WorldWideScience

Sample records for aga khan university

  1. Urinary tract infections at aga Khan University hospital nairobi - a ...

    African Journals Online (AJOL)

    2013-06-11

    Jun 11, 2013 ... (Uti) are normally treated empirically and urine culture is usual ordered for as a last ... symptomatic Uti in patients at aga Khan University hospital by looking at the trends of Uti ... in the context of pyelonephritis in pregnancy(9).

  2. Stapled hemorrhoidopexy: The Aga Khan University Hospital Experience

    International Nuclear Information System (INIS)

    Athar, Ali; Chawla, Tabish; Turab, Pishori

    2009-01-01

    Stapled hemorrhoidopexy for prolapsing hemorrhoids is conceptually different from excision hemorrhoidectomy. It does not accompany the pain that usually occurs after resection of the sensitive anoderm. This study was carried out to evaluate the clinical outcome of stapled hemorrhoidopexy at The Aga Khan University Hospital. A sample of 140 patients with symptomatic second-, third-, and fourth-degree hemorrhoids and circumferential mucosal prolapse underwent stapled hemorrhoidopexy from July 2002 to July 2007. They were evaluated for postoperative morbidity, analgesic requirement, and recurrence. Seventy-eight percent were males and the mean age was 45 (range 16-90) years. The mean operative time was 35 (15-78) min. The mean parenteral analgesic doses during the first 24 h were 2.1. All patients received oral analgesics alone after 24 h. No significant postoperative morbidity was observed. The mean in-patient hospital stay was 1.3 (0-5) days. Patients were followed-up for 24 (range, 2-48) months. Minor local recurrence of hemorrhoids was seen in four patients and was managed by band ligation. Stapled hemorrhoidopexy procedure was found safe, well tolerated by patients with minimal parenteral analgesic use and early discharge from the hospital. (author)

  3. The effect of a knowledge-based ergonomic intervention amongst administrators at Aga Khan University Hospital, Nairobi.

    Science.gov (United States)

    Wanyonyi, Nancy; Frantz, Jose; Saidi, Hassan

    2015-01-01

    Low back pain (LBP) and neck pain are part of the common work-related musculoskeletal disorders with a large impact on the affected person. Despite having a multifactorial aetiology, ergonomic factors play a major role thus necessitating workers' education. To determine the prevalence of ergonomic-related LBP and neck pain, and describe the effect of a knowledge-based ergonomic intervention amongst administrators in Aga Khan University Hospital, Nairobi. This study applied a mixed method design utilizing a survey and two focus group discussions (FGD). A self-administered questionnaire was distributed to 208 participants through systematic sampling. A one hour knowledge-based ergonomic session founded on the survey results was thereafter administered to interested participants, followed by two FGDs a month later with purposive selection of eight participants to explore their experience of the ergonomic intervention. Quantitative data was captured and analyzed using SPSS by means of descriptive and inferential statistics, whereas thematic content analysis was used for qualitative data. Most participants were knowledgeable about ergonomic-related LBP and neck pain with a twelve month prevalence of 75.5% and 67.8% respectively. Continual ergonomic education is necessary for adherence to health-related behaviours that will preventwork-related LBP and neck pain.

  4. Screening strategies for gestational diabetes mellitus at the Aga ...

    African Journals Online (AJOL)

    Background: Universal screening strategy for gestational diabetes mellitus offers biochemical screening to all women irrespective of risk factor status while selective strategy screens only those with risk factors. The Aga Khan University Hospital adopted a selective screening protocol by consensus. This study compares both ...

  5. AFJU OFC 18(3).indd

    African Journals Online (AJOL)

    imac-3

    a Department of Radiology, Aga Khan Medical University, Karachi, Pakistan b Rhode Island Hospital, Brown University, Providence, RI 02912, USA c Department of Surgery, Aga .... In defense of IVU, Saeed et al. [12] noted that the addition of ...

  6. Saleem Khan

    Indian Academy of Sciences (India)

    Home; Journals; Bulletin of Materials Science. Saleem Khan. Articles written in Bulletin of Materials Science. Volume 36 Issue 4 August 2013 pp 535-539. Synthesis of copper telluride nanowires using template-based electrodeposition method as chemical sensor · Sandeep Arya Saleem Khan Suresh Kumar Rajnikant ...

  7. Bone marrow examination findings at Aga Khan University Hospital ...

    African Journals Online (AJOL)

    Nutritional anaemia as a group was the most common haematological disorder ... examination in our patients with megaloblastic anaemia predominating. ... indication for bone marrow examination was anaemia followed by diagnostic work up ...

  8. A Letter to Ahmad Khan

    Directory of Open Access Journals (Sweden)

    I.M. Mirgaleev

    2016-12-01

    Full Text Available We bring to attention of specialists an undated letter of Ottoman ruler Mehmed II Fatih to the Great Horde khan Ahmad from the collection of famous collector of Ottoman charters Feridun-bey [1, S. 289]. The addressee is the famous ruler of the Great Horde, khan Ahmad. Daulat Khan mentioned in the letter is Nur-Davlet. He was connected with khan Ahmad, and, as indicated by the letter, he had also set in close contact with the Ottomans whose ruler openly declares in a letter that “our sight of benevolence and patronage is directed toward him”. Thereby the Sultan made it clear to the “principal” Tatar khan Akhmad that Nur-Davlet was under the patronage of the Ottoman Empire. Considering the period of activity of Nur-Davlet in Crimea, presumably the letter was written in 1477. Famous researcher of the Crimean Khanate V.D. Smirnov had already examined the letter and the question of why Ahmad Khan was named the Crimean khan in the title of the letter [2, p. 221–222].

  9. N-acetylgalatosamine-mediated regulation of the aga operon by AgaR in Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Muhammad Afzal

    2016-09-01

    Full Text Available Here, we analyze the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylgalactosamine (NAGa. Transcriptome comparison of S. pneumoniae D39 grown NAGaM17 (0.5% NAGa + M17 to that grown in GM17 (0.5% Glucose + M17 revealed the elevated expression of various carbon metabolic genes/operons, including a PTS operon (denoted here as the aga operon, which is putatively involved in NAGa transport and utilization, in the presence of NAGa. We further studied the role of a GntR-family transcriptional regulator (denoted here as AgaR in the regulation of aga operon. Our transcriptome and RT-PCR data suggest the role of AgaR as a transcriptional repressor of the aga operon. We predicted a 20-bp operator site of AagR (5’- ATAATTAATATAACAACAAA -3’ in the promoter region of the aga operon (PbgaC, which was further verified by mutating the AgaR operator site in the respective promoter. The role of CcpA in the additional regulation of the aga operon was elucidated by further transcriptome analyses and confirmed by quantitative RT-PCR.

  10. Effects of intravenous diclofenac on postoperative sore throat in ...

    African Journals Online (AJOL)

    Effects of intravenous diclofenac on postoperative sore throat in patients undergoing laparoscopic surgery at Aga Khan University Hospital, Nairobi: A prospective, randomized, double blind controlled trial.

  11. Mentoring the modern African surgeon: A call to arms!

    African Journals Online (AJOL)

    2011-01-16

    Jan 16, 2011 ... Hospital, Nairobi, 2-University of Nairobi, Kenya, 3-King Khalid University, UAE. Correspondence: Dr. Miriam Mutebi, Aga Khan. University Hospital. P.O. Bx 30270 .... Galukande M, Kijjambu S, Luboga S Improving recruitment of surgical trainees and training of surgeons in Uganda. East. Cent Afr J Surg.

  12. Janybek Khan and Prince Liubartas-Dmitry

    Directory of Open Access Journals (Sweden)

    Ya.V. Pilipchuk

    2013-11-01

    Full Text Available This study focuses on the relations between the Volyn principality of Liubartas-Dmitry and the Ulus of Jochi under the rule of Janybek Khan. Liubartas-Dmitry ascended the throne of the Eastern Volyn largely due to the will of Uzbek Khan. The Land of Berestia together with the Eastern Volyn was the Liubartas’ appanage land in Volyn. As Boleslaw-Yuri II, Liubartas-Dmitry was compelled to pay tribute to the Tatars. During the War of the Galicia-Volyn legacy, Liubartas acted as a vassal of the Ulus of Jochi and ally of Uzbek Khan. Liubartas’ relations with Janybek Khan were fundamentally different from his previous relations with Uzbek Khan. Casimir III enjoyed greater sympathy of the Golden Horde khan due to the payment of tribute. Except for the campaign of 1351–1352, Janybek was hostile towards Lithuania. Only the common hostility of the Poles and Hungarians towards the Volyn and Podolia forced the khan of Ulus of Jochi to intervene on the side of the Lithuanians. For Janibek the western vector of his foreign policy was not a priority. He could accept the loss of a tribute from several Slavic principalities in exchange for success on other fronts, more profitable in terms of the spoils of war. Unlike the Koriatoviches and Olelkoviches, the Gediminoviches of Volyn were more peacefully disposed towards the Tatars since during the “Great Disorder” their land-holdings did not increase at the expense of Jochid possessions.

  13. Original Article Surgical Margin Status after Breast Conservation ...

    African Journals Online (AJOL)

    KIGZ

    analysis of breast surgery for breast cancer patients was done from 2008 to 2011 at Aga Khan. University ... early breast cancer, thus breast conservation therapy is becoming more available. Excision of the ... palpable nodes. Histology was ...

  14. Research

    African Journals Online (AJOL)

    abp

    2016-03-30

    Mar 30, 2016 ... 1School of Public Health, University of Alberta, Edmonton, Alberta, Canada, 2Aga Khan .... “Focus on Opportunity, Ability and Motivation” (FOAM) framework ... children (-28%), before eating (-4%), and after attending to a child.

  15. Cordylobia Anthropophaga: Furuncular Myiasis in a Family of 3

    African Journals Online (AJOL)

    Department of Surgery, Aga Khan University Hospital, Nairobi. Correspondence ... the need for a detailed travel history in such a presentation. ... factors for myiasis (5). The adult .... myiasis in a young male presenting as fungating rectal mass: ...

  16. The A.Q. Khan case, two years later

    International Nuclear Information System (INIS)

    Tertrais, Bruno

    2005-01-01

    Two years after the first public revelations on the importance of Pakistani nuclear trades, the author proposes a critical comment of the so-called A.Q. Khan case. He outlines that making A.Q. Khan the father of the Pakistani atomic bomb is exaggerated, indicates what Khan actually exported (some know-how on head militarization, and on uranium centrifugation). He identifies Khan's motivations and outlines the different situations and relationships associated with the different concerned countries (Iran, North Korea, Libya)

  17. Single voxel magnetic resonance spectroscopy in distinguishing ...

    African Journals Online (AJOL)

    Objective: Assess diagnostic utility of combined magnetic resonance imaging and magnetic resonance spectroscopy (MRI, MRS) in differentiating focal neoplastic lesions from focal non- neoplastic (infective or degenerative) brain lesions. Design: Descriptive, analytical - prospective study. Setting: The Aga Khan University ...

  18. Author Details

    African Journals Online (AJOL)

    Incidence of post dural puncture headache following Caesarean section under spinal anaesthesia at the Aga Khan University Hospital, Nairobi Abstract PDF · Vol 87, No 8 (2010) - Articles Conformity to the Surviving Sepsis Campaign International Guidelines among Physicians in a general Inensive care unit in Nairobi

  19. PEMANFAATAN WEB KHAN ACADEMY DALAM PEMBELAJARAN MATEMATIKA

    Directory of Open Access Journals (Sweden)

    Joko Soebagyo

    2016-02-01

    Full Text Available Artikel ini bertujuan untuk mengobservasi pemanfaatan web Khan Academy siswa SMK Swasta di Jakarta Utara. Observasi dilakukan untuk mengamati aktivitas siswa dalam menggunakan web khan academy selama proses pembelajaran matematika. Pemanfaatan teknologi dalam proses pembelajaran matematika sudah sepatutnya dilakukan oleh pihak-pihak yang ikut bertanggungjawab atas keberhasilan belajar matematika perserta didik.  Teknologi merupakan hal yang tidak bisa dipisahkan dalam kehidupan sehari-hari dan salah satu bentuk teknologi yang sering dimanfaatkan saat ini adalah website dimana akitifitas pekerjaan, pendidikan, hiburan dan hubungan  sosial, semuanya dapat dialami melalui website.  Dibutuhkan sebuah website yang bias mengakomodir siswa dalam proses pembelajaran matematika baik di dalam kelas maupun di luar kelas.  Kriteria web yang baik haruslah memberikan kemudahan dalam pemanfaatannya, salah satu web tersebut adalah web khan academy.   This paper aims to observe the use of web Khan Academy Private vocational students in North Jakarta. Observations carried out to observe the activities of the students in using web khan academy during the learning process of mathematics. The use of technology in the learning process of mathematics has been duly carried out by parties who share responsibility for the success of students studying mathematics participants. Technology is something that can not be separated in everyday life and one form of technology that is often used today is a website where the activity, employment, education, entertainment and social relationships, all of which can be experienced through the website. It takes a biased website to accommodate students in mathematics learning process both in the classroom and outside the classroom. Criteria for good web should provide ease of use, one of the web is a web khan academy.

  20. Ureteric injuries following laparoscopic hysterectomy: A report of ...

    African Journals Online (AJOL)

    The incidence of ureteric injuries following hysterectomy varies. Raut et al in 1991 documented 12 ureteric injuries (1.34%) following 892 gynaecological procedures (2) while Nawaz et al reported a rate of 0.6% following gynaecological procedures over a 20 year period at the Aga Khan University Hospital,. Karachi (2).

  1. Mehmed Senai: A Crimean Historian at Sarai of Khan Islam Giray »

    Directory of Open Access Journals (Sweden)

    Refat Rustem ogly Abduzhemilev

    2015-09-01

    Full Text Available The article is devoted to the creative work of Mehmed Senai – the Crimean chronicler at the serai of the khan Islam Geray III, as well as his chronicle “Tarih-i Islam Geray khan” (“History of the khan Islam Geray III”, 1651. The researcher gives biographical information about the author and a brief description of the source. The identity of the writer is defined and based on the text of the Preface to the Chronicle: background, education, position, religious status. The meaning of the pseudonym of Senai is under the study, the text of the chronogram in which it occurs is reproduced. Especially noted thing is the originality of the artistic structure of the Chronicle “Tarih-i Islam Geray khan”.The Chronicle “Tarih-i Islam Geray khan” is the panegyric to the Crimean khan Islam Geray whose reign represents the brilliant epoch in the history of the Crimean Khanate. The writing consists of the ceremonies of public appointments, episodes of military campaigns and making treaties, the text of khan Islam Geray’s pedigree (shejere, construction and repair of buildings. There is the brief information about the Chronicle and about M. Senai in “Catalogue of the Turkish Manuscripts in the British Museum” (1888. The primary work on writing was conducted by Polish orientalists who prepared the edition of the original text, its translation and processing, backed with comments. At the time of writing the Chronicle, Mehmed Senai was in his old age, he served as the kadi (religious judge. In his youth he worked as munshi (decorator of papers in the khan’s office. He got education in the Ottoman Empire, and was engaged in the implementation of diplomatic correspondence. The prospect of identification of the author on the basis of other sources is important to clarify the hypothesis of identifying M. Senai with such Crimean Tatar author as Dzhanmuhammed. The Chronıcle’s plot consists of the diary notes on the military expeditions

  2. Bhatti, Hamid Khan

    Indian Academy of Sciences (India)

    Home; Fellowship. Fellow Profile. Elected: 1940 Section: Animal Sciences. Bhatti, Hamid Khan Ph.D. (Cantab). Date of birth: 7 February 1895. Date of death: 14 December 1980. Specialization: Ichthyology. YouTube; Twitter; Facebook; Blog. Academy News. IAS Logo. 29th Mid-year meeting. Posted on 19 January 2018.

  3. saleem a khan

    Indian Academy of Sciences (India)

    Home; Journals; Bulletin of Materials Science. SALEEM A KHAN. Articles written in Bulletin of Materials Science. Volume 40 Issue 6 October 2017 pp 1105-1110. Structural, elastic, optoelectronic and magnetic properties of CdHo 2 S 4 spinel: a first-principle study · I HATRAF O MERABIHA T SEDDIK H BALTACHE R ...

  4. 76 FR 69318 - In the Matter of the Designation of Mali Khan also known as Madi Khan as a Specially Designated...

    Science.gov (United States)

    2011-11-08

    ... DEPARTMENT OF STATE [Public Notice 7681] In the Matter of the Designation of Mali Khan also known... Khan, committed, or poses a significant risk of committing, acts of terrorism that threaten the security of U.S. nationals or the national security, foreign policy, or economy of the United States...

  5. Commentary: The Khan Academy and the Day-Night Flipped Classroom

    Science.gov (United States)

    Parslow, Graham R.

