Human adenovirus serotype 12 virion precursors pMu and pVI are cleaved at amino-terminal and carboxy-terminal sites that conform to the adenovirus 2 endoproteinase cleavage consensus sequence.

Science.gov (United States)

Freimuth, P; Anderson, C W

1993-03-01

The sequence of a 1158-base pair fragment of the human adenovirus serotype 12 (Ad12) genome was determined. This segment encodes the precursors for virion components Mu and VI. Both Ad12 precursors contain two sequences that conform to a consensus sequence motif for cleavage by the endoproteinase of adenovirus 2 (Ad2). Analysis of the amino terminus of VI and of the peptide fragments found in Ad12 virions demonstrated that these sites are cleaved during Ad12 maturation. This observation suggests that the recognition motif for adenovirus endoproteinases is highly conserved among human serotypes. The adenovirus 2 endoproteinase polypeptide requires additional co-factors for activity (C. W. Anderson, Protein Expression Purif., 1993, 4, 8-15). Synthetic Ad12 or Ad2 pVI carboxy-terminal peptides each permitted efficient cleavage of an artificial endoproteinase substrate by recombinant Ad2 endoproteinase polypeptide.

Plasminogen fragments K 1-3 and K 5 bind to different sites in fibrin fragment DD.

Science.gov (United States)

Grinenko, T V; Kapustianenko, L G; Yatsenko, T A; Yusova, O I; Rybachuk, V N

2016-01-01

Specific plasminogen-binding sites of fibrin molecule are located in Аα148-160 regions of C-terminal domains. Plasminogen interaction with these sites initiates the activation process of proenzyme and subsequent fibrin lysis. In this study we investigated the binding of plasminogen fragments K 1-3 and K 5 with fibrin fragment DD and their effect on Glu-plasminogen interaction with DD. It was shown that the level of Glu-plasminogen binding to fibrin fragment DD is decreased by 50-60% in the presence of K 1-3 and K 5. Fragments K 1-3 and K 5 have high affinity to fibrin fragment DD (Kd is 0.02 for K 1-3 and 0.054 μМ for K 5). K 5 interaction is independent and K 1-3 is partly dependent on C-terminal lysine residues. K 1-3 interacts with complex of fragment DD-immobilized K 5 as well as K 5 with complex of fragment DD-immobilized K 1-3. The plasminogen fragments do not displace each other from binding sites located in fibrin fragment DD, but can compete for the interaction. The results indicate that fibrin fragment DD contains different binding sites for plasminogen kringle fragments K 1-3 and K 5, which can be located close to each other. The role of amino acid residues of fibrin molecule Аα148-160 region in interaction with fragments K 1-3 and K 5 is discussed.

Skin-Derived C-Terminal Filaggrin-2 Fragments Are Pseudomonas aeruginosa-Directed Antimicrobials Targeting Bacterial Replication.

Directory of Open Access Journals (Sweden)

Britta Hansmann

2015-09-01

Full Text Available Soil- and waterborne bacteria such as Pseudomonas aeruginosa are constantly challenging body surfaces. Since infections of healthy skin are unexpectedly rare, we hypothesized that the outermost epidermis, the stratum corneum, and sweat glands directly control the growth of P. aeruginosa by surface-provided antimicrobials. Due to its high abundance in the upper epidermis and eccrine sweat glands, filaggrin-2 (FLG2, a water-insoluble 248 kDa S100 fused-type protein, might possess these innate effector functions. Indeed, recombinant FLG2 C-terminal protein fragments display potent antimicrobial activity against P. aeruginosa and other Pseudomonads. Moreover, upon cultivation on stratum corneum, P. aeruginosa release FLG2 C-terminus-containing FLG2 fragments from insoluble material, indicating liberation of antimicrobially active FLG2 fragments by the bacteria themselves. Analyses of the underlying antimicrobial mechanism reveal that FLG2 C-terminal fragments do not induce pore formation, as known for many other antimicrobial peptides, but membrane blebbing, suggesting an alternative mode of action. The association of the FLG2 fragment with the inner membrane of treated bacteria and its DNA-binding implicated an interference with the bacterial replication that was confirmed by in vitro and in vivo replication assays. Probably through in situ-activation by soil- and waterborne bacteria such as Pseudomonads, FLG2 interferes with the bacterial replication, terminates their growth on skin surface and thus may contributes to the skin's antimicrobial defense shield. The apparent absence of FLG2 at certain body surfaces, as in the lung or of burned skin, would explain their higher susceptibility towards Pseudomonas infections and make FLG2 C-terminal fragments and their derivatives candidates for new Pseudomonas-targeting antimicrobials.

Skin-Derived C-Terminal Filaggrin-2 Fragments Are Pseudomonas aeruginosa-Directed Antimicrobials Targeting Bacterial Replication.

Science.gov (United States)

Hansmann, Britta; Schröder, Jens-Michael; Gerstel, Ulrich

2015-09-01

Soil- and waterborne bacteria such as Pseudomonas aeruginosa are constantly challenging body surfaces. Since infections of healthy skin are unexpectedly rare, we hypothesized that the outermost epidermis, the stratum corneum, and sweat glands directly control the growth of P. aeruginosa by surface-provided antimicrobials. Due to its high abundance in the upper epidermis and eccrine sweat glands, filaggrin-2 (FLG2), a water-insoluble 248 kDa S100 fused-type protein, might possess these innate effector functions. Indeed, recombinant FLG2 C-terminal protein fragments display potent antimicrobial activity against P. aeruginosa and other Pseudomonads. Moreover, upon cultivation on stratum corneum, P. aeruginosa release FLG2 C-terminus-containing FLG2 fragments from insoluble material, indicating liberation of antimicrobially active FLG2 fragments by the bacteria themselves. Analyses of the underlying antimicrobial mechanism reveal that FLG2 C-terminal fragments do not induce pore formation, as known for many other antimicrobial peptides, but membrane blebbing, suggesting an alternative mode of action. The association of the FLG2 fragment with the inner membrane of treated bacteria and its DNA-binding implicated an interference with the bacterial replication that was confirmed by in vitro and in vivo replication assays. Probably through in situ-activation by soil- and waterborne bacteria such as Pseudomonads, FLG2 interferes with the bacterial replication, terminates their growth on skin surface and thus may contributes to the skin's antimicrobial defense shield. The apparent absence of FLG2 at certain body surfaces, as in the lung or of burned skin, would explain their higher susceptibility towards Pseudomonas infections and make FLG2 C-terminal fragments and their derivatives candidates for new Pseudomonas-targeting antimicrobials.

Assessment of the PrPc Amino-Terminal Domain in Prion Species Barriers.

Science.gov (United States)

Davenport, Kristen A; Henderson, Davin M; Mathiason, Candace K; Hoover, Edward A

2016-12-01

Chronic wasting disease (CWD) in cervids and bovine spongiform encephalopathy (BSE) in cattle are prion diseases that are caused by the same protein-misfolding mechanism, but they appear to pose different risks to humans. We are interested in understanding the differences between the species barriers of CWD and BSE. We used real-time, quaking-induced conversion (RT-QuIC) to model the central molecular event in prion disease, the templated misfolding of the normal prion protein, PrP c , to a pathogenic, amyloid isoform, scrapie prion protein, PrP Sc We examined the role of the PrP c amino-terminal domain (N-terminal domain [NTD], amino acids [aa] 23 to 90) in cross-species conversion by comparing the conversion efficiency of various prion seeds in either full-length (aa 23 to 231) or truncated (aa 90 to 231) PrP c We demonstrate that the presence of white-tailed deer and bovine NTDs hindered seeded conversion of PrP c , but human and bank vole NTDs did the opposite. Additionally, full-length human and bank vole PrP c s were more likely to be converted to amyloid by CWD prions than were their truncated forms. A chimera with replacement of the human NTD by the bovine NTD resembled human PrP c The requirement for an NTD, but not for the specific human sequence, suggests that the NTD interacts with other regions of the human PrP c to increase promiscuity. These data contribute to the evidence that, in addition to primary sequence, prion species barriers are controlled by interactions of the substrate NTD with the rest of the substrate PrP c molecule. We demonstrate that the amino-terminal domain of the normal prion protein, PrP c , hinders seeded conversion of bovine and white-tailed deer PrP c s to the prion forms, but it facilitates conversion of the human and bank vole PrP c s to the prion forms. Additionally, we demonstrate that the amino-terminal domain of human and bank vole PrP c s requires interaction with the rest of the molecule to facilitate conversion by CWD

Aliphatic semisynthetic amino terminal variants of myoglobin: enrichment with carbon-13, determination and interpretation of terminal pK values and motions

International Nuclear Information System (INIS)

Busch, M.R.

1985-01-01

The synthesis of a series of myoglobins substituted in the amino terminal residue to provide variation in the aliphatic nature of the side chain and enrichment in 13 C was accomplished by semisynthetic methods. The replacements of valine, the native first residue, included 13 C enriched glycine, alanine, valine, leucine, and isoleucine. The products were extensively characterized and found to be virtually indistinguishable by most physical methods. 13 C NMR spectroscopy showed significant differences in the amino terminal pK value, ranging from 7.72 for myoglobin to 7.15 for myoglobin. Consideration of the electrostatic effects of the charge array indicated a balance of interactions at this site not significantly altered by variations in the side chain. By examination of the crystal structure, consideration of earlier work regarding the interactions of the side chain of Leu-2, and data regarding the motions of the terminal residue, it was concluded that the interaction of the side chain of the first residue with the hydrophobic cluster formed primarily by close contact of invariant residues Leu-2 and Leu-137 was the primary cause for the reduction in the terminal pK values seen for the larger aliphatics. By restricting the freedom of the residue, this interaction limits the available hydration volume, and consequently favors the unprotonated form of the amine. The concurrent observation of both functional elements in the series of α amino terminal residues brings out the interrelated consequences for the two categories of solvent interactions controlling structural and functional properties in a graded way

Protection against β-amyloid neurotoxicity by a non-toxic endogenous N-terminal β-amyloid fragment and its active hexapeptide core sequence.

Science.gov (United States)

Forest, Kelly H; Alfulaij, Naghum; Arora, Komal; Taketa, Ruth; Sherrin, Tessi; Todorovic, Cedomir; Lawrence, James L M; Yoshikawa, Gene T; Ng, Ho-Leung; Hruby, Victor J; Nichols, Robert A

2018-01-01

High levels (μM) of beta amyloid (Aβ) oligomers are known to trigger neurotoxic effects, leading to synaptic impairment, behavioral deficits, and apoptotic cell death. The hydrophobic C-terminal domain of Aβ, together with sequences critical for oligomer formation, is essential for this neurotoxicity. However, Aβ at low levels (pM-nM) has been shown to function as a positive neuromodulator and this activity resides in the hydrophilic N-terminal domain of Aβ. An N-terminal Aβ fragment (1-15/16), found in cerebrospinal fluid, was also shown to be a highly active neuromodulator and to reverse Aβ-induced impairments of long-term potentiation. Here, we show the impact of this N-terminal Aβ fragment and a shorter hexapeptide core sequence in the Aβ fragment (Aβcore: 10-15) to protect or reverse Aβ-induced neuronal toxicity, fear memory deficits and apoptotic death. The neuroprotective effects of the N-terminal Aβ fragment and Aβcore on Aβ-induced changes in mitochondrial function, oxidative stress, and apoptotic neuronal death were demonstrated via mitochondrial membrane potential, live reactive oxygen species, DNA fragmentation and cell survival assays using a model neuroblastoma cell line (differentiated NG108-15) and mouse hippocampal neuron cultures. The protective action of the N-terminal Aβ fragment and Aβcore against spatial memory processing deficits in amyloid precursor protein/PSEN1 (5XFAD) mice was demonstrated in contextual fear conditioning. Stabilized derivatives of the N-terminal Aβcore were also shown to be fully protective against Aβ-triggered oxidative stress. Together, these findings indicate an endogenous neuroprotective role for the N-terminal Aβ fragment, while active stabilized N-terminal Aβcore derivatives offer the potential for therapeutic application. © 2017 International Society for Neurochemistry.

Anticandida Activity Is Retained in P-113, a 12-Amino-Acid Fragment of Histatin 5

OpenAIRE

Rothstein, David M.; Spacciapoli, Peter; Tran, Linh T.; Xu, Tao; Roberts, F. Donald; Dalla Serra, Mauro; Buxton, Deborah K.; Oppenheim, Frank G.; Friden, Phillip

2001-01-01

Through the analysis of a series of 25 peptides composed of various portions of the histatin 5 sequence, we have identified P-113, a 12-amino-acid fragment of histatin 5, as the smallest fragment that retains anticandidal activity comparable to that of the parent compound. Amidation of the P-113 C terminus increased the anticandidal activity of P-113 approximately twofold. The three histidine residues could be exchanged for three hydrophobic residues, with the fragment retaining anticandidal ...

Functional evidence for the critical amino-terminal conserved domain and key amino acids of Arabidopsis 4-HYDROXY-3-METHYLBUT-2-ENYL DIPHOSPHATE REDUCTASE.

Science.gov (United States)

Hsieh, Wei-Yu; Sung, Tzu-Ying; Wang, Hsin-Tzu; Hsieh, Ming-Hsiun

2014-09-01

The plant 4-HYDROXY-3-METHYLBUT-2-ENYL DIPHOSPHATE REDUCTASE (HDR) catalyzes the last step of the methylerythritol phosphate pathway to synthesize isopentenyl diphosphate and its allyl isomer dimethylallyl diphosphate, which are common precursors for the synthesis of plastid isoprenoids. The Arabidopsis (Arabidopsis thaliana) genomic HDR transgene-induced gene-silencing lines are albino, variegated, or pale green, confirming that HDR is essential for plants. We used Escherichia coli isoprenoid synthesis H (Protein Data Bank code 3F7T) as a template for homology modeling to identify key amino acids of Arabidopsis HDR. The predicted model reveals that cysteine (Cys)-122, Cys-213, and Cys-350 are involved in iron-sulfur cluster formation and that histidine (His)-152, His-241, glutamate (Glu)-242, Glu-243, threonine (Thr)-244, Thr-312, serine-379, and asparagine-381 are related to substrate binding or catalysis. Glu-242 and Thr-244 are conserved only in cyanobacteria, green algae, and land plants, whereas the other key amino acids are absolutely conserved from bacteria to plants. We used site-directed mutagenesis and complementation assay to confirm that these amino acids, except His-152 and His-241, were critical for Arabidopsis HDR function. Furthermore, the Arabidopsis HDR contains an extra amino-terminal domain following the transit peptide that is highly conserved from cyanobacteria, and green algae to land plants but not existing in the other bacteria. We demonstrated that the amino-terminal conserved domain was essential for Arabidopsis and cyanobacterial HDR function. Further analysis of conserved amino acids in the amino-terminal conserved domain revealed that the tyrosine-72 residue was critical for Arabidopsis HDR. These results suggest that the structure and reaction mechanism of HDR evolution have become specific for oxygen-evolving photosynthesis organisms and that HDR probably evolved independently in cyanobacteria versus other prokaryotes. © 2014

Uniform {sup 15}N- and {sup 15}N/{sup 13}C-labeling of proteins in mammalian cells and solution structure of the amino terminal fragment of u-PA

Energy Technology Data Exchange (ETDEWEB)

Hansen, A.P.; Petros, A.M.; Meadows, R.P.; Mazar, A.P.; Nettesheim, D.G.; Pederson, T.M.; Fesik, S.W. [Abbott Laboratories, Abbott Park, IL (United States)

1994-12-01

Urokinase-type plasminogen activator (u-PA) is a 54-kDa glycoprotein that catalyzes the conversion of plasminogen to plasmin, a broad-specificity protease responsible for the degradation of fibrin clots and extracellular matrix components. The u-PA protein consists of three individual modules: a growth factor domain (GFD), a kringle, and a serine protease domain. The amino terminal fragment (ATF) includes the GFD-responsible for u-PA binding to its receptor-and the kringle domains. This protein was expressed and uniformly {sup 15}N-and {sup 15}N/{sup 13}C-labeled in mammalian cells by methods that will be described. In addition, we present the three-dimensional structure of ATF that was derived from 1299 NOE-derived distance restraints along with the {phi} angle and hydrogen bonding restraints. Although the individual domains in the structures were highly converged, the two domains are structurally independent. The overall structures of the individual domains are very similar to the structures of homologous proteins. However, important structural differences between the growth factor domain of u-PA and other homologous proteins were observed in the region that has been implicated in binding the urokinase receptor. These results may explain, in part, why other growth factors show no appreciable affinity for the urokinase receptor.

Analysis of proteolytic processes and enzymatic activities in the generation of huntingtin n-terminal fragments in an HEK293 cell model.

Directory of Open Access Journals (Sweden)

Andrew T N Tebbenkamp

Full Text Available N-terminal fragments of mutant huntingtin (htt that terminate between residues 90-115, termed cleavage product A or 1 (cp-A/1, form intracellular and intranuclear inclusion bodies in the brains of patients with Huntington's disease (HD. These fragments appear to be proteolytic products of the full-length protein. Here, we use an HEK293 cell culture model to investigate huntingtin proteolytic processing; previous studies of these cells have demonstrated cleavage of htt to cp-A/1 like htt fragments.Recombinant N-terminal htt fragments, terminating at residue 171 (also referred to as cp-B/2 like, were efficiently cleaved to produce cp-A/1 whereas fragments representing endogenous caspase, calpain, and metalloproteinase cleavage products, terminating between residues 400-600, were inefficiently cleaved. Using cysteine-labeling techniques and antibody binding mapping, we localized the C-terminus of the cp-A/1 fragments produced by HEK293 cells to sequences minimally limited by cysteine 105 and an antibody epitope composed of residues 115-124. A combination of genetic and pharmacologic approaches to inhibit potential proteases, including γ-secretase and calpain, proved ineffective in preventing production of cp-A/1.Our findings indicate that HEK293 cells express a protease that is capable of efficiently cleaving cp-B/2 like fragments of htt with normal or expanded glutamine repeats. For reasons that remain unclear, this protease cleaves longer htt fragments, with normal or expanded glutamine expansions, much less efficiently. The protease in HEK293 cells that is capable of generating a cp-A/1 like htt fragment may be a novel protease with a high preference for a cp-B/2-like htt fragment as substrate.

Density functional theory fragment descriptors to quantify the reactivity of a molecular family: application to amino acids.

Science.gov (United States)

Senet, P; Aparicio, F

2007-04-14

By using the exact density functional theory, one demonstrates that the value of the local electronic softness of a molecular fragment is directly related to the polarization charge (Coulomb hole) induced by a test electron removed (or added) from (at) the fragment. Our finding generalizes to a chemical group a formal relation between these molecular descriptors recently obtained for an atom in a molecule using an approximate atomistic model [P. Senet and M. Yang, J. Chem. Sci. 117, 411 (2005)]. In addition, a practical ab initio computational scheme of the Coulomb hole and related local descriptors of reactivity of a molecular family having in common a similar fragment is presented. As a blind test, the method is applied to the lateral chains of the 20 isolated amino acids. One demonstrates that the local softness of the lateral chain is a quantitative measure of the similarity of the amino acids. It predicts the separation of amino acids in different biochemical groups (aliphatic, basic, acidic, sulfur contained, and aromatic). The present approach may find applications in quantitative structure activity relationship methodology.

Detection of prosecretory mitogen lacritin in nonprimate tears primarily as a C-terminal-like fragment.

Science.gov (United States)

Laurie, Diane E; Splan, Rebecca K; Green, Kari; Still, Katherine M; McKown, Robert L; Laurie, Gordon W

2012-09-12

Lacritin is a human tear glycoprotein that promotes basal tear protein secretion in cultured rat lacrimal acinar cells and proliferation of subconfluent human corneal epithelial cells. When topically added to rabbit eyes, lacritin promotes basal tearing. Despite these activities on several species, lacritin's presence in nonprimate tears or other tissues has not been explored. Here we probed for lacritin in normal horse tears. Sequences were collected from the Ensembl genomic alignment of human LACRT gene with high-quality draft horse genome (EquCab2.0) and analyzed. Normal horse tears were collected and assayed by Western blotting, ELISA, and mass spectrometry. Newly generated rabbit antibodies, respectively, against N- and C-terminal regions of human lacritin were employed. Identity was 75% and 45%, respectively, at nucleotide and protein levels. Structural features were conserved, including a C-terminal amphipathic α-helix. Anti-C-terminal antibodies strongly detected a ∼13 kDa band in horse tears that was validated by mass spectrometry. In human tears, the same antibody detected uncleaved lacritin (∼24 kDa) strongly and C-terminal fragments of ∼13 and ∼11 kDa weakly. Anti-N-terminal antibodies were slightly reactive with a ∼24 kDa horse antigen and showed no reaction with the anti-C-terminal-reactive ∼13 kDa species. Similar respective levels of horse C-terminal versus N-terminal immunoreactivity were apparent by ELISA. Lacritin is present in horse tears, largely as a C-terminal fragment homologous to the mitogenic and bactericidal region in human lacritin, suggesting potential benefit in corneal wound repair.

The effects of amino acid composition of glutamine-rich domains on amyloid formation and fragmentation.

Directory of Open Access Journals (Sweden)

Alexander I Alexandrov

Full Text Available Fragmentation of amyloid polymers by the chaperone Hsp104 allows them to propagate as prions in yeast. The factors which determine the frequency of fragmentation are unclear, though it is often presumed to depend on the physical strength of prion polymers. Proteins with long polyglutamine stretches represent a tractable model for revealing sequence elements required for polymer fragmentation in yeast, since they form poorly fragmented amyloids. Here we show that interspersion of polyglutamine stretches with various amino acid residues differentially affects the in vivo formation and fragmentation of the respective amyloids. Aromatic residues tyrosine, tryptophan and phenylalanine strongly stimulated polymer fragmentation, leading to the appearance of oligomers as small as dimers. Alanine, methionine, cysteine, serine, threonine and histidine also enhanced fragmentation, while charged residues, proline, glycine and leucine inhibited polymerization. Our data indicate that fragmentation frequency primarily depends on the recognition of fragmentation-promoting residues by Hsp104 and/or its co-chaperones, rather than on the physical stability of polymers. This suggests that differential exposure of such residues to chaperones defines prion variant-specific differences in polymer fragmentation efficiency.

Fate of circulating amino-terminal propeptide of type III procollagen in conscious pigs

DEFF Research Database (Denmark)

Jensen, L T; Henriksen, Jens Henrik Sahl; Risteli, J

1993-01-01

The amino-terminal propeptide of type III procollagen (PIIINP, M(r) 42,000) is a promising marker for the formation of type III collagen of granulation tissue in experimental and clinical studies. The disposal kinetics of circulating PIIINP is, however, almost unknown. In conscious pigs with a th......The amino-terminal propeptide of type III procollagen (PIIINP, M(r) 42,000) is a promising marker for the formation of type III collagen of granulation tissue in experimental and clinical studies. The disposal kinetics of circulating PIIINP is, however, almost unknown. In conscious pigs...... of the plasma disappearance curve originated from the formation and disappearance of a high and a low molecular weight (MW) fraction as part of the degradation of PIIINP. The high MW fraction (approximately M(r) 90,000) was similar to a previously described, but not further characterized, PIIINP immunoreactive...

Molecular determinants of interactions between the N-terminal domain and the transmembrane core that modulate hERG K+ channel gating.

Directory of Open Access Journals (Sweden)

Jorge Fernández-Trillo

Full Text Available A conserved eag domain in the cytoplasmic amino terminus of the human ether-a-go-go-related gene (hERG potassium channel is critical for its slow deactivation gating. Introduction of gene fragments encoding the eag domain are able to restore normal deactivation properties of channels from which most of the amino terminus has been deleted, and also those lacking exclusively the eag domain or carrying a single point mutation in the initial residues of the N-terminus. Deactivation slowing in the presence of the recombinant domain is not observed with channels carrying a specific Y542C point mutation in the S4-S5 linker. On the other hand, mutations in some initial positions of the recombinant fragment also impair its ability to restore normal deactivation. Fluorescence resonance energy transfer (FRET analysis of fluorophore-tagged proteins under total internal reflection fluorescence (TIRF conditions revealed a substantial level of FRET between the introduced N-terminal eag fragments and the eag domain-deleted channels expressed at the membrane, but not between the recombinant eag domain and full-length channels with an intact amino terminus. The FRET signals were also minimized when the recombinant eag fragments carried single point mutations in the initial portion of their amino end, and when Y542C mutated channels were used. These data suggest that the restoration of normal deactivation gating by the N-terminal recombinant eag fragment is an intrinsic effect of this domain directed by the interaction of its N-terminal segment with the gating machinery, likely at the level of the S4-S5 linker.

Complementarily addressed modification and cleavage of a single-stranded fragment of DNA with the aid of alkylating derivatives of oligonucleotides

International Nuclear Information System (INIS)

Brosalina, E.B.; Vlasov, V.V.; Kutyavin, I.V.; Mamaev, S.V.; Pletnev, A.G.; Podyminogin, M.A.

1986-01-01

The chemical modification of a 303-nucleotide single-stranded fragment of DNA by alkylating oligonucleotide derivatives bearing 4-[N-methyl-N-(2-chloroethyl)amino]benzyl groups in the 5'-terminal phosphate of the 3'-terminal ribose residue has been investigated. It has been shown that under the conditions of the formation of a complex with the DNA fragment both types of derivatives specifically alkylate nucleotides of the DNA fragments that are located directly adjacent to the sections complementary to the oligonucleotides bearing the reactive groups. Alkylation takes place with a high efficiency, and the DNA fragment can be cleaved specifically at the position of the alkylated nucleotides

Amino acid sequences and structures of chicken and turkey beta 2-microglobulin

DEFF Research Database (Denmark)

Welinder, K G; Jespersen, H M; Walther-Rasmussen, J

1991-01-01

The complete amino acid sequences of chicken and turkey beta 2-microglobulins have been determined by analyses of tryptic, V8-proteolytic and cyanogen bromide fragments, and by N-terminal sequencing. Mass spectrometric analysis of chicken beta 2-microglobulin supports the sequence-derived Mr of 11...

Controlled surface functionalization of silica-coated magnetic nanoparticles with terminal amino and carboxyl groups

International Nuclear Information System (INIS)

Kralj, Slavko; Drofenik, Miha; Makovec, Darko

2011-01-01

General and versatile methods for the functionalization of superparamagnetic, silica-coated, maghemite nanoparticles by surface amino and/or carboxyl groups have been established. The nanoparticles were synthesized using co-precipitation from aqueous solutions and coated with a thin layer of silica using the hydrolysis and condensation of tetraethoxysilane (TEOS). For the amino functionalization, 3-(2-aminoethylamino)propylmethyldimethoxysilane (APMS) was grafted onto the nanoparticle surfaces in their aqueous suspensions. The grafting process was followed by measurements of the ζ-potential and a determination of the concentration of the surface amino groups with conductometric titrations. The surface concentration of the amino groups could be varied by increasing the amount of APMS in the grafting process up to approximately 2.3 –NH 2 groups per nm 2 . The carboxyl functionalization was obtained in two ways: (i) by a ring-opening linker elongation reaction of the surface amines at the functionalized nanoparticles with succinic anhydride (SA) in non-aqueous medium, and (ii) by reacting the APMS and SA first, followed by grafting of the carboxyl-terminated reagent onto the nanoparticle surfaces. Using the first method, the SA only reacted with the terminal primary amino groups (–NH 2 ) of the surface-grafted APMS molecules. Infra-red spectroscopy (ATR FTIR) and mass spectrometry (HRMS) showed that the second method enables the bonding of up to two SA molecules per one APMS molecule, since the SA reacted with both the primary (–NH 2 ) and secondary amino (–NH–) groups of the APMS molecule. When using both methods, the ratio between the surface amino and carboxyl groups can be controlled.

Fragment-Based Drug Discovery in the Bromodomain and Extra-Terminal Domain Family.

Science.gov (United States)

Radwan, Mostafa; Serya, Rabah

2017-08-01

Bromodomain and extra-terminal domain (BET) inhibition has emerged recently as a potential therapeutic target for the treatment of many human disorders such as atherosclerosis, inflammatory disorders, chronic obstructive pulmonary disease (COPD), some viral infections, and cancer. Since the discovery of the two potent inhibitors, I-BET762 and JQ1, different research groups have used different techniques to develop novel potent and selective inhibitors. In this review, we will be concerned with the trials that used fragment-based drug discovery (FBDD) approaches to discover or optimize BET inhibitors, also showing fragments that can be further optimized in future projects to reach novel potent BET inhibitors. © 2017 Deutsche Pharmazeutische Gesellschaft.

Dramatic elevation in urinary amino terminal titin fragment excretion quantified by immunoassay in Duchenne muscular dystrophy patients and in dystrophin deficient rodents.

Science.gov (United States)

Robertson, Alan S; Majchrzak, Mark J; Smith, Courtney M; Gagnon, Robert C; Devidze, Nino; Banks, Glen B; Little, Sean C; Nabbie, Fizal; Bounous, Denise I; DiPiero, Janet; Jacobsen, Leslie K; Bristow, Linda J; Ahlijanian, Michael K; Stimpson, Stephen A

2017-07-01

Enzyme-linked and electrochemiluminescence immunoassays were developed for quantification of amino (N-) terminal fragments of the skeletal muscle protein titin (N-ter titin) and qualified for use in detection of urinary N-ter titin excretion. Urine from normal subjects contained a small but measurable level of N-ter titin (1.0 ± 0.4 ng/ml). A 365-fold increase (365.4 ± 65.0, P = 0.0001) in urinary N-ter titin excretion was seen in Duchene muscular dystrophy (DMD) patients. Urinary N-ter titin was also evaluated in dystrophin deficient rodent models. Mdx mice exhibited low urinary N-ter titin levels at 2 weeks of age followed by a robust and sustained elevation starting at 3 weeks of age, coincident with the development of systemic skeletal muscle damage in this model; fold elevation could not be determined because urinary N-ter titin was not detected in age-matched wild type mice. Levels of serum creatine kinase and serum skeletal muscle troponin I (TnI) were also low at 2 weeks, elevated at later time points and were significantly correlated with urinary N-ter titin excretion in mdx mice. Corticosteroid treatment of mdx mice resulted in improved exercise performance and lowering of both urinary N-ter titin and serum skeletal muscle TnI concentrations. Low urinary N-ter titin levels were detected in wild type rats (3.0 ± 0.6 ng/ml), while Dmd mdx rats exhibited a 556-fold increase (1652.5 ± 405.7 ng/ml, P = 0.002) (both at 5 months of age). These results suggest that urinary N-ter titin is present at low basal concentrations in normal urine and increases dramatically coincident with muscle damage produced by dystrophin deficiency. Urinary N-ter titin has potential as a facile, non-invasive and translational biomarker for DMD. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

Application of the fragment molecular orbital method analysis to fragment-based drug discovery of BET (bromodomain and extra-terminal proteins) inhibitors.

Science.gov (United States)

Ozawa, Motoyasu; Ozawa, Tomonaga; Ueda, Kazuyoshi

2017-06-01

The molecular interactions of inhibitors of bromodomains (BRDs) were investigated. BRDs are protein interaction modules that recognizing ε-N-acetyl-lysine (εAc-Lys) motifs found in histone tails and are promising protein-protein interaction (PPI) targets. First, we analyzed a peptide ligand containing εAc-Lys to evaluate native PPIs. We then analyzed tetrahydroquinazoline-6-yl-benzensulfonamide derivatives found by fragment-based drug design (FBDD) and examined their interactions with the protein compared with the peptide ligand in terms of the inter-fragment interaction energy. In addition, we analyzed benzodiazepine derivatives that are high-affinity ligands for BRDs and examined differences in the CH/π interactions of the amino acid residues. We further surveyed changes in the charges of the amino acid residues among individual ligands, performed pair interaction energy decomposition analysis and estimated the water profile within the ligand binding site. Thus, useful insights for drug design were provided. Through these analyses and considerations, we show that the FMO method is a useful drug design tool to evaluate the process of FBDD and to explore PPI inhibitors. Copyright © 2017 Elsevier Inc. All rights reserved.

Natural variation of the amino-terminal glutamine-rich domain in Drosophila argonaute2 is not associated with developmental defects.

Directory of Open Access Journals (Sweden)

Daniel Hain

2010-12-01

Full Text Available The Drosophila argonaute2 (ago2 gene plays a major role in siRNA mediated RNA silencing pathways. Unlike mammalian Argonaute proteins, the Drosophila protein has an unusual amino-terminal domain made up largely of multiple copies of glutamine-rich repeats (GRRs. We report here that the ago2 locus produces an alternative transcript that encodes a putative short isoform without this amino-terminal domain. Several ago2 mutations previously reported to be null alleles only abolish expression of the long, GRR-containing isoform. Analysis of drop out (dop mutations had previously suggested that variations in GRR copy number result in defects in RNAi and embryonic development. However, we find that dop mutations genetically complement transcript-null alleles of ago2 and that ago2 alleles with variant GRR copy numbers support normal development. In addition, we show that the assembly of the central RNAi machinery, the RISC (RNA induced silencing complex, is unimpaired in embryos when GRR copy number is altered. In fact, we find that GRR copy number is highly variable in natural D. melanogaster populations as well as in laboratory strains. Finally, while many other insects share an extensive, glutamine-rich Ago2 amino-terminal domain, its primary sequence varies drastically between species. Our data indicate that GRR variation does not modulate an essential function of Ago2 and that the amino-terminal domain of Ago2 is subject to rapid evolution.

Caspase-3-mediated cleavage of p65/RelA results in a carboxy-terminal fragment that inhibits IκBα and enhances HIV-1 replication in human T lymphocytes

Directory of Open Access Journals (Sweden)

Alcamí José

2008-12-01

Full Text Available Abstract Background Degradation of p65/RelA has been involved in both the inhibition of NF-κB-dependent activity and the onset of apoptosis. However, the mechanisms of NF-κB degradation are unclear and can vary depending on the cell type. Cleavage of p65/RelA can produce an amino-terminal fragment that was shown to act as a dominant-negative inhibitor of NF-κB, thereby promoting apoptosis. However, the opposite situation has also been described and the production of a carboxy-terminal fragment that contains two potent transactivation domains has also been related to the onset of apoptosis. In this context, a carboxy-terminal fragment of p65/RelA (ΔNH2p65, detected in non-apoptotic human T lymphocytes upon activation, has been studied. T cells constitute one of the long-lived cellular reservoirs of the human immunodeficiency virus type 1 (HIV-1. Because NF-κB is the most important inducible element involved in initiation of HIV-1 transcription, an adequate control of NF-κB response is of paramount importance for both T cell survival and viral spread. Its major inhibitor IκBα constitutes a master terminator of NF-κB response that is complemented by degradation of p65/RelA. Results and conclusions In this study, the function of a caspase-3-mediated carboxy-terminal fragment of p65/RelA, which was detected in activated human peripheral blood lymphocytes (PBLs, was analyzed. Cells producing this truncated p65/RelA did not undergo apoptosis but showed a high viability, in spite of caspase-3 activation. ΔNH2p65 lacked most of DNA-binding domain but retained the dimerization domain, NLS and transactivation domains. Consequently, it could translocate to the nucleus, associate with NF-κB1/p50 and IκBα, but could not bind -κB consensus sites. However, although ΔNH2p65 lacked transcriptional activity by itself, it could increase NF-κB activity in a dose-dependent manner by hijacking IκBα. Thus, its expression resulted in a persistent

Expression, purification, crystallization and preliminary X-ray analysis of a C-terminal fragment of the Epstein–Barr virus ZEBRA protein

Energy Technology Data Exchange (ETDEWEB)

Morand, Patrice [European Molecular Biology Laboratory, Grenoble Outstation, BP 181, 38042 Grenoble CEDEX 9 (France); Laboratoire de Virologie Moléculaire et Structurale, EA 2939, Université Joseph Fourier, Grenoble (France); Budayova-Spano, Monika [European Molecular Biology Laboratory, Grenoble Outstation, BP 181, 38042 Grenoble CEDEX 9 (France); Perrissin, Monique [Laboratoire de Virologie Moléculaire et Structurale, EA 2939, Université Joseph Fourier, Grenoble (France); Müller, Christoph W., E-mail: mueller@embl-grenoble.fr; Petosa, Carlo [European Molecular Biology Laboratory, Grenoble Outstation, BP 181, 38042 Grenoble CEDEX 9 (France)

2006-03-01

A C-terminal fragment of the Epstein–Barr virus lytic switch protein ZEBRA has been crystallized in complex with DNA. A C-terminal fragment of the Epstein–Barr virus immediate-early transcription factor ZEBRA has been expressed as a recombinant protein in Escherichia coli and purified to homogeneity. The fragment behaves as a dimer in solution, consistent with the presence of a basic region leucine-zipper (bZIP) domain. Crystals of the fragment in complex with a DNA duplex were grown by the hanging-drop vapour-diffusion technique using polyethylene glycol 4000 and magnesium acetate as crystallization agents. Crystals diffract to better than 2.5 Å resolution using synchrotron radiation (λ = 0.976 Å). Crystals belong to space group C2, with unit-cell parameters a = 94.2, b = 26.5, c = 98.1 Å, β = 103.9°.

Crystallization and preliminary crystallographic studies of the single-chain variable fragment of antibody chA21 in complex with an N-terminal fragment of ErbB2

International Nuclear Information System (INIS)

Liu, Yang; Zhou, Huihao; Zhu, Juanjuan; Gao, Yongxiang; Niu, Liwen; Liu, Jing; Teng, Maikun

2009-01-01

An antibody–antigen complex consisting of a single-chain variable fragment of the potential therapeutic antibody chA21 and an N-terminal fragment (residues 1–192) of the human ErbB2 extracellular domain was expressed, purified and crystallized. X-ray diffraction data were collected to 2.45 Å resolution. ErbB2 is a transmembrane tyrosine kinase, the overexpression of which causes abnormality and disorder in cell signalling and leads to cell transformation. Previously, an anti-ErbB2 single-chain chimeric antibody chA21 that specifically inhibits the growth of ErbB2-overexpressing cancer cells in vitro and in vivo was developed. Here, an antibody–antigen complex consisting of the single-chain variable fragment (scFv) of chA21 and an N-terminal fragment (residues 1–192, named EP I) of the ErbB2 extracellular domain was crystallized using the sitting-drop vapour-diffusion method. An X-ray diffraction data set was collected to 2.45 Å resolution from a single flash-cooled crystal; the crystal belonged to space group P2 1 2 1 2 1

The N-terminal 33 amino acid domain of Siva-1 is sufficient for nuclear localization

Energy Technology Data Exchange (ETDEWEB)

Chen, J.Y.; Yang, L.X. [Institute of Human Virology, Zhongshan School of Medicine, Sun Yat-sen University, Guangzhou (China); Huang, Z.F. [Institute of Human Virology, Zhongshan School of Medicine, Sun Yat-sen University, Guangzhou (China); Department of Biochemistry, Zhongshan School of Medicine, Sun Yat-sen University, Guangzhou (China); Key Laboratory of Tropical Diseases Control, Sun Yat-sen University, Ministry of Education in China, Guangzhou (China)

2013-12-02

Siva-1 induces apoptosis in multiple pathological processes and plays an important role in the suppression of tumor metastasis, protein degradation, and other functions. Although many studies have demonstrated that Siva-1 functions in the cytoplasm, a few have found that Siva-1 can relocate to the nucleus. In this study, we found that the first 33 amino acid residues of Siva-1 are required for its nuclear localization. Further study demonstrated that the green fluorescent protein can be imported into the nucleus after fusion with these 33 amino acid residues. Other Siva-1 regions and domains showed less effect on Siva-1 nuclear localization. By site-mutagenesis of all of these 33 amino acid residues, we found that mutants of the first 1-18 amino acids affected Siva-1 nuclear compartmentalization but could not complete this localization independently. In summary, we demonstrated that the N-terminal 33 amino acid residues were sufficient for Siva-1 nuclear localization, but the mechanism of this translocation needs additional investigation.

The N-terminal 33 amino acid domain of Siva-1 is sufficient for nuclear localization

International Nuclear Information System (INIS)

Chen, J.Y.; Yang, L.X.; Huang, Z.F.

2013-01-01

Siva-1 induces apoptosis in multiple pathological processes and plays an important role in the suppression of tumor metastasis, protein degradation, and other functions. Although many studies have demonstrated that Siva-1 functions in the cytoplasm, a few have found that Siva-1 can relocate to the nucleus. In this study, we found that the first 33 amino acid residues of Siva-1 are required for its nuclear localization. Further study demonstrated that the green fluorescent protein can be imported into the nucleus after fusion with these 33 amino acid residues. Other Siva-1 regions and domains showed less effect on Siva-1 nuclear localization. By site-mutagenesis of all of these 33 amino acid residues, we found that mutants of the first 1-18 amino acids affected Siva-1 nuclear compartmentalization but could not complete this localization independently. In summary, we demonstrated that the N-terminal 33 amino acid residues were sufficient for Siva-1 nuclear localization, but the mechanism of this translocation needs additional investigation

Diagnosis of invasive candidiasis by enzyme-linked immunosorbent assay using the N-terminal fragment of Candida albicans hyphal wall protein 1

Directory of Open Access Journals (Sweden)

Pontón José

2007-04-01

Full Text Available Abstract Background The diagnosis of invasive candidiasis is difficult because there are no specific clinical manifestations of the disease and colonization and infection are difficult to distinguish. In the last decade, much effort has been made to develop reliable tests for rapid diagnosis of invasive candidiasis, but none of them have found widespread clinical use. Results Antibodies against a recombinant N-terminal fragment of the Candida albicans germ tube-specific antigen hyphal wall protein 1 (Hwp1 generated in Escherichia coli were detected by both immunoblotting and ELISA tests in a group of 36 hematological or Intensive Care Unit patients with invasive candidiasis and in a group of 45 control patients at high risk for the mycosis who did not have clinical or microbiological data to document invasive candidiasis. Results were compared with an immunofluorescence test to detect antibodies to C. albicans germ tubes (CAGT. The sensitivity, specificity, positive and negative predictive values of a diagnostic test based on the detection of antibodies against the N-terminal fragment of Hwp1 by immunoblotting were 27.8 %, 95.6 %, 83.3 % and 62.3 %, respectively. Detection of antibodies to the N-terminal fragment of Hwp1 by ELISA increased the sensitivity (88.9 % and the negative predictive value (90.2 % but slightly decreased the specificity (82.6 % and positive predictive values (80 %. The kinetics of antibody response to the N-terminal fragment of Hwp1 by ELISA was very similar to that observed by detecting antibodies to CAGT. Conclusion An ELISA test to detect antibodies against a recombinant N-terminal fragment of the C. albicans germ tube cell wall antigen Hwp1 allows the diagnosis of invasive candidiasis with similar results to those obtained by detecting antibodies to CAGT but without the need of treating the sera to adsorb the antibodies against the cell wall surface of the blastospore.

A new assay based on terminal restriction fragment length polymorphism of homocitrate synthase gene fragments for Candida species identification.

Science.gov (United States)

Szemiako, Kasjan; Śledzińska, Anna; Krawczyk, Beata

2017-08-01

Candida sp. have been responsible for an increasing number of infections, especially in patients with immunodeficiency. Species-specific differentiation of Candida sp. is difficult in routine diagnosis. This identification can have a highly significant association in therapy and prophylaxis. This work has shown a new application of the terminal restriction fragment length polymorphism (t-RFLP) method in the molecular identification of six species of Candida, which are the most common causes of fungal infections. Specific for fungi homocitrate synthase gene was chosen as a molecular target for amplification. The use of three restriction enzymes, DraI, RsaI, and BglII, for amplicon digestion can generate species-specific fluorescence labeled DNA fragment profiles, which can be used to determine the diagnostic algorithm. The designed method can be a cost-efficient high-throughput molecular technique for the identification of six clinically important Candida species.

Gas-phase structure and fragmentation pathways of singly protonated peptides with N-terminal arginine.

Science.gov (United States)

Bythell, Benjamin J; Csonka, István P; Suhai, Sándor; Barofsky, Douglas F; Paizs, Béla

2010-11-25

The gas-phase structures and fragmentation pathways of the singly protonated peptide arginylglycylaspartic acid (RGD) are investigated by means of collision-induced-dissociation (CID) and detailed molecular mechanics and density functional theory (DFT) calculations. It is demonstrated that despite the ionizing proton being strongly sequestered at the guanidine group, protonated RGD can easily be fragmented on charge directed fragmentation pathways. This is due to facile mobilization of the C-terminal or aspartic acid COOH protons thereby generating salt-bridge (SB) stabilized structures. These SB intermediates can directly fragment to generate b(2) ions or facilely rearrange to form anhydrides from which both b(2) and b(2)+H(2)O fragments can be formed. The salt-bridge stabilized and anhydride transition structures (TSs) necessary to form b(2) and b(2)+H(2)O are much lower in energy than their traditional charge solvated counterparts. These mechanisms provide compelling evidence of the role of SB and anhydride structures in protonated peptide fragmentation which complements and supports our recent findings for tryptic systems (Bythell, B. J.; Suhai, S.; Somogyi, A.; Paizs, B. J. Am. Chem. Soc. 2009, 131, 14057-14065.). In addition to these findings we also report on the mechanisms for the formation of the b(1) ion, neutral loss (H(2)O, NH(3), guanidine) fragment ions, and the d(3) ion.

Amino-terminal pro-B-type natriuretic peptides: testing in general populations

DEFF Research Database (Denmark)

Lemos, J.A. de; Hildebrandt, P.

2008-01-01

Screening of general populations with amino-terminal pro-B-type natriuretic peptides (NT-proBNP) holds promise for the detection of significant underlying cardiac structural and functional abnormalities, as well as for the early detection of the propensity to develop future cardiovascular events....... In comparative studies to date, NT-proBNP performs at least as well as BNP in the detection of heart disease and prognostication in the general population. In some studies and subgroups, NT-proBNP appears to outperform BNP in population screening. More needs to be learned about noncardiac sources of NT...

Studies on Aculeines: Synthetic Strategy to the Fully Protected Protoaculeine B, the N-Terminal Amino Acid of Aculeine B.

Science.gov (United States)

Shiozaki, Hiroki; Miyahara, Masayoshi; Otsuka, Kazunori; Miyako, Kei; Honda, Akito; Takasaki, Yuichi; Takamizawa, Satoshi; Tukada, Hideyuki; Ishikawa, Yuichi; Sakai, Ryuichi; Oikawa, Masato

2018-05-23

A synthetic strategy for accessing protoaculeine B (1), the N-terminal amino acid of the highly modified peptide toxin aculeine, was developed via the synthesis of the fully protected natural homologue of 1 with a 12-mer poly(propanediamine). The synthesis of mono(propanediamine) analog 2, as well as core amino acid 3, was demonstrated by this strategy. New amino acid 3 induced convulsions in mice; however, compound 2 showed no such activity.

Identification of a direct interaction between residue 19 in the helical portion of calcitonin and the amino-terminal domain of the calcitonin receptor from photoaffinity cross-linking and mutational studies

International Nuclear Information System (INIS)

Pham, V.; Wade, J.; McDowall, S.G.; Quiza, M.; Sexton, P.M.

2001-01-01

Full text: Calcitonins (CTs) are 32 amino acid hormones with both peripheral and central actions mediated via specific cell surface receptors, which belong to the superfamily of class II G-protein coupled receptors. Chimeric receptor and mutational data suggested that the helical portion (residues 8-22) of salmon CT (sCT) is important for high affinity binding to the amino-terminal extracellular domain of the human CT receptor (hCTR). In this study, we have developed photoactive sCT analogues [Arg 11, 18 , Bpa 19 ]sCT and [Arg 11 , 18 , Bpa 19 ]sCT(8-32) that incorporate a photolabile Bpa (p-benzoyl-L-phenylalanine) into position 19 of the helical domain of the ligand and used this to determine a specific receptor fragment proximate to it. These analogues saturably bound to the CTR with high affinity (IC 50 = 3 nM) which was similar to that of the natural sCT and its antagonist (IC 50 = 2 nM and 20 nM, respectively). Upon photolysis, radioiodinated 125 I-[Arg 11, 18 , Bpa 19 ]sCT and 125 I-[Arg 11,18 , Bpa 19 ]sCT(8-32) efficiently and specifically cross-linked to hCTR stably expressed in baby hamster kidney cells (Hollexl cells, ∼ 800,000 receptors per cell), generating a single radiolabeled band of ∼ 72-kDa on SDS/PAGE autoradiography. To identify the 'contact domain' within CTR involved in binding of 125 I-[Arg1 1 , 18 , Bpa 19 ]sCT and 125 I-[Arg 11, 18 , Bpa 19 ]sCT(8-32), the radiolabeled band containing the ligand-receptor conjugate was subjected to chemical and enzymatic cleavage. Cyanogen bromide cleavage of the native receptor yielded a radiolabeled fragment of apparent Mr ∼ 31-kDa that shifted to Mr ∼ 14 kDa after deglycosylation. This receptor domain corresponded to amino acids 59-134 of the hCTR, located at the amino-terminal extracellular region of the receptor. These results provide the first direct demonstration of a contact domain between calcitonin and its receptor, and will contribute towards the modelling of CT-CTR interface. Copyright

Basic amino acid residues located in the N-terminal region of BEND3 are essential for its nuclear localization

Energy Technology Data Exchange (ETDEWEB)

Shiheido, Hirokazu, E-mail: shiheido@ak.med.kyoto-u.ac.jp; Shimizu, Jun

2015-02-20

BEN domain-containing protein 3 (BEND3) has recently been reported to function as a heterochromatin-associated protein in transcriptional repression in the nucleus. BEND3 should have nuclear localization signals (NLSs) to localize to the nucleus in light of its molecular weight, which is higher than that allowed to pass through nuclear pore complexes. We here analyzed the subcellular localization of deletion/site-directed mutants of human BEND3 by an immunofluorescence assay in an attempt to identify the amino acids essential for its nuclear localization. We found that three basic amino acid residues located in the N-terminal region of BEND3 (BEND3{sub 56–58}, KRK) are essential, suggesting that these residues play a role as a functional NLS. These results provide valuable information for progressing research on BEND3. - Highlights: • BEND3 localizes to the nucleus. • The N-terminal 60 amino acids region of BEND3 contains NLS. • Amino acids located between 56 and 58 of BEND3 (KRK) are part of NLS. • KRK motif is highly conserved among BEND3 homologs.

Amino-terminal sequence of glycoprotein D of herpes simplex virus types 1 and 2

International Nuclear Information System (INIS)

Eisenberg, R.J.; Long, D.; Hogue-Angeletti, R.; Cohen, G.H.

1984-01-01

Glycoprotein D (gD) of herpes simplex virus is a structural component of the virion envelope which stimulates production of high titers of herpes simplex virus type-common neutralizing antibody. The authors caried out automated N-terminal amino acid sequencing studies on radiolabeled preparations of gD-1 (gD of herpes simplex virus type 1) and gD-2 (gD of herpes simplex virus type 2). Although some differences were noted, particularly in the methionine and alanine profiles for gD-1 and gD-2, the amino acid sequence of a number of the first 30 residues of the amino terminus of gD-1 and gD-2 appears to be quite similar. For both proteins, the first residue is a lysine. When we compared out sequence data for gD-1 with those predicted by nucleic acid sequencing, the two sequences could be aligned (with one exception) starting at residue 26 (lysine) of the predicted sequence. Thus, the first 25 amino acids of the predicted sequence are absent from the polypeptides isolated from infected cells

The amino-terminal 200 amino acids of the plasma membrane Na+,K+-ATPase alpha subunit confer ouabain sensitivity on the sarcoplasmic reticulum Ca(2+)-ATPase.

OpenAIRE

Ishii, T; Takeyasu, K

1993-01-01

Cardiac glycosides such as G-strophanthin (ouabain) bind to and inhibit the plasma membrane Na+,K(+)-ATPase but not the sarcoplasmic reticulum (SR) Ca(2+)-ATPase, whereas thapsigargin specifically blocks the SR Ca(2+)-ATPase. The chimera [n/c]CC, in which the amino-terminal amino acids Met1 to Asp162 of the SR Ca(2+)-ATPase (SERCA1) were replaced with the corresponding portion of the Na+,K(+)-ATPase alpha 1 subunit (Met1 to Asp200), retained thapsigargin- and Ca(2+)-sensitive ATPase activity,...

N-terminal region of gelsolin induces apoptosis of activated hepatic stellate cells by a caspase-dependent mechanism.

Directory of Open Access Journals (Sweden)

Budhaditya Mazumdar

Full Text Available Activated hepatic stellate cells (HSCs are the major source for alteration of extracellular matrix in fibrosis and cirrhosis. Conditioned medium (CM collected from immortalized human hepatocytes (IHH have earlier been shown to be responsible for apoptosis of HSCs. In this study, we have shown that antibodies raised against a peptide derived from a linear B-cell epitope in the N-terminal region of gelsolin identified a gelsolin fragment in IHH CM. Analysis of activated stellate cell death by CM collected from Huh7 cells transfected with plasmids encoding gelsolin deletion mutants suggested that the N-terminal half of gelsolin contained sequences which were responsible for stellate cell death. Further analysis determined that this activity was restricted to a region encompassing amino acids 1-70 in the gelsolin sequence; antibody directed to an epitope within this region was able to neutralize stellate cell death. Gelsolin modulation of cell death using this fragment involved upregulation of TRAIL-R1 and TRAIL-R2, and involved caspase 3 activation by extrinsic pathway. The apoptotic activity of N-terminal gelsolin fragments was restricted to activated but not quiescent stellate cells indicating its potential application in therapeutic use as an anti-fibrotic agent. Gelsolin fragments encompassing N-terminal regions in polypeptides of different molecular sizes were detected by N-terminal peptide specific antiserum in IHH CM immunoprecipitated with chronically HCV infected patient sera, suggesting the presence of autoantibodies generated against N-terminal gelsolin fragments in patients with chronic liver disease.

A fragment of alpha-actinin promotes monocyte/macrophage maturation in vitro.

Science.gov (United States)

Luikart, S; Wahl, D; Hinkel, T; Masri, M; Oegema, T

1999-02-01

Conditioned media (CM) from cultures of HL-60 myeloid leukemia cells grown on extracellular bone marrow matrix contains a factor that induces macrophage-like maturation of HL-60 cells. This factor was purified from the CM of HL-60 cells grown on bone marrow stroma by ammonium sulfate precipitation, then sequential chromatography on DEAE, affi-gel blue affinity, gel exclusion, and wheat germ affinity columns, followed by C-4 reverse phase HPLC, and SDS-PAGE. The maturation promoting activity of the CM was identified in a single 31 kD protein. Amino acid sequence analysis of four internal tryptic peptides of this protein confirmed significant homology with amino acid residues 48-60, 138-147, 215-220, and 221-236 of human cytoskeletal alpha-actinin. An immunoaffinity purified rabbit polyclonal anti-chicken alpha-actinin inhibited the activity of HL-60 conditioned media. A 27 kD amino-terminal fragment of alpha-actinin produced by thermolysin digestion of chicken gizzard alpha-actinin, but not intact alpha-actinin, had maturation promoting activity on several cell types, including blood monocytes, as measured by lysozyme secretion and tartrate-resistant acid phosphatase staining. We conclude that an extracellular alpha-actinin fragment can promote monocyte/macrophage maturation. This represents the first example of a fragment of a cytoskeletal component, which may be released during tissue remodeling and repair, playing a role in phagocyte maturation.

N-terminal prolactin-derived fragments, vasoinhibins, are proapoptoptic and antiproliferative in the anterior pituitary.

Science.gov (United States)

Ferraris, Jimena; Radl, Daniela Betiana; Zárate, Sandra; Jaita, Gabriela; Eijo, Guadalupe; Zaldivar, Verónica; Clapp, Carmen; Seilicovich, Adriana; Pisera, Daniel

2011-01-01

The anterior pituitary is under a constant cell turnover modulated by gonadal steroids. In the rat, an increase in the rate of apoptosis occurs at proestrus whereas a peak of proliferation takes place at estrus. At proestrus, concomitant with the maximum rate of apoptosis, a peak in circulating levels of prolactin is observed. Prolactin can be cleaved to different N-terminal fragments, vasoinhibins, which are proapoptotic and antiproliferative factors for endothelial cells. It was reported that a 16 kDa vasoinhibin is produced in the rat anterior pituitary by cathepsin D. In the present study we investigated the anterior pituitary production of N-terminal prolactin-derived fragments along the estrous cycle and the involvement of estrogens in this process. In addition, we studied the effects of a recombinant vasoinhibin, 16 kDa prolactin, on anterior pituitary apoptosis and proliferation. We observed by Western Blot that N-terminal prolactin-derived fragments production in the anterior pituitary was higher at proestrus with respect to diestrus and that the content and release of these prolactin forms from anterior pituitary cells in culture were increased by estradiol. A recombinant preparation of 16 kDa prolactin induced apoptosis (determined by TUNEL assay and flow cytometry) of cultured anterior pituitary cells and lactotropes from ovariectomized rats only in the presence of estradiol, as previously reported for other proapoptotic factors in the anterior pituitary. In addition, 16 kDa prolactin decreased forskolin-induced proliferation (evaluated by BrdU incorporation) of rat total anterior pituitary cells and lactotropes in culture and decreased the proportion of cells in S-phase of the cell cycle (determined by flow cytometry). In conclusion, our study indicates that the anterior pituitary production of 16 kDa prolactin is variable along the estrous cycle and increased by estrogens. The antiproliferative and estradiol-dependent proapoptotic actions of this

N-terminal prolactin-derived fragments, vasoinhibins, are proapoptoptic and antiproliferative in the anterior pituitary.

Directory of Open Access Journals (Sweden)

Jimena Ferraris

Full Text Available The anterior pituitary is under a constant cell turnover modulated by gonadal steroids. In the rat, an increase in the rate of apoptosis occurs at proestrus whereas a peak of proliferation takes place at estrus. At proestrus, concomitant with the maximum rate of apoptosis, a peak in circulating levels of prolactin is observed. Prolactin can be cleaved to different N-terminal fragments, vasoinhibins, which are proapoptotic and antiproliferative factors for endothelial cells. It was reported that a 16 kDa vasoinhibin is produced in the rat anterior pituitary by cathepsin D. In the present study we investigated the anterior pituitary production of N-terminal prolactin-derived fragments along the estrous cycle and the involvement of estrogens in this process. In addition, we studied the effects of a recombinant vasoinhibin, 16 kDa prolactin, on anterior pituitary apoptosis and proliferation. We observed by Western Blot that N-terminal prolactin-derived fragments production in the anterior pituitary was higher at proestrus with respect to diestrus and that the content and release of these prolactin forms from anterior pituitary cells in culture were increased by estradiol. A recombinant preparation of 16 kDa prolactin induced apoptosis (determined by TUNEL assay and flow cytometry of cultured anterior pituitary cells and lactotropes from ovariectomized rats only in the presence of estradiol, as previously reported for other proapoptotic factors in the anterior pituitary. In addition, 16 kDa prolactin decreased forskolin-induced proliferation (evaluated by BrdU incorporation of rat total anterior pituitary cells and lactotropes in culture and decreased the proportion of cells in S-phase of the cell cycle (determined by flow cytometry. In conclusion, our study indicates that the anterior pituitary production of 16 kDa prolactin is variable along the estrous cycle and increased by estrogens. The antiproliferative and estradiol-dependent proapoptotic

The human receptor for urokinase plasminogen activator. NH2-terminal amino acid sequence and glycosylation variants

DEFF Research Database (Denmark)

Behrendt, N; Rønne, E; Ploug, M

1990-01-01

-PA. The purified protein shows a single 55-60 kDa band after sodium dodecyl sulfate-polyacrylamide gel electrophoresis and silver staining. It is a heavily glycosylated protein, the deglycosylated polypeptide chain comprising only 35 kDa. The glycosylated protein contains N-acetyl-D-glucosamine and sialic acid......, but no N-acetyl-D-galactosamine. Glycosylation is responsible for substantial heterogeneity in the receptor on phorbol ester-stimulated U937 cells, and also for molecular weight variations among various cell lines. The amino acid composition and the NH2-terminal amino acid sequence are reported...

Solution and crystal structures of a C-terminal fragment of the neuronal isoform of the polypyrimidine tract binding protein (nPTB

Directory of Open Access Journals (Sweden)

Amar Joshi

2014-03-01

Full Text Available The eukaryotic polypyrimidine tract binding protein (PTB serves primarily as a regulator of alternative splicing of messenger RNA, but is also co-opted to other roles such as RNA localisation and translation initiation from internal ribosome entry sites. The neuronal paralogue of PTB (nPTB is 75% identical in amino acid sequence with PTB. Although the two proteins have broadly similar RNA binding specificities and effects on RNA splicing, differential expression of PTB and nPTB can lead to the generation of alternatively spliced mRNAs. RNA binding by PTB and nPTB is mediated by four RNA recognition motifs (RRMs. We present here the crystal and solution structures of the C-terminal domain of nPTB (nPTB34 which contains RRMs 3 and 4. As expected the structures are similar to each other and to the solution structure of the equivalent fragment from PTB (PTB34. The result confirms that, as found for PTB, RRMs 3 and 4 of nPTB interact with one another to form a stable unit that presents the RNA-binding surfaces of the component RRMs on opposite sides that face away from each other. The major differences between PTB34 and nPTB34 arise from amino acid side chain substitutions on the exposed β-sheet surfaces and adjoining loops of each RRM, which are likely to modulate interactions with RNA.

The human immunodeficiency virus-1 protein Tat and its discrete fragments evoke selective release of acetylcholine from human and rat cerebrocortical terminals through species-specific mechanisms.

Science.gov (United States)

Feligioni, Marco; Raiteri, Luca; Pattarini, Roberto; Grilli, Massimo; Bruzzone, Santina; Cavazzani, Paolo; Raiteri, Maurizio; Pittaluga, Anna

2003-07-30

The effect of the human immunodeficiency virus-1 protein Tat was investigated on neurotransmitter release from human and rat cortical nerve endings. Tat failed to affect the release of several neurotransmitters, such as glutamate, GABA, norepinephrine, and others, but it evoked the release of [3H]ACh via increase of cytosolic [Ca2+]. In human nerve terminals, the Tat effect partly depends on Ca2+ entry through voltage-sensitive Ca2+ channels, because Cd2+ halved the Tat-evoked release. Activation of group I metabotropic glutamate receptors (mGluR) and mobilization of Ca2+ from IP3-sensitive intraterminal stores are also involved, because the Tat effect was prevented by mGluR antagonists 2-methyl-6-(phenylethynyl)pyridine hydrochloride and 7-(hydroxyimino)cyclopropa[b]chromen-1a-carboxylate ethyl ester and by the IP3 receptor antagonists heparin and xestospongin C. Furthermore, the group I selective mGlu agonist (RS)-3,5-dihydroxyphenylglycine enhanced [3H]ACh release. In rat nerve terminals, the Tat-evoked release neither depends on external Ca2+ ions entry nor on IP3-mediated mechanisms. Tat seems to cause mobilization of Ca2+ from ryanodine-sensitive internal stores because its effect was prevented by both 8-bromo-cyclic adenosine diphosphate-ribose and dantrolene. The Tat-evoked release from human synaptosomes was mimicked by the peptide sequences Tat 32-62, Tat 49-86, and Tat 41-60. In contrast, the Tat 49-86 and Tat 61-80 fragments, but not the Tat 32-62 fragment, were active in rat synaptosomes. In conclusion, Tat elicits Ca2+-dependent [3H]ACh release by species-specific intraterminal mechanisms by binding via discrete amino acid sequences to different receptive sites on human and rat cholinergic terminals.

The recombinant C-terminal fragment of tetanus toxin protects against cholinotoxicity by intraseptal injection of β-amyloid peptide (25-35) in rats.

Science.gov (United States)

Patricio-Martínez, A; Mendieta, L; Martínez, I; Aguilera, J; Limón, I D

2016-02-19

The recombinant C-terminal domain of tetanus toxin (Hc-TeTx) is a new non-toxic peptide of the tetanus toxin that exerts a protective action against glutamate excitotoxicity in motoneurons. Moreover, its efficacy as a neuroprotective agent has been demonstrated in several animal models of neurodegeneration. The eleven amino acids in the β amyloid peptide (Aβ25-35) mimic the toxic effects of the full β amyloid peptide (Aβ1-42), causing the impairment of the cholinergic system in the medial septum (MS) which, in turn, alters the septo-hippocampal pathway and leads to learning and memory impairments. The aim of this study was to examine the neuroprotective effects of the Hc-TeTx fragment against cholinotoxicity. The Hc-TeTx fragment (100 ng) was injected into the rats intercranially, with the Aβ(25-35) (2 μg) then injected into their MS. The animals were tested for spatial learning and memory in the eight-arm radial maze. The brains were removed to assess cholinergic markers, such as choline acetyltransferase (ChAT) and acetylcholinesterase (AChE), and to explore neurodegeneration in the MS and hippocampus, using amino-cupric silver and H&E staining. Finally, capase-3, a marker of apoptosis, was examined in the MS. Our results clearly demonstrate that the application of Hc-TeTx prevents the loss of cholinergic markers (ChAT and AChE), the activation of capase-3, and neurodegeneration in the MS and the CA1 and CA3 subfields of the hippocampus. All these improvements were reflected in spatial learning and memory performance, and were significantly higher compared with animals treated with Aβ(25-35). Interestingly, the single administration of Hc-TeTx into the MS modified the ChAT and AChE expression that affect cognitive processes, without inducing neurodegeneration or an increase in capase-3 expression in the MS and hippocampus. In summary, our findings suggest that the recombinant Hc-TeTx fragment offers effective protection for the septo-hippocampal pathway

Use of Full-Length Recombinant Calflagin and Its C Fragment for Improvement of Diagnosis of Trypanosoma cruzi Infection†

Science.gov (United States)

Marcipar, Iván S.; Roodveldt, Cintia; Corradi, Gerardo; Cabeza, María L.; Brito, Maria Edileuza F.; Winter, Lucile M. Floeter; Marcipar, Alberto J.; Silber, Ariel M.

2005-01-01

Serological diagnosis of Trypanosoma cruzi infection is hampered by issues related to test specificity due to the cross-reactivity of most antigens with proteins of related parasites such as Leishmania spp. The recombinant calflagins are considered relevant antigens for the diagnosis of infection by Trypanosoma cruzi. In the present work, we describe two genes coding for putative calflagins in Leishmania major with the N-terminal moieties presenting high similarity with T. cruzi genes. This fact raised questions about their role in some cross-recognition of this antigen by sera from Leishmania spp.-infected individuals. The complete T. cruzi calflagin and two fragments of the protein, consisting of 146 amino acids of the N-terminal and 65 amino acids of the C-terminal regions, were expressed and evaluated against a panel of sera, which included well-characterized samples from T. cruzi, and Leishmania-infected patients. We were able to show that sera from Leishmania (Viannia) braziliensis-infected individuals recognized the recombinant full-length calflagin. Both the N-terminal and the complete protein presented the same high sensitivity (98.5% of sera from T. cruzi-infected patients was detected) but different specificities (94% and 98%, respectively, when evaluated against sera from people not infected by T. cruzi, including 15 sera from people infected with L. braziliensis). The C-terminal fragment presented low sensitivity (70%) but 100% specificity. We propose the use of these antigens in two sequential assays to optimize the serological diagnosis of T. cruzi infection in humans in geographic areas where Leishmania spp. infection is coendemic. PMID:16272476

Synthesis of Water-Soluble Amino Functionalized Multithiacalix[4]arene via Quaternization of Tertiary Amino Groups

Directory of Open Access Journals (Sweden)

Roman Nosov

2018-05-01

Full Text Available A convenient approach to the synthesis of multithiacalix[4]arene derivatives containing amino groups and phthalimide fragments by the formation of quaternary ammonium salts is presented. As the initial macrocycle for the synthesis of multithiacalix[4]arenes, a differently substituted p-tert-butylthiacalix[4]arene containing bromoacetamide and three phthalimide fragments was used in a 1,3-alternate conformation. The macrocycle in cone conformation containing the tertiary amino groups was found to be a convenient core for the multithiacalix[4]arene systems. Interaction of the core multithiacalix[4]arene with monobromoacetamide derivatives of p-tert-butylthiacalix[4]arene resulted in formation in high yields of pentakisthiacalix[4]arene containing quaternary ammonium and phthalimide fragments. The removal of phthalimide groups led to the formation of amino multithiacalix[4]arene in a good yield. Based on dynamic light scattering, it was shown that the synthesized amino multithiacalix[4]arene, with pronounced hydrophobic and hydrophilic fragments, formed dendrimer-like nanoparticles in water via direct supramolecular self-assembly.

N-terminal amino acid sequence of Bacillus licheniformis alpha-amylase: comparison with Bacillus amyloliquefaciens and Bacillus subtilis Enzymes.

OpenAIRE

Kuhn, H; Fietzek, P P; Lampen, J O

1982-01-01

The thermostable, liquefying alpha-amylase from Bacillus licheniformis was immunologically cross-reactive with the thermolabile, liquefying alpha-amylase from Bacillus amyloliquefaciens. Their N-terminal amino acid sequences showed extensive homology with each other, but not with the saccharifying alpha-amylases of Bacillus subtilis.

Structural organization of intercellular channels II. Amino terminal domain of the connexins: sequence, functional roles, and structure.

Science.gov (United States)

Beyer, Eric C; Lipkind, Gregory M; Kyle, John W; Berthoud, Viviana M

2012-08-01

The amino terminal domain (NT) of the connexins consists of their first 22-23 amino acids. Site-directed mutagenesis studies have demonstrated that NT amino acids are determinants of gap junction channel properties including unitary conductance, permeability/selectivity, and gating in response to transjunctional voltage. The importance of this region has also been emphasized by the identification of multiple disease-associated connexin mutants affecting amino acid residues in the NT region. The first part of the NT is α-helical. The structure of the Cx26 gap junction channel shows that the NT α-helix localizes within the channel, and lines the wall of the pore. Interactions of the amino acid residues in the NT with those in the transmembrane helices may be critical for holding the channel open. The predicted sites of these interactions and the applicability of the Cx26 structure to the NT of other connexins are considered. This article is part of a Special Issue entitled: The Communicating junctions, composition, structure and characteristics. Copyright © 2011. Published by Elsevier B.V.

Human dermatosparaxis: a form of Ehlers-Danlos syndrome that results from failure to remove the amino-terminal propeptide of type I procollagen.

Science.gov (United States)

Smith, L T; Wertelecki, W; Milstone, L M; Petty, E M; Seashore, M R; Braverman, I M; Jenkins, T G; Byers, P H

1992-08-01

Dermatosparaxis is a recessively inherited connective-tissue disorder that results from lack of the activity of type I procollagen N-proteinase, the enzyme that removes the amino-terminal propeptides from type I procollagen. Initially identified in cattle more than 20 years ago, the disorder was subsequently characterized in sheep, cats, and dogs. Affected animals have fragile skin, lax joints, and often die prematurely because of sepsis following avulsion of portions of skin. We recently identified two children with soft, lax, and fragile skin, which, when examined by transmission electron microscopy, contained the twisted, ribbon-like collagen fibrils characteristic of dermatosparaxis. Skin extracts from one child contained collagen precursors with amino-terminal extensions. Cultured fibroblasts from both children failed to cleave the amino-terminal propeptides from the pro alpha 1(I) and pro alpha 2(I) chains in type I procollagen molecules. Extracts of normal cells cleaved to collagen, the type I procollagen synthesized by cells from both children, demonstrating that the enzyme, not the substrate, was defective. These findings distinguish dermatosparaxis from Ehlers-Danlos syndrome type VII, which results from substrate mutations that prevent proteolytic processing of type I procollagen molecules.

