Silencing of the rotavirus NSP4 protein decreases the incidence of biliary atresia in murine model.

Directory of Open Access Journals (Sweden)

Jiexiong Feng

Full Text Available Biliary atresia is a common disease in neonates which causes obstructive jaundice and progressive hepatic fibrosis. Our previous studies indicate that rotavirus infection is an initiator in the pathogenesis of experimental biliary atresia (BA through the induction of increased nuclear factor-kappaB and abnormal activation of the osteopontin inflammation pathway. In the setting of rotavirus infection, rotavirus nonstructural protein 4 (NSP4 serves as an important immunogen, viral protein 7 (VP7 is necessary in rotavirus maturity and viral protein 4 (VP4 is a virulence determiner. The purpose of the current study is to clarify the roles of NSP4, VP7 and VP4 in the pathogenesis of experimental BA. Primary cultured extrahepatic biliary epithelia were infected with Rotavirus (mmu18006. Small interfering RNA targeting NSP4, VP7 or VP4 was transfected before rotavirus infection both in vitro and in vivo. We analyzed the incidence of BA, morphological change, morphogenesis of viral particles and viral mRNA and protein expression. The in vitro experiments showed NSP4 silencing decreased the levels of VP7 and VP4, reduced viral particles and decreased cytopathic effect. NSP4-positive cells had strongly positive expression of integrin subunit α2. Silencing of VP7 or VP4 partially decreased epithelial injury. Animal experiments indicated after NSP4 silencing, mouse pups had lower incidence of BA than after VP7 or VP4 silencing. However, 33.3% of VP4-silenced pups (N = 6 suffered BA and 50% of pups (N = 6 suffered biliary injury after VP7 silencing. Hepatic injury was decreased after NSP4 or VP4 silencing. Neither VP4 nor VP7 were detected in the biliary ducts after NSP4. All together, NSP4 silencing down-regulates VP7 and VP4, resulting in decreased incidence of BA.

Mutations in ash1 and trx enhance P-element-dependent silencing in Drosophila melanogaster.

Science.gov (United States)

McCracken, Allen; Locke, John

2016-08-01

In Drosophila melanogaster, the mini-w(+) transgene in Pci is normally expressed throughout the adult eye; however, when other P or KP elements are present, a variegated-eye phenotype results, indicating random w(+) silencing during development called P-element-dependent silencing (PDS). Mutant Su(var)205 and Su(var)3-7 alleles act as haplo-suppressors/triplo-enhancers of this variegated phenotype, indicating that these heterochromatic modifiers act dose dependently in PDS. Previously, we recovered a spontaneous mutation of P{lacW}ci(Dplac) called P{lacW}ci(DplacE1) (E1) that variegated in the absence of P elements, presumably due to the insertion of an adjacent gypsy element. From a screen for genetic modifiers of E1 variegation, we describe here the isolation of five mutations in ash1 and three in trx that enhance the E1 variegated phenotype in a dose-dependent and cumulative manner. These mutant alleles enhance PDS at E1, and in E1/P{lacW}ci(Dplac), but suppress position effect variegation (PEV) at In(1)w(m)(4). This opposite action is consistent with a model where ASH1 and TRX mark transcriptionally active chromatin domains. If ASH1 or TRX function is lost or reduced, heterochromatin can spread into these domains creating a sink that diverts heterochromatic proteins from other variegating locations, which then may express a suppressed phenotype.

Argonaute Utilization for miRNA Silencing Is Determined by Phosphorylation-Dependent Recruitment of LIM-Domain-Containing Proteins

Directory of Open Access Journals (Sweden)

Katherine S. Bridge

2017-07-01

Full Text Available As core components of the microRNA-induced silencing complex (miRISC, Argonaute (AGO proteins interact with TNRC6 proteins, recruiting other effectors of translational repression/mRNA destabilization. Here, we show that LIMD1 coordinates the assembly of an AGO-TNRC6 containing miRISC complex by binding both proteins simultaneously at distinct interfaces. Phosphorylation of AGO2 at Ser 387 by Akt3 induces LIMD1 binding, which in turn enables AGO2 to interact with TNRC6A and downstream effector DDX6. Conservation of this serine in AGO1 and 4 indicates this mechanism may be a fundamental requirement for AGO function and miRISC assembly. Upon CRISPR-Cas9-mediated knockout of LIMD1, AGO2 miRNA-silencing function is lost and miRNA silencing becomes dependent on a complex formed by AGO3 and the LIMD1 family member WTIP. The switch to AGO3 utilization occurs due to the presence of a glutamic acid residue (E390 on the interaction interface, which allows AGO3 to bind to LIMD1, AJUBA, and WTIP irrespective of Akt signaling.

DICER-LIKE2 plays a primary role in transitive silencing of transgenes in Arabidopsis.

Directory of Open Access Journals (Sweden)

Sizolwenkosi Mlotshwa

2008-03-01

Full Text Available Dicer-like (DCL enzymes play a pivotal role in RNA silencing in plants, processing the long double-stranded RNA (dsRNA that triggers silencing into the primary short interfering RNAs (siRNAs that mediate it. The siRNA population can be augmented and silencing amplified via transitivity, an RNA-dependent RNA polymerase (RDR-dependent pathway that uses the target RNA as substrate to generate secondary siRNAs. Here we report that Arabidopsis DCL2-but not DCL4-is required for transitivity in cell-autonomous, post-transcriptional silencing of transgenes. An insertion mutation in DCL2 blocked sense transgene-induced silencing and eliminated accumulation of the associated RDR-dependent siRNAs. In hairpin transgene-induced silencing, the dcl2 mutation likewise eliminated accumulation of secondary siRNAs and blocked transitive silencing, but did not block silencing mediated by primary siRNAs. Strikingly, in all cases, the dcl2 mutation eliminated accumulation of all secondary siRNAs, including those generated by other DCL enzymes. In contrast, mutations in DCL4 promoted a dramatic shift to transitive silencing in the case of the hairpin transgene and enhanced silencing induced by the sense transgene. Suppression of hairpin and sense transgene silencing by the P1/HC-Pro and P38 viral suppressors was associated with elimination of secondary siRNA accumulation, but the suppressors did not block processing of the stem of the hairpin transcript into primary siRNAs. Thus, these viral suppressors resemble the dcl2 mutation in their effects on siRNA biogenesis. We conclude that DCL2 plays an essential, as opposed to redundant, role in transitive silencing of transgenes and may play a more important role in silencing of viruses than currently thought.

Homology-dependent Gene Silencing in Paramecium

Science.gov (United States)

Ruiz, Françoise; Vayssié, Laurence; Klotz, Catherine; Sperling, Linda; Madeddu, Luisa

1998-01-01

Microinjection at high copy number of plasmids containing only the coding region of a gene into the Paramecium somatic macronucleus led to a marked reduction in the expression of the corresponding endogenous gene(s). The silencing effect, which is stably maintained throughout vegetative growth, has been observed for all Paramecium genes examined so far: a single-copy gene (ND7), as well as members of multigene families (centrin genes and trichocyst matrix protein genes) in which all closely related paralogous genes appeared to be affected. This phenomenon may be related to posttranscriptional gene silencing in transgenic plants and quelling in Neurospora and allows the efficient creation of specific mutant phenotypes thus providing a potentially powerful tool to study gene function in Paramecium. For the two multigene families that encode proteins that coassemble to build up complex subcellular structures the analysis presented herein provides the first experimental evidence that the members of these gene families are not functionally redundant. PMID:9529389

Diversifying selection and functional analysis of interleukin-4 suggests antagonism-driven evolution at receptor-binding interfaces

Directory of Open Access Journals (Sweden)

Brown Scott

2010-07-01

Full Text Available Abstract Background Interleukin-4 (IL4 is a secreted immunoregulatory cytokine critically involved in host protection from parasitic helminths 1. Reasoning that helminths may have evolved mechanisms to antagonize IL4 to maximize their dispersal, we explored mammalian IL4 evolution. Results This analysis revealed evidence of diversifying selection at 15 residues, clustered in epitopes responsible for IL4 binding to its Type I and Type II receptors. Such a striking signature of selective pressure suggested either recurrent episodes of pathogen antagonism or ligand/receptor co-evolution. To test the latter possibility, we performed detailed functional analysis of IL4 allotypes expressed by Mus musculus musculus and Mus musculus castaneus, which happen to differ at 5 residues (including three at positively selected sites in and adjacent to the site 1 epitope that binds the IL4Rα subunit shared by the Type I and Type II IL4 receptors. We show that this intra-species variation affects the ability of IL4 neither to bind IL4 receptor alpha (IL4Rα nor to signal biological responses through its Type I receptor. Conclusions Our results -- reminiscent of clustered positively selected sites revealing functionally important residues at host-virus interaction interfaces -- are consistent with IL4 having evolved to avoid recurrent pathogen antagonism, while maintaining the capacity to bind and signal through its cognate receptor. This work exposes what may be a general feature of evolutionary conflicts fought by pathogen antagonists at host protein-protein interaction interfaces involved in immune signaling: the emergence of receptor-binding ligand epitopes capable of buffering amino acid variation.

A hypoxia-inducible factor (HIF)-3α splicing variant, HIF-3α4 impairs angiogenesis in hypervascular malignant meningiomas with epigenetically silenced HIF-3α4

Energy Technology Data Exchange (ETDEWEB)

Ando, Hitoshi [Department of Neurosurgery, Nagoya University School of Medicine, Nagoya (Japan); Department of Neurosurgery, Fukushima Medical University School of Medicine, Fukushima (Japan); Natsume, Atsushi, E-mail: anatsume@med.nagoya-u.ac.jp [Department of Neurosurgery, Nagoya University School of Medicine, Nagoya (Japan); Iwami, Kenichiro; Ohka, Fumiharu [Department of Neurosurgery, Nagoya University School of Medicine, Nagoya (Japan); Kuchimaru, Takahiro; Kizaka-Kondoh, Shinae [Department of Biomolecular Engineering, Tokyo Institute of Technology Graduate School of Bioscience and Biotechnology, Yokohama (Japan); Ito, Kengo [National Center for Geriatrics and Gerontology, Aichi (Japan); Saito, Kiyoshi [Department of Neurosurgery, Fukushima Medical University School of Medicine, Fukushima (Japan); Sugita, Sachi; Hoshino, Tsuneyoshi [MICRON Inc.Medical Facilities Support Department, Aichi (Japan); Wakabayashi, Toshihiko [Department of Neurosurgery, Nagoya University School of Medicine, Nagoya (Japan)

2013-03-29

Highlights: ► HIF-3α4 is silenced by DNA methylation in meningiomas. ► Induction of HIF-3α4 impaired angiogenesis in meningiomas. ► Induction of HIF-3α4 impaired proliferation and oxygen-dependent metabolism. -- Abstract: Hypoxia inducible factor is a dominant regulator of adaptive cellular responses to hypoxia and controls the expression of a large number of genes regulating angiogenesis as well as metabolism, cell survival, apoptosis, and other cellular functions in an oxygen level-dependent manner. When a neoplasm is able to induce angiogenesis, tumor progression occurs more rapidly because of the nutrients provided by the neovasculature. Meningioma is one of the most hypervascular brain tumors, making anti-angiogenic therapy an attractive novel therapy for these tumors. HIF-3α has been conventionally regarded as a dominant-negative regulator of HIF-1α, and although alternative HIF-3α splicing variants are extensively reported, their specific functions have not yet been determined. In this study, we found that the transcription of HIF-3α4 was silenced by the promoter DNA methylation in meningiomas, and inducible HIF-3α4 impaired angiogenesis, proliferation, and metabolism/oxidation in hypervascular meningiomas. Thus, HIF-3α4 could be a potential molecular target in meningiomas.

A hypoxia-inducible factor (HIF)-3α splicing variant, HIF-3α4 impairs angiogenesis in hypervascular malignant meningiomas with epigenetically silenced HIF-3α4

International Nuclear Information System (INIS)

Ando, Hitoshi; Natsume, Atsushi; Iwami, Kenichiro; Ohka, Fumiharu; Kuchimaru, Takahiro; Kizaka-Kondoh, Shinae; Ito, Kengo; Saito, Kiyoshi; Sugita, Sachi; Hoshino, Tsuneyoshi; Wakabayashi, Toshihiko

2013-01-01

Highlights: ► HIF-3α4 is silenced by DNA methylation in meningiomas. ► Induction of HIF-3α4 impaired angiogenesis in meningiomas. ► Induction of HIF-3α4 impaired proliferation and oxygen-dependent metabolism. -- Abstract: Hypoxia inducible factor is a dominant regulator of adaptive cellular responses to hypoxia and controls the expression of a large number of genes regulating angiogenesis as well as metabolism, cell survival, apoptosis, and other cellular functions in an oxygen level-dependent manner. When a neoplasm is able to induce angiogenesis, tumor progression occurs more rapidly because of the nutrients provided by the neovasculature. Meningioma is one of the most hypervascular brain tumors, making anti-angiogenic therapy an attractive novel therapy for these tumors. HIF-3α has been conventionally regarded as a dominant-negative regulator of HIF-1α, and although alternative HIF-3α splicing variants are extensively reported, their specific functions have not yet been determined. In this study, we found that the transcription of HIF-3α4 was silenced by the promoter DNA methylation in meningiomas, and inducible HIF-3α4 impaired angiogenesis, proliferation, and metabolism/oxidation in hypervascular meningiomas. Thus, HIF-3α4 could be a potential molecular target in meningiomas

Mutations within ICP4 acquired during in vitro attenuation do not alter virulence of recombinant Marek's disease viruses in vivo

Directory of Open Access Journals (Sweden)

Evin Hildebrandt

2015-12-01

Full Text Available Marek's disease (MD is a T-cell lymphoma of chickens caused by the oncogenic Marek's disease virus (MDV. MD is primarily controlled by live-attenuated vaccines generated by repeated in vitro serial passage. Previous efforts to characterize attenuated MDVs identified numerous mutations, particularly a convergence of high-frequency mutations around amino acids 60–63 within ICP4 (RS1, therefore, ICP4 was considered a candidate gene deserving further characterization. Recombinant MDVs were generated containing a single Q63H mutation or double Q63H + S1630P mutations. Despite the repetitive nature of mutations within ICP4, neither recombinant virus decreased virulence, although one mutant reduced in vivo replication and failed to transmit horizontally. Our results indicate that these mutations are insufficient to reduce disease incidence in infected birds, and suggest that variants in ICP4 do not directly alter virulence, but rather may enhance MDV replication rates in vitro, offering an explanation for the widespread occurrence of ICP4 mutations in a variety of attenuated herpesviruses.

A Novel Detection Platform for Shrimp White Spot Syndrome Virus Using an ICP11-Dependent Immunomagnetic Reduction (IMR) Assay.

Science.gov (United States)

Liu, Bing-Hsien; Lin, Yu-Chen; Ho, Chia-Shin; Yang, Che-Chuan; Chang, Yun-Tsui; Chang, Jui-Feng; Li, Chun-Yuan; Cheng, Cheng-Shun; Huang, Jiun-Yan; Lee, Yen-Fu; Hsu, Ming-Hung; Lin, Feng-Chun; Wang, Hao-Ching; Lo, Chu-Fang; Yang, Shieh-Yueh; Wang, Han-Ching

2015-01-01

Shrimp white spot disease (WSD), which is caused by white spot syndrome virus (WSSV), is one of the world's most serious shrimp diseases. Our objective in this study was to use an immunomagnetic reduction (IMR) assay to develop a highly sensitive, automatic WSSV detection platform targeted against ICP11 (the most highly expressed WSSV protein). After characterizing the magnetic reagents (Fe3O4 magnetic nanoparticles coated with anti ICP11), the detection limit for ICP11 protein using IMR was approximately 2 x 10(-3) ng/ml, and the linear dynamic range of the assay was 0.1~1 x 10(6) ng/ml. In assays of ICP11 protein in pleopod protein lysates from healthy and WSSV-infected shrimp, IMR signals were successfully detected from shrimp with low WSSV genome copy numbers. We concluded that this IMR assay targeting ICP11 has potential for detecting the WSSV.

The epigenetic modifier PRDM5 functions as a tumor suppressor through modulating WNT/β-catenin signaling and is frequently silenced in multiple tumors.

Directory of Open Access Journals (Sweden)

Xing-sheng Shu

Full Text Available BACKGROUND: PRDM (PRDI-BF1 and RIZ domain containing proteins are zinc finger proteins involved in multiple cellular regulations by acting as epigenetic modifiers. We studied a recently identified PRDM member PRDM5 for its epigenetic abnormality and tumor suppressive functions in multiple tumorigeneses. METHODOLOGY/PRINCIPAL FINDINGS: Semi-quantitative RT-PCR showed that PRDM5 was broadly expressed in human normal tissues, but frequently silenced or downregulated in multiple carcinoma cell lines due to promoter CpG methylation, including 80% (4/5 nasopharyngeal, 44% (8/18 esophageal, 76% (13/17 gastric, 50% (2/4 cervical, and 25% (3/12 hepatocellular carcinoma cell lines, but not in any immortalized normal epithelial cell lines. PRDM5 expression could be restored by 5-aza-2'-deoxycytidine demethylation treatment in silenced cell lines. PRDM5 methylation was frequently detected by methylation-specific PCR (MSP in multiple primary tumors, including 93% (43/46 nasopharyngeal, 58% (25/43 esophageal, 88% (37/42 gastric and 63% (29/46 hepatocellular tumors. PRDM5 was further found a stress-responsive gene, but its response was impaired when the promoter was methylated. Ectopic PRDM5 expression significantly inhibited tumor cell clonogenicity, accompanied by the inhibition of TCF/β-catenin-dependent transcription and downregulation of CDK4, TWIST1 and MDM2 oncogenes, while knocking down of PRDM5 expression lead to increased cell proliferation. ChIP assay showed that PRDM5 bound to its target gene promoters and suppressed their transcription. An inverse correlation between the expression of PRDM5 and activated β-catenin was also observed in cell lines. CONCLUSIONS/SIGNIFICANCE: PRDM5 functions as a tumor suppressor at least partially through antagonizing aberrant WNT/β-catenin signaling and oncogene expression. Frequent epigenetic silencing of PRDM5 is involved in multiple tumorigeneses, which could serve as a tumor biomarker.

Silence in the Communication or Communicating through Silence: Silence in Psychoanalysis

Directory of Open Access Journals (Sweden)

Rita Marta

2014-10-01

Full Text Available This paper is a reflection upon the meaning and importance of silence in the psychoanalytical relationship. Beginning with the silence in the “normal” relationship between people, we show how silence can be experienced as confortable or unconfortable, and how it can be used to achieve a bigger proximity or distance in the relationship with others. We show these same aspects in the psychoanalytical relationship, and the evolution of the regard towards silence along the development of psychoanalysis. We end, presenting the Nacht’s thinking about silence, who emphasizes its integrative and fundamental role in the psychoanalytical relationship. Thus, only through silence certain affects can be born, and silence allows the patient to internalize the analyst.

Inhalable delivery of AAV-based MRP4/ABCC4 silencing RNA prevents monocrotaline-induced pulmonary hypertension

Directory of Open Access Journals (Sweden)

Caroline Claude

Full Text Available The ATP-binding cassette transporter MRP4 (encoded by ABCC4 regulates membrane cyclic nucleotides concentrations in arterial cells including smooth muscle cells. MRP4/ABCC4 deficient mice display a reduction in smooth muscle cells proliferation and a prevention of pulmonary hypertension in response to hypoxia. We aimed to study gene transfer of a MRP4/ABCC4 silencing RNA via intratracheal delivery of aerosolized adeno-associated virus 1 (AAV1.shMRP4 or AAV1.control in a monocrotaline-induced model of pulmonary hypertension in rats. Gene transfer was performed at the time of monocrotaline administration and the effect on the development of pulmonary vascular remodeling was assessed 35 days later. AAV1.shMRP4 dose-dependently reduced right ventricular systolic pressure and hypertrophy with a significant reduction with the higher doses (i.e., >1011 DRP/animal as compared to AAV1.control. The higher dose of AAV1.shMRP4 was also associated with a significant reduction in distal pulmonary arteries remodeling. AAV1.shMRP4 was finally associated with a reduction in the expression of ANF, a marker of cardiac hypertrophy. Collectively, these results support a therapeutic potential for downregulation of MRP4 for the treatment of pulmonary artery hypertension.

Analysis of Determinants in Filovirus Glycoproteins Required for Tetherin Antagonism

Directory of Open Access Journals (Sweden)

Kerstin Gnirß

2014-04-01

Full Text Available The host cell protein tetherin can restrict the release of enveloped viruses from infected cells. The HIV-1 protein Vpu counteracts tetherin by removing it from the site of viral budding, the plasma membrane, and this process depends on specific interactions between the transmembrane domains of Vpu and tetherin. In contrast, the glycoproteins (GPs of two filoviruses, Ebola and Marburg virus, antagonize tetherin without reducing surface expression, and the domains in GP required for tetherin counteraction are unknown. Here, we show that filovirus GPs depend on the presence of their authentic transmembrane domains for virus-cell fusion and tetherin antagonism. However, conserved residues within the transmembrane domain were dispensable for membrane fusion and tetherin counteraction. Moreover, the insertion of the transmembrane domain into a heterologous viral GP, Lassa virus GPC, was not sufficient to confer tetherin antagonism to the recipient. Finally, mutation of conserved residues within the fusion peptide of Ebola virus GP inhibited virus-cell fusion but did not ablate tetherin counteraction, indicating that the fusion peptide and the ability of GP to drive host cell entry are not required for tetherin counteraction. These results suggest that the transmembrane domains of filoviral GPs contribute to tetherin antagonism but are not the sole determinants.

Metal ion transport quantified by ICP-MS in intact cells

Science.gov (United States)

Figueroa, Julio A. Landero; Stiner, Cory A.; Radzyukevich, Tatiana L.; Heiny, Judith A.

2016-01-01

The use of ICP-MS to measure metal ion content in biological tissues offers a highly sensitive means to study metal-dependent physiological processes. Here we describe the application of ICP-MS to measure membrane transport of Rb and K ions by the Na,K-ATPase in mouse skeletal muscles and human red blood cells. The ICP-MS method provides greater precision and statistical power than possible with conventional tracer flux methods. The method is widely applicable to studies of other metal ion transporters and metal-dependent processes in a range of cell types and conditions. PMID:26838181

Multielement determination and speciation of major-to-ultratrace elements in green tea leaves by ICP-AES and ICP-MS

International Nuclear Information System (INIS)

Matsuura, Hirotaka; Hokura, Akiko; Haraguchi, Hiroki

2000-01-01

In order to investigate the multi-elemental composition of green tea leaves as well as chemical species in tea infusions, inductively coupled plasma atomic emission spectrometry (ICP-AES) and inductively coupled plasma mass spectrometry (ICP-MS) were used for elemental analysis and elemental speciation with the aid of size exclusion chromatography (SEC). As a result, the multielement determination of major-to-ultratrace elements in green tea leaves and green tea infusions was carried out by ICP-AES and ICP-MS. About 40 elements in these tea samples could be determined in a wide concentration range of over 8 orders of magnitude. The extraction efficiency of each element was estimated as the ratio of its concentration in tea infusion to that in tea leaves. It was found from the experimental results that the elements in tea leaves could be classified into three characteristic groups, depending on their extraction efficiencies. Furthermore, tea infusions were analyzed by a combined system of SEC, UV absorption detector, and ICP-AES (or ICP-MS) for the speciation of major-to-ultratrace elements. Most of the elements in tea infusions were found to be present as associated complexes with large organic molecules. (author)

A comparison of the M3/M4 metastable defect detected in hydrogen and ICP Ar plasma treated n-GaAs

International Nuclear Information System (INIS)

Nyamhere, C.; Venter, A.

2012-01-01

Defects created by a dc hydrogen plasma have been compared to those observed in n-GaAs exposed to an inductively coupled (ICP) Ar plasma. The reference sample (in the case of H-plasma treated material) contained two prominent native deep level electron traps, possibly M4 and E C −0.56 eV, which were both passivated by hydrogen. Plasma treatment also resulted in the formation of a defect observed at 0.58 eV (M3) below the conduction band. This defect transforms back into what is believed to be M4 when annealed at 350 K for 3 h under reverse bias. These two defects compare well with two similar defects observed in the Ar ICP treated samples also showing metastable behavior. Additionally, the electrical characterization of Schottky barrier diodes on n-GaAs, prior to and after hydrogen passivation shows that, depending on the plasma conditions, the plasma ions significantly damage the surface resulting in poor rectifying contacts. The damage is considerably reversed/repaired upon annealing between the room temperature and 573 K (300 °C).

A comparison of the M3/M4 metastable defect detected in hydrogen and ICP Ar plasma treated n-GaAs

Energy Technology Data Exchange (ETDEWEB)

Nyamhere, C., E-mail: cloud.nyamhere@nmmu.ac.za [Department of Physics, Nelson Mandela Metropolitan University, P.O. Box 77000, Port Elizabeth 6031 (South Africa); Venter, A. [Department of Physics, Nelson Mandela Metropolitan University, P.O. Box 77000, Port Elizabeth 6031 (South Africa)

2012-05-15

Defects created by a dc hydrogen plasma have been compared to those observed in n-GaAs exposed to an inductively coupled (ICP) Ar plasma. The reference sample (in the case of H-plasma treated material) contained two prominent native deep level electron traps, possibly M4 and E{sub C}-0.56 eV, which were both passivated by hydrogen. Plasma treatment also resulted in the formation of a defect observed at 0.58 eV (M3) below the conduction band. This defect transforms back into what is believed to be M4 when annealed at 350 K for 3 h under reverse bias. These two defects compare well with two similar defects observed in the Ar ICP treated samples also showing metastable behavior. Additionally, the electrical characterization of Schottky barrier diodes on n-GaAs, prior to and after hydrogen passivation shows that, depending on the plasma conditions, the plasma ions significantly damage the surface resulting in poor rectifying contacts. The damage is considerably reversed/repaired upon annealing between the room temperature and 573 K (300 Degree-Sign C).

Herpes simplex virus 1 regulatory protein ICP22 interacts with a new cell cycle-regulated factor and accumulates in a cell cycle-dependent fashion in infected cells.

Science.gov (United States)

Bruni, R; Roizman, B

1998-11-01

The herpes simplex virus 1 infected cell protein 22 (ICP22), the product of the alpha22 gene, is a nucleotidylylated and phosphorylated nuclear protein with properties of a transcriptional factor required for the expression of a subset of viral genes. Here, we report the following. (i) ICP22 interacts with a previously unknown cellular factor designated p78 in the yeast two-hybrid system. The p78 cDNA encodes a polypeptide with a distribution of leucines reminiscent of a leucine zipper. (ii) In uninfected and infected cells, antibody to p78 reacts with two major bands with an apparent Mr of 78,000 and two minor bands with apparent Mrs of 62, 000 and 55,000. (ii) p78 also interacts with ICP22 in vitro. (iii) In uninfected cells, p78 was dispersed largely in the nucleoplasm in HeLa cells and in the nucleoplasm and cytoplasm in HEp-2 cells. After infection, p78 formed large dense bodies which did not colocalize with the viral regulatory protein ICP0. (iv) Accumulation of p78 was cell cycle dependent, being highest very early in S phase. (v) The accumulation of ICP22 in synchronized cells was highest in early S phase, in contrast to the accumulation of another protein, ICP27, which was relatively independent of the cell cycle. (vi) In the course of the cell cycle, ICP22 was transiently modified in an aberrant fashion, and this modification coincided with expression of p78. The results suggest that ICP22 interacts with and may be stabilized by cell cycle-dependent proteins.

Titration and hysteresis in epigenetic chromatin silencing

International Nuclear Information System (INIS)

Dayarian, Adel; Sengupta, Anirvan M

2013-01-01

Epigenetic mechanisms of silencing via heritable chromatin modifications play a major role in gene regulation and cell fate specification. We consider a model of epigenetic chromatin silencing in budding yeast and study the bifurcation diagram and characterize the bistable and the monostable regimes. The main focus of this paper is to examine how the perturbations altering the activity of histone modifying enzymes affect the epigenetic states. We analyze the implications of having the total number of silencing proteins, given by the sum of proteins bound to the nucleosomes and the ones available in the ambient, to be constant. This constraint couples different regions of chromatin through the shared reservoir of ambient silencing proteins. We show that the response of the system to perturbations depends dramatically on the titration effect caused by the above constraint. In particular, for a certain range of overall abundance of silencing proteins, the hysteresis loop changes qualitatively with certain jump replaced by continuous merger of different states. In addition, we find a nonmonotonic dependence of gene expression on the rate of histone deacetylation activity of Sir2. We discuss how these qualitative predictions of our model could be compared with experimental studies of the yeast system under anti-silencing drugs. (paper)

The orphan nuclear receptor GCNF recruits DNA methyltransferase for Oct-3/4 silencing

International Nuclear Information System (INIS)

Sato, Noriko; Kondo, Mitsumasa; Arai, Ken-ichi

2006-01-01

Somatic DNA methylation patterns are determined in part by the de novo methylation that occurs after early embryonic demethylation. Oct-3/4, a pluripotency gene, is unmethylated in the blastocyst, but undergoes de novo methylation and silencing during gastrulation. Here we show that the transcriptional repressor GCNF recruits DNA methyltransferase to the Oct-3/4 promoter and facilitates its methylation. Although acetylation of histone H3 at lysine 9 (K9) and/or 14 (K14) and methylation of H3 at lysine 4 (K4) decrease during this period, as do Oct-3/4 transcript levels, H3K9 and H3K27 methylation levels remain constant, indicating that DNA methylation does not require repressive histone modifications. We found that GCNF interacts directly with Dnmt3 molecule(s) and verified that this interaction induces the methylation of the Oct-3/4 promoter. Our finding suggests a model in which differentiation-induced GCNF recruits de novo DNA methyltransferase and facilitates the silencing of a pluripotency gene

Igf2/H19 Imprinting Control Region (ICR: An Insulator or a Position-Dependent Silencer?

Directory of Open Access Journals (Sweden)

Subhasis Banerjee

2001-01-01

Full Text Available The imprinting control region (ICR located far upstream of the H19 gene, in conjunction with enhancers, modulates the transcription of Igf2 and H19 genes in an allele-specific manner. On paternal inheritance, the methylated ICR silences the H19 gene and indirectly facilitates transcription from the distant Igf2 promoter, whereas on the maternal chromosome the unmethylated ICR, together with enhancers, activates transcription of the H19 gene and thereby contributes to the repression of Igf2. This repression of maternal Igf2 has recently been postulated to be due to a chromatin boundary or insulator function of the unmethylated ICR. Central to the insulator model is the site-specific binding of a ubiquitous nuclear factor CTCF which exhibits remarkable flexibility in functioning as transcriptional activator or silencer. We suggest that the ICR positioned close to the enhancers in an episomal context might function as a transcriptional silencer by virtue of interaction of CTCF with its modifiers such as SIN3A and histone deacetylases. Furthermore, a localised folded chromatin structure resulting from juxtaposition of two disparate regulatory sequences (enhancer ICR could be the mechanistic basis of ICR-mediated position-dependent (ICR-promoter transcriptional repression in transgenic Drosophila.

Silencing the alarms: innate immune antagonism by rotavirus NSP1 and VP3

Science.gov (United States)

Morelli, Marco; Ogden, Kristen M.; Patton, John T.

2016-01-01

The innate immune response involves a broad array of pathogen sensors that stimulate the production of interferons (IFN) to induce an antiviral state. Rotavirus, a significant cause of childhood gastroenteritis and a member of the Reoviridae family of segmented, double-stranded RNA viruses, encodes at least two direct antagonists of host innate immunity: NSP1 and VP3. NSP1, a putative E3 ubiquitin ligase, mediates the degradation of cellular factors involved in both IFN induction and downstream signaling. VP3, the viral capping enzyme, utilizes a 2H-phosphodiesterase domain to prevent activation of the cellular oligoadenylate synthase (OAS)-RNase L pathway. Computational, molecular, and biochemical studies have provided key insights into the structural and mechanistic basis of innate immune antagonism by NSP1 and VP3 of group A rotaviruses (RVA). Future studies with non-RVA isolates will be essential to understand how other RV species evade host innate immune responses. PMID:25724417

Silencing of the Wnt transcription factor TCF4 sensitizes colorectal cancer cells to (chemo-) radiotherapy

Science.gov (United States)

Kendziorra, Emil; Ahlborn, Kerstin; Spitzner, Melanie; Rave-Fränk, Margret; Emons, Georg; Gaedcke, Jochen; Kramer, Frank; Wolff, Hendrik A.; Becker, Heinz; Beissbarth, Tim; Ebner, Reinhard; Ghadimi, B.Michael; Pukrop, Tobias; Ried, Thomas; Grade, Marian

2011-01-01

A considerable percentage of rectal cancers are resistant to standard preoperative chemoradiotherapy. Because patients with a priori-resistant tumors do not benefit from multimodal treatment, understanding and overcoming this resistance remains of utmost clinical importance. We recently reported overexpression of the Wnt transcription factor TCF4, also known as TCF7L2, in rectal cancers that were resistant to 5-fluorouracil-based chemoradiotherapy. Because Wnt signaling has not been associated with treatment response, we aimed to investigate whether TCF4 mediates chemoradioresistance. RNA interference-mediated silencing of TCF4 was employed in three colorectal cancer (CRC) cell lines, and sensitivity to (chemo-) radiotherapy was assessed using a standard colony formation assay. Silencing of TCF4 caused a significant sensitization of CRC cells to clinically relevant doses of X-rays. This effect was restricted to tumor cells with high T cell factor (TCF) reporter activity, presumably in a β-catenin-independent manner. Radiosensitization was the consequence of (i) a transcriptional deregulation of Wnt/TCF4 target genes, (ii) a silencing-induced G2/M phase arrest, (iii) an impaired ability to adequately halt cell cycle progression after radiation and (iv) a compromised DNA double strand break repair as assessed by γH2AX staining. Taken together, our results indicate a novel mechanism through which the Wnt transcription factor TCF4 mediates chemoradioresistance. Moreover, they suggest that TCF4 is a promising molecular target to sensitize resistant tumor cells to (chemo-) radiotherapy. PMID:21983179

Detection and characterisation of aluminium-containing nanoparticles in Chinese noodles by single particle ICP-MS.

Science.gov (United States)

Loeschner, Katrin; Correia, Manuel; López Chaves, Carlos; Rokkjær, Inge; Sloth, Jens J

2018-01-01

This study investigated Chinese noodles for the presence of aluminium-containing nanoparticles by using inductively coupled plasma mass spectrometry in single particle mode (spICP-MS) after enzymatic digestion by α-amylase. The aluminium concentrations in the noodle samples, determined by conventional ICP-MS without or with the use of hydrofluoric acid for digestion, were 5.4 ± 1.9 µg/g and 10.1 ± 2.2 µg/g (N = 21), respectively. Aluminium-containing nanoparticles were detected by spICP-MS in all 21 samples. Depending on the assumed particle composition, Al 2 O 3 or Al 2 O 3 ∙2SiO 2 ∙2H 2 O, the median particle diameters were either below or above 100 nm, respectively. The minimum detectable particle diameter by spICP-MS was between 54 and 83 nm. The mass recovery of aluminium in the form of particles was between 5% and 18%. The presented work reports for the first time the detection of Al-containing particles in food by spICP-MS.

Multielement determination of major-to-ultratrace elements in deep-seawater salts by ICP-AES and ICP-MS

International Nuclear Information System (INIS)

Sakai, Takeshi; Nakagawa, Koji; Nakajima, Hiroshi; Itoh, Akihide; Ji, Shan; Haraguchi, Hiroki

2002-01-01

Major-to-ultratrace elements in deep-seawater salts were determined by ICP-AES and ICP-MS, after they were separated into the water-soluble, acid-soluble, and insoluble particle components. Deep-seawater salts were prepared from seawater collected at 344 m deep near the off-shore of Cape Muroto in Kochi Prefecture. The major and minor elements in salts were determined by ICP-AES after appropriate dilution with pure water. Trace and ultratrace elements in the water-soluble and acid-soluble components were preconcentrated by a chelating resin preconcentration method. In addition, the major to-ultratrace elements in the insoluble particle component were determined by ICP-AES and ICP-MS, after acid-digestion using HNO 3 /HF/HClO 4 . As a result, 21-35 elements in deep-seawater salts could be determined over the wide concentration range. It was found that the elements, such as Al, V, Fe, Mn, Co, Cu, Zn, and rare earth elements, were more abundant in the acid-soluble component of deep-seawater salts, which may play some essential roles in physiological effectiveness for intake of salt. (author)

Epigenetic silencing of the DNA mismatch repair gene, MLH1, induced by hypoxic stress in a pathway dependent on the histone demethylase, LSD1

Science.gov (United States)

Lu, Yuhong; Wajapeyee, Narendra; Turker, Mitchell S.; Glazer, Peter M.

2014-01-01

SUMMARY Silencing of the MLH1 gene is frequently seen in sporadic cancers. We report that hypoxia causes decreased H3K4 methylation at the MLH1 promoter via the H3K4 demethylases, LSD1 and PLU-1, and promotes long-term silencing of the promoter in a pathway that requires LSD1. Knockdown of LSD1 or its co-repressor, CoREST, also prevents the re-silencing (and cytosine DNA methylation) of the endogenous MLH1 promoter in RKO colon cancer cells following transient reactivation by the DNA methyltransferase inhibitor 5-aza-2′-deoxycytidine (5-aza-dC). The results demonstrate that hypoxia is a critical driving force for silencing of MLH1 through chromatin modification and indicate that the LSD1/CoREST complex is essential for MLH1 silencing. PMID:25043185

Two classes of silencing RNAs move between C. elegans tissues

Science.gov (United States)

Jose, Antony M; Garcia, Giancarlo A; Hunter, Craig P

2011-01-01

Summary Organism-wide RNA interference (RNAi) is due to the transport of mobile silencing RNA throughout the organism but the identities of these mobile RNA species in animals are unknown. Here we present genetic evidence that both the initial double-stranded RNA (dsRNA), which triggers RNAi, and at least one dsRNA intermediate produced during RNAi can act as or generate mobile silencing RNA in Caenorhabditis elegans. This dsRNA intermediate requires the long dsRNA-binding protein RDE-4, the endonuclease DCR-1, which cleaves long dsRNA into double-stranded short-interfering RNA (ds-siRNA), and the putative nucleotidyltransferase MUT-2 (RDE-3). However, single-stranded siRNA and downstream secondary siRNA produced upon amplification by the RNA-dependent RNA Polymerase RRF-1 do not generate mobile silencing RNA. Restricting inter-tissue transport to long dsRNA and directly processed siRNA intermediates rather than amplified siRNA may serve to modulate the extent of systemic silencing in proportion to available dsRNA. PMID:21984186

Silence multiple

DEFF Research Database (Denmark)

Søndergaard, Katia Dupret

The article highlights the importance of silences in the processes of innovation in organizations, and the claim is that silence and the absence of talk distribute authority, responsibility and decisions. The act of silencing is conceptualised as a central “configurating actor”. Using an Actor......-Network Theoretical approach to organization studies silence is conceptualised as both a means and an effect of innovative efforts. It is a way of ordering practices. Thus silencing is thought of as a central potential change agent both in composing a kind of specific organizational collectivity and in composing new...... working practices more generally. In line with the approach to destabilise the mundane, invisible and taken-for-granted aspects of innovative efforts in organisations (crucial for ANT and foucauldian post-structuralism more broadly), this article suggests to non-silence the silence and make...

Simultaneous Silencing of Xylanase Genes in Botrytis cinerea

Directory of Open Access Journals (Sweden)

Néstor García

2017-12-01

Full Text Available The endo-β-1,4-xylanase BcXyn11A is one of several plant cell-wall degrading enzymes that the phytopathogenic fungus Botrytis cinerea secretes during interaction with its hosts. In addition to its enzymatic activity, this protein also acts as an elicitor of the defense response in plants and has been identified as a virulence factor. In the present work, other four endoxylanase coding genes (Bcxyn11B, Bcxyn11C, Bcxyn10A, and Bcxyn10B were identified in the B. cinerea genome and the expression of all five genes was analyzed by Q-RT- PCR in vitro and in planta. A cross-regulation between xylanase genes was identified analyzing their expression pattern in the ΔBcxyn11A mutant strain and a putative BcXyn11A-dependt induction of Bcxyn10B gene was found. In addition, multiple knockdown strains were obtained for the five endoxylanase genes by transformation of B. cinerea with a chimeric DNA construct composed of 50-nt sequences from the target genes. The silencing of each xylanase gene was analyzed in axenic cultures and during infection and the results showed that the efficiency of the multiple silencing depends on the growth conditions and on the cross-regulation between them. Although the simultaneous silencing of the five genes was observed by Q-RT-PCR when the silenced strains were grown on medium supplemented with tomato extract, the endoxylanase activity measured in the supernatants was reduced only by 40%. Unexpectedly, the silenced strains overexpressed the Bcxyn11A and Bcxyn11C genes during the infection of tomato leaves, making difficult the analysis of the role of the endo-β-1,4-xylanases in the virulence of the fungus.

Inflammation kinase PKR phosphorylates α-synuclein and causes α-synuclein-dependent cell death

DEFF Research Database (Denmark)

Reimer, Lasse; Lund, Louise Buur; Betzer, Cristine

2018-01-01

, and acute brain slices), while overexpression of constitutively active PKR increases Ser129 α-syn phosphorylation. Treatment with pre-formed α-synuclein fibrils, proteostatic stress-promoting MG-132 and known PKR activators, herpes simplex virus-1-∆ICP34.5 and LPS, as well as PKR inducer, IFN-β-1b, lead...... on Ser129. Although the inflammation-associated serine-threonine kinase, PKR (EIF2AK2), promotes cellular protection against infection, we demonstrate a pro-degenerative role of activated PKR in an α-synuclein-dependent cell model of multiple system atrophy, where inhibition and silencing of PKR decrease...

Multielemental analysis of Korean geological reference samples by INAA, ICP-AES and ICP-MS

International Nuclear Information System (INIS)

Naoki Shirai; Hiroki Takahashi; Yuta Yokozuka; Mitsuru Ebihara; Meiramkhan Toktaganov; Shun Sekimoto

2015-01-01

Six Korean geological reference samples (KB-1, KGB-1, KT-1, KD-1, KG-1 and KG-2) prepared by Korea Institutes of Geoscience and Mineral Resources were analyzed by using INAA, ICP-AES and ICP-MS. Some elements could be determined by both INAA and non-INAA methods (ICP-AES and ICP-MS), and these data are consistent with each other. This study confirms that a combination of ICP-AES and ICP-MS is comparable to INAA in determining a wide range of major, minor and trace elements in geological materials. (author)

The ethics of silence: Does conflict of interest explain employee silence?

Science.gov (United States)

Anderson, James

2018-03-01

Employee silence constitutes a significant threat to organizational success. This article argues that silence is a by-product of a structural Conflict of Interest (COI) between employees and their employers. This argument turns on the claim, also defended here, that employees are in a privileged position vis-à-vis knowledge of their work and that leaders-whether they recognize it or not-are dependent on their employees for reliable information about the work they are doing. Employee voice, therefore, is an organizational necessity. It is also a moral achievement as it involves risking one's personal interests for the sake of the organization. Leaders must take steps to mitigate COI and encourage employee voice; this article provides several strategies for doing exactly that.

Fundamental studies of interferences in ICP-MS

Energy Technology Data Exchange (ETDEWEB)

Rowley, L.K

2000-11-01

Methods of temperature measurement by mass spectrometry have been critically reviewed. It was concluded that the most appropriate method depended critically on the availability of fundamental data, hence a database of fundamental spectroscopic constants, for diatomic ions which cause interferences in ICP-MS, was compiled. The equilibration temperature, calculated using the different methods and using various diatomic ions as the thermometric probes, was between c.a. 400 - 10,000 K in the central channel, and between c.a. 600 - 16,000 K when the plasma was moved 1.8 mm off-centre. The wide range in temperature reflected the range of temperature measurement methods and uncertainty in the fundamental data. Optical studies using a fibre optic connected to a monochromator were performed in order to investigate the presence of interferences both in the plasma and the interface region of the ICP-MS, and the influence of a shielded torch on these interferences. It was possible to determine the presence of some species in the plasma, such as the strongly bound metal oxides, however, no species other than OH were detected in the interface region of the ICP-MS. The OH rotational temperature within the interface region of the ICP-MS was calculated to be between 2,000 - 4,000 K. The effect of sampling depth, operating power, radial position and solvent loading, with and without the shielded torch, on the dissociation temperature of a variety of polyatomic interferences was investigated. These calculated temperatures were then used to elucidate the site of formation for different polyatomic interferences. Results confirmed that strongly bound ions such as MO{sup +} were formed in the plasma, whereas weakly bound ions such as ArO{sup +} were formed in the interface region due to gross deviation of the calculated temperatures from those expected for a system in thermal equilibrium. (author)

ICP measurement accuracy: the effect of temperature drift. Design of a laboratory test for assessment of ICP transducers.

Science.gov (United States)

Morgalla, M H; Mettenleiter, H; Katzenberger, T

1999-01-01

Intracranial pressure (ICP) monitoring has become the mainstay of multimodal neuromonitoring of comatous patients after head injury. In the presence of rising ICP and faced with pressures, difficult to control, aggressive measures, such as hypothermia may be used. The ICP readings should not be influenced by temperature changes. A laboratory test was designed to simulate temperature variations between 20 degrees C and 45 degrees C at different pressure levels under physiological conditions. Five types of transducers were examined: Epidyn Braun Melsungen, ICT/B-Titan Gaeltec, Camino-OLM-110-4B, Codman MicroSensor ICP-Transducer, Neurovent ICP transducer Rehau Ag+Co. Tests were performed at 6 different pressure levels between 0 mmHg and 50 mmHg. The results show very low drifts of less than 0.15 mmHg degree C-1 for Codman, Epidyn and Neurovent. Gaeltec and Camino exhibited higher drifts of 0.18 mmHg and 0.2 mmHg degree C-1 respectively. Within the temperature range from 35 degrees C to 42 degrees C all probes tested show insignificant temperature drift. Whether these results also apply to other types of transducers needs further evaluation. Problems and requirements related to the design of a laboratory test for the in vitro assessment of ICP transducers are discussed in detail.

Silencing of CXCR4 inhibits tumor cell proliferation and neural invasion in human hilar cholangiocarcinoma.

Science.gov (United States)

Tan, Xin-Yu; Chang, Shi; Liu, Wei; Tang, Hui-Huan

2014-03-01

To evaluate the expression of CXC motif chemokine receptor 4 (CXCR4) in the tissues of patients with hilar cholangiocarcinoma (hilar-CCA) and to investigate the cell proliferation and frequency of neural invasion (NI) influenced by RNAi-mediated CXCR4 silencing. An immunohistochemical technique was used to detect the expression of CXCR4 in 41 clinical tissues, including hilar-CCA, cholangitis, and normal bile duct tissues. The effects of small interference RNA (siRNA)-mediated CXCR4 silencing were detected in the hilar-CCA cell line QBC939. Cell proliferation was determined by MTT. Expression of CXCR4 was monitored by quantitative real time polymerase chain reaction and Western blot analysis. The NI ability of hilar-CCA cells was evaluated using a perineural cell and hilar-CCA cell coculture migration assay. The expression of CXCR4 was significantly induced in clinical hilar-CCA tissue. There was a positive correlation between the expression of CXCR4 and lymph node metastasis/NI in hilar-CCA patients (philar-CCA. CXCR4 is involved in the invasion and proliferation of human hilar-CCA cell line QBC939, indicating that CXCR4 could be a promising therapeutic target for hilar-CCA.

The dynamics and efficacy of antiviral RNA silencing: A model study

Directory of Open Access Journals (Sweden)

Hogeweg Paulien

2008-03-01

Full Text Available Abstract Background Mathematical modeling is important to provide insight in the complicated pathway of RNA silencing. RNA silencing is an RNA based mechanism that is widely used by eukaryotes to fight viruses, and to control gene expression. Results We here present the first mathematical model that combines viral growth with RNA silencing. The model involves a plus-strand RNA virus that replicates through a double-strand RNA intermediate. The model of the RNA silencing pathway consists of cleavage of viral RNA into siRNA by Dicer, target cleavage of viral RNA via the RISC complex, and a secondary response. We found that, depending on the strength of the silencing response, different viral growth patterns can occur. Silencing can decrease viral growth, cause oscillations, or clear the virus completely. Our model can explain various observed phenomena, even when they seem contradictory at first: the diverse responses to the removal of RNA dependent RNA polymerase; different viral growth curves; and the great diversity in observed siRNA ratios. Conclusion The model presented here is an important step in the understanding of the natural functioning of RNA silencing in viral infections.

Silence, an Eye of Knowledge

Directory of Open Access Journals (Sweden)

Mehdi Aghamohammadi

2017-04-01

Full Text Available One of the conspicuous features of the twentieth-century West was silence. This idea could be supported by examining reflections of Ludwig Wittgenstein, Fritz Mauthner, John Cage, Samuel Beckett, Ihab Hassan, Franz Kafka, Wassily Kandinsky, Jean-Paul Sartre, Virginia Woolf, Wolfgang Iser, Jacques Derrida, and Pierre Macherey. To me, silence is not a mere theory, but rather a phenomenon from which we can get practical benefits. I believe silence is an eye, eye of knowledge. We can broaden our knowledge of the world through silence. To convey the idea that silence is an eye, I have concocted the word slence, where  has replaced the letter i and stands for the eye. This means knowledge can enable us to see, thereby acquiring knowledge of, what used to be invisible, and accordingly unknowable. In other words, through silence, we can achieve a certain type of literacy. I substantiate this claim by exploring the Horus myth, Ojo de Dios, John Cage’s 4' 33", the nature of Expressionist paintings, Hinduism, thoughts of Hermes Trismegistus and Ibn al-Arabi, and practices of Mohammad, the prophet of Islam.

TGF-β induces the expression of Nedd4 family-interacting protein 1 (Ndfip1) to silence IL-4 production during iTreg cell differentiation

Science.gov (United States)

Beal, Allison M.; Ramos-Hernández, Natalia; Riling, Chris R.; Nowelsky, Erin A.; Oliver, Paula M.

2011-01-01

Mice deficient for the adaptor Ndfip1 develop inflammation at sites of environmental antigen exposure. We show here that these animals contain fewer inducible regulatory (iTreg) cells. In vitro, Ndfip1-deficient T cells express normal levels of the transcription factor Foxp3 during the first 48 hours of iTreg cell differentiation, however this cannot be sustained. Abortive Foxp3 expression is because Ndfip1–/– cells produce interleukin 4 (IL-4). We demonstrate that Ndfip1 is transiently unregulated during iTreg cell differentiation in a transforming growth factor-β (TGF-β) dependent manner. Once expressed Ndfip1 promotes Itch-mediated degradation of the transcription factor JunB, thus preventing IL-4 production. Based on these data, we propose that TGF-β signaling induces Ndfip1 expression to silence IL-4 production, thus permitting iTreg cell differentiation. PMID:22080920

Lipoxin A4 stable analogs reduce allergic airway responses via mechanisms distinct from CysLT1 receptor antagonism.

Science.gov (United States)

Levy, Bruce D; Lukacs, Nicholas W; Berlin, Aaron A; Schmidt, Birgitta; Guilford, William J; Serhan, Charles N; Parkinson, John F

2007-12-01

Cellular recruitment during inflammatory/immune responses is tightly regulated. The ability to dampen inflammation is imperative for prevention of chronic immune responses, as in asthma. Here we investigated the ability of lipoxin A4 (LXA4) stable analogs to regulate airway responses in two allergen-driven models of inflammation. A 15-epi-LXA4 analog (ATLa) and a 3-oxa-15-epi-LXA4 analog (ZK-994) prevented excessive eosinophil and T lymphocyte accumulation and activation after mice were sensitized and aerosol-challenged with ovalbumin. At 50% and to a greater extent than equivalent doses of the CysLT1 receptor antagonist montelukast. Distinct from montelukast, ATLa treatment led to marked reductions in cysteinyl leukotrienes, interleukin-4 (IL-4), and IL-10, and both ATLa and ZK-994 inhibited levels of IL-13. In cockroach allergen-induced airway responses, both intraperitoneal and oral administration of ZK-994 significantly reduced parameters of airway inflammation and hyper-responsiveness in a dose-dependent manner. ZK-994 also significantly changed the balance of Th1/Th2-specific cytokine levels. Thus, the ATLa/LXA4 analog actions are distinct from CysLT1 antagonism and potently block both allergic airway inflammation and hyper-reactivity. Moreover, these results demonstrate these analogs' therapeutic potential as new agonists for the resolution of inflammation.

Characterization of the RNA silencing suppression activity of the Ebola virus VP35 protein in plants and mammalian cells.

Science.gov (United States)

Zhu, Yali; Cherukuri, Nil Celebi; Jackel, Jamie N; Wu, Zetang; Crary, Monica; Buckley, Kenneth J; Bisaro, David M; Parris, Deborah S

2012-03-01

Ebola virus (EBOV) causes a lethal hemorrhagic fever for which there is no approved effective treatment or prevention strategy. EBOV VP35 is a virulence factor that blocks innate antiviral host responses, including the induction of and response to alpha/beta interferon. VP35 is also an RNA silencing suppressor (RSS). By inhibiting microRNA-directed silencing, mammalian virus RSSs have the capacity to alter the cellular environment to benefit replication. A reporter gene containing specific microRNA target sequences was used to demonstrate that prior expression of wild-type VP35 was able to block establishment of microRNA silencing in mammalian cells. In addition, wild-type VP35 C-terminal domain (CTD) protein fusions were shown to bind small interfering RNA (siRNA). Analysis of mutant proteins demonstrated that reporter activity in RSS assays did not correlate with their ability to antagonize double-stranded RNA (dsRNA)-activated protein kinase R (PKR) or bind siRNA. The results suggest that enhanced reporter activity in the presence of VP35 is a composite of nonspecific translational enhancement and silencing suppression. Moreover, most of the specific RSS activity in mammalian cells is RNA binding independent, consistent with VP35's proposed role in sequestering one or more silencing complex proteins. To examine RSS activity in a system without interferon, VP35 was tested in well-characterized plant silencing suppression assays. VP35 was shown to possess potent plant RSS activity, and the activities of mutant proteins correlated strongly, but not exclusively, with RNA binding ability. The results suggest the importance of VP35-protein interactions in blocking silencing in a system (mammalian) that cannot amplify dsRNA.

Reducing the 2, 4 D+MCPA Antagonism from Hard Spray Waters by Ammonium Sulfate

Directory of Open Access Journals (Sweden)

Seyed Hossein Torabi

2017-03-01

Full Text Available Introduction: Water is the main carrier of herbicides (HC that its quality plays an important role in herbicide performance hard water has a high concentration of Ca++ and Mg++ and reviews have shown that calcium, manganese and zinc are the main factors reducing the effectiveness of weak acid herbicides. Weak acid herbicides such as glyphosate, paraquat, clethodim and 2, 4 D are compounds that release the H+ ions once dissolved in water, but just slightly. Therefore, herbicides that are weak acids partially dissociate. Herbicides not dissociated (the compound remains whole are more readily absorbed by plant foliage than those that dissociate. Dissociated herbicide molecules have a negative charge. After being dissociated, herbicides might remain as negatively charged molecules, or they might bind with other positively charged cations. Binding to some cations improves herbicide uptake and absorption, binding to others such as Ca++ and Mg++ antagonizes herbicide activity by decreasing absorption or activity in the cell. To correct such carriers, the use of adjuvants, such as ammonium sulphate (AMS, is recommended, which can reduce the use of herbicides and cause economic savings. The aim of this study was to investigate the simple effects and interactions between different amounts of AMS and carrier hardness (CH levels on 2, 4 D + MCPA herbicide efficacy in controlling white clover (Trifolium repens L. in turf grass. Materials and Methods: The experiment was laid out in a RCBD with three replications for each treatment during spring-summer 2013 in 10 years old mixed cold season turf grass (Festuca rubra + Poa pratensis + Poa pratensis dominated by white clover in Mashhad (Iran. The treatments were the factorial combination of four carrier hardness (CH rates (Deionized, 45, 90 and 180 ppm of Ca++ +Mg++ and three Ammonium Sulfate (AMS rates (0, 2, 3 and 4 Kg per100 L of carrier water were studied. The turf was sprayed with 2, 4 D + MCPA (67.5% SL at

Pathophysiological Consequences of a Break in S1P1-Dependent Homeostasis of Vascular Permeability Revealed by S1P1 Competitive Antagonism.

Science.gov (United States)

Bigaud, Marc; Dincer, Zuhal; Bollbuck, Birgit; Dawson, Janet; Beckmann, Nicolau; Beerli, Christian; Fishli-Cavelti, Gina; Nahler, Michaela; Angst, Daniela; Janser, Philipp; Otto, Heike; Rosner, Elisabeth; Hersperger, Rene; Bruns, Christian; Quancard, Jean

2016-01-01

Homeostasis of vascular barriers depends upon sphingosine 1-phosphate (S1P) signaling via the S1P1 receptor. Accordingly, S1P1 competitive antagonism is known to reduce vascular barrier integrity with still unclear pathophysiological consequences. This was explored in the present study using NIBR-0213, a potent and selective S1P1 competitive antagonist. NIBR-0213 was tolerated at the efficacious oral dose of 30 mg/kg BID in the rat adjuvant-induced arthritis (AiA) model, with no sign of labored breathing. However, it induced dose-dependent acute vascular pulmonary leakage and pleural effusion that fully resolved within 3-4 days, as evidenced by MRI monitoring. At the supra-maximal oral dose of 300 mg/kg QD, NIBR-0213 impaired lung function (with increased breathing rate and reduced tidal volume) within the first 24 hrs. Two weeks of NIBR-0213 oral dosing at 30, 100 and 300 mg/kg QD induced moderate pulmonary changes, characterized by alveolar wall thickening, macrophage accumulation, fibrosis, micro-hemorrhage, edema and necrosis. In addition to this picture of chronic inflammation, perivascular edema and myofiber degeneration observed in the heart were also indicative of vascular leakage and its consequences. Overall, these observations suggest that, in the rat, the lung is the main target organ for the S1P1 competitive antagonism-induced acute vascular leakage, which appears first as transient and asymptomatic but could lead, upon chronic dosing, to lung remodeling with functional impairments. Hence, this not only raises the question of organ specificity in the homeostasis of vascular barriers, but also provides insight into the pre-clinical evaluation of a potential safety window for S1P1 competitive antagonists as drug candidates.

Obsidian provenance studies in archaeology: A comparison between PIXE, ICP-AES and ICP-MS

International Nuclear Information System (INIS)

Bellot-Gurlet, Ludovic; Poupeau, Gerard; Salomon, Joseph; Calligaro, Thomas; Moignard, Brice; Dran, Jean-Claude; Barrat, Jean-Alix; Pichon, Laurent

2005-01-01

Elemental composition fingerprinting by PIXE technique is very attractive for obsidian provenance studies as it may proceed in a non-destructive mode, even if a more complete elemental characterization can be obtained by ICP-MS and/or ICP-AES. Only few studies have compared results obtained by both methods for solid rock samples. In this work, elemental compositions were determined by ICP-MS/-AES for international geochemical standards and by ICP-MS/-AES and PIXE for inter-laboratory reference obsidians. In addition 49 obsidian source samples and artefacts were analysed by both ICP-MS/-AES and PIXE. Instrumental work and measurement quality control performed for obsidian chemical characterization, underline that PIXE and ICP-MS/-AES provide reproducible, accurate and comparable measurements. In some volcanic districts the limited number of elements dosed by PIXE is sufficient for the discrimination of the potential raw sources of obsidians. Therefore, PIXE can be an advantageous substitute to ICP-MS/-AES techniques for provenance studies

Durability of timber silencers at Wairakei geothermal steam field

Energy Technology Data Exchange (ETDEWEB)

Hedley, M E

1979-02-01

After early failures of reinforced concrete silencers and because of high costs of concrete-lined steel structures, preliminary tests were undertaken to assess the suitability of timber for silencer construction. Tests indicated that radiata pine treated with pentachlorophenol/oil or untreated red beech had most potential for timber silencer fabrication. One prototype silencer of each material was constructed and both were installed on operational bores in 1965. The red beech silencer had a service life of 4 years. The radiata pine silencer operated for 12/sup 1///sub 2/ years, although replacement had been recommended 1 year before this time expired. The performance of this silencer encouraged the general use of timber for silencer construction and further units were built. Procurement of satisfactory grades of timber has proved difficult and has limited silencer fabrication. Ways of improving timber supply, which require modification of silencer design, are discussed.

CB1 receptor antagonism increases hippocampal acetylcholine release: site and mechanism of action.

Science.gov (United States)

Degroot, Aldemar; Köfalvi, Attila; Wade, Mark R; Davis, Richard J; Rodrigues, Ricardo J; Rebola, Nelson; Cunha, Rodrigo A; Nomikos, George G

2006-10-01

Evidence indicates that blockade of cannabinoid receptors increases acetylcholine (ACh) release in brain cortical regions. Although it is assumed that this type of effect is mediated through CB1 receptor (CB1R) antagonism, several in vitro functional studies recently have suggested non-CB1R involvement. In addition, neither the precise neuroanatomical site nor the exact mechanisms underlying this effect are known. We thoroughly examined these issues using a combination of systemic and local administration of CB1R antagonists, different methods of in vivo microdialysis, CB1R knockout (KO) mice, tissue measurements of ACh, and immunochemistry. First, we showed that systemic injections of the CB1R antagonists N-(piperidin-1-yl)-5-(4-chlorophenyl)-1-(2,4-dichlorophenyl)-4-methyl-1H-pyrazole-3-carboximide hydrochloride (SR-141716A) and N-(piperidin-1-yl)-5-(4-iodophenyl)-1-(2, 4-dichlorophenyl)-4-methyl-1H-pyrazole-3-carboxamide (AM251) dose-dependently increased hippocampal ACh efflux. Likewise, local hippocampal, but not septal, infusions of SR141716A or AM251 increased hippocampal ACh release. It is noteworthy that the stimulatory effects of systemically administered CB1R antagonists on hippocampal ACh release were completely abolished in CB1R KO mice. CB1R KO mice had similar basal but higher stress-enhanced hippocampal ACh levels compared with wild-type controls. It is interesting that dopamine D1 receptor antagonism counteracted the stimulatory effect of CB1R blockade on hippocampal ACh levels. Finally, immunohistochemical methods revealed that a high proportion of CB1R-positive nerve terminals were found in hippocampus and confirmed the colocalization of CB1 receptors with cholinergic and dopaminergic nerve terminals. In conclusion, hippocampal ACh release may specifically be controlled through CB1Rs located on both cholinergic and dopaminergic neuronal projections, and CB1R antagonism increases hippocampal ACh release, probably through both a direct

Surface modification of ceramic materials induced by irradiation of high power pulsed ICP

International Nuclear Information System (INIS)

Ishigaki, Takamasa; Okada, Nobuhiro; Ohashi, Naoki; Haneda, Hajime

2003-01-01

Newly developed pulse-modulated high-power inductively coupled plasma [ICP] is expected to offer the unique physico-chemical condition, such as the increased concentration of chemically reactive species, as well as the appropriate heat flux for materials processing. Two kinds of oxide materials, titanium and zinc oxide, were placed at the downstream of Ar-H 2 ICP and irradiated in the plasma of continuous [CN] and pulse-modulated [PM] modes. The CN-ICP irradiation at the position close to the plasma tail gave rise to the thermal reduction of oxides. In the PM-ICP irradiation, the degree of thermal reduction depended on the lower power level during pulse-off time, as well as the total electric power. Irradiation in PM-ICP led to the increased formation of oxygen vacancies in titanium dioxide. In the case of zinc oxide, the UV emission efficiency was improved by PM-ICP irradiation, while the green emission became predominant by CN-ICP irradiation at the appropriate position. Induced effects in the two oxides by PM-ICP would be related to the high concentration of hydrogen radicals in the plasma. (author)

Early Implementation of THAM for ICP Control: Therapeutic Hypothermia Avoidance and Reduction in Hypertonics/Hyperosmotics

Directory of Open Access Journals (Sweden)

F. A. Zeiler

2014-01-01

Full Text Available Background. Tromethamine (THAM has been demonstrated to reduce intracranial pressure (ICP. Early consideration for THAM may reduce the need for other measures for ICP control. Objective. To describe 4 cases of early THAM therapy for ICP control and highlight the potential to avoid TH and paralytics and achieve reduction in sedation and hypertonic/hyperosmotic agent requirements. Methods. We reviewed the charts of 4 patients treated with early THAM for ICP control. Results. We identified 2 patients with aneurysmal subarachnoid hemorrhage (SAH and 2 with traumatic brain injury (TBI receiving early THAM for ICP control. The mean time to initiation of THAM therapy was 1.8 days, with a mean duration of 5.3 days. In all patients, after 6 to 12 hours of THAM administration, ICP stability was achieved, with reduction in requirements for hypertonic saline and hyperosmotic agents. There was a relative reduction in mean hourly hypertonic saline requirements of 89.1%, 96.1%, 82.4%, and 97.0% for cases 1, 2, 3, and 4, respectively, comparing pre- to post-THAM administration. Mannitol, therapeutic hypothermia, and paralytics were avoided in all patients. Conclusions. Early administration of THAM for ICP control could potentially lead to the avoidance of other ICP directed therapies. Prospective studies of early THAM administration are warranted.

Bacterial Associations: Antagonism to Symbiosis

Digital Repository Service at National Institute of Oceanography (India)

Nair, S.

mutualism through commensalisms and competition, to antagonism, determined ultimately by balancing the cost of the association against the benefits received (Pianka, 1994). A continuum can be envisioned that spans a dynamic bridge from antagonism... when two organisms form a relationship, which provides an advantage for both the partners at least temporarily. In commensalisms only one partner derives benefit and the other does not. Symbiosis The word, ?symbiosis? is derived from the Greek word...

LA-ICP-MS of magnetite: Methods and reference materials

Science.gov (United States)

Nadoll, P.; Koenig, A.E.

2011-01-01

Magnetite (Fe3O4) is a common accessory mineral in many geologic settings. Its variable geochemistry makes it a powerful petrogenetic indicator. Electron microprobe (EMPA) analyses are commonly used to examine major and minor element contents in magnetite. Laser ablation ICP-MS (LA-ICP-MS) is applicable to trace element analyses of magnetite but has not been widely employed to examine compositional variations. We tested the applicability of the NIST SRM 610, the USGS GSE-1G, and the NIST SRM 2782 reference materials (RMs) as external standards and developed a reliable method for LA-ICP-MS analysis of magnetite. LA-ICP-MS analyses were carried out on well characterized magnetite samples with a 193 nm, Excimer, ArF LA system. Although matrix-matched RMs are sometimes important for calibration and normalization of LA-ICP-MS data, we demonstrate that glass RMs can produce accurate results for LA-ICP-MS analyses of magnetite. Cross-comparison between the NIST SRM 610 and USGS GSE-1G indicates good agreement for magnetite minor and trace element data calibrated with either of these RMs. Many elements show a sufficiently good match between the LA-ICP-MS and the EMPA data; for example, Ti and V show a close to linear relationship with correlation coefficients, R2 of 0.79 and 0.85 respectively. ?? 2011 The Royal Society of Chemistry.

Silence of the Genes

Indian Academy of Sciences (India)

Home; Journals; Resonance – Journal of Science Education; Volume 12; Issue 4. Silence of the Genes - 2006 Nobel Prize in Physiology or Medicine. Utpal Nath Saumitra Das. General Article Volume 12 Issue 4 April 2007 pp 6-18. Fulltext. Click here to view fulltext PDF. Permanent link:

Experimental testing of Mackay's model for functional antagonism in the isolated costo-uterus of the rat.

Science.gov (United States)

Henry, P. J.; Lulich, K. M.; Paterson, J. W.

1985-01-01

Several key predictions of a recently developed model for functional antagonism (Mackay, 1981) were experimentally tested using the rat isolated costo-uterine preparation. In the presence of the functional antagonist fenoterol (Fen), the functional constants (KAF) for carbachol and oxotremorine (Oxo) were respectively 9.9 and 3.4 fold greater than their corresponding affinity constants (KA). According to Mackay's model for functional antagonism, the higher KAF/KA ratio for carbachol indicates that this cholinoceptor agonist has a greater efficacy than Oxo. This was confirmed by using conventional pharmacological methods. As predicted from the model of functional antagonism, the plot of KAF/KA-1 against the fraction of cholinoceptors not irreversibly blocked by phenoxybenzamine (Pbz) was linear for both carbachol and Oxo and the lines of best fit crossed the axes at a point not significantly different from the origin. The value of 4.6 for the relative efficacy of carbachol to Oxo estimated from functional antagonism studies was comparable to the value of 5.6 calculated using the method of irreversible antagonism proposed by Furchgott (1966). PMID:3840396

Characterisation of Supra- and Infratentorial ICP Profiles.