    2012-01-01

    Teaching by night and reflecting on a subject by day is the way that Salman Khan sees education evolving in the age of online lectures. Khan believes he is onto something in what he styles the "flipped classroom." In Khan's view, there is no need for students to be divided into grades by age. Instead, they should learn at their own pace, moving on…

  6. (AGA) Pre Term Babies

    African Journals Online (AJOL)

    Haematological Indices in Healthy Appropriate For-Gestational-Age (AGA) Pre Term Babies. ... International Journal of Medicine and Health Development. Journal Home ... Patient and Methods: All consecutive healthy pre-term new born babies delivered at UNTH and admitted into the hospital NBSCU were included.

  7. Can Khan Move the Bell Curve to the Right?

    Science.gov (United States)

    Kronholz, June

    2012-01-01

    This article features Khan Academy which offers an online math program and short video lectures embedded in the "module", or math concept, that fit students' goals. By now, more than 1 million people have watched the online video in which Salman Khan--a charming MIT math whiz, Harvard Business School graduate, and former Boston hedge-fund…

  8. Can Khan Move the Bell Curve to the Right?

    Science.gov (United States)

    Kronholz, June

    2012-01-01

    More than 1 million people have watched the online video in which Salman Khan--a charming MIT math whiz, Harvard Business School graduate, and former Boston hedge-fund analyst--explains how he began tutoring his cousins in math by posting short lessons for them on YouTube. Other people began watching the lessons and sending Khan adulatory notes.…

  9. Clinical, biochemical and ultrasonographic features of infertile women with polycystic ovarian syndrome

    International Nuclear Information System (INIS)

    Haq, F.; Rizvi, J.

    2007-01-01

    To evaluate and compare the clinical, biochemical and ultrasonic features of infertile women with PCOS from the two infertility centers of Karachi, The Aga Khan University Hospital and Concept Fertility Centre. Patients attending the Infertility Clinics of Aga Khan University Hospital, Karachi and Concept Fertility Centre, Karachi, were evaluated for their clinical features. Complete biochemical evaluation was performed by day 2 FSH, LH, serum prolactin, serum testosterone and fasting serum insulin determination. These results were recorded on the data collection form. Ultrasonic evaluation was performed with transvaginal ultrasound to check the morphological appearance of ovaries. A total of 508 patients were evaluated for epidemiological features of PCOS. Frequency of PCOS in the infertility clinic was 17.6% with high rate of obesity (68.5%) and hyperinsulinemia (59%). The highest rate of abnormal clinical, biochemical features were seen above BMI of 30. High rates of obesity, hyperinsulinemia and impaired glycemic control were seen in this series. It was demonstrated that high BMI had an association and correlation with abnormal clinical and biochemical features. Obese women with PCOS need more attention for their appropriate management. (author)

  10. AGA predicts winter jump in residential gas price

    International Nuclear Information System (INIS)

    Anon.

    1992-01-01

    The American Gas Association predicts the average heating bill for residential gas consumers could increase by as much as 18% this winter. AGA Pres. Mike Baly said, Last year's winter was warmer than normal. If the 1992-93 winter is similar, AGA projects that residential natural gas heating bills will go up about 6%. If we see a return to normal winter weather, our projection show the average bill could rise by almost 18%

  11. Chinggis Khan: Ancestor, Buddha or Shaman? : On the uses and abuses of the portrait of Chinggis Khan

    OpenAIRE

    Charleux, Isabelle

    2009-01-01

    International audience; This article explores some past and present visual images of Chinggis Khan in order to better understand how religious and lay authorities manipulated and distorted his image to make it serve ritual purposes that bolstered their power.

  12. Writeshops: An effective tool to enable African academics to publish

    CSIR Research Space (South Africa)

    Vincent, K

    2012-08-01

    Full Text Available -1 Writeshops: An effective tool to enable African academics to publish Vincent*, K., T. Cull, (Kulima Integrated Development Solutions, South Africa) E. Archer van Garderen, (CSIR, South Africa) and A. Awiti, (Aga Khan University, Kenya) * Corresponding... Seipt, Lisa Schipper and Richard J. T. Klein for their commitment to writeshops, and for various discussions on improving the accessibility of developing country researchers to the peer-reviewed literature. ...

  13. Fourth-generation spinal instrumentation: experience with adolescent idiopathic scoliosis at a tertiary care hospital in Pakistan

    Directory of Open Access Journals (Sweden)

    Fazal A

    2012-02-01

    Full Text Available Akil Fazal1, Riaz H Lakdawala21Hospital for Joint Disease, New York University, New York, USA; 2Section of Orthopaedics, Department of Surgery, The Aga Khan University Hospital, Karachi, PakistanObjective: To evaluate the radiological and functional outcome of surgical treatment of adolescent idiopathic scoliosis using fourth-generation posterior spinal instrumentation at The Aga Khan University, Karachi, Pakistan.Design: Case series.Place and duration of study: The Aga Khan University Hospital after a minimum of 2 years postoperatively.Patients and methods: A total of 20 patients with adolescent idiopathic scoliosis were recruited into the study and evaluated for radiological and functional outcome. The study period was from 2000 to 2005. Radiological outcome was assessed using Cobb angle measurement pre and postoperatively, hence assessing percentage correction. The lower instrumented vertebra was taken as the neutral vertebra and the level was recorded. Functional outcome was determined using the Scoliosis Research Society patient administered questionnaire. All patients were called to the clinic and asked to fill in the form. Those patients who were out of the city were mailed the forms and requested via telephone to complete and return.Results: Of the 20 patients operated on, twelve were female and eight were male. The average age at operation was 12.7 years. The mean Cobb angle was 69° preoperatively and 20° postoperatively, representing a percentage correction of 71%. The average duration of follow-up was 3.6 years. There was one major complication involving neurological injury post-op and two minor complications involving wound infection. The average Scoliosis Research Society score (on a scale of 1–5, with 5 being best for pain was 4.5, self-image was 4.2, functional status was 4.1, mental status was 3.8, and satisfaction was 4.4. There was no relationship between the percentage correction of scoliosis and the functional outcome

  14. A.Q. Khan Nuclear Smuggling Network

    Directory of Open Access Journals (Sweden)

    Molly MacCalman

    2016-03-01

    Full Text Available Abdul Qadeer Khan, widely viewed as the father of Pakistan’s nuclear weapons program, was arrested on January 31, 2004 for his key role in the black market sale of nuclear technology and equipment to Iran, North Korea, Libya, and possibly others. A.Q. Khan’s nuclear smuggling network prospered throughout the 1980s and 1990s and was linked to middlemen and businesses in over 20 countries. The network offered buyers a menu of both technical expertise and materials with prices ranging from millions to hundreds of millions of dollars. The Khan network was ultimately exposed largely due to years of intelligence gathering by the United States and the United Kingdom. However, very few of the network’s members have been successfully prosecuted and the demand for nuclear material by both state and non-state actors continues. The exposure of Khan’s network confirmed that a non-state actor could procure and sell a turnkey nuclear weapons program to willing buyers.

  15. Medicinal folk recipes used as traditional phyto therapies in district Dera Ismail Khan, KPK, Pakistan

    International Nuclear Information System (INIS)

    Marwat, S.K.; Rehman, F.; Khan, M.A.; Ahmad, M.

    2011-01-01

    This paper is based on the results of an ethno medicinal research work conducted in Dera Ismail Khan (D.I. Khan) District, Khyber Pakhtun Khwa (KPK), Pakistan, during May 2006 to March 2007. The study was focused for documentation of traditional knowledge of local people about the use of medicinal folk recipes of native plants. During field survey, questionnaires were used to interview the local inhabitants, older people including men and women both, who were familiar with traditional uses of indigenous plants. In total 40 new medicinal folk recipes of 26 plant species, belonging to 19 families were recorded. These folk recipes are used as traditional phyto therapies in the area. Plant specimens were identified, preserved and vouchers were deposited in the Department of Botany, Quaid-i-University Islamabad for future references. Results were systematically arranged by alphabetic order of botanical names followed by medicinal folk recipes. English name, local name, family name and voucher no., were listed. (author)

  16. 78 FR 48539 - Designation of Bahawal Khan, Also Known as Salahuddin Ayubi, Also Known as Bahwal Khan, as a...

    Science.gov (United States)

    2013-08-08

    ... DEPARTMENT OF STATE [Public Notice 8415] Designation of Bahawal Khan, Also Known as Salahuddin... committing, acts of terrorism that threaten the security of U.S. nationals or the national security, foreign policy, or economy of the United States. Consistent with the determination in section 10 of Executive...

  17. Yarlyk of Uzbek Khan Granted to the Franciscans of the Golden Horde in 1314: The Latin Text, Russian Translation, and Commentary

    Directory of Open Access Journals (Sweden)

    Roman Hautala

    2014-09-01

    Full Text Available The present article contains the Latin text, Russian translation, and commentary to the yarlyk of Uzbek khan (1312/13–1341. Uzbek khan granted this yarlyk to the Franciscans of the Golden Horde 20th March, 1314. Apparently, the original text of yarlyk was written in the Khwarezmian idiom of the Kipchak language. However, the original text of yarlyk has not been preserved as well as a number of other yarlyks of the Golden Horde khans, which survived only in the late Russian translation. Fortunately, this yarlyk was translated into Latin and, subsequently, this translation was rewritten by anonymous British copyist in the first half of the 14th century. Arthur Christopher Moule discovered this medieval copy of yarlyk along with several other Franciscan documents in one of the codices (D. Ii. 3.7. stored in the Cambridge University Library. In 1924, Moule published the first and only edition of the yarlyk’s copy together with other Franciscan sources, provided with a thorough preface of Michael Bihl. The text of this Uzbek’s yarlyk have never been translated into modern languages. For this reason, the content of yarlyk has been known only to a narrow circle of specialists studying the Catholic missionary activity in the Mongol Empire. In turn, the scholars of the Golden Horde history, including researchers of the Jochid official documentation, have been unaware of this important legal document up to the present time. The content of Uzbek khan’s yarlyk points out that this document was based on the previous yarlyks of khan Mengu-Timur (1267–1282 and khan Tokhta (1291–1312. Thus, the content of yarlyk allows us to define the time of an emergence and future activities of the Franciscans in the territory of the Golden Horde. Furthermore, this information provide further evidence on the religious tolerance practice of the Jochid khans. In this context, the most significant is an indication of the Uzbek khan’s tolerant attitude toward

  18. Scaling Value: Transnationalism and the Aga Khan's English as a "Second Language" Policy

    Science.gov (United States)

    Bolander, Brook

    2018-01-01

    Against the backdrop of growing sociolinguistic interest in transnationalism, this paper uses the notion of "scale" as an "ideological project" (Irvine in "Scale. Discourse and dimensions of social life," University of California Press, California, 2016: 214) to study situated discursive performances of…

  19. Diagnosis of hepatoma using grayscale and Doppler ultrasound in patients with chronic liver disease

    Directory of Open Access Journals (Sweden)

    Idris S

    2011-10-01

    Full Text Available Wasim A Memon, Zishan Haider, Mirza Amanullah Beg, Muhammad Idris, Tanveer-ul-Haq, Waseem Akhtar, Sidra IdrisRadiology Department, Aga Khan University Hospital, Karachi, Pakistan Every author contributed equally to the workObjective: To determine the diagnostic accuracy of liver ultrasound for the detection of hepatoma in chronic liver disease (CLD patients by either taking histopathology or serum α-fetoprotein levels or a biphasic computed tomography (CT scan (whichever is available as the gold standard.Study design: Cross-sectional.Place and duration of study: Radiology Department, The Aga Khan University Hospital, Karachi, Pakistan, from January 2007 to January 2010.Methods: A total of 239 patients (156 males and 83 females with clinical suspicion or surveillance of hepatoma in CLD referred to the radiology department for ultrasound evaluation followed by either liver biopsy and histopathology or serum α-fetoprotein level or biphasic CT scan.Results: The sensitivity of ultrasound for hepatoma detection in CLD was 65%, specificity was 85%, and accuracy was 70%, and positive predictive value and negative predictive value were 92% and 45%, respectively.Conclusion: Ultrasound is a relatively quick, safe, reasonably accurate, and noninvasive imaging modality for the detection of hepatoma in CLD and can be complemented with clinical assessment of screening high-risk patients.Keywords: hepatoma, ultrasound, radiology, chronic liver disease

  20. Khan Academy ehk Kuidas õppeaineid integreeriti / Kärt Matiisen

    Index Scriptorium Estoniae

    Matiisen, Kärt

    2012-01-01

    Kose gümnaasiumi 7. klassi matemaatikarühma uute õppemeetodite leidmise projektist ja erinevate õppeainete integreerimisest, mille käigus loodi subtiitrid Khan Academy ingliskeelsetele matemaatika õppetükkidele

  1. STRATEGI PEMBANGUNAN EKONOMI YANG ISLAMI MENURUT FAHIM KHAN

    Directory of Open Access Journals (Sweden)

    Ali Murtadho

    2016-10-01

    Full Text Available Several theories about the development strategy formulated by the most conventional neo-classical economists much criticized. Fahim Khan including contemporary Islamic economic thinkers who criticize conventional economic development strategy with alternative bids from the Islamic economics perspective. Their thinking is exciting to examined substance and its correlation with the economic development of contemporary Islamic discourse that dominated the development of financial institutions/syariah banking. The creation of entrepreneurial opportunities made Fahim Khan as a keyword in the concept of criticizing conventional strategy and supporting the Islamic economic development strategy. Strategy opened and graced this productive creative independent businesses are deemed appropriate and supported by the Islamic economic system based on profit and loss sharing partnership (profit-loss sharing. The idea is to promote excellence banking system of sharing based on the conventional interest-based banking system in spurring economic development suplus to enliven the entrepreneurial workforce.

  2. HARMONIZING GLOBAL EDUCATION-FROM GENGHIS KHAN TO FACEBOOK

    Directory of Open Access Journals (Sweden)

    Jon Baggaley reviewed by Wolfram LAASER

    Full Text Available The book starts with the optimistic definition of the Maastricht 2002 declaration about global education claiming that it should open people´s minds to the realities of the globalized world and bring about greater justice, equity and human rights. He then traces back the history of global communication to Denghis Khan and his arrow riders to end up with the modern forms developed by the different generations of distance education with special emphasis on the mega universities . Although communication is dominated today by iPads and smart phones Baggaley points out that important concepts how to bring online media to the population and to convert the recipients of that information into contributors (user generated content have been developed much earlier e.g. by the Polish filmmaker Dziga Vertov about one hundred years ago. So Baggaley always tries to put actual media development into a historical context that includes parallel developments and trends in music or painting as well.

  3. The role of anthropometric, growth and maturity index (AGaMI) influencing youth soccer relative performance

    Science.gov (United States)

    Bisyri Husin Musawi Maliki, Ahmad; Razali Abdullah, Mohamad; Juahir, Hafizan; Muhamad, Wan Siti Amalina Wan; Afiqah Mohamad Nasir, Nur; Muazu Musa, Rabiu; Musliha Mat-Rasid, Siti; Adnan, Aleesha; Azura Kosni, Norlaila; Abdullah, Farhana; Ain Shahirah Abdullah, Nurul

    2018-04-01

    The main purpose of this study was to develop Anthropometric, Growth and Maturity Index (AGaMI) in soccer and explore its differences to soccer player physical attributes, fitness, motivation and skills. A total 223 adolescent soccer athletes aged 12 to 18 years old were selected as respondent. AGaMI was develop based on anthropometric components (bicep, tricep, subscapular, suprailiac, calf circumference and muac) with growth and maturity component using tanner scale. Meanwhile, relative performance namely physical, fitness, motivation and skills attributes of soccer were measured as dependent variables. The Principal Component Analysis (PCA) and Analysis of Variance (ANOVA) are used to achieve the objective in this study. AGaMI had categorized players into three different groups namely; high (5 players), moderate (88 players) and low (91 players). PCA revealed a moderate to very strong dominant range of 0.69 to 0.90 of factor loading on AGaMI. Further analysis assigned AGaMI groups as treated as independent variables (IV) and physical, fitness, motivation and skills attributes were treated as dependent variables (DV). Finally, ANOVA showed that flexibility, leg power, age, weight, height, sitting height, short and long pass are the most significant parameters statistically differentiate by the groups of AGaMI (p<0.05). As a summary, body fat mass, growth and maturity are an essential component differentiating the output of the soccer players relative performance. In future, information of the AGaMI model are useful to the coach and players for identifying the suitable biological and physiological demand reflects more comprehensive means of youth soccer relative performance. This study further highlights the importance of assessing AGaMI when identifying soccer relative performance.

  4. Khan Academy as Supplemental Instruction: A Controlled Study of a Computer-Based Mathematics Intervention

    Science.gov (United States)

    Kelly, Daniel P.; Rutherford, Teomara

    2017-01-01

    Khan Academy is a large and popular open educational resource (OER) with little empirical study into its impact on student achievement in mathematics when used in schools. In this study, we examined the use of Khan Academy as a mathematics intervention among seventh grade students over a 4-week period versus a control group. We also compared…

  5. The Representation of Muslim American in Karan Johar's Movie My Name is Khan

    OpenAIRE

    PUTRI, SARAH WIDITA

    2015-01-01

    Keywords: Representation, Muslim American, My Name is Khan. Literature always appear with the story about something that reflects or describes the human life. Movie can be a medium of communication. Movie is one of mass media that deliver some minds, aspiration, and controversial issue. My Name is Khan presents the reflection in United States about how American treat Muslim unfairly where the United States is the country of various religion, ethnics, and uphold the human rights. Directed by ...