Molecular cloning and expression of the hyu genes from Microbacterium liquefaciens AJ 3912, responsible for the conversion of 5-substituted hydantoins to alpha-amino acids, in Escherichia coli.

Science.gov (United States)

Suzuki, Shun'ichi; Takenaka, Yasuhiro; Onishi, Norimasa; Yokozeki, Kenzo

2005-08-01

A DNA fragment from Microbacterium liquefaciens AJ 3912, containing the genes responsible for the conversion of 5-substituted-hydantoins to alpha-amino acids, was cloned in Escherichia coli and sequenced. Seven open reading frames (hyuP, hyuA, hyuH, hyuC, ORF1, ORF2, and ORF3) were identified on the 7.5 kb fragment. The deduced amino acid sequence encoded by the hyuA gene included the N-terminal amino acid sequence of the hydantoin racemase from M. liquefaciens AJ 3912. The hyuA, hyuH, and hyuC genes were heterologously expressed in E. coli; their presence corresponded with the detection of hydantoin racemase, hydantoinase, and N-carbamoyl alpha-amino acid amido hydrolase enzymatic activities respectively. The deduced amino acid sequences of hyuP were similar to those of the allantoin (5-ureido-hydantoin) permease from Saccharomyces cerevisiae, suggesting that hyuP protein might function as a hydantoin transporter.

On the terminal homologation of physiologically active peptides as a means of increasing stability in human serum--neurotensin, opiorphin, B27-KK10 epitope, NPY.

Science.gov (United States)

Seebach, Dieter; Lukaszuk, Aneta; Patora-Komisarska, Krystyna; Podwysocka, Dominika; Gardiner, James; Ebert, Marc-Olivier; Reubi, Jean Claude; Cescato, Renzo; Waser, Beatrice; Gmeiner, Peter; Hübner, Harald; Rougeot, Catherine

2011-05-01

The terminal homologation by CH(2) insertion into the peptides mentioned in the title is described. This involves replacement of the N-terminal amino acid residue by a β(2) - and of the C-terminal amino acid residue by a β(3) -homo-amino acid moiety (β(2) hXaa and β(3) hXaa, resp.; Fig. 1). In this way, the structure of the peptide chain from the N-terminal to the C-terminal stereogenic center is identical, and the modified peptide is protected against cleavage by exopeptidases (Figs. 2 and 3). Neurotensin (NT; 1) and its C-terminal fragment NT(8-13) are ligands of the G-protein-coupled receptors (GPCR) NT1, NT2, NT3, and NT analogs are promising tools to be used in cancer diagnostics and therapy. The affinities of homologated NT analogs, 2b-2e, for NT1 and NT2 receptors were determined by using cell homogenates and tumor tissues (Table 1); in the latter experiments, the affinities for the NT1 receptor are more or less the same as those of NT (0.5-1.3 vs. 0.6 nM). At the same time, one of the homologated NT analogs, 2c, survives in human plasma for 7 days at 37° (Fig. 6). An NMR analysis of NT(8-13) (Tables 2 and 4, and Fig. 8) reveals that this N-terminal NT fragment folds to a turn in CD(3) OH. - In the case of the human analgesic opiorphin (3a), a pentapeptide, and of the HIV-derived B27-KK10 (4a), a decapeptide, terminal homologation (→3b and 4b, resp.) led to a 7- and 70-fold half-life increase in plasma (Fig. 9). With N-terminally homologated NPY, 5c, we were not able to determine serum stability; the peptide consisting of 36 amino acid residues is subject to cleavage by endopetidases. Three of the homologated compounds, 2b, 2c, and 5c, were shown to be agonists (Fig. 7 and 11). A comparison of terminal homologation with other stability-increasing terminal modifications of peptides is performed (Fig. 5), and possible applications of the neurotensin analogs, described herein, are discussed. Copyright © 2011 Verlag Helvetica Chimica

Efficient production of Trastuzumab Fab antibody fragments in Brevibacillus choshinensis expression system.

Science.gov (United States)

Mizukami, Makoto; Onishi, Hiromasa; Hanagata, Hiroshi; Miyauchi, Akira; Ito, Yuji; Tokunaga, Hiroko; Ishibashi, Matsujiro; Arakawa, Tsutomu; Tokunaga, Masao

2018-10-01

The Brevibacillus expression system has been successfully employed for the efficient productions of a variety of recombinant proteins, including enzymes, cytokines, antigens and antibody fragments. Here, we succeeded in secretory expression of Trastuzumab Fab antibody fragments using B. choshinensis/BIC (Brevibacillus in vivocloning) expression system. In the fed-batch high-density cell culture, recombinant Trastuzumab Fab with amino-terminal His-tag (His-BcFab) was secreted at high level, 1.25 g/liter, and Fab without His-tag (BcFab) at ∼145 mg/L of culture supernatant. His-BcFab and BcFab were purified to homogeneity using combination of conventional column chromatographies with a yield of 10-13%. This BcFab preparation exhibited native structure and functions evaluated by enzyme-linked immunosorbent assay, surface plasmon resonance, circular dichroism measurements and size exclusion chromatography. To our knowledge, this is the highest production of Fab antibody fragments in gram-positive bacterial expression/secretion systems. Copyright © 2018 Elsevier Inc. All rights reserved.

Folding units in calcium vector protein of amphioxus: Structural and functional properties of its amino- and carboxy-terminal halves.

Science.gov (United States)

Baladi, S; Tsvetkov, P O; Petrova, T V; Takagi, T; Sakamoto, H; Lobachov, V M; Makarov, A A; Cox, J A

2001-04-01

Muscle of amphioxus contains large amounts of a four EF-hand Ca2+-binding protein, CaVP, and its target, CaVPT. To study the domain structure of CaVP and assess the structurally important determinants for its interaction with CaVPT, we expressed CaVP and its amino (N-CaVP) and carboxy-terminal halves (C-CaVP). The interactive properties of recombinant and wild-type CaVP are very similar, despite three post-translational modifications in the wild-type protein. N-CaVP does not bind Ca2+, shows a well-formed hydrophobic core, and melts at 44 degrees C. C-CaVP binds two Ca2+ with intrinsic dissociation constants of 0.22 and 140 microM (i.e., very similar to the entire CaVP). The metal-free domain in CaVP and C-CaVP shows no distinct melting transition, whereas its 1Ca2+ and 2Ca2+) forms melt in the 111 degrees -123 degrees C range, suggesting that C-CaVP and the carboxy- domain of CaVP are natively unfolded in the metal-free state and progressively gain structure upon binding of 1Ca2+ and 2Ca2+. Thermal denaturation studies provide evidence for interdomain interaction: the apo, 1Ca2+ and 2Ca2+ states of the carboxy-domain destabilize to different degrees the amino-domain. Only C-CaVP forms a Ca2+-dependent 1:1 complex with CaVPT. Our results suggest that the carboxy-terminal domain of CaVP interacts with CaVPT and that the amino-terminal lobe modulates this interaction.

Preferential assembly of heteromeric kainate and AMPA receptor amino terminal domains.

Science.gov (United States)

Zhao, Huaying; Lomash, Suvendu; Chittori, Sagar; Glasser, Carla; Mayer, Mark L; Schuck, Peter

2017-10-23

Ion conductivity and the gating characteristics of tetrameric glutamate receptor ion channels are determined by their subunit composition. Competitive homo- and hetero-dimerization of their amino-terminal domains (ATDs) is a key step controlling assembly. Here we measured systematically the thermodynamic stabilities of homodimers and heterodimers of kainate and AMPA receptors using fluorescence-detected sedimentation velocity analytical ultracentrifugation. Measured affinities span many orders of magnitude, and complexes show large differences in kinetic stabilities. The association of kainate receptor ATD dimers is generally weaker than the association of AMPA receptor ATD dimers, but both show a general pattern of increased heterodimer stability as compared to the homodimers of their constituents, matching well physiologically observed receptor combinations. The free energy maps of AMPA and kainate receptor ATD dimers provide a framework for the interpretation of observed receptor subtype combinations and possible assembly pathways.

Pharmacologic study of C-terminal fragments of frog skin calcitonin gene-related peptide.

Science.gov (United States)

Ladram, Ali; Besné, Isabelle; Breton, Lionel; de Lacharrière, Olivier; Nicolas, Pierre; Amiche, Mohamed

2008-07-01

The calcitonin gene-related peptide from the skin of the frog Phyllomedusa bicolor (pbCGRP) is a 37-residue neuropeptide that differs from human alpha CGRP (halphaCGRP) at 16 positions. The affinities of the C-terminal fragments of pbCGRP and halphaCGRP were evaluated in SK-N-MC cells: pbCGRP(8-37) (K(i)=0.2nM) and pbCGRP(27-37) (K(i)=95nM) were, respectively, 3 times and 20 times more potent than the human fragments halphaCGRP(8-37) and halphaCGRP(27-37). Their antagonistic potencies were measured in SK-N-MC and Col 29 cells, and the rat vas deferens. pbCGRP(8-37) inhibited the halphaCGRP-stimulated production of cAMP by SK-N-MC and Col 29 cells 3 to 4 times more strongly than halphaCGRP(8-37). Thus pbCGRP(8-37) is the most potent CGRP-1 competitive antagonist of all the natural sequences reported to date. pbCGRP(27-37) was also as potent as [D(31), A(34), F(35)] halphaCGRP(27-37), a prototypic antagonist analog derived from structure-activity relationship studies of halphaCGRP(8-37).

Chaperone protein HYPK interacts with the first 17 amino acid region of Huntingtin and modulates mutant HTT-mediated aggregation and cytotoxicity

Energy Technology Data Exchange (ETDEWEB)

Choudhury, Kamalika Roy [Crystallography and Molecular Biology Division, Saha Institute of Nuclear Physics, 1/AF Bidhannagar, Kolkata 700064 (India); Centre for Neuroscience, Indian Institute of Science, Bangalore 560012 (India); Bhattacharyya, Nitai P., E-mail: nitai_sinp@yahoo.com [Biomedical Genomics Centre, PG Polyclinic Building, 5, Suburbun Hospital Road, Kolkata 700020 (India)

2015-01-02

Highlights: • HYPK reduces mutant HTT-mediated aggregate formation and cytotoxicity. • Interaction of HYPK with HTT requires N-terminal 17 amino acid of HTT (HTT-N17). • Deletion of HTT-N17 leads to SDS-soluble, smaller, nuclear aggregates. • These smaller aggregates do not associate with HYPK and are more cytotoxic. • Maybe, interaction of HYPK with amphipathic HTT-N17 block HTT aggregate formation. - Abstract: Huntington’s disease is a polyglutamine expansion disorder, characterized by mutant HTT-mediated aggregate formation and cytotoxicity. Many reports suggests roles of N-terminal 17 amino acid domain of HTT (HTT-N17) towards subcellular localization, aggregate formation and subsequent pathogenicity induced by N-terminal HTT harboring polyQ stretch in pathogenic range. HYPK is a HTT-interacting chaperone which can reduce N-terminal mutant HTT-mediated aggregate formation and cytotoxicity in neuronal cell lines. However, how HYPK interacts with N-terminal fragment of HTT remained unknown. Here we report that specific interaction of HYPK with HTT-N17 is crucial for the chaperone activity of HYPK. Deletion of HTT-N17 leads to formation of tinier, SDS-soluble nuclear aggregates formed by N-terminal mutant HTT. The increased cytotoxicity imparted by these tiny aggregates might be contributed due to loss of interaction with HYPK.

Community analysis of preservative-treated southern pine (Pinus spp.) using terminal restriction fragment length polymorphism (T-RFLP) analysis

Science.gov (United States)

Grant T. Kirker; M. Lynn Prewitt; Walter J. Diehl; Susan V. Diehl

2012-01-01

The effects of wood preservatives on the bacterial community in southern yellow pine were assessed by the molecular method ‘terminal restriction fragment length polymorphism’ (T-RFLP). Stakes, treated with 0.25 % and 0.37 % ammoniacal copper quat (ACQ-C), 0.1 % and 0.25 % chlorothalonil (CTN), 0.1 % and 0.25 % CTN with 2 % butylated hydroxytoluene (BHT), and 2 % BHT...

Reaction of hypochlorite with amino acids and peptides : EPR evidence for rapid rearrangement and fragmentation of nitrogen-centred radicals

International Nuclear Information System (INIS)

Hawkins, C.L.; Davies, M.J.

1998-01-01

Various amino acid side chains have been shown to be particularly susceptible to attack and modification by hypochlorite (HOCl). It is known that tyrosine is readily chlorinated by HOCl to give 3-chlorotyrosine and this product has been employed as a marker of HOCl-mediated damage to proteins. Cysteine and methionine react rapidly with HOCl to give oxy acids and cystine (from cysteine) and sulphoxides (from methionine). Lysine and amino acids which lack the above functional groups also react with HOCl via the free amino group which results in the generation of unstable chloramine intermediates; subsequent decomposition of these species gives NH 3 , CO 2 and aldehydes. While the products of reaction of HOCl with amino acids and peptides are reasonably well characterised, the mechanism(s) by which these products arise is less well understood. Electron paramagnetic resonance (EPR) spectroscopy with spin trapping and UV/visible spectroscopy has been employed to examine the reaction of HOCl with amino acids and some small peptides. Reaction of HOCl with N-acetyl amino acids or small peptides gives radicals predominantly at α-carbon sites via reaction at N-terminal free amino groups or amide (peptide) bonds. It is proposed that these carbon-centred radicals are produced as a result of the rearrangement of initial nitrogen-centred radicals formed on cleavage of the N-CI bond of the chloramine/chloramide species by a 1,2-shift reaction

A novel branched chain amino acids responsive transcriptional regulator, BCARR, negatively acts on the proteolytic system in Lactobacillus helveticus.

Directory of Open Access Journals (Sweden)

Taketo Wakai

Full Text Available Transcriptional negative regulation of the proteolytic system of Lactobacillus helveticus CM4 in response to amino acids seems to be very important for the control of antihypertensive peptide production; however, it remains poorly understood. A 26-kDa protein with N-terminal cystathionine β-synthase domains (CBS domain protein, which seems to be involved in the regulatory system, was purified by using a DNA-sepharose bound 300-bp DNA fragment corresponding to the upstream regions of the six proteolytic genes that are down-regulated by amino acids. The CBS domain protein bound to a DNA fragment corresponding to the region upstream of the pepV gene in response to branched chain amino acids (BCAAs. The expression of the pepV gene in Escherichia coli grown in BCAA-enriched medium was repressed when the CBS domain protein was co-expressed. These results reveal that the CBS domain protein acts as a novel type of BCAA-responsive transcriptional regulator (BCARR in L. helveticus. From comparative analysis of the promoter regions of the six proteolysis genes, a palindromic AT-rich motif, 5'-AAAAANNCTWTTATT-3', was predicted as the consensus DNA motif for the BCARR protein binding. Footprint analysis using the pepV promotor region and gel shift analyses with the corresponding short DNA fragments strongly suggested that the BCARR protein binds adjacent to the pepV promoter region and affects the transcription level of the pepV gene in the presence of BCAAs. Homology search analysis of the C-terminal region of the BCARR protein suggested the existence of a unique βαββαβ fold structure that has been reported in a variety of ACT (aspartate kinase-chorismate mutase-tyrA domain proteins for sensing amino acids. These results also suggest that the sensing of BCAAs by the ACT domain might promote the binding of the BCARR to DNA sequences upstream of proteolysis genes, which affects the gene expression of the proteolytic system in L. helveticus.

Graph Theory. 1. Fragmentation of Structural Graphs

Directory of Open Access Journals (Sweden)

Lorentz JÄNTSCHI

2002-12-01

Full Text Available The investigation of structural graphs has many fields of applications in engineering, especially in applied sciences like as applied chemistry and physics, computer sciences and automation, electronics and telecommunication. The main subject of the paper is to express fragmentation criteria in graph using a new method of investigation: terminal paths. Using terminal paths are defined most of the fragmentation criteria that are in use in molecular topology, but the fields of applications are more generally than that, as I mentioned before. Graphical examples of fragmentation are given for every fragmentation criteria. Note that all fragmentation is made with a computer program that implements a routine for every criterion.[1] A web routine for tracing all terminal paths in graph can be found at the address: http://vl.academicdirect.ro/molecular_topology/tpaths/ [1] M. V. Diudea, I. Gutman, L. Jäntschi, Molecular Topology, Nova Science, Commack, New York, 2001, 2002.

Effects of a one year physical activity program on serum C Terminal Agrin Fragment (CAF) concentrations among mobility limited older adults

Science.gov (United States)

OBJECTIVES: C terminal Agrin Fragment (CAF) has been proposed as a potential circulating biomarker for predicting changes in physical function among older adults. To determine the effect of a one year PA intervention on changes in CAF concentrations and to evaluate baseline and longitudinal associat...

A theoretical and mass spectrometry study of the fragmentation of mycosporine-like amino acids

Science.gov (United States)

Cardozo, Karina H. M.; Vessecchi, Ricardo; Carvalho, Valdemir M.; Pinto, Ernani; Gates, Paul J.; Colepicolo, Pio; Galembeck, Sérgio E.; Lopes, Norberto P.

2008-06-01

In the present study, the mycosporine-like amino acids (MAAs) were isolated from the marine red alga Gracilaria tenuistipitata and analysed by high-resolution accurate-mass sequential mass spectrometry (MSn). In addition to the proposed fragmentation mechanism based on the MSn analysis, it is clearly demonstrated that the elimination of mass 15 is a radical processes taking place at the methoxyl substituent of the double bond. This characteristic loss of a methyl radical was studied by theoretical calculations and the homolytic cleavage of the OC bond is suggested to be dependent on the bond weakening. The protonation site of the MAAs was indicated by analysis of the Fukui functions and the relative Gibbs energies of the several possible protonated forms.

Crystal Structure of the Carboxy-Terminal Region of the Bacteriophage T4 Proximal Long Tail Fiber Protein Gp34

Directory of Open Access Journals (Sweden)

Meritxell Granell

2017-06-01

Full Text Available Long tail fibers of bacteriophage T4 are formed by proteins gp34, gp35, gp36, and gp37, with gp34 located at the phage-proximal end and gp37 at the phage-distal, receptor-binding end. We have solved the structure of the carboxy-terminal region of gp34, consisting of amino acids 894–1289, by single-wavelength anomalous diffraction and extended the structure to amino acids 744–1289 using data collected from crystals containing longer gp34-fragments. The structure reveals three repeats of a mixed α-β fibrous domain in residues 744 to 877. A triple-helical neck connects to an extended triple β-helix domain (amino acids 900–1127 punctuated by two β-prism domains. Next, a β-prism domain decorated with short helices and extended β-helices is present (residues 1146–1238, while the C-terminal end is capped with another short β-helical region and three β-hairpins. The structure provides insight into the stability of the fibrous gp34 protein.

Partial amino acid sequence of apolipoprotein(a) shows that it is homologous to plasminogen

International Nuclear Information System (INIS)

Eaton, D.L.; Fless, G.M.; Kohr, W.J.; McLean, J.W.; Xu, Q.T.; Miller, C.G.; Lawn, R.M.; Scanu, A.M.

1987-01-01

Apolipoprotein(a) [apo(a)] is a glycoprotein with M/sub r/ ∼ 280,000 that is disulfide linked to apolipoprotein B in lipoprotein(a) particles. Elevated plasma levels of lipoprotein(a) are correlated with atherosclerosis. Partial amino acid sequence of apo(a) shows that it has striking homology to plasminogen. Plasminogen is a plasma serine protease zymogen that consists of five homologous and tandemly repeated domains called kringles and a trypsin-like protease domain. The amino-terminal sequence obtained for apo(a) is homologous to the beginning of kringle 4 but not the amino terminus of plasminogen. Apo(a) was subjected to limited proteolysis by trypsin or V8 protease, and fragments generated were isolated and sequenced. Sequences obtained from several of these fragments are highly (77-100%) homologous to plasminogen residues 391-421, which reside within kringle 4. Analysis of these internal apo(a) sequences revealed that apo(a) may contain at least two kringle 4-like domains. A sequence obtained from another tryptic fragment also shows homology to the end of kringle 4 and the beginning of kringle 5. Sequence data obtained from the two tryptic fragments shows homology with the protease domain of plasminogen. One of these sequences is homologous to the sequences surrounding the activation site of plasminogen. Plasminogen is activated by the cleavage of a specific arginine residue by urokinase and tissue plasminogen activator; however, the corresponding site in apo(a) is a serine that would not be cleaved by tissue plasminogen activator or urokinase. Using a plasmin-specific assay, no proteolytic activity could be demonstrated for lipoprotein(a) particles. These results suggest that apo(a) contains kringle-like domains and an inactive protease domain

Fragger: a protein fragment picker for structural queries.

Science.gov (United States)

Berenger, Francois; Simoncini, David; Voet, Arnout; Shrestha, Rojan; Zhang, Kam Y J

2017-01-01

Protein modeling and design activities often require querying the Protein Data Bank (PDB) with a structural fragment, possibly containing gaps. For some applications, it is preferable to work on a specific subset of the PDB or with unpublished structures. These requirements, along with specific user needs, motivated the creation of a new software to manage and query 3D protein fragments. Fragger is a protein fragment picker that allows protein fragment databases to be created and queried. All fragment lengths are supported and any set of PDB files can be used to create a database. Fragger can efficiently search a fragment database with a query fragment and a distance threshold. Matching fragments are ranked by distance to the query. The query fragment can have structural gaps and the allowed amino acid sequences matching a query can be constrained via a regular expression of one-letter amino acid codes. Fragger also incorporates a tool to compute the backbone RMSD of one versus many fragments in high throughput. Fragger should be useful for protein design, loop grafting and related structural bioinformatics tasks.

Efficient heterologous expression and secretion in Aspergillus oryzae of a llama variable heavy-chain antibody fragment V(HH) against EGFR.

Science.gov (United States)

Okazaki, Fumiyoshi; Aoki, Jun-ichi; Tabuchi, Soichiro; Tanaka, Tsutomu; Ogino, Chiaki; Kondo, Akihiko

2012-10-01

We have constructed a filamentous fungus Aspergillus oryzae that secretes a llama variable heavy-chain antibody fragment (V(HH)) that binds specifically to epidermal growth factor receptor (EGFR) in a culture medium. A major improvement in yield was achieved by fusing the V(HH) with a Taka-amylase A signal sequence (sTAA) and a segment of 28 amino acids from the N-terminal region of Rhizopus oryzae lipase (N28). The yields of secreted, immunologically active anti-EGFR V(HH) reached 73.8 mg/1 in a Sakaguchi flask. The V(HH) fragments were released from the sTAA or N28 proteins by an indigenous A. oryzae protease during cultivation. The purified recombinant V(HH) fragment was specifically recognized and could bind to the EGFR with a high affinity.

Purification, properties, and N-terminal amino acid sequence of homogeneous Escherichia coli 2-amino-3-ketobutyrate CoA ligase, a pyridoxal phosphate-dependent enzyme.

Science.gov (United States)

Mukherjee, J J; Dekker, E E

1987-10-25

Starting with 100 g (wet weight) of a mutant of Escherichia coli K-12 forced to grow on L-threonine as sole carbon source, we developed a 6-step procedure that provides 30-40 mg of homogeneous 2-amino-3-ketobutyrate CoA ligase (also called aminoacetone synthetase or synthase). This ligase, which catalyzes the cleavage/condensation reaction between 2-amino-3-ketobutyrate (the presumed product of the L-threonine dehydrogenase-catalyzed reaction) and glycine + acetyl-CoA, has an apparent molecular weight approximately equal to 85,000 and consists of two identical (or nearly identical) subunits with Mr = 42,000. Computer analysis of amino acid composition data, which gives the best fit nearest integer ratio for each residue, indicates a total of 387 amino acids/subunit with a calculated Mr = 42,093. Stepwise Edman degradation provided the N-terminal sequence of the first 21 amino acids. It is a pyridoxal phosphate-dependent enzyme since (a) several carbonyl reagents caused greater than 90% loss of activity, (b) dialysis against buffer containing hydroxylamine resulted in 89% loss of activity coincident with an 86% decrease in absorptivity at 428 nm, (c) incubation of the apoenzyme with 20 microM pyridoxal phosphate showed a parallel recovery (greater than 90%) of activity and 428-nm absorptivity, and (d) reduction of the holoenzyme with NaBH4 resulted in complete inactivation, disappearance of a new absorption maximum at 333 nm. Strict specificity for glycine is shown but acetyl-CoA (100%), n-propionyl-CoA (127%), or n-butyryl-CoA (16%) is utilized in the condensation reaction. Apparent Km values for acetyl-CoA, n-propionyl-CoA, and glycine are 59 microM, 80 microM, and 12 mM, respectively; the pH optimum = 7.5. Added divalent metal ions or sulfhydryl compounds inhibited catalysis of the condensation reaction.

The value of use of amino-terminal brain naturitic peptide as marker in cases of pleural effusion of different etiologies

Directory of Open Access Journals (Sweden)

Laila A. Banawan

2013-10-01

Conclusion: The results support the feasibility of using the pleural fluid amino terminal proBNP measurement in thoracentesis that would enhance discrimination among the different causes of pleural effusion especially for heart failure patients. Serum and pleural fluid levels of NT-pro BNP were closely correlated and measurement of NT-pro BNP in serum showed equally good diagnostic properties.

Structure of a tropomyosin N-terminal fragment at 0.98 Å resolution

International Nuclear Information System (INIS)

Meshcheryakov, Vladimir A.; Krieger, Inna; Kostyukova, Alla S.; Samatey, Fadel A.

2011-01-01

The crystal structure of the N-terminal fragment of the short nonmuscle α-tropomyosin has been determined at a resolution of 0.98 Å. Tropomyosin (TM) is an elongated two-chain protein that binds along actin filaments. Important binding sites are localized in the N-terminus of tropomyosin. The structure of the N-terminus of the long muscle α-TM has been solved by both NMR and X-ray crystallography. Only the NMR structure of the N-terminus of the short nonmuscle α-TM is available. Here, the crystal structure of the N-terminus of the short nonmuscle α-TM (αTm1bZip) at a resolution of 0.98 Å is reported, which was solved from crystals belonging to space group P3 1 with unit-cell parameters a = b = 33.00, c = 52.03 Å, α = β = 90, γ = 120°. The first five N-terminal residues are flexible and residues 6–35 form an α-helical coiled coil. The overall fold and the secondary structure of the crystal structure of αTM1bZip are highly similar to the NMR structure and the atomic coordinates of the corresponding C α atoms between the two structures superimpose with a root-mean-square deviation of 0.60 Å. The crystal structure validates the NMR structure, with the positions of the side chains being determined precisely in our structure

Structure of a tropomyosin N-terminal fragment at 0.98 Å resolution

Energy Technology Data Exchange (ETDEWEB)

Meshcheryakov, Vladimir A. [Okinawa Institute of Science and Technology, Okinawa (Japan); Krieger, Inna [Texas A& M University, College Station, Texas (United States); Kostyukova, Alla S. [Robert Wood Johnson Medical School, Piscataway, New Jersey (United States); Samatey, Fadel A., E-mail: f.a.samatey@oist.jp [Okinawa Institute of Science and Technology, Okinawa (Japan)

2011-09-01

The crystal structure of the N-terminal fragment of the short nonmuscle α-tropomyosin has been determined at a resolution of 0.98 Å. Tropomyosin (TM) is an elongated two-chain protein that binds along actin filaments. Important binding sites are localized in the N-terminus of tropomyosin. The structure of the N-terminus of the long muscle α-TM has been solved by both NMR and X-ray crystallography. Only the NMR structure of the N-terminus of the short nonmuscle α-TM is available. Here, the crystal structure of the N-terminus of the short nonmuscle α-TM (αTm1bZip) at a resolution of 0.98 Å is reported, which was solved from crystals belonging to space group P3{sub 1} with unit-cell parameters a = b = 33.00, c = 52.03 Å, α = β = 90, γ = 120°. The first five N-terminal residues are flexible and residues 6–35 form an α-helical coiled coil. The overall fold and the secondary structure of the crystal structure of αTM1bZip are highly similar to the NMR structure and the atomic coordinates of the corresponding C{sup α} atoms between the two structures superimpose with a root-mean-square deviation of 0.60 Å. The crystal structure validates the NMR structure, with the positions of the side chains being determined precisely in our structure.

Importance of the terminal α-amino group of bradykinin and some kynins on capillary permeability increase

International Nuclear Information System (INIS)

Sugavara, S.

1979-01-01

A simple and reliable method is described for the quantitative evaluation of vascular permeability increase induced by vasoactive drugs with Evans blue labelled with iodine-125 or 131. By using this method the importance of α-amino group of bradykinin (Bk), kallidin (Kd) and methionyl-kallidin (Met-Kd) on the biological activity were studied after reacting the kinins with pyridoxal 5'-phosphate followed by reduction with sodium borohydride. Phosphopyridoxyl-kinins were formed leaving free the guanidino groups. Aminoacid analysis of phosphopyridoxyl-kinin showed that the efficiency of the reaction was extremely good in the blockage of α-amino groups [phosphopyridoxyl-bradikinin (PP-Bk) = 98,8%, phosphopyridoxyl-kallidin (PP-Kd) = 95,2%, phosphopyridoxyl-methionyl-kallidin (PP-Met-Kd) = 98,0%. Log dose-response curves were obtained for Bk, Kd, Met-Kd, acetyl-bradykinin (Ac-Bk), PP-Bk, PP-Kd and PP-Met-Kd and the relative potencies calculated through the Lineweaver-Burk plots. The relative potencies were: PP-Bk about 16% the activity of Bk, Ac-Bk about 31% the activity of Bk, PP-Kd about 17% the activity of Kd, PP-Met-Kd about 12% the activity of Met-Kd. The results show that the terminal α-amino group of kinins is important in the mechanisms of biological activity. (Author) [pt

Effect of body mass index on diagnostic and prognostic usefulness of amino-terminal pro-brain natriuretic peptide in patients with acute dyspnea

NARCIS (Netherlands)

Bayes-Genis, Antoni; Lloyd-Jones, Donald M.; van Kimmenade, Roland R. J.; Lainchbury, John G.; Richards, A. Mark; Ordoñez-Llanos, Jordi; Santaló, Miquel; Pinto, Yigal M.; Januzzi, James L.

2007-01-01

BACKGROUND: Amino (N)-terminal pro-brain natriuretic peptide (NT-proBNP) testing is useful for diagnostic and prognostic evaluation in patients with dyspnea. An inverse relationship between body mass index (BMI); (calculated as weight in kilograms divided by height in meters squared) and NT-proBNP

Crystallization and preliminary X-ray analysis of a C-terminal fragment of FlgJ, a putative flagellar rod cap protein from Salmonella

International Nuclear Information System (INIS)

Kikuchi, Yuki; Matsunami, Hideyuki; Yamane, Midori; Imada, Katsumi; Namba, Keiichi

2008-01-01

A C-terminal fragment of Salmonella FlgJ, FlgJ 120–316 , which has peptidoglycan-hydrolysing activity, has been overproduced, purified and crystallized and the crystals have been characterized by X-ray diffraction. The formation of the bacterial flagellar axial structure, including the filament, the hook and the rod, requires the attachment of a cap complex to the distal end of the growing structure. Because the rod penetrates the peptidoglycan (PG) layer, the rod cap complex is thought to have PG-hydrolyzing activity. FlgJ is a putative rod cap protein whose C-terminal region shows sequence similarity to known muramidases. In this study, FlgJ 120–316 , a C-terminal fragment of FlgJ which contains the muramidase region, was overproduced, purified and crystallized. Crystals were obtained by the sitting-drop vapour-diffusion technique using PEG 3350 as a crystallizing agent and belonged to the orthorhombic space group P2 1 2 1 2 1 , with unit-cell parameters a = 38.8, b = 43.9, c = 108.5 Å. Anomalous difference Patterson maps calculated from the diffraction data set of a selenomethionine-labelled crystal showed significant peaks in the Harker sections, indicating that the data were suitable for structure determination

Crystallization and preliminary X-ray crystallographic analysis of a 40 kDa N-terminal fragment of the yeast prion-remodeling factor Hsp104

Energy Technology Data Exchange (ETDEWEB)

Lee, Sukyeong; Tsai, Francis T. F., E-mail: ftsai@bcm.tmc.edu [Verna and Marrs McLean Department of Biochemistry and Molecular Biology, Baylor College of Medicine, Houston, TX 77030 (United States)

2007-09-01

An N-terminal fragment of S. cerevisiae Hsp104 has been crystallized. This is the first report of the crystallization of a eukaryotic member of the Hsp100 family of molecular chaperones. A 40 kDa N-terminal fragment of Saccharomyces cerevisiae Hsp104 was crystallized in two different crystal forms. Native 1 diffracted to 2.6 Å resolution and belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 66.6, b = 75.8, c = 235.7 Å. Native 2 diffracted to 2.9 Å resolution and belonged to space group P6{sub 1}22 or P6{sub 5}22, with unit-cell parameters a = 179.1, b = 179.1, c = 69.7 Å. This is the first report of the crystallization of a eukaryotic member of the Hsp100 family of molecular chaperones.

An Algebra for Program Fragments

DEFF Research Database (Denmark)

Kristensen, Bent Bruun; Madsen, Ole Lehrmann; Møller-Pedersen, Birger

1985-01-01

Program fragments are described either by strings in the concrete syntax or by constructor applications in the abstract syntax. By defining conversions between these forms, both may be intermixed. Program fragments are constructed by terminal and nonterminal symbols from the grammar and by variab...

Structure and inhibition analysis of the mouse SAD-B C-terminal fragment.

Science.gov (United States)

Ma, Hui; Wu, Jing-Xiang; Wang, Jue; Wang, Zhi-Xin; Wu, Jia-Wei

2016-10-01

The SAD (synapses of amphids defective) kinases, including SAD-A and SAD-B, play important roles in the regulation of neuronal development, cell cycle, and energy metabolism. Our recent study of mouse SAD-A identified a unique autoinhibitory sequence (AIS), which binds at the junction of the kinase domain (KD) and the ubiquitin-associated (UBA) domain and exerts autoregulation in cooperation with UBA. Here, we report the crystal structure of the mouse SAD-B C-terminal fragment including the AIS and the kinase-associated domain 1 (KA1) at 2.8 Å resolution. The KA1 domain is structurally conserved, while the isolated AIS sequence is highly flexible and solvent-accessible. Our biochemical studies indicated that the SAD-B AIS exerts the same autoinhibitory role as that in SAD-A. We believe that the flexible isolated AIS sequence is readily available for interaction with KD-UBA and thus inhibits SAD-B activity.

Characterization, cell-surface expression and ligand-binding properties of different truncated N-terminal extracellular domains of the ionotropic glutamate receptor subunit GluR1.

Science.gov (United States)

McIlhinney, R A; Molnár, E

1996-04-01

To identify the location of the first transmembrane segment of the GluR1 glutamate receptor subunit artificial stop codons have been introduced into the N-terminal domain at amino acid positions 442, 510, and 563, namely just before and spanning the proposed first two transmembrane regions. The resultant truncated N-terminal fragments of GluR1, termed NT1, NT2, and NT3 respectively were expressed in Cos-7 cells and their cellular distribution and cell-surface expression analysed using an N-terminal antibody to GluR1. All of the fragments were fully glycosylated and were found to be associated with cell membranes but none was secreted. Differential extraction of the cell membranes indicated that both NT1 and NT2 behave as peripheral membrane proteins. In contrast NT3, like the full subunit, has integral membrane protein properties. Furthermore only NT3 is expressed at the cell surface as determined by immunofluorescence and cell-surface biotinylation. Protease protection assays indicated that only NT3 had a cytoplasmic tail. Binding studies using the selective ligand [(3)H]alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionate ([(3)H]AMPA) demonstrated that NT3 does not bind ligand. Together these results indicate that the first transmembrane domain of the GluR1 subunit lies between residues 509 and 562, that the N-terminal domain alone cannot form a functional ligand-binding site and that this domain can be targeted to the cell surface provided that it has a transmembrane-spanning region.

Cross-Reactivity of Polyclonal Antibodies against Canavalia ensiformis (Jack Bean) Urease and Helicobacter pylori Urease Subunit A Fragments.

Science.gov (United States)

Kaminski, Zbigniew Jerzy; Relich, Inga; Konieczna, Iwona; Kaca, Wieslaw; Kolesinska, Beata

2018-01-01

Overlapping decapeptide fragments of H. pylori urease subunit A (UreA) were synthesized and tested with polyclonal antibodies against Canavalia ensiformis (Jack bean) urease. The linear epitopes of UreA identified using the dot blot method were then examined using epitope mapping. For this purpose, series of overlapping fragments of UreA, frameshifted ± four amino acid residues were synthesized. Most of the UreA epitopes which reacted with the Jack bean urease polyclonal antibodies had been recognized in previous studies by monoclonal antibodies against H. pylori urease. Fragments 11 - 24, 21 - 33, and 31 - 42 were able to interact with the Jack bean urease antibodies, giving stable immunological complexes. However, the lack of recognition by these antibodies of all the components in the peptide map strongly suggests that a non-continuous (nonlinear) epitope is located on the N-terminal domain of UreA. © 2018 Wiley-VHCA AG, Zurich, Switzerland.

Analyzing Internal Fragmentation of Electrosprayed Ubiquitin Ions During Beam-Type Collisional Dissociation

Science.gov (United States)

Durbin, Kenneth R.; Skinner, Owen S.; Fellers, Ryan T.; Kelleher, Neil L.

2015-05-01

Gaseous fragmentation of intact proteins is multifaceted and can be unpredictable by current theories in the field. Contributing to the complexity is the multitude of precursor ion states and fragmentation channels. Terminal fragment ions can be re-fragmented, yielding product ions containing neither terminus, termed internal fragment ions. In an effort to better understand and capitalize upon this fragmentation process, we collisionally dissociated the high (13+), middle (10+), and low (7+) charge states of electrosprayed ubiquitin ions. Both terminal and internal fragmentation processes were quantified through step-wise increases of voltage potential in the collision cell. An isotope fitting algorithm matched observed product ions to theoretical terminal and internal fragment ions. At optimal energies for internal fragmentation of the 10+, nearly 200 internal fragments were observed; on average each of the 76 residues in ubiquitin was covered by 24.1 internal fragments. A pertinent finding was that formation of internal ions occurs at similar energy thresholds as terminal b- and y-ion types in beam-type activation. This large amount of internal fragmentation is frequently overlooked during top-down mass spectrometry. As such, we present several new approaches to visualize internal fragments through modified graphical fragment maps. With the presented advances of internal fragment ion accounting and visualization, the total percentage of matched fragment ions increased from approximately 40% to over 75% in a typical beam-type MS/MS spectrum. These sequence coverage improvements offer greater characterization potential for whole proteins with no needed experimental changes and could be of large benefit for future high-throughput intact protein analysis.

Modulation of the functional association between the HIV-1 intasome and the nucleosome by histone amino-terminal tails.

Science.gov (United States)

Benleulmi, Mohamed S; Matysiak, Julien; Robert, Xavier; Miskey, Csaba; Mauro, Eric; Lapaillerie, Delphine; Lesbats, Paul; Chaignepain, Stéphane; Henriquez, Daniel R; Calmels, Christina; Oladosu, Oyindamola; Thierry, Eloïse; Leon, Oscar; Lavigne, Marc; Andreola, Marie-Line; Delelis, Olivier; Ivics, Zoltán; Ruff, Marc; Gouet, Patrice; Parissi, Vincent

2017-11-28

Stable insertion of the retroviral DNA genome into host chromatin requires the functional association between the intasome (integrase·viral DNA complex) and the nucleosome. The data from the literature suggest that direct protein-protein contacts between integrase and histones may be involved in anchoring the intasome to the nucleosome. Since histone tails are candidates for interactions with the incoming intasomes we have investigated whether they could participate in modulating the nucleosomal integration process. We show here that histone tails are required for an optimal association between HIV-1 integrase (IN) and the nucleosome for efficient integration. We also demonstrate direct interactions between IN and the amino-terminal tail of human histone H4 in vitro. Structure/function studies enabled us to identify amino acids in the carboxy-terminal domain of IN that are important for this interaction. Analysis of the nucleosome-binding properties of catalytically active mutated INs confirmed that their ability to engage the nucleosome for integration in vitro was affected. Pseudovirus particles bearing mutations that affect the IN/H4 association also showed impaired replication capacity due to altered integration and re-targeting of their insertion sites toward dynamic regions of the chromatin with lower nucleosome occupancy. Collectively, our data support a functional association between HIV-1 IN and histone tails that promotes anchoring of the intasome to nucleosomes and optimal integration into chromatin.

Characterization of microbial communities found in the human vagina by analysis of terminal restriction fragment length polymorphisms of 16S rRNA genes

NARCIS (Netherlands)

Coolen, MJL; Post, E; Davis, CC; Forney, LJ

2005-01-01

To define and monitor the structure of microbial communities found in the human vagina, a cultivation-independent approach based on analyses of terminal restriction fragment length polymorphisms (T-RFLP) of 16S rRNA genes was developed and validated. Sixteen bacterial strains commonly found in the

Mapping of the antigenic and allergenic epitopes of Lol p VB using gene fragmentation.

Science.gov (United States)

Ong, E K; Knox, R B; Singh, M B

1995-03-01

The recombinant proteins of Lol p VA and Lol p VB expressed in E. coli reacted with IgE antibodies from sera of allergic patients and mAbs FMC A7 and PpV1. Cross-absorption analyses using these recombinant proteins showed that Lol p VA and Lol p VB possess both similar and unique IgE binding determinants. Gene fragmentation was utilized to localize the antigenic and allergenic determinants of Lol p VB. When full-length cDNA of Lol p VB was digested into three fragments and expressed as the fusions from the glutathione transferase of pGEX vectors, fragments Met1-Val196 and Asp197-Val339 bound IgE while fragment Met1-Pro96 did not. The data suggest that there are at least two IgE binding determinants in Lol p VB. In addition, only fragment Met1-Val196 reacted with mAb PpV1. The localization of these determinants was further resolved using random fragment expression libraries. The mAb PpV1 determinant was near the N-terminal region of Lol p VB molecule. The IgE binding determinants were distributed in the central region: region I (amino acids 111-195) and II (199-254). These IgE binding determinants are conserved in Lol p VA.

Amino-terminal extension present in the methionine aminopeptidase type 1c of Mycobacterium tuberculosis is indispensible for its activity

Directory of Open Access Journals (Sweden)

Kumaran Sangaralingam

2011-07-01

Full Text Available Abstract Background Methionine aminopeptidase (MetAP is a ubiquitous enzyme in both prokaryotes and eukaryotes, which catalyzes co-translational removal of N-terminal methionine from elongating polypeptide chains during protein synthesis. It specifically removes the terminal methionine in all organisms, if the penultimate residue is non-bulky and uncharged. The MetAP action for exclusion of N-terminal methionine is mandatory in 50-70% of nascent proteins. Such an activity is required for proper sub cellular localization, additional processing and eventually for the degradation of proteins. Results We cloned genes encoding two such metalloproteases (MtMetAP1a and MtMetAP1c present in Mycobacterium tuberculosis and expressed them as histidine-tagged proteins in Escherichia coli. Although they have different substrate preferences, for Met-Ala-Ser, we found, MtMetAP1c had significantly high enzyme turnover rate as opposed to MtMetAP1a. Circular dichroism spectroscopic studies as well as monitoring of enzyme activity indicated high temperature stability (up to 50°C of MtMetAP1a compared to that of the MtMetAP1c. Modelling of MtMetAP1a based on MtMetAP1c crystal structure revealed the distinct spatial arrangements of identical active site amino acid residues and their mutations affected the enzymatic activities of both the proteins. Strikingly, we observed that 40 amino acid long N-terminal extension of MtMetAP1c, compared to its other family members, contributes towards the activity and stability of this enzyme, which has never been reported for any methionine aminopeptidase. Furthermore, mutational analysis revealed that Val-18 and Pro-19 of MtMetAP1c are crucial for its enzymatic activity. Consistent with this observation, molecular dynamic simulation studies of wild-type and these variants strongly suggest their involvement in maintaining active site conformation of MtMetAP1c. Conclusion Our findings unequivocally emphasized that N-terminal

Functional interactions of the AF-2 activation domain core region of the human androgen receptor with the amino-terminal domain and with the transcriptional coactivator TIF2 (transcriptional intermediary factor2)

NARCIS (Netherlands)

C.A. Berrevoets (Cor); P. Doesburg (Paul); K. Steketee (Karine); J. Trapman (Jan); A.O. Brinkmann (Albert)

1998-01-01

textabstractPrevious studies in yeast and mammalian cells showed a functional interaction between the amino-terminal domain and the carboxy-terminal, ligand-binding domain (LBD) of the human androgen receptor (AR). In the present study, the AR subdomains involved in

Effects of alkali or acid treatment on the isomerization of amino acids.

Science.gov (United States)

Ohmori, Taketo; Mutaguchi, Yuta; Doi, Katsumi; Ohshima, Toshihisa

2012-10-01

The effect of alkali treatment on the isomerization of amino acids was investigated. The 100×D/(D+L) values of amino acids from peptide increased with increase in the number of constituent amino acid residues. Furthermore, the N-terminal amino acid of a dipeptide was isomerized to a greater extent than the C-terminal residue. Copyright © 2012. Published by Elsevier B.V.

Heterogeneous Distributions of Amino Acids Provide Evidence of Multiple Sources Within the Almahata Sitta Parent Body, Asteroid 2008 TC(sub 3)

Science.gov (United States)

Burton, Aaron S.; Glavin, Daniel P.; Callahan, Michael P.; Dworkin, Jason P.; Jenniskens, Peter; Shaddad, Muawia H.

2011-01-01

Two new fragments of the Almahata Sitta meteorite and a sample of sand from the related strewn field in the Nubian Desert, Sudan, were analyzed for two to six carbon aliphatic primary amino acids by ultrahigh performance liquid chromatography with UV-fluorescence detection and time-of-flight mass spectrometry (LC-FT/ToF-MS). The distribution of amino acids in fragment #25, an H5 ordinary chondrite, and fragment #27, a polymict ureilite, were compared with results from the previously analyzed fragment #4, also a polymict ureilite. All three meteorite fragments contain 180-270 parts-per-billion (ppb) of amino acids, roughly 1000-fold lower than the total amino acid abundance of the Murchison carbonaceous chondrite. All of the Almahata Sitta fragments analyzed have amino acid distributions that differ from the Nubian Desert sand, which primarily contains L-alpha-amino acids. In addition, the meteorites contain several amino acids that were not detected in the sand, indicating that many of the amino acids are extraterrestrial in origin. Despite their petrological differences, meteorite fragments #25 and #27 contain similar amino acid compositions; however, the distribution of amino acids in fragment #27 was distinct from those in fragment #4, even though both arc polymict ureilites from the same parent body. Unlike in CM2 and CR2/3 meteorites, there are low relative abundances of alpha-amino acids in the Almahata Sitta meteorite fragments, which suggest that Strecker-type chemistry was not a significant amino acid formation mechanism. Given the high temperatures that asteroid 2008 TC3 appears to have experienced and lack of evidence for aqueous alteration on the asteroid, it is possible that the extraterrestrial amino acids detected in Almahata Sitta were formed by Fischer-Tropsch/Haber-Bosch type gas-grain reactions at elevated temperatures.

Structures of endothiapepsin-fragment complexes from crystallographic fragment screening using a novel, diverse and affordable 96-compound fragment library.

Science.gov (United States)

Huschmann, Franziska U; Linnik, Janina; Sparta, Karine; Ühlein, Monika; Wang, Xiaojie; Metz, Alexander; Schiebel, Johannes; Heine, Andreas; Klebe, Gerhard; Weiss, Manfred S; Mueller, Uwe

2016-05-01

Crystallographic screening of the binding of small organic compounds (termed fragments) to proteins is increasingly important for medicinal chemistry-oriented drug discovery. To enable such experiments in a widespread manner, an affordable 96-compound library has been assembled for fragment screening in both academia and industry. The library is selected from already existing protein-ligand structures and is characterized by a broad ligand diversity, including buffer ingredients, carbohydrates, nucleotides, amino acids, peptide-like fragments and various drug-like organic compounds. When applied to the model protease endothiapepsin in a crystallographic screening experiment, a hit rate of nearly 10% was obtained. In comparison to other fragment libraries and considering that no pre-screening was performed, this hit rate is remarkably high. This demonstrates the general suitability of the selected compounds for an initial fragment-screening campaign. The library composition, experimental considerations and time requirements for a complete crystallographic fragment-screening campaign are discussed as well as the nine fully refined obtained endothiapepsin-fragment structures. While most of the fragments bind close to the catalytic centre of endothiapepsin in poses that have been observed previously, two fragments address new sites on the protein surface. ITC measurements show that the fragments bind to endothiapepsin with millimolar affinity.

Structures of endothiapepsin–fragment complexes from crystallographic fragment screening using a novel, diverse and affordable 96-compound fragment library

Science.gov (United States)

Huschmann, Franziska U.; Linnik, Janina; Sparta, Karine; Ühlein, Monika; Wang, Xiaojie; Metz, Alexander; Schiebel, Johannes; Heine, Andreas; Klebe, Gerhard; Weiss, Manfred S.; Mueller, Uwe

2016-01-01

Crystallographic screening of the binding of small organic compounds (termed fragments) to proteins is increasingly important for medicinal chemistry-oriented drug discovery. To enable such experiments in a widespread manner, an affordable 96-compound library has been assembled for fragment screening in both academia and industry. The library is selected from already existing protein–ligand structures and is characterized by a broad ligand diversity, including buffer ingredients, carbohydrates, nucleotides, amino acids, peptide-like fragments and various drug-like organic compounds. When applied to the model protease endothiapepsin in a crystallographic screening experiment, a hit rate of nearly 10% was obtained. In comparison to other fragment libraries and considering that no pre-screening was performed, this hit rate is remarkably high. This demonstrates the general suitability of the selected compounds for an initial fragment-screening campaign. The library composition, experimental considerations and time requirements for a complete crystallographic fragment-screening campaign are discussed as well as the nine fully refined obtained endothiapepsin–fragment structures. While most of the fragments bind close to the catalytic centre of endothiapepsin in poses that have been observed previously, two fragments address new sites on the protein surface. ITC measurements show that the fragments bind to endothiapepsin with millimolar affinity. PMID:27139825

Amino acid substitutions affecting aspartic acid 605 and valine 606 decrease the interaction strength between the influenza virus RNA polymerase PB2 '627' domain and the viral nucleoprotein.

Science.gov (United States)

Hsia, Ho-Pan; Yang, Yin-Hua; Szeto, Wun-Chung; Nilsson, Benjamin E; Lo, Chun-Yeung; Ng, Andy Ka-Leung; Fodor, Ervin; Shaw, Pang-Chui

2018-01-01

The influenza virus RNA genome is transcribed and replicated in the context of the viral ribonucleoprotein (vRNP) complex by the viral RNA polymerase. The nucleoprotein (NP) is the structural component of the vRNP providing a scaffold for the viral RNA. In the vRNP as well as during transcription and replication the viral polymerase interacts with NP but it is unclear which parts of the polymerase and NP mediate these interactions. Previously the C-terminal '627' domain (amino acids 538-693) of PB2 was shown to interact with NP. Here we report that a fragment encompassing amino acids 146-185 of NP is sufficient to mediate this interaction. Using NMR chemical shift perturbation assays we show that amino acid region 601 to 607 of the PB2 '627' domain interacts with this fragment of NP. Substitutions of these PB2 amino acids resulted in diminished RNP activity and surface plasmon resonance assays showed that amino acids D605 was essential for the interaction with NP and V606 may also play a partial role in the interaction. Collectively these results reveal a possible interaction surface between NP and the PB2 subunit of the RNA polymerase complex.

Heparan sulfate regulates fibrillin-1 N- and C-terminal interactions

DEFF Research Database (Denmark)

Cain, Stuart A; Baldwin, Andrew K; Mahalingam, Yashithra

2008-01-01

Fibrillin-1 N- and C-terminal heparin binding sites have been characterized. An unprocessed monomeric N-terminal fragment (PF1) induced a very high heparin binding response, indicating heparin-mediated multimerization. Using PF1 deletion and short fragments, a heparin binding site was localized w......-terminal interactions with heparin/heparan sulfate directly influence cell behavior, whereas C-terminal interactions with heparin/heparan sulfate regulate elastin deposition. These data highlight how heparin/heparan sulfate controls fibrillin-1 interactions....

Keratin 8 phosphorylation in vitro by cAMP-dependent protein kinase occurs within the amino- and carboxyl-terminal end domains.

Science.gov (United States)

Ando, S; Tokui, T; Yano, T; Inagaki, M

1996-04-05

We reported earlier that phosphorylation in vitro of keratin filaments reconstituted from rat type I keratin 18 and type II keratin 8 by cAPM-dependent protein kinase induces disassembly of the keratin filament structure. Keratin 8 rather than keratin 18 was the major target of the kinase. We have now identified the sites on rat keratin 8 for cAMP-dependent protein kinase. Sequential analysis of the purified phosphoropeptides, together with the known primary sequence, revealed that four major sites, Ser-12, Ser-23, Ser-36, and Ser-50, and three minor sites, Ser-8, Ser-33, Ser-42, are located in the amino-terminal head domain, while three minor sites, Ser-416, Ser-423 and Ser-425 locate in the carboxyl-terminal tail domain.

Towards a fragment-based approach in gelator design: halogen effects leading to thixotropic, mouldable and self-healing systems in aryl-triazolyl amino acid-based gelators!

Science.gov (United States)

Srivastava, Bhartendu K; Manheri, Muraleedharan K

2017-04-18

A simple replacement of a H atom by Br transformed non-gelating aryl triazolyl amino acid benzyl ester into a versatile gelator, which formed shape-persistent, self-healing and mouldable gels. The 'bromo-aryl benzyl ester' fragment was then transplanted into another framework, which resulted in similar solvent preference and gelation efficiency.

Single amino acids in the carboxyl terminal domain of aquaporin-1 contribute to cGMP-dependent ion channel activation

Directory of Open Access Journals (Sweden)

Yool Andrea J

2003-10-01

Full Text Available Abstract Background Aquaporin-1 (AQP1 functions as an osmotic water channel and a gated cation channel. Activation of the AQP1 ion conductance by intracellular cGMP was hypothesized to involve the carboxyl (C- terminus, based on amino acid sequence alignments with cyclic-nucleotide-gated channels and cGMP-selective phosphodiesterases. Results Voltage clamp analyses of human AQP1 channels expressed in Xenopus oocytes demonstrated that the nitric oxide donor, sodium nitroprusside (SNP; 3–14 mM activated the ionic conductance response in a dose-dependent manner. Block of soluble guanylate cyclase prevented the response. Enzyme immunoassays confirmed a linear dose-dependent relationship between SNP and the resulting intracellular cGMP levels (up to 1700 fmol cGMP /oocyte at 14 mM SNP. Results here are the first to show that the efficacy of ion channel activation is decreased by mutations of AQP1 at conserved residues in the C-terminal domain (aspartate D237 and lysine K243. Conclusions These data support the idea that the limited amino acid sequence similarities found between three diverse classes of cGMP-binding proteins are significant to the function of AQP1 as a cGMP-gated ion channel, and provide direct evidence for the involvement of the AQP1 C-terminal domain in cGMP-mediated ion channel activation.

Modelling fragmentations of amino-acids after resonant electron attachment: quantum evidence of possible direct -OH detachment

Energy Technology Data Exchange (ETDEWEB)

Panosetti, C.; Sebastianelli, F.; Gianturco, F.A. [Department of Chemistry and CNISM, University of Rome -La Sapienza-, Roma (Italy); Baccarelli, I. [CASPUR, Supercomputing Consortium for University and Research, Roma (Italy)

2010-10-15

We investigate some aspects of the radiation damage mechanisms in biomolecules, focusing on the modelling of resonant fragmentation caused by the attachment of low-energy electrons (LEEs) initially ejected by biological tissues when exposed to ionizing radiation. Scattering equations are formulated within a symmetry-adapted, single-center expansion of both continuum and bound electrons, and the interaction forces are obtained from a combination of ab initio calculations and a nonempirical model of exchange and correlation effects developed in our group. We present total elastic scattering cross-sections and resonance features obtained for the equilibrium geometries of glycine, alanine, proline and valine. Our results at those geometries of the target molecules are briefly shown to qualitatively explain some of the fragmentation patterns obtained in experiments. We further carry out a one-dimensional (1D) modeling for the dynamics of intramolecular energy transfers mediated by the vibrational activation of selected bonds: our calculations indicate that resonant electron attachment to glycine can trigger direct, dissociative evolution of the complex into (Gly-OH)- and -OH losses, while they also find that the same process does not occur via a direct, 1D dissociative path in the larger amino acids of the present study. (authors)

Crystallization of the two-domain N-terminal fragment of the archaeal ribosomal protein L10(P0) in complex with a specific fragment of 23S rRNA

Science.gov (United States)

Kravchenko, O. V.; Mitroshin, I. V.; Gabdulkhakov, A. G.; Nikonov, S. V.; Garber, M. B.

2011-07-01

Lateral L12-stalk (P1-stalk in Archaea, P1/P2-stalk in eukaryotes) is an obligatory morphological element of large ribosomal subunits in all organisms studied. This stalk is composed of the complex of ribosomal proteins L10(P0) and L12(P1) and interacts with 23S rRNA through the protein L10(P0). L12(P1)-stalk is involved in the formation of GTPase center of the ribosome and plays an important role in the ribosome interaction with translation factors. High mobility of this stalk puts obstacles in determination of its structure within the intact ribosome. Crystals of a two-domain N-terminal fragment of ribosomal protein L10(P0) from the archaeon Methanococcus jannaschii in complex with a specific fragment of rRNA from the same organism have been obtained. The crystals diffract X-rays at 3.2 Å resolution.

Crystallization of the two-domain N-terminal fragment of the archaeal ribosomal protein L10(P0) in complex with a specific fragment of 23S rRNA

Energy Technology Data Exchange (ETDEWEB)

Kravchenko, O. V.; Mitroshin, I. V.; Gabdulkhakov, A. G.; Nikonov, S. V.; Garber, M. B., E-mail: garber@vega.protres.ru [Institute of Protein Research RAS (Russian Federation)

2011-07-15

Lateral L12-stalk (P1-stalk in Archaea, P1/P2-stalk in eukaryotes) is an obligatory morphological element of large ribosomal subunits in all organisms studied. This stalk is composed of the complex of ribosomal proteins L10(P0) and L12(P1) and interacts with 23S rRNA through the protein L10(P0). L12(P1)-stalk is involved in the formation of GTPase center of the ribosome and plays an important role in the ribosome interaction with translation factors. High mobility of this stalk puts obstacles in determination of its structure within the intact ribosome. Crystals of a two-domain N-terminal fragment of ribosomal protein L10(P0) from the archaeon Methanococcus jannaschii in complex with a specific fragment of rRNA from the same organism have been obtained. The crystals diffract X-rays at 3.2 Angstrom-Sign resolution.

cDNA cloning of human DNA topoisomerase I. Catalytic activity of a 67.7-kDa carboxyl-terminal fragment

International Nuclear Information System (INIS)

D'Arpa, P.; Machlin, P.S.; Ratrie, H. III; Rothfield, N.F.; Cleveland, D.W.; Earnshaw, W.C.

1988-01-01

cDNA clones encoding human topoisomerase I were isolated from an expression vector library (λgt11) screened with autoimmune anti-topoisomerase I serum. One of these clones has been expressed as a fusion protein comprised of a 32-kDa fragment of the bacterial TrpE protein linked to 67.7 kDa of protein encoded by the cDNA. Three lines of evidence indicate that the cloned cDNA encodes topoisomerase I. (i) Proteolysis maps of the fusion protein and human nuclear topoisomerase I are essentially identical. (ii) The fusion protein relaxes supercoiled DNA, an activity that can be immunoprecipitated by anti-topoisomerase I serum. (iii) Sequence analysis has revealed that the longest cDNA clone (3645 base pairs) encodes a protein of 765 amino acids that shares 42% identity with Saccharomyces cerevisiae topoisomerase I. The sequence data also show that the catalytically active 67.7-kDa fragment is comprised of the carboxyl terminus

Amino-terminal domain of classic cadherins determines the specificity of the adhesive interactions

DEFF Research Database (Denmark)

Klingelhöfer, Jörg; Troyanovsky, R B; Laur, O Y

2000-01-01

Classic cadherins are transmembrane receptors involved in cell type-specific calcium-dependent intercellular adhesion. The specificity of adhesion is mediated by homophilic interactions between cadherins extending from opposing cell surfaces. In addition, classic cadherins can self-associate form......Classic cadherins are transmembrane receptors involved in cell type-specific calcium-dependent intercellular adhesion. The specificity of adhesion is mediated by homophilic interactions between cadherins extending from opposing cell surfaces. In addition, classic cadherins can self....... To study lateral and adhesive intercadherin interactions, we examined interactions between two classic cadherins, E- and P-cadherins, in epithelial A-431 cells co-producing both proteins. We showed that these cells exhibited heterocomplexes consisting of laterally assembled E- and P....... The specificity of adhesive interaction was localized to the amino-terminal (EC1) domain of both cadherins. Thus, EC1 domain of classic cadherins exposes two determinants responsible for nonspecific lateral and cadherin type-specific adhesive dimerization....

Extraterrestrial Amino Acids in Ureilites Including Almahata Sitta

Science.gov (United States)

Burton, A. S.; Glavin, D. P.; Callahan, M. P.; Dworkin, J. P.

2011-01-01

Ureilites are a class of meteorites that lack chondrules (achondrites) but have relatively high carbon abundances, averaging approx.3 wt %. Using highly sensitive liquid chromatography coupled with UV fluorescence and time-of-flight mass spectrometry (LC-FD/ToF-MS), it was recently determined that there are amino acids in. fragment 94 of the Almahata Sitta ureilite[l]. Based on the presence of amino acids that are rare in the Earth's biosphere, as well as the near-racemic enantiomeric ratios of marry of the more common amino acids, it was concluded that most of the detected amino acids were indigenous to the meteorite. Although the composition of the Almahata Sitta ureilite appears to be unlike other recovered ureilites, the discovery of amino acids in this meteorite raises the question of whether other ureilites rnav also contain amino acids. Herein we present the results of LC-FDlTo.F-MS analyses of: a sand sample from the Almahata Sitta strewn held, Almahata Sitta fragments 425 (an ordinary H5 chondrite) and 427 (ureilite), as well as an Antarctic ureilite (Allan lulls, ALHA 77257).

The Contributions of the Amino and Carboxy Terminal Domains of Flightin to the Biomechanical Properties of Drosophila Flight Muscle Thick Filaments.

Science.gov (United States)

Gasek, Nathan S; Nyland, Lori R; Vigoreaux, Jim O

2016-04-27

Flightin is a myosin binding protein present in Pancrustacea. In Drosophila, flightin is expressed in the indirect flight muscles (IFM), where it is required for the flexural rigidity, structural integrity, and length determination of thick filaments. Comparison of flightin sequences from multiple Drosophila species revealed a tripartite organization indicative of three functional domains subject to different evolutionary constraints. We use atomic force microscopy to investigate the functional roles of the N-terminal domain and the C-terminal domain that show different patterns of sequence conservation. Thick filaments containing a C-terminal domain truncated flightin (fln(ΔC44)) are significantly shorter (2.68 ± 0.06 μm; p thick filaments containing a full length flightin (fln⁺; 3.21 ± 0.05 μm) and thick filaments containing an N-terminal domain truncated flightin (fln(ΔN62); 3.21 ± 0.06 μm). Persistence length was significantly reduced in fln(ΔN62) (418 ± 72 μm; p thick filament bending propensity. Our results indicate that the flightin amino and carboxy terminal domains make distinct contributions to thick filament biomechanics. We propose these distinct roles arise from the interplay between natural selection and sexual selection given IFM's dual role in flight and courtship behaviors.

An amino-terminal segment of hantavirus nucleocapsid protein presented on hepatitis B virus core particles induces a strong and highly cross-reactive antibody response in mice

International Nuclear Information System (INIS)

Geldmacher, Astrid; Skrastina, Dace; Petrovskis, Ivars; Borisova, Galina; Berriman, John A.; Roseman, Alan M.; Crowther, R. Anthony; Fischer, Jan; Musema, Shamil; Gelderblom, Hans R.; Lundkvist, Aake; Renhofa, Regina; Ose, Velta; Krueger, Detlev H.; Pumpens, Paul; Ulrich, Rainer

2004-01-01

Previously, we have demonstrated that hepatitis B virus (HBV) core particles tolerate the insertion of the amino-terminal 120 amino acids (aa) of the Puumala hantavirus nucleocapsid (N) protein. Here, we demonstrate that the insertion of 120 amino-terminal aa of N proteins from highly virulent Dobrava and Hantaan hantaviruses allows the formation of chimeric core particles. These particles expose the inserted foreign protein segments, at least in part, on their surface. Analysis by electron cryomicroscopy of chimeric particles harbouring the Puumala virus (PUUV) N segment revealed 90% T = 3 and 10% T = 4 shells. A map computed from T = 3 shells shows additional density splaying out from the tips of the spikes producing the effect of an extra shell of density at an outer radius compared with wild-type shells. The inserted Puumala virus N protein segment is flexibly linked to the core spikes and only partially icosahedrally ordered. Immunisation of mice of two different haplotypes (BALB/c and C57BL/6) with chimeric core particles induces a high-titered and highly cross-reactive N-specific antibody response in both mice strains

Structural comparisons of two allelic variants of human placental alkaline phosphatase.

Science.gov (United States)

Millán, J L; Stigbrand, T; Jörnvall, H

1985-01-01

A simple immunosorbent purification scheme based on monoclonal antibodies has been devised for human placental alkaline phosphatase. The two most common allelic variants, S and F, have similar amino acid compositions with identical N-terminal amino acid sequences through the first 13 residues. Both variants have identical lectin binding properties towards concanavalin A, lentil-lectin, wheat germ agglutinin, phytohemagglutinin and soybean agglutinin, and identical carbohydrate contents as revealed by methylation analysis. CNBr fragments of the variants demonstrate identical high performance liquid chromatography patterns. The carbohydrate containing fragment is different from the 32P-labeled active site fragment and the N-terminal fragment.

Identification of an N-terminal 27 kDa fragment of Mycoplasma pneumoniae P116 protein as specific immunogen in M. pneumoniae infections

Directory of Open Access Journals (Sweden)

Chourasia Bishwanath

2010-12-01

Full Text Available Abstract Background Mycoplasma pneumoniae is an important cause of respiratory tract infection and is increasingly being associated with other diseases such as asthma and extra-pulmonary complications. Considerable cross-reactivity is known to exist between the whole cell antigens used in the commercial serological testing assays. Identification of specific antigens is important to eliminate the risk of cross-reactions among different related organisms. Adherence of M. pneumoniae to human epithelial cells is mediated through a well defined apical organelle to which a number of proteins such as P1, P30, P116 and HMW1-3 have been localized, and are being investigated for adhesion, gliding and immunodiagnostic purposes. Methods A 609 bp fragment P116(N-27, corresponding to the N-terminal region of M. pneumoniae P116 gene was cloned and expressed. A C-terminal fragment P1(C-40, of P1 protein of M. pneumoniae was also expressed. Three IgM ELISA assays based on P116(N-27, P1(C-40 and (P116 (N-27 + P1(C-40 proteins were optimized and a detailed analysis comparing the reactivity of these proteins with a commercial kit was carried out. Comparative statistical analysis of these assays was performed with the SPSS version 15.0. Results The expressed P116(N-27 protein was well recognized by the patient sera and was immunogenic in rabbit. P1(C-40 of M. pneumoniae was also immunogenic in rabbit. In comparison to the reference kit, which is reported to be 100% sensitive and 75% specific, ELISA assay based on purified P116(N-27, P1(C-40 and (P116(N-27 + P1(C-40 proteins showed 90.3%, 87.1% and 96.8% sensitivity and 87.0%, 87.1% and 90.3% specificity respectively. The p value for all the three assays was found to be Conclusion This study shows that an N-terminal fragment of P116 protein holds a promise for serodiagnosis of M. pneumoniae infection. The IgM ELISA assays based on the recombinant proteins seem to be suitable for the use in serodiagnosis of acute M

On the fragmentation of biomolecules: fragmentation of alanine dipeptide along the polypeptide chain

DEFF Research Database (Denmark)

Solov'yov, Ilia; Yakubovich, Alexander; Solov'yov, Andrey

2006-01-01

The interaction potential between amino acids in alanine dipeptide has been studied for the first time taking into account exact molecular geometry. Ab initio calculation has been performed in the framework of density functional theory taking into account all electrons in the system. The fragment...

Interpreting ecological diversity indices applied to terminal restriction fragment length polymorphism data: insights from simulated microbial communities.

Science.gov (United States)

Blackwood, Christopher B; Hudleston, Deborah; Zak, Donald R; Buyer, Jeffrey S

2007-08-01

Ecological diversity indices are frequently applied to molecular profiling methods, such as terminal restriction fragment length polymorphism (T-RFLP), in order to compare diversity among microbial communities. We performed simulations to determine whether diversity indices calculated from T-RFLP profiles could reflect the true diversity of the underlying communities despite potential analytical artifacts. These include multiple taxa generating the same terminal restriction fragment (TRF) and rare TRFs being excluded by a relative abundance (fluorescence) threshold. True community diversity was simulated using the lognormal species abundance distribution. Simulated T-RFLP profiles were generated by assigning each species a TRF size based on an empirical or modeled TRF size distribution. With a typical threshold (1%), the only consistently useful relationship was between Smith and Wilson evenness applied to T-RFLP data (TRF-E(var)) and true Shannon diversity (H'), with correlations between 0.71 and 0.81. TRF-H' and true H' were well correlated in the simulations using the lowest number of species, but this correlation declined substantially in simulations using greater numbers of species, to the point where TRF-H' cannot be considered a useful statistic. The relationships between TRF diversity indices and true indices were sensitive to the relative abundance threshold, with greatly improved correlations observed using a 0.1% threshold, which was investigated for comparative purposes but is not possible to consistently achieve with current technology. In general, the use of diversity indices on T-RFLP data provides inaccurate estimates of true diversity in microbial communities (with the possible exception of TRF-E(var)). We suggest that, where significant differences in T-RFLP diversity indices were found in previous work, these should be reinterpreted as a reflection of differences in community composition rather than a true difference in community diversity.

C-terminal agrin fragment is inversely related to neuromuscular fatigue in older men.

Science.gov (United States)

Stout, Jeffrey R; Fragala, Maren S; Hoffman, Jay R; Robinson, Edward H; Mccormack, William P; Townsend, Jeremy R; Jatjner, Adam R; Emerson, Nadia S; Oliveira, Leonardo P; Fukuda, David H

2015-01-01

The aim of this study was to examine the relationship between serum C-terminal agrin fragment (CAF) concentrations and neuromuscular fatigue in older adults. Twenty-two healthy older men and women volunteered for this study. Resting fasted blood samples were collected and prepared for measurement of serum CAF concentration by a commercially available ELISA kit. The onset of neuromuscular fatigue was measured by monitoring electromyographic fatigue curves from the vastus lateralis muscle using the physical working capacity at fatigue threshold (PWCFT ) test. A significant inverse correlation for men was observed between CAF and PWCFT (r = -0.602; P = 0.05), but not for women (r = 0.208; P = 0.54). After controlling for age and body mass index, significant correlations (r = -0.69; P = 0.042) remained for men, but not for women (r = 0.12; P = 0.76). These data suggest that serum CAF concentrations were significantly related to the onset of neuromuscular fatigue independent of age and BMI in men only. © 2014 Wiley Periodicals, Inc.