Science.gov (United States)

Moyse, Emmanuel; Ros, Maxime; Marhar, Fouad; Swider, Pascal; Schmidt, Eric Albert

2016-01-01

In pathophysiology and clinical practice, the intracranial pressure (ICP) profiles in the supratentorial and infratentorial compartments are unclear. We know that the pressure within the skull is unevenly distributed, with demonstrated ICP gradients. We recorded and characterised the supra- and infratentorial ICP patterns to understand what drives the transtentorial ICP gradient.A 70-year-old man was operated on for acute cerebellar infarction. One supratentorial probe and one cerebellar probe were implanted. Both signals were recorded concurrently and analysed off-line. We calculated mean ICP, ICP pulse amplitude, respiratory waves, slow waves and the RAP index of supra- and infratentorial ICP signals. Then, we measured transtentorial difference and performed correlation analysis for every index.Supratentorial ICP mean was 8.5 mmHg lower than infratentorial ICP, but the difference lessens for higher values. Both signals across the tentorium showed close correlation. Supra- and infratentorial pulse amplitude, respiratory waves and slow waves also showed a high degree of correlation. The compensatory reserve (RAP) showed good correlation. In this case report, we demonstrate that the mean value of ICP is higher in the posterior fossa, with a strong correlation across the tentorium. All other ICP-derived parameters display a symmetrical profile.

The Institute on Climate and Planets (ICP): A Research Education Program

Science.gov (United States)

Carlson, Barbara (Technical Monitor)

2003-01-01

Giving students a fair start to become productive and responsible contributors in the 21st century workforce and society depends on our ability to help them develop: (1) A global view of the world; (2) Problem-solving and/or reasoning abilities; (3) Basic scientific and technical literacy; and (4) A multi-disciplinary understanding of how humans and nature interact with the earth system. The Institute on Climate and Planets (ICP) in New York City is NASA Goddard Institute for Space Studies' (GISS) response to the national challenge to give students a fair start to become productive in America's workforce and society, GISS is part of the Earth Science Director at NASA Goddard Space Flight Center in Maryland and a component of Columbia University's Earth Institute, a university-wide initiative whose mission is to understand our planet so as to enhance its sustainability. In 1994 Jim Hansen, several of his GISS and Columbia University colleagues and Fitzgerald Bramwell, the former Director of the New York City Alliance for Minority Participation at City University of New York, launched the ICP. ICP contributes to NASA education and minority outreach goals by directly involving underrepresented college, high school and junior high school students and their educators in research. ICP takes advantage of the interest of many civil servants and Columbia University research scientists at GISS to involve students and educators on multi-level research teams working on problems at the core of NASA's Earth Science Enterprise - advancing our understanding of Earth s climate, climate variability, and climate impacts.

Zinc finger protein 521 antagonizes early B-cell factor 1 and modulates the B-lymphoid differentiation of primary hematopoietic progenitors.

Science.gov (United States)

Mega, Tiziana; Lupia, Michela; Amodio, Nicola; Horton, Sarah J; Mesuraca, Maria; Pelaggi, Daniela; Agosti, Valter; Grieco, Michele; Chiarella, Emanuela; Spina, Raffaella; Moore, Malcolm A S; Schuringa, Jan Jacob; Bond, Heather M; Morrone, Giovanni

2011-07-01

Zinc finger protein 521 (EHZF/ZNF521) is a multi-functional transcription co-factor containing 30 zinc fingers and an amino-terminal motif that binds to the nucleosome remodelling and histone deacetylase (NuRD) complex. ZNF521 is believed to be a relevant player in the regulation of the homeostasis of the hematopoietic stem/progenitor cell compartment, however the underlying molecular mechanisms are still largely unknown. Here, we show that this protein plays an important role in the control of B-cell development by inhibiting the activity of early B-cell factor-1 (EBF1), a master factor in B-lineage specification. In particular, our data demonstrate that: (1) ZNF521 binds to EBF1 via its carboxyl-terminal portion and this interaction is required for EBF1 inhibition; (2) NuRD complex recruitment by ZNF521 is not essential for the inhibition of transactivation of EBF1-dependent promoters; (3) ZNF521 represses EBF1 target genes in a human B-lymphoid molecular context; and (4) RNAi-mediated silencing of ZNF521/Zfp521 in primary human and murine hematopoietic progenitors strongly enhances the generation of B-lymphocytes in vitro. Taken together, our data indicate that ZNF521 can antagonize B-cell development and lend support to the notion that it may contribute to conserve the multipotency of primitive lympho-myeloid progenitors by preventing or delaying their EBF1-driven commitment toward the B-cell lineage.

The Antagonism Mechanism Of Trichoderma spp. Towards Fusarium solani Mold

OpenAIRE

Utami Sri Hastuti; Indriana Rahmawati

2016-01-01

The antagonism ability of seven Trichoderma isolates towards F.solani have been observed and tested by dual culture technique. The antagonism mechanism observed by microscopic observation with light microscope and Scanning Electron Microscopy (SEM). The research result showed seven species of Trichoderma molds have different antagonism ability towards F.solani each other. The antagonism mechanism observed by light microscope and Scanning Electron Microscopy were mycoparasitism, antibiosis, an...

The macromolecular complex of ICP and falcipain-2 from Plasmodium: preparation, crystallization and preliminary X-ray diffraction analysis

International Nuclear Information System (INIS)

Hansen, Guido; Schwarzloh, Britta; Rennenberg, Annika; Heussler, Volker T.; Hilgenfeld, Rolf

2011-01-01

The macromolecular complex of ICP (inhibitor of cysteine proteases) from P. berghei and falcipain-2 from P. falciparum has been prepared and crystallized, and a diffraction data set has been collected to a resolution of 2.6 Å. The malaria parasite Plasmodium depends on the tight control of cysteine-protease activity throughout its life cycle. Recently, the characterization of a new class of potent inhibitors of cysteine proteases (ICPs) secreted by Plasmodium has been reported. Here, the recombinant production, purification and crystallization of the inhibitory C-terminal domain of ICP from P. berghei in complex with the P. falciparum haemoglobinase falcipain-2 is described. The 1:1 complex was crystallized in space group P4 3 , with unit-cell parameters a = b = 71.15, c = 120.09 Å. A complete diffraction data set was collected to a resolution of 2.6 Å

The Antagonism Mechanism Of Trichoderma spp. Towards Fusarium solani Mold

Directory of Open Access Journals (Sweden)

Utami Sri Hastuti

2016-09-01

Full Text Available The antagonism ability of seven Trichoderma isolates towards F.solani have been observed and tested by dual culture technique. The antagonism mechanism observed by microscopic observation with light microscope and Scanning Electron Microscopy (SEM. The research result showed seven species of Trichoderma molds have different antagonism ability towards F.solani each other. The antagonism mechanism observed by light microscope and Scanning Electron Microscopy were mycoparasitism, antibiosis, and competition.

Plutonium bioassay by inductively coupled plasma mass spectrometry ICP/MS

International Nuclear Information System (INIS)

Wyse, E.J.; Fisher, D.R.

1993-04-01

The determination of plutonium in urine poses several analytical challenges, e.g., detectability, matrix, etc. We have investigated the feasibility of analyzing plutonium in processed urine by inductively coupled plasma mass spectrometry (ICP/MS). The urine samples are first spiked with 244 Pu as a tracer and internal standard, then processed by co-precipitation and column chromatography using TRU-Spec trademark, an extraction resin. By enhancing ICP/MS detection capabilities via improved sample introduction and data acquisition efficiencies, an instrumental detection limit of 5 to 50 fg (0.3 to 3 fCi for 239 pu) is typically obtained, depending on the desired degree of quantitation. A brief summary of the analytical method as well as the basis for measuring radionuclides by ICP/MS are submitted; the separation procedure, methods of sample introduction, and data acquisition techniques are then highlighted

Co-evolution of transcriptional silencing proteins and the DNA elements specifying their assembly.

Directory of Open Access Journals (Sweden)

Oliver A Zill

Full Text Available Co-evolution of transcriptional regulatory proteins and their sites of action has been often hypothesized but rarely demonstrated. Here we provide experimental evidence of such co-evolution in yeast silent chromatin, a finding that emerged from studies of hybrids formed between two closely related Saccharomyces species. A unidirectional silencing incompatibility between S. cerevisiae and S. bayanus led to a key discovery: asymmetrical complementation of divergent orthologs of the silent chromatin component Sir4. In S. cerevisiae/S. bayanus interspecies hybrids, ChIP-Seq analysis revealed a restriction against S. cerevisiae Sir4 associating with most S. bayanus silenced regions; in contrast, S. bayanus Sir4 associated with S. cerevisiae silenced loci to an even greater degree than did S. cerevisiae's own Sir4. Functional changes in silencer sequences paralleled changes in Sir4 sequence and a reduction in Sir1 family members in S. cerevisiae. Critically, species-specific silencing of the S. bayanus HMR locus could be reconstituted in S. cerevisiae by co-transfer of the S. bayanus Sir4 and Kos3 (the ancestral relative of Sir1 proteins. As Sir1/Kos3 and Sir4 bind conserved silencer-binding proteins, but not specific DNA sequences, these rapidly evolving proteins served to interpret differences in the two species' silencers presumably involving emergent features created by the regulatory proteins that bind sequences within silencers. The results presented here, and in particular the high resolution ChIP-Seq localization of the Sir4 protein, provided unanticipated insights into the mechanism of silent chromatin assembly in yeast.

Toepassing ICP-AES op het RIKILT

NARCIS (Netherlands)

Ruig, de W.G.

1980-01-01

Rapportage over de toepassing van ICP-AES op het RIKILT. Bij ICP-AES worden twee manieren van lichtemissie detectie toegepast nl. simultaan en sequentieel. De voor- en nadelen van ICP-AES t.o.v. AAS worden op een rij gezet.

Locus-specific ribosomal RNA gene silencing in nucleolar dominance.

Directory of Open Access Journals (Sweden)

Michelle S Lewis

2007-08-01

Full Text Available The silencing of one parental set of rRNA genes in a genetic hybrid is an epigenetic phenomenon known as nucleolar dominance. We showed previously that silencing is restricted to the nucleolus organizer regions (NORs, the loci where rRNA genes are tandemly arrayed, and does not spread to or from neighboring protein-coding genes. One hypothesis is that nucleolar dominance is the net result of hundreds of silencing events acting one rRNA gene at a time. A prediction of this hypothesis is that rRNA gene silencing should occur independent of chromosomal location. An alternative hypothesis is that the regulatory unit in nucleolar dominance is the NOR, rather than each individual rRNA gene, in which case NOR localization may be essential for rRNA gene silencing. To test these alternative hypotheses, we examined the fates of rRNA transgenes integrated at ectopic locations. The transgenes were accurately transcribed in all independent transgenic Arabidopsis thaliana lines tested, indicating that NOR localization is not required for rRNA gene expression. Upon crossing the transgenic A. thaliana lines as ovule parents with A. lyrata to form F1 hybrids, a new system for the study of nucleolar dominance, the endogenous rRNA genes located within the A. thaliana NORs are silenced. However, rRNA transgenes escaped silencing in multiple independent hybrids. Collectively, our data suggest that rRNA gene activation can occur in a gene-autonomous fashion, independent of chromosomal location, whereas rRNA gene silencing in nucleolar dominance is locus-dependent.

TGF-β induces the expression of the adaptor Ndfip1 to silence IL-4 production during iTreg cell differentiation.

Science.gov (United States)

Beal, Allison M; Ramos-Hernández, Natalia; Riling, Chris R; Nowelsky, Erin A; Oliver, Paula M

2011-11-13

Mice deficient in the adaptor Ndfip1 develop inflammation at sites of environmental antigen exposure. We show here that such mice had fewer inducible regulatory T cells (iT(reg) cells). In vitro, Ndfip1-deficient T cells expressed normal amounts of the transcription factor Foxp3 during the first 48 h of iT(reg) cell differentiation; however, this expression was not sustained. Abortive Foxp3 expression was caused by production of interleukin 4 (IL-4) by Ndfip1(-/-) cells. We found that Ndfip1 expression was transiently upregulated during iT(reg) cell differentiation in a manner dependent on transforming growth factor-β (TGF-β). Once expressed, Ndfip1 promoted degradation of the transcription factor JunB mediated by the E3 ubiquitin ligase Itch, thus preventing IL-4 production. On the basis of our data, we propose that TGF-β signaling induces Ndfip1 expression to silence IL-4 production, thus permitting iT(reg) cell differentiation.

Comparison of elemental quantity by PIXE and ICP-MS and/or ICP-AES for NIST standards

International Nuclear Information System (INIS)

Saitoh, K.; Sera, K.; Gotoh, T.; Nakamura, M.

2002-01-01

Urban particulate matter (SRM 1648), Buffalo River sediment (SRM 2704) and pine needle (SRM 1575) standard reference materials prepared by the National Institute of Standards and Technology (NIST, USA) were analyzed by three multi-element analysis methods, i.e., particle induced X-ray emission (PIXE), inductively coupled plasma-mass spectrometry (ICP-MS) and inductively coupled plasma-atomic emission spectrometry (ICP-AES); values determined by those analysis methods were compared with certified and/or non-certified values of NIST samples. Values determined by PIXE were 70-120% relative to certified and/or non-certified values of NIST samples except for Co in the urban particulate matter, for V and Co in Buffalo River sediment and for Ni and Br in the pine needles samples. In particular, Al, K, Ca, Cr, Mn, Fe, Cu, Zn and Pb were 85-110% in all samples. On the other hand, Na and Fe values determined by ICP-MS were very much different from the certified values in all samples, but the other elements were 70-120%. As for ICP-AES, all elements except for Na were 80-100% in all samples. Comparing the values determined by PIXE and those determined by ICP-MS and/or ICP-AES, there was a slight difference between the samples, but the range was 75-120% except for Na, V, Fe and Co determined by ICP-MS and Na determined by ICP-AES, which was generally consistent with PIXE

Performative Silences

DEFF Research Database (Denmark)

Dupret, Katia

2018-01-01

static nor neutral. It has performative effects. Silencing as an act, rather than a noun, is conceptualised as a central ‘configurating actor’ of change. Through the description of minute details from a videotaped supervision session in the mental healthcare sector, it is shown how different performative...... configurations of silence makes people relate to each other in new ways and influence new work practices. In spite of its somewhat immaterial connotations, using an Actor-Network Theory approach to organization studies, silencing is conceptualised as both a means and an effect of change efforts, which are socio...

Interleukin-1 Antagonism Decreases Cortisol Levels in Obese Individuals.

Science.gov (United States)

Urwyler, Sandrine Andrea; Schuetz, Philipp; Ebrahimi, Fahim; Donath, Marc Y; Christ-Crain, Mirjam

2017-05-01

Increased cortisol levels in obesity may contribute to the associated metabolic syndrome. In obesity, the activated innate immune system leads to increased interleukin (IL)-1β, which is known to stimulate the release of adrenocorticotropin hormone (ACTH). We hypothesized that in obesity IL-1 antagonism would result in downregulation of the hypothalamo-pituitary-adrenal axis, leading to decreased cortisol levels. In this prospective intervention study, we included 73 patients with obesity (body mass index [BMI] ≥30 kg/m2) and at least one additional feature of the metabolic syndrome. The primary end point was change in morning cortisol from baseline to after the administration of the IL-1 receptor antagonist (anakinra/Kineret®, total dose 3 × 100 mg). Secondary end points were effects on salivary cortisol and ACTH. Median age was 56 years, 50.7% of patients were female, and median BMI was 36.3 kg/m2. Median morning serum cortisol levels (nmol/L) decreased significantly after IL-1 antagonism [from baseline, 452 to 423; absolute difference, -38.7; 95% confidence interval (CI), -64 to -13.4; P = 0.0019]. Similar effects were found for salivary cortisol levels (-2.8; 95% CI, -4.4 to -1.3; P = 0.0007), ACTH levels (-2.2; 95% CI; -4.2 to -0.1; P = 0.038), systolic blood pressure (-5.2, 95% CI, -8.5 to -1.8; P = 0.0006), and heart rate (-2.9; 95% CI, -4.7 to -1.0; P = 0.0029). IL-1 antagonism in obese individuals with features of the metabolic syndrome leads to a decrease in serum cortisol, salivary cortisol, and ACTH levels along with a reduction in systolic blood pressure and heart rate. Copyright © 2017 Endocrine Society

Quality control of Al alloy by ICP-MS

International Nuclear Information System (INIS)

Zahran, N.F.; Amr, M.A.; Helal, A.I.; Waly, S.A.; Afifi, Y.K.

2000-01-01

Laser ablation sample introduction system in combination with an inductive coupled plasma mass spectrometer (ICP-MS) is used for the investigation of elemental distribution of Al alloy. The samples are ablated by an ultraviolet laser beam at 266 nm with an energy of 4mJ/shot at a repetition rate of 20 Hz. Samples are digested using HNO 3 in a microwave system and analyzed in a solution form by ICP-MS. The quantification of the analytical results is carried out using multielement solution. Quantitative data from the solution samples are used as a standard data for the laser ablation technique. The effect of Aluminum as a matrix is studied. High-resolution mass spectrometer is used to identify the Aluminum polyatomic ions in the ICP-ion source

MicroRNA-Mediated Downregulation of the Potassium Channel Kv4.2 Contributes to Seizure Onset

Directory of Open Access Journals (Sweden)

Christina Gross

2016-09-01

Full Text Available Seizures are bursts of excessive synchronized neuronal activity, suggesting that mechanisms controlling brain excitability are compromised. The voltage-gated potassium channel Kv4.2, a major mediator of hyperpolarizing A-type currents in the brain, is a crucial regulator of neuronal excitability. Kv4.2 expression levels are reduced following seizures and in epilepsy, but the underlying mechanisms remain unclear. Here, we report that Kv4.2 mRNA is recruited to the RNA-induced silencing complex shortly after status epilepticus in mice and after kainic acid treatment of hippocampal neurons, coincident with reduction of Kv4.2 protein. We show that the microRNA miR-324-5p inhibits Kv4.2 protein expression and that antagonizing miR-324-5p is neuroprotective and seizure suppressive. MiR-324-5p inhibition also blocks kainic-acid-induced reduction of Kv4.2 protein in vitro and in vivo and delays kainic-acid-induced seizure onset in wild-type but not in Kcnd2 knockout mice. These results reveal an important role for miR-324-5p-mediated silencing of Kv4.2 in seizure onset.

APETALA 2-domain-containing transcription factors: focusing on abscisic acid and gibberellins antagonism.

Science.gov (United States)

Shu, Kai; Zhou, Wenguan; Yang, Wenyu

2018-02-01

The phytohormones abscisic acid (ABA) and gibberellin (GA) antagonistically mediate diverse plant developmental processes including seed dormancy and germination, root development, and flowering time control, and thus the optimal balance between ABA and GA is essential for plant growth and development. Although more than a half and one century have passed since the initial discoveries of ABA and GA, respectively, the precise mechanisms underlying ABA-GA antagonism still need further investigation. Emerging evidence indicates that two APETALA 2 (AP2)-domain-containing transcription factors (ATFs), ABI4 in Arabidopsis and OsAP2-39 in rice, play key roles in ABA and GA antagonism. These two transcription factors precisely regulate the transcription pattern of ABA and GA biosynthesis or inactivation genes, mediating ABA and GA levels. In this Viewpoint article, we try to shed light on the effects of ATFs on ABA-GA antagonism, and summarize the overlapping but distinct biological functions of these ATFs in the antagonism between ABA and GA. Finally, we strongly propose that further research is needed into the detailed roles of additional numerous ATFs in ABA and GA crosstalk, which will improve our understanding of the antagonism between these two phytohormones. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

RNA-Interference Components Are Dispensable for Transcriptional Silencing of the Drosophila Bithorax-Complex

KAUST Repository

Cernilogar, Filippo M.; Burroughs, A. Maxwell; Lanzuolo, Chiara; Breiling, Achim; Imhof, Axel; Orlando, Valerio

2013-01-01

.Conclusions:We conclude that the Dicer-2/Argonaute-2 RNAi pathway, despite its role in pairing sensitive gene silencing of transgenes, does not have a role in PcG dependent silencing of major homeotic gene cluster loci in Drosophila. © 2013 Cernilogar et al.

Characterization of Elements Regulating the Nuclear-to-Cytoplasmic Translocation of ICP0 in Late Herpes Simplex Virus 1 Infection.

Science.gov (United States)

Samrat, Subodh Kumar; Ha, Binh L; Zheng, Yi; Gu, Haidong

2018-01-15

Infected cell protein 0 (ICP0) of herpes simplex virus 1 (HSV-1) is an immediate early protein containing a RING-type E3 ubiquitin ligase. It targets several host factors for proteasomal degradation and subsequently activates viral expression. ICP0 has a nuclear localization sequence and functions in the nucleus early during infection. However, later in infection, ICP0 is found solely in the cytoplasm. The molecular mechanism and biological function of the ICP0 nuclear-to-cytoplasmic translocation are not well understood. In this study, we sought to characterize elements important for this translocation. We found that (i) in human embryonic lung fibroblast (HEL) cells, ICP0 C-terminal residues 741 to 775 were necessary but not sufficient for the nuclear-to-cytoplasmic translocation; (ii) the loss of ICP0 E3 ubiquitin ligase activity, which led to defective viral replication in nonpermissive cells, also caused mutant ICP0 to be retained in the nucleus of HEL cells; (iii) in permissive U2OS cells, however, ICP0 lacking E3 ligase activity was translocated to the cytoplasm at a pace faster than that of wild-type ICP0, suggesting that nuclear retention of ICP0 occurs in an ICP0 E3 ligase-dependent manner; and (iv) the ICP0 C terminus and late viral proteins cooperate in order to overcome nuclear retention and stimulate ICP0 cytoplasmic translocation. Taken together, less ICP0 nuclear retention may contribute to the permissiveness of U2OS cells to HSV-1 in the absence of functional ICP0. IMPORTANCE A distinct characteristic for eukaryotes is the compartmentalization of cell metabolic pathways, which allows greater efficiency and specificity of cellular functions. ICP0 of HSV-1 is a multifunctional viral protein that travels through different compartments as infection progresses. Its main regulatory functions are carried out in the nucleus, but it is translocated to the cytoplasm late during HSV-1 infection. To understand the biological significance of cytoplasmic ICP0 in

The evolution of reduced antagonism--A role for host-parasite coevolution.

Science.gov (United States)

Gibson, A K; Stoy, K S; Gelarden, I A; Penley, M J; Lively, C M; Morran, L T

2015-11-01

Why do some host-parasite interactions become less antagonistic over evolutionary time? Vertical transmission can select for reduced antagonism. Vertical transmission also promotes coevolution between hosts and parasites. Therefore, we hypothesized that coevolution itself may underlie transitions to reduced antagonism. To test the coevolution hypothesis, we selected for reduced antagonism between the host Caenorhabditis elegans and its parasite Serratia marcescens. This parasite is horizontally transmitted, which allowed us to study coevolution independently of vertical transmission. After 20 generations, we observed a response to selection when coevolution was possible: reduced antagonism evolved in the copassaged treatment. Reduced antagonism, however, did not evolve when hosts or parasites were independently selected without coevolution. In addition, we found strong local adaptation for reduced antagonism between replicate host/parasite lines in the copassaged treatment. Taken together, these results strongly suggest that coevolution was critical to the rapid evolution of reduced antagonism. © 2015 The Author(s). Evolution © 2015 The Society for the Study of Evolution.

Assessment of RNAi-induced silencing in banana (Musa spp.).

Science.gov (United States)

Dang, Tuong Vi T; Windelinckx, Saskia; Henry, Isabelle M; De Coninck, Barbara; Cammue, Bruno P A; Swennen, Rony; Remy, Serge

2014-09-18

In plants, RNA- based gene silencing mediated by small RNAs functions at the transcriptional or post-transcriptional level to negatively regulate target genes, repetitive sequences, viral RNAs and/or transposon elements. Post-transcriptional gene silencing (PTGS) or the RNA interference (RNAi) approach has been achieved in a wide range of plant species for inhibiting the expression of target genes by generating double-stranded RNA (dsRNA). However, to our knowledge, successful RNAi-application to knock-down endogenous genes has not been reported in the important staple food crop banana. Using embryogenic cell suspension (ECS) transformed with ß-glucuronidase (GUS) as a model system, we assessed silencing of gusAINT using three intron-spliced hairpin RNA (ihpRNA) constructs containing gusAINT sequences of 299-nt, 26-nt and 19-nt, respectively. Their silencing potential was analysed in 2 different experimental set-ups. In the first, Agrobacterium-mediated co-transformation of banana ECS with a gusAINT containing vector and an ihpRNA construct resulted in a significantly reduced GUS enzyme activity 6-8 days after co-cultivation with either the 299-nt and 19-nt ihpRNA vectors. In the second approach, these ihpRNA constructs were transferred to stable GUS-expressing ECS and their silencing potential was evaluated in the regenerated in vitro plants. In comparison to control plants, transgenic plants transformed with the 299-nt gusAINT targeting sequence showed a 4.5 fold down-regulated gusA mRNA expression level, while GUS enzyme activity was reduced by 9 fold. Histochemical staining of plant tissues confirmed these findings. Northern blotting used to detect the expression of siRNA in the 299-nt ihpRNA vector transgenic in vitro plants revealed a negative relationship between siRNA expression and GUS enzyme activity. In contrast, no reduction in GUS activity or GUS mRNA expression occurred in the regenerated lines transformed with either of the two gusAINT oligo target

Sumoylation of Sir2 differentially regulates transcriptional silencing in yeast.

Science.gov (United States)

Hannan, Abdul; Abraham, Neethu Maria; Goyal, Siddharth; Jamir, Imlitoshi; Priyakumar, U Deva; Mishra, Krishnaveni

2015-12-02

Silent information regulator 2 (Sir2), the founding member of the conserved sirtuin family of NAD(+)-dependent histone deacetylase, regulates several physiological processes including genome stability, gene silencing, metabolism and life span in yeast. Within the nucleus, Sir2 is associated with telomere clusters in the nuclear periphery and rDNA in the nucleolus and regulates gene silencing at these genomic sites. How distribution of Sir2 between telomere and rDNA is regulated is not known. Here we show that Sir2 is sumoylated and this modification modulates the intra-nuclear distribution of Sir2. We identify Siz2 as the key SUMO ligase and show that multiple lysines in Sir2 are subject to this sumoylation activity. Mutating K215 alone counteracts the inhibitory effect of Siz2 on telomeric silencing. SUMO modification of Sir2 impairs interaction with Sir4 but not Net1 and, furthermore, SUMO modified Sir2 shows predominant nucleolar localization. Our findings demonstrate that sumoylation of Sir2 modulates distribution between telomeres and rDNA and this is likely to have implications for Sir2 function in other loci as well. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Pnc1p-mediated nicotinamide clearance modifies the epigenetic properties of rDNA silencing in Saccharomyces cerevisiae.

Science.gov (United States)

McClure, Julie M; Gallo, Christopher M; Smith, Daniel L; Matecic, Mirela; Hontz, Robert D; Buck, Stephen W; Racette, Frances G; Smith, Jeffrey S

2008-10-01

The histone deacetylase activity of Sir2p is dependent on NAD(+) and inhibited by nicotinamide (NAM). As a result, Sir2p-regulated processes in Saccharomyces cerevisiae such as silencing and replicative aging are susceptible to alterations in cellular NAD(+) and NAM levels. We have determined that high concentrations of NAM in the growth medium elevate the intracellular NAD(+) concentration through a mechanism that is partially dependent on NPT1, an important gene in the Preiss-Handler NAD(+) salvage pathway. Overexpression of the nicotinamidase, Pnc1p, prevents inhibition of Sir2p by the excess NAM while maintaining the elevated NAD(+) concentration. This growth condition alters the epigenetics of rDNA silencing, such that repression of a URA3 reporter gene located at the rDNA induces growth on media that either lacks uracil or contains 5-fluoroorotic acid (5-FOA), an unusual dual phenotype that is reminiscent of telomeric silencing (TPE) of URA3. Despite the similarities to TPE, the modified rDNA silencing phenotype does not require the SIR complex. Instead, it retains key characteristics of typical rDNA silencing, including RENT and Pol I dependence, as well as a requirement for the Preiss-Handler NAD(+) salvage pathway. Exogenous nicotinamide can therefore have negative or positive impacts on rDNA silencing, depending on the PNC1 expression level.

Impaired STING Pathway in Human Osteosarcoma U2OS Cells Contributes to the Growth of ICP0-Null Mutant Herpes Simplex Virus.

Science.gov (United States)

Deschamps, Thibaut; Kalamvoki, Maria

2017-05-01

Human herpes simplex virus 1 (HSV-1) is a widespread pathogen, with 80% of the population being latently infected. To successfully evade the host, the virus has evolved strategies to counteract antiviral responses, including the gene-silencing and innate immunity machineries. The immediately early protein of the virus, infected cell protein 0 (ICP0), plays a central role in these processes. ICP0 blocks innate immunity, and one mechanism is by degrading hostile factors with its intrinsic E3 ligase activity. ICP0 also functions as a promiscuous transactivator, and it blocks repressor complexes to enable viral gene transcription. For these reasons, the growth of a ΔICP0 virus is impaired in most cells, except cells of the human osteosarcoma cell line U2OS, and it is only partially impaired in cells of the human osteosarcoma cell line Saos-2. We found that the two human osteosarcoma cell lines that supported the growth of the ΔICP0 virus failed to activate innate immune responses upon treatment with 2'3'-cyclic GAMP (2'3'-cGAMP), the natural agonist of STING (i.e., stimulator of interferon genes) or after infection with the ΔICP0 mutant virus. Innate immune responses were restored in these cells by transient expression of the STING protein but not after overexpression of interferon-inducible protein 16 (IFI16). Restoration of STING expression resulted in suppression of ΔICP0 virus gene expression and a decrease in viral yields. Overexpression of IFI16 also suppressed ΔICP0 virus gene expression, albeit to a lesser extent than STING. These data suggest that the susceptibility of U2OS and Saos-2 cells to the ΔICP0 HSV-1 is in part due to an impaired STING pathway. IMPORTANCE The DNA sensor STING plays pivotal role in controlling HSV-1 infection both in cell culture and in mice. The HSV-1 genome encodes numerous proteins that are dedicated to combat host antiviral responses. The immediate early protein of the virus ICP0 plays major role in this process as it targets

New application and future of ICP-MS

International Nuclear Information System (INIS)

Masuda, Kimihiko

1994-01-01

By ICP-MS, since high sensibility, multi-element rapid analysis and isotope ratio analysis can be carried out, the position as the analysis for ultra-minute amount of elements has been established. Further recently, sample feeder system has been developed, and the multi-collector type device for the purpose of high resolution type isotope ratio analysis has appeared, so the range of its application is spreading more and more. In this report, the examples of application which were able to be attained accompanying the development of these devices are introduced, and the development of the ICP-MS hereafter is described. At present, about 1000 apparatuses are in operation in the world, and the application spread to the fields of semiconductors and materials, earth science, environment, atomic energy and so on. The ICP-MS was developed for the purpose of easily carrying out spectral analysis with high sensibility by using argon ICP as the ion source and doing ion detection which is more efficient than light detection, and has lower background. The progress and the present status of the ICP-MS are reported. As the latest examples of application of the ICP-MS, the analysis of iron by quadrupole type ICP-MS, the small region measurement of solids by laser abrasion, ultra-minute amount analysis by high resolution ICP-MS, the isotope ratio measurement of lead by multi-collector type ICP-MS are reported. (K.I.)

"Listening Silence" and Its Discursive Effects

Science.gov (United States)

Applebaum, Barbara

2016-01-01

While researchers have studied how white silence protects white innocence and white ignorance, in this essay Barbara Applebaum explores a form of white silence that she refers to as "listening silence" in which silence protects white innocence but does not necessarily promote resistance to learning. White listening silence can appear to…

Exploitative and hierarchical antagonism in a cooperative bacterium.

Directory of Open Access Journals (Sweden)

Francesca Fiegna

2005-11-01

Full Text Available Social organisms that cooperate with some members of their own species, such as close relatives, may fail to cooperate with other genotypes of the same species. Such noncooperation may take the form of outright antagonism or social exploitation. Myxococcus xanthus is a highly social prokaryote that cooperatively develops into spore-bearing, multicellular fruiting bodies in response to starvation. Here we have characterized the nature of social interactions among nine developmentally proficient strains of M. xanthus isolated from spatially distant locations. Strains were competed against one another in all possible pairwise combinations during starvation-induced development. In most pairings, at least one competitor exhibited strong antagonism toward its partner and a majority of mixes showed bidirectional antagonism that decreased total spore production, even to the point of driving whole populations to extinction. Differential response to mixing was the primary determinant of competitive superiority rather than the sporulation efficiencies of unmixed populations. In some competitive pairings, the dominant partner sporulated more efficiently in mixed populations than in clonal isolation. This finding represents a novel form of exploitation in bacteria carried out by socially competent genotypes and is the first documentation of social exploitation among natural bacterial isolates. Patterns of antagonistic superiority among these strains form a highly linear dominance hierarchy. At least some competition pairs construct chimeric, rather than segregated, fruiting bodies. The cooperative prokaryote M. xanthus has diverged into a large number of distinct social types that cooperate with clone-mates but exhibit intense antagonism toward distinct social types of the same species. Most lengthy migration events in nature may thus result in strong antagonism between migratory and resident populations, and this antagonism may have large effects on local

Registration of TLS and MLS Point Cloud Combining Genetic Algorithm with ICP

Directory of Open Access Journals (Sweden)

YAN Li

2018-04-01

Full Text Available Large scene point cloud can be quickly acquired by mobile laser scanning (MLS technology,which needs to be supplemented by terrestrial laser scanning (TLS point cloud because of limited field of view and occlusion.MLS and TLS point cloud are located in geodetic coordinate system and local coordinate system respectively.This paper proposes an automatic registration method combined genetic algorithm (GA and iterative closed point ICP to achieve a uniform coordinate reference frame.The local optimizer is utilized in ICP.The efficiency of ICP is higher than that of GA registration,but it depends on a initial solution.GA is a global optimizer,but it's inefficient.The combining strategy is that ICP is enabled to complete the registration when the GA tends to local search.The rough position measured by a built-in GPS of a terrestrial laser scanner is used in the GA registration to limit its optimizing search space.To improve the GA registration accuracy,a maximum registration model called normalized sum of matching scores (NSMS is presented.The results for measured data show that the NSMS model is effective,the root mean square error (RMSE of GA registration is 1~5 cm and the registration efficiency can be improved by about 50% combining GA with ICP.

Rhubarb Antagonizes Matrix Metalloproteinase-9-induced Vascular Endothelial Permeability

Directory of Open Access Journals (Sweden)

Yun-Liang Cui

2016-01-01

Conclusions: The rhubarb mixture of emodin, 3,8-dihydroxy-1-methyl-anthraquinone-2-carboxylic acid, 1-O-caffeoyl-2-(4-hydroxyl-O-cinnamoyl-β-D-glucose, daucosterol linoleate, and rhein, at a low concentration, antagonized the MMP9-induced HUVEC monolayer permeability by promoting HUVEC proliferation and reducing extracellular VE-cadherin concentrations.

Synemin promotes AKT-dependent glioblastoma cell proliferation by antagonizing PP2A.

Science.gov (United States)

Pitre, Aaron; Davis, Nathan; Paul, Madhumita; Orr, A Wayne; Skalli, Omar

2012-04-01

The intermediate filament protein synemin is present in astrocyte progenitors and glioblastoma cells but not in mature astrocytes. Here we demonstrate a role for synemin in enhancing glioblastoma cell proliferation and clonogenic survival, as synemin RNA interference decreased both behaviors by inducing G1 arrest along with Rb hypophosphorylation and increased protein levels of the G1/S inhibitors p21(Cip1) and p27(Kip1). Akt involvement was demonstrated by decreased phosphorylation of its substrate, p21(Cip1), and reduced Akt catalytic activity and phosphorylation at essential activation sites. Synemin silencing, however, did not affect the activities of PDPK1 and mTOR complex 2, which directly phosphorylate Akt activation sites, but instead enhanced the activity of the major regulator of Akt dephosphorylation, protein phosphatase type 2A (PP2A). This was accompanied by changes in PP2A subcellular distribution resulting in increased physical interactions between PP2A and Akt, as shown by proximity ligation assays (PLAs). PLAs and immunoprecipitation experiments further revealed that synemin and PP2A form a protein complex. In addition, treatment of synemin-silenced cells with the PP2A inhibitor cantharidic acid resulted in proliferation and pAkt and pRb levels similar to those of controls. Collectively these results indicate that synemin positively regulates glioblastoma cell proliferation by helping sequester PP2A away from Akt, thereby favoring Akt activation.

Aggression, Sibling Antagonism, and Theory-of-Mind During the First Year of Siblinghood: A Developmental Cascade Model

Science.gov (United States)

Song, Ju-Hyun; Volling, Brenda L.; Lane, Jonathan D.; Wellman, Henry M.

2016-01-01

A developmental cascade model was tested to examine longitudinal associations among firstborn children’s aggression, Theory-of-Mind, and antagonism toward their younger sibling during the first year of siblinghood. Aggression and Theory-of-Mind were assessed before the birth of a sibling, and 4 and 12 months after the birth, and antagonism was examined at 4 and 12 months in a sample of 208 firstborn children (initial M age = 30 months, 56% girls) from primarily European American, middle- class families. Firstborns’ aggression consistently predicted high sibling antagonism both directly and through poorer Theory-of-Mind. Results highlight the importance of examining longitudinal influences across behavioral, social-cognitive, and relational factors that are closely intertwined even from the early years of life. PMID:27096923

ICP (ITER Collaborative Platform)

Energy Technology Data Exchange (ETDEWEB)

Capuano, C.; Carayon, F.; Patel, V. [ITER, 13 - St. Paul-Lez Durance (France)

2009-07-01

The ITER organization has the necessity to manage a massive amount of data and processes. Each team requires different process and databases often interconnected with those of others teams. ICP is the current central ITER repository of structured and unstructured data. All data in ICP is served and managed via a web interface that provides global accessibility with a common user friendly interface. This paper will explain the model used by ICP and how it serves the ITER project by providing a robust and agile platform. ICP is developed in ASP.NET using MSSQL Server for data storage. It currently houses 15 data driven applications, 150 different types of record, 500 k objects and 2.5 M references. During European working hours the system averages 150 concurrent users and 20 requests per second. ICP connects to external database applications to provide a single entry point to ITER data and a safe shared storage place to maintain this data long-term. The Core model provides an easy to extend framework to meet the future needs of the Organization. ICP follows a multi-tier architecture, providing logical separation of process. The standard three-tier architecture is expanded, with the data layer separated into data storage, data structure, and data access components. The business or applications logic layer is broken up into a common business functionality layer, a type specific logic layer, and a detached work-flow layer. Finally the presentation tier comprises a presentation adapter layer and an interface layer. Each layer is built up from small blocks which can be combined to create a wide range of more complex functionality. Each new object type developed gains access to a wealth of existing code functionality, while also free to adapt and extend this. The hardware structure is designed to provide complete redundancy, high availability and to handle high load. This document is composed of an abstract followed by the presentation transparencies. (authors)

Telomeric trans-silencing: an epigenetic repression combining RNA silencing and heterochromatin formation.

Directory of Open Access Journals (Sweden)

Thibaut Josse

2007-09-01

Full Text Available The study of P-element repression in Drosophila melanogaster led to the discovery of the telomeric Trans-Silencing Effect (TSE, a repression mechanism by which a transposon or a transgene inserted in subtelomeric heterochromatin (Telomeric Associated Sequence or TAS has the capacity to repress in trans in the female germline, a homologous transposon, or transgene located in euchromatin. TSE shows variegation among egg chambers in ovaries when silencing is incomplete. Here, we report that TSE displays an epigenetic transmission through meiosis, which involves an extrachromosomal maternally transmitted factor. We show that this silencing is highly sensitive to mutations affecting both heterochromatin formation (Su(var205 encoding Heterochromatin Protein 1 and Su(var3-7 and the repeat-associated small interfering RNA (or rasiRNA silencing pathway (aubergine, homeless, armitage, and piwi. In contrast, TSE is not sensitive to mutations affecting r2d2, which is involved in the small interfering RNA (or siRNA silencing pathway, nor is it sensitive to a mutation in loquacious, which is involved in the micro RNA (or miRNA silencing pathway. These results, taken together with the recent discovery of TAS homologous small RNAs associated to PIWI proteins, support the proposition that TSE involves a repeat-associated small interfering RNA pathway linked to heterochromatin formation, which was co-opted by the P element to establish repression of its own transposition after its recent invasion of the D. melanogaster genome. Therefore, the study of TSE provides insight into the genetic properties of a germline-specific small RNA silencing pathway.

Antiviral RNA silencing initiated in the absence of RDE-4, a double-stranded RNA binding protein, in Caenorhabditis elegans.

Science.gov (United States)

Guo, Xunyang; Zhang, Rui; Wang, Jeffrey; Lu, Rui

2013-10-01

Small interfering RNAs (siRNAs) processed from double-stranded RNA (dsRNA) of virus origins mediate potent antiviral defense through a process referred to as RNA interference (RNAi) or RNA silencing in diverse organisms. In the simple invertebrate Caenorhabditis elegans, the RNAi process is initiated by a single Dicer, which partners with the dsRNA binding protein RDE-4 to process dsRNA into viral siRNAs (viRNAs). Notably, in C. elegans this RNA-directed viral immunity (RDVI) also requires a number of worm-specific genes for its full antiviral potential. One such gene is rsd-2 (RNAi spreading defective 2), which was implicated in RDVI in our previous studies. In the current study, we first established an antiviral role by showing that rsd-2 null mutants permitted higher levels of viral RNA accumulation, and that this enhanced viral susceptibility was reversed by ectopic expression of RSD-2. We then examined the relationship of rsd-2 with other known components of RNAi pathways and established that rsd-2 functions in a novel pathway that is independent of rde-4 but likely requires the RNA-dependent RNA polymerase RRF-1, suggesting a critical role for RSD-2 in secondary viRNA biogenesis, likely through coordinated action with RRF-1. Together, these results suggest that RDVI in the single-Dicer organism C. elegans depends on the collective actions of both RDE-4-dependent and RDE-4-independent mechanisms to produce RNAi-inducing viRNAs. Our study reveals, for the first time, a novel siRNA-producing mechanism in C. elegans that bypasses the need for a dsRNA-binding protein.

The Nuclear Cap-Binding Complex Mediates Meiotic Silencing by Unpaired DNA

Directory of Open Access Journals (Sweden)

Logan M. Decker

2017-04-01

Full Text Available In the filamentous fungus Neurospora crassa, cross walls between individual cells are normally incomplete, making the entire fungal network vulnerable to attack by viruses and selfish DNAs. Accordingly, several genome surveillance mechanisms are maintained to help the fungus combat these repetitive elements. One of these defense mechanisms is called meiotic silencing by unpaired DNA (MSUD, which identifies and silences unpaired genes during meiosis. Utilizing common RNA interference (RNAi proteins, such as Dicer and Argonaute, MSUD targets mRNAs homologous to the unpaired sequence to achieve silencing. In this study, we have identified an additional silencing component, namely the cap-binding complex (CBC. Made up of cap-binding proteins CBP20 and CBP80, CBC associates with the 5′ cap of mRNA transcripts in eukaryotes. The loss of CBC leads to a deficiency in MSUD activity, suggesting its role in mediating silencing. As confirmed in this study, CBC is predominantly nuclear, although it is known to travel in and out of the nucleus to facilitate RNA transport. As seen in animals but not in plants, CBP20’s robust nuclear import depends on CBP80 in Neurospora. CBC interacts with a component (Argonaute of the perinuclear meiotic silencing complex (MSC, directly linking the two cellular factors.

ICP-MS and elemental tags for the life sciences

Energy Technology Data Exchange (ETDEWEB)

Giesen, Charlotte

2012-08-07

Inductively coupled plasma mass spectrometry (ICP-MS) has been applied for the analysis of biomolecules due to its high sensitivity, wide linear dynamic range, and multielement capabilities. However, outside the elemental MS community the potential of this technique, e.g. for life sciences applications, is not yet fully exploited. Thus, the development of ICP-MS-based (immuno) assays for a wide range of medical (cancer diagnostics, cisplatin toxicity studies), biochemical (DNA microarray, single cell analysis), and environmental (analysis of comestible goods) applications was accomplished by utilization of chemical labels. Laser ablation (LA)-ICP-MS was employed for the direct analysis of solid samples like microarrays and thin tissue sections. An immunoassay was developed for ochratoxin A (OTA) determination in wine, and ICP-MS detection was compared to conventional photometry by gold nanoparticle tagging and horseradish peroxidase, respectively. Detection limits of the assay were optimized to 0.003 {mu}g L{sup -1}, and the quantification range was 0.01-1 {mu}g L{sup -1} for both methods. For LA-ICP-MS-based DNA microarray detection, gold nanoparticle tags were specifically introduced via a streptavidin-biotin linkage. In immunohistochemistry (IHC), up to 20 tumor markers are routinely evaluated for one patient and thus, a common analysis results in a series of time consuming staining procedures. Hence, LA-ICP-MS was elaborated as a detection tool for a novel, multiplexed IHC analysis of tissue sections. Different lanthanides were employed for the simultaneous detection of up to three tumor markers (Her 2, CK 7, and MUC 1) in a breast cancer tissue. Additionally, iodine was employed as a labeling reagent, and a new LA-ICP-MS method for single cell and cell nucleus imaging was developed at 4 {mu}m laser spot size. Iodine was also applied as a new internal standard for tissue samples. Moreover, Pt-protein complexes separated by an optimized 1D and 2D gel

Comparative study for toxic elements determination in air particulate reference material by INAA, CCT-ICP-MS, and ICP-MS

International Nuclear Information System (INIS)

Lim, J.M.; Lee, J.H.; Kim, K.H.; Moon, J.H.; Chung, Y.S.

2005-01-01

Although toxic elements are minor components in the atmospheric environment, they play a significant role as important marker for atmospheric science such as risk assessment, long-range transfer study, and source apportionment. Therefore, the techniques, which allow accurate and fast elemental analysis with a minimum pre-treatment, are very important. INAA has a main advantage of non-destruction of air particulate samples, while inductively Coupled plasma with mass spectrometry (ICP-MS) encounters the most significant difficulties in pre-treatment (digestion, fusion, and dilution) and polyatomic spectral interferences for interest toxic elements, Although INAA is still reference method, a number of factors (disadvantages of cost, complexity of the instruments, and scarcity of nuclear reactor) limit its applications. To date, the use of collision cell technology ICP-MS (CCT-ICP-MS) is recommended instead of typical ICP-MS for the analysis of the toxic elements; this is because CCT-ICP-MS technique prevents polyatomic spectral interferences despite of contamination and volatile effects. In this study, a number of toxic elements in reference material, NIST SRM 2783 (air particulate on filter media) were determined by INAA, CCT-ICP-MS, and ICP-MS. For both ICP methods, the filters were decomposed by microwave digestion with 5mL nitric acid. The analytical results by three methods were compared with certificated data; the INAA results showed the most accurate and precise data sets for all target elements among three methods. In detail, the deviation between analytical results and SRM's by INAA fell below 10% for all elements excluding As (14%), while those by CCT-ICP-MS were about 20%. For ICP-MS, the result does not agree with certificated data for several elements, because polyatomic spectral interference (due to 40 Ar 35 Cl, 40 Ar 23 Na, and 35 Cl 16 O) generate positive error of analytical result for As, Cu, and V. Based on our result, INAA is still one of the most

Sodium Bicarbonate for Control of ICP: A Systematic Review.

Science.gov (United States)

Zeiler, Frederick A; Sader, Nicholas; West, Michael; Gillman, Lawrence M

2018-01-01

Our goal was to perform a systematic review of the literature on the use of intravenous sodium bicarbonate for intracranial pressure (ICP) reduction in patients with neurologic illness. Data sources: articles from MEDLINE, BIOSIS, EMBASE, Global Health, Scopus, Cochrane Library, the International Clinical Trials Registry Platform (inception to April 2015), reference lists of relevant articles, and gray literature were searched. 2 reviewers independently extracted data including population characteristics and treatment characteristics. The strength of evidence was adjudicated using both the Oxford and Grading of Recommendation Assessment Development and Education methodology. Our search strategy produced a total 559 citations. Three original articles were included in the review. There were 2 prospective studies, 1 randomized control trial and 1 single arm, and 1 retrospective case report.Across all studies there were a total of 19 patients studied, with 31 episodes of elevated ICP being treated. Twenty-one of those episodes were treated with sodium bicarbonate infusion, with the remaining 10 treated with hypertonic saline in a control model. All elevated ICP episodes treated with sodium bicarbonate solution demonstrated a significant drop in ICP, without an elevation of serum partial pressure of carbon dioxide. No significant complications were described. There currently exists Oxford level 4, Grading of Recommendation Assessment Development and Education D evidence to support an ICP reduction effect with intravenous sodium bicarbonate in TBI. No comments on its impact in other neuropathologic states, or on patient outcomes, can be made at this time.

Silencing of mitochondrial NADP+-dependent isocitrate dehydrogenase gene enhances glioma radiosensitivity

International Nuclear Information System (INIS)

Kim, Sung Youl; Yoo, Young Hyun; Park, Jeen-Woo

2013-01-01

Highlights: •Silencing of the IDPm gene enhances IR-induced autophagy in glioma cells. •Autophagy inhibition augmented apoptosis of irradiated glioma cells. •Results offer a redox-active therapeutic strategy for the treatment of cancer. -- Abstract: Reactive oxygen species (ROS) levels are elevated in organisms that have been exposed to ionizing radiation and are protagonists in the induction of cell death. Recently, we demonstrated that the control of mitochondrial redox balance and the cellular defense against oxidative damage are primary functions of mitochondrial NADP + -dependent isocitrate dehydrogenase (IDPm) via the supply of NADPH for antioxidant systems. In the present study, we report an autophagic response to ionizing radiation in A172 glioma cells transfected with small interfering RNA (siRNA) targeting the IDPm gene. Autophagy in A172 transfectant cells was associated with enhanced autophagolysosome formation and GFP–LC3 punctuation/aggregation. Furthermore, we found that the inhibition of autophagy by chloroquine augmented apoptotic cell death of irradiated A172 cells transfected with IDPm siRNA. Taken together, our data suggest that autophagy functions as a survival mechanism in A172 cells against ionizing radiation-induced apoptosis and the sensitizing effect of IDPm siRNA and autophagy inhibitor on the ionizing radiation-induced apoptotic cell death of glioma cells offers a novel redox-active therapeutic strategy for the treatment of cancer

Silêncios Silences

Directory of Open Access Journals (Sweden)

Luciano Marcondes Godoy

1999-01-01

Full Text Available Muitas são as vivências que se expressarão em SILÊNCIOS. Muitos são os silêncios. No Bloco A, o silêncio denuncia a retirada para um outro mundo, a queda num abismo. No bloco B, o silêncio é controlador, exigindo a fala do analista, um jogo em que o que é falado não tem a menor importância. Surge ainda como expressão da necessidade de discriminar-se do analista e, na sua evolução, como um enfrentamento a um estado sem sentido. No Bloco C, o silêncio é agressivo, e a sobrevivência do analisando e analista ao mesmo criará um espaço que propiciará sonhos que surgirão no Bloco D. Esses momentos de silêncio-sonho são situações em que não há discriminação eu-não eu.Many are the experiences which are expressed through silences. Many are the silences. In Block A, silence denounces a pretreatment to another world, a fall into an abysm. In Block B, silence is a controlling factor, demanding the words of the analyst, a game where what is said does not have any importance what so ever. It emerges also as an expression of the analyst's necessity to discriminate himself, and within his evolution the revision of a senseless state. In Block C, the silence is aggressive. As a response, the survival of the patient and of the analyst will create a place in which dreams will come up. Block D analyses these moments of dream-silence situations, where there aren't any forms of self-non self discrimination.

Voice and silence in organizations

Directory of Open Access Journals (Sweden)

Moaşa, H.

2011-01-01

Full Text Available Unlike previous research on voice and silence, this article breaksthe distance between the two and declines to treat them as opposites. Voice and silence are interrelated and intertwined strategic forms ofcommunication which presuppose each other in such a way that the absence of one would minimize completely the other’s presence. Social actors are not voice, or silence. Social actors can have voice or silence, they can do both because they operate at multiple levels and deal with multiple issues at different moments in time.

Determination of rhenium traces in river water by Q-ICP-MS and HR-ICP-MS

International Nuclear Information System (INIS)

Uchida, S.; Tagami, K.; Saito, M.

2003-01-01

A simple separation method was applied to determine rhenium in river water using Q-ICP-MS and HR-ICP-MS. Re was concentrated from 420-925 ml river water using a TEVA resin minicolumn. Such extraction using a resin could separate Re from most sample matrices and trace elements. Almost 100% recovery was found throughout the method as determined with radioactive multitracers. The HR-ICP-MS was also used for the direct determination because of its low detection limit for Re (0.007 pg/ml). The Re concentration in the river water samples ranged from 0.9 to 6.5 pg/ml and the three analysis results showed good agreement with each other. (author)

Determination of phosphorus in small amounts of protein samples by ICP-MS.

Science.gov (United States)

Becker, J Sabine; Boulyga, Sergei F; Pickhardt, Carola; Becker, J; Buddrus, Stefan; Przybylski, Michael

2003-02-01

Inductively coupled plasma mass spectrometry (ICP-MS) is used for phosphorus determination in protein samples. A small amount of solid protein sample (down to 1 micro g) or digest (1-10 micro L) protein solution was denatured in nitric acid and hydrogen peroxide by closed-microvessel microwave digestion. Phosphorus determination was performed with an optimized analytical method using a double-focusing sector field inductively coupled plasma mass spectrometer (ICP-SFMS) and quadrupole-based ICP-MS (ICP-QMS). For quality control of phosphorus determination a certified reference material (CRM), single cell proteins (BCR 273) with a high phosphorus content of 26.8+/-0.4 mg g(-1), was analyzed. For studies on phosphorus determination in proteins while reducing the sample amount as low as possible the homogeneity of CRM BCR 273 was investigated. Relative standard deviation and measurement accuracy in ICP-QMS was within 2%, 3.5%, 11% and 12% when using CRM BCR 273 sample weights of 40 mg, 5 mg, 1 mg and 0.3 mg, respectively. The lowest possible sample weight for an accurate phosphorus analysis in protein samples by ICP-MS is discussed. The analytical method developed was applied for the analysis of homogeneous protein samples in very low amounts [1-100 micro g of solid protein sample, e.g. beta-casein or down to 1 micro L of protein or digest in solution (e.g., tau protein)]. A further reduction of the diluted protein solution volume was achieved by the application of flow injection in ICP-SFMS, which is discussed with reference to real protein digests after protein separation using 2D gel electrophoresis.The detection limits for phosphorus in biological samples were determined by ICP-SFMS down to the ng g(-1) level. The present work discusses the figure of merit for the determination of phosphorus in a small amount of protein sample with ICP-SFMS in comparison to ICP-QMS.

AGO/RISC-mediated antiviral RNA silencing in a plant in vitro system.

Science.gov (United States)

Schuck, Jana; Gursinsky, Torsten; Pantaleo, Vitantonio; Burgyán, Jozsef; Behrens, Sven-Erik

2013-05-01

AGO/RISC-mediated antiviral RNA silencing, an important component of the plant's immune response against RNA virus infections, was recapitulated in vitro. Cytoplasmic extracts of tobacco protoplasts were applied that supported Tombusvirus RNA replication, as well as the formation of RNA-induced silencing complexes (RISC) that could be functionally reconstituted with various plant ARGONAUTE (AGO) proteins. For example, when RISC containing AGO1, 2, 3 or 5 were programmed with exogenous siRNAs that specifically targeted the viral RNA, endonucleolytic cleavages occurred and viral replication was inhibited. Antiviral RNA silencing was disabled by the viral silencing suppressor p19 when this was present early during RISC formation. Notably, with replicating viral RNA, only (+)RNA molecules were accessible to RISC, whereas (-)RNA replication intermediates were not. The vulnerability of viral RNAs to RISC activity also depended on the RNA structure of the target sequence. This was most evident when we characterized viral siRNAs (vsiRNAs) that were particularly effective in silencing with AGO1- or AGO2/RISC. These vsiRNAs targeted similar sites, suggesting that accessible parts of the viral (+)RNA may be collectively attacked by different AGO/RISC. The in vitro system was, hence, established as a valuable tool to define and characterize individual molecular determinants of antiviral RNA silencing.

In trans silencing properties of a tobacco transgene locus depend on its epigenetic state

Czech Academy of Sciences Publication Activity Database

Fojtová, Miloslava; Van Houdt, H.; Depicker, A.; Kovařík, Aleš

2004-01-01

Roč. 26, č. 3 (2004), s. 147 ISSN 0137-5881. [Congress of the Federation of European Societies of Plant Biology /14./. 23.08.2004-27.08.2004, Cracow] Keywords : plant transgenes * gene expression * silencing Subject RIV: BO - Biophysics

ICP curve morphology and intracranial flow-volume changes

DEFF Research Database (Denmark)

Unnerbäck, Mårten; Ottesen, Johnny T.; Reinstrup, Peter

2018-01-01

proposed to shape the ICP curve. This study tested the hypothesis that the ICP curve correlates to intracranial volume changes. METHODS: Cine phase contrast magnetic resonance imaging (MRI) examinations were performed in neuro-intensive care patients with simultaneous ICP monitoring. The MRI was set......BACKGROUND: The intracranial pressure (ICP) curve with its different peaks has been extensively studied, but the exact physiological mechanisms behind its morphology are still not fully understood. Both intracranial volume change (ΔICV) and transmission of the arterial blood pressure have been...

PIXE analysis of human stones: comparison with data from ICP-AES

International Nuclear Information System (INIS)

Pougnet, M.A.B.; Peisach, M.; Pineda, C.A.; Rodgers, A.L.

1987-01-01

25 human stone samples previously analyzed by inductively coupled plasma atomic emission spectroscopy (ICP-AES) and the IAEA Animal Bone Standard Reference Material were used to evaluate trace element analysis by PIXE. Bombardment with 4 MeV protons was used for the determination of Mn, Fe, Cu, Pb, Br, Rb, Sr and Ca. PIXE and ICP-AES data gave correlation factors better than 0.97 for the elements Ca, Fe, Zn, Sr and Pb. (author) 9 refs.; 5 figs

The parental antagonism theory of language evolution: preliminary evidence for the proposal.

Science.gov (United States)

Brown, William M

2011-04-01

not maternally silenced Alu elements are positively correlated with language diversity. Furthermore, there is a much higher than expected frequency of Alu elements inserted into the protein-coding machinery of imprinted and X-chromosomal language loci compared with nonimprinted language loci. Taken together these findings provide some support for parental antagonism theory. Unlike previous theories for language evolution, parental antagonism theory generates testable predictions at the proximate (e.g., neurocognitive areas important for social transmission and language capacities), ontogenetic (e.g., the function of language at different points of development), ultimate (e.g., inclusive fitness), and phylogenetic levels (e.g., the spread of maternally derived brain components in mammals, particularly in the hominin lineage), thus making human capacities for culture more tractable than previously thought.

Isotope dilution ICP-MS with laser-assisted sample introduction for direct determination of sulfur in petroleum products.

Science.gov (United States)

Boulyga, Sergei F; Heilmann, Jens; Heumann, Klaus G

2005-08-01

Inductively coupled plasma isotope dilution mass spectrometry (ICP-IDMS) with direct laser-assisted introduction of isotope-diluted samples into the plasma, using a laser ablation system with high ablation rates, was developed for accurate sulfur determinations in different petroleum products such as 'sulfur-free' premium gasoline, diesel fuel, and heating oil. Two certified gas oil reference materials were analyzed for method validation. Two different 34S-enriched spike compounds, namely, elementary sulfur dissolved in xylene and dibenzothiophene in hexane, were synthesized and tested for their usefulness in this isotope dilution technique. The isotope-diluted sample was adsorbed on a filter-paper-like material, which was fixed in a special holder for irradiation by the laser beam. Under these conditions no time-dependent spike/analyte fractionation was only observed for the dibenzothiophene spike during the laser ablation process, which means that the measured 34S/32S isotope ratio of the isotope-diluted sample remained constant-a necessary precondition for accurate results with the isotope dilution technique. A comparison of LA-ICP-IDMS results with the certified values of the gas oil reference materials and with results obtained from ICP-IDMS analyses with wet sample digestion demonstrated the accuracy of the new LA-ICP-IDMS method in the concentration range of 9.2 microg g(-1) ('sulfur-free' premium gasoline) to 10.4 mg g(-1) (gas oil reference material BCR 107). The detection limit for sulfur by LA-ICP-IDMS is 0.04 microg g(-1) and the analysis time is only about 10 min, which therefore also qualifies this method for accurate determinations of low sulfur contents in petroleum products on a routine level.

Mxi1 and Mxi1-0 Antagonize N-Myc Function and Independently Mediate Apoptosis in Neuroblastoma

Directory of Open Access Journals (Sweden)

David A. Erichsen

2015-02-01

Full Text Available Neuroblastoma (NB is the third most common malignancy of childhood, and outcomes for children with advanced disease remain poor; amplification of the MYCN gene portends a particularly poor prognosis. Mxi1 antagonizes N-Myc by competing for binding to Max and E-boxes. Unlike N-Myc, Mxi1 mediates transcriptional repression and suppresses cell proliferation. Mxi1 and Mxi1-0 (an alternatively transcribed Mxi1 isoform share identical Max and DNA binding domains but differ in amino-terminal sequences. Because of the conservation of these critical binding domains, we hypothesized that Mxi1-0 antagonizes N-Myc activity similar to Mxi1. SHEP NB cells and SHEP cells stably transfected with MYCN (SHEP/MYCN were transiently transfected with vectors containing full-length Mxi1, full-length Mxi1-0, or the common Mxi domain encoded by exons 2 to 6 (ex2-6. After incubation in low serum, parental SHEP/MYCN cell numbers were reduced compared with SHEP cells. Activated caspase-3 staining and DNA fragmentation ELISA confirmed that SHEP/MYCN cells undergo apoptosis in low serum, while SHEP/MYCN cells transfected with Mxi1 or Mxi1-0 do not. However, SHEP/MYCN cells transfected with Mxi1 or Mxi1-0 and grown in normal serum showed proliferation rates similar to SHEP cells. Mxi ex2-6 did not affect cell number in low or normal serum, suggesting that amino terminal domains of Mxi1 and Mxi1-0 are critical for antagonism. In the absence of N-Myc, Mxi1 and Mxi1-0 induce apoptosis independently through the caspase-8–dependent extrinsic pathway, while N-Myc activates the caspase-9–dependent intrinsic pathway. Together, these data indicate that Mxi1 and Mxi1-0 antagonize N-Myc but also independently impact NB cell survival.

Performance of laser ablation. Quadrupole-based ICP-MS coupling for the analysis of single micrometric uranium particles

International Nuclear Information System (INIS)

Fabien Pointurier; Amelie Hubert; Anne-Claire Pottin

2013-01-01

In this paper we describe the application of laser ablation-inductively coupled plasma-mass spectrometry (LA-ICP-MS) coupling to particle analysis, i.e., the determination of the isotopic composition of micrometric uranium particles. The performances of this analysis technique are compared with those of the two reference particle analysis techniques: secondary ion mass spectrometry (SIMS) and fission track-thermo-ionization mass spectrometry (FT-TIMS), based on the measurement of the isotopic ratios of 235 U/ 238 U in particles present in an inter-comparison particulate sample. The agreement of the results obtained using LA-ICP-MS with target values and with the results obtained using FT-TIMS and SIMS was good. Accuracy was equivalent to that of the other two techniques (±3 % deviation). However, relative experimental uncertainties present with LA-ICP-MS (7 %) were higher than those present with FT-TIMS (4.5 %) and SIMS (3 %). Furthermore, measurement yield of LA-ICP-MS coupling was close to that obtained with the same quadrupole ICP-MS for the measurement of a liquid sample (∼10 -4 ), but lower than that obtained with FT-TIMS and SIMS, respectively, by a factor of 10 and 20, although the particles analyzed using LA-ICP-MS were most likely smaller (diameter ∼0.6 μm, containing 4-7 fg of 235 U). Nevertheless, thanks to the brevity of the signals obtained, the detection capacity for low isotopic concentrations by LA-ICP-MS coupling is equivalent to that of FT-TIMS, although it remains well below that of SIMS (x 15). However, with more sensitive double focusing ICP-MS, performances equivalent to those achieved using SIMS could be obtained. (author)

Ombuds’ corner: Employee silence

CERN Multimedia

Vincent Vuillemin

2013-01-01

Although around a hundred cases a year are reported to the Ombuds, several issues may still not be disclosed due to employee silence*. The deliberate withholding of concerns, escalating misunderstandings or genuine conflicts can impede the global process of learning and development of a better respectful organizational workplace environment, and prevent the detection and correction of acts violating the CERN Code of Conduct.   For the employee him/herself, such silence can lead to feelings of anger, resentment, helplessness and humiliation. These feelings will inevitably contaminate personal and interpersonal relations, and poison creativity and effectiveness. Employee silence can be explained by many factors; sometimes it is connected to organizational forces. In their published paper*, authors Michael Knoll and Rolf van Dick found four forms of employee silence. People may stay silent if they feel that their opinion is neither welcomed nor valued by their management. They have gi...

Comparision of ICP-OES and MP-AES in determing soil nutrients by Mechlich3 method

Science.gov (United States)

Tonutare, Tonu; Penu, Priit; Krebstein, Kadri; Rodima, Ako; Kolli, Raimo; Shanskiy, Merrit

2014-05-01

Accurate, routine testing of nutrients in soil samples is critical to understanding soil potential fertility. There are different factors which must be taken into account selecting the best analytical technique for soil laboratory analysis. Several techniques can provide adequate detection range for same analytical subject. In similar cases the choise of technique will depend on factors such as sample throughput, required infrastructure, ease of use, used chemicals and need for gas supply and operating costs. Mehlich 3 extraction method is widely used for the determination of the plant available nutrient elements contents in agricultural soils. For determination of Ca, K, and Mg from soil extract depending of laboratory ICP and AAS techniques are used, also flame photometry for K in some laboratories. For the determination of extracted P is used ICP or Vis spectrometry. The excellent sensitivity and wide working range for all extracted elements make ICP a nearly ideal method, so long as the sample throughput is big enough to justify the initial capital outlay. Other advantage of ICP techniques is the multiplex character (simultaneous acquisition of all wavelengths). Depending on element the detection limits are in range 0.1 - 1000 μg/L. For smaller laboratories with low sample throughput requirements the use of AAS is more common. Flame AAS is a fast, relatively cheap and easy technique for analysis of elements. The disadvantages of the method is single element analysis and use of flammable gas, like C2H2 and oxidation gas N2O for some elements. Detection limits of elements for AAS lays from 1 to 1000 μg/L. MP-AES offers a unique alternative to both, AAS and ICP-OES techniques with its detection power, speed of analysis. MP-AES is quite new, simple and relatively inexpensive multielemental technique, which is use self-sustained atmospheric pressure microwave plasma (MP) using nitrogen gas generated by nitrogen generator. Therefore not needs for argon and

Multielement determination of major-to-ultratrace elements in salmon egg by ICP-AES and ICP-MS

Energy Technology Data Exchange (ETDEWEB)

Matsuura, Hirotaka; Haraguchi, Hiroki [Nagoya Univ., Graduate School of Engineering, Dept. of Applied Chemistry, Nagoya, Aichi (Japan)

2002-04-01

The multielement determination of major-to-ultratrace elements in salmon egg was carried out by ICP-AES and ICP-MS. First, salmon eggs (30 eggs used) were digested with conc. nitric acid and 60% perchloric acid by heating almost to dryness repeatedly. Finally, the residues of salmon eggs were dissolved in 1 M nitric acid and the sample solutions were analyzed by ICP-AES and ICP-MS. About 40 elements could be determined over the concentration range in 9 orders of magnitude. The concentrations of bio-essential elements, such as Zn, Fe, and Cu, in salmon egg were 10-100 times higher than those in human blood serum. In addition, the major-to-ultratrace elements in cell cytoplasm and cell membrane were separately determined in a similar manner to those in whole egg cell. The concentrations of most bio-essential elements were higher in cell cytoplasm than in cell membrane, while those of Fe and Cu were higher in cell membrane than in cell cytoplasm of salmon egg. (author)

A general approach for controlling transcription and probing epigenetic mechanisms: application to the CD4 locus.