  6. Maternal genital tract colonisation by group-b streptococcus: a hospital based study

    International Nuclear Information System (INIS)

    Najmi, N.; Sikandar, R.; Zuberi, N.F.

    2013-01-01

    Objectives: To determine the prevalence of Group B Streptococcus genital tract infection in pregnant women and to determine the risk factors for its colonisation. Methods: The cross-sectional study was conducted at the Aga Khan University Hospital, Karachi and Sobhraj Hospital, Karachi, from May to August 2007. Pregnant women at 35-37 weeks gestation attending antenatal clinic at these hospitals constituted the study population. Based on stratified sampling, 405 patients were recruited. High vaginal swabs of these patients were taken in order to calculate the prevalence of infection at each hospital. Logistic regression was used to evaluate the risk factor association. SPSS 11.5 was used for statistical analysis. Results: The overall prevalence of colonisation was 17% (n=69) (95% CI: 13.4-20.7). Of the 155(38.27%) women at the Aga Khan Hospital, 35(22.6%) were positive, while among the 250 (61.72%) women at Sobhraj Hospital, the prevalence was 13.6% (n=34). The colonisation was found to be significantly associated inversely with the body mass index of the patient (OR 0.91; 95% CI: 0.08-1.0). Conclusion: Group B Streptococcus screening should be an integral part of antenatal care and should be offered to all pregnant women. (author)

  7. Changing trends of hepatitis b seromarkers amongst pakistani population: a laboratory-based review

    International Nuclear Information System (INIS)

    Zafar, A.; Khan, E.; Khan, M.S.; Moiz, B.; Jafri, W.

    2013-01-01

    Objective: To study the changing trends of hepatitis B markers tested at Aga Khan University Hospital clinical laboratory according to the internationally recognised classification of hepatitis B profile. Methods: The retrospective study involved analysis of laboratory records of hepatitis B profiles of all patients collected from January 2001 to December 2008 at the Aga Khan University Hospital's clinical laboratory. Patients with complete profile tested were categorised according to the Centre for Diseases Control classification of hepatitis B profile. SPSS 16 was used for statistical analysis. Results: A total of 185,825 patients had serological markers for hepatitis B tested. Mean-age of reactive hepatitis B surface antigen (HBsAg) patients was 30+-12.5 years. HBsAg reactivity was significantly higher in males than females (34% vs 12%; p <0.0001). HBsAg showed a slight decline in the percentage reactivity during the 8-year study period, while a gradual increase in hepatitis B surface antibody (HBsAb) reactivity was observed. Of the total, 23% patients belonged to the 'susceptible to infection' category; 39% patients were classified as 'chronically-ill'; 12% patients were categorised as 'immune due to hepatitis B vaccination'. 3% patients were classed as 'acutely infected'. Overall, samples received from Peshawar, Quetta and Larkana showed very high reactivity rates. Conclusion: The study substantiated the general perception that levels of HBsAg is showing a decreasing trend, while levels of HBsAb are increasing perhaps due to better vaccination of population. (author)

  8. ELT in a changing world innovative approaches to new challenges

    CERN Document Server

    Ahmed, Azra; Saleem, Faiza; Cane, Graeme

    2013-01-01

    A novel ELT resource for language specialists and teachers across the world, this selection of papers is a collection of the most compelling and innovative ideas presented at a seminar hosted by the Centre of English Language, Aga Khan University, Pakistan, in January 2011, entitled 'ELT in a Changing World: Innovative Approaches to New Challenges'.The book is divided into three sections, the first of which is 'Global change and language learning'. This section offers a guided tour of language teaching evolution, highlighting the merits of enhanced language awareness, self-immersive and input/

  9. STRATEGI PEMBANGUNAN EKONOMI YANG ISLAMI MENURUT FAHIM KHAN

    OpenAIRE

    Ali Murtadho

    2017-01-01

    Several theories about the development strategy formulated by the most conventional neo-classical economists much criticized. Fahim Khan including contemporary Islamic economic thinkers who criticize conventional economic development strategy with alternative bids from the Islamic economics perspective. Their thinking is exciting to examined substance and its correlation with the economic development of contemporary Islamic discourse that dominated the development of financial institutions/sy...

  10. [Distribution of the male lineages of Genghis Khan's descendants in northern Eurasian populations].

    Science.gov (United States)

    Derenko, M V; Maliarchuk, B A; Wozniak, M; Denisova, G A; Dambueva, I K; Dorzhu, C M; Grzybowski, T; Zakharov, I A

    2007-03-01

    Data on the variation of 12 microsatellite loci of Y-chromosome haplogroup C3 were used to screen lineages included in the cluster of Genghis Khan's descendants in 18 northern Eurasian populations (Altaian Kazakhs, Altaians-Kizhi, Teleuts, Khakassians, Shorians, Tyvans, Todjins, Tofalars, Sojots, Buryats, Khamnigans, Evenks, Mongols, Kalmyks, Tajiks, Kurds, Persians, and Russians; the total sample size was 1437 people). The highest frequency of haplotypes from the cluster of the Genghis Khan's descendants was found in Mongols (34.8%). In Russia, this cluster was found in Altaian Kazakhs (8.3%), Altaians (3.4%), Buryats (2.3%), Tyvans (1.9%), and Kalmyks (1.7%).

  11. Towards excellence in cardiac surgery: experience from a developing country.

    Science.gov (United States)

    Saifuddin, Aamir; Shahabuddin, Syed; Perveen, Shazia; Furnaz, Shumaila; Sharif, Hasanat

    2015-08-01

    The objective of this study is an attempt to measure the performance in terms of comparing results with a large internationally recognized database used as a benchmark. Cross-sectional (prospectively collected data analysed and compared retrospectively). Aga Khan University Hospital, Karachi, Pakistan. From January 2006 to December 2010, information of the 2198 CABGs performed at Aga Khan University Hospital (AKU) was collected prospectively. This included patient characteristics and specific intra- and post-operative outcomes and compared with findings from the American Society of Thoracic Surgeons' National Cardiac Database (STS-NCD). There were more male patients in the AKU cohort and more diabetics. In AKU, more cases involved three or more grafts (85 vs. 78%), and in both groups, an internal mammary artery graft was used over 90% of the time. The overall 30-day mortality was 2.7% at AKU, compared with 1.5% in the STS-NCD data. AKU had a lower incidence of permanent stroke (0.5 vs. 1.2%), prolonged ventilation (10.5 vs. 11.0%), deep sternal wound infection (0.2 vs. 0.4%) and reoperation (4.0 vs. 4.7%). It had more cases of renal failure (5.4 vs. 3.6%). Readmission rates within 30 days were also less in AKU (3.9 vs. 9.1%). The outcomes of this study compare very favourably with the benchmark (STS). This demonstrates that high level of quality care can be achieved in this part of the world. © The Author 2015. Published by Oxford University Press in association with the International Society for Quality in Health Care; all rights reserved.

  12. Peroneal island flap for wound coverage in complex injuries of the lower extremity

    Directory of Open Access Journals (Sweden)

    Fazal A

    2012-01-01

    Full Text Available Akil Fazal1, Haroon-ur-Rashid1, Tahseen Cheema21Section of Orthopedics, Department of Surgery, Aga Khan University, Karachi, Pakistan; 2Department of Orthopedics and Rehabilitation, University of New Mexico, Albuquerque, NM, USABackground: Complex injuries of the lower extremity pose a therapeutic challenge owing to limited availability of local soft tissue for coverage. One option in this region is the pedicled fasciocutaneous flap based on perforators of the peroneal artery. In this case series, we present our experience of the peroneal island pedicled flap for reconstruction of lower extremity wounds.Methods: Records of 18 cases of peroneal island flap admitted consecutively to the Section of Orthopedics at Aga Khan University Hospital from January 1996 to December of 2009 were studied and their outcomes determined.Results: The most common indication for coverage was open wounds due to a road traffic accident (n = 10, followed by burns (n = 3. The most common area exposed was the lower third of the leg followed by the middle third. The tibia was exposed in 11 patients. The flaps ranged in size from 35 cm2 to over 200 cm2. In 13 patients, the flaps healed uneventfully, while in the remaining five there was partial flap necrosis. In four of the latter patients, the residual wound healed with conservative measures only, but the fifth patient required further surgery to achieve acceptable coverage.Conclusion: The peroneal artery flap appears to be a simple, useful, and reliable flap in the armamentarium of the surgeon when planning soft tissue coverage of the lower extremity.Keywords: leg injuries, surgical flaps, lower extremity

  13. Comparison of Patent Claim Construction between Netherlands and Germany on Basis of AGA v. Occlutech

    NARCIS (Netherlands)

    Tsoutsanis, A.; Kau, C.

    2013-01-01

    This article provides a brief overview on how the Dutch and German courts interpret the claims of a patent. It briefly compares each national approach on the basis of the recent AGA v Occlutech litigation in both countries. The dispute between AGA and Occlutech involved socalled ‘‘occluders’’, a

  14. Breast imaging reports for malignant lesions: are we maintaining recommended BI-RADS® lexicon standards?

    International Nuclear Information System (INIS)

    Masroor, Imrana; Azeemuddin, Muhammad; Sakhawat, Saima; Beg, Madiha; Sohail, Saba; Ahmed, Rashid; Irfan-Ul-Haq; Mehboob, Javed

    2012-01-01

    The purpose of this study was to evaluate mammography reports for diagnosed breast cancer cases in major government and private centers in Karachi, Pakistan, with respect to concordance with the Breast Imaging Reports And Data System (BI-RADS ® ) lexicon. A prospective, descriptive, multicenter study was conducted in the radiology sections of the Aga Khan University Hospital, Pakistan Naval Station Shifa Hospital, Advanced Radiology Clinic, Karachi Institute of Radiotherapy and Nuclear Medicine, and Civil Hospital Karachi between May and October 2010 after approval from the ethical review committee of Aga Khan University. Mammograms reported as BI-RADS category 4 and 5 were included in the study. Mammograms reported as BI-RADS category 0, 1, 2 and 3 were excluded. Fifty reports were collected from each center. Data were collected about the clinical indication, breast density, location and description of the lesion, calcification, and comments on axillary lymph nodes. This description was compared with the BI-RADS lexicon. The mean age of the patients was 50 ± 12 years. The clinical indication, breast parenchymal density, lesion location, and presence of calcification were better described by the private centers, while description of lymph node status was better stated by the government centers. This difference was statistically significant, except for lesion description. The description of masses by the two reporting groups was comparable. Mammographic reporting of malignant breast lesions in the private sector is more in line with the BI-RADS lexicon, as compared with government sector hospitals in Karachi, Pakistan. Lymph node documentation was better in government sector reports

  15. Clinical and Biochemical Characteristics of Children with Juvenile Idiopathic Arthritis

    International Nuclear Information System (INIS)

    Ahmed, S.; Ali, S. R.; Ishaque, S.

    2014-01-01

    Objective: To determine the clinical and biochemical characteristics of children with Juvenile Idiopathic Arthritis (JIA) at a tertiary care centre in Karachi, Pakistan. Study Design: A descriptive study. Place and Duration of Study: Paediatric Rheumatology Clinic of The Aga Khan University Hospital (AKUH), Karachi, from January 2008 to December 2011. Methodology: Clinical and laboratory profile and outcome of children less than 15 years of age attending the Paediatric Rheumatology Clinic of the Aga Khan University, Karachi with the diagnosis of Juvenile Idiopathic Arthritis according to International League against Rheumatism were studied. These children were classified into different types of JIA; their clinical and laboratory characteristics, response to therapy and outcome was evaluated. Results: Sixty eight patients satisfying the criteria of International League against Rheumatism (ILAR) for Juvenile Idiopathic Arthritis were enrolled during the study period of four consecutive years, their age ranged from 9 months to 15 years. Mean age at onset was 6.45 +- 4.03 years while mean age at diagnosis was 7.60 +- 3.93 years. Polyarticular was the most predominant subtype with 37 (54%) patients, out of these, 9 (24%) were rheumatoid factor positive. An almost equal gender predisposition was observed. Fever and arthritis were the most common presenting symptoms, with only 2 patients presenting with uveitis. Conclusion: The clinico-biochemical characteristics of JIA at the study centre showed a pattern distinct with early onset of disease, high frequency of polyarticular type and a higher rheumatoid factor (QRA) and ANA positivity in girls. (author)

  16. Ex-vivo assessment and non-invasive in vivo imaging of internal hemorrhages in Aga2/+ mutant mice

    Energy Technology Data Exchange (ETDEWEB)

    Ermolayev, Vladimir [Institute for Biological and Medical Imaging, Helmholtz Zentrum München, Building 56, Ingolstädter Landstraße 1, D-85764 Neuherberg (Germany); Cohrs, Christian M. [Institute for Experimental Genetics, Helmholtz Zentrum München, Ingolstädter Landstraße 1, D-85764 Neuherberg (Germany); Mohajerani, Pouyan; Ale, Angelique [Institute for Biological and Medical Imaging, Helmholtz Zentrum München, Building 56, Ingolstädter Landstraße 1, D-85764 Neuherberg (Germany); Hrabé de Angelis, Martin [Institute for Experimental Genetics, Helmholtz Zentrum München, Ingolstädter Landstraße 1, D-85764 Neuherberg (Germany); Ntziachristos, Vasilis, E-mail: v.ntziachristos@tum.de [Institute for Biological and Medical Imaging, Helmholtz Zentrum München, Building 56, Ingolstädter Landstraße 1, D-85764 Neuherberg (Germany)

    2013-03-08

    Highlights: ► Aga2/+ mice, model for Osteogenesis imperfecta, have type I collagen mutation. ► Aga2/+ mice display both moderate and severe phenotypes lethal 6–11th postnatal. ► Internal hemorrhages studied in Aga2/+ vs. control mice at 6 and 9 days postnatal. ► Anatomical and functional findings in-vivo contrasted to the ex-vivo appearance. -- Abstract: Mutations in type I collagen genes (COL1A1/2) typically lead to Osteogenesis imperfecta, the most common heritable cause of skeletal fractures and bone deformation in humans. Heterozygous Col1a1{sup Aga2/+}, animals with a dominant mutation in the terminal C-propeptide domain of type I collagen develop typical skeletal hallmarks and internal hemorrhages starting from 6 day after birth. The disease progression for Aga2/+ mice, however, is not uniform differing between severe phenotype lethal at the 6–11th day of life, and moderate-to-severe one with survival to adulthood. Herein we investigated whether a new modality that combines X-ray computer tomography with fluorescence tomography in one hybrid system can be employed to study internal bleedings in relation to bone fractures and obtain insights into disease progression. The disease phenotype was characterized on Aga2/+ vs. wild type mice between 6 and 9 days postnatal. Anatomical and functional findings obtained in-vivo were contrasted to the ex-vivo appearance of the same tissues under cryo-slicing.

  17. Ex-vivo assessment and non-invasive in vivo imaging of internal hemorrhages in Aga2/+ mutant mice

    International Nuclear Information System (INIS)

    Ermolayev, Vladimir; Cohrs, Christian M.; Mohajerani, Pouyan; Ale, Angelique; Hrabé de Angelis, Martin; Ntziachristos, Vasilis

    2013-01-01

    Highlights: ► Aga2/+ mice, model for Osteogenesis imperfecta, have type I collagen mutation. ► Aga2/+ mice display both moderate and severe phenotypes lethal 6–11th postnatal. ► Internal hemorrhages studied in Aga2/+ vs. control mice at 6 and 9 days postnatal. ► Anatomical and functional findings in-vivo contrasted to the ex-vivo appearance. -- Abstract: Mutations in type I collagen genes (COL1A1/2) typically lead to Osteogenesis imperfecta, the most common heritable cause of skeletal fractures and bone deformation in humans. Heterozygous Col1a1 Aga2/+ , animals with a dominant mutation in the terminal C-propeptide domain of type I collagen develop typical skeletal hallmarks and internal hemorrhages starting from 6 day after birth. The disease progression for Aga2/+ mice, however, is not uniform differing between severe phenotype lethal at the 6–11th day of life, and moderate-to-severe one with survival to adulthood. Herein we investigated whether a new modality that combines X-ray computer tomography with fluorescence tomography in one hybrid system can be employed to study internal bleedings in relation to bone fractures and obtain insights into disease progression. The disease phenotype was characterized on Aga2/+ vs. wild type mice between 6 and 9 days postnatal. Anatomical and functional findings obtained in-vivo were contrasted to the ex-vivo appearance of the same tissues under cryo-slicing

  18. The Christian Nobles at the Court of Great Khan, as Described in Mediaeval European Sources

    Directory of Open Access Journals (Sweden)

    Vladimír Liščák

    2017-06-01

    Full Text Available Research objectives: “Moreover, the chief princes of his whole empire, more than thirty thousand in number, who are called Alans, and govern the whole Orient, are Christians either in fact or in name, calling themselves the Pope’s slaves, and ready to die for the Franks.” With these words John of Marignola, a notable traveller to the Far East in the fourteenth century and a legate to the Great Khan of Cathay, attested in his Cronica Boemorum the presence of certain Christian nobles of the Alan race in the service of the Mongol-Chinese emperor. The immediate impetus for Marignola’s mission was that in 1336 the Great Khan Ukhaghatu Toghon-Temür sent a delegation of sixteen “Franks” (Franquis, as the Mongols called Europeans, ad Papam, Dominum Christianorum in Franchiam. They brought two letters to the pope: one purporting to be from the Great Khan himself, and the other from certain princes of the Christian Alans in his service. By the coming of the Mongolian legation in Avignon in 1338, we are informed, among others, that the successor of John of Montecorvino, the first archbishop in Khanbalik, had never reached his destination, as well as the other succeeding archbishops to Khanbalik. Research materials: Marignola’s mission was important not only with its spiritual message, but rather with an excellent choice of gift for the Great Khan. Western messengers brought with them, among the gifts from the Pope in Rome, a singularly auspicious present: a magnificent black horse with white hind hooves. Marignola, in his Cronica Boemorum, identifies the Christian dignitaries at the court of the Great Khan as the Alans. We know of them from earlier sources, but mostly under the generic name “Christians” or “Nestorian Christians”. John of Montecorvino reportedly converted many Alans (he did not mention their name to Roman Catholic Christianity in addition to Armenians in China. According to the Annals of the Yuan Dynasty, in 1229 and

  19. Antisecretory and analgesic activities of Terminalia bellerica

    African Journals Online (AJOL)

    STORAGESEVER

    2010-05-03

    May 3, 2010 ... medicine to treat asthma, cancer, colic, diarrhea, dysuria, headache, hypertension ... mice (20 - 25 g) of either sex and local breed were housed at the animal house of the Aga Khan .... J. Food Drug Anal. 16: 6-14. Koster R ...