Nucleotide sequence of a cDNA coding for the amino-terminal region of human prepro. alpha. 1(III) collagen

Energy Technology Data Exchange (ETDEWEB)

Toman, P D; Ricca, G A [Rorer Biotechnology, Inc., Springfield, VA (USA); de Crombrugghe, B [National Institutes of Health, Bethesda, MD (USA)

1988-07-25

Type III Collagen is synthesized in a variety of tissues as a precursor macromolecule containing a leader sequence, a N-propeptide, a N-telopeptide, the triple helical region, a C-telopeptide, and C-propeptide. To further characterize the human type III collagen precursor, a human placental cDNA library was constructed in gt11 using an oligonucleotide derived from a partial cDNA sequence corresponding to the carboxy-terminal part of the 1(III) collagen. A cDNA was identified which contains the leader sequence, the N-propeptide and N-telopeptide regions. The DNA sequence of these regions are presented here. The triple helical, C-telopeptide and C-propeptide amino acid sequence for human type III collagen has been determined previously. A comparison of the human amino acid sequence with mouse, chicken, and calf sequence shows 81%, 81%, and 92% similarity, respectively. At the DNA level, the sequence similarity between human and mouse or chicken type III collagen sequences in this area is 82% and 77%, respectively.

Acute regulation of circulating parathyroid hormone (PTH) molecular forms by calcium: utility of PTH fragments/PTH(1-84) ratios derived from three generations of PTH assays.

Science.gov (United States)

D'Amour, Pierre; Räkel, Agnès; Brossard, Jean-Hugues; Rousseau, Louise; Albert, Caroline; Cantor, Tom

2006-01-01

The quantitative evaluation of circulating PTH peaks revealed by PTH assays after HPLC separation constitutes the best way to study the behavior of PTH molecular forms, but it is also impractical. The objective of the study was to investigate the regulation of circulating PTH molecular forms by calcium through the use of PTH fragments/PTH (1-84) ratios derived from PTH assays with different specificities before and after HPLC separation of circulating PTH. CaCl2 and Na citrate were infused in eight volunteers. PTH was measured in serum and HPLC fractions at different calcium concentrations in PTH assays reacting with regions 1-2 (CA), 12-18 (T), and 65-69 (C) of the PTH structure. From hypo- to hypercalcemia, the C/CA ratio had the highest range (1.92 to 9.75; P < 0.001), and the C/T ratio had a higher range (1.69 to 6.11; P < 0.01) than the T/CA ratio (1.15 to 1.86). Human (h) PTH (1-84) represented 32.7 and 4.3% of circulating PTH in hypo- and hypercalcemic HPLC profiles, respectively. These numbers were 5 and 0.9% for amino-terminal (N)-PTH, an amino-terminal form of PTH distinct from hPTH (1-84), 7.3 and 6.8% for non-(1-84) PTH or large C-PTH fragments with a partially preserved N structure, and 54.9 and 88.1% for C-PTH fragments missing a N structure. The HPLC C-PTH fragments to hPTH (1-84) ratio had the most extensive range (1.67 to 20.58). Despite their quantitative differences, all ratios identified identical behavior of PTH fragments relative to PTH (1-84). PTH assay ratios are an adequate tool to investigate the modulation of PTH molecular forms, even if all PTH assays show some undesirable cross-reactivity with certain circulating forms of PTH.

Amino acid derived 1,4-dialkyl substituted imidazolones

DEFF Research Database (Denmark)

Diness, Frederik; Meldal, Morten Peter

2010-01-01

A general method for synthesis of 1,4-substituted imidazolones from amino acids on solid support or in solution has been developed. Amino acid derived 3-Boc-(1,3)-oxazinane (Box) protected amino aldehyde building blocks were coupled through urea bonds to the amino terminal of dipeptides or amino...... acids. Upon acidic release, the aldehyde instantaneously formed the cyclic N-carbamyliminium ion, which rearranged to the corresponding imidazolone. Under strongly acidic conditions the imidazolones acted as nuclophiles in the Pictet-Spengler reaction....

Carbamylation of N-terminal proline.

Science.gov (United States)

Olajuyigbe, Folasade M; Demitri, Nicola; Ajele, Joshua O; Maurizio, Elisa; Randaccio, Lucio; Geremia, Silvano

2010-09-09

Protein carbamylation is of great concern both in vivo and in vitro. Here, we report the first structural characterization of a protein carbamylated at the N-terminal proline. The unexpected carbamylation of the α-amino group of the least reactive codified amino acid has been detected in high-resolution electron density maps of a new crystal form of the HIV-1 protease/saquinavir complex. The carbamyl group is found coplanar to the proline ring with a trans conformation. The reaction of N-terminal with cyanate ion derived from the chaotropic agent urea was confirmed by mass spectra analysis on protease single crystals. Implications of carbamylation process in vitro and in vivo are discussed.

Human dermatosparaxis: a form of Ehlers-Danlos syndrome that results from failure to remove the amino-terminal propeptide of type I procollagen.

OpenAIRE

Smith, L T; Wertelecki, W; Milstone, L M; Petty, E M; Seashore, M R; Braverman, I M; Jenkins, T G; Byers, P H

1992-01-01

Dermatosparaxis is a recessively inherited connective-tissue disorder that results from lack of the activity of type I procollagen N-proteinase, the enzyme that removes the amino-terminal propeptides from type I procollagen. Initially identified in cattle more than 20 years ago, the disorder was subsequently characterized in sheep, cats, and dogs. Affected animals have fragile skin, lax joints, and often die prematurely because of sepsis following avulsion of portions of skin. We recently ide...

Fragger: a protein fragment picker for structural queries [version 2; referees: 2 approved

Directory of Open Access Journals (Sweden)

Francois Berenger

2018-04-01

Full Text Available Protein modeling and design activities often require querying the Protein Data Bank (PDB with a structural fragment, possibly containing gaps. For some applications, it is preferable to work on a specific subset of the PDB or with unpublished structures. These requirements, along with specific user needs, motivated the creation of a new software to manage and query 3D protein fragments. Fragger is a protein fragment picker that allows protein fragment databases to be created and queried. All fragment lengths are supported and any set of PDB files can be used to create a database. Fragger can efficiently search a fragment database with a query fragment and a distance threshold. Matching fragments are ranked by distance to the query. The query fragment can have structural gaps and the allowed amino acid sequences matching a query can be constrained via a regular expression of one-letter amino acid codes. Fragger also incorporates a tool to compute the backbone RMSD of one versus many fragments in high throughput. Fragger should be useful for protein design, loop grafting and related structural bioinformatics tasks.

Antifungal properties of durancins isolated from Enterococcus durans A5-11 and of its synthetic fragments.

Science.gov (United States)

Belguesmia, Y; Choiset, Y; Rabesona, H; Baudy-Floc'h, M; Le Blay, G; Haertlé, T; Chobert, J-M

2013-04-01

The aim of this work was to study the antifungal properties of durancins isolated from Enterococcus durans A5-11 and of their chemically synthesized fragments. Enterococcus durans A5-11 is a lactic acid bacteria strain isolated from traditional Mongolian airag cheese. This strain inhibits the growth of several fungi including Fusarium culmorum, Penicillium roqueforti and Debaryomyces hansenii. It produces two bacteriocins: durancin A5-11a and durancin A5-11b, which have similar antimicrobial properties. The whole durancins A5-11a and A5-11b, as well as their N- and C-terminal fragments were synthesized, and their antifungal properties were studied. C-terminal fragments of both durancins showed stronger antifungal activities than other tested peptides. Treatment of D. hansenii LMSA2.11.003 strain with 2 mmol l(-1) of the synthetic peptides led to the loss of the membrane integrity and to several changes in the ultra-structure of the yeast cells. Chemically synthesized durancins and their synthetic fragments showed different antimicrobial properties from each other. N-terminal peptides show activities against both bacterial and fungal strains tested. C-terminal peptides have specific activities against tested fungal strain and do not show antibacterial activity. However, the C-terminal fragment enhances the activity of the N-terminal fragment in the whole bacteriocins against bacteria. © 2012 The Society for Applied Microbiology.

Differential isotope dansylation labeling combined with liquid chromatography mass spectrometry for quantification of intact and N-terminal truncated proteins

International Nuclear Information System (INIS)

Tang, Yanan; Li, Liang

2013-01-01

Graphical abstract: -- Highlights: •LC–MS was developed for quantifying protein mixtures containing both intact and N-terminal truncated proteins. • 12 C 2 -Dansylation of the N-terminal amino acid of proteins was done first, followed by microwave-assisted acid hydrolysis. •The released 12 C 2 -dansyl labeled N-terminal amino acid was quantified using 13 C 2 -dansyl labeled amino acid standards. •The method provided accurate and precise results for quantifying intact and N-terminal truncated proteins within 8 h. -- Abstract: The N-terminal amino acids of proteins are important structure units for maintaining the biological function, localization, and interaction networks of proteins. Under different biological conditions, one or several N-terminal amino acids could be cleaved from an intact protein due to processes, such as proteolysis, resulting in the change of protein properties. Thus, the ability to quantify the N-terminal truncated forms of proteins is of great importance, particularly in the area of development and production of protein-based drugs where the relative quantity of the intact protein and its truncated form needs to be monitored. In this work, we describe a rapid method for absolute quantification of protein mixtures containing intact and N-terminal truncated proteins. This method is based on dansylation labeling of the N-terminal amino acids of proteins, followed by microwave-assisted acid hydrolysis of the proteins into amino acids. It is shown that dansyl labeled amino acids are stable in acidic conditions and can be quantified by liquid chromatography mass spectrometry (LC–MS) with the use of isotope analog standards

Four phosphoproteins with common amino termini are encoded by human cytomegalovirus AD169

International Nuclear Information System (INIS)

Wright, D.A.; Staprans, S.I.; Spector, D.H.

1988-01-01

In this report, the authors identify the proteins encoded by the 2.2-kilobase class of early transcripts arising from a region of the strain AD169 human cytomegalovirus genome (map units 0.682 to 0.713) which contains cell-related sequences. These transcripts, encoded by adjacent EcoRI fragments R and d, have a complex spliced structure with 5' and 3' coterminal ends. Antiserum directed against a synthetic 11-amino-acid peptide corresponding to the predicted amino terminus of the proteins was generated and found to immunoprecipitate four-infected-cell proteins of 84, 50, 43, and 34 kilodaltons. These proteins were phosphorylated and were associated predominantly with the nuclei of infected cells. The 43-kilodalton protein was the most abundant of the four proteins, and its level of expression remained relatively constant throughout the infection. Expression of the other proteins increased as the infection progressed. Pulse-chase analysis failed to show a precursor-product relationship between any of the proteins. A comparison of the [ 35 S]methionine-labeled tryptic peptide maps of the four proteins from infected cells and an in vitro-generated polypeptide derived from the putative first exon showed that all four infected-cell proteins were of viral origin and contained a common amino-terminal region

DNA fragmentation in spermatozoa

DEFF Research Database (Denmark)

Rex, A S; Aagaard, J.; Fedder, J

2017-01-01

Sperm DNA Fragmentation has been extensively studied for more than a decade. In the 1940s the uniqueness of the spermatozoa protein complex which stabilizes the DNA was discovered. In the fifties and sixties, the association between unstable chromatin structure and subfertility was investigated....... In the seventies, the impact of induced DNA damage was investigated. In the 1980s the concept of sperm DNA fragmentation as related to infertility was introduced as well as the first DNA fragmentation test: the Sperm Chromatin Structure Assay (SCSA). The terminal deoxynucleotidyl transferase nick end labelling...... (TUNEL) test followed by others was introduced in the nineties. The association between DNA fragmentation in spermatozoa and pregnancy loss has been extensively investigated spurring the need for a therapeutic tool for these patients. This gave rise to an increased interest in the aetiology of DNA damage...

Zonula occludens toxin structure-function analysis. Identification of the fragment biologically active on tight junctions and of the zonulin receptor binding domain.

Science.gov (United States)

Di Pierro, M; Lu, R; Uzzau, S; Wang, W; Margaretten, K; Pazzani, C; Maimone, F; Fasano, A

2001-06-01

Zonula occludens toxin (Zot) is an enterotoxin elaborated by Vibrio cholerae that increases intestinal permeability by interacting with a mammalian cell receptor with subsequent activation of intracellular signaling leading to the disassembly of the intercellular tight junctions. Zot localizes in the bacterial outer membrane of V. cholerae with subsequent cleavage and secretion of a carboxyl-terminal fragment in the host intestinal milieu. To identify the Zot domain(s) directly involved in the protein permeating effect, several zot gene deletion mutants were constructed and tested for their biological activity in the Ussing chamber assay and their ability to bind to the target receptor on intestinal epithelial cell cultures. The Zot biologically active domain was localized toward the carboxyl terminus of the protein and coincided with the predicted cleavage product generated by V. cholerae. This domain shared a putative receptor-binding motif with zonulin, the Zot mammalian analogue involved in tight junction modulation. Amino acid comparison between the Zot active fragment and zonulin, combined with site-directed mutagenesis experiments, confirmed the presence of an octapeptide receptor-binding domain toward the amino terminus of the processed Zot.

Characterization of cDNA for human tripeptidyl peptidase II: The N-terminal part of the enzyme is similar to subtilisin

International Nuclear Information System (INIS)

Tomkinson, B.; Jonsson, A-K

1991-01-01

Tripeptidyl peptidase II is a high molecular weight serine exopeptidase, which has been purified from rat liver and human erythrocytes. Four clones, representing 4453 bp, or 90% of the mRNA of the human enzyme, have been isolated from two different cDNA libraries. One clone, designated A2, was obtained after screening a human B-lymphocyte cDNA library with a degenerated oligonucleotide mixture. The B-lymphocyte cDNA library, obtained from human fibroblasts, were rescreened with a 147 bp fragment from the 5' part of the A2 clone, whereby three different overlapping cDNA clones could be isolated. The deduced amino acid sequence, 1196 amino acid residues, corresponding to the longest open rading frame of the assembled nucleotide sequence, was compared to sequences of current databases. This revealed a 56% similarity between the bacterial enzyme subtilisin and the N-terminal part of tripeptidyl peptidase II. The enzyme was found to be represented by two different mRNAs of 4.2 and 5.0 kilobases, respectively, which probably result from the utilziation of two different polyadenylation sites. Futhermore, cDNA corresponding to both the N-terminal and C-terminal part of tripeptidyl peptidase II hybridized with genomic DNA from mouse, horse, calf, and hen, even under fairly high stringency conditions, indicating that tripeptidyl peptidase II is highly conserved

Interfering amino terminal peptides and functional implications for heteromeric gap junction formation

Directory of Open Access Journals (Sweden)

Richard David Veenstra

2013-05-01

Full Text Available Connexin43 (Cx43 is widely expressed in many different tissues of the human body. In cells of some organs, Cx43 is co-expressed with other connexins (Cx, including Cx46 and Cx50 in lens, Cx40 in atrium, Purkinje fibers, and the blood vessel wall, Cx45 in heart, and Cx37 in the ovary. Interactions with the co-expressed connexins may have profound functional implications. The abilities of Cx37, Cx45, Cx46, and Cx50 to function in heteromeric gap junction combinations with Cx43 are well documented. Different studies disagree regarding the ability of Cx43 and Cx40 to produce functional heteromeric gap junctions with each other. We review previous studies regarding the heteromeric interactions of Cx43. The possibility of negative functional interactions between the cytoplasmic pore-forming amino terminal (NT domains of these connexins was assessed using pentameric connexin sequence-specific NT domain (iNT peptides applied to cells expressing homomeric Cx40, Cx37, Cx45, Cx46, and Cx50 gap junctions. A Cx43 iNT peptide corresponding to amino acids 9 to 13 (Ac-KLLDK-NH2 specifically inhibited the electrical coupling of Cx40 gap junctions in a transjunctional (Vj voltage-dependent manner without affecting the function of homologous Cx37, Cx46, Cx50, and Cx45 gap junctions. A Cx40 iNT (Ac-EFLEE-OH peptide counteracted the Vj-dependent block of Cx40 gap junctions, whereas a similarly charged Cx50 iNT (Ac-EEVNE-OH peptide did not, suggesting that these NT domain interactions are not solely based on electrostatics. These data are consistent with functional Cx43 heteromeric gap junction formation with Cx37, Cx45, Cx46, and Cx50 and suggest that Cx40 uniquely experiences functional suppressive interactions with a Cx43 NT domain sequence. These findings present unique functional implications about the heteromeric interactions between Cx43 and Cx40 that may influence cardiac conduction in atrial myocardium and the specialized conduction system.

Towards the molecular characterisation of parasitic nematode assemblages: an evaluation of terminal-restriction fragment length polymorphism (T-RFLP) analysis.

Science.gov (United States)

Lott, M J; Hose, G C; Power, M L

2014-09-01

Identifying factors which regulate temporal and regional structuring within parasite assemblages requires the development of non-invasive techniques which facilitate both the rapid discrimination of individual parasites and the capacity to monitor entire parasite communities across time and space. To this end, we have developed and evaluated a rapid fluorescence-based method, terminal restriction fragment length polymorphism (T-RFLP) analysis, for the characterisation of parasitic nematode assemblages in macropodid marsupials. The accuracy with which T-RFLP was capable of distinguishing between the constituent taxa of a parasite community was assessed by comparing sequence data from two loci (the ITS+ region of nuclear ribosomal DNA and the mitochondrial CO1) across ∼20 species of nematodes (suborder Strongylida). Our results demonstrate that with fluorescent labelling of the forward and reverse terminal restriction fragments (T-RFs) of the ITS+ region, the restriction enzyme Hinf1 was capable of generating species specific T-RFLP profiles. A notable exception was within the genus Cloacina, in which closely related species often shared identical T-RFs. This may be a consequence of the group's comparatively recent evolutionary radiation. While the CO1 displayed higher sequence diversity than the ITS+, the subsequent T-RFLP profiles were taxonomically inconsistent and could not be used to further differentiate species within Cloacina. Additionally, several of the ITS+ derived T-RFLP profiles exhibited unexpected secondary peaks, possibly as a consequence of the restriction enzymes inability to cleave partially single stranded amplicons. These data suggest that the question of T-RFLPs utility in monitoring parasite communities cannot be addressed without considering the ecology and unique evolutionary history of the constituent taxa. Copyright © 2014 Elsevier Inc. All rights reserved.

Differential isotope dansylation labeling combined with liquid chromatography mass spectrometry for quantification of intact and N-terminal truncated proteins

Energy Technology Data Exchange (ETDEWEB)

Tang, Yanan; Li, Liang, E-mail: Liang.Li@ualberta.ca

2013-08-20

Graphical abstract: -- Highlights: •LC–MS was developed for quantifying protein mixtures containing both intact and N-terminal truncated proteins. •{sup 12}C{sub 2}-Dansylation of the N-terminal amino acid of proteins was done first, followed by microwave-assisted acid hydrolysis. •The released {sup 12}C{sub 2}-dansyl labeled N-terminal amino acid was quantified using {sup 13}C{sub 2}-dansyl labeled amino acid standards. •The method provided accurate and precise results for quantifying intact and N-terminal truncated proteins within 8 h. -- Abstract: The N-terminal amino acids of proteins are important structure units for maintaining the biological function, localization, and interaction networks of proteins. Under different biological conditions, one or several N-terminal amino acids could be cleaved from an intact protein due to processes, such as proteolysis, resulting in the change of protein properties. Thus, the ability to quantify the N-terminal truncated forms of proteins is of great importance, particularly in the area of development and production of protein-based drugs where the relative quantity of the intact protein and its truncated form needs to be monitored. In this work, we describe a rapid method for absolute quantification of protein mixtures containing intact and N-terminal truncated proteins. This method is based on dansylation labeling of the N-terminal amino acids of proteins, followed by microwave-assisted acid hydrolysis of the proteins into amino acids. It is shown that dansyl labeled amino acids are stable in acidic conditions and can be quantified by liquid chromatography mass spectrometry (LC–MS) with the use of isotope analog standards.

High-sensitivity stable-isotope probing by a quantitative terminal restriction fragment length polymorphism protocol.

Science.gov (United States)

Andeer, Peter; Strand, Stuart E; Stahl, David A

2012-01-01

Stable-isotope probing (SIP) has proved a valuable cultivation-independent tool for linking specific microbial populations to selected functions in various natural and engineered systems. However, application of SIP to microbial populations with relatively minor buoyant density increases, such as populations that utilize compounds as a nitrogen source, results in reduced resolution of labeled populations. We therefore developed a tandem quantitative PCR (qPCR)-TRFLP (terminal restriction fragment length polymorphism) protocol that improves resolution of detection by quantifying specific taxonomic groups in gradient fractions. This method combines well-controlled amplification with TRFLP analysis to quantify relative taxon abundance in amplicon pools of FAM-labeled PCR products, using the intercalating dye EvaGreen to monitor amplification. Method accuracy was evaluated using mixtures of cloned 16S rRNA genes, DNA extracted from low- and high-G+C bacterial isolates (Escherichia coli, Rhodococcus, Variovorax, and Microbacterium), and DNA from soil microcosms amended with known amounts of genomic DNA from bacterial isolates. Improved resolution of minor shifts in buoyant density relative to TRFLP analysis alone was confirmed using well-controlled SIP analyses.

Peri/nuclear localization of intact insulin-like growth factor binding protein-2 and a distinct carboxyl-terminal IGFBP-2 fragment in vivo

International Nuclear Information System (INIS)

Hoeflich, A.; Reisinger, R.; Schuett, B.S.; Elmlinger, M.W.; Russo, V.C.; Vargas, G.A.; Jehle, P.M.; Lahm, H.; Renner-Mueller, I.; Wolf, E.

2004-01-01

Insulin-like growth factor binding protein-2 (IGFBP-2) as one of the most important IGFBPs has never been assessed in the intracellular compartment in vivo. Since there is evidence for novel intracellular functions of distinct IGFBPs, we investigated the presence of IGFBP-2 inside the cell. In peri/nuclear fractions of various tissues isolated from IGFBP-2 transgenic and non-transgenic mice we were able to show the presence of intact IGFBP-2. In addition, we demonstrate the presence of a highly conserved carboxyl-terminal IGFBP-2 fragment in the peri/nuclear fraction by using different peptide-induced antibodies. In pancreatic sections, confocal microscopy revealed the presence of IGFBP-2 on the nuclear surface but not within the nucleus. Our findings suggest novel functions of intact IGFBP-2 and IGFBP-2 fragments within the cell

A C-terminal fragment of fibulin-7 interacts with endothelial cells and inhibits their tube formation in culture.

Science.gov (United States)

de Vega, Susana; Suzuki, Nobuharu; Nonaka, Risa; Sasaki, Takako; Forcinito, Patricia; Arikawa-Hirasawa, Eri; Yamada, Yoshihiko

2014-03-01

We have previously demonstrated that fibulin-7 (Fbln7) is expressed in teeth by pre-odontoblast and odontoblast cells, localized in the basement membrane and dentin matrices, and is an adhesion molecule for dental mesenchyme cells and odontoblasts. Fbln7 is also expressed in blood vessels by endothelial cells. In this report, we show that a recombinant C-terminal Fbln7 fragment (Fbln7-C) bound to Human Umbilical Vein Endothelial Cells (HUVECs) but did not promote cell spreading and actin stress fiber formation. Fbln7-C binding to HUVECs induced integrin clustering at cell adhesion sites with other focal adhesion molecules, and sustained activation of FAK, p130Cas, and Rac1. In addition, RhoA activation was inhibited, thereby preventing HUVEC spreading. As endothelial cell spreading is an important step for angiogenesis, we examined the effect of Fbln7-C on angiogenesis using in vitro assays for endothelial cell tube formation and vessel sprouting from aortic rings. We found that Fbln7-C inhibited the HUVEC tube formation and the vessel sprouting in aortic ring assays. Our findings suggest potential anti-angiogenic activity of the Fbln7 C-terminal region. Published by Elsevier Inc.

Structural analysis and taste evaluation of γ-glutamyl peptides comprising sulfur-containing amino acids.

Science.gov (United States)

Amino, Yusuke; Wakabayashi, Hidehiko; Akashi, Satoko; Ishiwatari, Yutaka

2018-03-01

The structures, flavor-modifying effects, and CaSR activities of γ-glutamyl peptides comprising sulfur-containing amino acids were investigated. The chemical structures, including the linkage mode of the N-terminal glutamic acid, of γ-L-glutamyl-S-(2-propenyl)-L-cysteine (γ-L-glutamyl-S-allyl-L-cysteine) and its sulfoxide isolated from garlic were established by comparing their NMR spectra with those of authentic peptides prepared using chemical methods. Mass spectrometric analysis also enabled determination of the linkage modes in the glutamyl dipeptides by their characteristic fragmentation. In sensory evaluation, these peptides exhibited flavor-modifying effects (continuity) in umami solutions less pronounced but similar to that of glutathione. Furthermore, the peptides exhibited intrinsic flavor due to the sulfur-containing structure, which may be partially responsible for their flavor-modifying effects. In CaSR assays, γ-L-glutamyl-S-methyl-L-cysteinylglycine was most active, which indicates that the presence of a medium-sized aliphatic substituent at the second amino acid residue in γ-glutamyl peptides enhances CaSR activity.

Adsorption behavior of oxidized galactomannans onto amino terminated surfaces and their interaction with bovine serum albumin

International Nuclear Information System (INIS)

Sierakowski, M.-R; Silva, Maria R.V. da; Freitas, R.A.; Moreira, Jose S.R.; Fujimoto, J.; Petri, D.F.S.; Cordeiro, Paulo R.D.; Andrade, Fabiana D.

2001-01-01

A galactomannan (CF) extracted from Cassia fastuosa seeds was purified and oxidized with (2,2,6,6- tetramethylpiperidine-1-oxyl) to form a uronic acid-containing polysaccharide (CFOX) with a degree of oxidation (DO) of 0.22. The chemical structures of CF and CFOX were characterized. The adsorption behavior of CF and CFOX onto amino-terminated surfaces was studied by means of ellipsometric measurements. The influence of p H and ionic strength on the adsorption was also investigated. At p H 4, there was a maximum in the adsorbed amount caused by strong electrostatic attraction between the substrate and the oxidized galactomannans. There was no ionic strength effect on the adsorption behavior. The immobilization of bovine serum albumin onto CF and CFOX was studied as a function of p H. At the isoelectric point a maximum in the adsorbed amount was found. (author)

Adsorption behavior of oxidized galactomannans onto amino terminated surfaces and their interaction with bovine serum albumin

Energy Technology Data Exchange (ETDEWEB)

Sierakowski, M.-R; Silva, Maria R.V. da [Universidade Federal do Parana, Curitiba, PR (Brazil). Dept. de Quimica. Lab. de Biopolimeros]. E-mail: mrbiopol@quimica.ufpr.br; Freitas, R.A.; Moreira, Jose S.R. [Universidade Federal do Parana, Curitiba, PR (Brazil). Dept. de Bioquimica; Fujimoto, J.; Petri, D.F.S.; Cordeiro, Paulo R.D. [Sao Paulo Univ., SP (Brazil). Inst. de Quimica]. E-mail: dfsp@quim.iq.usp.br; Andrade, Fabiana D

2001-07-01

A galactomannan (CF) extracted from Cassia fastuosa seeds was purified and oxidized with (2,2,6,6- tetramethylpiperidine-1-oxyl) to form a uronic acid-containing polysaccharide (CFOX) with a degree of oxidation (DO) of 0.22. The chemical structures of CF and CFOX were characterized. The adsorption behavior of CF and CFOX onto amino-terminated surfaces was studied by means of ellipsometric measurements. The influence of p H and ionic strength on the adsorption was also investigated. At p H 4, there was a maximum in the adsorbed amount caused by strong electrostatic attraction between the substrate and the oxidized galactomannans. There was no ionic strength effect on the adsorption behavior. The immobilization of bovine serum albumin onto CF and CFOX was studied as a function of p H. At the isoelectric point a maximum in the adsorbed amount was found. (author)

Fragments of e-Cadherin as Biomarkers of Non-erosive Reflux Disease.

Science.gov (United States)

Jovov, Biljana; Reed, Craig C; Shaheen, Nicholas J; Pruitt, Amy; Ferrell, Kathleen; Orlando, Geraldine S; Djukic, Zorka; Orlando, Roy C

2018-03-01

Approximately, 20% of patients with heartburn and normal endoscopic findings do not symptomatically improve on proton pump inhibitor (PPI) therapy making diagnosis and treatment uncertain. A biomarker distinguishing PPI-responsive from PPI-refractory heartburn is desirable. We performed a pilot study assessing whether carboxy(C)-terminal fragments (CTFs) of e-cadherin in esophageal biopsies or amino(N)-terminal fragments (NTFs) of e-cadherin in serum could serve this purpose. Twenty-nine patients with endoscopy-negative heartburn had esophageal biopsies for CTFs on Western blot and blood for serum NTFs on ELISA. All patients received dexlansoprazole 30 mg daily for 4 weeks, and heartburn was assessed by daily diary entry. Post-treatment blood samples were obtained for serum NTFs. A control group without GERD symptoms (n = 6) had biopsies for CTFs and a second control group (n = 20) blood serum for serum NTFs. Twenty-seven of 29 patients (93.1%) with endoscopy-negative heartburn, but 0 of 6 controls, were positive for CTFs. All patients and controls had measureable serum NTFs, but mean NTFs were significantly higher in those with PPI-responsive heartburn compared to those with PPI-refractory heartburn and controls. Following treatment, 24 of 29 (82.8) patients had relief of heartburn, which associated with a decline in mean NTFs compared to controls. NTFs in PPI-refractory patients (n = 5) were similar to controls before and after PPI therapy. When heartburn responds to PPI, elevated serum NTFs decline to normal. These data suggest that cleaved products of e-cadherin may serve as biomarkers of NERD. Further data are needed to assess and confirm this concept.

Parent Body Influences on Amino Acids in the Tagish Lake Meteorite

Science.gov (United States)

Glavin, D. P.; Callahan, M. P.; Dworkin, J. P.; Elsila, J. E.; Herd, C. D. K.

2010-01-01

The Tagish Lake meteorite is a primitive C2 carbonaceous chondrite with a mineralogy, oxygen isotope, and bulk chemical. However, in contrast to many CI and CM carbonaceous chondrites, the Tagish Lake meteorite was reported to have only trace levels of indigenous amino acids, with evidence for terrestrial L-amino acid contamination from the Tagish Lake meltwater. The lack of indigenous amino acids in Tagish Lake suggested that they were either destroyed during parent body alteration processes and/or the Tagish Lake meteorite originated on a chemically distinct parent body from CI and CM meteorites where formation of amino acids was less favorable. We recently measured the amino acid composition of three different lithologies (11h, 5b, and 11i) of pristine Tagish Lake meteorite fragments that represent a range of progressive aqueous alteration in order 11h amino acids found in hot-water extracts of the Tagish Lake fragments were determined by ultra performance liquid chromatography fluorescence detection and time of flight mass spectrometry coupled with OPA/NAC derivatization. Stable carbon isotope analyses of the most abundant amino acids in 11h were measured with gas chromatography coupled with quadrupole mass spectrometry and isotope ratio mass spectrometry.

Self-decomposition components generated from [sup 35]S-labeled amino acids

Energy Technology Data Exchange (ETDEWEB)

Kato, Takahisa; Saito, Kazumi; Kurihara, Norio (Kyoto Univ. (Japan). Radioisotope Research Center)

1994-06-01

We examined the fragment molecules in the gaseous components generated from [sup 35]S-amino acids with high specific radioactivity. The self-decomposition mode of a molecule labeled with a [beta]-emitter was similar to the fragmentation mode of organic compounds impacted by accelerated electrons as in organic mass spectrometry. Degradation products of unlabeled amino acids irradiated by [sup 60]Co [gamma]-ray indicated that the degradation mode induced by external [gamma]-rays irradiation was different from the self-decomposition mode of labeled compounds. (Author).

Lack of a 5.9 kDa peptide C-terminal fragment of fibrinogen α chain precedes fibrosis progression in patients with liver disease.

Directory of Open Access Journals (Sweden)

Santiago Marfà

Full Text Available Early detection of fibrosis progression is of major relevance for the diagnosis and management of patients with liver disease. This study was designed to find non-invasive biomarkers for fibrosis in a clinical context where this process occurs rapidly, HCV-positive patients who underwent liver transplantation (LT. We analyzed 93 LT patients with HCV recurrence, 41 non-LT patients with liver disease showing a fibrosis stage F≥1 and 9 patients without HCV recurrence who received antiviral treatment before LT, as control group. Blood obtained from 16 healthy subjects was also analyzed. Serum samples were fractionated by ion exchange chromatography and their proteomic profile was analyzed by SELDI-TOF-MS. Characterization of the peptide of interest was performed by ion chromatography and electrophoresis, followed by tandem mass spectrometry identification. Marked differences were observed between the serum proteome profile of LT patients with early fibrosis recurrence and non-recurrent LT patients. A robust peak intensity located at 5905 m/z was the distinguishing feature of non-recurrent LT patients. However, the same peak was barely detected in recurrent LT patients. Similar results were found when comparing samples of healthy subjects with those of non-LT fibrotic patients, indicating that our findings were not related to either LT or HCV infection. Using tandem mass-spectrometry, we identified the protein peak as a C-terminal fragment of the fibrinogen α chain. Cell culture experiments demonstrated that TGF-β reduces α-fibrinogen mRNA expression and 5905 m/z peak intensity in HepG2 cells, suggesting that TGF-β activity regulates the circulating levels of this protein fragment. In conclusion, we identified a 5.9 kDa C-terminal fragment of the fibrinogen α chain as an early serum biomarker of fibrogenic processes in patients with liver disease.

Structure of non-(1-84) PTH fragments secreted by parathyroid glands in primary and secondary hyperparathyroidism.

Science.gov (United States)

D'Amour, Pierre; Brossard, Jean-Hugues; Rousseau, Louise; Nguyen-Yamamoto, Loan; Nassif, Edgard; Lazure, Claude; Gauthier, Dany; Lavigne, Jeffrey R; Zahradnik, Richard J

2005-09-01

Non-(1-84) parathyroid hormone (PTH) fragments are large circulating carboxyl-terminal (C) fragments with a partially preserved amino-terminal (N) structure. hPTH (7-84), a synthetic surrogate, has been demonstrated to exert biologic effects in vivo and in vitro which are opposite to those of hPTH (1-34) on the PTH/PTHrP type I receptor through a C-PTH receptor. We wanted to determine the N structure of non-(1-84) PTH fragments. Parathyroid cells isolated from glands obtained at surgery from three patients with primary hyperparathyroidism and three patients with secondary hyperparathyroidism were incubated with 35S-methionine to internally label their secretion products. Incubations were performed for 8 hours at the patient-ionized calcium concentration and in the presence of various protease inhibitors. The supernatant was fractionated by high-performance liquid chromatography (HPLC) and fractions were analyzed with PTH assays having (1 to 4) and (12 to 23) epitopes, respectively. The serum of each patient was similarly analyzed. Peaks of immunoreactivity identified were submitted to sequence analysis to recover the 35S-methionine residues in positions 8 and 18. Three regions of interest were identified with PTH assays. They corresponded to non-(1-84) PTH fragments (further divided in regions 3 and 4), a peak of N-PTH migrating in front of hPTH (1-84) (region 2) and a peak of immunoreactivity corresponding to the elution position of hPTH (1-84) (region 1). The last corresponded to a single sequence starting at position 1. Region 2 gave similar results in all cases (a major signal starting at position 1) but also sometimes minor sequences starting at position 4 or 7. Regions 3 and 4 always identified a major sequence starting at positions 7 and minor sequences starting at positions 8, 10, and 15. Surprisingly, a major signal starting at position 1 was also present in region 3. The HPLC profile obtained from a given patient's parathyroid cells was qualitatively

Cloning and expression of cell wall acid invertase gene fragment ...

African Journals Online (AJOL)

A fragment of invertase gene containing catalytic sites of cysteine was cloned from poinsettia (Euphorbia pulcherrima wild.) by using the polymerase chain reaction (PCR) method. The length of the fragment was 521 bp, encoding 173 amino acids and containing a part of open reading frames, but no intron. It had a high ...

Surface characterization on binary nano/micro-domain composed of alkyl- and amino-terminated self-assembled monolayer

Energy Technology Data Exchange (ETDEWEB)

Lee, S.H. [Faculty of Engineering, Shinshu University, 4-17-1 Wakasato, Nagano 380-8553 (Japan); Ishizaki, T. [Materials Research Institute for Sustainable Development, National Institute of Advanced Industrial Science and Technology, 2266-98 Anagahora, Shimo-Shidami, Moriyama-ku, Nagoya 463-8560 (Japan); Saito, N. [Department of Molecular Design and Engineering, Graduate School of Engineering, Nagoya University, Furo-cho, Chikusa, Nagano 464-8603 (Japan)], E-mail: hiro@eco-t.esi.nagoya-u.ac.jp; Takai, O. [EcoTopia Science Institute, Nagoya University, Furo-cho, Chikusa, Nagoya 464-8603 (Japan)

2008-09-15

The binary alkyl- and amino-terminated self-assembled monolayers (SAMs) composed of nano/micro-sized domains was prepared though a self-assembly technique. In addition, the wetting and electrostatic property of the binary SAMs was investigated by the analysis of the static and dynamic water contact angle and zeta-potentials measurement. The binary SAMs were also characterized by atomic force microscope (AFM), Kelvin probe force microscope (KPFM) and X-ray photoelectron spectroscopy (XPS). The domains on the binary SAMs were observed in topographic and surface potential images. The height of domain and the surface potential between octadecyltrichlorosilanes (OTS)-domain and n-(6-aminohexl)aminopropyl-trimethoxysilane (AHAPS)-SAM were about 1.1 nm and -30 mV. These differences of height and surface potential correspond to the ones between OTS and AHAPS. In XPS N 1s spectra, we confirmed the formation of binary SAMs by an amino peak observed at 399.15 eV. The dynamic and the static water contact angles indicated that the wetting property of the binary SAMs was depended on the OTS domain size. In addition, static water contact angles were measured under the conditions of different pH water and zeta-potential also indicated that the electrostatic property of the binary SAMs depended on OTS domain size. Thus, these results showed that the wetting and electrostatic property on the binary SAMs could be regulated by controlling the domain size.

A 19-kDa C-terminal tryptic fragment of the α chain of Na/K-ATPase is essential for occlusion and transport of cations

International Nuclear Information System (INIS)

Karlish, S.J.D.; Goldshleger, R.; Stein, W.D.

1990-01-01

Tryptic digestion of pig renal Na/K-ATPase in the presence of Rb and absence of Ca ions removes about half of the protein but leaves a stable 19-kDa membrane-embedded fragment derived from the α chain, a largely intact β chain, and essentially normal Rb- and Na-occlusion capacity. Subsequent digestion with trypsin in the presence of Ca or absence of Rb ions leads to rapid loss of the 19-kDa fragment and a parallel loss of Rb occlusion, demonstrating that the fragment is essential for occlusion. The N-terminal sequence of the 19-kDa fragment is Asn-Pro-Lys-Thr-Asp-Lys-Leu-Val-Asn-Glu-Arg-Leu-Ile-Ser-Met-Ala, beginning at residue 830 and extending toward the C terminus. Membranes containing the 19-kDa fragment have the following functional properties. (i) ATP-dependent functions are absent. (ii) The apparent affinity for occluding Rb is unchanged, the affinity for Na is lower than in the control enzyme, and activation is now strongly sigmoidal rather than hyperbolic. (iii) Membranes containing the 19-kDa fragment can be reconstituted into phospholipid vesicles and sustain slow Rb-Rb exchange. Thus the transport pathway is retained. The authors conclude that cation occlusion sites and the transport pathway within transmembrane segments are quite separate from the ATP binding sites, located on the cytoplasmic domain of the α chain. Interactions between cation and ATP sites, the heart of active transport, must be indirect - mediated, presumably, by conformational changes of the protein

A 19-kDa C-terminal tryptic fragment of the. alpha. chain of Na/K-ATPase is essential for occlusion and transport of cations

Energy Technology Data Exchange (ETDEWEB)

Karlish, S.J.D.; Goldshleger, R. (Weizmann Institute of Science, Rehovot (Israel)); Stein, W.D. (Hebrew Univ. Jerusalem (Israel))

1990-06-01

Tryptic digestion of pig renal Na/K-ATPase in the presence of Rb and absence of Ca ions removes about half of the protein but leaves a stable 19-kDa membrane-embedded fragment derived from the {alpha} chain, a largely intact {beta} chain, and essentially normal Rb- and Na-occlusion capacity. Subsequent digestion with trypsin in the presence of Ca or absence of Rb ions leads to rapid loss of the 19-kDa fragment and a parallel loss of Rb occlusion, demonstrating that the fragment is essential for occlusion. The N-terminal sequence of the 19-kDa fragment is Asn-Pro-Lys-Thr-Asp-Lys-Leu-Val-Asn-Glu-Arg-Leu-Ile-Ser-Met-Ala, beginning at residue 830 and extending toward the C terminus. Membranes containing the 19-kDa fragment have the following functional properties. (i) ATP-dependent functions are absent. (ii) The apparent affinity for occluding Rb is unchanged, the affinity for Na is lower than in the control enzyme, and activation is now strongly sigmoidal rather than hyperbolic. (iii) Membranes containing the 19-kDa fragment can be reconstituted into phospholipid vesicles and sustain slow Rb-Rb exchange. Thus the transport pathway is retained. The authors conclude that cation occlusion sites and the transport pathway within transmembrane segments are quite separate from the ATP binding sites, located on the cytoplasmic domain of the {alpha} chain. Interactions between cation and ATP sites, the heart of active transport, must be indirect - mediated, presumably, by conformational changes of the protein.

The dual role of fragments in fragment-assembly methods for de novo protein structure prediction

Science.gov (United States)

Handl, Julia; Knowles, Joshua; Vernon, Robert; Baker, David; Lovell, Simon C.

2013-01-01

In fragment-assembly techniques for protein structure prediction, models of protein structure are assembled from fragments of known protein structures. This process is typically guided by a knowledge-based energy function and uses a heuristic optimization method. The fragments play two important roles in this process: they define the set of structural parameters available, and they also assume the role of the main variation operators that are used by the optimiser. Previous analysis has typically focused on the first of these roles. In particular, the relationship between local amino acid sequence and local protein structure has been studied by a range of authors. The correlation between the two has been shown to vary with the window length considered, and the results of these analyses have informed directly the choice of fragment length in state-of-the-art prediction techniques. Here, we focus on the second role of fragments and aim to determine the effect of fragment length from an optimization perspective. We use theoretical analyses to reveal how the size and structure of the search space changes as a function of insertion length. Furthermore, empirical analyses are used to explore additional ways in which the size of the fragment insertion influences the search both in a simulation model and for the fragment-assembly technique, Rosetta. PMID:22095594

Secretion of intact proteins and peptide fragments by lysosomal pathways of protein degradation

International Nuclear Information System (INIS)

Isenman, L.D.; Dice, J.F.

1989-01-01

We report that degradation of proteins microinjected into human fibroblasts is accompanied by release into the culture medium of peptide fragments and intact proteins as well as single amino acids. For the nine proteins and polypeptides microinjected, acid-precipitable radioactivity, i.e. peptide fragments and/or intact proteins, ranged from 10 to 67% of the total released radioactivity. Peptide fragments and/or intact protein accounted for 60% of the radioactivity released into the medium by cells microinjected with ribonuclease A. Two major radiolabeled peptide fragments were found, and one was of an appropriate size to function as an antigen in antigen-presenting cells. The peptides released from microinjected ribonuclease A were derived from lysosomal pathways of proteolysis based on several lines of evidence. Previous studies have shown that microinjected ribonuclease A is degraded to single amino acids entirely within lysosomes. We show that release of free amino acids and peptide fragments and/or intact protein was equivalently stimulated by serum deprivation and equivalently inhibited by NH4Cl. We also show that lysosomal degradation of endocytosed [3H]ribonuclease A was accompanied by the release of two peptide fragments similar in size and charge to those from microinjected [ 3 H]ribonuclease A. These findings demonstrate that degradation within lysosomes occurs in a manner that spares specific peptides; they also suggest a previously unsuspected pathway by which cells can secrete cytosol-derived polypeptides

A Search for Amino Acids and Nucleobases in the Martian Meteorite Roberts Massif 04262 Using Liquid Chromatography-Mass Spectrometry

Science.gov (United States)

Callahan, Michael P.; Burton, Aaron S.; Elsila, Jamie E.; Baker, Eleni M.; Smith, Karen E.; Glavin, Daniel P.; Dworkin, Jason P.

2013-01-01

The investigation into whether Mars contains signatures of past or present life is of great interest to science and society. Amino acids and nucleobases are compounds that are essential for all known life on Earth and are excellent target molecules in the search for potential Martian biomarkers or prebiotic chemistry. Martian meteorites represent the only samples from Mars that can be studied directly in the laboratory on Earth. Here, we analyzed the amino acid and nucleobase content of the shergottite Roberts Massif (RBT) 04262 using liquid chromatography-mass spectrometry. We did not detect any nucleobases above our detection limit in formic acid extracts; however, we did measure a suite of protein and nonprotein amino acids in hot-water extracts with high relative abundances of beta-alanine and gamma-amino-eta-butyric acid. The presence of only low (to absent) levels of several proteinogenic amino acids and a lack of nucleobases suggest that this meteorite fragment is fairly uncontaminated with respect to these common biological compounds. The distribution of straight-chained amine-terminal eta-omega-amino acids in RBT 04262 resembled those previously measured in thermally altered carbonaceous meteorites. A carbon isotope ratio of -24(0/00) +/- 6(0/00) for beta-alanine in RBT 04262 is in the range of reduced organic carbon previously measured in Martian meteorites (Steele et al. 2012). The presence of eta-omega-amino acids may be due to a high temperature Fischer-Tropschtype synthesis during igneous processing on Mars or impact ejection of the meteorites from Mars, but more experimental data are needed to support these hypotheses.

Repression of HNF1α-mediated transcription by amino-terminal enhancer of split (AES)

Energy Technology Data Exchange (ETDEWEB)

Han, Eun Hee [Section of Structural Biology, Hormel Institute, University of Minnesota, Austin, MN 55912 (United States); Gorman, Amanda A. [Department of Molecular and Cellular Biochemistry, University of Kentucky, Lexington, KY 40536 (United States); Singh, Puja [Section of Structural Biology, Hormel Institute, University of Minnesota, Austin, MN 55912 (United States); Chi, Young-In, E-mail: ychi@hi.umn.edu [Section of Structural Biology, Hormel Institute, University of Minnesota, Austin, MN 55912 (United States)

2015-12-04

HNF1α (Hepatocyte Nuclear Factor 1α) is one of the master regulators in pancreatic beta-cell development and function, and the mutations in Hnf1α are the most common monogenic causes of diabetes mellitus. As a member of the POU transcription factor family, HNF1α exerts its gene regulatory function through various molecular interactions; however, there is a paucity of knowledge in their functional complex formation. In this study, we identified the Groucho protein AES (Amino-terminal Enhancer of Split) as a HNF1α-specific physical binding partner and functional repressor of HNF1α-mediated transcription, which has a direct link to glucose-stimulated insulin secretion in beta-cells that is impaired in the HNF1α mutation-driven diabetes. - Highlights: • We identified AES as a transcriptional repressor for HNF1α in pancreatic beta-cell. • AES's repressive activity was HNF1α-specific and was not observed with HNF1β. • AES interacts with the transactivation domain of HNF1α. • Small molecules can be designed or discovered to disrupt this interaction and improve insulin secretion and glucose homeostasis.

Repression of HNF1α-mediated transcription by amino-terminal enhancer of split (AES)

International Nuclear Information System (INIS)

Han, Eun Hee; Gorman, Amanda A.; Singh, Puja; Chi, Young-In

2015-01-01

HNF1α (Hepatocyte Nuclear Factor 1α) is one of the master regulators in pancreatic beta-cell development and function, and the mutations in Hnf1α are the most common monogenic causes of diabetes mellitus. As a member of the POU transcription factor family, HNF1α exerts its gene regulatory function through various molecular interactions; however, there is a paucity of knowledge in their functional complex formation. In this study, we identified the Groucho protein AES (Amino-terminal Enhancer of Split) as a HNF1α-specific physical binding partner and functional repressor of HNF1α-mediated transcription, which has a direct link to glucose-stimulated insulin secretion in beta-cells that is impaired in the HNF1α mutation-driven diabetes. - Highlights: • We identified AES as a transcriptional repressor for HNF1α in pancreatic beta-cell. • AES's repressive activity was HNF1α-specific and was not observed with HNF1β. • AES interacts with the transactivation domain of HNF1α. • Small molecules can be designed or discovered to disrupt this interaction and improve insulin secretion and glucose homeostasis.

Barley polyamine oxidase: Characterisation and analysis of the cofactor and the N-terminal amino acid sequence

DEFF Research Database (Denmark)

Radova, A.; Sebela, M.; Galuszka, P.

2001-01-01

This paper reports the first purification method developed for the isolation of an homogeneous polyamine oxidase (PAO) from etiolated barley seedlings. The crude enzyme preparation was obtained after initial precipitation of the extract with protamine sulphate and ammonium sulphate. The enzyme...... was further confirmed by measuring the fluorescence spectra, Barley PAO is an acidic protein (pI 5.4) containing 3% of neutral sugars: its molecular mass determined by SDS-PAGE was 56 kDa, whilst gel permeation chromatography revealed the higher value of 76 kDa. The N-terminal amino acid sequence of barley...... PAO shows a high degree of similarity to that of maize PAO and to several other flavoprotein oxidases. The polyamines spermine and spermidine were the only two substrates of the enzyme with K-m values 4 x 10(-5) and 3 x 10(-5) M and pH optima of 5.0 and 6.0, respectively. Barley polyamine oxidase...

Characterization of melanocortin NDP-MSH agonist peptide fragments at the mouse central and peripheral melanocortin receptors.

Science.gov (United States)

Haskell-Luevano, C; Holder, J R; Monck, E K; Bauzo, R M

2001-06-21

The central melanocortin receptors, melanocortin-4 (MC4R) and melanocortin-3 (MC3R), are involved in the regulation of satiety and energy homeostasis. The MC4R in particular has become a pharmaceutical industry drug target due to its direct involvement in the regulation of food intake and its potential therapeutic application for the treatment of obesity-related diseases. The melanocortin receptors are stimulated by the native ligand, alpha-melanocyte stimulating hormone (alpha-MSH). The potent and enzymatically stable analogue NDP-MSH (Ac-Ser-Tyr-Ser-Nle-Glu-His-DPhe-Arg-Trp-Gly-Lys-Pro-Val-NH(2)) is a lead peptide for the identification of melanocortin amino acids important for receptor molecular recognition and stimulation. We have synthesized nine peptide fragments of NDP-MSH, deleting N- and C-terminal amino acids to determine the "minimally active" sequence of NDP-MSH. Additionally, five peptides were synthesized to study stereochemical inversion at the Phe 7 and Trp 9 positions in attempts to increase tetra- and tripeptide potencies. These peptide analogues were pharmacologically characterized at the mouse melanocortin MC1, MC3, MC4, and MC5 receptors. This study has identified the Ac-His-DPhe-Arg-Trp-NH(2) tetrapeptide as possessing 10 nM agonist activity at the brain MC4R. The tripeptide Ac-DPhe-Arg-Trp-NH(2) possessed micromolar agonist activities at the MC1R, MC4R, and MC5R but only slight stimulatory activity was observed at the MC3R (at up to 100 microM concentration). This study has also examined to importance of both N- and C-terminal NDP-MSH amino acids at the different melanocortin receptors, providing information for drug design and identification of putative ligand-receptor interactions.

The amino terminal end determines the stability and assembling capacity of eukaryotic ribosomal stalk proteins P1 and P2.

Science.gov (United States)

Camargo, Hendricka; Nusspaumer, Gretel; Abia, David; Briceño, Verónica; Remacha, Miguel; Ballesta, Juan P G

2011-05-01

The eukaryotic ribosomal proteins P1 and P2 bind to protein P0 through their N-terminal domain to form the essential ribosomal stalk. A mutational analysis points to amino acids at positions 2 and 3 as determinants for the drastic difference of Saccharomyces cerevisiae P1 and P2 half-life, and suggest different degradation mechanisms for each protein type. Moreover, the capacity to form P1/P2 heterodimers is drastically affected by mutations in the P2β four initial amino acids, while these mutations have no effect on P1β. Binding of P2β and, to a lesser extent, P1β to the ribosome is also seriously affected showing the high relevance of the amino acids in the first turn of the NTD α-helix 1 for the stalk assembly. The negative effect of some mutations on ribosome binding can be reversed by the presence of the second P1/P2 couple in the ribosome, indicating a stabilizing structural influence between the two heterodimers. Unexpectedly, some mutations totally abolish heterodimer formation but allow significant ribosome binding and, therefore, a previous P1 and P2 association seems not to be an absolute requirement for stalk assembly. Homology modeling of the protein complexes suggests that the mutated residues can affect the overall protein conformation. © The Author(s) 2011. Published by Oxford University Press.

N-terminal modifications of cellular proteins: The enzymes involved, their substrate specificities and biological effects

Science.gov (United States)

Varland, Sylvia; Osberg, Camilla; Arnesen, Thomas

2015-01-01

The vast majority of eukaryotic proteins are N-terminally modified by one or more processing enzymes. Enzymes acting on the very first amino acid of a polypeptide include different peptidases, transferases, and ligases. Methionine aminopeptidases excise the initiator methionine leaving the nascent polypeptide with a newly exposed amino acid that may be further modified. N-terminal acetyl-, methyl-, myristoyl-, and palmitoyltransferases may attach an acetyl, methyl, myristoyl, or palmitoyl group, respectively, to the α-amino group of the target protein N-terminus. With the action of ubiquitin ligases, one or several ubiquitin molecules are transferred, and hence, constitute the N-terminal modification. Modifications at protein N-termini represent an important contribution to proteomic diversity and complexity, and are essential for protein regulation and cellular signaling. Consequently, dysregulation of the N-terminal modifying enzymes is implicated in human diseases. We here review the different protein N-terminal modifications occurring co- or post-translationally with emphasis on the responsible enzymes and their substrate specificities. PMID:25914051

Partial amino acid sequence of the branched chain amino acid aminotransferase (TmB) of E. coli JA199 pDU11

International Nuclear Information System (INIS)

Feild, M.J.; Armstrong, F.B.

1987-01-01

E. coli JA199 pDU11 harbors a multicopy plasmid containing the ilv GEDAY gene cluster of S. typhimurium. TmB, gene product of ilv E, was purified, crystallized, and subjected to Edman degradation using a gas phase sequencer. The intact protein yielded an amino terminal 31 residue sequence. Both carboxymethylated apoenzyme and [ 3 H]-NaBH-reduced holoenzyme were then subjected to digestion by trypsin. The digests were fractionated using reversed phase HPLC, and the peptides isolated were sequenced. The borohydride-treated holoenzyme was used to isolate the cofactor-binding peptide. The peptide is 27 residues long and a comparison with known sequences of other aminotransferases revealed limited homology. Peptides accounting for 211 of 288 predicted residues have been sequenced, including 9 residues of the carboxyl terminus. Comparison of peptides with the inferred amino acid sequence of the E. coli K-12 enzyme has helped determine the sequence of the amino terminal 59 residues; only two differences between the sequences are noted in this region

Isomer Information from Ion Mobility Separation of High-Mannose Glycan Fragments.

Science.gov (United States)

Harvey, David J; Seabright, Gemma E; Vasiljevic, Snezana; Crispin, Max; Struwe, Weston B

2018-05-01

Extracted arrival time distributions of negative ion CID-derived fragments produced prior to traveling-wave ion mobility separation were evaluated for their ability to provide structural information on N-linked glycans. Fragmentation of high-mannose glycans released from several glycoproteins, including those from viral sources, provided over 50 fragments, many of which gave unique collisional cross-sections and provided additional information used to assign structural isomers. For example, cross-ring fragments arising from cleavage of the reducing terminal GlcNAc residue on Man 8 GlcNAc 2 isomers have unique collision cross-sections enabling isomers to be differentiated in mixtures. Specific fragment collision cross-sections enabled identification of glycans, the antennae of which terminated in the antigenic α-galactose residue, and ions defining the composition of the 6-antenna of several of the glycans were also found to have different cross-sections from isomeric ions produced in the same spectra. Potential mechanisms for the formation of the various ions are discussed and the estimated collisional cross-sections are tabulated. Graphical Abstract ᅟ.

Fragmentation of Protein Kinase N (PKN) in the Hydrocephalic Rat Brain

International Nuclear Information System (INIS)

Okii, Norifumi; Amano, Taku; Seki, Takahiro; Matsubayashi, Hiroaki; Mukai, Hideyuki; Ono, Yoshitaka; Kurisu, Kaoru; Sakai, Norio

2007-01-01

PKN (protein kinase N; also called protein kinase C-related kinase (PRK-1)), is a serine/threonine protein kinase that is ubiquitously expressed in several organs, including the brain. PKN has a molecular mass of 120 kDa and has two domains, a regulatory and a catalytic domain, in its amino-terminals and carboxyl-terminus, respectively. Although the role of PKN has not been fully elucidated, previous studies have revealed that PKN is cleaved to a constitutively active catalytic fragment of 55 kDa in response to apoptotic signals. Hydrocephalus is a pathological condition caused by insufficient cerebrospinal fluid (CSF) circulation and subsequent excess of CSF in the brain. In this study, in order to elucidate the role of PKN in the pathophysiology of hydrocephalus, we examined PKN fragmentation in hydrocephalic model rats. Hydrocephalus was induced in rats by injecting kaolin into the cisterna magna. Kaolin-induced rats (n=60) were divided into three groups according to the observation period after treatment (group 1: 3–6 weeks, group 2: 7–12 weeks, and group 3: 13–18 weeks). Sham-treated control rats, injected with sterile saline (n=20), were similarly divided into three groups. Spatial learning ability was estimated by a modified water maze test. Thereafter, brains were cut into slices and ventricular dilatation was estimated. Fragmentation of PKN was observed by Western blotting in samples collected from the parietal cortex, striatum, septal nucleus, hippocampus, and periaqueductal gray matter. All kaolin-induced rats showed ventricular dilatation. Most of them showed less spatial learning ability than those of sham-treated controls. In most regions, fragmentation of PKN had occurred in a biphasic manner more frequently than that in controls. The appearance of PKN fragmentation in periaqueductal gray matter was correlated with the extent of ventricular dilation and spatial learning disability. These results revealed that PKN fragmentation was observed in

Amino-terminal residues of ΔNp63, mutated in ectodermal dysplasia, are required for its transcriptional activity.

Science.gov (United States)

Lena, Anna Maria; Duca, Sara; Novelli, Flavia; Melino, Sonia; Annicchiarico-Petruzzelli, Margherita; Melino, Gerry; Candi, Eleonora

2015-11-13

p63, a member of the p53 family, is a crucial transcription factor for epithelial development and skin homeostasis. Heterozygous mutations in TP63 gene have been associated with human ectodermal dysplasia disorders. Most of these TP63 mutations are missense mutations causing amino acidic substitutions at p63 DNA binding or SAM domains that reduce or abolish the transcriptional activity of mutants p63. A significant number of mutants, however, resides in part of the p63 protein that apparently do not affect DNA binding and/or transcriptional activity, such as the N-terminal domain. Here, we characterize five p63 mutations at the 5' end of TP63 gene aiming to understand the pathogenesis of the diseases and to uncover the role of ΔNp63α N-terminus residues in determining its transactivation potential. Copyright © 2015 Elsevier Inc. All rights reserved.

C-terminal peptide extension via gas-phase ion/ion reactions

Science.gov (United States)

Peng, Zhou; McLuckey, Scott A.

2015-01-01

The formation of peptide bonds is of great importance from both a biological standpoint and in routine organic synthesis. Recent work from our group demonstrated the synthesis of peptides in the gas-phase via ion/ion reactions with sulfo-NHS reagents, which resulted in conjugation of individual amino acids or small peptides to the N-terminus of an existing ‘anchor’ peptide. Here, we demonstrate a complementary approach resulting in the C-terminal extension of peptides. Individual amino acids or short peptides can be prepared as reagents by incorporating gas phase-labile protecting groups to the reactive C-terminus and then converting the N-terminal amino groups to the active ketenimine reagent. Gas-phase ion/ion reactions between the anionic reagents and doubly protonated “anchor” peptide cations results in extension of the “anchor” peptide with new amide bond formation at the C-terminus. We have demonstrated that ion/ion reactions can be used as a fast, controlled, and efficient means for C-terminal peptide extension in the gas phase. PMID:26640400

Linkage map of the fragments of herpesvirus papio DNA.

Science.gov (United States)

Lee, Y S; Tanaka, A; Lau, R Y; Nonoyama, M; Rabin, H

1981-01-01

Herpesvirus papio (HVP), an Epstein-Barr-like virus, causes lymphoblastoid disease in baboons. The physical map of HVP DNA was constructed for the fragments produced by cleavage of HVP DNA with restriction endonucleases EcoRI, HindIII, SalI, and PvuI, which produced 12, 12, 10, and 4 fragments, respectively. The total molecular size of HVP DNA was calculated as close to 110 megadaltons. The following methods were used for construction of the map; (i) fragments near the ends of HVP DNA were identified by treating viral DNA with lambda exonuclease before restriction enzyme digestion; (ii) fragments containing nucleotide sequences in common with fragments from the second enzyme digest of HVP DNA were examined by Southern blot hybridization; and (iii) the location of some fragments was determined by isolating individual fragments from agarose gels and redigesting the isolated fragments with a second restriction enzyme. Terminal heterogeneity and internal repeats were found to be unique features of HVP DNA molecule. One to five repeats of 0.8 megadaltons were found at both terminal ends. Although the repeats of both ends shared a certain degree of homology, it was not determined whether they were identical repeats. The internal repeat sequence of HVP DNA was found in the EcoRI-C region, which extended from 8.4 to 23 megadaltons from the left end of the molecule. The average number of the repeats was calculated to be seven, and the molecular size was determined to be 1.8 megadaltons. Similar unique features have been reported in EBV DNA (D. Given and E. Kieff, J. Virol. 28:524-542, 1978). Images PMID:6261015

Characterization of a bioactive 15 kDa fragment produced by proteolytic cleavage of chicken growth hormone.

Science.gov (United States)

Arámburo, C; Carranza, M; Reyes, M; Luna, M; Martinez-Coria, H; Berúmen, L; Scanes, C G

2001-07-01

There is evidence for a cleaved form of GH in the chicken pituitary gland. A 25 kDa band of immunoreactive-(ir-)GH, as well as the 22 kDa monomeric form and some oligomeric forms were observed when purified GH or fresh pituitary extract were subjected to SDS-PAGE under nonreducing conditions. Under reducing conditions, the 25 kDa ir-GH was no longer observed, being replaced by a 15 kDa band, consistent with reduction of the disulfide bridges of the cleaved form. The type of protease involved was investigated using exogenous proteases and monomeric cGH. Cleaved forms of chicken GH were generated by thrombin or collagenase. The site of cleavage was found in position Arg133-Gly134 as revealed by sequencing the fragments produced. The NH2-terminal sequence of 40 amino acid residues in the 15 kDa form was identical to that of the rcGH and analysis of the remaining 7 kDa fragment showed an exact identity with positions 134-140 of cGH structure. The thrombin cleaved GH and the 15 kDa form showed reduced activity (0.8% and 0.5% of GH, respectively) in a radioreceptor assay employing a chicken liver membrane preparation. However, this fragment had a clear bioactivity in an angiogenic bioassay and was capable to inhibit the activity of deiodinase type III in the chicken liver.

In situ formation of the amino sugars 1-amino-1-deoxy-fructose and 2-amino-2-deoxy-glucose under Maillard reaction conditions in the absence of ammonia.

Science.gov (United States)

Nashalian, Ossanna; Yaylayan, Varoujan A

2016-04-15

Replacing amino acids with their binary metal complexes during the Maillard reaction can initiate various processes, including the oxidative degradation of their glucose conjugates, generating 1-amino-1-deoxy-fructose and its derivatives. These reactive amino sugars are not easily accessible under Maillard reaction conditions and are only formed in the presence of ammonia. To explore the generality of this observation and to study in particular the ability of fructose to generate glucosamine, the amino acid-metal complexes were heated in aqueous solutions with three aldohexoses and two ketohexoses at 110°C for 2 h and the dry residues were analysed by ESI/qTOF/MS/MS. All the sugars generated relatively intense ions at [M+H](+) 180 (C6H14NO5); those ions originating from ketohexoses exhibited MS/MS fragmentations identical to glucosamine and those originating form aldohexoses showed ions identical to fructosamine. Furthermore, the amino sugars were found to form fructosazine, react with other sugars and undergo dehydration reactions. Copyright © 2015 Elsevier Ltd. All rights reserved.

Transfer of the amino-terminal nuclear envelope targeting domain of human MX2 converts MX1 into an HIV-1 resistance factor.

Science.gov (United States)

Goujon, Caroline; Moncorgé, Olivier; Bauby, Hélène; Doyle, Tomas; Barclay, Wendy S; Malim, Michael H

2014-08-01

The myxovirus resistance 2 (MX2) protein of humans has been identified recently as an interferon (IFN)-inducible inhibitor of human immunodeficiency virus type 1 (HIV-1) that acts at a late postentry step of infection to prevent the nuclear accumulation of viral cDNA (C. Goujon et al., Nature 502:559-562, 2013, http://dx.doi.org/10.1038/nature12542; M. Kane et al., Nature 502:563-566, 2013, http://dx.doi.org/10.1038/nature12653; Z. Liu et al., Cell Host Microbe 14:398-410, 2013, http://dx.doi.org/10.1016/j.chom.2013.08.015). In contrast, the closely related human MX1 protein, which suppresses infection by a range of RNA and DNA viruses (such as influenza A virus [FluAV]), is ineffective against HIV-1. Using a panel of engineered chimeric MX1/2 proteins, we demonstrate that the amino-terminal 91-amino-acid domain of MX2 confers full anti-HIV-1 function when transferred to the amino terminus of MX1, and that this fusion protein retains full anti-FluAV activity. Confocal microscopy experiments further show that this MX1/2 fusion, similar to MX2 but not MX1, can localize to the nuclear envelope (NE), linking HIV-1 inhibition with MX accumulation at the NE. MX proteins are dynamin-like GTPases, and while MX1 antiviral function requires GTPase activity, neither MX2 nor MX1/2 chimeras require this attribute to inhibit HIV-1. This key discrepancy between the characteristics of MX1- and MX2-mediated viral resistance, together with previous observations showing that the L4 loop of the stalk domain of MX1 is a critical determinant of viral substrate specificity, presumably reflect fundamental differences in the mechanisms of antiviral suppression. Accordingly, we propose that further comparative studies of MX proteins will help illuminate the molecular basis and subcellular localization requirements for implementing the noted diversity of virus inhibition by MX proteins. Interferon (IFN) elicits an antiviral state in cells through the induction of hundreds of IFN

Conserved Patterns of Microbial Immune Escape: Pathogenic Microbes of Diverse Origin Target the Human Terminal Complement Inhibitor Vitronectin via a Single Common Motif.

Directory of Open Access Journals (Sweden)

Teresia Hallström

Full Text Available Pathogenicity of many microbes relies on their capacity to resist innate immunity, and to survive and persist in an immunocompetent human host microbes have developed highly efficient and sophisticated complement evasion strategies. Here we show that different human pathogens including Gram-negative and Gram-positive bacteria, as well as the fungal pathogen Candida albicans, acquire the human terminal complement regulator vitronectin to their surface. By using truncated vitronectin fragments we found that all analyzed microbial pathogens (n = 13 bound human vitronectin via the same C-terminal heparin-binding domain (amino acids 352-374. This specific interaction leaves the terminal complement complex (TCC regulatory region of vitronectin accessible, allowing inhibition of C5b-7 membrane insertion and C9 polymerization. Vitronectin complexed with the various microbes and corresponding proteins was thus functionally active and inhibited complement-mediated C5b-9 deposition. Taken together, diverse microbial pathogens expressing different structurally unrelated vitronectin-binding molecules interact with host vitronectin via the same conserved region to allow versatile control of the host innate immune response.

Identification of cross-linked amino acids in the protein pair HmaL23-HmaL29 from the 50S ribosomal subunit of the archaebacterium Haloarcula marismortui.

Science.gov (United States)

Bergmann, U; Wittmann-Liebold, B

1993-03-23

50S ribosomal subunits from the extreme halophilic archaebacterium Haloarcula marismortui were treated with the homobifunctional protein-protein cross-linking reagents diepoxybutane (4 A) and dithiobis(succinimidyl propionate) (12 A). The dominant product with both cross-linking reagents was identified on the protein level as HmaL23-HmaL29, which is homologous to the protein pair L23-L29 from Escherichia coli [Walleczek, J., Martin, T., Redl, B., Stöffler-Meilicke, M., & Stöffler, G. (1989) Biochemistry 28, 4099-4105] and from Bacillus stearothermophilus [Brockmöller, J., & Kamp, R. M. (1986) Biol. Chem. Hoppe-Seyler 367, 925-935]. To reveal the exact cross-linking site in HmaL23-HmaL29, the cross-linked complex was purified on a preparative scale by conventional and high-performance liquid chromatography. After endoproteolytic fragmentation of the protein pair, the amino acids engaged in cross-link formation were unambiguously identified by N-terminal sequence analysis and mass spectrometry of the cross-linked peptides. The cross-link is formed between lysine-57 in the C-terminal region of HmaL29 and the alpha-amino group of the N-terminal serine in protein HmaL23, irrespective of the cross-linking reagent. This result demonstrates that the N-terminal region of protein HmaL23 and the C-terminal domain of HmaL29 are highly flexible so that the distance between the two polypeptide chains can vary by at least 8 A. Comparison of our cross-linking results with those obtained with B. stearothermophilus revealed that the fine structure within this ribosomal domain is at least partially conserved.

PCI-GC-MS-MS approach for identification of non-amino organic acid and amino acid profiles.

Science.gov (United States)

Luan, Hemi; Yang, Lin; Ji, Fenfen; Cai, Zongwei

2017-03-15

Alkyl chloroformate have been wildly used for the fast derivatization of metabolites with amino and/or carboxyl groups, coupling of powerful separation and detection systems, such as GC-MS, which allows the comprehensive analysis of non-amino organic acids and amino acids. The reagents involving n-alkyl chloroformate and n-alcohol are generally employed for providing symmetric labeling terminal alkyl chain with the same length. Here, we developed an asymmetric labeling strategy and positive chemical ionization gas chromatography-tandem mass spectrometry (PCI-GC-MS-MS) approach for determination of non-amino organic acids and amino acids, as well as the short chain fatty acids. Carboxylic and amino groups could be selectively labelled by propyl and ethyl groups, respectively. The specific neutral loss of C 3 H 8 O (60Da), C 3 H 5 O 2 (74Da) and C 4 H 8 O 2 (88Da) were useful in the selective identification for qualitative analysis of organic acids and amino acid derivatives. PCI-GC-MS-MS using multiple reaction monitoring (MRM) was applied for semi-quantification of typical non-amino organic acids and amino acids. This method exhibited a wide range of linear range, good regression coefficient (R 2 ) and repeatability. The relative standard deviation (RSD) of targeted metabolites showed excellent intra- and inter-day precision (chloroformate derivatization. Copyright © 2016 Elsevier B.V. All rights reserved.