Science.gov (United States)

Wan, Mimi; Kaundal, Ravinder; Huang, Haichang; Zhao, Jiugang; Yang, Xiaojun; Chaiyachati, Barbara H; Li, Sicong; Chi, Tian

2013-01-15

Synthetic regulatory proteins such as tetracycline (tet)-controlled transcription factors are potentially useful for repression as well as ectopic activation of endogenous genes and also for probing their regulatory mechanisms, which would offer a versatile genetic tool advantageous over conventional gene targeting methods. In this study, we provide evidence supporting this concept using Cd4 as a model. CD4 is expressed in double-positive and CD4 cells but irreversibly silenced in CD8 cells. The silencing is mediated by heterochromatin established during CD8 lineage development via transient action of the Cd4 silencer; once established, the heterochromatin becomes self-perpetuating independently of the Cd4 silencer. Using a tet-sensitive Cd4 allele harboring a removable Cd4 silencer, we found that a tet-controlled repressor recapitulated the phenotype of Cd4-deficient mice, inhibited Cd4 expression in a reversible and dose-dependent manner, and could surprisingly replace the Cd4 silencer to induce irreversible Cd4 silencing in CD8 cells, thus suggesting the Cd4 silencer is not the (only) determinant of heterochromatin formation. In contrast, a tet-controlled activator reversibly disrupted Cd4 silencing in CD8 cells. The Cd4 silencer impeded this disruption but was not essential for its reversal, which revealed a continuous role of the silencer in mature CD8 cells while exposing a remarkable intrinsic self-regenerative ability of heterochromatin after forced disruption. These data demonstrate an effective approach for gene manipulation and provide insights into the epigenetic Cd4 regulatory mechanisms that are otherwise difficult to obtain.

Triclosan antagonizes fluconazole activity against Candida albicans.

LENUS (Irish Health Repository)

Higgins, J

2012-01-01

Triclosan is a broad-spectrum antimicrobial compound commonly used in oral hygiene products. Investigation of its activity against Candida albicans showed that triclosan was fungicidal at concentrations of 16 mg\\/L. However, at subinhibitory concentrations (0.5-2 mg\\/L), triclosan antagonized the activity of fluconazole. Although triclosan induced CDR1 expression in C. albicans, antagonism was still observed in cdr1Δ and cdr2Δ strains. Triclosan did not affect fluconazole uptake or alter total membrane sterol content, but did induce the expression of FAS1 and FAS2, indicating that its mode of action may involve inhibition of fatty acid synthesis, as it does in prokaryotes. However, FAS2 mutants did not exhibit increased susceptibility to triclosan, and overexpression of both FAS1 and FAS2 alleles did not alter triclosan susceptibility. Unexpectedly, the antagonistic effect was specific for C. albicans under hypha-inducing conditions and was absent in the non-filamentous efg1Δ strain. This antagonism may be due to the membranotropic activity of triclosan and the unique composition of hyphal membranes.

The molecular basis for stability of heterochromatin-mediated silencing in mammals.

Science.gov (United States)

Hiragami-Hamada, Kyoko; Xie, Sheila Q; Saveliev, Alexander; Uribe-Lewis, Santiago; Pombo, Ana; Festenstein, Richard

2009-11-04

The archetypal epigenetic phenomenon of position effect variegation (PEV) in Drosophila occurs when a gene is brought abnormally close to heterochromatin, resulting in stochastic silencing of the affected gene in a proportion of cells that would normally express it. PEV has been instrumental in unraveling epigenetic mechanisms. Using an in vivo mammalian model for PEV we have extensively investigated the molecular basis for heterochromatin-mediated gene silencing. Here we distinguish 'epigenetic effects' from other cellular differences by studying ex vivo cells that are identical, apart from the expression of the variegating gene which is silenced in a proportion of the cells. By separating cells according to transgene expression we show here that silencing appears to be associated with histone H3 lysine 9 trimethylation (H3K9me3), DNA methylation and the localization of the silenced gene to a specific nuclear compartment enriched in these modifications. In contrast, histone H3 acetylation (H3Ac) and lysine 4 di or tri methylation (H3K4me2/3) are the predominant modifications associated with expression where we see the gene in a euchromatic compartment. Interestingly, DNA methylation and inaccessibility, rather than H3K9me3, correlated most strongly with resistance to de-repression by cellular activation. These results have important implications for understanding the contribution of specific factors involved in the establishment and maintenance of gene silencing and activation in vivo.

The molecular basis for stability of heterochromatin-mediated silencing in mammals

Directory of Open Access Journals (Sweden)

Hiragami-Hamada Kyoko

2009-11-01

Full Text Available Abstract The archetypal epigenetic phenomenon of position effect variegation (PEV in Drosophila occurs when a gene is brought abnormally close to heterochromatin, resulting in stochastic silencing of the affected gene in a proportion of cells that would normally express it. PEV has been instrumental in unraveling epigenetic mechanisms. Using an in vivo mammalian model for PEV we have extensively investigated the molecular basis for heterochromatin-mediated gene silencing. Here we distinguish 'epigenetic effects' from other cellular differences by studying ex vivo cells that are identical, apart from the expression of the variegating gene which is silenced in a proportion of the cells. By separating cells according to transgene expression we show here that silencing appears to be associated with histone H3 lysine 9 trimethylation (H3K9me3, DNA methylation and the localization of the silenced gene to a specific nuclear compartment enriched in these modifications. In contrast, histone H3 acetylation (H3Ac and lysine 4 di or tri methylation (H3K4me2/3 are the predominant modifications associated with expression where we see the gene in a euchromatic compartment. Interestingly, DNA methylation and inaccessibility, rather than H3K9me3, correlated most strongly with resistance to de-repression by cellular activation. These results have important implications for understanding the contribution of specific factors involved in the establishment and maintenance of gene silencing and activation in vivo.

The D4Z4 macrosatellite repeat acts as a CTCF and A-type lamins-dependent insulator in facio-scapulo-humeral dystrophy.

Directory of Open Access Journals (Sweden)

Alexandre Ottaviani

2009-02-01

Full Text Available Both genetic and epigenetic alterations contribute to Facio-Scapulo-Humeral Dystrophy (FSHD, which is linked to the shortening of the array of D4Z4 repeats at the 4q35 locus. The consequence of this rearrangement remains enigmatic, but deletion of this 3.3-kb macrosatellite element might affect the expression of the FSHD-associated gene(s through position effect mechanisms. We investigated this hypothesis by creating a large collection of constructs carrying 1 to >11 D4Z4 repeats integrated into the human genome, either at random sites or proximal to a telomere, mimicking thereby the organization of the 4q35 locus. We show that D4Z4 acts as an insulator that interferes with enhancer-promoter communication and protects transgenes from position effect. This last property depends on both CTCF and A-type Lamins. We further demonstrate that both anti-silencing activity of D4Z4 and CTCF binding are lost upon multimerization of the repeat in cells from FSHD patients compared to control myoblasts from healthy individuals, suggesting that FSHD corresponds to a gain-of-function of CTCF at the residual D4Z4 repeats. We propose that contraction of the D4Z4 array contributes to FSHD physio-pathology by acting as a CTCF-dependent insulator in patients.

IFITM Proteins Restrict HIV-1 Infection by Antagonizing the Envelope Glycoprotein

Directory of Open Access Journals (Sweden)

Jingyou Yu

2015-10-01

Full Text Available The interferon-induced transmembrane (IFITM proteins have been recently shown to restrict HIV-1 and other viruses. Here, we provide evidence that IFITM proteins, particularly IFITM2 and IFITM3, specifically antagonize the HIV-1 envelope glycoprotein (Env, thereby inhibiting viral infection. IFITM proteins interact with HIV-1 Env in viral producer cells, leading to impaired Env processing and virion incorporation. Notably, the level of IFITM incorporation into HIV-1 virions does not strictly correlate with the extent of inhibition. Prolonged passage of HIV-1 in IFITM-expressing T lymphocytes leads to emergence of Env mutants that overcome IFITM restriction. The ability of IFITMs to inhibit cell-to-cell infection can be extended to HIV-1 primary isolates, HIV-2 and SIVs; however, the extent of inhibition appears to be virus-strain dependent. Overall, our study uncovers a mechanism by which IFITM proteins specifically antagonize HIV-1 Env to restrict HIV-1 infection and provides insight into the specialized role of IFITMs in HIV infection.

Inductively coupled plasma mass spectrometry (ICP-MS)

International Nuclear Information System (INIS)

Shimamura, Tadashi

1997-01-01

The period of investigation for the previous general remarks on the progress of ICP-MS was from January, 1991 to September, 1993. In the investigation of this time, for the object of the Chemical Abstracts from January, 1994 to September, 1996, retrieval was carried out by using the STN International. As the key words, ICP-MS, Inductively Coupled Plasma Mass Spectrometry or Inductively Coupled Plasma Mass Spectrometer was used. The number of hit was 373 in 1994, 462 in 1995, and 356 as of September, 1996, 1191 in total. The cumulative number of the papers from 1980 to 1996 is shown. It is known how rapidly the ICP-MS has pervaded as the means of analysis. In order to cope with the enormous number of papers, this time, it was decided to do the review by limiting to the papers which were published in the main journals deeply related to analytical chemistry. As to the tendency in the last three years, it is summarized as how to overcome the spectrum interference and matrix effect in the ICP-MS and the trend of using the ICP-MS as the high sensitivity detector for separation techniques. The technical basic research of the ICP-MS on spectrum interference, sample introduction method and others and the analysis of living body samples are reported. (K.I.)

The silence.

Science.gov (United States)

Millenson, Michael L

2003-01-01

Despite several well-crafted Institute of Medicine (IOM) reports, there remains within health care a persistent refusal to confront providers' responsibility for severe quality problems. There is a silence of deed--failing to take corrective actions--and of word--failing to discuss openly the true consequences of that inertia. These silences distort public policy, delay change, and, by leading (albeit inadvertently) to thousands of patient deaths, undermine professionalism. The IOM quality committee, to retain its moral authority, should forgo issuing more reports and instead lead an emergency corrective-action campaign comparable to Flexner's crusade against charlatan medical schools.

Thermodynamic control of small RNA-mediated gene silencing

Directory of Open Access Journals (Sweden)

Kumiko eUi-Tei

2012-06-01

Full Text Available Small interfering RNAs (siRNAs and microRNAs (miRNAs are crucial regulators of posttranscriptional gene silencing, which is referred to as RNA interference (RNAi or RNA silencing. In RNAi, siRNA loaded onto the RNA-induced silencing complex (RISC downregulates target gene expression by cleaving mRNA whose sequence is perfectly complementary to the siRNA guide strand. We previously showed that highly functional siRNAs possessed the following characteristics: A or U residues at nucleotide position 1 measured from the 5’ terminal, four to seven A/Us in positions 1–7, and G or C residues at position 19. This finding indicated that an RNA strand with a thermodynamically unstable 5’ terminal is easily retained in the RISC and functions as a guide strand. In addition, it is clear that unintended genes with complementarities only in the seed region (positions 2–8 are also downregulated by off-target effects. siRNA efficiency is mainly determined by the Watson-Crick base-pairing stability formed between the siRNA seed region and target mRNA. siRNAs with a low seed-target duplex melting temperature (Tm have little or no seed-dependent off-target activity. Thus, important parts of the RNA silencing machinery may be regulated by nucleotide base-pairing thermodynamic stability. A mechanistic understanding of thermodynamic control may enable an efficient target gene-specific RNAi for functional genomics and safe therapeutic applications.

Comparative evaluation of ICP sample introduction systems to be used in the metabolite profiling of chlorine-containing pharmaceuticals via HPLC-ICP-MS.

Science.gov (United States)

Klencsár, Balázs; Sánchez, Carlos; Balcaen, Lieve; Todolí, José; Lynen, Frederic; Vanhaecke, Frank

2018-05-10

A systematic evaluation of four different ICP sample introduction systems to be used in the context of metabolite profiling of chlorine-containing pharmaceuticals via HPLC-ICP-MS was carried out using diclofenac and its major metabolite, 4'-hydroxy-diclofenac, as model compounds. The strict requirements for GMP validation of chromatographic methods in the pharmaceutical industry were adhered to in this context. The final aim of this investigation is an extension of the applicability and validatability of HPLC-ICP-MS in the field of pharmaceutical R&D. Five different gradient programmes were tested while the baseline peak width (w b ), peak capacity (P), USP tailing factor (A s ) and USP signal-to-noise ratio (USP S/N) were determined as major indicators of the chromatographic performance and the values obtained were compared to the corresponding FDA recommendations (if applicable). Four different ICP-MS sample introductions systems were investigated involving two units typically working at higher flow rates (∼1.0 mL min -1 ) and another two systems working at lower flow rates (∼0.1 mL min -1 ). Optimal conditions with potential for applicability under GMP conditions were found at a mobile phase flow rate of 1.0 mL min -1 by using a pneumatic micro-flow LC nebulizer mounted onto a Peltier-cooled cyclonic spray chamber cooled to -1 °C for sample introduction. Under these conditions, HPLC-ICP-MS provided a chromatographic performance similar to that of HPLC with UV detection. The peak shape (USP tailing factor = 1.1-1.4) was significantly improved compared to that obtained with the Peltier-cooled Scott-type spray chamber. Two alternative sample introduction systems - a POINT ® and a High-Temperature Torch-Integrated Sample Introduction System (hTISIS) - were also tested at a flow rate of 0.1 mL min -1 using a chromatographic column with 1.0 mm ID. Although these systems allowed the peak shape to be improved compared to that obtained with

Silencing of Pokemon enhances caspase-dependent apoptosis via fas- and mitochondria-mediated pathways in hepatocellular carcinoma cells.

Science.gov (United States)

Zhang, Yu-Qin; Xiao, Chuan-Xing; Lin, Bi-Yun; Shi, Ying; Liu, Yun-Peng; Liu, Jing-Jing; Guleng, Bayasi; Ren, Jian-Lin

2013-01-01

The role of Pokemon (POK erythroid myeloid ontogenic actor), a recently identified POK transcription factor with proto-oncogenic activity, in hepatocellular carcinogenesis has only been assessed by a few studies. Our previous study revealed that Pokemon is overexpressed in hepatocellular carcinomas (HCC) and promotes HCC cell proliferation and migration via an AKT- and ERK- dependent manner. In the present study, we used the TUNEL assay and FACS analysis to demonstrate that oxaliplatin induced apoptosis was significantly increased in cells with silenced Pokemon. Western blots showed that p53 expression and phosphorylation were significantly increased in Pokemon defective cells, thereby initiating the mitochondria-mediated and death receptor-mediated apoptotic pathways. In the mitochondria-mediated pathway, expression of pro-apoptotic Bcl-2 family members (including Bad, Bid, Bim and Puma) as well as AIF was increased and decreasing the mitochondrial membrane potential resulted in cytochrome C released from mitochondrial in HepG2 si-Pokemon cells. In addition, upon oxaliplatin treatment of Pokemon-silenced cells, the FAS receptor, FADD and their downstream targets caspase-10 and caspase-8 were activated, causing increased release of caspase-8 active fragments p18 and p10. Increased activated caspase-8-mediated cleavage and activation of downstream effector caspases such as caspase-9 and caspase-3 was observed in HepG2 si-Pokemon cells as compared to control. Therefore, Pokemon might serve as an important mediator of crosstalk between intrinsic and extrinsic apoptotic pathways in HCC cells. Moreover, our findings suggest that Pokemon could be an attractive therapeutic target gene for human cancer therapy.

Silencing of Pokemon enhances caspase-dependent apoptosis via fas- and mitochondria-mediated pathways in hepatocellular carcinoma cells.

Directory of Open Access Journals (Sweden)

Yu-Qin Zhang

Full Text Available The role of Pokemon (POK erythroid myeloid ontogenic actor, a recently identified POK transcription factor with proto-oncogenic activity, in hepatocellular carcinogenesis has only been assessed by a few studies. Our previous study revealed that Pokemon is overexpressed in hepatocellular carcinomas (HCC and promotes HCC cell proliferation and migration via an AKT- and ERK- dependent manner. In the present study, we used the TUNEL assay and FACS analysis to demonstrate that oxaliplatin induced apoptosis was significantly increased in cells with silenced Pokemon. Western blots showed that p53 expression and phosphorylation were significantly increased in Pokemon defective cells, thereby initiating the mitochondria-mediated and death receptor-mediated apoptotic pathways. In the mitochondria-mediated pathway, expression of pro-apoptotic Bcl-2 family members (including Bad, Bid, Bim and Puma as well as AIF was increased and decreasing the mitochondrial membrane potential resulted in cytochrome C released from mitochondrial in HepG2 si-Pokemon cells. In addition, upon oxaliplatin treatment of Pokemon-silenced cells, the FAS receptor, FADD and their downstream targets caspase-10 and caspase-8 were activated, causing increased release of caspase-8 active fragments p18 and p10. Increased activated caspase-8-mediated cleavage and activation of downstream effector caspases such as caspase-9 and caspase-3 was observed in HepG2 si-Pokemon cells as compared to control. Therefore, Pokemon might serve as an important mediator of crosstalk between intrinsic and extrinsic apoptotic pathways in HCC cells. Moreover, our findings suggest that Pokemon could be an attractive therapeutic target gene for human cancer therapy.

Alfalfa dwarf cytorhabdovirus P protein is a local and systemic RNA silencing supressor which inhibits programmed RISC activity and prevents transitive amplification of RNA silencing.

Science.gov (United States)

Bejerman, Nicolás; Mann, Krin S; Dietzgen, Ralf G

2016-09-15

Plants employ RNA silencing as an innate defense mechanism against viruses. As a counter-defense, plant viruses have evolved to express RNA silencing suppressor proteins (RSS), which target one or more steps of the silencing pathway. In this study, we show that the phosphoprotein (P) encoded by the negative-sense RNA virus alfalfa dwarf virus (ADV), a species of the genus Cytorhabdovirus, family Rhabdoviridae, is a suppressor of RNA silencing. ADV P has a relatively weak local RSS activity, and does not prevent siRNA accumulation. On the other hand, ADV P strongly suppresses systemic RNA silencing, but does not interfere with the short-distance spread of silencing, which is consistent with its lack of inhibition of siRNA accumulation. The mechanism of suppression appears to involve ADV P binding to RNA-induced silencing complex proteins AGO1 and AGO4 as shown in protein-protein interaction assays when ectopically expressed. In planta, we demonstrate that ADV P likely functions by inhibiting miRNA-guided AGO1 cleavage and prevents transitive amplification by repressing the production of secondary siRNAs. As recently described for lettuce necrotic yellows cytorhabdovirus P, but in contrast to other viral RSS known to disrupt AGO activity, ADV P sequence does not contain any recognizable GW/WG or F-box motifs, which suggests that cytorhabdovirus P proteins may use alternative motifs to bind to AGO proteins. Crown Copyright © 2016. Published by Elsevier B.V. All rights reserved.

THREE-DIMENSIONAL MAPPING OF DIFFERENTIAL AMINO ACIDS OF HUMAN, MURINE, CANINE AND EQUINE TLR4/MD-2 RECEPTOR COMPLEXES CONFERRING ENDOTOXIC ACTIVATION BY LIPID A, ANTAGONISM BY ERITORAN AND SPECIES-DEPENDENT ACTIVITIES OF LIPID IVA IN THE MAMMALIAN LPS SENSOR SYSTEM

Directory of Open Access Journals (Sweden)

Thomas Scior

2013-05-01

Full Text Available A literature review concerning the unexpected species differences of the vertebrate innate immune response to lipid IVA was published in CSBJ prior to the present computational study to address the unpaired activity-sequence correlation of prototypic E. coli -type lipid A and its precursor lipid IVA regarding human, murine, equine and canine species. To this end, their sequences and structures of hitherto known Toll-like receptor 4 (TLR4 and myeloid differentiation factor 2 (MD-2 complexes were aligned and their differential side chain patterns studied. If required due to the lack of the corresponding X-ray crystallographic data, three-dimensional models of TLR4/MD-2/ligand complexes were generated using mono and dimeric crystal structures as templates and in silico docking of the prototypic ligands lipid A, lipid IVA and Eritoran. All differential amino acids were mapped to pinpoint species dependency on an atomic scale, i.e. the possible concert of mechanistically relevant side chains. In its most abstract and general form the three-dimensional (3D- models devise a triangular interface or “wedge” where molecular interactions between TLR4, MD-2 and ligand itself take place. This study identifies two areas in the wedge related to either agonism or antagonism reflecting why ligands like lipid IVA can possess a species dependent dual activity. Lipid IVA represents an imperfect (underacylated and backbone-flipped, low affinity ligand of mammalian TLR4/MD-2 complexes. Its specific but weak antagonistic activity in the human system is in particular due to the loss of phosphate attraction in the wedge-shaped region conferred by nonhomologous residue changes when compared to crystal and modeled structures of the corresponding murine and equine TLR4/MD-2 complexes. The counter-TLR4/MD-2 unit was also taken into account since agonist-mediated dimerization in a defined m-shaped complex composed of two TLR4/MD-2/agonist subunits triggers intracellular

Precise and accurate isotope ratio measurements by ICP-MS.

Science.gov (United States)

Becker, J S; Dietze, H J

2000-09-01

The precise and accurate determination of isotope ratios by inductively coupled plasma mass spectrometry (ICP-MS) and laser ablation ICP-MS (LA-ICP-MS) is important for quite different application fields (e.g. for isotope ratio measurements of stable isotopes in nature, especially for the investigation of isotope variation in nature or age dating, for determining isotope ratios of radiogenic elements in the nuclear industry, quality assurance of fuel material, for reprocessing plants, nuclear material accounting and radioactive waste control, for tracer experiments using stable isotopes or long-lived radionuclides in biological or medical studies). Thermal ionization mass spectrometry (TIMS), which used to be the dominant analytical technique for precise isotope ratio measurements, is being increasingly replaced for isotope ratio measurements by ICP-MS due to its excellent sensitivity, precision and good accuracy. Instrumental progress in ICP-MS was achieved by the introduction of the collision cell interface in order to dissociate many disturbing argon-based molecular ions, thermalize the ions and neutralize the disturbing argon ions of plasma gas (Ar+). The application of the collision cell in ICP-QMS results in a higher ion transmission, improved sensitivity and better precision of isotope ratio measurements compared to quadrupole ICP-MS without the collision cell [e.g., for 235U/238U approximately 1 (10 microg x L(-1) uranium) 0.07% relative standard deviation (RSD) vs. 0.2% RSD in short-term measurements (n = 5)]. A significant instrumental improvement for ICP-MS is the multicollector device (MC-ICP-MS) in order to obtain a better precision of isotope ratio measurements (with a precision of up to 0.002%, RSD). CE- and HPLC-ICP-MS are used for the separation of isobaric interferences of long-lived radionuclides and stable isotopes by determination of spallation nuclide abundances in an irradiated tantalum target.

Isotope dilution ICP-MS with laser-assisted sample introduction for direct determination of sulfur in petroleum products

Energy Technology Data Exchange (ETDEWEB)

Boulyga, Sergei F.; Heilmann, Jens; Heumann, Klaus G. [Johannes Gutenberg-University Mainz (Germany). Institute of Inorganic Chemistry and Analytical Chemistry

2005-08-01

Inductively coupled plasma isotope dilution mass spectrometry (ICP-IDMS) with direct laser-assisted introduction of isotope-diluted samples into the plasma, using a laser ablation system with high ablation rates, was developed for accurate sulfur determinations in different petroleum products such as 'sulfur-free' premium gasoline, diesel fuel, and heating oil. Two certified gas oil reference materials were analyzed for method validation. Two different {sup 34}S-enriched spike compounds, namely, elementary sulfur dissolved in xylene and dibenzothiophene in hexane, were synthesized and tested for their usefulness in this isotope dilution technique. The isotope-diluted sample was adsorbed on a filter-paper-like material, which was fixed in a special holder for irradiation by the laser beam. Under these conditions no time-dependent spike/analyte fractionation was only observed for the dibenzothiophene spike during the laser ablation process, which means that the measured {sup 34}S/{sup 32}S isotope ratio of the isotope-diluted sample remained constant - a necessary precondition for accurate results with the isotope dilution technique. A comparison of LA-ICP-IDMS results with the certified values of the gas oil reference materials and with results obtained from ICP-IDMS analyses with wet sample digestion demonstrated the accuracy of the new LA-ICP-IDMS method in the concentration range of 9.2 {mu}g g{sup -1} ('sulfur-free' premium gasoline) to 10.4 mg g{sup -1} (gas oil reference material BCR 107). The detection limit for sulfur by LA-ICP-IDMS is 0.04 {mu}g g{sup -1} and the analysis time is only about 10 min, which therefore also qualifies this method for accurate determinations of low sulfur contents in petroleum products on a routine level. (orig.)

Separation of Pu from soil prior to determination by ICP-MS

International Nuclear Information System (INIS)

Nygren, U.; Baxter, D.C.

2002-01-01

In the determination of plutonium in environmental materials by ICP-MS, chemical separation is often needed to remove, e.g., heavy sample matrices and interference from UH + on m/z 239. This separation can be, and often is, performed in the same way as for alpha-spectrometric analysis. There are, however, somewhat different demands on separation for ICP-MS compared to alpha-spectrometry, but so far little has been published on the optimisation of separation procedures for plutonium determination by ICP-MS. This paper describes the development of a separation procedure especially suited for the determination of Pu by ICP-MS. Focus has been on parameters such as chemical yield of plutonium and decontamination from uranium, as well as time requirements and ease of performance. The separation of plutonium was performed using various resins, such as anion exchange resin and extraction chromatographic materials. The procedures were carried out on water spiked with 238 U and 240 Pu to concentrations of approximately 300 ppb and 50 ppt, respectively. The basic separation procedure was: 1. Adjustment of oxidation state for Pu 2. Loading on column 3. Rinsing using 4*5 free column volumes (FCVs) of load solution - if needed in combination with 1*5 FCVs of an other rinsing agent 4. Elution of Pu - if needed followed by evaporation and dissolution in a solution suitable for ICP-MS determination 5. Determination by high resolution ICP-MS The elution of plutonium was performed using various media, based on either reduction of Pu(IV) to Pu(III) or complex formation. The chemical yield of plutonium and the decontamination from uranium for various resin/elution combinations can be seen in Figs. 1 and 2. It was found that the most efficient separation procedure in terms of yield and uranium decontamination was the combination of two extraction chromatographic materials, UTEVA followed by TRU, and elution of Pu by 0.1 % 1-hydroxyethane-1,1-diphosphonic acid (HEDPA). In this procedure

RNA-Interference Components Are Dispensable for Transcriptional Silencing of the Drosophila Bithorax-Complex

KAUST Repository

Cernilogar, Filippo M.

2013-06-13

Background:Beyond their role in post-transcriptional gene silencing, Dicer and Argonaute, two components of the RNA interference (RNAi) machinery, were shown to be involved in epigenetic regulation of centromeric heterochromatin and transcriptional gene silencing. In particular, RNAi mechanisms appear to play a role in repeat induced silencing and some aspects of Polycomb-mediated gene silencing. However, the functional interplay of RNAi mechanisms and Polycomb group (PcG) pathways at endogenous loci remains to be elucidated.Principal Findings:Here we show that the endogenous Dicer-2/Argonaute-2 RNAi pathway is dispensable for the PcG mediated silencing of the homeotic Bithorax Complex (BX-C). Although Dicer-2 depletion triggers mild transcriptional activation at Polycomb Response Elements (PREs), this does not induce transcriptional changes at PcG-repressed genes. Moreover, Dicer-2 is not needed to maintain global levels of methylation of lysine 27 of histone H3 and does not affect PRE-mediated higher order chromatin structures within the BX-C. Finally bioinformatic analysis, comparing published data sets of PcG targets with Argonaute-2-bound small RNAs reveals no enrichment of these small RNAs at promoter regions associated with PcG proteins.Conclusions:We conclude that the Dicer-2/Argonaute-2 RNAi pathway, despite its role in pairing sensitive gene silencing of transgenes, does not have a role in PcG dependent silencing of major homeotic gene cluster loci in Drosophila. © 2013 Cernilogar et al.

How Silent is the Right to Silence?

Directory of Open Access Journals (Sweden)

Katherine Biber

2012-11-01

Full Text Available A long-held and fundamental principle of our criminal justice system is that people accused of crimes have a right to silence, arising from the presumption of innocence. Rules of evidence try to protect this ‘right’ during trial, by ensuring that juries understand that adverse inferences cannot be drawn from the silence of the accused. Silence, in court, can mean nothing, and we are not to speculate about what might motivate an accused person to remain silent, or what they might have said had they spoken. However, an examination of the jurisprudence in this area shows that the law is often not dealing with actual silence; sometimes when the law refers to the ‘right to silence’, it seems to mean a ‘refusal to hear’. In other instances, there is actual silence, and yet the law refuses to subject that silence to any critical interpretation, insisting that we cannot infer anything from it. While we have learned, from theatre, music, linguistics, religion and psychology, to develop sophisticated means for interpreting silence, the law demands that we set aside these interpretive tools, hearing silence that isn’t there, and inferring nothing about something.

Integrated care pathways for airway diseases (AIRWAYS-ICPs)

DEFF Research Database (Denmark)

Bousquet, J; Addis, A; Adcock, I

2014-01-01

The objective of Integrated Care Pathways for Airway Diseases (AIRWAYS-ICPs) is to launch a collaboration to develop multi-sectoral care pathways for chronic respiratory diseases in European countries and regions. AIRWAYS-ICPs has strategic relevance to the European Union Health Strategy...... and will add value to existing public health knowledge by: 1) proposing a common framework of care pathways for chronic respiratory diseases, which will facilitate comparability and trans-national initiatives; 2) informing cost-effective policy development, strengthening in particular those on smoking...... and environmental exposure; 3) aiding risk stratification in chronic disease patients, using a common strategy; 4) having a significant impact on the health of citizens in the short term (reduction of morbidity, improvement of education in children and of work in adults) and in the long-term (healthy ageing); 5...

Nicotinamide clearance by Pnc1 directly regulates Sir2-mediated silencing and longevity.

Science.gov (United States)

Gallo, Christopher M; Smith, Daniel L; Smith, Jeffrey S

2004-02-01

The Saccharomyces cerevisiae Sir2 protein is an NAD(+)-dependent histone deacetylase (HDAC) that functions in transcriptional silencing and longevity. The NAD(+) salvage pathway protein, Npt1, regulates Sir2-mediated processes by maintaining a sufficiently high intracellular NAD(+) concentration. However, another NAD(+) salvage pathway component, Pnc1, modulates silencing independently of the NAD(+) concentration. Nicotinamide (NAM) is a by-product of the Sir2 deacetylase reaction and is a natural Sir2 inhibitor. Pnc1 is a nicotinamidase that converts NAM to nicotinic acid. Here we show that recombinant Pnc1 stimulates Sir2 HDAC activity in vitro by preventing the accumulation of NAM produced by Sir2. In vivo, telomeric, rDNA, and HM silencing are differentially sensitive to inhibition by NAM. Furthermore, PNC1 overexpression suppresses the inhibitory effect of exogenously added NAM on silencing, life span, and Hst1-mediated transcriptional repression. Finally, we show that stress suppresses the inhibitory effect of NAM through the induction of PNC1 expression. Pnc1, therefore, positively regulates Sir2-mediated silencing and longevity by preventing the accumulation of intracellular NAM during times of stress.

The human HECA interacts with cyclins and CDKs to antagonize Wnt-mediated proliferation and chemoresistance of head and neck cancer cells

Energy Technology Data Exchange (ETDEWEB)

Dowejko, Albert, E-mail: Albert.Dowejko@klinik.uni-regensburg.de [Department of Oral and Maxillofacial Surgery, University Hospital Regensburg, Franz-Josef-Strauss-Allee 11, 93053 Regensburg (Germany); Bauer, Richard; Bauer, Karin [Department of Oral and Maxillofacial Surgery, University Hospital Regensburg, Franz-Josef-Strauss-Allee 11, 93053 Regensburg (Germany); Mueller-Richter, Urs D.A. [Department of Oral and Maxillofacial Plastic Surgery, University of Wuerzburg, Pleicherwall 2, 97070 Wuerzburg (Germany); Reichert, Torsten E. [Department of Oral and Maxillofacial Surgery, University Hospital Regensburg, Franz-Josef-Strauss-Allee 11, 93053 Regensburg (Germany)

2012-03-10

There is a growing evidence that the human homologue of the Drosophila headcase (HECA) plays an important role in human carcinogenesis. So far specific protein interaction partners and affected signaling pathways of HECA are still elusive. In a recent study we showed that HECA overexpression in oral squamous-cell carcinoma (OSCC) keratinocytes has tumor suppressive effects resulting in a recuperation of cell cycle control concerning the entry and progression of S-phase, G2- and M-phase. Currently, quantitative RT-PCR and immunohistochemical analysis of primary tumor tissue from OSCC patients demonstrate that HECA expression is markedly decreased compared to normal control patients with abundant HECA expression. Additionally, there is nearly no HECA expression in OSCC metastases. Here, we show that HECA expression is negatively controlled by the Wnt-pathway and TCF4, a Wnt related transcription factor, binds to the HECA promoter. Furthermore, immunocytochemistry reveals colocalization of HECA with the cyclin dependent kinase CDK9. Immunoprecipitation experiments and proximity ligation assays further reveal an interaction of HECA with CDK2, CDK9, Cyclin A and Cyclin K, a direct transcriptional target of the p53 tumor suppressor. Silencing HECA in OSCC cell lines leads to a significant increase of cell division and a markedly increased resistance against the chemotherapeutic cisplatin. On the contrary, HECA overexpressing OSCC cell lines show decreased resistance of OSCC cells against cisplatin. Therefore, HECA could be considered as future therapeutic agent against Wnt-dependent tumor progression. -- Highlights: Black-Right-Pointing-Pointer HECA is a new cell cycle regulator with anti-tumor features in head and neck cancer. Black-Right-Pointing-Pointer During tumor progression HECA mRNA and protein expression decrease. Black-Right-Pointing-Pointer The HECA promotor is a direct target of the Wnt/beta-catenin/TCF-pathway. Black-Right-Pointing-Pointer The HECA protein

{sup 99}Tc bioassay by inductively coupled plasma mass spectrometry (ICP-MS)

Energy Technology Data Exchange (ETDEWEB)

Lewis, L.A.

1998-05-01

A means of analyzing {sup 99}Tc in urine by inductively coupled plasma mass spectrometry (ICP-MS) has been developed. Historically, {sup 99}Tc analysis was based on the radiometric detection of the 293 keV E{sub Max} beta decay product by liquid scintillation or gas flow proportional counting. In a urine matrix, the analysis of{sup 99}Tc is plagued with many difficulties using conventional radiometric methods. Difficulties originate during chemical separation due to the volatile nature of Tc{sub 2}O{sub 7} or during radiation detection due to color or chemical quenching. A separation scheme for {sup 99}Tc detection by ICP-MS is given and is proven to be a sensitive and robust analytical alternative. A comparison of methods using radiometric and mass quantitation of {sup 99}Tc has been conducted in water, artificial urine, and real urine matrices at activity levels between 700 and 2,200 dpm/L. Liquid scintillation results based on an external standard quench correction and a quench curve correction method are compared to results obtained by ICP-MS. Each method produced accurate results, however the precision of the ICP-MS results is superior to that of liquid scintillation results. Limits of detection (LOD) for ICP-MS and liquid scintillation detection are 14.67 and 203.4 dpm/L, respectively, in a real urine matrix. In order to determine the basis for the increased precision of the ICP-MS results, the detection sensitivity for each method is derived and measured. The detection sensitivity for the {sup 99}Tc isotope by ICP-MS is 2.175 x 10{sup {minus}7} {+-} 8.990 x 10{sup {minus}9} and by liquid scintillation is 7.434 x 10{sup {minus}14} {+-} 7.461 x 10{sup {minus}15}. A difference by seven orders of magnitude between the two detection systems allows ICP-MS samples to be analyzed for a period of 15 s compared to 3,600 s by liquid scintillation counting with a lower LOD.

Judicial review of administrative silence

Directory of Open Access Journals (Sweden)

Radošević Ratko S.

2015-01-01

Full Text Available Administrative silence is a situation in which the competent authority, within the statutory deadline, has not issued an administrative act at the request of the party. In the case of administrative silence, given the fact that the citizens are unable to protect their rights and legal interests without an administrative act, they are provided with legal protection. In this case, the same legal relationship is created, directly on the basis of the statute, as in the situation in which the party's request is rejected. This means that the party may, under the conditions prescribed by the statute, initiate the procedure of judicial review of administrative silence. In the paper, the author explains the conditions under which the judicial review of administrative silence can be initiated and the role of the court in this judicial procedure.

Identification of TRIM27 as a novel degradation target of herpes simplex virus 1 ICP0.

Science.gov (United States)

Conwell, Sara E; White, Anne E; Harper, J Wade; Knipe, David M

2015-01-01

The herpes simplex virus 1 (HSV-1) immediate early protein ICP0 performs many functions during infection, including transactivation of viral gene expression, suppression of innate immune responses, and modification and eviction of histones from viral chromatin. Although these functions of ICP0 have been characterized, the detailed mechanisms underlying ICP0's complex role during infection warrant further investigation. We thus undertook an unbiased proteomic approach to identifying viral and cellular proteins that interact with ICP0 in the infected cell. Cellular candidates resulting from our analysis included the ubiquitin-specific protease USP7, the transcriptional repressor TRIM27, DNA repair proteins NBN and MRE11A, regulators of apoptosis, including BIRC6, and the proteasome. We also identified two HSV-1 early proteins involved in nucleotide metabolism, UL39 and UL50, as novel candidate interactors of ICP0. Because TRIM27 was the most statistically significant cellular candidate, we investigated the relationship between TRIM27 and ICP0. We observed rapid, ICP0-dependent loss of TRIM27 during HSV-1 infection. TRIM27 protein levels were restored by disrupting the RING domain of ICP0 or by inhibiting the proteasome, arguing that TRIM27 is a novel degradation target of ICP0. A mutant ICP0 lacking E3 ligase activity interacted with endogenous TRIM27 during infection as demonstrated by reciprocal coimmunoprecipitation and supported by immunofluorescence data. Surprisingly, ICP0-null mutant virus yields decreased upon TRIM27 depletion, arguing that TRIM27 has a positive effect on infection despite being targeted for degradation. These results illustrate a complex interaction between TRIM27 and viral infection with potential positive or negative effects of TRIM27 on HSV under different infection conditions. During productive infection, a virus must simultaneously redirect multiple cellular pathways to replicate itself while evading detection by the host's defenses. To

Epigenetic Silencing of CXCR4 Promotes Loss of Cell Adhesion in Cervical Cancer

Directory of Open Access Journals (Sweden)

Suresh Singh Yadav

2014-01-01

Full Text Available In the network of chemokine signaling pathways, recent reports have described the SDF-1α/CXCR4 axis and its role in cancer progression and metastasis. Interestingly, we found downregulation of CXCR4 at both transcript and protein level in cervical cancer cell lines and primary tumors. We also found CXCR4 promoter hypermethylation in cervical cancer cell lines and primary biopsy samples. DNA hypomethylating drug 5-AZA-2′-deoxycytidine and histone deacetylase inhibitor Trichostatin A treatments in cell lines reactivate both CXCR4 transcription and protein expression. Cell adhesion assay demonstrated that autocrine SDF-1α promotes the loss of cell adhesion while paracrine SDF-1α predominantly protects the normal cervical cells from loss of cell adhesion. Cervical cancer cell line C-33A having increased expression of CXCR4 after TSA treatment showed increased cell adhesion by paracrine source of SDF-1α in comparison to untreated C-33A. These findings demonstrate the first evidence that epigenetic silencing of CXCR4 makes the cells inefficient to respond to the paracrine source of SDF-1α leading to loss of cell adhesion, one of the key events in metastases and progression of the disease. Our results provide novel insight of SDF-1α/CXCR4 signaling in tumor microenvironment which may be promising to further delineate molecular mechanism of cervical carcinogenesis.

Detection of the argonaute protein Ago2 and microRNAs in the RNA induced silencing complex (RISC) using a monoclonal antibody.

Science.gov (United States)

Ikeda, Keigo; Satoh, Minoru; Pauley, Kaleb M; Fritzler, Marvin J; Reeves, Westley H; Chan, Edward K L

2006-12-20

MicroRNAs (miRNAs) are short RNA molecules responsible for post-transcriptional gene silencing by the degradation or translational inhibition of their target messenger RNAs (mRNAs). This process of gene silencing, known as RNA interference (RNAi), is mediated by highly conserved Argonaute (Ago) proteins which are the key components of the RNA induced silencing complex (RISC). In humans, Ago2 is responsible for the endonuclease cleavage of targeted mRNA and it interacts with the mRNA-binding protein GW182, which is a marker for cytoplasmic foci referred to as GW bodies (GWBs). We demonstrated that the anti-Ago2 monoclonal antibody 4F9 recognized GWBs in a cell cycle dependent manner and was capable of capturing miRNAs associated with Ago2. Since Ago2 protein is the effector protein of RNAi, anti-Ago2 monoclonal antibody may be useful in capturing functional miRNAs.

Antagonism of Innate Immunity by Paramyxovirus Accessory Proteins

Directory of Open Access Journals (Sweden)

Raychel Chambers

2009-10-01

Full Text Available Paramyxovirinae, a subfamily of Paramyxoviridae, are negative strand RNA viruses comprised of many important human and animal pathogens, which share a high degree of genetic and structural homology. The accessory proteins expressed from the P/V/C gene are major factors in the pathogenicity of the viruses, because of their ability to abrogate various facets of type I interferon (IFN induction and signaling. Most of the paramyxoviruses exhibit a commonality in their ability to antagonize innate immunity by blocking IFN induction and the Jak/STAT pathway. However, the manner in which the accessory proteins inhibit the pathway differs among viruses. Similarly, there are variations in the capability of the viruses to counteract intracellular detectors (RNA helicases, mda-5 and RIG-I. Furthermore, a functional specificity in the antagonism of the IFN response has been reported, suggesting that specificity in the circumvention of innate immunity restricts viral host range. Available evidence indicates that paramyxoviruses employ specific strategies to antagonize the IFN response of their specific hosts, which is one of the major factors that determine viral pathogenicity and host range.

Ophthalmodynamometry for ICP prediction and pilot test on Mt. Everest.

Science.gov (United States)

Querfurth, Henry W; Lieberman, Philip; Arms, Steve; Mundell, Steve; Bennett, Michael; van Horne, Craig

2010-11-01

A recent development in non-invasive techniques to predict intracranial pressure (ICP) termed venous ophthalmodynamometry (vODM) has made measurements in absolute units possible. However, there has been little progress to show utility in the clinic or field. One important application would be to predict changes in actual ICP during adaptive responses to physiologic stress such as hypoxia. A causal relationship between raised intracranial pressure and acute mountain sickness (AMS) is suspected. Several MRI studies report that modest physiologic increases in cerebral volume, from swelling, normally accompany subacute ascent to simulated high altitudes. 1) Validate and calibrate an advanced, portable vODM instrument on intensive patients with raised intracranial pressure and 2) make pilot, non-invasive ICP estimations of normal subjects at increasing altitudes. The vODM was calibrated against actual ICP in 12 neurosurgical patients, most affected with acute hydrocephalus and monitored using ventriculostomy/pressure transducers. The operator was blinded to the transducer read-out. A clinical field test was then conducted on a variable data set of 42 volunteer trekkers and climbers scaling Mt. Everest, Nepal. Mean ICPs were estimated at several altitudes on the ascent both across and within subjects. Portable vODM measurements increased directly and linearly with ICP resulting in good predictability (r = 0.85). We also found that estimated ICP increases normally with altitude (10 ± 3 mm Hg; sea level to 20 ± 2 mm Hg; 6553 m) and that AMS symptoms did not correlate with raised ICP. vODM technology has potential to reliably estimate absolute ICP and is portable. Physiologic increases in ICP and mild-mod AMS are separate responses to high altitude, possibly reflecting swelling and vasoactive instability, respectively.

Calibration and correction of LA-ICP-MS and LA-MC-ICP-MS analyses for element contents and isotopic ratios

Directory of Open Access Journals (Sweden)

Jie Lin

2016-06-01

Full Text Available LA-ICP-MS and LA-MC-ICP-MS have been the techniques of choice for achieving accurate and precise element content and isotopic ratio, the state-of-the-art technique combines the advantages of low detection limits with high spatial resolution, however, the analysis accuracy and precision are restricted by many factors, such as sensitivity drift, elemental/isotopic fractionation, matrix effects, interferences and the lack of sufficiently matrix-matched reference materials. Thus, rigorous and suitable calibration and correction methods are needed to obtain quantitative data. This review systematically summarized and evaluated the interference correction, quantitative calculation and sensitivity correction strategies in order to provide the analysts with suitable calibration and correction strategies according to the sample types and the analyzed elements. The functions and features of data reduction software ICPMSDataCal were also outlined, which can provide real-time and on-line data reduction of element content and isotopic ratios analyzed by LA-ICP-MS and LA-MC-ICP-MS.

Frank-ter Haar syndrome protein Tks4 regulates epidermal growth factor-dependent cell migration.

Science.gov (United States)

Bögel, Gábor; Gujdár, Annamária; Geiszt, Miklós; Lányi, Árpád; Fekete, Anna; Sipeki, Szabolcs; Downward, Julian; Buday, László

2012-09-07

Mutations in the SH3PXD2B gene coding for the Tks4 protein are responsible for the autosomal recessive Frank-ter Haar syndrome. Tks4, a substrate of Src tyrosine kinase, is implicated in the regulation of podosome formation. Here, we report a novel role for Tks4 in the EGF signaling pathway. In EGF-treated cells, Tks4 is tyrosine-phosphorylated and associated with the activated EGF receptor. This association is not direct but requires the presence of Src tyrosine kinase. In addition, treatment of cells with LY294002, an inhibitor of PI 3-kinase, or mutations of the PX domain reduces tyrosine phosphorylation and membrane translocation of Tks4. Furthermore, a PX domain mutant (R43W) Tks4 carrying a reported point mutation in a Frank-ter Haar syndrome patient showed aberrant intracellular expression and reduced phosphoinositide binding. Finally, silencing of Tks4 was shown to markedly inhibit HeLa cell migration in a Boyden chamber assay in response to EGF or serum. Our results therefore reveal a new function for Tks4 in the regulation of growth factor-dependent cell migration.

Dating of Uranium Materials by Using Combination of ICP-MS and SIMS

International Nuclear Information System (INIS)

Stebelkov, Y.; Aleshin, M.; Elantyev, I.; Grachev, A.; Zhizhin, K.; Stebelkov, V.

2015-01-01

The age of nuclear and some other radioactive materials can be determined undoubtedly by using ICP-MS techniques. But it can be correct if only one nuclear or another radioactive material is presented in analyzed sample and no isotope-chronograph presented in background particles in significant quantities. For particle analysis, which can be implemented by using SIMS, these restrictions are not valid. Practically one particle always characterizes only one material and does not contain background isotopes-chronographs. But age determination is based on the result of measuring of the content ratio of Th230 and U234. The difference of ionization coefficients of uranium and thorium and dependence of these coefficients on composition of particle does not allow using this method directly for age determination. Nevertheless SIMS is useful for dating of uranium materials, especially if the sample can contain small amounts of different materials. In this case the analysis of different fragments of materials by SIMS can confirm or not confirm the result, had been obtained by ICP-MS. If all detected and analyzed particles and fragments will have the same ratio of ion currents of Th230 and U234, the result of ICP-MS is true. If particles and fragments will have different ratios the result of ICP-MS cannot be related to any of presented materials. But in the last case the ages of different materials can be still estimated if different fragments have different ages, but the same elemental composition. The ''age'' had been determined by ICP-MS can be correlated with the average ratio of ion currents of Th230 and U234 had been determined by SIMS for all analyzed particles or fragments. This correlation determines the ratio of ionization coefficients of uranium and thorium, which should be the same for particles with the same elemental composition. (author)

Ophthalmodynamometry for ICP prediction and pilot test on Mt. Everest

Directory of Open Access Journals (Sweden)

Bennett Michael

2010-11-01

Full Text Available Abstract Background A recent development in non-invasive techniques to predict intracranial pressure (ICP termed venous ophthalmodynamometry (vODM has made measurements in absolute units possible. However, there has been little progress to show utility in the clinic or field. One important application would be to predict changes in actual ICP during adaptive responses to physiologic stress such as hypoxia. A causal relationship between raised intracranial pressure and acute mountain sickness (AMS is suspected. Several MRI studies report that modest physiologic increases in cerebral volume, from swelling, normally accompany subacute ascent to simulated high altitudes. Objectives 1 Validate and calibrate an advanced, portable vODM instrument on intensive patients with raised intracranial pressure and 2 make pilot, non-invasive ICP estimations of normal subjects at increasing altitudes. Methods The vODM was calibrated against actual ICP in 12 neurosurgical patients, most affected with acute hydrocephalus and monitored using ventriculostomy/pressure transducers. The operator was blinded to the transducer read-out. A clinical field test was then conducted on a variable data set of 42 volunteer trekkers and climbers scaling Mt. Everest, Nepal. Mean ICPs were estimated at several altitudes on the ascent both across and within subjects. Results Portable vODM measurements increased directly and linearly with ICP resulting in good predictability (r = 0.85. We also found that estimated ICP increases normally with altitude (10 ± 3 mm Hg; sea level to 20 ± 2 mm Hg; 6553 m and that AMS symptoms did not correlate with raised ICP. Conclusion vODM technology has potential to reliably estimate absolute ICP and is portable. Physiologic increases in ICP and mild-mod AMS are separate responses to high altitude, possibly reflecting swelling and vasoactive instability, respectively.

An albumin-mediated cholesterol design-based strategy for tuning siRNA pharmacokinetics and gene silencing.

Science.gov (United States)

Bienk, Konrad; Hvam, Michael Lykke; Pakula, Malgorzata Maria; Dagnæs-Hansen, Frederik; Wengel, Jesper; Malle, Birgitte Mølholm; Kragh-Hansen, Ulrich; Cameron, Jason; Bukrinski, Jens Thostrup; Howard, Kenneth A

2016-06-28

Major challenges for the clinical translation of small interfering RNA (siRNA) include overcoming the poor plasma half-life, site-specific delivery and modulation of gene silencing. In this work, we exploit the intrinsic transport properties of human serum albumin to tune the blood circulatory half-life, hepatic accumulation and gene silencing; based on the number of siRNA cholesteryl modifications. We demonstrate by a gel shift assay a strong and specific affinity of recombinant human serum albumin (rHSA) towards cholesteryl-modified siRNA (Kd>1×10(-7)M) dependent on number of modifications. The rHSA/siRNA complex exhibited reduced nuclease degradation and reduced induction of TNF-α production by human peripheral blood mononuclear cells. The increased solubility of heavily cholesteryl modified siRNA in the presence of rHSA facilitated duplex annealing and consequent interaction that allowed in vivo studies using multiple cholesteryl modifications. A structural-activity-based screen of in vitro EGFP-silencing was used to select optimal siRNA designs containing cholesteryl modifications within the sense strand that were used for in vivo studies. We demonstrate plasma half-life extension in NMRI mice from t1/2 12min (naked) to t1/2 45min (single cholesteryl) and t1/2 71min (double cholesteryl) using fluorescent live bioimaging. The biodistribution showed increased accumulation in the liver for the double cholesteryl modified siRNA that correlated with an increase in hepatic Factor VII gene silencing of 28% (rHSA/siRNA) compared to 4% (naked siRNA) 6days post-injection. This work presents a novel albumin-mediated cholesteryl design-based strategy for tuning pharmacokinetics and systemic gene silencing. Copyright © 2016 Elsevier B.V. All rights reserved.

Mucin 4 Gene Silencing Reduces Oxidative Stress and Calcium Oxalate Crystal Formation in Renal Tubular Epithelial Cells Through the Extracellular Signal-Regulated Kinase Signaling Pathway in Nephrolithiasis Rat Model

Directory of Open Access Journals (Sweden)

Ling Sun

2018-05-01

Full Text Available Background/Aims: Nephrolithiasis plagues a great number of patients all over the world. Increasing evidence shows that the extracellular signal-regulated kinase (ERK signaling pathway and renal tubular epithelial cell (RTEC dysfunction and attrition are central to the pathogenesis of kidney diseases. Mucin 4 (MUC4 is reported as an activator of ERK signaling pathway in epithelial cells. In this study, using rat models of calcium oxalate (CaOx nephrolithiasis, the present study aims to define the roles of MUC4 and ERK signaling pathway as contributors to oxidative stress and CaOx crystal formation in RTEC. Methods: Data sets of nephrolithiasis were searched using GEO database and a heat flow map was drawn. Then MUC4 function was predicted. Wistar rats were prepared for the purpose of model establishment of ethylene glycol and ammonium chloride induced CaOx nephrolithiasis. In order to assess the detailed regulatory mechanism of MUC4 silencing on the ERK signaling pathway and RTEC, we used recombinant plasmid to downregulate MUC4 expression in Wistar rat-based models. Samples from rat urine, serum and kidney tissues were reviewed to identify oxalic acid and calcium contents, BUN, Cr, Ca2+ and P3+ levels, calcium crystal formation in renal tubules and MUC4 positive expression rate. Finally, RT-qPCR, Western blot analysis, and ELISA were employed to access oxidative stress state and CaOx crystal formation in RTEC. Results: Initially, MUC4 was found to have an influence on the process of nephrolithiasis. MUC4 was upregulated in the CaOx nephrolithiasis model rats. We proved that the silencing of MUC4 triggered the inactivation of ERK signaling pathway. Following the silencing of MUC4 or the inhibition of ERK signaling pathway, the oxalic acid and calcium contents in rat urine, BUN, Cr, Ca2+ and P3+ levels in rat serum, p-ERK1/2, MCP-1 and OPN expressions in RTEC and H2O2 and MDA levels in the cultured supernatant were downregulated, but the GSH

Renal-Specific Silencing of TNF (Tumor Necrosis Factor) Unmasks Salt-Dependent Increases in Blood Pressure via an NKCC2A (Na+-K+-2Cl- Cotransporter Isoform A)-Dependent Mechanism.

Science.gov (United States)

Hao, Shoujin; Hao, Mary; Ferreri, Nicholas R

2018-06-01

We tested the hypothesis that TNF (tumor necrosis factor)-α produced within the kidney and acting on the renal tubular system is part of a regulatory mechanism that attenuates increases in blood pressure in response to high salt intake. Intrarenal administration of a lentivirus construct, which specifically silenced TNF in the kidney, did not affect baseline blood pressure. However, blood pressure increased significantly 1 day after mice with intrarenal silencing of TNF ingested 1% NaCl in the drinking water. The increase in blood pressure, which was continuously observed for 11 days, promptly returned to baseline levels when mice were switched from 1% NaCl to tap water. Silencing of renal TNF also increased NKCC2 (Na + -K + -2Cl - cotransporter) phosphorylation and induced a selective increase in NKCC2A (NKCC2 isoform A) mRNA accumulation in both the cortical and medullary thick ascending limb of Henle loop that was neither associated with a compensatory decrease of NKCC2F in the medulla nor NKCC2B in the cortex. The NaCl-mediated increases in blood pressure were completely absent when NKCC2A, using a lentivirus construct that did not alter expression of NKCC2F or NKCC2B, and TNF were concomitantly silenced in the kidney. Moreover, the decrease in urine volume and NaCl excretion induced by renal TNF silencing was abolished when NKCC2A was concurrently silenced, suggesting that this isoform contributes to the transition from a salt-resistant to salt-sensitive phenotype. Collectively, the data are the first to demonstrate a role for TNF produced by the kidney in the modulation of sodium homeostasis and blood pressure regulation. © 2018 American Heart Association, Inc.

Laser ablation ICP-MS for quantitative biomedical applications

International Nuclear Information System (INIS)

Konz, Ioana; Fernandez, Beatriz; Fernandez, M.L.; Pereiro, Rosario; Sanz-Medel, Alfredo

2012-01-01

LA-ICP-MS allows precise, relatively fast, and spatially resolved measurements of elements and isotope ratios at trace and ultratrace concentration levels with minimal sample preparation. Over the past few years this technique has undergone rapid development, and it has been increasingly applied in many different fields, including biological and medical research. The analysis of essential, toxic, and therapeutic metals, metalloids, and nonmetals in biomedical tissues is a key task in the life sciences today, and LA-ICP-MS has proven to be an excellent complement to the organic MS techniques that are much more commonly employed in the biomedical field. In order to provide an appraisal of the fast progress that is occurring in this field, this review critically describes new developments for LA-ICP-MS as well as the most important applications of LA-ICP-MS, with particular emphasis placed on the quantitative imaging of elements in biological tissues, the analysis of heteroatom-tagged proteins after their separation and purification by gel electrophoresis, and the analysis of proteins that do not naturally have ICP-MS-detectable elements in their structures, thus necessitating the use of labelling strategies. (orig.)

Breaching cultural silence: enhancing resilience among Ugandan ...

African Journals Online (AJOL)

Cultural silence is frequently the outcome of deep-seated taboos regarding adults talking to children about sex and death. This paper examines the impact of cultural silence on the resilience of children orphaned by AIDS in Uganda. Cultural silence is often linked with denial. This article explores the complexities of cultural ...

ICP-MS analysis for long-lived radionuclides

International Nuclear Information System (INIS)

Roos, P.

2010-01-01

Full text: Inductively coupled plasma mass spectrometry (ICP-MS) is an attractive alternative for the analysis of radioisotopes having a half-life in the order of several hundred years and above. The technique should not be considered a replacement for radiometric measurements of these isotopes but merely an alternative. Similarly to radiometric techniques like alpha and beta spectrometry most analysis of 'low-level' concentrations by ICP-MS requires chemical isolation of the element in question. For 'ultra-low-level' concentrations this clean-up of the sample is usually even more necessary than for the alternative radiometric techniques. The presentation gives an overview of advantages and disadvantages in using ICP-MS and compares it to relevant radiometric alternatives. (author)

Comparison of GC-ICP-MS and HPLC-ICP-MS for species-specific isotope dilution analysis of tributyltin in sediment after accelerated solvent extraction

International Nuclear Information System (INIS)

Wahlen, Raimund; Wolff-Briche, Celine

2003-01-01

This study describes a direct comparison of GC and HPLC hyphenated to ICP-MS determination of tributyltin (TBT) in sediment by species-specific isotope dilution analysis (SS-IDMS). The certified reference sediment PACS-2 (NRC, Canada) and a candidate reference sediment (P-18/HIPA-1) were extracted using an accelerated solvent extraction (ASE) procedure. For comparison of GC and LC methods an older bottle of PACS-2 was used, whilst a fresh bottle was taken for demonstration of the accuracy of the methods. The data obtained show good agreement between both methods for both the PACS-2 sediment (LC-ICP-IDMS 828±87 ng g -1 TBT as Sn, GC-ICP-IDMS 848±39 ng g -1 TBT as Sn) and the P-18/ HIPA-1 sediment (LC-ICP-IDMS 78.0±9.7 ng g -1 TBT as Sn, GC-ICP-IDMS 79.2±3.8 ng g -1 TBT as Sn). The analysis by GC-ICP-IDMS offers a greater signal-to-noise ratio and hence a superior detection limit of 0.03 pg TBT as Sn, in the sediment extracts compared to HPLC-ICP-IDMS (3 pg TBT as Sn). A comparison of the uncertainties associated with both methods indicates superior precision of the GC approach. This is related to the better reproducibility of the peak integration, which affects the isotope ratio measurements used for IDMS. The accuracy of the ASE method combined with HPLC-ICP-IDMS was demonstrated during the international interlaboratory comparison P-18 organised by the Comite Consultatif pour la Quantite de Matiere (CCQM). The results obtained by GC-ICP-IDMS for a newly opened bottle of PACS-2 were 1087±77 ng g -1 Sn for DBT and 876±51 ng g -1 Sn for TBT (expanded uncertainties with a coverage factor of 2), which are in good agreement with the certified values of 1090±150 ng g -1 Sn and 980±130 ng g -1 Sn, respectively. (orig.)

Organizational Silence in Sports Employees

Science.gov (United States)

Bastug, Gulsum; Pala, Adem; Yilmaz, Taner; Duyan, Mehdi; Gunel, Ilker

2016-01-01

Organizational silence can be defined as a way of behaviour belonging to men and women employees in the organization exhibited without reflecting their feelings, ideas, concerns and suggestions related with their workplaces, works for which they are responsible or other activities of the organization. In the period of organizational silence,…

Calcium signalling silencing in atrial fibrillation.

Science.gov (United States)

Greiser, Maura

2017-06-15

Subcellular calcium signalling silencing is a novel and distinct cellular and molecular adaptive response to rapid cardiac activation. Calcium signalling silencing develops during short-term sustained rapid atrial activation as seen clinically during paroxysmal atrial fibrillation (AF). It is the first 'anti-arrhythmic' adaptive response in the setting of AF and appears to counteract the maladaptive changes that lead to intracellular Ca 2+ signalling instability and Ca 2+ -based arrhythmogenicity. Calcium signalling silencing results in a failed propagation of the [Ca 2+ ] i signal to the myocyte centre both in patients with AF and in a rabbit model. This adaptive mechanism leads to a substantial reduction in the expression levels of calcium release channels (ryanodine receptors, RyR2) in the sarcoplasmic reticulum, and the frequency of Ca 2+ sparks and arrhythmogenic Ca 2+ waves remains low. Less Ca 2+ release per [Ca 2+ ] i transient, increased fast Ca 2+ buffering strength, shortened action potentials and reduced L-type Ca 2+ current contribute to a substantial reduction of intracellular [Na + ]. These features of Ca 2+ signalling silencing are distinct and in contrast to the changes attributed to Ca 2+ -based arrhythmogenicity. Some features of Ca 2+ signalling silencing prevail in human AF suggesting that the Ca 2+ signalling 'phenotype' in AF is a sum of Ca 2+ stabilizing (Ca 2+ signalling silencing) and Ca 2+ destabilizing (arrhythmogenic unstable Ca 2+ signalling) factors. Calcium signalling silencing is a part of the mechanisms that contribute to the natural progression of AF and may limit the role of Ca 2+ -based arrhythmogenicity after the onset of AF. © 2017 The Authors. The Journal of Physiology © 2017 The Physiological Society.

Simultaneous multielement analysis of zirconium alloys by chlorination separation of matrix/ICP-AES

International Nuclear Information System (INIS)

Kato, Kaneharu

1990-01-01

An analytical method combined chlorination separation of matrix with ICP-AES has been developed for reactor grade Zr alloys (Zircaloy-2). A sample (1 g) is taken into a Pt boat and chlorinated with HCl gas of 100 ml/min in a glass reaction tube at ca. 330degC. Matrix Zr of the sample is volatilized and separated as ZrCl 4 . The analytic elements remaining quantitatively as chlorination residue are dissolved in a mixture of mineral acids (6 M HCl 3 ml+conc. HNO 3 0.5 ml+conc. H 2 SO 4 0.2 ml) and diluted to 20 ml with distilled water after filtration. ICP-AES was used for simultaneous multielement determination using a calibration curve method. The present method has the following advantages: simple sample preparation procedure; applicability to any form of samples to determine multielements; simple ICP-AES calibration procedure. This method was successfully applied to the determination of Fe, Ni, Cu, Co, Mn and Pb in the Zr alloys of JAERI CRM's and NBS SRM's. (author)

Imaging of metal bioaccumulation in Hay-scented fern (Dennstaedtia punctilobula) rhizomes growing on contaminated soils by laser ablation ICP-MS

International Nuclear Information System (INIS)

Koelmel, Jeremy; Amarasiriwardena, Dulasiri

2012-01-01

Understanding Pb removal from the translocation stream is vital to engineering Pb hyperaccumulation in above ground organs, which would enhance the economic feasibility of Pb phytoextraction technologies. We investigated Cu, Pb, Sb and Zn distributions in Hay-scented fern (Dennstaedtia punctilobula) rhizomes on shooting range soils by laser ablation-inductively coupled plasma-mass spectrometry (LA-ICP-MS), analyzing digested rhizomes, stems, and fronds using ICP-MS. Nutrients Cu and Zn concentrated in fronds while toxic elements Pb and Sb did not, showing potential Pb and Sb sequestration in the rhizome. Frond and rhizome concentration of Pb was 0.17 ± 0.10% and 0.32 ± 0.21% of dry biomass, respectively. The 208 Pb/ 13 C and 121 Sb/ 13 C determined by LA-ICP-MS increased from inner sclerotic cortex to the epidermis, while Pb concentrated in the starchy cortex only in contaminated sites. These results suggest that concentration dependent bioaccumulation in the rhizome outer cortex removes Pb from the vascular transport stream. - Highlights: ► Bioimaged Cu, Pb, Sb, Zn across fern rhizomes from shooting ranges using LA-ICP-MS. ► Pb levels were highest in the outer starchy cortex. ► Pb seemed to displace nutrients Cu and Zn in contaminated site rhizomes. ► [Pb] and [Sb] were correlated across organs suggesting similar transport factors. - Using LA-ICP-MS we determined elemental distributions in Hay-scented fern rhizomes including concentration dependent Pb sequestration patterns in the outer cortex.

Silence, an Eye of Knowledge

Science.gov (United States)

Aghamohammadi, Mehdi

2017-01-01

One of the conspicuous features of the twentieth-century West was silence. This idea could be supported by examining reflections of Ludwig Wittgenstein, Fritz Mauthner, John Cage, Samuel Beckett, Ihab Hassan, Franz Kafka, Wassily Kandinsky, Jean-Paul Sartre, Virginia Woolf, Wolfgang Iser, Jacques Derrida, and Pierre Macherey. To me, silence is not…

Mass Spectrometric Investigation of Silicon Extremely Enriched in (28)Si: From (28)SiF4 (Gas Phase IRMS) to (28)Si Crystals (MC-ICP-MS).

Science.gov (United States)

Pramann, Axel; Rienitz, Olaf

2016-06-07

A new generation of silicon crystals even further enriched in (28)Si (x((28)Si) > 0.999 98 mol/mol), recently produced by companies and institutes in Russia within the framework of a project initiated by PTB, were investigated with respect to their isotopic composition and molar mass M(Si). A modified isotope dilution mass spectrometric (IDMS) method treating the silicon as the matrix containing a so-called virtual element (VE) existing of the isotopes (29)Si and (30)Si solely and high resolution multicollector inductively coupled plasma mass spectrometry (MC-ICP-MS) were applied in combination. This method succeeds also when examining the new materials holding merely trace amounts of (29)Si (x((29)Si) ≈ 5 × 10(-6) mol/mol) and (30)Si (x((30)Si) ≈ 7 × 10(-7) mol/mol) extremely difficult to detect with lowest uncertainty. However, there is a need for validating the enrichment in (28)Si already in the precursor material of the final crystals, silicon tetrafluoride (SiF4) gas prior to crystal production. For that purpose, the isotopic composition of selected SiF4 samples was determined using a multicollector magnetic sector field gas-phase isotope ratio mass spectrometer. Contaminations of SiF4 by natural silicon due to storing and during the isotope ratio mass spectrometry (IRMS) measurements were observed and quantified. The respective MC-ICP-MS measurements of the corresponding crystal samples show-in contrast-several advantages compared to gas phase IRMS. M(Si) of the new crystals were determined to some extent with uncertainties urel(M) < 1 × 10(-9). This study presents a clear dependence of the uncertainty urel(M(Si)) on the degree of enrichment in (28)Si. This leads to a reduction of urel(M(Si)) during the past decade by almost 3 orders of magnitude and thus further reduces the uncertainty of the Avogadro constant NA which is one of the preconditions for the redefinition of the SI unit kilogram.

Precedents and consequences of prosocial behaviors of voice and silence

Directory of Open Access Journals (Sweden)

Alicia Omar

2015-09-01

Full Text Available Prosocial behavior is that which that encourages solidarity and harmony in interpersonal relationships, and produce personal or collective benefits. Although early research on job prosociality was focused on the study of conventional behaviors such as help, courtesy and sportsmanship, the identification and operationalization of new dimensions is rapidly expanding this nomological network. Such is the case of prosocial voice and prosocial silence, recently introduced in the scientific literature. The aim of this study is to explore possible relationships between employee’s voice and employee’s silence, and their personality structure; and examine the role of interpersonal justice perceptions on such relationships. We worked with a sample of 316 employees- aged 37 years and holding a 4.2-year signority working at public and private companies in southern and central Rosario (Argentina. The subjects completed Colquitt’ Justice Organizational Scale, Eysenck Personality Questionnaire, and Van Dyne’s Prosocial Voice and Prosocial Silence Scales. Extraversion and neuroticism emerged as the strongest predictors of prosocial voice and prosocial silence, respectively. Interpersonal justice perceptions emerged as moderators of the ‘natural’ tendency of extraverted workers to engage in prosocial voice, and emotionally controlled workers to engage in prosocial silence. Such findings would indicate that the promotion of high levels of interpersonal justice on job contexts could help workers to engage in more prosocial behavior with positive effects for the organization. 

