés industrial en una cepa de bacteria termofílica aislada de aguas termanles de Salta (Argentina  

Directory of Open Access Journals (Sweden)

Full Text Available Se aislaron dos bacterias termofílicas a partir de aguas termales de la provincia de Salta, Argentina. Estudios filogenéticos permitieron caracterizar los aislamientos como pertenecientes a los géneros Thermus y Geobacillus. Se determinó la secuencia nucleotídica parcial del genoma de Thermus sp. 2.9 con un equipo de secuenciación masiva de ADN de tecnología Roche 454. Se generaron 215.557 lecturas que proveen una cobertura aproximada de 40 veces el tamaño del genoma. Se realizó un análisis preliminar de las secuencias obtenidas para la identificación de regiones codificantes. Mediante el mismo se identificaron y caracterizaron genes que codifican enzimas utilizadas en procesos de transformación de alimentos y relacionadas con la degradación de polímeros, tales como xilanasas, proteasas, esterasas, lipasas, catalasas y galactosidasas. Este primer paso indica que este microorganismo es un potencial productor de enzimas termofílicas que podrían ser aplicadas en la industria alimentaria.

Navas, L.E.

2014-04-01

241

Cellular viability of Saccharomyces cerevisiae cultivated in association with contaminates bacteria of alcoholic fermentation;Viabilidade celular de Saccharomyces cerevisiae cultivada em associacao com bacterias contaminantes da fermentacao alcoolica  

Energy Technology Data Exchange (ETDEWEB)

The aim of this work was to study the influence of the bacteria Bacillus and Lactobacillus, as well as their metabolic products, in reduction of cellular viability of Saccharomyces cerevisiae, when in mixed culture of yeast and active and treated bacteria. Also was to evaluated an alternative medium (MCC) for the cultivation of bacteria and yeast, constituted of sugarcane juice diluted to 5 deg Brix and supplemented with yeast extract and peptone. The bacteria Bacillus subtilis, Bacillus coagulans, Bacillus stearothermophilus, Lactobacillus fermentum and Lactobacillus plantarum were cultivated in association with yeast Saccharomyces cerevisiae (strain Y-904) for 72 h on 32 deg C, under agitation. The cellular viability, budding rate and population of S. cerevisiae, the total acidity, volatile acidity and pH of culture were determined from 0, 24, 48 e 72 h of mixed culture. Also were determined the initial and final of microorganism population across the pour plate method, in traditional culture medium (PCA for Bacillus, MRS-agar for Lactobacillus and YEPD-agar for yeast S. cerevisiae) and in medium constituted of sugarcane juice. The bacteria cultures were treated by heat sterilization (120 deg C for 20 minutes), antibacterial agent (Kamoran HJ in concentration 3,0 ppm) or irradiation (radiation gamma, with doses of 5,0 kGy for Lactobacillus and 15,0 kGy for Bacillus). The results of the present research showed that just the culture mediums more acids (with higher concentrations of total and volatile acidity, and smaller values of pH), contaminated with active bacteria L. fermentum and B. subtilis, caused reduction on yeast cellular viability. Except the bacteria B. subtilis treated with radiation, the others bacteria treated by different procedures (heat, radiation e antibacterial) did not cause reduction on yeast cellular viability and population, indicating that the isolated presence of the cellular metabolic of theses bacteria was not enough to reduce the percentage of the yeast live cells and a density population. For all microorganisms, the counts obtained with the cultivation medium constituted of sugarcane juice were similar obtained in traditional mediums, probably because the alternative medium simulate the composition of sugarcane must, that the bacteria were isolated in industrial process of ethanol yield. However, the culture medium constituted of sugarcane juice could be replacing traditional culture mediums of yeast and bacteria tested in this work. (author)

Nobre, Thais de Paula

2005-07-01

242

Cultivation Media for Bacteria  

Science.gov (United States)

Common bacteriological culture media (tryptic soy agar, chocolate agar, Thayer-Martin agar, MacConkey agar, eosin-methylene blue agar, hektoen agar, mannitol salt agar, and sheep blood agar) are shown uninoculated and inoculated with bacteria.

American Society For Microbiology

2009-12-08

243

Bacteria and Foodborne Illness  

Science.gov (United States)

... foodborne illnesses may lead to chronic disorders, including reactive arthritis, a type of joint inflammation that usually affects ... by certain bacteria, including C. jejuni and Salmonella . Reactive arthritis usually lasts fewer than 6 months, but this ...

244

Rapid identification of dairy mesophilic and thermophilic sporeforming bacteria using DNA high resolution melt analysis of variable 16S rDNA regions.  

Science.gov (United States)

Due to their ubiquity in the environment and ability to survive heating processes, sporeforming bacteria are commonly found in foods. This can lead to product spoilage if spores are present in sufficient numbers and where storage conditions favour spore germination and growth. A rapid method to identify the major aerobic sporeforming groups in dairy products, including Bacillus licheniformis group, Bacillus subtilis group, Bacillus pumilus group, Bacillus megaterium, Bacillus cereus group, Geobacillus species and Anoxybacillus flavithermus was devised. This method involves real-time PCR and high resolution melt analysis (HRMA) of V3 (~70 bp) and V6 (~100 bp) variable regions in the 16S rDNA. Comparisons of HRMA curves from 194 isolates of the above listed sporeforming bacteria obtained from dairy products which were identified using partial 16S rDNA sequencing, allowed the establishment of criteria for differentiating them from each other and several non-sporeforming bacteria found in samples. A blinded validation trial on 28 bacterial isolates demonstrated complete accuracy in unambiguous identification of the 7 different aerobic sporeformers. The reliability of HRMA method was also verified using boiled extractions of crude DNA, thereby shortening the time needed for identification. The HRMA method described in this study provides a new and rapid approach to identify the dominant mesophilic and thermophilic aerobic sporeforming bacteria found in a wide variety of dairy products. PMID:23743474

Chauhan, Kanika; Dhakal, Rajat; Seale, R Brent; Deeth, Hilton C; Pillidge, Christopher J; Powell, Ian B; Craven, Heather; Turner, Mark S

2013-07-15

245

Presence and potential role of thermophilic bacteria in temperate terrestrial environments  

Science.gov (United States)

Organic sulfur and nitrogen are major reservoirs of these elements in terrestrial systems, although their cycling remains to be fully understood. Both sulfur and nitrogen mineralization are directly related to microbial metabolism. Mesophiles and thermophiles were isolated from temperate environments. Thermophilic isolates were classified within the Firmicutes, belonging to the Geobacillus, Brevibacillus, and Ureibacillus genera, and showed optimum growth temperatures between 50°C and 60°C. Sulfate and ammonium produced were higher during growth of thermophiles both for isolated strains and natural bacterial assemblages. They were positively related to organic nutrient load. Temperature also affected the release of sulfate and ammonium by thermophiles. Quantitative, real-time reverse-transcription polymerase chain reaction on environmental samples indicated that the examined thermophilic Firmicutes represented up to 3.4% of the total bacterial community RNA. Temperature measurements during summer days showed values above 40°C for more than 10 h a day in soils from southern Spain. These results support a potential role of thermophilic bacteria in temperate terrestrial environments by mineralizing organic sulfur and nitrogen ruled by the existence and length of warm periods.

Portillo, M. C.; Santana, M.; Gonzalez, J. M.

2012-01-01

246

Antibiotic-Resistant Bacteria.  

Science.gov (United States)

A study conducted by high school advanced bacteriology students appears to confirm the hypothesis that the incremental administration of antibiotics on several species of bacteria (Escherichia coli, Staphylococcus epidermis, Bacillus sublitus, Bacillus megaterium) will allow for the development of antibiotic-resistant strains. (PEB)

Longenecker, Nevin E.; Oppenheimer, Dan

1982-01-01

247

Immunity to intracellular bacteria  

OpenAIRE

Immunity to intracellular bacteria including Mycobacterium tuberculosis. Mycobacterium leprae, and Listeria monocytogenes depends on specific T cells. Evidence to be described suggests that CD4 (alpha/beta)T cells which interact with each other and with macrophages contribute to acquired resistence against as well as pathogenesis of intracellular bacterial infections.

Kaufmann, Stefan H. E.; Follows, George A.; Munik, Martin E.

1992-01-01

248

Immunity to intracellular bacteria  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in english Immunity to intracellular bacteria including Mycobacterium tuberculosis. Mycobacterium leprae, and Listeria monocytogenes depends on specific T cells. Evidence to be described suggests that CD4 (alpha/beta)T cells which interact with each other and with macrophages contribute to acquired resistence [...] against as well as pathogenesis of intracellular bacterial infections.

Stefan H. E., Kaufmann; George A., Follows; Martin E., Munik.

249

Immunity to intracellular bacteria  

Directory of Open Access Journals (Sweden)

Full Text Available Immunity to intracellular bacteria including Mycobacterium tuberculosis. Mycobacterium leprae, and Listeria monocytogenes depends on specific T cells. Evidence to be described suggests that CD4 (alpha/betaT cells which interact with each other and with macrophages contribute to acquired resistence against as well as pathogenesis of intracellular bacterial infections.

Stefan H. E. Kaufmann

1992-01-01

250

Mechanistic Diversity in the RuBisCO Superfamily: The Enolase in the Methionine Salvage Pathway in Geobacillus kaustophilus  

International Nuclear Information System (INIS)

D-Ribulose 1,5-bisphosphate carboxylase/oxygenase (RuBisCO), the most abundant enzyme, is the paradigm member of the recently recognized mechanistically diverse RuBisCO superfamily. The RuBisCO reaction is initiated by abstraction of the proton from C3 of the D-ribulose 1,5-bisphosphate substrate by a carbamate oxygen of carboxylated Lys 201 (spinach enzyme). Heterofunctional homologues of RuBisCO found in species of Bacilli catalyze the tautomerization ('enolization') of 2,3-diketo-5-methylthiopentane 1-phosphate (DK-MTP 1-P) in the methionine salvage pathway in which 5-methylthio-D-ribose (MTR) derived from 5'-methylthioadenosine is converted to methionine (Ashida, H., Saito, Y., Kojima, C., Kobayashi, K., Ogasawara, N., and Yokota, A. (2003) A functional link between RuBisCO-like protein of Bacillus and photosynthetic RuBisCO, Science 302, 286-290]. The reaction catalyzed by this 'enolase' is accomplished by abstraction of a proton from C1 of the DK-MTP 1-P substrate to form the tautomerized product, a conjugated enol. Because the RuBisCO- and 'enolase'-catalyzed reactions differ in the regiochemistry of proton abstraction but are expected to share stabilization of an enolate anion intermediate by coordination to an active site Mg2+, we sought to establish structure-function relationships for the 'enolase' reaction so that the structural basis for the functional diversity could be established. We determined the stereochemical course of the reaction cataltereochemical course of the reaction catalyzed by the 'enolases' from Bacillus subtilis and Geobacillus kaustophilus. Using stereospecifically deuterated samples of an alternate substrate derived from D-ribose (5-OH group instead of the 5-methylthio group in MTR) as well as of the natural DK-MTP 1-P substrate, we determined that the 'enolase'-catalyzed reaction involves abstraction of the 1-proS proton. We also determined the structure of the activated 'enolase' from G. kaustophilus (carboxylated on Lys 173) liganded with Mg2+ and 2,3-diketohexane 1-phosphate, a stable alternate substrate. The stereospecificity of proton abstraction restricts the location of the general base to the N-terminal ?+ ? domain instead of the C-terminal (?/?)8-barrel domain that contains the carboxylated Lys 173. Lys 98 in the N-terminal domain, conserved in all 'enolases', is positioned to abstract the 1-proS proton. Consistent with this proposed function, the K98A mutant of the G. kaustophilus 'enolase' is unable to catalyze the 'enolase' reaction. Thus, we conclude that this functionally divergent member of the RuBisCO superfamily uses the same structural strategy as RuBisCO for stabilizing the enolate anion intermediate, i.e., coordination to an essential Mg2+, but the proton abstraction is catalyzed by a different general base

251

Use of a mixture of surrogates for infectious bioagents in a standard approach to assessing disinfection of environmental surfaces.  

Science.gov (United States)

We used a mixture of surrogates (Acinetobacter baumannii, Mycobacterium terrae, hepatitis A virus, and spores of Geobacillus stearothermophilus) for bioagents in a standardized approach to test environmental surface disinfectants. Each carrier containing 10 microl of mixture received 50 microl of a test chemical or saline at 22 +/- 2 degrees C. Disinfectant efficacy criteria were > or = 6 log(10) reduction for the bacteria and the spores and > or = 3 log(10) reduction for the virus. Peracetic acid (1,000 ppm) was effective in 5 min against the two bacteria and the spores but not against the virus. Chlorine dioxide (CD; 500 and 1,000 ppm) and domestic bleach (DB; 2,500, 3,500, and 5,000 ppm) were effective in 5 min, except for sporicidal activity, which needed 20 min of contact with either 1,000 ppm of CD or the two higher concentrations of DB. PMID:20639366

Sabbah, Safaa; Springthorpe, Susan; Sattar, Syed A

2010-09-01

252

Can bacteria save the planet?  

OpenAIRE

Bacteria might just hold the key to preserving the environment for our great grandchildren. Philip Hunter explores some of the novel ways in which systems biology and biotechnology are harnessing bacteria to produce renewable energy and clean up pollution.

Hunter, Philip

2010-01-01

253

Secretory expression of thermostable alkaline protease from Bacillus stearothermophilus FI by using native signal peptide and ?-factor secretion signal in Pichia pastoris.  

Science.gov (United States)

The thermostable alkaline protease from Bacillus stearothermophilus F1 has high potential for industrial applications, and attempt to produce the enzyme in yeast for higher yield was undertaken. Secretory expression of F1 protease through yeast system could improve enzyme's capability, thus simplifying the purification steps. Mature and full genes of F1 protease were cloned into Pichia pastoris expression vectors (pGAPZ?B and pPICZ?B) and transformed into P. pastoris strains (GS115 and SMD1168H) via electroporation method. Recombinant F1 protease under regulation constitutive GAP promoter revealed that the highest expression was achieved after 72 h cultivation. While inducible AOX promoter showed that 0.5% (v/v) methanol was the best to induce expression. It was proven that constitutive expression strategy was better than inducible system. The ?-secretion signal from the plasmid demonstrated higher secretory expression level of F1 protease as compared to native Open Reading Frame (ORF) in GS115 strain (GE6GS). Production medium YPTD was found to be the best for F1 protease expression with the highest yield of 4.13 U/mL. The protein was expressed as His-tagged fusion protein with a size about 34 kDa. PMID:23832300

Latiffi, Amaliawati Ahmad; Salleh, Abu Bakar; Rahman, Raja Noor Zaliha Raja Abd; Oslan, Siti Nurbaya; Basri, Mahiran

2013-01-01

254

Three Activities: Bacteria Study, Micro Study, and Bacteria Killers  

Science.gov (United States)

This resource provides a problem-based activity on risk assessment of environmental health issues. The lesson consists of three related activities: Bacteria Study, Micro Study and Bacteria Killers. "Bacteria Study" gives students hands-on experience with the concepts of epidemiology. "Micro Study" has students sketch, observe, and compare different types of bacteria that can grow in moist conditions. "Bacteria Killers" has students determine what kills bateria, especially in common household products. Detailed instructions are provided for each activity. This resource is free to download. Users must first create a login with ATEEC's website to access the file.

255

Denitrification by extremely halophilic bacteria  

Science.gov (United States)

Extremely halophilic bacteria were isolated from widely separated sites by anaerobic enrichment in the presence of nitrate. The anaerobic growth of several of these isolates was accompanied by the production of nitrite, nitrous oxide, and dinitrogen. These results are a direct confirmation of the existence of extremely halophilic denitrifying bacteria, and suggest that such bacteria may be common inhabitants of hypersaline environments.

Hochstein, L. I.; Tomlinson, G. A.

1985-01-01

256

[Immunobiological properties of bacteria].  

Science.gov (United States)

Opsonins found on the surface of microbial cells in vivo and ex vivo are characterized. The possibility of their visualization by immune electron and fluorescent microscopy has been demonstrated. Opsonins are shown to play a role in immune-mediated adhesion of bacteria to phagocytes and erythrocytes and formation of virus-bacterium associations. Staphylococci, Streptococci, and Propionibacteria appear to actively adsorb blood proteins on their cell surface giving rise to well-apparent capsular structures tentatively called immunoglobulin coatings. Pathogen (microorganism)-associated molecular patterns of gram-positive and gram-negative bacteria show different degree of interaction with soluble proteins that in turn promote their adhesion to blood corpuscles. The role of erythrocytes in transportation and elimination of immune complexes bound to their membrane receptors is discussed. PMID:21312383

Bykov, A S; Bykov, S A; Romanovskaia, L M; Solntseva, V K; Fomina, E S

2010-01-01

257

Manufacture of Probiotic Bacteria  

Science.gov (United States)

Lactic acid bacteria (LAB) have been used for many years as natural biopreservatives in fermented foods. A small group of LAB are also believed to have beneficial health effects on the host, so called probiotic bacteria. Probiotics have emerged from the niche industry from Asia into European and American markets. Functional foods are one of the fastest growing markets today, with estimated growth to 20 billion dollars worldwide by 2010 (GIA, 2008). The increasing demand for probiotics and the new food markets where probiotics are introduced, challenges the industry to produce high quantities of probiotic cultures in a viable and stable form. Dried concentrated probiotic cultures are the most convenient form for incorporation into functional foods, given the ease of storage, handling and transport, especially for shelf-stable functional products. This chapter will discuss various aspects of the challenges associated with the manufacturing of probiotic cultures.

Muller, J. A.; Ross, R. P.; Fitzgerald, G. F.; Stanton, C.

258

Bacteria, food, and cancer.  

Science.gov (United States)

Gut microbes are essential components of the human organism-helping us metabolize food into energy, produce micronutrients, and shape our immune systems. Having a particular pattern of gut microbes is also increasingly being linked to medical conditions including obesity, inflammatory bowel disease, and diabetes. Recent studies now indicate that our resident intestinal bacteria may also play a critical role in determining one's risk of developing cancer, ranging from protection against cancer to promoting its initiation and progression. Gut bacteria are greatly influenced by diet and in this review we explore evidence that they may be the missing piece that explains how dietary intake influences cancer risk, and discuss possible prevention and treatment strategies. PMID:21876723

Rooks, Michelle G; Garrett, Wendy S

2011-01-01

259

Glacial lake hides bacteria  

Science.gov (United States)

This article highlights the published work of a geomicrobiology research team led by Eric Gaidos from the University of Hawaii and Brian Lanoil, from the University of California, Riverside. This group reports the identification of bacteria from an Icelandic sub-glacial lake, and how the collection and description of these microorganisms immured within glacial ice and sub-surface water serve as a model in the search for extra-terrestrial life.

Peplow, Mark; Online, Bioed

260

Bacteria are not Lamarckian  

OpenAIRE

Instructive influence of environment on heredity has been a debated topic for centuries. Darwin's identification of natural selection coupled to chance variation as the driving force for evolution, against a formal interpretation proposed by Lamarck, convinced most scientists that environment does not specifically instruct evolution in an oriented direction. This is true for multicellular organisms. In contrast, bacteria were long thought of as prone to receive oriented infl...

Danchin, Antoine

2007-01-01

261

Growing Unculturable Bacteria  

OpenAIRE

The bacteria that can be grown in the laboratory are only a small fraction of the total diversity that exists in nature. At all levels of bacterial phylogeny, uncultured clades that do not grow on standard media are playing critical roles in cycling carbon, nitrogen, and other elements, synthesizing novel natural products, and impacting the surrounding organisms and environment. While molecular techniques, such as metagenomic sequencing, can provide some information independent of our ability...

Stewart, Eric J.

2012-01-01

262

Antibiotic Resistant Bacteria  

Science.gov (United States)

This week's Topic In Depth is about antibiotic resistant bacteria.The first site is a recent news report from BBC news (1) that describes some recent research on resistant strains of two "of the world's most dangerous bacteria. Next is a Centers for Disease Control (CDC) page (2) with a brief background on antibiotic resistance and how to prevent it. A much more in-depth report is provided by the Select Committee on Science and Technology of the British House of Lords (3). There has been some public concern over the use of antibiotic resistant bacteria strains as markers in genetically modified food crops. The next two resources present information specific to this topic. The first is from the European Federation of Biotechnology (4), and the second is a shorter report from the Council for Biotechnology Information (5). The Alliance for the Prudent Use of Antibiotics (6) has a consumer and patient information section that explains what individuals can do to help prevent the problem from increasing. Readers who need a brief primer on antibiotics may appreciate this Web site from the University of Edinburgh (7). The last site is a "bugs in the news" feature from the University of Kansas (8), which is an easy-to-read explanation of "what the heck" antibiotic resistance is.

Lee, Amy.

2002-01-01

263

Stereospecific production of the herbicide phosphinothricin (glufosinate): purification of aspartate transaminase from Bacillus stearothermophilus, cloning of the corresponding gene, aspC, and application in a coupled transaminase process.  

OpenAIRE

We have isolated and characterized an aspartate transaminase (glutamate:oxalacetate transaminase, EC 2.6.1.1) from the thermophilic microorganism Bacillus stearothermophilus. The purified enzyme has a molecular mass of 40.5 kDa by sodium dodecyl sulfate gel analysis, a temperature optimum of 95 degrees C, and a pH optimum of 8.0. The corresponding gene, aspC, was cloned and overexpressed in Escherichia coli. The recombinant glutamate:oxalacetate transaminase protein was used in immobilized fo...

Bartsch, K.; Schneider, R.; Schulz, A.

1996-01-01

264

Evidence that an N-terminal S-layer protein fragment triggers the release of a cell-associated high-molecular-weight amylase in Bacillus stearothermophilus ATCC 12980.  

OpenAIRE

During growth on starch medium, the S-layer-carrying Bacillus stearothermophilus ATCC 12980 and an S-layer-deficient variant each secreted three amylases, with identical molecular weights of 58,000, 122,000, and 184,000, into the culture fluid. Only the high-molecular-weight amylase (hmwA) was also identified as cell associated. Extraction and reassociation experiments showed that the hmwA had a high-level affinity to the peptidoglycan-containing layer and to the S-layer surface, but the inte...

Egelseer, E. M.; Schocher, I.; Sleytr, U. B.; Sa?ra, M.

1996-01-01

265

Programmed Death in Bacteria  

OpenAIRE

Programmed cell death (PCD) in bacteria plays an important role in developmental processes, such as lysis of the mother cell during sporulation of Bacillus subtilis and lysis of vegetative cells in fruiting body formation of Myxococcus xanthus. The signal transduction pathway leading to autolysis of the mother cell includes the terminal sporulation sigma factor E?K, which induces the synthesis of autolysins CwlC and CwlH. An activator of autolysin in this and other PCD processes is yet to be...

Lewis, Kim

2000-01-01

266

Bacteria in solitary confinement.  

Science.gov (United States)

Even in clonal bacterial cultures, individual bacteria can show substantial stochastic variation, leading to pitfalls in the interpretation of data derived from millions of cells in a culture. In this issue of the Journal of Bacteriology, as part of their study on osmoadaptation in a cyanobacterium, Nanatani et al. describe employing an ingenious microfluidic device that gently cages individual cells (J Bacteriol 197:676-687, 2015, http://dx.doi.org/10.1128/JB.02276-14). The device is a welcome addition to the toolkit available to probe the responses of individual cells to environmental cues. PMID:25488297

Mullineaux, Conrad W

2015-02-15

267

Ecophysiology of the anammox bacteria  

OpenAIRE

Anaerobic ammonium oxidizing (anammox) bacteria oxidize ammonium to dinitrogen gas with nitrite as the electron acceptor. These bacteria are the key players in the global nitrogen cycle, responsible for the most of nitrogen production in natural ecosystems. The anammox process is also a cost-effective and environment-friendly alternative to conventional ammonium removal from wastewater streams. Still, little is known about the metabolism and niche differentiation of anammox bacteria. The inte...

Kartal, Mustafa Boran

2008-01-01

268

Bioinspired magneto-optical bacteria.  

Science.gov (United States)

"Two-in-one" magneto-optical bacteria have been produced using the probiotic Lactobacillus fermentum for the first time. We took advantage of two features of bacteria to synthesize this novel and bifunctional nanostructure: their metal-reducing properties, to produce gold nanoparticles, and their capacity to incorporate iron oxide nanoparticles at their external surface. The magneto-optical bacteria survive the process and behave as a magnet at room temperature. PMID:25068183

Carmona, Fernando; Martín, Miguel; Gálvez, Natividad; Dominguez-Vera, Jose M

2014-08-18

269

Characterization of recombinant amylopullulanase (gt-apu) and truncated amylopullulanase (gt-apuT) of the extreme thermophile Geobacillus thermoleovorans NP33 and their action in starch saccharification.  