  20. Aga sellepärast, et on po... / Aleksandr Astrov

    Index Scriptorium Estoniae

    Astrov, Aleksandr

    2005-01-01

    Arutledes venekeelse valija hääletuskäitumise ümber juhib autor tähelepanu, et Eestis sätestab üks konkreetne seadus venelastele valimisõiguse, andes neile reaalse poliitilise jõu, teine aga piirab nende juurdepääsu ainult keele kaudu ligipääsetavatele eetikaressurssidele, mis võimaldaksid teha teadlikku valikut

  1. Traumatic brain injury in a rural and an urban Tanzanian hospital--a comparative, retrospective analysis based on computed tomography.

    Science.gov (United States)

    Maier, Daniel; Njoku, Innocent; Schmutzhard, Erich; Dharsee, Jaffer; Doppler, Magdalena; Härtl, Roger; Winkler, Andrea Sylvia

    2014-01-01

    In a resource-poor environment such as rural East Africa, expensive medical devices such as computed tomographic (CT) scanners are rare. The CT scanner at the rural Haydom Lutheran Hospital (HLH) in Tanzania therefore offers a unique chance to observe possible differences with urban medical centers in the disease pattern of trauma-related cranial pathologies. The purpose of this study was to compare traumatic brain injuries (TBIs) between a rural and an urban area of Tanzania. HLH has 350 beds and one CT scanner. The urban Aga Khan Hospital is a private hospital with 80 beds and one CT scanner. This was a retrospective study. Data of 248 patients at HLH and of 432 patients at Aga Khan Hospital with TBI could be collected. The prevalence of TBI was significantly higher in the rural area compared to the urban area (34.2% vs. 21.9%, P workplace is primarily urban or rural. Copyright © 2014 Elsevier Inc. All rights reserved.

  2. Hassan Aga and his Government in Algiers. The Consolidation of a Mediterranean Myth

    Directory of Open Access Journals (Sweden)

    Fernando FERNÁNDEZ LANZA

    2014-12-01

    Full Text Available This work tries to describe graphically the consolidation of a social myth in the unsettled Mediterranean of the 16th century, through a personage: the Spanish convert to Islam Hassan Aga (Azan Aga, the Sardinian renegade who succeeded Hayreddin Barbarrosa at the helms of Algiers from 1533 till his death ten years later. This was a period of intense activity, with the climax that came with the expedition of Charles to Algiers in 1541, whose spectacular defeat can be considered as the principal nucleus of the myth of this popular personage who as a Sardinian slave came to defeat the Emperor. A myth of social ascension with maquiavelical profiles of a new prince of the frontiers.

  3. AGA: Interactive pipeline for reproducible gene expression and DNA methylation data analyses [version 2; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Michael Considine

    2015-10-01

    Full Text Available Automated Genomics Analysis (AGA is an interactive program to analyze high-throughput genomic data sets on a variety of platforms. An easy to use, point and click, guided pipeline is implemented to combine, define, and compare datasets, and customize their outputs. In contrast to other automated programs, AGA enables flexible selection of sample groups for comparison from complex sample annotations. Batch correction techniques are also included to further enable the combination of datasets from diverse studies in this comparison. AGA also allows users to save plots, tables and data, and log files containing key portions of the R script run for reproducible analyses. The link between the interface and R supports collaborative research, enabling advanced R users to extend preliminary analyses generated from bioinformatics novices.

  4. Managing opium: Policy choices for Afghanistan | IDRC ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    2011-01-27

    Jan 27, 2011 ... The role of the International Development Research Centre (IDRC) is not ... Under the sponsorship of various agencies, including Aga Khan Development Network and ... busy in the poppy fields, were free to seek wage labour in the city. ... producing opium for medicinal purposes — Australia, France, India, ...

  5. Molecular Genealogy of a Mongol Queen's Family and Her Possible Kinship with Genghis Khan.

    Science.gov (United States)

    Lkhagvasuren, Gavaachimed; Shin, Heejin; Lee, Si Eun; Tumen, Dashtseveg; Kim, Jae-Hyun; Kim, Kyung-Yong; Kim, Kijeong; Park, Ae Ja; Lee, Ho Woon; Kim, Mi Jin; Choi, Jaesung; Choi, Jee-Hye; Min, Na Young; Lee, Kwang-Ho

    2016-01-01

    Members of the Mongol imperial family (designated the Golden family) are buried in a secret necropolis; therefore, none of their burial grounds have been found. In 2004, we first discovered 5 graves belonging to the Golden family in Tavan Tolgoi, Eastern Mongolia. To define the genealogy of the 5 bodies and the kinship among them, SNP and/or STR profiles of mitochondria, autosomes, and Y chromosomes were analyzed. Four of the 5 bodies were determined to carry the mitochondrial DNA haplogroup D4, while the fifth carried haplogroup CZ, indicating that this individual had no kinship with the others. Meanwhile, Y-SNP and Y-STR profiles indicate that the males examined belonged to the R1b-M343 haplogroup. Thus, their East Asian D4 or CZ matrilineal and West Eurasian R1b-M343 patrilineal origins reveal genealogical admixture between Caucasoid and Mongoloid ethnic groups, despite a Mongoloid physical appearance. In addition, Y chromosomal and autosomal STR profiles revealed that the four D4-carrying bodies bore the relationship of either mother and three sons or four full siblings with almost the same probability. Moreover, the geographical distribution of R1b-M343-carrying modern-day individuals demonstrates that descendants of Tavan Tolgoi bodies today live mainly in Western Eurasia, with a high frequency in the territories of the past Mongol khanates. Here, we propose that Genghis Khan and his family carried Y-haplogroup R1b-M343, which is prevalent in West Eurasia, rather than the Y-haplogroup C3c-M48, which is prevalent in Asia and which is widely accepted to be present in the family members of Genghis Khan. Additionally, Tavan Tolgoi bodies may have been the product of marriages between the lineage of Genghis Khan's Borjigin clan and the lineage of either the Ongud or Hongirad clans, indicating that these individuals were members of Genghis Khan's immediate family or his close relatives.

  6. Surgical wisdom and Genghis Khan's Pax Mongolica.

    Science.gov (United States)

    Köstenbauer, Jakob

    2017-03-01

    The unrivalled conquests of Genghis Khan (CE c.1162-1227) led to the establishment of the Greater Mongolian Empire. By 1279, the Mongol dynasty controlled a vast Empire which, for the first time in history, unified Europe and China via the famous Silk Road. The ensuing century of peace and stability is referred to by historians as the Pax Mongolica, which facilitated Europe's renaissance and remarkably contributed to the rise of modern medicine and surgery. Secondary sources from published literature, primary sources from manuscripts and illustrations courtesy of universities, museum libraries and archives. There is ample evidence detailing the Mongol Empire's power during the thirteenth century and the Silk Road's role as a vehicle of commercial, cultural and scientific exchange. Advances in medical knowledge and surgical skills were made in all parts of the Empire and exchanged from China to Constantinople and back. Prominent medical figures traversed these centres, and no doubt contributed to the spread of surgical science, including Rashid al-Din and Mansur Ibn Ilyas. Their works, it is argued, enriched the practice of surgery and may have indirectly ushered-in the rise of modern surgery in the early medical schools at Salerno, Bologna, Pavia, Oxford, Montpellier and Constantinople to name but a few. The blossoming and diversification of medical and surgical knowledge was an integral part of the great cultural exchange facilitated by the Pax Mongolica. This enhanced surgical practice in China, Persia and Arabia, while coinciding with the renaissance of surgical teaching in Europe. © 2017 Royal Australasian College of Surgeons.

  7. Improving Early-Grade Literacy in East Africa: Experimental Evidence from Kenya and Uganda

    Science.gov (United States)

    Lucas, Adrienne M.; McEwan, Patrick J.; Ngware, Moses; Oketch, Moses

    2014-01-01

    Primary school enrollments have increased rapidly in sub-Saharan Africa, spurring concerns about low levels of learning. We analyze field experiments in Kenya and Uganda that assessed whether the Reading to Learn intervention, implemented by the Aga Khan Foundation in both countries, improved early-grade literacy as measured by common assessments.…

  8. Religious Citizenship: The Case of the Globalised Khoja

    African Journals Online (AJOL)

    based economic development in emerging economies. ... also as the 'Aga Khan'; at stake was access to the caste's extensive trading networks and .... the Khōjā represent a new facet of Muslim global citizenship through the continuing evolution ..... The rise of HIV-AIDS epidemic in Tanzania in 1990s was quickly responded.

  9. Endoscopic variceal band ligation: a local experience | Jani | East ...

    African Journals Online (AJOL)

    Objective: To evaluate the results of endoscopic variceal band ligation (EVBL) in the local set-up. Design: Retrospective analysis of data of all patients who had EVBL. Setting: Patients having EVBL at the office endoscopy suite. The Nairobi Hospital, the Aga Khan Hospital and M.P Shah Hospital. Methods: The varices were ...

  10. Frequency of colistin and fosfomycin resistance in carbapenem-resistant Enterobacteriaceae from a tertiary care hospital in Karachi

    Directory of Open Access Journals (Sweden)

    Qamar S

    2017-07-01

    Full Text Available Salima Qamar, Najma Shaheen, Sadia Shakoor, Joveria Farooqi, Kauser Jabeen, Rumina Hasan Clinical Microbiology, Department of Pathology And Laboratory Medicine, Aga Khan University Hospital, Karachi, Pakistan Introduction: Management of infections with carbapenem-resistant Enterobacteriaceae (CRE is challenging. In recent times, agents such as colistin and fosfomycin have been used in combination with other antibiotics to treat such infections. In this study, we aim to seek frequency of colistin and fosfomycin resistance in CRE from Pakistan.Methods: This study was conducted at clinical laboratories, Aga Khan University Hospital. In total, 251 CRE were included in the study. Colistin minimum inhibitory concentrations (MICs were performed using broth microdilution (BMD method and VITEK® 2 system, whereas fosfomycin susceptibility was performed using Kirby–Bauer method. MIC50 and MIC90 were calculated for colistin and agreement between VITEK and BMD was also calculated.Results: Out of 251 strains colistin MIC of ≥4 µg/mL was seen in 40 (15.9%. Of these strains 20 (50% were Klebsiella pneumoniae. Colistin MIC50 and MIC90 were found to be 0.5 and 16 µg/mL, respectively. BMD and VITEK 2 showed 100% categorical agreement. Essential agreement was 88.5% with kappa score 0.733 indicating strong agreement between VITEK and BMD. 31 out of 251 (12.3% CREs were resistant to fosfomycin.Conclusion: Study shows frequency of colistin and fosfomycin resistance to be 15.9% and 12.3%, respectively. In countries where rate of CREs is high, emerging resistance against these last resort antibiotics is alarming as it leaves clinicians with almost no options to manage such multidrug resistant and extensively drug resistant infections. Keywords: emerging drug resistance, colistin resistance, fosfomycin resistance, carbapenam resistant enterobacteriaceae, salvage antibiotics 

  11. Validation of acute physiologic and chronic health evaluation II scoring system software developed at The Aga Khan University, Pakistan.

    Science.gov (United States)

    Hashmi, M; Asghar, A; Shamim, F; Khan, F H

    2016-01-01

    To assess the predictive performance of Acute Physiologic and Chronic Health Evaluation II (APACHE II) software available on the hospital intranet and analyze interrater reliability of calculating the APACHE II score by the gold standard manual method or automatically using the software. An expert scorer not involved in the data collection had calculated APACHE II score of 213 patients admitted to surgical Intensive Care Unit using the gold standard manual method for a previous study performed in the department. The same data were entered into the computer software available on the hospital intranet (http://intranet/apacheii) to recalculate the APACHE II score automatically along with the predicted mortality. Receiver operating characteristic curve (ROC), Hosmer-Lemeshow goodness-of-fit statistical test and Pearson's correlation coefficient was computed. The 213 patients had an average APACHE II score of 17.20 ± 8.24, the overall mortality rate was 32.8% and standardized mortality ratio was 1.00. The area under the ROC curve of 0.827 was significantly >0.5 (P test showed a good calibration (H = 5.46, P = 0.71). Interrater reliability using Pearson's product moment correlations demonstrated a strong positive relationship between the computer and the manual expert scorer (r = 0.98, P = 0.0005). APACHE II software available on the hospital's intranet has satisfactory calibration and discrimination and interrater reliability is good when compared with the gold standard manual method.

  12. Validation of acute physiologic and chronic health evaluation II scoring system software developed at The Aga Khan University, Pakistan

    Directory of Open Access Journals (Sweden)

    M Hashmi

    2016-01-01

    Conclusion: APACHE II software available on the hospital′s intranet has satisfactory calibration and discrimination and interrater reliability is good when compared with the gold standard manual method.

  13. Khan's lectures handbook of the physics of radiation therapy

    CERN Document Server

    Khan, Faiz M; Mihailidis, Dimitris

    2011-01-01

    Khan's Lectures: Handbook of the Physics of Radiation Therapy will provide a digest of the material contained in The Physics of Radiation Therapy. Lectures will be presented somewhat similar to a PowerPoint format, discussing key points of individual chapters. Selected diagrams from the textbook will be used to initiate the discussion. New illustrations will used, wherever needed, to enhance the understanding of important concepts. Discussion will be condensed and often bulleted. Theoretical details will be referred to the textbook and the cited literature. A problem set (practice questions) w

  14. Khan et al., Afr J Tradit Complement Altern Med. (2015) 12(2):60-64 ...

    African Journals Online (AJOL)

    cadewumi

    alkalinity, chronic catarrh, renal disorders, dyspepsia, bloody dysentery and coronary (Madhavashetty et al., 2008), vomiting (Khan et al., 2013), leucoderma, antiviral, lymphatic glyndular system disease, antidiabetic, rectal prolapsus, aphrodisiac, anti-cholesterol, impetigo and carbubuncles (Nardkarnis, 2008; Pullaiah and ...

  15. Abdulgaffar Qyrymi. Excerpt from “Umdet ul-Ahbar”. From the History of Crimean Khans »

    Directory of Open Access Journals (Sweden)

    Nariman Seitametovich Seyityahya

    2015-12-01

    Full Text Available This publication contains a fragment about the history of Crimean khans from the historical work “Umdet al-Akhbar” written by a Crimean author Abdulgaffar Kyrymi. In particular, this publication contains a translation of the story about the descendants of Bash-Timur (Tash-Timur according to another version. In this story, Abdulgaffar Kyrymi thoroughly reveals the history of the descendants of Bash-Timur – Gyyaseddin and Devlet-Berdi. He also tells how Haji Giray, Devlet-Berdi’s son, became Khan. In addition, he provides information about khan Ulugh Muhammad, Bash-Timur’s cousin. The author provides us with a very interesting and supporting information in a separate addition to the margins of the manuscript. In particular, this addition contains a brief history of the Turkic tribes and inhabitants of Tataristan, birthplace of the Seljuks and Osman family from the Kayi clan. It also tells how the Ottomans took control of Crimea, examines in detail the reasons for this event, it speaks both about Mengli Giray’s education together with Ottoman princes and on the establishment of relations with Emenek-Bek Shirinsky, Chief Karachi of the Khanate. Then it tells about the rule of Muhammad Giray and his death in the war against the Nogays, about the reign of Saadet Giray, a son of Mengli Giray, during whose reign the uprising of Islam Giray took place.