Forensic discrimination of aluminum foil by SR-XRF and ICP-AES

International Nuclear Information System (INIS)

Kasamatsu, Masaaki; Suzuki, Yasuhiro; Suzuki, Shinichi; Miyamoto, Naoki; Watanabe, Seiya; Shimoda, Osamu; Takatsu, Masahisa; Nakanishi, Toshio

2010-01-01

The application of synchrotron radiation X-ray fluorescence spectrometry (SR-XRF) was investigated for the forensic discrimination of aluminum foil by comparisons of the elemental components. Small fragments (1 x 1 mm) were taken from 4 kinds of aluminum foils produced by different manufactures and used for measurements of the XRF spectrum at BL37XU of SPring-8. A comparison of the XRF spectra was effective for the discrimination of aluminum foils from different sources, because significant differences were observed in the X-ray peak intensities of Fe, Cu, Zn, Ga, Zr and Sn. These elements, except for Zr and Sn in the aluminum foils and NIST SRM1258 (Aluminium Alloy 6011), were also determined by inductively coupled plasma atomic emission spectrometry (ICP-AES). The observed values of Fe, Cu, Zn and Ga in NIST standard samples by ICP-AES showed satisfactorily good agreements with the certified or information values with relative standard deviations from 1.1% for Zn to 6.7% for Ga. The observed values for the aluminum foils by ICP-AES were compared with those by SR-XRF. Correlation coefficients from 0.997 for Cu/Fe to 0.999 for Zn/Fe and Ga/Fe were obtained between the ratio of the elemental concentration by ICP-AES and normalized the X-ray intensity by SR-XRF. This result demonstrates that a comparison of the normalized X-ray intensity is nearly as effective for the discrimination of aluminum foils as quantitative analysis by ICP-AES. Comparisons of the analytical results by SR-XRF allow the discrimination of all aluminum foils using only a 1 mm 2 fragment with no destruction of the samples. (author)

The Enamovirus P0 protein is a silencing suppressor which inhibits local and systemic RNA silencing through AGO1 degradation

International Nuclear Information System (INIS)

Fusaro, Adriana F.; Correa, Regis L.; Nakasugi, Kenlee; Jackson, Craig; Kawchuk, Lawrence; Vaslin, Maite F.S.; Waterhouse, Peter M.

2012-01-01

The P0 protein of poleroviruses and P1 protein of sobemoviruses suppress the plant's RNA silencing machinery. Here we identified a silencing suppressor protein (SSP), P0 PE , in the Enamovirus Pea enation mosaic virus-1 (PEMV-1) and showed that it and the P0s of poleroviruses Potato leaf roll virus and Cereal yellow dwarf virus have strong local and systemic SSP activity, while the P1 of Sobemovirus Southern bean mosaic virus supresses systemic silencing. The nuclear localized P0 PE has no discernable sequence conservation with known SSPs, but proved to be a strong suppressor of local silencing and a moderate suppressor of systemic silencing. Like the P0s from poleroviruses, P0 PE destabilizes AGO1 and this action is mediated by an F-box-like domain. Therefore, despite the lack of any sequence similarity, the poleroviral and enamoviral SSPs have a conserved mode of action upon the RNA silencing machinery.

The Enamovirus P0 protein is a silencing suppressor which inhibits local and systemic RNA silencing through AGO1 degradation

Energy Technology Data Exchange (ETDEWEB)

Fusaro, Adriana F. [University of Sydney, NSW 2006 (Australia); CSIRO Plant Industry, Canberra, P.O. Box 1600, ACT 2601 (Australia); Correa, Regis L. [CSIRO Plant Industry, Canberra, P.O. Box 1600, ACT 2601 (Australia); Depto. de Virologia, IMPPG, UFRJ, 21941-902 (Brazil); Nakasugi, Kenlee; Jackson, Craig [University of Sydney, NSW 2006 (Australia); Kawchuk, Lawrence [Research Centre, Agriculture and Agri-Food Canada, Lethbridge, AB T1J4B1 (Canada); Vaslin, Maite F.S. [Depto. de Virologia, IMPPG, UFRJ, 21941-902 (Brazil); Waterhouse, Peter M., E-mail: peter.waterhouse@sydney.edu.au [University of Sydney, NSW 2006 (Australia); CSIRO Plant Industry, Canberra, P.O. Box 1600, ACT 2601 (Australia)

2012-05-10

The P0 protein of poleroviruses and P1 protein of sobemoviruses suppress the plant's RNA silencing machinery. Here we identified a silencing suppressor protein (SSP), P0{sup PE}, in the Enamovirus Pea enation mosaic virus-1 (PEMV-1) and showed that it and the P0s of poleroviruses Potato leaf roll virus and Cereal yellow dwarf virus have strong local and systemic SSP activity, while the P1 of Sobemovirus Southern bean mosaic virus supresses systemic silencing. The nuclear localized P0{sup PE} has no discernable sequence conservation with known SSPs, but proved to be a strong suppressor of local silencing and a moderate suppressor of systemic silencing. Like the P0s from poleroviruses, P0{sup PE} destabilizes AGO1 and this action is mediated by an F-box-like domain. Therefore, despite the lack of any sequence similarity, the poleroviral and enamoviral SSPs have a conserved mode of action upon the RNA silencing machinery.

Integrated care pathways for airway diseases (AIRWAYS-ICPs)

NARCIS (Netherlands)

Bousquet, J.; Addis, A.; Adcock, I.; Agache, I.; Agusti, A.; Alonso, A.; Annesi-Maesano, I.; Anto, J. M.; Bachert, C.; Baena-Cagnani, C. E.; Bai, C.; Baigenzhin, A.; Barbara, C.; Barnes, P. J.; Bateman, E. D.; Beck, L.; Bedbrook, A.; Bel, E. H.; Benezet, O.; Bennoor, K. S.; Benson, M.; Bernabeu-Wittel, M.; Bewick, M.; Bindslev-Jensen, C.; Blain, H.; Blasi, F.; Bonini, M.; Bonini, S.; Boulet, L. P.; Bourdin, A.; Bourret, R.; Bousquet, P. J.; Brightling, C. E.; Briggs, A.; Brozek, J.; Buhl, R.; Bush, A.; Caimmi, D.; Calderon, M.; Calverley, P.; Camargos, P. A.; Camuzat, T.; Canonica, G. W.; Carlsen, K. H.; Casale, T. B.; Cazzola, M.; Cepeda Sarabia, A. M.; Cesario, A.; Chen, Y. Z.; Chkhartishvili, E.; Chavannes, N. H.; Chiron, R.; Chuchalin, A.; Chung, K. F.; Cox, L.; Crooks, G.; Crooks, M. G.; Cruz, A. A.; Custovic, A.; Dahl, R.; Dahlen, S. E.; de Blay, F.; Dedeu, T.; Deleanu, D.; Demoly, P.; Devillier, P.; Didier, A.; Dinh-Xuan, A. T.; Djukanovic, R.; Dokic, D.; Douagui, H.; Dubakiene, R.; Eglin, S.; Elliot, F.; Emuzyte, R.; Fabbri, L.; Fink Wagner, A.; Fletcher, M.; Fokkens, W. J.; Fonseca, J.; Franco, A.; Frith, P.; Furber, A.; Gaga, M.; Garcés, J.; Garcia-Aymerich, J.; Gamkrelidze, A.; Gonzales-Diaz, S.; Gouzi, F.; Guzmán, M. A.; Haahtela, T.; Harrison, D.; Hayot, M.; Heaney, L. G.; Heinrich, J.; Hellings, P. W.; Hooper, J.; Humbert, M.; Hyland, M.; Iaccarino, G.; Jakovenko, D.; Jardim, J. R.; Jeandel, C.; Jenkins, C.; Johnston, S. L.; Jonquet, O.; Joos, G.; Jung, K. S.; Kalayci, O.; Karunanithi, S.; Keil, T.; Khaltaev, N.; Kolek, V.; Kowalski, M. L.; Kull, I.; Kuna, P.; Kvedariene, V.; Le, L. T.; Lodrup Carlsen, K. C.; Louis, R.; MacNee, W.; Mair, A.; Majer, I.; Manning, P.; de Manuel Keenoy, E.; Masjedi, M. R.; Melen, E.; Melo-Gomes, E.; Menzies-Gow, A.; Mercier, G.; Mercier, J.; Michel, J. P.; Miculinic, N.; Mihaltan, F.; Milenkovic, B.; Molimard, M.; Momas, I.; Montilla-Santana, A.; Morais-Almeida, M.; Morgan, M.; N'Diaye, M.; Nafti, S.; Nekam, K.; Neou, A.; Nicod, L.; O'Hehir, R.; Ohta, K.; Paggiaro, P.; Palkonen, S.; Palmer, S.; Papadopoulos, N. G.; Papi, A.; Passalacqua, G.; Pavord, I.; Pigearias, B.; Plavec, D.; Postma, D. S.; Price, D.; Rabe, K. F.; Radier Pontal, F.; Redon, J.; Rennard, S.; Roberts, J.; Robine, J. M.; Roca, J.; Roche, N.; Rodenas, F.; Roggeri, A.; Rolland, C.; Rosado-Pinto, J.; Ryan, D.; Samolinski, B.; Sanchez-Borges, M.; Schünemann, H. J.; Sheikh, A.; Shields, M.; Siafakas, N.; Sibille, Y.; Similowski, T.; Small, I.; Sola-Morales, O.; Sooronbaev, T.; Stelmach, R.; Sterk, P. J.; Stiris, T.; Sud, P.; Tellier, V.; To, T.; Todo-Bom, A.; Triggiani, M.; Valenta, R.; Valero, A. L.; Valiulis, A.; Valovirta, E.; van Ganse, E.; Vandenplas, O.; Vasankari, T.; Vestbo, J.; Vezzani, G.; Viegi, G.; Visier, L.; Vogelmeier, C.; Vontetsianos, T.; Wagstaff, R.; Wahn, U.; Wallaert, B.; Whalley, B.; Wickman, M.; Williams, D. M.; Wilson, N.; Yawn, B. P.; Yiallouros, P. K.; Yorgancioglu, A.; Yusuf, O. M.; Zar, H. J.; Zhong, N.; Zidarn, M.; Zuberbier, T.

2014-01-01

The objective of Integrated Care Pathways for Airway Diseases (AIRWAYS-ICPs) is to launch a collaboration to develop multi-sectoral care pathways for chronic respiratory diseases in European countries and regions. AIRWAYS-ICPs has strategic relevance to the European Union Health Strategy and will

Integrated care pathways for airway diseases (AIRWAYS-ICPs)

NARCIS (Netherlands)

Bousquet, J.; Addis, A.; Adcock, I.; Agache, I.; Agusti, A.; Alonso, A.; Annesi-Maesano, I.; Anto, J. M.; Bachert, C.; Baena-Cagnani, C. E.; Bai, C.; Baigenzhin, A.; Barbara, C.; Barnes, P. J.; Bateman, E. D.; Beck, L.; Bedbrook, A.; Bel, E. H.; Benezet, O.; Bennoor, K. S.; Benson, M.; Bernabeu-Wittel, M.; Bewick, M.; Bindslev-Jensen, C.; Blain, H.; Blasi, F.; Bonini, M.; Bonini, S.; Boulet, L. P.; Bourdin, A.; Bourret, R.; Bousquet, P. J.; Brightling, C. E.; Briggs, A.; Brozek, J.; Buh, R.; Bush, A.; Caimmi, D.; Calderon, M.; Calverley, P.; Camargos, P. A.; Camuzat, T.; Canonica, G. W.; Carlsen, K. H.; Casale, T. B.; Cazzola, M.; Sarabia, A. M. Cepeda; Cesario, A.; Chen, Y. Z.; Chkhartishvili, E.; Chavannes, N. H.; Chiron, R.; Chuchalin, A.; Chung, K. F.; Cox, L.; Crooks, G.; Crooks, M. G.; Cruz, A. A.; Custovic, A.; Dahl, R.; Dahlen, S. E.; De Blay, F.; Dedeu, T.; Deleanu, D.; Demoly, P.; Devillier, P.; Didier, A.; Dinh-Xuan, A. T.; Djukanovic, R.; Dokic, D.; Douagui, H.; Dubakiene, R.; Eglin, S.; Elliot, F.; Emuzyte, R.; Fabbri, L.; Wagner, A. Fink; Fletcher, M.; Fokkens, W. J.; Fonseca, J.; Franco, A.; Frith, P.; Furber, A.; Gaga, M.; Garces, J.; Garcia-Aymerich, J.; Gamkrelidze, A.; Gonzales-Diaz, S.; Gouzi, F.; Guzman, M. A.; Haahtela, T.; Harrison, D.; Hayot, M.; Heaney, L. G.; Heinrich, J.; Hellings, P. W.; Hooper, J.; Humbert, M.; Hyland, M.; Iaccarino, G.; Jakovenko, D.; Jardim, J. R.; Jeandel, C.; Jenkins, C.; Johnston, S. L.; Jonquet, O.; Joos, G.; Jung, K. S.; Kalayci, O.; Karunanithi, S.; Keil, T.; Khaltaev, N.; Kolek, V.; Kowalski, M. L.; Kull, I.; Kuna, P.; Kvedariene, V.; Le, L. T.; Carlsen, K. C. Lodrup; Louis, R.; MacNee, W.; Mair, A.; Majer, I.; Manning, P.; Keenoy, E. de Manuel; Masjedi, M. R.; Meten, E.; Melo-Gomes, E.; Menzies-Gow, A.; Mercier, G.; Mercier, J.; Michel, J. P.; Miculinic, N.; Mihaltan, F.; Milenkovic, B.; Molimard, M.; Mamas, I.; Montilla-Santana, A.; Morais-Almeida, M.; Morgan, M.; N'Diaye, M.; Nafti, S.; Nekam, K.; Neou, A.; Nicod, L.; O'Hehir, R.; Ohta, K.; Paggiaro, P.; Palkonen, S.; Palmer, S.; Papadopoulos, N. G.; Papi, A.; Passalacqua, G.; Pavord, I.; Pigearias, B.; Plavec, D.; Postma, D. S.; Price, D.; Rabe, K. F.; Pontal, F. Radier; Redon, J.; Rennard, S.; Roberts, J.; Robine, J. M.; Roca, J.; Roche, N.; Rodenas, F.; Roggeri, A.; Rolland, C.; Rosado-Pinto, J.; Ryan, D.; Samolinski, B.; Sanchez-Borges, M.; Schunemann, H. J.; Sheikh, A.; Shields, M.; Siafakas, N.; Sibille, Y.; Similowski, T.; Small, I.; Sola-Morales, O.; Sooronbaev, T.; Stelmach, R.; Sterk, P. J.; Stiris, T.; Sud, P.; Tellier, V.; To, T.; Todo-Bom, A.; Triggiani, M.; Valenta, R.; Valero, A. L.; Valiulis, A.; Valovirta, E.; Van Ganse, E.; Vandenplas, O.; Vasankari, T.; Vestbo, J.; Vezzani, G.; Viegi, G.; Visier, L.; Vogelmeier, C.; Vontetsianos, T.; Wagstaff, R.; Wahn, U.; Wallaert, B.; Whalley, B.; Wickman, M.; Williams, D. M.; Wilson, N.; Yawn, B. P.; Yiallouros, P. K.; Yorgancioglu, A.; Yusuf, O. M.; Zar, H. J.; Zhong, N.; Zidarn, M.; Zuberbier, T.

The objective of Integrated Care Pathways for Airway Diseases (AIRWAYS-ICPs) is to launch a collaboration to develop multi-sectoral care pathways for chronic respiratory diseases in European countries and regions. AIRWAYS-ICPs has strategic relevance to the European Union Health Strategy and will

Development of ICP-MS and ICP-OES methods for determination of gadolinium in samples related to hospital waste water treatment

Czech Academy of Sciences Publication Activity Database

Bendakovská, L.; Krejčovská, A.; Černohorský, T.; Zelenková, Jana

2016-01-01

Roč. 70, č. 9 (2016), s. 1155-1165 ISSN 0366-6352 Institutional support: RVO:67985874 Keywords : gadolinium * rare-earth elements * bioaccumulation * gadolinium anomaly * inductively coupled plasma mass spectrometry (ICP-MS) * inductively coupled plasma optical emission spectrometry (ICP-OES) Subject RIV: BK - Fluid Dynamics Impact factor: 1.258, year: 2016

Variations of the blood gas levels and thermodilutional parameters during ICP monitoring after severe head trauma in children.

Science.gov (United States)

Lubrano, Riccardo; Elli, Marco; Stoppa, Francesca; Di Traglia, Mario; Di Nardo, Matteo; Perrotta, Daniela; David, Piero; Paoli, Sara; Cecchetti, Corrado

2015-08-01

The purpose of this study was to define, in children following head trauma and GSC ≤ 8, at which level of intracranial pressure (ICP), the thermodilutional, and gas analytic parameters implicated in secondary cerebral insults shows initial changes. We enrolled in the study 56 patients: 30 males and 26 females, mean age 71 ± 52 months. In all children, volumetric hemodynamic and blood gas parameters were monitored following initial resuscitation and every 4 h thereafter or whenever a hemodynamic deterioration was suspected. During the cumulative hospital stay, a total of 1050 sets of measurements were done. All parameters were stratified in seven groups according to ICP (group A1 = 0-5 mmHg, group A2 = 6-10 mmHg, group A3 = 11-15 mmHg, group A4 16-20 mmHg, group A5 21-25 mmHg, group A6 26-30 mmHg, group A7 >31 mmHg). Mean values of jugular oxygen saturation (SJO2), jugular oxygen partial pressure (PJO2), extravascular lung water (EVLWi), pulmonary vascular permeability (PVPi), fluid overload (FO), and cerebral extraction of oxygen (CEO2) vary significantly from A3 (11-15 mmHg) to A4 (16-20 mmHg). They relate to ICP in a four-parameter sigmoidal function (4PS function with: r(2) = 0.90), inflection point of 15 mmHg of ICP, and a maximum curvature point on the left horizontal asymptote at 13 mmHg of ICP. Mean values of SJO2, PJO2, EVLWi, PVPi, FO, and CEO2 become pathologic at 15 mmHg of ICP; however, the curve turns steeper at 13 mmHg, possibly a warning level in children for the development of post head trauma secondary insult.

A comparison between PIXE and ICP-AES measurements of metals in aerosol particulate collected in urban and marine sites in Italy

Energy Technology Data Exchange (ETDEWEB)

Traversi, R.; Becagli, S. [Department of Chemistry “Ugo Schiff”, University of Florence, Via della Lastruccia 3, I-50019 Sesto F.no, Florence (Italy); Calzolai, G.; Chiari, M.; Giannoni, M. [Department of Physics and Astronomy, University of Florence and I.N.F.N., Florence, Via G. Sansone 1, I-50019 Sesto F.no, Florence (Italy); Lucarelli, F., E-mail: lucarelli@fi.infn.it [Department of Physics and Astronomy, University of Florence and I.N.F.N., Florence, Via G. Sansone 1, I-50019 Sesto F.no, Florence (Italy); Nava, S. [Department of Physics and Astronomy, University of Florence and I.N.F.N., Florence, Via G. Sansone 1, I-50019 Sesto F.no, Florence (Italy); Rugi, F.; Severi, M.; Udisti, R. [Department of Chemistry “Ugo Schiff”, University of Florence, Via della Lastruccia 3, I-50019 Sesto F.no, Florence (Italy)

2014-01-01

PIXE and ICP-AES techniques are largely used in atmospheric aerosol studies. Since PIXE is able to provide the total elemental concentrations, while ICP-AES results depend on the extraction conditions, parallel PIXE and ICP-AES measurements of Fe, Al, Cu, Pb, Mn, Cr, Ni, V, As on PM10 and PM2.5 samples were compared. Two extraction procedures were applied to samples from 5 sites at different anthropization level in Italy: a “weak” extraction (HNO{sub 3} at pH = 1.5) and a “strong” extraction (micro-wave oven in HNO{sub 3} and H{sub 2}O{sub 2} – following EU rules). The amount of the metal extracted in the different conditions resulted to be strongly dependent on the sampling site, on the main sources of the particle (crustal or anthropic) containing the metal and on the sampled size class.

Small RNA-Mediated Epigenetic Myostatin Silencing

Directory of Open Access Journals (Sweden)

Thomas C Roberts

2012-01-01

Full Text Available Myostatin (Mstn is a secreted growth factor that negatively regulates muscle mass and is therefore a potential pharmacological target for the treatment of muscle wasting disorders such as Duchenne muscular dystrophy. Here we describe a novel Mstn blockade approach in which small interfering RNAs (siRNAs complementary to a promoter-associated transcript induce transcriptional gene silencing (TGS in two differentiated mouse muscle cell lines. Silencing is sensitive to treatment with the histone deacetylase inhibitor trichostatin A, and the silent state chromatin mark H3K9me2 is enriched at the Mstn promoter following siRNA transfection, suggesting epigenetic remodeling underlies the silencing effect. These observations suggest that long-term epigenetic silencing may be feasible for Mstn and that TGS is a promising novel therapeutic strategy for the treatment of muscle wasting disorders.

Mitochondrial calcium uniporter silencing potentiates caspase-independent cell death in MDA-MB-231 breast cancer cells

Energy Technology Data Exchange (ETDEWEB)

Curry, Merril C.; Peters, Amelia A. [School of Pharmacy, The University of Queensland, Brisbane, Queensland 4072 (Australia); Kenny, Paraic A. [Department of Developmental and Molecular Biology, Albert Einstein College of Medicine, Bronx, New York 10461 (United States); Roberts-Thomson, Sarah J. [School of Pharmacy, The University of Queensland, Brisbane, Queensland 4072 (Australia); Monteith, Gregory R., E-mail: gregm@uq.edu.au [School of Pharmacy, The University of Queensland, Brisbane, Queensland 4072 (Australia)

2013-05-10

Highlights: •Some clinical breast cancers are associated with MCU overexpression. •MCU silencing did not alter cell death initiated with the Bcl-2 inhibitor ABT-263. •MCU silencing potentiated caspase-independent cell death initiated by ionomycin. •MCU silencing promoted ionomycin-mediated cell death without changes in bulk Ca{sup 2+}. -- Abstract: The mitochondrial calcium uniporter (MCU) transports free ionic Ca{sup 2+} into the mitochondrial matrix. We assessed MCU expression in clinical breast cancer samples using microarray analysis and the consequences of MCU silencing in a breast cancer cell line. Our results indicate that estrogen receptor negative and basal-like breast cancers are characterized by elevated levels of MCU. Silencing of MCU expression in the basal-like MDA-MB-231 breast cancer cell line produced no change in proliferation or cell viability. However, distinct consequences of MCU silencing were seen on cell death pathways. Caspase-dependent cell death initiated by the Bcl-2 inhibitor ABT-263 was not altered by MCU silencing; whereas caspase-independent cell death induced by the calcium ionophore ionomycin was potentiated by MCU silencing. Measurement of cytosolic Ca{sup 2+} levels showed that the promotion of ionomycin-induced cell death by MCU silencing occurs independently of changes in bulk cytosolic Ca{sup 2+} levels. This study demonstrates that MCU overexpression is a feature of some breast cancers and that MCU overexpression may offer a survival advantage against some cell death pathways. MCU inhibitors may be a strategy to increase the effectiveness of therapies that act through the induction of caspase-independent cell death pathways in estrogen receptor negative and basal-like breast cancers.

ICP/AES radioactive sample analyses at Pacific Northwest Laboratory

International Nuclear Information System (INIS)

Matsuzaki, C.L.; Hara, F.T.

1986-03-01

Inductively coupled argon plasma atomic emission spectroscopy (ICP/AES) analyses of radioactive materials at Pacific Northwest Laboratory (PNL) began about three years ago upon completion of the installation of a modified Applied Research Laboratory (ARL) 3560. Funding for the purchase and installation of the ICP/AES was provided by the Nuclear Waste Materials Characterization Center (MCC) established at PNL by the Department of Energy in 1979. MCC's objective is to ensure that qualified materials data are available on waste materials. This paper is divided into the following topics: (1) Instrument selection considerations; (2) initial installation of the simultaneous system with the source stand enclosed in a 1/2'' lead-shielded glove box; (3) retrofit installation of the sequential spectrometer; and (4) a brief discussion on several types of samples analyzed. 1 ref., 7 figs., 1 tab

Effect of organic matrices on the determination of the trace element chemistry (Mg, Sr, Mg/Ca, Sr/Ca) of aragonitic bivalve shells (Arctica islandica). Comparison of ICP-OES and LA-ICP-MS data

International Nuclear Information System (INIS)

Schoene, Bernd R.; Zhang, Zengjie; Jacob, Dorrit; Soldate, Analia; Gillikin, David P.; Tuetken, Thomas; Garbe-Shoenberg, Dieter; McConnaughey, Ted

2010-01-01

The element chemistry of biogenic carbonates can provide important data on past environments. However, the Sr/Ca and Mg/Ca ratios as well as the Mg and Sr concentrations of biological carbonates, especially aragonitic bivalves often depart from apparent thermodynamic equilibrium. When measured in situ by means of LA-ICP-MS, the Mg concentration is often substantially enriched (two- to threefold) near the organic-rich, annual growth lines. To test the hypothesis that some organic components exert a major influence on the skeletal metal content, the element chemistry of different shell components (insoluble organic matrix, IOM; dissolved CaCO 3 and soluble organics, SOM) of Arctica islandica was measured by means of ICP-OES and LA-ICP-MS. The ICP-OES data indicate that the IOM is strongly enriched in Mg (130 ppm) and depleted in Sr and Ca (10 ppm and 0.22 wt%, respectively) when compared to the whole biomineral (Mg: 68 to 99 ppm, Sr: 860 to 1,060 ppm, Ca: ∼35.72 wt%). Although the average relative abundance of the IOM barely exceeds 0.46 wt%, its chemical composition in combination with its heterogeneous distribution across the shell can significantly increase estimates of the Mg concentration if measured in situ by LA-ICP-MS. Depending on the distribution of the IOM, the Ca concentration may be significantly lower locally than the average Ca concentration of the whole shell (35.72 wt%). If this remains undetected, the Mg concentration of shell portions with higher than average IOM content is overestimated by LA-ICP-MS and, conversely, the Mg concentration is underestimated in shell portions with lower than average IOM content. Removal of the IOM prior to the chemical analysis by LA-ICP-MS or mathematical correction for the IOM-derived magnesium concentrations is therefore strongly advised. The different chemistry of the IOM may also exert a major control on the trace element to calcium ratios. Shell portions enriched in IOM will show up to 200 times higher Mg

Chinanteco children’s silences in different classroom situations

Directory of Open Access Journals (Sweden)

Valeria Rebolledo Angulo

2016-01-01

Full Text Available This article analyzes, from an ethnographic perspective and a sociocultural framework, the construction of silences in the interaction between students and teachers in a multilingual classroom situation in an indigenous community in méxico. the analysis reveals how the silence of the chinanteco speaking children when asked to answer certain questions in class is not always due to their failure to understand spoken and written spanish that is used in class. their silences are responses taking different meanings in specific situations. the silence of the children can be a way of resisting, a way of hiding, and, sometimes, their voices are silenced.

The relative potency of inverse opioid agonists and a neutral opioid antagonist in precipitated withdrawal and antagonism of analgesia and toxicity.

Science.gov (United States)

Sirohi, Sunil; Dighe, Shveta V; Madia, Priyanka A; Yoburn, Byron C

2009-08-01

Opioid antagonists can be classified as inverse agonists and neutral antagonists. In the opioid-dependent state, neutral antagonists are significantly less potent in precipitating withdrawal than inverse agonists. Consequently, neutral opioid antagonists may offer advantages over inverse agonists in the management of opioid overdose. In this study, the relative potency of three opioid antagonists to block opioid analgesia and toxicity and precipitate withdrawal was examined. First, the potency of two opioid inverse agonists (naltrexone and naloxone) and a neutral antagonist (6beta-naltrexol) to antagonize fentanyl-induced analgesia and lethality was determined. The order of potency to block analgesia was naltrexone > naloxone > 6beta-naltrexol (17, 4, 1), which was similar to that to block lethality (13, 2, 1). Next, the antagonists were compared using withdrawal jumping in fentanyl-dependent mice. The order of potency to precipitate withdrawal jumping was naltrexone > naloxone 6beta-naltrexol (1107, 415, 1). The relative potencies to precipitate withdrawal for the inverse agonists compared with the neutral antagonist were dramatically different from that for antagonism of analgesia and lethality. Finally, the effect of 6beta-naltrexol pretreatment on naloxone-precipitated jumping was determined in morphine and fentanyl-dependent mice. 6beta-Naltrexol pretreatment decreased naloxone precipitated withdrawal, indicating that 6beta-naltrexol is a neutral antagonist. These data demonstrate that inverse agonists and neutral antagonists have generally comparable potencies to block opioid analgesia and lethality, whereas the neutral opioid antagonist is substantially less potent in precipitating opioid withdrawal. These results support suggestions that neutral antagonists may have advantages over inverse agonists in the management of opioid overdose.

Complement C5a receptor antagonism by protamine and poly-L-Arg on human leukocytes.

Science.gov (United States)

Olsen, U B; Selmer, J; Kahl, J U

1988-01-01

It is shown that protamine selectively and dose-dependently inhibits complement C5a-induced leukocyte responses such as histamine release from basophils, chemiluminescence and beta-glucuronidase release from neutrophils. Protamine produces parallel rightward displacements of the C5a dose-response curves. The inhibitory capacity of the polypeptide is reversible and disappears following repeated washing of exposed cells. In neutrophils poly-L-Arg similarly and specifically antagonizes C5a-induced chemiluminescence and enzyme release. This polymer alone, however, degranulates basophils and neutrophils, leading to histamine and enzyme release, respectively. It is concluded that on human neutrophils the arginine-rich polycations protamine and poly-L-Arg exhibit a competitive C5a receptor antagonism. In addition, protamine inhibits the C5a receptors on basophils. It is hypothesized that molecular conformations of the arginine-rich polycations might bind reversibly to, and block negatively charged groups at the C5a-receptor sites.

The use of ICP-MS and LA-ICP-MS techniques for uranium analysis in real-life swipe samples for safeguards purposes

Energy Technology Data Exchange (ETDEWEB)

Pestana, Rafael C.B.; Sarkis, Jorge E.S.; Carvalho, Elita F.U., E-mail: rcbpestana@gmail.com, E-mail: jesarkis@ipen.br [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil); Abreu Junior, Cassio H. [Centro de Energia Nuclear na Agricultura (CENA/USP), Piracicaba, SP (Brazil)

2013-07-01

Environmental swipe sampling for safeguards purposes is a powerful tool to detect undeclared materials and activities, and has been used by the International Atomic Energy Agency since 1997. This work describes the utilization of the inductively coupled plasma mass spectrometry (ICP-MS) and laser ablation inductively coupled plasma mass spectrometry (LA-ICP-MS) for determining uranium isotopic ratios in a real-life swipe samples collected in a conversion plant at IPEN/CNEN, Brazil. Uncertainties were estimated by following the International Organization for Standardization - Guide to the Expression of Uncertainties in Measurement (ISO GUM), with a confidence level of 95%. The major uncertainties percentage for n({sup 235}U)/n({sup 238}U) ratio for ICP-MS was 3% and for LA-ICP-MS was 30% The values of uranium isotopic ratios obtained for each technique demonstrate the viability of these analytical techniques as an alternative tool for uranium analysis in swipe samples for safeguards purposes. (author)

The use of ICP-MS and LA-ICP-MS techniques for uranium analysis in real-life swipe samples for safeguards purposes

International Nuclear Information System (INIS)

Pestana, Rafael C.B.; Sarkis, Jorge E.S.; Carvalho, Elita F.U.; Abreu Junior, Cassio H.

2013-01-01

Environmental swipe sampling for safeguards purposes is a powerful tool to detect undeclared materials and activities, and has been used by the International Atomic Energy Agency since 1997. This work describes the utilization of the inductively coupled plasma mass spectrometry (ICP-MS) and laser ablation inductively coupled plasma mass spectrometry (LA-ICP-MS) for determining uranium isotopic ratios in a real-life swipe samples collected in a conversion plant at IPEN/CNEN, Brazil. Uncertainties were estimated by following the International Organization for Standardization - Guide to the Expression of Uncertainties in Measurement (ISO GUM), with a confidence level of 95%. The major uncertainties percentage for n( 235 U)/n( 238 U) ratio for ICP-MS was 3% and for LA-ICP-MS was 30% The values of uranium isotopic ratios obtained for each technique demonstrate the viability of these analytical techniques as an alternative tool for uranium analysis in swipe samples for safeguards purposes. (author)

DNA topoisomerase 1α promotes transcriptional silencing of transposable elements through DNA methylation and histone lysine 9 dimethylation in Arabidopsis.

Directory of Open Access Journals (Sweden)

Thanh Theresa Dinh

2014-07-01

Full Text Available RNA-directed DNA methylation (RdDM and histone H3 lysine 9 dimethylation (H3K9me2 are related transcriptional silencing mechanisms that target transposable elements (TEs and repeats to maintain genome stability in plants. RdDM is mediated by small and long noncoding RNAs produced by the plant-specific RNA polymerases Pol IV and Pol V, respectively. Through a chemical genetics screen with a luciferase-based DNA methylation reporter, LUCL, we found that camptothecin, a compound with anti-cancer properties that targets DNA topoisomerase 1α (TOP1α was able to de-repress LUCL by reducing its DNA methylation and H3K9me2 levels. Further studies with Arabidopsis top1α mutants showed that TOP1α silences endogenous RdDM loci by facilitating the production of Pol V-dependent long non-coding RNAs, AGONAUTE4 recruitment and H3K9me2 deposition at TEs and repeats. This study assigned a new role in epigenetic silencing to an enzyme that affects DNA topology.

The VP3 factor from viruses of Birnaviridae family suppresses RNA silencing by binding both long and small RNA duplexes.

Science.gov (United States)

Valli, Adrian; Busnadiego, Idoia; Maliogka, Varvara; Ferrero, Diego; Castón, José R; Rodríguez, José Francisco; García, Juan Antonio

2012-01-01

RNA silencing is directly involved in antiviral defense in a wide variety of eukaryotic organisms, including plants, fungi, invertebrates, and presumably vertebrate animals. The study of RNA silencing-mediated antiviral defences in vertebrates is hampered by the overlap with other antiviral mechanisms; thus, heterologous systems are often used to study the interplay between RNA silencing and vertebrate-infecting viruses. In this report we show that the VP3 protein of the avian birnavirus Infectious bursal disease virus (IBDV) displays, in addition to its capacity to bind long double-stranded RNA, the ability to interact with double-stranded small RNA molecules. We also demonstrate that IBDV VP3 prevents the silencing mediated degradation of a reporter mRNA, and that this silencing suppression activity depends on its RNA binding ability. Furthermore, we find that the anti-silencing activity of IBDV VP3 is shared with the homologous proteins expressed by both insect- and fish-infecting birnaviruses. Finally, we show that IBDV VP3 can functionally replace the well-characterized HCPro silencing suppressor of Plum pox virus, a potyvirus that is unable to infect plants in the absence of an active silencing suppressor. Altogether, our results support the idea that VP3 protects the viral genome from host sentinels, including those of the RNA silencing machinery.

Proline oxidase silencing induces proline-dependent pro-survival pathways in MCF-7 cells

Science.gov (United States)

Zareba, Ilona; Celinska-Janowicz, Katarzyna; Surazynski, Arkadiusz; Miltyk, Wojciech; Palka, Jerzy

2018-01-01

Proline degradation by proline dehydrogenase/proline oxidase (PRODH/POX) contributes to apoptosis or autophagy. The identification of specific pathway of apoptosis/survival regulation is the aim of this study. We generated knocked-down PRODH/POX MCF-7 breast cancer cells (MCF-7shPRODH/POX). PRODH/POX silencing did not affect cell viability. However, it contributed to decrease in DNA and collagen biosynthesis, increase in prolidase activity and intracellular proline concentration as well as increase in the expression of iNOS, NF-κB, mTOR, HIF-1α, COX-2, AMPK, Atg7 and Beclin-1 in MCF-7shPRODH/POX cells. In these cells, glycyl-proline (GlyPro, substrate for prolidase) further inhibited DNA and collagen biosynthesis, maintained high prolidase activity, intracellular concentration of proline and up-regulated HIF-1α, AMPK, Atg7 and Beclin-1, compared to GlyPro-treated MCF-7 cells. In MCF-7 cells, GlyPro increased collagen biosynthesis, concentration of proline and expression of caspase-3, cleaved caspases -3 and -9, iNOS, NF-κB, COX-2 and AMPKβ. PRODH/POX knock-down contributed to pro-survival autophagy pathways in MCF-7 cells and GlyPro-derived proline augmented this process. However, GlyPro induced apoptosis in PRODH/POX-expressing MCF-7 cells as detected by up-regulation of active caspases -3 and -9. The data suggest that PRODH/POX silencing induces autophagy in MCF-7 cells and GlyPro-derived proline supports this process. PMID:29568391

Extraction inductively coupled plasma-optical emission spectrometry (ICP-OES). Determination of traces of phosphorus in tungsten

International Nuclear Information System (INIS)

Bauer, G.; Wegscheider, W.; Mueller, K.

1989-01-01

A method for the separation and preconcentration of traces of phosphorus from tungsten was developed. Solid phase extraction of the phosphovanadomolybdate complex performed on a micro-column was applied. Phosphorus was determined by optical emission spectroscopy (OES) with inductively coupled plasma (ICP) excitation. A limit of detection of 0,4 μg/g P with respect to the solid phase is obtained. By directly coupling the extraction/elution step to the ICP instrument a detection limit of 0,06 μg/g P in W was achieved. Besides, the complexity of spectral evaluation in ICP-OES determinations of traces in spectralline-rich matrices is discussed. (Authors)

Development of analytical procedures for determination of total chromium by quadrupole ICP-MS and high-resolution ICP-MS, and hexavalent chromium by HPLC-ICP-MS, in different materials used in the automotive industry.

Science.gov (United States)

Séby, F; Gagean, M; Garraud, H; Castetbon, A; Donard, O F X

2003-10-01

A European directive was recently adopted limiting the use of hazardous substances such as Pb, Hg, Cd, and Cr(VI) in vehicle manufacturing. From July 2003 a maximum of 2 g Cr(VI) will be authorised per vehicle in corrosion-preventing coatings of key components. As no standardised procedures are available to check if produced vehicles are in agreement with this directive, the objective of this work was to develop analytical procedures for total chromium and Cr(VI) determination in these materials. The first step of this study was to optimise digestion procedures for total chromium determination in plastic and metallic materials by inductively coupled plasma mass spectrometry (ICP-MS). High resolution (HR) ICP-MS was used to examine the influence of polyatomic interferences on the detection of the (52)Cr(+) and (53)Cr(+) isotopes. If there was strong interference with m/ z 52 for plastic materials, it was possible to use quadrupole ICP-MS for m/ z 53 if digestions were performed with HNO(3)+H(2)O(2). This mixture was also necessary for digestion of chromium from metallic materials. Extraction procedures in alkaline medium (NH(4)(+)/NH(3) buffer solution at pH 8.9) assisted by sonication were developed for determining Cr(VI) in four different corrosion-preventing coatings by HPLC-ICP-MS. After optimisation and validation with the only solid reference material certified for its Cr(VI) content (BCR 545; welding dusts), the efficiency of this extraction procedure for screw coatings was compared with that described in the EN ISO 3613 standard generally used in routine laboratories. For coatings comprising zinc and aluminium passivated in depth with chromium oxides the extraction procedure developed herein enabled determination of higher Cr(VI) concentrations. This was also observed for the screw covered with a chromium passivant layer on zinc-nickel. For coating comprising a chromium passivant layer on alkaline zinc the standardized extraction procedure was more efficient

Antisense targeting of 3' end elements involved in DUX4 mRNA processing is an efficient therapeutic strategy for facioscapulohumeral dystrophy: a new gene-silencing approach.

Science.gov (United States)

Marsollier, Anne-Charlotte; Ciszewski, Lukasz; Mariot, Virginie; Popplewell, Linda; Voit, Thomas; Dickson, George; Dumonceaux, Julie

2016-04-15

Defects in mRNA 3'end formation have been described to alter transcription termination, transport of the mRNA from the nucleus to the cytoplasm, stability of the mRNA and translation efficiency. Therefore, inhibition of polyadenylation may lead to gene silencing. Here, we choose facioscapulohumeral dystrophy (FSHD) as a model to determine whether or not targeting key 3' end elements involved in mRNA processing using antisense oligonucleotide drugs can be used as a strategy for gene silencing within a potentially therapeutic context. FSHD is a gain-of-function disease characterized by the aberrant expression of the Double homeobox 4 (DUX4) transcription factor leading to altered pathogenic deregulation of multiple genes in muscles. Here, we demonstrate that targeting either the mRNA polyadenylation signal and/or cleavage site is an efficient strategy to down-regulate DUX4 expression and to decrease the abnormally high-pathological expression of genes downstream of DUX4. We conclude that targeting key functional 3' end elements involved in pre-mRNA to mRNA maturation with antisense drugs can lead to efficient gene silencing and is thus a potentially effective therapeutic strategy for at least FSHD. Moreover, polyadenylation is a crucial step in the maturation of almost all eukaryotic mRNAs, and thus all mRNAs are virtually eligible for this antisense-mediated knockdown strategy. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Virus-induced gene silencing in diverse maize lines using the Brome Mosaic virus-based silencing vector

Science.gov (United States)

Virus-induced gene silencing (VIGS) is a widely used tool for gene function studies in many plant species, though its use in monocots has been limited. Using a Brome mosaic virus (BMV) vector designed to silence the maize phytoene desaturase gene, a genetically diverse set of maize inbred lines was ...

Epigenetic silencing of ADAMTS18 promotes cell migration and invasion of breast cancer through AKT and NF-κB signaling.

Science.gov (United States)

Xu, Hongying; Xiao, Qian; Fan, Yu; Xiang, Tingxiu; Li, Chen; Li, Chunhong; Li, Shuman; Hui, Tianli; Zhang, Lu; Li, Hongzhong; Li, Lili; Ren, Guosheng

2017-06-01

ADAMTS18 dysregulation plays an important role in many disease processes including cancer. We previously found ADAMTS18 as frequently methylated tumor suppressor gene (TSG) for multiple carcinomas, however, its biological functions and underlying molecular mechanisms in breast carcinogenesis remain unknown. Here, we found that ADAMTS18 was silenced or downregulated in breast cancer cell lines. ADAMTS18 was reduced in primary breast tumor tissues as compared with their adjacent noncancer tissues. ADAMTS18 promoter methylation was detected in 70.8% of tumor tissues by methylation-specific PCR, but none of the normal tissues. Demethylation treatment restored ADAMTS18 expression in silenced breast cell lines. Ectopic expression of ADAMTS18 in breast tumor cells resulted in inhibition of cell migration and invasion. Nude mouse model further confirmed that ADAMTS18 suppressed breast cancer metastasis in vivo. Further mechanistic studies showed that ADAMTS18 suppressed epithelial-mesenchymal transition (EMT), further inhibited migration and invasion of breast cancer cells. ADAMT18 deregulated AKT and NF-κB signaling, through inhibiting phosphorylation levels of AKT and p65. Thus, ADAMTS18 as an antimetastatic tumor suppressor antagonizes AKT and NF-κB signaling in breast tumorigenesis. Its methylation could be a potential tumor biomarker for breast cancer. © 2017 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

ICP experiments more durable pavements

International Nuclear Information System (INIS)

Carta Petrolera

1994-01-01

A new asphalts technology that will make more durable the pavement in the highways and roads of the cities of Colombia investigates the Colombian Institute of the Petroleum ICP. The project that will have important incidence in the solution of one of the main problems in the roads of cities like Bogota, is only one of the 35 investigation programs and application of new technologies that with relationship to the sector of the hydrocarbons and its influence branches the ICP advances. The investigation looks for to elevate the current average of useful life of the pavements, with that it would be reached a standard that has the developed countries in this field

Analytical applications of ICP-FTS

International Nuclear Information System (INIS)

Faires, L.M.; Palmer, B.A.; Cunningham, P.T.

1986-01-01

The Analytical Chemistry Group of the Chemistry Division at Los Alamos National Laboratory has been investigating the analytical utility of the inductively coupled plasma (ICP) - Fourier transform spectrometer (FTS) combination. While a new state-of-the-art FTS facility is under construction at Los Alamos, preliminary data has been obtained on the one-meter FTS at the National Solar Observatory at Kitt Peak, Arizona. This paper presents an update of the Los Alamos FTS facility, which is expected to be completed in 1986, and presents data showing the analytical potential of an ICP-FTS system. Some of the potential problems of the multiplex disadvantage are discussed, and the advantages of the high resolution obtainable with the FTS are illustrated

Feasibility of asymmetric flow field-flow fractionation coupled to ICP-MS for the characterization of wear metal particles and metalloproteins in biofluids from hip replacement patients

DEFF Research Database (Denmark)

Löschner, Katrin; Harrington, Chris F.; Kearney, Jacque-Lucca

2015-01-01

or other elements, but the current analytical methods used to investigate the processes involved do not provide sufficient information to understand the size or composition of the wear particles generated in vivo. In this qualitative feasibility study, asymmetric flow field-flow fractionation (AF4) coupled...... to ICP-MS was used to confirm the metal–protein associations in the serum samples. Off-line single particle ICP-MS (spICP-MS) analysis was used to confirm the approximate size distribution indicated by AF4 of the wear particles in hip aspirates. In the serum samples, AF4–ICP-MS suggested that Cr...... unidentified compounds; AEC analysis confirmed the Cr results and the association of Co with Alb and a second compound. Enzymatic digestion of the hip aspirate sample, followed by separation using AF4 with detection by UV absorption (280 nm), multi-angle light scattering and ICP-MS, suggested that the sizes...

The potyviral suppressor of RNA silencing confers enhanced resistance to multiple pathogens

International Nuclear Information System (INIS)

Pruss, Gail J.; Lawrence, Christopher B.; Bass, Troy; Li Qingshun Q.; Bowman, Lewis H.; Vance, Vicki

2004-01-01

Helper component-protease (HC-Pro) is a plant viral suppressor of RNA silencing, and transgenic tobacco expressing HC-Pro has increased susceptibility to a broad range of viral pathogens. Here we report that these plants also exhibit enhanced resistance to unrelated heterologous pathogens. Tobacco mosaic virus (TMV) infection of HC-Pro-expressing plants carrying the N resistance gene results in fewer and smaller lesions compared to controls without HC-Pro. The resistance to TMV is compromised but not eliminated by expression of nahG, which prevents accumulation of salicylic acid (SA), an important defense signaling molecule. HC-Pro-expressing plants are also more resistant to tomato black ring nepovirus (TBRV) and to the oomycete Peronospora tabacina. Enhanced TBRV resistance is SA-independent, whereas the response to P. tabacina is associated with early induction of markers characteristic of SA-dependent defense. Thus, a plant viral suppressor of RNA silencing enhances resistance to multiple pathogens via both SA-dependent and SA-independent mechanisms

The potyviral suppressor of RNA silencing confers enhanced resistance to multiple pathogens.

Science.gov (United States)

Pruss, Gail J; Lawrence, Christopher B; Bass, Troy; Li, Qingshun Q; Bowman, Lewis H; Vance, Vicki

2004-03-01

Helper component-protease (HC-Pro) is a plant viral suppressor of RNA silencing, and transgenic tobacco expressing HC-Pro has increased susceptibility to a broad range of viral pathogens. Here we report that these plants also exhibit enhanced resistance to unrelated heterologous pathogens. Tobacco mosaic virus (TMV) infection of HC-Pro-expressing plants carrying the N resistance gene results in fewer and smaller lesions compared to controls without HC-Pro. The resistance to TMV is compromised but not eliminated by expression of nahG, which prevents accumulation of salicylic acid (SA), an important defense signaling molecule. HC-Pro-expressing plants are also more resistant to tomato black ring nepovirus (TBRV) and to the oomycete Peronospora tabacina. Enhanced TBRV resistance is SA-independent, whereas the response to P. tabacina is associated with early induction of markers characteristic of SA-dependent defense. Thus, a plant viral suppressor of RNA silencing enhances resistance to multiple pathogens via both SA-dependent and SA-independent mechanisms.

The influence of laser pulse duration and energy on ICP-MS signal intensity, elemental fractionation, and particle size distribution in NIR fs-LA-ICP-MS

Science.gov (United States)

Diwakar, Prasoon K.; Harilal, Sivanandan S.; LaHaye, Nicole L.; Hassanein, Ahmed; Kulkarni, Pramod

2015-01-01

Laser parameters, typically wavelength, pulse width, irradiance, repetition rate, and pulse energy, are critical parameters which influence the laser ablation process and thereby influence the LA-ICP-MS signal. In recent times, femtosecond laser ablation has gained popularity owing to the reduction in fractionation related issues and improved analytical performance which can provide matrix-independent sampling. The advantage offered by fs-LA is due to shorter pulse duration of the laser as compared to the phonon relaxation time and heat diffusion time. Hence the thermal effects are minimized in fs-LA. Recently, fs-LA-ICP-MS demonstrated improved analytical performance as compared to ns-LA-ICP-MS, but detailed mechanisms and processes are still not clearly understood. Improvement of fs-LA-ICP-MS over ns-LA-ICP-MS elucidates the importance of laser pulse duration and related effects on the ablation process. In this study, we have investigated the influence of laser pulse width (40 fs to 0.3 ns) and energy on LA-ICP-MS signal intensity and repeatability using a brass sample. Experiments were performed in single spot ablation mode as well as rastering ablation mode to monitor the Cu/Zn ratio. The recorded ICP-MS signal was correlated with total particle counts generated during laser ablation as well as particle size distribution. Our results show the importance of pulse width effects in the fs regime that becomes more pronounced when moving from femtosecond to picosecond and nanosecond regimes. PMID:26664120

ICP-AES determination of trace elements in carbon steel

International Nuclear Information System (INIS)

Sengupta, Arijit; Rajeswari, B.; Kadam, R.M.; Babu, Y.; Godbole, S.V.

2010-01-01

Full text: Carbon steel, a combination of the elements iron and carbon, can be classified into four types as mild, medium, high and very high depending on the carbon content which varies from 0.05% to 2.1%. Carbon steel of different types finds application in medical devices, razor blades, cutlery and spring. In the nuclear industry, it is used in feeder pipes in the reactor. A strict quality control measure is required to monitor the trace elements, which have deleterious effects on the mechanical properties of the carbon steel. Thus, it becomes imperative to check the purity of carbon steel as a quality control measure before it is used in feeder pipes in the reactor. Several methods have been reported in literature for trace elemental determination in high purity iron. Some of these include neutron activation analysis, atomic absorption spectrometry and atomic emission spectrometry. Inductively coupled plasma atomic emission spectrometry (ICP-AES) is widely recognized as a sensitive technique for the determination of trace elements in various matrices, its major advantages being good accuracy and precision, high sensitivity, multi-element capability, large linear dynamic range and relative freedom from matrix effects. The present study mainly deals with the direct determination of trace elements in carbon steel using ICP-AES. An axially viewing ICP spectrometer having a polychromator with 35 fixed analytical channels and limited sequential facility to select any analytical line within 2.2 nm of a polychromator line was used in these studies. Iron, which forms one of the main constituents of carbon steel, has a multi electronic configuration with line rich emission spectrum and, therefore, tends to interfere in the determination of trace impurities in carbon steel matrix. Spectral interference in ICP-AES can be seriously detrimental to the accuracy and reliability of trace element determinations, particularly when they are performed in the presence of high

Probe-Dependent Negative Allosteric Modulators of the Long-Chain Free Fatty Acid Receptor FFA4

DEFF Research Database (Denmark)

Watterson, Kenneth R; Hansen, Steffen V F; Hudson, Brian D

2017-01-01

High-affinity and selective antagonists that are able to block the actions of both endogenous and synthetic agonists of G protein-coupled receptors are integral to analysis of receptor function and to support suggestions of therapeutic potential. Although there is great interest in the potential...... of endogenous and synthetic agonists, clear agonist probe dependence in the nature of allosteric modulation was apparent. Although AH-7614 did not antagonize the second long-chain free fatty acid receptor, free fatty acid receptor 1, the simple chemical structure of AH-7614 containing features found in many...

Antagonism of morphine-induced central respiratory depression by donepezil in the anesthetized rabbit

Directory of Open Access Journals (Sweden)

MIKI TSUJITA

2007-01-01

Full Text Available Morphine is often used in cancer pain and postoperative analgesic management but induces respiratory depression. Therefore, there is an ongoing search for drug candidates that can antagonize morphine-induced respiratory depression but have no effect on morphine-induced analgesia. Acetylcholine is an excitatory neurotransmitter in central respiratory control and physostigmine antagonizes morphine-induced respiratory depression. However, physostigmine has not been applied in clinical practice because it has a short action time, among other characteristics. We therefore asked whether donepezil (a long-acting acetylcholinesterase inhibitor used in the treatment of Alzheimer's disease can antagonize morphine-induced respiratory depression. Using the anesthetized rabbit as our model, we measured phrenic nerve discharge as an index of respiratory rate and amplitude. We compared control indices with discharges after the injection of morphine and after the injection of donepezil. Morphine-induced depression of respiratory rate and respiratory amplitude was partly antagonized by donepezil without any effect on blood pressure and end-tidal C0(2. In the other experiment, apneic threshold PaC0(2 was also compared. Morphine increased the phrenic nerve apnea threshold but this was antagonized by donepezil. These findings indicate that systemically administered donepezil partially restores morphine-induced respiratory depression and morphine-deteriorated phrenic nerve apnea threshold in the anesthetized rabbit

Alcohol-Induced Impairment of Balance is Antagonized by Energy Drinks.

Science.gov (United States)

Marczinski, Cecile A; Fillmore, Mark T; Stamates, Amy L; Maloney, Sarah F

2018-01-01

The acute administration of alcohol reliably impairs balance and motor coordination. While it is common for consumers to ingest alcohol with other stimulant drugs (e.g., caffeine, nicotine), little is known whether prototypical alcohol-induced balance impairments are altered by stimulant drugs. The purpose of this study was to examine whether the coadministration of a high-caffeine energy drink with alcohol can antagonize expected alcohol-induced increases in body sway. Sixteen social drinkers (of equal gender) participated in 4 separate double-blind dose administration sessions that involved consumption of alcohol and energy drinks, alone and in combination. Following dose administration, participants completed automated assessments of balance stability (both eyes open and eyes closed) measured using the Biosway Portable Balance System. Participants completed several subjective measures including self-reported ratings of sedation, stimulation, fatigue, and impairment. Blood pressure and pulse rate were recorded repeatedly. The acute administration of alcohol increased body sway, and the coadministration of energy drinks antagonized this impairment. When participants closed their eyes, alcohol-induced body sway was similar whether or not energy drinks were ingested. While alcohol administration increased ratings of sedation and fatigue, energy drink administration increased ratings of stimulation and reduced ratings of fatigue. Modest increases in systolic and diastolic blood pressure following energy drink administration were also observed. Visual assessment of balance impairment is frequently used to indicate that an individual has consumed too much alcohol (e.g., as part of police-standardized field sobriety testing or by a bartender assessing when someone should no longer be served more alcohol). The current findings suggest that energy drinks can antagonize alcohol-induced increases in body sway, indicating that future work is needed to determine whether this

Choosing Silence for Equality in and through Schooling

Science.gov (United States)

Lees, Helen E.

2016-01-01

This article considers silences and equality as combined from a theoretical perspective. Equality in and through chosen, deliberate and regular silence experience is seen as an equaliser: if no one is speaking no one can dominate. The article uses a bifurcated concept of silence: weak, negative forms and strong, positive forms. Only the strong…

ICP-MS Workshop

Energy Technology Data Exchange (ETDEWEB)

Carman, April J. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Eiden, Gregory C. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States)

2014-11-01

This is a short document that explains the materials that will be transmitted to LLNL and DNN HQ regarding the ICP-MS Workshop held at PNNL June 17-19th. The goal of the information is to pass on to LLNL information regarding the planning and preparations for the Workshop at PNNL in preparation of the SIMS workshop at LLNL.

Identification of a novel higher molecular weight isoform of USP7/HAUSP that interacts with the Herpes simplex virus type-1 immediate early protein ICP0.

Science.gov (United States)

Antrobus, Robin; Boutell, Chris

2008-10-01

The Herpes simplex virus type-1 (HSV-1) regulatory protein ICP0, a RING-finger E3 ubiquitin ligase, stimulates the onset of viral lytic replication and the reactivation of quiescent viral genomes from latency. Like many ubiquitin ligases ICP0 induces its own ubiquitination, a process that can lead to its proteasome-dependent degradation. ICP0 counteracts this activity by recruiting the cellular ubiquitin-specific protease USP7/HAUSP. Here we show that ICP0 can also interact with a previously unidentified isoform of USP7 (termed here USP7(beta)). This isoform is not a predominantly ubiquitinated, SUMO-modified, or phosphorylated species of USP7 but is constitutively expressed in a number of different cell types. Like USP7, USP7(beta) binds specifically to an electrophilic ubiquitin probe, indicating that it contains an accessible catalytic core with potential ubiquitin-protease activity. The interaction formed between ICP0 and USP7(beta) requires ICP0 to have an intact USP7-binding domain and results in its susceptibility to ICP0-mediated degradation during HSV-1 infection.

Speciation of the plutonium at trace levels by capillary electrophoresis-ICP-MS coupling

International Nuclear Information System (INIS)

Ambard, Ch.

2007-01-01

The CE-ICP-MS coupling allowed the development of new analytical methods for the study of plutonium (Pu) speciation at trace levels including complexation studies of this element by organic and inorganic ligands. First, a method, called dual detection, based on the simultaneous use of the UV-Visible spectrophotometer integrated in the capillary electrophoresis and the ICP-MS was developed and validated. It allows the unambiguous determination of electrophoretic mobilities for separated chemical species and gives a powerful tool for speciation studies. Then, the influence on Pu redox speciation of the buffer from the background electrolyte was evaluated. This study showed the implications of the electrolyte constituents' choice on Pu redox equilibrium in the sample. Furthermore, the CE-ICP-MS coupling was used for studying the Pu complexation at trace levels by some organic (NTA and DTPA) and inorganic ligands (carbonates). The behaviour of Pu valence +III, +IV and +VI was studied in the presence of buffer at near neutral pH. Different species of Pu were observed depending on the initial oxidation state of the plutonium. The study showed the potential of poly-amino-carboxylic acids, such as NTA and DTPA, for dissolving Pu precipitates, regardless its initial speciation. Finally, the carbonation of pentavalent neptunium, as an analogue of Pu(V), was achieved at very low concentration of Np (10 -8 mol.L -1 ). The formation of NpO 2 (CO 3 ) - at 25 C and 2,5*10 -2 mol.L -1 ionic strength was measured by CE-ICP-MS and found to consistent with literature data. (author)

Bioimaging of isosteric osmium and ruthenium anticancer agents by LA-ICP-MS.

Science.gov (United States)

Klose, Matthias H M; Theiner, Sarah; Kornauth, Christoph; Meier-Menches, Samuel M; Heffeter, Petra; Berger, Walter; Koellensperger, Gunda; Keppler, Bernhard K

2018-03-01

Laser ablation-inductively coupled plasma-mass spectrometry (LA-ICP-MS) was used to study the spatial distribution of two metallodrugs with anticancer activities in vivo, namely the organoruthenium plecstatin-1 (1) and its isosteric osmium analogue (2), in liver, kidneys, muscles and tumours of treated mice bearing a CT-26 tumour after single-dose i.p. administration. To the best of our knowledge, this is the first time that the spatial distribution of an osmium drug candidate has been investigated using LA-ICP-MS in tissues. Independent measurements of the average ruthenium and osmium concentration via microwave digestion and ICP-MS in organs and tumours were in good agreement with the LA-ICP-MS results. Matrix-matched standards (MMS) ranging from 1 to 30 μg g -1 were prepared to quantify the spatial distributions of the metals and the average metal content of the MMS samples was additionally quantified by ICP-MS after microwave digestion. The recoveries for osmium and ruthenium in the MMS were 105% and 101% on average, respectively, validating the sample preparation procedure of the MMS. Preparation of MMS was carried out under an argon atmosphere to prevent oxidation of osmium-species to the volatile OsO 4 . The highest metal concentrations were found in the liver, followed by kidney, lung and tumour tissues, while muscles displayed only very low quantities of the respective metal. Both metallodrugs accumulated in the cortex of the kidneys more strongly compared to the medulla. Interestingly, osmium from 2 was largely located at the periphery and tissue edges, whereas ruthenium from 1 was observed to penetrate deeper into the organs and tumours.

Development of a gene silencing DNA vector derived from a broad host range geminivirus

Directory of Open Access Journals (Sweden)

Hancock Leandria C

2009-07-01

Full Text Available Abstract Background Gene silencing is proving to be a powerful tool for genetic, developmental, and physiological analyses. The use of viral induced gene silencing (VIGS offers advantages to transgenic approaches as it can be potentially applied to non-model systems for which transgenic techniques are not readily available. However, many VIGS vectors are derived from Gemini viruses that have limited host ranges. We present a new, unipartite vector that is derived from a curtovirus that has a broad host range and will be amenable to use in many non-model systems. Results The construction of a gene silencing vector derived from the geminivirus Beet curly top virus (BCTV, named pWSRi, is reported. Two versions of the vector have been developed to allow application by biolistic techniques or by agro-infiltration. We demonstrate its ability to silence nuclear genes including ribulose bisphosphate carboxylase small subunit (rbcS, transketolase, the sulfur allele of magnesium chelatase (ChlI, and two homeotic transcription factors in spinach or tomato by generating gene-specific knock-down phenotypes. Onset of phenotypes occurred 3 to 12 weeks post-inoculation, depending on the target gene, in organs that developed after the application. The vector lacks movement genes and we found no evidence for significant spread from the site of inoculation. However, viral amplification in inoculated tissue was detected and is necessary for systemic silencing, suggesting that signals generated from active viral replicons are efficiently transported within the plant. Conclusion The unique properties of the pWSRi vector, the ability to silence genes in meristem tissue, the separation of virus and silencing phenotypes, and the broad natural host range of BCTV, suggest that it will have wide utility.

A petunia ethylene-responsive element binding factor, PhERF2, plays an important role in antiviral RNA silencing.

Science.gov (United States)

Sun, Daoyang; Nandety, Raja Sekhar; Zhang, Yanlong; Reid, Michael S; Niu, Lixin; Jiang, Cai-Zhong

2016-05-01

Virus-induced RNA silencing is involved in plant antiviral defense and requires key enzyme components, including RNA-dependent RNA polymerases (RDRs), Dicer-like RNase III enzymes (DCLs), and Argonaute proteins (AGOs). However, the transcriptional regulation of these critical components is largely unknown. In petunia (Petunia hybrida), an ethylene-responsive element binding factor, PhERF2, is induced by Tobacco rattle virus (TRV) infection. Inclusion of a PhERF2 fragment in a TRV silencing construct containing reporter fragments of phytoene desaturase (PDS) or chalcone synthase (CHS) substantially impaired silencing efficiency of both the PDS and CHS reporters. Silencing was also impaired in PhERF2- RNAi lines, where TRV-PhPDS infection did not show the expected silencing phenotype (photobleaching). In contrast, photobleaching in response to infiltration with the TRV-PhPDS construct was enhanced in plants overexpressing PhERF2 Transcript abundance of the RNA silencing-related genes RDR2, RDR6, DCL2, and AGO2 was lower in PhERF2-silenced plants but higher in PhERF2-overexpressing plants. Moreover, PhERF2-silenced lines showed higher susceptibility to Cucumber mosaic virus (CMV) than wild-type (WT) plants, while plants overexpressing PhERF2 exhibited increased resistance. Interestingly, growth and development of PhERF2-RNAi lines were substantially slower, whereas the overexpressing lines were more vigorous than the controls. Taken together, our results indicate that PhERF2 functions as a positive regulator in antiviral RNA silencing. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

The VP3 factor from viruses of Birnaviridae family suppresses RNA silencing by binding both long and small RNA duplexes.

Directory of Open Access Journals (Sweden)

Adrian Valli

Full Text Available RNA silencing is directly involved in antiviral defense in a wide variety of eukaryotic organisms, including plants, fungi, invertebrates, and presumably vertebrate animals. The study of RNA silencing-mediated antiviral defences in vertebrates is hampered by the overlap with other antiviral mechanisms; thus, heterologous systems are often used to study the interplay between RNA silencing and vertebrate-infecting viruses. In this report we show that the VP3 protein of the avian birnavirus Infectious bursal disease virus (IBDV displays, in addition to its capacity to bind long double-stranded RNA, the ability to interact with double-stranded small RNA molecules. We also demonstrate that IBDV VP3 prevents the silencing mediated degradation of a reporter mRNA, and that this silencing suppression activity depends on its RNA binding ability. Furthermore, we find that the anti-silencing activity of IBDV VP3 is shared with the homologous proteins expressed by both insect- and fish-infecting birnaviruses. Finally, we show that IBDV VP3 can functionally replace the well-characterized HCPro silencing suppressor of Plum pox virus, a potyvirus that is unable to infect plants in the absence of an active silencing suppressor. Altogether, our results support the idea that VP3 protects the viral genome from host sentinels, including those of the RNA silencing machinery.

Natural Protection of Wood with Antagonism Fungi

Directory of Open Access Journals (Sweden)

Alba ZAREMSKI

2011-03-01

Full Text Available Biological environments contain a certain number of microbial populations which, within a givenecological niche, display various relations ranging from symbiosis to parasitism. Researchers have beeninterested in these types of relations for around fifty years, especially in one very particular type ofrelationship: the antagonism exerted between individuals of the same microbial population.Today, the role played by biological agents, bringing into play inhibitive or destructive antibioticsubstances, reveals a certain potential for their use in controlling microorganisms associated with suchdegradation processes.The work undertaken by HydroQuébec and CIRAD involved two types of experiment: 1 in Petri dishes toassess and characterize the antagonistic capacity of Trichoderma against white rot and brown rot fungi; 2on pieces taken from untreated poles in order to study confrontation between the basidiomycete and theantagonistic strain in wood.This study investigated the antagonism of three ascomycetes of the genus Trichoderma against two whiterot basidiomycetes, Pycnoporus sanguineus and Coriolus versicolor, and two brown rot basidiomycetes,Antrodia sp. and Coniophora puteana, through direct confrontation in Petri dishes and in the wood ofHydroQuébec poles.The results obtained seemed to complete each other coherently. They revealed that the Trichodermagroup of fungi was not aggressive to wood and the results obtained after direct confrontation in Petri disheswere confirmed in wood.By directly exposing the different basidiomycetes and antagonists to each other in Petri dishes, two bytwo, we effectively revealed an antagonism effect for a large majority of the pairs. However, there wassubstantial variability in reactions from one pair to the next.

[E. M. Jellinek's silenced and silencing transgenerational story].

Science.gov (United States)

Kelemen, Gábor; Márk, Mónika

2013-01-01

Jellinek is a kind of archetypal character for future generations in the field of addiction studies. His implosion in the arena of alcoholism around the age of 50 was an unexpected challenge to medical science. We know very little about his own role models giving an intellectual and moral compass to his pragmatic creativity. More than 30 years has passed since Jellinek's death when an American sociologist Ron Roizen started unearthing his silent story. Roizen discerned that there are a lot of unsaid and muted issues in his personal Hungarian past. Our paper, based on the authors' research in Hungarian archives and other sources reveals that not just Jellinek's personal but his transgenerational narrative has been not-yet-said. This silenced and silencing history appears an unfinished business of acculturation of the family, which started prior to four generations. Authors have been concluding that the issue of religious conversion is a critical point in the process of acculturation. They examine the counter move of loyalty to family values and driving force of assimilation making their story unspeakable.