Science.gov (United States)

A gene encoding amylopullulanase (gt-apu) of the extremely thermophilic Geobacillus thermoleovorans NP33 was cloned and expressed in Escherichia coli. The gene has an open reading frame of 4,965 bp that encodes a protein of 1,655 amino acids with molecular mass of 182 kDa. The six conserved regions, characteristic of GH13 family, have been detected in gt-apu. The recombinant enzyme has only one active site for ?-amylase and pullulanase activities based on the enzyme kinetic analyses in a system that contains starch as well as pullulan as competing substrates and response to inhibitors. The end-product analysis confirmed that this is an endoacting enzyme. The specific enzyme activities for ?-amylase and pullulanase of the truncated amylopullulanase (gt-apuT) are higher than gt-apu. Both enzymes exhibited similar temperature (60 °C) and pH (7.0) optima, although gt-apuT possessed a higher thermostability than gt-apu. The overall catalytic efficiency (K(cat)/K(m)) of gt-apuT is greater than that of gt-apu, with almost similar substrate specificities. The C-terminal region of gt-apu appeared to be non-essential, and furthermore, it negatively affects the substrate binding and stability of the enzyme. PMID:23132347

Nisha, M; Satyanarayana, T

2013-07-01

270

Improving production of hyperthermostable and high maltose-forming alpha-amylase by an extreme thermophile Geobacillus thermoleovorans using response surface methodology and its applications.  

Science.gov (United States)

By cultivating Geobacillus thermoleovorans in shake flasks containing cane molasses medium at 70 degrees C, the fermentation variables were optimized by 'one variable at a time' approach followed by response surface methodology (RSM). The statistical model was obtained by central composite design (CCD) using three variables (cane-molasses, urea and inoculum density). An overall 1.6- and 2.1-fold increase in enzyme production was achieved in the optimized medium in shake flasks and fermenter, respectively. The alpha-amylase titre increased significantly in cane-molasses medium (60 U ml(-1)) as compared to that in the synthetic medium (26 U ml(-1)). Thus the cost of enzyme produced in cane molasses medium (0.823 euros per million U) was much lower than that produced in the synthetic starch-yeast extract-tryptone medium (18.52 euros per million U). The shelf life of bread was improved by supplementing dough with alpha-amylase, and thus, the enzyme was found to be useful in preventing the staling of bread. Reducing sugars liberated from 20% and 30% raw pearl millet starch were fermented to ethanol; ethanol production levels attained were 35.40 and 28.0 g l(-1), respectively. PMID:16473003

Uma Maheswar Rao, J L; Satyanarayana, T

2007-01-01

271

Thermostable and alkalistable endoxylanase of the extremely thermophilic bacterium Geobacillus thermodenitrificans TSAA1: cloning, expression, characteristics and its applicability in generating xylooligosaccharides and fermentable sugars.  

Science.gov (United States)

Xylanase encoding gene (1,224 bp) from Geobacillus thermodenitrificans was cloned in pET28a (+) vector and successfully expressed in Escherichia coli BL21 (DE3). The deduced amino acid sequence analysis revealed homology with that of glycosyl hydrolase (GH) 10 family with a high molecular mass (50 kDa). The purified recombinant xylanase is optimally active at pH 9.0 and 70 °C with T(1/2) of 10 min at 80 °C, and retains greater than 85 % activity after exposure to 70 °C for 180 min. The enzyme liberates xylose as well as xylooligosaccharides from birchwood xylan and agro-residues, and therefore, this is an endoxylanase. The xylan hydrolytic products (xylooligosaccharides, xylose, and xylobiose) find application as prebiotics and in the production of bioethanol. The xylanase being thermostable and alkalistable, it has released chromophores and phenolics from the residual lignin of pulps, suggesting its utility in mitigating chlorine requirement in pulp bleaching. PMID:23479291

Verma, Digvijay; Anand, Ashima; Satyanarayana, T

2013-05-01

272

Characteristics of thermostable endoxylanase and ?-xylosidase of the extremely thermophilic bacterium Geobacillus thermodenitrificans TSAA1 and its applicability in generating xylooligosaccharides and xylose from agro-residues.  

Science.gov (United States)

An extremely thermophilic bacterial isolate that produces a high titer of thermostable endoxylanase and ?-xylosidase extracellularly in an inducible manner was identified as Geobacillus thermodenitrificans TSAA1. The distinctive features of this strain are alkalitolerance and halotolerance. The endoxylanase is active over a broad range of pH (5.0-10.0) and temperatures (30-100 °C) with optima at pH 7.5 and 70 °C, while ?-xylosidase is optimally active at pH 7.0 and 60 °C. The T 1/2 values of the endoxylanase and ?-xylosidase are 30 min at 80 °C, and 180 min at 70 °C, respectively. The endoxylanase activity is stimulated by dithiothreitol, but inhibited strongly by EDAC and Woodward's reagent K. N-BS and DEPC strongly inhibited ?-xylosidase. MALDI-ToF (MS/MS) analysis of tryptic digest of ?-xylosidase revealed similarity with that of G. thermodenitrificans NG 80-2, and suggested that this belongs to the GH 52 glycosyl hydrolase super family. The action of endoxylanase on birch wood xylan and agro-residues such as wheat bran and wheat straw liberated xylooligosaccharides similar to endoxylanases of the family 10 glycoside hydrolases, while the enzyme preparation having both endoxylanase and ?-xylosidase liberated xylose as main hydrolysis product. PMID:23504033

Anand, Ashima; Kumar, Vikash; Satyanarayana, T

2013-05-01

273

Geobacillus thermoleovorans immobilized on Amberlite XAD-4 resin as a biosorbent for solid phase extraction of uranium (VI) prior to its spectrophotometric determination  

International Nuclear Information System (INIS)

Geobacillus thermoleovorans subsp stromboliensis, was immobilized on an Amberlite XAD-4 ion exchanger and used as a solid phase extractant for the preconcentration of U(VI) ions prior to their determination by UV-VIS spectrophotometry. Parameters affecting the preconcentration (such as the pH value of the sample solution, the concentration of U(VI), the volume and type of eluent, the flow rate and the effect of potentially interfering ions) were studied. The optimum pH for the sorption of U(VI) was found to be pH 5.0. 5.0 mL of 1 M hydrochloric acid were used to eluate the U(VI) from the column. The loading capacity is 11 mg g-1. The limits of detection and quantification are 2.7 and 9.0 ?g L-1, respectively, and relative standard deviations are <10 %. The method was applied to the determination of U(VI) in a certified reference sample (NCS ZC-73014; tea leaves) and in natural water samples. (author)

274

A novel ?-xylosidase structure from Geobacillus thermoglucosidasius: the first crystal structure of a glycoside hydrolase family GH52 enzyme reveals unpredicted similarity to other glycoside hydrolase folds.  

Science.gov (United States)

Geobacillus thermoglucosidasius is a thermophilic bacterium that is able to ferment both C6 and C5 sugars to produce ethanol. During growth on hemicellulose biomass, an intracellular ?-xylosidase catalyses the hydrolysis of xylo-oligosaccharides to the monosaccharide xylose, which can then enter the pathways of central metabolism. The gene encoding a G. thermoglucosidasius ?-xylosidase belonging to CAZy glycoside hydrolase family GH52 has been cloned and expressed in Escherichia coli. The recombinant enzyme has been characterized and a high-resolution (1.7 Å) crystal structure has been determined, resulting in the first reported structure of a GH52 family member. A lower resolution (2.6 Å) structure of the enzyme-substrate complex shows the positioning of the xylobiose substrate to be consistent with the proposed retaining mechanism of the family; additionally, the deep cleft of the active-site pocket, plus the proximity of the neighbouring subunit, afford an explanation for the lack of catalytic activity towards the polymer xylan. Whilst the fold of the G. thermoglucosidasius ?-xylosidase is completely different from xylosidases in other CAZy families, the enzyme surprisingly shares structural similarities with other glycoside hydrolases, despite having no more than 13% sequence identity. PMID:24816105

Espina, Giannina; Eley, Kirstin; Pompidor, Guillaume; Schneider, Thomas R; Crennell, Susan J; Danson, Michael J

2014-05-01

275

Extracellular communication in bacteria  

DEFF Research Database (Denmark)

Populations of bacterial cells often coordinate their responses to changes in their local environmental conditions through "quorum sensing", a cell-to-cell communication system employing small diffusible signal molecules. While there is considerable diversity in the chemistry of such signal molecules, in different Gram-positive and Gram-negative bacteria they control pathogenicity, secondary metabolite production, biofilm differentiation, DNA transfer and bioluminescence. The development of biosensors for the detection of these signal molecules has greatly facilitated their subsequent chemical analysis which in turn has resulted in significant progress in understanding the molecular basis of quorum sensing-dependent gene expression. Consequently, the discovery and characterisation of natural molecules which antagonize quorum sensing-mediated responses has created new opportunities for the design of novel anti-infective agents which control infection through the attenuation of bacterial virulence.

Chhabra, S.R.; Philipp, B.

2005-01-01

276

The immobilization of enzymes and cells of Bacillus stearothermophilus onto poly(maleic anhydride/styrene)-Co-polyethylene and poly(maleic anhydride/vinyl acetate)-Co-polyethylene.  

Science.gov (United States)

The graft copolymer, poly(maleic anhydride/styrene)-co-polyethylene was prepared. The copolymer immobilized bovine serum albumin (BSA), but the amount coupled appeared to be effected by the amount of styrene in the graft copolymer, temperature, and pH of the coupling medium. Competition existed between hydrolysis of the grafted anhydride groups and the protein. A graft copolymer with 66% add-on immobilized 4.5 mg/glucose oxidase/g copolymer, 4.6 mg alkaline phosphates/g copolymer and 0.2 mg cell of Bacillus stearothermophilus/g copolymer. A number of copolymers containing poly(maleic anhydride/vinyl acetate)-co-polyethylene were prepared to cover a range of grafting levels. These immobilized larger quantities of BSA, alkaline phosphatase, and cells of B. stearothermophilus than did the styrene graft copolymer. The copolymer was also hydrolyzed to release the hydroxyl group from the poly(vinyl acetate) component of the grafted chains. Using p-benzoquinone as the "activating agent," the copolymer coupled to BSA and to acid phosphatase. Using p-toluene-sulfonyl chloride, the copolymer was very effective in immobilizing trypsin. PMID:18553712

Beddows, C G; Gil, H G; Guthrie, J T

1985-05-01

277

Comparative study on disinfection potency of spore forming bacteria by electron-beam irradiation and gamma-ray irradiation  

International Nuclear Information System (INIS)

Along with gamma-ray irradiation, electron-beam irradiation (EB) is a method to disinfect microorganisms which cause food decomposition and food-poisoning. The present study was undertaken to compare sterilization efficacy of EB and gamma-ray irradiation on bacterial spores and vegetative cells under various conditions. Spores of Bacillus pumilus, a marker strain for irradiation study, and Bacillus stearothermophilus known as a thermophilic bacteria were irradiated by electron-beam and gamma-ray separately at irradiation dose of 0 to 10 kGy on combination of wet/dry and aerobic/anaerobic conditions. Sterilization effect of irradiation on spores was evaluated by colony counting on agar plates. Results showed that both EB and gamma-ray irradiation gave sufficient sterilization effect on spores, and the sterilization effect increased exponentially with irradiation dose. The sterilization effect of gamma-ray irradiation was higher than that of EB in all cases. Higher disinfection effect was observed under aerobic condition. The present study suggests that oxygen supply in EB is more important than gamma-ray irradiation. No results suggesting that chlorine ion at 0.1 ppm (as available chlorine concentration) enhanced the sterilization efficacy of either EB or gamma-ray irradiation was obtained under any conditions examined. (author)

278

Bacteria Growth Inquiry: Bodily Bacteria and Healthy Hygiene Habits  

Science.gov (United States)

In this inquiry activity, students generate investigable questions to explore the link between hygiene/cleanliness and bacteria growth/population. The students will present their conclusions, and video clips containing additional information will be discussed.

279

Sampling bacteria with a laser  

Science.gov (United States)

Water quality is a topic of high interest and it's getting more and more important due to climate change and the implementation of European Water Framework Directive (WFD). One point of interest here is the inflow of bacteria into a river caused by combined sewer overflows which lead untreated wastewater including bacteria directly into a river. These bacteria remain in the river for a certain time, they settle down and can be remobilised again. In our study we want to investigate these processes of sedimentation and resuspension and use the results for the development of a software module coupled with the software Flow3D. Thereby we should be able to simulate and therefore predict the water quality influenced by combined sewer overflows. Hence we need to get information about the bacteria transport and fate. We need to know about the size of the bacteria or of the bacteria clumps and the size of the particles the bacteria are attached to. The agglomerates lead to different characteristics and velocities of settlement. The timespan during this bacteria can be detected in the bulk phase depends on many factors like the intensity of UV light, turbidity of the water, the temperature of the water, if there are grazers and a lot more. The size, density and composition of the agglomerates is just a part of all these influencing factors, but it is extremely difficult to differ between the other effects if we have no information about the simple sedimentation in default of these basic information. However we have a big problem getting the data. The chaining between bacteria or bacteria and particles is not too strong, so filtering the water to get a sieving curve may destroy these connections. We did some experiments similar to PIV (particle image velocimetry) measurements and evaluated the pictures with a macro written for the software ImageJ. Doing so we were able to get the concentration of bacteria in the water and collect information about the size of the bacteria. We also compared these data to samples of usual collection and filtering. The results of these laser measurements are very promising.

Schwarzwälder, Kordula; Rutschmann, Peter

2014-05-01

280

Purification studies on a thermo-active amidase of Geobacillus pallidus BTP-5x MTCC 9225 isolated from thermal springs of Tatapani (Himachal Pradesh).  

Science.gov (United States)

An intracellular aliphatic amide degrading inducible thermo-active amidase produced by Geobacillus pallidus BTP-5x MTCC 9225 was purified to apparent homogeneity using anion exchange and gel filtration chromatography, giving a yield of 6.7 % and a specific activity of 30.49 units mg(-1). The purified protein migrated as a single band of estimated molecular mass of 158 kDa (homo-tetramer) in 8 % polyacrylamide gel electrophoresis and ?38.5 kDa in 12 % sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). Optima of pH and temperature varied widely in broad pH range (pH 6-9) and temperature range (45-70 °C). The purified amidase was stable up to 6 h at 50 °C, with a t (1/2) of 7 h at 55 °C. The multimeric nature of the holozyme (tetramer) contributed to protection of the enzyme against thermal denaturation. The enzyme showed resistance to metal chelating agents (EDTA, 8-hydroxyquinoline, and sodium azide), explaining its non-metallic nature, and is strongly inhibited by thiol reagents that means cysteine is involved in catalysis. The amidase of G. pallidus BTP-5x preferentially hydrolyzed only small aliphatic amides and has a narrow substrate spectrum. The K (M) value for acrylamide is 10.54 mM, V (max) 45.19 ?mol(-1)?min(-1)?mg(-1) protein, and k (cat) 4.29 min(-1). The sequence of amino acids of the purified enzyme MRHGDISSSHDTVGI appears similar to thermophilic amidases. Sequence analysis of the amidase gene showed that the enzyme is 347 amino-acid-long with a molecular weight of 38.4 kDa (as observed in SDS-PAGE), theoretical pI 5.38, and show strong similarity to thermostable amidases, possessing unique restriction sites. PMID:23096998

Sharma, Monica; Sharma, Nitya Nand; Bhalla, Tek Chand

2013-01-01

281

Characterization of a F280N variant of L-arabinose isomerase from Geobacillus thermodenitrificans identified as a D-galactose isomerase.  

Science.gov (United States)

The double-site variant (C450S-N475K) L-arabinose isomerase (L-AI) from Geobacillus thermodenitrificans catalyzes the isomerization of D-galactose to D-tagatose, a functional sweetener. Using a substrate-docking homology model, the residues near to D-galactose O6 were identified as Met186, Phe280, and Ile371. Several variants obtained by site-directed mutagenesis of these three residues were analyzed, and a triple-site (F280N) variant enzyme exhibited the highest activity for D-galactose isomerization. The k cat/K m of the triple-site variant enzyme for D-galactose was 2.1-fold higher than for L-arabinose, whereas the k cat/K m of the double-site variant enzyme for L-arabinose was 43.9-fold higher than for D-galactose. These results suggest that the triple-site variant enzyme is a D-galactose isomerase. The conversion rate of D-galactose to D-tagatose by the triple-site variant enzyme was approximately 3-fold higher than that of the double-site variant enzyme for 30 min. However, the conversion yields of L-arabinose to L-ribulose by the triple-site and double-site variant enzymes were 10.6 and 16.0 % after 20 min, respectively. The triple-site variant enzyme exhibited increased specific activity, turnover number, catalytic efficiency, and conversion rate for D-galactose isomerization compared to the double-site variant enzyme. Therefore, the amino acid at position 280 determines the substrate specificity for D-galactose and L-arabinose, and the triple-site variant enzyme has the potential to produce D-tagatose on an industrial scale. PMID:24880627

Kim, Baek-Joong; Hong, Seung-Hye; Shin, Kyung-Chul; Jo, Ye-Seul; Oh, Deok-Kun

2014-11-01

282

Improvement of Thermal Stability via Outer-Loop Ion Pair Interaction of Mutated T1 Lipase from Geobacillus zalihae Strain T1  

Directory of Open Access Journals (Sweden)

Full Text Available Mutant D311E and K344R were constructed using site-directed mutagenesis to introduce an additional ion pair at the inter-loop and the intra-loop, respectively, to determine the effect of ion pairs on the stability of T1 lipase isolated from Geobacillus zalihae. A series of purification steps was applied, and the pure lipases of T1, D311E and K344R were obtained. The wild-type and mutant lipases were analyzed using circular dichroism. The Tm for T1 lipase, D311E lipase and K344R lipase were approximately 68.52 °C, 70.59 °C and 68.54 °C, respectively. Mutation at D311 increases the stability of T1 lipase and exhibited higher Tm as compared to the wild-type and K344R. Based on the above, D311E lipase was chosen for further study. D311E lipase was successfully crystallized using the sitting drop vapor diffusion method. The crystal was diffracted at 2.1 Å using an in-house X-ray beam and belonged to the monoclinic space group C2 with the unit cell parameters a = 117.32 Å, b = 81.16 Å and c = 100.14 Å. Structural analysis showed the existence of an additional ion pair around E311 in the structure of D311E. The additional ion pair in D311E may regulate the stability of this mutant lipase at high temperatures as predicted in silico and spectroscopically.

Mahiran Basri

2012-01-01

283

Dissipative Shocks behind Bacteria Gliding  

OpenAIRE

Gliding is a means of locomotion on rigid substrates utilized by a number of bacteria includingmyxobacteria and cyanobacteria. One of the hypotheses advanced to explain this motility mechanism hinges on the role played by the slime filaments continuously extruded from gliding bacteria. This paper solves in full a non-linear mechanical theory that treats as dissipative shocks both the point where the extruded slime filament comes in contact with the substrate, called the fila...

Virga, Epifanio G.

2014-01-01

284

Chromosome dynamics in multichromosome bacteria  

OpenAIRE

On the basis of limited information, bacteria were once assumed to have no more than one chromosome. In the era of genomics, it has become clear that some, like eukaryotes, have more than one chromosome. Multichromosome bacteria provide opportunities to investigate how split genomes emerged, whether the individual chromosomes communicate to coordinate their replication and segregation, and what selective advantages split genomes might provide. Our current knowledge of these topics comes mostl...

Jha, Jyoti K.; Baek, Jonghwan; Venkova-canova, Tatiana; Chattoraj, Dhruba K.

2012-01-01

285

Thymidine kinase diversity in bacteria  

DEFF Research Database (Denmark)

Thymidine kinases (TKs) appear to be almost ubiquitous and are found in nearly all prokaryotes, eukaryotes, and several viruses. They are the key enzymes in thymidine salvage and activation of several anti-cancer and antiviral drugs. We show that bacterial TKs can be subdivided into 2 groups. The TKs from Gram-positive bacteria are more closely related to the eukaryotic TK1 enzymes than are TKs from Gram-negative bacteria.

Sandrini, Michael; Clausen, A.R.

2006-01-01

286

Bacteria Galore by Sunday at Four  

Science.gov (United States)

This colorful picture book provides an introduction to the world of bacteria â where bacteria are found, what it is and how they spread. While the book is beautiful to look at, this childrenâs picture book is also full of accurate and interesting facts about bacteria. Author Dr. Mel Rosenberg emphasizes the colors, shapes, sizes, forms, and functions of bacteria.

Rosenberg, Mel; Niv-Dolinski, Tali

287

IDENTIFICATION OF BACTERIA IN LATEX PAINTS  

Directory of Open Access Journals (Sweden)

Full Text Available The bacteria are prokaryote organisms with a high capacity to colonize many types of habits. This research was developed with the object to identify extremophiles bacteria presents in latex paint. The bacteria were cultivated in culture mediums TSA, Blood Agar, Mc Conkey and finally the biochemical proof API-NF® for bacteria's isolation and identification, respectively. Characterization showed bacterial profile of Pasteurella sp. Hypothesis that could be found extremophiles bacteria in latex paint were demonstrated.

Rojas, J.

2008-01-01

288

Commensal bacteria and cutaneous immunity.  

Science.gov (United States)

The skin is the human body's largest organ and is home to a diverse and complex variety of innate and adaptive immune functions that protect against pathogenic invasion. Recent studies have demonstrated that cutaneous commensal bacteria modulated the host immune system. For example, Staphylococcus epidermidis, a skin commensal bacterium, has been demonstrated to induce cutaneous interferon (IFN)-?- and interleukin (IL)-17A-producing T cells. In addition, cutaneous microbiota changes occur in the chronic inflammatory skin disorders, such as atopic dermatitis, and may influence the activity of skin diseases. In this article, we will review the recent findings related to the interactions of the commensal bacteria with skin homeostasis and discuss the role of the dysbiosis of these bacteria in the pathogenesis of skin diseases. PMID:25326105

Nakamizo, Satoshi; Egawa, Gyohei; Honda, Tetsuya; Nakajima, Saeko; Belkaid, Yasmine; Kabashima, Kenji

2015-01-01

289

Genetic transfer in acidophilic bacteria  

Energy Technology Data Exchange (ETDEWEB)

There is increasing interest in the use of microorganisms to recover metals from ores, as well as to remove sulfur from coal. These so-called bioleaching processes are mediated by a number of bacteria. The best-studied of these organisms are acidophiles including Thiobacillus and Acidiphilium species. Our laboratory has focused on developing genetic strategies to allow the manipulation of acidophilic bacteria to improve and augment their utility in large scale operations. We have recently been successful in employing conjugation for interbacterial transfer of genetic information, as well as in directly transforming Acidiphilium by use of electroporation. We are now testing the properties of IncPl, IncW and IncQ plasmid vectors in Acidiphilium to determine their relative usefulness in routine manipulation of acidophiles and transfer between organisms. This study also allows us to determine the natural ability of these bacteria to transfer genetic material amongst themselves in their particular environment. 21 refs., 3 figs., 2 tabs.

Roberto, F.F.; Glenn, A.W.; Bulmer, D.; Ward, T.E.

1990-01-01

290

Bacteria and the ubiquitin pathway.  

Science.gov (United States)

Ubiquitylation participates in a repertoire of reversible post-translational modifications that modulate the function, localization and half-life of proteins by regulating their association with various ubiquitin-binding proteins. In response to pathogen infection, bacterial effectors impact ubiquitin and ubiquitin-like modifications of key proteins in immune and anti-apoptotic signaling cascades. Certain bacteria corrupt the ubiquitylation machinery in order to regulate their virulence factors spatially and temporally or to trigger internalization of bacteria into host cells. Several new examples of how bacterial factors target ubiquitin and ubiquitin-like regulation emphasize the importance of modulating ubiquitin signaling to establish either long-lasting or devastating relationships of bacteria with their hosts. PMID:17157551

Munro, Patrick; Flatau, Gilles; Lemichez, Emmanuel

2007-02-01

291

Antifungal activity of rhizospheric bacteria.  

Science.gov (United States)

Fluorescent Pseudomonad spp. were isolated from the rhizosphere of potato plants (Algeria) by serial dilutions of rhizosphere soils on Kings B medium and were tested for their antifungal activity. The antifungal activity of the Pseudomonas isolated from Potatoes rhizosphere was tested against Pythium ultimum, Rhizoctonia solani and Fusarium oxysporum in dual culture with bacteria on PDA. The Petri dish was divided into tow, on one the bacteria was spread and on the opposite side fungal plugs were inoculated and incubated for one week. Fourteen bacteria were isolated; only one isolate inhibited the growth of Pythium ultimum, Rhizoctonia solani, Fusarium solani; Fusarium oxysporum f.sp. albedinis and Fusarium oxysporum f. sp. Lycopersici with inhibition zones of 39.9, 33.7, 30.8, 19.9 and 22.5 mm respectively. PMID:21534477

Mezaache, S; Guechi, A; Zerroug, M M; Strange, R N; Nicklin, J

2010-01-01

292

Tunable protein degradation in bacteria.  