  16. Westgate Shootings: An Emergency Department Approach to a Mass-casualty Incident.

    Science.gov (United States)

    Wachira, Benjamin W; Abdalla, Ramadhani O; Wallis, Lee A

    2014-10-01

    At approximately 12:30 pm on Saturday September 21, 2013, armed assailants attacked the upscale Westgate shopping mall in the Westlands area of Nairobi, Kenya. Using the seven key Major Incident Medical Management and Support (MIMMS) principles, command, safety, communication, assessment, triage, treatment, and transport, the Aga Khan University Hospital, Nairobi (AKUH,N) emergency department (ED) successfully coordinated the reception and care of all the casualties brought to the hospital. This report describes the AKUH,N ED response to the first civilian mass-casualty shooting incident in Kenya, with the hope of informing the development and implementation of mass-casualty emergency preparedness plans by other EDs and hospitals in Kenya, appropriate for the local health care system.

  17. KONFLIK LINGKUNGAN DI KAMPUNG AGAS, TANJUNG UMA, BATAM (Environmental Conflict in Kampung Agas, Tanjung Uma, Batam

    Directory of Open Access Journals (Sweden)

    Saprial Saprial

    2004-11-01

    Full Text Available ABSTRAK Perkembangan kota Batam sebagai kawasan industri, perdagangan, pelabuhan, dan pariwisata, membawa tidak saja dampak positip, melainkan juga dampak negatif. Salah satu dampak negatif yang muncul adalah konffik lingkungan dalam bentuk pencemaran air di sungai Jodoh yang menganggu pemukiman liar di Kampung Agas, Tanjung Uma. Penelitian ini bertujuan untuk mengkaji akar masalah konflik dan resolusinya. Penelitian ini merupakan studi deskriptif-kualitatip, dengan data yang dikumpulkan melalui wawancara mendalam dengan pihak-pihak yang terlibat dalam konflik. Penelitian ini menemukan bahwa akar masalah konffik adalah konflik spasial antara permukiman liar dan pembangunan ruko yang menimbulkan limbah di sekitar permukiman liar. Tidak dibangunnya IPAL memicu protes warga di permukiman liar dan terjadilah konflik. Penelitian ini melihat bahwa penyelesaian konflik dalam bentuk kompensasi atau “sagu hati" tidak menyelesaikan akar masalah konflik. Walaupun begitu, penyelesaian ini dipandang oleh pihak-pihak yang berkonflik sebagai hasil mufakat yang dimungkinkan untuk menghindari konflik sosial yang lebih besar. Penelitian ini juga menemukan bahwa bentuk penyelesaian konflik melalui musyawarah dan mufakat dapat dilakukan secara efektif sejauh ada mediator yang dipercaya oleh pihak-pihak yang bersengketa.   ABSTRACT The development of Batam City as an area for industry, trade, ship transit, and tourism activities brings not only positive impacts, but negative impact as well. One of the negative impacts is environmental conflict in the form of water pollution in Sei Jodoh downstream which affected informal settlement in Kampung Agas, Tanjung Uma. This research aimed to study the roots of the conflict and evaluated the resolution. It adopted a descriptive, qualitative research method. Data were collected through in-depth interviews with parties involved in the conflict. The research founded that the root causes of the environmental conflict was the

  18. Derin Paşaoǧlu D. Genealogy of the Crimean Khans according to “Umdet al-Akhbar” by Abdulgaffar Kyrymi

    Directory of Open Access Journals (Sweden)

    Derya Derin Paşaoǧlu

    2017-03-01

    Full Text Available The article considers the genealogy of the Girayids contained in “Umdet al-Akhbar” by Abdulgaffar Kyrymi. Abdulgaffar Kyrymi was a great connoisseur of the Turkic-Tatar history. He wrote his historical work in 1747 according to the Ottoman-Turkish tradition, that is, the author gave detailed information about the history of the prophets since Adam, the history of Islam, Islamic Turkic states, the State of Seljuks and the Ottoman State, Chinggis Khan and his sons. Moreover, he collected most of the information from local sources of that period. But the main part of the work contains the history of Juchi Khan, his children and the history of the Crimea. It is for this reason that Abdulgaffar Kyrymi gives such a detailed genealogy of the Girayids and the sequence of their rules in the Crimean Khanate. Abdulgaffar Kyrymi’s genealogy begins with Chinggis Khan and his daughters (Kuchi Bike, Chechgan Bigim, Tumalyn Bigim, Elyatun Bigim, Turaly Bigim as well as with his 500 wives. But only five of them were respected: Borte Kuchin Biim, Kulan Bigim, Suyugan Khatun Bigim, Kökchi Bigim, Jeksulu Bigim. List of the Crimean dynasty of the Girayids is offered here to specialists, beginning with Haji Giray to Arslan Giray. Comparison of the list of the Girayid khans contained in “Umdet al-Akhbar” with researches on this topic reveals some differences. In the opinion of the author, to solve these problems, along with genealogical and other narrative sources, it is also necessary to use the numismatics data and a large corpus of letters of the Crimean khans to the rulers of various countries.

  19. AGA answers complaints on burner tip prices

    International Nuclear Information System (INIS)

    Anon.

    1992-01-01

    This paper reports that the American Gas Association has rebutted complaints that natural gas prices have dropped at the wellhead but not at the burner tip. AGA Pres. Mike Baly the an association study of the issue found that all classes of customers paid less for gas in 1991 than they did in 1984, when gas prices were at their peak. He the, the study also shows that 100% of the wellhead price decline has been passed through to natural gas consumers in the form of lower retail prices. Baly the the average cost of gas delivered to all customers classes fell by $1.12/Mcf from 1984 to 1991, which exceeds the $1.10/Mcf decline in average wellhead prices during the same period

  20. Managing Tourism in the Greater Mekong Region (GMS: A Case Study of Chiang Khan Community, Northeast Thailand

    Directory of Open Access Journals (Sweden)

    Rawee Hanpachern

    2014-05-01

    Full Text Available This study aims to examine complex ‘sustainability’ aspects of the Community-based tourism concept in tourism and destination management in the Greater Mekong Sub-region (GMS. This research is conceptualized in assessing the potential for Community-Based Tourism (CBT development in Chiang Khan, a small village by the Mekong River in the Northeast of Thailand. For collecting data, semi-interviews questions are designed. Focus-group discussion and indepth interviews are carried to include tourism stakeholders of the destination. This study argues that although a community may contain many tourism assets, it is not the only factor necessary for a ‘sustainable’ tourism to be developed in that community. Through a case study, its natural features, cultural activities, local lifestyle and the serene landscape of its location are exemplified as the important community-based tourism assets. However, a number of complex components and holistic approaches that worked well together Chiang Khan becoming a sustainable tourism destination. There elements and approaches that contribute to starting up Chiang Khan as a sustainable tourist destination include: its unique features of recreational activities and local businesses, knowledge and skills of the locals to develop tourism related businesses, and direct proper marketing strategies.

  1. Les transformations d'un mythe d'origine L'exemple de Gengis Khan et de Tamerlan

    Directory of Open Access Journals (Sweden)

    Denise Aigle

    2009-05-01

    Full Text Available La figure de Gengis Khan, grand conquérant et fondateur de dynastie, correspond étroitement à la figure du héros. Sa vie est jalonnée des signes d'un destin extraordinaire, en particulier sa naissance présentée comme miraculeuse, dont le récit a été transformé à mesure que ses descendants puis ses épigones s'éloignaient des origines mongoles chamaniques du grand ancêtre. Le récit de la naissance de Gengis Khan se rattache d'abord au mythe d'origine des Mongols qui descendraient de « Loup-bleu » et de « Biche-Fauve », récit lui-même visiblement inspiré du mythe des Turcs. Selon {'Histoire secrète des Mongols, de peu postérieure à la mort de Gengis Khan, l'ancêtre de celui-ci, Alan-Qo'a, veuve, aurait été fécondée par un être « qui sortait en rampant tel un chien jaune ». Ce rôle joué par un animal est conforme au chamanisme, qui repose sur un système d'échange entre le monde animal et celui des humains. Quelques décennies plus tard, le Jàmi' al-tawârikh de Rashïd al-dïn reprend la même légende, mais ne parle que d'un « être de couleur fauve ». Par la suite, les références animales disparaissent totalement dans un contexte musulman complètement détaché des repères chamaniques. Dans la première moitié du XVe siècle, les inscriptions relevées dans le mausolée de Tamerlan, mentionnent un rayon lumineux qui se manifeste sous la forme d'un « mortel accompli " descendant de 'Ali. Dans l'Inde moghole, enfin, Gengis Khan se trouve rapproché de Jésus puisque l'auteur de l'Akbar-nâma écrit que son ancêtre est devenue enceinte de la même manière que Maryam.

  2. Latin Sources on the Religious Situation in the Golden Horde in the Early Reign of Uzbek Khan »

    Directory of Open Access Journals (Sweden)

    R. Hautala

    2016-07-01

    Full Text Available The author of this article presents the content of selected Latin sources on the Franciscan missionary activity on the territory of the Golden Horde in the 14th century. These sources are of particular interest for the study of the history of the ulus of Jochi since they were written within the Golden Horde during the reign of khan Uzbek (1312–1341. In particular, these sources contain valuable information about religious policy of the rulers of the ulus of Jochi, which allows us to re-evaluate the process of the spread of Islam in the Golden Horde and the degree of Islamization of nomads during the reign of khan Uzbek. First, the author presents the yarlyk that khan Uzbek granted to the Minorites of Kaffa in 1314. The author points to specific conformity of its content with well-known yarlyks granted by the Golden Horde khans to the metropolitans of the Orthodox Church of Rus’. This yarlyk of Uzbek is essential for clarifying the nature of Uzbek’s religious policy in the initial period of his reign. Its information allows us to review the accuracy of the information contained in the well-known Muslim sources. Further, the author points to the importance of the information contained in a later letter by the Franciscans of Caffa, sent by them to the West in 1323. This letter mentions the substantial proselytizing successes of the Franciscans and, more importantly, indicates that Uzbek’s administration did not obstruct the Minorites’ missionary activities deployed by them among the nomads of the ulus of Jochi. At the end of the article, the author pays attention to frequent conflicts between the Catholics and Muslim residents of the Golden Horde and focuses on the information of the Latin sources, which allows us to determine the reasons for these conflicts.

  3. The Early Khans of Crimea: the Chronology of the Turmoil in the Ac-counts of the Genoese Treasury of Caffa, 1420s

    Directory of Open Access Journals (Sweden)

    A.L. Ponomarev

    2013-11-01

    Full Text Available Four account books of the Genoese colony in Caffa kept in 1420–1426 by its treasurers (massarii are still unpublished as a whole. Almost four hundreds records in these manuscripts deal with the Tartar-Genoese relations and the political situation in Crimea. Combined with the numismatic data and evidences from chronicles and state correspondence they let the author to ascertain up to weeks and days the chronology of khans’ reign. After the death of the first Crimean khan Bek Sufi in 1421 his brother Dawlat Berdi (the kinship became evident from these records struggled for power with his cousin Ulugh Muhammed, khan of the Golden Horde, for six years and climbed to the Solhat throne four times. The newly obtained information proves that neither Bek Sufi nor Dawlat Berdi, cannot be treated as the khans of the Golden Horde. They were two of the first members of the Tukatimurid dynasty which came to power in Crimea. The separatism and the might of the Crimean tribal beks were a real reason and basis for forming this independent khanate. The same beks reestablished the dynasty in 1441 having invited to the throne Haji Giray, nephew of both khans, who gave his name to the dynasty of the state, established in 1419. It was necessary to use original Latin texts to understand the history that accompaied the research.

  4. "Parim" on subjektiivne, aga kõhutundest ka ei piisa / Inga Kuusik

    Index Scriptorium Estoniae

    Kuusik, Inga, 1961-

    2007-01-01

    Ilmunud ka: Finansovõi Menedzhment : infovõpusk nr. 13 apr. lk. 6-7. Saku Õlletehase uus finantsjuht oma tööst tubakatootja Imperial Tobacco Grupi Kesk-Aasia regiooni finantsdirektorina Kõrgõzstanis, Saku Õlletehase kapitali struktuurist, finantsdirektori rollist ettevõttes ja tööjõu värbamisest Saku Õlletehases. Lisad: Saku Õlletehas 2006: mõõdukas käibe-, aga suur kasumikasv; Tabel: Saku Õlletehase dividendimaksed 1997-2007

  5. Effect of different plant spacing on the production of cauliflower (Brassica oleraceae var. Botrytis) under the agro-climatic conditions of D.I. Khan.

    Science.gov (United States)

    Mujeeb-ur-Rahman; Iqbal, Muhammad; Jilani, Muhammad Saleem; Waseem, Kashif

    2007-12-15

    A research project to evaluate the effect of different plant spacing on the production of cauliflower was conducted at Horticulture Research Area, Faculty of Agriculture, Gomal University, Dera Ismail Khan, NWFP, Pakistan. Six different plant spacing viz., 30, 35, 40, 45, 50 and 55 cm were used. The results revealed significant variations in all the parameters and amongst various plant spacing, 45 cm spacing showed the best response for all the parameters. Maximum plant height (49.33 cm), curd diameter (19.13 cm), maximum curd weight (1.23 kg plant(-1)) and yield (30.77 t ha(-1)) were recorded in the plots where the plants were spaced 45 cm apart.

  6. Musculoskeletal imaging insight 2015: Kenya

    International Nuclear Information System (INIS)

    Stevens, Kathryn J.; Mutiso, Kavulani; Sconfienza, Luca Maria; Monu, Johnny

    2016-01-01

    Over the past 6 years the International Skeletal Society (ISS) outreach programs have become popular amongst the various radiology organizations in sub-Saharan Africa. So much so that that the ISS outreach is now routinely expected to participate in many of the international radiology conferences in that part of the world. The organizational planning for an outreach visit to Kenya took place over a 3-year period. Eventually a double-headed event; the seventh and eighth sub-Saharan outreach efforts were organized in Nairobi and in Mombasa, Kenya. The Nairobi outreach was an educational course on musculoskeletal imaging at the University of Nairobi and the Aga Khan University in Nairobi from 26 to 28 May 2015. The Mombasa outreach was organized in collaboration with the African Society of Radiology (ASR) at their annual meeting in Mombasa from 30 May to 2 June 2015. (orig.)

  7. Musculoskeletal imaging insight 2015: Kenya

    Energy Technology Data Exchange (ETDEWEB)

    Stevens, Kathryn J. [Stanford University School of Medicine, Department of Radiology, Stanford, CA (United States); Mutiso, Kavulani [Aga Khan University Hospital, Department of Radiology, Nairobi (Kenya); Sconfienza, Luca Maria [University of Milan, Department of Biomedical Sciences for Health, Milan (Italy); IRCCS Istituto Ortopedico Galeazzi, Unit of Radiology, Milan (Italy); Monu, Johnny [University of Rochester Medical Center, Rochester, NY (United States)

    2016-07-15

    Over the past 6 years the International Skeletal Society (ISS) outreach programs have become popular amongst the various radiology organizations in sub-Saharan Africa. So much so that that the ISS outreach is now routinely expected to participate in many of the international radiology conferences in that part of the world. The organizational planning for an outreach visit to Kenya took place over a 3-year period. Eventually a double-headed event; the seventh and eighth sub-Saharan outreach efforts were organized in Nairobi and in Mombasa, Kenya. The Nairobi outreach was an educational course on musculoskeletal imaging at the University of Nairobi and the Aga Khan University in Nairobi from 26 to 28 May 2015. The Mombasa outreach was organized in collaboration with the African Society of Radiology (ASR) at their annual meeting in Mombasa from 30 May to 2 June 2015. (orig.)

  8. Cardiopulmonary dysfunction in the Osteogenesis imperfecta mouse model Aga2 and human patients are caused by bone-independent mechanisms.

    Science.gov (United States)

    Thiele, Frank; Cohrs, Christian M; Flor, Armando; Lisse, Thomas S; Przemeck, Gerhard K H; Horsch, Marion; Schrewe, Anja; Gailus-Durner, Valerie; Ivandic, Boris; Katus, Hugo A; Wurst, Wolfgang; Reisenberg, Catherine; Chaney, Hollis; Fuchs, Helmut; Hans, Wolfgang; Beckers, Johannes; Marini, Joan C; Hrabé de Angelis, Martin

    2012-08-15

    Osteogenesis imperfecta (OI) is an inherited connective tissue disorder with skeletal dysplasia of varying severity, predominantly caused by mutations in the collagen I genes (COL1A1/COL1A2). Extraskeletal findings such as cardiac and pulmonary complications are generally considered to be significant secondary features. Aga2, a murine model for human OI, was systemically analyzed in the German Mouse Clinic by means of in vivo and in vitro examinations of the cardiopulmonary system, to identify novel mechanisms accounting for perinatal lethality. Pulmonary and, especially, cardiac fibroblast of perinatal lethal Aga2/+ animals display a strong down-regulation of Col1a1 transcripts in vivo and in vitro, resulting in a loss of extracellular matrix integrity. In addition, dysregulated gene expression of Nppa, different types of collagen and Agt in heart and lung tissue support a bone-independent vicious cycle of heart dysfunction, including hypertrophy, loss of myocardial matrix integrity, pulmonary hypertension, pneumonia and hypoxia leading to death in Aga2. These murine findings are corroborated by a pediatric OI cohort study, displaying significant progressive decline in pulmonary function and restrictive pulmonary disease independent of scoliosis. Most participants show mild cardiac valvular regurgitation, independent of pulmonary and skeletal findings. Data obtained from human OI patients and the mouse model Aga2 provide novel evidence for primary effects of type I collagen mutations on the heart and lung. The findings will have potential benefits of anticipatory clinical exams and early intervention in OI patients.