Yeast two-hybrid screening of proteins interacting with plasmin receptor subunit: C-terminal fragment of annexin A2.

Science.gov (United States)

Li, Qun; Laumonnier, Yves; Syrovets, Tatiana; Simmet, Thomas

2011-11-01

To identify proteins that interact with the C-terminal fragment of annexin A2 (A2IC), generated by plasmin cleavage of the plasmin receptor, a heterotetramer (AA2t) containing annexin A2. The gene that encodes the A2IC fragment was obtained from PCR-amplified cDNA isolated from human monocytes, and was ligated into the pBTM116 vector using a DNA ligation kit. The resultant plasmid (pBTM116-A2IC) was sequenced with an ABI PRISM 310 Genetic Analyzer. The expression of an A2IC bait protein fused with a LexA-DNA binding domain (BD) was determined using Western blot analysis. The identification of proteins that interact with A2IC and are encoded in a human monocyte cDNA library was performed using yeast two-hybrid screening. The DNA sequences of the relevant cDNAs were determined using an ABI PRISM BigDye terminator cycle sequencing ready reaction kit. Nucleotide sequence databases were searched for homologous sequences using BLAST search analysis (http://www.ncbi.nlm.nih.gov). Confirmation of the interaction between the protein LexA-A2IC and each of cathepsin S and SNX17 was conducted using a small-scale yeast transformation and X-gal assay. The yeast transformed with plasmids encoding the bait proteins were screened with a human monocyte cDNA library by reconstituting full-length transcription factors containing the GAL4-active domain (GAL4-AD) as the prey in a yeast two-hybrid approach. After screening 1×10(7) clones, 23 independent β-Gal-positive clones were identified. Sequence analysis and a database search revealed that 15 of these positive clones matched eight different proteins (SNX17, ProCathepsin S, RPS2, ZBTB4, OGDH, CCDC32, PAPD4, and actin which was already known to interact with annexin A2). A2IC A2IC interacts with various proteins to form protein complexes, which may contribute to the molecular mechanism of monocyte activation induced by plasmin. The yeast two-hybrid system is an efficient approach for investigating protein interactions.

C-terminal substitution of MDM2 interacting peptides modulates binding affinity by distinctive mechanisms.

Directory of Open Access Journals (Sweden)

Christopher J Brown

Full Text Available The complex between the proteins MDM2 and p53 is a promising drug target for cancer therapy. The residues 19-26 of p53 have been biochemically and structurally demonstrated to be a most critical region to maintain the association of MDM2 and p53. Variation of the amino acid sequence in this range obviously alters the binding affinity. Surprisingly, suitable substitutions contiguous to this region of the p53 peptides can yield tightly binding peptides. The peptide variants may differ by a single residue that vary little in their structural conformations and yet are characterized by large differences in their binding affinities. In this study a systematic analysis into the role of single C-terminal mutations of a 12 residue fragment of the p53 transactivation domain (TD and an equivalent phage optimized peptide (12/1 were undertaken to elucidate their mechanistic and thermodynamic differences in interacting with the N-terminal of MDM2. The experimental results together with atomistically detailed dynamics simulations provide insight into the principles that govern peptide design protocols with regard to protein-protein interactions and peptidomimetic design.

Sequence of the amino-terminal region of rat liver ribosomal proteins S4, S6, S8, L6, L7a, L18, L27, L30, L37, L37a, and L39.

Science.gov (United States)

Wittmann-Liebold, B; Geissler, A W; Lin, A; Wool, I G

1979-01-01

The sequence of the amino-terminal region of eleven rat liver ribosomal proteins--S4, S6, S8, L6, L7a, L18, L27, L30, L37a, and L39--was determined. The analysis confirmed the homogeneity of the proteins and suggests that they are unique, since no extensive common sequences were found. The N-terminal regions of the rat liver proteins were compared with amino acid sequences in Saccharomyces cerevisiae and in Escherichia coli ribosomal proteins. It seems likely that the proteins L37 from rat liver and Y55 from yeast ribosomes are homologous. It is possible that rat liver L7a or L37a or both are related to S cerevisiae Y44, although the similar sequences are at the amino-terminus of the rat liver proteins and in an internal region of Y44. A number of similarities in the sequences of rat liver and E coli ribosomal proteins have been found; however, it is not yet possible to say whether they connote a common ancestry.

Side-chain amino-acid-based pH-responsive self-assembled block copolymers for drug delivery and gene transfer.

Science.gov (United States)

Kumar, Sonu; Acharya, Rituparna; Chatterji, Urmi; De, Priyadarsi

2013-12-10

Developing safe and effective nanocarriers for multitype of delivery system is advantageous for several kinds of successful biomedicinal therapy with the same carrier. In the present study, we have designed amino acid biomolecules derived hybrid block copolymers which can act as a promising vehicle for both drug delivery and gene transfer. Two representative natural chiral amino acid-containing (l-phenylalanine and l-alanine) vinyl monomers were polymerized via reversible addition-fragmentation chain transfer (RAFT) process in the presence of monomethoxy poly(ethylene glycol) based macro-chain transfer agents (mPEGn-CTA) for the synthesis of well-defined side-chain amino-acid-based amphiphilic block copolymers, monomethoxy poly(ethylene glycol)-b-poly(Boc-amino acid methacryloyloxyethyl ester) (mPEGn-b-P(Boc-AA-EMA)). The self-assembled micellar aggregation of these amphiphilic block copolymers were studied by fluorescence spectroscopy, atomic force microscopy (AFM) and scanning electron microscopy (SEM). Potential applications of these hybrid polymers as drug carrier have been demonstrated in vitro by encapsulation of nile red dye or doxorubicin drug into the core of the micellar nanoaggregates. Deprotection of side-chain Boc- groups in the amphiphilic block copolymers subsequently transformed them into double hydrophilic pH-responsive cationic block copolymers having primary amino groups in the side-chain terminal. The DNA binding ability of these cationic block copolymers were further investigated by using agarose gel retardation assay and AFM. The in vitro cytotoxicity assay demonstrated their biocompatible nature and these polymers can serve as "smart" materials for promising bioapplications.

Specific labeling of the thyroxine binding site in thyroxine-binding globulin: determination of the amino acid composition of a labeled peptide fragment isolated from a proteolytic digest of the derivatized protein.

Science.gov (United States)

Tabachnick, M; Perret, V

1987-08-01

[125I] Thyroxine has been covalently bound to the thyroxine binding site in thyroxine-binding globulin by reaction with the bifunctional reagent, 1,5-difluoro-2,4-dinitrobenzene. An average of 0.47 mol of [125I] thyroxine was incorporated per mol protein; nonspecific binding amounted to 8%. A labeled peptide fragment was isolated from a proteolytic digest of the derivatized protein by HPLC and its amino acid composition was determined. Comparison with the amino acid sequence of thyroxine-binding globulin indicated partial correspondence of the labeled peptide with two possible regions in the protein. These regions also coincide with part of the barrel structure present in the closely homologous protein, alpha 1-antitrypsin.

Common Amino Acid Subsequences in a Universal Proteome—Relevance for Food Science

Directory of Open Access Journals (Sweden)

Piotr Minkiewicz

2015-09-01

Full Text Available A common subsequence is a fragment of the amino acid chain that occurs in more than one protein. Common subsequences may be an object of interest for food scientists as biologically active peptides, epitopes, and/or protein markers that are used in comparative proteomics. An individual bioactive fragment, in particular the shortest fragment containing two or three amino acid residues, may occur in many protein sequences. An individual linear epitope may also be present in multiple sequences of precursor proteins. Although recent recommendations for prediction of allergenicity and cross-reactivity include not only sequence identity, but also similarities in secondary and tertiary structures surrounding the common fragment, local sequence identity may be used to screen protein sequence databases for potential allergens in silico. The main weakness of the screening process is that it overlooks allergens and cross-reactivity cases without identical fragments corresponding to linear epitopes. A single peptide may also serve as a marker of a group of allergens that belong to the same family and, possibly, reveal cross-reactivity. This review article discusses the benefits for food scientists that follow from the common subsequences concept.

Role of N-terminal 28-amino-acid region of Rhizopus oryzae lipase in directing proteins to secretory pathway of Aspergillus oryzae.

Science.gov (United States)

Hama, Shinji; Tamalampudi, Sriappareddy; Shindo, Naoki; Numata, Takao; Yamaji, Hideki; Fukuda, Hideki; Kondo, Akihiko

2008-07-01

To develop a new approach for improving heterologous protein production in Aspergillus oryzae, we focused on the functional role of the N-terminal region of Rhizopus oryzae lipase (ROL). Several N-terminal deletion variants of ROL were expressed in A. oryzae. Interestingly, a segment of 28 amino acids from the C-terminal region of the propeptide (N28) was found to be critical for secretion of ROL into the culture medium. To further investigate the role of N28, the ROL secretory process was visualized in vivo using ROL-green fluorescent protein (GFP) fusion proteins. In cells producing ROL with N28, fluorescence observations showed that the fusion proteins are transported through endoplasmic reticulum (ER), Golgi, and cell wall, which is one of the typical secretory processes in a eukaryotic cell. Because the expression of the mature ROL-GFP fusion protein induced fluorescence accumulation without its translocation into the ER, N28 is considered to play a crucial role in protein transport. When N28 was inserted between the secretion signal and GFP, fluorescence observations showed that GFP, which is originally a cytoplasmic protein, was efficiently translocated into the ER of A. oryzae, resulting in an enhanced secretion of mature GFP after proteolytic cleavage of N28. These findings suggest that N28 facilitates protein translocation into ER and can be a promising candidate for improving heterologous protein production in A. oryzae.

Sortilin Fragments Deposit at Senile Plaques in Human Cerebrum

Directory of Open Access Journals (Sweden)

Xia Hu

2017-06-01

Full Text Available Genetic variations in the vacuolar protein sorting 10 protein (Vps10p family have been linked to Alzheimer’s disease (AD. Here we demonstrate deposition of fragments from the Vps10p member sortilin at senile plaques (SPs in aged and AD human cerebrum. Sortilin changes were characterized in postmortem brains with antibodies against the extracellular and intracellular C-terminal domains. The two antibodies exhibited identical labeling in normal human cerebrum, occurring in the somata and dendrites of cortical and hippocampal neurons. The C-terminal antibody also marked extracellular lesions in some aged and all AD cases, appearing as isolated fibrils, mini-plaques, dense-packing or circular mature-looking plaques. Sortilin and β-amyloid (Aβ deposition were correlated overtly in a region/lamina- and case-dependent manner as analyzed in the temporal lobe structures, with co-localized immunofluorescence seen at individual SPs. However, sortilin deposition rarely occurred around the pia, at vascular wall or in areas with typical diffuse Aβ deposition, with the labeling not enhanced by section pretreatment with heating or formic acid. Levels of a major sortilin fragment ~15 kDa, predicted to derive from the C-terminal region, were dramatically elevated in AD relative to control cortical lysates. Thus, sortilin fragments are a prominent constituent of the extracellularly deposited protein products at SPs in human cerebrum.

A novel synthesis of chromone based unnatural -amino acid ...

Indian Academy of Sciences (India)

VENU KANDULA

years, both pharmaceutical companies and academics became ... the other hand, peptidomimetics offer the advantages of nearly ... inal work on synthesis of unnatural amino acids has ... tures24,25 due to the importance of this fragment in.

Quantitative structure-activity relationship study of antioxidative peptide by using different sets of amino acids descriptors

Science.gov (United States)

Li, Yao-Wang; Li, Bo; He, Jiguo; Qian, Ping

2011-07-01

A database consisting of 214 tripeptides which contain either His or Tyr residue was applied to study quantitative structure-activity relationships (QSAR) of antioxidative tripeptides. Partial Least-Squares Regression analysis (PLSR) was conducted using parameters individually of each amino acid descriptor, including Divided Physico-chemical Property Scores (DPPS), Hydrophobic, Electronic, Steric, and Hydrogen (HESH), Vectors of Hydrophobic, Steric, and Electronic properties (VHSE), Molecular Surface-Weighted Holistic Invariant Molecular (MS-WHIM), isotropic surface area-electronic charge index (ISA-ECI) and Z-scale, to describe antioxidative tripeptides as X-variables and antioxidant activities measured with ferric thiocyanate methods were as Y-variable. After elimination of outliers by Hotelling's T 2 method and residual analysis, six significant models were obtained describing the entire data set. According to cumulative squared multiple correlation coefficients ( R2), cumulative cross-validation coefficients ( Q2) and relative standard deviation for calibration set (RSD c), the qualities of models using DPPS, HESH, ISA-ECI, and VHSE descriptors are better ( R2 > 0.6, Q2 > 0.5, RSD c 0.44). Furthermore, the predictive ability of models using DPPS descriptor is best among the six descriptors systems (cumulative multiple correlation coefficient for predict set ( Rext2) > 0.7). It was concluded that the DPPS is better to describe the amino acid of antioxidative tripeptides. The results of DPPS descriptor reveal that the importance of the center amino acid and the N-terminal amino acid are far more than the importance of the C-terminal amino acid for antioxidative tripeptides. The hydrophobic (positively to activity) and electronic (negatively to activity) properties of the N-terminal amino acid are suggested to play the most important significance to activity, followed by the hydrogen bond (positively to activity) of the center amino acid. The N-terminal amino acid

Generation of the beta-amyloid peptide and the amyloid precursor protein C-terminal fragment gamma are potentiated by FE65L1.

Science.gov (United States)

Chang, Yang; Tesco, Giuseppina; Jeong, William J; Lindsley, Loren; Eckman, Elizabeth A; Eckman, Christopher B; Tanzi, Rudolph E; Guénette, Suzanne Y

2003-12-19

Members of the FE65 family of adaptor proteins, FE65, FE65L1, and FE65L2, bind the C-terminal region of the amyloid precursor protein (APP). Overexpression of FE65 and FE65L1 was previously reported to increase the levels of alpha-secretase-derived APP (APPs alpha). Increased beta-amyloid (A beta) generation was also observed in cells showing the FE65-dependent increase in APPs alpha. To understand the mechanism for the observed increase in both A beta and APPs alpha given that alpha-secretase cleavage of a single APP molecule precludes A beta generation, we examined the effects of FE65L1 overexpression on APP C-terminal fragments (APP CTFs). Our data show that FE65L1 potentiates gamma-secretase processing of APP CTFs, including the amyloidogenic CTF C99, accounting for the ability of FE65L1 to increase generation of APP C-terminal domain and A beta 40. The FE65L1 modulation of these processing events requires binding of FE65L1 to APP and APP CTFs and is not because of a direct effect on gamma-secretase activity, because Notch intracellular domain generation is not altered by FE65L1. Furthermore, enhanced APP CTF processing can be detected in early endosome vesicles but not in endoplasmic reticulum or Golgi membranes, suggesting that the effects of FE65L1 occur at or near the plasma membrane. Finally, although FE65L1 increases APP C-terminal domain production, it does not mediate the APP-dependent transcriptional activation observed with FE65.

Ca-C backbone fragmentation dominates in electron detachment dissociation of gas-phase polypeptide polyanions

DEFF Research Database (Denmark)

Kjeldsen, Frank; Silivra, Oleg A; Ivonin, Igor A

2005-01-01

the dissociation of oxidized radical anions [M-nH]((n-1)-*. We demonstrate that C(alpha)-C cleavages, which are otherwise rarely observed in tandem mass spectrometry, can account for most of the backbone fragmentation, with even-electron x fragments dominating over radical a* ions. Ab initio calculations at the B3...... LYP level of theory with the 6-311+G(2 p,2 d)//6-31+G(d,p) basis set suggested a unidirectional mechanism for EDD (cleavage always N-terminal to the radical site), with a*, x formation being favored over a, x* fragmentation by 74.2 kJ mol(-1). Thus, backbone C(alpha)-C bonds N-terminal to proline...

Constant region of a kappa III immunoglobulin light chain as a major AL-amyloid protein

DEFF Research Database (Denmark)

Engvig, J P; Olsen, K E; Gislefoss, R E

1998-01-01

AL-amyloidoses are generally described as a group of disorders in which N-terminal fragments of monoclonal immunoglobulin light chains are transferred into amyloid fibrils. We have, by amino acid sequence analyses and immunological methods, characterized the Bence-Jones protein and the correspond......AL-amyloidoses are generally described as a group of disorders in which N-terminal fragments of monoclonal immunoglobulin light chains are transferred into amyloid fibrils. We have, by amino acid sequence analyses and immunological methods, characterized the Bence-Jones protein...... and the corresponding AL protein as a kappa III immunoglobulin light chain from material of a patient with systemic AL-amyloidosis presenting as a local inguinal tumour. The two proteins showed some unique features. The major part of the AL amyloid fibril protein consisted of C-terminal fragments of the Bence......-Jones protein. Furthermore, both the Bence-Jones protein and the AL protein were glycosylated, with possibly a glycosylation in the constant part of the light chain....

Excitatory amino acid transporters as potential drug targets

DEFF Research Database (Denmark)

Bunch, Lennart; Erichsen, Mette Navy; Jensen, Anders Asbjørn

2009-01-01

BACKGROUND: Excitatory amino acid transporters (EAATs) are transmembrane proteins responsible for the uptake of (S)-glutamate (Glu) from the synaptic cleft, thereby terminating the glutamatergic neurotransmitter signal. Today five subtypes have been identified. Except for EAAT2, their individual...

Azide- and Alkyne-Functionalised α- and β3-Amino Acids

DEFF Research Database (Denmark)

Sminia, T.J.; Pedersen, Daniel Sejer

2012-01-01

The synthesis and full characterisation of bifunctional β -amino acids that have side chains functionalised with terminal azides (S)-4 and (R)-4 or acetylenes 5 and 6 is reported for the first time. The building blocks incorporate a turn-inducing β -segment and a side chain that can...... be functionalised further, for example, through copper-catalysed Huisgen cycloaddition. Moreover, the corresponding α-amino acids 1 and 3 have been synthesised and characterised. All amino acid building blocks were of high optical purity as demonstrated by derivatisation and subsequent NMR analysis....

Amino acid metabolism of Lemna minor L

International Nuclear Information System (INIS)

Rhodes, D.; Rich, P.J.; Brunk, D.G.

1989-01-01

A serious limitation to the use of N(O,S)-heptafluorobutyryl isobutyl amino acid derivatives in the analysis of 15 N-labeling kinetics of amino acids in plant tissues, is that the amides glutamine and asparagine undergo acid hydrolysis to glutamate and aspartate, respectively, during derivatization. This led us to consider an alternative procedure for derivatization of glutamine and asparagine with N-methyl-N-(tert-butyldimethylsilyl)-trifluoroacetamide in pyridine. Gas chromatography-mass spectrometry yielded fragment ions (M-57) of mass 417 and 431 for the [ 14 N]asparagine and [ 14 N]glutamine derivatives, respectively, suitable for monitoring unlabeled, single- 15 N- and double- 15 N-labeled amide species from the ion clusters at mass to charge ratio (m/z) 415 to 423 for asparagine, and m/z 429 to 437 for glutamine. From separate analyses of the specific isotope abundance of the amino-N groups of asparagine and glutamine as their N-heptafluorobutyryl isobutyl derivatives, the specific amide-[ 15 N] abundance of these amino acids was determined

The complete amino acid sequence of human erythrocyte diphosphoglycerate mutase.

OpenAIRE

Haggarty, N W; Dunbar, B; Fothergill, L A

1983-01-01

The complete amino acid sequence of human erythrocyte diphosphoglycerate mutase, comprising 239 residues, was determined. The sequence was deduced from the four cyanogen bromide fragments, and from the peptides derived from these fragments after digestion with a number of proteolytic enzymes. Comparison of this sequence with that of the yeast glycolytic enzyme, phosphoglycerate mutase, shows that these enzymes are 47% identical. Most, but not all, of the residues implicated as being important...

Molecular characterization of the 30-AA N-terminal mineral interaction domain of the biomineralization protein AP7.

Science.gov (United States)

Kim, Il Won; Morse, Daniel E; Evans, John Spencer

2004-12-21

The AP7 protein is one of several mollusk shell proteins which are responsible for aragonite polymorph formation and stabilization within the nacre layer of the Pacific red abalone, H. rufescens. Previously, we demonstrated that the 30-AA N-terminal domain of AP7, denoted as AP7-1, exists as an unfolded sequence and possesses the capability of inhibiting calcium carbonate crystal growth in vitro via growth step frustration or interruption. However, very little is known with regard to the interactive capabilities of this sequence with Ca(II) and with calcium carbonates. Using multidisciplinary techniques, we determine that the AP7-1 polypeptide interacts with Ca(II) ions at the -DD- sequence clusters, yet retains its unfolded, conformationally labile structure in the presence of Ca(II) ions. Further, NMR experiments reveal that the extended structured sequence blocks, -GNGM-, -SVRTQG-, and -ISYL, exhibit motional, chemical exchange, and/or backbone geometry perturbations in response to Ca(II) interactions with AP7-1. Solid-state NMR magic angle spinning studies verify that during the course of in vitro calcium carbonate crystal growth, AP7-1 becomes bound to calcite fragments and cannot be entirely displaced from the mineral fragments using competitive Ca(II) washing. Finally, using a scrambled sequence version of the AP7-1 polypeptide, we observe that sequence scrambling does not adversely affect the crystal growth inhibitory activity of AP7-1, suggesting that the amino acid composition of AP7-1 may be more critical to growth step inhibition than the linear ordering of amino acids.

28-mer Fragment Derived from Enterocin CRL35 Displays an Unexpected Bactericidal Effect on Listeria Cells.

Science.gov (United States)

Masias, Emilse; Sanches, Paulo R S; Dupuy, Fernando G; Acuna, Leonardo; Bellomio, Augusto; Cilli, Eduardo; Saavedra, Lucila; Minahk, Carlos

2015-01-01

Two shorter peptides derived from enterocin CRL35, a 43-mer bacteriocin, were synthesized i.e. the N-terminal fragment spanning from residues 1 to 15, and a 28-mer fragment that represents the C-terminal of enterocin CRL35, the residues 16 to 43. The separate peptides showed no activity when combined. On one hand, the 28-mer peptide displayed an unpredicted antimicrobial activity. On the other, 15- mer peptide had no consistent anti-Listeria effect. The dissociation constants calculated from experimental data indicated that all peptides could bind at similar extent to the sensitive cells. However, transmembrane electrical potential was not dissipated to the same level by the different peptides; whereas the full-length and the C-terminal 28-mer fragment induced almost full dissipation, 15-mer fragment produced only a slow and incomplete effect. Furthermore, a different interaction of each peptide with membranes was demonstrated based on studies carried out with liposomes, which led us to conclude that activity was related to structure rather than to net positive charges. These results open up the possibility of designing new peptides based on the 28-mer fragment with enhanced activity, which would represent a promising approach for combating Listeria and other pathogens.

Production of carboxy-terminal specific antiserum against glucagon

International Nuclear Information System (INIS)

Liu Yibing; Han Shiquan

1993-01-01

To produce carboxy-terminal specific antisera against glucagon was coupled mainly via its amino terminal histidine to thyroglobulin, using the amino group reactive pentandiol at pH 7.0 for the conjugation procedure. After repeated immunization of guinea pigs and rabbits, the antisera were obtained. The titer of guinea pig antiserum against glucagon was 1:3000-1:35000 and affinity constant was 9.3 x 10 10 -11.4 x 10 10 l · mol -1 . There were no cross reaction with GIP, INS, Copeptide and gastrin. The titer of rabbit antiserum against glucagon was 1:900-1:9000 and affinity constant was 0.36 x 10 10 -3.9 x 10 10 l · mol -1 . There were no cross reaction with INS, C-peptide and gastrin. The cross reaction with GIP was 0.02%

Discovery of novel dengue virus NS5 methyltransferase non-nucleoside inhibitors by fragment-based drug design.

Science.gov (United States)

Benmansour, Fatiha; Trist, Iuni; Coutard, Bruno; Decroly, Etienne; Querat, Gilles; Brancale, Andrea; Barral, Karine

2017-01-05

With the aim to help drug discovery against dengue virus (DENV), a fragment-based drug design approach was applied to identify ligands targeting a main component of DENV replication complex: the NS5 AdoMet-dependent mRNA methyltransferase (MTase) domain, playing an essential role in the RNA capping process. Herein, we describe the identification of new inhibitors developed using fragment-based, structure-guided linking and optimization techniques. Thermal-shift assay followed by a fragment-based X-ray crystallographic screening lead to the identification of three fragment hits binding DENV MTase. We considered linking two of them, which bind to proximal sites of the AdoMet binding pocket, in order to improve their potency. X-ray crystallographic structures and computational docking were used to guide the fragment linking, ultimately leading to novel series of non-nucleoside inhibitors of flavivirus MTase, respectively N-phenyl-[(phenylcarbamoyl)amino]benzene-1-sulfonamide and phenyl [(phenylcarbamoyl)amino]benzene-1-sulfonate derivatives, that show a 10-100-fold stronger inhibition of 2'-O-MTase activity compared to the initial fragments. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

Urinary amino acid analysis: a comparison of iTRAQ-LC-MS/MS, GC-MS, and amino acid analyzer.

Science.gov (United States)

Kaspar, Hannelore; Dettmer, Katja; Chan, Queenie; Daniels, Scott; Nimkar, Subodh; Daviglus, Martha L; Stamler, Jeremiah; Elliott, Paul; Oefner, Peter J

2009-07-01

Urinary amino acid analysis is typically done by cation-exchange chromatography followed by post-column derivatization with ninhydrin and UV detection. This method lacks throughput and specificity. Two recently introduced stable isotope ratio mass spectrometric methods promise to overcome those shortcomings. Using two blinded sets of urine replicates and a certified amino acid standard, we compared the precision and accuracy of gas chromatography/mass spectrometry (GC-MS) and liquid chromatography-tandem mass spectrometry (LC-MS/MS) of propyl chloroformate and iTRAQ derivatized amino acids, respectively, to conventional amino acid analysis. The GC-MS method builds on the direct derivatization of amino acids in diluted urine with propyl chloroformate, GC separation and mass spectrometric quantification of derivatives using stable isotope labeled standards. The LC-MS/MS method requires prior urinary protein precipitation followed by labeling of urinary and standard amino acids with iTRAQ tags containing different cleavable reporter ions distinguishable by MS/MS fragmentation. Means and standard deviations of percent technical error (%TE) computed for 20 amino acids determined by amino acid analyzer, GC-MS, and iTRAQ-LC-MS/MS analyses of 33 duplicate and triplicate urine specimens were 7.27+/-5.22, 21.18+/-10.94, and 18.34+/-14.67, respectively. Corresponding values for 13 amino acids determined in a second batch of 144 urine specimens measured in duplicate or triplicate were 8.39+/-5.35, 6.23+/-3.84, and 35.37+/-29.42. Both GC-MS and iTRAQ-LC-MS/MS are suited for high-throughput amino acid analysis, with the former offering at present higher reproducibility and completely automated sample pretreatment, while the latter covers more amino acids and related amines.

Expression of a humanized SZ-63 McAb functional recombinant Fab fragment in E. Coli

International Nuclear Information System (INIS)

Xia Lijun; Gu Jianming; Zhang Xiaoming; Liu Yue; Wan Haiying; Li Peixia; Ruan Changgeng

1995-06-01

MRNA was selected on oligo(dT)-cellulose from total RNA isolated from SZ-63 hybridoma cells by CsCl ultracentrifugation. cDNA coding for heavy and light variable regions were amplified by reverse transcriptase-polymerase chain reaction (RT-PCR). The amplified fragments were then cloned and sequenced by the 32 P labelled sanger dideoxy-mediated chain-termination method. The nucleotides of VH and Vκ are 354 and 321 respectively, the amino acid sequence of heavy and light chain of SZ-63 were also deduced. Then, linking the variable genes of SZ-63 with human immunoglobulin γ 1 CH and κ VL genes, constructing pHEN1-63 Fab/Hu chimera for expression and transforming E. coli HB2151. The expressed chimeric SZ-63 Fab was soluble. Both ELISA and Western blot results showed the expression products could specifically bind with cross-linked fibrin and the content in expression culture was about 225 μg/L. (5 figs.)

Lipidization of Simple and di-Functional Amino Acids

International Nuclear Information System (INIS)

Zainab Idris; Mohd Wahid Samsudin; Salmiah Ahmad

2013-01-01

This paper discuss the modification of azelaic acid into its applicable form by attachment of both its carboxyl sites to N-terminal of amino acid ethyl ester forming amide linkages in anhydrous medium. Acylation of glycine ethyl ester hydrochloride with azelaic acid dichloride was best conducted in a 100 % anhydrous medium. L-amino acid ethyl ester bearing a primary hydroxyl group on its side chain gave mixtures of product and variation in composition depending on the mole ratio of reactants used. Reduction in purity was also observed for L-amino acid ethyl ester with primary -SH group on its side chain as compared to L-amino acid ethyl ester having -SCH 3 group on the L-amino acid side chain. The diamidoester of azelaic acid with L-alanine ethyl ester, L-valine ethyl ester, L-leucine ethyl ester and L-glutamic acid diethyl ester were in good yield when prepared through the modified Schotten-Baumann reaction conditions. (author)

Relationship between serum amino-terminal propeptide of type III procollagen and changes of left ventricular function after acute myocardial infarction

DEFF Research Database (Denmark)

Poulsen, S H; Høst, N B; Jensen, S E

2000-01-01

BACKGROUND: The amino-terminal propeptide of type III procollagen (PIIINP) is a marker of type III collagen synthesis, which has previously been shown to correlate with infarct size in nonthrombolyzed myocardial infarction (MI) and to provide prognostic information after MI. METHODS AND RESULTS......: The relationship between PIIINP and changes of left ventricular (LV) function was studied in 47 consecutive patients with first acute MI and 16 control subjects. Serum PIIINP analysis was measured daily during hospitalization and on days 90, 180, and 360. LV function was assessed by echocardiography on days 1, 5......, 90, and 360. Patients with MI were stratified according to their serum PIIINP value at day 4 (group A, 5.0 microg/L). On arrival, LV function and size were comparable between groups A (n=31) and B (n=16). LV ejection fraction, initially depressed (day 1: group A, 47...

Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine.

Directory of Open Access Journals (Sweden)

Utut Widyastuti Suharsono

2008-11-01

Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.

Blocking of proteolytic processing and deletion of glycosaminoglycan side chain of mouse DMP1 by substituting critical amino acid residues.

Science.gov (United States)

Peng, Tao; Huang, Bingzhen; Sun, Yao; Lu, Yongbo; Bonewald, Lynda; Chen, Shuo; Butler, William T; Feng, Jerry Q; D'Souza, Rena N; Qin, Chunlin

2009-01-01

Dentin matrix protein 1 (DMP1) is present in the extracellular matrix (ECM) of dentin and bone as processed NH(2)- and COOH-terminal fragments, resulting from proteolytic cleavage at the NH(2) termini of 4 aspartic acid residues during rat DMP1 processing. One cleavage site residue, Asp(181) (corresponding to Asp(197) of mouse DMP1), and its flanking region are highly conserved across species. We speculate that cleavage at the NH(2) terminus of Asp(197) of mouse DMP1 represents an initial, first-step scission in the whole cascade of proteolytic processing. To test if Asp(197) is critical for initiating the proteolytic processing of mouse DMP1, we substituted Asp(197) with Ala(197) by mutating the corresponding nucleotides of mouse cDNA that encode this amino acid residue. This mutant DMP1 cDNA was cloned into a pcDNA3.1 vector. Data from transfection experiments indicated that this single substitution blocked the proteolytic processing of mouse DMP1 in HEK-293 cells, indicating that cleavage at the NH(2) terminus of Asp(197) is essential for exposing other cleavage sites for the conversion of DMP1 to its fragments. The NH(2)-terminal fragment of DMP1 occurs as a proteoglycan form (DMP1-PG) that contains a glycosaminoglycan (GAG) chain. Previously, we showed that a GAG chain is linked to Ser(74) in rat DMP1 (Ser(89) in mouse DMP1). To confirm that mouse DMP1-PG possesses a single GAG chain attached to Ser(89), we substituted Ser(89) by Gly(89). Data from transfection analysis indicated that this substitution completely prevented formation of the GAG-containing form, confirming that DMP1-PG contains a single GAG chain attached to Ser(89) in mouse DMP1. Copyright 2008 S. Karger AG, Basel.

Synthesis and NMR of {sup 15}N-labeled DNA fragments

Energy Technology Data Exchange (ETDEWEB)

Jones, R.A. [Rutgers, The State Univ. of New Jersey, Piscataway, NJ (United States)

1994-12-01

DNA fragments labeled with {sup 15}N at the ring nitrogens and at the exocyclic amino groups can be used to obtain novel insight into interactions such as base pairing, hydration, drug binding, and protein binding. A number of synthetic routes to {sup 15}N-labeled pyrimidine nucleosides, purines, and purine nucleosides have been reported. Moreover, many of these labeled bases or monomers have been incorporated into nucleic acids, either by chemical synthesis or by biosynthetic procedures. The focus of this chapter will be on the preparation of {sup 15}N-labeled purine 2{prime}-deoxynucleosides, their incorporation into DNA fragments by chemical synthesis, and the results of NMR studies using these labeled DNA fragments.

Production of carboxy-terminal specific antiserum against glucagon

Energy Technology Data Exchange (ETDEWEB)

Yibing, Liu; Shiquan, Han [Academia Sinica, Beijing, BJ (China). Inst. of Atomic Energy

1993-02-01

To produce carboxy-terminal specific antisera against glucagon was coupled mainly via its amino terminal histidine to thyroglobulin, using the amino group reactive pentandiol at pH 7.0 for the conjugation procedure. After repeated immunization of guinea pigs and rabbits, the antisera were obtained. The titer of guinea pig antiserum against glucagon was 1:3000-1:35000 and affinity constant was 9.3 x 10[sup 10]-11.4 x 10[sup 10] l [center dot] mol[sup -1]. There were no cross reaction with GIP, INS, Copeptide and gastrin. The titer of rabbit antiserum against glucagon was 1:900-1:9000 and affinity constant was 0.36 x 10[sup 10]-3.9 x 10[sup 10] l [center dot] mol[sup -1]. There were no cross reaction with INS, C-peptide and gastrin. The cross reaction with GIP was 0.02%.

Urinary Amino Acid Analysis: A Comparison of iTRAQ®-LC-MS/MS, GC-MS, and Amino Acid Analyzer

Science.gov (United States)

Kaspar, Hannelore; Dettmer, Katja; Chan, Queenie; Daniels, Scott; Nimkar, Subodh; Daviglus, Martha L.; Stamler, Jeremiah; Elliott, Paul; Oefner, Peter J.

2009-01-01

Urinary amino acid analysis is typically done by cation-exchange chromatography followed by post-column derivatization with ninhydrin and UV detection. This method lacks throughput and specificity. Two recently introduced stable isotope ratio mass spectrometric methods promise to overcome those shortcomings. Using two blinded sets of urine replicates and a certified amino acid standard, we compared the precision and accuracy of gas chromatography/mass spectrometry (GC-MS) and liquid chromatography-tandem mass spectrometry (LC-MS/MS) of propyl chloroformate and iTRAQ® derivatized amino acids, respectively, to conventional amino acid analysis. The GC-MS method builds on the direct derivatization of amino acids in diluted urine with propyl chloroformate, GC separation and mass spectrometric quantification of derivatives using stable isotope labeled standards. The LC-MS/MS method requires prior urinary protein precipitation followed by labeling of urinary and standard amino acids with iTRAQ® tags containing different cleavable reporter ions distinguishable by MS/MS fragmentation. Means and standard deviations of percent technical error (%TE) computed for 20 amino acids determined by amino acid analyzer, GC-MS, and iTRAQ®-LC-MS/MS analyses of 33 duplicate and triplicate urine specimens were 7.27±5.22, 21.18±10.94, and 18.34±14.67, respectively. Corresponding values for 13 amino acids determined in a second batch of 144 urine specimens measured in duplicate or triplicate were 8.39±5.35, 6.23±3.84, and 35.37±29.42. Both GC-MS and iTRAQ®-LC-MS/MS are suited for high-throughput amino acid analysis, with the former offering at present higher reproducibility and completely automated sample pretreatment, while the latter covers more amino acids and related amines. PMID:19481989

Extraterrestrial Amino Acids in the Almahata Sitta Meteorite

Science.gov (United States)

Glavin, Daniel P.; Aubrey, Andrew D.; Callahan, Michael P.; Dworkin, Jason P.; Elsila, Jamie E.; Parker, Eric T.; Bada, Jeffrey L.

2010-01-01

Amino acid analysis of a meteorite fragment of asteroid 2008 TC3 called Almahata Sitta was carried out using reverse-phase liquid chromatography coupled with UV fluorescence detection and time-of-flight mass spectrometry (LC-FD/ToF-MS) as part of a sample analysis consortium. LC-FD/ToF-MS analyses of hot-water extracts from the meteorite revealed a complex distribution of two- to seven-carbon aliphatic amino acids and one- to three-carbon amines with abundances ranging from 0.5 to 149 parts-per-billion (ppb). The enantiomeric ratios of the amino acids alanine, R-amino-n-butyric acid (beta-ABA), 2-amino-2-methylbutanoic acid (isovaline), and 2-aminopentanoic acid (norvaline) in the meteorite were racemic (D/L approximately 1), indicating that these amino acids are indigenous to the meteorite and not terrestrial contaminants. Several other non-protein amino acids were also identified in the meteorite above background levels including alpha-aminoisobutyric acid (alpha-AIB), 4-amino-2- methylbutanoic acid, 4-amino-3-methylbutanoic acid, and 3-, 4-, and 5-aminopentanoic acid. The total abundances of isovaline and alpha-AIB in Almahata Sitta are 1000 times lower than the abundances of these amino acids found in the CM carbonaceous chondrite Murchison. The extremely low abundances and unusual distribution of five carbon amino acids in Almahata Sitta compared to Cl, CM, and CR carbonaceous chondrites may reflect extensive thermal alteration of amino acids on the parent asteroid by partial melting during formation or subsequent impact shock heating. It is also possible that amino acids were synthesized by catalytic reactions on the parent body after asteroid 2008 TC3 cooled to lower temperatures.

Structural Basis for Toughness and Flexibility in the C-terminal Passenger Domain of an Acinetobacter Trimeric Autotransporter Adhesin*

Science.gov (United States)

Koiwai, Kotaro; Hartmann, Marcus D.; Linke, Dirk; Lupas, Andrei N.; Hori, Katsutoshi

2016-01-01

Trimeric autotransporter adhesins (TAAs) on the cell surface of Gram-negative pathogens mediate bacterial adhesion to host cells and extracellular matrix proteins. However, AtaA, a TAA in the nonpathogenic Acinetobacter sp. strain Tol 5, shows nonspecific high adhesiveness to abiotic material surfaces as well as to biotic surfaces. It consists of a passenger domain secreted by the C-terminal transmembrane anchor domain (TM), and the passenger domain contains an N-terminal head, N-terminal stalk, C-terminal head (Chead), and C-terminal stalk (Cstalk). The Chead-Cstalk-TM fragment, which is conserved in many Acinetobacter TAAs, has by itself the head-stalk-anchor architecture of a complete TAA. Here, we show the crystal structure of the Chead-Cstalk fragment, AtaA_C-terminal passenger domain (CPSD), providing the first view of several conserved TAA domains. The YadA-like head (Ylhead) of the fragment is capped by a unique structure (headCap), composed of three β-hairpins and a connector motif; it also contains a head insert motif (HIM1) before its last inner β-strand. The headCap, Ylhead, and HIM1 integrally form a stable Chead structure. Some of the major domains of the CPSD fragment are inherently flexible and provide bending sites for the fiber between segments whose toughness is ensured by topological chain exchange and hydrophobic core formation inside the trimer. Thus, although adherence assays using in-frame deletion mutants revealed that the characteristic adhesive sites of AtaA reside in its N-terminal part, the flexibility and toughness of the CPSD part provide the resilience that enables the adhesive properties of the full-length fiber across a wide range of conditions. PMID:26698633

Acquisition of a novel eleven amino acid insertion directly N-terminal to a tetrabasic cleavage site confers intracellular cleavage of an H7N7 influenza virus hemagglutinin

International Nuclear Information System (INIS)

Hamilton, Brian S.; Sun, Xiangjie; Chung, Changik; Whittaker, Gary R.

2012-01-01

A critical feature of highly pathogenic avian influenza viruses (H5N1 and H7N7) is the efficient intracellular cleavage of the hemagglutinin (HA) protein. H7N7 viruses also exist in equine species, and a unique feature of the equine H7N7 HA is the presence of an eleven amino acid insertion directly N-terminal to a tetrabasic cleavage site. Here, we show that three histidine residues within the unique insertion of the equine H7N7 HA are essential for intracellular cleavage. An asparagine residue within the insertion-derived glycosylation site was also found to be essential for intracellular cleavage. The presence of the histidine residues also appear to be involved in triggering fusion, since mutation of the histidine residues resulted in a destabilizing effect. Importantly, the addition of a tetrabasic site and the eleven amino acid insertion conferred efficient intracellular cleavage to the HA of an H7N3 low pathogenicity avian influenza virus. Our studies show that acquisition of the eleven amino acid insertion offers an alternative mechanism for intracellular cleavage of influenza HA.

Acquisition of a novel eleven amino acid insertion directly N-terminal to a tetrabasic cleavage site confers intracellular cleavage of an H7N7 influenza virus hemagglutinin

Energy Technology Data Exchange (ETDEWEB)

Hamilton, Brian S.; Sun, Xiangjie; Chung, Changik [Department of Microbiology and Immunology, College of Veterinary Medicine, Cornell University, Ithaca NY 14853 (United States); New York Center of Excellence for Influenza Research and Surveillance, University of Rochester Medical Center, Rochester NY 14627 (United States); Whittaker, Gary R., E-mail: grw7@cornell.edu [Department of Microbiology and Immunology, College of Veterinary Medicine, Cornell University, Ithaca NY 14853 (United States); New York Center of Excellence for Influenza Research and Surveillance, University of Rochester Medical Center, Rochester NY 14627 (United States)

2012-12-05

A critical feature of highly pathogenic avian influenza viruses (H5N1 and H7N7) is the efficient intracellular cleavage of the hemagglutinin (HA) protein. H7N7 viruses also exist in equine species, and a unique feature of the equine H7N7 HA is the presence of an eleven amino acid insertion directly N-terminal to a tetrabasic cleavage site. Here, we show that three histidine residues within the unique insertion of the equine H7N7 HA are essential for intracellular cleavage. An asparagine residue within the insertion-derived glycosylation site was also found to be essential for intracellular cleavage. The presence of the histidine residues also appear to be involved in triggering fusion, since mutation of the histidine residues resulted in a destabilizing effect. Importantly, the addition of a tetrabasic site and the eleven amino acid insertion conferred efficient intracellular cleavage to the HA of an H7N3 low pathogenicity avian influenza virus. Our studies show that acquisition of the eleven amino acid insertion offers an alternative mechanism for intracellular cleavage of influenza HA.

Complete covalent structure of statherin, a tyrosine-rich acidic peptide which inhibits calcium phosphate precipitation from human parotid saliva.

Science.gov (United States)

Schlesinger, D H; Hay, D I

1977-03-10

The complete amino acid sequence of human salivary statherin, a peptide which strongly inhibits precipitation from supersaturated calcium phosphate solutions, and therefore stabilizes supersaturated saliva, has been determined. The NH2-terminal half of this Mr=5380 (43 amino acids) polypeptide was determined by automated Edman degradations (liquid phase) on native statherin. The peptide was digested separately with trypsin, chymotrypsin, and Staphylococcus aureus protease, and the resulting peptides were purified by gel filtration. Manual Edman degradations on purified peptide fragments yielded peptides that completed the amino acid sequence through the penultimate COOH-terminal residue. These analyses, together with carboxypeptidase digestion of native statherin and of peptide fragments of statherin, established the complete sequence of the molecule. The 2 serine residues (positions 2 and 3) in statherin were identified as phosphoserine. The amino acid sequence of human salivary statherin is striking in a number of ways. The NH2-terminal one-third is highly polar and includes three polar dipeptides: H2PO3-Ser-Ser-H2PO3-Arg-Arg-, and Glu-Glu-. The COOH-terminal two-thirds of the molecule is hydrophobic, containing several repeating dipeptides: four of -Gn-Pro-, three of -Tyr-Gln-, two of -Gly-Tyr-, two of-Gln-Tyr-, and two of the tetrapeptide sequence -Pro-Tyr-Gln-Pro-. Unusual cleavage sites in the statherin sequence obtained with chymotrypsin and S. aureus protease were also noted.

Carbobenzoxy amino acids: Structural requirements for cholecystokinin receptor antagonist activity

International Nuclear Information System (INIS)

Maton, P.N.; Sutliff, V.E.; Jensen, R.T.; Gardner, J.D.

1985-01-01

The authors used dispersed acini prepared from guinea pig pancreas to examine 28 carbobenzoxy (CBZ) amino acids for their abilities to function as cholecystokinin receptor antagonists. All amino acid derivatives tested, except for CBZ-alanine, CBZ-glycine, and N alpha-CBZ- lysine, were able to inhibit the stimulation of amylase secretion caused by the C-terminal octapeptide of cholecystokinin. In general, there was a good correlation between the ability of a carbobenzoxy amino acid to inhibit stimulated amylase secretion and the ability of the amino acid derivative to inhibit binding of 125 I-cholecystokinin. The inhibition of cholecystokinin-stimulated amylase secretion was competitive, fully reversible, and specific for those secretagogues that interact with the cholecystokinin receptor. The potencies with which the various carbobenzoxy amino acids inhibited the action of cholecystokinin varied 100-fold and CBZ-cystine was the most potent cholecystokinin receptor antagonist. This variation in potency was primarily but not exclusively a function of the hydrophobicity of the amino acid side chain

The outermost N-terminal region of tapasin facilitates folding of major histocompatibility complex class I

DEFF Research Database (Denmark)

Røder, Gustav Andreas; Geironson, Linda; Darabi, Anna

2009-01-01

). Using a biochemical peptide-MHC-I-binding assay, recombinant Tpn(1-87) was found to specifically facilitate peptide-dependent folding of HLA-A*0201. Furthermore, we used Tpn(1-87) to generate a monoclonal antibody, alphaTpn(1-87)/80, specific for natural human Tpn and capable of cellular staining of ER......Tapasin (Tpn) is an ER chaperone that is uniquely dedicated to MHC-I biosynthesis. It binds MHC-I molecules, integrates them into peptide-loading complexes, and exerts quality control of the bound peptides; only when an "optimal peptide" is bound will the MHC-I be released and exported to the cell...... surface for presentation to T cells. The exact mechanisms of Tpn quality control and the criteria for being an optimal peptide are still unknown. Here, we have generated a recombinant fragment of human Tpn, Tpn(1-87) (representing the 87 N-terminal and ER-luminal amino acids of the mature Tpn protein...

Properties, production and applications of camelid single-domain antibody fragments

NARCIS (Netherlands)

Harmsen, M.M.; Haard, de H.J.

2007-01-01

Camelids produce functional antibodies devoid of light chains of which the single N-terminal domain is fully capable of antigen binding. These single-domain antibody fragments (VHHs or Nanobodies®) have several advantages for biotechnological applications. They are well expressed in microorganisms

Carboxy terminal region of the Fanconi anemia protein, FANCG/XRCC9, is required for functional activity.

Science.gov (United States)

Kuang, Y; Garcia-Higuera, I; Moran, A; Mondoux, M; Digweed, M; D'Andrea, A D

2000-09-01

Fanconi anemia (FA) is an autosomal recessive cancer susceptibility syndrome with eight complementation groups. Four of the FA genes have been cloned, and at least three of the encoded proteins, FANCA, FANCC, and FANCG/XRCC9, interact in a nuclear complex, required for the maintenance of normal chromosome stability. In the current study, mutant forms of the FANCA and FANCG proteins have been generated and analyzed with respect to protein complex formation, nuclear translocation, and functional activity. The results demonstrate that the amino terminal two-thirds of FANCG (FANCG amino acids 1-428) binds to the amino terminal nuclear localization signal (NLS) of the FANCA protein. On the basis of 2-hybrid analysis, the FANCA/FANCG binding is a direct protein-protein interaction. Interestingly, a truncated mutant form of the FANCG protein, lacking the carboxy terminus, binds in a complex with FANCA and translocates to the nucleus; however, this mutant protein fails to bind to FANCC and fails to correct the mitomycin C sensitivity of an FA-G cell line. Taken together, these results demonstrate that binding of FANCG to the amino terminal FANCA NLS sequence is necessary but not sufficient for the functional activity of FANCG. Additional amino acid sequences at the carboxy terminus of FANCG are required for the binding of FANCC in the complex. (Blood. 2000;96:1625-1632)

Molecular and structural characterisation of the human sodium/iodide symporter (h N.I.S.) C-terminus and the implication of this domain in the transporter regulation; Caracterisation moleculaire et structurale de l'extremite C-Terminale du co-transporteur sodium/iode humain (h N.I.S.): Implication de ce domaine dans la regulation du transporteur

Energy Technology Data Exchange (ETDEWEB)

Huc, S

2007-12-15

The human natrium iodide symporter (h N.I.S.) is an intrinsic membrane protein expressed in thyroid cells where it allows iodide uptake and accumulation. It is composed of thirteen transmembrane helices and its ninety- three amino acids long cytosolic C-terminus presents many potential post-translational regulatory sites. A first part of the PhD work has been dedicated to the expression in a bacterial system and to the purification of the cytosolic C-terminal fragment. Biochemical and structural characterisation have revealed that this C-terminus is very flexible but prone to dimerization. The fragment has also been used as a bait to test the interactions with PDZ domain proteins spotted on a membrane. Several proteins interacting with the (natrium/iodide symporter) N.I.S. C-terminus have thus been identified and the study of their implication in the protein regulation has been initiated. A second part of the work has underlined the existence of a N.I.S. fragment co-purified with the entire protein. This fragment has been found in cells in culture stably expressing N.I.S. and also in human thyroid extracts and in rodent thyroid cells. We observed that this fragment is spontaneously associated with the entire protein. It is composed of the last 131 amino acid of the protein and so comprises the last transmembrane domain and the C-terminal extremity. The expression of a truncated form of h N.I.S., lacking the last 131 amino acids, shows that this protein is not correctly addressed to the cell membrane and cells expressing this mutated symporter cannot accumulate iodide. However, our results show that the co-expression of the two N.I.S. parts, the truncated form lacking the last 131 amino acid, and the complementary C-terminal fragment, leads to cells presenting 10 % of the activity of cells expressing the whole N.I.S.. (author)

Molecular and structural characterisation of the human sodium/iodide symporter (h N.I.S.) C-terminus and the implication of this domain in the transporter regulation

International Nuclear Information System (INIS)

Huc, S.

2007-12-01

The human natrium iodide symporter (h N.I.S.) is an intrinsic membrane protein expressed in thyroid cells where it allows iodide uptake and accumulation. It is composed of thirteen transmembrane helices and its ninety- three amino acids long cytosolic C-terminus presents many potential post-translational regulatory sites. A first part of the PhD work has been dedicated to the expression in a bacterial system and to the purification of the cytosolic C-terminal fragment. Biochemical and structural characterisation have revealed that this C-terminus is very flexible but prone to dimerization. The fragment has also been used as a bait to test the interactions with PDZ domain proteins spotted on a membrane. Several proteins interacting with the (natrium/iodide symporter) N.I.S. C-terminus have thus been identified and the study of their implication in the protein regulation has been initiated. A second part of the work has underlined the existence of a N.I.S. fragment co-purified with the entire protein. This fragment has been found in cells in culture stably expressing N.I.S. and also in human thyroid extracts and in rodent thyroid cells. We observed that this fragment is spontaneously associated with the entire protein. It is composed of the last 131 amino acid of the protein and so comprises the last transmembrane domain and the C-terminal extremity. The expression of a truncated form of h N.I.S., lacking the last 131 amino acids, shows that this protein is not correctly addressed to the cell membrane and cells expressing this mutated symporter cannot accumulate iodide. However, our results show that the co-expression of the two N.I.S. parts, the truncated form lacking the last 131 amino acid, and the complementary C-terminal fragment, leads to cells presenting 10 % of the activity of cells expressing the whole N.I.S.. (author)

A novel tandem reporter quantifies RNA polymerase II termination in mammalian cells.

Directory of Open Access Journals (Sweden)

Ayan Banerjee

2009-07-01

Full Text Available Making the correct choice between transcription elongation and transcription termination is essential to the function of RNA polymerase II, and fundamental to gene expression. This choice can be influenced by factors modifying the transcription complex, factors modifying chromatin, or signals mediated by the template or transcript. To aid in the study of transcription elongation and termination we have developed a transcription elongation reporter system that consists of tandem luciferase reporters flanking a test sequence of interest. The ratio of expression from the reporters provides a measure of the relative rates of successful elongation through the intervening sequence.Size matched fragments containing the polyadenylation signal of the human beta-actin gene (ACTB and the human beta-globin gene (HBB were evaluated for transcription termination using this new ratiometric tandem reporter assay. Constructs bearing just 200 base pairs on either side of the consensus poly(A addition site terminated 98% and 86% of transcription for ACTB and HBB sequences, respectively. The nearly 10-fold difference in read-through transcription between the two short poly(A regions was eclipsed when additional downstream poly(A sequence was included for each gene. Both poly(A regions proved very effective at termination when 1100 base pairs were included, stopping 99.6% of transcription. To determine if part of the increased termination was simply due to the increased template length, we inserted several kilobases of heterologous coding sequence downstream of each poly(A region test fragment. Unexpectedly, the additional length reduced the effectiveness of termination of HBB sequences 2-fold and of ACTB sequences 3- to 5-fold.The tandem construct provides a sensitive measure of transcription termination in human cells. Decreased Xrn2 or Senataxin levels produced only a modest release from termination. Our data support overlap in allosteric and torpedo mechanisms

The complete amino acid sequence of human erythrocyte diphosphoglycerate mutase.

Science.gov (United States)

Haggarty, N W; Dunbar, B; Fothergill, L A

1983-01-01

The complete amino acid sequence of human erythrocyte diphosphoglycerate mutase, comprising 239 residues, was determined. The sequence was deduced from the four cyanogen bromide fragments, and from the peptides derived from these fragments after digestion with a number of proteolytic enzymes. Comparison of this sequence with that of the yeast glycolytic enzyme, phosphoglycerate mutase, shows that these enzymes are 47% identical. Most, but not all, of the residues implicated as being important for the activity of the glycolytic mutase are conserved in the erythrocyte diphosphoglycerate mutase. PMID:6313356

Residue preference mapping of ligand fragments in the Protein Data Bank.

Science.gov (United States)

Wang, Lirong; Xie, Zhaojun; Wipf, Peter; Xie, Xiang-Qun

2011-04-25

The interaction between small molecules and proteins is one of the major concerns for structure-based drug design because the principles of protein-ligand interactions and molecular recognition are not thoroughly understood. Fortunately, the analysis of protein-ligand complexes in the Protein Data Bank (PDB) enables unprecedented possibilities for new insights. Herein, we applied molecule-fragmentation algorithms to split the ligands extracted from PDB crystal structures into small fragments. Subsequently, we have developed a ligand fragment and residue preference mapping (LigFrag-RPM) algorithm to map the profiles of the interactions between these fragments and the 20 proteinogenic amino acid residues. A total of 4032 fragments were generated from 71 798 PDB ligands by a ring cleavage (RC) algorithm. Among these ligand fragments, 315 unique fragments were characterized with the corresponding fragment-residue interaction profiles by counting residues close to these fragments. The interaction profiles revealed that these fragments have specific preferences for certain types of residues. The applications of these interaction profiles were also explored and evaluated in case studies, showing great potential for the study of protein-ligand interactions and drug design. Our studies demonstrated that the fragment-residue interaction profiles generated from the PDB ligand fragments can be used to detect whether these fragments are in their favorable or unfavorable environments. The algorithm for a ligand fragment and residue preference mapping (LigFrag-RPM) developed here also has the potential to guide lead chemistry modifications as well as binding residues predictions.

Amino-terminal pro-brain natriuretic peptide as a predictor of outcome in patients admitted to intensive care. A prospective observational study.

Science.gov (United States)

De Geer, Lina; Fredrikson, Mats; Oscarsson, Anna

2012-06-01

Amino-terminal pro-brain-type natriuretic peptide is known to predict outcome in patients with heart failure, but its role in an intensive care setting is not yet fully established. To assess the incidence of elevated amino-terminal pro-brain natriuretic peptide (NT-pro-BNP) on admission to intensive care and its relation to death in the ICU and within 30 days. Prospective, observational cohort study. A mixed non-cardiothoracic tertiary ICU in Sweden. NT-pro-BNP was collected from 481 consecutive patients on admission to intensive care, in addition to data on patient characteristics and outcome. A receiver-operating characteristic curve was used to identify a discriminatory level of significance, a stepwise logistic regression analysis to correct for other clinical factors and a Kaplan-Meier analysis to assess survival. The correlation between Simplified Acute Physiology Score (SAPS) 3, Sequential Organ Failure Assessment score (SOFA) and NT-pro-BNP was analysed using Spearman's correlation test. Quartiles of NT-pro-BNP elevation were compared for baseline data and outcome using a logistic regression model. An NT-pro-BNP more than 1380 ng -l on admission was an independent predictor of death in the ICU and within 30 days [odds ratio (OR) 2.6; 95% confidence interval (CI), 1.5 to 4.4] and was present in 44% of patients. Thirty-three percent of patients with NT-pro-BNP more than 1380 ng -1, and 14.6% of patients below that threshold died within 30 days (log rank P=0.005). NT-pro-BNP correlated moderately with SAPS 3 and with SOFA on admission (Spearman's ρ 0.5552 and 0.5129, respectively). In quartiles of NT-pro-BNP elevation on admission, severity of illness and mortality increased significantly (30-day mortality 36.1%; OR 3.9; 95% CI, 2.0 to 7.3 in the quartile with the highest values, vs. 12.8% in the lowest quartile). We conclude that NT-pro-BNP is commonly elevated on admission to intensive care, that it increases with severity of illness and that it is an

Circulating forms of immunoreactive parathyroid hormone-related protein for identifying patients with humoral hypercalcemia of malignancy. A comparative study with C-terminal (109-141)- and N-terminal (1-86)-region-specific PTHrP radioassay

International Nuclear Information System (INIS)

Suehiro, Mitsuko; Murakami, Minoru; Fukuchi, Minoru

1994-01-01

We evaluated the circulating forms of immunoreactive parathyroid hormone-related protein(PTHrP) in 115 healthy subjects and 122 patients with malignant diseases by using radioassay systems (RAS) specific for the C-terminal (109-141) fragment of PTHrP (C-RAS) and for the N-terminal(1-86) (N-RAS). PTHrP levels in healthy controls ranged from 1.5 to 38.2 (mean: 24.5) pmol/L with the C-RAS and from 0.9 to 2.5 (mean: 1.7) pmol/L with the N-RAS. The ratio of circulating N-terminal fragment (N) to C-terminal fragment (C) of PTHrP was calculated to be about 1 : 14.4 in the healthy subjects. Of the 122 patients with malignant diseases, 40 (32.8%) had circulating PTHrP levels undetectable with the N-RAS, but only 11 (9.0%) patients had levels undetectable with the C-RAS. Of the former 122 patients, 41 (33.6%) had high PTHrP as determined with the C-RAS, and 10 (8.2%) had high PTHrP as determined with the N-RAS. The former of these included only 8 (19.5%) humoral hypercalcemia malignancy(HHM) patients, while the latter included 8 (80.0%) HHM patients. The circulating N to C ratio was about 1 : 70.7 in the HHM patients. The N and C obtained with the different RASs showed a close correlation (r=0.86). The values also showed a close correlation with serum Ca; r=0.75 for C-RAS and r=0.81 for N-RAS. In addition, the correlation between the PTHrP reading obtained with the different RASs and serum Cr were: r=0.42 with C-RAS and r=0.26 with N-RAS. The circulating form of immunoreactive PTHrP fragments is therefore comprised mainly of PTHrP (109-141). In contrast, circulating concentrations of the PTHrP (1-86) fragment are very low, but detection of the PTHrP (1-86) fragment with the N-RAS is a more useful indicator of HHM with fewer false positive results and is less likely to be influenced by renal function than the detection of the PHPrP (109-141) fragment with C-RAS. (author)

Conformational and functional analysis of the C-terminal globular head of the reovirus cell attachment protein.

Science.gov (United States)

Duncan, R; Horne, D; Strong, J E; Leone, G; Pon, R T; Yeung, M C; Lee, P W

1991-06-01

We have been investigating structure-function relationships in the reovirus cell attachment protein sigma 1 using various deletion mutants and protease analysis. In the present study, a series of deletion mutants were constructed which lacked 90, 44, 30, 12, or 4 amino acids from the C-terminus of the 455-amino acid-long reovirus type 3 (T3) sigma 1 protein. The full-length and truncated sigma 1 proteins were expressed in an in vitro transcription/translation system and assayed for L cell binding activity. It was found that the removal of as few as four amino acids from the C-terminus drastically affected the cell binding function of the sigma 1 protein. The C-terminal-truncated proteins were further characterized using trypsin, chymotrypsin, and monoclonal and polyclonal antibodies. Our results indicated that the C-terminal portions of the mutant proteins were misfolded, leading to a loss in cell binding function. The N-terminal fibrous tail of the proteins was unaffected by the deletions as was sigma 1 oligomerization, further illustrating the discrete structural and functional roles of the N- and C-terminal domains of sigma 1. In an attempt to identify smaller, functional peptides, full-length sigma 1 expressed in vitro was digested with trypsin and subsequently with chymotrypsin under various conditions. The results clearly demonstrated the highly stable nature of the C-terminal globular head of sigma 1, even when separated from the N-terminal fibrous tail. We concluded that: (1) the C-terminal globular head of sigma 1 exists as a compact, protease-resistant oligomeric structure; (2) an intact C-terminus is required for proper head folding and generation of the conformationally dependent cell binding domain.

Biosynthesis of 2-aminooctanoic acid and its use to terminally modify a lactoferricin B peptide derivative for improved antimicrobial activity.

Science.gov (United States)

Almahboub, Sarah A; Narancic, Tanja; Devocelle, Marc; Kenny, Shane T; Palmer-Brown, William; Murphy, Cormac; Nikodinovic-Runic, Jasmina; O'Connor, Kevin E

2018-01-01

Terminal modification of peptides is frequently used to improve their hydrophobicity. While N-terminal modification with fatty acids (lipidation) has been reported previously, C-terminal lipidation is limited as it requires the use of linkers. Here we report the use of a biocatalyst for the production of an unnatural fatty amino acid, (S)-2-aminooctanoic acid (2-AOA) with enantiomeric excess > 98% ee and the subsequent use of 2-AOA to modify and improve the activity of an antimicrobial peptide. A transaminase originating from Chromobacterium violaceum was employed with a conversion efficiency 52-80% depending on the ratio of amino group donor to acceptor. 2-AOA is a fatty acid with amino functionality, which allowed direct C- and N-terminal conjugation respectively to an antimicrobial peptide (AMP) derived from lactoferricin B. The antibacterial activity of the modified peptides was improved by up to 16-fold. Furthermore, minimal inhibitory concentrations (MIC) of C-terminally modified peptide were always lower than N-terminally conjugated peptides. The C-terminally modified peptide exhibited MIC values of 25 μg/ml for Escherichia coli, 50 μg/ml for Bacillus subtilis, 100 μg/ml for Salmonella typhimurium, 200 μg/ml for Pseudomonas aeruginosa and 400 μg/ml for Staphylococcus aureus. The C-terminally modified peptide was the only peptide tested that showed complete inhibition of growth of S. aureus.

Ninety-five- and 25-kDa fragments of the human immunodeficiency virus envelope glycoprotein gp120 bind to the CD4 receptor

International Nuclear Information System (INIS)

Nygren, A.; Bergman, T.; Matthews, T.; Joernvall, H.; Wigzell, H.

1988-01-01

Iodine-125-labeled gp120 (120-kDa envelope glycoprotein) from the BH10 isolate of human immunodeficiency virus is cleaved to a limited extend with the glutamate-specific protease from Staphylococcus aureus. After disulfide bond reduction, fragments with approximate molecular masses of 95, 60, 50, and 25 kDa are produced. Tests for binding to CD4-positive cells show that only two fragments, the 95- and 25- kDa peptides, are observed in cleavage products that retain the selective binding capacity of gp120. Radiosequence analysis of the fragments after sodium dodecyl sulfate/polyacrylamide gel electrophoresis and electroblotting demonstrates that the 95-kDa fragment lacks the N-terminal region of gp120 and starts at position 143 of the mature envelope protein. The 50-kDa fragment starts at the same position. The 25-kDa binding fragment was similarly deduced to be generated as a small fragment from a cleavage site in the C-terminal part of gp120. The identifications of these fragments demonstrate that radiosequence analysis utilizing 125 I-labeled tyrosine residues can function as a useful and reliable method for small-scale determination of cleavage sites in proteins. Combined, the data suggest domain-like subdivisions of gp120, define at least two intervening segments especially sensitive to proteolytic cleavage, and demonstrate the presence of a functional region for receptor binding in the C-terminal part of the molecule

Nonnatural amino acid incorporation into the methionine 214 position of the metzincin Pseudomonas aeruginosa alkaline protease

Directory of Open Access Journals (Sweden)

Honek John F

2005-10-01

Full Text Available Abstract Background The alkaline protease from Pseudomonas aeruginosa (AprA is a member of the metzincin superfamily of metalloendoproteases. A key feature of these proteases is a conserved methionine-containing 1,4-tight β turn at the base of the active site zinc binding region. Results To explore the invariant methionine position in this class of protease, incorporation of a nonnatural fluorinated methionine, L-difluoromethionine (DFM, into this site was accomplished. Although overproduction of the N-terminal catalytic fragment of AprA resulted in protein aggregates which could not be resolved, successful heterologous production of the entire AprA was accomplished in the presence and absence of the nonnatural amino acid. DFM incorporation was found to only slightly alter the enzyme kinetics of AprA. In addition, differential scanning calorimetry indicated no significant alteration in the thermal stability of the modified enzyme. Conclusion Although invariant in all metzincin proteases, the methionine 214 position in AprA can be successfully replaced by the nonnatural amino acid DFM resulting in little effect on protein structure and function. This study indicates that the increased size of the methyl group by the introduction of two fluorines is still sufficiently non-sterically demanding, and bodes well for the application of DFM to biophysical studies of protein structure and function in this class of protease.

Nonnatural amino acid incorporation into the methionine 214 position of the metzincin Pseudomonas aeruginosa alkaline protease

Science.gov (United States)

Walasek, Paula; Honek, John F

2005-01-01

Background The alkaline protease from Pseudomonas aeruginosa (AprA) is a member of the metzincin superfamily of metalloendoproteases. A key feature of these proteases is a conserved methionine-containing 1,4-tight β turn at the base of the active site zinc binding region. Results To explore the invariant methionine position in this class of protease, incorporation of a nonnatural fluorinated methionine, L-difluoromethionine (DFM), into this site was accomplished. Although overproduction of the N-terminal catalytic fragment of AprA resulted in protein aggregates which could not be resolved, successful heterologous production of the entire AprA was accomplished in the presence and absence of the nonnatural amino acid. DFM incorporation was found to only slightly alter the enzyme kinetics of AprA. In addition, differential scanning calorimetry indicated no significant alteration in the thermal stability of the modified enzyme. Conclusion Although invariant in all metzincin proteases, the methionine 214 position in AprA can be successfully replaced by the nonnatural amino acid DFM resulting in little effect on protein structure and function. This study indicates that the increased size of the methyl group by the introduction of two fluorines is still sufficiently non-sterically demanding, and bodes well for the application of DFM to biophysical studies of protein structure and function in this class of protease. PMID:16221305

Biomonitoring of carcinogenic substances: enzymatic digestion of globin for detecting alkylated amino acids

Science.gov (United States)

Bader, Michael; Rauscher, Dankwart; Geibel, Kurt; Angerer, Juergen

1993-03-01

We report the application of proteases for the total hydrolysis of globin with subsequent determination of amino acids. Optimization of the proteolysis was made with respect to enzyme concentration, time of incubation and type of protease. Ethylene oxide modified globin was used to compare the results of the analysis of the N-terminal amino acid valine after enzymatic cleavage to those obtained from the widely used modified Edman procedure. It is shown that the cleavage is of good reproducibility and yields more alkylated amino acid than the Edman procedure.

Measurement of amino terminal propeptide of type III procollagen (PIIINP) employing the ADVIA Centaur platform. Validation, reference interval and comparison to UniQ RIA

DEFF Research Database (Denmark)

Knudsen, Cindy Soendersoe; Heickendorff, Lene; Nexo, Ebba

2014-01-01

Background: Recently, measurement of amino terminal propeptide of type III procollagen (PIIINP) was introduced as a part of the hepatic cirrhotic marker enhanced liver fibrosis™ test on the automated ADVIA Centaur® immunoassay platform (Siemens Healthcare Diagnostics Inc., Tarrytown, NY, USA...... UniQ PIIINP RIA assay (Orion Diagnostica, Espoo, Finland) using 55 patient samples (range=3.7-43.3 µg/L). Furthermore, we established a reference interval based on samples from 287 blood donors. Results: In the concentration range 2.5-11.9 µg/L, the total imprecision was below 8%. Comparison...... PIIINP assay is suitable for routine use with our newly defined reference interval. The results obtained by Centaur correlates well with those obtained by the previously employed RIA, though the absolute values are higher....

Alterations of telomerase activity and terminal restriction fragment in gastric cancer and its premalignant lesions.

Science.gov (United States)

Yang, S M; Fang, D C; Luo, Y H; Lu, R; Battle, P D; Liu, W W

2001-08-01

In order to explore the role of alterations of telomerase activity and terminal restriction fragment (TRF) length in the development and progression of gastric cancer. Telomerase activity was detected in 176 specimens of gastric mucosa obtained through an operation or endoscopical biopsy by using the telomeric repeat amplification protocol (TRAP) assay. Meanwhile, the mean length of TRF was measured with the use of a Southern blot in part of those samples. Telomerase activity was detected in 14 of 57 (24.6%) chronic atrophy gastritis patients, six of 18 (33.3%) intestinal metaplasia patients, three of eight (37.5%) dysplasia patients and 60 of 65 (92.3%) gastric cancer patients, respectively. Normal gastric mucosa revealed no telomerase activity. No association was found between telomerase activity and any clinicopathological parameters. The mean TRF length was decreased gradually with age in normal mucosa and in gastric cancer tissue. Regression analysis demonstrated that the reduction rate in these tissues was 41 +/- 12 base pairs/year. Among 35 gastric cancers, TRF length was shown to be shorter in 20 cases (57.1%), similar in 12 cases (34.3%) and elongated in three cases (7.6%), compared to the corresponding adjacent tissues. The mean TRF length tended to decrease as the mucosa underwent chronic atrophy gastritis, intestinal metaplasia, dysplasia and into gastric cancer. The mean TRF length in gastric cancer was not statistically correlated with clinicopathological parameters and telomerase activity. Our results suggest that telomerase is expressed during the early stage of gastric carcinogenesis, and that the clinical significance of TRF length appears to be limited in gastric cancer.