Science.gov (United States)

Tunable control of protein degradation in bacteria would provide a powerful research tool. Here we use components of the Mesoplasma florum transfer-messenger RNA system to create a synthetic degradation system that provides both independent control of steady-state protein level and inducible degradation of targeted proteins in Escherichia coli. We demonstrate application of this system in synthetic circuit development and control of core bacterial processes and antibacterial targets, and we transfer the system to Lactococcus lactis to establish its broad functionality in bacteria. We create a 238-member library of tagged essential proteins in E. coli that can serve as both a research tool to study essential gene function and an applied system for antibiotic discovery. Our synthetic protein degradation system is modular, does not require disruption of host systems and can be transferred to diverse bacteria with minimal modification. PMID:25402616

Cameron, D Ewen; Collins, James J

2014-12-01

293

A modeling study by response surface methodology and artificial neural network on culture parameters optimization for thermostable lipase production from a newly isolated thermophilic Geobacillus sp. strain ARM  

Directory of Open Access Journals (Sweden)

Full Text Available Abstract Background Thermostable bacterial lipases occupy a place of prominence among biocatalysts owing to their novel, multifold applications and resistance to high temperature and other operational conditions. The capability of lipases to catalyze a variety of novel reactions in both aqueous and nonaqueous media presents a fascinating field for research, creating interest to isolate novel lipase producers and optimize lipase production. The most important stages in a biological process are modeling and optimization to improve a system and increase the efficiency of the process without increasing the cost. Results Different production media were tested for lipase production by a newly isolated thermophilic Geobacillus sp. strain ARM (DSM 21496 = NCIMB 41583. The maximum production was obtained in the presence of peptone and yeast extract as organic nitrogen sources, olive oil as carbon source and lipase production inducer, sodium and calcium as metal ions, and gum arabic as emulsifier and lipase production inducer. The best models for optimization of culture parameters were achieved by multilayer full feedforward incremental back propagation network and modified response surface model using backward elimination, where the optimum condition was: growth temperature (52.3°C, medium volume (50 ml, inoculum size (1%, agitation rate (static condition, incubation period (24 h and initial pH (5.8. The experimental lipase activity was 0.47 Uml-1 at optimum condition (4.7-fold increase, which compared well to the maximum predicted values by ANN (0.47 Uml-1 and RSM (0.476 Uml-1, whereas R2 and AAD were determined as 0.989 and 0.059% for ANN, and 0.95 and 0.078% for RSM respectively. Conclusion Lipase production is the result of a synergistic combination of effective parameters interactions. These parameters are in equilibrium and the change of one parameter can be compensated by changes of other parameters to give the same results. Though both RSM and ANN models provided good quality predictions in this study, yet the ANN showed a clear superiority over RSM for both data fitting and estimation capabilities. On the other hand, ANN has the disadvantage of requiring large amounts of training data in comparison with RSM. This problem was solved by using statistical experimental design, to reduce the number of experiments.

Basri Mahiran

2008-12-01

294

Carbon metabolism of intracellular bacteria.  

Science.gov (United States)

Bacterial metabolism has been studied intensively since the first observations of these 'animalcules' by Leeuwenhoek and their isolation in pure cultures by Pasteur. Metabolic studies have traditionally focused on a small number of model organisms, primarily the Gram negative bacillus Escherichia coli, adapted to artificial culture conditions in the laboratory. Comparatively little is known about the physiology and metabolism of wild microorganisms living in their natural habitats. For approximately 500-1000 species of commensals and symbionts, and a smaller number of pathogenic bacteria, that habitat is the human body. Emerging evidence suggests that the metabolism of bacteria grown in vivo differs profoundly from their metabolism in axenic cultures. PMID:16367862

Muñoz-Elías, Ernesto J; McKinney, John D

2006-01-01

295

Commensal ocular bacteria degrade mucins  

OpenAIRE

Background/aims: Antimicrobial activity in tears prevents infection while maintaining a commensal bacterial population. The relation between mucin and commensal bacteria was assessed to determine whether commensals possess mucinolytic activity, how degradation depends on mucin integrity, and whether mucins affect bacterial replication.

Berry, M.; Harris, A.; Lumb, R.; Powell, K.

2002-01-01

296

Arsenic-tolerant, arsenite-oxidising bacterial strains in the contaminated soils of West Bengal, India.  

Science.gov (United States)

As biological agents represent an affordable alternative to costly metal decontamination technologies, we isolated arsenic (As) oxidising bacteria from the As-contaminated soils of West Bengal, India. These strains were closely related to various species of Bacillus and Geobacillus based on their 16S rRNA gene sequences. They were found to be hyper-resistant to both As(V) (167-400 mM) and As(III) (16-47 mM). Elevated rates of As(III) oxidation (278-1250 ?M h(-1)) and arsenite oxidase activity (2.1-12.5 nM min(-1) mg(-1) protein) were observed in these isolates. Screening identified four strains as superior As-oxidisers. Among them, AMO-10 completely (100%) oxidised 30 mM of As(III) within 24 h. The presence of the aoxB gene was confirmed in the screened isolates. Phylogenetic tree construction based on the aoxB sequence revealed that two strains, AGO-S5 and AGH-02, clustered with Achromobacter and Variovorax, whereas the other two (AMO-10 and ADP-25) remained unclustered. The increased rate of As(III) oxidation by these native strains might be exploited for the remediation of As in contaminated environments. Notably, this study presents the first correlation regarding the presence of the aoxB gene and As(III) oxidation ability in Geobacillus stearothermophilus. PMID:23876545

Majumder, Aparajita; Bhattacharyya, K; Bhattacharyya, S; Kole, S C

2013-10-01

297

Sterilization of single-use helical stone baskets: an experimental study  

Directory of Open Access Journals (Sweden)

Full Text Available Objectives: To experimentally evaluate the efficacy of a standard sterilization protocol employed during reuse of disposable helical stone baskets. Methods: Study performed on 20 helical stone baskets: 10 were used in the initial validation process, contaminated with Escherichia coli ATCC 25922 and imprinted on Müeller-Hinton media; 10 catheters were contaminated with Geobacillus stearothermophilus ATCC 7953, processed, inoculated in TSB and incubated in a water bath at a temperature of 55ºC. Bacterial growth was evaluated after 1, 3, 5 and 7 days. After sterilization, stone baskets were also opened and closed 40 times to check for functional problems. All plastic and basket parts were carefully checked for damages. Results: After the 72-hour incubation period, there was growth of E. coli ATCC 25922 in 100% of imprints. After the sterilization process and up to 7 days incubation period on a blood agar plate, there was no growth of G. stearothermophilus ATCC 7953 or any other bacteria. There were no functional problems or damage to baskets after the sterilization process. Conclusion: The ethylene oxide system is efficacious and safe for sterilization of disposable helical stone baskets. However, further clinical studies are required and should provide more safety information.

Cely Barreto da Silva

2011-03-01

298

Fuzzy species among recombinogenic bacteria  

Directory of Open Access Journals (Sweden)

Full Text Available Abstract Background It is a matter of ongoing debate whether a universal species concept is possible for bacteria. Indeed, it is not clear whether closely related isolates of bacteria typically form discrete genotypic clusters that can be assigned as species. The most challenging test of whether species can be clearly delineated is provided by analysis of large populations of closely-related, highly recombinogenic, bacteria that colonise the same body site. We have used concatenated sequences of seven house-keeping loci from 770 strains of 11 named Neisseria species, and phylogenetic trees, to investigate whether genotypic clusters can be resolved among these recombinogenic bacteria and, if so, the extent to which they correspond to named species. Results Alleles at individual loci were widely distributed among the named species but this distorting effect of recombination was largely buffered by using concatenated sequences, which resolved clusters corresponding to the three species most numerous in the sample, N. meningitidis, N. lactamica and N. gonorrhoeae. A few isolates arose from the branch that separated N. meningitidis from N. lactamica leading us to describe these species as 'fuzzy'. Conclusion A multilocus approach using large samples of closely related isolates delineates species even in the highly recombinogenic human Neisseria where individual loci are inadequate for the task. This approach should be applied by taxonomists to large samples of other groups of closely-related bacteria, and especially to those where species delineation has historically been difficult, to determine whether genotypic clusters can be delineated, and to guide the definition of species.

Fraser Christophe

2005-03-01

299

New Antibiotic May Combat Resistant Bacteria  

Science.gov (United States)

... please enable JavaScript. New Antibiotic May Combat Resistant Bacteria Teixobactin shows promise in early experiments, researchers say (* ... that could prove valuable in fighting disease-causing bacteria that no longer respond to older, more frequently ...

300

Barbecue Bliss: Keeping Bacteria at Bay  

Science.gov (United States)

... Blood & Biologics Articulos en Espanol Barbecue Bliss: Keeping Bacteria at Bay Search the Consumer Updates Section Get ... your list. Summer brings out barbecue grills—and bacteria, which multiply in food faster in warm weather ...

301

Re-engineering bacteria for ethanol production  

Energy Technology Data Exchange (ETDEWEB)

The invention provides recombinant bacteria, which comprise a full complement of heterologous ethanol production genes. Expression of the full complement of heterologous ethanol production genes causes the recombinant bacteria to produce ethanol as the primary fermentation product when grown in mineral salts medium, without the addition of complex nutrients. Methods for producing the recombinant bacteria and methods for producing ethanol using the recombinant bacteria are also disclosed.

Yomano, Lorraine P; York, Sean W; Zhou, Shengde; Shanmugam, Keelnatham; Ingram, Lonnie O

2014-05-06

302

Oligotrophic bacteria isolated from clinical materials.  

OpenAIRE

Oligotrophic bacteria (oligotrophs) are microorganisms that grow in extremely nutritionally deficient conditions in which the concentrations of organic substances are low. Many oligotrophic bacteria were isolated from clinical materials including urine, sputum, swabbings of the throat, vaginal discharges, and others. Seventy-seven strains of oligotrophic bacteria from 871 samples of clinical material were isolated. A relatively higher frequency of isolation of oligotrophic bacteria was shown ...

Tada, Y.; Ihmori, M.; Yamaguchi, J.

1995-01-01

303

Antimicrobial activity and Characterization of Marine bacteria  

OpenAIRE

Marine bacteria were isolated from seawater was collected from different coastal areas of the Tamilnadu Sea. The antimicrobial activities of these bacteria were investigated. Ethyl acetate extracts of marine bacterial fermentation were screened for antimicrobial activities using the method of agar diffusion. The results showed that 25 strains of the isolates have antimicrobial activity. The proportion of active bacteria associated with isolated from seawater. The active marine bacteria were a...

Jeganathan, P.; Rajasekaran, K. M.; Asha Devi, N. K.; Karuppusamy, S.

2013-01-01

304

Laser-Based Identification of Pathogenic Bacteria  

Science.gov (United States)

Bacteria are ubiquitous in our world. From our homes, to our work environment, to our own bodies, bacteria are the omnipresent although often unobserved companions to human life. Physicists are typically untroubled professionally by the presence of these bacteria, as their study usually falls safely outside the realm of our typical domain. In the…

Rehse, Steven J.

2009-01-01

305

The Cyclic Antibacterial Peptide Enterocin AS-48: Isolation, Mode of Action, and Possible Food Applications  

Directory of Open Access Journals (Sweden)

Full Text Available Enterocin AS-48 is a circular bacteriocin produced by Enterococcus. It contains a 70 amino acid-residue chain circularized by a head-to-tail peptide bond. The conformation of enterocin AS-48 is arranged into five alpha-helices with a compact globular structure. Enterocin AS-48 has a wide inhibitory spectrum on Gram-positive bacteria. Sensitivity of Gram-negative bacteria increases in combination with outer-membrane permeabilizing treatments. Eukaryotic cells are bacteriocin-resistant. This cationic peptide inserts into bacterial membranes and causes membrane permeabilization, leading ultimately to cell death. Microarray analysis revealed sets of up-regulated and down-regulated genes in Bacillus cereus cells treated with sublethal bacteriocin concentration. Enterocin AS-48 can be purified in two steps or prepared as lyophilized powder from cultures in whey-based substrates. The potential applications of enterocin AS-48 as a food biopreservative have been corroborated against foodborne pathogens and/or toxigenic bacteria (Listeria monocytogenes, Bacillus cereus, Staphylococcus aureus, Escherichia coli, Salmonella enterica and spoilage bacteria (Alicyclobacillus acidoterrestris, Bacillus spp., Paenibacillus spp., Geobacillus stearothermophilus, Brochothrix thermosphacta, Staphylococcus carnosus, Lactobacillus sakei and other spoilage lactic acid bacteria. The efficacy of enterocin AS-48 in food systems increases greatly in combination with chemical preservatives, essential oils, phenolic compounds, and physico-chemical treatments such as sublethal heat, high-intensity pulsed-electric fields or high hydrostatic pressure.

María José Grande Burgos

2014-12-01

306

The Cyclic Antibacterial Peptide Enterocin AS-48: Isolation, Mode of Action, and Possible Food Applications.  

Science.gov (United States)

Enterocin AS-48 is a circular bacteriocin produced by Enterococcus. It contains a 70 amino acid-residue chain circularized by a head-to-tail peptide bond. The conformation of enterocin AS-48 is arranged into five alpha-helices with a compact globular structure. Enterocin AS-48 has a wide inhibitory spectrum on Gram-positive bacteria. Sensitivity of Gram-negative bacteria increases in combination with outer-membrane permeabilizing treatments. Eukaryotic cells are bacteriocin-resistant. This cationic peptide inserts into bacterial membranes and causes membrane permeabilization, leading ultimately to cell death. Microarray analysis revealed sets of up-regulated and down-regulated genes in Bacillus cereus cells treated with sublethal bacteriocin concentration. Enterocin AS-48 can be purified in two steps or prepared as lyophilized powder from cultures in whey-based substrates. The potential applications of enterocin AS-48 as a food biopreservative have been corroborated against foodborne pathogens and/or toxigenic bacteria (Listeria monocytogenes, Bacillus cereus, Staphylococcus aureus, Escherichia coli, Salmonella enterica) and spoilage bacteria (Alicyclobacillus acidoterrestris, Bacillus spp., Paenibacillus spp., Geobacillus stearothermophilus, Brochothrix thermosphacta, Staphylococcus carnosus, Lactobacillus sakei and other spoilage lactic acid bacteria). The efficacy of enterocin AS-48 in food systems increases greatly in combination with chemical preservatives, essential oils, phenolic compounds, and physico-chemical treatments such as sublethal heat, high-intensity pulsed-electric fields or high hydrostatic pressure. PMID:25493478

Grande Burgos, María José; Pulido, Rubén Pérez; Del Carmen López Aguayo, María; Gálvez, Antonio; Lucas, Rosario

2014-01-01

307

Dissipative Shocks behind Bacteria Gliding  

CERN Document Server

Gliding is a means of locomotion on rigid substrates utilized by a number of bacteria includingmyxobacteria and cyanobacteria. One of the hypotheses advanced to explain this motility mechanism hinges on the role played by the slime filaments continuously extruded from gliding bacteria. This paper solves in full a non-linear mechanical theory that treats as dissipative shocks both the point where the extruded slime filament comes in contact with the substrate, called the filament's foot, and the pore on the bacterium outer surface from where the filament is ejected. We prove that kinematic compatibility for shock propagation requires that the bacterium uniform gliding velocity (relative to the substrate) and the slime ejecting velocity (relative to the bacterium) must be equal, a coincidence that seems to have already been observed.

Virga, Epifanio G

2014-01-01

308

Dissipative shocks behind bacteria gliding.  

Science.gov (United States)

Gliding is a means of locomotion on rigid substrates used by a number of bacteria, including myxobacteria and cyanobacteria. One of the hypotheses advanced to explain this motility mechanism hinges on the role played by the slime filaments continuously extruded from gliding bacteria. This paper solves, in full, a non-linear mechanical theory that treats as dissipative shocks both the point where the extruded slime filament comes into contact with the substrate, called the filament's foot, and the pore on the bacterium outer surface from where the filament is ejected. I prove that kinematic compatibility for shock propagation requires that the bacterium uniform gliding velocity (relative to the substrate) and the slime ejecting velocity (relative to the bacterium) must be equal, a coincidence that seems to have already been observed. PMID:25332385

Virga, Epifanio G

2014-11-28

309

Folate Production by Probiotic Bacteria  

OpenAIRE

Probiotic bacteria, mostly belonging to the genera Lactobacillus and Bifidobacterium, confer a number of health benefits to the host, including vitamin production. With the aim to produce folate-enriched fermented products and/or develop probiotic supplements that accomplish folate biosynthesis in vivo within the colon, bifidobacteria and lactobacilli have been extensively studied for their capability to produce this vitamin. On the basis of physiological studies and genome analysis, wild-typ...

Stefano Raimondi; Alberto Amaretti; Maddalena Rossi

2011-01-01

310

Compartmentalization of bacteria in microcapsules.  

Science.gov (United States)

Lactobacillus plantarum strain 423 was encapsulated in hollow poly(organosiloxane) microcapsules by templating water-in-oil Pickering emulsion droplets via the interfacial reaction of alkylchlorosilanes. The bacteria were suspended in growth medium or buffer to protect the cells against pH changes during the interfacial reactions with alkylchlorosilanes. The results of this work open up novel avenues for the encapsulation of microbial cells. PMID:25351443

van Wijk, Judith; Heunis, Tiaan; Harmzen, Elrika; Dicks, Leon M T; Meuldijk, Jan; Klumperman, Bert

2014-12-18

311

Virulence properties of cariogenic bacteria  

OpenAIRE

Abstract The importance of Streptococcus mutans in the etiology of dental caries has been well documented. However, there is growing recognition that the cariogenic potential of dental plaque may be determined by the composite interactions of the total plaque bacteria rather than solely the virulence properties of a single organism. This study will examine how the interactions of S. mutans with other biofilm constituents may influence the cariogenicity of plaque sa...

Wang Bing-Yan; Kuramitsu Howard K

2006-01-01

312

Engineering robust lactic acid bacteria  

OpenAIRE

For centuries, lactic acid bacteria (LAB) have been industrially exploited as starter cultures in the fermentation of foods and feeds for their spoilage-preventing and flavor-enhancing characteristics. More recently, the health-promoting effects of LAB on the consumer have been widely acknowledged, which has led to the introduction of many products containing these probiotic strains. Within this rapidly growing market for the food industry, there is increasing interest in unraveling the molec...

Bron, P. A.; Bokhorst-van Veen, H.; Wels, M.; Kleerebezem, M.

2011-01-01

313

Anaerobic bacteria from hypersaline environments.  

Science.gov (United States)

Strictly anaerobic halophiles, namely fermentative, sulfate-reducing, homoacetogenic, phototrophic, and methanogenic bacteria are involved in the oxidation of organic carbon in hypersaline environments. To date, six anaerobic fermentative genera, containing nine species, have been described. Two of them are homoacetogens. Six species belong to the family Haloanaerobiaceae, as indicated by their unique 16S rRNA oligonucleotide sequences. Desulfohalobium retbaense and Desulfovibrio halophilus represent the only two moderately halophilic sulfate reducers so far reported. Among anoxygenic phototrophic anaerobes, a few purple bacteria with optimal growth at salinities between 6 and 11% NaCl have been isolated from hypersaline habitats. They belong to the genera Rhodospirillum, Chromatium, Thiocapsa, and Ectothiorhodospira. The commonest organisms isolated so far are Chromatium salexigens, Thiocapsa halophila, and Rhodospirillum salinarum. Extremely halophilic purple bacteria have most commonly been isolated from alkaline brines and require about 20 to 25% NaCl for optimal growth. They belong to the family Ectothiorodhospiraceae. Their osmoregulation involves synthesis or uptake of compatible solutes such as glycine-betaine that accumulate in their cytoplasm. The existence of methanogens in hypersaline environments is related to the presence of noncompetitive substrates such as methylamines, which originate mainly from the breakdown of osmoregulatory amines. Methanogenesis probably does not contribute to the mineralization of carbohydrates at NaCl concentrations higher than 15%. Above this concentration, sulfate reduction is probably the main way to oxidize H2 (although at rates too low to use up all the H2 formed) and occupies a terminal function kn the degradation of carbohydrates. Three genera and five species of halophilic methylotrophic methanogens have been reported. A bloom of phototrophic bacteria in the marine salterns of Salins-de-Giraud, located on the Mediterranean French coast in the Rhone Delta, is also described. PMID:8177169

Ollivier, B; Caumette, P; Garcia, J L; Mah, R A

1994-03-01

314

Bacteria Allocation Using Monte Carlo  

Science.gov (United States)

This applet, created by David Hill and Lila Roberts, uses the Monte Carlo technique to simulate a count of bacteria that are present as a result of a certain sampling process. This simulation could be modified to perform other experiments. This experiment is geared towards high school calculus students or probability courses for mathematics majors in college. Students must possess a basic understanding of probability concepts before performing this experiment. Overall, it is a nice activity for a mathematics classroom.

Hill, David R.

315

Nitrifying Bacteria in Wastewater Reservoirs  

OpenAIRE

Deep wastewater reservoirs are used throughout Israel to store domestic wastewater effluents for summer irrigation. These effluents contain high concentrations of ammonia (?5 mM) that are frequently toxic to photosynthetic microorganisms and that lead to development of anoxic conditions. Population dynamics of nitrifying bacteria and rates of nitrification were studied in two wastewater reservoirs that differed in organic load and degree of oxygenation and in the laboratory under controlled...

Abeliovich, Aharon

1987-01-01

316

Lima Bean Bacteria DNA Extraction  

Science.gov (United States)

This laboratory exercise is designed to show learners how DNA can easily be extracted from lima bean bacteria. This experiment requires the use of a centrifuge (not included in cost of materials). Use this experiment to supplement any unit on genetics and to demonstrate how scientists study DNA. Adult supervision is recommended. This resource guide includes tips and suggestions for instructors as well as other DNA extraction experiments and a chart for learners to answer questions.

Lana Hays

2009-01-01

317

F-LE Bacteria Populations  

Science.gov (United States)

This is a task from the Illustrative Mathematics website that is one part of a complete illustration of the standard to which it is aligned. Each task has at least one solution and some commentary that addresses important asects of the task and its potential use. Here are the first few lines of the commentary for this task: A hospital is conducting a study to see how different environmental conditions influence the growth of streptococcus pneumonia, one of the bacteria whi...

318

R-body-producing bacteria.  

OpenAIRE

Until 10 years ago, R bodies were known only as diagnostic features by which endosymbionts of paramecia were identified as kappa particles. They were thought to be limited to the cytoplasm of two species in the Paramecium aurelia species complex. Now, R bodies have been found in free-living bacteria and other Paramecium species. The organisms now known to form R bodies include the cytoplasmic kappa endosymbionts of P. biaurelia and P. tetraurelia, the macronuclear kappa endosymbionts of P. ca...

Pond, F. R.; Gibson, I.; Lalucat, J.; Quackenbush, R. L.

1989-01-01

319

Antibiotic resistance in probiotic bacteria  

OpenAIRE

Probiotics are live microorganisms which when administered in adequate amounts confer a health benefit on the host. The main probiotic bacteria are strains belonging to the genera Lactobacillus and Bifidobacterium, although other representatives, such as Bacillus or Escherichia coli strains, have also been used. Lactobacillus and Bifidobacterium are two common inhabitants of the human intestinal microbiota. Also, some species are used in food fermentation processes as starters, or as adjunct ...

AbelardoMargolles

2013-01-01

320

Crystallization and preliminary X-ray diffraction studies of two thermostable ?-galactosidases from glycoside hydrolase family 36  

OpenAIRE

The ?-galactosidases AgaA, AgaB and AgaA A355E mutant from Geobacillus stearothermophilus have been overexpressed in Escherichia coli. Crystals of AgaB and AgaA A355E have been obtained by the vapour-diffusion method and synchrotron data have been collected to 2.0 and 2.8?Å resolution, respectively.

Foucault, M.; Watzlawick, H.; Mattes, R.; Haser, R.; Gouet, P.

2006-01-01

321

A thermostable transketolase evolved for aliphatic aldehyde acceptors.  

Science.gov (United States)

Directed evolution of the thermostable transketolase from Geobacillus stearothermophilus based on a pH-based colorimetric screening of smart libraries yielded several mutants with up to 16-fold higher activity for aliphatic aldehydes and high enantioselectivity (>95% ee) in the asymmetric carboligation step. PMID:25415647

Yi, Dong; Saravanan, Thangavelu; Devamani, Titu; Charmantray, Franck; Hecquet, Laurence; Fessner, Wolf-Dieter

2015-01-11

322

Potential role of bacteria packaging by protozoa in the persistence and transmission of pathogenic bacteria  

OpenAIRE

Many pathogenic bacteria live in close association with protozoa. These unicellular eukaryotic microorganisms are ubiquitous in various environments. A number of protozoa such as amoebae and ciliates ingest pathogenic bacteria, package them usually in membrane structures, and then release them into the environment. Packaged bacteria are more resistant to various stresses and are more apt to survive than free bacteria. New evidence indicates that protozoa and not bacteria control the packaging...

SteveJCharette

2014-01-01

323

Dispersal dynamics of groundwater bacteria.  