  9. Geographical information system based model of land suitability for good yield of rice in prachuap khiri khan province, thailand

    International Nuclear Information System (INIS)

    Hussain, W.; Sohaib, O.

    2012-01-01

    Correct assessment of land is a major issue in agricultural sector to use possible capability of any land, to raise cultivation and production of rice. Geographical Information System (GIS) provides broad techniques for suitable land classifications. This study is GIS based on land suitability analysis for rice farming in Prachuap Khiri Khan Province, Thailand, where the main livelihood of people is rice farming. This analysis was conducted considering the relationship of rice production with various data layers of elevation, slope, soil pH, rainfall, fertilizer use and land use. ArcView GIS 3.2 software is used to consider each layer according to related data to weight every coefficient, ranking techniques are used. It was based on determining correlation of rice production and these variables. This analysis showed a positive correlation with these variables in varying degrees depending on the magnitude and quality of these factors. By combining both data layers of GIS and weighted linear combination, various suitable lands have been developed for cultivation of rice. Integrated suitable assessment map and current land were compared to find suitable land in Prachuap Khiri Khan Province of Thailand. As a result of this comparison, we get a land which is suitable for optimum utilization for rice production in Prachuap Khiri Khan Province. (author)

  10. Shaping Influences on the Leadership of Genghis Khan, George Washington, and Nelson Mandela: Applications for Educators

    Science.gov (United States)

    Bongila, Jean-Pierre

    2011-01-01

    Using a prosopographical methodology this study examines common leadership influences that might have existed among Genghis Khan, George Washington, and Nelson Mandela. Shoup (2005) suggests that the following seven influences have contributed to nurturing the leadership of 12 renowned individuals: involved parents, happy childhood, formal,…

  11. Incidence and review of hydatidiform mole; chorioadenoma, destruens and chorio carcinoma in Mirza Kochek Khan Hospita

    Directory of Open Access Journals (Sweden)

    Ghaffari V

    1995-04-01

    Full Text Available Initial management, incidence and review of hydatidiform mole, chorioadenoma and destruens and chorio carcinoma in Mirza Kochek khan hospital department of ob.gyn and gynecology oncology of women's hospital Tehran-Iran school of medicin from September 1985 to March 1990, 209 patients received primary management for hydatidiform mole at oncology department of Mirza Kochek Khan hospital medical school of Tehran Iran. All of these women HAD complete record available for analysis, of these, 167 women bydatidiform mole, 12 patients chorioadenoma-destruens 30 patients chorio carcinoma a survey was made of factors likely to provide an important clinical perspective patient aye and the status of pregnancy were noted. 41 patient only sharp curettage and 55 patients suction curettage to remove the hydatidiform mole. 97 patient require chemo terapy, suction curettage of the uterus is clearly the best means of management in the most cases their eyperince documents that hydatidiform mole is an high risk pregnancy that requires prompt and in tensive management.

  12. Investigating Learning Strategies for Vocabulary Development: A Comparative Study of Two Universities of Quetta, Pakistan

    Science.gov (United States)

    Fatima, Irum; Pathan, Zahid Hussain

    2016-01-01

    The primary purpose of this research is to investigate the vocabulary learning strategies employed by the undergraduate students of Sardar Bahadur Khan Women's University (SBKWU) and University of Balochistan (UOB), Quetta, Pakistan. A quantitative design was employed in this study to answer the two research questions of the present study. The…

  13. Short-Term Neonatal Outcome in Late Preterm vs. Term Infants

    International Nuclear Information System (INIS)

    Haroon, A.; Ali, S. R.; Ahmed, S.; Maheen, H.

    2014-01-01

    Objective: To determine the short-term neonatal outcomes in late preterm infants (LPIs) as compared to term infants and their association with maternal risk factors. Study Design: A case control, descriptive study. Place and Duration of Study: The Aga Khan University Hospital, Karachi, Pakistan, from January to December 2009. Methodology: The study included 326 late preterm babies (defined as those born between 34 to 37 weeks of gestation) and equal number of term control babies at the Aga Khan University Hospital, Karachi, Pakistan. Data, including obstetric history, maternal complications, neonatal morbidities, etc., was retrieved from patients medical records. The data was compared with the control group for complications, fetal morbidity and maternal morbidity. Results: Late preterm infants constituted 10.6% of all deliveries and 77% of all live preterm births during the study period. Respiratory distress syndrome (RDS) (16.5% vs. 0.3%, p < 0.001), growth retardation (24.8% vs. 4%, p < 0.001), hyperbilirubinemia requiring phototherapy (37.9% vs. 11%, p < 0.001), and sepsis (4.9% vs. 0.3%, p < 0.001) were found to be the major morbidities in the study group. The need for resuscitation was 12.7 times higher in the study group as compared to the term babies (21.4% vs. 1.2%, p < 0.001). NICU admissions in the study group were also higher (18.8% vs. 2.4%, p < 0.001). Hypertension (12.5% vs. 1.5%, p < 0.001), diabetes (12.5% vs. 9.2%, p < 0.001), antenatal history of UTI (1.5% vs. 0.3%, p < 0.001), and prolong rupture of membrane (8.9% vs. 4%, p < 0.001) were significant maternal morbidities in the late preterm group. Conclusion: The late preterm group had greater morbidity, compared to term neonates. Prior awareness of the morbidities associated with late preterm babies is helpful for the health care providers to anticipate and manage potential complications in late preterm infants. (author)

  14. Fourth-generation spinal instrumentation: experience with adolescent idiopathic scoliosis at a tertiary care hospital in Pakistan.

    Science.gov (United States)

    Fazal, Akil; Lakdawala, Riaz H

    2012-01-01

    To evaluate the radiological and functional outcome of surgical treatment of adolescent idiopathic scoliosis using fourth-generation posterior spinal instrumentation at The Aga Khan University, Karachi, Pakistan. Case series. The Aga Khan University Hospital after a minimum of 2 years postoperatively. A total of 20 patients with adolescent idiopathic scoliosis were recruited into the study and evaluated for radiological and functional outcome. The study period was from 2000 to 2005. Radiological outcome was assessed using Cobb angle measurement pre and postoperatively, hence assessing percentage correction. The lower instrumented vertebra was taken as the neutral vertebra and the level was recorded. Functional outcome was determined using the Scoliosis Research Society patient administered questionnaire. All patients were called to the clinic and asked to fill in the form. Those patients who were out of the city were mailed the forms and requested via telephone to complete and return. Of the 20 patients operated on, twelve were female and eight were male. The average age at operation was 12.7 years. The mean Cobb angle was 69° preoperatively and 20° postoperatively, representing a percentage correction of 71%. The average duration of follow-up was 3.6 years. There was one major complication involving neurological injury post-op and two minor complications involving wound infection. The average Scoliosis Research Society score (on a scale of 1-5, with 5 being best) for pain was 4.5, self-image was 4.2, functional status was 4.1, mental status was 3.8, and satisfaction was 4.4. There was no relationship between the percentage correction of scoliosis and the functional outcome. Those patients with a high preoperative Cobb angle tended to have a better outcome for functional and mental status postoperatively. There was no relation between the lower instrumented vertebra and functional outcome. In the correct indications, fourth-generation posterior instrumentation

  15. Parents’ Attitude toward Daughters’ Education in Tribal Area of Dera Ghazi Khan (Pakistan)

    OpenAIRE

    Muhammad Ayub Buzdar; Akhtar Ali

    2011-01-01

    The paper aimed to investigate the parents’ attitudes toward their daughters’ education in tribal areas of district Dera Ghazi Khan (Pakistan). To achieve the objectives four research questions were established. Focus of the questions was to examine the significance of girls’ education for tribal parents. Existing and expected role of tribal parents as well as contribution from government and community for girls’ education was also aimed to explore in research questions. Sample comprised thir...

  16. Remission of Grave's disease after oral anti-thyroid drug treatment.

    Science.gov (United States)

    Ishtiaq, Osama; Waseem, Sabiha; Haque, M Naeemul; Islam, Najmul; Jabbar, Abdul

    2009-11-01

    To evaluate remission rate of anti-thyroid drug treatment in patients with Grave's disease, and to study the factors associated with remission. A cross sectional study. The Endocrine Department of the Aga Khan University Hospital, Karachi from 1999 to 2000. Seventy four patients of Grave's disease were recruited who were prescribed medical treatment. Grave's disease was diagnosed in the presence of clinical and biochemical hyperthyroidism along with anti-microsomal (AMA) and anti-thyroglobulin antibodies (ATA) and thyroid scan. These patients were prescribed oral anti-thyroid drugs using titration regime and followed at 3, 6, 12 and 18 months. Patients were categorized into two groups: "remission group" and "treatment failure group" and results were compared using a chi-square test, t-test and logistic regression model with significance at p disease on initial presentation.

  17. 76 FR 42159 - Lifting of Sanctions on Person Associated With the A.Q. Khan Nuclear Procurement Network

    Science.gov (United States)

    2011-07-18

    ... DEPARTMENT OF STATE [Public Notice: 7525] Lifting of Sanctions on Person Associated With the A.Q. Khan Nuclear Procurement Network AGENCY: Bureau of International Security and Nonproliferation... the Foreign Relations Authorization Act for Fiscal Years 1994-1995 (22 U.S.C. 6301), the Export-Import...

  18. A novel base change leading to Hb Vanderbilt [β89(F5)Ser→Arg, AGT>AGA].

    Science.gov (United States)

    Goodyer, Matthew J; Elhassadi, Ezzat I; Percy, Melanie J; McMullin, Mary F

    2011-01-01

    We describe a high oxygen affinity hemoglobin (Hb) variant (Hb Vanderbilt) as a result of a heterozygous novel base change from T to A at codon 89 (AGT>AGA) leading to an amino acid change from serine to arginine.

  19. The Christian Nobles at the Court of Great Khan, as Described in Mediaeval European Sources

    Czech Academy of Sciences Publication Activity Database

    Liščák, Vladimír

    2017-01-01

    Roč. 5, č. 2 (2017), s. 276-289 ISSN 2308-152X Institutional support: RVO:68378009 Keywords : religion in mediaeval China * Yuan Dynasty China * Christianity in the Great Khan court * Franciscan missions * Christian Alan nobility * Western mediaeval sources Subject RIV: AB - History OBOR OECD: History (history of science and technology to be 6.3, history of specific sciences to be under the respective headings)

  20. The German Working Group of Obesity in Childhood and Adolescence (AGA): improving the quality of care for overweight and obese children in Germany.

    Science.gov (United States)

    Reinehr, Thomas; Holl, Reinhard W; Wabitsch, Martin

    2008-01-01

    The Working Group of Obesity in Childhood and Adolescence (AGA) comprises scientists, clinicians, and therapists dealing with obesity in children and adolescents. More than 250 pediatricians, psychiatrics, dieticians, psychologists and sports therapists are integrated. On an international level, the AGA cooperates with the European Childhood Obesity Group and the International Obesity Taskforce (IOTF) for Childhood Obesity. The aims of the AGA are to initiate clinical and scientific studies, to join diagnostic, therapeutic and scientific centers, to improve the education, to support self-help groups, and to standardize diagnostic and therapeutic procedures in the field of obesity in childhood and adolescence. The milestones in the history of the AGA are the consensus process to define overweight and obesity in Germany, the development of guidelines for diagnostic procedures and treatment of obesity in childhood and adolescence, the determination of all therapy centers for obese children and adolescents in Germany, the development of a PC software (APV) to document longitudinally diagnostic and therapeutic procedures as well as outcomes by a quality management program, the certification of therapeutic institutions, and the implementation of prevention and treatment studies. As effect of these initiatives, the quality of care in overweight children has been improved in the last years. For example, the APV quality program demonstrated an increase of diagnostic procedures such as blood pressure measurement in the last 4 years. Copyright 2008 S. Karger AG, Basel.

  1. Intimate partner violence in urban Pakistan: prevalence, frequency, and risk factors

    Directory of Open Access Journals (Sweden)

    Tazeen S Ali

    2011-03-01

    Full Text Available Tazeen S Ali1,2, Nargis Asad3, Ingrid Mogren4, Gunilla Krantz51School of Nursing, Aga Khan University, Karachi, Pakistan; 2Department of Public Health Sciences, Division of Global Health, Karolinska Institutet, Stockholm, Sweden; 3Department of Psychiatry, Aga Khan University, Karachi, Pakistan; 4Department of Clinical Science, Obstetrics and Gynecology, Umeå University, Umeå, Sweden; 5Department of Public Health and Community Medicine/Social Medicine, The Sahlgrenska Academy at University of Gothenburg, Göteborg, SwedenBackground: Intimate partner violence (IPV is an important public health issue with severe adverse consequences. Population-based data on IPV from Muslim societies are scarce, and Pakistan is no exception. This study was conducted among women residing in urban Karachi, to estimate the prevalence and frequency of different forms of IPV and their associations with sociodemographic factors.Methods: This cross-sectional community-based study was conducted using a structured questionnaire developed by the World Health Organisation for research on violence. Community midwives conducted face-to-face interviews with 759 married women aged 25–60 years.Results: Self-reported past-year and lifetime prevalence of physical violence was 56.3 and 57.6%, respectively; the corresponding figures for sexual violence were 53.4% and 54.5%, and for psychological abuse were 81.8% and 83.6%. Violent incidents were mostly reported to have occurred on more than three occasions during the lifetime. Risk factors for physical violence related mainly to the husband, his low educational attainment, unskilled worker status, and five or more family members living in one household. For sexual violence, the risk factors were the respondent’s low educational attainment, low socioeconomic status of the family, and five or more family members in one household. For psychological violence, the risk factors were the husband being an unskilled worker and low

  2. The Mongols: Early Practitioners of Maneuver Warfare

    Science.gov (United States)

    2012-05-17

    Robert Marshall , Storm From the East: from Genghis Khan to Khubilai Khan (Berkeley: University of California Press, 1993); Douglas Benson, Mongol...craftsman, merchants, Chinese artisans, leather workers, goldsmiths and silversmiths. In the fields beyond the city walls aubergines and melons... Marshall , Storm from the East: from Genghis Khan to Khubilai Khan (Berkeley: University of California Press, 1993), 49. 42 All troops strengths are

  3. Investigating the Use of the Khan Academy and Mathematics Software with a Flipped Classroom Approach in Mathematics Teaching

    Science.gov (United States)

    Zengin, Yilmaz

    2017-01-01

    The purpose of this study was to determine the effect of the flipped classroom approach designed by using Khan Academy and free open source software on students' academic achievement and to examine students' views about this approach. The research was evaluated in the light of both qualitative and quantitative data. Twenty-eight students studying…

  4. Microbial contamination of the drinking water distribution system and its impact on human health in Khan Yunis Governorate, Gaza Strip: seven years of monitoring (2000-2006).

    Science.gov (United States)

    Abu Amr, S S; Yassin, M M

    2008-11-01

    To assess total and faecal coliform contamination in water wells and distribution networks over the past 7 years, and their association with human health in Khan Yunis Governorate, Gaza Strip. Historical data and interview questionnaire. Data were obtained from the Palestinian Ministry of Health on total and faecal coliform contamination in water wells and distribution networks, and on the incidence of water-related diseases in Khan Yunis Governorate. An interview questionnaire was conducted with 210 residents of Khan Yunis Governorate. Total and faecal coliform contamination exceeded the World Health Organization's limit for water wells and networks. However, the contamination percentages were higher in networks than in wells. Diarrhoeal diseases were strongly correlated with faecal coliform contamination in water networks (r=0.98). This is consistent with the finding that diarrhoeal diseases were the most common self-reported diseases among the interviewees. Such diseases were more prevalent among subjects who drank municipal water than subjects who drank desalinated or home-filtered water (odds ratio=2.03). Intermittent water supply, insufficient chlorination and sewage flooding seem to be associated with self-reported diseases. Residents in the Gaza Strip have a good level of knowledge about drinking water contamination, and this is reflected in good practice. Water quality has deteriorated in the Gaza Strip, and this may contribute to the prevalence of water-related diseases. Self-reported diseases among interviewees in Khan Yunis Governorate were associated with source of drinking water, intermittent water supply, insufficient chlorination, sewage flooding and age of water networks.

  5. Perception and knowledge about dietary intake in patients with liver cirrhosis and its relationship with the level of education

    International Nuclear Information System (INIS)

    Khan, R.; Ahmed, A.; Ismail, F.W.; Abid, S.; Awan, S.