The N-terminal neurotensin fragment, NT1-11, inhibits cortisol secretion by human adrenocortical cells.

Science.gov (United States)

Sicard, Flavie; Contesse, Vincent; Lefebvre, Hervé; Ait-Ali, Djida; Gras, Marjorie; Cartier, Dorthe; Decker, Annick; Chartrel, Nicolas; Anouar, Youssef; Vaudry, Hubert; Delarue, Catherine

2006-08-01

Neurotensin (NT) modulates corticosteroid secretion from the mammalian adrenal gland. The objective of this study was to investigate the possible involvement of NT in the control of cortisol secretion in the human adrenal gland. In vitro studies were conducted on cultured human adrenocortical cells. This study was conducted in a university research laboratory. Adrenal explants from patients undergoing expanded nephrectomy for kidney cancer were studied. Cortisol secretion from cultured adrenocortical cells was measured. NT1-11, the N-terminal fragment of NT, dose-dependently inhibited basal and ACTH-stimulated cortisol production by human adrenocortical cells in primary culture. In contrast, NT had no influence on cortisol output at concentrations up to 10(-6) m. HPLC and RT-PCR analyses failed to detect any significant amounts of NT and NT mRNA, respectively, in adrenal extracts. Molecular and pharmacological studies were performed to determine the type of NT receptor involved in the corticostatic effect of NT1-11. RT-PCR analysis revealed the expression of NT receptor type (NTR) 3 mRNA but not NTR1 and NTR2 mRNAs in the human adrenal tissue. However, the pharmacological profile of the adrenal NT1-11 receptor was different from that of NTR3, indicating that this receptor type is not involved in the action of NT1-11 on corticosteroidogenesis. Our results indicate that NT1-11 may act as an endocrine factor to inhibit cortisol secretion through activation of a receptor distinct from the classical NTR1, NTR2, and NTR3.

Protein-observed (19)F-NMR for fragment screening, affinity quantification and druggability assessment.

Science.gov (United States)

Gee, Clifford T; Arntson, Keith E; Urick, Andrew K; Mishra, Neeraj K; Hawk, Laura M L; Wisniewski, Andrea J; Pomerantz, William C K

2016-08-01

NMR spectroscopy can be used to quantify the binding affinity between proteins and low-complexity molecules, termed 'fragments'; this versatile screening approach allows researchers to assess the druggability of new protein targets. Protein-observed (19)F-NMR (PrOF NMR) using (19)F-labeled amino acids generates relatively simple spectra that are able to provide dynamic structural information toward understanding protein folding and function. Changes in these spectra upon the addition of fragment molecules can be observed and quantified. This protocol describes the sequence-selective labeling of three proteins (the first bromodomains of Brd4 and BrdT, and the KIX domain of the CREB-binding protein) using commercially available fluorinated aromatic amino acids and fluorinated precursors as example applications of the method developed by our research group. Fragment-screening approaches are discussed, as well as Kd determination, ligand-efficiency calculations and druggability assessment, i.e., the ability to target these proteins using small-molecule ligands. Experiment times on the order of a few minutes and the simplicity of the NMR spectra obtained make this approach well-suited to the investigation of small- to medium-sized proteins, as well as the screening of multiple proteins in the same experiment.

Systemic N-terminal fragments of adrenocorticotropin reduce inflammation- and stress-induced anhedonia in rats.

Science.gov (United States)

Markov, Dmitrii D; Yatsenko, Ksenia A; Inozemtseva, Lyudmila S; Grivennikov, Igor A; Myasoedov, Nikolai F; Dolotov, Oleg V

2017-08-01

Emerging evidence implicates impaired self-regulation of the hypothalamic-pituitary-adrenal (HPA) axis and inflammation as important and closely related components of the pathophysiology of major depression. Antidepressants show anti-inflammatory effects and are suggested to enhance glucocorticoid feedback inhibition of the HPA axis. HPA axis activity is also negatively self-regulated by the adrenocorticotropic hormone (ACTH), a potent anti-inflammatory peptide activating five subtypes of melanocortin receptors (MCRs). There are indications that ACTH-mediated feedback can be activated by noncorticotropic N-terminal ACTH fragments such as a potent anti-inflammatory MC1/3/4/5R agonist α-melanocyte-stimulating hormone (α-MSH), corresponding to ACTH(1-13), and a MC3/5R agonist ACTH(4-10). We investigated whether intraperitoneal administration of rats with these peptides affects anhedonia, which is a core symptom of depression. Inflammation-related anhedonia was induced by a single intraperitoneal administration of a low dose (0.025mg/kg) of lipopolysaccharide (LPS). Stress-related anhedonia was induced by the chronic unpredictable stress (CUS) procedure. The sucrose preference test was used to detect anhedonia. We found that ACTH(4-10) pretreatment decreased LPS-induced increase in serum corticosterone and tumor necrosis factor (TNF)-α, and a MC3/4R antagonist SHU9119 blocked this effect. Both α-MSH and ACTH(4-10) alleviated LPS-induced anhedonia. In the CUS model, these peptides reduced anhedonia and normalized body weight gain. The data indicate that systemic α-MSH and ACTH(4-10) produce an antidepressant-like effect on anhedonia induced by stress or inflammation, the stimuli that trigger the release of ACTH and α-MSH into the bloodstream. The results suggest a counterbalancing role of circulating melanocortins in depression and point to a new approach for antidepressant treatment. Copyright © 2017 Elsevier Ltd. All rights reserved.

Generation of biologically active endostatin fragments from human collagen XVIII by distinct matrix metalloproteases

International Nuclear Information System (INIS)

Heljasvaara, Ritva; Nyberg, Pia; Luostarinen, Jani; Parikka, Mataleena; Heikkilae, Pia; Rehn, Marko; Sorsa, Timo; Salo, Tuula; Pihlajaniemi, Taina

2005-01-01

Endostatin, a potent inhibitor of endothelial cell proliferation, migration, angiogenesis and tumor growth, is proteolytically cleaved from the C-terminal noncollagenous NC1 domain of type XVIII collagen. We investigated the endostatin formation from human collagen XVIII by several MMPs in vitro. The generation of endostatin fragments differing in molecular size (24-30 kDa) and in N-terminal sequences was identified in the cases of MMP-3, -7, -9, -13 and -20. The cleavage sites were located in the protease-sensitive hinge region between the trimerization and endostatin domains of NC1. MMP-1, -2, -8 and -12 did not show any significant activity against the C-terminus of collagen XVIII. The anti-proliferative effect of the 20-kDa endostatin, three longer endostatin-containing fragments generated in vitro by distinct MMPs and the entire NC1 domain, on bFGF-stimulated human umbilical vein endothelial cells was established. The anti-migratory potential of some of these fragments was also studied. In addition, production of endostatin fragments between 24-30 kDa by human hepatoblastoma cells was shown to be due to MMP action on type XVIII collagen. Our results indicate that certain, especially cancer-related, MMP family members can generate biologically active endostatin-containing polypeptides from collagen XVIII and thus, by releasing endostatin fragments, may participate in the inhibition of endothelial cell proliferation, migration and angiogenesis

Alkylation or Silylation for Analysis of Amino and Non-Amino Organic Acids by GC-MS?

Directory of Open Access Journals (Sweden)

Silas G. Villas-Bôas

2011-01-01

Full Text Available Gas chromatography–mass spectrometry (GC-MS is a widely used analytical technique in metabolomics. GC provides the highest resolution of any standard chromatographic separation method, and with modern instrumentation, retention times are very consistent between analyses. Electron impact ionization and fragmentation is generally reproducible between instruments and extensive libraries of spectra are available that enhance the identification of analytes. The major limitation is the restriction to volatile analytes, and hence the requirement to convert many metabolites to volatile derivatives through chemical derivatization. Here we compared the analytical performance of two derivatization techniques, silylation (TMS and alkylation (MCF, used for the analysis of amino and non-amino organic acids as well as nucleotides in microbial-derived samples. The widely used TMS derivatization method showed poorer reproducibility and instability during chromatographic runs while the MCF derivatives presented better analytical performance. Therefore, alkylation (MCF derivatization seems to be preferable for the analysis of polyfunctional amines, nucleotides and organic acids in microbial metabolomics studies.

Diverse amino acid changes at specific positions in the N-terminal region of the coat protein allow Plum pox virus to adapt to new hosts.

Science.gov (United States)

Carbonell, Alberto; Maliogka, Varvara I; Pérez, José de Jesús; Salvador, Beatriz; León, David San; García, Juan Antonio; Simón-Mateo, Carmen

2013-10-01

Plum pox virus (PPV)-D and PPV-R are two isolates from strain D of PPV that differ in host specificity. Previous analyses of chimeras originating from PPV-R and PPV-D suggested that the N terminus of the coat protein (CP) includes host-specific pathogenicity determinants. Here, these determinants were mapped precisely by analyzing the infectivity in herbaceous and woody species of chimeras containing a fragment of the 3' region of PPV-D (including the region coding for the CP) in a PPV-R backbone. These chimeras were not infectious in Prunus persica, but systemically infected Nicotiana clevelandii and N. benthamiana when specific amino acids were modified or deleted in a short 30-amino-acid region of the N terminus of the CP. Most of these mutations did not reduce PPV fitness in Prunus spp. although others impaired systemic infection in this host. We propose a model in which the N terminus of the CP, highly relevant for virus systemic movement, is targeted by a host defense mechanism in Nicotiana spp. Mutations in this short region allow PPV to overcome the defense response in this host but can compromise the efficiency of PPV systemic movement in other hosts such as Prunus spp.

Molecular mechanism of the intramembrane cleavage of the β-carboxyl terminal fragment of amyloid precursor protein by γ-secretase

Directory of Open Access Journals (Sweden)

Maho eMorishima-Kawashima

2014-11-01

Full Text Available Amyloid β-protein (Aβ plays a central role in the pathogenesis of Alzheimer’s disease, the most common age-associated neurodegenerative disorder. Aβ is generated through intramembrane proteolysis of the β-carboxyl terminal fragment (βCTF of β-amyloid precursor protein (APP by γ-secretase. The initial cleavage by γ-secretase occurs in the membrane/cytoplasm boundary of the βCTF, liberating the APP intracellular domain (AICD. The remaining βCTFs, which are truncated at the C-terminus (longer Aβs, are then cropped sequentially in a stepwise manner, predominantly at three residue intervals, to generate Aβ. There are two major Aβ product lines which generate Aβ40 and Aβ42 with concomitant release of three and two tripeptides, respectively. Additionally, many alternative cleavages occur, releasing peptides with three to six residues. These modulate the Aβ product lines and define the species and quantity of Aβ generated. Here, we review our current understanding of the intramembrane cleavage of the βCTF by γ-secretase, which may contribute to the future goal of developing an efficient therapeutic strategy for Alzheimer’s disease.

Role for excitatory amino acids in methamphetamine-induced nigrostriatal dopaminergic toxicity.

Science.gov (United States)

Sonsalla, P K; Nicklas, W J; Heikkila, R E

1989-01-20

The systemic administration of either methamphetamine or 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) to experimental animals produces degenerative changes in nigrostriatal dopaminergic neurons or their axon terminals. This study was conducted to determine if excitatory amino acids, which appear to be involved in various neurodegenerative disorders, might also contribute to the dopaminergic neurotoxicity produced in mice by either methamphetamine or MPTP. MK-801, phencyclidine, and ketamine, noncompetitive antagonists of one subtype of excitatory amino acid receptor, the N-methyl-D-aspartate receptor, provided substantial protection against neurotoxicity produced by methamphetamine but not that produced by MPTP. These findings indicate that excitatory amino acids play an important role in the nigrostriatal dopaminergic damage induced by methamphetamine.

The N-end rule pathway counteracts cell death by destroying proapoptotic protein fragments.

Science.gov (United States)

Piatkov, Konstantin I; Brower, Christopher S; Varshavsky, Alexander

2012-07-03

In the course of apoptosis, activated caspases cleave ∼500 to ∼1,000 different proteins in a mammalian cell. The dynamics of apoptosis involve a number of previously identified, caspase-generated proapoptotic protein fragments, defined as those that increase the probability of apoptosis. In contrast to activated caspases, which can be counteracted by inhibitor of apoptosis proteins, there is little understanding of antiapoptotic responses to proapoptotic protein fragments. One possibility is the regulation of proapoptotic fragments through their selective degradation. The previously identified proapoptotic fragments Cys-RIPK1, Cys-TRAF1, Asp-BRCA1, Leu-LIMK1, Tyr-NEDD9, Arg-BID, Asp-BCL(XL), Arg-BIM(EL), Asp-EPHA4, and Tyr-MET bear destabilizing N-terminal residues. Tellingly, the destabilizing nature (but not necessarily the actual identity) of N-terminal residues of proapoptotic fragments was invariably conserved in evolution. Here, we show that these proapoptotic fragments are short-lived substrates of the Arg/N-end rule pathway. Metabolic stabilization of at least one such fragment, Cys-RIPK1, greatly augmented the activation of the apoptosis-inducing effector caspase-3. In agreement with this understanding, even a partial ablation of the Arg/N-end rule pathway in two specific N-end rule mutants is shown to sensitize cells to apoptosis. We also found that caspases can inactivate components of the Arg/N-end rule pathway, suggesting a mutual suppression between this pathway and proapoptotic signaling. Together, these results identify a mechanistically specific and functionally broad antiapoptotic role of the Arg/N-end rule pathway. In conjunction with other apoptosis-suppressing circuits, the Arg/N-end rule pathway contributes to thresholds that prevent a transient or otherwise weak proapoptotic signal from reaching the point of commitment to apoptosis.

Age-related changes in the proteoglycans of human skin. Specific cleavage of decorin to yield a major catabolic fragment in adult skin.

Science.gov (United States)

Carrino, David A; Onnerfjord, Patrik; Sandy, John D; Cs-Szabo, Gabriella; Scott, Paul G; Sorrell, J Michael; Heinegård, Dick; Caplan, Arnold I

2003-05-09

Dramatic changes occur in skin as a function of age, including changes in morphology, physiology, and mechanical properties. Changes in extracellular matrix molecules also occur, and these changes likely contribute to the overall age-related changes in the physical properties of skin. The major proteoglycans detected in extracts of human skin are decorin and versican. In addition, adult human skin contains a truncated form of decorin, whereas fetal skin contains virtually undetectable levels of this truncated decorin. Analysis of this molecule, herein referred to as decorunt, indicates that it is a catabolic fragment of decorin rather than a splice variant. With antibody probes to the core protein, decorunt is found to lack the carboxyl-terminal portion of decorin. Further analysis by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry shows that the carboxyl terminus of decorunt is at Phe(170) of decorin. This result indicates that decorunt represents the amino-terminal 43% of the mature decorin molecule. Such a structure is inconsistent with alternative splicing of decorin and suggests that decorunt is a catabolic fragment of decorin. A neoepitope antiserum, anti-VRKVTF, was generated against the carboxyl terminus of decorunt. This antiserum does not recognize intact decorin in any skin proteoglycan sample tested on immunoblots but recognizes every sample of decorunt tested. The results with anti-VRKVTF confirm the identification of the carboxyl terminus of decorunt. Analysis of collagen binding by surface plasmon resonance indicates that the affinity of decorunt for type I collagen is 100-fold less than that of decorin. This observation correlates with the structural analysis of decorunt, in that it lacks regions of decorin previously shown to be important for interaction with type I collagen. The detection of a catabolic fragment of decorin suggests the existence of a specific catabolic pathway for this proteoglycan. Because of the

Establishment of the enzyme-linked immunosorbent assay system to detect the amino terminal secretory form of rat Erc/Mesothelin.

Science.gov (United States)

Nakaishi, Masayuki; Kajino, Kazunori; Ikesue, Masahiro; Hagiwara, Yoshiaki; Kuwahara, Maki; Mitani, Hiroaki; Horikoshi-Sakuraba, Yuko; Segawa, Tatsuya; Kon, Shigeyuki; Maeda, Masahiro; Wang, Tegexibaiyin; Abe, Masaaki; Yokoyama, Masayoshi; Hino, Okio

2007-05-01

By representational difference analysis, we previously identified the rat Erc (Expressed in renal carcinoma) gene that was more abundantly expressed in the renal carcinoma tissues of Eker rats than in the rat normal kidney. In this study, we raised antibodies against the amino-terminal portion of the rat Erc, and demonstrated the existence of a approximately 30-kDa secretory form in the supernatant of cultured cells derived from rat renal carcinoma. The enzyme-linked immunosorbent assay (ELISA) system using these antibodies detected high concentrations of this form in the sera of Eker rats bearing renal carcinomas, and in the sera of rats transplanted with mesothelioma cells. Mesothelin, a human homolog of the rat Erc, was recently reported to be a serum marker of malignant mesothelioma. The prognosis of mesothelioma is poor and there is no effective treatment at present. There are several rat model systems of mesothelioma that may be promising tools in the development of an antimesothelioma treatment. We hope our ELISA to detect the soluble form of rat Erc/Mesothelin is useful in the rat model system to exploit the antimesothelioma therapy to be used in human cases.

Functional roles of the amino terminal domain in determining biophysical properties of Cx50 gap junction channels

Directory of Open Access Journals (Sweden)

Li eXin

2013-12-01

Full Text Available Communication through gap junction channels is essential for synchronized and coordinated cellular activities. The gap junction channel pore size, its switch control for opening/closing, and the modulations by chemicals can be different depending on the connexin subtypes that compose the channel. Recent structural and functional studies provide compelling evidence that the amino terminal (NT domains of several connexins line the pore of gap junction channels and play an important role in single channel conductance (γj and transjunctional voltage-dependent gating (Vj-gating. This article reviews recent studies conducted on a series of mutations/chimeras in the NT domain of connexin50 (Cx50. Functional examination of the gap junction channels formed by these mutants/chimeras shows the net charge number at the NT domain to be an important factor in γj and in Vj-gating. Furthermore, with an increase in the net negative charge at the NT domain, we observed an increase in the γj, as well as changes in the parameters of the Boltzmann fit of the normalized steady-state conductance and Vj relationship. Our data are consistent with a structural model where the NT domain of Cx50 lines the gap junction pore and plays an important role in sensing Vj and in the subsequent conformational changes leading to gating, as well as in limiting the rate of ion permeation.

Overproduction and secretion of a novel amino-terminal form of parathyroid hormone from a severe type of parathyroid hyperplasia in uremia.

Science.gov (United States)

Arakawa, Toshio; D'Amour, Pierre; Rousseau, Louise; Brossard, Jean-Hugues; Sakai, Makoto; Kasumoto, Hiroomi; Igaki, Naoya; Goto, Takeo; Cantor, Tom; Fukagawa, Masafumi

2006-05-01

Measurement of bioactive parathyroid hormone (PTH) is essential for optimal management of bone abnormalities in dialysis patients. This can be accomplished by PTH measurements using third-generation PTH assays, which detect more or less of the first six amino acids of the PTH structure. Such assays do not detect non-(1-84) PTH fragments, such as human PTH (7-84), which are recognized by the second-generation PTH assays that use a detection antibody that recognizes an epitope within the 13-34 region of the PTH structure. Therefore, third-generation PTH results are expected to be lower than those that are obtained with second-generation PTH assays. Rare exceptions to this rule have been reported for patients with severe primary hyperparathyroidism or parathyroid cancer. Sera and gland extracts were analyzed from a dialysis patient with high bone turnover disease and with surprising higher PTH levels by a third-generation assay than by a second-generation assay. This finding normalized after the surgical removal of an enlarged gland with a single nodule, an advanced type of nodular hyperplasia. HPLC fractionation of sera and gland extracts revealed the overproduction and secretion of a PTH molecule with an intact amino-terminus structure distinct from (1-84) PTH. This form of PTH was readily detectable by third-generation PTH assays but was poorly reactive in second-generation PTH assays. Therefore, parathyroid glands with advanced uremic nodular hyperplasia may overproduce and secrete a novel, biologically active form of PTH with an intact 1-6 region but a presumably modified 12-18 region required for the detection in second-generation PTH assays.

Fusion expression and high-level preparation of a glycine-rich ...

African Journals Online (AJOL)

STORAGESEVER

2009-09-15

Sep 15, 2009 ... SK66, a derivative of the gene cg13551 of Drosophila containing 66 amino acid peptide with N-terminal serine and C-terminal lysine, shows high antimicrobial activities. To obtain it in large amounts, the mature DNA fragment of SK66 was acquired from the pMD18-T-SK66 simple vector using PCR and then.

PTH Assays: Understanding What We Have and Forecasting What We Will Have

Directory of Open Access Journals (Sweden)

Jose Gilberto H. Vieira

2012-01-01

Full Text Available Parathyroid hormone (PTH assays have evolved continuously for the last 50 years. Since the first radioimmunoassay was described in 1963, several assays based on immunological identification have been published (first generation assays. The routine assays used nowadays are immunometric “sandwich-type”. They are based on two different monoclonal antibodies, one amino-terminal and the other carboxyl terminal specific. These second generation assays are widely available and adapted to most of the automation platforms. The specificity of the amino terminal antibody defines if the immunometric assay measures only the bioactive PTH circulating form (including the first amino terminal amino acids or the “intact” PTH, which includes, besides bioactive PTH, other “long” carboxyl-terminal forms, for example, 7–84-PTH. Assays for “intact” PTH are the most commonly available and the potential advantage of the bioactive PTH assays is still debatable. Next generation of assays will be based on different principles, mainly mass spectrometry in samples submitted to a prior purification and fragmentation steps. These assays will provide information about the whole spectra of PTH peptides in circulation, with a significant increase of the information regarding this biologically important peptide hormone.

A Propensity for n-omega-Amino Acids in Thermally-Altered Antarctic Meteorites

Science.gov (United States)

Burton, Aaron S.; Elsila, Jamie E.; Callahan, Michael P.; Martin, Mildred G.; Glavin, Daniel P.; Johnson, Natasha M.; Dworkin, Jason P.

2012-01-01

Carbonaceous meteorites are known to contain a wealth of indigenous organic molecules, including amino acids, which suggests that these meteorites could have been an important source of prebiotic organic material during the origins of life on Earth and possibly elsewhere. We report the detection of extraterrestrial amino acids in thermally-altered type 3 CV and CO carbonaceous chondrites and ureilites recovered from Antarctica. The amino acid concentrations of the thirteen Antarctic meteorites were generally less abundant than in more amino acid-rich CI, CM, and CR carbonaceous chondrites that experienced much lower temperature aqueous alteration on their parent bodies. In contrast to low-temperature aqueously-altered meteorites that show complete structural diversity in amino acids formed predominantly by Strecker-cyanohydrin synthesis, the thermally-altered meteorites studied here are dominated by small, straight-chain, amine terminal (n-omega-amino) amino acids that are not consistent with Strecker formation. The carbon isotopic ratios of two extraterrestrial n-omega-amino acids measured in one of the CV chondrites are consistent with C-13-depletions observed previously in hydrocarbons produced by Fischer-Tropsch type reactions. The predominance of n-omega-amino acid isomers in thermally-altered meteorites hints at cosmochemical mechanisms for the preferential formation and preservation of a small subset of the possible amino acids.

Structure-activity relationships of the antimicrobial peptide arasin 1 - and mode of action studies of the N-terminal, proline-rich region.

Directory of Open Access Journals (Sweden)

Victoria S Paulsen

Full Text Available Arasin 1 is a 37 amino acid long proline-rich antimicrobial peptide isolated from the spider crab, Hyas araneus. In this work the active region of arasin 1 was identified through structure-activity studies using different peptide fragments derived from the arasin 1 sequence. The pharmacophore was found to be located in the proline/arginine-rich NH(2 terminus of the peptide and the fragment arasin 1(1-23 was almost equally active to the full length peptide. Arasin 1 and its active fragment arasin 1(1-23 were shown to be non-toxic to human red blood cells and arasin 1(1-23 was able to bind chitin, a component of fungal cell walls and the crustacean shell. The mode of action of the fully active N-terminal arasin 1(1-23 was explored through killing kinetic and membrane permeabilization studies. At the minimal inhibitory concentration (MIC, arasin 1(1-23 was not bactericidal and had no membrane disruptive effect. In contrast, at concentrations of 5×MIC and above it was bactericidal and interfered with membrane integrity. We conclude that arasin 1(1-23 has a different mode of action than lytic peptides, like cecropin P1. Thus, we suggest a dual mode of action for arasin 1(1-23 involving membrane disruption at peptide concentrations above MIC, and an alternative mechanism of action, possibly involving intracellular targets, at MIC.

Deletion of a 197-Amino-Acid Region in the N-Terminal Domain of Spike Protein Attenuates Porcine Epidemic Diarrhea Virus in Piglets.

Science.gov (United States)

Hou, Yixuan; Lin, Chun-Ming; Yokoyama, Masaru; Yount, Boyd L; Marthaler, Douglas; Douglas, Arianna L; Ghimire, Shristi; Qin, Yibin; Baric, Ralph S; Saif, Linda J; Wang, Qiuhong

2017-07-15

We previously isolated a porcine epidemic diarrhea virus (PEDV) strain, PC177, by blind serial passaging of the intestinal contents of a diarrheic piglet in Vero cell culture. Compared with the highly virulent U.S. PEDV strain PC21A, the tissue culture-adapted PC177 (TC-PC177) contains a 197-amino-acid (aa) deletion in the N-terminal domain of the spike (S) protein. We orally inoculated neonatal, conventional suckling piglets with TC-PC177 or PC21A to compare their pathogenicities. Within 7 days postinoculation, TC-PC177 caused mild diarrhea and lower fecal viral RNA shedding, with no mortality, whereas PC21A caused severe clinical signs and 55% mortality. To investigate whether infection with TC-PC177 can induce cross-protection against challenge with a highly virulent PEDV strain, all the surviving piglets were challenged with PC21A at 3 weeks postinoculation. Compared with 100% protection in piglets initially inoculated with PC21A, 88% and 100% TC-PC177- and mock-inoculated piglets had diarrhea following challenge, respectively, indicating incomplete cross-protection. To investigate whether this 197-aa deletion was the determinant for the attenuation of TC-PC177, we generated a mutant (icPC22A-S1Δ197) bearing the 197-aa deletion from an infectious cDNA clone of the highly virulent PEDV PC22A strain (infectious clone PC22A, icPC22A). In neonatal gnotobiotic pigs, the icPC22A-S1Δ197 virus caused mild to moderate diarrhea, lower titers of viral shedding, and no mortality, whereas the icPC22A virus caused severe diarrhea and 100% mortality. Our data indicate that deletion of this 197-aa fragment in the spike protein can attenuate a highly virulent PEDV, but the virus may lose important epitopes for inducing robust protective immunity. IMPORTANCE The emerging, highly virulent PEDV strains have caused substantial economic losses worldwide. However, the virulence determinants are not established. In this study, we found that a 197-aa deletion in the N-terminal region

Optimization of dendrimer structure for sentinel lymph node imaging: Effects of generation and terminal group.

Science.gov (United States)

Niki, Yuichiro; Ogawa, Mikako; Makiura, Rie; Magata, Yasuhiro; Kojima, Chie

2015-11-01

The detection of the sentinel lymph node (SLN), the first lymph node draining tumor cells, is important in cancer diagnosis and therapy. Dendrimers are synthetic macromolecules with highly controllable structures, and are potent multifunctional imaging agents. In this study, 12 types of dendrimer of different generations (G2, G4, G6, and G8) and different terminal groups (amino, carboxyl, and acetyl) were prepared to determine the optimal dendrimer structure for SLN imaging. Radiolabeled dendrimers were intradermally administrated to the right footpads of rats. All G2 dendrimers were predominantly accumulated in the kidney. Amino-terminal, acetyl-terminal, and carboxyl-terminal dendrimers of greater than G4 were mostly located at the injection site, in the blood, and in the SLN, respectively. The carboxyl-terminal dendrimers were largely unrecognized by macrophages and T-cells in the SLN. Finally, SLN detection was successfully performed by single photon emission computed tomography imaging using carboxyl-terminal dendrimers of greater than G4. The early detection of tumor cells in the sentinel draining lymph nodes (SLN) is of utmost importance in terms of determining cancer prognosis and devising treatment. In this article, the authors investigated various formulations of dendrimers to determine the optimal one for tumor detection. The data generated from this study would help clinicians to fight the cancer battle in the near future. Copyright © 2015 Elsevier Inc. All rights reserved.

Structure of the N-terminal Gyrase B fragment in complex with ADP⋅Pi reveals rigid-body motion induced by ATP hydrolysis.

Directory of Open Access Journals (Sweden)

Frédéric V Stanger

Full Text Available Type II DNA topoisomerases are essential enzymes that catalyze topological rearrangement of double-stranded DNA using the free energy generated by ATP hydrolysis. Bacterial DNA gyrase is a prototype of this family and is composed of two subunits (GyrA, GyrB that form a GyrA2GyrB2 heterotetramer. The N-terminal 43-kDa fragment of GyrB (GyrB43 from E. coli comprising the ATPase and the transducer domains has been studied extensively. The dimeric fragment is competent for ATP hydrolysis and its structure in complex with the substrate analog AMPPNP is known. Here, we have determined the remaining conformational states of the enzyme along the ATP hydrolysis reaction path by solving crystal structures of GyrB43 in complex with ADP⋅BeF3, ADP⋅Pi, and ADP. Upon hydrolysis, the enzyme undergoes an obligatory 12° domain rearrangement to accommodate the 1.5 Å increase in distance between the γ- and β-phosphate of the nucleotide within the sealed binding site at the domain interface. Conserved residues from the QTK loop of the transducer domain (also part of the domain interface couple the small structural change within the binding site with the rigid body motion. The domain reorientation is reflected in a significant 7 Å increase in the separation of the two transducer domains of the dimer that would embrace one of the DNA segments in full-length gyrase. The observed conformational change is likely to be relevant for the allosteric coordination of ATP hydrolysis with DNA binding, cleavage/re-ligation and/or strand passage.

Determination of L-AP4-bound human mGlu8 receptor amino terminal domain structure and the molecular basis for L-AP4’s group III mGlu receptor functional potency and selectivity

Energy Technology Data Exchange (ETDEWEB)

Schkeryantz, Jeffery M.; Chen, Qi; Ho, Joseph D.; Atwell, Shane; Zhang, Aiping; Vargas, Michelle C.; Wang, Jing; Monn, James A.; Hao, Junliang (Lilly)

2018-02-01

Here, L-2-Amino-4-phosphonobutyric acid (L-AP4) is a known potent and selective agonist for the Group III mGlu receptors. However, it does not show any selectivity among the individual group III mGlu subtypes. In order to understand the molecular basis for this group selectivity, we solved the first human mGlu8 amino terminal domain (ATD) crystal structures in complex with L-glu and L-AP4. In comparison with other published L-glu-bound mGlu ATD structures, we have observed L-glu binds in a significantly different manner in mGlu1. Furthermore, these new structures provided evidence that both the electronic and steric nature of the distal phosphate of L-AP4 contribute to its exquisite Group III functional agonist potency and selectivity.

Murine protein H is comprised of 20 repeating units, 61 amino acids in length

DEFF Research Database (Denmark)

Kristensen, Torsten; Tack, B F

1986-01-01

A cDNA library constructed from size-selected (greater than 28 S) poly(A)+ RNA isolated from the livers of C57B10. WR mice was screened by using a 249-base-pair (bp) cDNA fragment encoding 83 amino acid residues of human protein H as a probe. Of 120,000 transformants screened, 30 hybridized......, 448 bp of 3'-untranslated sequence, and a polyadenylylated tail of undetermined length. Murine pre-protein H was deduced to consist of an 18-amino acid signal peptide and 1216 residues of H-protein sequence. Murine H was composed of 20 repetitive units, each about 61 amino acid residues in length...

Characterization of the C-terminal ER membrane anchor of PTP1B

International Nuclear Information System (INIS)

Anderie, Ines; Schulz, Irene; Schmid, Andreas

2007-01-01

The tyrosine phosphatase PTP1B is an important regulator of cell function. In living cells PTP1B activity is restricted to the vicinity of the endoplasmic reticulum (ER) by post-translational C-terminal attachment of PTP1B to the ER membrane network. In our study we investigated the membrane anchor of PTP1B by use of EGFP fusion proteins. We demonstrate that the membrane anchor of PTP1B cannot be narrowed down to a unique amino acid sequence with a defined start and stop point but rather is moveable within several amino acids. Removal of up to seven amino acids from the C-terminus, as well as exchange of single amino acids in the putative transmembrane sequence did not influence subcellular localization of PTP1B. With the method of bimolecular fluorescence complementation we could demonstrate dimerization of PTP1B in vivo. Homodimerization was, in contrast to other tail-anchored proteins, not dependent on the membrane anchor. Our data demonstrate that the C-terminal membrane anchor of PTP1B is formed by a combination of a single stretch transmembrane domain (TMD) followed by a tail. TMD and tail length are variable and there are no sequence-specific features. Our data for PTP1B are consistent with a concept that explains the ER membrane anchor of tail-anchored proteins as a physicochemical structure

Biochemical Characterization of Mycobacterium smegmatis RnhC (MSMEG_4305), a Bifunctional Enzyme Composed of Autonomous N-Terminal Type I RNase H and C-Terminal Acid Phosphatase Domains.

Science.gov (United States)

Jacewicz, Agata; Shuman, Stewart

2015-08-01

Mycobacterium smegmatis encodes several DNA repair polymerases that are adept at incorporating ribonucleotides, which raises questions about how ribonucleotides in DNA are sensed and removed. RNase H enzymes, of which M. smegmatis encodes four, are strong candidates for a surveillance role. Here, we interrogate the biochemical activity and nucleic acid substrate specificity of M. smegmatis RnhC, a bifunctional RNase H and acid phosphatase. We report that (i) the RnhC nuclease is stringently specific for RNA:DNA hybrid duplexes; (ii) RnhC does not selectively recognize and cleave DNA-RNA or RNA-DNA junctions in duplex nucleic acid; (iii) RnhC cannot incise an embedded monoribonucleotide or diribonucleotide in duplex DNA; (iv) RnhC can incise tracts of 4 or more ribonucleotides embedded in duplex DNA, leaving two or more residual ribonucleotides at the cleaved 3'-OH end and at least one or two ribonucleotides on the 5'-PO4 end; (v) the RNase H activity is inherent in an autonomous 140-amino-acid (aa) N-terminal domain of RnhC; and (vi) the C-terminal 211-aa domain of RnhC is an autonomous acid phosphatase. The cleavage specificity of RnhC is clearly distinct from that of Escherichia coli RNase H2, which selectively incises at an RNA-DNA junction. Thus, we classify RnhC as a type I RNase H. The properties of RnhC are consistent with a role in Okazaki fragment RNA primer removal or in surveillance of oligoribonucleotide tracts embedded in DNA but not in excision repair of single misincorporated ribonucleotides. RNase H enzymes help cleanse the genome of ribonucleotides that are present either as ribotracts (e.g., RNA primers) or as single ribonucleotides embedded in duplex DNA. Mycobacterium smegmatis encodes four RNase H proteins, including RnhC, which is characterized in this study. The nucleic acid substrate and cleavage site specificities of RnhC are consistent with a role in initiating the removal of ribotracts but not in single-ribonucleotide surveillance. Rnh

Synthetic study on prion protein fragments using a SPPS and native chemical ligation

Czech Academy of Sciences Publication Activity Database

Zawada, Z.; Šebestík, Jaroslav; Bednárová, Lucie; Bouř, Petr; Hlaváček, Jan; Stibor, Ivan

2009-01-01

Roč. 37, Suppl. 1 (2009), s. 44-44 ISSN 0939-4451. [International Congress on Amino Acids, Peptides and Proteins /11./. 03.08.2009-07.08.2009, Vienna] Institutional research plan: CEZ:AV0Z40550506 Keywords : prion protein * SPPS * native chemical ligation * fragments Subject RIV: CC - Organic Chemistry

Quantitative analysis of Terminal Restriction Fragment Length Polymorphism (T-RFLP microbial community profiles: peak height data showed to be more reproducible than peak area Análise quantitativa de perfis de T-RFLP de comunidades microbianas: dados de altura de picos mostraram-se mais reprodutíveis do que os de área

Directory of Open Access Journals (Sweden)

Roberto A. Caffaro-Filho

2007-12-01

Full Text Available Terminal Restriction Fragment Length Polymorphism (T-RFLP is a culture-independent fingerprinting method for microbial community analysis. Profiles generated by an automated electrophoresis system can be analysed quantitatively using either peak height or peak area data. Statistical testing demontrated that peak height data showed to be more reproducible than peak area data.Terminal Restriction Fragment Length Polymorphism (T-RFLP é um método molecular, independente de cultivo, para análise de comunidades microbianas. Perfis gerados por um sistema automatizado de eletroforese podem ser analisados quantitativamente usando dados de altura ou área dos picos. Os dados de altura mostraram-se mais reprodutíveis do que os de área.

Sperm DNA fragmentation, recurrent implantation failure and recurrent miscarriage

Directory of Open Access Journals (Sweden)

Carol Coughlan

2015-01-01

Full Text Available Evidence is increasing that the integrity of sperm DNA may also be related to implantation failure and recurrent miscarriage (RM. To investigate this, the sperm DNA fragmentation in partners of 35 women with recurrent implantation failure (RIF following in vitro fertilization, 16 women diagnosed with RM and seven recent fathers (control were examined. Sperm were examined pre- and post-density centrifugation by the sperm chromatin dispersion (SCD test and the terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL assay. There were no significant differences in the age of either partner or sperm concentration, motility or morphology between three groups. Moreover, there were no obvious differences in sperm DNA fragmentation measured by either test. However, whilst on average sperm DNA fragmentation in all groups was statistically lower in prepared sperm when measured by the SCD test, this was not seen with the results from the TUNEL assay. These results do not support the hypothesis that sperm DNA fragmentation is an important cause of RIF or RM, or that sperm DNA integrity testing has value in such patients. It also highlights significant differences between test methodologies and sperm preparation methods in interpreting the data from sperm DNA fragmentation tests.

Radioimmunoassays of parathyroid hormone: Clinical value of the midregion and c-terminal assay

International Nuclear Information System (INIS)

Hengst, K.; Raidt, H.; Hoegemann, B.; Wagner, H.

1984-01-01

PTH was measured by midregion and carboxy-terminal assay in 20 patients suffering from primary hyperparathyroidism, 30 patients with secondary hyperparathyroidism, 10 persons with tertiary hyperparathyroidism, 50 patients who underwent transplantation of the kidney, 10 patients with hypoparathyroidism and 10 patients with other hypocalcemia as well as in 50 normal persons. Diagnosing hyperparathyroidism both assays were successful, when serum kreatinine was within the normal range. Especially midregion fragments became elevated, when serum kreatinine was above 2,0 mg. During renal failure diagnosis of hyperparathyroidism and hypoparathyroidism is more difficult. In normal renal function, however, the midregion assay is more sensitive for diagnosis of hypoparathyroidism compared to the carboxy-terminal assay. After kidney transplantation midregion levels of PTH are elevated, perhaps because of a failure of the transplanted kidney to eliminate the midregion fragment. (orig.) [de

Distribution of a Nocardia brasiliensis Catalase Gene Fragment in Members of the Genera Nocardia, Gordona, and Rhodococcus

Science.gov (United States)

Vera-Cabrera, Lucio; Johnson, Wendy M.; Welsh, Oliverio; Resendiz-Uresti, Francisco L.; Salinas-Carmona, Mario C.

1999-01-01

An immunodominant protein from Nocardia brasiliensis, P61, was subjected to amino-terminal and internal sequence analysis. Three sequences of 22, 17, and 38 residues, respectively, were obtained and compared with the protein database from GenBank by using the BLAST system. The sequences showed homology to some eukaryotic catalases and to a bromoperoxidase-catalase from Streptomyces violaceus. Its identity as a catalase was confirmed by analysis of its enzymatic activity on H2O2 and by a double-staining method on a nondenaturing polyacrylamide gel with 3,3′-diaminobenzidine and ferricyanide; the result showed only catalase activity, but no peroxidase. By using one of the internal amino acid sequences and a consensus catalase motif (VGNNTP), we were able to design a PCR assay that generated a 500-bp PCR product. The amplicon was analyzed, and the nucleotide sequence was compared to the GenBank database with the observation of high homology to other bacterial and eukaryotic catalases. A PCR assay based on this target sequence was performed with primers NB10 and NB11 to confirm the presence of the NB10-NB11 gene fragment in several N. brasiliensis strains isolated from mycetoma. The same assay was used to determine whether there were homologous sequences in several type strains from the genera Nocardia, Rhodococcus, Gordona, and Streptomyces. All of the N. brasiliensis strains presented a positive result but only some of the actinomycetes species tested were positive in the PCR assay. In order to confirm these findings, genomic DNA was subjected to Southern blot analysis. A 1.7-kbp band was observed in the N. brasiliensis strains, and bands of different molecular weight were observed in cross-reacting actinomycetes. Sequence analysis of the amplicons of selected actinomycetes showed high homology in this catalase fragment, thus demonstrating that this protein is highly conserved in this group of bacteria. PMID:10325357

Purification and characterization of a branched-chain amino acid aminotransferase from Lactobacillus paracasei subsp paracasei CHCC 2115

DEFF Research Database (Denmark)

Thage, B.V.; Rattray, F.P.; Laustsen, M.W.

2004-01-01

Purification and characterization of an aminotransferase (AT) specific for the degradation of branched-chain amino acids from Lactobacillus paracasei subsp. paracasei CHCC 2115. Methods and Results: The purification protocol consisted of anion exchange chromatography, affinity chromatography...... of other metal ions, thiol- and carbonyl-binding agents. The N-terminal sequence of the enzyme was SVNIDWNNLGFDYMQLPYRYVAHXKDGVXD, and had at the amino acid level, 60 and 53% identity to a branched-chain amino acid AT of Lact. plantarum and Lactococcus lactis, respectively. Conclusions: The results suggest...

Influence of the Amino Acid Sequence on Protein-Mineral Interactions in Soil

Science.gov (United States)

Chacon, S. S.; Reardon, P. N.; Purvine, S.; Lipton, M. S.; Washton, N.; Kleber, M.

2017-12-01

The intimate associations between protein and mineral surfaces have profound impacts on nutrient cycling in soil. Proteins are an important source of organic C and N, and a subset of proteins, extracellular enzymes (EE), can catalyze the depolymerization of soil organic matter (SOM). Our goal was to determine how variation in the amino acid sequence could influence a protein's susceptibility to become chemically altered by mineral surfaces to infer the fate of adsorbed EE function in soil. We hypothesized that (1) addition of charged amino acids would enhance the adsorption onto oppositely charged mineral surfaces (2) addition of aromatic amino acids would increase adsorption onto zero charged surfaces (3) Increase adsorption of modified proteins would enhance their susceptibility to alterations by redox active minerals. To test these hypotheses, we generated three engineered proxies of a model protein Gb1 (IEP 4.0, 6.2 kDA) by inserting either negatively charged, positively charged or aromatic amino acids in the second loop. These modified proteins were allowed to interact with functionally different mineral surfaces (goethite, montmorillonite, kaolinite and birnessite) at pH 5 and 7. We used LC-MS/MS and solution-state Heteronuclear Single Quantum Coherence Spectroscopy NMR to observe modifications on engineered proteins as a consequence to mineral interactions. Preliminary results indicate that addition of any amino acids to a protein increase its susceptibility to fragmentation and oxidation by redox active mineral surfaces, and alter adsorption to the other mineral surfaces. This suggest that not all mineral surfaces in soil may act as sorbents for EEs and chemical modification of their structure should also be considered as an explanation for decrease in EE activity. Fragmentation of proteins by minerals can bypass the need to produce proteases, but microbial acquisition of other nutrients that require enzymes such as cellulases, ligninases or phosphatases

Monitoring of antibiotic-induced alterations in the human intestinal microflora and detection of probiotic strains by use of terminal restriction fragment length polymorphism.

Science.gov (United States)

Jernberg, Cecilia; Sullivan, Asa; Edlund, Charlotta; Jansson, Janet K

2005-01-01

Terminal restriction fragment length polymorphism (T-RFLP) was investigated as a tool for monitoring the human intestinal microflora during antibiotic treatment and during ingestion of a probiotic product. Fecal samples from eight healthy volunteers were taken before, during, and after administration of clindamycin. During treatment, four subjects were given a probiotic, and four subjects were given a placebo. Changes in the microbial intestinal community composition and relative abundance of specific microbial populations in each subject were monitored by using viable counts and T-RFLP fingerprints. T-RFLP was also used to monitor specific bacterial populations that were either positively or negatively affected by clindamycin. Some dominant bacterial groups, such as Eubacterium spp., were easily monitored by T-RFLP, while they were hard to recover by cultivation. Furthermore, the two probiotic Lactobacillus strains were easily tracked by T-RFLP and were shown to be the dominant Lactobacillus community members in the intestinal microflora of subjects who received the probiotic.

Electron ionization and dissociation of aliphatic amino acids

Science.gov (United States)

Papp, P.; Shchukin, P.; Kočíšek, J.; Matejčík, Š.

2012-09-01

We present experimental and theoretical study of electron ionization and dissociative ionization to the gas phase amino acids valine, leucine, and isoleucine. A crossed electron/molecular beams technique equipped with quadrupole mass analyzer has been applied to measure mass spectra and ion efficiency curves for formation of particular ions. From experimental data the ionization energies of the molecules and the appearance energies of the fragment ions were determined. Ab initio calculations (Density Functional Theory and G3MP2 methods) were performed in order to calculate the fragmentation paths and interpret the experimental data. The experimental ionization energies of parent molecules [P]+ 8.91 ± 0.05, 8.85 ± 0.05, and 8.79 ± 0.05 eV and G3MP2 ionization energies (adiabatic) of 8.89, 8.88, and 8.81 eV were determined for valine, leucine, and isoleucine, respectively, as well as the experimental and theoretical threshold energies for dissociative ionization channels. The comparison of experimental data with calculations resulted in identification of the ions as well as the neutral fragments formed in the dissociative reactions. Around 15 mass/charge ratio fragments were identified from the mass spectra by comparison of experimental appearance energies with calculated reaction enthalpies for particular dissociative reactions.

A Convenient Approach to Synthesizing Peptide C-Terminal N-Alkyl Amides

Science.gov (United States)

Fang, Wei-Jie; Yakovleva, Tatyana; Aldrich, Jane V.

2014-01-01

Peptide C-terminal N-alkyl amides have gained more attention over the past decade due to their biological properties, including improved pharmacokinetic and pharmacodynamic profiles. However, the synthesis of this type of peptide on solid phase by current available methods can be challenging. Here we report a convenient method to synthesize peptide C-terminal N-alkyl amides using the well-known Fukuyama N-alkylation reaction on a standard resin commonly used for the synthesis of peptide C-terminal primary amides, the PAL-PEG-PS (Peptide Amide Linker-polyethylene glycol-polystyrene) resin. The alkylation and oNBS deprotection were conducted under basic conditions and were therefore compatible with this acid labile resin. The alkylation reaction was very efficient on this resin with a number of different alkyl iodides or bromides, and the synthesis of model enkephalin N-alkyl amide analogs using this method gave consistently high yields and purities, demonstrating the applicability of this methodology. The synthesis of N-alkyl amides was more difficult on a Rink amide resin, especially the coupling of the first amino acid to the N-alkyl amine, resulting in lower yields for loading the first amino acid onto the resin. This method can be widely applied in the synthesis of peptide N-alkyl amides. PMID:22252422

Variations in the cytoplasmic region account for the heterogeneity of the chicken MHC class I (B-F) molecules

DEFF Research Database (Denmark)

Møller, L B; Kaufman, J; Verland, S

1991-01-01

. Unlike the parent proteins, the Mr 36,000 fragment derived from isolated variants yielded identical, simple patterns in two-dimensional gel electrophoresis and identical finger prints in peptide mapping. This, together with N-terminal amino acid sequencing, as well as comparison of hydrophobicity...

Diacylglycerol Acyltransferase 1 Is Regulated by Its N-Terminal Domain in Response to Allosteric Effectors.

Science.gov (United States)

Caldo, Kristian Mark P; Acedo, Jeella Z; Panigrahi, Rashmi; Vederas, John C; Weselake, Randall J; Lemieux, M Joanne

2017-10-01

Diacylglycerol acyltransferase 1 (DGAT1) is an integral membrane enzyme catalyzing the final and committed step in the acyl-coenzyme A (CoA)-dependent biosynthesis of triacylglycerol (TAG). The biochemical regulation of TAG assembly remains one of the least understood areas of primary metabolism to date. Here, we report that the hydrophilic N-terminal domain of Brassica napus DGAT1 (BnaDGAT1 1-113 ) regulates activity based on acyl-CoA/CoA levels. The N-terminal domain is not necessary for acyltransferase activity and is composed of an intrinsically disordered region and a folded segment. We show that the disordered region has an autoinhibitory function and a dimerization interface, which appears to mediate positive cooperativity, whereas the folded segment of the cytosolic region was found to have an allosteric site for acyl-CoA/CoA. Under increasing acyl-CoA levels, the binding of acyl-CoA with this noncatalytic site facilitates homotropic allosteric activation. Enzyme activation, on the other hand, is prevented under limiting acyl-CoA conditions (low acyl-CoA-to-CoA ratio), whereby CoA acts as a noncompetitive feedback inhibitor through interaction with the same folded segment. The three-dimensional NMR solution structure of the allosteric site revealed an α-helix with a loop connecting a coil fragment. The conserved amino acid residues in the loop interacting with CoA were identified, revealing details of this important regulatory element for allosteric regulation. Based on these results, a model is proposed illustrating the role of the N-terminal domain of BnaDGAT1 as a positive and negative modulator of TAG biosynthesis. © 2017 American Society of Plant Biologists. All Rights Reserved.

Amino Acid Chemistry as a Link Between Small Solar System Bodies and Carbonaceous Chondrites

Science.gov (United States)

Glavin, Daniel P.; Ehrenfreund, Pascale; Botta, Oliver; Cooper, George; Bada, Jeffrey L.

2000-01-01

Establishing chemical links between meteorites and small solar system bodies, such as comets and asteroids, provides a tool for investigating the processes that occurred during the formation of the solar system. Carbonaceous meteorites are of particular interest, since they may have seeded the early Earth with a variety of prebiotic organic compounds including amino acids, purines and pyrimidines, which are thought to be necessary for the origin of life. Here we report the results of high-performance liquid chromatography (HPLC) based amino acid analyses of the acid-hydrolyzed hot water extracts from pristine interior pieces of the CI carbonaceous chondrites Orgueil and Ivuna and the CM meteorites Murchison and Murray. We found that the CI meteorites Orgueil and Ivuna contained high abundances of beta-alanine and glycine, while only traces of other amino acids like alanine, alpha-amino-n-butryic acid (ABA) and alpha-aminoisobutyric acid (AIB) were detected in these meteorites. Carbon isotopic measurements of beta-alanine and glycine in Orgueil by gas chromatography combustion-isotope ratio mass spectrometry clearly indicate an extraterrestrial origin of these amino acids. The amino acid composition of Orgueil and Ivuna was strikingly different from the CM chondrites Murchison and Murray. The most notable difference was the high relative abundance of B-alanine in Orgueil and Ivuna compared to Murchison and Murray. Furthermore, AIB, which is one of the most abundant amino acids found in Murchison and Murray, was present in only trace amounts in Orgueil and Ivuna. Our amino acid data strongly suggest that the CI meteorites Orgueil and Ivuna came from a different type of parent body than the CM meteorites Murchison and Murray, possibly from an extinct comet. It is generally thought that carbonaceous meteorites are fragments of larger asteroidal bodies delivered via near Earth objects (NEO). Orbital and dynamic studies suggest that both fragments of main belt asteroids

Amino Acids in Asteroids and Comets: Implications for the Origin of Life on Earth and Possibly Elsewhere

Science.gov (United States)

Glavin, Daniel

2012-01-01

Meteorites provide a record of the chemical processes that occurred in the early solar system before life began on Earth. The delivery of organic matter by asteroids, comets, and their fragments to the Earth and other planetary bodies in our solar system could have been an important source of the prebiotic organic inventory needed for the emergence of life. Amino acids are essential components of proteins and enzymes in life on Earth and these prebiotic organic compounds have been detected in a wide variety of carbon-rich meteorites, the majority of which have been determined to be extraterrestrial in origin. In addition, many amino acids are structurally chiral (they possess handedness) and with a few very rare exceptions, only left handed (L) amino acids are found in biology, while all known abiotic syntheses of amino acids result in equal mixtures of left and right handed (LD) amino acids. The discovery of a significant left handed amino acid imbalance of up to 20% in several different carbonaceous meteorites, could point toward a possible prebiotic contribution to the origin of biological homochirality by the exogenous delivery of extraterrestrial organic material to the early Earth. In this talk, I will focus on recent state-of-the-art measurements of the distribution, chirality, and isotopic composition of amino acids in meteorites and cometary samples carried out at the Goddard Astrobiology Analytical Laboratory. Results from the analyses of a variety of Antarctic meteorites, samples from comet Wild 2 returned by the STARDUST mission, and meteorite fragments of asteroid 2008 TC3 called Almahata Sitta recovered from northern Sudan will be discussed

Discrimination among individuals using terminal restriction fragment length polymorphism profiling of bacteria derived from forensic evidence.

Science.gov (United States)

Nishi, Eiji; Tashiro, Yukihiro; Sakai, Kenji

2015-05-01

DNA typing from forensic evidence is commonly used to identify individuals. However, when the quantity of the forensic evidence is insufficient, successful identification using DNA typing is impossible. Such evidence may also contain DNA from bacteria that occur naturally on the skin. In this study, we aimed to establish a profiling method using terminal restriction fragment length polymorphisms (T-RFLPs) of the amplified bacterial 16S ribosomal RNA (rRNA) gene. First, the extraction and digestion processes were investigated, and the T-RFLP profiling method using the 16S rRNA gene amplicon was optimized. We then used this method to compare the profiles of bacterial flora from the hands of 12 different individuals. We found that the T-RFLP profiles from one person on different days displayed higher similarity than those between individuals. In a principal component analysis (PCA), T-RFLPs from each individual were closely clustered in 11 out of 12 cases. The clusters could be distinguished from each other, even when the samples were collected from different conditions. No major change of the profile was observed after six months except in two cases. When handprints on glass plates were compared, 11 of 12 individuals were assigned to a few clusters including the cluster corresponding to the correct individual. In conclusion, a method for reproducible T-RFLP profiling of bacteria from trace amounts of handprints was established. The profiles were obtained for particular individuals clustered in PCA and were experimentally separable from other individuals in most cases. This technique could provide useful information for narrowing down a suspect in a criminal investigation.

Targeting lysine specific demethylase 4A (KDM4A) tandem TUDOR domain - A fragment based approach.

Science.gov (United States)

Upadhyay, Anup K; Judge, Russell A; Li, Leiming; Pithawalla, Ron; Simanis, Justin; Bodelle, Pierre M; Marin, Violeta L; Henry, Rodger F; Petros, Andrew M; Sun, Chaohong

2018-06-01

The tandem TUDOR domains present in the non-catalytic C-terminal half of the KDM4A, 4B and 4C enzymes play important roles in regulating their chromatin localizations and substrate specificities. They achieve this regulatory role by binding to different tri-methylated lysine residues on histone H3 (H3-K4me3, H3-K23me3) and histone H4 (H4-K20me3) depending upon the specific chromatin environment. In this work, we have used a 2D-NMR based fragment screening approach to identify a novel fragment (1a), which binds to the KDM4A-TUDOR domain and shows modest competition with H3-K4me3 binding in biochemical as well as in vitro cell based assays. A co-crystal structure of KDM4A TUDOR domain in complex with 1a shows that the fragment binds stereo-specifically to the methyl lysine binding pocket forming a network of strong hydrogen bonds and hydrophobic interactions. We anticipate that the fragment 1a can be further developed into a novel allosteric inhibitor of the KDM4 family of enzymes through targeting their C-terminal tandem TUDOR domain. Copyright © 2018 Elsevier Ltd. All rights reserved.

Gamma-carboxylation and fragmentation of osteocalcin in human serum defined by mass spectrometry

Science.gov (United States)

Serum osteocalcin (Oc) concentration is a highly specific measure of bone turnover, but its circulating proteoform(s) have not been well defined. Based on immunological methods, the major forms are thought to be the intact polypeptide and a large N-terminal-mid molecule fragment for which there is n...

Interstellar Grains as Amino Acid Factories and the Origin of Life

Science.gov (United States)

Sorrell, Wilfred H.

1997-09-01

Some two decades ago, Hoyle and Wickramasinghe (1976) proposed that the physical conditions inside dense molecular clouds favour the formation of amino acids and complex organic polymers. There now exists both astronomical and laboratory evidence supporting this idea. Recent millimeter array observations have discovered the amino acid glycine (NH2CH2COOH) in the gas phase of the dense star-forming cloud Sagittarius B2. These observations would pose serious problems for present-day theories of molecule formation in space because it is unlikely that glycline can form by the gas-phase reaction schemes normally considered for dense cloud chemistry. Several laboratory experiments suggest a new paradigm in which amino acids and other large organic molecules are chemically manufactured inside the bulk interior of icy grain mantles photoprocessed by direct and scattered ultraviolet starlight. Frequent chemical explosions of the processed mantles would eject large fragments of organic dust into the ambient cloud. Large dust fragments break up into smaller ones by sputtering and ultimately by photodissociation of individual molecules. Hence, a sizeable column density (N≈ 1010-1015 cm-2) of amino acids would be present in the gaseous medium as a consequence of balancing the rate of supply from exploding mantles with the rate of molecule destruction. Exploding mantles can therefore solve the longstanding molecule desorption problem for interstellar dense cloud chemistry. A sizeable fraction of the organic dust population can survive destruction and seed primitive planetary systems throughout our galaxy with prebiological organic molecules needed for proteins and nucleic acids in living organisms. This possibility provides fresh grounds for a new version of the old panspermia hypothesis first introduced by Anaxagoras. It is shown that panspermia is more important than asteroid and cometary organic depositions onto primitive Earth. Furthermore, no appeal to Miller

Yeast carboxypeptidase Y vacuolar targeting signal is defined by four propeptide amino acids

DEFF Research Database (Denmark)

Valls, L A; Winther, Jakob R.; Stevens, T H

1990-01-01

The amino-terminal propeptide of carboxypeptidase Y (CPY) is necessary and sufficient for targeting this glycoprotein to the vacuole of Saccharomyces cerevisiae. A 16 amino acid stretch of the propeptide was subjected to region-directed mutagenesis using randomized oligonucleotides. Mutations...... sort and deliver only the wild-type molecule to the vacuole. These results indicate that the PRC1 missorting mutations are cis-dominant, implying that the mutant forms of proCPY are secreted as a consequence of failing to interact with the sorting apparatus, rather than a general poisoning...

Automated main-chain model building by template matching and iterative fragment extension.

Science.gov (United States)

Terwilliger, Thomas C

2003-01-01

An algorithm for the automated macromolecular model building of polypeptide backbones is described. The procedure is hierarchical. In the initial stages, many overlapping polypeptide fragments are built. In subsequent stages, the fragments are extended and then connected. Identification of the locations of helical and beta-strand regions is carried out by FFT-based template matching. Fragment libraries of helices and beta-strands from refined protein structures are then positioned at the potential locations of helices and strands and the longest segments that fit the electron-density map are chosen. The helices and strands are then extended using fragment libraries consisting of sequences three amino acids long derived from refined protein structures. The resulting segments of polypeptide chain are then connected by choosing those which overlap at two or more C(alpha) positions. The fully automated procedure has been implemented in RESOLVE and is capable of model building at resolutions as low as 3.5 A. The algorithm is useful for building a preliminary main-chain model that can serve as a basis for refinement and side-chain addition.

N-terminal pro-atrial natriuretic peptide measurement in plasma suggests covalent modification

DEFF Research Database (Denmark)

Hunter, Ingrid; Alehagen, Urban; Dahlström, Ulf

2011-01-01

different proANP assays on clinical outcome. METHODS: We examined 474 elderly patients with symptoms of heart failure presenting in a primary healthcare setting. Samples were analyzed with an automated immunoluminometric midregion proANP (MR-proANP) assay and a new processing-independent assay (PIA.......74 (95% CI, 0.66–0.81); P = 0.32]. The prognostic ability to report cardiovascular mortality during a 10-year follow-up revealed AUC values of 0.66 (95% CI, 0.60–0.71) for the proANP PIA and 0.69 (95% CI, 0.63–0.74) for the MR-proANP assay (P = 0.08, for comparing the 2 assays). CONCLUSIONS: Our data......BACKGROUND: The N-terminal fragment of cardiac-derived pro–B-type natriuretic peptide is a glycosylated polypeptide. It is unknown whether N-terminal pro–atrial natriuretic peptide (proANP) fragments are also covalently modified. We therefore evaluated the clinical performance of 2 distinctly...

Human liver phosphatase 2A: cDNA and amino acid sequence of two catalytic subunit isotypes

International Nuclear Information System (INIS)

Arino, J.; Woon, Chee Wai; Brautigan, D.L.; Miller, T.B. Jr.; Johnson, G.L.

1988-01-01

Two cDNA clones were isolated from a human liver library that encode two phosphatase 2A catalytic subunits. The two cDNAs differed in eight amino acids (97% identity) with three nonconservative substitutions. All of the amino acid substitutions were clustered in the amino-terminal domain of the protein. Amino acid sequence of one human liver clone (HL-14) was identical to the rabbit skeletal muscle phosphatase 2A cDNA (with 97% nucleotide identity). The second human liver clone (HL-1) is encoded by a separate gene, and RNA gel blot analysis indicates that both mRNAs are expressed similarly in several human clonal cell lines. Sequence comparison with phosphatase 1 and 2A indicates highly divergent amino acid sequences at the amino and carboxyl termini of the proteins and identifies six highly conserved regions between the two proteins that are predicted to be important for phosphatase enzymatic activity

Diversity analysis of bacterial community compositions in sediments of urban lakes by terminal restriction fragment length polymorphism (T-RFLP).

Science.gov (United States)

Zhao, Dayong; Huang, Rui; Zeng, Jin; Yan, Wenming; Wang, Jianqun; Ma, Ting; Wang, Meng; Wu, Qinglong L

2012-11-01

Bacteria are crucial components in lake sediments and play important role in various environmental processes. Urban lakes in the densely populated cities are often small, shallow, highly artificial and hypereutrophic compared to rural and natural lakes and have been overlooked for a long time. In the present study, bacterial community compositions in surface sediments of three urban lakes (Lake Mochou, Lake Qianhu and Lake Zixia) in Nanjing City, China, were investigated using the terminal restriction fragment length polymorphism (T-RFLP) of PCR-amplified 16S rRNA gene and clone libraries. Remarkable differences in the T-RFLP patterns were observed in different lakes or different sampling stations of the same lake. Canonical correspondence analysis indicated that total nitrogen (TN) had significant effects on bacterial community structure in the lake sediments. Chloroflexi were the most dominant bacterial group in the clone library from Lake Mochou (21.7 % of the total clones) which was partly associated with its higher TN and organic matters concentrations. However, Bacteroidetes appeared to be dominated colonizers in the sediments of Lake Zixia (20.4 % of the total clones). Our study gives a comprehensive insight into the structure of bacterial community of urban lake sediments, indicating that the environmental factors played a key role in influencing the bacterial community composition in the freshwater ecosystems.

Primary structure of human alpha 2-macroglobulin. I. Isolation of the 26 CNBr fragments, amino acid sequence of 13 small CNBr fragments, amino acid sequence of methionine-containing peptides, and alignment of all CNBr fragments

DEFF Research Database (Denmark)

Sottrup-Jensen, Lars; Stepanik, T M; Jones, C M

1984-01-01

-775). These fragments account for 603 of the 1451 residues of the subunits of alpha 2-macroglobulin. CB2 contains two glucosamine-based carbohydrate groups attached to Asn-23 and Asn-38, and one internal disulfide bridge connecting Cys-16 with Cys-54. CB6 contains one glucosamine-based carbohydrate group attached...... to Asn-1 and two internal disulfide bridges (Cys-5 bound to Cys-53 and Cys-23 bound to Cys-41, respectively); Cys-32 is bound to Cys-16 in CB8. CB7 contains two glucosamine-based carbohydrate groups attached to Asn-78 and Asn-92, CB8 contains 1 Cys residue (Cys-16), bridged to Cys-32 of CB6. CB11...

Effects of two novel amino acid substitutions on the penicillin binding properties of the PBP5 C‑terminal from Enterococcus faecium.

Science.gov (United States)

Zhou, Chengjiang; Niu, Haiying; Yu, Hui; Zhou, Lishe; Wang, Zhanli

2015-10-01

The low‑affinity penicillin‑binding protein (PBP)5 is responsible for resistance to β‑lactam antibiotics in Enterococcus faecium. (E. faecium). In order to evaluate more fully the potential of this species for the development of resistance to β-lactam antibiotics, the present study aimed to examine the extent of penicillin-binding protein (PBP) variations in a collection of clinical E. faecium isolates. In the present study, the C‑terminal domain of PBP5 (PBP5‑CD) of 13 penicillin‑resistant clinical isolates of E. faecium were sequenced and the correlation between penicillin resistance and particular amino acid changes were analyzed. The present study identified for the first time, to the best of our knowledge, two novel substitutions (Tyr460Phe and Ala462Thr or Val462Thr) of E. faecium PBP5‑CD. The covalent interaction between penicillin and PBP5‑CD was also investigated using homology modeling and molecular docking methods. The theoretical calculation revealed that Phe460 and Thr462 were involved in penicillin binding, suggesting that substitutions at these positions exert effects on the affinity for penicillin, and this increased affinity translates into lower resistance in vitro.

In vitro digestion and physicochemical characteristics of corn starch mixed with amino acid modified by low pressure treatment.

Science.gov (United States)

Ji, Ying

2018-03-01

The digestibility and molecular structure of corn starch mixed with amino acid modified by low-pressure treatment (LPT) was investigated. Amino acid induced a significant increase in the slowly digestible starch (SDS) and decrease in the rapidly digestible starch (RDS) after LPT. The reason is the formation of ester bond between the molecular chains of amino acid and starch. Low pressure treatment altered greatly the morphology of corn starch mixed with or without amino acid. After LPT, less ordered Maltese and more granule fragments were observed for starch-amino acid complex. An increase in size distribution was obvious after LPT and the size distribution curves provided from a new variety. We found that higher enthalpy and relative crystallinity of the starch-amino acid complex were associated with a higher SDS content. It can be inferred that LPT had a greater impact on the digestion and structural characterization of corn starch mixed with amino acids. Copyright © 2017 Elsevier Ltd. All rights reserved.

A 17-kDa Fragment of Lactoferrin Associates With the Termination of Inflammation and Peptides Within Promote Resolution

Directory of Open Access Journals (Sweden)

Aviv Lutaty

2018-03-01

Full Text Available During the resolution of inflammation, macrophages engulf apoptotic polymorphonuclear cells (PMN and can accumulate large numbers of their corpses. Here, we report that resolution phase macrophages acquire the neutrophil-derived glycoprotein lactoferrin (Lf and fragments thereof in vivo and ex vivo. During the onset and resolving phases of inflammation in murine peritonitis and bovine mastitis, Lf fragments of 15 and 17 kDa occurred in various body fluids, and the murine fragmentation, accumulation, and release were mediated initially by neutrophils and later by efferocytic macrophages. The 17-kDa fragment contained two bioactive tripeptides, FKD and FKE that promoted resolution phase macrophage conversion to a pro-resolving phenotype. This resulted in a reduction in peritoneal macrophage numbers and an increase in the CD11blow subset of these cells. Moreover, FKE, but not FKD, peptides enhanced efferocytosis of apoptotic PMN, reduced TNFα and interleukin (IL-6, and increased IL-10 secretion by lipopolysaccharide-stimulated macrophages ex vivo. In addition, FKE promoted neutrophil-mediated resolution at high concentrations (100 µM by enhancing the formation of cytokine-scavenging aggregated NETs (tophi at a low cellular density. Thus, PMN Lf is processed, acquired, and “recycled” by neutrophils and macrophages during inflammation resolution to generate fragments and peptides with paramount pro-resolving activities.

Lower sperm DNA fragmentation after r-FSH administration in functional hypogonadotropic hypogonadism.

Science.gov (United States)

Ruvolo, Giovanni; Roccheri, Maria Carmela; Brucculeri, Anna Maria; Longobardi, Salvatore; Cittadini, Ettore; Bosco, Liana

2013-04-01

An observational clinical and molecular study was designed to evaluate the effects of the administration of recombinant human FSH on sperm DNA fragmentation in men with a non-classical form of hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia. In the study were included 53 men with a non-classical form of hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia. In all patients, sperm DNA fragmentation index (DFI), assessed by terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate (dUTP) in situ DNA nick end-labelling (TUNEL) assay, was evaluated before starting the treatment with 150 IU of recombinant human FSH, given three times a week for at least 3 months. Patients' semen analysis and DNA fragmentation index were re-evaluated after the 3-month treatment period. After recombinant human FSH therapy, we did not find any differences in terms of sperm count, motility and morphology. The average DNA fragmentation index was significantly reduced (21.15 vs 15.2, p15 %), while no significant variation occurred in the patients with DFI values ≤ 15 %. Recombinant human FSH administration improves sperm DNA integrity in hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia men with DNA fragmentation index value >15 % .

Computational Analysis of the Interaction Energies between Amino Acid Residues of the Measles Virus Hemagglutinin and Its Receptors

Directory of Open Access Journals (Sweden)

Fengqi Xu

2018-05-01

Full Text Available Measles virus (MV causes an acute and highly devastating contagious disease in humans. Employing the crystal structures of three human receptors, signaling lymphocyte-activation molecule (SLAM, CD46, and Nectin-4, in complex with the measles virus hemagglutinin (MVH, we elucidated computationally the details of binding energies between the amino acid residues of MVH and those of the receptors with an ab initio fragment molecular orbital (FMO method. The calculated inter-fragment interaction energies (IFIEs revealed a number of significantly interacting amino acid residues of MVH that played essential roles in binding to the receptors. As predicted from previously reported experiments, some important amino-acid residues of MVH were shown to be common but others were specific to interactions with the three receptors. Particularly, some of the (non-polar hydrophobic residues of MVH were found to be attractively interacting with multiple receptors, thus indicating the importance of the hydrophobic pocket for intermolecular interactions (especially in the case of Nectin-4. In contrast, the electrostatic interactions tended to be used for specific molecular recognition. Furthermore, we carried out FMO calculations for in silico experiments of amino acid mutations, finding reasonable agreements with virological experiments concerning the substitution effect of residues. Thus, the present study demonstrates that the electron-correlated FMO method is a powerful tool to search exhaustively for amino acid residues that contribute to interactions with receptor molecules. It is also applicable for designing inhibitors of MVH and engineered MVs for cancer therapy.