Science.gov (United States)

Dispersal of bacteria in saturated, porous soils can be characterized by the partitioning of cells between the aqueous and solid phases, as a result of the physical and chemical nature of the soil and water and cell surface modifications. The purpose of this work is to understand variations in partitioning as a consequence of the nutrient conditions and to use this information in mathematical models to predict the dispersal rate of bacteria in aquifer material. Two different models were used to describe dispersal: an advective-dispersive-sorptive model with a first order kinetic sink term to account for irreversible cell reactions, such as death and sorption; and a two-site reaction model, in which the retardation was assumed to be determined by two types of sites, one characterized by instantaneous equilibrium sorption reactions and the other by kinetic nonequilibrium reactions. Water-saturated sand columns were used as continuous-flow groundwater microcosms to test the models under different nutrient regimes. Two strains of indigenous groundwater bacteria were isolated from aquifer material and labelled with(3)H-alanine,(14)C-pyruvic acid,(3)H-glucose, and(3)H-adenosine for different measurements of sorption and dispersal, which were estimated from breakthrough curves. Both experimental data and model variables showed that dispersal of bacteria was a dynamic nonequilibrium process, possibly shaped by two subpopulations, one strongly, even irreversibly, adsorbing to the solid particles, and one with very slow adsorption kinetics. The cell surfaces were modified in response to the growth conditions, which was demonstrated by hydrophobic and electrostatic interaction chromatography. Cell surface hydrophobicity was about eight times higher in groundwater than in eutrophic lake water. The partition coefficient varied between 12.6 in the groundwater and 6.4 in the lake water, indicating the prime importance of hydrophobic binding for attachment in low nutrient conditions. The partitioning was also sensitive to the hydrodynamics of the system and the oxygen supply, as demonstrated by comparison of sorption in agitated test tubes, gently shaken vials, and air-flushed bottles. Sorption kinetics were demonstrated in a continuous flow cell. About 45% of a population was associated with sand particles with a continuous flow of pure groundwater and as little as 20% in lake water. However, more than 50% of the bacteria in the aqueous phase were associated with suspended material of less than 60 ?m in diameter. This association may enhance dispersal for example, by size exclusion of the colloidal material in the interstitial pores. PMID:24194201

Lindqvist, R; Bengtsson, G

1991-12-01

324

[Isolation and characterization of marine oligotrophic bacteria].  

Science.gov (United States)

A significant part of the world ocean is characterized by low absolute nutrients and chlorophyll concentrations. In these oligotrophic environments, bacteria are very abundant and play a vital role in the remineralization of the dissolved organic matter. Bacteria adapted to oligotrophic waters differ from those adapted to richer environments by some genetic and metabolic characteristics. Culture techniques in bacteriology are based on rich media and do not allow the growth of most marine bacteria. New techniques have been developed for the culture of oligotrophic bacteria, which allow to isolate unknown bacteria. Pelagibacter ubique and Sphingopyxis alaskensis belong to these bacteria recently isolated from the marine environment and their study yielded better understanding of how marine bacteria adapt to oligotrophic conditions. PMID:17762823

Matallana-Surget, Sabine; Joux, Fabien; Lebaron, Philippe; Cavicchioli, Ricardo

2007-01-01

325

Chromosome dynamics in multichromosome bacteria.  

Science.gov (United States)

On the basis of limited information, bacteria were once assumed to have no more than one chromosome. In the era of genomics, it has become clear that some, like eukaryotes, have more than one chromosome. Multichromosome bacteria provide opportunities to investigate how split genomes emerged, whether the individual chromosomes communicate to coordinate their replication and segregation, and what selective advantages split genomes might provide. Our current knowledge of these topics comes mostly from studies in Vibrio cholerae, which has two chromosomes, chr1 and chr2. Chr1 carries out most of the house-keeping functions and is considered the main chromosome, whereas chr2 appears to have originated from a plasmid and has acquired genes of mostly unknown origin and function. Nevertheless, unlike plasmids, chr2 replicates once and only once per cell cycle, like a bona fide chromosome. The two chromosomes replicate and segregate using separate programs, unlike eukaryotic chromosomes. They terminate replication synchronously, suggesting that there might be communication between them. Replication of the chromosomes is affected by segregation genes but in a chromosome specific fashion, a new development in the field of DNA replication control. The split genome allows genome duplication to complete in less time and with fewer replication forks, which could be beneficial for genome maintenance during rapid growth, which is the norm for V. cholerae in broth cultures and in the human host. In the latter, the expression of chr2 genes increases preferentially. Studies of chromosome maintenance in multichromosomal bacteria, although in their infancy, are already broadening our view of chromosome biology. This article is part of a Special Issue entitled: Chromatin in time and space. PMID:22306663

Jha, Jyoti K; Baek, Jong Hwan; Venkova-Canova, Tatiana; Chattoraj, Dhruba K

2012-07-01

326

Bacteria and vampirism in cinema.  

Science.gov (United States)

A vampire is a non-dead and non-alive chimerical creature, which, according to various folklores and popular superstitions, feeds on blood of the living to draw vital force. Vampires do not reproduce by copulation, but by bite. Vampirism is thus similar to a contagious disease contracted by intravascular inoculation with a suspected microbial origin. In several vampire films, two real bacteria were staged, better integrated than others in popular imagination: Yersinia pestis and Treponema pallidum. Bacillus vampiris was created for science-fiction. These films are attempts to better define humans through one of their greatest fears: infectious disease. PMID:23916557

Castel, O; Bourry, A; Thévenot, S; Burucoa, C

2013-09-01

327

Bacteria for faster oil production  

Energy Technology Data Exchange (ETDEWEB)

The article deals with a new method of enhancing the production from oil wells which may be crucial to the production economy of oil fields. The method is based on the use of bacteria, and produce their own basis for a jellylike substance consisting of a viscous mixture of the biopolymer xanthan (0.5 percent) and water which fills the voids left behind the recovered oil in order to prevent backflow into the reservoirs. The substance may be used for clogging up the porous oil-bearing strata with a more viscous xantan mixture to prevent the injection fluids to flow to the outside of the oil bearing strata.

Anon.

1993-01-01

328

Methanotrophic Bacteria: Use in Bioremediation  

Energy Technology Data Exchange (ETDEWEB)

The methanotrophs are aerobic bacteria that oxidize methane as an energy source and carbon source through the enzyme methane monooxygenase (MMO). This MMO can cometabolize or transform nongrowth substrates by either growing or resting cells. Cometabolism is a result of nonspecific MMO activity towards organic compounds that do not serve as carbon or energy sources. While many cometabolizing bacterial species have been identified, the best studied are the methanotrophs. The reason for this is that methanotrophs are ubiquitous and can cometabolize many aliphatic compounds, alkanes, and aromatic compounds. Methanotrophs have been intensely studied for use in degrading chlorinated solvents, most notably trichloroethylene, to environmentally acceptable concentrations in soils, sediment, and groundwater. Stimulation of methanotrophic bacteria is accomplished through the addition of methane and other gaseous nutrients resulting in an increase in contaminant biodegradation and biotransformation. The composition of gaseous nutrients used with methane is dependent on the characteristics of the site geochemistry and microbiology. This biostimulation may be applied in situ within the contaminated aquifer or soil. If necessary, the contaminated soil or groundwater can be moved and treated ex situ based on the site-specific needs.

Brigmon, R.L.

2001-02-15

329

DMTB: the magnetotactic bacteria database  

Science.gov (United States)

Magnetotactic bacteria (MTB) are of interest in biogeomagnetism, rock magnetism, microbiology, biomineralization, and advanced magnetic materials because of their ability to synthesize highly ordered intracellular nano-sized magnetic minerals, magnetite or greigite. Great strides for MTB studies have been made in the past few decades. More than 600 articles concerning MTB have been published. These rapidly growing data are stimulating cross disciplinary studies in such field as biogeomagnetism. We have compiled the first online database for MTB, i.e., Database of Magnestotactic Bacteria (DMTB, http://database.biomnsl.com). It contains useful information of 16S rRNA gene sequences, oligonucleotides, and magnetic properties of MTB, and corresponding ecological metadata of sampling sites. The 16S rRNA gene sequences are collected from the GenBank database, while all other data are collected from the scientific literature. Rock magnetic properties for both uncultivated and cultivated MTB species are also included. In the DMTB database, data are accessible through four main interfaces: Site Sort, Phylo Sort, Oligonucleotides, and Magnetic Properties. References in each entry serve as links to specific pages within public databases. The online comprehensive DMTB will provide a very useful data resource for researchers from various disciplines, e.g., microbiology, rock magnetism and paleomagnetism, biogeomagnetism, magnetic material sciences and others.

Pan, Y.; Lin, W.

2012-12-01

330

Money and transmission of bacteria  

Science.gov (United States)

Money is one of the most frequently passed items in the world. The aim of this study was to ascertain the survival status of bacteria including Staphylococcus aureus, Escherichia coli, and Vancomycin- Resistant Enterococci (VRE) on banknotes from different countries and the transmission of bacteria to people who come in contact with the banknotes. The survival rate was highest for the Romanian Leu yielding all three microorganisms used after both three and six hours of drying. Furthermore, the Leu was the only banknote to yield VRE after one day of drying. Other currencies either enabled the survival of Extended-Spectrum Beta-Lactamases (ESBL) and VRE (e.g. Euro), but not of MRSA, or the other way round (e.g. US Dollar). While a variety of factors such as community hygiene levels, people’s behaviour, and antimicrobial resistance rates at community level obviously have influence on the transmission of resistant microorganisms, the type of banknote-paper may be an additional variable to consider. PMID:23985137

2013-01-01

331

Medicinal smoke reduces airborne bacteria.  

Science.gov (United States)

This study represents a comprehensive analysis and scientific validation of our ancient knowledge about the effect of ethnopharmacological aspects of natural products' smoke for therapy and health care on airborne bacterial composition and dynamics, using the Biolog microplate panels and Microlog database. We have observed that 1h treatment of medicinal smoke emanated by burning wood and a mixture of odoriferous and medicinal herbs (havan sámagri=material used in oblation to fire all over India), on aerial bacterial population caused over 94% reduction of bacterial counts by 60 min and the ability of the smoke to purify or disinfect the air and to make the environment cleaner was maintained up to 24h in the closed room. Absence of pathogenic bacteria Corynebacterium urealyticum, Curtobacterium flaccumfaciens, Enterobacter aerogenes (Klebsiella mobilis), Kocuria rosea, Pseudomonas syringae pv. persicae, Staphylococcus lentus, and Xanthomonas campestris pv. tardicrescens in the open room even after 30 days is indicative of the bactericidal potential of the medicinal smoke treatment. We have demonstrated that using medicinal smoke it is possible to completely eliminate diverse plant and human pathogenic bacteria of the air within confined space. PMID:17913417

Nautiyal, Chandra Shekhar; Chauhan, Puneet Singh; Nene, Yeshwant Laxman

2007-12-01

332

Molecular Communication Between Two Populations of Bacteria  

OpenAIRE

Molecular communication is an expanding body of research. Recent advances in biology have encouraged using genetically engineered bacteria as the main component in the molecular communication. This has stimulated a new line of research that attempts to study molecular communication among bacteria from an information-theoretic point of view. Due to high randomness in the individual behavior of the bacterium, reliable communication between two bacteria is almost impossible. Th...

Einolghozati, Arash; Sardari, Mohsen; Fekr, Faramarz

2012-01-01

333

Magnetization processes in magnetotactic bacteria systems  

International Nuclear Information System (INIS)

In low fields, the magnetization of magnetotactic bacteria (MTB) culture is affected by chemotaxis and can be described by the Langevin function which depends on magnetic field strength and chemotaxis energy. In moderate fields, bacteria magnetization switching occurs as the second-order phase transition induced by increasing the field applied opposite the MTB magnetic moments. For bacteria containing one or two chains of magnetosomes we calculated the switching field as a function of the gap between magnetic particles

334

Utilization of xylooligosaccharides by selected ruminal bacteria.  

OpenAIRE

The ability of ruminal bacteria to utilize xylooligosaccharides was examined. Xylooligosaccharides were prepared by partially hydrolyzing oat spelt xylan in phosphoric acid. This substrate solution was added (0.2%, wt/vol) to a complex medium containing yeast extract and Trypticase that was inoculated with individual species of ruminal bacteria, and growth and utilization were monitored over time. All of the xylanolytic bacteria examined were able to utilize this oligosaccharide mixture as a ...

Cotta, M. A.

1993-01-01

335

Transformation of gram positive bacteria by sonoporation  

Science.gov (United States)

The present invention provides a sonoporation-based method that can be universally applied for delivery of compounds into Gram positive bacteria. Gram positive bacteria which can be transformed by sonoporation include, for example, Bacillus, Streptococcus, Acetobacterium, and Clostridium. Compounds which can be delivered into Gram positive bacteria via sonoporation include nucleic acids (DNA or RNA), proteins, lipids, carbohydrates, viruses, small organic and inorganic molecules, and nano-particles.

Yang, Yunfeng; Li, Yongchao

2014-03-11

336

Antibiotic-resistant bacteria in drinking water.  

OpenAIRE

We analyzed drinking water from seven communities for multiply antibiotic-resistant (MAR) bacteria (bacteria resistant to two or more antibiotics) and screened the MAR bacterial isolates obtained against five antibiotics by replica plating. Overall, 33.9% of 2,653 standard plate count bacteria from treated drinking waters were MAR. Two different raw water supplies for two communities carried MAR standard plate count bacteria at frequencies of 20.4 and 18.6%, whereas 36.7 and 67.8% of the stan...

Armstrong, J. L.; Shigeno, D. S.; Calomiris, J. J.; Seidler, R. J.

1981-01-01

337

Coryneform bacteria associated with canine otitis externa.  

Science.gov (United States)

This study aims to investigate the occurrence of coryneform bacteria in canine otitis externa. A combined case series and case-control study was carried out to improve the current knowledge on frequency and clinical significance of coryneform bacteria in samples from canine otitis externa. A total of 16 cases of otitis externa with involvement of coryneform bacteria were recorded at two referral veterinary hospitals in Denmark and the US, respectively. Coryneform bacteria were identified by partial 16S rRNA gene sequencing. Corynebacterium auriscanis was the most common coryneform species (10 cases). Small colony variants of this species were also observed. Other coryneform isolates were identified as Corynebacterium amycolatum (3 cases), Corynebacterium freneyi (2 cases) and an Arcanobacterium-like species (1 case). The coryneform bacteria were in all cases isolated together with other bacteria, mainly Staphylococcus pseudintermedius alone (n=5) or in combination with Malassezia pachydermatis (n=5). Some coryneform isolates displayed resistance to fusidic acid or enrofloxacin, two antimicrobial agents commonly used for the treatment of otitis externa in dogs. The frequency of isolation of coryneform bacteria was 16% among 55 cases of canine otitis externa examined at the Danish hospital during 2007. In contrast, detectable levels of coryneform bacteria were not demonstrated in samples from the acustic meatus of 35 dogs with apparently healthy ears, attending the hospital during the same year. On basis of the current knowledge, these coryneform bacteria should be regarded as potential secondary pathogens able to proliferate in the environment of an inflamed ear canal. PMID:20434850

Aalbæk, Bent; Bemis, David A; Schjærff, Mette; Kania, Stephen A; Frank, Linda A; Guardabassi, Luca

2010-10-26

338

Bioremoval of rare earth elements by bacteria  

International Nuclear Information System (INIS)

Forty nine bacterial isolates (17 gram positive bacteria and 32 gram negative bacteria) from soil and water were screened for resistance to rare earth elements, namely, Lanthanum, Praseodymium, Samarium, Gadolinium and Dysprosium. Neodymium was found to be the most tolerant metal. Maximum sensitivity among the isolates was observed for lanthanum and samarium. Praseodymium was used to test the removal capabilities of the bacteria. Gram-positive bacteria exhibited higher capacity for accumulating Pr. The highest removal capacity of 125 ig/ml Pr was observed for strain WB01 in 17 days. (author)

339

Coryneform bacteria associated with canine otitis externa  

DEFF Research Database (Denmark)

This study aims to investigate the occurrence of coryneform bacteria in canine otitis externa. A combined case series and case-control study was carried out to improve the current knowledge on frequency and clinical significance of coryneform bacteria in samples from canine otitis externa. A total of 16 cases of otitis externa with involvement of coryneform bacteria were recorded at two referral veterinary hospitals in Denmark and the US, respectively. Coryneform bacteria were identified by partial 16S rRNA gene sequencing. Corynebacterium auriscanis was the most common coryneform species (10 cases). Small colony variants of this species were also observed. Other coryneform isolates were identified as Corynebacterium amycolatum (3 cases), Corynebacterium freneyi (2 cases) and an Arcanobacterium-like species (1 case). The coryneform bacteria were in all cases isolated together with other bacteria, mainly Staphylococcus pseudintermedius alone (n=5) or in combination with Malassezia pachydermatis (n=5). Some coryneform isolates displayed resistance to fusidic acid or enrofloxacin, two antimicrobial agents commonly used for the treatment of otitis externa in dogs. The frequency of isolation of coryneform bacteria was 16% among 55 cases of canine otitis externa examined at the Danish hospital during 2007. In contrast, detectable levels of coryneform bacteria were not demonstrated in samples from the acustic meatus of 35 dogs with apparently healthy ears, attending the hospital during the same year. On basis of the current knowledge, these coryneform bacteria should be regarded as potential secondary pathogens able to proliferate in the environment of an inflamed ear canal.

Aalbæk, Bent; Bemis, David A.

2010-01-01

340

Isolation and Presumptive Identification of Adherent Epithelial Bacteria (“Epimural” Bacteria) from the Ovine Rumen Wall  

OpenAIRE

One hundred sixty-one strains of adherent bacteria were isolated under anaerobic conditions from four sites on the rumen epithelial surface of sheep fed hay or a hay-grain ration. Before isolation of bacteria, rumen tissue was washed six times in an anaerobic dilution solution, and viable bacteria suspended in the washings were counted. Calculation indicated that unattached bacteria would have been removed from the tissue by this procedure, but a slow and progressive release of attached bacte...

Mead, Lorna J.; Jones, G. A.

1981-01-01

341

[Surface layers of methanotrophic bacteria].  

Science.gov (United States)

Structural and functional characteristics of the regular glycoprotein layers in prokaryotes are analyzed with a special emphasis on aerobic methanotrophic bacteria. S-layers are present at the surfaces of Methylococcus, Methylothermus, and Methylomicrobium cells. Different Methylomicrobium species either synthesize S-layers with planar (p2, p4) symmetry or form cup-shaped or conicalstructures with hexagonal (p6) symmetry. A unique, copper-binding polypeptide 'CorA'/MopE (27/45 kDa), which is coexpressed with the diheme periplasmic cytochrome c peroxidase 'CorB'/Mca (80 kDa) was found in Methylomicrobium album BG8, Methylomicrobium alcaliphilum 20Z, and Methylococcus capsulatus Bath. This tandem of the surface proteins is functionally analogous to a new siderophore, methanobactin. Importantly, no 'CorA'/MopE homologue was found in methanotrophs not forming S-layers. The role of surface proteins in copper metabolism and initial methane oxidation is discussed. PMID:25509389

Khmelenina, V N; Suzina, N E; Trotsenko, Iu A

2013-01-01

342

Cell Size Regulation in Bacteria  

Science.gov (United States)

Various bacteria such as the canonical gram negative Escherichia coli or the well-studied gram positive Bacillus subtilis divide symmetrically after they approximately double their volume. Their size at division is not constant, but is typically distributed over a narrow range. Here, we propose an analytically tractable model for cell size control, and calculate the cell size and interdivision time distributions, as well as the correlations between these variables. We suggest ways of extracting the model parameters from experimental data, and show that existing data for E. coli supports partial size control, and a particular explanation: a cell attempts to add a constant volume from the time of initiation of DNA replication to the next initiation event. This hypothesis accounts for the experimentally observed correlations between mother and daughter cells as well as the exponential dependence of size on growth rate.

Amir, Ariel

2014-05-01

343

Characterization of (per)chlorate-reducing bacteria  

OpenAIRE

Some bacteria can use (per)chlorateas terminal electron acceptor for growth. These bacteria convert perchlorate via chlorate and chlorite into chloride and molecular oxygen. Oxygen formation in microbial respiration is unique. In this study two chlorate-reducing strains belonging to the species Pseudomonas chloritidismutans and a (per)chlorate-reducing strain Dechloromonas hortensis were isolated. The characterization of the chlorate-reducing ...

Wolterink, A. F. W. M.

2004-01-01

344

Chryseobacterium indologenes, novel mannanase-producing bacteria  

Directory of Open Access Journals (Sweden)

Full Text Available Mannanase is a mannan degrading enzyme which is produced by microorganisms, including bacteria. This enzyme can be used in many industrial processes as well as for improving the quality of animal feeds. The aim of the present study was toscreen and characterize the mannanase-producing bacteria. Two genera of bacteria were isolated from Thai soil samples,fermented coconut, and fertilizer. Screening was carried out on agar plates containing mannan stained with iodine solution.The bacteria were identified by partial 16S rRNA gene sequence, biochemical test and morphology, respectively. The mannanase activity was determined by zymogram and DNS method. Two strains of bacteria with mannanase activity were identified as Bacillus and Chryseobacterium. This is the first report of mannanase-producing Chryseobacterium.

Surachai Rattanasuk

2009-10-01

345

HYDROCARBON-DEGRADING BACTERIA AND SURFACTANT ACTIVITY  

Energy Technology Data Exchange (ETDEWEB)

Fate of benzene ethylbenzene toluene xylenes (BTEX) compounds through biodegradation was investigated using two different bacteria, Ralstonia picketti (BP-20) and Alcaligenes piechaudii (CZOR L-1B). These bacteria were isolated from extremely polluted petroleum hydrocarbon contaminated soils. PCR and Fatty Acid Methyl Ester (FAME) were used to identify the isolates. Biodegradation was measured using each organism individually and in combination. Both bacteria were shown to degrade each of the BTEX compounds. Alcaligenes piechaudii biodegraded BTEXs more efficiently while mixed with BP-20 and individually. Biosurfactant production was observed by culture techniques. In addition 3-hydroxy fatty acids, important in biosurfactant production, was observed by FAME analysis. In the all experiments toluene and m+p- xylenes were better growth substrates for both bacteria than the other BTEX compounds. In addition, the test results indicate that the bacteria could contribute to bioremediation of aromatic hydrocarbons (BTEX) pollution increase biodegradation through the action by biosurfactants.

Brigmon, R; Topher Berry, T; Grazyna A. Plaza, G; jacek Wypych, j

2006-08-15

346

Antimicrobial activity and Characterization of Marine bacteria  

Directory of Open Access Journals (Sweden)

Full Text Available Marine bacteria were isolated from seawater was collected from different coastal areas of the Tamilnadu Sea. The antimicrobial activities of these bacteria were investigated. Ethyl acetate extracts of marine bacterial fermentation were screened for antimicrobial activities using the method of agar diffusion. The results showed that 25 strains of the isolates have antimicrobial activity. The proportion of active bacteria associated with isolated from seawater. The active marine bacteria were assigned to the genera Alteromonas, Pseudomonas, Bacillus and Marinobacter. The TLC autobiographic overlay assay implied that the antimicrobial metabolites produced by four strains with wide antimicrobial spectrum were different. These marine bacteria were expected to be potential resources of natural antibiotic products. It can be concluded that isolation of Marine bacterial samples can offer a numbers of microbial strains for sources of new biomolecules from Marine sources.

P.Jeganathan*

2013-12-01

347

Chemotactic selection of pollutant degrading soil bacteria  

Science.gov (United States)

A method is described for identifying soil microbial strains which may be bacterial degraders of pollutants. This method includes: Placing a concentration of a pollutant in a substantially closed container; placing the container in a sample of soil for a period of time ranging from one minute to several hours; retrieving the container and collecting its contents; microscopically determining the identity of the bacteria present. Different concentrations of the pollutant can be used to determine which bacteria respond to each concentration. The method can be used for characterizing a polluted site or for looking for naturally occurring biological degraders of the pollutant. Then bacteria identified as degraders of the pollutant and as chemotactically attracted to the pollutant are used to innoculate contaminated soil. To enhance the effect of the bacteria on the pollutant, nutrients are cyclicly provided to the bacteria then withheld to alternately build up the size of the bacterial colony or community and then allow it to degrade the pollutant.

Hazen, T.C.

1991-03-04

348

Potential role of bacteria packaging by protozoa in the persistence and transmission of pathogenic bacteria  

Directory of Open Access Journals (Sweden)

Full Text Available Many pathogenic bacteria live in close association with protozoa. These unicellular eukaryotic microorganisms are ubiquitous in various environments. A number of protozoa such as amoebae and ciliates ingest pathogenic bacteria, package them usually in membrane structures, and then release them into the environment. Packaged bacteria are more resistant to various stresses and are more apt to survive than free bacteria. New evidence indicates that protozoa and not bacteria control the packaging process. It is possible that packaging is more common than suspected and may play a major role in the persistence and transmission of pathogenic bacteria. To confirm the role of packaging in the propagation of infections, it is vital that the molecular mechanisms governing the packaging of bacteria by protozoa be identified as well as elements related to the ecology of this process in order to determine whether packaging acts as a Trojan Horse.

SteveJCharette

2014-05-01

349

Birefringence Determination of Magnetic Moments of Magnetotactic Bacteria  

OpenAIRE

A birefringence technique is used to determine the average magnetic moments of magnetotactic bacteria in culture. Differences in are noted between live and dead bacteria, as well as between normal density and high density samples of live bacteria.

Rosenblatt, Charles; Araujo, F. Flavio Torres; Frankel, Richard B.

1982-01-01

350

Isolation of an indigenous imidacloprid-degrading bacterium and imidacloprid bioremediation under simulated in situ and ex situ conditions.  