    2012-01-01

    Objective: To determine patients perception and knowledge regarding diet in cirrhosis and its relationship with the level of patients education. Study Design: Cross-sectional observational study. Place and Duration of Study: This study was conducted at Gastroenterology Outpatient Clinics at the Aga Khan University Hospital, Karachi, the Aga Khan Health Services, Malir, Karachi and Hamdard University, Karachi, from January to December 2010. Methodology: Consecutive adult patients with compensated cirrhosis were enrolled. Demographic data, level of education, type and reason of food restriction as well as the source of dietary information was asked. Baseline laboratory test were performed, and nutritional status was assessed by BMI normogram. Results: Ninety patients, 58% male were enrolled. Mean age of the patient was 49 +- 11 years. Overall 73% of the patients were restricting fat, meat, fish and eggs in their diet; 53% were in uneducated group and 47% were in educated group (CI, 0.24-1.62, p-0.34). Twenty two patients (62.8%) in uneducated and 21 in educated group (68%) were restricting diet on the advice of their doctors, whereas 13 in uneducated group (37%) and 11 in educated group (32%) believed these dietary components to be harmful for the liver. Thirty two of uneducated patient (71.1%) and 28 of educated patients (62.2%) believed that vegetables, fruits and sugarcane had a beneficial effect on the liver. Main source of dietary information to the patients was the doctor. On sub-group analysis those who restricted diet irrespective of their educational level, had more patients with BMI less than 18.5 kg/m/sup 2/, (CI 0.01-0.94, p-0.001), haemoglobin less than 12 g/dl (CI 0- 0.03, p-0.001) and serum albumin less than 3 g/dl (CI 0.1- 03, p-0.001). Conclusion: Both educated and uneducated classes of the patients have improper knowledge and perception of diet in cirrhosis. Patients with cirrhosis who restricted diet, had relatively low BMI, haemoglobin and albumin

  6. Patellar resurfacing versus nonresurfacing in total knee arthroplasty for osteoarthritis: experience at a tertiary care institution in Pakistan

    Directory of Open Access Journals (Sweden)

    Lakdawala RH

    2012-02-01

    Full Text Available Akil Fazal1, Riaz H Lakdawala21Clinical Fellow, NYU Hospital for Joint Disease, New York, US; 2Associate Professor and Chief, Section of Orthopedics, Department of Surgery, The Aga Khan University Hospital, Karachi, PakistanObjective: To determine the effect of patellar resurfacing in patients offered total knee arthroplasty for osteoarthritis.Design: Randomized control study.Place and duration of study: The Aga Khan University Hospital, Karachi, Pakistan from January 3, 2005 to January 9, 2010.Patients and methods: Patients undergoing primary total knee arthroplasty for osteoarthritis were assigned to either the patellar resurfacing or nonresurfacing arm using systematic sampling. This consisted of patients undergoing unilateral and bilateral knee arthroplasty. Preoperatively, Knee Society Knee and Function Scores were calculated. After a minimum of 3 years postoperatively Knee Society Knee and Function Scores as well as the Clinical Anterior Knee Pain Rating were calculated and analysis done to check for differences.Results: Seventy-five patients were recruited in each arm; 135 patients had bilateral and 15 had unilateral knee arthroplasty. The mean preoperative knee score was 40.4 for the resurfacing group and 40.60 for the nonresurfacing group (P = 0.45. This improved postoperatively to 93.67 and 94.23 respectively, with no difference between the two groups (P = 0.67. The mean preoperative function score was 45.50 for resurfaced patellae and 45.83 for nonresurfaced. This improved to 89.67 and 90.50, respectively, again with no difference (P = 0.51. Postoperative Clinical Anterior Knee Pain Rating was a mean of 0.1 for resurfaced and 0.13 for nonresurfaced patellas, with no difference on analysis (P = 0.06. However, patients who had bilateral knee arthroplasty had a slightly higher Clinical Anterior Knee Pain Rating than those who had single knee surgery (P = 0.046 irrespective of whether the patellar was resurfaced or not.Conclusion: In

  7. Research on efficiency test of a turbine in Khan Khwar hydropower station

    International Nuclear Information System (INIS)

    Zhang, H K; Liang, Z; Deng, M G; Liu, X B; Wang, H Y; Liu, D M

    2012-01-01

    The efficiency test is an important indicator to evaluate the energy conversion performance of a hydraulic turbine. For hydropower stations which do not have the direct flow measurement conditions, whether the characteristic curve of a turbine obtained through similarity theory conversion by using the comprehensive characteristic curve of the turbine can correctly reflect the operating performance of the prototype unit is a key issue in this industry. By taking the No.1 unit of Khan Khwar hydropower station as the example, the efficiency test of this turbine was studied on the site, including the measurement method of test parameters, the configuration of the computer test system, as well as the processing and analysis of test data.

  8. VIDEO PRIKAZ VIZUALIZACIJE DOŽIVLJAJA ENGLESKE PJESME KUBLA KHAN UZ POMOĆ ALATA ZA OBRADU MULTIMEDIJE

    OpenAIRE

    Stojaković, Biljana; Popović, Mihaela

    2017-01-01

    U radu je prikazan način na koji je uz pomoć alata multimedije postignuta vizualizacija doživljaja poznate engleske pjesme Kubla Khan, osebujnog autora Samuela Taylora Coleridgea. Izrađen je video kojim se dočarao subjektivni doživljaj pjesme, predstavljeni su opisani dijelove pjesme i usklađeni ritam kitica, slika i animacije. Korišteni su programi Adobe Photoshop, Adobe Flash i Adobe Illustrator.. Video je doprinos aplikaciji LEO (Learning English Online) koju stu...

  9. Enzymatic liquefaction of agarose above the sol-gel transition temperature using a thermostable endo-type β-agarase, Aga16B.

    Science.gov (United States)

    Kim, Jung Hyun; Yun, Eun Ju; Seo, Nari; Yu, Sora; Kim, Dong Hyun; Cho, Kyung Mun; An, Hyun Joo; Kim, Jae-Han; Choi, In-Geol; Kim, Kyoung Heon

    2017-02-01

    The main carbohydrate of red macroalgae is agarose, a heterogeneous polysaccharide composed of D-galactose and 3,6-anhydro-L-galactose. When saccharifying agarose by enzymes, the unique physical properties of agarose, namely the sol-gel transition and the near-insolubility of agarose in water, limit the accessibility of agarose to the enzymes. Due to the lower accessibility of agarose to enzymes in the gel state than to the sol state, it is important to prevent the sol-gel transition by performing the enzymatic liquefaction of agarose at a temperature higher than the sol-gel transition temperature of agarose. In this study, a thermostable endo-type β-agarase, Aga16B, originating from Saccharophagus degradans 2-40 T , was characterized and introduced in the liquefaction process. Aga16B was thermostable up to 50 °C and depolymerized agarose mainly into neoagarooligosaccharides with degrees of polymerization 4 and 6. Aga16B was applied to enzymatic liquefaction of agarose at 45 °C, which was above the sol-gel transition temperature of 1 % (w/v) agarose (∼35 °C) when cooling agarose. This is the first systematic demonstration of enzymatic liquefaction of agarose, enabled by determining the sol-gel temperature of agarose under specific conditions and by characterizing the thermostability of an endo-type β-agarase.

  10. Evaluation of lipid and glucose metabolism and cortisol and thyroid hormone levels in obese appropriate for gestational age (AGA) born and non-obese small for gestational age (SGA) born prepubertal Slovak children.

    Science.gov (United States)

    Blusková, Zuzana; Koštálová, Ludmila; Celec, Peter; Vitáriušová, Eva; Pribilincová, Zuzana; Maršálková, Marianna; Šemberová, Jana; Kyselová, Tatiana; Hlavatá, Anna; Kovács, László

    2014-07-01

    Obesity is the major determinant of metabolic syndrome. Being born small for gestational age (SGA) may be co-responsible. We aimed at evaluating the association between 1. obesity and 2. being born SGA and the presence of endocrine-metabolic abnormalities in prepubertal Slovak children. The study included 98 children, aged 3-10.9 years: 36 AGA-born obese children (OB), 31 SGA-born children (SGA) and 31 appropriate for gestational age born non-obese children (AGA). Fasting serum levels of glucose, total cholesterol, LDL, HDL, triglycerides, fT4, TSH, cortisol and insulin were determined. HOMA-IR was calculated. Personal data about birth weight and length and family history were collected. Actual anthropometric measurement was done. In every group, high prevalence of positive family history of metabolic disorder was found. In comparison with AGA children, OB children were taller (plevels and homeostasis model assessment for insulin resistance (HOMA-IR) (pcortisol levels (p=0.069) was noted. SGA-born children were shorter (plevels (plevels (p=0.085) and increased fT4 levels (pobese children and twice more metabolic abnormalities were present in SGA-born children in comparison with AGA-born children. SGA-born children are more prone to developing endocrine-metabolic abnormalities than non-obese children born AGA, but they are at less risk than obese AGA-born children. We should provide specialized care for obese children already in prepubertal age and pay attention to SGA-born children.

  11. Rotational Mal-Alignment after Reamed Intramedullary Nailing for tibial shaft fracture.

    Science.gov (United States)

    Khan, Sher Baz; Mohib, Yasir; Rashid, Rizwan Haroon; Rashid, Haroonur

    2016-10-01

    Intra-medullary (IM) nailing is standard of care for unstable tibial shaft fractures. Malrotation is very common but it is under-recognised, inpart because of variation in normal anatomy and partly due to difficulty in accurately assessing rotation. This study was planned to evaluate the frequency of rotational mal-alignment after reamed tibia IMnailing. This cross-sectional study was conducted at Aga khan University Hospital, Karachi, and comprised patients with tibia shaft fractures managed with IMnailing from January to December 2014. All the patients were assessed intra-operatively for rotational alignment using the knee and ankle fluoroscopic images. There were 81 patients with a mean age of 38±16.9 years. There were 64(79%) male patients. Overall the incidence of malrotation was in 20(24.7%) cases. Rotational mal-alignment is one of the preventable complications after IMnailing which can be assesed intra-operatively under fluoroscope.

  12. Content Validity of a Tool Measuring Medication Errors.

    Science.gov (United States)

    Tabassum, Nishat; Allana, Saleema; Saeed, Tanveer; Dias, Jacqueline Maria

    2015-08-01

    The objective of this study was to determine content and face validity of a tool measuring medication errors among nursing students in baccalaureate nursing education. Data was collected from the Aga Khan University School of Nursing and Midwifery (AKUSoNaM), Karachi, from March to August 2014. The tool was developed utilizing literature and the expertise of the team members, expert in different areas. The developed tool was then sent to five experts from all over Karachi for ensuring the content validity of the tool, which was measured on relevance and clarity of the questions. The Scale Content Validity Index (S-CVI) for clarity and relevance of the questions was found to be 0.94 and 0.98, respectively. The tool measuring medication errors has an excellent content validity. This tool should be used for future studies on medication errors, with different study populations such as medical students, doctors, and nurses.

  13. Neoplasia yield and colonoscopic workload of surveillance regimes for colorectal cancer in colitis patients: a retrospective study comparing the performance of the updated AGA and BSG guidelines.

    Science.gov (United States)

    Mooiweer, Erik; van der Meulen, Andrea E; van Bodegraven, Adriaan A; Jansen, Jeroen M; Mahmmod, Nofel; Nijsten, Joyce; van Oijen, Martijn G H; Siersema, Peter D; Oldenburg, Bas

    2013-11-01

    Due to the increased risk of colorectal cancer, colonoscopic surveillance is recommended for patients with ulcerative and Crohn's colitis. Because surveillance intervals differ considerably between the recently updated American Gastroenterological Association (AGA) and British Society of Gastroenterology (BSG) guidelines, we compared the neoplasia yield and colonoscopic workload of these guidelines. Patients with inflammatory bowel disease undergoing surveillance were identified using medical records. Patients were stratified according to the BSG and AGA guidelines, and corresponding colonoscopic workload was calculated based on the risk factors present during follow-up. The incidence of colitis-associated neoplasia (CAN), defined as a low-grade dysplasia in flat mucosa or a non-adenoma-like mass, high-grade dysplasia, or colorectal cancer was compared between the risk groups of either guidelines. In total, 1018 patients with inflammatory bowel disease who underwent surveillance were identified. Using the AGA surveillance intervals, 64 patients (6%) were assigned to annual and 954 patients (94%) to biannual surveillance, resulting in 541 colonoscopies per year. The yield of CAN was 5.3% and 20.3% in the low- and high-risk groups, respectively (P = 0.02). Using the BSG surveillance intervals, 204 patients received surveillance annually (20%), 393 patients every 3 years (39%), and 421 patients every 5 years (41%), resulting in 420 colonoscopies per year, which is 22% lower than the AGA guidelines. The yield of CAN was 3.6%, 6.9%, and 10.8%, for the low-, intermediate-, and high-risk groups, respectively (P = 0.26). Although the BSG surveillance intervals offer the advantage of a lower colonoscopic workload, the risk stratification of the AGA seems superior in distinguishing patients at higher risk of CAN.

  14. An Assessment of the AGA and CCFA Quality Indicators in a Sample of Patients Diagnosed with Inflammatory Bowel Disease.

    Science.gov (United States)

    Tkacz, Joseph; Brady, Brenna L; Meyer, Roxanne; Lofland, Jennifer H; Ruetsch, Charles; Coelho-Prabhu, Nayantara

    2015-11-01

    Inflammatory bowel disease (IBD) is a chronic relapsing disease characterized by activation of the mucosal immune system and inflammation of the gastrointestinal tract. Management of IBD places a significant burden on the health care system because of the complexity of treatment, variability in patient outcomes, and chronic nature of the disease.  To investigate the American Gastroenterological Association (AGA) and Crohn's and Colitis Foundation of America's (CCFA) quality measurement sets in a sample of IBD patients. Fourteen quality measures were restated for application to a claims database and calculated using Optum Clinformatics DataMart database. Selected measures were calculated over calendar year 2011. Performance measures ranged from 0.4% for AGA measure 9, prophylaxis for venous thromboembolism, to 66.9% for AGA measure 8, testing for Clostridium difficile. CCFA outcome measures ranged from 0.6% qualifying for CCFA O10, report of fecal incontinence, to 32.9% for CCFA O1, prednisone usage. In addition to Clostridium difficile testing, the use of appropriate corticosteroid-sparing therapy (51.1%) and testing for latent tuberculosis before initiating anti-tumor necrosis factor therapy (45.0%) were the highest achieved measures. This is the first examination of IBD quality measures using administrative claims. Rates of achievement across measures were variable and likely affected by the ability to calculate certain measures with claims data. Future studies should further examine measurement of IBD quality indicators in claims data to assess the validity of claims-based analyses and to ascertain whether measure attainment translates into better overall health or IBD-related outcomes.

  15. Water-right and water-allocation procedures of farmers' managed perennial spate irrigation systems of mithawan watershed, D.G. Khan, Pakistan

    International Nuclear Information System (INIS)

    Ahmad, M.; Ahmad, S.

    2007-01-01

    A study was conducted on water rights, water allocation and local institutions prevailing in the perennial spate irrigation systems of Mithawan watershed o D.G. Khan District of Punjab. The Study Area was selected is the Mthawan watershed on the D.G. Khan-Quetta Road almost 70 kms from D.G. Khan and 10 km away from the road, representing real-life operating systems. Small-scale isolated and large-scale contiguous perennial spate irrigation systems were selected for study. A three-prong methodology was designed covering (a) interactive dialogue of the focus groups to document the community-perceptions regarding systems water-rights, water allocation and local institution prevailing in the area; (b) structured interviews to document systematic data regarding some of the study-aspects; and (c) diagnostic surveys to document some of the measured data regarding scheme performance. Water rights and allocation procedures both in small-scale isolated and large-scale Contiguous perennial spate irrigation-system are very clearly defined and do not change with time and space. Local institutions like Biradri and Muchi take care of just allocation of water. An irrigator is deputed who takes care of allocated time among various tribes. At the same time, the community is bringing more area under irrigation. Obviously it has increased water-requirements and in turn management of irrigation system. Previously they were reconstructing the diversion structure only. Present expansion in irrigated area has increased the necessity of maintaining the water-conveyance network more frequently, particularly at critical sections. However, the realization regarding water-losses still needs to be promoted. The linkages of resource-management with water-productivity are going to be the future area of consideration in theses systems, due to expansion of the system largely because of increased population and urge to increase their livelihood. (author)

  16. Unusual Presentation of Dengue Fever; A child with acute myocarditis

    Directory of Open Access Journals (Sweden)

    Moaz Aslam

    2016-02-01

    Full Text Available Dengue fever (DF is an acute febrile illness that follows a self-limiting course. However, some patients suffer from complications, including myocarditis, due to the involvement of other organs. A child presented at the Aga Khan University Hospital in Karachi, Pakistan, in June 2013 with a high-grade fever, malaise and epigastric pain radiating to the chest. Positive DF antigen and immunoglobulin M assays confirmed the diagnosis of DF. Persistent bradycardia with low blood pressure led to further cardiac investigations which showed a decreased ejection fraction and raised serum cardiac enzymes, indicating myocardial damage. With supportive care and use of inotropes, the spontaneous normalisation of cardiac enzyme levels and ejection fraction was observed. The child was discharged five days after admission. This case highlights the importance of identifying myocarditis in DF patients suffering from cardiac symptoms that are not explained by other potential aetiologies. Awareness, early suspicion and supportive care are essential to ensure favourable outcomes.