Overexpression and Purification of C-terminal Fragment of the Passenger Domain of Hap Protein from Nontypeable Haemophilus influenzae in a Highly Optimized Escherichia coli Expression System

Science.gov (United States)

Tabatabaee, Akram; Siadat, Seyed Davar; Moosavi, Seyed Fazllolah; Aghasadeghi, Mohammad Reza; Memarnejadian, Arash; Pouriayevali, Mohammad Hassan; Yavari, Neda

2013-01-01

Background Nontypeable Haemophilus influenzae (NTHi) is a common cause of respiratory tract disease and initiates infection by colonization in nasopharynx. The Haemophilus influenzae (H. influenzae) Hap adhesin is an auto transporter protein that promotes initial interaction with human epithelial cells. Hap protein contains a 110 kDa internal passenger domain called “HapS” and a 45 kDa C-terminal translocator domain called “Hapβ”. Hap adhesive activity has been recently reported to be connected to its Cell Binding Domain (CBD) which resides within the 311 C-terminal residues of the internal passenger domain of the protein. Furthermore, immunization with this CBD protein has been shown to prevent bacterial nasopharynx colonization in animal models. Methods To provide enough amounts of pure HapS protein for vaccine studies, we sought to develop a highly optimized system to overexpress and purify the protein in large quantities. To this end, pET24a-cbd plasmid harboring cbd sequence from NTHi ATCC49766 was constructed and its expression was optimized by testing various expression parameters such as growth media, induction temperature, IPTG inducer concentration, induction stage and duration. SDS-PAGE and Western-blotting were used for protein analysis and confirmation and eventually the expressed protein was easily purified via immobilized metal affinity chromatography (IMAC) using Ni-NTA columns. Results The highest expression level of target protein was achieved when CBD expressing E. coli BL21 (DE3) cells were grown at 37°C in 2xTY medium with 1.0 mM IPTG at mid-log phase (OD600 nm equal to 0.6) for 5 hrs. Amino acid sequence alignment of expressed CBD protein with 3 previously published CBD amino acid sequences were more than %97 identical and antigenicity plot analysis further revealed 9 antigenic domains which appeared to be well conserved among different analyzed CBD sequences. Conclusion Due to the presence of high similarity among CBD from NTHi ATCC

Preliminary studies on fragmentation in tissue-equivalent material produced by 55 MeV/u 40Ar17+ ion beam

International Nuclear Information System (INIS)

Dang Bingrong; Wei Zengquan; Duan Limin; Zhang Baoguo; Li Songlin; Yin Xu; Zhu Yongtai; Li Wenjian; Li Qiang; Yuan Shibin

2002-01-01

By using a 55 MeV/u 40 Ar 17+ beam produced by HIRFL, the distribution of fragments in 1.5 mm lucite on three different directions were measured at the radiobiology terminal. Feasibilities of the phoswich detector composed of fast plastic scintillator and CsI(Tl) detectors for determination of angular distribution of fragments in tissue-equivalent materials were investigated. The results obtained were satisfactory

Identification of a nonsense mutation at amino acid 584-arginine of platelet glycoprotein IIb in patients with type I glanzmann thrombasthenia

International Nuclear Information System (INIS)

Gu Jianming; Xu Wenfeng; Wang Xiaodong; Wu Qingyu; Qi Zhengwu; Ruan Changgeng

1993-08-01

Using southern blot, the restriction digests of genomic DNAs in eleven patients with Glanzmann thrombasthenia from ten unrelated kindred were probed with a platelet full-length GP IIb cDNA. An abnormal 2.3 kb Taq I fragment and two 1.65 kb and 0.65 kb fragments with reduced band intensity were found in the genes of two affected siblings from a family originated in city Huang Yan of Zhejiang Province. The Taq I digest of the abnormal gene was further probed with three portions of GP IIb cDNA, revealing that the heterozygous mutation was present in the region around exons 15 ∼ 17 of the GP IIb gene. Two primers for polymerase chain reaction (PCR) were then designed, and a 394 bp PCR product was generated and sequenced, indicating that a stop codon was substituted for an Arg codon at amino acid position 584 of GP IIb, and brought about a premature termination of translation and production of a shortened protein. The Western blot analysis showed that GP IIb and GP IIIa at the platelet surface were apparently deficient, it may be ascribed to the rapid turn-over of GP IIIa uncomplexed with the truncated GP II b. The abnormal 2.3 kb Tag I fragment was used as a specific genetic marker to detect the carrier status of the patient's family. The abnormal allele was proved to be derived from the mother, the two affected siblings are double heterozygotes carrying two different GP II b-defective alleles and one clinically unaffected sister has also inherited this defective allele, while the father carries another unidentified recessive abnormal GP IIb-defective allele

Intestinal microbiota is different in women with preterm birth: results from terminal restriction fragment length polymorphism analysis.

Directory of Open Access Journals (Sweden)

Arihiro Shiozaki

Full Text Available Preterm birth is a leading cause of perinatal morbidity and mortality. Studies using a cultivation method or molecular identification have shown that bacterial vaginosis is one of the risk factors for preterm birth. However, an association between preterm birth and intestinal microbiota has not been reported using molecular techniques, although the vaginal microbiota changes during pregnancy. Our aim here was to clarify the difference in intestinal and vaginal microbiota between women with preterm birth and women without preterm labor. 16S ribosomal ribonucleic acid genes were amplified from fecal and vaginal DNA by polymerase chain reaction. Using terminal restriction fragment length polymorphism (T-RFLP, we compared the levels of operational taxonomic units of both intestinal and vaginal flora among three groups: pregnant women who delivered term babies without preterm labor (non-PTL group (n = 20, those who had preterm labor but delivered term babies (PTL group (n = 11, and those who had preterm birth (PTB group (n = 10. Significantly low levels of Clostridium subcluster XVIII, Clostridium cluster IV, Clostridium subcluster XIVa, and Bacteroides, and a significantly high level of Lactobacillales were observed in the intestinal microbiota in the PTB group compared with those in the non-PTL group. The levels of Clostridium subcluster XVIII and Clostridium subcluster XIVa in the PTB group were significantly lower than those in the PTL group, and these levels in the PTL group were significantly lower than those in non-PTL group. However, there were no significant differences in vaginal microbiota among the three groups. Intestinal microbiota in the PTB group was found to differ from that in the non-PTL group using the T-RFLP method.

Terminal Restriction Fragment Length Polymorphism Analysis of Soil Bacterial Communities under Different Vegetation Types in Subtropical Area.

Directory of Open Access Journals (Sweden)

Zeyan Wu

Full Text Available Soil microbes are active players in energy flow and material exchange of the forest ecosystems, but the research on the relationship between the microbial diversity and the vegetation types is less conducted, especially in the subtropical area of China. In this present study, the rhizosphere soils of evergreen broad-leaf forest (EBF, coniferous forest (CF, subalpine dwarf forest (SDF and alpine meadow (AM were chosen as test sites. Terminal-restriction fragment length polymorphisms (T-RFLP analysis was used to detect the composition and diversity of soil bacterial communities under different vegetation types in the National Natural Reserve of Wuyi Mountains. Our results revealed distinct differences in soil microbial composition under different vegetation types. Total 73 microbes were identified in soil samples of the four vegetation types, and 56, 49, 46 and 36 clones were obtained from the soils of EBF, CF, SDF and AM, respectively, and subsequently sequenced. The Actinobacteria, Fusobacterium, Bacteroidetes and Proteobacteria were the most predominant in all soil samples. The order of Shannon-Wiener index (H of all soil samples was in the order of EBF>CF>SDF>AM, whereas bacterial species richness as estimated by four restriction enzymes indicated no significant difference. Principal component analysis (PCA revealed that the soil bacterial communities' structures of EBF, CF, SDF and AM were clearly separated along the first and second principal components, which explained 62.17% and 31.58% of the total variance, respectively. The soil physical-chemical properties such as total organic carbon (TOC, total nitrogen (TN, total phosphorus (TP and total potassium (TK were positively correlated with the diversity of bacterial communities.

Intestinal microbiota is different in women with preterm birth: results from terminal restriction fragment length polymorphism analysis.

Science.gov (United States)

Shiozaki, Arihiro; Yoneda, Satoshi; Yoneda, Noriko; Yonezawa, Rika; Matsubayashi, Takamichi; Seo, Genichiro; Saito, Shigeru

2014-01-01

Preterm birth is a leading cause of perinatal morbidity and mortality. Studies using a cultivation method or molecular identification have shown that bacterial vaginosis is one of the risk factors for preterm birth. However, an association between preterm birth and intestinal microbiota has not been reported using molecular techniques, although the vaginal microbiota changes during pregnancy. Our aim here was to clarify the difference in intestinal and vaginal microbiota between women with preterm birth and women without preterm labor. 16S ribosomal ribonucleic acid genes were amplified from fecal and vaginal DNA by polymerase chain reaction. Using terminal restriction fragment length polymorphism (T-RFLP), we compared the levels of operational taxonomic units of both intestinal and vaginal flora among three groups: pregnant women who delivered term babies without preterm labor (non-PTL group) (n = 20), those who had preterm labor but delivered term babies (PTL group) (n = 11), and those who had preterm birth (PTB group) (n = 10). Significantly low levels of Clostridium subcluster XVIII, Clostridium cluster IV, Clostridium subcluster XIVa, and Bacteroides, and a significantly high level of Lactobacillales were observed in the intestinal microbiota in the PTB group compared with those in the non-PTL group. The levels of Clostridium subcluster XVIII and Clostridium subcluster XIVa in the PTB group were significantly lower than those in the PTL group, and these levels in the PTL group were significantly lower than those in non-PTL group. However, there were no significant differences in vaginal microbiota among the three groups. Intestinal microbiota in the PTB group was found to differ from that in the non-PTL group using the T-RFLP method.

Alteration of the mode of antibacterial action of a defensin by the amino-terminal loop substitution

Energy Technology Data Exchange (ETDEWEB)

Gao, Bin [Group of Animal Innate Immunity, State Key Laboratory of Integrated Management of Pest Insects and Rodents, Institute of Zoology, Chinese Academy of Sciences, 1 Beichen West Road, Chaoyang District, 100101 Beijing (China); Zhu, Shunyi, E-mail: Zhusy@ioz.ac.cn [Group of Animal Innate Immunity, State Key Laboratory of Integrated Management of Pest Insects and Rodents, Institute of Zoology, Chinese Academy of Sciences, 1 Beichen West Road, Chaoyang District, 100101 Beijing (China)

2012-10-05

Highlights: Black-Right-Pointing-Pointer Al-M is an engineered fungal defensin with the n-loop of an insect defensin. Black-Right-Pointing-Pointer Al-M adopts a native defensin-like structure with high antibacterial potency. Black-Right-Pointing-Pointer Al-M kills bacteria through a membrane disruptive mechanism. Black-Right-Pointing-Pointer This work sheds light on the functional evolution of CS{alpha}{beta}-type defensins. -- Abstract: Ancient invertebrate-type and classical insect-type defensins (AITDs and CITDs) are two groups of evolutionarily related antimicrobial peptides (AMPs) that adopt a conserved cysteine-stabilized {alpha}-helical and {beta}-sheet (CS{alpha}{beta}) fold with a different amino-terminal loop (n-loop) size and diverse modes of antibacterial action. Although they both are identified as inhibitors of cell wall biosynthesis, only CITDs evolved membrane disruptive ability by peptide oligomerization to form pores. To understand how this occurred, we modified micasin, a fungus-derived AITDs with a non-membrane disruptive mechanism, by substituting its n-loop with that of an insect-derived CITDs. After air oxidization, the synthetic hybrid defensin (termed Al-M) was structurally identified by circular dichroism (CD) and functionally evaluated by antibacterial and membrane permeability assays and electronic microscopic observation. Results showed that Al-M folded into a native-like defensin structure, as determined by its CD spectrum that is similar to that of micasin. Al-M was highly efficacious against the Gram-positive bacterium Bacillus megaterium with a lethal concentration of 1.76 {mu}M. As expected, in contrast to micasin, Al-M killed the bacteria through a membrane disruptive mechanism of action. The alteration in modes of action supports a key role of the n-loop extension in assembling functional surface of CITDs for membrane disruption. Our work provides mechanical evidence for evolutionary relationship between AITDs and CITDs.

Alteration of the mode of antibacterial action of a defensin by the amino-terminal loop substitution

International Nuclear Information System (INIS)

Gao, Bin; Zhu, Shunyi

2012-01-01

Highlights: ► Al-M is an engineered fungal defensin with the n-loop of an insect defensin. ► Al-M adopts a native defensin-like structure with high antibacterial potency. ► Al-M kills bacteria through a membrane disruptive mechanism. ► This work sheds light on the functional evolution of CSαβ-type defensins. -- Abstract: Ancient invertebrate-type and classical insect-type defensins (AITDs and CITDs) are two groups of evolutionarily related antimicrobial peptides (AMPs) that adopt a conserved cysteine-stabilized α-helical and β-sheet (CSαβ) fold with a different amino-terminal loop (n-loop) size and diverse modes of antibacterial action. Although they both are identified as inhibitors of cell wall biosynthesis, only CITDs evolved membrane disruptive ability by peptide oligomerization to form pores. To understand how this occurred, we modified micasin, a fungus-derived AITDs with a non-membrane disruptive mechanism, by substituting its n-loop with that of an insect-derived CITDs. After air oxidization, the synthetic hybrid defensin (termed Al-M) was structurally identified by circular dichroism (CD) and functionally evaluated by antibacterial and membrane permeability assays and electronic microscopic observation. Results showed that Al-M folded into a native-like defensin structure, as determined by its CD spectrum that is similar to that of micasin. Al-M was highly efficacious against the Gram-positive bacterium Bacillus megaterium with a lethal concentration of 1.76 μM. As expected, in contrast to micasin, Al-M killed the bacteria through a membrane disruptive mechanism of action. The alteration in modes of action supports a key role of the n-loop extension in assembling functional surface of CITDs for membrane disruption. Our work provides mechanical evidence for evolutionary relationship between AITDs and CITDs.

N-terminal nesprin-2 variants regulate β-catenin signalling

Energy Technology Data Exchange (ETDEWEB)

Zhang, Qiuping; Minaisah, Rose-Marie; Ferraro, Elisa; Li, Chen; Porter, Lauren J.; Zhou, Can; Gao, Fang; Zhang, Junyi; Rajgor, Dipen; Autore, Flavia; Shanahan, Catherine M.; Warren, Derek T., E-mail: derek.warren@kcl.ac.uk

2016-07-15

The spatial compartmentalisation of biochemical signalling pathways is essential for cell function. Nesprins are a multi-isomeric family of proteins that have emerged as signalling scaffolds, herein, we investigate the localisation and function of novel nesprin-2 N-terminal variants. We show that these nesprin-2 variants display cell specific distribution and reside in both the cytoplasm and nucleus. Immunofluorescence microscopy revealed that nesprin-2 N-terminal variants colocalised with β-catenin at cell-cell junctions in U2OS cells. Calcium switch assays demonstrated that nesprin-2 and β-catenin are lost from cell-cell junctions in low calcium conditions whereas emerin localisation at the NE remained unaltered, furthermore, an N-terminal fragment of nesprin-2 was sufficient for cell-cell junction localisation and interacted with β-catenin. Disruption of these N-terminal nesprin-2 variants, using siRNA depletion resulted in loss of β-catenin from cell-cell junctions, nuclear accumulation of active β-catenin and augmented β-catenin transcriptional activity. Importantly, we show that U2OS cells lack nesprin-2 giant, suggesting that the N-terminal nesprin-2 variants regulate β-catenin signalling independently of the NE. Together, these data identify N-terminal nesprin-2 variants as novel regulators of β-catenin signalling that tether β-catenin to cell-cell contacts to inhibit β-catenin transcriptional activity. - Highlights: • N-terminal nesprin-2 variants display cell specific expression patterns. • N-terminal spectrin repeats of nesprin-2 interact with β-catenin. • N-terminal nesprin-2 variants scaffold β-catenin at cell-cell junctions.. • Nesprin-2 variants play multiple roles in β-catenin signalling.

N-terminal arginines modulate plasma-membrane localization of Kv7.1/KCNE1 channel complexes.

Directory of Open Access Journals (Sweden)

Zenawit Girmatsion

Full Text Available BACKGROUND AND OBJECTIVE: The slow delayed rectifier current (I(Ks is important for cardiac action potential termination. The underlying channel is composed of Kv7.1 α-subunits and KCNE1 β-subunits. While most evidence suggests a role of KCNE1 transmembrane domain and C-terminus for the interaction, the N-terminal KCNE1 polymorphism 38G is associated with reduced I(Ks and atrial fibrillation (a human arrhythmia. Structure-function relationship of the KCNE1 N-terminus for I(Ks modulation is poorly understood and was subject of this study. METHODS: We studied N-terminal KCNE1 constructs disrupting structurally important positively charged amino-acids (arginines at positions 32, 33, 36 as well as KCNE1 constructs that modify position 38 including an N-terminal truncation mutation. Experimental procedures included molecular cloning, patch-clamp recording, protein biochemistry, real-time-PCR and confocal microscopy. RESULTS: All KCNE1 constructs physically interacted with Kv7.1. I(Ks resulting from co-expression of Kv7.1 with non-atrial fibrillation '38S' was greater than with any other construct. Ionic currents resulting from co-transfection of a KCNE1 mutant with arginine substitutions ('38G-3xA' were comparable to currents evoked from cells transfected with an N-terminally truncated KCNE1-construct ('Δ1-38'. Western-blots from plasma-membrane preparations and confocal images consistently showed a greater amount of Kv7.1 protein at the plasma-membrane in cells co-transfected with the non-atrial fibrillation KCNE1-38S than with any other construct. CONCLUSIONS: The results of our study indicate that N-terminal arginines in positions 32, 33, 36 of KCNE1 are important for reconstitution of I(Ks. Furthermore, our results hint towards a role of these N-terminal amino-acids in membrane representation of the delayed rectifier channel complex.

Cloning and characterization of Bacillus subtilis iep, which has positive and negative effects on production of extracellular proteases.

Science.gov (United States)

Tanaka, T; Kawata, M

1988-08-01

We have isolated a DNA fragment from Bacillus subtilis 168 which, when present in a high-copy plasmid, inhibited production of extracellular alkaline and neutral proteases. The gene responsible for this activity was referred to as iep. The open reading frame of iep was found to be incomplete in the cloned DNA fragment. When the intact iep gene was reconstructed after the missing part of the iep gene had been cloned, it showed an enhancing effect on the production of the extracellular proteases. The open reading frame encodes a polypeptide of 229 amino acids with a molecular weight of ca. 25,866. Deletion of two amino acids from the N-terminal half of the putative iep protein resulted in dual effects, i.e., a decrease in the inhibitory activity shown by the incomplete iep gene and a slight increase in the enhancing activity shown by the complete iep gene. These results show that the iep gene product is a bifunctional protein, containing inhibitory and enhancing activities for the exoprotease production in the N-terminal and C-terminal regions, respectively. It was found by genetic and functional analyses that iep lies very close to sacU.

Separation of polyethylene glycols and amino-terminated polyethylene glycols by high-performance liquid chromatography under near critical conditions.

Science.gov (United States)

Wei, Y-Z; Zhuo, R-X; Jiang, X-L

2016-05-20

The separation and characterization of polyethylene glycols (PEGs) and amino-substituted derivatives on common silica-based reversed-phase packing columns using isocratic elution is described. This separation is achieved by liquid chromatography under the near critical conditions (LCCC), based on the number of amino functional end groups without obvious effect of molar mass for PEGs. The mobile phase is acetonitrile in water with an optimal ammonium acetate buffer. The separation mechanism of PEG and amino-substituted PEG under the near LCCC on silica-based packing columns is confirmed to be ion-exchange interaction. Under the LCCC of PEG backbone, with fine tune of buffer concentration, the retention factor ratios for benzylamine and phenol in buffered mobile phases, α(benzylamine/phenol)-values, were used to assess the ion-exchange capacity on silica-based reversed-phase packing columns. To the best of our knowledge, this is the first report on separation of amino-functional PEGs independent of the molar mass by isocratic elution using common C18 or phenyl reversed-phase packing columns. Copyright © 2016 Elsevier B.V. All rights reserved.

Overproduction of an amino-terminal form of PTH distinct from human PTH(1-84) in a case of severe primary hyperparathyroidism: influence of medical treatment and surgery.

Science.gov (United States)

Räkel, Agnès; Brossard, Jean-Hugues; Patenaude, Jean-Victor; Albert, Caroline; Nassif, Edgard; Cantor, Tom; Rousseau, Louise; D'Amour, Pierre

2005-06-01

an amino-terminal (N) form of PTH recognized by PTH assays with (1-4) or (26-32) epitopes but not by the T-PTH assay with a (12-18) epitope. This molecular form represented 50% of CA-PTH measured in this patient, but only 7% in less severe cases of primary hyperparathyroidism. It was unaffected by medical therapy and disappeared after surgery. The relationship between the overexpression of this N-PTH molecular form and severe primary hyperparathyroidism remains unclear. Further studies will be required in these rare patients to see whether N-PTH is a marker of less well differentiated parathyroid tumours and/or relates to the overproduction of C-PTH fragments in the presence of severe hypercalcaemia.

A domain of the Klenow fragment of Escherichia coli DNA polymerase I has polymerase but no exonuclease activity.

Science.gov (United States)

Freemont, P S; Ollis, D L; Steitz, T A; Joyce, C M

1986-09-01

The Klenow fragment of DNA polymerase I from Escherichia coli has two enzymatic activities: DNA polymerase and 3'-5' exonuclease. The crystal structure showed that the fragment is folded into two distinct domains. The smaller domain has a binding site for deoxynucleoside monophosphate and a divalent metal ion that is thought to identify the 3'-5' exonuclease active site. The larger C-terminal domain contains a deep cleft that is believed to bind duplex DNA. Several lines of evidence suggested that the large domain also contains the polymerase active site. To test this hypothesis, we have cloned the DNA coding for the large domain into an expression system and purified the protein product. We find that the C-terminal domain has polymerase activity (albeit at a lower specific activity than the native Klenow fragment) but no measurable 3'-5' exonuclease activity. These data are consistent with the hypothesis that each of the three enzymatic activities of DNA polymerase I from E. coli resides on a separate protein structural domain.

Cross-protective immunity to Leishmania amazonensis is mediated by CD4+ and CD8+-epitopes of Leishmania donovani Nucleoside Hydrolase terminal domains

Directory of Open Access Journals (Sweden)

Dirlei eNico

2014-05-01

Full Text Available The Nucleoside hydrolase of Leishmania donovani (NH36 is a phylogenetic marker of high homology among Leishmania parasites. In mice and dog vaccination NH36 induces a CD4+ T cell-driven protective response against Leishmania chagasi infection directed against its C-terminal domain (F3. The C-terminal and N-terminal domain vaccines also decreased the footpad lesion caused by Leishmania amazonensis. We studied the basis of the crossed immune response using recombinant generated peptides covering the whole NH36 sequence and saponin for mice prophylaxis against L. amazonensis. The F1 (amino acids 1-103 and F3 peptide (amino acids 199-314 vaccines enhanced the IgG and IgG2a anti-NH36 antibodies to similar levels. The F3 vaccine induced the strongest DTH response, the highest proportions of NH36-specific CD4+ and CD8+ T cells after challenge and the highest expression of IFN-γ and TNF-α. The F1 vaccine, on the other hand, induced a weaker but significant DTH response and a mild enhancement of IFN-γ and TNF-α levels. The in vivo depletion with anti-CD4 or CD8 monoclonal antibodies disclosed that cross-protection against L. amazonensis infection was mediated by a CD4+ T cell response directed against the C-terminal domain (75% of reduction of the size of footpad lesion followed by a CD8+ T cell response against the N-terminal domain of NH36 (57% of reduction of footpad lesions. Both vaccines were capable of inducing long-term cross-immunity. The amino acid sequence of NH36 showed 93% identity to the sequence of the NH A34480 of L. amazonensis which also showed the presence of completely conserved predicted epitopes for CD4+ and CD8+ T cells in F1 domain, and of CD4+ epitopes differing in a single amino acid, in F1 and F3 domains. The identification of the C-terminal and N-terminal domains as the targets of the immune response to NH36 in the model of L. amazonesis infection represents a basis for the rationale development of a bivalent vaccine

Truncation of the C-terminal region of Toscana Virus NSs protein is critical for interferon-β antagonism and protein stability.

Science.gov (United States)

Gori Savellini, Gianni; Gandolfo, Claudia; Cusi, Maria Grazia

2015-12-01

Toscana Virus (TOSV) is a Phlebovirus responsible for central nervous system (CNS) injury in humans. The TOSV non-structural protein (NSs), which interacting with RIG-I leads to its degradation, was analysed in the C terminus fragment in order to identify its functional domains. To this aim, two C-terminal truncated NSs proteins, Δ1C-NSs (aa 1-284) and Δ2C-NSs (aa 1-287) were tested. Only Δ1C-NSs did not present any inhibitory effect on RIG-I and it showed a greater stability than the whole NSs protein. Moreover, the deletion of the TLQ aa sequence interposed between the two ΔC constructs caused a greater accumulation of the protein with a weak inhibitory effect on RIG-I, indicating some involvement of these amino acids in the NSs activity. Nevertheless, all the truncated proteins were still able to interact with RIG-I, suggesting that the domains responsible for RIG-I signaling and RIG-I interaction are mapped on different regions of the protein. Copyright © 2015 Elsevier Inc. All rights reserved.

Automated main-chain model building by template matching and iterative fragment extension

International Nuclear Information System (INIS)

Terwilliger, Thomas C.

2003-01-01

A method for automated macromolecular main-chain model building is described. An algorithm for the automated macromolecular model building of polypeptide backbones is described. The procedure is hierarchical. In the initial stages, many overlapping polypeptide fragments are built. In subsequent stages, the fragments are extended and then connected. Identification of the locations of helical and β-strand regions is carried out by FFT-based template matching. Fragment libraries of helices and β-strands from refined protein structures are then positioned at the potential locations of helices and strands and the longest segments that fit the electron-density map are chosen. The helices and strands are then extended using fragment libraries consisting of sequences three amino acids long derived from refined protein structures. The resulting segments of polypeptide chain are then connected by choosing those which overlap at two or more C α positions. The fully automated procedure has been implemented in RESOLVE and is capable of model building at resolutions as low as 3.5 Å. The algorithm is useful for building a preliminary main-chain model that can serve as a basis for refinement and side-chain addition

Fragment-based lead generation: identification of seed fragments by a highly efficient fragment screening technology

Science.gov (United States)

Neumann, Lars; Ritscher, Allegra; Müller, Gerhard; Hafenbradl, Doris

2009-08-01

For the detection of the precise and unambiguous binding of fragments to a specific binding site on the target protein, we have developed a novel reporter displacement binding assay technology. The application of this technology for the fragment screening as well as the fragment evolution process with a specific modelling based design strategy is demonstrated for inhibitors of the protein kinase p38alpha. In a fragment screening approach seed fragments were identified which were then used to build compounds from the deep-pocket towards the hinge binding area of the protein kinase p38alpha based on a modelling approach. BIRB796 was used as a blueprint for the alignment of the fragments. The fragment evolution of these deep-pocket binding fragments towards the fully optimized inhibitor BIRB796 included the modulation of the residence time as well as the affinity. The goal of our study was to evaluate the robustness and efficiency of our novel fragment screening technology at high fragment concentrations, compare the screening data with biochemical activity data and to demonstrate the evolution of the hit fragments with fast kinetics, into slow kinetic inhibitors in an in silico approach.

Analysis of different DNA fragments of Corynebacterium glutamicum complementing dapE of Escherichia coli.

Science.gov (United States)

Wehrmann, A; Eggeling, L; Sahm, H

1994-12-01

In Corynebacterium glutamicum L-lysine is synthesized simultaneously via the succinylase and dehydrogenase variant of the diaminopimelate pathway. Starting from a strain with a disrupted dehydrogenase gene, three different-sized DNA fragments were isolated which complemented defective Escherichia coli mutants in the succinylase pathway. Enzyme studies revealed that in one case the dehydrogenase gene had apparently been reconstituted in the heterologous host. The two other fragments resulted in desuccinylase activity; one of them additionally in succinylase activity. However, the physical analysis showed that structural changes had taken place in all fragments. Using a probe derived from one of the fragments we isolated a 3.4 kb BamHI DNA fragment without selective pressure (by colony hybridization). This was structurally intact and proved functionally to result in tenfold desuccinylase overexpression. The nucleotide sequence of a 1966 bp fragment revealed the presence of one truncated open reading frame of unknown function and that of dapE encoding N-succinyl diaminopimelate desuccinylase (EC 3.5.1.18). The deduced amino acid sequence of the dapE gene product shares 23% identical residues with that from E. coli. The C. glutamicum gene now available is the first gene from the succinylase branch of lysine synthesis of this biotechnologically important organism.

Magnetic bead purification of labeled DNA fragments forhigh-throughput capillary electrophoresis sequencing

Energy Technology Data Exchange (ETDEWEB)

Elkin, Christopher; Kapur, Hitesh; Smith, Troy; Humphries, David; Pollard, Martin; Hammon, Nancy; Hawkins, Trevor

2001-09-15

We have developed an automated purification method for terminator sequencing products based on a magnetic bead technology. This 384-well protocol generates labeled DNA fragments that are essentially free of contaminates for less than $0.005 per reaction. In comparison to laborious ethanol precipitation protocols, this method increases the phred20 read length by forty bases with various DNA templates such as PCR fragments, Plasmids, Cosmids and RCA products. Our method eliminates centrifugation and is compatible with both the MegaBACE 1000 and ABIPrism 3700 capillary instruments. As of September 2001, this method has produced over 1.6 million samples with 93 percent averaging 620 phred20 bases as part of Joint Genome Institutes Production Process.

Detection of titin fragments in urine in response to exercise-induced muscle damage.

Directory of Open Access Journals (Sweden)

Kazue Kanda

Full Text Available Many studies have attempted to determine the associations between blood biomarkers and exercise-induced muscle damage. However, poor correlations between the changes in biomarker levels and the magnitude of muscle symptoms have been reported. Recent advances in proteomic tools offer a strategy for the comprehensive analysis of protein expression, which can be used to identify biomarkers. Here, we used a proteomic analysis to identify urinary proteins that appear in response to a calf-raise exercise, including repetitive eccentric muscle contractions, and found that a titin (also known as connectin N-terminal fragment molecule appears in the urine after eccentric exercise. We measured the titin fragment in urine samples from nine individuals before and after eccentric exercise using a newly-established enzyme-linked immunosorbent assay and found that the titin fragment excretion rate increased 96 h after the exercise (5.1 to 77.6 pg/min, p <0.01. The changes in the titin fragment excretion rate were correlated strongly with blood markers of muscle damage and with muscle symptoms. These findings suggest that the urinary titin fragment is potentially a noninvasive biomarker of muscle damage.

Stereoconversion of amino acids and peptides in uryl-pendant binol schiff bases.

Science.gov (United States)

Park, Hyunjung; Nandhakumar, Raju; Hong, Jooyeon; Ham, Sihyun; Chin, Jik; Kim, Kwan Mook

2008-01-01

(S)-2-Hydroxy-2'-(3-phenyluryl-benzyl)-1,1'-binaphthyl-3-carboxaldehyde (1) forms Schiff bases with a wide range of nonderivatized amino acids, including unnatural ones. Multiple hydrogen bonds, including resonance-assisted ones, fix the whole orientation of the imine and provoke structural rigidity around the imine C==N bond. Due to the structural difference and the increase in acidity of the alpha proton of the amino acid, the imine formed with an L-amino acid (1-l-aa) is converted into the imine of the D-amino acid (1-D-aa), with a D/L ratio of more than 10 for most amino acids at equilibrium. N-terminal amino acids in dipeptides are also predominantly epimerized to the D form upon imine formation with 1. Density functional theory calculations show that 1-D-Ala is more stable than 1-L-Ala by 1.64 kcal mol(-1), a value that is in qualitative agreement with the experimental result. Deuterium exchange of the alpha proton of alanine in the imine form was studied by (1)H NMR spectroscopy and the results support a stepwise mechanism in the L-into-D conversion rather than a concerted one; that is, deprotonation and protonation take place in a sequential manner. The deprotonation rate of L-Ala is approximately 16 times faster than that of D-Ala. The protonation step, however, appears to favor L-amino acid production, which prevents a much higher predominance of the D form in the imine. Receptor 1 and the predominantly D-form amino acid can be recovered from the imine by simple extraction under acidic conditions. Hence, 1 is a useful auxiliary to produce D-amino acids of industrial interest by the conversion of naturally occurring L-amino acids or relatively easily obtainable racemic amino acids.

Conversion of des-tyrosine-y-endorphin by brain synaptic membrane associated peptidases: identification of generated peptide fragments

NARCIS (Netherlands)

Burbach, J.P.H.; Schotman, P.; Verhoef, J.; Kloet, E.R. de; Wied, D. de

1980-01-01

Des-tyrosine-γ-endorphin, a β-endorphin fragment with neuroleptic-like properties, was digested with a cSPM fraction of rat brain. A profile of metabolites and a time course of conversion were obtained by HPLC analysis of the digests. Quantitative amino acid analysis and a second HPLC fractionation

Titan's Primordial Soup: Formation of Amino Acids via Low-Temperature Hydrolysis of Tholins

Science.gov (United States)

Neish, Catherine D.; Somogyi, Árpád; Smith, Mark A.

2010-04-01

Titan organic haze analogues, or "tholins," produce biomolecules when hydrolyzed at low temperature over long timescales. By using a combination of high-resolution mass spectroscopy and tandem mass spectrometry fragmentation techniques, four amino acids were identified in a tholin sample that had been hydrolyzed in a 13 wt % ammonia-water solution at 253 ± 1 K and 293 ± 1 K for 1 year. These four species have been assigned as the amino acids asparagine, aspartic acid, glutamine, and glutamic acid. This represents the first detection of biologically relevant molecules created under conditions thought to be similar to those found in impact melt pools and cryolavas on Titan, which are at a stage of chemical evolution not unlike the "primordial soup" of the early Earth. Future missions to Titan should therefore carry instrumentation capable of, but certainly not limited to, detecting amino acids and other prebiotic molecules on Titan's surface.

Radioimmunological assay of the biologically active fragment of the human parathyroid hormone

International Nuclear Information System (INIS)

Desplan, C.; Jullienne, A.; Raulais, D.; Rivaille, P.; Barlet, J.P.; Moukthar, M.S.; Milhaud, G.

1977-01-01

The authors describe a RIA of the biologically active fraction (N-terminal) of human parathyroid hormone. This homologous test uses antibodies obtained in goats against a N-terminal 1-34 fragment of hPTH synthetised according to the method of Niall and Coll. In this system, natural hPTH of different origin (extracts from parathyroid adenomas, adenomal culture medium, hyperparathyroid plasma, adsorption chromatography extract of normal human plasma) behaved in the same manner as the synthetic reference hormone 1-34 hPTHN. The RIA detected PTH in 65% of the normal subjects and distinguished the normal values from the values of hyperparathyroid patients, which makes it suitable for clinical practice. (AJ) [de

Docking Studies of Binding of Ethambutol to the C-Terminal Domain of the Arabinosyltransferase from Mycobacterium tuberculosis

Directory of Open Access Journals (Sweden)

Guillermo Salgado-Moran

2013-01-01

Full Text Available The binding of ethambutol to the C-terminal domain of the arabinosyltransferase from Mycobacterium tuberculosis was studied. The analysis was performed using an in silico approach in order to find out, by docking calculations and energy descriptors, the conformer of Ethambutol that forms the most stable complex with the C-terminal domain of arabinosyltransferase. The complex shows that location of the Ethambutol coincides with the cocrystallization ligand position and that amino acid residues ASH1051, ASN740, ASP1052, and ARG1055 should be critical in the binding of Ethambutol to C-terminal domain EmbC.

Telomere Restriction Fragment (TRF) Analysis.

Science.gov (United States)

Mender, Ilgen; Shay, Jerry W

2015-11-20

While telomerase is expressed in ~90% of primary human tumors, most somatic tissue cells except transiently proliferating stem-like cells do not have detectable telomerase activity (Shay and Wright, 1996; Shay and Wright, 2001). Telomeres progressively shorten with each cell division in normal cells, including proliferating stem-like cells, due to the end replication (lagging strand synthesis) problem and other causes such as oxidative damage, therefore all somatic cells have limited cell proliferation capacity (Hayflick limit) (Hayflick and Moorhead, 1961; Olovnikov, 1973). The progressive telomere shortening eventually leads to growth arrest in normal cells, which is known as replicative senescence (Shay et al. , 1991). Once telomerase is activated in cancer cells, telomere length is stabilized by the addition of TTAGGG repeats to the end of chromosomes, thus enabling the limitless continuation of cell division (Shay and Wright, 1996; Shay and Wright, 2001). Therefore, the link between aging and cancer can be partially explained by telomere biology. There are many rapid and convenient methods to study telomere biology such as Telomere Restriction Fragment (TRF), Telomere Repeat Amplification Protocol (TRAP) (Mender and Shay, 2015b) and Telomere dysfunction Induced Foci (TIF) analysis (Mender and Shay, 2015a). In this protocol paper we describe Telomere Restriction Fragment (TRF) analysis to determine average telomeric length of cells. Telomeric length can be indirectly measured by a technique called Telomere Restriction Fragment analysis (TRF). This technique is a modified Southern blot, which measures the heterogeneous range of telomere lengths in a cell population using the length distribution of the terminal restriction fragments (Harley et al. , 1990; Ouellette et al. , 2000). This method can be used in eukaryotic cells. The description below focuses on the measurement of human cancer cells telomere length. The principle of this method relies on the lack of

Presence and expression of hydrogenase specific C-terminal endopeptidases in cyanobacteria

Directory of Open Access Journals (Sweden)

Lindblad Peter

2003-05-01

Full Text Available Abstract Background Hydrogenases catalyze the simplest of all chemical reactions: the reduction of protons to molecular hydrogen or vice versa. Cyanobacteria can express an uptake, a bidirectional or both NiFe-hydrogenases. Maturation of those depends on accessory proteins encoded by hyp-genes. The last maturation step involves the cleavage of a ca. 30 amino acid long peptide from the large subunit by a C-terminal endopeptidase. Until know, nothing is known about the maturation of cyanobacterial NiFe-hydrogenases. The availability of three complete cyanobacterial genome sequences from strains with either only the uptake (Nostoc punctiforme ATCC 29133/PCC 73102, only the bidirectional (Synechocystis PCC 6803 or both NiFe-hydrogenases (Anabaena PCC 7120 prompted us to mine these genomes for hydrogenase maturation related genes. In this communication we focus on the presence and the expression of the NiFe-hydrogenases and the corresponding C-terminal endopeptidases, in the three strains mentioned above. Results We identified genes encoding putative cyanobacterial hydrogenase specific C-terminal endopeptidases in all analyzed cyanobacterial genomes. The genes are not part of any known hydrogenase related gene cluster. The derived amino acid sequences show only low similarity (28–41% to the well-analyzed hydrogenase specific C-terminal endopeptidase HybD from Escherichia coli, the crystal structure of which is known. However, computational secondary and tertiary structure modeling revealed the presence of conserved structural patterns around the highly conserved active site. Gene expression analysis shows that the endopeptidase encoding genes are expressed under both nitrogen-fixing and non-nitrogen-fixing conditions. Conclusion Anabaena PCC 7120 possesses two NiFe-hydrogenases and two hydrogenase specific C-terminal endopeptidases but only one set of hyp-genes. Thus, in contrast to the Hyp-proteins, the C-terminal endopeptidases are the only known

PPII propensity of multiple-guest amino acids in a proline-rich environment.

Science.gov (United States)

Moradi, Mahmoud; Babin, Volodymyr; Sagui, Celeste; Roland, Christopher

2011-07-07

There has been considerable debate about the intrinsic PPII propensity of amino acid residues in denatured polypeptides. Experimentally, this scale is based on the behavior of guest amino acid residues placed in the middle of proline-based hosts. We have used classical molecular dynamics simulations combined with replica-exchange methods to carry out a comprehensive analysis of the conformational equilibria of proline-based host oligopeptides with multiple guest amino acids including alanine, glutamine, valine, and asparagine. The tracked structural characteristics include the secondary structural motifs based on the Ramachandran angles and the cis/trans isomerization of the prolyl bonds. In agreement with our recent study of single amino acid guests, we did not observe an intrinsic PPII propensity in any of the guest amino acids in a multiple-guest setting. Instead, the experimental results can be explained in terms of (i) the steric restrictions imposed on the C-terminal guest amino acid that is immediately followed by a proline residue and (ii) an increase in the trans content of the prolyl bonds due to the presence of guest residues. In terms of the latter, we found that the more guests added to the system, the larger the increase in the trans content of the prolyl bonds, which results in an effective increase in the PPII content of the peptide.

PLASMA PROTEIN AND HEMOGLOBIN PRODUCTION : DELETION OF INDIVIDUAL AMINO ACIDS FROM GROWTH MIXTURE OF TEN ESSENTIAL AMINO ACIDS. SIGNIFICANT CHANGES IN URINARY NITROGEN.

Science.gov (United States)

Robscheit-Robbins, F S; Miller, L L; Whipple, G H

1947-02-28

Given healthy dogs fed abundant iron and protein-free or low protein diets with sustained anemia and hypoproteinemia, we can study the capacity of these animals to produce simultaneously new hemoglobin and plasma protein. Reserve stores of blood protein-building materials are measurably depleted and levels of 6 to 8 gm. per cent for hemoglobin and 4 to 5 gm. per cent for plasma protein can be maintained for weeks or months depending upon the intake of food proteins or amino acid mixtures. These dogs are very susceptible to infection and various poisons. Dogs tire of these diets and loss of appetite terminates many experiments. Under these conditions (double depletion) standard growth mixtures of essential amino acids are tested to show the response in blood protein output and urinary nitrogen balance. As a part of each tabulated experiment one of the essential amino acids is deleted from the complete growth mixture to compare such response with that of the whole mixture. Methionine, threonine, phenylalanine, and tryptophane when singly eliminated from the complete amino acid mixture do effect a sharp rise in urinary nitrogen. This loss of urinary nitrogen is corrected when the individual amino acid is replaced in the mixture. Histidine, lysine, and valine have a moderate influence upon urinary nitrogen balance toward nitrogen conservation. Leucine, isoleucine, and arginine have minimal or no effect upon urinary nitrogen balance when these individual amino acids are deleted from the complete growth mixture of amino acids during 3 to 4 week periods. Tryptophane and to a less extent phenylalanine and threonine when returned to the amino acid mixture are associated with a conspicuous preponderance of plasma protein output over the hemoglobin output (Table 4). Arginine, lysine, and histidine when returned to the amino acid mixture are associated with a large preponderance of hemoglobin output. Various amino acid mixtures under these conditions may give a positive

Structural inferences for the native skeletal muscle sodium channel as derived from patterns of endogenous proteolysis

International Nuclear Information System (INIS)

Kraner, S.; Yang, J.; Barchi, R.

1989-01-01

The alpha subunit (Mr approximately 260,000) of the rat skeletal muscle sodium channel is sensitive to cleavage by endogenous proteases during the isolation of muscle surface membrane. Antisera against synthetic oligopeptides were used to map the resultant fragments in order to identify protease-sensitive regions of the channel's structure in its native membrane environment. Antibodies to the amino terminus labeled major fragments of Mr approximately 130,000 and 90,000 and lesser amounts of other peptides as small as Mr approximately 12,000. Antisera to epitopes within the carboxyl-terminal half of the primary sequence recognized two fragments of Mr approximately 110,000 and 78,000. Individual antisera also selectively labeled smaller polypeptides in the most extensively cleaved preparations. The immunoreactivity patterns of monoclonal antibodies previously raised against the purified channel were then surveyed. The binding sites for one group of monoclonals, including several that recognize subtype-specific epitopes in the channel structure, were localized within a 12-kDa fragment near the amino terminus. The distribution of carbohydrate along the primary structure of the channel was also assessed by quantitating 125 I-wheat germ agglutinin and 125I-concanavalin A binding to the proteolytic peptides. Most of the carbohydrate detected by these lectins was located between 22 and 90 kDa from the amino terminus of the protein. No lectin binding was detected to fragments arising from carboxyl-terminal half of the protein. These results were analyzed in terms of current models of sodium channel tertiary structure. In its normal membrane environment, the skeletal muscle sodium channel appears sensitive to cleavage by endogenous proteases in regions predicted to link the four repeat domains on the cytoplasmic side of the membrane while the repeat domains themselves are resistant to proteolysis

Identification of N-ethylmethylamine as a novel scaffold for inhibitors of soluble epoxide hydrolase by crystallographic fragment screening.

Science.gov (United States)

Amano, Yasushi; Tanabe, Eiki; Yamaguchi, Tomohiko

2015-05-15

Soluble epoxide hydrolase (sEH) is a potential target for the treatment of inflammation and hypertension. X-ray crystallographic fragment screening was used to identify fragment hits and their binding modes. Eight fragment hits were identified via soaking of sEH crystals with fragment cocktails, and the co-crystal structures of these hits were determined via individual soaking. Based on the binding mode, N-ethylmethylamine was identified as a promising scaffold that forms hydrogen bonds with the catalytic residues of sEH, Asp335, Tyr383, and Tyr466. Compounds containing this scaffold were selected from an in-house chemical library and assayed. Although the starting fragment had a weak inhibitory activity (IC50: 800μM), we identified potent inhibitors including 2-({[2-(adamantan-1-yl)ethyl]amino}methyl)phenol exhibiting the highest inhibitory activity (IC50: 0.51μM). This corresponded to a more than 1500-fold increase in inhibitory activity compared to the starting fragment. Co-crystal structures of the hit compounds demonstrate that the binding of N-ethylmethylamine to catalytic residues is similar to that of the starting fragment. We therefore consider crystallographic fragment screening to be appropriate for the identification of weak but promising fragment hits. Copyright © 2015 Elsevier Ltd. All rights reserved.

Binding of transcription termination protein nun to nascent RNA and template DNA.

Science.gov (United States)

Watnick, R S; Gottesman, M E

1999-12-17

The amino-terminal arginine-rich motif of coliphage HK022 Nun binds phage lambda nascent transcript, whereas the carboxyl-terminal domain interacts with RNA polymerase (RNAP) and blocks transcription elongation. RNA binding is inhibited by zinc (Zn2+) and stimulated by Escherichia coli NusA. To study these interactions, the Nun carboxyl terminus was extended by a cysteine residue conjugated to a photochemical cross-linker. The carboxyl terminus contacted NusA and made Zn2+-dependent intramolecular contacts. When Nun was added to a paused transcription elongation complex, it cross-linked to the DNA template. Nun may arrest transcription by anchoring RNAP to DNA.

The terminal portion of leptospiral immunoglobulin-like protein LigA confers protective immunity against lethal infection in the hamster model of leptospirosis.

Science.gov (United States)

Silva, Everton F; Medeiros, Marco A; McBride, Alan J A; Matsunaga, Jim; Esteves, Gabriela S; Ramos, João G R; Santos, Cleiton S; Croda, Júlio; Homma, Akira; Dellagostin, Odir A; Haake, David A; Reis, Mitermayer G; Ko, Albert I

2007-08-14

Subunit vaccines are a potential intervention strategy against leptospirosis, which is a major public health problem in developing countries and a veterinary disease in livestock and companion animals worldwide. Leptospiral immunoglobulin-like (Lig) proteins are a family of surface-exposed determinants that have Ig-like repeat domains found in virulence factors such as intimin and invasin. We expressed fragments of the repeat domain regions of LigA and LigB from Leptospira interrogans serovar Copenhageni. Immunization of Golden Syrian hamsters with Lig fragments in Freund's adjuvant induced robust antibody responses against recombinant protein and native protein, as detected by ELISA and immunoblot, respectively. A single fragment, LigANI, which corresponds to the six carboxy-terminal Ig-like repeat domains of the LigA molecule, conferred immunoprotection against mortality (67-100%, P<0.05) in hamsters which received a lethal inoculum of L. interrogans serovar Copenhageni. However, immunization with this fragment did not confer sterilizing immunity. These findings indicate that the carboxy-terminal portion of LigA is an immunoprotective domain and may serve as a vaccine candidate for human and veterinary leptospirosis.

Expression of the amino-terminal half-molecule of human serum transferrin in cultured cells and characterization of the recombinant protein

International Nuclear Information System (INIS)

Funk, W.D.; MacGillivray, R.T.A.; Mason, A.B.; Brown, S.A.; Woodworth, R.C.

1990-01-01

A human liver cDNA library was screened with a synthetic oligonucleotide, complementary to the 5' region of human transferrin mRNA, as a hybridization probe. The full-length human cDNA clone isolated from this screen contained part of the 5' untranslated region, the complete coding region for the signal peptide and the two lobes of transferrin, the 3' untranslated region, and a poly(A) tail. By use of oligonucleotide-directed mutagenesis in vitro, two translational stop codons and a HindIII site were introduced after the codon for Asp-337. This fragment was inserted into two different expression vectors that were then introduced into Escherichia coli. As judged by NaDodSO 4 -polyacrylamide gel electrophoresis and Western blot analysis, however, recombinant hTF/2N was undetectable in bacteria transformed by these plasmids. Concurrently, the authors developed a plasmid vector for the expression of recombinant hTF/2N in eukaryotic cells. The recombinant hTF/2N appeared to behave identically with the proteolytically derived half-molecule, but to show a higher degree of monodispersity than the latter protein. Addition of m-fluorotyrosine to the culture medium resulted in random incorporation of this amino acid into cellular protein in lieu of tyrosine. Purified recombinant 19 F-Tyr hTF/2N gave four well-resolved 19 F NMR resonances of 20-40 Hz line width, two with suggestions of shoulders

Virtual fragment preparation for computational fragment-based drug design.

Science.gov (United States)

Ludington, Jennifer L

2015-01-01

Fragment-based drug design (FBDD) has become an important component of the drug discovery process. The use of fragments can accelerate both the search for a hit molecule and the development of that hit into a lead molecule for clinical testing. In addition to experimental methodologies for FBDD such as NMR and X-ray Crystallography screens, computational techniques are playing an increasingly important role. The success of the computational simulations is due in large part to how the database of virtual fragments is prepared. In order to prepare the fragments appropriately it is necessary to understand how FBDD differs from other approaches and the issues inherent in building up molecules from smaller fragment pieces. The ultimate goal of these calculations is to link two or more simulated fragments into a molecule that has an experimental binding affinity consistent with the additive predicted binding affinities of the virtual fragments. Computationally predicting binding affinities is a complex process, with many opportunities for introducing error. Therefore, care should be taken with the fragment preparation procedure to avoid introducing additional inaccuracies.This chapter is focused on the preparation process used to create a virtual fragment database. Several key issues of fragment preparation which affect the accuracy of binding affinity predictions are discussed. The first issue is the selection of the two-dimensional atomic structure of the virtual fragment. Although the particular usage of the fragment can affect this choice (i.e., whether the fragment will be used for calibration, binding site characterization, hit identification, or lead optimization), general factors such as synthetic accessibility, size, and flexibility are major considerations in selecting the 2D structure. Other aspects of preparing the virtual fragments for simulation are the generation of three-dimensional conformations and the assignment of the associated atomic point charges.

Amino acid analysis in physiological samples by GC-MS with propyl chloroformate derivatization and iTRAQ-LC-MS/MS.

Science.gov (United States)

Dettmer, Katja; Stevens, Axel P; Fagerer, Stephan R; Kaspar, Hannelore; Oefner, Peter J

2012-01-01

Two mass spectrometry-based methods for the quantitative analysis of free amino acids are described. The first method uses propyl chloroformate/propanol derivatization and gas chromatography-quadrupole mass spectrometry (GC-qMS) analysis in single-ion monitoring mode. Derivatization is carried out directly in aqueous samples, thereby allowing automation of the entire procedure, including addition of reagents, extraction, and injection into the GC-MS. The method delivers the quantification of 26 amino acids. The isobaric tagging for relative and absolute quantification (iTRAQ) method employs the labeling of amino acids with isobaric iTRAQ tags. The tags contain two different cleavable reporter ions, one for the sample and one for the standard, which are detected by fragmentation in a tandem mass spectrometer. Reversed-phase liquid chromatography of the labeled amino acids is performed prior to mass spectrometric analysis to separate isobaric amino acids. The commercial iTRAQ kit allows for the analysis of 42 physiological amino acids with a respective isotope-labeled standard for each of these 42 amino acids.

Characterization of crystals of an antibody-recognition fragment of the cancer differentiation antigen mesothelin in complex with the therapeutic antibody MORAb-009

International Nuclear Information System (INIS)

Ma, Jichun; Tang, Wai Kwan; Esser, Lothar; Pastan, Ira; Xia, Di

2012-01-01

The therapeutic antibody MORAb-009 disrupts the interaction of mesothelin and the ovarian cancer antigen CA-125. Crystals have been grown of the Fab fragment derived from MORAb-009 and of its complex with an N-terminal fragment of mesothelin. The mesothelin-specific monoclonal antibody MORAb-009 is capable of blocking the binding of mesothelin to CA-125 and displays promising anticancer potential. It is currently undergoing clinical trials. In order to understand the basis of the interaction between MORAb-009 and mesothelin at atomic resolution, both the Fab fragment of MORAb-009 and the complex between the Fab and an N-terminal fragment of mesothelin (residues 7–64) were crystallized. The crystals of the Fab diffracted X-rays to 1.75 Å resolution and had the symmetry of space group P4 1 2 1 2, with unit-cell parameters a = b = 140.6, c = 282.0 Å. The crystals of the mesothelin–Fab complex diffracted to 2.6 Å resolution and belonged to the hexagonal space group P6 4 , with unit-cell parameters a = b = 146.2, c = 80.9 Å. Structural analyses of these molecules are in progress

Mirrors in the PDB: left-handed alpha-turns guide design with D-amino acids.

Science.gov (United States)

Annavarapu, Srinivas; Nanda, Vikas

2009-09-22

Incorporating variable amino acid stereochemistry in molecular design has the potential to improve existing protein stability and create new topologies inaccessible to homochiral molecules. The Protein Data Bank has been a reliable, rich source of information on molecular interactions and their role in protein stability and structure. D-amino acids rarely occur naturally, making it difficult to infer general rules for how they would be tolerated in proteins through an analysis of existing protein structures. However, protein elements containing short left-handed turns and helices turn out to contain useful information. Molecular mechanisms used in proteins to stabilize left-handed elements by L-amino acids are structurally enantiomeric to potential synthetic strategies for stabilizing right-handed elements with D-amino acids. Propensities for amino acids to occur in contiguous alpha(L) helices correlate with published thermodynamic scales for incorporation of D-amino acids into alpha(R) helices. Two backbone rules for terminating a left-handed helix are found: an alpha(R) conformation is disfavored at the amino terminus, and a beta(R) conformation is disfavored at the carboxy terminus. Helix capping sidechain-backbone interactions are found which are unique to alpha(L) helices including an elevated propensity for L-Asn, and L-Thr at the amino terminus and L-Gln, L-Thr and L-Ser at the carboxy terminus. By examining left-handed alpha-turns containing L-amino acids, new interaction motifs for incorporating D-amino acids into right-handed alpha-helices are identified. These will provide a basis for de novo design of novel heterochiral protein folds.

Role of mTOR, Bad, and Survivin in RasGAP Fragment N-Mediated Cell Protection

Science.gov (United States)

Yang, Jiang-Yan; Widmann, Christian

2013-01-01

Partial cleavage of p120 RasGAP by caspase-3 in stressed cells generates an N-terminal fragment, called fragment N, which activates an anti-apoptotic Akt-dependent survival response. Akt regulates several effectors but which of these mediate fragment N-dependent cell protection has not been defined yet. Here we have investigated the role of mTORC1, Bad, and survivin in the capacity of fragment N to protect cells from apoptosis. Neither rapamycin, an inhibitor of mTORC1, nor silencing of raptor, a subunit of the mTORC1 complex, altered the ability of fragment N from inhibiting cisplatin- and Fas ligand-induced death. Cells lacking Bad, despite displaying a stronger resistance to apoptosis, were still protected by fragment N against cisplatin-induced death. Fragment N was also able to protect cells from Fas ligand-induced death in conditions where Bad plays no role in apoptosis regulation. Fragment N expression in cells did neither modulate survivin mRNA nor its protein expression. Moreover, the expression of cytoplasmic survivin, known to exert anti-apoptotic actions in cells, still occurred in UV-B-irradiated epidermis of mouse expressing a caspase-3-resistant RasGAP mutant that cannot produce fragment N. Additionally, survivin function in cell cycle progression was not affected by fragment N. These results indicate that, taken individually, mTOR, Bad, or Survivin are not required for fragment N to protect cells from cell death. We conclude that downstream targets of Akt other than mTORC1, Bad, or survivin mediate fragment N-induced protection or that several Akt effectors can compensate for each other to induce the pro-survival fragment N-dependent response. PMID:23826368

SPERM MORPHOLOGICAL ABNORMALITIES AS INDICATORS OF DNA FRAGMENTATION AND FERTILIZATION IN ASSISTED REPRODUCTION

Directory of Open Access Journals (Sweden)

Barbara Dariš

2018-02-01

Full Text Available Background. To determine the relationship between sperm morphological abnormalities, DNA fragmentation and fertilization rate in IVF and ICSI. Methods. Sperm samples from 10 IVF and 20 ICSI cycles were analyzed. Morphology was assessed according to strict criteria, and DNA fragmentation was measured by terminal deoxynucleotidyl transferase (TdT-mediated fluorescein-dUTP nick end labelling (TUNEL using a flow cytometry. Results. There was a significant difference in the amount of morphological abnormalities between sperm samples with low (< 20 % and high (≥ 20 % degree of DNA fragmentation. The percentages of amorphous heads (10 vs. 4 % and overall head abnormalities (42 vs. 30 % were significantly higher in sperm samples with elevated degree of DNA fragmentation. No correlation was found between sperm DNA fragmentation and fertilization rate after IVF and ICSI. When the predominant morphological abnormality in sperm samples was determined, a negative correlation was found between the percentage of spermatozoa with elongated heads and fertilization rate in ICSI (r = –0.45, P < 0.05. The fertilization rate after IVF was lower in the case of acrosomal abnormalities (35.3 %, compared to the cases of other predominant morphological abnormalities. Conclusions. Head abnormalities, especially amorphous heads, are related to elevated degree of DNA fragmentation. Predominant abnormal form in sperm samples, such as elongated heads and acrosomal abnormalities, may affect fertilization in ART.

Structure of the RBD-PRDI fragment of the antiterminator protein GlcT

International Nuclear Information System (INIS)

Himmel, Sebastian; Grosse, Christian; Wolff, Sebastian; Schwiegk, Claudia; Becker, Stefan

2012-01-01

The crystal structure of the RBD-PRDI fragment of the antiterminator protein GlcT from Bacillus subtilis has been solved at 2 Å resolution. The structure represents an inactive state of the protein. GlcT is a transcriptional antiterminator protein that is involved in regulation of glucose metabolism in Bacillus subtilis. Antiterminator proteins bind specific RNA sequences, thus preventing the formation of overlapping terminator stem-loops. The structure of a fragment (residues 3–170) comprising the RNA-binding domain (RBD) and the first regulatory domain (PRDI) of GlcT was solved at 2.0 Å resolution with one molecule in the asymmetric unit. The two domains are connected by a helical linker. Their interface is mostly constituted by hydrophobic interactions

[3H]Azidodantrolene photoaffinity labeling, synthetic domain peptides and monoclonal antibody reactivity identify the dantrolene binding sequence on RyR1

Energy Technology Data Exchange (ETDEWEB)

Paul-Pletzer, Kalanethee; Yamamoto, Takeshi; Bhat, Manju B.; Ma, Jianjie; Ikemoto, Noriaki; Jimenez, Leslie S.; Morimoto, Hiromi; Williams, Philip G.; Parness, Jerome

2002-06-14

Dantrolene is a drug that suppresses intracellular Ca2+ release from sarcoplasmic reticulum in normal skeletal muscle and is used as a therapeutic agent in individuals susceptible to malignant hyperthermia. Though its precise mechanism of action has not been elucidated, we have identified the N-terminal region (amino acids 1-1400) of the skeletal muscle isoform of the ryanodine receptor (RyR1), the primary Ca2+ release channel in sarcoplasmic reticulum, as a molecular target for dantrolene using the photoaffinity analog [3H]azidodantrolene(1). Here, we demonstrate that heterologously expressed RyR1 retains its capacity to be specifically labeled with [3H]azidodantrolene,indicating that muscle specific factors are not required for this ligand-receptor interaction. Synthetic domain peptides of RyR1, previously shown to affect RyR1 function in vitro and in vivo, were exploited as potential drug binding site mimics and used in photoaffinity labeling experiments. Only DP1 and DP1-2, peptide s containing the amino acid sequence corresponding to RyR1 residues 590-609, were specifically labeled by [3H]azidodantrolene. A monoclonal anti-RyR1 antibody which recognizes RyR1 and its 1400 amino acid N-terminal fragment, recognizes DP1 and DP1-2 in both Western blots and immunoprecipitation assays, and specifically inhibits [3H]azidodantrolene photolabeling of RyR1 and its N-terminal fragment in sarcoplasmic reticulum. Our results indicate that synthetic domain peptides can mimic a native, ligand binding conformation in vitro, and that the dantrolene binding site and the epitope for the monoclonal antibody on RyR1 are equivalent and composed of amino-acids 590-609.

Critical amino acids within the human immunodeficiency virus type 1 envelope glycoprotein V4 N- and C-terminals contribute to virus entry.

Directory of Open Access Journals (Sweden)

Yan Li

Full Text Available The importance of the fourth variable (V4 region of the human immunodeficiency virus 1 (HIV-1 envelope glycoprotein (Env in virus infection has not been well clarified, though the polymorphism of this region has been found to be associated with disease progression to acquired immunodeficiency syndrome (AIDS. In the present work, we focused on the correlation between HIV-1 gp120 V4 region polymorphism and the function of the region on virus entry, and the possible mechanisms for how the V4 region contributes to virus infectivity. Therefore, we analyzed the differences in V4 sequences along with coreceptor usage preference from CCR5 to CXCR4 and examined the importance of the amino acids within the V4 region for CCR5- and CXCR4-tropic virus entry. In addition, we determined the influence of the V4 amino acids on Env expression and gp160 processing intracellularly, as well as the amount of Env on the pseudovirus surface. The results indicated that V4 tended to have a shorter length, fewer potential N-linked glycosylation sites (PNGS, greater evolutionary distance, and a lower negative net charge when HIV-1 isolates switched from a coreceptor usage preference for CCR5 to CXCR4. The N- and C-terminals of the HIV-1 V4 region are highly conserved and critical to maintain virus entry ability, but only the mutation at position 417 in the context of ADA (a R5-tropic HIV-1 strain resulted in the ability to utilize CXCR4. In addition, 390L, 391F, 414I, and 416L are critical to maintain gp160 processing and maturation. It is likely that the hydrophobic properties and the electrostatic surface potential of gp120, rather than the conformational structure, greatly contribute to this V4 functionality. The findings provide information to aid in the understanding of the functions of V4 in HIV-1 entry and offer a potential target to aid in the development of entry inhibitors.

Synthesis of α-hydroxy-ω-amino poly(ethylene oxide) and its use in reaction injection moulding (RIM)

NARCIS (Netherlands)

Loontjens, Ton J.A.; Scholtens, Boudewijn J.R.; Belt, Wil J.W.; Frisch, Kurt C.; Wong, Shaio-wen

1993-01-01

Computer simulations show that oligomers with two different terminal groups with dissimilar reactivities for isoeyanates give a delayed viscosity rise in polyurethanes. This is a desired behaviour for RIM processes. Therefore, an α-hydroxy-ω-amino poly(ethylene oxide) (HAPEO) has been prepared. The

Anti-androgen effects of cypermethrin on the amino- and carboxyl-terminal interaction of the androgen receptor

International Nuclear Information System (INIS)

Hu, Jin-xia; Li, Yan-fang; Pan, Chen; Zhang, Jin-peng; Wang, Hong-mei; Li, Jing; Xu, Li-chun

2012-01-01

Graphical abstract: Both the known AR antagonist nilutamide and the pyrethroid insecticide cypermethrin inhibited DHT-induced AR N/C interaction in the mammalian two-hybrid assay. However, cypermethrin was a weaker androgen antagonist than nilutamide. Highlights: ► We have developed the mammalian two-hybrid assay. ► The assay displayed appropriate response to DHT and nilutamide. ► The N/C interaction was induced by DHT in a dose-dependent manner. ► Nilutamide inhibited DHT-induced AR N/C interaction. ► Cypermethrin exhibits inhibitory effects on DHT-induced AR N/C interaction. -- Abstract: The pyrethroid insecticide, cypermethrin has been demonstrated to be an environmental anti-androgen in the androgen receptor (AR) reporter gene assay. The amino- and carboxyl-terminal (N/C) interaction is required for transcription potential of the AR. In order to characterize the anti-androgen effects of cypermethrin involved in the N/C interaction of AR, the mammalian two-hybrid assay has been developed in the study. The fusion vectors pVP16-ARNTD, pM-ARLBD and the pG5CAT Reporter Vector were cotransfected into the CV-1 cells. The assay displayed appropriate response to the potent, classical AR agonist 5α-dihydrotestosterone (DHT) and known AR antagonist nilutamide. The N/C interaction was induced by DHT from 10 −11 M to 10 −5 M in a dose-dependent manner. Nilutamide did not activate N/C interaction, while inhibited DHT-induced AR N/C interaction at the concentrations from 10 −7 M to 10 −5 M. Treatment of CV-1 cells with cypermethrin alone did not activate the reporter CAT. Cypermethrin significantly decreased the DHT-induced reporter CAT expression at the higher concentration of 10 −5 M. The mammalian two-hybrid assay provides a promising tool both for defining mechanism involved in AR N/C interaction of EDCs and for screening of chemicals with androgen agonistic and antagonistic activities. Cypermethrin exhibits inhibitory effects on the DHT-induced AR N

Synthesis of nanodiamond derivatives carrying amino functions and quantification by a modified Kaiser test

Directory of Open Access Journals (Sweden)

Gerald Jarre

2014-11-01

Full Text Available Nanodiamonds functionalized with different organic moieties carrying terminal amino groups have been synthesized. These include conjugates generated by Diels–Alder reactions of ortho-quinodimethanes formed in situ from pyrazine and 5,6-dihydrocyclobuta[d]pyrimidine derivatives. For the quantification of primary amino groups a modified photometric assay based on the Kaiser test has been developed and validated for different types of aminated nanodiamond. The results correspond well to values obtained by thermogravimetry. The method represents an alternative wet-chemical quantification method in cases where other techniques like elemental analysis fail due to unfavourable combustion behaviour of the analyte or other impediments.

The effect of insulin on amino acid incorporation into exocrine pancreatic cells of the rat

International Nuclear Information System (INIS)

Kramer, M.F.; Poort, C.

1975-01-01

The rate of incorporation of radioactive leucine per cell in the acinar pancreatic cells of the rat increases by 50 per cent within one hour after subcutaneous administration of insulin, an effect that lasts for at least one more hour. The rate of incorporation has been measured by quantitative radioautography and by determination of the radioactivity per μg DNA in TCA-precipitable material from tissue homogenates. The capacity for amino acid (leucine and lysine) incorporation as measured by incubating pancreatic fragments in vitro is not enhanced by insulin treatment of the rat in vivo during one or more hours. Insulin was found to lower the serum concentration of most amino acids significantly, leucine by 50 per cent. The apparent effect of insulin on the incorporation of radioactive leucine in vivo can be explained by the difference in the specific radioactivity of the circulating amino acid in the treated rats as compared to the untreated ones. A change in amino acid concentration in the serum may likewise be the explanation of the decrease in amino acid incorporation rate in alloxan diabetic rats. (orig./GSE) [de

Ionic interaction of myosin loop 2 with residues located beyond the N-terminal part of actin probed by chemical cross-linking.

Science.gov (United States)

Pliszka, Barbara; Martin, Brian M; Karczewska, Emilia

2008-02-01

To probe ionic contacts of skeletal muscle myosin with negatively charged residues located beyond the N-terminal part of actin, myosin subfragment 1 (S1) and actin split by ECP32 protease (ECP-actin) were cross-linked with 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC). We have found that unmodified S1 can be cross-linked not only to the N-terminal part, but also to the C-terminal 36 kDa fragment of ECP-actin. Subsequent experiments performed on S1 cleaved by elastase or trypsin indicate that the cross-linking site in S1 is located within loop 2. This site is composed of Lys-636 and Lys-637 and can interact with negatively charged residues of the 36 kDa actin fragment, most probably with Glu-99 and Glu-100. Cross-links are formed both in the absence and presence of MgATP.P(i) analog, although the addition of nucleotide decreases the efficiency of the cross-linking reaction.

GAWK, a novel human pituitary polypeptide: isolation, immunocytochemical localization and complete amino acid sequence.

Science.gov (United States)

Benjannet, S; Leduc, R; Lazure, C; Seidah, N G; Marcinkiewicz, M; Chrétien, M

1985-01-16

During the course of reverse-phase high pressure liquid chromatography (RP-HPLC) purification of a postulated big ACTH (1) from human pituitary gland extracts, a highly purified peptide bearing no resemblance to any known polypeptide was isolated. The complete sequence of this 74 amino acid polypeptide, called GAWK, has been determined. Search on a computer data bank on the possible homology to any known protein or fragment, using a mutation data matrix, failed to reveal any homology greater than 30%. An antibody produced against a synthetic fragment allowed us to detect several immunoreactive forms. The antisera also enabled us to localize the polypeptide, by immunocytochemistry, in the anterior lobe of the pituitary gland.

Natural monomeric form of fetal bovine serum acetylcholinesterase lacks the C-terminal tetramerization domain.

Science.gov (United States)

Saxena, Ashima; Hur, Regina S; Luo, Chunyuan; Doctor, Bhupendra P

2003-12-30

Acetylcholinesterase isolated from fetal bovine serum (FBS AChE) was previously characterized as a globular tetrameric form. Analysis of purified preparations of FBS AChE by gel permeation chromatography revealed the presence of a stable, catalytically active, monomeric form of this enzyme. The two forms could be distinguished from each other based on their molecular weight, hydrodynamic properties, kinetic properties, thermal stability, and the type of glycans they carry. No differences between the two forms were observed for the binding of classical inhibitors such as edrophonium and propidium or inhibitors that are current or potential drugs for the treatment of Alzheimer's disease such as (-) huperzine A and E2020; tacrine inhibited the monomeric form 2-3-fold more potently than the tetrameric form. Sequencing of peptides obtained from an in-gel tryptic digest of the monomer and tetramer by tandem mass spectrometry indicated that the tetramer consists of 583 amino acid residues corresponding to the mature form of the enzyme, whereas the monomer consists of 543-547 amino acid residues. The subunit molecular weight of the protein component of the monomer (major species) was determined to be 59 414 Da and that of the tetramer as 64 239 Da. The N-terminal of the monomer and the tetramer was Glu, suggesting that the monomer is not a result of truncation at the N-terminal. The only differences detected were at the C-terminus. The tetramer yielded the expected C-terminus, CSDL, whereas the C-terminus of the monomer yielded a mixture of peptides, of which LLSATDTLD was the most abundant. These results suggest that monomeric FBS AChE is trimmed at the C-terminus, and the results are consistent with the involvement of C-terminal amino acids in the assembly of monomers into tetramers.