Science.gov (United States)

The Bacterial community structure and its complexity of the enrichment culture during the isolation and screening of imidacloprid-degrading strain were studied using denaturating gradient gel electrophoresis analysis. The dominant bacteria in the original tea rhizosphere soil were uncultured bacteria, Rhizobium sp., Sinorhizobium, Ochrobactrum sp., Alcaligenes, Bacillus sp., Bacterium, Klebsiella sp., and Ensifer adhaerens. The bacterial community structure was altered extensively and its complexity reduced during the enrichment process, and four culturable bacteria, Ochrobactrum sp., Rhizobium sp., Geobacillus stearothermophilus, and Alcaligenes faecalis, remained in the final enrichment. Only one indigenous strain, BCL-1, with imidacloprid-degrading potential, was isolated from the sixth enrichment culture. This isolate was a gram-negative rod-shaped bacterium and identified as the genus Ochrobactrum based on its morphological, physiological, and biochemical properties and its 16S rRNA gene sequence. The degradation test showed that approximately 67.67% of the imidacloprid (50 mg/l) was degraded within 48 h by strain BCL-1. The optimum conditions for degradation were a pH of 8 and 30°C. The simulation of imidacloprid bioremediation by strain BCL-1 in soil demonstrated that the best performance in situ (tea soil) resulted in the degradation of 92.44% of the imidacloprid (100 mg/g) within 20 days, which was better than those observed in the ex situ simulations that were 64.66% (cabbage soil), 41.15% (potato soil), and 54.15% (tomato soil). PMID:23985542

Hu, Guiping; Zhao, Yan; Liu, Bo; Song, Fengqing; You, Minsheng

2013-11-28

351

Comparative cytotoxicity of periodontal bacteria  

Energy Technology Data Exchange (ETDEWEB)

The direct cytotoxicity of sonic extracts (SE) from nine periodontal bacteria for human gingival fibroblasts (HGF) was compared. Equivalent dosages (in terms of protein concentration) of SE were used to challenge HGF cultures. The cytotoxic potential of each SE was assessed by its ability to (1) inhibit HGF proliferation, as measured by direct cell counts; (2) inhibit 3H-thymidine incorporation in HGF cultures; or (3) cause morphological alterations of the cells in challenged cultures. The highest concentration (500 micrograms SE protein/ml) of any of the SEs used to challenge the cells was found to be markedly inhibitory to the HGFs by all three of the criteria of cytotoxicity. At the lowest dosage tested (50 micrograms SE protein/ml); only SE from Actinobacillus actinomycetemcomitans, Bacteroides gingivalis, and Fusobacterium nucleatum caused a significant effect (greater than 90% inhibition or overt morphological abnormalities) in the HGFs as determined by any of the criteria employed. SE from Capnocytophaga sputigena, Eikenella corrodens, or Wolinella recta also inhibited cell proliferation and thymidine incorporation at this dosage; however, the degree of inhibition (5-50%) was consistently, clearly less than that of the first group of three organisms named above. The SE of the three other organisms tested (Actinomyces odontolyticus, Bacteroides intermedius, and Streptococcus sanguis) had little or no effect (0-10% inhibition) at this concentration. The data suggest that the outcome of the interaction between bacterial components and normal resident cells of the periodontium is, at least in part, a function of the bacterial species.

Stevens, R.H.; Hammond, B.F.

1988-11-01

352

Antibiotic resistance in probiotic bacteria  

Directory of Open Access Journals (Sweden)

Full Text Available Probiotics are live microorganisms which when administered in adequate amounts confer a health benefit on the host. The main probiotic bacteria are strains belonging to the genera Lactobacillus and Bifidobacterium, although other representatives, such as Bacillus or Escherichia coli strains, have also been used. Lactobacillus and Bifidobacterium are two common inhabitants of the human intestinal microbiota. Also, some species are used in food fermentation processes as starters, or as adjunct cultures in the food industry. With some exceptions, antibiotic resistance in these beneficial microbes does not constitute a safety concern in itself, when mutations or intrinsic resistance mechanisms are responsible for the resistance phenotype. In fact, some probiotic strains with intrinsic antibiotic resistance could be useful for restoring the gut microbiota after antibiotic treatment. However, specific antibiotic resistance determinants carried on mobile genetic elements, such as tetracycline resistance genes, are often detected in the typical probiotic genera, and constitute a reservoir of resistance for potential food or gut pathogens, thus representing a serious safety issue.

AbelardoMargolles

2013-07-01

353

Therapeutic Properties of Probiotic Bacteria  

Directory of Open Access Journals (Sweden)

Full Text Available In spite of its long history, public consciousness of probiotics has shifted dramatically in recent years. This is due to a number of factors, including an increased concern about the potential generation of antibiotic resistant bacterial strains due to widespread antibacterial use, and also to the spreading realization that one`s health can be, not simply maintained, but actually improved with proper nutrition. Combined, these factors have stimulated a surge in probiotic research in the past decade, resulting in increasingly refined studies. Indeed, after Elie Metchnikov first printed his work suggesting a positive correlation between human longevity and the consumption of fermented milk, information on probiotics is leaving the realm of the anecdotal as recent, double-blind, placebo controlled randomized tests support beneficial probiotic activity. Concurrently, more is being learned about their activities in vivo. While much work remains to be done before a detailed understanding of probiotics can be achieved, there is mounting evidence that probiotics, when used in proper conditions, may indeed have prophylactic or preventative effects on a broad array of human and animal diseases. This article briefly surveys probiotic history and discusses recent research with a special emphasis on lactic acid bacteria probiotics. Finally, it discusses the inherent difficulties of their study and suggestions for standards for future work.

Nathanon Trachoo

2006-01-01

354

Oxidized magnetosomes in magnetotactic bacteria  

Energy Technology Data Exchange (ETDEWEB)

Single domain magnetite particles formed in chain assemblies by magnetotactic bacteria (MTB) are taken as proxy in inferring environmental and Earth's magnetism. The reliable use of magnetosomes in MTB, or their fossil remains (magnetofossils), requires that they are unaffected by oxidation. Here we present experimental data from saturation isothermal remanent magnetization (SIRM) and ferromagnetic resonance spectroscopy (FMR) between room temperature and 10 K, which were applied to detect oxidation in intact MTB. The distinction of non-oxidized from oxidized MTB-assemblies is based mainly on two different characteristic physical properties: (i) the intrinsic Verwey transition in pure magnetite, and (ii) blocking of spins of nano-sized products formed during oxidation at the surface or the interior of the magnetosomes. Suppression of the Verwey transition due to oxidation prevents the shift of the anisotropy axes, which in turn conserves the anisotropic properties at room temperature down to low temperature. The presented methodology assures a distinction between non- and oxidized magnetite assemblies, with pronounced certainty, unlike standard dc methods.

Gehring, Andreas U., E-mail: agehring@erdw.ethz.ch [Institute of Geophysics, ETH Zurich, 8092 Zurich (Switzerland); Charilaou, Michalis, E-mail: michalis.charilaou@erdw.ethz.ch [Institute of Geophysics, ETH Zurich, 8092 Zurich (Switzerland); Garcia-Rubio, Ines, E-mail: garciarubio@phys.chem.ethz.ch [Laboratory of Physical Chemistry, ETH Zurich, 8093 Zurich (Switzerland)

2012-04-15

355

Oxidized magnetosomes in magnetotactic bacteria  

Science.gov (United States)

Single domain magnetite particles formed in chain assemblies by magnetotactic bacteria (MTB) are taken as proxy in inferring environmental and Earth's magnetism. The reliable use of magnetosomes in MTB, or their fossil remains (magnetofossils), requires that they are unaffected by oxidation. Here we present experimental data from saturation isothermal remanent magnetization (SIRM) and ferromagnetic resonance spectroscopy (FMR) between room temperature and 10 K, which were applied to detect oxidation in intact MTB. The distinction of non-oxidized from oxidized MTB-assemblies is based mainly on two different characteristic physical properties: (i) the intrinsic Verwey transition in pure magnetite, and (ii) blocking of spins of nano-sized products formed during oxidation at the surface or the interior of the magnetosomes. Suppression of the Verwey transition due to oxidation prevents the shift of the anisotropy axes, which in turn conserves the anisotropic properties at room temperature down to low temperature. The presented methodology assures a distinction between non- and oxidized magnetite assemblies, with pronounced certainty, unlike standard dc methods.

Gehring, Andreas U.; Charilaou, Michalis; García-Rubio, Inés

2012-04-01

356

Oxidized magnetosomes in magnetotactic bacteria  

International Nuclear Information System (INIS)

Single domain magnetite particles formed in chain assemblies by magnetotactic bacteria (MTB) are taken as proxy in inferring environmental and Earth's magnetism. The reliable use of magnetosomes in MTB, or their fossil remains (magnetofossils), requires that they are unaffected by oxidation. Here we present experimental data from saturation isothermal remanent magnetization (SIRM) and ferromagnetic resonance spectroscopy (FMR) between room temperature and 10 K, which were applied to detect oxidation in intact MTB. The distinction of non-oxidized from oxidized MTB-assemblies is based mainly on two different characteristic physical properties: (i) the intrinsic Verwey transition in pure magnetite, and (ii) blocking of spins of nano-sized products formed during oxidation at the surface or the interior of the magnetosomes. Suppression of the Verwey transition due to oxidation prevents the shift of the anisotropy axes, which in turn conserves the anisotropic properties at room temperature down to low temperature. The presented methodology assures a distinction between non- and oxidized magnetite assemblies, with pronounced certainty, unlike standard dc methods.

357

H2 from hot bacteria  

International Nuclear Information System (INIS)

This paper reports that a surprisingly large number of bacteria either oxidize or evolve molecular hydrogen (H2) in their natural environments. In such organisms, the reversible activation of H2 is catalyzed by an enzyme turned hydrogenase that can cause electrons provided by an electron donor with protons to evolve H2. The enzyme may oxidize H2 in the presence of a suitable electron acceptor. Hydrogenase will also catalyze an isotope exchange reaction between deuterium (D2) or tritium (T2) gas and water. Few enzymes have as many potential biotechnological applications as hydrogenase. H2 is a versatile and efficient energy carrier, considered the fuel of the future by some, and is an important intermediate in a variety of chemical and petrochemical processes. Hydrogenase has also been proposed to replace platinum in H/D and H/T separations in the nuclear power industry and to activate H2 for electrode-based processes. Indeed, H2 is considered one of the most abundant substrates for the future chemical synthesis industry and the enzyme-catalyzed production of organic chemicals from H2 and CO2 has been described. a complete understanding of how hydrogenases catalyze the reversible activation of H2 might therefore have farreaching consequences in both applied and basic research

358

Membrane damage of bacteria by silanols treatment  

Scientific Electronic Library Online (English)

Full Text Available SciELO Chile | Language: English Abstract in english Antimicrobial action of silanols, a new class of antimicrobials, was investigated by transmission electron microscopy and fluorescent dye studies. Gram-negative bacteria, Escherichia coli and Pseudomonas aeruginosa and Gram-positive bacteria, Staphylococcus aureus and Enterococcus faecalis were trea [...] ted by silanols at concentration of less than 0.2 wt% for one hour. Membrane damage of the bacteria by the silanol treatment was clearly observed by transmission electron microscopy. Separation of the cytoplasmic membrane from the outer membrane for E. coli and disorganized cytoplasmic membrane of the Gram-positive bacteria were observed when compared to the control. Fluorescent dyes, green-fluorescent nucleic acid stain (Syto 9) and the red-fluorescent nucleic acid stain (Propidium iodide), were used to monitor membrane damage of the bacteria by Confocal microscopy and Spectrophotometer. A reduction of the green fluorescent emission was detected for silanol treated bacteria indicating membrane damage of the bacteria and supporting the hypothesis that their viability loss may be due to their membrane damage analogus to alcohols

Yun-mi, Kim; Samuel, Farrah; Ronald H, Baney.

2007-04-15

359

Bacteria classification using Cyranose 320 electronic nose  

Directory of Open Access Journals (Sweden)

Full Text Available Abstract Background An electronic nose (e-nose, the Cyrano Sciences' Cyranose 320, comprising an array of thirty-two polymer carbon black composite sensors has been used to identify six species of bacteria responsible for eye infections when present at a range of concentrations in saline solutions. Readings were taken from the headspace of the samples by manually introducing the portable e-nose system into a sterile glass containing a fixed volume of bacteria in suspension. Gathered data were a very complex mixture of different chemical compounds. Method Linear Principal Component Analysis (PCA method was able to classify four classes of bacteria out of six classes though in reality other two classes were not better evident from PCA analysis and we got 74% classification accuracy from PCA. An innovative data clustering approach was investigated for these bacteria data by combining the 3-dimensional scatter plot, Fuzzy C Means (FCM and Self Organizing Map (SOM network. Using these three data clustering algorithms simultaneously better 'classification' of six eye bacteria classes were represented. Then three supervised classifiers, namely Multi Layer Perceptron (MLP, Probabilistic Neural network (PNN and Radial basis function network (RBF, were used to classify the six bacteria classes. Results A [6 × 1] SOM network gave 96% accuracy for bacteria classification which was best accuracy. A comparative evaluation of the classifiers was conducted for this application. The best results suggest that we are able to predict six classes of bacteria with up to 98% accuracy with the application of the RBF network. Conclusion This type of bacteria data analysis and feature extraction is very difficult. But we can conclude that this combined use of three nonlinear methods can solve the feature extraction problem with very complex data and enhance the performance of Cyranose 320.

Gardner Julian W

2002-10-01

360

Threats and opportunities of plant pathogenic bacteria.  

Science.gov (United States)

Plant pathogenic bacteria can have devastating effects on plant productivity and yield. Nevertheless, because these often soil-dwelling bacteria have evolved to interact with eukaryotes, they generally exhibit a strong adaptivity, a versatile metabolism, and ingenious mechanisms tailored to modify the development of their hosts. Consequently, besides being a threat for agricultural practices, phytopathogens may also represent opportunities for plant production or be useful for specific biotechnological applications. Here, we illustrate this idea by reviewing the pathogenic strategies and the (potential) uses of five very different (hemi)biotrophic plant pathogenic bacteria: Agrobacterium tumefaciens, A. rhizogenes, Rhodococcus fascians, scab-inducing Streptomyces spp., and Pseudomonas syringae. PMID:24216222

Tarkowski, Petr; Vereecke, Danny

2014-01-01

361

Inmunidad frente a infecciones: bacterias, virus, hongos y parásitos  

OpenAIRE

Respuesta inmune frente a la infección: Bacterias extracelulares, bacterias intracelulares, hongos, virus, parásitos. Inmunidad innata, inmunidad adaptativa, mecanismos de evasión, consecuencias perjudiciales de la respuesta inmune.

Sen Ferna?ndez, Mari?a Luz La; Sempere Ortells, Jose? Miguel; Marco La Calle, Francisco Manuel; Va?zquez Araujo, Begon?a

2012-01-01

362

Release of bacteria during the purge cycles of steam-jacketed sterilizers.  

Science.gov (United States)

The design of the steam-jacketed sterilizer includes an exterior air-gap fixture through which purged chamber aerosols potentially could escape into the ambient environment. Studies of the purge cycle in two sterilizer models tested the potential release of a genetically marked Enterococcus faecalis, together with Bacillus stearothermophilus spores introduced as exposed cultures. Direct plate counts, broth enrichment and polymerase chain reaction analysis were used to confirm any released organisms trapped in an all-glass impinger. From the retrieval of both bacterial strains, an estimated 10(3) organisms can be released from uncontained bacterial loads of 10(11) E. faecalis and 10(7) B. stearothermophilus, even from properly functioning autoclaves. The release of an opportunistic pathogen from sterilizer purge exhausts emphasises the importance of proper sterilizer location, ventilation, containment of heavily contaminated loads, and adequate sterilizer maintenance. PMID:10795367

Marshall, B M; Shin-Kim, H; Perlov, D; Levy, S B

1999-01-01

363

Magnetotactic Bacteria from Extreme Environments  

Science.gov (United States)

Magnetotactic bacteria (MTB) represent a diverse collection of motile prokaryotes that biomineralize intracellular, membrane-bounded, tens-of-nanometer-sized crystals of a magnetic mineral called magnetosomes. Magnetosome minerals consist of either magnetite (Fe3O4) or greigite (Fe3S4) and cause cells to align along the Earth's geomagnetic field lines as they swim, a trait called magnetotaxis. MTB are known to mainly inhabit the oxic-anoxic interface (OAI) in water columns or sediments of aquatic habitats and it is currently thought that magnetosomes function as a means of making chemotaxis more efficient in locating and maintaining an optimal position for growth and survival at the OAI. Known cultured and uncultured MTB are phylogenetically associated with the Alpha-, Gamma- and Deltaproteobacteria classes of the phylum Proteobacteria, the Nitrospirae phylum and the candidate division OP3, part of the Planctomycetes-Verrucomicrobia-Chlamydiae (PVC) bacterial superphylum. MTB are generally thought to be ubiquitous in aquatic environments as they are cosmopolitan in distribution and have been found in every continent although for years MTB were thought to be restricted to habitats with pH values near neutral and at ambient temperature. Recently, however, moderate thermophilic and alkaliphilic MTB have been described including: an uncultured, moderately thermophilic magnetotactic bacterium present in hot springs in northern Nevada with a probable upper growth limit of about 63 °C; and several strains of obligately alkaliphilic MTB isolated in pure culture from different aquatic habitats in California, including the hypersaline, extremely alkaline Mono Lake, with an optimal growth pH of >9.0.

Bazylinski, Dennis A.; Lefère, Christopher T.

2013-03-01

364

Magnetotactic Bacteria from Extreme Environments  

Directory of Open Access Journals (Sweden)

Full Text Available Magnetotactic bacteria (MTB represent a diverse collection of motile prokaryotes that biomineralize intracellular, membrane-bounded, tens-of-nanometer-sized crystals of a magnetic mineral called magnetosomes. Magnetosome minerals consist of either magnetite (Fe3O4 or greigite (Fe3S4 and cause cells to align along the Earth’s geomagnetic field lines as they swim, a trait called magnetotaxis. MTB are known to mainly inhabit the oxic–anoxic interface (OAI in water columns or sediments of aquatic habitats and it is currently thought that magnetosomes function as a means of making chemotaxis more efficient in locating and maintaining an optimal position for growth and survival at the OAI. Known cultured and uncultured MTB are phylogenetically associated with the Alpha-, Gamma- and Deltaproteobacteria classes of the phylum Proteobacteria, the Nitrospirae phylum and the candidate division OP3, part of the Planctomycetes-Verrucomicrobia-Chlamydiae (PVC bacterial superphylum. MTB are generally thought to be ubiquitous in aquatic environments as they are cosmopolitan in distribution and have been found in every continent although for years MTB were thought to be restricted to habitats with pH values near neutral and at ambient temperature. Recently, however, moderate thermophilic and alkaliphilic MTB have been described including: an uncultured, moderately thermophilic magnetotactic bacterium present in hot springs in northern Nevada with a probable upper growth limit of about 63 °C; and several strains of obligately alkaliphilic MTB isolated in pure culture from different aquatic habitats in California, including the hypersaline, extremely alkaline Mono Lake, with an optimal growth pH of >9.0.

Christopher T. Lefèvre

2013-03-01

365

Comparative cytotoxicity of periodontal bacteria  

International Nuclear Information System (INIS)

The direct cytotoxicity of sonic extracts (SE) from nine periodontal bacteria for human gingival fibroblasts (HGF) was compared. Equivalent dosages (in terms of protein concentration) of SE were used to challenge HGF cultures. The cytotoxic potential of each SE was assessed by its ability to (1) inhibit HGF proliferation, as measured by direct cell counts; (2) inhibit 3H-thymidine incorporation in HGF cultures; or (3) cause morphological alterations of the cells in challenged cultures. The highest concentration (500 micrograms SE protein/ml) of any of the SEs used to challenge the cells was found to be markedly inhibitory to the HGFs by all three of the criteria of cytotoxicity. At the lowest dosage tested (50 micrograms SE protein/ml); only SE from Actinobacillus actinomycetemcomitans, Bacteroides gingivalis, and Fusobacterium nucleatum caused a significant effect (greater than 90% inhibition or overt morphological abnormalities) in the HGFs as determined by any of the criteria employed. SE from Capnocytophaga sputigena, Eikenella corrodens, or Wolinella recta also inhibited cell proliferation and thymidine incorporation at this dosage; however, the degree of inhibition (5-50%) was consistently, clearly less than that of the first group of three organisms named above. The SE of the three other organisms tested (Actinomyces odontolyticus, Bacteroides intermedius, and Streptococcus sanguis) had little or no effect (0-10% inhibition) at this concentration. The data suggtion) at this concentration. The data suggest that the outcome of the interaction between bacterial components and normal resident cells of the periodontium is, at least in part, a function of the bacterial species

366

Folate Production by Probiotic Bacteria  

Directory of Open Access Journals (Sweden)

Full Text Available Probiotic bacteria, mostly belonging to the genera Lactobacillus and Bifidobacterium, confer a number of health benefits to the host, including vitamin production. With the aim to produce folate-enriched fermented products and/or develop probiotic supplements that accomplish folate biosynthesis in vivo within the colon, bifidobacteria and lactobacilli have been extensively studied for their capability to produce this vitamin. On the basis of physiological studies and genome analysis, wild-type lactobacilli cannot synthesize folate, generally require it for growth, and provide a negative contribution to folate levels in fermented dairy products. Lactobacillus plantarum constitutes an exception among lactobacilli, since it is capable of folate production in presence of para-aminobenzoic acid (pABA and deserves to be used in animal trials to validate its ability to produce the vitamin in vivo. On the other hand, several folate-producing strains have been selected within the genus Bifidobacterium, with a great variability in the extent of vitamin released in the medium. Most of them belong to the species B. adolescentis and B. pseudocatenulatum, but few folate producing strains are found in the other species as well. Rats fed a probiotic formulation of folate-producing bifidobacteria exhibited increased plasma folate level, confirming that the vitamin is produced in vivo and absorbed. In a human trial, the same supplement raised folate concentration in feces. The use of folate-producing probiotic strains can be regarded as a new perspective in the specific use of probiotics. They could more efficiently confer protection against inflammation and cancer, both exerting the beneficial effects of probiotics and preventing the folate deficiency that is associated with premalignant changes in the colonic epithelia.

Stefano Raimondi

2011-01-01

367

Mixed Messages: How Bacteria Resolve Conflicting Signals  

OpenAIRE

An elegant new study by Bollenbach and Kishony (2011) in this issue of Molecular Cell shows how bacteria resolve the apparent conflicts created when they face two signals with opposite effects on gene expression.

Young, Jonathan W.; Elowitz, Michael B.

2011-01-01

368

Comparative genomics of the lactic acid bacteria  

Energy Technology Data Exchange (ETDEWEB)

Lactic acid-producing bacteria are associated with various plant and animal niches and play a key role in the production of fermented foods and beverages. We report nine genome sequences representing the phylogenetic and functional diversity of these bacteria. The small genomes of lactic acid bacteria encode a broad repertoire of transporters for efficient carbon and nitrogen acquisition from the nutritionally rich environments they inhabit and reflect a limited range of biosynthetic capabilities that indicate both prototrophic and auxotrophic strains. Phylogenetic analyses, comparison of gene content across the group, and reconstruction of ancestral gene sets indicate a combination of extensive gene loss and key gene acquisitions via horizontal gene transfer during the coevolution of lactic acid bacteria with their habitats.

Makarova, K.; Slesarev, A.; Wolf, Y.; Sorokin, A.; Mirkin, B.; Koonin, E.; Pavlov, A.; Pavlova, N.; Karamychev, V.; Polouchine, N.; Shakhova, V.; Grigoriev, I.; Lou, Y.; Rokhsar, D.; Lucas, S.; Huang, K.; Goodstein, D. M.; Hawkins, T.; Plengvidhya, V.; Welker, D.; Hughes, J.; Goh, Y.; Benson, A.; Baldwin, K.; Lee, J. -H.; Diaz-Muniz, I.; Dosti, B.; Smeianov, V; Wechter, W.; Barabote, R.; Lorca, G.; Altermann, E.; Barrangou, R.; Ganesan, B.; Xie, Y.; Rawsthorne, H.; Tamir, D.; Parker, C.; Breidt, F.; Broadbent, J.; Hutkins, R.; O' Sullivan, D.; Steele, J.; Unlu, G.; Saier, M.; Klaenhammer, T.; Richardson, P.; Kozyavkin, S.; Weimer, B.; Mills, D.

2006-06-01

369

Protection of probiotic bacteria in synbiotic matrices  

Science.gov (United States)

Probiotics, like Lactobacillus acidophilus, Lactobacillus reuteri, Bifidobacterium breve, Bifidobacterium longum, when encapsulated with prebiotic fibers such as fructo-oligosaccharides (FOS), inulin (I) and pectic-oligosaccharides (POS), formed a synbiotic matrix system that protected the bacteria ...

370

Methylation of ribosomal proteins in bacteria: evidence of conserved modification of the eubacterial 50S subunit.  