Things talked about while we remain silence and things we’re silence about while talking: The starting assumptions for an anthropology of silence about the nearest past

Directory of Open Access Journals (Sweden)

Đerić Gordana

2007-01-01

Full Text Available Wars of the last decade of the 20th century in former Yugoslavia have brought the whole region into the center of media attention and, accordingly, have aroused interest of the western academic theory. Since the latest ′discovery of the Balkans′ was brought into being precisely due to wars, one shouldn’t be surprised to find that many academic approaches to questions of Yugoslavia dismemberment are biased, superficial or exotic. On the other hand, Serbian academic auditorium was far from being active in elaborating questions of its own contemporality and closest past - for various reasons, but mostly because of its detachment from systematic explorations. Thus, acknowledgement and presentations of mentioned issues were left to be the job of media publicists, others outside of academic community or were left to be treated in the time to come. Domestic scholars were rarely intrigued to deal with these matters, despite the fact that images of recent wars were often built on stereotypes and propaganda and that the formed knowledge of the entire subject suffered from severe simplification. The themes of great violence were particularly avoided which left some of the crucial war events out of the academic focus - the reason being, very probably, the estimation that what made Serbia and the region worldwide known is best to be forgotten. Contemporary academic silence on recent wars, in retrospection, could easily be placed within the continuum of silence during the socialist period and war which preceded it. Having all mentioned in mind, this paper not only investigates reasons for avoiding the issues of the nearest past and influences of silence in socialism on what came afterwards, but also highlights the importance of exploring semantics and functions of silence and silencing in recent wars, as well as the relationship between silence and social memory constructions.

In C. elegans, high levels of dsRNA allow RNAi in the absence of RDE-4.

Science.gov (United States)

Habig, Jeffrey W; Aruscavage, P Joseph; Bass, Brenda L

2008-01-01

C. elegans Dicer requires an accessory double-stranded RNA binding protein, RDE-4, to enact the first step of RNA interference, the cleavage of dsRNA to produce siRNA. While RDE-4 is typically essential for RNAi, we report that in the presence of high concentrations of trigger dsRNA, rde-4 deficient animals are capable of silencing a transgene. By multiple criteria the silencing occurs by the canonical RNAi pathway. For example, silencing is RDE-1 dependent and exhibits a decrease in the targeted mRNA in response to an increase in siRNA. We also find that high concentrations of dsRNA trigger lead to increased accumulation of primary siRNAs, consistent with the existence of a rate-limiting step during the conversion of primary to secondary siRNAs. Our studies also revealed that transgene silencing occurs at low levels in the soma, even in the presence of ADARs, and that at least some siRNAs accumulate in a temperature-dependent manner. We conclude that an RNAi response varies with different conditions, and this may allow an organism to tailor a response to specific environmental signals.

In C. elegans, high levels of dsRNA allow RNAi in the absence of RDE-4.

Directory of Open Access Journals (Sweden)

Jeffrey W Habig

Full Text Available C. elegans Dicer requires an accessory double-stranded RNA binding protein, RDE-4, to enact the first step of RNA interference, the cleavage of dsRNA to produce siRNA. While RDE-4 is typically essential for RNAi, we report that in the presence of high concentrations of trigger dsRNA, rde-4 deficient animals are capable of silencing a transgene. By multiple criteria the silencing occurs by the canonical RNAi pathway. For example, silencing is RDE-1 dependent and exhibits a decrease in the targeted mRNA in response to an increase in siRNA. We also find that high concentrations of dsRNA trigger lead to increased accumulation of primary siRNAs, consistent with the existence of a rate-limiting step during the conversion of primary to secondary siRNAs. Our studies also revealed that transgene silencing occurs at low levels in the soma, even in the presence of ADARs, and that at least some siRNAs accumulate in a temperature-dependent manner. We conclude that an RNAi response varies with different conditions, and this may allow an organism to tailor a response to specific environmental signals.

Using ICP and micro-PIXE to investigate possible differences in the mineral composition of genetically modified versus wild-type sorghum grain

Science.gov (United States)

Ndimba, R.; Cloete, K.; Mehlo, L.; Kossmann, J.; Mtshali, C.; Pineda-Vargas, C.

2017-08-01

In the present study, possible differences in the mineral composition of transgenic versus non-transgenic sorghum grains were investigated using inductively coupled atomic emission spectroscopy (ICP-AES); and, in-tissue elemental mapping by micro Proton-Induced X-ray Emission (micro-PIXE) analysis. ICP AES was used to analyse the bulk mineral content of the wholegrain flour derived from each genotype; whilst micro-PIXE was used to interrogate localised differences in mineral composition specific to certain areas of the grain, such as the bran layer and the central endosperm tissue. According to the results obtained, no significant difference in the average Fe, Zn or Ca content was found to differentiate the transgenic from the wild-type grain using ICP-AES. However, using micro-PIXE, a significant reduction in zinc could be detected in the bran layer of the transgenic grains relative to wild-type. Although it is difficult to draw firm conclusions, as a result of the small sample size used in this study, micro-PIXE has nonetheless proven itself as a useful technique for highlighting the possibility that there may be reduced levels of zinc accumulation in the bran layer of the transgenic grains. Given that the genetic modification targets proteins that are highly concentrated in certain parts of the bran tissue, it seems plausible that the reduced levels of zinc may be an unintended consequence of the silencing of kafirin proteins. Although no immediate health or nutritional concerns emerge from this preliminary finding, it is noted that zinc plays an important biological role within this part of the grain as a structural stabiliser and antioxidant factor. Further study is therefore needed to assess more definitively the extent of the apparent localised reduction in zinc in the transgenic grains and how this may affect other important grain quality characteristics.

Transcriptional Silencing of Retroviral Vectors

DEFF Research Database (Denmark)

Lund, Anders Henrik; Duch, M.; Pedersen, F.S.

1996-01-01

. Extinction of long-term vector expression has been observed after implantation of transduced hematopoietic cells as well as fibroblasts, myoblasts and hepatocytes. Here we review the influence of vector structure, integration site and cell type on transcriptional silencing. While down-regulation of proviral...... transcription is known from a number of cellular and animal models, major insight has been gained from studies in the germ line and embryonal cells of the mouse. Key elements for the transfer and expression of retroviral vectors, such as the viral transcriptional enhancer and the binding site for the t......RNA primer for reverse transcription may have a major influence on transcriptional silencing. Alterations of these elements of the vector backbone as well as the use of internal promoter elements from housekeeping genes may contribute to reduce transcriptional silencing. The use of cell culture and animal...

Listen and the question of silence

DEFF Research Database (Denmark)

Doubinsky, Sebastien

2018-01-01

Listen is a film about words, but around words. The words become useless and are surrounded by silence. And the whole film is constructed on this silence, which builds up like an unbreakable wall. The question is thus: what are we listening to? What should we listen to? And maybe, even more crucial...

Effect of postural changes on ICP in healthy and ill subjects

DEFF Research Database (Denmark)

Petersen, Lonnie G; Juhler, Marianne

2015-01-01

to distinguish normal human physiology from disease entities such as idiopathic intracranial hypertension and normal pressure hydrocephalus, we investigated ICP in different body postures in both normal and ill subjects. METHODS: Thirty-one patients were included: four normal patients following complete removal......: upright standing, sitting in a chair, supine and right lateral lumbar puncture position. RESULTS: Linear regression of median ICP based on patient posture, group, and purpose of monitoring presented a significant model (p ... of differences in median ICP between body postures and supine ICP as the baseline, presented a highly significant model (p posture (p postures enabled...

PCA3 Silencing Sensitizes Prostate Cancer Cells to Enzalutamide-mediated Androgen Receptor Blockade.

Science.gov (United States)

Özgür, Emre; Celik, Ayca Iribas; Darendeliler, Emin; Gezer, Ugur

2017-07-01

Prostate cancer (PCa) is an androgen-dependent disease. Novel anti-androgens (i.e. enzalutamide) have recently been developed for the treatment of patients with metastatic castration-resistant prostate cancer (CRPC). Evidence is accumulating that prostate cancer antigen 3 (PCA3) is involved in androgen receptor (AR) signaling. Here, in combination with enzalutamide-mediated AR blockade, we investigated the effect of PCA3 targeting on the viability of PCa cells. In hormone-sensitive LNCaP cells, AR-overexpressing LNCaP-AR + cells and VCaP cells (representing CRPC), PCA3 was silenced using siRNA oligonucleotides. Gene expression and cell viability was assessed in PCA3-silenced and/or AR-blocked cells. PCA3 targeting reduced the expression of AR-related genes (i.e. prostate-specific antigen (PSA) and prostate-specific transcript 1 (non-protein coding) (PCGEM1)) and potentiated the effect of enzalutamide. Proliferation of PCa cells was suppressed upon PCA3 silencing with a greater effect in LNCaP-AR + cells. Furthermore, PCA3 silencing sensitized PCa cells to enzalutamide-induced loss of cell growth. PCA3, as a therapeutic target in PCa, might be used to potentiate AR antagonists. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

Silence as a Response to Everyday Violence

DEFF Research Database (Denmark)

Gammeltoft, Tine

2016-01-01

Across the world, existing research indicates that many women respond with silence to marital abuse. This article offers an ethnographic investigation of the social and psychic forces behind Vietnamese women’s silencing of violence and a theoretical exploration of how the psychoanalytic concept...... of fantasy—understood as unconscious or subconscious mental processes—may contribute to the analysis of everyday violence and psychic distress. Distinguishing between what I term deliberate and subconscious silence, I explore the role that fantasy plays when Vietnamese women silently endure intimate partner...

High-Precision Measurement of Eu/Eu* in Geological Glasses via LA-ICP-MS Analysis

Science.gov (United States)

Tang, Ming; McDonough, William F.; Arevalo, Ricardo, Jr.

2014-01-01

Elemental fractionation during laser ablation inductively coupled plasma mass spectrometry (LA-ICP-MS) analysis has been historically documented between refractory and volatile elements. In this work, however, we observed fractionation between light rare earth elements (LREEs) and heavy rare earth elements (HREEs) when using ablation strategies involving large spot sizes (greater than 100 millimeters) and line scanning mode. In addition: (1) ion yields decrease when using spot sizes above 100 millimeters; (2) (Eu/Eu*)(sub raw) (i.e. Europium anomaly) positively correlates with carrier gas (He) flow rate, which provides control over the particle size distribution of the aerosol reaching the ICP; (3) (Eu/Eu*)(sub raw) shows a positive correlation with spot size, and (4) the changes in REE signal intensity, induced by the He flow rate change, roughly correlate with REE condensation temperatures. The REE fractionation is likely driven by the slight but significant difference in their condensation temperatures. Large particles may not be completely dissociated in the ICP and result in preferential evaporation of the less refractory LREEs and thus non-stoichiometric particle-ion conversion. This mechanism may also be responsible for Sm-Eu-Gd fractionation as Eu is less refractory than Sm and Gd. The extent of fractionation depends upon the particle size distribution of the aerosol, which in turn is influenced by the laser parameters and matrix. Ablation pits and lines defined by low aspect ratios produce a higher proportion of large particles than high aspect ratio ablation, as confirmed by measurements of particle size distribution in the laser induced aerosol. Therefore, low aspect ratio ablation introduces particles that cannot be decomposed and/or atomized by the ICP and thus results in exacerbated elemental fractionation. Accurate quantification of REE concentrations and Eu/Eu* requires reduction of large particle production during laser ablation. For the reference

Oct4 Methylation-Mediated Silencing As an Epigenetic Barrier Preventing Müller Glia Dedifferentiation in a Murine Model of Retinal Injury.

Science.gov (United States)

Reyes-Aguirre, Luis I; Lamas, Monica

2016-01-01

Müller glia (MG) is the most abundant glial type in the vertebrate retina. Among its many functions, it is capable of responding to injury by dedifferentiating, proliferating, and differentiating into every cell types lost to damage. This regenerative ability is notoriously absent in mammals. We have previously reported that cultured mammalian MG undergoes a partial dedifferentiation, but fails to fully acquire a progenitor phenotype and differentiate into neurons. This might be explained by a mnemonic mechanism comprised by epigenetic traits, such as DNA methylation. To achieve a better understanding of this epigenetic memory, we studied the expression of pluripotency-associated genes, such as Oct4, Nanog , and Lin28 , which have been reported as necessary for regeneration in fish, at early times after NMDA-induced retinal injury in a mouse experimental model. We found that although Oct4 is expressed rapidly after damage (4 hpi), it is silenced at 24 hpi. This correlates with a significant decrease in the DNA methyltransferase Dnmt3b expression, which returns to basal levels at 24 hpi. By MS-PCR, we observed a decrease in Oct4 methylation levels at 4 and 12 hpi, before returning to a fully methylated state at 24 hpi. To demonstrate that these changes are restricted to MG, we separated these cells using a GLAST antibody coupled with magnetic beads. Finally, intravitreous administration of the DNA-methyltransferase inhibitor SGI-1027 induced Oct4 expression at 24 hpi in MG. Our results suggest that mammalian MG injury-induced dedifferentiation could be restricted by DNA methylation, which rapidly silences Oct4 expression, preventing multipotency acquisition.

Down-Regulation of Gene Expression by RNA-Induced Gene Silencing

Science.gov (United States)

Travella, Silvia; Keller, Beat

Down-regulation of endogenous genes via post-transcriptional gene silencing (PTGS) is a key to the characterization of gene function in plants. Many RNA-based silencing mechanisms such as post-transcriptional gene silencing, co-suppression, quelling, and RNA interference (RNAi) have been discovered among species of different kingdoms (plants, fungi, and animals). One of the most interesting discoveries was RNAi, a sequence-specific gene-silencing mechanism initiated by the introduction of double-stranded RNA (dsRNA), homologous in sequence to the silenced gene, which triggers degradation of mRNA. Infection of plants with modified viruses can also induce RNA silencing and is referred to as virus-induced gene silencing (VIGS). In contrast to insertional mutagenesis, these emerging new reverse genetic approaches represent a powerful tool for exploring gene function and for manipulating gene expression experimentally in cereal species such as barley and wheat. We examined how RNAi and VIGS have been used to assess gene function in barley and wheat, including molecular mechanisms involved in the process and available methodological elements, such as vectors, inoculation procedures, and analysis of silenced phenotypes.

PhOBF1, a petunia ocs element binding factor, plays an important role in antiviral RNA silencing.

Science.gov (United States)

Sun, Daoyang; Li, Shaohua; Niu, Lixin; Reid, Michael S; Zhang, Yanlong; Jiang, Cai-Zhong

2017-02-01

Virus-induced gene silencing (VIGS) is a common reverse genetics strategy for characterizing the function of genes in plants. The detailed mechanism governing RNA silencing efficiency triggered by viruses is largely unclear. Here, we reveal that a petunia (Petunia hybrida) ocs element binding factor, PhOBF1, one of the basic leucine zipper (bZIP) transcription factors, was up-regulated by Tobacco rattle virus (TRV) infection. Simultaneous silencing of PhOBF1 and a reporter gene, phytoene desaturase (PDS) or chalcone synthase (CHS), by TRV-based VIGS led to a failure of the development of leaf photobleaching or the white-corollas phenotype. PhOBF1 silencing caused down-regulation of RNA silencing-related genes, including RNA-dependent RNA polymerases (RDRs), Dicer-like RNase III enzymes (DCLs), and Argonautes (AGOs). After inoculation with the TRV-PhPDS, PhOBF1-RNAi lines exhibited a substantially impaired PDS silencing efficiency, whereas overexpression of PhOBF1 resulted in a recovery of the silencing phenotype (photobleaching) in systemic leaves. A compromised resistance to TRV and Tobacco mosaic virus was found in PhOBF1-RNAi lines, while PhOBF1-overexpressing lines displayed an enhanced resistance to their infections. Compared with wild-type plants, PhOBF1-silenced plants accumulated lower levels of free salicylic acid (SA), salicylic acid glucoside, and phenylalanine, contrarily to higher levels of those in plants overexpressing PhOBF1. Furthermore, transcripts of a number of genes associated with the shikimate and phenylpropanoid pathways were decreased or increased in PhOBF1-RNAi or PhOBF1-overexpressing lines, respectively. Taken together, the data suggest that PhOBF1 regulates TRV-induced RNA silencing efficiency through modulation of RDRs, DCLs, and AGOs mediated by the SA biosynthesis pathway. © The Author 2017. Published by Oxford University Press on behalf of the Society for Experimental Biology.

Computer simulation of ICP spectra: A new tool for the study of excitation, emission, and line overlap

International Nuclear Information System (INIS)

Blades, M.W.; Burton, L.L.

1986-01-01

It is well known that the relatively high temperature of ICP sources provides an excitation environment relatively free from dissociation and vaporization interferences and, in addition, produces intense analyte line spectra and hence high analytical sensitivity. However, this feature also introduces the potential for spectral overlaps from sample concomitants. The degree to which an analyte spectral line intensity can be corrected for interfering spectral overlaps depends on many factors including spectrometer resolution, sample composition and ICP operating conditions. The authors have been using a computer program to assist them in the study of ICP analyte emission spectra. This program is being used to study the spectral distribution of line intensity information and also to do detailed investigations on spectral overlaps in complex sample mixtures. As input data the program uses tabulated wavelengths, transition probabilities (gA values), partition functions, excitation energies of the transitions, ionization energy, temperature, and Doppler and Stark linewidths

Multielement determination of major-to-ultratrace elements in vegetable samples by ICP-MS and ICP-AES after acid digestion

Energy Technology Data Exchange (ETDEWEB)

Hokura, Akiko; Oguri, Sachiko; Matsuura, Hirotaka; Haraguchi, Hiroki [Dept. of Applied Chemistry, Graduate School of Engineering, Nagoya Univ. (Japan)

2000-06-01

A multielement determination of major-to-ultratrace elements in vegetable samples was carried out by inductively coupled plasma mass spectrometry (ICP-MS) and inductively coupled plasma atomic emission spectrometry (ICP-AES). Spinach samples (0.5 g) were digested with nitric acid and hydrofluoric acid in a Teflon beaker on a hot plate. The decomposed samples were dissolved in a 1 M ( = mol dm{sup -3}) HNO{sub 3} solution containing internal standard elements (Ge, In, and Re, 10 ppb each), and were subjected to multielement analyses by ICP-AES and ICP-MS. As a result, about 40 elements were successfully determined over a wide concentration range from % to ppb level. Spinach samples grown in different production areas were also analyzed in order to understand the influences of the environmental conditions on growth. Among the major and minor elements, the values of the coefficient of variance (CV) for B, Mg, P, and K were < 20%, and those for Ca, Na, Al, and Mn were higher than 50%. On the other hand, the values of CV for trace and ultratrace elements were significantly high. Furthermore, the present analytical method was also applied to the determination of major-to-ultratrace elements in various vegetable samples (23 species in 11 families); the similarities and differences of the elemental distributions in vegetables were found in the experimental results. (author)

Multielement determination of major-to-ultratrace elements in vegetable samples by ICP-MS and ICP-AES after acid digestion

International Nuclear Information System (INIS)

Hokura, Akiko; Oguri, Sachiko; Matsuura, Hirotaka; Haraguchi, Hiroki

2000-01-01

A multielement determination of major-to-ultratrace elements in vegetable samples was carried out by inductively coupled plasma mass spectrometry (ICP-MS) and inductively coupled plasma atomic emission spectrometry (ICP-AES). Spinach samples (0.5 g) were digested with nitric acid and hydrofluoric acid in a Teflon beaker on a hot plate. The decomposed samples were dissolved in a 1 M ( = mol dm -3 ) HNO 3 solution containing internal standard elements (Ge, In, and Re, 10 ppb each), and were subjected to multielement analyses by ICP-AES and ICP-MS. As a result, about 40 elements were successfully determined over a wide concentration range from % to ppb level. Spinach samples grown in different production areas were also analyzed in order to understand the influences of the environmental conditions on growth. Among the major and minor elements, the values of the coefficient of variance (CV) for B, Mg, P, and K were < 20%, and those for Ca, Na, Al, and Mn were higher than 50%. On the other hand, the values of CV for trace and ultratrace elements were significantly high. Furthermore, the present analytical method was also applied to the determination of major-to-ultratrace elements in various vegetable samples (23 species in 11 families); the similarities and differences of the elemental distributions in vegetables were found in the experimental results. (author)

Separation techniques for the clean-up of radioactive mixed waste for ICP-AES/ICP-MS analysis

International Nuclear Information System (INIS)

Swafford, A.M.; Keller, J.M.

1993-01-01

Two separation techniques were investigated for the clean-up of typical radioactive mixed waste samples requiring elemental analysis by Inductively Coupled Plasma-Atomic Emission Spectroscopy (ICP-AES) or Inductively Coupled Plasma-Mass Spectrometry (ICP-MS). These measurements frequently involve regulatory or compliance criteria which include the determination of elements on the EPA Target Analyte List (TAL). These samples usually consist of both an aqueous phase and a solid phase which is mostly an inorganic sludge. Frequently, samples taken from the waste tanks contain high levels of uranium and thorium which can cause spectral interferences in ICP-AES or ICP-MS analysis. The removal of these interferences is necessary to determine the presence of the EPA TAL elements in the sample. Two clean-up methods were studied on simulated aqueous waste samples containing the EPA TAL elements. The first method studied was a classical procedure based upon liquid-liquid extraction using tri-n- octylphosphine oxide (TOPO) dissolved in cyclohexane. The second method investigated was based on more recently developed techniques using extraction chromatography; specifically the use of a commercially available Eichrom TRU·Spec trademark column. Literature on these two methods indicates the efficient removal of uranium and thorium from properly prepared samples and provides considerable qualitative information on the extraction behavior of many other elements. However, there is a lack of quantitative data on the extraction behavior of elements on the EPA Target Analyte List. Experimental studies on these two methods consisted of determining whether any of the analytes were extracted by these methods and the recoveries obtained. Both methods produced similar results; the EPA target analytes were only slightly or not extracted. Advantages and disadvantages of each method were evaluated and found to be comparable

Identification and mechanism of ABA receptor antagonism

KAUST Repository

Melcher, Karsten; Xu, Yong; Ng, Ley-Moy; Zhou, X. Edward; Soon, Fen-Fen; Chinnusamy, Viswanathan; Suino-Powell, Kelly M.; Kovach, Amanda; Tham, Fook S.; Cutler, Sean R.; Li, Jun; Yong, Eu-Leong; Zhu, Jian-Kang; Xu, H. Eric

2010-01-01

The phytohormone abscisic acid (ABA) functions through a family of fourteen PYR/PYL receptors, which were identified by resistance to pyrabactin, a synthetic inhibitor of seed germination. ABA activates these receptors to inhibit type 2C protein phosphatases, such as ABI1, yet it remains unclear whether these receptors can be antagonized. Here we demonstrate that pyrabactin is an agonist of PYR1 and PYL1 but is unexpectedly an antagonist of PYL2. Crystal structures of the PYL2-pyrabactin and PYL1-pyrabactin-ABI1 complexes reveal the mechanism responsible for receptor-selective activation and inhibition, which enables us to design mutations that convert PYL1 to a pyrabactin-inhibited receptor and PYL2 to a pyrabactin-activated receptor and to identify new pyrabactin-based ABA receptor agonists. Together, our results establish a new concept of ABA receptor antagonism, illustrate its underlying mechanisms and provide a rational framework for discovering novel ABA receptor ligands. © 2010 Nature America, Inc. All rights reserved.

Identification and mechanism of ABA receptor antagonism

KAUST Repository

Melcher, Karsten

2010-08-22

The phytohormone abscisic acid (ABA) functions through a family of fourteen PYR/PYL receptors, which were identified by resistance to pyrabactin, a synthetic inhibitor of seed germination. ABA activates these receptors to inhibit type 2C protein phosphatases, such as ABI1, yet it remains unclear whether these receptors can be antagonized. Here we demonstrate that pyrabactin is an agonist of PYR1 and PYL1 but is unexpectedly an antagonist of PYL2. Crystal structures of the PYL2-pyrabactin and PYL1-pyrabactin-ABI1 complexes reveal the mechanism responsible for receptor-selective activation and inhibition, which enables us to design mutations that convert PYL1 to a pyrabactin-inhibited receptor and PYL2 to a pyrabactin-activated receptor and to identify new pyrabactin-based ABA receptor agonists. Together, our results establish a new concept of ABA receptor antagonism, illustrate its underlying mechanisms and provide a rational framework for discovering novel ABA receptor ligands. © 2010 Nature America, Inc. All rights reserved.

Identification and characterization of a silencer regulatory element in the 3'-flanking region of the murine CD46 gene.

Science.gov (United States)

Nomura, M; Tsujimura, A; Begum, N A; Matsumoto, M; Wabiko, H; Toyoshima, K; Seya, T

2000-01-01

The murine membrane cofactor protein (CD46) gene is expressed exclusively in testis, in contrast to human CD46, which is expressed ubiquitously. To elucidate the mechanism of differential CD46 gene expression among species, we cloned entire murine CD46 genomic DNA and possible regulatory regions were placed in the flanking region of the luciferase reporter gene. The reporter gene assay revealed a silencing activity not in the promoter, but in the 3'-flanking region of the gene and the silencer-like element was identified within a 0.2-kb region between 0.6 and 0.8 kb downstream of the stop codon. This silencer-like element was highly similar to that of the pig MHC class-I gene. The introduction of a mutation into this putative silencer element of murine CD46 resulted in an abrogation of the silencing effect. Electrophoretic mobility-shift assay indicated the presence of the binding molecule(s) for this silencer sequence in murine cell lines and tissues. A size difference of the protein-silencer-element complex was observed depending upon the solubilizers used for preparation of the nuclear extracts. A mutated silencer sequence failed to interact with the binding molecules. The level of the binding factor was lower in the testicular germ cells compared with other organs. Thus the silencer element and its binding factor may play a role in transcriptional regulation of murine CD46 gene expression. These results imply that the effects of the CD46 silencer element encompass the innate immune and reproductive systems, and in mice may determine the testicular germ-cell-dominant expression of CD46. PMID:11023821

Antagonism of a (+)N-allylnormetazocine stimulus by (-)PPAP and several structurally related analogs.

Science.gov (United States)

Glennon, R A; Young, R; Herndon, J L

1993-08-01

Employing rats trained to discriminate 5 mg/kg of the benzomorphan opioid (+)N-allylnormetazocine [(+)NANM] from vehicle, tests of stimulus generalization and antagonism were conducted to determine the influence of several potential sigma-receptor ligands. It has been previously suggested that the (+)NANM stimulus may involve concurrent action at sigma- and phencyclidine (PCP) receptors. Although the low-affinity sigma-antagonist rimcazole was without stimulus-attenuating effect, three novel sigma-ligands--(-)PPAP, CNS 3018, and CNS 3093 (ID50 doses = 3.2, 6.7, and 4.5 mg/kg, respectively)--antagonized the (+)NANM stimulus in a dose-related fashion. The nonselective serotonergic agent 1-(3-trifluoromethyl)phenylpiperazine (TFMPP) produced partial generalization in (+)NANM-trained animals whereas buspirone, a 5-hydroxytryptamine1A (5-HT1A) agonist, attenuated (to 27% drug-appropriate responding) the (+)NANM stimulus. Because the prototypic 5-HT1A agonist 8-hydroxy-2-(di-n-propylamino)tetralin (8-OH-DPAT) failed to attenuate the (+)NANM stimulus at pharmacologically relevant doses, it seems unlikely that the (+)NANM stimulus involves a 5-HT1A mechanism. TFMPP and buspirone display modest affinity for sigma-receptors and this may account for the present findings with these agents. The present results neither establish a role for sigma involvement in the stimulus properties of (+)NANM nor eliminate a role for PCP receptors. They do, however, demonstrate that sigma-ligands with little to no affinity for PCP receptors are capable of antagonizing the (+)NANM stimulus.

Mutuality, Self-Silencing, and Disordered Eating in College Women

Science.gov (United States)

Wechsler, Lisa S.; Riggs, Shelley A.; Stabb, Sally D.; Marshall, David M.

2006-01-01

The current study examined patterns of association among mutuality, self-silencing, and disordered eating in an ethnically diverse sample of college women (N = 149). Partner mutuality and overall self-silencing were negatively correlated and together were associated with six disordered eating indices. All four self-silencing subscales were…

RNAi dynamics in Juvenile Fasciola spp. Liver flukes reveals the persistence of gene silencing in vitro.

Directory of Open Access Journals (Sweden)

Paul McVeigh

2014-09-01

Full Text Available Fasciola spp. liver fluke cause pernicious disease in humans and animals. Whilst current control is unsustainable due to anthelmintic resistance, gene silencing (RNA interference, RNAi has the potential to contribute to functional validation of new therapeutic targets. The susceptibility of juvenile Fasciola hepatica to double stranded (dsRNA-induced RNAi has been reported. To exploit this we probe RNAi dynamics, penetrance and persistence with the aim of building a robust platform for reverse genetics in liver fluke. We describe development of standardised RNAi protocols for a commercially-available liver fluke strain (the US Pacific North West Wild Strain, validated via robust transcriptional silencing of seven virulence genes, with in-depth experimental optimisation of three: cathepsin L (FheCatL and B (FheCatB cysteine proteases, and a σ-class glutathione transferase (FheσGST.Robust transcriptional silencing of targets in both F. hepatica and Fasciola gigantica juveniles is achievable following exposure to long (200-320 nt dsRNAs or 27 nt short interfering (siRNAs. Although juveniles are highly RNAi-susceptible, they display slower transcript and protein knockdown dynamics than those reported previously. Knockdown was detectable following as little as 4h exposure to trigger (target-dependent and in all cases silencing persisted for ≥25 days following long dsRNA exposure. Combinatorial silencing of three targets by mixing multiple long dsRNAs was similarly efficient. Despite profound transcriptional suppression, we found a significant time-lag before the occurrence of protein suppression; FheσGST and FheCatL protein suppression were only detectable after 9 and 21 days, respectively.In spite of marked variation in knockdown dynamics, we find that a transient exposure to long dsRNA or siRNA triggers robust RNAi penetrance and persistence in liver fluke NEJs supporting the development of multiple-throughput phenotypic screens for control

The Application of Coconut Fiber as Dissipative Silencer

Science.gov (United States)

Madlan, M. A.; Ghazali, M. I.; Zaman, I.; Kasron, M. Z.; Ying, T. C.

2017-01-01

Heat ventilation air conditioning system (HVAC) is one of the ducting systems that broadly applied in the building. There are HVAC silencers in the market, however the sound absorptive material commonly used is mineral wool. In this research study, a sound absorptive material made of coconut fiber was tested to identify its performance as a potential replacement of green material for ducting silencer. The experiment was carried out in a testing apparatus that follows the BS EN ISO 11691:2009 standard. Different configurations of sound absorptive material and contents of coconut fiber were investigated in the study. The trend of insertion loss at 1/3 octave frequency was identified where at frequency below 3000Hz, the insertion loss of dissipative silencer is observed high at certain frequency with a very narrow range. At 3000Hz, the insertion loss of 4dB to 6dB is constant until 4000Hz and drops until 5000Hz before it increases again steadily up to 13dB at 10000Hz. A similar trend was observed for different configuration of sound absorptive material. Despite the configuration different, the outcome shows that the insertion loss is increasing with higher content of coconut fiber.

PIXE and ICP-AES comparison in evaluating the efficiency of metal extraction and analysis in aerosol samples

Energy Technology Data Exchange (ETDEWEB)

Rugi, F.; Becagli, S.; Ghedini, C.; Marconi, M.; Severi, M.; Traversi, R.; Udisti, R. [Dep. of Chemistry, University of Florence, Sesto F.no (Fl) (Italy); Calzolai, G.; Chiari, M.; Lucarelli, F.; Nava, S. [Dep. of Physics and Astronomy , University of Florence and INFN, Sesto F. no (Fl) (Italy)

2013-07-01

ICP-AES versus PIXE determination: Al=75, As=102, Cu=92, Fe=104, Mn=92, Ni=103, Pb=86. Finally, we will show some examples in which ICP methods are used to determine the 'soluble fraction' (in the acidic extraction conditions) of several major (ICP-AES) and trace (ICP-Ms) metals. By comparing data obtained by PIXE and by ICP-AES or ICP-Ms, we could assess the 'soluble fraction' (in different conditions, depending on the strength of the acidic solubilization) of several elements. In this way, PIXE and ICP techniques appear to constitute a powerful complementary method, able to obtain a more complete data set of the aerosol chemical composition. (author)

After the Blackbird Whistles: Listening to Silence in Classrooms

Science.gov (United States)

Schultz, Katherine

2010-01-01

Background/Context: Students spend a large part of their time in schools in silence. However, teachers tend to spend most of their time attending to student talk. Anthropological and linguistic research has contributed to an understanding of silence in particular communities, offering explanations for students' silence in school. This research…

Memories Persist in Silence

Directory of Open Access Journals (Sweden)

Sandra Patricia Arenas Grisales

2012-08-01

Full Text Available This article exposes the hypothesis that memory artifacts, created to commemorate the victims of armed conflict in Colombia, are an expression of the underground memories and a way of political action in the midst of war. We analyze three cases of creations of memory artifacts in Medellín, Colombia, as forms of suffering, perceiving and resisting the power of armed groups in Medellín. The silence, inherent in these objects, should not be treated as an absence of language, but as another form of expression of memory. Silence is a tactic used to overcome losses and reset everyday life in contexts of protracted violence.

The DNA-mimic antirestriction proteins ArdA ColIB-P9, Arn T4, and Ocr T7 as activators of H-NS-dependent gene transcription.

Science.gov (United States)

Melkina, Olga E; Goryanin, Ignatiy I; Zavilgelsky, Gennadii B

2016-11-01

The antirestriction proteins ArdA ColIb-P9, Arn T4 and Ocr T7 specifically inhibit type I and type IV restriction enzymes and belong to the family of DNA-mimic proteins because their three-dimensional structure is similar to the double-helical B-form DNA. It is proposed that the DNA-mimic proteins are able to bind nucleoid protein H-NS and alleviate H-NS-silencing of the transcription of bacterial genes. Escherichia coli lux biosensors were constructed by inserting H-NS-dependent promoters into a vector, thereby placing each fragment upstream of the promoterless Photorhabdus luminescens luxCDABE operon. It was demonstrated that the DNA-mimic proteins ArdA, Arn and Ocr activate the transcription of H-NS-dependent promoters of the lux operon of marine luminescent bacteria (mesophilic Aliivibrio fischeri and psychrophilic Aliivibrio logei), and the dps gene from E. coli. It was also demonstrated that the ArdA antirestriction protein, the genes of which are located on transmissive plasmids ColIb-P9, R64, PK101, decreases levels of H-NS silencing of the PluxC promoter during conjugation in the recipient bacteria. Copyright © 2016 Elsevier GmbH. All rights reserved.

Measurement of inclusion size by laser ablation ICP mass spectrometry

International Nuclear Information System (INIS)

Karasev, Andrey V.; Suito, Hideaki

2004-01-01

By using laser ablation inductively coupled plasma mass spectrometry (LA-ICP-MS), the measurement of particle size has been made for one component oxide (Al 2 O 3 and MgO) and multicomponent oxide (12CaO·7Al 2 O 3 and CaO-Al 2 O 3 -MgO) located on surface of iron or glass sample. The method of particle size estimation by LA-ICP-MS has been developed coupled with a new method of making samples with particles. The size calibration lines for Al 2 O 3 , MgO and CaO particles have been obtained. The results of particle size measurement by LA-ICP-MS are compared with those by SEM and single-particle optical sensing (SPOS) methods. It was confirmed that LA-ICP-MS has the perspective to be used for the quick measurement of inclusion composition and size in metal and other materials. The size frequency distributions of Al 2 O 3 particles measured by LA-ICP-MS in iron samples with particles agree reasonably well with those by SEM and SPOS in the range of particle diameter from 2 to 20 μm. The size of Al 2 O 3 , MgO and complex oxide (12CaO·7Al 2 O 3 and CaO-Al 2 O 3 -MgO) particles measured by LA-ICP-MS is in good agreement with that by SEM in the range of particle diameter from 10 to 40 μm. (author)

Analysis of Tospovirus NSs Proteins in Suppression of Systemic Silencing.

Science.gov (United States)

Hedil, Marcio; Sterken, Mark G; de Ronde, Dryas; Lohuis, Dick; Kormelink, Richard

2015-01-01

RNA silencing is a sequence-specific gene regulation mechanism that in plants also acts antiviral. In order to counteract antiviral RNA silencing, viruses have evolved RNA silencing suppressors (RSS). In the case of tospoviruses, the non-structural NSs protein has been identified as the RSS. Although the tomato spotted wilt virus (TSWV) tospovirus NSs protein has been shown to exhibit affinity to long and small dsRNA molecules, its ability to suppress the non-cell autonomous part of RNA silencing has only been studied to a limited extent. Here, the NSs proteins of TSWV, groundnut ringspot virus (GRSV) and tomato yellow ring virus (TYRV), representatives for three distinct tospovirus species, have been studied on their ability and strength to suppress local and systemic silencing. A system has been developed to quantify suppression of GFP silencing in Nicotiana benthamiana 16C lines, to allow a comparison of relative RNA silencing suppressor strength. It is shown that NSs of all three tospoviruses are suppressors of local and systemic silencing. Unexpectedly, suppression of systemic RNA silencing by NSsTYRV was just as strong as those by NSsTSWV and NSsGRSV, even though NSsTYRV was expressed in lower amounts. Using the system established, a set of selected NSsTSWV gene constructs mutated in predicted RNA binding domains, as well as NSs from TSWV isolates 160 and 171 (resistance breakers of the Tsw resistance gene), were analyzed for their ability to suppress systemic GFP silencing. The results indicate another mode of RNA silencing suppression by NSs that acts further downstream the biogenesis of siRNAs and their sequestration. The findings are discussed in light of the affinity of NSs for small and long dsRNA, and recent mutant screen of NSsTSWV to map domains required for RSS activity and triggering of Tsw-governed resistance.

Organizational Silence in Universities as the Predictor of Organizational Culture

Directory of Open Access Journals (Sweden)

Erkan YAMAN

2014-04-01

Full Text Available The aim of this study is to determine the relationship between the sense of organizational silence and the organizational culture the instructors perceived. In this study, the scale for determining organizational culture developed by İpek (1999 and the scale for measuring organizational silence developed by Çakıcı (2007 and adapted by Soycan (2010 are used. No remarkable difference was found in the academic staff's sense of organizational silence degree according to their genders and educational backgrounds. It was seen that the instructors' sense of organizational silence had remarkable differences according to their age group, faculty, sense of administration type in their institutions, frequency of their face-to-face communication with their administrators and their thoughts of speaking clearly with their administrators. It was observed that research assistants had a significantly higher sense of organizational silence than the lecturers in the sense of ‘Lack of Experience'. It was seen that academicians who had 1-5 years of employment period had the highest sense of organizational silence while those who had 21 years or more employment period had the lowest sense of organizational silence in the sense of ‘Lack of Experience' of organizational silence. When the points that participant academicians got from organizational silence and organizational culture scales analyzed in the correlation table, it was found out that there was a remarkable relationship between the academicians' sense of organizational silence and sense of organizational culture. This relationship was a medium-level negative relationship between subdimensions of two scales. A medium-level negative relationship between the organizational silence (total and the organizational culture was also seen. Based on the findings, university administrators were proposed to create a participant culture in their institutions as well as to encourage instructors to speak clearly and

A matrix effect and accuracy evaluation for the determination of elements in milk powder LIBS and laser ablation/ICP-OES spectrometry.

Science.gov (United States)

Gilon, N; El-Haddad, J; Stankova, A; Lei, W; Ma, Q; Motto-Ros, V; Yu, J

2011-11-01

Laser ablation coupled to inductively coupled plasma optical emission spectrometry (LA-ICP-OES) and laser-induced breakdown spectroscopy (LIBS) were investigated for the determination of Ca, Mg, Zn and Na in milk samples. The accuracy of both methods was evaluated by comparison of the concentration found using LA-ICP-OES and LIBS with classical wet digestion associated with ICP-OES determination. The results were not fully acceptable, with biases from less than 1% to more than 60%. Matrix effects were also investigated. The sample matrix can influence the temperature, electron number density (n (e)) and other excitation characteristics in the ICP. These ICP characteristics were studied and evaluated during ablation of eight milk samples. Differences in n (e) (from 8.9 to 13.8 × 10(14) cm(-3)) and rotational temperature (ranging from 3,400 to 4,400 K) occurred with no correlation with trueness. LIBS results obtained after classical external calibration procedure gave degraded accuracy, indicating a strong matrix effect. The LIBS measurements clearly showed that the major problem in LA-ICP was related to the ablation process and that LIBS spectroscopy is an excellent diagnostic tool for LA-ICP techniques.

SGS3 Cooperates with RDR6 in Triggering Geminivirus-Induced Gene Silencing and in Suppressing Geminivirus Infection in Nicotiana Benthamiana

Directory of Open Access Journals (Sweden)

Fangfang Li

2017-09-01

Full Text Available RNA silencing has an important role in defending against virus infection in plants. Plants with the deficiency of RNA silencing components often show enhanced susceptibility to viral infections. RNA-dependent RNA polymerase (RDRs mediated-antiviral defense has a pivotal role in resistance to many plant viruses. In RDR6-mediated defense against viral infection, a plant-specific RNA binding protein, Suppressor of Gene Silencing 3 (SGS3, was also found to fight against some viruses in Arabidopsis. In this study, we showed that SGS3 from Nicotiana benthamiana (NbSGS3 is required for sense-RNA induced post-transcriptional gene silencing (S-PTGS and initiating sense-RNA-triggered systemic silencing. Further, the deficiency of NbSGS3 inhibited geminivirus-induced endogenous gene silencing (GIEGS and promoted geminivirus infection. During TRV-mediated NbSGS3 or N. benthamiana RDR6 (NbRDR6 silencing process, we found that their expression can be effectively fine-tuned. Plants with the knock-down of both NbSGS3 and NbRDR6 almost totally blocked GIEGS, and were more susceptible to geminivirus infection. These data suggest that NbSGS3 cooperates with NbRDR6 against GIEGS and geminivirus infection in N. benthamiana, which provides valuable information for breeding geminivirus-resistant plants.

Tospovirus : induction and suppression of RNA silencing

NARCIS (Netherlands)

Hedil, Marcio

2016-01-01

While infecting their hosts, viruses must deal with host immunity. In plants the antiviral RNA silencing pathway is an important part of plant innate immunity. Tospoviruses are segmented negative-stranded RNA viruses of plants. To counteract the antiviral RNA silencing response in plants,

Angiopoietin-like 4 mediates PPAR delta effect on lipoprotein lipase-dependent fatty acid uptake but not on beta-oxidation in myotubes.

Directory of Open Access Journals (Sweden)

Marius R Robciuc

Full Text Available Peroxisome proliferator-activated receptor (PPAR delta is an important regulator of fatty acid (FA metabolism. Angiopoietin-like 4 (Angptl4, a multifunctional protein, is one of the major targets of PPAR delta in skeletal muscle cells. Here we investigated the regulation of Angptl4 and its role in mediating PPAR delta functions using human, rat and mouse myotubes. Expression of Angptl4 was upregulated during myotubes differentiation and by oleic acid, insulin and PPAR delta agonist GW501516. Treatment with GW501516 or Angptl4 overexpression inhibited both lipoprotein lipase (LPL activity and LPL-dependent uptake of FAs whereas uptake of BSA-bound FAs was not affected by either treatment. Activation of retinoic X receptor (RXR, PPAR delta functional partner, using bexarotene upregulated Angptl4 expression and inhibited LPL activity in a PPAR delta dependent fashion. Silencing of Angptl4 blocked the effect of GW501516 and bexarotene on LPL activity. Treatment with GW501516 but not Angptl4 overexpression significantly increased palmitate oxidation. Furthermore, Angptl4 overexpression did not affect the capacity of GW501516 to increase palmitate oxidation. Basal and insulin stimulated glucose uptake, glycogen synthesis and glucose oxidation were not significantly modulated by Angptl4 overexpression. Our findings suggest that FAs-PPARdelta/RXR-Angptl4 axis controls the LPL-dependent uptake of FAs in myotubes, whereas the effect of PPAR delta activation on beta-oxidation is independent of Angptl4.

Yeast Tdh3 (glyceraldehyde 3-phosphate dehydrogenase is a Sir2-interacting factor that regulates transcriptional silencing and rDNA recombination.

Directory of Open Access Journals (Sweden)

Alison E Ringel

Full Text Available Sir2 is an NAD(+-dependent histone deacetylase required to mediate transcriptional silencing and suppress rDNA recombination in budding yeast. We previously identified Tdh3, a glyceraldehyde 3-phosphate dehydrogenase (GAPDH, as a high expression suppressor of the lethality caused by Sir2 overexpression in yeast cells. Here we show that Tdh3 interacts with Sir2, localizes to silent chromatin in a Sir2-dependent manner, and promotes normal silencing at the telomere and rDNA. Characterization of specific TDH3 alleles suggests that Tdh3's influence on silencing requires nuclear localization but does not correlate with its catalytic activity. Interestingly, a genetic assay suggests that Tdh3, an NAD(+-binding protein, influences nuclear NAD(+ levels; we speculate that Tdh3 links nuclear Sir2 with NAD(+ from the cytoplasm.

Multielement analytical procedure coupling INAA, ICP-MS and ICP-AES: Application to the determination of major and trace elements in sediment samples of the Bouregreg river (Morocco)

International Nuclear Information System (INIS)

Bounouira, H.; CEA - CNRS/UMR, Centre de Saclay, 91 - Gif sur Yvette; Choukri, A.; Hakam, O.K.; Cherkaoui, R.; Gaudry, A.; Delmas, R.; Mariet, C.; Chakiri, S.

2008-01-01

Instrumental neutron activation analysis (INAA), inductively coupled plasma-mass spectrometry (ICP-MS) and inductively coupled plasma-atomic emission spectrometry (ICP-AES) were used for the determination of major and trace elements in sediment samples of the Bouregreg river (Morocco). The reliability of the results was checked, by using IAEA Soil-7 certified reference material. Results obtained by the three techniques were compared to control digestions efficiencies. A general good agreement was found between INAA and both ICP-MS and ICP-AES after alkaline fusion (ICPf). The ICP-MS technique used after acid attack (ICPa) was satisfactory for a few elements. A principal component analysis (PCA) has been used for analyzing the variability of concentrations, and defining the most influential sites with respect to the general variation trends. Three groups of elements could be distinguished. For these groups a normalization of concentrations to the central element concentration (that means Mn, Si or Al) is proposed. (author)

Comparison between INAA and ICP-OES: analysis of Sudanese medicinal plants

International Nuclear Information System (INIS)

Sheikhaldin, Elsadig Abdelmoniem

2014-07-01

The aim of this study was to provide elemental concentrations in medicinal plants and mainly to compare the two different determination methods (INAA and ICP-OES after wet digestion) elemental analysis of 14 Sudanese medicinal plants was carried out using INAA and ICP-OES techniques. The selection of reported elements was done according to intersection of elements determined by both techniques. This intersecting element list contained Ca, K, Fe, Mn, Mg, Sr, Zn, Cu, Co, and Cr. INAA correlated well with ICP-OES measurements of the same plants as long as concentrations were sufficiently above LoQ. Correlation coefficients (R 2 ) in this case is close to 1. Generally, INAA results tended to be higher compared to ICP-OES. The performance and possible source of errors of both techniques was discussed also with respect to measurements of certified reference materials. INAA provided the advantage of having both, faster and non destructive sample preparation than ICP-OES. Therefore, INAA may be technique of choice for Ca, K, Zn, and Mg elements specifically when samples are needed for further investigations. Regarding the low concentrations e.g for Cr, Ni or Cu, ICP-OES is the superior technique over INAA due to the sufficiently low limits of determination and thus gaining more detectable results at low concentrations. (author)

Salpeterzuurdestructie en ICP-MS analyse van biotisch materiaal en voeding

NARCIS (Netherlands)

Velde-Koerts T van der; LAC

2000-01-01

Voor de bepaling van elementen in voeding en biotisch materiaal werd een analytische methode ontwikkeld, bestaande uit een salpeterzuurdestructie en een ICP-MS-analyse. De destructie werd geoptimaliseerd op basis van de salpeterzuurconcentratie en de destructietijd. De ICP-MS-analyse werd

Antagonism of botulinum toxin-induced muscle weakness by aminopyridines in rat phrenic nerve-hemidiaphragm preparations

Energy Technology Data Exchange (ETDEWEB)

Adler, M.; Scovill, J.; Deshpande, S.S.

1993-05-13

The effects of the potassium channel inhibitor and putative botulinum toxin antagonists 4-aminopyridine (4-AP) and 3,4-diaminopyridine (3,4-DAP) were investigated in vitro on the contractile and electrophysiological properties of rat diaphragm muscle. In the presence of 300 pM botulinum toxin A (BoTx A), twitches elicited by supramaximal nerve stimulation (0. 1 Hz) were reduced by over 80% in 3 hr. The time to block decreased with increases in temperature, toxin concentration and stimulation frequency. Addition of 4-AP or 3,4-DAP led to a prompt reversal of the BoTx A-induced depression of twitch tension. This reversal was concentration-dependent such that, in the presence of 1 mM 4-AP, reversal of the BoTx A-induced blockade was complete in 6.7 min. The beneficial effect of the APs were well maintained and persisted for up to 6 hr after addition. Application of 1 microns M neostigmine 1 hr after 3,4-DAP produced a further potentiation of twitch tensions, but this action lasted for < 5 min and led to the appearance of tetanic fade during repetitive stimulation. It is concluded that the APs are of benefit in antagonizing the muscle paralysis following exposure to botulinum toxin. Co-application of neostigmine, however, appears to confer no additional benefit.

Gender Differences in Self-Silencing and Psychological Distress in Informal Cancer Carers

Science.gov (United States)

Ussher, Jane M.; Perz, Janette

2010-01-01

This study examined gender differences in self-silencing, the relationship between self-silencing and psychological distress, and reasons for self-silencing in informal cancer carers (329 women, 155 men), using a mixed-method design. Men reported greater self-silencing than women on the Silencing the Self Scale; however, women reported higher…

Analogues of neuroactive polyamine wasp toxins that lack inner basic sites exhibit enhanced antagonism toward a muscle-type mammalian nicotinic acetylcholine receptor

DEFF Research Database (Denmark)

Stromgaard, K; Brierley, M J; Andersen, K

1999-01-01

noncompetitively antagonized the nicotinic acetylcholine receptor (nAChR) in a concentration-, time-, and voltage-dependent manner. The amplitudes of acetylcholine-induced currents were compared at their peaks and at the end of a 1 s application in the presence or absence of the analogues. Most of the analogues...

FXR silencing in human colon cancer by DNA methylation and KRAS signaling.

Science.gov (United States)

Bailey, Ann M; Zhan, Le; Maru, Dipen; Shureiqi, Imad; Pickering, Curtis R; Kiriakova, Galina; Izzo, Julie; He, Nan; Wei, Caimiao; Baladandayuthapani, Veerabhadran; Liang, Han; Kopetz, Scott; Powis, Garth; Guo, Grace L

2014-01-01

Farnesoid X receptor (FXR) is a bile acid nuclear receptor described through mouse knockout studies as a tumor suppressor for the development of colon adenocarcinomas. This study investigates the regulation of FXR in the development of human colon cancer. We used immunohistochemistry of FXR in normal tissue (n = 238), polyps (n = 32), and adenocarcinomas, staged I-IV (n = 43, 39, 68, and 9), of the colon; RT-quantitative PCR, reverse-phase protein array, and Western blot analysis in 15 colon cancer cell lines; NR1H4 promoter methylation and mRNA expression in colon cancer samples from The Cancer Genome Atlas; DNA methyltransferase inhibition; methyl-DNA immunoprecipitation (MeDIP); bisulfite sequencing; and V-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog (KRAS) knockdown assessment to investigate FXR regulation in colon cancer development. Immunohistochemistry and quantitative RT-PCR revealed that expression and function of FXR was reduced in precancerous lesions and silenced in a majority of stage I-IV tumors. FXR expression negatively correlated with phosphatidylinositol-4, 5-bisphosphate 3 kinase signaling and the epithelial-to-mesenchymal transition. The NR1H4 promoter is methylated in ~12% colon cancer The Cancer Genome Atlas samples, and methylation patterns segregate with tumor subtypes. Inhibition of DNA methylation and KRAS silencing both increased FXR expression. FXR expression is decreased early in human colon cancer progression, and both DNA methylation and KRAS signaling may be contributing factors to FXR silencing. FXR potentially suppresses epithelial-to-mesenchymal transition and other oncogenic signaling cascades, and restoration of FXR activity, by blocking silencing mechanisms or increasing residual FXR activity, represents promising therapeutic options for the treatment of colon cancer.

Conifers have a unique small RNA silencing signature

OpenAIRE

Dolgosheina, Elena V.; Morin, Ryan D.; Aksay, Gozde; Sahinalp, S. Cenk; Magrini, Vincent; Mardis, Elaine R.; Mattsson, Jim; Unrau, Peter J.

2008-01-01

Plants produce small RNAs to negatively regulate genes, viral nucleic acids, and repetitive elements at either the transcriptional or post-transcriptional level in a process that is referred to as RNA silencing. While RNA silencing has been extensively studied across the different phyla of the animal kingdom (e.g., mouse, fly, worm), similar studies in the plant kingdom have focused primarily on angiosperms, thus limiting evolutionary studies of RNA silencing in plants. Here we report on an u...

Environmental application of XRF, ICP-AES and INAA on biological matrix

International Nuclear Information System (INIS)

Zararsiz, A.; Dogangun, A.; Tuncel, S.

2004-01-01

Full text: It is very important to determine trace quantities of metals in different matrices with high accuracy since the metals are used as markers for different sources in air pollution studies. In this study, the analytical capabilities of XRF, ICP-AES and INM techniques on a biological matrix namely lichens, which are widely used as bio monitoring organisms for the pollutants mapping in the atmosphere, were tested. Lichen samples were collected in Aegean Region of Turkey where pollution is an important issue. 9 elements were determined by XRF, 14 elements by ICP-AES and 13 elements by INM. Quality assurance was achieved using lichen SRM (IAEA-336) and Orchard leaves SRM (NIST- 1571). Produced data are subjected to statistical tests, like t-test, Q-test in order to determine the accuracy and precision of each technique. A recommendation list of the proper analytical technique is obtained for determination of each specific element considering analytical capabilities of ICP-AES, XRF and INM. As a result we can recommend that the first choice for Cd, Cu, Mg is ICP-AES, for In, K, Rb is INAA, for Br is XRF, if the concentrations are not close to the detection limit of XRF. For V, Cr, AI, Na, Fe ICP-AES and INM are both well, for Pb ICP-AES and XRF are both well, if the concentrations are not close to the detection limit of XRF, for Mn and Ca INM, XRF and ICP-AES are all give similar results for this type of biological matrix

Structural Dynamics of the GW182 Silencing Domain Including its RNA Recognition motif (RRM) Revealed by Hydrogen-Deuterium Exchange Mass Spectrometry

Science.gov (United States)

Cieplak-Rotowska, Maja K.; Tarnowski, Krzysztof; Rubin, Marcin; Fabian, Marc R.; Sonenberg, Nahum; Dadlez, Michal; Niedzwiecka, Anna

2018-01-01

The human GW182 protein plays an essential role in micro(mi)RNA-dependent gene silencing. miRNA silencing is mediated, in part, by a GW182 C-terminal region called the silencing domain, which interacts with the poly(A) binding protein and the CCR4-NOT deadenylase complex to repress protein synthesis. Structural studies of this GW182 fragment are challenging due to its predicted intrinsically disordered character, except for its RRM domain. However, detailed insights into the properties of proteins containing disordered regions can be provided by hydrogen-deuterium exchange mass spectrometry (HDX/MS). In this work, we applied HDX/MS to define the structural state of the GW182 silencing domain. HDX/MS analysis revealed that this domain is clearly divided into a natively unstructured part, including the CCR4-NOT interacting motif 1, and a distinct RRM domain. The GW182 RRM has a very dynamic structure, since water molecules can penetrate the whole domain in 2 h. The finding of this high structural dynamics sheds new light on the RRM structure. Though this domain is one of the most frequently occurring canonical protein domains in eukaryotes, these results are - to our knowledge - the first HDX/MS characteristics of an RRM. The HDX/MS studies show also that the α2 helix of the RRM can display EX1 behavior after a freezing-thawing cycle. This means that the RRM structure is sensitive to environmental conditions and can change its conformation, which suggests that the state of the RRM containing proteins should be checked by HDX/MS in regard of the conformational uniformity. [Figure not available: see fulltext.

Platformed antagonism: Racist discourses on fake Muslim Facebook pages

DEFF Research Database (Denmark)

Farkas, Johan; Schou, Jannick; Neumayer, Christina

2018-01-01

This research examines how fake identities on social media create and sustain antagonistic and racist discourses. It does so by analysing 11 Danish Facebook pages, disguised as Muslim extremists living in Denmark, conspiring to kill and rape Danish citizens. It explores how anonymous content...... producers utilize Facebook's socio-technical characteristics to construct, what we propose to term as, platformed antagonism. This term refers to socio-technical and discursive practices that produce new modes of antagonistic relations on social media platforms. Through a discourse-theoretical analysis...... of posts, images, 'about' sections and user comments on the studied Facebook pages, the article highlights how antagonism between ethno-cultural identities is produced on social media through fictitious social media accounts, prompting thousands of user reactions. These findings enhance our current...

The physics of chromatin silencing: Bi-stability and front propagation

Science.gov (United States)

Sedighi, Mohammad

A mean-field dynamical model of chromatin silencing in budding yeast is provided and the conditions giving rise to two states: one silenced and another un-silenced, is studied. Based on these conditions, the space of control parameters is divided into two distinct regions of mono-stable and bi-stable solutions (the bifurcation diagram). Then, considering both the discrete and continuous versions of the model, the formation of a stable boundary between the silenced and un-silenced areas on DNA is investigated. As a result, a richer phase diagram is provided. The dynamics of the boundary is also studied under different conditions. Consequently, assuming negative feedback due to possible depletion of silencing proteins, the model explains a paradoxical epigenetic behavior of yeast that happens under some mutation. A stochastic treatment of the model is also considered to verify the results of the mean-field approximation and also to understand the role of intrinsic noise at single cell level. This model could be used as a general guide to discuss chromatin silencing in many organisms.

The effects of sedative music, arousal music, and silence on electrocardiography signals.

Science.gov (United States)

Dousty, Mehdy; Daneshvar, Sabalan; Haghjoo, Majid

2011-01-01

Research indicates that music can affect heart rate, blood pressure, and skin conductance. Music can stimulate central emotions in the brain and release biochemical materials that change the physiologic state. We sought to compare changes in the electrical function of the heart in response to music. Subjects were asked to listen to 2 types of music, namely, sedative and arousal music, in conjunction with two 30-second periods of complete silence. The experiment was conducted in 4 segments: the first and third parts were silence, and the second and fourth parts were music. First, the response to each type of music was compared with that to the preceding period of silence. Next, the responses to both types of music were compared. Finally, the response to music regardless of the type was compared with that to silence. The amplitude of polarization and depolarization changed in response to different kinds of music. The electrical function of the heart in response to music, irrespective of the music type, differed from that in response to silence. The 2 types of music impacted the electrical function of the heart in different ways: the arousal music influenced T-wave maximum amplitude, whereas no such change was recorded in response to the sedative music. The bandwidth of the polarization and depolarization of the heart rate and R-wave amplitude increased in response to music by comparison with silence. In addition, the heart did not seem to try to synchronize with music. The mean R-wave amplitude in sedative music is higher than the arousal music, so our heart works differently when different types of music are heard. Copyright © 2011 Elsevier Inc. All rights reserved.

A Soluble Fluorescent Binding Assay Reveals PIP2 Antagonism of TREK-1 Channels

Directory of Open Access Journals (Sweden)

Cerrone Cabanos

2017-08-01

Full Text Available Lipid regulation of ion channels by low-abundance signaling lipids phosphatidylinositol 4,5-bisphosphate (PIP2 and phosphatidic acid (PA has emerged as a central cellular mechanism for controlling ion channels and the excitability of nerves. A lack of robust assays suitable for facile detection of a lipid bound to a channel has hampered the probing of the lipid binding sites and measuring the pharmacology of putative lipid agonists for ion channels. Here, we show a fluorescent PIP2 competition assay for detergent-purified potassium channels, including TWIK-1-related K+-channel (TREK-1. Anionic lipids PA and phosphatidylglycerol (PG bind dose dependently (9.1 and 96 μM, respectively and agonize the channel. Our assay shows PIP2 binds with high affinity (0.87 μM but surprisingly can directly antagonize TREK-1 in liposomes. We propose a model for TREK-1 lipid regulation where PIP2 can compete with PA and PG agonism based on the affinity of the lipid for a site within the channel.

Control of thermoacoustic instability with a drum-like silencer

Science.gov (United States)

Zhang, Guangyu; Wang, Xiaoyu; Li, Lei; Jing, Xiaodong; Sun, Xiaofeng

2017-10-01

Theoretical investigation is carried out by a novel method of controlling thermoacoustic instability with a drum-like silencer. It is shown that by decreasing the frequency of thermoacoustic system, the instability can be suppressed with the help of drum-like silencer. The purely reactive silencer, which is composed of a flexible membrane and a backing cavity, is usually known as a noise control device that works effectively in low frequency bandwidth without any aerodynamic loss. In present research, the silencer is exploited in a Rijke tube, as a means of decreasing the natural frequency of the system, and consequently changing the resonance period of the system. The "transfer element method" (TEM) is used to consider the interactions between the acoustic waves and the flexible membranes of the silencer. The effects of all possible properties of the silencer on the growth rate and resonance frequency of the thermoacoustic system are explored. According to the calculation results, it is found that for some properties of the silencer, the resonance frequencies are greatly decreased and then the phase difference between the unsteady heat release and the pressure fluctuation is increased. Consequently, the instability is suppressed with some dissipation that can not be able to control its onset in the original system. Therefore, when the damping is low, but not zero, it is effective to control thermoacoustic instability with this technique.

Reconceptualizing synergism and antagonism among multiple stressors.

Science.gov (United States)

Piggott, Jeremy J; Townsend, Colin R; Matthaei, Christoph D

2015-04-01

The potential for complex synergistic or antagonistic interactions between multiple stressors presents one of the largest uncertainties when predicting ecological change but, despite common use of the terms in the scientific literature, a consensus on their operational definition is still lacking. The identification of synergism or antagonism is generally straightforward when stressors operate in the same direction, but if individual stressor effects oppose each other, the definition of synergism is paradoxical because what is synergistic to one stressor's effect direction is antagonistic to the others. In their highly cited meta-analysis, Crain et al. (Ecology Letters, 11, 2008: 1304) assumed in situations with opposing individual effects that synergy only occurs when the cumulative effect is more negative than the additive sum of the opposing individual effects. We argue against this and propose a new systematic classification based on an additive effects model that combines the magnitude and response direction of the cumulative effect and the interaction effect. A new class of "mitigating synergism" is identified, where cumulative effects are reversed and enhanced. We applied our directional classification to the dataset compiled by Crain et al. (Ecology Letters, 11, 2008: 1304) to determine the prevalence of synergistic, antagonistic, and additive interactions. Compared to their original analysis, we report differences in the representation of interaction classes by interaction type and we document examples of mitigating synergism, highlighting the importance of incorporating individual stressor effect directions in the determination of synergisms and antagonisms. This is particularly pertinent given a general bias in ecology toward investigating and reporting adverse multiple stressor effects (double negative). We emphasize the need for reconsideration by the ecological community of the interpretation of synergism and antagonism in situations where

Nogo-receptor 1 antagonization in combination with neurotrophin-4/5 is not superior to single factor treatment in promoting survival and morphological complexity of cultured dopaminergic neurons.

Science.gov (United States)

Seiler, Stefanie; Di Santo, Stefano; Sahli, Sebastian; Andereggen, Lukas; Widmer, Hans Rudolf

2017-08-01

Cell transplantation using ventral mesencephalic tissue is an experimental approach to treat Parkinson's disease. This approach is limited by poor survival of the transplants and the high number of dopaminergic neurons needed for grafting. Increasing the yield of dopaminergic neurons in donor tissue is of great importance. We have previously shown that antagonization of the Nogo-receptor 1 by NEP1-40 promoted survival of cultured dopaminergic neurons and exposure to neurotrophin-4/5 increased dopaminergic cell densities in organotypic midbrain cultures. We investigated whether a combination of both treatments offers a novel tool to further improve dopaminergic neuron survival. Rat embryonic ventral mesencephalic neurons grown as organotypic free-floating roller tube or primary dissociated cultures were exposed to neurotrophin-4/5 and NEP1-40. The combined and single factor treatment resulted in significantly higher numbers of tyrosine hydroxylase positive neurons compared to controls. Significantly stronger tyrosine hydroxylase signal intensity was detected by Western blotting in the combination-treated cultures compared to controls but not compared to single factor treatments. Neurotrophin-4/5 and the combined treatment showed significantly higher signals for the neuronal marker microtubule-associated protein 2 in Western blots compared to control while no effects were observed for the astroglial marker glial fibrillary acidic protein between groups, suggesting that neurotrophin-4/5 targets mainly neuronal cells. Finally, NEP1-40 and the combined treatment significantly augmented tyrosine hydroxylase positive neurite length. Summarizing, our findings substantiate that antagonization of the Nogo-receptor 1 promotes dopaminergic neurons but does not further increase the yield of dopaminergic neurons and their morphological complexity when combined with neurotrophin-4/5 hinting to the idea that these treatments might exert their effects by activating common

Metal RIE 2: Unaxis SHUTTLELINE ICP

Data.gov (United States)

Federal Laboratory Consortium — Description:CORAL Name: Unaxis ICP EtcherChlorine-based system utilizing Boron Trichloride and Chlorine to etch metals and III-V group materials on planar substrates...

Air pollution studies using PIXE and ICP methods

International Nuclear Information System (INIS)

Stihi, Claudia; Bancuta, Anca; Popescu, I V; Virgolici, M; Cimpoca, V; Gugiu, M; Vlaicu, Gh

2006-01-01

In the present work the moss biomonitoring technique and the combination of two analytical techniques - Particle Induced X-ray Emission (PIXE) and Inductively Coupled Plasma (ICP) - were applied for assessing environmental situation from the point of view of air polluting along the transect from north to south of the Dambovita County. PIXE analysis at the Tandem Accelerator FN-8 of the National Institute of Nuclear Physics - Horia Hulubei of Magurele, Bucharest, allowed determination of P, S, Cl, K, Ca, Mn, Fe, Ni, Cu, Zn, As, Sr, Cd and Pb in samples. ICP analyses were made using a Baird ICP2070 - Sequential Plasma Spectrometer in Targoviste and we determined in samples the concentration of Li, B, Na, and Mg together with Cd and Pb. The obtained results will permit to determine the regional extent of heavy metals and toxic elements atmospheric pollution and to identify specially affected areas and local sources of

Histone Methylation and Epigenetic Silencing in Breast Cancer

National Research Council Canada - National Science Library

Simon, Jeffrey A; Lange, Carol A

2008-01-01

.... EZH2 is a histone methyltransferase which modifies lysine-27 of histone H3 an epigenetic mark which is generally linked to gene silencing and is implicated in tumor suppressor silencing during breast cancer progression...

FCJ-156 Hacking the Social: Internet Memes, Identity Antagonism, and the Logic of Lulz.

Directory of Open Access Journals (Sweden)

Ryan M. Milner

2013-12-01

Full Text Available 4chan and reddit are participatory media collectives undergirded by a “logic of lulz” that favours distanced irony and critique. It often works at the expense of core identity categories like race and gender. However, the logic need not be entirely counterproductive to public discourse. Provided that diverse identities find voice instead of exclusion, these sites may facilitate vibrant, agonistic discussion instead of disenfranchising antagonism. In order to assess this potential for productive agonism, I undertook a critical discourse analysis of these collectives. Emphasising the image memes they produce, I evaluated discourses on race and gender. Both race and gender representations were dominated by familiar stereotypes and partial representations. However, while dissenting perspectives on race were repressed or excluded, dissenting perspectives on gender were vocalised and contested. The ‘logic of lulz’ facilitated both dominance and counter, each articulated with heavy reliance on irony and critique. This logic ambiguously balanced agonism and antagonism, but contestation provided sharper engagement than repression.

Analysis of Tospovirus NSs Proteins in Suppression of Systemic Silencing

NARCIS (Netherlands)

Hedil, M.; Sterken, M.G.; Ronde, de D.; Lohuis, D.; Kormelink, R.

2015-01-01

RNA silencing is a sequence-specific gene regulation mechanism that in plants also acts antiviral. In order to counteract antiviral RNA silencing, viruses have evolved RNA silencing suppressors (RSS). In the case of tospoviruses, the non-structural NSs protein has been identified as the RSS.

Optimisation of tomato Micro-tom regeneration and selection on glufosinate/Basta and dependency of gene silencing on transgene copy number.