Tub-Tag Labeling; Chemoenzymatic Incorporation of Unnatural Amino Acids.

Science.gov (United States)

Helma, Jonas; Leonhardt, Heinrich; Hackenberger, Christian P R; Schumacher, Dominik

2018-01-01

Tub-tag labeling is a chemoenzymatic method that enables the site-specific labeling of proteins. Here, the natural enzyme tubulin tyrosine ligase incorporates noncanonical tyrosine derivatives to the terminal carboxylic acid of proteins containing a 14-amino acid recognition sequence called Tub-tag. The tyrosine derivative carries a unique chemical reporter allowing for a subsequent bioorthogonal modification of proteins with a great variety of probes. Here, we describe the Tub-tag protein modification protocol in detail and explain its utilization to generate labeled proteins for advanced applications in cell biology, imaging, and diagnostics.

Structure of a C-terminal AHNAK peptide in a 1:2:2 complex with S100A10 and an acetylated N-terminal peptide of annexin A2

International Nuclear Information System (INIS)

Ozorowski, Gabriel; Milton, Saskia; Luecke, Hartmut

2013-01-01

Structure of a 20-amino-acid peptide of AHNAK bound asymmetrically to the AnxA2–S100A10A heterotetramer (1:2:2 symmetry) provides insights into the atomic level interactions that govern this membrane-repair scaffolding complex. AHNAK, a large 629 kDa protein, has been implicated in membrane repair, and the annexin A2–S100A10 heterotetramer [(p11) 2 (AnxA2) 2 )] has high affinity for several regions of its 1002-amino-acid C-terminal domain. (p11) 2 (AnxA2) 2 is often localized near the plasma membrane, and this C2-symmetric platform is proposed to be involved in the bridging of membrane vesicles and trafficking of proteins to the plasma membrane. All three proteins co-localize at the intracellular face of the plasma membrane in a Ca 2+ -dependent manner. The binding of AHNAK to (p11) 2 (AnxA2) 2 has been studied previously, and a minimal binding motif has been mapped to a 20-amino-acid peptide corresponding to residues 5654–5673 of the AHNAK C-terminal domain. Here, the 2.5 Å resolution crystal structure of this 20-amino-acid peptide of AHNAK bound to the AnxA2–S100A10 heterotetramer (1:2:2 symmetry) is presented, which confirms the asymmetric arrangement first described by Rezvanpour and coworkers and explains why the binding motif has high affinity for (p11) 2 (AnxA2) 2 . Binding of AHNAK to the surface of (p11) 2 (AnxA2) 2 is governed by several hydrophobic interactions between side chains of AHNAK and pockets on S100A10. The pockets are large enough to accommodate a variety of hydrophobic side chains, allowing the consensus sequence to be more general. Additionally, the various hydrogen bonds formed between the AHNAK peptide and (p11) 2 (AnxA2) 2 most often involve backbone atoms of AHNAK; as a result, the side chains, particularly those that point away from S100A10/AnxA2 towards the solvent, are largely interchangeable. While the structure-based consensus sequence allows interactions with various stretches of the AHNAK C-terminal domain, comparison

37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.

Science.gov (United States)

2010-07-01

... may not include material other than part of the sequence listing. A fixed-width font should be used... integer expressing the number of bases or amino acid residues M. Type Whether presented sequence molecule is DNA, RNA, or PRT (protein). If a nucleotide sequence contains both DNA and RNA fragments, the type...

Ion induced fragmentation of biomolecular systems at low collision energies

International Nuclear Information System (INIS)

Bernigaud, V; Adoui, L; Chesnel, J Y; Rangama, J; Huber, B A; Manil, B; Alvarado, F; Bari, S; Hoekstra, R; Postma, J; Schlathoelter, T

2009-01-01

In this paper, we present results of different collision experiments between multiply charged ions at low collision energies (in the keV-region) and biomolecular systems. This kind of interaction allows to remove electrons form the biomolecule without transferring a large amount of vibrational excitation energy. Nevertheless, following the ionization of the target, fragmentation of biomolecular species may occur. It is the main objective of this work to study the physical processes involved in the dissociation of highly electronically excited systems. In order to elucidate the intrinsic properties of certain biomolecules (porphyrins and amino acids) we have performed experiments in the gas phase with isolated systems. The obtained results demonstrate the high stability of porphyrins after electron removal. Furthermore, a dependence of the fragmentation pattern produced by multiply charged ions on the isomeric structure of the alanine molecule has been shown. By considering the presence of other surrounding biomolecules (clusters of nucleobases), a strong influence of the environment of the biomolecule on the fragmentation channels and their modification, has been clearly proven. This result is explained, in the thymine and uracil case, by the formation of hydrogen bonds between O and H atoms, which is known to favor planar cluster geometries.

Fluorescent fusion proteins of soluble guanylyl cyclase indicate proximity of the heme nitric oxide domain and catalytic domain.

Directory of Open Access Journals (Sweden)

Tobias Haase

Full Text Available BACKGROUND: To examine the structural organisation of heterodimeric soluble guanylyl cyclase (sGC Förster resonance energy transfer (FRET was measured between fluorescent proteins fused to the amino- and carboxy-terminal ends of the sGC beta1 and alpha subunits. METHODOLOGY/PRINCIPAL FINDINGS: Cyan fluorescent protein (CFP was used as FRET donor and yellow fluorescent protein (YFP as FRET acceptor. After generation of recombinant baculovirus, fluorescent-tagged sGC subunits were co-expressed in Sf9 cells. Fluorescent variants of sGC were analyzed in vitro in cytosolic fractions by sensitized emission FRET. Co-expression of the amino-terminally tagged alpha subunits with the carboxy-terminally tagged beta1 subunit resulted in an enzyme complex that showed a FRET efficiency of 10% similar to fluorescent proteins separated by a helix of only 48 amino acids. Because these findings indicated that the amino-terminus of the alpha subunits is close to the carboxy-terminus of the beta1 subunit we constructed fusion proteins where both subunits are connected by a fluorescent protein. The resulting constructs were not only fluorescent, they also showed preserved enzyme activity and regulation by NO. CONCLUSIONS/SIGNIFICANCE: Based on the ability of an amino-terminal fragment of the beta1 subunit to inhibit activity of an heterodimer consisting only of the catalytic domains (alphacatbetacat, Winger and Marletta (Biochemistry 2005, 44:4083-90 have proposed a direct interaction of the amino-terminal region of beta1 with the catalytic domains. In support of such a concept of "trans" regulation of sGC activity by the H-NOX domains our results indicate that the domains within sGC are organized in a way that allows for direct interaction of the amino-terminal regulatory domains with the carboxy-terminal catalytic region. In addition, we constructed "fluorescent-conjoined" sGC's by fusion of the alpha amino-terminus to the beta1 carboxy-terminus leading to a

Nicked apomyoglobin: a noncovalent complex of two polypeptide fragments comprising the entire protein chain.

Science.gov (United States)

Musi, Valeria; Spolaore, Barbara; Picotti, Paola; Zambonin, Marcello; De Filippis, Vincenzo; Fontana, Angelo

2004-05-25

Limited proteolysis of the 153-residue chain of horse apomyoglobin (apoMb) by thermolysin results in the selective cleavage of the peptide bond Pro88-Leu89. The N-terminal (residues 1-88) and C-terminal (residues 89-153) fragments of apoMb were isolated to homogeneity and their conformational and association properties investigated in detail. Far-UV circular dichroism (CD) measurements revealed that both fragments in isolation acquire a high content of helical secondary structure, while near-UV CD indicated the absence of tertiary structure. A 1:1 mixture of the fragments leads to a tight noncovalent protein complex (1-88/89-153, nicked apoMb), characterized by secondary and tertiary structures similar to those of intact apoMb. The apoMb complex binds heme in a nativelike manner, as given by CD measurements in the Soret region. Second-derivative absorption spectra in the 250-300 nm region provided evidence that the degree of exposure of Tyr residues in the nicked species is similar to that of the intact protein at neutral pH. Also, the microenvironment of Trp residues, located in positions 7 and 14 of the 153-residue chain of the protein, is similar in both protein species, as given by fluorescence emission data. Moreover, in analogy to intact apoMb, the nicked protein binds the hydrophobic dye 1-anilinonaphthalene-8-sulfonate (ANS). Taken together, our results indicate that the two proteolytic fragments 1-88 and 89-153 of apoMb adopt partly folded states characterized by sufficiently nativelike conformational features that promote their specific association and mutual stabilization into a nicked protein species much resembling in its structural features intact apoMb. It is suggested that the formation of a noncovalent complex upon fragment complementation can mimic the protein folding process of the entire protein chain, with the difference that the folding of the complementary fragments is an intermolecular process. In particular, this study emphasizes the

Analysis of amino acids by HPLC/electrospray negative ion tandem mass spectrometry using 9-fluorenylmethoxycarbonyl chloride (Fmoc-Cl) derivatization.

Science.gov (United States)

Ziegler, Jörg; Abel, Steffen

2014-12-01

A new method for the determination of amino acids is presented. It combines established methods for the derivatization of primary and secondary amino groups with 9-fluorenylmethoxycarbonyl chloride (Fmoc-Cl) with the subsequent amino acid specific detection of the derivatives by LC-ESI-MS/MS using multiple reaction monitoring (MRM). The derivatization proceeds within 5 min, and the resulting amino acid derivatives can be rapidly purified from matrix by solid-phase extraction (SPE) on HR-X resin and separated by reversed-phase HPLC. The Fmoc derivatives yield several amino acid specific fragment ions which opened the possibility to select amino acid specific MRM transitions. The method was applied to all 20 proteinogenic amino acids, and the quantification was performed using L-norvaline as standard. A limit of detection as low as 1 fmol/µl with a linear range of up to 125 pmol/µl could be obtained. Intraday and interday precisions were lower than 10 % relative standard deviations for most of the amino acids. Quantification using L-norvaline as internal standard gave very similar results compared to the quantification using deuterated amino acid as internal standards. Using this protocol, it was possible to record the amino acid profiles of only a single root from Arabidopsis thaliana seedlings and to compare it with the amino acid profiles of 20 dissected root meristems (200 μm).

Mirrors in the PDB: left-handed α-turns guide design with D-amino acids

Directory of Open Access Journals (Sweden)

Nanda Vikas

2009-09-01

Full Text Available Abstract Background Incorporating variable amino acid stereochemistry in molecular design has the potential to improve existing protein stability and create new topologies inaccessible to homochiral molecules. The Protein Data Bank has been a reliable, rich source of information on molecular interactions and their role in protein stability and structure. D-amino acids rarely occur naturally, making it difficult to infer general rules for how they would be tolerated in proteins through an analysis of existing protein structures. However, protein elements containing short left-handed turns and helices turn out to contain useful information. Molecular mechanisms used in proteins to stabilize left-handed elements by L-amino acids are structurally enantiomeric to potential synthetic strategies for stabilizing right-handed elements with D-amino acids. Results Propensities for amino acids to occur in contiguous αL helices correlate with published thermodynamic scales for incorporation of D-amino acids into αR helices. Two backbone rules for terminating a left-handed helix are found: an αR conformation is disfavored at the amino terminus, and a βR conformation is disfavored at the carboxy terminus. Helix capping sidechain-backbone interactions are found which are unique to αL helices including an elevated propensity for L-Asn, and L-Thr at the amino terminus and L-Gln, L-Thr and L-Ser at the carboxy terminus. Conclusion By examining left-handed α-turns containing L-amino acids, new interaction motifs for incorporating D-amino acids into right-handed α-helices are identified. These will provide a basis for de novo design of novel heterochiral protein folds.

Characterization of two conformational epitopes of the Chlamydia trachomatis serovar L2 DnaK immunogen

DEFF Research Database (Denmark)

Birkelund, Svend; Mygind, P; Holm, A

1996-01-01

this protein. By use of recombinant DNA techniques, we located the epitopes for two MAbs in the C-terminal variable part. Although the antibodies reacted in an immunoblot assay, it was not possible to map the epitopes completely by use of 16-mer synthetic peptides displaced by one amino acid corresponding......Chlamydia trachomatis DnaK is an important immunogen in chlamydial infections. DnaK is composed of a conserved N-terminal ATP-binding domain and a variable C-terminal peptide-binding domain. To locate the immunogenic part of C. trachomatis Dnak, we generated monoclonal antibodies (MAbs) against...... with the two antibodies. The epitopes were found not to overlap. To obtain DnaK fragments recognized by the antibodies with the same affinity as native C. trachomatis DnaK, it was necessary to express, respectively, regions of 127 and 77 amino acids. The MAbs described in this study thus recognized...

Sequencing Lys-N Proteolytic Peptides by ESI and MALDI Tandem Mass Spectrometry

Science.gov (United States)

Dupré, Mathieu; Cantel, Sonia; Verdié, Pascal; Martinez, Jean; Enjalbal, Christine

2011-02-01

In this study, we explored the MS/MS behavior of various synthetic peptides that possess a lysine residue at the N-terminal position. These peptides were designed to mimic peptides produced upon proteolysis by the Lys-N enzyme, a metalloendopeptidase issued from a Japanese fungus Grifola frondosa that was recently investigated in proteomic studies as an alternative to trypsin digestion, as a specific cleavage at the amide X-Lys chain is obtained that provides N-terminal lysine peptide fragments. In contrast to tryptic peptides exhibiting a lysine or arginine residue solely at the C-terminal position, and are thus devoid of such basic amino acids within the sequence, these Lys-N proteolytic peptides can contain the highly basic arginine residue anywhere within the peptide chain. The fragmentation patterns of such sequences with the ESI-QqTOF and MALDI-TOF/TOF mass spectrometers commonly used in proteomic bottom-up experiments were investigated.

Characterization of Tumor-Avid Antibody Fragments Genetically Engineered for Mono-Specific Radionuclide Chelation

International Nuclear Information System (INIS)

Quinn, T.P.

2003-01-01

The successful clinical application of targeted-radiopharmaceuticals depends on the development of molecules that optimize tumor specific radionuclide deposition and minimize non-specific organ irradiation. To this end, this proposal outlines a research effort to identify and evaluate novel antibodies and antibody fragments that bind breast tumors. The tumor-avid antibodies will be investigated for as imaging and therapeutic agents and to gain a better understanding of the pharmacokinetics and metabolism of radiolabeled tumor-avid antibody fragments through the use of site-specifically labeled molecules. Antibodies or antibody fragments, that bind breast carcinoma carbohydrate antigens, will be obtained from hybridoma or bacteriophage library screening. More specifically, antibody fragments that bind the carcinoma-associated Thomsen-Friedenreich (T) antigen will be radiolabeled with 99m Tc and 188 Re at a natural amino acid chelation site and will be investigated in vivo for their abilities to target human breast tumors. In addition, site-specific radiolabeled antibody fragments will be biosynthesized using misacylated suppressor tRNAs. Homogeneously radiolabeled populations of antibody fragments will be used to investigate the effects of radionuclide location and chelation chemistries on their biodistribution and metabolism. It is hypothesized that site-specifically radiolabeled antibody fragments will possess enhanced tumor imaging and therapeutic properties due to optimal label location and conjugation chemistries. New insights into the factors that govern antibody metabolism in vivo are also expected from this work. Results from these studies should enhance our ability to design and synthesize radiolabeled antibody fragments that have improved pharmacokinetic properties. The studies in this proposal involve basic research into the development of antibody-based radiopharmaceuticals, with the ultimate goal of application in humans. This type of basic nuclear

Comparison of Glutamate Turnover in Nerve Terminals and Brain Tissue During [1,6-13C2]Glucose Metabolism in Anesthetized Rats.

Science.gov (United States)

Patel, Anant B; Lai, James C K; Chowdhury, Golam I M; Rothman, Douglas L; Behar, Kevin L

2017-01-01

The 13 C turnover of neurotransmitter amino acids (glutamate, GABA and aspartate) were determined from extracts of forebrain nerve terminals and brain homogenate, and fronto-parietal cortex from anesthetized rats undergoing timed infusions of [1,6- 13 C 2 ]glucose or [2- 13 C]acetate. Nerve terminal 13 C fractional labeling of glutamate and aspartate was lower than those in whole cortical tissue at all times measured (up to 120 min), suggesting either the presence of a constant dilution flux from an unlabeled substrate or an unlabeled (effectively non-communicating on the measurement timescale) glutamate pool in the nerve terminals. Half times of 13 C labeling from [1,6- 13 C 2 ]glucose, as estimated by least squares exponential fitting to the time course data, were longer for nerve terminals (Glu C4 , 21.8 min; GABA C2 21.0 min) compared to cortical tissue (Glu C4 , 12.4 min; GABA C2 , 14.5 min), except for Asp C3 , which was similar (26.5 vs. 27.0 min). The slower turnover of glutamate in the nerve terminals (but not GABA) compared to the cortex may reflect selective effects of anesthesia on activity-dependent glucose use, which might be more pronounced in the terminals. The 13 C labeling ratio for glutamate-C4 from [2- 13 C]acetate over that of 13 C-glucose was twice as large in nerve terminals compared to cortex, suggesting that astroglial glutamine under the 13 C glucose infusion was the likely source of much of the nerve terminal dilution. The net replenishment of most of the nerve terminal amino acid pools occurs directly via trafficking of astroglial glutamine.

Structure discrimination for the C-terminal domain of Escherichia coli trigger factor in solution

International Nuclear Information System (INIS)

Yao Yong; Bhabha, Gira; Kroon, Gerard; Landes, Mindy; Dyson, H. Jane

2008-01-01

NMR measurements can give important information on solution structure, without the necessity for a full-scale solution structure determination. The C-terminal protein binding domain of the ribosome-associated chaperone protein trigger factor is composed of non-contiguous parts of the polypeptide chain, with an interpolated prolyl isomerase domain. A construct of the C-terminal domain of Escherichia coli trigger factor containing residues 113-149 and 247-432, joined by a Gly-Ser-Gly-Ser linker, is well folded and gives excellent NMR spectra in solution. We have used NMR measurements on this construct, and on a longer construct that includes the prolyl isomerase domain, to distinguish between two possible structures for the C-terminal domain of trigger factor, and to assess the behavior of the trigger factor C-terminal domain in solution. Two X-ray crystal structures, of intact trigger factor from E. coli (Ferbitz et al., Nature 431:590-596, 2004), and of a truncated trigger factor from Vibrio cholerae (Ludlam et al., Proc Natl Acad Sci USA 101:13436-13441, 2004) showed significant differences in the structure of the C-terminal domain, such that the two structures could not be superimposed. We show using NMR chemical shifts and long range nuclear Overhauser effects that the secondary and tertiary structure of the E. coli C-terminal domain in solution is consistent with the crystal structure of the E. coli trigger factor and not with the V. cholerae protein. Given the similarity of the amino acid sequences of the E. coli and V. cholerae proteins, it appears likely that the structure of the V. cholerae protein has been distorted as a result of truncation of a 44-amino acid segment at the C-terminus. Analysis of residual dipolar coupling measurements shows that the overall topology of the solution structure is completely inconsistent with both structures. Dynamics analysis of the C-terminal domain using T 1 , T 2 and heteronuclear NOE parameters show that the protein is

Community Structure of Denitrifiers, Bacteria, and Archaea along Redox Gradients in Pacific Northwest Marine Sediments by Terminal Restriction Fragment Length Polymorphism Analysis of Amplified Nitrite Reductase (nirS) and 16S rRNA Genes

Science.gov (United States)

Braker, Gesche; Ayala-del-Río, Héctor L.; Devol, Allan H.; Fesefeldt, Andreas; Tiedje, James M.

2001-01-01

Steep vertical gradients of oxidants (O2 and NO3−) in Puget Sound and Washington continental margin sediments indicate that aerobic respiration and denitrification occur within the top few millimeters to centimeters. To systematically explore the underlying communities of denitrifiers, Bacteria, and Archaea along redox gradients at distant geographic locations, nitrite reductase (nirS) genes and bacterial and archaeal 16S rRNA genes (rDNAs) were PCR amplified and analyzed by terminal restriction fragment length polymorphism (T-RFLP) analysis. The suitablility of T-RFLP analysis for investigating communities of nirS-containing denitrifiers was established by the correspondence of dominant terminal restriction fragments (T-RFs) of nirS to computer-simulated T-RFs of nirS clones. These clones belonged to clusters II, III, and IV from the same cores and were analyzed in a previous study (G. Braker, J. Zhou, L. Wu, A. H. Devol, and J. M. Tiedje, Appl. Environ. Microbiol. 66:2096–2104, 2000). T-RFLP analysis of nirS and bacterial rDNA revealed a high level of functional and phylogenetic diversity, whereas the level of diversity of Archaea was lower. A comparison of T-RFLPs based on the presence or absence of T-RFs and correspondence analysis based on the frequencies and heights of T-RFs allowed us to group sediment samples according to the sampling location and thus clearly distinguish Puget Sound and the Washington margin populations. However, changes in community structure within sediment core sections during the transition from aerobic to anaerobic conditions were minor. Thus, within the top layers of marine sediments, redox gradients seem to result from the differential metabolic activities of populations of similar communities, probably through mixing by marine invertebrates rather than from the development of distinct communities. PMID:11282647

Secretory signal peptide modification for optimized antibody-fragment expression-secretion in Leishmania tarentolae

Directory of Open Access Journals (Sweden)

Klatt Stephan

2012-07-01

Full Text Available Abstract Background Secretory signal peptides (SPs are well-known sequence motifs targeting proteins for translocation across the endoplasmic reticulum membrane. After passing through the secretory pathway, most proteins are secreted to the environment. Here, we describe the modification of an expression vector containing the SP from secreted acid phosphatase 1 (SAP1 of Leishmania mexicana for optimized protein expression-secretion in the eukaryotic parasite Leishmania tarentolae with regard to recombinant antibody fragments. For experimental design the online tool SignalP was used, which predicts the presence and location of SPs and their cleavage sites in polypeptides. To evaluate the signal peptide cleavage site as well as changes of expression, SPs were N-terminally linked to single-chain Fragment variables (scFv’s. The ability of L. tarentolae to express complex eukaryotic proteins with highly diverse post-translational modifications and its easy bacteria-like handling, makes the parasite a promising expression system for secretory proteins. Results We generated four vectors with different SP-sequence modifications based on in-silico analyses with SignalP in respect to cleavage probability and location, named pLTEX-2 to pLTEX-5. To evaluate their functionality, we cloned four individual scFv-fragments into the vectors and transfected all 16 constructs into L. tarentolae. Independently from the expressed scFv, pLTEX-5 derived constructs showed the highest expression rate, followed by pLTEX-4 and pLTEX-2, whereas only low amounts of protein could be obtained from pLTEX-3 clones, indicating dysfunction of the SP. Next, we analysed the SP cleavage sites by Edman degradation. For pLTEX-2, -4, and -5 derived scFv’s, the results corresponded to in-silico predictions, whereas pLTEX-3 derived scFv’s contained one additional amino-acid (AA. Conclusions The obtained results demonstrate the importance of SP-sequence optimization for efficient

Dissection of malonyl-coenzyme A reductase of Chloroflexus aurantiacus results in enzyme activity improvement.

Directory of Open Access Journals (Sweden)

Changshui Liu

Full Text Available The formation of fusion protein in biosynthetic pathways usually improves metabolic efficiency either channeling intermediates and/or colocalizing enzymes. In the metabolic engineering of biochemical pathways, generating unnatural protein fusions between sequential biosynthetic enzymes is a useful method to increase system efficiency and product yield. Here, we reported a special case. The malonyl-CoA reductase (MCR of Chloroflexus aurantiacus catalyzes the conversion of malonyl-CoA to 3-hydroxypropionate (3HP, and is a key enzyme in microbial production of 3HP, an important platform chemical. Functional domain analysis revealed that the N-terminal region of MCR (MCR-N; amino acids 1-549 and the C-terminal region of MCR (MCR-C; amino acids 550-1219 were functionally distinct. The malonyl-CoA was reduced into free intermediate malonate semialdehyde with NADPH by MCR-C fragment, and further reduced to 3HP by MCR-N fragment. In this process, the initial reduction of malonyl-CoA was rate limiting. Site-directed mutagenesis demonstrated that the TGXXXG(AX(1-2G and YXXXK motifs were important for enzyme activities of both MCR-N and MCR-C fragments. Moreover, the enzyme activity increased when MCR was separated into two individual fragments. Kinetic analysis showed that MCR-C fragment had higher affinity for malonyl-CoA and 4-time higher K cat/K m value than MCR. Dissecting MCR into MCR-N and MCR-C fragments also had a positive effect on the 3HP production in a recombinant Escherichia coli strain. Our study showed the feasibility of protein dissection as a new strategy in biosynthetic systems.

Electrostatic field of the large fragment of Escherichia coli DNA polymerase I.

Science.gov (United States)

Warwicker, J; Ollis, D; Richards, F M; Steitz, T A

1985-12-05

The electrostatic field of the large fragment of Escherichia coli DNA polymerase I (Klenow fragment) has been calculated by the finite difference procedure on a 2 A grid. The potential field is substantially negative at physiological pH (reflecting the net negative charge at this pH). The largest regions of positive potential are in the deep crevice of the C-terminal domain, which is the proposed binding site for the DNA substrate. Within the crevice, the electrostatic potential has a partly helical form. If the DNA is positioned to fulfil stereochemical requirements, then the positive potential generally follows the major groove and (to a lesser extent) the negative potential is in the minor groove. Such an arrangement could stabilize DNA configurations related by screw symmetry. The histidine residues of the Klenow fragment give the positive field of the groove a sensitivity to relatively small pH changes around neutrality. We suggest that the histidine residues could change their ionization states in response to DNA binding, and that this effect could contribute to the protein-DNA binding energy.

Untangling spider silk evolution with spidroin terminal domains

Directory of Open Access Journals (Sweden)

Garb Jessica E

2010-08-01

Full Text Available Abstract Background Spidroins are a unique family of large, structural proteins that make up the bulk of spider silk fibers. Due to the highly variable nature of their repetitive sequences, spidroin evolutionary relationships have principally been determined from their non-repetitive carboxy (C-terminal domains, though they offer limited character data. The few known spidroin amino (N-terminal domains have been difficult to obtain, but potentially contain critical phylogenetic information for reconstructing the diversification of spider silks. Here we used silk gland expression data (ESTs from highly divergent species to evaluate the functional significance and phylogenetic utility of spidroin N-terminal domains. Results We report 11 additional spidroin N-termini found by sequencing ~1,900 silk gland cDNAs from nine spider species that shared a common ancestor > 240 million years ago. In contrast to their hyper-variable repetitive regions, spidroin N-terminal domains have retained striking similarities in sequence identity, predicted secondary structure, and hydrophobicity. Through separate and combined phylogenetic analyses of N-terminal domains and their corresponding C-termini, we find that combined analysis produces the most resolved trees and that N-termini contribute more support and less conflict than the C-termini. These analyses show that paralogs largely group by silk gland type, except for the major ampullate spidroins. Moreover, spidroin structural motifs associated with superior tensile strength arose early in the history of this gene family, whereas a motif conferring greater extensibility convergently evolved in two distantly related paralogs. Conclusions A non-repetitive N-terminal domain appears to be a universal attribute of spidroin proteins, likely retained from the origin of spider silk production. Since this time, spidroin N-termini have maintained several features, consistent with this domain playing a key role in silk

GBNV encoded movement protein (NSm) remodels ER network via C-terminal coiled coil domain

Energy Technology Data Exchange (ETDEWEB)

Singh, Pratibha; Savithri, H.S., E-mail: bchss@biochem.iisc.ernet.in

2015-08-15

Plant viruses exploit the host machinery for targeting the viral genome–movement protein complex to plasmodesmata (PD). The mechanism by which the non-structural protein m (NSm) of Groundnut bud necrosis virus (GBNV) is targeted to PD was investigated using Agrobacterium mediated transient expression of NSm and its fusion proteins in Nicotiana benthamiana. GFP:NSm formed punctuate structures that colocalized with mCherry:plasmodesmata localized protein 1a (PDLP 1a) confirming that GBNV NSm localizes to PD. Unlike in other movement proteins, the C-terminal coiled coil domain of GBNV NSm was shown to be involved in the localization of NSm to PD, as deletion of this domain resulted in the cytoplasmic localization of NSm. Treatment with Brefeldin A demonstrated the role of ER in targeting GFP NSm to PD. Furthermore, mCherry:NSm co-localized with ER–GFP (endoplasmic reticulum targeting peptide (HDEL peptide fused with GFP). Co-expression of NSm with ER–GFP showed that the ER-network was transformed into vesicles indicating that NSm interacts with ER and remodels it. Mutations in the conserved hydrophobic region of NSm (residues 130–138) did not abolish the formation of vesicles. Additionally, the conserved prolines at positions 140 and 142 were found to be essential for targeting the vesicles to the cell membrane. Further, systematic deletion of amino acid residues from N- and C-terminus demonstrated that N-terminal 203 amino acids are dispensable for the vesicle formation. On the other hand, the C-terminal coiled coil domain when expressed alone could also form vesicles. These results suggest that GBNV NSm remodels the ER network by forming vesicles via its interaction through the C-terminal coiled coil domain. Interestingly, NSm interacts with NP in vitro and coexpression of these two proteins in planta resulted in the relocalization of NP to PD and this relocalization was abolished when the N-terminal unfolded region of NSm was deleted. Thus, the NSm

Asparagine 326 in the extremely C-terminal region of XRCC4 is essential for the cell survival after irradiation

Energy Technology Data Exchange (ETDEWEB)

Wanotayan, Rujira; Fukuchi, Mikoto; Imamichi, Shoji; Sharma, Mukesh Kumar; Matsumoto, Yoshihisa, E-mail: yoshim@nr.titech.ac.jp

2015-02-20

XRCC4 is one of the crucial proteins in the repair of DNA double-strand break (DSB) through non-homologous end-joining (NHEJ). As XRCC4 consists of 336 amino acids, N-terminal 200 amino acids include domains for dimerization and for association with DNA ligase IV and XLF and shown to be essential for XRCC4 function in DSB repair and V(D)J recombination. On the other hand, the role of the remaining C-terminal region of XRCC4 is not well understood. In the present study, we noticed that a stretch of ∼20 amino acids located at the extreme C-terminus of XRCC4 is highly conserved among vertebrate species. To explore its possible importance, series of mutants in this region were constructed and assessed for the functionality in terms of ability to rescue radiosensitivity of M10 cells lacking XRCC4. Among 13 mutants, M10 transfectant with N326L mutant (M10-XRCC4{sup N326L}) showed elevated radiosensitivity. N326L protein showed defective nuclear localization. N326L sequence matched the consensus sequence of nuclear export signal. Leptomycin B treatment accumulated XRCC4{sup N326L} in the nucleus but only partially rescued radiosensitivity of M10-XRCC4{sup N326L}. These results collectively indicated that the functional defects of XRCC4{sup N326L} might be partially, but not solely, due to its exclusion from nucleus by synthetic nuclear export signal. Further mutation of XRCC4 Asn326 to other amino acids, i.e., alanine, aspartic acid or glutamine did not affect the nuclear localization but still exhibited radiosensitivity. The present results indicated the importance of the extremely C-terminal region of XRCC4 and, especially, Asn326 therein. - Highlights: • Extremely C-terminal region of XRCC4 is highly conserved among vertebrate species. • XRCC4 C-terminal point mutants, R325F and N326L, are functionally deficient in terms of survival after irradiation. • N326L localizes to the cytoplasm because of synthetic nuclear export signal. • Leptomycin B restores the

N-terminal Pro-B-type natriuretic peptide: a measure of significant patent cuctus arteriosus

LENUS (Irish Health Repository)

OFarombi-Oghuvbu, IO

2008-01-24

Background: B type natriuretic peptide (BNP) is a marker for ventricular dysfunction secreted as a pre-prohormone, Pro-B-type natriuretic peptide (ProBNP), and cleaved into BNP and a biologically inactive fragment, N-terminal pro-B-type natriuretic peptide (NT-proBNP). Little is known about the clinical usefulness of NT-proBNP in preterm infants.\\r\

The innate immunity adaptor SARM translocates to the nucleus to stabilize lamins and prevent DNA fragmentation in response to pro-apoptotic signaling.

Directory of Open Access Journals (Sweden)

Chad R Sethman

Full Text Available Sterile alpha and armadillo-motif containing protein (SARM, a highly conserved and structurally unique member of the MyD88 family of Toll-like receptor adaptors, plays an important role in innate immunity signaling and apoptosis. Its exact mechanism of intracellular action remains unclear. Apoptosis is an ancient and ubiquitous process of programmed cell death that results in disruption of the nuclear lamina and, ultimately, dismantling of the nucleus. In addition to supporting the nuclear membrane, lamins serve important roles in chromatin organization, epigenetic regulation, transcription, nuclear transport, and mitosis. Mutations and other damage that destabilize nuclear lamins (laminopathies underlie a number of intractable human diseases. Here, we report that SARM translocates to the nucleus of human embryonic kidney cells by using its amino-terminal Armadillo repeat region. Within the nucleus, SARM forms a previously unreported lattice akin to the nuclear lamina scaffold. Moreover, we show that SARM protects lamins from apoptotic degradation and reduces internucleosomal DNA fragmentation in response to signaling induced by the proinflammatory cytokine Tumor Necrosis Factor alpha. These findings indicate an important link between the innate immunity adaptor SARM and stabilization of nuclear lamins during inflammation-driven apoptosis in human cells.

Chemo-enzymatic synthesis of (2S,4R)-2-amino-4-(3-(2,2-diphenylethylamino)-3-oxopropyl)pentanedioic acid

DEFF Research Database (Denmark)

Sagot, Emanuelle; Jensen, Anders A.; Pickering, Darryl S

2008-01-01

In the mammalian central nervous system (CNS), the action of sodium dependent excitatory amino acid transporters (EAATs) is responsible for termination of glutamatergic neurotransmission by reuptake of ( S) -glutamate (Glu) from the synaptic cleft. Five EAAT subtypes have been identified, of which...

A role for galanin N-terminal fragment (1-15) in anxiety- and depression-related behaviors in rats.

Science.gov (United States)

Millón, Carmelo; Flores-Burgess, Antonio; Narváez, Manuel; Borroto-Escuela, Dasiel O; Santín, Luis; Parrado, Concepción; Narváez, José Angel; Fuxe, Kjell; Díaz-Cabiale, Zaida

2014-10-31

Galanin (GAL) plays a role in mood regulation. In this study we analyzed the action of the active N-terminal fragment [GAL(1-15)] in anxiety- and depression-related behavioral tests in rats. The effect of GAL(1-15) was analyzed in the forced swimming test, tail suspension test, open field test, and light/dark test. The proximity of GAL1 and GAL2 receptors was examined with the proximity ligation assay (PLA). We tested the GAL receptors involved in GAL(1-15) effects with the GAL2 receptor antagonist M871 and with an in vivo model of siRNA GAL2 receptor knockdown or siRNA GAL1 receptor knockdown rats. The effects of GAL(1-15) were also studied in the cell line RN33B. GAL(1-15) induced strong depression-like and anxiogenic-like effects in all the tests. These effects were stronger than the ones induced by GAL. The involvement of the GAL2 receptor was demonstrated with M871 and with the siRNA GAL2 receptor knockdown rats. The PLA indicated the possible existence of GAL1 and GAL2 heteroreceptor complexes in the dorsal hippocampus and especially in the dorsal raphe nucleus. In the siRNA GAL1 receptor knockdown rats the behavioral actions of GAL(1-15) disappeared, and in the siRNA GAL2 receptor knockdown rats the reductions of the behavioral actions of GAL(1-15) was linked to a disappearance of PLA. In the cell line RN33B, GAL(1-15) decreased 5-HT immunoreactivity more strongly than GAL. Our results indicate that GAL(1-15) exerts strong depression-related and anxiogenic-like effects and may give the basis for the development of drugs targeting GAL1 and GAL2 heteroreceptor complexes in the raphe-limbic system for the treatment of depression and anxiety. © The Author 2015. Published by Oxford University Press on behalf of CINP.

Amino-terminal domain of the v-fms oncogene product includes a functional signal peptide that directs synthesis of a transforming glycoprotein in the absence of feline leukemia virus gag sequences

International Nuclear Information System (INIS)

Wheeler, E.F.; Roussel, M.F.; Hampe, A.; Walker, M.H.; Fried, V.A.; Look, A.T.; Rettenmier, C.W.; Sherr, C.J.

1986-01-01

The nucleotide sequence of a 5' segment of the human genomic c-fms proto-oncogene suggested that recombination between feline leukemia virus and feline c-fms sequences might have occurred in a region encoding the 5' untranslated portion of c-fms mRNA. The polyprotein precursor gP180/sup gag-fms/ encoded by the McDonough strain of feline sarcoma virus was therefore predicted to contain 34 v-fms-coded amino acids derived from sequences of the c-fms gene that are not ordinarily translated from the proto-oncogene mRNA. The (gP180/sup gag-fms/) polyprotein was cotranslationally cleaved near the gag-fms junction to remove its gag gene-coded portion. Determination of the amino-terminal sequence of the resulting v-fms-coded glycoprotein, gp120/sup v-fms/, showed that the site of proteolysis corresponded to a predicted signal peptidase cleavage site within the c-fms gene product. Together, these analyses suggested that the linked gag sequences may not be necessary for expression of a biologically active v-fms gene product. The gag-fms sequences of feline sarcoma virus strain McDonough and the v-fms sequences alone were inserted into a murine retroviral vector containing a neomycin resistance gene. The authors conclude that a cryptic hydrophobic signal peptide sequence in v-fms was unmasked by gag deletion, thereby allowing the correct orientation and transport of the v-fms was unmasked by gag deletion, thereby allowing the correct orientation and transport of the v-fms gene product within membranous organelles. It seems likely that the proteolytic cleavage of gP180/gag-fms/ is mediated by signal peptidase and that the amino termini of gp140/sup v-fms/ and the c-fms gene product are identical

Amino-terminal domain of the v-fms oncogene product includes a functional signal peptide that directs synthesis of a transforming glycoprotein in the absence of feline leukemia virus gag sequences

Energy Technology Data Exchange (ETDEWEB)

Wheeler, E.F.; Roussel, M.F.; Hampe, A.; Walker, M.H.; Fried, V.A.; Look, A.T.; Rettenmier, C.W.; Sherr, C.J.

1986-08-01

The nucleotide sequence of a 5' segment of the human genomic c-fms proto-oncogene suggested that recombination between feline leukemia virus and feline c-fms sequences might have occurred in a region encoding the 5' untranslated portion of c-fms mRNA. The polyprotein precursor gP180/sup gag-fms/ encoded by the McDonough strain of feline sarcoma virus was therefore predicted to contain 34 v-fms-coded amino acids derived from sequences of the c-fms gene that are not ordinarily translated from the proto-oncogene mRNA. The (gP180/sup gag-fms/) polyprotein was cotranslationally cleaved near the gag-fms junction to remove its gag gene-coded portion. Determination of the amino-terminal sequence of the resulting v-fms-coded glycoprotein, gp120/sup v-fms/, showed that the site of proteolysis corresponded to a predicted signal peptidase cleavage site within the c-fms gene product. Together, these analyses suggested that the linked gag sequences may not be necessary for expression of a biologically active v-fms gene product. The gag-fms sequences of feline sarcoma virus strain McDonough and the v-fms sequences alone were inserted into a murine retroviral vector containing a neomycin resistance gene. The authors conclude that a cryptic hydrophobic signal peptide sequence in v-fms was unmasked by gag deletion, thereby allowing the correct orientation and transport of the v-fms was unmasked by gag deletion, thereby allowing the correct orientation and transport of the v-fms gene product within membranous organelles. It seems likely that the proteolytic cleavage of gP180/gag-fms/ is mediated by signal peptidase and that the amino termini of gp140/sup v-fms/ and the c-fms gene product are identical.

Locus-specific detection of HLA-DQ and -DR antigens by antibodies against synthetic N-terminal octapeptides of the beta chain

DEFF Research Database (Denmark)

Deufel, T; Grove, A; Kofod, Hans

1985-01-01

Antibodies against synthetic peptides representing the class-II antigen HLA-DR and -DQ beta chain N-terminal sequences were prepared in rabbits. The two octapeptides only share two amino acids and enzyme-linked immuno-assays showed the antisera only to bind to its own antigen. Both peptide antisera...... chains of HLA-DR and -DQ have been prepared by the preparation by the production of antibodies against the N-terminal sequences of each polypeptide....

Amino acid sequences of the ribosomal proteins HL30 and HmaL5 from the archaebacterium Halobacterium marismortui.

Science.gov (United States)

Hatakeyama, T; Hatakeyama, T

1990-07-06

The complete amino acid sequences of the ribosomal proteins HL30 and HmaL5 from the archaebacterium Halobacterium marismortui were determined. Protein HL30 was found to be acetylated at its N-terminal amino acid and shows homology to the eukaryotic ribosomal proteins YL34 from yeast and RL31 from rat. Protein HmaL5 was homologous to the protein L5 from Escherichia coli and Bacillus stearothermophilus as well as to YL16 from yeast. HmaL5 shows more similarities to its eukaryotic counterpart than to eubacterial ones.

Involvement of tyrosine residues, N-terminal amino acids, and beta-alanine in insect cuticular sclerotization.

Science.gov (United States)

Andersen, Svend Olav

2007-09-01

During sclerotization of insect cuticle the acyldopamines, N-acetyldopamine (NADA) and N-beta-alanyldopamine (NBAD), are oxidatively incorporated into the cuticular matrix, thereby hardening and stabilizing the material by forming crosslinks between the proteins in the cuticular matrix and by forming polymers filling the intermolecular spaces in the cuticle. Sclerotized cuticle from the locust, Schistocerca gregaria, and the beetle, Tenebrio molitor, was hydrolyzed in dilute hydrochloric acid, and from the hydrolysates some components presumably degradation products of cuticular crosslinks were isolated. In two of the components, the sidechain of 3,4-dihydroxyacetophenone was linked to the amino groups of glycine and beta-alanine, respectively, and in the third component to the phenolic group of tyrosine. These three compounds, glycino-dihydroxyacetophenone, beta-alanino-dihydroxyacetophenone, and O-tyrosino-dihydroxyacetophenone, as well as the previously reported compound, lysino-dihydroxyacetophenone [Andersen, S.O., Roepstorff, P., 2007. Aspects of cuticular sclerotization in the locust, Schistocerca gregaria, and the beetle, Tenebrio molitor. Insect Biochem. Mol. Biol. 37, 223-234], are suggested to be degradation products of cuticular crosslinks, in which amino acid residues formed linkages to both the alpha- and beta-positions of the sidechain of acyldopamines.

Covalent Bonding of Pyrrolobenzodiazepines (PBDs) to Terminal Guanine Residues within Duplex and Hairpin DNA Fragments

Science.gov (United States)

Mantaj, Julia; Jackson, Paul J. M.; Karu, Kersti; Rahman, Khondaker M.; Thurston, David E.

2016-01-01

Pyrrolobenzodiazepines (PBDs) are covalent-binding DNA-interactive agents with growing importance as payloads in Antibody Drug Conjugates (ADCs). Until now, PBDs were thought to covalently bond to C2-NH2 groups of guanines in the DNA-minor groove across a three-base-pair recognition sequence. Using HPLC/MS methodology with designed hairpin and duplex oligonucleotides, we have now demonstrated that the PBD Dimer SJG-136 and the C8-conjugated PBD Monomer GWL-78 can covalently bond to a terminal guanine of DNA, with the PBD skeleton spanning only two base pairs. Control experiments with the non-C8-conjugated anthramycin along with molecular dynamics simulations suggest that the C8-substituent of a PBD Monomer, or one-half of a PBD Dimer, may provide stability for the adduct. This observation highlights the importance of PBD C8-substituents, and also suggests that PBDs may bind to terminal guanines within stretches of DNA in cells, thus representing a potentially novel mechanism of action at the end of DNA strand breaks. PMID:27055050

Relation of N-Terminal Pro B-Type Natriuretic Peptide Levels After Symptom-Limited Exercise to Baseline and Ischemia Levels

NARCIS (Netherlands)

van der Zee, P. Marc; Verberne, Hein J.; van Spijker, Rianne C.; van Straalen, Jan P.; Fischer, Johan C.; Sturk, Augueste; van Eck-Smit, Berthe L. F.; de Winter, Robbert J.

2009-01-01

Circulating levels of B-type natriuretic peptide (BNP) and the amino-terminal portion of the prohormone (NT-proBNP) have been reported to increase immediately after myocardial ischemia. The association between extent of exercise-induced myocardial ischemia measured using myocardial perfusion

The L-L oligomerization domain resides at the very N-terminus of the sendai virus L RNA polymerase protein

International Nuclear Information System (INIS)

Cevik, Bayram; Smallwood, Sherin; Moyer, Sue A.

2003-01-01

The Sendai virus RNA-dependent RNA polymerase is composed of the L and P proteins. We previously showed that the L protein gives intragenic complementation and forms an oligomer where the L-L interaction site mapped to the N-terminal half of the protein (S. Smallwood et al., 2002, Virology, 00, 000-000). We now show that L oligomerization does not depend on P protein and progressively smaller N-terminal fragments of L from amino acids (aa) 1-1146 through aa 1-174 all bind wild-type L. C-terminal truncations up to aa 424, which bind L, can complement the transcription defect in an L mutant altered at aa 379, although these L truncation mutants do not bind P. The fragment of L comprising aa 1-895, furthermore, acts as a dominant-negative mutant to inhibit transcription of wild-type L. N-terminal deletions of aa 1-189 and aa 1-734 have lost the ability to form the L-L complex as well as the L-P complex, although they still bind C protein. These data are consistent with the L-L interaction site residing in aa 1-174. Site-directed mutations in the N-terminal 347 aa, of L which abolish P binding, do not affect L-L complex formation, so while the L and P binding sites on L are overlapping they are mediated by different amino acids. The N-terminal portions of L with aa 1-424, aa 1-381, and to a lesser extent aa 1-174, can complement the transcription defect in an L mutant altered at aa 77-81, showing their L-L interaction is functional

Modulation of procaspase-7 self-activation by PEST amino acid residues of the N-terminal prodomain and intersubunit linker.

Science.gov (United States)

Alves, Juliano; Garay-Malpartida, Miguel; Occhiucci, João M; Belizário, José E

2017-12-01

Procaspase-7 zymogen polypeptide is composed of a short prodomain, a large subunit (p20), and a small subunit (p10) connected to an intersubunit linker. Caspase-7 is activated by an initiator caspase-8 and -9, or by autocatalysis after specific cleavage at IQAD 198 ↓S located at the intersubunit linker. Previously, we identified that PEST regions made of amino acid residues Pro (P), Glu (E), Asp (D), Ser (S), Thr (T), Asn (N), and Gln (Q) are conserved flanking amino acid residues in the cleavage sites within a prodomain and intersubunit linker of all caspase family members. Here we tested the impact of alanine substitution of PEST amino acid residues on procaspase-7 proteolytic self-activation directly in Escherichia coli. The p20 and p10 subunit cleavage were significantly delayed in double caspase-7 mutants in the prodomain (N18A/P26A) and intersubunit linker (S199A/P201A), compared with the wild-type caspase-7. The S199A/P201A mutants effectively inhibited the p10 small subunit cleavage. However, the mutations did not change the kinetic parameters (k cat /K M ) and optimal tetrapeptide specificity (DEVD) of the purified mutant enzymes. The results suggest a role of PEST-amino acid residues in the molecular mechanism for prodomain and intersubunit cleavage and caspase-7 self-activation.

Identification of antigenic domains in the non-structural protein of Muscovy duck parvovirus.

Science.gov (United States)

Yu, Tian-Fei; Li, Ming; Yan, Bing; Shao, Shu-Li; Fan, Xing-Dong; Wang, Jia; Wang, Dan-Na

2016-08-01

Muscovy duck parvovirus (MDPV) infection is widespread in many Muscovy-duck-farming countries, leading to a huge economic loss. By means of overlapping peptides expressed in Escherichia coli in combination with Western blot, antigenic domains on the non-structural protein (NSP) of MDPV were identified for the first time. On the Western blot, the fragments NS(481-510), NS (501-530), NS (521-550), NS (541-570), NS (561-590), NS (581-610) and NS (601-627) were positive (the numbers in parentheses indicate the location of amino acids), and other fragments were negative. These seven fragments were also reactive in an indirect enzyme-linked immunosorbent assay (i-ELISA). We therefore conclude that a linear antigenic domain of the NSP is located at its C-terminal end (amino acid residues 481-627). These results may facilitate future investigations into the function of NSP of MDPV and the development of immunoassays for the diagnosis of MDPV infection.

The C-terminal amino acid of the MHC-I heavy chain is critical for binding to Derlin-1 in human cytomegalovirus US11-induced MHC-I degradation.

Science.gov (United States)

Cho, Sunglim; Kim, Bo Young; Ahn, Kwangseog; Jun, Youngsoo

2013-01-01

Derlin-1 plays a critical role in endoplasmic reticulum-associated protein degradation (ERAD) of a particular subset of proteins. Although it is generally accepted that Derlin-1 mediates the export of ERAD substrates from the ER to the cytosol, little is known about how Derlin-1 interacts with these substrates. Human cytomegalovirus (HCMV) US11 exploits Derlin-1-dependent ERAD to degrade major histocompatibility complex class I (MHC-I) molecules and evade immune surveillance. US11 requires the cytosolic tail of the MHC-I heavy chain to divert MHC-I molecules into the ERAD pathway for degradation; however, the underlying mechanisms remain unknown. Here, we show that the cytosolic tail of the MHC-I heavy chain, although not required for interaction with US11, is required for tight binding to Derlin-1 and thus for US11-induced dislocation of the MHC-I heavy chain to the cytosol for proteasomal degradation. Surprisingly, deletion of a single C-terminal amino acid from the cytosolic tail disrupted the interaction between MHC-I molecules and Derlin-1, rendering mutant MHC-I molecules resistant to US11-induced degradation. Consistently, deleting the C-terminal cytosolic region of Derlin-1 prevented it from binding to MHC-I molecules. Taken together, these results suggest that the cytosolic region of Derlin-1 is involved in ERAD substrate binding and that this interaction is critical for the Derlin-1-mediated dislocation of the MHC-I heavy chain to the cytosol during US11-induced MHC-I degradation.

Timeframe Dependent Fragment Ions Observed in In-Source Decay Experiments with β-Casein Using MALDI MS.

Science.gov (United States)

Sekiya, Sadanori; Nagoshi, Keishiro; Iwamoto, Shinichi; Tanaka, Koichi; Takayama, Mitsuo

2015-09-01

The fragment ions observed with time-of-flight (TOF) and quadrupole ion trap (QIT) TOF mass spectrometers (MS) combined with matrix-assisted laser desorption/ionization in-source decay (MALDI-ISD) experiments of phosphorylated analytes β-casein and its model peptide were compared from the standpoint of the residence timeframe of analyte and fragment ions in the MALDI ion source and QIT cell. The QIT-TOF MS gave fragment c-, z'-, z-ANL, y-, and b-ions, and further degraded fragments originating from the loss of neutrals such as H(2)O, NH(3), CH(2)O (from serine), C2H4O (from threonine), and H(3)PO(4), whereas the TOF MS merely showed MALDI source-generated fragment c-, z'-, z-ANL, y-, and w-ions. The fragment ions observed in the QIT-TOF MS could be explained by the injection of the source-generated ions into the QIT cell or a cooperative effect of a little internal energy deposition, a long residence timeframe (140 ms) in the QIT cell, and specific amino acid effects on low-energy CID, whereas the source-generated fragments (c-, z'-, z-ANL, y-, and w-ions) could be a result of prompt radical-initiated fragmentation of hydrogen-abundant radical ions [M + H + H](+) and [M + H - H](-) within the 53 ns timeframe, which corresponds to the delayed extraction time. The further degraded fragment b/y-ions produced in the QIT cell were confirmed by positive- and negative-ion low-energy CID experiments performed on the source-generated ions (c-, z'-, and y-ions). The loss of phosphoric acid (98 u) from analyte and fragment ions can be explained by a slow ergodic fragmentation independent of positive and negative charges.

Timeframe Dependent Fragment Ions Observed in In-Source Decay Experiments with β-Casein Using MALDI MS

Science.gov (United States)

Sekiya, Sadanori; Nagoshi, Keishiro; Iwamoto, Shinichi; Tanaka, Koichi; Takayama, Mitsuo

2015-09-01

The fragment ions observed with time-of-flight (TOF) and quadrupole ion trap (QIT) TOF mass spectrometers (MS) combined with matrix-assisted laser desorption/ionization in-source decay (MALDI-ISD) experiments of phosphorylated analytes β-casein and its model peptide were compared from the standpoint of the residence timeframe of analyte and fragment ions in the MALDI ion source and QIT cell. The QIT-TOF MS gave fragment c-, z'-, z-ANL, y-, and b-ions, and further degraded fragments originating from the loss of neutrals such as H2O, NH3, CH2O (from serine), C2H4O (from threonine), and H3PO4, whereas the TOF MS merely showed MALDI source-generated fragment c-, z'-, z-ANL, y-, and w-ions. The fragment ions observed in the QIT-TOF MS could be explained by the injection of the source-generated ions into the QIT cell or a cooperative effect of a little internal energy deposition, a long residence timeframe (140 ms) in the QIT cell, and specific amino acid effects on low-energy CID, whereas the source-generated fragments (c-, z'-, z-ANL, y-, and w-ions) could be a result of prompt radical-initiated fragmentation of hydrogen-abundant radical ions [M + H + H]+ and [M + H - H]- within the 53 ns timeframe, which corresponds to the delayed extraction time. The further degraded fragment b/y-ions produced in the QIT cell were confirmed by positive- and negative-ion low-energy CID experiments performed on the source-generated ions (c-, z'-, and y-ions). The loss of phosphoric acid (98 u) from analyte and fragment ions can be explained by a slow ergodic fragmentation independent of positive and negative charges.

Jet fragmentation

International Nuclear Information System (INIS)

Saxon, D.H.

1985-10-01

The paper reviews studies on jet fragmentation. The subject is discussed under the topic headings: fragmentation models, charged particle multiplicity, bose-einstein correlations, identified hadrons in jets, heavy quark fragmentation, baryon production, gluon and quark jets compared, the string effect, and two successful models. (U.K.)

Protein Analysis by Mass Spectrometry

Directory of Open Access Journals (Sweden)

Cindic, M.

2008-04-01

Full Text Available Soft ionization techniques, electrospray (ESI and matrix-assisted laser desorption/ionization (MALDI make the analysis of biomolecules by mass spectrometry (MS possible. MS is used for determination of the molecular weight of peptides and protein, sequence analysis, characterization of protein-ligand interactions etc. The detection limit, resolution and mass accuracy depend on instrument used (Table 1. Impurities (buffers, salts, detergents can reduce the ion intensities or even totally suppress them, so a separation method (chromatography, 2D-gel electrophoresis must be used for purification of the sample.Molecular mass of intact protein can be determined by ESI or MALDI MS. Multiply charged ions are produced by ESI MS, while singly charged ions are predominant in MALDI spectra (Fig. 2.Sequence analysis of proteins by MS can be performed using peptide mass fingerprint. In this method, proteins are separated by 2-D gel electrophoresis and digested with specific protease (Table 2 or digested and then separated by two-dimensional chromatography (Fig. 1. The obtained peptide mixtures are analyzed by MS or MALDI-TOF technique. The masses determined by MS are compared with calculated masses from database entries. Different algorithms have been developed for protein identification. Example of posttranslational modifications (N- and O-glycosylation and protein sequence complex analysis after dual digestion (endoproteinase digestion followed by endoglycosidase digestion is shown in Fig. 3.It is known that detection of peptides by MS is influenced by intrinsic properties like amino acid composition, the basicity of the C-terminal amino acid, hydrophobicity, etc. Arginine-containing peptides dominate in MS spectra of tryptic digest, so the chemical derivatization of lysine terminal residue by O-methilisourea or 2-methoxy-4,5-1H-imidazole was suggested (Fig. 4.The peptide mass fingerprint method can be improved further by peptide fragmentation using tandem

Unusual chemical properties of N-terminal histidine residues of glucagon and vasoactive intestinal peptide

International Nuclear Information System (INIS)

Hefford, M.A.; Evans, R.M.; Oda, G.; Kaplan, H.

1985-01-01

An N-terminal histidine residue of a protein or peptide has two functional groups, viz., an alpha-amino group and an imidazole group. A new procedure, based on the competitive labeling approach described by Duggleby and Kaplan has been developed by which the chemical reactivity of each functional group in such a residue can be determined as a function of pH. Only very small amounts of material are required, which makes it possible to determine the chemical properties in dilute solution or in proteins and polypeptides that can be obtained in only minute quantities. With this approach, the reactivity of the alpha-amino group of histidylglycine toward 1-fluoro-2,4-dinitrobenzene gave an apparent pK /sub a/ value of 7.64 +/- 0.07 at 37 degrees C, in good agreement with a value of 7.69 +/- 0.02 obtained by acid-base titration. However, the reactivity of the imidazole function gave an apparent pK /sub a/ value of 7.16 +/- 0.07 as compared to the pK /sub a/ value of 5.85 +/- 0.01 obtained by acid-base titration. Similarly, in glucagon and vasoactive intestinal peptide (VIP), apparent pKa values of 7.60 +/- 0.04 and 7.88 +/- 0.18, respectively, were obtained for the alpha-amino of their N-terminal histidine, and pKa values of 7.43 +/- 0.09 and 7.59 +/- 0.18 were obtained for the imidazole function

Specific recognition of the C-terminal end of A beta 42 by a high affinity monoclonal antibody

DEFF Research Database (Denmark)

Axelsen, Trine Veje; Holm, Arne; Birkelund, Svend

2009-01-01

The neurotoxic peptide A beta(42) is derived from the amyloid precursor protein by proteolytic cleavage and is deposited in the brain of patients suffering from Alzheimer's disease (AD). In this study we generate a high affinity monoclonal antibody that targets the C-terminal end of A beta(42......) with high specificity. By this is meant that the paratope of the antibody must enclose the C-terminal end of A beta(42) including the carboxy-group of amino acid 42, and not just recognize a linear epitope in the C-terminal part of A beta. This has been accomplished by using a unique antigen construct made...... by the Ligand Presenting Assembly technology (LPA technology). This strategy results in dimeric presentation of the free C-terminal end of A beta(42). The generated Mab A beta1.1 is indeed specific for the C-terminal end of A beta(42) to which it binds with high affinity. Mab A beta1.1 recognizes the epitope...

Atrial natriuretic peptides in plasma

DEFF Research Database (Denmark)

Goetze, Jens Peter; Hansen, Lasse H; Terzic, Dijana

2014-01-01

Measurement of cardiac natriuretic peptides in plasma has gained a diagnostic role in the assessment of heart failure. Plasma measurement is though hampered by the marked instability of the hormones, which has led to the development of analyses that target N-terminal fragments from the prohormone....... These fragments are stable in plasma and represent surrogate markers of the actual natriuretic hormone. Post-translational processing of the precursors, however, is revealing itself to be a complex event with new information still being reported on proteolysis, covalent modifications, and amino acid...

Atrial natriuretic peptides in plasma

DEFF Research Database (Denmark)

Goetze, Jens P; Holst Hansen, Lasse; Terzic, Dijana

2015-01-01

Measurement of cardiac natriuretic peptides in plasma has gained a diagnostic role in the assessment of heart failure. Plasma measurement is though hampered by the marked instability of the hormones, which has led to the development of analyses that target N-terminal fragments from the prohormone....... These fragments are stable in plasma and represent surrogate markers of the actual natriuretic hormone. Post-translational processing of the precursors, however, is revealing itself to be a complex event with new information still being reported on proteolysis, covalent modifications, and amino acid...

Cutting edge: HLA-B27 acquires many N-terminal dibasic peptides: coupling cytosolic peptide stability to antigen presentation

NARCIS (Netherlands)

Herberts, Carla A.; Neijssen, Joost J.; de Haan, Jolanda; Janssen, Lennert; Drijfhout, Jan Wouter; Reits, Eric A.; Neefjes, Jacques J.

2006-01-01

Ag presentation by MHC class I is a highly inefficient process because cytosolic peptidases destroy most peptides after proteasomal generation. Various mechanisms shape the MHC class I peptidome. We define a new one: intracellular peptide stability. Peptides with two N-terminal basic amino acids are

Termination of DNA synthesis in vitro at apurinic sites but not at ethyl adducts of the template

Energy Technology Data Exchange (ETDEWEB)

Lockhart, M.L.; Deutsch, J.F.; Yamaura, I.; Cavalieri, L.F.; Rosenberg, B.H.

1982-01-01

The effects of DNA lesions produced by the carcinogenic alkylating agents ethylnitrosourea and diethylsulfate on the extent of DNA synthesis have been studied in a system utilizing circular single-stranded phi X174 DNA as template and a 392-base restriction fragment as primer with E. coli polymerase I (Klenow fragment). Apurinic sites produced by loss of unstable ethylated bases from the template terminate DNA synthesis at the first such site encountered, but ethyl adducts at most, if not all, locations permit readthrough. 22 references, 3 figures, 1 table.

Missing Fragments: Detecting Cooperative Binding in Fragment-Based Drug Design

Science.gov (United States)

2012-01-01

The aim of fragment-based drug design (FBDD) is to identify molecular fragments that bind to alternate subsites within a given binding pocket leading to cooperative binding when linked. In this study, the binding of fragments to human phenylethanolamine N-methyltransferase is used to illustrate how (a) current protocols may fail to detect fragments that bind cooperatively, (b) theoretical approaches can be used to validate potential hits, and (c) apparent false positives obtained when screening against cocktails of fragments may in fact indicate promising leads. PMID:24900472

Procollagen type III amino terminal peptide and myocardial fibrosis: A study in hypertensive patients with and without left ventricular hypertrophy.

Science.gov (United States)

dos Santos Moreira, Carlos; Serejo, Fátima; Alcântara, Paula; Ramalhinho, Vítor; Braz Nogueira, J

2015-05-01

An exaggerated accumulation of type I and type III fibrillar collagens occurs throughout the free wall and interventricular septum of patients with primary hypertension and left ventricular hypertrophy (LVH). In the present study the serum concentration of procollagen type III amino terminal peptide (PIIIP) was measured to determine the value of this peptide as a potential marker of ventricular fibrosis in hypertensive patients, particularly those with LVH. The study population consisted of patients with never-treated mild to moderate essential hypertension and 30 normotensive control subjects. Clinical, echocardiographic, electrocardiographic and biochemical parameters were assessed in all patients. Heart rate, body mass index and levels of blood pressure were increased in hypertensives, particularly those with LVH, compared to normotensive controls. Posterior wall thickness, left ventricular (LV) mass and LV mass index, and serum PIIIP concentration were also increased in hypertensives, with significant differences between the two hypertensive groups. The ratio between maximal early and late transmitral flow velocity measured during diastole was lower in hypertensives, particularly those with LVH, than in normotensive controls. The increase in PIIIP indicates that type III collagen synthesis increases in hypertensives, particularly those with LVH, implying that alterations in the heart in hypertension are the result not solely of hypertrophied LV muscle, but also of increased collagen deposition within the ventricular wall and around the coronary vessels. Thus, measurement of serum PIIIP could be a practical and useful tool in the non-invasive assessment of myocardial remodeling in hypertension. Copyright © 2014 Sociedade Portuguesa de Cardiologia. Published by Elsevier España. All rights reserved.

Structure predictions of two Bauhinia variegata lectins reveal patterns of C-terminal properties in single chain legume lectins.

Science.gov (United States)

Moreira, Gustavo M S G; Conceição, Fabricio R; McBride, Alan J A; Pinto, Luciano da S

2013-01-01

Bauhinia variegata lectins (BVL-I and BVL-II) are single chain lectins isolated from the plant Bauhinia variegata. Single chain lectins undergo post-translational processing on its N-terminal and C-terminal regions, which determines their physiological targeting, carbohydrate binding activity and pattern of quaternary association. These two lectins are isoforms, BVL-I being highly glycosylated, and thus far, it has not been possible to determine their structures. The present study used prediction and validation algorithms to elucidate the likely structures of BVL-I and -II. The program Bhageerath-H was chosen from among three different structure prediction programs due to its better overall reliability. In order to predict the C-terminal region cleavage sites, other lectins known to have this modification were analysed and three rules were created: (1) the first amino acid of the excised peptide is small or hydrophobic; (2) the cleavage occurs after an acid, polar, or hydrophobic residue, but not after a basic one; and (3) the cleavage spot is located 5-8 residues after a conserved Leu amino acid. These rules predicted that BVL-I and -II would have fifteen C-terminal residues cleaved, and this was confirmed experimentally by Edman degradation sequencing of BVL-I. Furthermore, the C-terminal analyses predicted that only BVL-II underwent α-helical folding in this region, similar to that seen in SBA and DBL. Conversely, BVL-I and -II contained four conserved regions of a GS-I association, providing evidence of a previously undescribed X4+unusual oligomerisation between the truncated BVL-I and the intact BVL-II. This is the first report on the structural analysis of lectins from Bauhinia spp. and therefore is important for the characterisation C-terminal cleavage and patterns of quaternary association of single chain lectins.

Hilic MS/MS determination of amino acids in herbs of Fumaria schleicheri L., Ocimum basilicum L., and leaves of Corylus avellana L.

Science.gov (United States)

Prokopenko, Yuliya; Jakštas, Valdas; Žvikas, Vaidotas; Georgiyants, Victoriya; Ivanauskas, Liudas

2018-05-18

The aim of research was to study the content of amino acids using in extracts of Fumaria schleicheri L., Ocimum basilicum L., and Corylus avellana L. by HILIC MS/MS method. Separation of amino acids in the samples was carried out with Acquity H-class UPLC system (Waters, Milford, USA) equipped with SeQuant ZIC-Hilic collumn (2.1 × 150 mm, 3.5 μm) (Merck Millipore, Darmstadt, Germany). The MS/MS fragment ion chromatograms of the test solutions established the presence of 19 amino acids. The obtained results have shown that O. basilicum L. characterized the highest concentrations of different neurogenic amino acids (128.1 mg/kg), comparing with F. schleicheri L. and C. avellana L. (57.72 and 52.91 mg/kg, respectively).

Vacuum Ultraviolet Single-Photon Postionization of Amino Acids

Directory of Open Access Journals (Sweden)

Hsu Chen Hsu

2018-05-01

Full Text Available In this study, ultraviolet (UV laser desorption and vacuum UV single-photon (VUV SP postionization were performed to ionize and successfully analyze 20 common amino acids. The analytical merit and efficiency of the ionization was compared with those of conventional UV matrix-assisted laser desorption ionization (UV-MALDI. A VUV light source (118 nm was generated from the ninth harmonic of a Q-switched Nd:YAG laser, and the photon number was determined to be larger than 1012 for each laser pulse in the ionization region. In general, the detection sensitivity of VUV-SP-postionization was 10–100 times higher than that of conventional UV-MALDI. In particular, the ion signal from VUV-SP-postionization was considerably larger than that from UV-MALDI for analytes with low proton affinity such as glycine. However, some fragmentation of intact ions was observed in VUV-SP-postionization. Quantitative analysis performed using a glycine/histidine mixture and tryptophan/phenylalanine mixture revealed that the dynamic range of VUV-SP-postionization was one order of magnitude larger than that of UV-MALDI, indicating that VUV-SP-postionization is suitable for the quantitative analysis of amino acids.

Isolation and sequence analysis of a cDNA clone encoding the fifth complement component

DEFF Research Database (Denmark)

Lundwall, Åke B; Wetsel, Rick A; Kristensen, Torsten

1985-01-01

DNA clone of 1.85 kilobase pairs was isolated. Hybridization of the mixed-sequence probe to the complementary strand of the plasmid insert and sequence analysis by the dideoxy method predicted the expected protein sequence of C5a (positions 1-12), amino-terminal to the anticipated priming site. The sequence......, subcloned into M13 mp8, and sequenced at random by the dideoxy technique, thereby generating a contiguous sequence of 1703 base pairs. This clone contained coding sequence for the C-terminal 262 amino acid residues of the beta-chain, the entire C5a fragment, and the N-terminal 98 residues of the alpha......'-chain. The 3' end of the clone had a polyadenylated tail preceded by a polyadenylation recognition site, a 3'-untranslated region, and base pairs homologous to the human Alu concensus sequence. Comparison of the derived partial human C5 protein sequence with that previously determined for murine C3 and human...

Interaction of N-terminal peptide analogues of the Na⁺,K⁺-ATPase with membranes

DEFF Research Database (Denmark)

Nguyen, Khoa; Garcia, Alvaro; Sani, Marc Antoine

2018-01-01

phosphatidylserine) in the surrounding membrane. Furthermore, to isolate which segments of the N-terminus could be involved in membrane binding, we chemically synthesized N-terminal fragments of various lengths. Based on a combination of results from RH421 UV/visible absorbance measurements and solid-state 31P and 2...

Terminal investment in the gustatory appeal of nuptial food gifts in crickets.

Science.gov (United States)

Duffield, K R; Hunt, J; Rapkin, J; Sadd, B M; Sakaluk, S K

2015-10-01

Investment in current versus future reproduction represents a prominent trade-off in life-history theory and is likely dependent on an individual's life expectancy. The terminal investment hypothesis posits that a reduction in residual reproductive value (i.e. potential for future offspring) will result in increased investment in current reproduction. We tested the hypothesis that male decorated crickets (Gryllodes sigillatus), when cued to their impending mortality, should increase their reproductive effort by altering the composition of their nuptial food gifts (i.e. spermatophylaxes) to increase their gustatory appeal to females. Using a repeated-measures design, we analysed the amino acid composition of spermatophylaxes derived from males both before and after injection of either a saline control or a solution of heat-killed bacteria. The latter, although nonpathogenic, represents an immune challenge that may signal an impending survival threat. One principal component explaining amino acid variation in spermatophylaxes, characterized by a high loading to histidine, was significantly lower in immune-challenged versus control males. The relevance of this difference for the gustatory appeal of gifts to females was assessed by mapping spermatophylax composition onto a fitness surface derived in an earlier study identifying the amino acid composition of spermatophylaxes preferred by females. We found that immune-challenged males maintained the level of attractiveness of their gifts post-treatment, whereas control males produced significantly less attractive gifts post-injection. These results are consistent with the hypothesis that cues of a survival-threatening infection stimulate terminal investment in male decorated crickets with respect to the gustatory appeal of their nuptial food gifts. © 2015 European Society For Evolutionary Biology. Journal of Evolutionary Biology © 2015 European Society For Evolutionary Biology.