OpenAIRE

Methylation of the 50S ribosomal proteins from Bacillus stearothermophilus, Bacillus subtilis, Alteromonas espejiana, and Halobacterium cutirubrum was measured after the cells were grown in the presence of [1-14C]methionine or [methyl-3H]methionine or both. Two-dimensional polyacrylamide gel electrophoretic analysis revealed, in general, similar relative electrophoretic mobilities of the methylated proteins from each eubacterium studied. Proteins known to be structurally and functionally homo...

Amaro, A. M.; Jerez, C. A.

1984-01-01

371

Antimicrobial activity of lysozyme against bacteria involved in food spoilage and food-borne disease.  

OpenAIRE

Egg white lysozyme was demonstrated to have antibacterial activity against organisms of concern in food safety, including Listeria monocytogenes and certain strains of Clostridium botulinum. We also found that the food spoilage thermophile Clostridium thermosaccharolyticum was highly susceptible to lysozyme and confirmed that the spoilage organisms Bacillus stearothermophilus and Clostridium tyrobutyricum were also extremely sensitive. Several gram-positive and gram-negative pathogens isolate...

Hughey, V. L.; Johnson, E. A.

1987-01-01

372

Study of Lactobacillus as Probiotic Bacteria  

OpenAIRE

Because of inhibitory effect, selected probiotic lactobacilli may be used as biological preservative, so, the aim of this study was to present some data on lactobacillus as probiotic bacteria. Lactic acid bacteria were isolated from sausage. Each isolate of lactobacillus species was identified by biochemical tests and comparing their sugar fermentation pattern. Antibacterial activities were done by an agar spot, well diffusion and blank disk method. Enzyme sensitivity of supernatant fluid and...

Nowroozi, J.; Mirzaii, M.; Norouzi, M.

2004-01-01

373

Rapid methods for detection of bacteria  

OpenAIRE

Traditional methods for detection of bacteria in drinking water e.g. Heterotrophic Plate Counts (HPC) or Most Probable Number (MNP) take 48-72 hours to give the result. New rapid methods for detection of bacteria are needed to protect the consumers against contaminations. Two rapid methods: Measurements of Adosine Triphosphate and BactiQuantTM have shown promising results as new monitoring tools, which gives the result within minutes/hours.

Corfitzen, Charlotte B.; Andersen, B. Ø.; Miller, M.; Ursin, C.; Arvin, Erik; Albrechtsen, Hans-jørgen

2006-01-01

374

Systemic resistance induced by rhizosphere bacteria  

OpenAIRE

Nonpathogenic rhizobacteria can induce a systemic resistance in plants that is phenotypically similar to pathogen-induced systemic acquired resistance (SAR). Rhizobacteria-mediated induced systemic resistance (ISR) has been demonstrated against fungi, bacteria, and viruses in Arabidopsis, bean, carnation, cucumber, radish, tobacco, and tomato under conditions in which the inducing bacteria and the challenging pathogen remained spatially separated. Bacterial strains differ in their ability to ...

Loon, L. C.; Bakker, P. A. H. M.; Pieterse, C. M. J.

1998-01-01

375

Investigating the Uses of Backyard Bacteria  

Science.gov (United States)

The purpose of this lab is to recognize that the answers to some of society's industrial challenges may lie right in our own backyards. Learners discover how to select protein-digesting bacteria from various soil samples. After isolating the colonies, learners are then encouraged to investigate ways to test the effectiveness of their specimens in breaking down protein stains on clothing. This activity demonstrates how bacteria with specific enzymatic capabilities can be isolated with a simple microbiology technique. Adult supervision recommended.

Elisa Brako

2009-01-01

376

Biotechnology Curriculum Freshman Exploratory: Growing Bacteria  

Science.gov (United States)

Bacteria are everywhere in the environment. To prove this in this activity, students will take samples of different surfaces around the classroom, and nearby places, as well as their own fingers. To detect bacteria, students will need to provide food for them to grow on. Students will be using the nutrient agar plates that have already been prepared. This lesson plan document may be downloaded in Microsoft Word file format.

Kurtz, Mary Jane

377

Diversity of Rumen Bacteria in Canadian Cervids  

OpenAIRE

Interest in the bacteria responsible for the breakdown of lignocellulosic feedstuffs within the rumen has increased due to their potential utility in industrial applications. To date, most studies have focused on bacteria from domesticated ruminants. We have expanded the knowledge of the microbial ecology of ruminants by examining the bacterial populations found in the rumen of non-domesticated ruminants found in Canada. Next-generation sequencing of 16S rDNA was employed to characterize the ...

Gruninger, Robert J.; Sensen, Christoph W.; Mcallister, Timothy A.; Forster, Robert J.

2014-01-01

378

Corrosion inhibition of steel by bacteria  

Energy Technology Data Exchange (ETDEWEB)

Mild steel was exposed to Pseudomonas sp. S9 or Serratia marcescens in synthetic seawater. An increase in corrosion resistance over that i natural seawater was monitored by electrochemical techniques. Biological analyses were performed to characterize the system. The inhibition effect also was observed when mild steel was coated with bacteria and then immersed in synthetic seawater. When specimens coated with bacteria were transferred to a natural seawater flow system, the inhibition effect disappeared during the first 2 weeks.

Hernandez, G.; Kucera, V.; Thierry, D.; Pedersen, A. (Swedish Corrosion Inst., Stockholm (Sweden)); Hermansson, M. (Univ. of Gothenburg (Sweden). Dept. of General and Marine Microbiology)

1994-08-01

379

[Conjugation mapping of Pseudomonas mendocina bacteria].  

Science.gov (United States)

Donor strains of the Hfr type were isolated using plasmid pRK2013 with transposons Tn10 and Tn5 as a chromosome-mobilizing factor. The isolated strains were shown to promote transfer of donor chromosome from different origins in different directions during isogenic matings of Pseudomonas mendocina bacteria. The created collection of donors and polyauxotrophic recipient bacteria permitted mapping 26 genetic determinants on the bacterial chromosome and identifying the genome of these microorganisms as a circular DNA molecule. PMID:14714457

Vasilenko, S L; Maksimova, N P; Titok, M A

2003-11-01

380

Peroxide-Sensing Transcriptional Regulators in Bacteria  

OpenAIRE

The ability to maintain intracellular concentrations of toxic reactive oxygen species (ROS) within safe limits is essential for all aerobic life forms. In bacteria, as well as other organisms, ROS are produced during the normal course of aerobic metabolism, necessitating the constitutive expression of ROS scavenging systems. However, bacteria can also experience transient high-level exposure to ROS derived either from external sources, such as the host defense response, or as a secondary effe...

Dubbs, James M.; Mongkolsuk, Skorn

2012-01-01

381

Molecular approaches to study probiotic bacteria  

OpenAIRE

Functional foods comprising probiotic bacteria are receiving increasing attention from the scientific community and science funding agencies [1]. An essential aspect relating to the functionality of probiotic-based foods is to develop molecular methods to determine the presence, activity and viability of probiotic bacteria in the human gastrointestinal (GI) tract [2]. The GI tract is composed of a complex ecosystem of various microbial habitats colonized by numerous different commensal micro-...

Vaughan, E. E.; Heilig, G. H. J.; Zoetendal, E. G.; Satokari, R.; Collins, J. K.; Akkermans, A. D. L.; Vos, W. M.

2000-01-01

382

Bacteria Are Omnipresent on Phanerochaete chrysosporium Burdsall  

OpenAIRE

Bacteria have been isolated from 10 different strains of Phanerochaete chrysosporium, a white rot fungus which degrades lignocellulosic materials. The investigations showed that one or more bacterial species were always associated with the fungus. Various attempts to eliminate the bacteria on the fungus were unsuccessful. Three different bacterial species were isolated and identified. One of these was Agrobacterium radiobacter, while another may represent a new taxon close to the genus Burkho...

Seigle-murandi, F.; Guiraud, P.; Croize, J.; Falsen, E.; Eriksson, K. L.

1996-01-01

383

Glucose Biosensor Using Selected Indonesian Bacteria  

OpenAIRE

Microbial glucose sensors have been developed using Escherichia coli bacterial strains from Japan. However, there is interest in developing local bacteria as glucose sensors in Indonesia. In this research, the stability and the potential of a selected number of Indonesian bacteria as glucose biosensors was explored. Results of this study indicate that three of them, E. coli, Bacillus subtilis, and Thermus filiformis exhibit properties of high viability and stability at high temperature (30...

DYAH ISWANTINI; NOVIK; TRIVADILA

2011-01-01

384

Study of Lactobacillus as Probiotic Bacteria  

Directory of Open Access Journals (Sweden)

Full Text Available Because of inhibitory effect, selected probiotic lactobacilli may be used as biological preservative, so, the aim of this study was to present some data on lactobacillus as probiotic bacteria. Lactic acid bacteria were isolated from sausage. Each isolate of lactobacillus species was identified by biochemical tests and comparing their sugar fermentation pattern. Antibacterial activities were done by an agar spot, well diffusion and blank disk method. Enzyme sensitivity of supernatant fluid and concentrated cell free culture after treatment with ?-amylase, lysozyme and trypsin was determined. The isolated bacteria were Lacto. plantarum, Lacto delbruekii, Lacto. acidophilus, Lacto. brevis. The isolated bacteria had strong activity against indicator strains. The antibacterial activity was stable at 100ºC for 10 min and at 56ºC for 30 min, but activity was lost after autoclaving. The maximum production of plantaricin was obtained at 25 - 30ºC at pH 6.5. Because, lactobacilli that used to process sausage fermentation are producing antimicrobial activity with heat stability bacteriocin, so, these bacteria may be considered to be a healthy probiotic diet. Lactobacilli originally isolated from meat products are the best condidates as probiotic bacteria to improve the microbiological safety of these foods.

J Nowroozi

2004-07-01

385

Molecular probe technology detects bacteria without culture  

Directory of Open Access Journals (Sweden)

Full Text Available Abstract Background Our ultimate goal is to detect the entire human microbiome, in health and in disease, in a single reaction tube, and employing only commercially available reagents. To that end, we adapted molecular inversion probes to detect bacteria using solely a massively multiplex molecular technology. This molecular probe technology does not require growth of the bacteria in culture. Rather, the molecular probe technology requires only a sequence of forty sequential bases unique to the genome of the bacterium of interest. In this communication, we report the first results of employing our molecular probes to detect bacteria in clinical samples. Results While the assay on Affymetrix GenFlex Tag16K arrays allows the multiplexing of the detection of the bacteria in each clinical sample, one Affymetrix GenFlex Tag16K array must be used for each clinical sample. To multiplex the clinical samples, we introduce a second, independent assay for the molecular probes employing Sequencing by Oligonucleotide Ligation and Detection. By adding one unique oligonucleotide barcode for each clinical sample, we combine the samples after processing, but before sequencing, and sequence them together. Conclusions Overall, we have employed 192 molecular probes representing 40 bacteria to detect the bacteria in twenty-one vaginal swabs as assessed by the Affymetrix GenFlex Tag16K assay and fourteen of those by the Sequencing by Oligonucleotide Ligation and Detection assay. The correlations among the assays were excellent.

Hyman Richard W

2012-03-01

386

Nutritional Interdependence Among Rumen Bacteria During Cellulose Digestion In Vitro  

OpenAIRE

A study has been made of the promoting effect of starch on cellulose digestion by mixed rumen bacteria in a cellulose-urea medium. Starch supplementation of the medium promoted the growth of bacteria that required neither amino acids (AA) nor branched-chain fatty acids (BrFA). The growth of these bacteria was followed by the growth of AA-dependent bacteria, AA- or BrFA-dependent bacteria, BrFA-producing bacteria, and finally, BrFA-dependent cellulolytic bacteria. Population changes of these b...

Miura, Hideki; Horiguchi, Masaaki; Ogimoto, Keiji; Matsumoto, Tatsuro

1983-01-01

387

The growth of bacteria on organic compounds in drinking water  

OpenAIRE

Growth ("regrowth") of bacteria In drinking water distribution systems results in a deterioration of the water quality. Regrowth of chemoheterotrophic bacteria depends on the presence of organic. compounds that serve as a nutrient source for these bacteria. A batch-culture technique was developed to study the growth of bacteria in drinking water. The maximum colony counts of selected pure cultures of bacteria grown in drinking water were used as a measure for the concentration of easily assim...

Kooy, D.

1984-01-01

388

Dispersal of non-sporeforming anaerobic bacteria from the skin.  

OpenAIRE

Dispersal of non-sporeforming anaerobic bacteria was studied. Skin samples were taken from the subjects, and dispersed from different parts of the body was examined. The number of anaerobic bacteria dispersed was not correlated to their density on the surface of skin area exposed. The highest density of anaerobic bacteria on the skin was found in the face and upper trunk, but the highest yield of anaerobic bacteria dispersed came from the lower trunk. The dominant anaerobic bacteria dispersed...

Benediktsda?³ttir, E.; Hambraeus, A.

1982-01-01

389

Antioxidant and Antimicrobial Potential of the Bifurcaria bifurcata Epiphytic Bacteria  

OpenAIRE

Surface-associated marine bacteria are an interesting source of new secondary metabolites. The aim of this study was the isolation and identification of epiphytic bacteria from the marine brown alga, Bifurcaria bifurcata, and the evaluation of the antioxidant and antimicrobial activity of bacteria extracts. The identification of epiphytic bacteria was determined by 16S rRNA gene sequencing. Bacteria extracts were obtained with methanol and dichloromethane (1:1) extraction. The antioxidant act...

André Horta; Susete Pinteus; Celso Alves; Nádia Fino; Joana Silva; Sara Fernandez; Américo Rodrigues; Rui Pedrosa

2014-01-01

390

Using Fluorescent Viruses for Detecting Bacteria in Water  

Science.gov (United States)

A method of detecting water-borne pathogenic bacteria is based partly on established molecular-recognition and fluorescent-labeling concepts, according to which bacteria of a species of interest are labeled with fluorescent reporter molecules and the bacteria can then be detected by fluorescence spectroscopy. The novelty of the present method lies in the use of bacteriophages (viruses that infect bacteria) to deliver the fluorescent reporter molecules to the bacteria of the species of interest.

Tabacco, Mary Beth; Qian, Xiaohua; Russo, Jaimie A.

2009-01-01

391

Killing Effect of Membrane Vesicles Produced by Gram-negative Bacteria on Other Bacteria  

OpenAIRE

The gram-negative bacteria Citrobacter freundii, Enterobacter cloacae NCTC10005, Erwinia carotovora NCPPB312, Klebsiella pneumoniae, Proteus vulgaris 1753 and Serratia marcescens HIM 307-2 produced natural outer membrane vesicles under normal growth conditions. The membrane vesicles showed bacteriolytic activities against different gram-positive and gram-negative host bacteria. Different killing potencies were obtained by membrane vesicles of differen...

Azab, Essam A.; Osfor, Mostafa H.; Seleem, Iman A.

2005-01-01

392

Method of Detecting Coliform Bacteria and Escherichia Coli Bacteria from Reflected Light  

Science.gov (United States)

The present invention relates to a method of detecting coliform bacteria in water from reflected light and a method of detecting Eschericha Coli bacteria in water from reflected light, and also includes devices for the measurement, calculation and transmission of data relating to that method.

Vincent, Robert (Inventor)

2013-01-01

393

Bacterias, fuente de energía para el futuro / Bacteria, source of energy for the future  

Scientific Electronic Library Online (English)

Full Text Available SciELO Colombia | Language: Spanish Abstract in spanish En el presente trabajo expone una familia de bacterias denominadas Geobacter que tienen la capacidad de producir energía eléctrica como fuente renovable en una celda de combustible microbiana. Estas bacterias pueden oxidar totalmente compuestos orgánicos empleando diferentes elementos o sustancias c [...] omo aceptores de electrones. El trabajo aborda características principales de la bacteria, como los mecanismos utilizados para aprovechar la electricidad que genera y una aproximación sobre el sistema requerido para convertirla en una fuente de energía renovable competitiva. Los resultados muestran un análisis comparativo de fuentes de energía convencionales y no convencionales con respecto a la familia de bacterias Geobacter. Abstract in english This paper presents a family of bacteria called Geobacter that have the ability to produce power as a renewable source in a microbial fuel cell. These bacteria can completely oxidize organic compounds using different elements or substances as electron acceptors. The paper addresses key features of t [...] he bacteria, the mechanisms used to harness the electricity generated and an approximation of the system required to become a competitive source of renewable energy. The results show a comparative analysis of sources of conventional and unconventional energy with respect to the Geobacter family of bacteria.

Alba Ayde, Romero Mejía; Jorge Adrian, Vásquez; Armando, Lugo González.

2012-04-01

394

Biodegradation of 17?-ethinylestradiol by heterotrophic bacteria  

International Nuclear Information System (INIS)

The presence of the synthetic estrogen 17?-ethinylestradiol (EE2) in the environment is of increasing concern due to the endocrine disruption of aquatic organisms. Incomplete removal from wastewater (WW) is one of the main sources of EE2 in aquatic ecosystems, thus improving processes like biological WW treatment/activated sludge (AS) is becoming significantly important. There are opposing results regarding EE2 biodegradability by AS; one discrepancy is the efficacy of heterotrophic bacteria. This research demonstrated the ability of heterotrophs commonly present in AS (B. subtilis, P. aeruginosa, P. putida, R. equi, R. erythropolis, R. rhodochrous, R. zopfii) to remove EE2. R. rhodochrous was the most successful with no detectable EE2 after 48 h; the other bacteria achieved 21%–61% EE2 removal. No additive or synergistic effects were observed due to the combination of the bacterial cultures with maximum EE2 removals of 43% after 300 h. - Highlights: ? Seven species of heterotrophic bacteria demonstrated the ability to degrade EE2. ? Rhodococcus species (especially R. rhodochrous) were the most successful. ? EE2 degradation by individual bacteria does not represent the capability of mixtures. ? Slight differences in bacterial mixture composition impact degradation trends. - Heterotrophic bacteria, especially Rhodococcus species, are capable of successfully degrading 17?-ethinylestradiol (EE2).

395

Single bacteria identification by Raman spectroscopy  

Science.gov (United States)

We report on rapid identification of single bacteria using a low-cost, compact, Raman spectroscope. We demonstrate that a 60-s procedure is sufficient to acquire a comprehensive Raman spectrum in the range of 600 to 3300. This time includes localization of small bacteria aggregates, alignment on a single individual, and spontaneous Raman scattering signal collection. Fast localization of small bacteria aggregates, typically composed of less than a dozen individuals, is achieved by lensfree imaging over a large field of view of 24. The lensfree image also allows precise alignment of a single bacteria with the probing beam without the need for a standard microscope. Raman scattered light from a 34-mW continuous laser at 532 nm was fed to a customized spectrometer (prototype Tornado Spectral Systems). Owing to the high light throughput of this spectrometer, integration times as low as 10 s were found acceptable. We have recorded a total of 1200 spectra over seven bacterial species. Using this database and an optimized preprocessing, classification rates of ˜90% were obtained. The speed and sensitivity of our Raman spectrometer pave the way for high-throughput and nondestructive real-time bacteria identification assays. This compact and low-cost technology can benefit biomedical, clinical diagnostic, and environmental applications.

Strola, Samy Andrea; Baritaux, Jean-Charles; Schultz, Emmanuelle; Simon, Anne Catherine; Allier, Cédric; Espagnon, Isabelle; Jary, Dorothée; Dinten, Jean-Marc

2014-11-01

396

Bacteria and plutonium in marine environments  

International Nuclear Information System (INIS)

Microbes are important in geochemical cycling of many elements. Recent reports emphasize biogenous particulates and bacterial exometabolites as controlling oceanic distribution of plutonium. Bacteria perform oxidation/reduction reactions on metals such as mercury, nickel, lead, copper, and cadmium. Redox transformations or uptake of Pu by marine bacteria may well proceed by similar mechanisms. Profiles of water samples and sediment cores were obtained along the continental shelf off Nova Scotia and in the Gulf of St. Lawrence. Profiles of water samples, and sediment cores were obtained. Epifluorescent microscopy was used to view bacteria (from water or sediment) after concentration on membrane filters and staining with acridine orange. Radiochemical analyses measured Pu in sediments and water samples. Studies of 237Pu uptake used a strain of Leucothrix mucor isolated from a macroalga. Enumeration shows bacteria to range 104 to 105 cells/ml in seawater or 107 to 108 cells/gram of sediment. These numbers are related to the levels and distrbution of Pu in the samples. In cultures of L. mucor amended with Pu atom concentrations approximating those present in open ocean environments, bacterial cells concentrated 237Pu slower and to lower levels than did clay minerals, glass beads, or phytoplankton. These data further clarify the role of marine bacteria in Pu biogeochemistryemistry

397

Bacteria dispersal by hitchhiking on zooplankton  

DEFF Research Database (Denmark)

Microorganisms and zooplankton are both important components of aquatic food webs. Although both inhabit the same environment, they are often regarded as separate functional units that are indirectly connected through nutrient cycling and trophic cascade. However, research on pathogenic and nonpathogenic bacteria has shown that direct association with zooplankton has significant influences on the bacteria's physiology and ecology. We used stratified migration columns to study vertical dispersal of hitchhiking bacteria through migrating zooplankton across a density gradient that was otherwise impenetrable for bacteria in both upward and downward directions (conveyor-belt hypothesis). The strength of our experiments is to permit quantitative estimation of transport and release of associated bacteria: vertical migration of Daphnia magna yielded an average dispersal rate of 1.3 x 10(5) x cells x Daphnia(-1) x migration cycle(-1) for the lake bacterium Brevundimonas sp. Bidirectional vertical dispersal by migrating D. magna was also shown for two other bacterial species, albeit at lower rates. The prediction that diurnally migrating zooplankton acquire different attached bacterial communities from hypolimnion and epilimnion between day and night was subsequently confirmed in our field study. In mesotrophic Lake Nehmitz, D. hyalina showed pronounced diel vertical migration along with significant diurnal changes in attached bacterial community composition. These results confirm that hitchhiking on migrating animals can be an important mechanism for rapidly relocating microorganisms, including pathogens, allowing them to access otherwise inaccessible resources.

Grossart, Hans-Peter; Dziallas, Claudia

2010-01-01

398

A RAPD-based comparison of thermophilic bacilli from milk powders.  

Science.gov (United States)

The similarity of strains of thermophilic Geobacillus stearothermophilus (formerly Bacillus stearothermophilus), Anoxybacillus flavithermus (formerly Bacillus flavothermus), Bacillus licheniformis and Bacillus subtilis isolated from separate milk powder production runs from multiple factories was examined using a random amplified polymorphic DNA (RAPD) protocol. As a result of the analysis of the RAPD fingerprints and data relating to general growth and biochemical tests, over 98% of the 1470 isolates examined (grown at 55 degrees C) were assigned to the species G. stearothermophilus, A. flavithermus, B. licheniformis and B. subtilis. The G. stearothermophilus isolates were identified as being nearly identical to G. stearothermophilus (DSMZ 22; equivalent to ATCC 12980), or G. stearothermophilus var. calidolactis (DSMZ 1550). Three groups of isolates were found to be related to A. flavithermus (DSMZ 2641) by partial small ribosomal subunit (16S) sequence comparisons and shown to be interrelated by RAPD analyses with multiple primer sets. The thermophilic isolates of B. licheniformis were positively identified by comparison with type strains of B. licheniformis DSMZ 13 and DSMZ 8785. All of the B. subtilis strains shared bands in their RAPD profiles and were similar to a common B. subtilis type strain (DSMZ 10 and DSMZ 347). Overall, the most common and prevalent group of strains (group A) was demonstrated to be closely related to G. stearothermophilus (DSMZ 22). PMID:12810270

Ronimus, Ron S; Parker, Lynne E; Turner, Nicola; Poudel, Sushma; Rückert, Andreas; Morgan, Hugh W

2003-08-15

399

Chemotaxis When Bacteria Remember: Drift versus Diffusion  

CERN Document Server

Escherichia coli (E. coli) bacteria govern their trajectories by switching between running and tumbling modes as a function of the nutrient concentration they experienced in the past. At short time one observes a drift of the bacterial population, while at long time one observes accumulation in high-nutrient regions. Recent work has pointed to an apparent theoretical contradiction between drift toward favorable regions and accumulation in favorable regions. A number of such earlier studies assume that a bacterium resets its memory at tumbles -- a fact not borne out by experiment -- and make use of approximate coarse-grained descriptions. Here, we revisit the problem of chemotaxis without resorting to any memory resets. We find that when bacteria respond to the environment in a non-adaptive manner, chemotaxis is generally dominated by diffusion, whereas when bacteria respond in an adaptive manner, chemotaxis is dominated by a bias in the motion. In all cases, the apparent contradiction between favorable drift ...

Chatterjee, Sakuntala; Kafri, Yariv

2011-01-01

400

Encapsulation of probiotic bacteria in biopolymeric system.  