Science.gov (United States)

Khuong, Thi Thu Huong; Crété, Patrice; Robaglia, Christophe; Caffarri, Stefano

2013-09-01

An efficient protocol of transformation and selection of transgenic lines of Micro-tom, a widespread model cultivar for tomato, is reported. RNA interference silencing efficiency and stability have been investigated and correlated with the number of insertions. Given its small size and ease of cultivation, the tomato (Solanum lycopersicon) cultivar Micro-tom is of widespread use as a model tomato plant. To create and screen transgenic plants, different selectable markers are commonly used. The bar marker carrying the resistance to the herbicide glufosinate/Basta, has many advantages, but it has been little utilised and with low efficiency for identification of tomato transgenic plants. Here we describe a procedure for accurate selection of transgenic Micro-tom both in vitro and in soil. Immunoblot, Southern blot and phenotypic analyses showed that 100 % of herbicide-resistant plants were transgenic. In addition, regeneration improvement has been obtained by using 2 mg/l Gibberellic acid in the shoot elongation medium; rooting optimisation on medium containing 1 mg/l IAA allowed up to 97 % of shoots developing strong and very healthy roots after only 10 days. Stable transformation frequency by infection of leaf explants with Agrobacterium reached 12 %. Shoots have been induced by combination of 1 mg/l zeatin-trans and 0.1 mg/l IAA. Somatic embryogenesis of cotyledon on medium containing 1 mg/l zeatin + 2 mg/l IAA is described in Micro-tom. The photosynthetic psbS gene has been used as reporter gene for RNA silencing studies. The efficiency of gene silencing has been found equivalent using three different target gene fragments of 519, 398 and 328 bp. Interestingly, silencing efficiency decreased from T0 to the T3 generation in plants containing multiple copies of the inserted T-DNA, while it was stable in plants containing a single insertion.

Primer-dependent and primer-independent initiation of double stranded RNA synthesis by purified arabidopsis RNA-dependent RNA polymerases RDR2 and RDR6

DEFF Research Database (Denmark)

Devert, Anthony; Fabre, Nicolas; Floris, Maina Huguette Joséphine

2015-01-01

) targeted by RNA silencing. The dsRNA is subsequently cleaved by the ribonuclease DICER-like into secondary small interfering RNAs (siRNAs) that reinforce and/or maintain the silenced state of the target RNA. Models of RNA silencing propose that RDRs could use primer-independent and primer......Cellular RNA-dependent RNA polymerases (RDRs) are fundamental components of RNA silencing in plants and many other eukaryotes. In Arabidopsis thaliana genetic studies have demonstrated that RDR2 and RDR6 are involved in the synthesis of double stranded RNA (dsRNA) from single stranded RNA (ssRNA......-dependent initiation to generate dsRNA from a transcript targeted by primary siRNA or microRNA (miRNA). However, the biochemical activities of RDR proteins are still partly understood. Here, we obtained active recombinant RDR2 and RDR6 in a purified form. We demonstrate that RDR2 and RDR6 have primer...

No-Big-Silence teeb klubituuri / Urmas Hännile

Index Scriptorium Estoniae

Hännile, Urmas

2009-01-01

Rockansamblist No-Big-Silence ja dark-popansamblist Sinine, nende kontsertttuurist mööda Eestimaad, tutvustamisel bändide uued albumid (No-Big-Silence "Starstealer" ja Sinine "Butterflies"), Pärnus on kontsert 24. oktoobril klubis Sugar

Application of ICP-MS in Environmental Sampling Analysis for Safeguards

International Nuclear Information System (INIS)

Eko Pudjadi; Petrus Zacharias; Budi Prayitno

2004-01-01

Environmental samples measured by ICP-MS were analyzed for safeguards. There are two isotopes in environmental sampling that is used to find out the origin of nuclear materials and verify undeclared nuclear activities. Uranium isotopes are 234 U, 235 U, 236 U and 238 U and Plutonium isotopes are 239 Pu, 240 Pu, 241 Pu and 242 Pu. Uranium isotopes are used to verify an existing of nuclear power plants, enrichment plants or reprocessing plants. Plutonium isotopes are used to clarify global fallout from nuclear weapon testing and accident of nuclear facility or military purposes. The high sensitivity of ICP-MS can detect the isotopic fingerprint and trace elements in ppb concentration; ICP-MS has been applied to measure 235 U isotopic ratio and 240 Pu/ 239 Pu isotopic ratios. The sensitivity of ICP-MS is high precision and low operational cost in environmental sampling and can be considered in nuclear power design based on safeguards for development countries. (author)

In vitro antagonism of Trichoderma harzianum Rifai against Mycosphaerella fijiensis Morelet

Directory of Open Access Journals (Sweden)

Mayra Acosta-Suárez

2013-10-01

Full Text Available The in vitro antagonism of Trichoderma harzianum against Mycosphaerella fijiensis, foliar pathogen of banana and plantain, was evaluated. The assays were performed using the dual culture method. Competition for space and nutrients, the antagonistic capacity and forms and intensity of antagonism were determined considering the invasion of the surface of the colony, colonization and sporulation of T. harzianum on M. fijiensis after seven days of inoculation. Finally, the effect of volatile metabolites of T. harzianum was evaluated. The results showed in vitro antagonism of T. harzianum against M. fijiensis by competition for space and nutrients of the culture medium. Trichoderma grew over the pathogen colony with hyperparasitism and high intensity. Also, it completely covered the surface of the culture medium. T. harzianum not inhibited the growth of M. fijiensis by volatile metabolites. Damage was observed in the integrity of the cell wall of M. fijiensis hyphae and the cell content exit. The use of antagonistic fungi, could contribute to the design of strategies for integrated management of this disease. Key words: banana and plantain, biocontrol, mechanisms of action

Some practical applications of an ICP-MS instrument

International Nuclear Information System (INIS)

Meddings, B.; Ng, R.

1987-01-01

An early model commercial ICP-MS instrument (PlasmaQuad from VG Isotopes Limited) was acquired more than two years ago. As a typical analytical laboratory in the metallurgical field, the application of the ICP-MS technique to real sample analysis is the authors prime concern. The process of introducing this state-of-the-art instrument into routine analysis will be described. The modifications and limitations necessary to achieve acceptable precision under normal working conditions will be outlined. In most cases, practical problems can be circumvented with some sacrifice in analytical performance in the area of detection limits and dynamic range. In this presentation, specific applications of the ICP-MS technique in the authors laboratory will be discussed. These include trace analysis on high purity metals such as copper, aluminum, cobalt, nickel etc., on refinery feed samples such as nickel sulfate, mixed cobalt and nickel sulfide, cobalt cathode, samarium oxide etc., on alloys such as cobalt-samarium magnetic materials, nickel or cobalt based alloys used in turbine blades etc. Other applications such as the determination of uranium in phosphate rock, trace analysis on fertilizers, water samples and high purity acids will also be mentioned. The solutions to the practical problems encountered in these applications will be discussed. The analytical power of the ICP-MS technique for real sample analysis will be assessed

RNA interference silencing of CHS greatly alters the growth pattern of apple (Malus x domestica).

Science.gov (United States)

Dare, Andrew P; Hellens, Roger P

2013-08-01

Plants produce a vast array of phenolic compounds which are essential for their survival on land. One major class of polyphenols are the flavonoids and their formation is dependent on the enzyme chalcone synthase (CHS). In a recent study we silenced the CHS genes of apple (Malus × domestica Borkh.) and observed a loss of pigmentation in the fruit skin, flowers and stems. More surprisingly, highly silenced lines were significantly reduced in size, with small leaves and shortened internode lengths. Chemical analysis also revealed that the transgenic shoots contained greatly reduced concentrations of flavonoids which are known to modulate auxin flow. An auxin transport study verified this, with an increased auxin transport in the CHS-silenced lines. Overall, these findings suggest that auxin transport in apple has adapted to take place in the presence of high endogenous concentrations of flavonoids. Removal of these compounds therefore results in abnormal auxin movement and a highly disrupted growth pattern.

Breaking the silence

DEFF Research Database (Denmark)

Konradsen, Hanne; Kirkevold, Marit; McCallin, Antoinette

2012-01-01

and individual interviews were analyzed using the grounded theory method. The findings revealed that the main concern of the patients was feeling isolated, which was resolved using a process of interactional integration. Interactional integration begins by breaking the silence to enable the progression from...

Antisense gene silencing

DEFF Research Database (Denmark)

Nielsen, Troels T; Nielsen, Jørgen E

2013-01-01

Since the first reports that double-stranded RNAs can efficiently silence gene expression in C. elegans, the technology of RNA interference (RNAi) has been intensively exploited as an experimental tool to study gene function. With the subsequent discovery that RNAi could also be applied...

Toward a science of silence: The consequences of leaving a memory unsaid

DEFF Research Database (Denmark)

Stone, Charles; Coman, Alin; Brown, Adam

2012-01-01

of the silence—and listeners—those attending to the speaker. Although the topic of silence is widely discussed, it is rarely mentioned in the empirical literature on memory. Three factors are employed to classify silence into different types: whether a silence is accompanied by covert remembering, whether...... the silence is intentional or unintentional, and whether the silenced memory is related or unrelated to the memories emerging in a conversation. These factors appear to be critical when considering the mnemonic consequences. Moreover, the influence of silence on memory varies between speaker and listener...

Behavioral effects of gamma-hydroxybutyrate, its precursor gamma-butyrolactone, and GABA(B) receptor agonists: time course and differential antagonism by the GABA(B) receptor antagonist 3-aminopropyl(diethoxymethyl)phosphinic acid (CGP35348).

Science.gov (United States)

Koek, Wouter; Mercer, Susan L; Coop, Andrew; France, Charles P

2009-09-01

Gamma-hydroxybutyrate (GHB) is used therapeutically and recreationally. The mechanism by which GHB produces its therapeutic and recreational effects is not entirely clear, although GABA(B) receptors seem to play an important role. This role could be complex, because there are indications that different GABA(B) receptor mechanisms mediate the effects of GHB and the prototypical GABA(B) receptor agonist baclofen. To further explore possible differences in underlying GABA(B) receptor mechanisms, the present study examined the effects of GHB and baclofen on operant responding and their antagonism by the GABA(B) receptor antagonist 3-aminopropyl(diethoxymethyl)phosphinic acid (CGP35348). Pigeons were trained to peck a key for access to food during response periods that started at different times after the beginning of the session. In these pigeons, GHB, its precursor gamma-butyrolactone (GBL), and the GABA(B) receptor agonists baclofen and 3-aminopropyl(methyl)phosphinic acid hydrochloride (SKF97541) decreased the rate of responding in a dose- and time-dependent manner. CGP35348 shifted the dose-response curve of each agonist to the right, but the magnitude of the shift differed among the agonists. Schild analysis yielded a pA(2) value of CGP35348 to antagonize GHB and GBL [i.e., 3.9 (3.7-4.2)] that was different (P = 0.0011) from the pA(2) value to antagonize baclofen and SKF97541 [i.e., 4.5 (4.4-4.7)]. This finding is further evidence that the GABA(B) receptor mechanisms mediating the effects of GHB and prototypical GABA(B) receptor agonists are not identical. A better understanding of the similarities and differences between these mechanisms, and their involvement in the therapeutic effects of GHB and baclofen, could lead to more effective medications with fewer adverse effects.

Opioid-Induced Glial Activation: Mechanisms of Activation and Implications for Opioid Analgesia, Dependence, and Reward

Directory of Open Access Journals (Sweden)

Mark R. Hutchinson

2007-01-01

Full Text Available This review will introduce the concept of toll-like receptor (TLR–mediated glial activation as central to all of the following: neuropathic pain, compromised acute opioid analgesia, and unwanted opioid side effects (tolerance, dependence, and reward. Attenuation of glial activation has previously been demonstrated both to alleviate exaggerated pain states induced by experimental pain models and to reduce the development of opioid tolerance. Here we demonstrate that selective acute antagonism of TLR4 results in reversal of neuropathic pain as well as potentiation of opioid analgesia. Attenuating central nervous system glial activation was also found to reduce the development of opioid dependence, and opioid reward at a behavioral (conditioned place preference and neurochemical (nucleus accumbens microdialysis of morphine-induced elevations in dopamine level of analysis. Moreover, a novel antagonism of TLR4 by (+- and (˗-isomer opioid antagonists has now been characterized, and both antiallodynic and morphine analgesia potentiating activity shown. Opioid agonists were found to also possess TLR4 agonistic activity, predictive of glial activation. Targeting glial activation is a novel and as yet clinically unexploited method for treatment of neuropathic pain. Moreover, these data indicate that attenuation of glial activation, by general or selective TLR antagonistic mechanisms, may also be a clinical method for separating the beneficial (analgesia and unwanted (tolerance, dependence, and reward actions of opioids, thereby improving the safety and efficacy of their use.

Optoelectronic properties of Black-Silicon generated through inductively coupled plasma (ICP) processing for crystalline silicon solar cells

Energy Technology Data Exchange (ETDEWEB)

Hirsch, Jens, E-mail: J.Hirsch@emw.hs-anhalt.de [Anhalt University of Applied Sciences, Faculty EMW, Bernburger Str. 55, DE-06366 Köthen (Germany); Fraunhofer Center for Silicon Photovoltaics CSP, Otto-Eißfeldt-Str. 12, DE-06120 Halle (Saale) (Germany); Gaudig, Maria; Bernhard, Norbert [Anhalt University of Applied Sciences, Faculty EMW, Bernburger Str. 55, DE-06366 Köthen (Germany); Lausch, Dominik [Fraunhofer Center for Silicon Photovoltaics CSP, Otto-Eißfeldt-Str. 12, DE-06120 Halle (Saale) (Germany)

2016-06-30

Highlights: • Fabrication of black silicon through inductively coupled plasma (ICP) processing. • Suppressed formation a self-bias and therefore a reduced ion bombardment of the silicon sample. • Reduction of the average hemispherical reflection between 300 and 1120 nm up to 8% within 5 min ICP process time. • Reflection is almost independent of the angle of incidence up to 60°. • 2.5 ms effective lifetime at 10{sup 15} cm{sup −3} MCD after ALD Al{sub 2}O{sub 3} surface passivation. - Abstract: The optoelectronic properties of maskless inductively coupled plasma (ICP) generated black silicon through SF{sub 6} and O{sub 2} are analyzed by using reflection measurements, scanning electron microscopy (SEM) and quasi steady state photoconductivity (QSSPC). The results are discussed and compared to capacitively coupled plasma (CCP) and industrial standard wet chemical textures. The ICP process forms parabolic like surface structures in a scale of 500 nm. This surface structure reduces the average hemispherical reflection between 300 and 1120 nm up to 8%. Additionally, the ICP texture shows a weak increase of the hemispherical reflection under tilted angles of incidence up to 60°. Furthermore, we report that the ICP process is independent of the crystal orientation and the surface roughness. This allows the texturing of monocrystalline, multicrystalline and kerf-less wafers using the same parameter set. The ICP generation of black silicon does not apply a self-bias on the silicon sample. Therefore, the silicon sample is exposed to a reduced ion bombardment, which reduces the plasma induced surface damage. This leads to an enhancement of the effective charge carrier lifetime up to 2.5 ms at 10{sup 15} cm{sup −3} minority carrier density (MCD) after an atomic layer deposition (ALD) with Al{sub 2}O{sub 3}. Since excellent etch results were obtained already after 4 min process time, we conclude that the ICP generation of black silicon is a promising technique

Application of ICP-MS and HPLC-ICP-MS for diagnosis and therapy of a severe intoxication with hexavalent chromium and inorganic arsenic.

Science.gov (United States)

Heitland, Peter; Blohm, Martin; Breuer, Christian; Brinkert, Florian; Achilles, Eike Gert; Pukite, Ieva; Köster, Helmut Dietrich

2017-05-01

ICP-MS and HPLC-ICP-MS were applied for diagnosis and therapeutic monitoring in a severe intoxication with a liquid containing hexavalent chromium (Cr(VI)) and inorganic arsenic (iAs). In this rare case a liver transplantation of was considered as the only chance of survival. We developed and applied methods for the determination of Cr(VI) in erythrocytes and total chromium (Cr) and arsenic (As) in blood, plasma, urine and liver tissue by ICP-MS. Exposure to iAs was diagnosed by determination of iAs species and their metabolites in urine by anion exchange HPLC-ICP-MS. Three days after ingestion of the liquid the total Cr concentrations were 2180 and 1070μg/L in whole blood and plasma, respectively, and 4540μg/L Cr(VI) in erythrocytes. The arsenic concentration in blood was 206μg/L. The urinary As species concentrations were <0.5, 109, 115, 154 and 126μg/L for arsenobetaine, As(III), As(V), methylarsonate (V) and dimethylarsinate (V), respectively. Total Cr and As concentrations in the explanted liver were 11.7 and 0.9mg/kg, respectively. Further analytical results of this case study are tabulated and provide valuable data for physicians and toxicologists. Copyright © 2017. Published by Elsevier GmbH.

Applications of ICP-MS in marine analytical chemistry

Energy Technology Data Exchange (ETDEWEB)

McLaren, J W; Siu, K W.M.; Lam, J W; Willie, S N; Maxwell, P S; Palepu, A; Koether, M; Berman, S S [National Research Council of Canada, Ottawa, ON (Canada). Analytical Chemistry Section

1990-07-01

The versatility of ICP-MS in marine analytical chemistry is illustrated with applications to the multielement trace analysis of two recently released marine reference materials, the coastal seawater CASS-2 and the non-defatted lobster hepatopancreas tissue LUTS-1, and to the determination of tributyltin and dibutyltin in the harbour sediment reference material PACS-1 by HPLC-ICP-MS. Seawater analyses were performed after separation of the trace elements either by adsorption on immobilized 8-hydroxyquinoline or by reductive coprecipitation with iron and palladium. Simultaneous determination of seven trace elements in LUTS-1, including mercury, by isotope dilution ICP-MS, was achieved after dissolution by microwave digestion with nitric acid and hydrogen peroxide. Butyltin species in PACS-1 were separated by cation exchange HPLC of an extract of the sediment; method detection limits for tributyltin and dibutyltin in sediment samples are estimated to be 5 ng Sn/g and 12 ng Sn/g, respectively. (orig.).

5-HT4 receptors mediating enhancement of contractility in canine stomach; an in vitro and in vivo study

NARCIS (Netherlands)

Prins, NH; van der Grijn, A; Lefebvre, RA; Akkermans, LMA; Schuurkes, JAJ

1 We aimed to study 5-HT4 receptors in canine stomach contractility both in vivo and in vitro. 2 In anaesthetized Beagle dogs, the selective 5-HT4 receptor agonist prucalopride (i.v.) induced dose-dependent tonic stomach contractions under isobaric conditions, an effect that was antagonized by the

Comparison of vascular alpha(1)-adrenoceptor antagonism of tamsulosin in oral controlled absorption system (OCAS) and modified release (MR) formulations

NARCIS (Netherlands)

Michel, M. C.; Korstanje, C.; Krauwinkel, W.; Shear, M.; Davies, J.; Quartel, A.

2005-01-01

Objective: The cardiovascular a-l-adrenoceptor (AR) antagonism of the new oral controlled absorption system (OCAS) 0.4 mg tablet formulation of tamsulosin was compared with that of the modified release (MR) 0.4 mg capsule formulation in healthy male volunteers after a single dose in the fasted

Determination of trace elements in seawater by air-flow injection/ICP-MS with chelating resin preconcentration

International Nuclear Information System (INIS)

Lee, Kyue-Hyung; Ohshima, Mitsuko; Motomizu, Shoji

2002-01-01

Multielement determination of major to trace metals in a deep seawater malt was accomplished by inductively coupled plasma-mass spectrometry (ICP-MS) together with inductively coupled plasma-atomic emission spectrometry (ICP-AES). Major elements, such as Na, K, Mg, and Ca, were measured by ICP-AES and normal continuos nebulization ICP-MS after sample dilution by 10 3 -10 6 fold. Fifteen trace elements in the concentrated metal solutions pretreated with cation-exchange resin or chelating resin could be simultaneously determined by air-flow injection/ICP-mass spectrometry (AFI/ICP-MS). Since the injection volume for AFI/ICP-MS was 25 μl, final samples volumes less than 500 μl were enough for several replicate measurements. Three different preconcentration methods assisted with AFI/ICP-MS were examined and could be successfully applied to a deep seawater malt. The analytical results of rate earth elements (REEs) and Co, Ni, Cu, Zn, Cd, and Pb obtained by AFI/ICP-MS coupled with disk filtration method using iminodiacetate (IDA)-type chelating resin were favorably agreed with the data obtained by AFI/ICP-MS coupled with column preconcentration method using chitosan-based chelating resin. (author)

Strategies for Improving siRNA-Induced Gene Silencing Efficiency.

Science.gov (United States)

Safari, Fatemeh; Rahmani Barouji, Solmaz; Tamaddon, Ali Mohammad

2017-12-01

Purpose: Human telomerase reverse transcriptase (hTERT) plays a crucial role in tumorigenesis and progression of cancers. Gene silencing of hTERT by short interfering RNA (siRNA) is considered as a promising strategy for cancer gene therapy. Various algorithms have been devised for designing a high efficient siRNA which is a significant issue in the clinical usage. Thereby, in the present study, the relation of siRNA designing criteria and the gene silencing efficiency was evaluated. Methods: The siRNA sequences were designed and characterized by using on line soft wares. Cationic co-polymer (polyethylene glycol-g-polyethylene imine (PEG-g-PEI)) was used for the construction of polyelectrolyte complexes (PECs) containing siRNAs. The cellular uptake of the PECs was evaluated. The gene silencing efficiency of different siRNA sequences was investigated and the effect of observing the rational designing on the functionality of siRNAs was assessed. Results: The size of PEG-g-PEI siRNA with N/P (Nitrogen/Phosphate) ratio of 2.5 was 114 ± 0.645 nm. The transfection efficiency of PECs was desirable (95.5% ± 2.4%.). The results of Real-Time PCR showed that main sequence (MS) reduced the hTERT expression up to 90% and control positive sequence (CPS) up to 63%. These findings demonstrated that the accessibility to the target site has priority than the other criteria such as sequence preferences and thermodynamic features. Conclusion: siRNA opens a hopeful window in cancer therapy which provides a convenient and tolerable therapeutic approach. Thereby, using the set of criteria and rational algorithms in the designing of siRNA remarkably affect the gene silencing efficiency.

ICP-MS: Analytical Method for Identification and Detection of Elemental Impurities.

Science.gov (United States)

Mittal, Mohini; Kumar, Kapil; Anghore, Durgadas; Rawal, Ravindra K

2017-01-01

Aim of this article is to review and discuss the currently used quantitative analytical method ICP-MS, which is used for quality control of pharmaceutical products. ICP-MS technique has several applications such as determination of single elements, multi element analysis in synthetic drugs, heavy metals in environmental water, trace element content of selected fertilizers and dairy manures. ICP-MS is also used for determination of toxic and essential elements in different varieties of food samples and metal pollutant present in the environment. The pharmaceuticals may generate impurities at various stages of development, transportation and storage which make them risky to be administered. Thus, it is essential that these impurities must be detected and quantified. ICP-MS plays an important function in the recognition and revealing of elemental impurities. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Inhibition of Dengue Virus Replication by a Class of Small-Molecule Compounds That Antagonize Dopamine Receptor D4 and Downstream Mitogen-Activated Protein Kinase Signaling

Science.gov (United States)

Smith, Jessica L.; Stein, David A.; Shum, David; Fischer, Matthew A.; Radu, Constantin; Bhinder, Bhavneet; Djaballah, Hakim; Nelson, Jay A.; Früh, Klaus

2014-01-01

ABSTRACT Dengue viruses (DENV) are endemic pathogens of tropical and subtropical regions that cause significant morbidity and mortality worldwide. To date, no vaccines or antiviral therapeutics have been approved for combating DENV-associated disease. In this paper, we describe a class of tricyclic small-molecule compounds—dihydrodibenzothiepines (DHBTs), identified through high-throughput screening—with potent inhibitory activity against DENV serotype 2. SKI-417616, a highly active representative of this class, displayed activity against all four serotypes of DENV, as well as against a related flavivirus, West Nile virus (WNV), and an alphavirus, Sindbis virus (SINV). This compound was characterized to determine its mechanism of antiviral activity. Investigation of the stage of the viral life cycle affected revealed that an early event in the life cycle is inhibited. Due to the structural similarity of the DHBTs to known antagonists of the dopamine and serotonin receptors, we explored the roles of two of these receptors, serotonin receptor 2A (5HTR2A) and the D4 dopamine receptor (DRD4), in DENV infection. Antagonism of DRD4 and subsequent downstream phosphorylation of epidermal growth factor receptor (EGFR)-related kinase (ERK) were found to impact DENV infection negatively, and blockade of signaling through this network was confirmed as the mechanism of anti-DENV activity for this class of compounds. IMPORTANCE The dengue viruses are mosquito-borne, reemerging human pathogens that are the etiological agents of a spectrum of febrile diseases. Currently, there are no approved therapeutic treatments for dengue-associated disease, nor is there a vaccine. This study identifies a small molecule, SKI-417616, with potent anti-dengue virus activity. Further analysis revealed that SKI-417616 acts through antagonism of the host cell dopamine D4 receptor and subsequent repression of the ERK phosphorylation pathway. These results suggest that SKI-417616, or other

Epigenetic Silencing and Resistance to Imatinib Mesylate in CML

National Research Council Canada - National Science Library

Issa, Jean-Pierre

2004-01-01

...). In this project, we are exploring the hypothesis that epigenetic silencing associated with promoter DNA methylation mediates resistance in selected cases, and that reversal of silencing by decitabine...

Epigenetic Silencing and Resistance to Imatinib Mesylate in CML

National Research Council Canada - National Science Library

Issa, Jean-Pierre

2005-01-01

...). In this project, we are exploring the hypothesis that epigenetic silencing associated with promoter DNA methylation mediates resistance in selected cases, and that reversal of silencing by decitabine...

Epigenetic Silencing and Resistance to Imatinib Mesylate in CML

National Research Council Canada - National Science Library

Issa, Jean-Pierre

2006-01-01

...). In this project we are exploring the hypothesis that epigenetic silencing associated with promoter DNA methylation mediates resistance in selected cases and that reversal of silencing by decitabine...

Targeted adhesion for sucralfate to impaired gastric mucosa of SD rats by ICP-AES method%ICP-AES法考察硫糖铝对SD大鼠胃溃疡粘膜的靶向粘附

Institute of Scientific and Technical Information of China (English)

李艳; 林凤云; 罗立骏; 曾令高; 朱照静

2016-01-01

目的:建立硫糖铝中铝离子(Al3+)在大鼠胃组织残留量的测定方法,考察硫糖铝对胃溃疡粘膜的靶向粘附作用.方法:采用干法灰化消解胃组织样品,电感耦合等离子体-原子发射光谱法(ICP-AES)测定给药后不同时间点大鼠胃组织中Al3+的残留量.ICP-AES检测波长为396.153 nm,检测器为电感耦合阵列检测器,载气为氩气.结果:干法灰化大鼠胃溃疡组织,样品消解完全,可满足ICP-AES的检测要求;在选定的最佳条件下用ICP-AES检测Al3+的检出限为8 ng· mL-1,样品间Al3+残留量相对偏差小于13.4％,回收率在96.0％～99.5％之间;给药0.5～4 h时间段内,溃疡胃组织中的Al3+残留率为正常胃组织的2倍以上;给药6h后,正常胃组织中Al3+残留率显著下降,仅为0.84％,而溃疡胃组织在给药16 h后仍高达29％.结论:ICP-AES测定大鼠胃组织中Al3+的残留量准确可行;硫糖铝对胃溃疡粘膜的粘附性显著高于正常胃粘膜,具有良好的靶向性.

Determination of 99Tc in fresh water using TRU resin by ICP-MS.

Science.gov (United States)

Guérin, Nicolas; Riopel, Remi; Kramer-Tremblay, Sheila; de Silva, Nimal; Cornett, Jack; Dai, Xiongxin

2017-10-02

Technetium-99 ( 99 Tc) determination at trace level by inductively coupled plasma mass spectrometry (ICP-MS) is challenging because there is no readily available appropriate Tc isotopic tracer. A new method using Re as a recovery tracer to determine 99 Tc in fresh water samples, which does not require any evaporation step, was developed. Tc(VII) and Re(VII) were pre-concentrated on a small anion exchange resin (AER) cartridge from one litre of water sample. They were then efficiently eluted from the AER using a potassium permanganate (KMnO 4 ) solution. After the reduction of KMnO 4 in 2 M sulfuric acid solution, the sample was passed through a small TRU resin cartridge. Tc(VII) and Re(VII) retained on the TRU resin were eluted using near boiling water, which can be directly used for the ICP-MS measurement. The results for method optimisation, validation and application were reported. Crown Copyright © 2017. Published by Elsevier B.V. All rights reserved.

Autotaxin is induced by TSA through HDAC3 and HDAC7 inhibition and antagonizes the TSA-induced cell apoptosis.

Science.gov (United States)

Li, Song; Wang, Baolu; Xu, Yan; Zhang, Junjie

2011-02-12

Autotaxin (ATX) is a secreted glycoprotein with the lysophospholipase D (lysoPLD) activity to convert lysophosphatidylcholine (LPC) into lysophosphatidic acid (LPA), a bioactive lysophospholipid involved in diverse biological actions. ATX is highly expressed in some cancer cells and contributes to their tumorigenesis, invasion, and metastases, while in other cancer cells ATX is silenced or expressed at low level. The mechanism of ATX expression regulation in cancer cells remains largely unknown. In the present study, we demonstrated that trichostatin A (TSA), a well-known HDAC inhibitor (HDACi), significantly induced ATX expression in SW480 and several other cancer cells with low or undetectable endogenous ATX expression. ATX induction could be observed when HDAC3 and HDAC7 were down-regulated by their siRNAs. It was found that HDAC7 expression levels were low in the cancer cells with high endogenous ATX expression. Exogenous over-expression of HDAC7 inhibited ATX expression in these cells in a HDAC3-dependent manner. These data indicate that HDAC3 and HDAC7 collaboratively suppress ATX expression in cancer cells, and suggest that TSA induce ATX expression by inhibiting HDAC3 and HDAC7. The biological significance of this regulation mechanism was revealed by demonstrating that TSA-induced ATX protected cancer cells against TSA-induced apoptosis by producing LPA through its lysoPLD activity, which could be reversed by BrP-LPA and S32826, the inhibitors of the ATX-LPA axis. We have demonstrated that ATX expression is repressed by HDAC3 and HDAC7 in cancer cells. During TSA treatment, ATX is induced due to the HDAC3 and HDAC7 inhibition and functionally antagonizes the TSA-induced apoptosis. These results reveal an internal HDACi-resistant mechanism in cancer cells, and suggest that the inhibition of ATX-LPA axis would be helpful to improve the efficacy of HDACi-based therapeutics against cancer.

Silencing of cytosolic NADP(+)-dependent isocitrate dehydrogenase by small interfering RNA enhances the sensitivity of HeLa cells toward staurosporine.

Science.gov (United States)

Lee, Su-Min; Park, Sin Young; Shin, Seoung Woo; Kil, In Sup; Yang, Eun Sun; Park, Jeen-Woo

2009-02-01

Staurosporine induces the production of reactive oxygen species, which play an important causative role in apoptotic cell death. Recently, it was demonstrated that the control of cellular redox balance and the defense against oxidative damage is one of the primary functions of cytosolic NADP(+)-dependent isocitrate dehydrogenase (IDPc) by supplying NADPH for antioxidant systems. The present report shows that silencing of IDPc expression in HeLa cells greatly enhances apoptosis induced by staurosporine. Transfection of HeLa cells with an IDPc small interfering RNA (siRNA) markedly decreased activity of IDPc, enhancing the susceptibility of staurosporine-induced apoptosis reflected by DNA fragmentation, cellular redox status and the modulation of apoptotic marker proteins. These results indicate that IDPc may play an important role in regulating the apoptosis induced by staurosporine and the sensitizing effect of IDPc siRNA on the apoptotic cell death of HeLa cells offers the possibility of developing a modifier of cancer chemotherapy.

The baseline pressure of intracranial pressure (ICP) sensors can be altered by electrostatic discharges.

Science.gov (United States)

Eide, Per K; Bakken, André

2011-08-22

The monitoring of intracranial pressure (ICP) has a crucial role in the surveillance of patients with brain injury. During long-term monitoring of ICP, we have seen spontaneous shifts in baseline pressure (ICP sensor zero point), which are of technical and not physiological origin. The aim of the present study was to explore whether or not baseline pressures of ICP sensors can be affected by electrostatics discharges (ESD's), when ESD's are delivered at clinically relevant magnitudes. We performed bench-testing of a set of commercial ICP sensors. In our experimental setup, the ICP sensor was placed in a container with 0.9% NaCl solution. A test person was charged 0.5-10 kV, and then delivered ESD's to the sensor by touching a metal rod that was located in the container. The continuous pressure signals were recorded continuously before/after the ESD's, and the pressure readings were stored digitally using a computerized system A total of 57 sensors were tested, including 25 Codman ICP sensors and 32 Raumedic sensors. When charging the test person in the range 0.5-10 kV, typically ESD's in the range 0.5-5 kV peak pulse were delivered to the ICP sensor. Alterations in baseline pressure ≥ 2 mmHg was seen in 24 of 25 (96%) Codman sensors and in 17 of 32 (53%) Raumedic sensors. Lasting changes in baseline pressure > 10 mmHg that in the clinical setting would affect patient management, were seen frequently for both sensor types. The changes in baseline pressure were either characterized by sudden shifts or gradual drifts in baseline pressure. The baseline pressures of commercial solid ICP sensors can be altered by ESD's at discharge magnitudes that are clinically relevant. Shifts in baseline pressure change the ICP levels visualised to the physician on the monitor screen, and thereby reveal wrong ICP values, which likely represent a severe risk to the patient.

Environmental radioactivity research on the Fukushima Dai-ichi Nuclear Power Plant accident by ICP-MS

International Nuclear Information System (INIS)

Ohno, Takeshi; Muramatsu, Yasuyuki

2015-01-01

Inductively coupled plasma (ICP) is characterized by high ionization efficiency for almost all elements. Recently, a triple quadrupole ICP-MS (ICP-MS/MS) has been applied to the measurements of isotope ratios for ultra-low level radioisotopes. The ICP-MS/MS features an additional quadrupole mass filter situated in front of the octopole reaction cell and quadrupole mass filter, which allows only the analyte ion to enter the cell by rejecting all the other ions. In this manuscript, we review recent studies on environmental radioactivity in Fukushima achieved by ICP-MS/MS techniques. (author)

[Antagonism of Trichoderma spp. to fungi caused root rot of Sophora tonkinensis].

Science.gov (United States)

Qin, Liu-yan; Jiang, Ni; Tang, Mei-qiong; Miao, Jian-hua; Li, Lin-xuan

2011-04-01

To study the antagonism of Trichoderma spp. to fungi S9(Fusarium solani)which caused root rot of Sophora tonkinensis and discuss the further develop prospects of microbial biological control in soil-borne diseases on Chinese herbal medicines. Antagonism of H2 (Trichoderma harsianum), M6 (Trichoderma viride) and K1 (Trichoderma koningii) to Fusarium solani were researched by growth rate and confront culture. And their mechanisms were discussed. H2 and M6 had obvious competitive advantage, the growth rate of which were 1.43-2.72 times and 1.43-1.95 times as S9 respectively. The space competitive advantage of K1 was relatively weak; the growth rate was slower than S9. The antagonism of three species of Trichoderma spp. to S9 was in varying degrees. The antagonism to S9 of M6 and H2 was better,the inhibition rate were 100% and 82.35% respectively, even cultivated S9 for three days in advance. And their inhibition indexes were both reached class I. The inhibition index and inhibition rate of K1 was respectively 46.36% and class IV. The Trichoderma spp. could cause S9 mycelium to appear some phenomenon just like fracture, constriction reduced, digestion, etc. which were observed under the microscope. Trichoderma harsianum and Trichoderma viride showed the further develop prospects in the fight against soil-borne disease on Chinese herbal medicines.

Current role of ICP-MS in clinical toxicology and forensic toxicology: a metallic profile.

Science.gov (United States)

Goullé, Jean-Pierre; Saussereau, Elodie; Mahieu, Loïc; Guerbet, Michel

2014-08-01

As metal/metalloid exposure is inevitable owing to its omnipresence, it may exert toxicity in humans. Recent advances in metal/metalloid analysis have been made moving from flame atomic absorption spectrometry and electrothermal atomic absorption spectrometry to the multi-elemental inductively coupled plasma (ICP) techniques as ICP atomic emission spectrometry and ICP-MS. ICP-MS has now emerged as a major technique in inorganic analytical chemistry owing to its flexibility, high sensitivity and good reproducibility. This in depth review explores the ICP-MS metallic profile in human toxicology. It is now routinely used and of great importance, in clinical toxicology and forensic toxicology to explore biological matrices, specifically whole blood, plasma, urine, hair, nail, biopsy samples and tissues.

Antiviral RNA silencing viral counter defense in plants

NARCIS (Netherlands)

Bucher, E.C.

2006-01-01

The research described in this thesis centres around the mechanism of RNA silencing in relation to virus-host interaction, an area of increasing importance. It shows how this recently disclosed mechanism can be used to produce virus-resistant plants. Based on the activity of the RNA silencing

Anti-viral RNA silencing: do we look like plants ?

Directory of Open Access Journals (Sweden)

Lecellier Charles-Henri

2006-01-01

Full Text Available Abstract The anti-viral function of RNA silencing was first discovered in plants as a natural manifestation of the artificial 'co-suppression', which refers to the extinction of endogenous gene induced by homologous transgene. Because silencing components are conserved among most, if not all, eukaryotes, the question rapidly arose as to determine whether this process fulfils anti-viral functions in animals, such as insects and mammals. It appears that, whereas the anti-viral process seems to be similarly conserved from plants to insects, even in worms, RNA silencing does influence the replication of mammalian viruses but in a particular mode: micro(miRNAs, endogenous small RNAs naturally implicated in translational control, rather than virus-derived small interfering (siRNAs like in other organisms, are involved. In fact, these recent studies even suggest that RNA silencing may be beneficial for viral replication. Accordingly, several large DNA mammalian viruses have been shown to encode their own miRNAs. Here, we summarize the seminal studies that have implicated RNA silencing in viral infection and compare the different eukaryotic responses.

Environmental variation shifts the relationship between trees and scatterhoarders along the continuum from mutualism to antagonism.

Science.gov (United States)

Sawaya, Gina M; Goldberg, Adam S; Steele, Michael A; Dalgleish, Harmony J

2018-05-01

The conditional mutualism between scatterhoarders and trees varies on a continuum from mutualism to antagonism and can change across time and space, and among species. We examined 4 tree species (red oak [Quercus rubra], white oak [Quercus alba], American chestnut [Castanea dentata] and hybrid chestnut [C. dentata × Castanea mollissima) across 5 sites and 3 years to quantify the variability in this conditional mutualism. We used a published model to compare the rates of seed emergence with and without burial to the probability that seeds will be cached and left uneaten by scatterhoarders to quantify variation in the conditional mutualism that can be explained by environmental variation among sites, years, species, and seed provenance within species. All species tested had increased emergence when buried. However, comparing benefits of burial to the probability of caching by scatterhoarders indicated a mutualism in red oak, while white oak was nearly always antagonistic. Chestnut was variable around the boundary between mutualism and antagonism, indicating a high degree of context dependence in the relationship with scatterhoarders. We found that different seed provenances did not vary in their potential for mutualism. Temperature did not explain microsite differences in seed emergence in any of the species tested. In hybrid chestnut only, emergence on the surface declined with soil moisture in the fall. By quantifying the variation in the conditional mutualism that was not caused by changes in scatterhoarder behavior, we show that environmental conditions and seed traits are an important and underappreciated component of the variation in the relationship between trees and scatterhoarders. © 2018 International Society of Zoological Sciences, Institute of Zoology/Chinese Academy of Sciences and John Wiley & Sons Australia, Ltd.

MLH1-Silenced and Non-Silenced Subgroups of Hypermutated Colorectal Carcinomas Have Distinct Mutational Landscapes

Science.gov (United States)

Donehower, Lawrence A.; Creighton, Chad J.; Schultz, Nikolaus; Shinbrot, Eve; Chang, Kyle; Gunaratne, Preethi H.; Muzny, Donna; Sander, Chris; Hamilton, Stanley R.; Gibbs, Richard A.; Wheeler, David

2014-01-01

Approximately 15% of colorectal carcinomas (CRC) exhibit a hypermutated genotype accompanied by high levels of microsatellite instability (MSI-H) and defects in DNA mismatch repair. These tumors, unlike the majority of colorectal carcinomas, are often diploid, exhibit frequent epigenetic silencing of the MLH1 DNA mismatch repair gene, and have a better clinical prognosis. As an adjunct study to The Cancer Genome Atlas consortium that recently analyzed 224 colorectal cancers by whole exome sequencing, we compared the 35 CRC (15.6%) with a hypermutated genotype to those with a non-hypermutated genotype. We found that 22 (63%) of hypermutated CRC exhibited transcriptional silencing of the MLH1 gene, a high frequency of BRAF V600E gene mutations and infrequent APC and KRAS mutations, a mutational pattern significantly different from their non-hypermutated counterparts. However, the remaining 13 (37%) hypermutated CRC lacked MLH1 silencing, contained tumors with the highest mutation rates (“ultramutated” CRC), and exhibited higher incidences of APC and KRAS mutations, but infrequent BRAF mutations. These patterns were confirmed in an independent validation set of 250 exome-sequenced CRC. Analysis of mRNA and microRNA expression signatures revealed that hypermutated CRC with MLH1 silencing had greatly reduced levels of WNT signaling and increased BRAF signaling relative non-hypermutated CRC. Our findings suggest that hypermutated CRC include one subgroup with fundamentally different pathways to malignancy than the majority of CRC. Examination of MLH1 expression status and frequencies of APC, KRAS, and BRAF mutation in CRC may provide a useful diagnostic tool that could supplement the standard microsatellite instability assays and influence therapeutic decisions. PMID:22899370

[Effect of silencing Bmi-1 expression in reversing cisplatin resistance in lung cancer cells and its mechanism].

Science.gov (United States)

Mao, Nan; He, Guansheng; Rao, Jinjun; Lv, Lin

2014-06-01

To investigate the effect of silencing Bmi-1 expression in reversing cisplatin resistance in human lung cancer cells and explore the possible mechanisms. Cisplatin-resistant A549/DDP cells with small interference RNA (siRNA)-mediated Bmi-1 expression silencing were examined for cisplatin sensitivity using MTT assay and alterations in cell cycle distribution and apoptosis with flow cytometry, and the changes in cell senescence was assessed using β-galactosidase staining. The protein expressions of Bmi-1, P14(ARF), P16(INK4a), P53, P21, Rb and ubi-H2AK119 in the cells were determined with Western blotting. A549/DDP cells showed significantly higher Bmi-1 expression than A549 cells. After siRNA-mediated Bmi-1 silencing, A549/DDP cells showed significantly enhanced cisplatin sensitivity with an increased IC50 from 40.3±4.1 µmol/L to 18.3±2.8 µmol/L (Pcisplatin possibly by regulating INK4a/ARF/Rb senescence pathway.

Eloquent silences: A musical and lexical analysis of conversation between oncologists and their patients.

Science.gov (United States)

Bartels, Josef; Rodenbach, Rachel; Ciesinski, Katherine; Gramling, Robert; Fiscella, Kevin; Epstein, Ronald

2016-10-01

Silences in doctor-patient communication can be "connectional" and communicative, in contrast to silences that indicate awkwardness or distraction. Musical and lexical analyses can identify and characterize connectional silences in consultations between oncologists and patients. Two medical students and a professor of voice screened all 1211 silences over 2s in length from 124 oncology office visits. We developed a "strength of connection" taxonomy and examined ten connectional silences for lexical and musical features including pitch, volume, and speaker turn-taking rhythm. We identified connectional silences with good reliability. Typical dialog rhythms surrounding connectional silences are characterized by relatively equal turn lengths and frequent short vocalizations. We found no pattern of volume and pitch variability around these silences. Connectional silences occurred in a wide variety of lexical contexts. Particular patterns of dialog rhythm mark connectional silences. Exploring structures of connectional silence extends our understanding of the audio-linguistic conditions that mark patient-clinician connection. Communicating with an awareness of pitch, rhythm, and silence - in addition to lexical content - can facilitate shared understanding and emotional connection. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

ANTAGONISM OF A. VIRIDANS TO CONDITIONALLY - PATHOGENIC MICROFLORA OF THE NOSE AND OROPHARYNX OF CHILDREN WITH CARDIAC PATOLOGY

Directory of Open Access Journals (Sweden)

Stepansky D.O.

2015-12-01

Full Text Available Introduction. Search for harmless and simultaneously effective probiotics, which could be successfully used for treatment and prevention of infectious deseases, is currently important. A. viridans is of particular interest, as it is representative of the normal microflora of human with broad spectrum of antibacterial action. The use of this microorganism has a number of advantages: the absence of side effects on the body; high adhesive abilities; resistance to lysozyme in saliva; the ability of use in patients, sensitized to antibiotics and chemotherapeutic drugs; stimulation effects on the human immune system. Material and methods. The purpose of the study was to investigate the antagonism of A. viridans № 167 and autostrains of aerococcuses, isolated at patients, to conditionally - pathogenic microflora of the nose and oropharynx of children with cardiac patology. At the first stage of the study the microflora of the of the nose and oropharynx of 2 investigated categories was examined – 40 children 4-14 years with cardiac patology and 40 healthy children 4-5 years old. The second stage of work was to study the effect of A. viridans on the explored strains. Results and discussion. A. viridans manifests the antagonism to all studied strains of gram-positive and gram-negative microorganisms, except C. albisans. A. viridans antagonistic activity to staphylococci (10 + 3 mm and streptococci (10 + 2mm is at the approximately same level. It is interesting to compare the antagonism of aerococcuses to clinical isolates of S. pyogenes and similar strains from carriers (healthy children category. Impact of aerococcuses on P. mirabilis strain appeared at the highest level. Autosimbionts of A. viridans, isolated from healthy children, are more antagonistic to CPM strains, isolated from these children, than autostrains of A. viridans, isolated from children with with cardiac patology, and higher than the museum strain of A. viridans № 167 antagonism

Measurement of elemental speciation by liquid chromatography -- inductively coupled plasma mass spectrometry (LC-ICP-MS) with the direct injection nebulizer (DIN)

Energy Technology Data Exchange (ETDEWEB)

Shum, Sam [Iowa State Univ., Ames, IA (United States)

1993-05-01

This thesis is divided into 4 parts: elemental speciation, speciation of mercury and lead compounds by microbore column LC-ICP-MS with direct injection nebulization, spatially resolved measurements of size and velocity distributions of aerosol droplets from a direct injection nebulizer, and elemental speciation by anion exchange and size exclusion chromatography with detection by ICP-MS with direct injection nebulization.

The Tetherin Antagonism of the Ebola Virus Glycoprotein Requires an Intact Receptor-Binding Domain and Can Be Blocked by GP1-Specific Antibodies.

Science.gov (United States)

Brinkmann, Constantin; Nehlmeier, Inga; Walendy-Gnirß, Kerstin; Nehls, Julia; González Hernández, Mariana; Hoffmann, Markus; Qiu, Xiangguo; Takada, Ayato; Schindler, Michael; Pöhlmann, Stefan

2016-12-15

The glycoprotein of Ebola virus (EBOV GP), a member of the family Filoviridae, facilitates viral entry into target cells. In addition, EBOV GP antagonizes the antiviral activity of the host cell protein tetherin, which may otherwise restrict EBOV release from infected cells. However, it is unclear how EBOV GP antagonizes tetherin, and it is unknown whether the GP of Lloviu virus (LLOV), a filovirus found in dead bats in Northern Spain, also counteracts tetherin. Here, we show that LLOV GP antagonizes tetherin, indicating that tetherin may not impede LLOV spread in human cells. Moreover, we demonstrate that appropriate processing of N-glycans in tetherin/GP-coexpressing cells is required for tetherin counteraction by EBOV GP. Furthermore, we show that an intact receptor-binding domain (RBD) in the GP1 subunit of EBOV GP is a prerequisite for tetherin counteraction. In contrast, blockade of Niemann-Pick disease type C1 (NPC1), a cellular binding partner of the RBD, did not interfere with tetherin antagonism. Finally, we provide evidence that an antibody directed against GP1, which protects mice from a lethal EBOV challenge, may block GP-dependent tetherin antagonism. Our data, in conjunction with previous reports, indicate that tetherin antagonism is conserved among the GPs of all known filoviruses and demonstrate that the GP1 subunit of EBOV GP plays a central role in tetherin antagonism. Filoviruses are reemerging pathogens that constitute a public health threat. Understanding how Ebola virus (EBOV), a highly pathogenic filovirus responsible for the 2013-2016 Ebola virus disease epidemic in western Africa, counteracts antiviral effectors of the innate immune system might help to define novel targets for antiviral intervention. Similarly, determining whether Lloviu virus (LLOV), a filovirus detected in bats in northern Spain, is inhibited by innate antiviral effectors in human cells might help to determine whether the virus constitutes a threat to humans. The

Glass particles produced by laser ablation for ICP-MSmeasurements

Energy Technology Data Exchange (ETDEWEB)

Gonzalez, J.; Liu, C.; Wen, S.; Mao, X.; Russo, R.E.

2007-06-01

Pulsed laser ablation (266nm) was used to generate glass particles from two sets of standard reference materials using femtosecond (150fs) and nanosecond (4ns) laser pulses with identical fluences of 50 J cm{sup -2}. Scanning electron microscopy (SEM) images of the collected particles revealed that there are more and larger agglomerations of particles produced by nanosecond laser ablation. In contrast to the earlier findings for metal alloy samples, no correlation between the concentration of major elements and the median particle size was found. When the current data on glass were compared with the metal alloy data, there were clear differences in terms of particle size, crater depth, heat affected zone, and ICP-MS response. For example, glass particles were larger than metal alloy particles, the craters in glass were less deep than craters in metal alloys, and damage to the sample was less pronounced in glass compared to metal alloys samples. The femtosecond laser generated more intense ICP-MS signals compared to nanosecond laser ablation for both types of samples, although glass sample behavior was more similar between ns and fs-laser ablation than for metals alloys.

Silencing of flavanone-3-hydroxylase in apple (Malus × domestica Borkh.) leads to accumulation of flavanones, but not to reduced fire blight susceptibility.

Science.gov (United States)

Flachowsky, Henryk; Halbwirth, Heidi; Treutter, Dieter; Richter, Klaus; Hanke, Magda-Viola; Szankowski, Iris; Gosch, Christian; Stich, Karl; Fischer, Thilo C

2012-02-01

Transgenic antisense flavanone-3-hydroxylase apple plants were produced to mimic the effect of the agrochemical prohexadione-Ca on apple leaves. This enzyme inhibitor for 2-oxoglutarate dependent dioxygenases is used as a growth retardant and for control of secondary fire blight of leaves. Like using the agent, silencing of flavanone-3-hydroxylase leads to an accumulation of flavanones in leaves, but in contrast not to the formation of 3-deoxyflavonoids. In prohexadione-Ca treated leaves the 3-deoxyflavonoid luteoforol is formed from accumulating flavanones, acting as an antimicrobial compound against the fire blight pathogen Erwinia amylovora. Seemingly, the silencing of just one of the 2-oxoglutarate dependent dioxygenases (in apple also flavonol synthase and anthocyanidin synthase take part downstream in the pathway) does not provide a sufficiently high ratio of flavanones to dihydroflavonols. This seems to be needed to let the dihydroflavonol-4-reductase/flavanone-4-reductase enzyme reduce flavanones to luteoforol, and to let this be reduced by the leucoanthocyanidin-4-reductase/3-deoxyleucoanthocyanidin-4-reductase, each acting with their respective weak secondary activities. Accordingly, also the intended inducible resistance to fire blight by prohexadione-Ca is not observed with the antisense flavanone-3-hydroxylase apple plants. On the other hand, for most transgenic lines with strong flavanone-4-reductase down-regulation, up-regulation of gene expression for the other flavonoid genes was found. This provides further evidence for the feedback regulation of flavonoid gene expression having been previously reported for the prohexadione-Ca inhibited apple plants. Copyright © 2011 Elsevier Masson SAS. All rights reserved.

The organisational silence of midwives and nurses: reasons and results.

Science.gov (United States)

Yurdakul, Mine; Beşen, Meltem Aydin; Erdoğan, Semra

2016-07-01

The study was conducted to determine the issues about which nurses and midwives remain silent and the reasons for it and the perceived results of silence. Organisational silence is a vitally important issue in the health sector, due to the risks and mistakes that are not reported, and proposals for improvement that are not made. The sample of this descriptive survey, which investigated a cause and effect relationship, was 159 nurses and midwives. The data were collected using a questionnaire and the organisational silence scale. Of the study participants, 84.9% were nurses and 15.1% were midwives. Of all participants 88.7% were women. 8.8% of participants stated that they never remained silent about issues related to work and the workplace. Respondents most often remained silent about issues related to ethics and responsibility. 'Limited improvement and development' was frequently mentioned as a perceived result of organisational silence. Our study determined that organisational silence is quite common among nurses and midwives. Activities that raise the awareness of hospital administrations and employees about preventing the factors that cause and maintain silence in hospitals should be planned. © 2016 John Wiley & Sons Ltd.

The RNA silencing pathway: the bits and pieces that matter.

Directory of Open Access Journals (Sweden)

2005-07-01

Full Text Available Cellular pathways are generally proposed on the basis of available experimental knowledge. The proposed pathways, however, may be inadequate to describe the phenomena they are supposed to explain. For instance, by means of concise mathematical models we are able to reveal shortcomings in the current description of the pathway of RNA silencing. The silencing pathway operates by cleaving siRNAs from dsRNA. siRNAs can associate with RISC, leading to the degradation of the target mRNA. We propose and analyze a few small extensions to the pathway: a siRNA degrading RNase, primed amplification of aberrant RNA pieces, and cooperation between aberrant RNA to trigger amplification. These extensions allow for a consistent explanation for various types of silencing phenomena, such as virus induced silencing, transgene and transposon induced silencing, and avoidance of self-reactivity, as well as for differences found between species groups.

Analysis of nanoparticles using the ICAP Q ICP-MS

DEFF Research Database (Denmark)

Kutscher, Daniel; McSheehy-Ducos, Shona; Lindemann, Torsten

2014-01-01

The analysis of Nanoparticles (NPs) has become one of the hot topics in analytical chemistry. However, detailed knowledge about potential risks or hazards is still unavailable. Two approaches have been developed in recent years using ICP-MS as a detection system: hyphenation of an appropriate...... separation technique like Field-Flow-Fractionation (FFF), or direct analysis using spICP-MS. The separation of particles and particle mixtures using FFF is based on the differing mobilities of different particle sizes in a laminar liquid flow. FFF is compatible for particle sizes in the low nm to low μm...... range and is thus perfectly suited for the separation of different NPs. Combined with other detection systems such as dynamic light scattering, it can provide also additional information about the particles of interest, like shape. In comparison, spICP-MS is able to analyze NPs directly based...

The C. elegans CSR-1 argonaute pathway counteracts epigenetic silencing to promote germline gene expression.

Science.gov (United States)

Seth, Meetu; Shirayama, Masaki; Gu, Weifeng; Ishidate, Takao; Conte, Darryl; Mello, Craig C

2013-12-23

Organisms can develop adaptive sequence-specific immunity by reexpressing pathogen-specific small RNAs that guide gene silencing. For example, the C. elegans PIWI-Argonaute/piwi-interacting RNA (piRNA) pathway recruits RNA-dependent RNA polymerase (RdRP) to foreign sequences to amplify a transgenerational small-RNA-induced epigenetic silencing signal (termed RNAe). Here, we provide evidence that, in addition to an adaptive memory of silenced sequences, C. elegans can also develop an opposing adaptive memory of expressed/self-mRNAs. We refer to this mechanism, which can prevent or reverse RNAe, as RNA-induced epigenetic gene activation (RNAa). We show that CSR-1, which engages RdRP-amplified small RNAs complementary to germline-expressed mRNAs, is required for RNAa. We show that a transgene with RNAa activity also exhibits accumulation of cognate CSR-1 small RNAs. Our findings suggest that C. elegans adaptively acquires and maintains a transgenerational CSR-1 memory that recognizes and protects self-mRNAs, allowing piRNAs to recognize foreign sequences innately, without the need for prior exposure

Determination of Al of Sucralfate in Stomachs by ICP-AES%ICP-AES测定大鼠胃内硫糖铝中的铝

Institute of Scientific and Technical Information of China (English)

李艳; 朱照静

2009-01-01

采用干法灰化,电感耦合等离子体-原子发射光谱法(ICP-AES)测定正常大鼠胃内硫糖铝中的铝量.结果表明,最佳分析波长为396.153nm,检出限为8ng·mL-1,各组内相对标准偏差均小于0.81%,组间相对标准偏差均小于13.4%,铝的回收率在96.0%-99.5%之间,表明ICP-AES测定大鼠胃内硫糖铝中铝的精密度、准确度良好,满足生物样品分析要求.大鼠灌服硫糖铝6h后胃内的铝基本排空,与正常胃排空时间一致,表明硫糖铝中的铝对正常胃粘膜无枯附作用.

mTOR inhibition in macrophages of asymptomatic HIV+ persons reverses the decrease in TLR4-mediated TNFα release through prolongation of MAPK pathway activation1

Science.gov (United States)

Li, Xin; Han, Xinbing; Llano, Juliana; Bole, Medhavi; Zhou, Xiuqin; Swan, Katharine; Anandaiah, Asha; Nelson, Benjamin; Patel, Naimish R.; Reinach, Peter S.; Koziel, Henry; Tachado, Souvenir D.

2011-01-01

Toll-like receptor 4 (TLR4) mediated signaling is significantly impaired in macrophages from HIV+ persons predominantly due to altered MyD88-dependent pathway signaling caused in part by constitutive activation of PI3K. Here we assessed in these macrophages if the blunted increase in TLR4-mediated TNFα release induced by lipid A are associated with PI3K-induced upregulation of mammalian target of rapamycin (mTOR) activity. mTOR inhibition with rapamycin enhanced TLR4-mediated TNFα release, but instead suppressed anti-inflammatory IL-10 release. Targeted gene silencing of mTOR in macrophages resulted in lipid A-induced TNFα and IL-10 release patterns similar to those induced by rapamycin. Rapamycin restored MyD88-IRAK interaction in a dose-dependent manner. Targeted gene silencing of MyD88 (shRNA) and mTOR (RNAi) inhibition resulted in TLR4-mediated p70s6K activation and enhanced TNFα release, whereas IL-10 release was inhibited in both silenced and non-silenced HIV+ macrophages. Furthermore, mTOR inhibition augmented lipid A-induced TNFα release through enhanced and prolonged phosphorylation of ERK1/2 and JNK1/2 MAP kinases, which was associated with time-dependent MKP-1 destabilization. Taken together, impaired TLR4-mediated TNFα release in HIV+ macrophages is attributable in part to mTOR activation by constitutive PI3K expression in a MyD88-dependent signaling pathway. These changes result in MKP-1 stabilization, which shortens and blunts MAP kinase activation. mTOR inhibition may serve as a potential therapeutic target to upregulate macrophage innate immune host defense responsiveness in HIV+ persons. PMID:22025552

Pathways of cellular internalisation of liposomes delivered siRNA and effects on siRNA engagement with target mRNA and silencing in cancer cells.

Science.gov (United States)

Alshehri, Abdullah; Grabowska, Anna; Stolnik, Snow

2018-02-28

Design of an efficient delivery system is a generally recognised bottleneck in translation of siRNA technology into clinic. Despite research efforts, cellular processes that determine efficiency of siRNA silencing achieved by different delivery formulations remain unclear. Here, we investigated the mechanism(s) of cellular internalisation of a model siRNA-loaded liposome system in a correlation to the engagement of delivered siRNA with its target and consequent silencing by adopting siRNA molecular beacon technology. Probing of cellular internalisation pathways by a panel of pharmacological inhibitors indicated that clathrin-mediated (dynamin-dependent) endocytosis, macropinocytosis (dynamine independent), and cell membrane cholesterol dependent process(es) (clathrin and caveolea-independent) all play a role in the siRNA-liposomes internalization. The inhibition of either of these entry routes was, in general, mirrored by a reduction in the level of siRNA engagement with its target mRNA, as well as in a reduction of the target gene silencing. A dramatic increase in siRNA engagement with its target RNA was observed on disruption of endosomal membrane (by chloroquine), accompanied with an increased silencing. The work thus illustrates that employing molecular beacon siRNA technology one can start to assess the target RNA engagement - a stage between initial cellular internalization and final gene silencing of siRNA delivery systems.

Silencing criticism in Mexico

Directory of Open Access Journals (Sweden)

Ximena Suárez

2017-10-01

Full Text Available Journalists and human rights defenders in Mexico are being attacked in an attempt to silence their criticism. Many are forced to flee or risk being assassinated. The consequences are both personal and of wider social significance.

Technical advances in trigger-induced RNA interference gene silencing in the parasite Entamoeba histolytica.

Science.gov (United States)

Khalil, Mohamed I; Foda, Bardees M; Suresh, Susmitha; Singh, Upinder

2016-03-01

Entamoeba histolytica has a robust endogenous RNA interference (RNAi) pathway. There are abundant 27 nucleotide (nt) anti-sense small RNAs (AS sRNAs) that target genes for silencing and the genome encodes many genes involved in the RNAi pathway such as Argonaute proteins. Importantly, an E. histolytica gene with numerous AS sRNAs can function as a "trigger" to induce silencing of a gene that is fused to the trigger. Thus, the amebic RNAi pathway regulates gene expression relevant to amebic biology and has additionally been harnessed as a tool for genetic manipulation. In this study we have further improved the trigger-induced gene silencing method. We demonstrate that rather than using the full-length gene, a short portion of the coding region fused to a trigger is sufficient to induce silencing; the first 537 bp of the E. histolytica rhomboid gene (EhROM1) fused in-frame to the trigger was sufficient to silence EhROM1. We also demonstrated that the trigger method could silence two amebic genes concomitantly; fusion of the coding regions of EhROM1 and transcription factor, EhMyb, in-frame to a trigger gene resulted in both genes being silenced. Alternatively, two genes can be silenced sequentially: EhROM1-silenced parasites with no drug selection plasmid were transfected with trigger-EhMyb, resulting in parasites with both EhROM1 and EhMyb silenced. With all approaches tested, the trigger-mediated silencing was substantive and silencing was maintained despite loss of the G418 selectable marker. All gene silencing was associated with generation of AS sRNAs to the silenced gene. We tested the reversibility of the trigger system using inhibitors of histone modifications but found that the silencing was highly stable. This work represents a technical advance in the trigger gene silencing method in E. histolytica. Approaches that readily silence multiple genes add significantly to the genetic toolkit available to the ameba research community. Copyright © 2016

Reconceptualizing synergism and antagonism among multiple stressors

OpenAIRE

Piggott, Jeremy J; Townsend, Colin R; Matthaei, Christoph D

2015-01-01

The potential for complex synergistic or antagonistic interactions between multiple stressors presents one of the largest uncertainties when predicting ecological change but, despite common use of the terms in the scientific literature, a consensus on their operational definition is still lacking. The identification of synergism or antagonism is generally straightforward when stressors operate in the same direction, but if individual stressor effects oppose each other, the definition of syner...

Can we trust mass spectrometry for determination of arsenic peptides in plants: comparison of LC-ICP-MS and LC-ES-MS/ICP-MS with XANES/EXAFS in analysis of Thunbergia alata.

Science.gov (United States)

Bluemlein, Katharina; Raab, Andrea; Meharg, Andrew A; Charnock, John M; Feldmann, Jörg

2008-04-01

The weakest step in the analytical procedure for speciation analysis is extraction from a biological material into an aqueous solution which undergoes HPLC separation and then simultaneous online detection by elemental and molecular mass spectrometry (ICP-MS/ES-MS). This paper describes a study to determine the speciation of arsenic and, in particular, the arsenite phytochelatin complexes in the root from an ornamental garden plant Thunbergia alata exposed to 1 mg As L(-1) as arsenate. The approach of formic acid extraction followed by HPLC-ES-MS/ICP-MS identified different As(III)-PC complexes in the extract of this plant and made their quantification via sulfur (m/z 32) and arsenic (m/z 75) possible. Although sulfur sensitivity could be significantly increased when xenon was used as collision gas in ICP-qMS, or when HR-ICP-MS was used in medium resolution, the As:S ratio gave misleading results in the identification of As(III)-PC complexes due to the relatively low resolution of the chromatography system in relation to the variety of As-peptides in plants. Hence only the parallel use of ES-MS/ICP-MS was able to prove the occurrence of such arsenite phytochelatin complexes. Between 55 and 64% of the arsenic was bound to the sulfur of peptides mainly as As(III)(PC(2))(2), As(III)(PC(3)) and As(III)(PC(4)). XANES (X-ray absorption near-edge spectroscopy) measurement, using the freshly exposed plant root directly, confirmed that most of the arsenic is trivalent and binds to S of peptides (53% As-S) while 38% occurred as arsenite and only 9% unchanged as arsenate. EXAFS data confirmed that As-S and As-O bonds occur in the plants. This study confirms, for the first time, that As-peptides can be extracted by formic acid and chromatographically separated on a reversed-phase column without significant decomposition or de-novo synthesis during the extraction step.

Quality and Safety of Home ICP Monitoring Compared with In-Hospital Monitoring

DEFF Research Database (Denmark)

Andresen, Morten; Juhler, Marianne; Munch, Tina Nørgaard

2012-01-01

Introduction: Intracranial pressure (ICP) monitoring is usually conducted in-hospital using stationary devices. Modern mobile ICP monitoring systems present new monitoring possibilities more closely following the patients' daily life. We reviewed patient safety, quality of technical data...

Plasmodium falciparum var Gene Silencing Is Determined by cis DNA Elements That Form Stable and Heritable Interactions ▿

Science.gov (United States)

Swamy, Lakshmi; Amulic, Borko; Deitsch, Kirk W.

2011-01-01

Antigenic variation in the human malaria parasite Plasmodium falciparum depends on the transcriptional regulation of the var gene family. In each individual parasite, mRNA is expressed exclusively from 1 var gene out of ∼60, while the rest of the genes are transcriptionally silenced. Both modifications to chromatin structure and DNA regulatory elements associated with each var gene have been implicated in the organization and maintenance of the silent state. Whether silencing is established at the level of entire chromosomal regions via heterochromatin spreading or at the level of individual var promoters through the action of a silencing element within each var intron has been debated. Here, we consider both possibilities, using clonal parasite lines carrying chromosomally integrated transgenes. We confirm a previous finding that the loss of an adjacent var intron results in var promoter activation and further show that transcriptional activation of a var promoter within a cluster does not affect the transcriptional activity of neighboring var promoters. Our results provide more evidence for the hypothesis that var genes are primarily silenced at the level of an individual gene, rather than by heterochromatin spreading. We also tested the intrinsic directionality of an intron's silencing effect on upstream or downstream var promoters. We found that an intron is capable of silencing in either direction and that, once established, a var promoter-intron pair is stably maintained through many generations, suggesting a possible role in epigenetic memory. This study provides insights into the regulation of endogenous var gene clusters. PMID:21317310

Suppressors of RNA silencing encoded by tomato leaf curl ...

Indian Academy of Sciences (India)

2013-01-06

Jan 6, 2013 ... Virus encoded RNA-silencing suppressors (RSSs) are the key components evolved by the viruses to ... severe disease symptom in the host (Briddon et al. ..... Voinnet O 2001 RNA silencing as a plant immune system against.

Extraction techniques for arsenic species in rice flour and their speciation by HPLC-ICP-MS.

Science.gov (United States)

Narukawa, Tomohiro; Suzuki, Toshihiro; Inagaki, Kazumi; Hioki, Akiharu

2014-12-01

The extraction of arsenic (As) species present in rice flour samples was investigated using different extracting solvents, and the concentration of each species was determined by HPLC-ICP-MS after heat-assisted extraction. The extraction efficiencies for total arsenic species and especially for arsenite [As(III)] and arsenate [As(V)] were investigated. As(III), As(V) and dimethylarsinic acid (DMAA) were found in the samples, and the concentration of DMAA did not vary with treatment conditions. However, the concentrations of extracted total arsenic and those of As(III) and As(V) depended on the extracting solvents. When an extracting solvent was highly acidic, the concentrations of extracted total arsenic were in good agreement with the total arsenic concentration determined by ICP-MS after microwave-assisted digestion, though a part of the As(V) was reduced to As(III) during the highly acidic extraction process. Extraction under neutral conditions increased the extracted As(V), but extracted total arsenic was decreased because a part of the As(III) could not be extracted. Optimum conditions for the extraction of As(III) and As(V) from rice flour samples are discussed to allow the accurate determinations of As(III), As(V) and DMAA in the rice flour samples. Heat block extraction techniques using 0.05 mol L(-1) HClO4 and silver-containing 0.15 mol L(-1) HNO3 were also developed. Copyright © 2014 Elsevier B.V. All rights reserved.