Structure of a C-terminal AHNAK peptide in a 1:2:2 complex with S100A10 and an acetylated N-terminal peptide of annexin A2

Energy Technology Data Exchange (ETDEWEB)

Ozorowski, Gabriel [University of California, Irvine, Irvine, CA 92697-3900 (United States); University of California, Irvine, Irvine, CA 92697-3900 (United States); Milton, Saskia [University of California, Irvine, Irvine, CA 92697-3900 (United States); Luecke, Hartmut, E-mail: hudel@uci.edu [University of California, Irvine, Irvine, CA 92697-3900 (United States); University of California, Irvine, Irvine, CA 92697-3900 (United States); University of California, Irvine, Irvine, CA 92697 (United States); University of California, Irvine, Irvine, CA 92697 (United States)

2013-01-01

Structure of a 20-amino-acid peptide of AHNAK bound asymmetrically to the AnxA2–S100A10A heterotetramer (1:2:2 symmetry) provides insights into the atomic level interactions that govern this membrane-repair scaffolding complex. AHNAK, a large 629 kDa protein, has been implicated in membrane repair, and the annexin A2–S100A10 heterotetramer [(p11){sub 2}(AnxA2){sub 2})] has high affinity for several regions of its 1002-amino-acid C-terminal domain. (p11){sub 2}(AnxA2){sub 2} is often localized near the plasma membrane, and this C2-symmetric platform is proposed to be involved in the bridging of membrane vesicles and trafficking of proteins to the plasma membrane. All three proteins co-localize at the intracellular face of the plasma membrane in a Ca{sup 2+}-dependent manner. The binding of AHNAK to (p11){sub 2}(AnxA2){sub 2} has been studied previously, and a minimal binding motif has been mapped to a 20-amino-acid peptide corresponding to residues 5654–5673 of the AHNAK C-terminal domain. Here, the 2.5 Å resolution crystal structure of this 20-amino-acid peptide of AHNAK bound to the AnxA2–S100A10 heterotetramer (1:2:2 symmetry) is presented, which confirms the asymmetric arrangement first described by Rezvanpour and coworkers and explains why the binding motif has high affinity for (p11){sub 2}(AnxA2){sub 2}. Binding of AHNAK to the surface of (p11){sub 2}(AnxA2){sub 2} is governed by several hydrophobic interactions between side chains of AHNAK and pockets on S100A10. The pockets are large enough to accommodate a variety of hydrophobic side chains, allowing the consensus sequence to be more general. Additionally, the various hydrogen bonds formed between the AHNAK peptide and (p11){sub 2}(AnxA2){sub 2} most often involve backbone atoms of AHNAK; as a result, the side chains, particularly those that point away from S100A10/AnxA2 towards the solvent, are largely interchangeable. While the structure-based consensus sequence allows interactions with various

Updating the profile of C-terminal MECP2 deletions in Rett syndrome

Science.gov (United States)

Bebbington, A; Percy, A; Christodoulou, J; Ravine, D; Ho, G; Jacoby, P; Anderson, A; Pineda, M; Ben Zeev, B; Bahi-Buisson, N; Smeets, E; Leonard, H

2014-01-01

Objectives This study aimed to compare the phenotype of Rett syndrome cases with C-terminal deletions to that of cases with different MECP2 mutations and to examine the phenotypic variation within C-terminal deletions. Methods Cases were selected from InterRett, an international database and from the population-based Australian Rett Syndrome Database. Cases (n=832) were included if they had a pathogenic MECP2 mutation in which the nature of the amino acid change was known. Three severity scale systems were used, and individual aspects of the phenotype were also compared. Results Lower severity was associated with C-terminal deletions (n=79) compared to all other MECP2 mutations (e.g. Pineda scale C-terminals mean 15.0 (95% CI 14.0–16.0) vs 16.2 (15.9–16.5). Cases with C-terminal deletions were more likely to have a normal head circumference (odds ratio 3.22, 95% CI 1.53 – 6.79) and weight (odds ratio 2.97, 95% CI 1.25–5.76). Onset of stereotypies tended to be later (median age 2.5 years vs 2 years, pmiddle of the range. In terms of individual aspects of phenotype growth and ability to ambulate appear to be particular strengths. By pooling data internationally this study has achieved the case numbers to provide a phenotypic profile of C-terminal deletions in Rett syndrome. PMID:19914908

Carbon isotope effects in carbohydrates and amino acids of photosynthesizing organisms

International Nuclear Information System (INIS)

Ivlev, A.A.; Kaloshin, A.G.; Koroleva, M.Ya.

1982-01-01

The analysis of the carbon isotope distribution in carbohydrates and amino acids of some photosynthesizing organisms revealed the close relationship between distribution and the pathways of biosynthesis of the molecules. This relationship is explained on the basis of the previously proposed mechanism of carbon isotope fractionation in a cell, in which the chief part is played by kinetic isotope effects in the pyruvate decarboxylation reaction progressively increased in the conjugated processes of gluconeogenesis. Isotope differences of C 2 and C 3 fragments arising in decarboxylation of pyruvate, as well as isotope differences of biogenic acceptor and environmental CO 2 appearing in assimilation are the main reasons of the observed intramolecular isotopic heterogeneity of biomolecules. The heterogeneity is preserved in metabolites owing to an incomplete mixing of carbon atoms in biochemical reactions. The probable existence of two pools of carbohydrates in photosynthesizing organisms different in isotopic composition is predicted. Two types of intramolecular isotope distribution in amino acids are shown. (author)

Carbon isotope effects in carbohydrates and amino acids of photosynthesizing organisms

Energy Technology Data Exchange (ETDEWEB)

Ivlev, A.A.; Kaloshin, A.G.; Koroleva, M.Ya. (Ministerstvo Geologii SSR, Moscow)

1982-02-10

The analysis of the carbon isotope distribution in carbohydrates and amino acids of some photosynthesizing organisms revealed the close relationship between distribution and the pathways of biosynthesis of the molecules. This relationship is explained on the basis of the previously proposed mechanism of carbon isotope fractionation in a cell, in which the chief part is played by kinetic isotope effects in the pyruvate decarboxylation reaction progressively increased in the conjugated processes of gluconeogenesis. Isotope differences of C/sub 2/ and C/sub 3/ fragments arising in decarboxylation of pyruvate, as well as isotope differences of biogenic acceptor and environmental CO/sub 2/ appearing in assimilation are the main reasons of the observed intramolecular isotopic heterogeneity of biomolecules. The heterogeneity is preserved in metabolites owing to an incomplete mixing of carbon atoms in biochemical reactions. The probable existence of two pools of carbohydrates in photosynthesizing organisms different in isotopic composition is predicted. Two types of intramolecular isotope distribution in amino acids are shown.

Mutations in the C-terminal region affect subcellular localization of crucian carp herpesvirus (CaHV) GPCR.

Science.gov (United States)

Wang, Jun; Gui, Lang; Chen, Zong-Yan; Zhang, Qi-Ya

2016-08-01

G protein-coupled receptors (GPCRs) are known as seven transmembrane domain receptors and consequently can mediate diverse biological functions via regulation of their subcellular localization. Crucian carp herpesvirus (CaHV) was recently isolated from infected fish with acute gill hemorrhage. CaHV GPCR of 349 amino acids (aa) was identified based on amino acid identity. A series of variants with truncation/deletion/substitution mutation in the C-terminal (aa 315-349) were constructed and expressed in fathead minnow (FHM) cells. The roles of three key C-terminal regions in subcellular localization of CaHV GPCR were determined. Lysine-315 (K-315) directed the aggregation of the protein preferentially at the nuclear side. Predicted N-myristoylation site (GGGWTR, aa 335-340) was responsible for punctate distribution in periplasm or throughout the cytoplasm. Predicted phosphorylation site (SSR, aa 327-329) and GGGWTR together determined the punctate distribution in cytoplasm. Detection of organelles localization by specific markers showed that the protein retaining K-315 colocalized with the Golgi apparatus. These experiments provided first evidence that different mutations of CaHV GPCR C-terminals have different affects on the subcellular localization of fish herpesvirus-encoded GPCRs. The study provided valuable information and new insights into the precise interactions between herpesvirus and fish cells, and could also provide useful targets for antiviral agents in aquaculture.

Analysis of the epitope structure of Plum pox virus coat protein.

Science.gov (United States)

Candresse, Thierry; Saenz, Pilar; García, Juan Antonio; Boscia, Donato; Navratil, Milan; Gorris, Maria Teresa; Cambra, Mariano

2011-05-01

Typing of the particular Plum pox virus (PPV) strain responsible in an outbreak has important practical implications and is frequently performed using strain-specific monoclonal antibodies (MAbs). Analysis in Western blots of the reactivity of 24 MAbs to a 112-amino-acid N-terminal fragment of the PPV coat protein (CP) expressed in Escherichia coli showed that 21 of the 24 MAbs recognized linear or denaturation-insensitive epitopes. A series of eight C-truncated CP fragments allowed the mapping of the epitopes recognized by the MAbs. In all, 14 of them reacted to the N-terminal hypervariable region, defining a minimum of six epitopes, while 7 reacted to the beginning of the core region, defining a minimum of three epitopes. Sequence comparisons allowed the more precise positioning of regions recognized by several MAbs, including those recognized by the 5B-IVIA universal MAb (amino acids 94 to 100) and by the 4DG5 and 4DG11 D serogroup-specific MAbs (amino acids 43 to 64). A similar approach coupled with infectious cDNA clone mutagenesis showed that a V74T mutation in the N-terminus of the CP abolished the binding of the M serogroup-specific AL MAb. Taken together, these results provide a detailed positioning of the epitopes recognized by the most widely used PPV detection and typing MAbs.

Effect of amino acids on the stability of spray freeze-dried immunoglobulin G in sugar-based matrices.

Science.gov (United States)

Emami, Fakhrossadat; Vatanara, Alireza; Najafabadi, Abdolhosein Rouholamini; Kim, Yejin; Park, Eun Ji; Sardari, Soroush; Na, Dong Hee

2018-07-01

The purpose of this study was to prepare spray freeze-dried particles of immunoglobulin G (IgG) using various combinations of trehalose and different amino acids (leucine, phenylalanine, arginine, cysteine, and glycine), and investigate the effect of the amino acids on the stability of IgG during the spray freeze-drying (SFD) process and storage. The morphology and structural integrity of the processed particles were evaluated by physical and spectroscopic techniques. SFD-processed IgG without any excipient resulted in the formation of aggregates corresponding to approximately 14% of IgG. In contrast, IgG formulations stabilized using an optimal level of leucine, phenylalanine, or glycine in the presence of trehalose displayed aggregates <2.2%. In particular, phenylalanine combined with trehalose was most effective in stabilizing IgG against shear, freezing, and dehydration stresses during SFD. Arginine and cysteine were destabilizers displaying aggregation and fragmentation of IgG, respectively. Aggregation and fragmentation were evaluated by dynamic light scattering, ultraviolet spectrophotometry, size-exclusion chromatography, and microchip capillary gel electrophoresis. The IgG formulations prepared with leucine, phenylalanine, or glycine in the presence of trehalose showed good stability after storage at 40 °C and 75% relative humidity for 2 months. Thus, a combination of the excipients trehalose and uncharged, nonpolar amino acids appears effective for production of stable SFD IgG formulations. Copyright © 2018 Elsevier B.V. All rights reserved.

The isolation, purification and amino-acid sequence of insulin from the teleost fish Cottus scorpius (daddy sculpin).

Science.gov (United States)

Cutfield, J F; Cutfield, S M; Carne, A; Emdin, S O; Falkmer, S

1986-07-01

Insulin from the principal islets of the teleost fish, Cottus scorpius (daddy sculpin), has been isolated and sequenced. Purification involved acid/alcohol extraction, gel filtration, and reverse-phase high-performance liquid chromatography to yield nearly 1 mg pure insulin/g wet weight islet tissue. Biological potency was estimated as 40% compared to porcine insulin. The sculpin insulin crystallised in the absence of zinc ions although zinc is known to be present in the islets in significant amounts. Two other hormones, glucagon and pancreatic polypeptide, were copurified with the insulin, and an N-terminal sequence for pancreatic polypeptide was determined. The primary structure of sculpin insulin shows a number of sequence changes unique so far amongst teleost fish. These changes occur at A14 (Arg), A15 (Val), and B2 (Asp). The B chain contains 29 amino acids and there is no N-terminal extension as seen with several other fish. Presumably as a result of the amino acid substitutions, sculpin insulin does not readily form crystals containing zinc-insulin hexamers, despite the presence of the coordinating B10 His.

Gut luminal endogenous protein: implications for the determination of ileal amino acid digestibility in humans.

Science.gov (United States)

Moughan, Paul J; Rutherfurd, Shane M

2012-08-01

The true ileal digestibility assay provides the most informative measure of digestibility to assess bioavailability of amino acids in foods for humans. To determine 'true' estimates of ileal amino acid digestibility, requires that endogenous amino acids present in digesta at the terminal ileum be quantified. The amounts of endogenous amino acids in ileal digesta can be determined after feeding an animal or human a protein-free diet (traditional approach) or by various methods after giving a protein-containing diet. When the protein-free method has been applied with adult human subjects an overall mean value (three separate studies) for endogenous ileal nitrogen flow of 800 mg N/d has been reported. This value is considerably lower than a comparable value obtained after feeding protein of 1852 mg N/d (mean of four separate studies), and thus endogenous ileal N and amino acids should be measured under conditions of protein alimentation. There is some confusion concerning the terminology used to define digestibility, with the term "true" digestibility having different adopted meanings. Here, true amino acid digestibility is defined as apparent amino acid digestibility corrected for the basal amino acid losses determined after giving either a protein-free or a protein-containing diet. Basal losses should be determined at a defined dry-matter and protein intake. The protein-free diet approach to determining endogenous amino acids is considered unphysiological and basal losses refer to ileal endogenous amino acid flows associated with digesta dry-matter flow, and not including "specific" effects of dietary factors such as non starch polysaccharides and anti nutritional factors. Arguments are advanced that the enzyme hydrolysed protein/ultra filtration method may be suitable for routine application with a cannulated pig model, to obtain physiologically-valid basal estimates of ileal endogenous amino acids to allow calculation of true ileal amino acid digestibility in the

Improved segmental isotope labeling of proteins and application to a larger protein

International Nuclear Information System (INIS)

Otomo, Takanori; Teruya, Kenta; Uegaki, Koichi; Yamazaki, Toshio; Kyogoku, Yoshimasa

1999-01-01

A new isotope labeling technique for peptide segments in a protein sample was recently established using the protein splicing element intein [Yamazaki et al. (1998) J. Am. Chem. Soc., 120, 5591-5592]. This method makes it possible to observe signals of a selected amino (N-) or carboxyl (C-) terminal region along a peptide chain. However, there is a problem with the yield of the segmentally labeled protein. In this paper, we report an increase in the yield of the protein that enables the production of sufficient amounts of segmentally 13 C/ 15 N-labeled protein samples. This was achieved by improvement of the expression level of the N-terminal fragment in cells and the efficiency of refolding into the active splicing conformation. The N-terminal fragment was expressed as a fused protein with the cellulose binding domain at its N-terminus, which was expressed as an insoluble peptide in cells and the expression level was increased. Incubation with 2.5 M urea and 50% glycerol increased the efficiency of the refolding greatly, thereby raising the final yields of the ligated proteins. The feasibility of application of the method to a high-molecular-weight protein was demonstrated by the results for a maltose binding protein consisting of 370 amino acids. All four examined joints in the maltose binding protein were successfully ligated to produce segmentally labeled protein samples

Discovery of potent, reversible MetAP2 inhibitors via fragment based drug discovery and structure based drug design-Part 1.

Science.gov (United States)

Cheruvallath, Zacharia; Tang, Mingnam; McBride, Christopher; Komandla, Mallareddy; Miura, Joanne; Ton-Nu, Thu; Erikson, Phil; Feng, Jun; Farrell, Pamela; Lawson, J David; Vanderpool, Darin; Wu, Yiqin; Dougan, Douglas R; Plonowski, Artur; Holub, Corine; Larson, Chris

2016-06-15

Methionine aminopeptidase 2 (MetAP2) is an enzyme that cleaves an N-terminal methionine residue from a number of newly synthesized proteins. Pre-clinical and clinical studies suggest that MetAP2 inhibitors could be used as a novel treatment for obesity. Herein we describe our use of fragment screening methods and structural biology to quickly identify and elaborate an indazole fragment into a series of reversible MetAP2 inhibitors with <10nM potency, excellent selectivity, and favorable in vitro safety profiles. Copyright © 2016 Elsevier Ltd. All rights reserved.

Towards a population synthesis model of self-gravitating disc fragmentation and tidal downsizing II: the effect of fragment-fragment interactions

Science.gov (United States)

Forgan, D. H.; Hall, C.; Meru, F.; Rice, W. K. M.

2018-03-01

It is likely that most protostellar systems undergo a brief phase where the protostellar disc is self-gravitating. If these discs are prone to fragmentation, then they are able to rapidly form objects that are initially of several Jupiter masses and larger. The fate of these disc fragments (and the fate of planetary bodies formed afterwards via core accretion) depends sensitively not only on the fragment's interaction with the disc, but also with its neighbouring fragments. We return to and revise our population synthesis model of self-gravitating disc fragmentation and tidal downsizing. Amongst other improvements, the model now directly incorporates fragment-fragment interactions while the disc is still present. We find that fragment-fragment scattering dominates the orbital evolution, even when we enforce rapid migration and inefficient gap formation. Compared to our previous model, we see a small increase in the number of terrestrial-type objects being formed, although their survival under tidal evolution is at best unclear. We also see evidence for disrupted fragments with evolved grain populations - this is circumstantial evidence for the formation of planetesimal belts, a phenomenon not seen in runs where fragment-fragment interactions are ignored. In spite of intense dynamical evolution, our population is dominated by massive giant planets and brown dwarfs at large semimajor axis, which direct imaging surveys should, but only rarely, detect. Finally, disc fragmentation is shown to be an efficient manufacturer of free-floating planetary mass objects, and the typical multiplicity of systems formed via gravitational instability will be low.

Multiple roles of genome-attached bacteriophage terminal proteins

International Nuclear Information System (INIS)

Redrejo-Rodríguez, Modesto; Salas, Margarita

2014-01-01

Protein-primed replication constitutes a generalized mechanism to initiate DNA or RNA synthesis in linear genomes, including viruses, gram-positive bacteria, linear plasmids and mobile elements. By this mechanism a specific amino acid primes replication and becomes covalently linked to the genome ends. Despite the fact that TPs lack sequence homology, they share a similar structural arrangement, with the priming residue in the C-terminal half of the protein and an accumulation of positively charged residues at the N-terminal end. In addition, various bacteriophage TPs have been shown to have DNA-binding capacity that targets TPs and their attached genomes to the host nucleoid. Furthermore, a number of bacteriophage TPs from different viral families and with diverse hosts also contain putative nuclear localization signals and localize in the eukaryotic nucleus, which could lead to the transport of the attached DNA. This suggests a possible role of bacteriophage TPs in prokaryote-to-eukaryote horizontal gene transfer. - Highlights: • Protein-primed genome replication constitutes a strategy to initiate DNA or RNA synthesis in linear genomes. • Bacteriophage terminal proteins (TPs) are covalently attached to viral genomes by their primary function priming DNA replication. • TPs are also DNA-binding proteins and target phage genomes to the host nucleoid. • TPs can also localize in the eukaryotic nucleus and may have a role in phage-mediated interkingdom gene transfer

Multiple roles of genome-attached bacteriophage terminal proteins

Energy Technology Data Exchange (ETDEWEB)

Redrejo-Rodríguez, Modesto; Salas, Margarita, E-mail: msalas@cbm.csic.es

2014-11-15

Protein-primed replication constitutes a generalized mechanism to initiate DNA or RNA synthesis in linear genomes, including viruses, gram-positive bacteria, linear plasmids and mobile elements. By this mechanism a specific amino acid primes replication and becomes covalently linked to the genome ends. Despite the fact that TPs lack sequence homology, they share a similar structural arrangement, with the priming residue in the C-terminal half of the protein and an accumulation of positively charged residues at the N-terminal end. In addition, various bacteriophage TPs have been shown to have DNA-binding capacity that targets TPs and their attached genomes to the host nucleoid. Furthermore, a number of bacteriophage TPs from different viral families and with diverse hosts also contain putative nuclear localization signals and localize in the eukaryotic nucleus, which could lead to the transport of the attached DNA. This suggests a possible role of bacteriophage TPs in prokaryote-to-eukaryote horizontal gene transfer. - Highlights: • Protein-primed genome replication constitutes a strategy to initiate DNA or RNA synthesis in linear genomes. • Bacteriophage terminal proteins (TPs) are covalently attached to viral genomes by their primary function priming DNA replication. • TPs are also DNA-binding proteins and target phage genomes to the host nucleoid. • TPs can also localize in the eukaryotic nucleus and may have a role in phage-mediated interkingdom gene transfer.

Amino acids 16-275 of minute virus of mice NS1 include a domain that specifically binds (ACCA)2-3-containing DNA.

Science.gov (United States)

Mouw, M; Pintel, D J

1998-11-10

GST-NS1 purified from Escherichia coli and insect cells binds double-strand DNA in an (ACCA)2-3-dependent fashion under similar ionic conditions, independent of the presence of anti-NS1 antisera or exogenously supplied ATP and interacts with single-strand DNA and RNA in a sequence-independent manner. An amino-terminal domain (amino acids 1-275) of NS1 [GST-NS1(1-275)], representing 41% of the full-length NS1 molecule, includes a domain that binds double-strand DNA in a sequence-specific manner at levels comparable to full-length GST-NS1, as well as single-strand DNA and RNA in a sequence-independent manner. The deletion of 15 additional amino-terminal amino acids yielded a molecule [GST-NS1(1-275)] that maintained (ACCA)2-3-specific double-strand DNA binding; however, this molecule was more sensitive to increasing ionic conditions than full-length GST-NS1 and GST-NS1(1-275) and could not be demonstrated to bind single-strand nucleic acids. A quantitative filter binding assay showed that E. coli- and baculovirus-expressed GST-NS1 and E. coli GST-NS1(1-275) specifically bound double-strand DNA with similar equilibrium kinetics [as measured by their apparent equilibrium DNA binding constants (KD)], whereas GST-NS1(16-275) bound 4- to 8-fold less well. Copyright 1998 Academic Press.

Universal elements of fragmentation

International Nuclear Information System (INIS)

Yanovsky, V. V.; Tur, A. V.; Kuklina, O. V.

2010-01-01

A fragmentation theory is proposed that explains the universal asymptotic behavior of the fragment-size distribution in the large-size range, based on simple physical principles. The basic principles of the theory are the total mass conservation in a fragmentation process and a balance condition for the energy expended in increasing the surface of fragments during their breakup. A flux-based approach is used that makes it possible to supplement the basic principles and develop a minimal theory of fragmentation. Such a supplementary principle is that of decreasing fragment-volume flux with increasing energy expended in fragmentation. It is shown that the behavior of the decreasing flux is directly related to the form of a power-law fragment-size distribution. The minimal theory is used to find universal asymptotic fragment-size distributions and to develop a natural physical classification of fragmentation models. A more general, nonlinear theory of strong fragmentation is also developed. It is demonstrated that solutions to a nonlinear kinetic equation consistent with both basic principles approach a universal asymptotic size distribution. Agreement between the predicted asymptotic fragment-size distributions and experimental observations is discussed.

A Role for Galanin N-Terminal Fragment (1–15) in Anxiety- and Depression-Related Behaviors in Rats

Science.gov (United States)

Millón, Carmelo; Flores-Burgess, Antonio; Narváez, Manuel; Borroto-Escuela, Dasiel O.; Santín, Luis; Parrado, Concepción; Narváez, José Angel; Fuxe, Kjell

2015-01-01

Background: Galanin (GAL) plays a role in mood regulation. In this study we analyzed the action of the active N-terminal fragment [GAL(1–15)] in anxiety- and depression-related behavioral tests in rats. Methods: The effect of GAL(1–15) was analyzed in the forced swimming test, tail suspension test, open field test, and light/dark test. The proximity of GAL1 and GAL2 receptors was examined with the proximity ligation assay (PLA). We tested the GAL receptors involved in GAL(1–15) effects with the GAL2 receptor antagonist M871 and with an in vivo model of siRNA GAL2 receptor knockdown or siRNA GAL1 receptor knockdown rats. The effects of GAL(1–15) were also studied in the cell line RN33B. Results: GAL(1–15) induced strong depression-like and anxiogenic-like effects in all the tests. These effects were stronger than the ones induced by GAL. The involvement of the GAL2 receptor was demonstrated with M871 and with the siRNA GAL2 receptor knockdown rats. The PLA indicated the possible existence of GAL1 and GAL2 heteroreceptor complexes in the dorsal hippocampus and especially in the dorsal raphe nucleus. In the siRNA GAL1 receptor knockdown rats the behavioral actions of GAL(1–15) disappeared, and in the siRNA GAL2 receptor knockdown rats the reductions of the behavioral actions of GAL(1–15) was linked to a disappearance of PLA. In the cell line RN33B, GAL(1–15) decreased 5-HT immunoreactivity more strongly than GAL. Conclusions: Our results indicate that GAL(1–15) exerts strong depression-related and anxiogenic-like effects and may give the basis for the development of drugs targeting GAL1 and GAL2 heteroreceptor complexes in the raphe-limbic system for the treatment of depression and anxiety. PMID:25522404

Foot-and-mouth disease virus 5'-terminal S fragment is required for replication and modulation of the innate immune response in host cells.

Science.gov (United States)

Kloc, Anna; Diaz-San Segundo, Fayna; Schafer, Elizabeth A; Rai, Devendra K; Kenney, Mary; de Los Santos, Teresa; Rieder, Elizabeth

2017-12-01

The S fragment of the FMDV 5' UTR is predicted to fold into a long stem-loop structure and it has been implicated in virus-host protein interactions. In this study, we report the minimal S fragment sequence required for virus viability and show a direct correlation between the extent of the S fragment deletion mutations and attenuated phenotypes. Furthermore, we provide novel insight into the role of the S fragment in modulating the host innate immune response. Importantly, in an FMDV mouse model system, all animals survive the inoculation with the live A 24 FMDV-S 4 mutant, containing a 164 nucleotide deletion in the upper S fragment loop, at a dose 1000 higher than the one causing lethality by parental A 24 FMDV, indicating that the A 24 FMDV-S 4 virus is highly attenuated in vivo. Additionally, mice exposed to high doses of live A 24 FMDV-S 4 virus are fully protected when challenged with parental A 24 FMDV virus. Published by Elsevier Inc.

CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

Directory of Open Access Journals (Sweden)

Tri Joko Raharjo

2011-12-01

Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

Crystallization of the C-terminal domain of the addiction antidote CcdA in complex with its toxin CcdB

International Nuclear Information System (INIS)

Buts, Lieven; De Jonge, Natalie; Loris, Remy; Wyns, Lode; Dao-Thi, Minh-Hoa

2005-01-01

The CcdA C-terminal domain was crystallized in complex with CcdB in two crystal forms that diffract to beyond 2.0 Å resolution. CcdA and CcdB are the antidote and toxin of the ccd addiction module of Escherichia coli plasmid F. The CcdA C-terminal domain (CcdA C36 ; 36 amino acids) was crystallized in complex with CcdB (dimer of 2 × 101 amino acids) in three different crystal forms, two of which diffract to high resolution. Form II belongs to space group P2 1 2 1 2 1 , with unit-cell parameters a = 37.6, b = 60.5, c = 83.8 Å and diffracts to 1.8 Å resolution. Form III belongs to space group P2 1 , with unit-cell parameters a = 41.0, b = 37.9, c = 69.6 Å, β = 96.9°, and diffracts to 1.9 Å resolution

A systematic review on sperm DNA fragmentation in male factor infertility: Laboratory assessment

Directory of Open Access Journals (Sweden)

Manesh Kumar Panner Selvam

2018-03-01

Full Text Available Objective: To review sperm DNA fragmentation (SDF testing as an important sperm function test in addition to conventional semen analysis. High SDF is negatively associated with semen quality, the fertilisation process, embryo quality, and pregnancy outcome. Over recent decades, different SDF assays have been developed and reviewed extensively to assess their applicability and accuracy as advanced sperm function tests. Amongst them, the standardisation of the terminal deoxynucleotidyl transferased UTP nick-end labelling (TUNEL assay with a bench top flow cytometer in clinical practice deserves special mention with a threshold value of 16.8% to differentiate infertile men with DNA damage from fertile men. Materials and methods: A systematic literature search was performed through the PubMed, Medline, and ScienceDirect databases using the keywords ‘sperm DNA fragmentation’ and ‘laboratory assessment’. Non-English articles were excluded and studies related to humans were only included. Results: Of the 618 identified, 87 studies (original research and reviews and in addition eight book chapters meeting the selection criteria were included in this review. In all, 366 articles were rejected in the preliminary screening and a further 165 articles related to non-human subjects were excluded. Conclusion: There are pros and cons to all the available SDF assays. TUNEL is a reliable technique with greater accuracy and as an additional diagnostic test in Andrology laboratories along with basic semen analysis can predict fertility outcome, and thus direct the choice of an assisted reproductive technology procedure for infertile couples. Also, the TUNEL assay can be used as a prognostic test and results are beneficial in deciding personalised treatment for infertile men. Keywords: Sperm DNA fragmentation (SDF, Terminal deoxynucleotidyl transferased UTP nick-end labelling (TUNEL, DNA damage, Sperm DNA fragmentation (SDF assay

Measurement of Urinary Amino-Terminal Pro-Brain Natriuretic Peptide in Childhood Lower Respiratory Tract Infections: An Indicator of Clinical Severity?

Directory of Open Access Journals (Sweden)

Nisa Eda Çullas İlarslan

2017-12-01

Full Text Available Aim: Prompt diagnosis and determination of the clinical severity and intervention of lower respiratory tract infections (LRTI is essential for the prevention and management of life-threatening complications. Laboratory tests do not serve as accurate indicators of clinical severity. Our aim was to evaluate the contribution of urinary amino-terminal pro-brain natriuretic peptide (NT-ProBNP concentrations in children with LRTI to clinical assessment in terms of determining clinical severity and the necessity of hospitalization. Materials and Methods: This prospective non-randomised study included a total of 160 patients, aged 0-6 years, diagnosed with LRTI [(group 1=outpatient group (n=108, and (group 2=hospitalized patients (n=52]. The control group (group 3 was comprised of 46 healthy children. Urinary NT-ProBNP level of each participant was measured by ELISA method. Results: Although not significant, the mean urinary NT-ProBNP level of all patients was higher than that of the control group (p=0.322. When we compared the three groups separately, the highest levels belonged to outpatients whereas hospitalized patients showed slightly lower levels than the control group without any statistical significance (p=0.128. As for newborns (n=16, patients showed higher levels than the controls (p=0.041. P value <0.05 was considered significant. Conclusion: Although urinary NT-ProBNP level tends to increase to some extent in childhood LRTI, this alteration does not seem to be valuable in the prediction of the severity of the disease. We believe that the establishment of further studies including larger series of patients, especially neonates, is warranted.

The alpha-fetoprotein third domain receptor binding fragment: in search of scavenger and associated receptor targets.

Science.gov (United States)

Mizejewski, G J

2015-01-01

Recent studies have demonstrated that the carboxyterminal third domain of alpha-fetoprotein (AFP-CD) binds with various ligands and receptors. Reports within the last decade have established that AFP-CD contains a large fragment of amino acids that interact with several different receptor types. Using computer software specifically designed to identify protein-to-protein interaction at amino acid sequence docking sites, the computer searches identified several types of scavenger-associated receptors and their amino acid sequence locations on the AFP-CD polypeptide chain. The scavenger receptors (SRs) identified were CD36, CD163, Stabilin, SSC5D, SRB1 and SREC; the SR-associated receptors included the mannose, low-density lipoprotein receptors, the asialoglycoprotein receptor, and the receptor for advanced glycation endproducts (RAGE). Interestingly, some SR interaction sites were localized on the AFP-derived Growth Inhibitory Peptide (GIP) segment at amino acids #480-500. Following the detection studies, a structural subdomain analysis of both the receptor and the AFP-CD revealed the presence of epidermal growth factor (EGF) repeats, extracellular matrix-like protein regions, amino acid-rich motifs and dimerization subdomains. For the first time, it was reported that EGF-like sequence repeats were identified on each of the three domains of AFP. Thereafter, the localization of receptors on specific cell types were reviewed and their functions were discussed.

Estimation of the basicity of the donor strength of terminal groups in cationic polymethine dyes

Science.gov (United States)

Kachkovsky, Alexey; Obernikhina, Nataliya; Prostota, Yaroslav; Naumenko, Antonina; Melnyk, Dmitriy; Yashchuk, Valeriy

2018-02-01

The well-known conception of the basicity of the terminal groups in the cationic polymethine dyes showing their donor properties is examined (considered) in detail. The various approachs are proposed to quantitative quantum-chemical estimation of a donor strength of the terminal groups in cationic polymethine dyes: shift of the frontier levels upon introducing terminal residues in comparison with unsybstituted polymethine cation; transferring of the electron density from the terminal groups to the polymethine chain and hence manifested itself as a redistribution of total positive charge between molecular fragments; changes of the charge alternation at carbon atoms along the chain. All approach correlate between them and agree with the concept of the basicity as a capability of terminal heterocycles to show its donor properties in the polymethine dyes. The results of the fulfilled calculations of numerous examples are presented; the proposed parameters point correctly the tendency in the change donor strength upon varying of the chemical constitution: the dimension of cycle, introducing of various heteroatoms, linear or angular annelating by benzene ring; as well as direct to take into consideration the existence of local levels.

Roles of the C-terminal domains of human dihydrodiol dehydrogenase isoforms in the binding of substrates and modulators: probing with chimaeric enzymes.

Science.gov (United States)

Matsuura, K; Hara, A; Deyashiki, Y; Iwasa, H; Kume, T; Ishikura, S; Shiraishi, H; Katagiri, Y

1998-01-01

Human liver dihydrodiol dehydrogenase (DD; EC 1.3.1.20) exists in isoforms (DD1, DD2 and DD4) composed of 323 amino acids. DD1 and DD2 share 98% amino acid sequence identity, but show lower identities (approx. 83%) with DD4, in which a marked difference is seen in the C-terminal ten amino acids. DD4 exhibits unique catalytic properties, such as the ability to oxidize both (R)- and (S)-alicyclic alcohols equally, high dehydrogenase activity for bile acids, potent inhibition by steroidal anti-inflammatory drugs and activation by sulphobromophthalein and clofibric acid derivatives. In this study, we have prepared chimaeric enzymes, in which we exchanged the C-terminal 39 residues between the two enzymes. Compared with DD1, CDD1-4 (DD1 with the C-terminal sequence of DD4) had increased kcat/Km values for 3alpha-hydroxy-5beta-androstanes and bile acids of 3-9-fold and decreased values for the other substrates by 5-100-fold. It also became highly sensitive to DD4 inhibitors such as phenolphthalein and hexoestrol. Another chimaeric enzyme, CDD4-1 (DD4 with the C-terminal sequence of DD1), showed the same (S)-stereospecificity for the alicyclic alcohols as DD1, had decreased kcat/Km values for bile acids with 7beta- or 12alpha-hydroxy groups by more than 120-fold and was resistant to inhibition by betamethasone. In addition, the activation effects of sulphobromophthalein and bezafibrate decreased or disappeared for CDD4-1. The recombinant DD4 with the His314-->Pro (the corresponding residue of DD1) mutation showed intermediate changes in the properties between those of wild-type DD4 and CDD4-1. The results indicate that the binding of substrates, inhibitors and activators to the enzymes is controlled by residues in their C-terminal domains; multiple residues co-ordinately act as determinants for substrate specificity and inhibitor sensitivity. PMID:9820821

Role of teh Rad52 Amino-terminal DNA Binding Activity in DNA Strand Capture in Homologous Recombination

DEFF Research Database (Denmark)

Shi, Idina; Hallwyl, Swee Chuang Lim; Seong, Changhyun

2009-01-01

Saccharomyces cerevisiae Rad52 protein promotes homologous recombination by nucleating the Rad51 recombinase onto replication protein A-coated single-stranded DNA strands and also by directly annealing such strands. We show that the purified rad52-R70A mutant protein, with a compromised amino-ter...

ToF-SIMS and principal component analysis of lipids and amino acids from inflamed and dysplastic human colonic mucosa.

Science.gov (United States)

Urbini, Marco; Petito, Valentina; de Notaristefani, Francesco; Scaldaferri, Franco; Gasbarrini, Antonio; Tortora, Luca

2017-10-01

Here, time of flight secondary ion mass spectrometry (ToF-SIMS) and multivariate analysis were combined to study the role of ulcerative colitis (UC), a type of inflammatory bowel disease (IBD), in the colon cancer progression. ToF-SIMS was used to obtain mass spectra and chemical maps from the mucosal surface of human normal (NC), inflamed (IC), and dysplastic (DC) colon tissues. Chemical mapping with a lateral resolution of ≈ 1 μm allowed to evaluate zonation of fatty acids and amino acids as well as the morphological condition of the intestinal glands. High mass resolution ToF-SIMS spectra showed chemical differences in lipid and amino acid composition as a function of pathological state. In positive ion mode, mono- (MAG), di- (DAG), and triacylglycerol (TAG) signals were detected in NC tissues, while in IC and DC tissues, the only cholesterol was present as lipid class representative. Signals from fatty acids, collected in negative ion mode, were subjected to principal component analysis (PCA). PCA showed a strict correlation between IC and DC samples, due to an increase of stearic, arachidonic, and linoleic acid. In the same way, differences in the amino acid composition were highlighted through multivariate analysis. PCA revealed that glutamic acid, leucine/isoleucine, and valine fragments are related to IC tissues. On the other hand, tyrosine, methionine, and tryptophan peaks contributed highly to the separation of DC tissues. Finally, a classification of NC, IC, and DC patients was also achieved through hierarchical cluster analysis of amino acid fragments. In this case, human colonic inflammation showed a stronger relationship with normal than dysplastic condition. Graphical Abstract ᅟ.

Associations between N-terminal pro-B-type natriuretic peptide and cardiac function in adults with corrected tetralogy of Fallot

NARCIS (Netherlands)

J.A. Eindhoven (Jannet); M.E. Menting (Myrthe); A.E. van den Bosch (Annemien); J.A.A.E. Cuypers (Judith); T.P.E. Ruys (Titia); M. Witsenburg (Maarten); J.S. Vletter-McGhie (Jackie); H. Boersma (Eric); J.W. Roos-Hesselink (Jolien)

2014-01-01

textabstractBackground Amino-terminal B-type natriuretic peptide (NT-proBNP) may detect early cardiac dysfunction in adults with tetralogy of Fallot (ToF) late after corrective surgery. We aimed to determine the value of NT-proBNP in adults with ToF and establish its relationship with

The influence of the N-terminal region of antimicrobial peptide pleurocidin on fungal apoptosis.

Science.gov (United States)

Choi, Hyemin; Lee, Dong Gun

2013-10-28

In our previous study, the 25-mer antimicrobial peptide pleurocidin (Ple) had been thought to induce apoptosis in Candida albicans. This study demonstrated that reactive oxygen species (ROS) production was a major cause of Ple-induced apoptosis. Four truncated analogs were synthesized to understand the functional roles in the N- and C-terminal regions of Ple on the apoptosis. Ple, Ple (4-25), Ple (1-22), and Ple (1-19) produced ROS, including hydroxyl radicals, on the order of [Ple > Ple (1-22) > Ple (4-25) > Ple (1-19)], whereas Ple (7-25) did not induce any ROS production. The results suggested that the N-terminal deletion affected the ROS-inducing activities much more than that of the C-terminal deletion, and net hydrophobicity [Ple > Ple (1-22) > Ple (4-25) > Ple (1-19) > Ple (7-25)] was related to ROS generation rather than other primary factors like net charge. Hence, we focused on the N-terminal-truncated peptides, Ple (4-25) and Ple (7-25), and examined other apoptotic features, including mitochondrial membrane depolarization, caspase activation, phosphatidylserine externalization, and DNA and nuclear fragmentation. The results also confirmed the disappearance of apoptotic activity of Ple (7-25) by the truncation of the N-terminal region (1-6) and the specific activity patterns between Ple and analogs. In conclusion, the N-terminal region of Ple played an important role in apoptosis.

Histidine, lysine, and arginine radical cations: isomer control via the choice of auxiliary ligand (L) in the dissociation of [CuII(L)amino acid]*2+ complexes.

Science.gov (United States)

Ke, Yuyong; Zhao, Junfang; Verkerk, Udo H; Hopkinson, Alan C; Siu, K W Michael

2007-12-27

Histidine, lysine, and arginine radical cations have been generated through collision-induced dissociation (CID) of complexes [CuII(auxiliary ligand)namino acid]*2+, using tri-, bi-, as well as monodentate auxiliary ligands. On the basis of the observed CID products, the existence of two isomeric amino-acid populations is postulated. The Type 1 radical cations of histidine and lysine, stable on the mass spectrometer time scale, were found to lose water, followed by the loss of carbon monoxide under more energetic CID conditions. The arginine Type 1 radical cation behaved differently, losing dehydroalanine. The Type 2 radical cations were metastable and easily fragmented by the loss of carbon dioxide, effectively preventing direct observation. Type 1 radical cations are proposed to result from neutral (canonical) amino-acid coordination, whereas Type 2 radical cations are from zwitterionic amino-acid coordination to copper in the complex. The ratio of Type 1/Type 2 ions was found to be dependent on the auxiliary ligand, providing a method of controlling which radical cation would be formed primarily. Density functional calculations at B3LYP/6-311++G(d,p) have been used to determine the relative energies of five His*+ isomers. Barriers against interconversion between the isomers and against fragmentation have been calculated, giving insight as to why the Type 1 ions are stable, while only fragmentation products of the Type 2 ions are observable under CID conditions.

Fundamental study of hydrogen-attachment-induced peptide fragmentation occurring in the gas phase and during the matrix-assisted laser desorption/ionization process.

Science.gov (United States)

Asakawa, Daiki; Takahashi, Hidenori; Iwamoto, Shinichi; Tanaka, Koichi

2018-05-09

Mass spectrometry with hydrogen-radical-mediated fragmentation techniques has been used for the sequencing of proteins/peptides. The two methods, matrix-assisted laser desorption/ionization in-source decay (MALDI-ISD) and hydrogen attachment/abstraction dissociation (HAD) are known as hydrogen-radical-mediated fragmentation techniques. MALDI-ISD occurs during laser induced desorption processes, whereas HAD utilizes the association of hydrogen with peptide ions in the gas phase. In this study, the general mechanisms of MALDI-ISD and HAD of peptides were investigated. We demonstrated the fragmentation of four model peptides and investigated the fragment formation pathways using density functional theory (DFT) calculations. The current experimental and computational joint study indicated that MALDI-ISD and HAD produce aminoketyl radical intermediates, which immediately undergo radical-induced cleavage at the N-Cα bond located on the C-terminal side of the radical site, leading to the c'/z˙ fragment pair. In the case of MALDI-ISD, the z˙ fragments undergo a subsequent reaction with the matrix to give z' and matrix adducts of the z fragments. In contrast, the c' and z˙ fragments react with hydrogen atoms during the HAD processes, and various fragment species, such as c˙, c', z˙ and z', were observed in the HAD-MS/MS mass spectra.

Controlled fragmentation

International Nuclear Information System (INIS)

Arnold, Werner

2002-01-01

Contrary to natural fragmentation, controlled fragmentation offers the possibility to adapt fragment parameters like size and mass to the performance requirements in a very flexible way. Known mechanisms like grooves inside the casing, weaken the structure. This is, however, excluded for applications with high accelerations during launch or piercing requirements for example on a semi armor piercing penetrator. Another method to achieve controlled fragmentation with an additional grid layer is presented with which the required grooves are produced 'just in time' inside the casing during detonation of the high explosive. The process of generating the grooves aided by the grid layer was studied using the hydrocode HULL with respect to varying grid designs and material combinations. Subsequent to this, a large range of these theoretically investigated combinations was contemplated in substantial experimental tests. With an optimised grid design and a suitable material selection, the controlled fragment admits a very flexible adaptation to the set requirements. Additional advantages like the increase of perforation performance or incendiary amplification can be realized with the grid layer

Pre-termination in aflR of Aspergillus sojae inhibits aflatoxin biosynthesis.

Science.gov (United States)

Matsushima, K; Chang, P K; Yu, J; Abe, K; Bhatnagar, D; Cleveland, T E

2001-05-01

The aflR gene product is the main transcriptional regulator of aflatoxin biosynthesis in Aspergillus parasiticus and Aspergillus flavus. Although A. sojae strains do not produce aflatoxins, they do have an aflR homologue. When compared with the aflR of A. parasiticus, the A. sojae gene contains two mutations: an HAHA motif and a premature stop codon. To investigate the functionality of the A. sojae aflR gene product, we used a GAL4 one-hybrid system in yeast. The transcription-activating activity of AflR from A. sojae was 15% of that from A. parasiticus. The introduction of an additional aflR from A. sojae into an A. parasiticus strain did not affect aflatoxin productivity. A hybrid aflR comprising the amino-terminal region of A. sojae aflR and the carboxy-terminal region of A. parasiticus aflR suppressed the effect associated with pre-termination of the A. sojae AflR. We conclude that the premature stop codon of the A. sojae aflR is the key to its functionality and leads to prevention of aflatoxin biosynthesis through loss of the transcription of aflatoxin biosynthesis-related genes.

Gastrin-releasing peptide in the porcine pancreas

DEFF Research Database (Denmark)

Holst, J J; Poulsen, Steen Seier

1987-01-01

to consist of one main form, namely the 27-amino acid peptide originally extracted from porcine stomach, and small amounts of a C-terminal fragment identical with the C-terminal 10-amino acid peptide. Gastrin-releasing peptide-like immunoreactivity released from the isolated perfused porcine pancreas during...... electrical vagal stimulation was shown by gel filtration to consist of the same two forms. By use of immunocytochemical techniques employing an antiserum directed against its N terminus, GRP was localized to varicose nerve fibers in close association with the exocrine tissue of the porcine pancreas...... in particular. Some fibers were found penetrating into pancreatic islets also. Immunoreactive nerve cell bodies as well as fibers were found within intrapancreatic ganglia. The potency of GRP in stimulating exocrine as well as endocrine secretion from the porcine pancreas, its presence in close contact...

Micropatterning of biomolecules on a glass substrate in fused silica microchannels by using photolabile linker-based surface activation

International Nuclear Information System (INIS)

Jang, K.; Mawatari, K.; Kitamori, T.; Xu, Y.; Sato, K.; Tanaka, Y.

2012-01-01

We report on a straightforward method for creating micropatterns of multiple biomolecules. The anti-fouling agent 2-methacryloyloxyethyl phosphorylcholine (MPC) polymer and a photolabile linker (PL) were covalently linked to an amino-terminated silane surface. Patterns were generated by selective removal of the MPC polymer via UV irradiation. Multiple micropatterns of fluorescein isothiocyanate (FITC)-labeled bovine serum albumin (BSA) and rhodamine-labeled goat fragment antigen-binding fragments (FAB) were deposited on a same glass substrate. We also employed micropatterning of multiple biomolecules in that Texas red-labeled BSA and FITC-labeled rabbit anti-mouse IgG were placed inside a microchannel. (author)

Fragment-Based, Structure-Enabled Discovery of Novel Pyridones and Pyridone Macrocycles as Potent Bromodomain and Extra-Terminal Domain (BET) Family Bromodomain Inhibitors

Energy Technology Data Exchange (ETDEWEB)

Wang, Le; Pratt, John K.; Soltwedel, Todd; Sheppard, George S.; Fidanze, Steven D.; Liu, Dachun; Hasvold, Lisa A.; Mantei, Robert A.; Holms, James H.; McClellan, William J.; Wendt, Michael D.; Wada, Carol; Frey, Robin; Hansen, T.Matthew; Hubbard, Robert; Park, Chang H.; Li, Leiming; Magoc, Terrance J.; Albert, Daniel H.; Lin, Xiaoyu; Warder, Scott E.; Kovar, Peter; Huang, Xiaoli; Wilcox, Denise; Wang, Rongqi; Rajaraman, Ganesh; Petros, Andrew M.; Hutchins, Charles W.; Panchal, Sanjay C.; Sun, Chaohong; Elmore, Steven W.; Shen, Yu; Kati, Warren M.; McDaniel, Keith F. (AbbVie)

2017-03-24

Members of the BET family of bromodomain containing proteins have been identified as potential targets for blocking proliferation in a variety of cancer cell lines. A two-dimensional NMR fragment screen for binders to the bromodomains of BRD4 identified a phenylpyridazinone fragment with a weak binding affinity (1, Ki = 160 μM). SAR investigation of fragment 1, aided by X-ray structure-based design, enabled the synthesis of potent pyridone and macrocyclic pyridone inhibitors exhibiting single digit nanomolar potency in both biochemical and cell based assays. Advanced analogs in these series exhibited high oral exposures in rodent PK studies and demonstrated significant tumor growth inhibition efficacy in mouse flank xenograft models.

Structure of a designed, right-handed coiled-coil tetramer containing all biological amino acids.

Science.gov (United States)

Sales, Mark; Plecs, Joseph J; Holton, James M; Alber, Tom

2007-10-01

The previous design of an unprecedented family of two-, three-, and four-helical, right-handed coiled coils utilized nonbiological amino acids to efficiently pack spaces in the oligomer cores. Here we show that a stable, right-handed parallel tetrameric coiled coil, called RH4B, can be designed entirely using biological amino acids. The X-ray crystal structure of RH4B was determined to 1.1 Angstrom resolution using a designed metal binding site to coordinate a single Yb(2+) ion per 33-amino acid polypeptide chain. The resulting experimental phases were particularly accurate, and the experimental electron density map provided an especially clear, unbiased view of the molecule. The RH4B structure closely matched the design, with equivalent core rotamers and an overall root-mean-square deviation for the N-terminal repeat of the tetramer of 0.24 Angstrom. The clarity and resolution of the electron density map, however, revealed alternate rotamers and structural differences between the three sequence repeats in the molecule. These results suggest that the RH4B structure populates an unanticipated variety of structures.

Intrinsic Tau Acetylation Is Coupled to Auto-Proteolytic Tau Fragmentation.

Directory of Open Access Journals (Sweden)

Todd J Cohen

Full Text Available Tau proteins are abnormally aggregated in a range of neurodegenerative tauopathies including Alzheimer's disease (AD. Recently, tau has emerged as an extensively post-translationally modified protein, among which lysine acetylation is critical for normal tau function and its pathological aggregation. Here, we demonstrate that tau isoforms have different propensities to undergo lysine acetylation, with auto-acetylation occurring more prominently within the lysine-rich microtubule-binding repeats. Unexpectedly, we identified a unique intrinsic property of tau in which auto-acetylation induces proteolytic tau cleavage, thereby generating distinct N- and C-terminal tau fragments. Supporting a catalytic reaction-based mechanism, mapping and mutagenesis studies showed that tau cysteines, which are required for acetyl group transfer, are also essential for auto-proteolytic tau processing. Further mass spectrometry analysis identified the C-terminal 2nd and 4th microtubule binding repeats as potential sites of auto-cleavage. The identification of acetylation-mediated auto-proteolysis provides a new biochemical mechanism for tau self-regulation and warrants further investigation into whether auto-catalytic functions of tau are implicated in AD and other tauopathies.

Nucleotide sequence of cloned cDNA for human sphingolipid activator protein 1 precursor

International Nuclear Information System (INIS)

Dewji, N.N.; Wenger, D.A.; O'Brien, J.S.

1987-01-01

Two cDNA clones encoding prepro-sphingolipid activator protein 1 (SAP-1) were isolated from a λ gt11 human hepatoma expression library using polyclonal antibodies. These had inserts of ≅ 2 kilobases (λ-S-1.2 and λ-S-1.3) and both were both homologous with a previously isolated clone (λ-S-1.1) for mature SAP-1. The authors report here the nucleotide sequence of the longer two EcoRI fragments of S-1.2 and S-1.3 that were not the same and the derived amino acid sequences of mature SAP-1 and its prepro form. The open reading frame encodes 19 amino acids, which are colinear with the amino-terminal sequence of mature SAP-1, and extends far beyond the predicted carboxyl terminus of mature SAP-1, indicating extensive carboxyl-terminal processing. The nucleotide sequence of cDNA encoding prepro-SAP-1 includes 1449 bases from the assigned initiation codon ATG at base-pair 472 to the stop codon TGA at base-pair 1921. The first 23 amino acids coded after the initiation ATG are characteristic of a signal peptide. The calculated molecular mass for a polypeptide encoded by 1449 bases is ≅ 53 kDa, in keeping with the reported value for pro-SAP-1. The data indicate that after removal of the signal peptide mature SAP-1 is generated by removing an additional 7 amino acids from the amino terminus and ≅ 373 amino acids from the carboxyl terminus. One potential glycosylation site was previously found in mature SAP-1. Three additional potential glycosylation sites are present in the processed carboxyl-terminal polypeptide, which they designate as P-2

Fragmentation cross sections outside the limiting-fragmentation regime

CERN Document Server

Sümmerer, K

2003-01-01

The empirical parametrization of fragmentation cross sections, EPAX, has been successfully applied to estimate fragment production cross sections in reactions of heavy ions at high incident energies. It is checked whether a similar parametrization can be found for proton-induced spallation around 1 GeV, the range of interest for ISOL-type RIB facilities. The validity of EPAX for medium-energy heavy-ion induced reactions is also checked. Only a few datasets are available, but in general EPAX predicts the cross sections rather well, except for fragments close to the projectile, where the experimental cross sections are found to be larger.

Amino acid neurotransmitters and new approaches to anticonvulsant drug action.

Science.gov (United States)

Meldrum, B

1984-01-01

Amino acids provide the most universal and important inhibitory (gamma-aminobutyric acid (GABA), glycine) and excitatory (glutamate, aspartate, cysteic acid, cysteine sulphinic acid) neurotransmitters in the brain. An anticonvulsant action may be produced (1) by enhancing inhibitory (GABAergic) processes, and (2) by diminishing excitatory transmission. Possible pharmacological mechanisms for enhancing GABA-mediated inhibition include (1) GABA agonist action, (2) GABA prodrugs, (3) drugs facilitating GABA release from terminals, (4) inhibition of GABA-transaminase, (5) allosteric enhancement of the efficacy of GABA at the receptor complex, (6) direction action on the chloride ionophore, and (7) inhibition of GABA reuptake. Examples of these approaches include the use of irreversible GABA-transaminase inhibitors, such as gamma-vinyl GABA, and the development of anticonvulsant beta-carbolines that interact with the "benzodiazepine receptor." Pharmacological mechanisms for diminishing excitatory transmission include (1) enzyme inhibitors that decrease the maximal rate of synthesis of glutamate or aspartate, (2) drugs that decrease the synaptic release of glutamate or aspartate, and (3) drugs that block the post-synaptic action of excitatory amino acids. Compounds that selectively antagonise excitation due to dicarboxylic amino acids have recently been developed. Those that selectively block excitation produced by N-methyl-D-aspartate (and aspartate) have proved to be potent anticonvulsants in many animal models of epilepsy. This provides a novel approach to the design of anticonvulsant drugs.

Subcritical Water Hydrolysis of Peptides: Amino Acid Side-Chain Modifications

Science.gov (United States)

Powell, Thomas; Bowra, Steve; Cooper, Helen J.

2017-09-01

Previously we have shown that subcritical water may be used as an alternative to enzymatic digestion in the proteolysis of proteins for bottom-up proteomics. Subcritical water hydrolysis of proteins was shown to result in protein sequence coverages greater than or equal to that obtained following digestion with trypsin; however, the percentage of peptide spectral matches for the samples treated with trypsin were consistently greater than for those treated with subcritical water. This observation suggests that in addition to cleavage of the peptide bond, subcritical water treatment results in other hydrolysis products, possibly due to modifications of amino acid side chains. Here, a model peptide comprising all common amino acid residues (VQSIKCADFLHYMENPTWGR) and two further model peptides (VCFQYMDRGDR and VQSIKADFLHYENPTWGR) were treated with subcritical water with the aim of probing any induced amino acid side-chain modifications. The hydrolysis products were analyzed by direct infusion electrospray tandem mass spectrometry, either collision-induced dissociation or electron transfer dissociation, and liquid chromatography collision-induced dissociation tandem mass spectrometry. The results show preferential oxidation of cysteine to sulfinic and sulfonic acid, and oxidation of methionine. In the absence of cysteine and methionine, oxidation of tryptophan was observed. In addition, water loss from aspartic acid and C-terminal amidation were observed in harsher subcritical water conditions. [Figure not available: see fulltext.

Synthesis of substituted mono- and diindole C-nucleoside analogues from sugar terminal alkynes by sequential sonogashira/heteroannulation reaction.

Science.gov (United States)

Zhang, Fuyi; Mu, Delong; Wang, Liming; Du, Pengfei; Han, Fen; Zhao, Yufen

2014-10-17

The synthesis of substituted mono- and diindole C-nucleoside analogues has been achieved in good to excellent yields by sequential Sonogashira coupling/NaAuCl4-catalyzed heteroannulation reactions of substituted 2-iodoanilines with various sugar terminal alkynes in one pot. The method is general, mild, and efficient and suitable for a wide range of sugar substrates, and 42 examples are given. The amino group of the substituted 2-iodoanilines is unprotected. The sugar terminal alkynes include furanosides, pyranosides, and acyclic glycosides with free hydroxyl groups, sensitive functional subtituents, and various protecting groups having different steric hindrance.

Sequestration of Sup35 by aggregates of huntingtin fragments causes toxicity of [PSI+] yeast.

Science.gov (United States)

Zhao, Xiaohong; Park, Yang-Nim; Todor, Horia; Moomau, Christine; Masison, Daniel; Eisenberg, Evan; Greene, Lois E

2012-07-06

Expression of huntingtin fragments with 103 glutamines (HttQ103) is toxic in yeast containing either the [PIN(+)] prion, which is the amyloid form of Rnq1, or [PSI(+)] prion, which is the amyloid form of Sup35. We find that HttQP103, which has a polyproline region at the C-terminal end of the polyQ repeat region, is significantly more toxic in [PSI(+)] yeast than in [PIN(+)], even though HttQP103 formed multiple aggregates in both [PSI(+)] and [PIN(+)] yeast. This toxicity was only observed in the strong [PSI(+)] variant, not the weak [PSI(+)] variant, which has more soluble Sup35 present than the strong variant. Furthermore, expression of the MC domains of Sup35, which retains the C-terminal domain of Sup35, but lacks the N-terminal prion domain, almost completely rescued HttQP103 toxicity, but was less effective in rescuing HttQ103 toxicity. Therefore, the toxicity of HttQP103 in yeast containing the [PSI(+)] prion is primarily due to sequestration of the essential protein, Sup35.

Isolation and N-terminal sequencing of a novel cadmium-binding protein from Boletus edulis

Science.gov (United States)

Collin-Hansen, C.; Andersen, R. A.; Steinnes, E.

2003-05-01

A Cd-binding protein was isolated from the popular edible mushroom Boletus edulis, which is a hyperaccumulator of both Cd and Hg. Wild-growing samples of B. edulis were collected from soils rich in Cd. Cd radiotracer was added to the crude protein preparation obtained from ethanol precipitation of heat-treated cytosol. Proteins were then further separated in two consecutive steps; gel filtration and anion exchange chromatography. In both steps the Cd radiotracer profile showed only one distinct peak, which corresponded well with the profiles of endogenous Cd obtained by atomic absorption spectrophotometry (AAS). Concentrations of the essential elements Cu and Zn were low in the protein fractions high in Cd. N-terminal sequencing performed on the Cd-binding protein fractions revealed a protein with a novel amino acid sequence, which contained aromatic amino acids as well as proline. Both the N-terminal sequencing and spectrofluorimetric analysis with EDTA and ABD-F (4-aminosulfonyl-7-fluoro-2, 1, 3-benzoxadiazole) failed to detect cysteine in the Cd-binding fractions. These findings conclude that the novel protein does not belong to the metallothionein family. The results suggest a role for the protein in Cd transport and storage, and they are of importance in view of toxicology and food chemistry, but also for environmental protection.

Terminal Restriction Fragment Length Polymorphism for the Identification of Spirorchiid Ova in Tissues from the Green Sea Turtle, Chelonia mydas.

Directory of Open Access Journals (Sweden)

Phoebe A Chapman

Full Text Available Blood flukes are among the most common disease causing pathogens infecting vertebrates, including humans and some of the world's most globally endangered fauna. Spirorchiid blood flukes are parasites of marine turtles, and are associated with pathology, strandings and mortalities worldwide. Their ova embolize in tissues and incite significant inflammatory responses, however attempts to draw correlations between species and lesions are frustrated by difficulties in identifying ova beyond the genus level. In this study, a newly developed terminal restriction fragment length polymorphism (T-RFLP method was validated as a tool for differentiating between mixed spirorchiid ova in turtle tissue. Initially, a multiplex PCR was used to differentiate between the five genera of spirorchiid flukes. Following this, PCR was performed using genus/genera-specific fluorescently tagged primer pairs and PCR products digested analysis using restriction endonucleases. Using capillary electrophoresis, this T-RFLP method could differentiate between twelve species and genotypes of spirorchiid flukes in turtles. It was applied to 151 tissue samples and successfully identified the spirorchiid species present. It was found to be more sensitive than visual diagnosis, detecting infections in 28 of 32 tissues that were negative on histology. Spirorchiids were present in 96.7% of tissues tested, with Neospirorchis genotype 2 being the most prevalent, present in 93% of samples. Mixed infections were common, being present in 60.7% of samples tested. The method described here is, to our knowledge, the first use of the T-RFLP technique on host tissues or in an animal ecology context, and describes a significant advancement in the clinical capacity to diagnose a common cause of illness in our environment. It is proven as a sensitive, specific and cost-efficient means of identifying spirorchiid flukes and ova in turtles, with the potential to contribute valuable information to

Rumen bacterial community evaluated by 454 pyrosequencing and terminal restriction fragment length polymorphism analyses in dairy sheep fed marine algae.

Science.gov (United States)

Castro-Carrera, T; Toral, P G; Frutos, P; McEwan, N R; Hervás, G; Abecia, L; Pinloche, E; Girdwood, S E; Belenguer, A

2014-03-01

Developing novel strategies to increase the content of bioactive unsaturated fatty acids (FA) in ruminant-derived products requires a deeper understanding of rumen biohydrogenation and bacteria involved in this process. Although high-throughput pyrosequencing may allow for a great coverage of bacterial diversity, it has hardly been used to investigate the microbiology of ruminal FA metabolism. In this experiment, 454 pyrosequencing and a molecular fingerprinting technique (terminal restriction fragment length polymorphism; T-RFLP) were used concurrently to assess the effect of diet supplementation with marine algae (MA) on the rumen bacterial community of dairy sheep. Eleven lactating ewes were divided in 2 lots and offered a total mixed ration based on alfalfa hay and concentrate (40:60), supplemented with 0 (control) or 8 (MA) g of MA/kg of dry matter. After 54 d on treatments, animals were slaughtered and samples of rumen content and fluid were collected separately for microbial analysis. Pyrosequencing yielded a greater coverage of bacterial diversity than T-RFLP and allowed the identification of low abundant populations. Conversely, both molecular approaches pointed to similar conclusions and showed that relevant changes due to MA addition were observed within the major ruminal phyla, namely Bacteroidetes, Firmicutes, and Proteobacteria. Decreases in the abundance of unclassified Bacteroidales, Porphyromonadaceae, and Ruminococcaceae and increases in as-yet uncultured species of the family Succinivibrionaceae, might be related to a potential role of these groups in different pathways of rumen FA metabolism. Diet supplementation with MA, however, had no effect on the relative abundance of Butyrivibrio and Pseudobutyrivibrio genera. In addition, results from both 454 pyrosequencing and T-RFLP indicate that the effect of MA was rather consistent in rumen content or fluid samples, despite inherent differences between these fractions in their bacterial composition

Differential functions of C- and N-terminal hepatitis B x protein in liver cells treated with doxorubicin in normoxic or hypoxic condition.

Directory of Open Access Journals (Sweden)

Davor Kin-Fan Chau

Full Text Available Hepatitis viral B x protein (HBx, a hepatocarcinogen, is frequently mutated. Hypoxia influences the growth of HCC and also the sensitivity of tumor cells to treatments. We aimed to test the role of HBx and acute hypoxia in the efficacy of chemotherapy. In this study, we established 4 Chang liver cell lines with the full-length HBx (HBx, the first 50 amino acids of N-terminal HBx (HBx/50, the last 104 amino acids of C-terminal HBx (HBx/51 and empty vector (CL, respectively. MTT and TNUEL assays were used to assess cell viability and apoptosis respectively. Western blot was used to determine the expression of relevant proteins. Results showed that among 4 cell lines, doxorubicin was most effective in decreasing the viability and enhancing apoptosis in HBx/51 cells, while HBx/50 cells were most resistant to the treatment. Cells in hypoxia were more susceptible to doxorubicin than cells in normoxia. Hypoxia facilitated the Bid cleavage especially in HBx/51 cells via phosphorylating p38 MAPK. p38 MAPK inhibitor significantly reduced the tBid level and increased cell viability. In conclusion, N-terminal HBx and C-terminal HBx function differentially in their ability to regulate cell growth, with the former being promotive but the latter being inhibitory. The acute hypoxia may overcome the HBx-induced resistance and facilitate the chemotherapy.

Universality of fragment shapes.

Science.gov (United States)

Domokos, Gábor; Kun, Ferenc; Sipos, András Árpád; Szabó, Tímea

2015-03-16

The shape of fragments generated by the breakup of solids is central to a wide variety of problems ranging from the geomorphic evolution of boulders to the accumulation of space debris orbiting Earth. Although the statistics of the mass of fragments has been found to show a universal scaling behavior, the comprehensive characterization of fragment shapes still remained a fundamental challenge. We performed a thorough experimental study of the problem fragmenting various types of materials by slowly proceeding weathering and by rapid breakup due to explosion and hammering. We demonstrate that the shape of fragments obeys an astonishing universality having the same generic evolution with the fragment size irrespective of materials details and loading conditions. There exists a cutoff size below which fragments have an isotropic shape, however, as the size increases an exponential convergence is obtained to a unique elongated form. We show that a discrete stochastic model of fragmentation reproduces both the size and shape of fragments tuning only a single parameter which strengthens the general validity of the scaling laws. The dependence of the probability of the crack plan orientation on the linear extension of fragments proved to be essential for the shape selection mechanism.

Polymorphisms at Amino Acid Residues 141 and 154 Influence Conformational Variation in Ovine PrP

Science.gov (United States)

Yang, Sujeong; Thackray, Alana M.; Hopkins, Lee; Monie, Tom P.; Burke, David F.; Bujdoso, Raymond

2014-01-01

Polymorphisms in ovine PrP at amino acid residues 141 and 154 are associated with susceptibility to ovine prion disease: Leu141Arg154 with classical scrapie and Phe141Arg154 and Leu141His154 with atypical scrapie. Classical scrapie is naturally transmissible between sheep, whereas this may not be the case with atypical scrapie. Critical amino acid residues will determine the range or stability of structural changes within the ovine prion protein or its functional interaction with potential cofactors, during conversion of PrPC to PrPSc in these different forms of scrapie disease. Here we computationally identified that regions of ovine PrP, including those near amino acid residues 141 and 154, displayed more conservation than expected based on local structural environment. Molecular dynamics simulations showed these conserved regions of ovine PrP displayed genotypic differences in conformational repertoire and amino acid side-chain interactions. Significantly, Leu141Arg154 PrP adopted an extended beta sheet arrangement in the N-terminal palindromic region more frequently than the Phe141Arg154 and Leu141His154 variants. We supported these computational observations experimentally using circular dichroism spectroscopy and immunobiochemical studies on ovine recombinant PrP. Collectively, our observations show amino acid residues 141 and 154 influence secondary structure and conformational change in ovine PrP that may correlate with different forms of scrapie. PMID:25126555

Anomalous nuclear fragments

International Nuclear Information System (INIS)

Karmanov, V.A.

1983-01-01

Experimental data are given, the status of anomalon problem is discussed, theoretical approaches to this problem are outlined. Anomalons are exotic objects formed following fragmentation of nuclei-targets under the effect of nuclei - a beam at the energy of several GeV/nucleon. These nuclear fragments have an anomalously large cross section of interaction and respectively, small free path, considerably shorter than primary nuclei have. The experimental daa are obtained in accelerators following irradiation of nuclear emulsions by 16 O, 56 Fe, 40 Ar beams, as well as propane by 12 C beams. The experimental data testify to dependence of fragment free path on the distance L from the point of the fragment formation. A decrease in the fragment free path is established more reliably than its dependence on L. The problem of the anomalon existence cannot be yet considered resolved. Theoretical models suggested for explanation of anomalously large cross sections of nuclear fragment interaction are variable and rather speculative

Importance of the content and localization of tyrosine residues for thyroxine formation within the N-terminal part of human thyroglobulin

NARCIS (Netherlands)

den Hartog, M. T.; Sijmons, C. C.; Bakker, O.; Ris-Stalpers, C.; de Vijlder, J. J.

1995-01-01

Thyroxine (T4) is formed by coupling of iodinated tyrosine residues within thyroglobulin (TG). In mature TG, some iodinated tyrosine residues are involved preferentially in T4 formation. In order to investigate the specific role of various tyrosine residues in T4 formation, N-terminal TG fragments

Self-assembled monolayers of semi-fluorinated thiols and disulfides with a potentially antibacterial terminal fragment on gold surfaces

International Nuclear Information System (INIS)

Thebault, P.; Taffin de Givenchy, E.; Guittard, F.; Guimon, C.; Geribaldi, S.

2008-01-01

Attempts to elaborate the best organized cationic self-assembled monolayers (SAMs) with sulfur derivatives containing potentially bactericidal quaternary ammonium salt moieties have been performed on gold with the final aim to obtain contact-active antibacterial surfaces. Four molecules bearing two hydrocarbon spacers with different lengths between the sulfur atom and the quaternized nitrogen atom, and two different terminal semi-fluorinated alkyl chains have been synthesised and used in view to evaluate their capacity for leading to the highest densities and the highest organization of potentially active molecules on the metal surface. The formation and quality of SAMs characterized by X-ray photoelectron spectroscopy, Internal Reflexion Infra Red Imaging, contact angle and blocking factor measurements depend on the lengths of both the hydrocarbon spacer and terminal perfluorinated chain

A potyvirus vector efficiently targets recombinant proteins to chloroplasts, mitochondria and nuclei in plant cells when expressed at the amino terminus of the polyprotein.

Science.gov (United States)

Majer, Eszter; Navarro, José-Antonio; Daròs, José-Antonio

2015-09-01

Plant virus-based expression systems allow quick and efficient production of recombinant proteins in plant biofactories. Among them, a system derived from tobacco etch virus (TEV; genus potyvirus) permits coexpression of equimolar amounts of several recombinant proteins. This work analyzed how to target recombinant proteins to different subcellular localizations in the plant cell using this system. We constructed TEV clones in which green fluorescent protein (GFP), with a chloroplast transit peptide (cTP), a nuclear localization signal (NLS) or a mitochondrial targeting peptide (mTP) was expressed either as the most amino-terminal product or embedded in the viral polyprotein. Results showed that cTP and mTP mediated efficient translocation of GFP to the corresponding organelle only when present at the amino terminus of the viral polyprotein. In contrast, the NLS worked efficiently at both positions. Viruses expressing GFP in the amino terminus of the viral polyprotein produced milder symptoms. Untagged GFPs and cTP and NLS tagged amino-terminal GFPs accumulated to higher amounts in infected tissues. Finally, viral progeny from clones with internal GFPs maintained the extra gene better. These observations will help in the design of potyvirus-based vectors able to coexpress several proteins while targeting different subcellular localizations, as required in plant metabolic engineering. Copyright © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Plasma amino acids

Science.gov (United States)

Amino acids blood test ... types of methods used to determine the individual amino acid levels in the blood. ... test is done to measure the level of amino acids in the blood. An increased level of a ...