Science.gov (United States)

Encapsulation of probiotic bacteria is generally used to enhance the viability during processing, and also for the target delivery in gastrointestinal tract. Probiotics are used with the fermented dairy products, pharmaceutical products, and health supplements. They play a great role in maintaining human health. The survival of these bacteria in the human gastrointestinal system is questionable. In order to protect the viability of the probiotic bacteria, several types of biopolymers such as alginate, chitosan, gelatin, whey protein isolate, cellulose derivatives are used for encapsulation and several methods of encapsulation such as spray drying, extrusion, emulsion have been reported. This review focuses on the method of encapsulation and the use of different biopolymeric system for encapsulation of probiotics. PMID:23768183

Huq, Tanzina; Khan, Avik; Khan, Ruhul A; Riedl, Bernard; Lacroix, Monique

2013-01-01

401

Isolation of aerobic bacteria from the placenta.  

Science.gov (United States)

Cultures for aerobic bacteria were prepared from 353 placentas. Specimens were taken from the chorion after removing the amnion. The specimens were immersed into Stuart transport medium. Microscopic examination of the placenta and cultures from the throat and ear of newborns were also done. The rate of positive bacterial cultures was 16%. Chorioamnionitis was found in 15%. The proportion of chorioamnionitis caused by aerobic bacteria was 44%. The rate of positive bacterial cultures from the placenta in the group of newborns with clinical signs of intrauterine infection was 63%. Bacteria can be present on the chorionic plate without any histological evidence of chorioamnionitis. Bacteriological examination of the placenta is therefore mandatory when amniotic fluid infection is suspected. PMID:6817588

Kovalovszki, L; Villányi, Z; Pataki, I; Veszelowvsky, I; Nagy, Z B

1982-01-01

402

Living Without Oxygen: Oxygen Tolerance in Bacteria  

Science.gov (United States)

This activity focuses on chemical processes, such as nitrogen fixation and denitrification, which are carried out by bacteria. Often the efficacy of these processes is determined by the amount of oxygen present in the environment in which the bacteria live. Much of the time, these processes are carried out by facultatively anaerobic bacteria in the suboxic region of lakes, oceans, sediments, and leaf litter. Students will discover whether facultatively anaerobic photoautotrophs share the same tolerance for oxygen, how differences in oxygen tolerance can be tested, and of what significance the tolerance for oxygen is in the nitrogen cycle. They will practice aseptic technique, monitor the growth of bacterial cultures, display their results graphically, and propose environmental problems associated with the oxygen tolerance of nitrogen fixers and denitifiers.

Sharon Harris

403

Detection of cytosolic bacteria by inflammatory caspases.  

Science.gov (United States)

The sanctity of the cytosolic compartment is rigorously maintained by a number of innate immune mechanisms. Inflammasomes detect signatures of microbial infection and trigger caspase-1 or caspase-11 activation, culminating in cytokine secretion and obliteration of the replicative niche via pyroptosis. Recent studies have examined inflammatory caspase responses to cytosolic bacteria, including Burkholderia, Shigella, Listeria, Francisella, and Mycobacterium species. For example, caspase-11 responds to LPS introduced into the cytosol after Gram-negative bacteria escape the vacuole. Not surprisingly, bacteria antagonize these responses; for example, Shigella delivers OspC3 to inhibit caspase-4, a potential human homolog of murine caspase-11. These findings underscore bacterial coevolution with the innate immune system, which has resulted in few, but highly specialized cytosolic pathogens. PMID:24581694

Hagar, Jon A; Miao, Edward A

2014-02-01

404

Study examines sulfate-reducing bacteria activity  

Energy Technology Data Exchange (ETDEWEB)

Low-sulfate seawater injection can reduce the potential of an oil reservoir turning sour because of sulfate-reducing bacteria. Sulfate-reducing bacteria (SRB) convert sulfate ions in seawater used in waterflooding into sulfide with the concomitant oxidation of a carbon source. A recent study at Capcis investigated the efficiency of SRB under various conditions of sulfate limitation. This study was conducted in a flowing bioreactor at 2,000 psia with different temperature zones (mesophilic 35 C and thermophilic 60--80 C). The study mixed microfloral populations derived from real North Sea-produced fluids, and included an active population of marine methanogenic bacteria present to provide competition for the available carbon sources. In general, results showed that SRB continue to convert sulfate to sulfide in stoichiometric quantities without regard to absolute concentrations. The paper discusses the results and recommends nanofiltration of seawater for ``sweet`` reservoirs.

McElhiney, J.E.; Hardy, J.A. [Marathon Oil Co., Littleton, CO (United States); Rizk, T.Y.; Stott, J.F.D.; Eden, R.D. [UMIST, Manchester (United Kingdom)

1996-12-09

405

Intestinal barrier dysfunction triggered by invasive bacteria.  

Science.gov (United States)

The ability to control uptake across the mucosa and to protect the gut from harmful substances present in the lumen is defined as intestinal barrier function. Two routes are usually distinguished for transepithelial transport. The paracellular route allows the passage of ions and small molecules and is mainly regulated by tight junctions (TJ). The transcellular route concerns large molecules or small particles (including bacteria) and is mediated by cell endocytosis and intracellular vesicular traffic. Enteropathogenic bacteria increase the transcellular permeability, especially in the follicle-associated epithelium. They also modulate TJ opening via the redistribution of TJ proteins and the activation of the myosin light chain kinase (MLCK). This review focuses on the molecular mechanisms involved in the bacteria-induced barrier defect and briefly discusses their consequences in human diseases. PMID:24440560

Barreau, F; Hugot, J P

2014-02-01

406

Bacteria?Triggered Release of Antimicrobial Agents  

DEFF Research Database (Denmark)

Medical devices employed in healthcare practice are often susceptible to microbial contamination. Pathogenic bacteria may attach themselves to device surfaces of catheters or implants by formation of chemically complex biofilms, which may be the direct cause of device failure. Extracellular bacterial lipases are particularly abundant at sites of infection. Herein it is shown how active or proactive compounds attached to polymeric surfaces using lipase?sensitive linkages, such as fatty acid esters or anhydrides, may be released in response to infection. Proof?of?concept of the responsive material is demonstrated by the bacteria?triggered release of antibiotics to control bacterial populations and signaling molecules to modulate quorum sensing. The self?regulating system provides the basis for the development of device?relevant polymeric materials, which only release antibiotics in dependency of the titer of bacteria surrounding the medical device.

Komnatnyy, Vitaly V.; Chiang, Wen?Chi

2014-01-01

407

Bacteria-Triggered Release of Antimicrobial Agents  

DEFF Research Database (Denmark)

Medical devices employed in healthcare practice are often susceptible to microbial contamination. Pathogenic bacteria may attach themselves to device surfaces of catheters or implants by formation of chemically complex biofilms, which may be the direct cause of device failure. Extracellular bacterial lipases are particularly abundant at sites of infection. Herein it is shown how active or proactive compounds attached to polymeric surfaces using lipase?sensitive linkages, such as fatty acid esters or anhydrides, may be released in response to infection. Proof?of?concept of the responsive material is demonstrated by the bacteria?triggered release of antibiotics to control bacterial populations and signaling molecules to modulate quorum sensing. The self?regulating system provides the basis for the development of device?relevant polymeric materials, which only release antibiotics in dependency of the titer of bacteria surrounding the medical device.

Komnatnyy, Vitaly V.; Chiang, Wen-Chi

2014-01-01

408

Bacteria-triggered release of antimicrobial agents  

DEFF Research Database (Denmark)

Medical devices employed in healthcare practice are often susceptible to microbial contamination. Pathogenic bacteria may attach themselves to device surfaces of catheters or implants by formation of chemically complex biofilms, which may be the direct cause of device failure. Extracellular bacterial lipases are particularly abundant at sites of infection. Herein it is shown how active or proactive compounds attached to polymeric surfaces using lipase-sensitive linkages, such as fatty acid esters or anhydrides, may be released in response to infection. Proof-of-concept of the responsive material is demonstrated by the bacteria-triggered release of antibiotics to control bacterial populations and signaling molecules to modulate quorum sensing. The self-regulating system provides the basis for the development of device-relevant polymeric materials, which only release antibiotics in dependency of the titer of bacteria surrounding the medical device.

Komnatnyy, Vitaly V; Chiang, Wen-Chi

2014-01-01

409

Microgravity effects on pathogenicity of bacteria  

Directory of Open Access Journals (Sweden)

Full Text Available Microgravity is one of the important environmental conditions during spaceflight. A series of studies have shown that many kinds of bacteria could be detected in space station and space shuttle. Space environment or simulated microgravity may throw a certain influence on those opportunistic pathogens and lead to some changes on their virulence, biofilm formation and drug tolerance. The mechanism of bacteria response to space environment or simulated microgravity has not been defined. However, the conserved RNA-binding protein Hfq has been identified as a likely global regulator involved in the bacteria response to this environment. In addition, microgravity effects on bacterial pathogenicity may threaten astronauts' health. The present paper will focus on microgravity-induced alterations of pathogenicity and relative mechanism in various opportunistic pathogens.

Ya-juan WANG

2013-01-01

410

Urban ants and transportation of nosocomial bacteria.  

Science.gov (United States)

Many ant species displaying synanthropic behavior that have successfully dispersed in urban areas can cause problems in hospitals by acting as bacterial vectors. In this study, we encountered bacteria on ants collected at the Universidade Federal de Uberlândia hospital, in the campus and at households nearby. The ants were identified as Tapinoma melanocephalum (Fabricius) and Camponotus vittatus (Forel) (Hymenoptera: Formicidae) and the bacterial strains found here belong to the group of the coagulase-positive staphylococcus, coagulase-negative staphylococcus and gram negative bacilli, including antimicrobial drug-resistant strains. An investigation of the bacteria found in the ants and in the environment revealed that some ants carried non-isolated bacteria from the same environment and with high levels of resistance, evidencing the transmission potential of these insects. PMID:17710329

Rodovalho, Cynara M; Santos, Ana L; Marcolino, Marcus T; Bonetti, Ana M; Brandeburgo, Malcon A M

2007-01-01

411

Bacteria under SOS evolve anticancer phenotypes  

Directory of Open Access Journals (Sweden)

Full Text Available Abstract Background The anticancer drugs, such as DNA replication inhibitors, stimulate bacterial adhesion and induce the bacterial SOS response. As a variety of bacterial mutants can be generated during SOS, novel phenotypes are likely to be selected under the drug pressure. Presentation of the hypothesis Bacteria growing with cancer cells in the presence of the replication inhibitors undergo the SOS response and evolve advantageous phenotypes for the bacteria to invade the cancer cells in order to evade the drug attack. This hypothesis predicts that bacteria produce the proteins that mediate bacterial capture and invasion of cancer cells--the advantageous phenotypes. Generation of the phenotypes may be facilitated during the SOS response induced by anticancer drugs. Testing the hypothesis Experimental design: 1 Examine attachment and invasion of bacterium Pseudomonas aeruginosa and the SOS mutant control to cancer cells in the presence of the anticancer drugs that inhibit DNA replication enzymes and trigger the SOS response. 2 Reveal the bacterial proteins that exhibit changes in expression. 3 Identify the genes encoding cancer adhesion and invasion. 4 Construct the mutants for the genes, clone and express these genes. 5 Examine the bacterial capture and invasion of cancer cells in contrast to non-cancer control. Expected results: 1 The bacterial proteins will be differentially induced during bacteria-cancer interaction under the SOS response to the anticancer drugs. 2 Knocking out the bacterial cancer-adhesion-invasion genes will disrupt the adhesion-invasion phenotypes of the bacteria. 3 Expressing these genes will direct the bacterial capture and invasion of cancer cells. Implications of the hypothesis Bacteria can evolve anticancer phenotypes targeting metastatic cells. If this hypothesis is true, the outcomes will contribute to development of a novel bacterial anti-metastasis regimen.

Weitao Tao

2010-02-01

412

Challenges to validation of a complex nonsterile medical device tray.  

Science.gov (United States)

Validation by steam sterilization of reusable medical devices requires careful attention to many parameters that directly influence whether or not complete sterilization occurs. Complex implant/instrument tray systems have a variety of configurations and components. Geobacillus stearothermophilus biological indicators (BIs) are used in overkill cycles to to simulate worst case conditions and are intended to provide substantial sterilization assurance. Survival of G. stearothermophilus spores was linked to steam access and size of load in the chamber. By a small and reproducible margin, it was determined that placement of the trays in a rigid container into minimally loaded chambers were more difficult to completely sterilize than maximally loaded chambers. PMID:25046511

Prince, Daniel; Mastej, Jozef; Hoverman, Isabel; Chatterjee, Raja; Easton, Diana; Behzad, Daniela

2014-01-01

413

Degradation of monomethylhydrazine by two soil bacteria  

International Nuclear Information System (INIS)

It has been reported that three heterotrophic soil bacteria had the capacity to degrade hydrazine. One of these organisms, Achromobacter sp., degraded hydrazine to N2 gas. Furthermore, it was reported that monomethylhydrazine (MMH) in Arredondo fine sand was mineralized to CO2, and that such degradation is microbial. However, microorganisms that degrade MMH have not been reported. MMH and hydrazine are chemically similar to one another. Therefore, this study was initiated to test the capacity of the two hydrazine-degrading bacteria, Achromobacter sp. and Pseudomonas sp., to degrade MMH

414

Anammox bacteria: from discovery to application.  

Science.gov (United States)

Anaerobic ammonium oxidation (anammox) bacteria, which were discovered in waste-water sludge in the early 1990s, have the unique metabolic ability to combine ammonium and nitrite or nitrate to form nitrogen gas. This discovery led to the realization that a substantial part of the enormous nitrogen losses that are observed in the marine environment--up to 50% of the total nitrogen turnover--were due to the activity of these bacteria. In this Timeline, Gijs Kuenen recalls the discovery of these unique microorganisms and describes the continuing elucidation of their roles in environmental and industrial microbiology. PMID:18340342

Kuenen, J Gijs

2008-04-01

415

Bacterial biofilms. Bacteria Quorum sensing in biofilms  

Directory of Open Access Journals (Sweden)

Full Text Available Data on biofilms, their structure and properties, peculiarities of formation and interaction between microorganisms in the film are presented. Information on discovery and study of biofilms, importance of biofilms in the medical and clinical microbiology are offered. The data allow to interpret biofilm as a form of existence of human normal microflora. For the exchange of information within the biofilm between the individual cells of the same or different species bacteria use the signal molecules of the Quorum sensing system. Coordination of bacterial cells activity in the biofilms gives them significant advantages: in the biofilms bacteria are protected from the influence of the host protective factors and the antibacterial drugs.

E. S. Vorobey

2012-03-01

416

CHARACTERIZATION OF NATURAL MICROCOSMS OF ESTUARINE MAGNETOTACTIC BACTERIA / CARACTERIZACIÓN DE MICROCOSMOS NATURALES DE BACTERIAS MAGNETOTÁCTICAS ESTUARINAS  

Scientific Electronic Library Online (English)

Full Text Available SciELO Colombia | Language: English Abstract in spanish No se ha reportado ningún estudio completo sobre microcosmos naturales de bacterias magnetotácticas (MTB) en estuarios o ambientes tropicales. Además, casi todos los estudios sobre las bacterias magnetotácticas se han desarrollado en aguas dulces alejadas del ecuador. Este trabajo se desarrolla sobr [...] e el ecuador y reporta una caracterización mineralógica y fisicoquímica detallada de dos microcosmos bacterianos estuarinos. Los resultados muestran que la lixiviación de minerales en los sedimentos puede ser un factor importante en la solubilización de elementos requeridos por las bacterias magnetotácticas. Específicamente, que el clinocloro, flogopita, nontronita y haloisita pueden estar entre los minerales más importantes en la lixiviación de hierro a los microcosmos estuarinos. Se concluye que la concentración de nitrato en el agua no debe ser tan baja como se ha reportado para lograr un crecimiento bacteriano óptimo. Las bacterias magnetotácticas no necesitan grandes cantidades de hierro disuelto para su crecimiento ni para la síntesis de magnetosomas. Abstract in english To date, no complete study of magnetotactic bacteria's (MTB) natural microcosms in estuarine or tropical environments has been reported. Besides, almost all the studies around magnetotactic bacteria have been based on fresh waters away from the Equator. In this work, we focused the experimental regi [...] on at the Equator and present a comprehensive mineralogical and physicochemical characterization of two estuarine bacterial microcosms. The results show that mineral lixiviation in the sediments may be an important factor in the solubilization of elements required by magnetotactic bacteria. Specifically, we show that clinochlore, phlogopite, nontronite, and halloysite could be among the main minerals that lixiviate iron to the estuarine microcosms. We conclude that nitrate concentration in the water should not be as low as those that have been reported for other authors to achieve optimal bacteria growth. It is confirmed that magnetotactic bacteria do not need large amounts of dissolved iron to grow or to synthesize magnetosomes.

ALEJANDRO, SALAZAR; ALVARO, MORALES; MARCO, MÁRQUEZ.

2011-08-01

417

Flow cytometry, fluorescent probes, and flashing bacteria  

OpenAIRE

 Key words: fluorescent probes, flow cytometry, CSLM, viability, survival, microbial physiology, lactic acid bacteria, Lactococcus lactis , Lactobacillus plantarum , cheese, milk, probiotic In food industry there is a perceived need for rapid methods for detection and viability assessment of microbes. Fluorescent staining and flow cytometry provide excellent tools for microbial analysis. This thesis describes fluorescent techniques for assessment of the physiological sta...

Bunthof, C. J.

2002-01-01

418

ACETOGENIC BACTERIA ASSOCIATED WITH SEAGRASS ROOTS  

Science.gov (United States)

Seagrasses are adapted to being rooted in reduced, anoxic sediments with high rates of sulfate reduction. During the day, an oxygen gradient is generated around the roots, becoming anoxic at night. Thus, obligate anaerobic bacteria in the rhizosphere have to tolerate elevated oxy...

419

Propolis antimicrobial activity against periodontopathic bacteria  

OpenAIRE

Propolis extract antimicrobial activity against periodontopathic (ATCC) bacteria was investigated "in vitro". Bacterial strains tested were: Prevotella intermedia, Prevotella melaninogenica, Porphyromonas gingivalis, Actinobacillus actinomycetemcomitans, Capnocytophaga gingivalis and Fusobacterium nucleatum. Minimal inhibitory concentration (MIC) for the strains tested was determined using the method of broth dilution with the propolis extract in serial concentrations. Results showed MIC of 1...

Gebara Elaine C.E.; Lima Luiz A.; Mayer Marcia P.A.

2002-01-01

420

Antibiotic-Resistant Bacteria: There is Hope.  

Science.gov (United States)

Argues that reduction in the use of antibiotics would enable antibiotic-sensitive bacteria to flourish. Presents an activity designed to show students how a small, seemingly unimportant difference in doubling time can, over a period of time, make an enormous difference in population size. (DDR)

Offner, Susan

1998-01-01

421

Freeze-drying of lactic acid bacteria.  

Science.gov (United States)

Lactic acid bacteria are of great importance for the food and biotechnology industry. They are widely used as starters for manufacturing food (e.g., yogurt, cheese, fermented meats, and vegetables) and probiotic products, as well as for green chemistry applications. Freeze-drying or lyophilization is a convenient method for preservation of bacteria. By reducing water activity to values below 0.2, it allows long-term storage and low-cost distribution at suprazero temperatures, while minimizing losses in viability and functionality. Stabilization of bacteria via freeze-drying starts with the addition of a protectant solution to the bacterial suspension. Freeze-drying includes three steps, namely, (1) freezing of the concentrated and protected cell suspension, (2) primary drying to remove ice by sublimation, and (3) secondary drying to remove unfrozen water by desorption. In this chapter we describe a method for freeze-drying of lactic acid bacteria at a pilot scale, thus allowing control of the process parameters for maximal survival and functionality recovery. PMID:25428024

Fonseca, Fernanda; Cenard, Stéphanie; Passot, Stéphanie

2015-01-01

422

Metabolic plasticity for isoprenoid biosynthesis in bacteria.  

Science.gov (United States)

Isoprenoids are a large family of compounds synthesized by all free-living organisms. In most bacteria, the common precursors of all isoprenoids are produced by the MEP (methylerythritol 4-phosphate) pathway. The MEP pathway is absent from archaea, fungi and animals (including humans), which synthesize their isoprenoid precursors using the completely unrelated MVA (mevalonate) pathway. Because the MEP pathway is essential in most bacterial pathogens (as well as in the malaria parasites), it has been proposed as a promising new target for the development of novel anti-infective agents. However, bacteria show a remarkable plasticity for isoprenoid biosynthesis that should be taken into account when targeting this metabolic pathway for the development of new antibiotics. For example, a few bacteria use the MVA pathway instead of the MEP pathway, whereas others possess the two full pathways, and some parasitic strains lack both the MVA and the MEP pathways (probably because they obtain their isoprenoids from host cells). Moreover, alternative enzymes and metabolic intermediates to those of the canonical MVA or MEP pathways exist in some organisms. Recent work has also shown that resistance to a block of the first steps of the MEP pathway can easily be developed because several enzymes unrelated to isoprenoid biosynthesis can produce pathway intermediates upon spontaneous mutations. In the present review, we discuss the major advances in our knowledge of the biochemical toolbox exploited by bacteria to synthesize the universal precursors for their essential isoprenoids. PMID:23614721

Pérez-Gil, Jordi; Rodríguez-Concepción, Manuel

2013-05-15

423

Tolerance of anaerobic bacteria to chlorinated solvents.  

Science.gov (United States)

The aim of this research was to evaluate the effects of four chlorinated aliphatic hydrocarbons (CAHs), perchloroethene (PCE), carbon tetrachloride (CT), chloroform (CF) and 1,2-dichloroethane (1,2-DCA), on the growth of eight anaerobic bacteria: four fermentative species (Escherichia coli, Klebsiella sp., Clostridium sp. and Paenibacillus sp.) and four respiring species (Pseudomonas aeruginosa, Geobacter sulfurreducens, Shewanella oneidensis and Desulfovibrio vulgaris). Effective concentrations of solvents which inhibited growth rates by 50% (EC50) were determined. The octanol-water partition coefficient or log Po/w of a CAH proved a generally satisfactory measure of its toxicity. Most species tolerated approximately 3-fold and 10-fold higher concentrations of the two relatively more polar CAHs CF and 1,2-DCA, respectively, than the two relatively less polar compounds PCE and CT. EC50 values correlated well with growth rates observed in solvent-free cultures, with fast-growing organisms displaying higher tolerance levels. Overall, fermentative bacteria were more tolerant to CAHs than respiring species, with iron- and sulfate-reducing bacteria in particular appearing highly sensitive to CAHs. These data extend the current understanding of the impact of CAHs on a range of anaerobic bacteria, which will benefit the field of bioremediation. PMID:24441515

Koenig, Joanna C; Groissmeier, Kathrin D; Manefield, Mike J

2014-01-01

424

Radiographic markers - A reservoir for bacteria?  

Energy Technology Data Exchange (ETDEWEB)

Introduction: Amongst the most frequently handled objects in the radiology department are radiographic markers. They are personal accessories used with every patient, and are kept in the radiographers pockets when not utilised. Upon enquiry it was discovered that many radiographers disregarded the potential of these accessories to become a vector for cross-contamination thus never or rarely clean them. The aims of this study were therefore to identify if radiographic markers are a reservoir for bacteria and to establish an effective cleaning method for decontaminating them. Methodology: 25 radiographers/student radiographers were selected for this study. Swabbing of their markers prior and post cleaning took place. The microbiology laboratory subsequently analyzed the results by quantifying and identifying the bacteria present. The participants also completed a closed questionnaire regarding their markers (e.g. frequency of cleaning and type of marker) to help specify the results gained from the swabbing procedure. Results: From the sample swabbed, 92% were contaminated with various organisms including Staphylococcus and Bacillus species, the amount of bacteria present ranged from 0 to >50 CFU. There were no significant differences between disinfectant wipes and alcohol gel in decontaminating the markers. Both successfully reduced their bacterial load, with 80% of the markers post cleaning having 0 CFU. Conclusion: The results indicated that radiographic markers can become highly contaminated with various organisms thus serve as a reservoir for bacteria. In addition, the markers need to be cleaned on a regular basis, with either disinfectant wipes or alcohol gel to reduce their bacterial load.

Tugwell, Jenna, E-mail: jenna.tugwell@googlemail.co [Department of Radiology, Ysbyty Gwynedd Hospital, Bangor, North Wales (United Kingdom); Maddison, Adele [Nuffield Health, Shrewsbury Hospital (United Kingdom)

2011-05-15

425

Occurrence of ?-Aminoglutaric Acid in Marine Bacteria  

OpenAIRE

?-Aminoglutaric acid, a nonprotein amino acid isomer of glutamic acid, was found in the free amino acid pool of a marine bacterium, Alteromonas luteoviolacea. It was also found in a mixed culture of fermenting bacteria enriched from an anoxic marine sediment.