RNA Silencing in Plants: Mechanisms, Technologies and Applications in Horticultural Crops.

Science.gov (United States)

Guo, Qigao; Liu, Qing; Smith, Neil A; Liang, Guolu; Wang, Ming-Bo

2016-12-01

Understanding the fundamental nature of a molecular process or a biological pathway is often a catalyst for the development of new technologies in biology. Indeed, studies from late 1990s to early 2000s have uncovered multiple overlapping but functionally distinct RNA silencing pathways in plants, including the posttranscriptional microRNA and small interfering RNA pathways and the transcriptional RNA-directed DNA methylation pathway. These findings have in turn been exploited for developing artificial RNA silencing technologies such as hairpin RNA, artificial microRNA, intrinsic direct repeat, 3' UTR inverted repeat, artificial trans-acting siRNA, and virus-induced gene silencing technologies. Some of these RNA silencing technologies, such as the hairpin RNA technology, have already been widely used for genetic improvement of crop plants in agriculture. For horticultural plants, RNA silencing technologies have been used to increase disease and pest resistance, alter plant architecture and flowering time, improve commercial traits of fruits and flowers, enhance nutritional values, remove toxic compounds and allergens, and develop high-value industrial products. In this article we aim to provide an overview of the RNA silencing pathways in plants, summarize the existing RNA silencing technologies, and review the current progress in applying these technologies for the improvement of agricultural crops particularly horticultural crops.

Speciation of the plutonium at trace levels by capillary electrophoresis-ICP-MS coupling

International Nuclear Information System (INIS)

Ambard, Ch.

2007-01-01

The CE-ICP-MS coupling allowed the development of new analytical methods for the study of plutonium speciation at trace levels including complexation studies of this element by organic and inorganic ligands. First, a method, called dual detection, based on the simultaneous use of the UV-Visible spectrophotometer integrated in the capillary electrophoresis and the ICPMS was developed and validated. It allows the unambiguous determination of electrophoretic mobilities for separated chemical species and gives a powerful tool for speciation studies. Then, the influence on plutonium redox speciation of the buffer from the background electrolyte was evaluated. This study showed the implications of the electrolyte constituents' choice on plutonium redox equilibrium in the sample. Furthermore, the CE-ICP-MS coupling was used for studying the plutonium complexation at trace levels by some organic (NTA and DTPA) and inorganic ligands (carbonates). The behaviour of plutonium valence +III, +IV and +VI was studied in the presence of buffer at near neutral pH. Different species of plutonium were observed depending on the initial oxidation state of the plutonium. This study showed the potential of poly-amino-carboxylic acids, such as NTA and DTPA, for dissolving plutonium precipitates, regardless its initial speciation. Finally, the carbonation of pentavalent neptunium, as an analogue of Pu(V), was achieved at very low concentration of Np (10 -8 mol.L -1 ). The formation constant of NpO 2 (CO 3 )- at 25 deg. C and 2,5 x 10 -2 mol.L -1 ionic strength was measured by CE-ICP-MS and found to be consistent with literature data. (author)

Antagonism in the carbon footprint between beef and dairy ...

African Journals Online (AJOL)

The higher increase in production (milk) of intensive dairy cows, compared to the increase in production (calf weight) of intensive beef cows, explains the antagonism in the carbon footprint between different beef and dairy production systems. Unfortunately, carbon sequestration estimates have been neglected and thus the ...

Stability of RNA silencing-based traits after virus infection

DEFF Research Database (Denmark)

Jørgensen, Bodil; Albrechtsen, Merete

2007-01-01

with constructs based on virus coat protein (CP) genes or other viral genes has been successfully used to engineer PTGS-mediated virus resistance into a large number of crop plants and some transgenic lines have been commercially exploited. However the discovery that plant viruses encode suppressors of gene...... silencing has raised concerns that virus infection of crop plants might reverse the new silencing-based traits. Most studies of virus suppression of silencing have used model systems based on silencing of reporter genes. A few studies have analysed the effects of virus infections on plants with genetically...... engineered virus resistance based on either a simple sense or an inverted repeat construct. We decided to use genetically engineered virus resistance in potato as a model system for further studies of the effect of virus infection on genetically engineered traits. We present for the first time a comparison...

Characterization of arsenic-contaminated aquifer sediments from eastern Croatia by ion microbeam, PIXE and ICP-OES techniques

Energy Technology Data Exchange (ETDEWEB)

Ujević Bošnjak, M., E-mail: magdalena.ujevic@hzjz.hr [Croatian National Institute of Public Health, Rockefelerova 7, 10000 Zagreb (Croatia); Fazinić, S. [Institute Ruđer Bošković, Bijenička cesta, 10000 Zagreb (Croatia); Duić, Ž. [University of Zagreb, Faculty of Mining, Geology and Petroleum Engineering, Pierottijeva 6, Zagreb (Croatia)

2013-10-01

Highlights: •ICP-OES and PIXE used in the characterization of As-contaminated sediments. •Observed high correlations between the results obtained by those techniques. •Discrepancies observed for Mn, and for the highest As concentrations. •Microbeam analyses showed As association with sulphides and iron. -- Abstract: Groundwater arsenic contamination has been evidenced in eastern Croatia and hydrochemical results suggest that the occurrence of arsenic in the groundwater depends on the local geology, hydrogeology, and geochemical characteristics of the aquifer. In order to perform the sediment characterization and to investigate arsenic association with the other elements in the sediments, 10 samples from two boreholes (PVc-3 and Gundinci 1) in eastern Croatia were analyzed using two techniques: PIXE (without sample pre-treatment) and ICP-OES (after digestion), as well by ion microbeam analyses. The results of the PIXE and ICP-OES techniques showed quite good agreement; however, greater discrepancies were observed at the higher arsenic and manganese mass ratios. According to both techniques, higher As mass ratios were observed in the sediments from the PVc-3 core (up to 651 mg/kg and 491 mg/kg using PIXE and ICP-OES analyses respectively) than from the Gundinci 1 core (up to 60 mg/kg using both techniques). Although arsenic association with Fe is expected, no correlation was observed. The microbeam analyses demonstrated that arsenic is associated with sulphides and iron in the most As-contaminated sample from the PVc-3 core, while this relationship was not evident in the most As-contaminated sample from the Gundinci 1 borehole.

Characterization of arsenic-contaminated aquifer sediments from eastern Croatia by ion microbeam, PIXE and ICP-OES techniques

International Nuclear Information System (INIS)

Ujević Bošnjak, M.; Fazinić, S.; Duić, Ž.

2013-01-01

Highlights: •ICP-OES and PIXE used in the characterization of As-contaminated sediments. •Observed high correlations between the results obtained by those techniques. •Discrepancies observed for Mn, and for the highest As concentrations. •Microbeam analyses showed As association with sulphides and iron. -- Abstract: Groundwater arsenic contamination has been evidenced in eastern Croatia and hydrochemical results suggest that the occurrence of arsenic in the groundwater depends on the local geology, hydrogeology, and geochemical characteristics of the aquifer. In order to perform the sediment characterization and to investigate arsenic association with the other elements in the sediments, 10 samples from two boreholes (PVc-3 and Gundinci 1) in eastern Croatia were analyzed using two techniques: PIXE (without sample pre-treatment) and ICP-OES (after digestion), as well by ion microbeam analyses. The results of the PIXE and ICP-OES techniques showed quite good agreement; however, greater discrepancies were observed at the higher arsenic and manganese mass ratios. According to both techniques, higher As mass ratios were observed in the sediments from the PVc-3 core (up to 651 mg/kg and 491 mg/kg using PIXE and ICP-OES analyses respectively) than from the Gundinci 1 core (up to 60 mg/kg using both techniques). Although arsenic association with Fe is expected, no correlation was observed. The microbeam analyses demonstrated that arsenic is associated with sulphides and iron in the most As-contaminated sample from the PVc-3 core, while this relationship was not evident in the most As-contaminated sample from the Gundinci 1 borehole

Accurate determination of sulfur in gasoline and related fuel samples using isotope dilution ICP-MS with direct sample injection and microwave-assisted digestion.

Science.gov (United States)

Heilmann, Jens; Boulyga, Sergei F; Heumann, Klaus G

2004-09-01

Inductively coupled plasma isotope-dilution mass spectrometry (ICP-IDMS) with direct injection of isotope-diluted samples into the plasma, using a direct injection high-efficiency nebulizer (DIHEN), was applied for accurate sulfur determinations in sulfur-free premium gasoline, gas oil, diesel fuel, and heating oil. For direct injection a micro-emulsion consisting of the corresponding organic sample and an aqueous 34S-enriched spike solution with additions of tetrahydronaphthalene and Triton X-100, was prepared. The ICP-MS parameters were optimized with respect to high sulfur ion intensities, low mass-bias values, and high precision of 32S/34S ratio measurements. For validation of the DIHEN-ICP-IDMS method two certified gas oil reference materials (BCR 107 and BCR 672) were analyzed. For comparison a wet-chemical ICP-IDMS method was applied with microwave-assisted digestion using decomposition of samples in a closed quartz vessel inserted into a normal microwave system. The results from both ICP-IDMS methods agree well with the certified values of the reference materials and also with each other for analyses of other samples. However, the standard deviation of DIHEN-ICP-IDMS was about a factor of two higher (5-6% RSD at concentration levels above 100 mircog g(-1)) compared with those of wet-chemical ICP-IDMS, mainly due to inhomogeneities of the micro-emulsion, which causes additional plasma instabilities. Detection limits of 4 and 18 microg g(-1) were obtained for ICP-IDMS in connection with microwave-assisted digestion and DIHEN-ICP-IDMS, respectively, with a sulfur background of the used Milli-Q water as the main limiting factor for both methods.

Accurate determination of sulfur in gasoline and related fuel samples using isotope dilution ICP-MS with direct sample injection and microwave-assisted digestion

Energy Technology Data Exchange (ETDEWEB)

Heilmann, Jens; Boulyga, Sergei F.; Heumann, Klaus G. [Johannes Gutenberg-University, Institute of Inorganic Chemistry and Analytical Chemistry, Mainz (Germany)

2004-09-01

Inductively coupled plasma isotope-dilution mass spectrometry (ICP-IDMS) with direct injection of isotope-diluted samples into the plasma, using a direct injection high-efficiency nebulizer (DIHEN), was applied for accurate sulfur determinations in sulfur-free premium gasoline, gas oil, diesel fuel, and heating oil. For direct injection a micro-emulsion consisting of the corresponding organic sample and an aqueous {sup 34}S-enriched spike solution with additions of tetrahydronaphthalene and Triton X-100, was prepared. The ICP-MS parameters were optimized with respect to high sulfur ion intensities, low mass-bias values, and high precision of {sup 32}S/{sup 34}S ratio measurements. For validation of the DIHEN-ICP-IDMS method two certified gas oil reference materials (BCR 107 and BCR 672) were analyzed. For comparison a wet-chemical ICP-IDMS method was applied with microwave-assisted digestion using decomposition of samples in a closed quartz vessel inserted into a normal microwave system. The results from both ICP-IDMS methods agree well with the certified values of the reference materials and also with each other for analyses of other samples. However, the standard deviation of DIHEN-ICP-IDMS was about a factor of two higher (5-6% RSD at concentration levels above 100 {mu}g g{sup -1}) compared with those of wet-chemical ICP-IDMS, mainly due to inhomogeneities of the micro-emulsion, which causes additional plasma instabilities. Detection limits of 4 and 18 {mu}g g{sup -1} were obtained for ICP-IDMS in connection with microwave-assisted digestion and DIHEN-ICP-IDMS, respectively, with a sulfur background of the used Milli-Q water as the main limiting factor for both methods. (orig.)

Antagonism by hemoglobin of effects induced by L-arginine in neuromuscular preparations from rats

Directory of Open Access Journals (Sweden)

C.R. Ambiel

2001-04-01

Full Text Available Nitric oxide (NO-synthase is present in diaphragm, phrenic nerve and vascular smooth muscle. It has been shown that the NO precursor L-arginine (L-Arg at the presynaptic level increases the amplitude of muscular contraction (AMC and induces tetanic fade when the muscle is indirectly stimulated at low and high frequencies, respectively. However, the precursor in muscle reduces AMC and maximal tetanic fade when the preparations are stimulated directly. In the present study the importance of NO synthesized in different tissues for the L-Arg-induced neuromuscular effects was investigated. Hemoglobin (50 nM did not produce any neuromuscular effect, but antagonized the increase in AMC and tetanic fade induced by L-Arg (9.4 mM in rat phrenic nerve-diaphragm preparations. D-Arg (9.4 mM did not produce any effect when preparations were stimulated indirectly at low or high frequency. Hemoglobin did not inhibit the decrease of AMC or the reduction in maximal tetanic tension induced by L-Arg in preparations previously paralyzed with d-tubocurarine and directly stimulated. Since only the presynaptic effects induced by L-Arg were antagonized by hemoglobin, the present results suggest that NO synthesized in muscle acts on nerve and skeletal muscle. Nevertheless, NO produced in nerve and vascular smooth muscle does not seem to act on skeletal muscle.

C-terminal region of herpes simplex virus ICP8 protein needed for intranuclear localization

International Nuclear Information System (INIS)

Taylor, Travis J; Knipe, David M.

2003-01-01

The herpes simplex virus single-stranded DNA-binding protein, ICP8, localizes initially to structures in the nucleus called prereplicative sites. As replication proceeds, these sites mature into large globular structures called replication compartments. The details of what signals or proteins are involved in the redistribution of viral and cellular proteins within the nucleus between prereplicative sites and replication compartments are poorly understood; however, we showed previously that the dominant-negative d105 ICP8 does not localize to prereplicative sites and prevents the localization of other viral proteins to prereplicative sites (J. Virol. 74 (2000) 10122). Within the residues deleted in d105 (1083 to 1168), we identified a region between amino acid residues 1080 and 1135 that was predicted by computer models to contain two α-helices, one with considerable amphipathic nature. We used site-specific and random mutagenesis techniques to identify residues or structures within this region that are required for proper ICP8 localization within the nucleus. Proline substitutions in the predicted helix generated ICP8 molecules that did not localize to prereplicative sites and acted as dominant-negative inhibitors. Other substitutions that altered the charged residues in the predicted α-helix to alanine or leucine residues had little or no effect on ICP8 intranuclear localization. The predicted α-helix was dispensable for the interaction of ICP8 with the U L 9 origin-binding protein. We propose that this C-terminal α-helix is required for localization of ICP8 to prereplicative sites by binding viral or cellular factors that target or retain ICP8 at specific intranuclear sites

AGO6 functions in RNA-mediated transcriptional gene silencing in shoot and root meristems in Arabidopsis thaliana.

Directory of Open Access Journals (Sweden)

Changho Eun

Full Text Available RNA-directed DNA methylation (RdDM is a small interfering RNA (siRNA-mediated epigenetic modification that contributes to transposon silencing in plants. RdDM requires a complex transcriptional machinery that includes specialized RNA polymerases, named Pol IV and Pol V, as well as chromatin remodelling proteins, transcription factors, RNA binding proteins, and other plant-specific proteins whose functions are not yet clarified. In Arabidopsis thaliana, DICER-LIKE3 and members of the ARGONAUTE4 group of ARGONAUTE (AGO proteins are involved, respectively, in generating and using 24-nt siRNAs that trigger methylation and transcriptional gene silencing of homologous promoter sequences. AGO4 is the main AGO protein implicated in the RdDM pathway. Here we report the identification of the related AGO6 in a forward genetic screen for mutants defective in RdDM and transcriptional gene silencing in shoot and root apical meristems in Arabidopsis thaliana. The identification of AGO6, and not AGO4, in our screen is consistent with the primary expression of AGO6 in shoot and root growing points.

Antiviral RNA silencing suppression activity of Tomato spotted wilt virus NSs protein.

Science.gov (United States)

Ocampo Ocampo, T; Gabriel Peralta, S M; Bacheller, N; Uiterwaal, S; Knapp, A; Hennen, A; Ochoa-Martinez, D L; Garcia-Ruiz, H

2016-06-17

In addition to regulating gene expression, RNA silencing is an essential antiviral defense system in plants. Triggered by double-stranded RNA, silencing results in degradation or translational repression of target transcripts. Viruses are inducers and targets of RNA silencing. To condition susceptibility, most plant viruses encode silencing suppressors that interfere with this process, such as the Tomato spotted wilt virus (TSWV) NSs protein. The mechanism by which NSs suppresses RNA silencing and its role in viral infection and movement remain to be determined. We cloned NSs from the Hawaii isolate of TSWV and using two independent assays show for the first time that this protein restored pathogenicity and supported the formation of local infection foci by suppressor-deficient Turnip mosaic virus and Turnip crinkle virus. Demonstrating the suppression of RNA silencing directed against heterologous viruses establishes the foundation to determine the means used by NSs to block this antiviral process.

Arctigenin antagonizes mineralocorticoid receptor to inhibit the transcription of Na/K-ATPase.

Science.gov (United States)

Cheng, Ye; Zhou, Meili; Wang, Yan

2016-01-01

Hypertension is one of the most important risk factors in cardiovascular disease and is the most common chronic disease. Mineralocorticoid receptor (MR) antagonists have been successfully used in clinic for the treatment of hypertension. Our study aims to investigate whether Arctigenin can antagonize MR and inhibit the transcription of Na/K-ATPase. The yeast two-hybrid assay was used to screen natural products and Arctigenin was identified as an MR antagonist. The direct binding of Arctigenin to MR was determined using assays based on surface plasmon resonance, differential scanning calorimetry and fluorescence quenching. Furthermore, results from mammalian one-hybrid and transcriptional activation experiments also confirmed that Arctigenin can potently antagonize MR in cells. We demonstrated that Arctigenin can decrease the level of Na/K-ATPase mRNA by antagonizing MR in HK-2 cells. Our findings show that Arctigenin can effectively decrease Na/K-ATPase transcription; thus highlight its potential as an anti-hypertensive drug lead compound. Our current findings demonstrate that Arctigenin is an antagonist of MR and effectively decreases the Na/K-ATPase 1 gene expression. Our work provides a hint for the drug discovery against cardiovascular disease.

Fundamental and applied measurements in ICP MS

International Nuclear Information System (INIS)

Carter, Julian Robert

2002-01-01

Fundamental and applied aspects of ICP-MS have been investigated to gain an increased understanding of the technique and improve on its analytical capabilities. Dissociation temperatures of polyatomic ions were calculated using a double-focusing sector instrument, to obtain more reliable mass spectral data with controlled vapour introduction via a Dreschel bottle to allow accurate calculation of the ingredients in the plasma. The equilibrium temperature for the plasma, operated at 1280 W calculated using CO + and C 2 + as the thermometric probes, was c.a. 5800 - 7400 K, while using ArO + and ArC + as the thermometric probes the temperature calculated was c.a. 2000 - 7000 K. Calculated dissociation temperatures were used to elucidate the site of formation of these ions. Results confirmed that strongly bound ions such as CO + and C 2 + were formed in the plasma whereas weakly bound ions such as ArO + and ArC + were formed in the interface region due to gross deviation of the calculated temperatures from those expected for a system in thermal equilibrium. The use of helium gas in a hexapole collision cell attenuated the signals of ArH + Ar + , ArO + , ArC + , ArCl + and Ar 2 + allowing improved determination of 39 K + , 40 Ca + , 56 Fe + , 52 Cr + , 75 As + and 80 Se + in standard solutions. The use of the hexapole collision cell also resulted in an enhancement of analyte signals due to the thermalisation of the ion beam. The ion kinetic energy of ions sampled from the plasma and those sampled from the skimmer cone were determined using a modified lens stack to assess the significance for memory effects of material deposited on the skimmer cone. The most probable kinetic energy of Be + ions sampled from the skimmer cone was found to be 2.4 eV, which was considerably lower than the most probable kinetic energy of Be + ions sampled from the plasma, which was found to be 9.5 eV. The low kinetic energy of the ions deposited on the skimmer cone means they will only

Application of isotope-dilution laser ablation ICP-MS for direct determination of Pu concentrations in soils at pg g(-1) levels.

Science.gov (United States)

Boulyga, Sergei F; Tibi, Markus; Heumann, Klaus G

2004-01-01

The methods available for determination of environmental contamination by plutonium at ultra-trace levels require labor-consuming sample preparation including matrix removal and plutonium extraction in both nuclear spectroscopy and mass spectrometry. In this work, laser-ablation inductively coupled plasma mass spectrometry (LA-ICP-MS) was applied for direct analysis of Pu in soil and sediment samples. Application of a LINA-Spark-Atomizer system (a modified laser ablation system providing high ablation rates) coupled with a sector-field ICP-MS resulted in detection limits as low as 3x10(-13) g g(-1) for Pu isotopes in soil samples containing uranium at a concentration of a few microg g(-1). The isotope dilution (ID) technique was used for quantification, which compensated for matrix effects in LA-ICP-MS. Interferences by UH+ and PbO2+ ions and by the peak tail of 238U+ ions were reduced or separated by use of dry plasma conditions and a mass resolution of 4000, respectively. No other effects affecting measurement accuracy, except sample inhomogeneity, were revealed. Comparison of results obtained for three contaminated soil samples by use of alpha-spectrometry, ICP-MS with sample decomposition, and LA-ICP-IDMS showed, in general, satisfactory agreement of the different methods. The specific activity of (239+240)Pu (9.8 +/- 3.0 mBq g(-1)) calculated from LA-ICP-IDMS analysis of SRM NIST 4357 coincided well with the certified value of 10.4 +/- 0.2 mBq g(-1). However, the precision of LA-ICP-MS for determination of plutonium in inhomogeneous samples, i.e. if "hot" particles are present, is limited. As far as we are aware this paper reports the lowest detection limits and element concentrations yet measured in direct LA-ICP-MS analysis of environmental samples.

Application of isotope-dilution laser ablation ICP-MS for direct determination of Pu concentrations in soils at pg g-1 levels

International Nuclear Information System (INIS)

Boulyga, Sergei F.; Tibi, Markus; Heumann, Klaus G.

2004-01-01

The methods available for determination of environmental contamination by plutonium at ultra-trace levels require labor-consuming sample preparation including matrix removal and plutonium extraction in both nuclear spectroscopy and mass spectrometry. In this work, laser-ablation inductively coupled plasma mass spectrometry (LA-ICP-MS) was applied for direct analysis of Pu in soil and sediment samples. Application of a LINA-Spark-Atomizer system (a modified laser ablation system providing high ablation rates) coupled with a sector-field ICP-MS resulted in detection limits as low as 3 x 10 -13 g g -1 for Pu isotopes in soil samples containing uranium at a concentration of a few μg g -1 . The isotope dilution (ID) technique was used for quantification, which compensated for matrix effects in LA-ICP-MS. Interferences by UH + and PbO 2 + ions and by the peak tail of 238 U + ions were reduced or separated by use of dry plasma conditions and a mass resolution of 4000, respectively. No other effects affecting measurement accuracy, except sample inhomogeneity, were revealed. Comparison of results obtained for three contaminated soil samples by use of α-spectrometry, ICP-MS with sample decomposition, and LA-ICP-IDMS showed, in general, satisfactory agreement of the different methods. The specific activity of 239+240 Pu (9.8±3.0 mBq g -1 ) calculated from LA-ICP-IDMS analysis of SRM NIST 4357 coincided well with the certified value of 10.4±0.2 mBq g -1 . However, the precision of LA-ICP-MS for determination of plutonium in inhomogeneous samples, i.e. if ''hot'' particles are present, is limited. As far as we are aware this paper reports the lowest detection limits and element concentrations yet measured in direct LA-ICP-MS analysis of environmental samples. (orig.)

Maternal Silences: Motherhood and Voluntary Childlessness in Contemporary Christianity

Directory of Open Access Journals (Sweden)

Dawn Llewellyn

2016-06-01

Full Text Available In Christianity, there is an ideology of motherhood that pervades scripture, ritual, and doctrine, yet there is an academic silence that means relatively little space has been given to motherhood and mothering, and even less to voluntary childlessness, from a faith perspective. By drawing on qualitative in-depth interviews with Christian women living in Britain, narrating their experiences of motherhood and voluntary childlessness, I suggest there are also lived maternal silences encountered by women in contemporary Christianity. There is a maternal expectation produced through church teaching, liturgy and culture that constructs women as ‘maternal bodies’ (Gatrell 2008; this silences and marginalises women from articulating their complex relationship with religion, motherhood, and childlessness in ways that challenge their spiritual development. However, this article also introduces the everyday and intentional tactics women employ to disrupt the maternal expectation, and hereby interrupt the maternal silence.

Antagonizing Effects of Aspartic Acid against Ultraviolet A-Induced Downregulation of the Stemness of Human Adipose Tissue-Derived Mesenchymal Stem Cells.

Directory of Open Access Journals (Sweden)

Kwangseon Jung

Full Text Available Ultraviolet A (UVA irradiation is responsible for a variety of changes in cell biology. The purpose of this study was to investigate effects of aspartic acid on UVA irradiation-induced damages in the stemness properties of human adipose tissue-derived mesenchymal stem cells (hAMSCs. Furthermore, we elucidated the UVA-antagonizing mechanisms of aspartic acid. The results of this study showed that aspartic acid attenuated the UVA-induced reduction of the proliferative potential and stemness of hAMSCs, as evidenced by increased proliferative activity in the 3-(4,5-dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide (MTT assay and upregulation of stemness-related genes OCT4, NANOG, and SOX2 in response to the aspartic acid treatment. UVA-induced reduction in the mRNA level of hypoxia-inducible factor (HIF-1α was also significantly recovered by aspartic acid. In addition, the antagonizing effects of aspartic acid against the UVA effects were found to be mediated by reduced production of PGE2 through the inhibition of JNK and p42/44 MAPK. Taken together, these findings show that aspartic acid improves reduced stemness of hAMSCs induced by UVA and its effects are mediated by upregulation of HIF-1α via the inhibition of PGE2-cAMP signaling. In addition, aspartic acid may be used as an antagonizing agent to mitigate the effects of UVA.

Antagonizing Effects of Aspartic Acid against Ultraviolet A-Induced Downregulation of the Stemness of Human Adipose Tissue-Derived Mesenchymal Stem Cells.

Science.gov (United States)

Jung, Kwangseon; Cho, Jae Youl; Soh, Young-Jin; Lee, Jienny; Shin, Seoung Woo; Jang, Sunghee; Jung, Eunsun; Kim, Min Hee; Lee, Jongsung

2015-01-01

Ultraviolet A (UVA) irradiation is responsible for a variety of changes in cell biology. The purpose of this study was to investigate effects of aspartic acid on UVA irradiation-induced damages in the stemness properties of human adipose tissue-derived mesenchymal stem cells (hAMSCs). Furthermore, we elucidated the UVA-antagonizing mechanisms of aspartic acid. The results of this study showed that aspartic acid attenuated the UVA-induced reduction of the proliferative potential and stemness of hAMSCs, as evidenced by increased proliferative activity in the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay and upregulation of stemness-related genes OCT4, NANOG, and SOX2 in response to the aspartic acid treatment. UVA-induced reduction in the mRNA level of hypoxia-inducible factor (HIF)-1α was also significantly recovered by aspartic acid. In addition, the antagonizing effects of aspartic acid against the UVA effects were found to be mediated by reduced production of PGE2 through the inhibition of JNK and p42/44 MAPK. Taken together, these findings show that aspartic acid improves reduced stemness of hAMSCs induced by UVA and its effects are mediated by upregulation of HIF-1α via the inhibition of PGE2-cAMP signaling. In addition, aspartic acid may be used as an antagonizing agent to mitigate the effects of UVA.

Rtt107/Esc4 binds silent chromatin and DNA repair proteins using different BRCT motifs

Directory of Open Access Journals (Sweden)

Jockusch Rebecca A

2006-11-01

Full Text Available Abstract Background By screening a plasmid library for proteins that could cause silencing when targeted to the HMR locus in Saccharomyces cerevisiae, we previously reported the identification of Rtt107/Esc4 based on its ability to establish silent chromatin. In this study we aimed to determine the mechanism of Rtt107/Esc4 targeted silencing and also learn more about its biological functions. Results Targeted silencing by Rtt107/Esc4 was dependent on the SIR genes, which encode obligatory structural and enzymatic components of yeast silent chromatin. Based on its sequence, Rtt107/Esc4 was predicted to contain six BRCT motifs. This motif, originally identified in the human breast tumor suppressor gene BRCA1, is a protein interaction domain. The targeted silencing activity of Rtt107/Esc4 resided within the C-terminal two BRCT motifs, and this region of the protein bound to Sir3 in two-hybrid tests. Deletion of RTT107/ESC4 caused sensitivity to the DNA damaging agent MMS as well as to hydroxyurea. A two-hybrid screen showed that the N-terminal BRCT motifs of Rtt107/Esc4 bound to Slx4, a protein previously shown to be involved in DNA repair and required for viability in a strain lacking the DNA helicase Sgs1. Like SLX genes, RTT107ESC4 interacted genetically with SGS1; esc4Δ sgs1Δ mutants were viable, but exhibited a slow-growth phenotype and also a synergistic DNA repair defect. Conclusion Rtt107/Esc4 binds to the silencing protein Sir3 and the DNA repair protein Slx4 via different BRCT motifs, thus providing a bridge linking silent chromatin to DNA repair enzymes.

Bodies, Spaces, Voices, Silences

Directory of Open Access Journals (Sweden)

Donatella Mazzoleni

2013-07-01

Full Text Available A good architecture should not only allow functional, formal and technical quality for urban spaces, but also let the voice of the city be perceived, listened, enjoyed. Every city has got its specific sound identity, or “ISO” (R. O. Benenzon, made up of a complex texture of background noises and fluctuation of sound figures emerging and disappearing in a game of continuous fadings. For instance, the ISO of Naples is characterized by a spread need of hearing the sound return of one’s/others voices, by a hate of silence. Cities may fall ill: illness from noise, within super-crowded neighbourhoods, or illness from silence, in the forced isolation of peripheries. The proposal of an urban music therapy denotes an unpublished and innovative enlarged interdisciplinary research path, where architecture, music, medicine, psychology, communication science may converge, in order to work for rebalancing spaces and relation life of the urban collectivity, through the care of body and sound dimensions.

Bone marrow mesenchymal stem cells with Nogo-66 receptor gene silencing for repair of spinal cord injury

Science.gov (United States)

Li, Zhiyuan; Zhang, Zhanxiu; Zhao, Lili; Li, Hui; Wang, Suxia; Shen, Yong

2014-01-01

We hypothesized that RNA interference to silence Nogo-66 receptor gene expression in bone marrow mesenchymal stem cells before transplantation might further improve neurological function in rats with spinal cord transection injury. After 2 weeks, the number of neurons and BrdU-positive cells in the Nogo-66 receptor gene silencing group was higher than in the bone marrow mesenchymal stem cell group, and significantly greater compared with the model group. After 4 weeks, behavioral performance was significantly enhanced in the model group. After 8 weeks, the number of horseradish peroxidase-labeled nerve fibers was higher in the Nogo-66 receptor gene silencing group than in the bone marrow mesenchymal stem cell group, and significantly higher than in the model group. The newly formed nerve fibers and myelinated nerve fibers were detectable in the central transverse plane section in the bone marrow mesenchymal stem cell group and in the Nogo-66 receptor gene silencing group. PMID:25206893

Analysis of Tospovirus NSs Proteins in Suppression of Systemic Silencing

OpenAIRE

Hedil, Marcio; Sterken, Mark G.; de Ronde, Dryas; Lohuis, Dick; Kormelink, Richard

2015-01-01

RNA silencing is a sequence-specific gene regulation mechanism that in plants also acts antiviral. In order to counteract antiviral RNA silencing, viruses have evolved RNA silencing suppressors (RSS). In the case of tospoviruses, the non-structural NSs protein has been identified as the RSS. Although the tomato spotted wilt virus (TSWV) tospovirus NSs protein has been shown to exhibit affinity to long and small dsRNA molecules, its ability to suppress the non-cell autonomous part of RNA silen...

DNA triplet repeats mediate heterochromatin-protein-1-sensitive variegated gene silencing.

Science.gov (United States)

Saveliev, Alexander; Everett, Christopher; Sharpe, Tammy; Webster, Zoë; Festenstein, Richard

2003-04-24

Gene repression is crucial to the maintenance of differentiated cell types in multicellular organisms, whereas aberrant silencing can lead to disease. The organization of DNA into chromatin and heterochromatin is implicated in gene silencing. In chromatin, DNA wraps around histones, creating nucleosomes. Further condensation of chromatin, associated with large blocks of repetitive DNA sequences, is known as heterochromatin. Position effect variegation (PEV) occurs when a gene is located abnormally close to heterochromatin, silencing the affected gene in a proportion of cells. Here we show that the relatively short triplet-repeat expansions found in myotonic dystrophy and Friedreich's ataxia confer variegation of expression on a linked transgene in mice. Silencing was correlated with a decrease in promoter accessibility and was enhanced by the classical PEV modifier heterochromatin protein 1 (HP1). Notably, triplet-repeat-associated variegation was not restricted to classical heterochromatic regions but occurred irrespective of chromosomal location. Because the phenomenon described here shares important features with PEV, the mechanisms underlying heterochromatin-mediated silencing might have a role in gene regulation at many sites throughout the mammalian genome and modulate the extent of gene silencing and hence severity in several triplet-repeat diseases.

Multielemental speciation analysis by advanced hyphenated technique - HPLC/ICP-MS: A review.

Science.gov (United States)

Marcinkowska, Monika; Barałkiewicz, Danuta

2016-12-01

Speciation analysis has become an invaluable tool in human health risk assessment, environmental monitoring or food quality control. Another step is to develop reliable multielemental speciation methodologies, to reduce costs, waste and time needed for the analysis. Separation and detection of species of several elements in a single analytical run can be accomplished by high performance liquid chromatography hyphenated to inductively coupled plasma mass spectrometry (HPLC/ICP-MS). Our review assembles articles concerning multielemental speciation determination of: As, Se, Cr, Sb, I, Br, Pb, Hg, V, Mo, Te, Tl, Cd and W in environmental, biological, food and clinical samples analyzed with HPLC/ICP-MS. It addresses the procedures in terms of following issues: sample collection and pretreatment, selection of optimal conditions for elements species separation by HPLC and determination using ICP-MS as well as metrological approach. The presented work is the first review article concerning multielemental speciation analysis by advanced hyphenated technique HPLC/ICP-MS. Copyright © 2016 Elsevier B.V. All rights reserved.

Kefiran antagonizes cytopathic effects of Bacillus cereus extracellular factors.

Science.gov (United States)

Medrano, Micaela; Pérez, Pablo Fernando; Abraham, Analía Graciela

2008-02-29

Kefiran, the polysaccharide produced by microorganisms present in kefir grains, is a water-soluble branched glucogalactan containing equal amounts of D-glucose and D-galactose. In this study, the effect of kefiran on the biological activity of Bacillus cereus strain B10502 extracellular factors was assessed by using cultured human enterocytes (Caco-2 cells) and human erythrocytes. In the presence of kefiran concentrations ranging from 300 to 1000 mg/L, the ability of B. cereus B10502 spent culture supernatants to detach and damage cultured human enterocytes was significantly abrogated. In addition, mitochondrial dehydrogenase activity was higher when kefiran was present during the cell toxicity assays. Protection was also demonstrated in hemolysis and apoptosis/necrosis assays. Scanning electron microscopy showed the protective effect of kefiran against structural cell damages produced by factors synthesized by B. cereus strain B10502. Protective effect of kefiran depended on strain of B. cereus. Our findings demonstrate the ability of kefiran to antagonize key events of B. cereus B10502 virulence. This property, although strain-specific, gives new perspectives for the role of bacterial exopolysaccharides in functional foods.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

Energy Technology Data Exchange (ETDEWEB)

Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

2014-11-14

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Determination of organic phosphorous in oil production waters by ICP-AES and ICP-MS after preconcentration on silica immobilized C{sub 18}; Determinacao de fosforo organico em aguas de producao petrolifera por ICP-AES e ICP-MS apos pre-concentracao em coluna de silica C{sub 18}

Energy Technology Data Exchange (ETDEWEB)

Rocha, Anderson Araujo; Miekeley, Norbert; Silveira, Carmem Lucia Porto da [Pontificia Univ. Catolica do Rio de Janeiro, RJ (Brazil). Dept. de Quimica; Bezerra, Maria Carmem Moreira [PETROBRAS, Rio de Janeiro, RJ (Brazil). Centro de Pesquisas

1998-10-01

Results on the optimization analytical methods for the determination of phosphorous in phosphino-poly carboxylate (PPCA), used frequently as scale inhibitor during oil production, by ICP-AES and ICP-MS are presented. Due to the complex matrix of production waters (brines) and their high concentration in inorganic phosphorus, the separation of organic phosphorus prior to its determination in necessary. In this work, mini columns of silica immobilized C{sub 18} were used. Optimization of the separation step resulted in the following working conditions: (1) pre washing of the column with methanol (80% v/v); (2) use of a flow rate of 5 m L/min and 10 m L/min, respectively, for the preconditioning step and for percolation of the water sample; (3) final elution of organic phosphorus with 7 m L of buffer of H{sub 3} BO{sub 3}/Na OH (0.05 M, p H 9) with a flow rate of 1 m L/min. Sample detection limits (3{sigma}) for different combinations of nebulizers and spectrometric methods, based on 10 m L water aliquots, are: ICP-AES-Cross flow (47 mg/L) and Ultrasonic (18 {mu}g/L); ICP-M S-Cross flow (1.2 {mu}g/L) and Ultrasonic (0.5 {mu}g/L). Typical recoveries of organic phosphorous are between 90 and 95% and the repeatability of the whole procedure is better than 10%. The developed methodology was applied successfully to samples from the oil-well N A 46, platform PNA 2, Campos basin, Brazil. Assessment of the PPCA inhibitor was possible at lower concentrations than achieved by current analytical methods., resulting in benefits such as reduced cost of chemicals, postponed oil production and lower environmental impacts. (author)

Theoretical Investigation of Spectral-Interferences of Cadmium Isotopes in ICP-MS

International Nuclear Information System (INIS)

Rashad, A.M.; Rashad, A.M.

2015-01-01

Thermal properties of polyatomic ions which can interfere with cadmium during the analysis process using the inductively coupled plasma mass spectrometer ICP-MS are studied. Ionization energies and heats of formation, of the selected species at 0 K and 298 K of the expected reactions to occur under the effect of plasma conditions in ICP-MS, are calculated using Gaussian 03

Quality control considerations for size exclusion chromatography with online ICP-MS: a powerful tool for evaluating the size dependence of metal-organic matter complexation.

Science.gov (United States)

McKenzie, Erica R; Young, Thomas M

2013-01-01

Size exclusion chromatography (SEC), which separates molecules based on molecular volume, can be coupled with online inductively coupled plasma mass spectrometry (ICP-MS) to explore size-dependent metal-natural organic matter (NOM) complexation. To make effective use of this analytical dual detector system, the operator should be mindful of quality control measures. Al, Cr, Fe, Se, and Sn all exhibited columnless attenuation, which indicated unintended interactions with system components. Based on signal-to-noise ratio and peak reproducibility between duplicate analyses of environmental samples, consistent peak time and height were observed for Mg, Cl, Mn, Cu, Br, and Pb. Al, V, Fe, Co, Ni, Zn, Se, Cd, Sn, and Sb were less consistent overall, but produced consistent measurements in select samples. Ultrafiltering and centrifuging produced similar peak distributions, but glass fiber filtration produced more high molecular weight (MW) peaks. Storage in glass also produced more high MW peaks than did plastic bottles.

Transition metal analysis. A comparison between ICP-AES and deuteron activation

International Nuclear Information System (INIS)

Pillay, A.E.; Williams, J.R.; Hassan, S.M.; Al-Hamdi, A.; El Mardi, M.O.

2002-01-01

The analytical capabilities of ICP-AES (ICP) and deuteron activation (associated with prompt gamma-rays and delayed X-rays) for the determination of certain transition metals, were investigated. The sensitivities of the three methods are given, and the general applicability of each technique is evaluated. In the case of ICP, numerical data were obtained from aqueous solutions containing digested plant material. These experimental results were assessed against minimum detectable limits attained in relevant solid matrices that were subjected to prompt gamma-ray and delayed X-ray spectrometry using 5 MeV 2 H + ions. The analytically useful lines originated mainly from (d,p) and (d,n) reactions. The potential of the three techniques for routine analysis is discussed and detailed methodologies are presented. (author)

Anaerobic expression of the gadE-mdtEF multidrug efflux operon is primarily regulated by the two-component system ArcBA through antagonizing the H-NS mediated repression.

Science.gov (United States)

Deng, Ziqing; Shan, Yue; Pan, Qing; Gao, Xiang; Yan, Aixin

2013-01-01

The gadE-mdtEF operon encodes a central acid resistance regulator GadE and two multidrug efflux proteins MdtEF. Although transcriptional regulation of gadE in the context of acid resistance under the aerobic growth environment of Escherichia coli has been extensively studied, regulation of the operon under the physiologically relevant environment of anaerobic growth and its effect on the expression of the multidrug efflux proteins MdtEF in the operon has not been disclosed. Our previous study revealed that anaerobic induction of the operon was dependent on ArcA, the response regulator of the ArcBA two-component system, in the M9 glucose minimal medium. However, the detailed regulatory mechanism remains unknown. In this study, we showed that anaerobic activation of mdtEF was driven by the 798 bp unusually long gadE promoter. Deletion of evgA, ydeO, rpoS, and gadX which has been shown to activate the gadE expression during acid stresses under aerobic condition did not have a significant effect on the anaerobic activation of the operon. Rather, anaerobic activation of the operon was largely dependent on the global regulator ArcA and a GTPase MnmE. Under aerobic condition, transcription of gadE was repressed by the global DNA silencer H-NS in M9 minimal medium. Interestingly, under anaerobic condition, while ΔarcA almost completely abolished transcription of gadE-mdtEF, further deletion of hns in ΔarcA mutant restored the transcription of the full-length PgadE-lacZ, and P1- and P3-lacZ fusions, suggesting an antagonistic effect of ArcA on the H-NS mediated repression. Taken together, we conclude that the anaerobic activation of the gadE-mdtEF was primarily mediated by the two-component system ArcBA through antagonizing the H-NS mediated repression.

Anaerobic expression of the gadE-mdtEF multidrug efflux operon is primarily regulated by the two-component system ArcBA through antagonizing the H-NS mediated repression

Directory of Open Access Journals (Sweden)

Ziqing eDeng

2013-07-01

Full Text Available The gadE-mdtEF operon encodes a central acid resistance regulator GadE and two multidrug efflux proteins MdtEF. Although transcriptional regulation of gadE in the context of acid resistance under the aerobic growth environment of E. coli has been extensively studied, regulation of the operon under the physiologically relevant environment of anaerobic growth and its effect on the expression of the multidrug efflux proteins MdtEF has not been disclosed. Our previous study revealed that anaerobic induction of the operon was dependent on ArcA, the response regulator of the ArcBA two-component system, in the M9 glucose minimal medium. However, the detailed regulatory mechanism remains unknown. In this study, we showed that anaerobic activation of mdtEF was driven by the 798bp unusually long gadE promoter. Deletion of evgA, ydeO, rpoS, and gadX which has been shown to activate the gadE expression during acid stresses under aerobic condition did not have a significant effect on the anaerobic activation of the operon. Rather, anaerobic activation of the operon was largely dependent on the global regulator ArcA and a GTPase MnmE. Under aerobic condition, transcription of gadE was repressed by the global DNA silencer H-NS in M9 minimal medium. Interestingly, under anaerobic condition, while ΔarcA almost completely abolished transcription of gadE-mdtEF, further deletion of hns in ΔarcA mutant restored the transcription of the full length PgadE-lacZ, and P1- and P3-lacZ fusions, suggesting an antagonistic effect of ArcA on the H-NS mediated repression. Taken together, we conclude that the anaerobic activation of the gadE-mdtEF was primarily mediated by the two-component system ArcBA through antagonizing the H-NS mediated repression.

Mdm2 is a novel activator of ApoCIII promoter which is antagonized by p53 and SHP inhibition

Energy Technology Data Exchange (ETDEWEB)

Yang, Zhihong; Zhang, Yuxia [Departments of Medicine and Oncological Sciences, Huntsman Cancer Institute, University of Utah School of Medicine, Salt Lake City, UT 84132 (United States); Wang, Li, E-mail: l.wang@hsc.utah.edu [Departments of Medicine and Oncological Sciences, Huntsman Cancer Institute, University of Utah School of Medicine, Salt Lake City, UT 84132 (United States)

2012-01-13

Highlights: Black-Right-Pointing-Pointer Mdm2 enhances HNF4{alpha} activation of the ApoCIII promoter via interaction with HNF4{alpha}. Black-Right-Pointing-Pointer p53 antagonizes the effect of Mdm2 activation of the ApoCIII promoter. Black-Right-Pointing-Pointer SHP strengthens p53 inhibition but abolishes Mdm2 activation of the ApoCIII promoter. Black-Right-Pointing-Pointer Mdm2 alters the enrichment of HNF4{alpha}, p53 and SHP to the ApoCIII promoter. -- Abstract: We examined the effect of Mdm2 on regulation of the ApoCIII promoter and its cross-talk with p53 and nuclear receptor SHP. Overexpression of Mdm2 markedly enhanced ApoCIII promoter activity by HNF4{alpha}. A direct association of Mdm2 protein with the HNF4{alpha} protein was observed by co-immunoprecipitation. Ectopic expression of p53 decreased HNF4{alpha} activation of the ApoCIII promoter and antagonized the effect of Mdm2. Co-expression of SHP further strengthened p53 inhibition and abolished Mdm2 activation of the ApoCIII promoter. Mdm2 inhibited p53-mediated enrichment of HNF4{alpha} to the ApoCIII promoter while simultaneously reducing p53 binding and increasing recruitment of SHP to the ApoCIII promoter. The results from this study implicate a potentially important function of Mdm2 in regulation of lipoprotein metabolism.

Mdm2 is a novel activator of ApoCIII promoter which is antagonized by p53 and SHP inhibition

International Nuclear Information System (INIS)

Yang, Zhihong; Zhang, Yuxia; Wang, Li

2012-01-01

Highlights: ► Mdm2 enhances HNF4α activation of the ApoCIII promoter via interaction with HNF4α. ► p53 antagonizes the effect of Mdm2 activation of the ApoCIII promoter. ► SHP strengthens p53 inhibition but abolishes Mdm2 activation of the ApoCIII promoter. ► Mdm2 alters the enrichment of HNF4α, p53 and SHP to the ApoCIII promoter. -- Abstract: We examined the effect of Mdm2 on regulation of the ApoCIII promoter and its cross-talk with p53 and nuclear receptor SHP. Overexpression of Mdm2 markedly enhanced ApoCIII promoter activity by HNF4α. A direct association of Mdm2 protein with the HNF4α protein was observed by co-immunoprecipitation. Ectopic expression of p53 decreased HNF4α activation of the ApoCIII promoter and antagonized the effect of Mdm2. Co-expression of SHP further strengthened p53 inhibition and abolished Mdm2 activation of the ApoCIII promoter. Mdm2 inhibited p53-mediated enrichment of HNF4α to the ApoCIII promoter while simultaneously reducing p53 binding and increasing recruitment of SHP to the ApoCIII promoter. The results from this study implicate a potentially important function of Mdm2 in regulation of lipoprotein metabolism.

Study on the low leakage current of an MIS structure fabricated by ICP-CVD

Energy Technology Data Exchange (ETDEWEB)

Tsai, S-Y; Hon, M-H [Department of Materials Science and Engineering, National Cheng Kung University, 1, Ta-Hsueh Road, Tainan, 701 Taiwan (China); Lu, Y-M, E-mail: ymlumit@yahoo.com.tw

2008-03-15

As the dimensions of electric devices continue to shrink, it is becoming increasingly important to understand how to obtain good quality gate oxide film materials wilth higher carrier mobility, lower leakage current and greater reliability. All of them have become major concerns in the fabrication of thin film oxide transistors. A novel film deposition method called Inductively Coupled Plasma-Chemical Vapor Deposition (ICP-CVD) has received attraction in the semiconductor industry, because it can be capable of generating high density plasmas at extremely low temperature, resulting in less ion bombardment of the material surface. In this work, we present the results of crystallized silicon dioxide films deposited by inductively coupled plasma chemical vapor deposition technique at an extremely low temperature of 90 deg. C. The value of the refractive index of the crystallized ICP-CVD SiO{sub 2} film depends on the r.f. power of the ICP system, and approximates to be 1.46. This value is comparable to that of SiO{sub 2} films prepared by thermal oxidation. As the r.f. power of ICP applied more than 1250 Watts, still only the (111) diffraction peak is observed by XRD, which implies a very strong preferred orientation or single crystal structure. Too low or too high r.f. power both produces amorphous SiO{sub 2} films. From the I-V curve, the MIS device with a SiO{sub 2} dielectric film has a lower leakage current density of 6.8x10{sup -8}A/cm{sup 2} at 1V as the film prepared at 1750 watts. The highest breakdown field in this study is 15.8 MV/cm. From the FTIR analysis, it was found that more hydrogen atoms incorporate into films and form Si-OH bonds as the r.f. power increases. The existence of Si-OH bonds leads to a poor reliability of the MIS device.

Silencing of beta-carotene hydroxylase increases total carotenoid and beta-carotene levels in potato tubers

Directory of Open Access Journals (Sweden)

Pizzichini Daniele

2007-03-01

Full Text Available Abstract Background Beta-carotene is the main dietary precursor of vitamin A. Potato tubers contain low levels of carotenoids, composed mainly of the xanthophylls lutein (in the beta-epsilon branch and violaxanthin (in the beta-beta branch. None of these carotenoids have provitamin A activity. We have previously shown that tuber-specific silencing of the first step in the epsilon-beta branch, LCY-e, redirects metabolic flux towards beta-beta carotenoids, increases total carotenoids up to 2.5-fold and beta-carotene up to 14-fold. Results In this work, we silenced the non-heme beta-carotene hydroxylases CHY1 and CHY2 in the tuber. Real Time RT-PCR measurements confirmed the tuber-specific silencing of both genes . CHY silenced tubers showed more dramatic changes in carotenoid content than LCY-e silenced tubers, with beta-carotene increasing up to 38-fold and total carotenoids up to 4.5-fold. These changes were accompanied by a decrease in the immediate product of beta-carotene hydroxylation, zeaxanthin, but not of the downstream xanthophylls, viola- and neoxanthin. Changes in endogenous gene expression were extensive and partially overlapping with those of LCY-e silenced tubers: CrtISO, LCY-b and ZEP were induced in both cases, indicating that they may respond to the balance between individual carotenoid species. Conclusion Together with epsilon-cyclization of lycopene, beta-carotene hydroxylation is another regulatory step in potato tuber carotenogenesis. The data are consistent with a prevalent role of CHY2, which is highly expressed in tubers, in the control of this step. Combination of different engineering strategies holds good promise for the manipulation of tuber carotenoid content.

Sample introduction systems for the analysis of liquid microsamples by ICP-AES and ICP-MS

Energy Technology Data Exchange (ETDEWEB)

Todoli, Jose L. [Departamento de Quimica Analitica, Nutricion y Bromatologia, Universidad de Alicante, 03080 Alicante (Spain)]. E-mail: jose.todoli@ua.es; Mermet, Jean M. [Spectroscopy Forever, 01390 Tramoyes (France)

2006-03-15

There are many fields in which the available sample volume is the limiting factor for an elemental analysis. Over the last ten years, sample introduction systems used in plasma spectrometry (i.e., Inductively Coupled Plasma Atomic Emission Spectrometry, ICP-AES, and Mass Spectrometry, ICP-MS) have evolved in order to expand the field of applicability of these techniques to the analysis of micro- and nanosamples. A full understanding of the basic processes occurring throughout the sample introduction system is absolutely necessary to improve analytical performance. The first part of the present review deals with fundamental studies concerning the different phenomena taking place from aerosol production to analyte excitation/ionization when the liquid consumption rate does not exceed 100 {mu}l/min. Existing sample introduction systems are currently far from the ideal and a significant effort has been made to develop new and efficient devices. Different approaches for continuously introducing small sample volumes (i.e., microsamples) have been reviewed and compared in the present work. Finally, applications as well as basic guidelines to select the best sample introduction system according to the sample particularities are given at the end of this review.

Sample introduction systems for the analysis of liquid microsamples by ICP-AES and ICP-MS

International Nuclear Information System (INIS)

Todoli, Jose L.; Mermet, Jean M.

2006-01-01

There are many fields in which the available sample volume is the limiting factor for an elemental analysis. Over the last ten years, sample introduction systems used in plasma spectrometry (i.e., Inductively Coupled Plasma Atomic Emission Spectrometry, ICP-AES, and Mass Spectrometry, ICP-MS) have evolved in order to expand the field of applicability of these techniques to the analysis of micro- and nanosamples. A full understanding of the basic processes occurring throughout the sample introduction system is absolutely necessary to improve analytical performance. The first part of the present review deals with fundamental studies concerning the different phenomena taking place from aerosol production to analyte excitation/ionization when the liquid consumption rate does not exceed 100 μl/min. Existing sample introduction systems are currently far from the ideal and a significant effort has been made to develop new and efficient devices. Different approaches for continuously introducing small sample volumes (i.e., microsamples) have been reviewed and compared in the present work. Finally, applications as well as basic guidelines to select the best sample introduction system according to the sample particularities are given at the end of this review

Differential effects of early-life NMDA receptor antagonism on aspartame-impaired insulin tolerance and behavior.

Science.gov (United States)

Collison, Kate S; Inglis, Angela; Shibin, Sherin; Andres, Bernard; Ubungen, Rosario; Thiam, Jennifer; Mata, Princess; Al-Mohanna, Futwan A

2016-12-01

We have previously showed that lifetime exposure to aspartame, commencing in utero via the mother's diet, may impair insulin tolerance and cause behavioral deficits in adulthood via mechanisms which are incompletely understood. The role of the CNS in regulating glucose homeostasis has been highlighted by recent delineation of the gut-brain axis, in which N-methyl-d-aspartic acid receptors (NMDARs) are important in maintaining glucose homeostasis, in addition to regulating certain aspects of behavior. Since the gut-brain axis can be modulated by fetal programming, we hypothesized that early-life NMDAR antagonism may affect aspartame-induced glucose deregulation in adulthood, and may alter the aspartame behavioral phenotype. Accordingly, C57Bl/6J mice were chronically exposed to aspartame commencing in utero, in the presence and absence of maternal administration of the competitive NMDAR antagonist CGP 39551, from conception until weaning. Drug/diet interactions in adulthood glucocentric and behavioral parameters were assessed. Aspartame exposure elevated blood glucose and impaired insulin-induced glucose disposal during an insulin tolerance test, which could be normalized by NMDAR antagonism. The same effects were not observed in control diet mice, suggesting an early-life drug/diet interaction. Behavioral analysis of adult offspring indicated that NMDAR antagonism of control diet mice caused hyperlocomotion and impaired spatial navigation. Conversely hypolocomotion, reduced exploratory activity and increased anxiety-related behavior were apparent in aspartame diet mice with early-life NMDAR antagonism. significant drug/diet interactions in glucocentric and behavioral parameters were identified in aspartame-exposed mice with early-life NMDAR antagonism. This suggests a possible involvement of early NMDAR interactions in aspartame-impaired glucose homeostasis and behavioral deficits. Copyright © 2016 Elsevier Inc. All rights reserved.

Determination of Trace Elements in Uranium by HPLC-ID-ICP-MS: NTNFC Final Report

Energy Technology Data Exchange (ETDEWEB)

Manard, Benjamin Thomas [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Wylie, Ernest Miller II [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Xu, Ning [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Tandon, Lav [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

2017-10-19

This report covers the FY 16 effort for the HPLC-ID-ICP-MS methodology 1) sub-method validation for the group I&II elements, 2) sub-method stood-up and validation for REE, 3) sub-method development for the transition element, and 4) completion of a comprehensive SOP for three families of elements.

ICP Mass and Optical Emission Spectrometry of Ore Samples Containing Rare Earth Elements

International Nuclear Information System (INIS)

Mohammed, A.E.W.M.

2013-01-01

Inductively Coupled Plasma Optical Emission and Mass Spectrometry (ICP-OES and ICPMS) are widely accepted as a rapid and sensitive techniques for Rare Earth Elements (REEs) analysis of geological samples. However, the achievable accuracy of these techniques are seriously limited by the problem of matrix interferences. In this study, matrix effects in ICP-AES were addressed using two approaches. In the first approach, the mechanisms of matrix interferences and analyte excitation were elucidated fundamentally. First, matrix effects from a comprehensive list of thirty-nine elements were investigated. It was confirmed that matrix elements with low second (instead of the widely reported first) ionization potentials (IP) produce a stronger matrix effect in all cases. Another critical parameter defining the severity of the matrix effect was found to be the availability of low-lying energy levels in the doubly charged matrix ion. Penning ionization followed by ion electron recombination through successive cycles is proposed as the mechanism for the more severe matrix effects caused by low second-IP matrices. In the second approach ICP-OES and ICP-MS are applied in this study for the analysis of Rare Earth Elements of two selected standard reference samples namely AGV-2 and BCR-2 beside a fluorspar geological sample (G-9 sample). Effective procedures are developed to avoid the spectral interference from matrix elements by using ion exchange resin Amberlite IR-120 before determination of REEs using ICP-OES and ICPMS. The potential of the method is evaluated by analysis of Certified Reference Materials (AGV-2 and BCR-2). Results obtained by ICP-MS show that experimental data are in agreement with the certified values and their values could be used as a quantitative data. The results obtained using ICP-OES were compared and discussed.

Optical silencing of body wall muscles induces pumping inhibition in Caenorhabditis elegans

OpenAIRE

Takahashi, Megumi; Takagi, Shin

2017-01-01

Feeding, a vital behavior in animals, is modulated depending on internal and external factors. In the nematode Caenorhabditis elegans, the feeding organ called the pharynx ingests food by pumping driven by the pharyngeal muscles. Here we report that optical silencing of the body wall muscles, which drive the locomotory movement of worms, affects pumping. In worms expressing the Arch proton pump or the ACR2 anion channel in the body wall muscle cells, the pumping rate decreases after activatio...

Multi-element determinations of N,N-dimethylformamide (DMF) coal slurries using ICP-OES

Energy Technology Data Exchange (ETDEWEB)

M. Mujuru; R.I. McCrindle; B.M. Botha; P.P. Ndibewu [Tshwane University of Technology, Pretoria (South Africa). Department of Chemistry

2009-04-15

A slurry nebulisation technique was applied for elemental analysis of bituminous coals SARM 18, SARM 19 and four coals from three different seams in Witbank, South Africa, by inductively coupled plasma optical emission spectroscopy (ICP-OES). Major elements (Al, Ca, Fe, Mg, S, Si and Ti) and trace elements (Ba, Cr, Mn, Ni, Sr, V, Zn and Zr) in coal were determined. Various slurry preparations were evaluated using two dispersants (glycerol and Triton X-100) and by varying the concentration of dispersants, between 0.1% and 1.0% (v/v). The effect of initially solubilising the ground coal in N,N-dimethylformamide (DMF) was investigated by varying the volume of DMF added. The effect of wet grinding with DMF was investigated. Wet grinding with DMF was shown to drastically reduce particle sizes (50.0% < 0.28 m and 90.0% < 6.17 {mu}m) as compared to dry grinding (50.0% < 5.25 {mu}m and 90.0% < 11.1 {mu}m). The reduced particle sizes and increased transport efficiency of the coal slurries led to improved analytical recoveries of elements in the reference coal, SARM 18. The best analytical recoveries for all elements were achieved using 0.1% Triton X-100 with 10.0% DMF. Results obtained by ICP-OES after wet grinding of the coal with DMF, using 0.1% Triton X-100, also gave excellent recoveries (Al, 100%; Ca, 103%; Cr, 106%; Fe, 102%; Mg, 100%; Mn, 104%; Ni, 109%; Si, 102%; Ti, 95.0%; and V, 108%). The results obtained with 10.0% DMF and 0.1% Triton X-100 were in agreement with certified values for all selected elements according to paired t-test at the 95.0% confidence level. Selected elements (Al, Ca, Fe, Mg, Mn, Si, Ti and V) were also analysed with X-ray fluorescence for comparison with results obtained from ICP-OES. Analysis by ICP-OES of microwave digested coal was also carried out. It is suggested that the DMF slurry technique could be used for routine analysis of bituminous coals. 27 refs., 4 figs., 4 tabs.

Simultaneous silencing of ACSL4 and induction of GADD45B in hepatocellular carcinoma cells amplifies the synergistic therapeutic effect of aspirin and sorafenib

Science.gov (United States)

Xia, Hongping; Lee, Kee Wah; Chen, Jianxiang; Kong, Shik Nie; Sekar, Karthik; Deivasigamani, Amudha; Seshachalam, Veerabrahma Pratap; Goh, Brian Kim Poh; Ooi, London Lucien; Hui, Kam M

2017-01-01

Sorafenib is currently the only US Food and Drug Administration (FDA)-approved molecular inhibitor for the systemic therapy of advanced hepatocellular carcinoma (HCC). Aspirin has been studied extensively as an anti-inflammation, cancer preventive and therapeutic agent. However, the potential synergistic therapeutic effects of sorafenib and aspirin on advanced HCC treatment have not been well studied. Drug combination studies and their synergy quantification were performed using the combination index method of Chou-Talalay. The synergistic therapeutic effects of sorafenib and aspirin were evaluated using an orthotopic mouse model of HCC and comprehensive gene profiling analyses were conducted to identify key factors mediating the synergistic therapeutic effects of sorafenib and aspirin. Sorafenib was determined to act synergistically on HCC cells with aspirin in vitro. Using Hep3B and HuH7 HCC cells, it was demonstrated that sorafenib and aspirin acted synergistically to induce apoptosis. Mechanistic studies demonstrated that combining sorafenib and aspirin yielded significant synergistically anti-tumor effects by simultaneously silencing ACSL4 and the induction of GADD45B expression in HCC cells both in vitro and in the orthotopic HCC xenograft mouse model. Importantly, clinical evidence has independently corroborated that survival of HCC patients expressing ACSL4highGADD45Blow was significantly poorer compared to patients with ACSL4lowGADD45Bhigh, thus demonstrating the potential clinical value of combining aspirin and sorafenib for HCC patients expressing ACSL4highGADD45Blow. In conclusion, sorafenib and aspirin provide synergistic therapeutic effects on HCC cells that are achieved through simultaneous silencing of ACSL4 and induction of GADD45B expression. Targeting HCC with ACSL4highGADD45Blow expression with aspirin and sorafenib could provide potential synergistic therapeutic benefits. PMID:28900541

QEMSCAN+LA-ICP-MS: a 'big data' generator for sedimentary provenance analysis

Science.gov (United States)

Vermeesch, Pieter; Rittner, Martin; Garzanti, Eduardo

2017-04-01

Angola. In addition to these geological findings, the first applications of QEMSCAN+LA-ICP-MS highlight some key advantages of the new workflow over traditional provenance analysis: (a) the new method not only increases sample throughput but also improves data quality by reducing significant biases associated with mineral separation and grain selection; (b) the three case studies highlight the importance of zircon 'fertility' for interpreting detrital zircon U-Pb datasets, and the ability of QEMSCAN to quantify this crucial parameter semi-automatically; (c) QEMSCAN+LA-ICP-MS provides an opportunity to add textural information to detrital geochronology and, for example, quantify possible grain-size dependence of U-Pb age distributions. But besides these advantages, the three case studies also reveal a number of limitations: (a) mineral identification by QEMSCAN is not as reliable as commonly achieved by human observers; (b) heavy mineral compositions obtained by QEMSCAN cannot easily be compared with conventional point counting data; and (c) apparent grain sizes can be greatly affected by polishing artefacts. In conclusion, QEMSCAN+LA-ICP-MS is a transformational new technique for provenance analysis but should be used with caution, in combination with conventional petrographic and heavy mineral techniques.

Tandem on-line continuous separations for atomic spectroscopic indirect analysis: iodide determination by ICP-AES

International Nuclear Information System (INIS)

Garcia, A.M.; Sanchez Uria, J.E.; Sanz-Medel, A.; Quintero Ortega, M.C.; Bautista, J.C.

1992-01-01

A sensitive and selective indirect determination of iodide by inductively coupled plasma emission spectrometry (ICP-AES) based on the principle of tandem on-line continuous separations as an alternative means of introducing samples into plasmas is proposed. Iodide is continuously extracted as an ion-pair into xylene by mixing the sample with Hg(II) and dipyridil solutions. The organic phase (containing the analyte in [Hg(Dipy) 2 ]I 2 form) is on-line continuously mixed with NaBH 4 (in DMF) and acetic acid solutions. Mercury vapour continuously generated from this organic phase is separated in a classical U-type gas-liquid separation device. The system has been optimized for the continuous extraction of KI, for the direct generation of cold mercury vapour from xylene and for the final ICP-AES determination of mercury. The optimised method has been applied to the determination of iodide (detection limit 20 ng/ml of iodide) in table salt and in synthetic samples. Very good agreement between found and certified results was observed. The usefulness and convenience of such alternative sample chemical pretreatment/presentation to the ICP is thus demonstrated for indirect determinations to be carried out by atomic spectroscopy methods. (authors)

Quantification of pharmaceutical peptides in human plasma by LC-ICP-MS sulfur detection

DEFF Research Database (Denmark)

Møller, Laura Hyrup; Macherius, André; Hansen, Thomas Hesselhøj

2016-01-01

A method for quantification of a pharmaceutical peptide in human plasma was developed using gradient elution LC-ICP-MS. A membrane desolvation (MD) system was applied to remove organic solvents from the eluent prior to the detection as SO+ in the dynamic reaction cell (DRC) of the ICP-DRC-MS inst......A method for quantification of a pharmaceutical peptide in human plasma was developed using gradient elution LC-ICP-MS. A membrane desolvation (MD) system was applied to remove organic solvents from the eluent prior to the detection as SO+ in the dynamic reaction cell (DRC) of the ICP......-DRC-MS instrument and subsequent quantification by post-column isotope dilution (IDA). Plasma proteins were precipitated prior to analysis. Analytical figures of merit including linearity, precision, LOD, LOQ and accuracy were considered satisfactory for analysis of plasma samples. The selectivity of the developed...... method was demonstrated for five pharmaceutically relevant peptides: desmopressin, penetratin, substance P, PTH (1-34) and insulin. Preliminary experiments on an ICP-MS/MS system using oxygen to reduce the effect of organic solvents were also performed to compare sensitivity. The results of the study...

The Curious Silence of the Dog and Paul of Tarsus; Revisiting The Argument from Silence

Directory of Open Access Journals (Sweden)

Michael Gary Duncan

2012-03-01

Full Text Available In this essay I propose an interpretative and explanatory structure for the so-called argumentum ex silento, or argument from silence (henceforth referred to as the AFS. To this end, I explore two examples, namely, Sherlock Holmes’s oft-quoted notice of the “curious incident of the dog in the night-time” from Arthur Conan Doyle’s short story “Silver Blaze,” and the historical question of Paul of Tarsus’s silence on biographical details of the historical Jesus. Through these cases, I conclude that the AFS serves as a dialogical topos best evaluated and understood through the perceived authority of the arguer and the willingness of the audience to accept that authority, due to the “curious” nature of the negative evidence that the argument employed.

Surprised by Bird, Bard, and Bach: Language, Silence, and Transcendence.