Henrichs, Susan M.; Cuhel, Russell

1985-01-01

426

Identification of marine methanol-utilizing bacteria  

Energy Technology Data Exchange (ETDEWEB)

A taxonomical study of 65 marine methanol-utilizing bacteria is described. They were Gram-negative, non-spore-forming rods with a polar flagellum and had marine bacterial properties and required vitamin B/sub 12/ for growth. All of them assimilated fructose in addition to C/sub 1/-compounds and produced acid oxidatively from fructose. Twenty-four strains assimilated only C/sub 1/-compounds. They were resistant to penicillin, oxytetracycline and 0/129 substance (Vibrio stat), and tolerant to 12% NaCl. Guanine-cytosine contents of deoxyribonucleic acid in typical strains fell in the range of 43.8 to 47.6%. Other morphological and physiological properties were almost the same as those of terrestrial methanol-utilizers. Bacteria in the first group (41 strains) were facultative methylotrophs and were divided into three subgroups by the assimilation of methylated amines, that is, subgroup I (30 strains) assimilated mono-, di- and tri-methylamine, subgroup II (9 strains) assimilated only mono-methylamine, the bacteria of subgroups I and II were named Alteromonas thalassomethanolica sp. nov. and subgroup III (2 strains) did not assimilate methylated amines, and was tentatively assigned as Alteromonas sp. The second group of bacteria (24 strains) was obligate methylotrophs, named Methylomonas thalassica sp. nov. and was divided into subgroup IV (15 strains) which assimilated mono-, di and tri-methylamine and subgroup V (9 strains) which assimilated mono-methylamine.

Yamamoto, M.; Iwaki, H.; Kouno, K.; Inui, T.

1980-01-01

427

Collective Sensing-Capacity of Bacteria Populations  

CERN Document Server

The design of biological networks using bacteria as the basic elements of the network is initially motivated by a phenomenon called quorum sensing. Through quorum sensing, each bacterium performs sensing the medium and communicating it to others via molecular communication. As a result, bacteria can orchestrate and act collectively and perform tasks impossible otherwise. In this paper, we consider a population of bacteria as a single node in a network. In our version of biological communication networks, such a node would communicate with one another via molecular signals. As a first step toward such networks, this paper focuses on the study of the transfer of information to the population (i.e., the node) by stimulating it with a concentration of special type of a molecules signal. These molecules trigger a chain of processes inside each bacteria that results in a final output in the form of light or fluorescence. Each stage in the process adds noise to the signal carried to the next stage. Our objective is ...

Einolghozati, Arash; Fekri, Faramarz

2012-01-01

428

Magnetic properties of heterotrophic bacteria (abstract)  

Science.gov (United States)

The magnetic properties (magnetic susceptibility and saturation magnetization) of six species of heterotrophic bacteria were studied: alcaligenes faecalis 81, arthrobacter globiformis BKM 685, bacillus cereus 8, leptothrix pseudo-ochracea D-405, proteus vulgaris 14, and seliberia stellata. It has been shown that the magnetic properties of bacteria depend on (1) the peculiarity of the micro-organism (species-specific and connected with cultivation conditions); (2) the source of the iron in the media. Most of the bacteria are diamagnetic in media with a minimum of iron (??=-7.2-0.3×10-6 sm3/g). The spore forming species (bacillus cereus) has increased diamagnetism. Usually the bacteria are paramagnetic in iron-containing media because they concentrate into Fe compounds. The paramagnetism of the iron-concentrating species (anthrobacter globiformis -?par=2.4×10-6, leptothrix pseudo-ochtracea ?par=11.0×10-6 and seliberia stellata ?par=3.2×10-6 sm3/g) depends, in general, on magnetically ordered compounds. Iron compounds not accumulated by proteus vulgaris and these species are always diamagnetic .

Verkhovceva, Nadezda V.; Glebova, Irina N.; Romanuk, Anatoly V.

1994-05-01

429

Bacteria Isolated from Post-Partum Infections  

Directory of Open Access Journals (Sweden)

Full Text Available Objective: This study was undertaken with an aim to determine bacterial species involved in post partum infections and also their abundance in patients admitted to at Khanevadeh hospital. In this study out of three different kinds of postpartum infections (i.e. genital, breast and urinary tract, only genital infection is considered."nMaterials and Methods: Post partum infection among 6077 patients (inpatients and re-admitted patients of Khanevadeh hospital from 2003 till 2008 was studied in this descriptive study. Samples were collected from patients for laboratory diagnosis to find out the causative organisms."nResults: Follow up of mothers after delivery revealed 7.59% (461 patients had post partum infection, out of which 1.03% (63 patients were re-hospitalized. "nInfection was more often among younger mothers. Bacteria isolated and identified were both aerobic and anaerobic cocci and bacilli, majority of which were normal flora of the site of infection. Though, some pathogenic bacteria like Staphylococcus aureus, Neisseria gonorrhea, Chlamydia trachomatis,were also the causative agents. The commonest infection was infection at the site of episiotomy. "nConclusion: Puerperal infection was detected in of 7.59% mothers. Bacteria isolated were both aerobic and anaerobic cocci and bacilli, majority of which were normal flora. However; some pathogenic bacteria were isolated.

Aghdas Safari

2009-06-01

430

Bioluminescent bacteria: lux genes as environmental biosensors  

OpenAIRE

Bioluminescent bacteria are widespread in natural environments. Over the years, many researchers have been studying the physiology, biochemistry and genetic control of bacterial bioluminescence. These discoveries have revolutionized the area of Environmental Microbiology through the use of luminescent genes as biosensors for environmental studies. This paper will review the chronology of scientific discoveries on bacterial bioluminescence and the current applications of bioluminescence in env...

Nunes-Halldorson Vânia da Silva; Duran Norma Letícia

2003-01-01

431

Probiotic Bacteria May Become Dormant during Storage  

OpenAIRE

The determination of bacterial viability in probiotic products is of economic, technological, and clinical significance. We compared four methods to enumerate three Bifidobacterium strains in fermented oat products during storage. A subpopulation of nonculturable cells retained a functional cell membrane typical of viable cells, indicating that probiotic bacteria become dormant during storage.

Lahtinen, Sampo J.; Gueimonde, Miguel; Ouwehand, Arthur C.; Reinikainen, Johanna P.; Salminen, Seppo J.

2005-01-01

432

Metabolic engineering of bacteria for ethanol production  

Energy Technology Data Exchange (ETDEWEB)

Technologies are available which will allow the conversion of lignocellulose into fuel ethanol using genetically engineered bacteria. Assembling these into a cost-effective process remains a challenge. The authors` work has focused primarily on the genetic engineering of enteric bacteria using a portable ethanol production pathway. Genes encoding Zymomonas mobilis pyruvate decarboxylase and alcohol dehydrogenase have been integrated into the chromosome of Escherichia coli B to produce strain KO11 for the fermentation of hemicellulose-derived syrups. This organism can efficiently ferment all hexose and pentose sugars present in the polymers of hemicellulose. Klebsiella oxytoca M5A1 has been genetically engineered in a similar manner to produce strain P2 for ethanol production from cellulose. This organism has the native ability to ferment cellobiose and cellotriose, eliminating the need for one class of cellulase enzymes. The optimal pH for cellulose fermentation with this organism is near that of fungal cellulases. The general approach for the genetic engineering of new biocatalysts has been most successful with enteric bacteria thus far. However, this approach may also prove useful with gram-positive bacteria which have other important traits for lignocellulose conversion. Many opportunities remain for further improvements in the biomass to ethanol processes.

Ingram, L.O.; Gomez, P.F.; Lai, X.; Moniruzzaman, M.; Wood, B.E.; Yomano, L.P.; York, S.W. [Univ. of Florida, Gainesville, FL (United States). Dept. of Microbiology and Cell Science

1998-04-20

433

Regulation of cell polarity in bacteria  

OpenAIRE

Bacteria are polarized cells with many asymmetrically localized proteins that are regulated temporally and spatially. This spatiotemporal dynamics is critical for several fundamental cellular processes including growth, division, cell cycle regulation, chromosome segregation, differentiation, and motility. Therefore, understanding how proteins find their correct location at the right time is crucial for elucidating bacterial cell function. Despite the diversity of proteins displaying spatiote...

Treuner-lange, Anke; Søgaard-andersen, Lotte

2014-01-01

434

Lactic acid bacteria from fresh fruit and vegetables as biocontrol agents of phytopathogenic bacteria and fungi  

OpenAIRE

This study evaluated the efficacy of lactic acid bacteria (LAB) isolated from fresh fruits and vegetables as biocontrol agents against the phytopathogenic and spoilage bacteria and fungi, Xanthomonas campestris, Erwinia carotovora, Penicillium expansum, Monilinia laxa, and Botrytis cinerea. The antagonistic activity of 496 LAB strains was tested in vitro and all tested microorganisms except P. expansum were inhibited by at least one isolate. The 496 isolates were also analyzed for the inhibit...

Trias Mansilla, Rosalia; Ban?eras Vives, Llui?s; Montesinos Segui?, Emilio; Badosa Roman?o?, Esther

2008-01-01

435

Assessment of the Levels of Airborne Bacteria, Gram-Negative Bacteria, and Fungi in Hospital Lobbies  

OpenAIRE

Aims: We assessed the levels of airborne bacteria, Gram-negative bacteria (GNB), and fungi in six hospital lobbies, and investigated the environmental and hospital characteristics that affected the airborne microorganism levels. Methods: An Andersen single-stage sampler equipped with appropriate nutrition plate agar was used to collect the samples. The three types of microorganisms were repeatedly collected at a fixed location in each hospital (assumed to be representative of the entire hospi...

Dong-Uk Park; Jeong-Kwan Yeom; Won Jae Lee; Kyeong-Min Lee

2013-01-01

436

Probabilistic exposure assessment model to estimate aseptic-UHT product failure rate.  

Science.gov (United States)

Aseptic-Ultra-High-Temperature (UHT) products are manufactured to be free of microorganisms capable of growing in the food at normal non-refrigerated conditions at which the food is likely to be held during manufacture, distribution and storage. Two important phases within the process are widely recognised as critical in controlling microbial contamination: the sterilisation steps and the following aseptic steps. Of the microbial hazards, the pathogen spore formers Clostridium botulinum and Bacillus cereus are deemed the most pertinent to be controlled. In addition, due to a relatively high thermal resistance, Geobacillus stearothermophilus spores are considered a concern for spoilage of low acid aseptic-UHT products. A probabilistic exposure assessment model has been developed in order to assess the aseptic-UHT product failure rate associated with these three bacteria. It was a Modular Process Risk Model, based on nine modules. They described: i) the microbial contamination introduced by the raw materials, either from the product (i.e. milk, cocoa and dextrose powders and water) or the packaging (i.e. bottle and sealing component), ii) the sterilisation processes, of either the product or the packaging material, iii) the possible recontamination during subsequent processing of both product and packaging. The Sterility Failure Rate (SFR) was defined as the sum of bottles contaminated for each batch, divided by the total number of bottles produced per process line run (10(6) batches simulated per process line). The SFR associated with the three bacteria was estimated at the last step of the process (i.e. after Module 9) but also after each module, allowing for the identification of modules, and responsible contamination pathways, with higher or lower intermediate SFR. The model contained 42 controlled settings associated with factory environment, process line or product formulation, and more than 55 probabilistic inputs corresponding to inputs with variability conditional to a mean uncertainty. It was developed in @Risk and run through Monte Carlo simulations. Overall, the highest SFR was associated with G. stearothermophilus (380000 bottles contaminated in 10(11) bottles produced) and the lowest to C. botulinum (3 bottles contaminated in 10(11) bottles produced). Unsurprisingly, SFR due to G. stearothermophilus was due to its ability to survive the UHT treatment. More interestingly, it was identified that SFR due to B. cereus (17000 bottles contaminated in 10(11) bottles produced) was due to an airborne recontamination of the aseptic tank (49%) and a post-sterilisation packaging contamination (33%). A deeper analysis (sensitivity and scenario analyses) was done to investigate how the SFR due to B. cereus could be reduced by changing the process settings related to potential air recontamination source. PMID:25440556

Pujol, Laure; Albert, Isabelle; Magras, Catherine; Johnson, Nicholas Brian; Membré, Jeanne-Marie

2015-01-01

437

Genes May Determine Body Weight by Shaping Gut Bacteria  

Science.gov (United States)

... Genes May Determine Body Weight by Shaping Gut Bacteria Study finds certain family of microbes more common ... person's body weight by determining the types of bacteria that live in the intestines, a new study ...

438

Oh What a Tangled Biofilm Web Bacteria Weave  

Science.gov (United States)

... Home Page Oh What a Tangled Biofilm Web Bacteria Weave By Elia Ben-Ari Posted May 1, ... a suitable surface, some water and nutrients, and bacteria will likely put down stakes and form biofilms. ...

439

Rapid detection of bacteria in foods and biological fluids  

Science.gov (United States)

Simple and inexpensive apparatus, called "redox monitoring cell," rapidly detects presence of bacteria. Bacteria is detected by measuring drop in oxygen content in test solution. Apparatus consists of vial with two specially designed electrodes connected to sensitive voltmeter.

Fealey, R. D.; Renner, W.

1973-01-01

440

Ulcer Bacteria Tied to Lower Multiple Sclerosis Risk in Women  

Science.gov (United States)

... features on this page, please enable JavaScript. Ulcer Bacteria Tied to Lower Multiple Sclerosis Risk in Women ... 2015 (HealthDay News) -- Women who harbor the stomach bacteria Helicobacter pylori (or H. pylori ) may be less ...

441

CHARACTERIZATION OF UNCLASSIFIED NONFERMENTATIVE GRAM NEGATIVE BACTERIA IN DRINKING WATER  

Science.gov (United States)

The group of bacteria most frequently encountered in water distribution systems consists of nonfermentative gram negative rods. Only a small percentage of these bacteria are identifiable using commercially prepared kits or other identification keys because many isolates fail to g...

442

Control of Fusarium Wilt of Chili With Chitinolytic Bacteria  

OpenAIRE

Biological control of plant disease using antagonistic microorganism has been obtaining much attention and implemented for decades. One of the potential microorganisms used in this strategy is chitinolytic bacteria. Utilization of this bacteria ranges from cell life, enzymes, genes, or other metabolites. In this study, we examined the ability of chitinolytic bacteria as a biocontrol agent of Fusarium wilt of red chili (Capsicum annuum L.) seedlings. The ability of chitinolytic bacteria to sup...

DWI SURYANTO; SITI PATONAH; ERMAN MUNIR

2010-01-01

443

Probiotic bacteria in prevention and treatment of diarrhea  

OpenAIRE

Probiotic bacteria have beneficial effects in prevention and treatment of different diseases. The results of preventive and therapeutic effect of probiotic bacteria on diarrhea during last ten years are shown in this paper. The greatest preventive and therapeutic effect of probiotic bacteria was identified for acute diarrhea in children caused by rotaviruses. Significant, but slightly lower effect of probiotic bacteria was proved for antibiotic associated diarrhea. Positive effect in preventi...

Jasmina Havranek; Šimun Zamberlin; Iva Dolen?i? Špehar; Tamara Prtilo; Milna Tudor; Dubravka Samaržija

2009-01-01

444

Coaggregation of oral bacteria. A physicochemical study based on microcalorimetry  

OpenAIRE

Coaggregation is defined as the specific recognition and interaction between bacteria in suspension. It was first reported in 1970 by Gibbons & Nygaard and has been mostly described between bacteria isolated from human dental plaque. Since the last ten years, coaggregation has been recognized amongst bacteria isolated from freshwater ecosystems, human and animal gastrointestinal and urogenital tracts. ... Zie: Summary.

Postollec, Florence

2005-01-01

445

Biotechnological potential of Clostridium butyricum bacteria  

Scientific Electronic Library Online (English)

Full Text Available SciELO Brazil | Language: English Abstract in english In response to demand from industry for microorganisms with auspicious biotechnological potential, a worldwide interest has developed in bacteria and fungi isolation. Microorganisms of interesting metabolic properties include non-pathogenic bacteria of the genus Clostridium, particularly C. acetobut [...] ylicum, C. butyricum and C. pasteurianum. A well-known property of C. butyricum is their ability to produce butyric acid, as well as effectively convert glycerol to 1,3-propanediol (38.2 g/L). A conversion rate of 0.66 mol 1,3-propanediol/mol of glycerol has been obtained. Results of the studies described in the present paper broaden our knowledge of characteristic features of C. butyricum specific isolates in terms of their phylogenetic affiliation, fermentation capacity and antibacterial properties.

Daria, Szymanowska-Powa& #322; owska; Dorota, Orczyk; Katarzyna, Leja.

2014-09-01

446

On Ants, Bacteria and Dynamic Environments  

CERN Document Server

Wasps, bees, ants and termites all make effective use of their environment and resources by displaying collective swarm intelligence. Termite colonies - for instance - build nests with a complexity far beyond the comprehension of the individual termite, while ant colonies dynamically allocate labor to various vital tasks such as foraging or defense without any central decision-making ability. Recent research suggests that microbial life can be even richer: highly social, intricately networked, and teeming with interactions, as found in bacteria. What strikes from these observations is that both ant colonies and bacteria have similar natural mechanisms based on Stigmergy and Self-Organization in order to emerge coherent and sophisticated patterns of global behaviour. Keeping in mind the above characteristics we will present a simple model to tackle the collective adaptation of a social swarm based on real ant colony behaviors (SSA algorithm) for tracking extrema in dynamic environments and highly multimodal co...

Ramos, V; Rosa, A C; Ramos, Vitorino; Fernandes, Carlos; Rosa, Agostinho C.

2005-01-01

447

Migration of bacteria through a monolith.  

Science.gov (United States)

The separation of bacteria by electromigration techniques was a subject of several of our previous papers. This contribution presents the results of investigation of the porosity of the monolithic bed and migration of Staphylococcus aureus cells through it. The gigaporous monolith was thermally synthesized using glycidyl methacrylate, triethylene glycol dimethacrylate and trimethylolpropane trimethacrylate as the monomers in the presence of porogen solvent containing 1-decanol, polyethylene glycol and 2-methoxyethanol. The porous properties were evaluated by inverse size-exclusion chromatography (ISEC) using a wide range of polystyrene standards of different molecular weights. The results have shown, that large pores (ca. 300 nm) dominate in the monolithic bed structure, however much larger flow-through pores must also be present as ca. 1 microm sized S. aureus bacteria were able to migrate through the bed. PMID:19592002

Buszewski, Bogus?aw; Szumski, Micha?; K?odzi?ska, Ewa; Jarmalaviciene, Reda; Maruska, Audrius

2009-08-14

448

In situ soil remediation: Bacteria or fungi?  

International Nuclear Information System (INIS)

Contamination of the environment is not a new problem. For most of recorded history, the unwanted byproducts of industrial and residential processes have been dumped into unlined pits or nearby streams. Although disposal techniques have greatly improved, significant quantities of hazardous materials are still being released to the environment via accidental spills and leaking underground storage tanks. One particular group of contaminants of critical environmental concern is polycyclic aromatic hydrocarbons (PAHs). PAH-contaminated sites typically cover large areas; therefore, the development of in situ remediation techniques such as bioremediation is strongly emphasized. In situations when inherent microorganisms are not capable of degrading the contaminants, foreign strains must be used. Bioremediation experiments were conducted to compare the remediation efficiencies of a bacteria and a fungus for an industrially PAH contaminated soil. Specifically, the use of three supplemental nutrient solutions were investigated in conjunction with the bacteria Achromobacter sp. and fungus Cunninghamella echinulata var. elegans

449

In situ soil remediation: Bacteria or fungi?  

Energy Technology Data Exchange (ETDEWEB)

Contamination of the environment is not a new problem. For most of recorded history, the unwanted byproducts of industrial and residential processes have been dumped into unlined pits or nearby streams. Although disposal techniques have greatly improved, significant quantities of hazardous materials are still being released to the environment via accidental spills and leaking underground storage tanks. One particular group of contaminants of critical environmental concern is polycyclic aromatic hydrocarbons (PAHs). PAH-contaminated sites typically cover large areas; therefore, the development of in situ remediation techniques such as bioremediation is strongly emphasized. In situations when inherent microorganisms are not capable of degrading the contaminants, foreign strains must be used. Bioremediation experiments were conducted to compare the remediation efficiencies of a bacteria and a fungus for an industrially PAH contaminated soil. Specifically, the use of three supplemental nutrient solutions were investigated in conjunction with the bacteria Achromobacter sp. and fungus Cunninghamella echinulata var. elegans.

Cutright, T.J.; Lee, S. [Univ. of Akron, OH (United States). Dept. of Chemical Engineering

1995-07-01

450

Resistant bacteria in stem cell transplant recipients  

Directory of Open Access Journals (Sweden)

Full Text Available Bacterial infections account for most infections in hematopoietic stem cell transplant recipients. While early mortality reduced dramatically with the introduction of the concept of empirical antibiotic therapy in neutropenic patients, no effect of prophylaxis on the mortality was observed in many studies. On the other hand, antibiotic prophylaxis has resulted in the emergence of resistance among bacteria. In addition, the choice of the antibiotic regimen for empirical therapy and the practices of antibiotic therapy during neutropenia may result in a significant shift in the pattern of bacterial infections. The use of quinolones and vancomycin as prophylaxis, and of carbapenems and vancomycin in the empirical antibiotic therapy, are associated with the appearance of resistant Gram-positive and Gram-negative bacteria. Therefore, hematologists must be aware of the impact of these practices on the emergence of infections due to multi-resistant pathogens, since these infections may be associated with increased mortality.

Nucci Marcio

2002-01-01

451

[RAPD analysis of plant pathogenic coryneform bacteria].  

Science.gov (United States)

RAPD analysis was used for the taxonomy of plant pathogenic coryneform bacteria, especially for the classification of two new pathogens (Curtobacterium flaccumfaciens pv. basellae pv. nov. and Curtobacterium flaccumfaciens pv. beticola pv. nov.). 20 random primers were screened from 50 ones to detect polymorphism among the total strains used. 80.4% were polymorphic bands among the 225 ones produced. The results of pairwise similarity and UPGMA cluster analysis suggest that the two new pathovars of sugar beet (Beta vulgaris var. saccharifera) and malabar spinach (Basella rubra) are genetically close related with Curtobacterium flacumfaciens, and the minimal similarity coefficient is 0.6511. According to the RAPD analysis and previous research, some newly made taxonomic changes of the plant pathogenic coryneform bacteria are discussed. PMID:16496687

Yin, Yan-Ni; Chen, Yong-Fang; Li, Shi-Mo; Guo, Jian-Hua

2005-12-01

452

Seeing Streptococcus pneumoniae, a Common Killer Bacteria  

DEFF Research Database (Denmark)

Look around you. The diversity and complexity of life on earth is overwhelming and data continues to grow. In our desire to understand and explain everything scientifically from molecular evolution to supernovas we depend on visual representations. This paper investigates visual representations of the bacteria Streptococcus pneumoniae by use of ink, watercolours and computer graphics. We propose a novel artistic visual rendering of Streptococcus pneumoniae and ask what the value of these kind of representations are compared to traditional scientific data. We ask if drawings and computer-assisted representations can add to our scientific knowledge about this dangerous bacteria. Is there still a role for the scientific illustrator in the scientific process and synthesis of scientific knowledge?

Kjærgaard, Rikke Schmidt; Andersen, Ebbe Sloth

2014-01-01

453

Comparative Genomics of Green Sulfur Bacteria  

DEFF Research Database (Denmark)

Eleven completely sequenced Chlorobi genomes were compared in oligonucleotide usage, gene contents, and synteny. The green sulfur bacteria (GSB) are equipped with a core genome that sustains their anoxygenic phototrophic lifestyle by photosynthesis, sulfur oxidation, and CO(2) fixation. Whole-genome gene family and single gene sequence comparisons yielded similar phylogenetic trees of the sequenced chromosomes indicating a concerted vertical evolution of large gene sets. Chromosomal synteny of genes is not preserved in the phylum Chlorobi. The accessory genome is characterized by anomalous oligonucleotide usage and endows the strains with individual features for transport, secretion, cell wall, extracellular constituents, and a few elements of the biosynthetic apparatus. Giant genes are a peculiar feature of the genera Chlorobium and Prosthecochloris. The predicted proteins have a huge molecular weight of 10(6), and are probably instrumental for the bacteria to generate their own intimate (micro)environment.

Ussery, David; Davenport, C

2010-01-01

454

Bioluminescent imaging of bacteria during mouse infection.  

Science.gov (United States)

Diagnostic imaging is a powerful tool that has recently been applied towards the study of infectious diseases. Optical imaging of bioluminescently labeled bacteria in infected animals allows for real-time analysis of bacterial proliferation and dissemination during infection without sacrificing the animal. Imaging also allows for tracking of disease progression in an individual subject over time, has the potential to reveal previously overlooked sites of infection, and reduces the number of research animals used in pathogenesis studies. Here, we describe the use of a deep-cooled CCD camera imager to record light emitted from bacteria during infection. We also describe the process of correlating bioluminescence to bacterial numbers by ex vivo imaging of necropsied tissues. Together these techniques can be used to estimate bacterial burdens in host tissues both in vivo and ex vivo using bioluminescent imaging. PMID:24166377

Warawa, Jonathan M; Lawrenz, Matthew B

2014-01-01

455

Pyrite oxidation by Acidithiobacillus ferrooxidans bacteria  

OpenAIRE

The kinetic model of pyrite particle dissolution by the action of bacteria Acidithiobacillus ferrooxidans in a shaken Erlenmeyer flask was presented. The model agreed well with the experimental data for the extracted iron and the number of cells in the liquid phase. The specific growth rate of the adsorbed cells was evaluated (?A = 1,6 d-1) by fitting the experimental data to the model curve. Also, the relevance of the two proposed mechanisms for the bacterial dissolution of sulphide (direct...

S