Science.gov (United States)

Suhor, Charles

1991-01-01

Argues the importance of the relationships among silence and literature, the arts, and other experiences that point toward transcendence. Suggests that English teachers can expand the repertoire of classroom activities and teaching techniques that make use of silence. (KEH)

Multielement determination and speciation of major-to-trace elements in black tea leaves by ICP-AES and ICP-MS with the aid of size exclusion chromatography

International Nuclear Information System (INIS)

Matsuura, Hirotaka; Hokura, Akiko; Katsuki, Fumie; Itoh, Akihide; Haraguchi, Hiroki

2001-01-01

A multielement determination of major-to-trace elements in black tea leaves and their tea infusions was carried out by ICP-AES (inductively coupled plasma atomic emission spectrometry) and ICP-MS (inductively coupled plasma mass spectrometry). Tea infusions were prepared as usual tea beverage by brewing black tea leaves in boiling water for 5 min. About 40 elements in tea leaves and tea infusions could be determined over the wide concentration range in 8 orders of magnitude. The extraction efficiency of each element was estimated as the ratio of its concentration in tea infusions to that in tea leaves. From the experimental results for the extraction efficiencies, the elements in black tea leaves were classified into three characteristic groups: (i) highly-extractable elements (>55%): Na, K, Co, Ni, Rb, Cs and Tl, (ii) moderately-extractable elements (20-55%): Mg, Al, P, Mn and Zn, and (iii) poorly-extractable elements (<20%): Ca, Fe, Cu, Sr, Y, Zr, Mo, Sn, Ba and lanthanoid elements. Furthermore, speciation of major-to-trace elements in tea infusions was performed by using a combined system of size exclusion chromatography (SEC) and ICP-MS (or ICP-AES). As a result, many diverse elements were found to be present as complexes associated with large organic molecules in tea infusions. (author)

Strategy of gene silencing in cassava for validation of resistance genes

International Nuclear Information System (INIS)

Cortes, Simon; Lopez, Camilo

2010-01-01

Cassava (Manihot esculenta) is a major source of food for more than 1000 million people in the world and constitutes an important staple crop. Cassava bacterial blight, caused by the gram negative bacterium Xanthomonas axonopodis pv. manihotis, is one of the most important constraints for this crop. A candidate resistance gene against cassava bacterial blight, named RXam1, has been identified previously. In this work, we employed the gene silencing approach using the African cassava mosaic virus (ACMV) to validate the function of the RXam1 gene. We used as positive control the su gen, which produce photo blanching in leaves when is silenced. Plants from the SG10735 variety were bombardment with the ACMV-A-SU+ACMV-B y ACMV-A-RXam1+ACMV-B constructions. The silencing efficiency employing the su gene was low, only one of seven plants showed photo blanching. In the putative silenced plants for the RXam1 gene, no presence of siRNAs corresponding to RXam1 was observed; although a low diminution of the RXam1 gene expression was obtained. The growth curves for the Xam strain CIO136 in cassava plants inoculated showing a little but no significance difference in the susceptibility in the silenced plants compared to not silenced

Arabidopsis HDA6 regulates locus-directed heterochromatin silencing in cooperation with MET1.

OpenAIRE

Taiko Kim To; Jong-Myong Kim; Akihiro Matsui; Yukio Kurihara; Taeko Morosawa; Junko Ishida; Maho Tanaka; Takaho Endo; Tetsuji Kakutani; Tetsuro Toyoda; Hiroshi Kimura; Shigeyuki Yokoyama; Kazuo Shinozaki; Motoaki Seki

2011-01-01

Heterochromatin silencing is pivotal for genome stability in eukaryotes. In Arabidopsis, a plant-specific mechanism called RNA–directed DNA methylation (RdDM) is involved in heterochromatin silencing. Histone deacetylase HDA6 has been identified as a component of such machineries; however, its endogenous targets and the silencing mechanisms have not been analyzed globally. In this study, we investigated the silencing mechanism mediated by HDA6. Genome-wide transcript profiling revealed that t...

SAD-3, a Putative Helicase Required for Meiotic Silencing by Unpaired DNA, Interacts with Other Components of the Silencing Machinery

Science.gov (United States)

Hammond, Thomas M.; Xiao, Hua; Boone, Erin C.; Perdue, Tony D.; Pukkila, Patricia J.; Shiu, Patrick K. T.

2011-01-01

In Neurospora crassa, genes lacking a pairing partner during meiosis are suppressed by a process known as meiotic silencing by unpaired DNA (MSUD). To identify novel MSUD components, we have developed a high-throughput reverse-genetic screen for use with the N. crassa knockout library. Here we describe the screening method and the characterization of a gene (sad-3) subsequently discovered. SAD-3 is a putative helicase required for MSUD and sexual spore production. It exists in a complex with other known MSUD proteins in the perinuclear region, a center for meiotic silencing activity. Orthologs of SAD-3 include Schizosaccharomyces pombe Hrr1, a helicase required for RNAi-induced heterochromatin formation. Both SAD-3 and Hrr1 interact with an RNA-directed RNA polymerase and an Argonaute, suggesting that certain aspects of silencing complex formation may be conserved between the two fungal species. PMID:22384347

Active compressor engine silencer reduces exhaust noise

International Nuclear Information System (INIS)

Denenberg, J.N.; Miller, S.K.; Jay, M.A.

1994-01-01

An active industrial silencer on a compressor engine at a Tenneco Gas station has reduced low-frequency 'rumbling' noise by 8 dB during trials while lowering backpressure about 90$. This 8 dB reduction of the piston firing frequency corresponds to a more than 80% decrease in emitted acoustic power. The silencing unit, installed on one of six engines at the station near Eden, N.Y., continues in operation. Based on the results, the manufacturer is identifying additional compressor sites for further tests. This paper reviews this project

Nuclear trafficking of the HIV-1 pre-integration complex depends on the ADAM10 intracellular domain

International Nuclear Information System (INIS)

Endsley, Mark A.; Somasunderam, Anoma D.; Li, Guangyu; Oezguen, Numan; Thiviyanathan, Varatharasa; Murray, James L.; Rubin, Donald H.; Hodge, Thomas W.

2014-01-01

Previously, we showed that ADAM10 is necessary for HIV-1 replication in primary human macrophages and immortalized cell lines. Silencing ADAM10 expression interrupted the HIV-1 life cycle prior to nuclear translocation of viral cDNA. Furthermore, our data indicated that HIV-1 replication depends on the expression of ADAM15 and γ-secretase, which proteolytically processes ADAM10. Silencing ADAM15 or γ-secretase expression inhibits HIV-1 replication between reverse transcription and nuclear entry. Here, we show that ADAM10 expression also supports replication in CD4 + T lymphocytes. The intracellular domain (ICD) of ADAM10 associates with the HIV-1 pre-integration complex (PIC) in the cytoplasm and immunoprecipitates and co-localizes with HIV-1 integrase, a key component of PIC. Taken together, our data support a model whereby ADAM15/γ-secretase processing of ADAM10 releases the ICD, which then incorporates into HIV-1 PIC to facilitate nuclear trafficking. Thus, these studies suggest ADAM10 as a novel therapeutic target for inhibiting HIV-1 prior to nuclear entry. - Highlights: • Nuclear trafficking of the HIV-1 pre-integration complex depends on ADAM10. • ADAM10 associates with HIV-1 integrase in the pre-integration complex. • HIV-1 replication depends on the expression of ADAM15 and γ-secretase. • Silencing ADAM15 or γ-secretase expression inhibits nuclear import of viral cDNA. • ADAM10 is important for HIV-1 replication in human macrophages and CD4 + T lymphocytes

Nuclear trafficking of the HIV-1 pre-integration complex depends on the ADAM10 intracellular domain

Energy Technology Data Exchange (ETDEWEB)

Endsley, Mark A., E-mail: maendsle@utmb.edu [Department Internal Medicine, Division of Infectious Diseases, University of Texas Medical Branch, 301 University Blvd, Galveston, TX 77555 (United States); Somasunderam, Anoma D., E-mail: asomasun@utmb.edu [Department Internal Medicine, Division of Infectious Diseases, University of Texas Medical Branch, 301 University Blvd, Galveston, TX 77555 (United States); Li, Guangyu, E-mail: LIG001@mail.etsu.edu [Department of Internal Medicine, Quillen College of Medicine, East Tennessee State University, Johnson City, TN 37614 (United States); Oezguen, Numan, E-mail: numan.oezguen@bcm.edu [Department of Pathology and Immunology, Microbiome Center, Texas Children' s Hospital, Houston, TX 77030 (United States); Thiviyanathan, Varatharasa, E-mail: Varatharasa.Thiviyanathan@uth.tmc.edu [Institute of Molecular Medicine, University of Texas Health Science Center, Houston, TX 77030 (United States); Murray, James L., E-mail: jmurray100@yahoo.com [GeneTAG Technology, Inc., 3155 Northwoods Place, Norcross, GA 30071 (United States); Rubin, Donald H., E-mail: don.h.rubin@vanderbilt.edu [Research Medicine, VA Tennessee Valley Healthcare System, 1310 24th Ave. South, Nashville, TN 37212 (United States); Departments of Medicine, Pathology, Microbiology and Immunology, Vanderbilt University School of Medicine, 1161 21st Ave South, Nashville, TN 37232 (United States); Hodge, Thomas W., E-mail: twhodge3@gmail.com [Pre-clinical and Antiviral Research, Tamir Biotechnology, Inc., 12625 High Bluff Dr., Suite 113, San Diego, CA 92130 (United States); and others

2014-04-15

Previously, we showed that ADAM10 is necessary for HIV-1 replication in primary human macrophages and immortalized cell lines. Silencing ADAM10 expression interrupted the HIV-1 life cycle prior to nuclear translocation of viral cDNA. Furthermore, our data indicated that HIV-1 replication depends on the expression of ADAM15 and γ-secretase, which proteolytically processes ADAM10. Silencing ADAM15 or γ-secretase expression inhibits HIV-1 replication between reverse transcription and nuclear entry. Here, we show that ADAM10 expression also supports replication in CD4{sup +} T lymphocytes. The intracellular domain (ICD) of ADAM10 associates with the HIV-1 pre-integration complex (PIC) in the cytoplasm and immunoprecipitates and co-localizes with HIV-1 integrase, a key component of PIC. Taken together, our data support a model whereby ADAM15/γ-secretase processing of ADAM10 releases the ICD, which then incorporates into HIV-1 PIC to facilitate nuclear trafficking. Thus, these studies suggest ADAM10 as a novel therapeutic target for inhibiting HIV-1 prior to nuclear entry. - Highlights: • Nuclear trafficking of the HIV-1 pre-integration complex depends on ADAM10. • ADAM10 associates with HIV-1 integrase in the pre-integration complex. • HIV-1 replication depends on the expression of ADAM15 and γ-secretase. • Silencing ADAM15 or γ-secretase expression inhibits nuclear import of viral cDNA. • ADAM10 is important for HIV-1 replication in human macrophages and CD4{sup +} T lymphocytes.

Determination of bismuth in environmental samples by ICP-MS and basic examination of cell toxicity for their compounds

International Nuclear Information System (INIS)

Kobayashi, Jun; Matsukawa, Takehisa; Chiba, Momoko; Yokoyama, Kazuhito; Terada, Hiroshi; Sugiyama, Hideo

2011-01-01

We examined both bismuth content levels in some environmental water samples (tapwater, bottled drinking water and slag obtained by sewage disposal) by inductively coupled plasma mass spectrometry (ICP-MS) and cultured cell toxicity of their compounds by the MTT assay. For ICP-MS, the conditions examined were addition of internal standard (IS), apparatus condition, and determination range, etc. When we examined an IS, the advantage was not clear that the ICP-MS response of the IS candidate elements was very variable. However, the sample induction rate into ICP-MS is more changeable at any time. Since the correction of analytical results was enabled by the addition of IS, Tl-203 was selected for IS, and was used in this study. The determination lower limit was 11 ppt by using 10 ppb Tl. Bi was detected in a few environmental water samples at 20.4 ppt - 6.8 ppb (0.07-6.83 μg/g original slags), but Bi concentrations of most samples were lower than the determination limit. On the other hand, concerning cell toxicity, the subgallate and free gallic acid affected the lives of cultured cells. Especially, the toxicity of free gallic acid was higher. It has been understood that the toxicity is weakly adjusted by chelating with Bi. (author)

Marie Nimier, au cœur du silence

Directory of Open Access Journals (Sweden)

Joëlle Papillon

2012-01-01

Full Text Available Dans La Reine du silence, Marie Nimier se confronte à la figure de son père, l’écrivain Roger Nimier, mort lorsqu’elle avait cinq ans. Elle y montre le poids qui pèse sur l’enfant d’écrivain, mais aussi celui de l’héritage du secret familial et de l’injonction au silence. La difficulté de l’élaboration de son récit de filiation se révèle dans les constants recommencements et reformulations, qui constituent la marque de la tension angoissante entre l’obligation de dire et celle de taire. In La Reine du silence, Marie Nimier confronts her father’s memory – the writer Roger Nimier, who died when she was five years old. The novel describes the burden of being a writer’s child, along with that of inheriting family secrets and submitting to a code of silence. The difficulty of recounting her relationship with her late father is evidenced by the narrator’s numerous “false starts” and her constant rewritings. The hesitant nature of the narration captures an anguish born of two irreconcilable obligations : the need to put things into words and the pressure to remain silent.

David Price--Pioneer of digital ICP monitoring, neurosurgeon and teacher.

Science.gov (United States)

Czosnyka, Marek; Kirollos, Ramez; van Hille, Philip

2015-06-01

In early 1970s first personal desk-top computers started to be available in hospitals. Mr Price was one of the pioneers introducing his own software to identify Marmarou's model of CSF space during infusion studies to diagnose patients suffering from hydrocephalus. His closed-loop control system for infusion of mannitol to manage patients at risk of intracranial hypertension was designed in 1977. The system worked successfully for 10 years in Pinderfields Hospital in Wakefield, UK. In the middle 1980's he initiated international cooperation with Children's Health Centre in Poland in long-term computer-assisted monitoring and analysis of ICP. Software designed in a course of this cooperation paved the way for contemporary package of ICM+ (Intensive Care Monitor, University of Cambridge, UK). Our scientific portfolio from these years (1985-1995) contains hundreds of head injured patients with waveform ICP analysis, introduction of compensatory reserve index RAP, few highly cited papers. Now, we understand ICP much better thanks to David's personal passion and extremely friendly support.

Direct determination of halogens in powdered geological and environmental samples using isotope dilution laser ablation ICP-MS

Science.gov (United States)

Boulyga, Sergei F.; Heumann, Klaus G.

2005-04-01

Laser ablation inductively coupled plasma isotope dilution mass spectrometry (LA-ICP-IDMS) with a special laser ablation system for bulk analyses (LINA-Spark(TM)-Atomiser) was applied for direct determinations of chlorine, bromine, and iodine in rock and sediment samples. Special attention was focused on possible inter-halogen fractionations and analyte/spike isotope fractionations by using LA-ICP-MS and LA-ICP-IDMS, respectively. A variation of Br/Cl and I/Cl element intensity ratios by a factor of 1.3-3 was observed when changing the nebulizer gas flow rate in the range of 0.84-1.0 L min-1 and the laser power density in the range of 2-10 GW cm-2, respectively. When using an internal standard for halogen quantification in LA-ICP-MS, this inter-element fractionation can cause systematic errors, which can be avoided by applying the isotope dilution technique. However, at high laser power densities (>5.7 GW cm-2 for iodine and >4.0 GW cm-2 for bromine and chlorine) the corresponding measured isotope ratio of the isotope-diluted sample deviates significantly from the target value. Under optimised conditions concentrations in the range of 30 [mu]g g-1-16 × 103 [mu]g g-1 for chlorine, <2-140 [mu]g g-1 for bromine, and <0.1-31 [mu]g g-1 for iodine were determined by LA-ICP-IDMS in two sediment reference materials (SRM 1646, SRM 2704) and three rock reference samples (GS-N, Granite; BX-N, Bauxite; DT-N, Disthene), which have not been certified for these halogens. The sediment results agree well within the given uncertainties with indicative values by different methods and the results of the rock samples with those obtained by negative thermal ionisation isotope dilution mass spectrometry. The detection limits of LA-ICP-IDMS are 8 [mu]g g-1 for chlorine, 1.7 [mu]g g-1 for bromine, and 0.1 [mu]g g-1 for iodine.

Combination of multielement technique (INAA and ICP-MS) for a French air pollution bio-monitoring survey using mosses

International Nuclear Information System (INIS)

Ayrault, S.; Deschamps, C.; Amblard, G.; Galsomies, L.; Letrouit-Galinou, M.A.; Bonhomme, P.

1998-01-01

This work presents the use of two trace analysis techniques through the data obtained for a significant part of the 557 mosses sampled in France. Sampling were made within the framework of European survey carried out in 1995-1996 and proposed by the Nordic Council. The analyses were produced with a combination of two multielement analysis techniques: INAA (Instrumental Neutron Activation Analysis) and ICP-MS (Inductively Coupled Plasma Mass Spectrometry). Theses two techniques were suitable for trace analyses in mosses. They were clearly complementary and provided for 36 elements including the heavy metals of key interest in air pollution studies. The choice of the technique for a given element depended on the feasibility (e g. Pb is not attainable by INAA), the detection limit, the analytical variability, the preparation procedures and the concentration ranges (5-100 μg/g for Pb, 0.5-5 μg/g for As). INAA measured the total content in the sample, while ICP-MS demanded a mineralization procedure resulting in losses/contamination hazards. Thus, INAA results were preferred, although this technique was time consuming. However the ICP-MS results for Cd, Cu, Ni and Pb were retained, for different reasons: detection limits (Cd, Cu), no convenient INAA conditions (Ni), and feasibility (Pb). (authors)

Gendered Communication in Iranian University Classrooms: The Relationship between Politeness and Silence in Persian Culture

Directory of Open Access Journals (Sweden)

Saeedeh Shafiee Nahrkhalaji

2013-05-01

Full Text Available This study examined naturally-occurring university classroominteractions at Iranian universities and provided an analysis ofsilence patterns as politeness strategies used by male andfemale students. Since empirical studies of silence inclassroom settings are scarce, this paper aimed to explainsuch phenomena using participant interviews, classroomobservation and detailed discourse analysis of classroominteraction. Silence patterns and their interpretations werescrutinized in these observations and were discussed inrelation to specific conceptualization of politeness anddevices employed to exercise it. The study found that femalesseem to be the most silent in the cross-sex classrooms, whilethe distribution of silence is more nearly equal in the same sexclassrooms. Based on the comments from follow-upinterviews, reasons for intentional silence as a politenessstrategy were categorized into four groups: silence as a face savingstrategy, silence as a ‘don’t do the FTA’ strategy,silence as a power strategy, and silence as an off-recordstrategy.

ICP OES Determination of Contaminant Elements Leached from Food Packaging Films

Directory of Open Access Journals (Sweden)

Éder José dos Santos

2017-08-01

Full Text Available ABSTRACT Determination of potential contaminants elements in food packing films arising from contact with acidic aqueous foods was undertaken by inductively coupled plasma optical emission spectrometry (ICP OES in accordance with DIN EN 1186-1. Test sections from plastic films were totally immersed in 3% w/v CH3COOH used as the food simulant. Testing was conducted under three conditions: (1 10 days at 40 ºC; (2 30 min at 70 ºC and 10 days at 40 ºC; and (3 30 min at 100 ºC and 10 days at 40 ºC. These time and temperature conditions were considered to be the most severe situations likely to be encountered in practice. Several different containers were investigated, including a borosilicate glass beaker, a glass bottle used for food canning, as well as one of polystyrene. The glass bottle was selected for testing treatments according to procedure (3 and a polystyrene one was chosen for use with procedures (1 and (2. Limits of quantitation were adequate for the determination of Ag, B, Ba, Cd, Cr, Cu, Pb, Sb, Sn and Zn by solution nebulization ICP OES and As by chemical vapor generation (CVG-ICP OES. Results for the analysis of AccuStandard certified reference materials as well as spike recoveries show good agreement with expected concentrations, demonstrating the accuracy and precision of the determinations. Eleven samples of food packing material were analyzed. The lead was present in the range 4.8 - 85.3 µg L-1 in 10 of 11 evaluated packing material, showing the importance of quality control measures.

Silencing of the violaxanthin de-epoxidase gene in the diatom Phaeodactylum tricornutum reduces diatoxanthin synthesis and non-photochemical quenching.

Directory of Open Access Journals (Sweden)

Johann Lavaud

Full Text Available Diatoms are a major group of primary producers ubiquitous in all aquatic ecosystems. To protect themselves from photooxidative damage in a fluctuating light climate potentially punctuated with regular excess light exposures, diatoms have developed several photoprotective mechanisms. The xanthophyll cycle (XC dependent non-photochemical chlorophyll fluorescence quenching (NPQ is one of the most important photoprotective processes that rapidly regulate photosynthesis in diatoms. NPQ depends on the conversion of diadinoxanthin (DD into diatoxanthin (DT by the violaxanthin de-epoxidase (VDE, also called DD de-epoxidase (DDE. To study the role of DDE in controlling NPQ, we generated transformants of P. tricornutum in which the gene (Vde/Dde encoding for DDE was silenced. RNA interference was induced by genetic transformation of the cells with plasmids containing either short (198 bp or long (523 bp antisense (AS fragments or, alternatively, with a plasmid mediating the expression of a self-complementary hairpin-like construct (inverted repeat, IR. The silencing approaches generated diatom transformants with a phenotype clearly distinguishable from wildtype (WT cells, i.e. a lower degree as well as slower kinetics of both DD de-epoxidation and NPQ induction. Real-time PCR based quantification of Dde transcripts revealed differences in transcript levels between AS transformants and WT cells but also between AS and IR transformants, suggesting the possible presence of two different gene silencing mediating mechanisms. This was confirmed by the differential effect of the light intensity on the respective silencing efficiency of both types of transformants. The characterization of the transformants strengthened some of the specific features of the XC and NPQ and confirmed the most recent mechanistic model of the DT/NPQ relationship in diatoms.

Silencing of the Violaxanthin De-Epoxidase Gene in the Diatom Phaeodactylum tricornutum Reduces Diatoxanthin Synthesis and Non-Photochemical Quenching

Science.gov (United States)

Vugrinec, Sascha; Kroth, Peter G.

2012-01-01

Diatoms are a major group of primary producers ubiquitous in all aquatic ecosystems. To protect themselves from photooxidative damage in a fluctuating light climate potentially punctuated with regular excess light exposures, diatoms have developed several photoprotective mechanisms. The xanthophyll cycle (XC) dependent non-photochemical chlorophyll fluorescence quenching (NPQ) is one of the most important photoprotective processes that rapidly regulate photosynthesis in diatoms. NPQ depends on the conversion of diadinoxanthin (DD) into diatoxanthin (DT) by the violaxanthin de-epoxidase (VDE), also called DD de-epoxidase (DDE). To study the role of DDE in controlling NPQ, we generated transformants of P. tricornutum in which the gene (Vde/Dde) encoding for DDE was silenced. RNA interference was induced by genetic transformation of the cells with plasmids containing either short (198 bp) or long (523 bp) antisense (AS) fragments or, alternatively, with a plasmid mediating the expression of a self-complementary hairpin-like construct (inverted repeat, IR). The silencing approaches generated diatom transformants with a phenotype clearly distinguishable from wildtype (WT) cells, i.e. a lower degree as well as slower kinetics of both DD de-epoxidation and NPQ induction. Real-time PCR based quantification of Dde transcripts revealed differences in transcript levels between AS transformants and WT cells but also between AS and IR transformants, suggesting the possible presence of two different gene silencing mediating mechanisms. This was confirmed by the differential effect of the light intensity on the respective silencing efficiency of both types of transformants. The characterization of the transformants strengthened some of the specific features of the XC and NPQ and confirmed the most recent mechanistic model of the DT/NPQ relationship in diatoms. PMID:22629333

GIP-(3-42) does not antagonize insulinotropic effects of GIP at physiological concentrations

DEFF Research Database (Denmark)

Deacon, Carolyn F; Plamboeck, Astrid; Rosenkilde, Mette M

2006-01-01

Glucose-dependent insulinotropic polypeptide [GIP-(1-42)] is degraded by dipeptidyl peptidase IV (DPP IV), forming GIP-(3-42). In mice, high concentrations of synthetic GIP-(3-42) may function as a GIP receptor antagonist, but it is unclear whether this occurs at physiological concentrations...... GIP, GIP-(3-42) behaved as a weak antagonist (IC(50), 92 and 731 nM for inhibition of cAMP accumulation elicited by 10 pM and 1 nM native GIP, respectively). In the isolated perfused rat pancreas, GIP-(3-42) alone had no effect on insulin output and only reduced the response to GIP (1 nM) when......-42) can weakly antagonize cAMP accumulation and insulin output in vitro, it does not behave as a physiological antagonist in vivo....

Sexual antagonism and meiotic drive cause stable linkage disequilibrium and favour reduced recombination on the X chromosome.

Science.gov (United States)

Rydzewski, W T; Carioscia, S A; Liévano, G; Lynch, V D; Patten, M M

2016-06-01

Sexual antagonism and meiotic drive are sex-specific evolutionary forces with the potential to shape genomic architecture. Previous theory has found that pairing two sexually antagonistic loci or combining sexual antagonism with meiotic drive at linked autosomal loci augments genetic variation, produces stable linkage disequilibrium (LD) and favours reduced recombination. However, the influence of these two forces has not been examined on the X chromosome, which is thought to be enriched for sexual antagonism and meiotic drive. We investigate the evolution of the X chromosome under both sexual antagonism and meiotic drive with two models: in one, both loci experience sexual antagonism; in the other, we pair a meiotic drive locus with a sexually antagonistic locus. We find that LD arises between the two loci in both models, even when the two loci freely recombine in females and that driving haplotypes will be enriched for male-beneficial alleles, further skewing sex ratios in these populations. We introduce a new measure of LD, Dz', which accounts for population allele frequencies and is appropriate for instances where these are sex specific. Both models demonstrate that natural selection favours modifiers that reduce the recombination rate. These results inform observed patterns of congealment found on driving X chromosomes and have implications for patterns of natural variation and the evolution of recombination rates on the X chromosome. © 2016 European Society For Evolutionary Biology. Journal of Evolutionary Biology © 2016 European Society For Evolutionary Biology.

Negative Energy Balance Blocks Neural and Behavioral Responses to Acute Stress by "Silencing" Central Glucagon-Like Peptide 1 Signaling in Rats.

Science.gov (United States)

Maniscalco, James W; Zheng, Huiyuan; Gordon, Patrick J; Rinaman, Linda

2015-07-29

Previous reports indicate that caloric restriction attenuates anxiety and other behavioral responses to acute stress, and blunts the ability of stress to increase anterior pituitary release of adrenocorticotropic hormone. Since hindbrain glucagon-like peptide-1 (GLP-1) neurons and noradrenergic prolactin-releasing peptide (PrRP) neurons participate in behavioral and endocrine stress responses, and are sensitive to the metabolic state, we examined whether overnight food deprivation blunts stress-induced recruitment of these neurons and their downstream hypothalamic and limbic forebrain targets. A single overnight fast reduced anxiety-like behavior assessed in the elevated-plus maze and acoustic startle test, including marked attenuation of light-enhanced startle. Acute stress [i.e., 30 min restraint (RES) or 5 min elevated platform exposure] robustly activated c-Fos in GLP-1 and PrRP neurons in fed rats, but not in fasted rats. Fasting also significantly blunted the ability of acute stress to activate c-Fos expression within the anterior ventrolateral bed nucleus of the stria terminalis (vlBST). Acute RES stress suppressed dark-onset food intake in rats that were fed ad libitum, whereas central infusion of a GLP-1 receptor antagonist blocked RES-induced hypophagia, and reduced the ability of RES to activate PrRP and anterior vlBST neurons in ad libitum-fed rats. Thus, an overnight fast "silences" GLP-1 and PrRP neurons, and reduces both anxiety-like and hypophagic responses to acute stress. The partial mimicking of these fasting-induced effects in ad libitum-fed rats after GLP-1 receptor antagonism suggests a potential mechanism by which short-term negative energy balance attenuates neuroendocrine and behavioral responses to acute stress. The results from this study reveal a potential central mechanism for the "metabolic tuning" of stress responsiveness. A single overnight fast, which markedly reduces anxiety-like behavior in rats, reduces or blocks the ability of

Communicative Silences: Forms and Functions

Science.gov (United States)

Bruneau, Thomas J.

1973-01-01

The nature of silence is discussed as an imposition of mind, as an interdependent signification ground for speech signs, as a relationship to mental time (as opposed to artificial time), and as it relates to sensation, perception and metaphorical movement. (Author)

Molecular Characterization of Prostate Cancer Cell Oncolysis by Herpes Simplex Virus ICP0 Mutants

National Research Council Canada - National Science Library

Mossman, Karen

2006-01-01

.... Briefly, the goals of the proposal were to characterize the oncolytic capacity of Herpes simplex virus type 1 ICP0 mutants in prostate cancer cells given the relationship between ICP0 and two tumor...

Precise determination of Pb isotope ratios by simple double spike MC-ICP-MS technique without Tl addition

Digital Repository Service at National Institute of Oceanography (India)

Makishima, A.; Nath, B.N.; Nakamura, E.

A double-spike multicollector ICP-MS (DS-MC-ICP-MS) technique for Pb isotope analysis without Tl addition is established and its analytical performance is examined in detail. This simple DS-MC-ICP-MS technique using 20 ng ml sup(-1) gave averages...

ORGANIZATIONAL SILENCE: SUATU PENGHAMBAT DALAM MEWUJUDKAN KREATIFITAS ORGANISASIONAL

Directory of Open Access Journals (Sweden)

Berta Bekti Retnawati

2016-11-01

Full Text Available There are powerful forces in many organzations that cause widespread withholding of information about potential problems or issues by employess, this collective-level phenomenon as ‘organizational silence’. One significant effect of organizational silence relates to lack of organizational creativity.There are five major organizational factors that enhance creativity in a work environment: organizational climate, leadership style, organizational culture, resources and skills, the structure and system of an organization. Keywords: organizational silence, organizational creativity

The Gift of Silence

Science.gov (United States)

Haskins, Cathleen

2011-01-01

Slowing down, quieting the mind and body, and experiencing silence nourishes the spirit. Montessori educators are mandated to cultivate not just the intellect but the whole child. They recognize that nurturing the spirit of the child is part of what makes this form of education work so well. This article discusses the benefits of stillness and…

ICP-oa TOFMS utilisation to determine the Gd isotopic abundance in gadolinium nitrate

International Nuclear Information System (INIS)

Dragomir, M.; Ohai, D.; Dumitrescu, I.; Furtuna, I.

2010-01-01

This paper is describes the development of a method that should permit the determination of isotope abundance of gadolinium in gadolinium nitrate, used as burnable poison at Cernavoda NPP. To determine the isotopic abundance of gadolinium the inductively coupled plasma orthogonal acceleration time-of-flight mass spectrometer (ICP-oa TOFMS) was used. The ICP-oa TOFMS allows the elimination of noise associated with instrumental drift and instability (flicker noise). The absence of flicker noise in the ICP-oa TOFMS means that the isotope ratios can be measured up to the statistical limit of ion counting. With TOFMS, each spectrum acquired represents signals from ions extracted from the plasma during the same time interval, formed from identical plasma and sample introduction events. Therefore, the ICP-oa TOFMS, Optimass 8000, has been successfully used for isotope ratio measurements of Gd in gadolinium nitrate [Gd (NO 3 ) 3 x 6H 2 O] sample solutions. (authors)

Strategies underlying RNA silencing suppression by negative strand RNA viruses

NARCIS (Netherlands)

Hemmes, J.C.

2007-01-01

The research described in this thesis focused on the strategies of negative strand RNA viruses to counteract antiviral RNA silencing. In plants and insects, RNA silencing has been shown to act as a sequence specific antiviral defence mechanism that is characterised by the processing of double

Le silence, ce cri qui résonne dans l’écriture de Viviane Forrester

Directory of Open Access Journals (Sweden)

Amelia Peral Crespo

2015-11-01

Full Text Available The Holocaust Literature is tied to Silence from its beginning as the writing to silence. Write about the Holocaust and relate the experiences lived in first person or transmit them to the coming generations means leaving the silence which, for years, was the ideal refuge. This research focuses on the literary production of Viviane Forrester. The different expressions of silence that characterize her writings are analyzed. Silence is the cry that underlies in the most profound of the human being that return from the concentration camps, as Lazarus from the dead. It is a silence that grows to a cry because Forrester’s writing, almost in parallel to the fragmentary writing of Blanchot, an-nounces livre à venir, expressing the cry in silence without the ending of the word

Salicylic acid-mediated and RNA-silencing defense mechanisms cooperate in the restriction of systemic spread of plum pox virus in tobacco.

Science.gov (United States)

Alamillo, Josefa M; Saénz, Pilar; García, Juan Antonio

2006-10-01

Plum pox virus (PPV) is able to replicate in inoculated leaves of Nicotiana tabacum, but is defective in systemic movement in this host. However, PPV produces a systemic infection in transgenic tobacco expressing the silencing suppressor P1/HC-Pro from tobacco etch virus (TEV). In this work we show that PPV is able to move to upper non-inoculated leaves of tobacco plants expressing bacterial salicylate hydroxylase (NahG) that degrades salicylic acid (SA). Replication and accumulation of PPV is higher in the locally infected leaves of plants deficient in SA or expressing TEV P1/HC-Pro silencing suppressor. Accumulation of viral derived small RNAs was reduced in the NahG transgenic plants, suggesting that SA might act as an enhancer of the RNA-silencing antiviral defense in tobacco. Besides, expression of SA-mediated defense transcripts, such as those of pathogenesis-related (PR) proteins PR-1 and PR-2 or alternative oxidase-1, as well as that of the putative RNA-dependent RNA polymerase NtRDR1, is induced in response to PPV infection, and the expression patterns of these defense transcripts are altered in the TEV P1/HC-Pro transgenic plants. Long-distance movement of PPV is highly enhanced in NahG x P1/HC-Pro double-transgenic plants and systemic symptoms in these plants reveal that the expression of an RNA-silencing suppressor and the lack of SA produce additive but distinct effects. Our results suggest that SA might act as an enhancer of the RNA-silencing antiviral defense in tobacco, and that silencing suppressors, such as P1/HC-Pro, also alter the SA-mediated defense. Both an RNA-silencing and an SA-mediated defense mechanism could act together to limit PPV infection.

Analysis of impurities in uranium oxide by ICP-MS

International Nuclear Information System (INIS)

Paul, M.; Hager, J.

1989-01-01

The method offers detection limits of less than 0.1 μg/g in solid samples and a wide linear dynamic working range and allows a fast sample throughput. The poster summarizes recent authors' experience with the analysis of high purity uranium oxide. The samples are analyzed using both conventional solution analysis and solid sampling method, using a new powerful laser sampling system attached to the ICP mass spectrometer. The total analysis time required for one uranium oxide sample is about 4 minutes including sample handling, data acquisition and processing. The results achieved from semiquantitative and quantitative analysis applying both techniques are in good agreement with the reference values. (author)

Analysis of I-Br-Cl in single fluid inclusions by LA-ICP-MS

Science.gov (United States)

Giehl, C.; Fusswinkel, T.; Beermann, O.; Garbe-Schönberg, D.; Scholten, L.; Wagner, T.

2017-12-01

Halogens are excellent tracers of hydrothermal fluid sources and in-situ LA-ICP-MS analysis of Cl and Br in single fluid inclusions has provided fundamentally new insight into hydrothermal fluid flow and ore formation. There is mounting evidence that enrichment and depletion of Br relative to Cl may be caused by a number of processes beyond seawater evaporation and halite dissolution which cannot be discriminated on the basis of Br/Cl ratios alone. Expanding the analytical capabilities of fluid inclusion LA-ICP-MS analysis to include iodine would allow to discern between selective and coupled enrichment processes of Cl, Br and I, even in geologically complex samples that are inaccessible to bulk extraction techniques. We present iodine concentration data determined by LA-ICP-MS analysis of synthetic fluid inclusions, using the Sca17 scapolite reference material for external standardization (Seo et al., 2011). Iodine concentrations in Sca17 were determined using the Durango apatite standard. Four starting solutions containing I (0.3, 1.5, 27, 78 µg/g), Br (941, 1403, 2868, 4275 µg/g), Na (30.7, 94.7 mg/g), and Cl (50, 137 mg/g) (analyzed by ICP-OES and ICP-MS at CAU Kiel) were prepared by dissolving reagent grade chemical powders in ultra-pure water. Spherical inclusions (up to 40 µm) were synthesized from the starting solutions in pre-cracked, HF-treated synthetic quartz crystals which were placed in gold capsules and equilibrated at 600°C, 100/200 MPa in cold seal pressure vessels. Fluid inclusion LA-ICP-MS analysis (University of Helsinki) yielded average I concentrations in excellent agreement with the starting solutions (27.3 µg/g ± 14 %RSD for the 27 µg/g solution and 77.6 µg/g ± 8.3 %RSD for the 78 µg/g solution). Average Br and I concentrations deviate less than 10 % from solution concentration values. For the low I concentration solutions, the synthetic inclusions were too small to detect I. Thus, given suitable standard materials and sufficient

Some aspects of ICP-AES analysis of high purity rare earths

International Nuclear Information System (INIS)

Murty, P.S.; Biswas, S.S.

1991-01-01

Inductively coupled plasma atomic emission spectrometry (ICP-AES) is a technique capable of giving high sensitivity in trace elemental analysis. While the technique possesses high sensitivity, it lacks high selectivity. Selectivity is important where substances emitting complex spectra are to be analysed for trace elements. Rare earths emit highly complex spectra in a plasma source and the determination of adjacent rare earths in a high purity rare earth matrix, with high sensitivity, is not possible due to the inadequate selectivity of ICP-AES. One approach that has yielded reasonably good spectral selectivity in the high purity rare earth analysis by ICP-AES is by employing a combination of wavelength modulation techniques and high resolution echelle grating. However, it was found that by using a high resolution monochromator senstitivities either comparable to or better than those reported by the wavelength modulation technique could be obtained. (author). 2 refs., 2 figs., 2 tabs

Giving Voice: Narrating silence, history and memory in André Brink ...

African Journals Online (AJOL)

Giving Voice: Narrating silence, history and memory in André Brink\\'s The Other Side of Silence and Before I Forget. ... Both narrators, though, draw attention to the problems associated with this reconstructive and potentially ... Article Metrics.

The complications and the position of the Codman MicroSensor™ ICP device: an analysis of 549 patients and 650 Sensors.

Science.gov (United States)

Koskinen, Lars-Owe D; Grayson, David; Olivecrona, Magnus

2013-11-01

Complications of and insertion depth of the Codman MicroSensor ICP monitoring device (CMS) is not well studied. To study complications and the insertion depth of the CMS in a clinical setting. We identified all patients who had their intracranial pressure (ICP) monitored using a CMS device between 2002 and 2010. The medical records and post implantation computed tomography (CT) scans were analyzed for occurrence of infection, hemorrhage and insertion depth. In all, 549 patients were monitored using 650 CMS. Mean monitoring time was 7.0 ± 4.9 days. The mean implantation depth was 21.3 ± 11.1 mm (0-88 mm). In 27 of the patients, a haematoma was identified; 26 of these were less than 1 ml, and one was 8 ml. No clinically significant bleeding was found. There was no statistically significant increase in the number of hemorrhages in presumed coagulopathic patients. The infection rate was 0.6 % and the calculated infection rate per 1,000 catheter days was 0.8. The risk for hemorrhagic and infectious complications when using the CMS for ICP monitoring is low. The depth of insertion varies considerably and should be taken into account if patients are treated with head elevation, since the pressure is measured at the tip of the sensor. To meet the need for ICP monitoring, an intraparenchymal ICP monitoring device should be preferred to the use of an external ventricular drainage (EVD).

Self-Silencing, Emotional Awareness, and Eating Behaviors in College Women

Science.gov (United States)

Shouse, Sarah H.; Nilsson, Johanna

2011-01-01

Self-silencing (or the suppression of expressing one's thoughts, feelings, and needs) can have a negative impact on the mental health of women, from depression to disordered eating behaviors. The authors examined the relationship between self-silencing and disordered eating as well as intuitive eating. The authors also explored whether emotional…

Evaluation of the antagonism of nicotine by mecamylamine and pempidine in the brain

International Nuclear Information System (INIS)

Martin, T.J.

1989-01-01

Antagonists have been crucial in the characterization of nicotine's pharmacology. Initial evidence for the existence of central nicotinic receptors was based on the fact that nicotine produced a number of behavioral effects that were antagonized by ganglionic blockers that crossed the blood-brain barrier, such as mecamylamine and pempidine. These compounds are thought to be noncompetitive antagonists due to the fact that they do not compete for agonist binding to brain homogenate in vitro. However, pharmacological evidence in support of noncompetitive antagonism is lacking. Dose-response curves for nicotine were determined in the presence of various doses of pempidine for depression of spontaneous activity and antinociception in mice. Pempidine was found to shift the dose response curves for these effects of nicotine in a manner consistent with noncompetitive antagonism. A number of mecamylamine analogs were investigated for antagonism of these central effects of nicotine as well. These studies revealed that the N-, 2-, and 3-methyls were crucial for optimal efficacy and potency and suggests that these compounds possess a specific mechanism of action, possibly involving a receptor. Furthermore, the structure-activity relationships for the mecamylamine analogs were found to be different than that previously reported for the agonists, suggesting that they do not act at the same site. The binding of [ 3 H]-L-nicotine and [ 3 H]-pempidine was studied in vitro to mouse brain homogentate and in situ to rat brain slices. The in situ binding of [ 3 H]-L-nicotine to rat brain slices was quantitated autoradiographically to discrete brain areas in the presence and absence of 1, 10 and 100 μM nicotine and pempidine. Pempidine did not effectively displace [ 3 H]-L-nicotine binding

The influence of room temperature on Mg isotope measurements by MC-ICP-MS.

Science.gov (United States)

Zhang, Xing-Chao; Zhang, An-Yu; Zhang, Zhao-Feng; Huang, Fang; Yu, Hui-Min

2018-03-24

We observed that the accuracy and precision of magnesium (Mg) isotope analyses could be affected if the room temperature oscillated during measurements. To achieve high quality Mg isotopic data, it is critical to evaluate how the unstable room temperature affects Mg isotope measurements by multi-collector inductively coupled plasma mass spectrometry (MC-ICP-MS). We measured the Mg isotopes for the reference material DSM-3 using MC-ICP-MS under oscillating room temperatures in spring. For a comparison, we also measured the Mg isotopes under stable room temperatures, which was achieved by the installation of an improved temperature control system in the laboratory. The δ 26 Mg values measured under oscillating room temperatures have a larger deviation (δ 26 Mg from -0.09 to 0.08‰, with average δ 26 Mg = 0.00 ± 0.08 ‰) than those measured under a stable room temperature (δ 26 Mg from -0.03 to 0.03‰, with average δ 26 Mg = 0.00 ± 0.02 ‰) using the same MC-ICP-MS system. The room temperature variation can influence the stability of MC-ICP-MS. Therefore, it is critical to keep the room temperature stable to acquire high precise and accurate isotopic data when using MC-ICP-MS, especially when using the sample-standard bracketing (SSB) correction method. This article is protected by copyright. All rights reserved.

L’architecture du silence de la Shoah dans les fictions de Sylvie Germain

Directory of Open Access Journals (Sweden)

José Luis Arráez Llobregat

2015-11-01

Full Text Available Silences concerning the Shoah constitute a leitmotiv in Sylvie Germain’s narrative work. Motive and motivation intentionally emerge as a proteiform phenomenon from the writer-philosopher’s genius and from the historical and ideological substance, which imbue the novelist in every sec-tion of her literary creation. The pur-pose of this study is to interpret those silences in a set of selected novels where the Shoah takes up either a primary or a secondary role, but in any case a relevant one. To this end this study carries out a detailed study of the silence coming from the narrator’s origin, the victims, the murderers or God. Beyond the silence in humans and supreme beings, this study also investigates the spatial silence in that apocalyptic world.

Fundamental and applied measurements in ICP MS

Energy Technology Data Exchange (ETDEWEB)

Carter, Julian Robert

2002-07-01

Fundamental and applied aspects of ICP-MS have been investigated to gain an increased understanding of the technique and improve on its analytical capabilities. Dissociation temperatures of polyatomic ions were calculated using a double-focusing sector instrument, to obtain more reliable mass spectral data with controlled vapour introduction via a Dreschel bottle to allow accurate calculation of the ingredients in the plasma. The equilibrium temperature for the plasma, operated at 1280 W calculated using CO{sup +} and C{sub 2}{sup +} as the thermometric probes, was c.a. 5800 - 7400 K, while using ArO{sup +} and ArC{sup +} as the thermometric probes the temperature calculated was c.a. 2000 - 7000 K. Calculated dissociation temperatures were used to elucidate the site of formation of these ions. Results confirmed that strongly bound ions such as CO{sup +} and C{sub 2}{sup +} were formed in the plasma whereas weakly bound ions such as ArO{sup +} and ArC{sup +} were formed in the interface region due to gross deviation of the calculated temperatures from those expected for a system in thermal equilibrium. The use of helium gas in a hexapole collision cell attenuated the signals of ArH{sup +} Ar{sup +}, ArO{sup +}, ArC{sup +}, ArCl{sup +} and Ar{sub 2}{sup +} allowing improved determination of {sup 39}K{sup +}, {sup 40}Ca{sup +}, {sup 56}Fe{sup +}, {sup 52}Cr{sup +}, {sup 75}As{sup +} and {sup 80}Se{sup +} in standard solutions. The use of the hexapole collision cell also resulted in an enhancement of analyte signals due to the thermalisation of the ion beam. The ion kinetic energy of ions sampled from the plasma and those sampled from the skimmer cone were determined using a modified lens stack to assess the significance for memory effects of material deposited on the skimmer cone. The most probable kinetic energy of Be{sup +} ions sampled from the skimmer cone was found to be 2.4 eV, which was considerably lower than the most probable kinetic energy of Be{sup +} ions

Design of the Magnetic Resonance Imaging Evaluation of Mineralocorticoid Receptor Antagonism in Diabetic Atherosclerosis (MAGMA) Trial.

Science.gov (United States)

Rajagopalan, Sanjay; Alaiti, M Amer; Broadwater, Kylene; Goud, Aditya; Gaztanaga, Juan; Connelly, Kim; Fares, Anas; Shirazian, Shayan; Kreatsoulas, Catherine; Farkouh, Michael; Dobre, Mirela; Fink, Jeffrey C; Weir, Matthew R

2017-09-01

Mineralocorticoid receptor (MR) activation plays an essential role in promoting inflammation, fibrosis, and target organ damage. Currently, no studies are investigating MR antagonism in patients with type 2 diabetes mellitus (T2DM) with chronic kidney disease, at high risk for cardiovascular complications, who are otherwise not candidates for MR antagonism by virtue of heart failure. Further, there is limited information on candidate therapies that may demonstrate differential benefit from this therapy. We hypothesized that MR antagonism may provide additional protection from atherosclerosis progression in higher-risk patients who otherwise may not be candidates for such a therapeutic approach. In this double-blind, randomized, placebo-controlled trial, subjects with T2DM with chronic kidney disease (≥ stage 3) will be randomized in a 1:1 manner to placebo or spironolactone (12.5 mg with eventual escalation to 25 mg daily over a 4-week period). The co-primary efficacy endpoint will be percentage change in total atheroma volume in thoracic aorta and left ventricular mass at 52 weeks in patients treated with spironolactone vs placebo. Secondary outcomes include 24-hour mean systolic blood pressure, central aortic blood pressure, and insulin resistance (HOMA-IR) at 6 weeks. A novel measure in the study will be changes in candidate miRNAs that regulate expression of NR3C2 (MR gene) as well as measuring monocyte/macrophage polarization in response to therapy with spironolactone. We envision that our strategy of simultaneously probing the effects of a drug combined with analysis of mechanisms of action and predictive response will likely provide key information with which to design event-based trials. © 2017 Wiley Periodicals, Inc.

RELATIONSHIP BETWEEN AFFECTIVE COMMITMENT ANDORGANIZATIONAL SILENCE: A CONCEPTUAL DISCUSSION

Directory of Open Access Journals (Sweden)

Fitnat Nazlı Sayğan

2011-07-01

Full Text Available In this study, the affective commitment that is oneof the components oforganizational commitment put forth by Allen and Meyer (Allen, Meyer 1996will be differentiated from the other commitment components. The importance ofcreating an emotional commitment to organizations will be examined and theorganizational factors needed to form organizational commitment will beinvestigated. Also, organizational silence is a situation that the company avoided.In the study, the reasons and the drawbacks of silence are focused on and thefactors that cause employees to remain silent are discussed.The aim of this study is intended to manifest the relationship of ‘organizationalsilence' with affective commitment’ which is one ofthe components of‘organizational commitment’ on the basis of literature. In this study, a negativecorrelation between affective commitment and organizational silence is suggested

高分解能ICP-MSの特徴とその測定例<総説 レビュー>

OpenAIRE

石井, 清孝

2000-01-01

At present, there are two kind of the instruments of ICP-MS. One is HR-ICP-MS that used double focusing mass spectrometer the other one is Q-ICP-MS that used a quadrupole mass spectrometer. HR-ICP-MS has many characteristics in comparison with Q-ICP-MS. It is reported of the HR-ICP-MS structure and characteristics and also reported one of the examples of the measurement that made the most of the characteristic of it’s high resolving power in this time.概要：現在，一般的に使用されているICP-MS にはその分光器に四重極形質量分析計...

Identification of a divalent metal cation binding site in herpes simplex virus 1 (HSV-1) ICP8 required for HSV replication.

Science.gov (United States)

Bryant, Kevin F; Yan, Zhipeng; Dreyfus, David H; Knipe, David M

2012-06-01

Herpes simplex virus 1 (HSV-1) ICP8 is a single-stranded DNA-binding protein that is necessary for viral DNA replication and exhibits recombinase activity in vitro. Alignment of the HSV-1 ICP8 amino acid sequence with ICP8 homologs from other herpesviruses revealed conserved aspartic acid (D) and glutamic acid (E) residues. Amino acid residue D1087 was conserved in every ICP8 homolog analyzed, indicating that it is likely critical for ICP8 function. We took a genetic approach to investigate the functions of the conserved ICP8 D and E residues in HSV-1 replication. The E1086A D1087A mutant form of ICP8 failed to support the replication of an ICP8 mutant virus in a complementation assay. E1086A D1087A mutant ICP8 bound DNA, albeit with reduced affinity, demonstrating that the protein is not globally misfolded. This mutant form of ICP8 was also recognized by a conformation-specific antibody, further indicating that its overall structure was intact. A recombinant virus expressing E1086A D1087A mutant ICP8 was defective in viral replication, viral DNA synthesis, and late gene expression in Vero cells. A class of enzymes called DDE recombinases utilize conserved D and E residues to coordinate divalent metal cations in their active sites. We investigated whether the conserved D and E residues in ICP8 were also required for binding metal cations and found that the E1086A D1087A mutant form of ICP8 exhibited altered divalent metal binding in an in vitro iron-induced cleavage assay. These results identify a novel divalent metal cation-binding site in ICP8 that is required for ICP8 functions during viral replication.

Application of isotope-dilution laser ablation ICP-MS for direct determination of Pu concentrations in soils at pg g{sup -1} levels

Energy Technology Data Exchange (ETDEWEB)

Boulyga, Sergei F.; Tibi, Markus; Heumann, Klaus G. [Institute of Inorganic Chemistry and Analytical Chemistry, Johannes Gutenberg-University Mainz, Duesbergweg 10-14, 55099, Mainz (Germany)

2004-01-01

The methods available for determination of environmental contamination by plutonium at ultra-trace levels require labor-consuming sample preparation including matrix removal and plutonium extraction in both nuclear spectroscopy and mass spectrometry. In this work, laser-ablation inductively coupled plasma mass spectrometry (LA-ICP-MS) was applied for direct analysis of Pu in soil and sediment samples. Application of a LINA-Spark-Atomizer system (a modified laser ablation system providing high ablation rates) coupled with a sector-field ICP-MS resulted in detection limits as low as 3 x 10{sup -13} g g{sup -1} for Pu isotopes in soil samples containing uranium at a concentration of a few {mu}g g{sup -1}. The isotope dilution (ID) technique was used for quantification, which compensated for matrix effects in LA-ICP-MS. Interferences by UH{sup +} and PbO{sub 2}{sup +} ions and by the peak tail of {sup 238}U{sup +} ions were reduced or separated by use of dry plasma conditions and a mass resolution of 4000, respectively. No other effects affecting measurement accuracy, except sample inhomogeneity, were revealed. Comparison of results obtained for three contaminated soil samples by use of {alpha}-spectrometry, ICP-MS with sample decomposition, and LA-ICP-IDMS showed, in general, satisfactory agreement of the different methods. The specific activity of {sup 239+240}Pu (9.8{+-}3.0 mBq g{sup -1}) calculated from LA-ICP-IDMS analysis of SRM NIST 4357 coincided well with the certified value of 10.4{+-}0.2 mBq g{sup -1}. However, the precision of LA-ICP-MS for determination of plutonium in inhomogeneous samples, i.e. if ''hot'' particles are present, is limited. As far as we are aware this paper reports the lowest detection limits and element concentrations yet measured in direct LA-ICP-MS analysis of environmental samples. (orig.)

Breaking through the uncertainty ceiling in LA-ICP-MS U-Pb geochronology

Science.gov (United States)

Horstwood, M.

2016-12-01

Sources of systematic uncertainty associated with session-to-session bias are the dominant contributor to the 2% (2s) uncertainty ceiling that currently limits the accuracy of LA-ICP-MS U-Pb geochronology. Sources include differential downhole fractionation (LIEF), `matrix effects' and ablation volume differences, which result in irreproducibility of the same reference material across sessions. Current mitigation methods include correcting for LIEF mathematically, using matrix-matched reference materials, annealing material to reduce or eliminate radiation damage effects and tuning for robust plasma conditions. Reducing the depth and volume of ablation can also mitigate these problems and should contribute to the reduction of the uncertainty ceiling. Reducing analysed volume leads to increased detection efficiency, reduced matrix-effects, eliminates LIEF, obviates ablation rate differences and reduces the likelihood of intercepting complex growth zones with depth, thereby apparently improving material homogeneity. High detection efficiencies (% level) and low sampling volumes (20um box, 1-2um deep) can now be achieved using MC-ICP-MS such that low volume ablations should be considered part of the toolbox of methods targeted at improving the reproducibility of LA-ICP-MS U-Pb geochronology. In combination with other strategies these improvements should be feasible on any ICP platform. However, reducing the volume of analysis reduces detected counts and requires a change of analytical approach in order to mitigate this. Appropriate strategies may include the use of high efficiency cell and torch technologies and the optimisation of acquisition protocols and data handling techniques such as condensing signal peaks, using log ratios and total signal integration. The tools required to break the 2% (2s) uncertainty ceiling in LA-ICP-MS U-Pb geochronology are likely now known but require a coherent strategy and change of approach to combine their implementation and realise

Gas turbine exhaust system silencing design

International Nuclear Information System (INIS)

Ozgur, D.

1991-01-01

Gas turbines are the preferred prime mover in many applications because of their high efficiency, fuel flexibility, and low environmental impact. A typical mid-size machine might have a power rating of 80 MW, a flow of about 1000 kg/hr, and an exhaust temperature of over 500C. The most powerful single source of noise is generally the exhaust, which may generate over a kilowatt of acoustic energy. This paper reports that there are two important ways in which exhaust systems can radiate noise. The first is through the discharge of the exhaust duct, with the exhaust gas. Because of the large quantity of hot gas, the duct exit is always oriented vertically; it may be fairly high in the air in order to promote dispersion of the exhaust plume. This source is almost always attenuated by means of a silencer located somewhere in the ductwork. The second source of noise is often called breakout; it is the radiation of exhaust noise through the walls of the ducting. Breakout is most important for those sections of the exhaust duct which lie upstream of the silencer, where sound levels inside the ducting are highest. Both exhaust duct exit noise and breakout noise can be calculated from the sound power level of the gas turbine exhaust and the sound transmission loss (TL) of the silencer and ducting

Refracted arrival waves in a zone of silence from a finite thickness mixing layer.

Science.gov (United States)

Suzuki, Takao; Lele, Sanjiva K

2002-02-01

Refracted arrival waves which propagate in the zone of silence of a finite thickness mixing layer are analyzed using geometrical acoustics in two dimensions. Here, two simplifying assumptions are made: (i) the mean flow field is transversely sheared, and (ii) the mean velocity and temperature profiles approach the free-stream conditions exponentially. Under these assumptions, ray trajectories are analytically solved, and a formula for acoustic pressure amplitude in the far field is derived in the high-frequency limit. This formula is compared with the existing theory based on a vortex sheet corresponding to the low-frequency limit. The analysis covers the dependence on the Mach number as well as on the temperature ratio. The results show that both limits have some qualitative similarities, but the amplitude in the zone of silence at high frequencies is proportional to omega(-1/2), while that at low frequencies is proportional to omega(-3/2), omega being the angular frequency of the source.

Reduction of Solvent Effect in Reverse Phase Gradient Elution LC-ICP-MS

Energy Technology Data Exchange (ETDEWEB)

Sullivan, Patrick Allen [Iowa State Univ., Ames, IA (United States)

2005-12-17

Quantification in liquid chromatography (LC) is becoming very important as more researchers are using LC, not as an analytical tool itself, but as a sample introduction system for other analytical instruments. The ability of LC instrumentation to quickly separate a wide variety of compounds makes it ideal for analysis of complex mixtures. For elemental speciation, LC is joined with inductively coupled plasma mass spectrometry (ICP-MS) to separate and detect metal-containing, organic compounds in complex mixtures, such as biological samples. Often, the solvent gradients required to perform complex separations will cause matrix effects within the plasma. This limits the sensitivity of the ICP-MS and the quantification methods available for use in such analyses. Traditionally, isotope dilution has been the method of choice for LC-ICP-MS quantification. The use of naturally abundant isotopes of a single element in quantification corrects for most of the effects that LC solvent gradients produce within the plasma. However, not all elements of interest in speciation studies have multiple naturally occurring isotopes; and polyatomic interferences for a given isotope can develop within the plasma, depending on the solvent matrix. This is the case for reverse phase LC separations, where increasing amounts of organic solvent are required. For such separations, an alternative to isotope dilution for quantification would be is needed. To this end, a new method was developed using the Apex-Q desolvation system (ESI, Omaha, NE) to couple LC instrumentation with an ICP-MS device. The desolvation power of the system allowed greater concentrations of methanol to be introduced to the plasma prior to destabilization than with direct methanol injection into the plasma. Studies were performed, using simulated and actual linear methanol gradients, to find analyte-internal standard (AIS) pairs whose ratio remains consistent (deviations {+-} 10%) over methanol concentration ranges of 5

A cellular system for quantitation of vitamin K cycle activity: structure-activity effects on vitamin K antagonism by warfarin metabolites

Science.gov (United States)

Haque, Jamil A.; McDonald, Matthew G.; Kulman, John D.

2014-01-01

Warfarin and other 4-hydroxycoumarins inhibit vitamin K epoxide reductase (VKOR) by depleting reduced vitamin K that is required for posttranslational modification of vitamin K–dependent clotting factors. In vitro prediction of the in vivo potency of vitamin K antagonists is complicated by the complex multicomponent nature of the vitamin K cycle. Here we describe a sensitive assay that enables quantitative analysis of γ-glutamyl carboxylation and its antagonism in live cells. We engineered a human embryonic kidney (HEK) 293–derived cell line (HEK 293-C3) to express a chimeric protein (F9CH) comprising the Gla domain of factor IX fused to the transmembrane and cytoplasmic regions of proline-rich Gla protein 2. Maximal γ-glutamyl carboxylation of F9CH required vitamin K supplementation, and was dose-dependently inhibited by racemic warfarin at a physiologically relevant concentration. Cellular γ-glutamyl carboxylation also exhibited differential VKOR inhibition by warfarin enantiomers (S > R) consistent with their in vivo potencies. We further analyzed the structure-activity relationship for inhibition of γ-glutamyl carboxylation by warfarin metabolites, observing tolerance to phenolic substitution at the C-5 and especially C-6, but not C-7 or C-8, positions on the 4-hydroxycoumarin nucleus. After correction for in vivo concentration and protein binding, 10-hydroxywarfarin and warfarin alcohols were predicted to be the most potent inhibitory metabolites in vivo. PMID:24297869

A new component of the Nasonia sex determining cascade is maternally silenced and regulates transformer expression.

Science.gov (United States)

Verhulst, Eveline C; Lynch, Jeremy A; Bopp, Daniel; Beukeboom, Leo W; van de Zande, Louis

2013-01-01

Although sex determination is a universal process in sexually reproducing organisms, sex determination pathways are among the most highly variable genetic systems found in nature. Nevertheless, general principles can be identified among the diversity, like the central role of transformer (tra) in insects. When a functional TRA protein is produced in early embryogenesis, the female sex determining route is activated, while prevention of TRA production leads to male development. In dipterans, male development is achieved by prevention of female-specific splicing of tra mRNA, either mediated by X-chromosome dose or masculinizing factors. In Hymenoptera, which have haplodiploid sex determination, complementary sex determination and maternal imprinting have been identified to regulate timely TRA production. In the parasitoid Nasonia, zygotic transformer (Nvtra) expression and splicing is regulated by a combination of maternal provision of Nvtra mRNA and silencing of Nvtra expression in unfertilized eggs. It is unclear, however, if this silencing is directly on the tra locus or whether it is mediated through maternal silencing of a trans-acting factor. Here we show that in Nasonia, female sex determination is dependent on zygotic activation of Nvtra expression by an as yet unknown factor. This factor, which we propose to term womanizer (wom), is maternally silenced during oogenesis to ensure male development in unfertilized eggs. This finding implicates the upstream recruitment of a novel gene in the Nasonia sex determining cascade and supports the notion that sex determining cascades can rapidly change by adding new components on top of existing regulators.

A New Component of the Nasonia Sex Determining Cascade Is Maternally Silenced and Regulates Transformer Expression

Science.gov (United States)

Bopp, Daniel; Beukeboom, Leo W.; van de Zande, Louis

2013-01-01

Although sex determination is a universal process in sexually reproducing organisms, sex determination pathways are among the most highly variable genetic systems found in nature. Nevertheless, general principles can be identified among the diversity, like the central role of transformer (tra) in insects. When a functional TRA protein is produced in early embryogenesis, the female sex determining route is activated, while prevention of TRA production leads to male development. In dipterans, male development is achieved by prevention of female-specific splicing of tra mRNA, either mediated by X-chromosome dose or masculinizing factors. In Hymenoptera, which have haplodiploid sex determination, complementary sex determination and maternal imprinting have been identified to regulate timely TRA production. In the parasitoid Nasonia, zygotic transformer (Nvtra) expression and splicing is regulated by a combination of maternal provision of Nvtra mRNA and silencing of Nvtra expression in unfertilized eggs. It is unclear, however, if this silencing is directly on the tra locus or whether it is mediated through maternal silencing of a trans-acting factor. Here we show that in Nasonia, female sex determination is dependent on zygotic activation of Nvtra expression by an as yet unknown factor. This factor, which we propose to term womanizer (wom), is maternally silenced during oogenesis to ensure male development in unfertilized eggs. This finding implicates the upstream recruitment of a novel gene in the Nasonia sex determining cascade and supports the notion that sex determining cascades can rapidly change by adding new components on top of existing regulators. PMID:23717455

Analytical data and sample locality map for aqua-regia leachates of stream sediments analyzed by ICP, and emission spectrographic and ICP results for many NURE stream sediments from the Killik River Quadrangle, Alaska

International Nuclear Information System (INIS)

Motooka, J.M.; Adrian, B.M.; Church, S.E.; McDougal, C.M.; Fife, J.B.

1989-01-01

A U.S. Geological Survey report is presented giving analytical data and sample locality map for aqua-regia leachates of stream sediments analyzed by ICP, and emission spectrographic and ICP results for many NURE stream sediments from the Killik River Quadrangle, Alaska

Viral RNA Silencing Suppression: The Enigma of Bunyavirus NSs Proteins

Directory of Open Access Journals (Sweden)

Marcio Hedil

2016-07-01

Full Text Available The Bunyaviridae is a family of arboviruses including both plant- and vertebrate-infecting representatives. The Tospovirus genus accommodates plant-infecting bunyaviruses, which not only replicate in their plant host, but also in their insect thrips vector during persistent propagative transmission. For this reason, they are generally assumed to encounter antiviral RNA silencing in plants and insects. Here we present an overview on how tospovirus nonstructural NSs protein counteracts antiviral RNA silencing in plants and what is known so far in insects. Like tospoviruses, members of the related vertebrate-infecting bunyaviruses classified in the genera Orthobunyavirus, Hantavirus and Phlebovirus also code for a NSs protein. However, for none of them RNA silencing suppressor activity has been unambiguously demonstrated in neither vertebrate host nor arthropod vector. The second part of this review will briefly describe the role of these NSs proteins in modulation of innate immune responses in mammals and elaborate on a hypothetical scenario to explain if and how NSs proteins from vertebrate-infecting bunyaviruses affect RNA silencing. If so, why this discovery has been hampered so far.

Viral RNA Silencing Suppression: The Enigma of Bunyavirus NSs Proteins.

Science.gov (United States)

Hedil, Marcio; Kormelink, Richard

2016-07-23

The Bunyaviridae is a family of arboviruses including both plant- and vertebrate-infecting representatives. The Tospovirus genus accommodates plant-infecting bunyaviruses, which not only replicate in their plant host, but also in their insect thrips vector during persistent propagative transmission. For this reason, they are generally assumed to encounter antiviral RNA silencing in plants and insects. Here we present an overview on how tospovirus nonstructural NSs protein counteracts antiviral RNA silencing in plants and what is known so far in insects. Like tospoviruses, members of the related vertebrate-infecting bunyaviruses classified in the genera Orthobunyavirus, Hantavirus and Phlebovirus also code for a NSs protein. However, for none of them RNA silencing suppressor activity has been unambiguously demonstrated in neither vertebrate host nor arthropod vector. The second part of this review will briefly describe the role of these NSs proteins in modulation of innate immune responses in mammals and elaborate on a hypothetical scenario to explain if and how NSs proteins from vertebrate-infecting bunyaviruses affect RNA silencing. If so, why this discovery has been hampered so far.

Flumazenil antagonizes the central effects of zolpidem, an imidazopyridine hypnotic.

Science.gov (United States)

Patat, A; Naef, M M; van Gessel, E; Forster, A; Dubruc, C; Rosenzweig, P

1994-10-01

Zolpidem is a new imidazopyridine-hypnotic that selectively binds to the central omega 1-receptor subtype. A double-blind, randomized, three-way, crossover placebo-controlled study was carried out in nine healthy male volunteers to assess the possible antagonism of central nervous system--depressant effects of zolpidem by flumazenil. Subjects received zolpidem (0.21 mg/kg) or placebo, intravenously, followed 17 minutes later by flumazenil (0.04 mg/kg) or placebo. Vigilance and performance were assessed by a trained anesthetist with use of ciliary reflex, response to a verbal instruction, subjective sedation, a tracking task, and a free recall task. Zolpidem produced a clinically relevant hypnotic effect in five subjects and significantly impaired performance in all nine subjects up to 90 minutes after dosing. Flumazenil rapidly antagonized clinical sedation in the five subjects who were asleep and significantly reversed the performance decrement within 3 minutes, without any escape phenomenon. Flumazenil did not change zolpidem plasma concentrations, confirming the pharmacodynamic nature of the interaction. Flumazenil may thus be a safe and effective antidote in patients with zolpidem overdosage.

Adaptation of the Four Forms of Employee Silence Scale in a Polish sample

Directory of Open Access Journals (Sweden)

Krystyna Adamska

2017-06-01

Full Text Available Background Silence is understood as a decision not to speak up in situations of observed irregularities both in productivity and ethics. The study examined the validity of the Four Forms of Employee Silence Scale (FFESS in the Polish population. The scale is a four-factor measure designed to capture differently motivated tendencies to be silent in organizations. The scale distinguishes acquiescent, quiescent, prosocial and opportunistic silence. Employee silence has been linked to many important individual outcomes: failure to react to ethical transgressions, stress and depression, and lower creativity and productivity. Participants and procedure A total of 1044 employees of various organizations working for at least six months at a given position provided the responses for the validation study. Results The results confirmed the superiority of the four-factor model shown by adequate fit indexes: The FFESS has adequate internal consistency at both the scale and item levels. The criterion-related validity of the scale was established by correlating four forms of silence with measures of emotional attitude toward organization, procedural justice, relational contract and turnover intention. Conclusions The four forms of employee silence are empirically distinct concepts in the Polish sample. The scale may be used as the measurement of individual differences. It can also serve as a tool for diagnosing a climate of silence in an organization.

Spectral lines and coincidence tables for the determination of zirconium, niobium and tantalum with the ICP

International Nuclear Information System (INIS)

Wuensch, G.; Wennemer, A.

1987-01-01

Coincidence tables for ICP-AES are given for 20 Zr lines, 9 Nb lines and 7 Ta lines. They include 582 interferent lines of 49 elements. The specified interference data (IEC and CCR) hold for a bandwidth FWHM = 16 pm and an interferent concentration of 1,000 mg/l. For trace determinations of Zr, Nb, Ta in a matrix of Fe, Z, Zr, Nb, Ta the dependence of the interference on the matrix concentration is specified up to 10,000 mg/l. Interference data CCR calculated for the ICP from the NBS tables often differ from the measured data by several orders of magnitude. The spectrum of Zr measured at a high concentration shows many weak lines most of which are not even listed in the MIT tables. They give rise to a quasi-continuous background the intensity of which increases nearly linearly with the matrix concentration. Therefore, an increase of sample concentration will not lead to an improved detection limit. The line intensities found in our investigations match well with those listed in the Wohlers tables. (orig.)