  17. Use of folk remedies among patients in Karachi Pakistan.

    Science.gov (United States)

    Qidwai, Waris; Alim, Salman Raza; Dhanani, Raheem H; Jehangir, Sana; Nasrullah, Aysha; Raza, Ammara

    2003-01-01

    The concept that food is medicine is being practiced in certain parts of the world, with positive outcomes on health of the population. We have such practice in Pakistan but it needs to be brought in line with the available scientific evidence. The study was conducted on 270 patients, visiting the Family Practice Center, the Aga Khan University, Karachi. A questionnaire was used to collect information on the demographic profile, and the use of folk remedies for medicinal uses. Substantial use of folk remedies for different medical conditions has been documented. The remedies included cinnamon, ginger, cloves, cordimon, sesame oil, poppy seeds, honey, lemon, table salt, eggs and curd. The medical conditions in which folk remedies are used in respondents' view, include conditions such as common cold, cough and flu to more serious conditions such as asthma, jaundice and heat stroke. We have found a substantial use of folk remedies for treatment of medical conditions. There is a need to organize their use on scientific lines.

  18. Omitting histopathology in wrist ganglions. A risky proposition

    Science.gov (United States)

    Zubairi, Akbar J.; Kumar, Santosh; Mohib, Yasir; Rashid, Rizwan H.; Noordin, Shahryar

    2016-01-01

    Objectives: To identify incidence and utility of histopathology in wrist ganglions. Methods: A retrospective study of 112 patients operated for wrist swellings between January 2009 and March 2014 at Aga Khan University Hospital, Karachi, Pakistan, was conducted. Medical records were reviewed for demographics, history, location and associated symptoms, provisional diagnosis and operative details. Histopathology reports were reviewed to confirm the final diagnosis. Results: One hundred and twelve patients were included in the study (34 males and 78 females) with a mean age of 28 ± 12 years. Ninety-five percent of ganglia were dorsally located and 85% were solitary in nature. Histopathology reports confirmed 107 as ganglion cysts, whereas 3 had giant cell tumor of tendon sheath and 2 were reported to be tuberculous tenosynovitis. Conclusion: Although most of the time, the clinical diagnosis conforms to the final diagnosis, the possibility of an alternate diagnosis cannot be ignored (4% in this study). We suggest routine histopathological analysis so that such diagnoses are not missed. PMID:27464871

  19. Frequency of color blindness in pre-employment screening in a tertiary health care center in Pakistan.

    Science.gov (United States)

    Chhipa, Shaukat Ali; Hashmi, Farzeen K; Ali, Shehreen; Kamal, Mustafa; Ahmad, Khabir

    2017-01-01

    To describe the frequency of color vision deficiency among Pakistani adults presenting for pre-employment health screening in a tertiary care hospital. The cross-sectional study was carried out at the Aga Khan University Hospital, Karachi, and the data was collected for color vision deficiency, age, gender, and job applied for from pre-employment examination during 2013-2014. IBM SPSS 20 was used for statistical analysis. Three thousand four hundred and thirty seven persons underwent pre-employment screening during 2013 and 2014; 1837 (53.44%) were males and 1600 (46.65%) females. The mean age was 29.01 (±6.53) years. A total of 0.9% (32/3437) persons had color vision deficiency with male being 1.4% and female 0.4%. Color vision deficiency was observed in 0.9% of candidates screened for pre-employment health check up in a tertiary care hospital. The color vision deficiency was predominantly present in male individuals.

  20. RADIOLOGY EDUCATION: A PILOT STUDY TO ASSESS KNOWLEDGE OF MEDICAL STUDENTS REGARDING IMAGING IN TRAUMA.

    Science.gov (United States)

    Siddiqui, Saad; Saeed, Muhammad Anwar; Shah, Noreen; Nadeem, Naila

    2015-01-01

    Trauma remains one of the most frequent presentations in emergency departments. Imaging has established role in setting of acute trauma with ability to identify potentially fatal conditions. Adequate knowledge of health professionals regarding trauma imaging is vital for improved healthcare. In this work we try to assess knowledge of medical students regarding imaging in trauma as well as identify most effective way of imparting radiology education. This cross-sectional pilot study was conducted at Aga Khan University Medical College & Khyber Girls Medical College, to assess knowledge of medical students regarding imaging protocols practiced in initial management of trauma patients. Only 40 & 20% respectively were able to identify radiographs included in trauma series. Very few had knowledge of correct indication for Focused abdominal sonography in trauma. Clinical radiology rotation was reported as best way of learning radiology. Change in curricula & restructuring of clinical radiology rotation structure is needed to improve knowledge regarding Trauma imaging.

  1. Frequency of thyroid peroxidase antibody and its association with miscarriages among pregnant women

    International Nuclear Information System (INIS)

    Iqbal, S.; Ghani, F.

    2016-01-01

    To measure the frequency of thyroid peroxidase antibody (TPO Ab) among clinically euthyroid pregnant women during first trimester and determine its association with pregnancy outcome as miscarriage or live birth by estimating the relative risk. Study Design: Cohort study. Place and Duration of Study: Section of Chemical Pathology, Department of Pathology and Laboratory Medicine and the Gynaecology and Obstetric outpatient clinics of the Aga Khan University Hospital, Karachi, from July to December 2012. Methodology: The study subjects comprised of apparently euthyroid pregnant women, who were tested for TPO Ab during first trimester of pregnancy and followed till pregnancy outcomes. Pregnancy outcome was noted and relative risk was determined. Results: TPO Ab was found positive in 127 (13.5%) pregnant women from a cohort of 943 subjects. A 2.03% increased risk of miscarriages was observed in TPO Ab positive subjects. Conclusion: There was a positive association of presence of presence of TPO Ab with loss pregnancy. (author)

  2. Feminist pedagogy: a framework for nursing education?

    Science.gov (United States)

    Hezekiah, J

    1993-02-01

    This article describes the feminist pedagogical strategies used in a nursing course in the post-RN Bachelor of Science in Nursing (BScN) program, Aga Khan University, Karachi, Pakistan. A variety of concepts that have direct relevance for nurses were discussed within small groups. These settings provided the venue for an examination of the issues that nurses, as primarily female, face in a patriarchal Muslim society and an androcentric health care system. Emphasis is on the process used in terms of feminist pedagogical practices and its relationship to feminist theory and critical pedagogy. The five process goals suggested by Schniedewind (1983) formed the basis for an exploration of this relationship through an analysis of the content and practices used in the course. It is demonstrated that the teaching practices advocated by feminist pedagogy hold much promise for nursing education to empower nurses and to make an impact on the health care system.

  3. Crowdsourcing the unknown: the satellite search for Genghis Khan.

    Directory of Open Access Journals (Sweden)

    A Y M Lin

    Full Text Available Massively parallel collaboration and emergent knowledge generation is described through a large scale survey for archaeological anomalies within ultra-high resolution earth-sensing satellite imagery. Over 10K online volunteers contributed 30K hours (3.4 years, examined 6,000 km², and generated 2.3 million feature categorizations. Motivated by the search for Genghis Khan's tomb, participants were tasked with finding an archaeological enigma that lacks any historical description of its potential visual appearance. Without a pre-existing reference for validation we turn towards consensus, defined by kernel density estimation, to pool human perception for "out of the ordinary" features across a vast landscape. This consensus served as the training mechanism within a self-evolving feedback loop between a participant and the crowd, essential driving a collective reasoning engine for anomaly detection. The resulting map led a National Geographic expedition to confirm 55 archaeological sites across a vast landscape. A increased ground-truthed accuracy was observed in those participants exposed to the peer feedback loop over those whom worked in isolation, suggesting collective reasoning can emerge within networked groups to outperform the aggregate independent ability of individuals to define the unknown.

  4. Cartographic Anxieties in Mongolia: The Bogd Khan's Picture-Map

    Directory of Open Access Journals (Sweden)

    Uranchimeg Tsultemin,

    2016-12-01

    Full Text Available This article extends cartography into ethnographic and representational practices for territorial inclusion (Hostetler 2005 and nation building (Krishna 1994. Outer Mongolia, a vassal state of the Qing Empire until 1911, produced ethnographic paintings intended as new cartographic visuals around the time of its independence. Mongolia’s last ruler, the Bogd Khan (1870–1924 commissioned the artist Balduugin Sharav to produce a large painting of the Mongol countryside titled Daily Events, a work that constitutes an unusual cartographic “picture-map” (Paul Harvey 1980 intended for a special public display. The work (now known as One Day in Mongolia depicts the Mongolian people as a distinct ethnic group in quotidian scenes of Central Mongolian (Khalkha nomadic life. This article demonstrates how the covert connections between the scenes together construct a Buddhist didactic narrative of the Wheel of Life, and argues that this picture-map was the result of the Tibetan-born ruler’s anxieties over ethnic identity, national unity, and the survival of his people, who strove for independence from the Qing, as well as their safe positioning vis-à-vis new political neighbors.

  5. Attitudes towards child restrains and seat belts usage in the learned population of Karachi, Pakistan.

    Science.gov (United States)

    Siddiqui, Emaduddin; Ejaz, Kiran; Waheed, Shahan; Kazi, Ghazala Irfan; Khursheed, Munawar

    2014-01-01

    Motor vehicles crashes (MVCs) are the leading cause of injury related morbidity and mortality in developed countries. Recent evidence proves that properly used child seat belts can dramatically reduce the risk of severe and life-threatening injury from MVCs. There are rarities of thought and inspiration regarding the use of child seat belts in our society and region, therefore we lack of data regarding factors and paucity of usage of child seat belts in motor vehicles. This study aimed to assess the knowledge and attitudes of child seat belt usage among the educated population in Karachi, Pakistan. Altogether 304 employees were investigated. They were employees of Aga Khan University who were using their cars and having children younger than 10 years old. A cross sectional observational study was designed, and a 36-item questionnaire in English was used to collect data on participants' demographic details, designation, educational level, economic status, validity of driving license, number of children and cars, availability of adult seat belts and child seat belts along with their functionality, awareness, knowledge and attitude toward its use, and reason of not using these devices. SPSS version 20 for Windows was used to analyze the data and the Chi-square test was used. Totally 290 participants were recruited with a response rate of 72% (212). Of 212 participants, 126 (59%) were male. 154 (72.6%) participants had valid driver licenses, and 154 (72.6%) had adult seat belts in their vehicles. Only 32 (15%) reported regular use of adult seat belts. Although 168 (79.2%) participants had some knowledge about child restrains (CRs), only 65 (22%) had CRs in their cars. Eighty-two (38.7%) participants got the knowledge about CRs and seat belts from media. Mothers were more concerned about the use of CRs than fathers. Only 14 (6.6%) parents were found to use both adult and child seat belts all the time. Of the 157 parents who did not us use CRs, 42 considered unnecessary

  6. Does gender affect career satisfaction and advancement in gastroenterology? Results of an AGA institute-sponsored survey.

    Science.gov (United States)

    Gerson, Lauren B; Twomey, Kay; Hecht, Gail; Lee, Linda; McQuaid, Ken; Pizarro, Theresa T; Street, Sarah; Yoshida, Cynthia; Early, Dayna

    2007-04-01

    Women comprise 19% of the American Gastroenterological Association (AGA) membership. We performed a prospective study to determine whether female gastroenterologists were less likely to achieve career advancement and satisfaction. We administered an online survey to AGA members from 2004-2006. The survey contained questions regarding effects of gender on career advancement, satisfaction with career, promotional policies, and integration of family and career. A total of 457 individuals (response rate 9% after 2 major invitations) completed the survey, including 262 (57%) women (20% in private practice, 53% in academic careers, and 27% trainees) and 195 men (23% in private practice, 58% in academic careers, and 19% trainees). The male gastroenterologists were significantly older (P careers for significantly more years (P = .002). There were no significant differences with respect to marital status, number of children, or number of hours worked between the genders. Men were more likely to achieve the rank of full professor (P = .035), and significantly more women reported that gender affected their career advancement (47% vs 9%; P careers reported less satisfaction with their careers (P = .01) and perceived more difficulty in achieving promotion and tenure. Women were more likely to choose private practice careers because of part-time options (P = .025). Equal numbers of men and women in practice reported difficulty balancing work and family life. Significantly more female than male gastroenterologists perceive that gender has affected their career advancement. Female academic gastroenterologists reported less overall career satisfaction and promotion than male academic gastroenterologists.

  7. An analysis of Canada-US natural gas trade using the AGAS energy model

    International Nuclear Information System (INIS)

    Quon, D.; Wong, S.

    1989-01-01

    The strength of AGAS is that it was structurally designed to address the primary issue of EMF9, namely the medium and long-term prospects for Canada-US natural gas trade. Consequently, it is one of the very few models with the following necessary features: (1) it treats all the regions of Canada and the United States as one continental entity, both with respect to demand and supply; (2) All regional supplies and demands are integrated. Hence, regional gas prices are endogenous; inter-regional gas flows, including Canadian-US gas exchanges, are endogenous. Models that do not have both of these features require that the answers that are being sought have to be specified exogenously. An iterative procedure can be used to reconcile unrealistic results but only with difficulty

  8. Andiroxylon Thanobolensis Sp.Nov. A New Species of Fossil Wood of Family Fabaceae from Manchar Formation Exposed Near Thanobola Khan, District Jamshoro, Sindh, Pakistan

    International Nuclear Information System (INIS)

    Khan, S. A.; Ahmed, B.; Tahir, S. S.

    2016-01-01

    Andiroxylon thanobolensis sp. nov., a new silicified wood has been described and identified from Tertiary Manchar formation exposed near Thanobola Khan, district Jamshoro, Sindh, Pakistan. The xylotomical features of present fossil shows close resemblance with the genus Andira of the Family Fabaceae. The absence of growth ring indicated that plants were growing in tropical type of climate. (author)

  9. Perinatal outcomes in pregnancy with asthma.

    Science.gov (United States)

    Syed, Rashid Zaheer; Zubairi, Ali Bin Sarwar; Zafar, Muhammad Ahsan; Qureshi, Rahat

    2008-09-01

    To examine the relationship between asthmatic pregnancies and selected maternal and neonatal outcomes in a representative cohort. A retrospective cohort study was conducted at the Aga Khan University Hospital during the year 2004. A random selection was made of 65 asthmatic and 63 non-asthmatic singleton births. The neonatal outcomes studied were birth weight, premature birth and Apgar scores at 1 and 5 minutes. The maternal outcomes studied were number of hospital admissions, and number of documented UTI during the studied pregnancy and past history of abortions and stillbirths. The mean age of asthmatics and nonasthmatics were 28.0 +/- 4.9 years and 27.7 +/- 3.6 years respectively. The average parity among asthmatic women was 2.97 while that in controls was 2.57 (p UTIs and hospital admissions. Asthmatic pregnancies are more likely to result in abortion, premature delivery and low birth weight babies. The asthmatic pregnancies were also linked with higher rates of maternal UTI. Thcrefore a more vigilant monitoring is required in asthmatic pregnancies.

  10. Importance of clinical toxicology teaching and its impact in improving knowledge: sharing experience from a workshop

    International Nuclear Information System (INIS)

    Khan, N.U.; Fayyaz, J.; Khan, U.R.; Feroze, A.

    2013-01-01

    Objective: To assess the impact of a one-day clinical toxicology workshop in improving knowledge. Methods: A one-day clinical toxicology workshop was conducted as a pre-conference workshop of the Annual Emergency Medicine Conference at the Aga Khan University Hospital, Karachi, in April 2012. The course was composed of poisoning-related common clinical scenarios. The pre-test and post-test understanding was used to assess the impact of the course in improving knowledge. The participants also evaluated the workshop as a whole thorough written evaluation forms. SPSS 19 was used for statistical analysis of the data. Result: There were 22 participants in the course. The pre-test mean score was 31.6+-15.1% (95% CI; 24-40; n=19) compared to the post-test the mean score of 56.0+-10.8% (95% CI; 47- 61; n=17). The positive difference was also statistically significant (p<0.001). The overall workshop was evaluated as excellent by 08 (47.46%) and very good by 10 (52.63%) participants. Conclusion: Short training in clinical toxicology improved knowledge of the participants. (author)

  11. Rapidly progressive cryptogenic organising pneumonia presenting as a lung mass

    Science.gov (United States)

    Akram, Saeed; Irfan, Muhammad; Aftab, Kanwal

    2009-01-01

    A very rare case of a rapidly progressive variant of cryptogenic organising pneumonia (COP) presenting as a focal mass-like lesion with compression of the large airways leading to respiratory failure is described. A 60-year-old lady presented to the Aga Khan University Hospital Emergency Department in hypoxaemic respiratory failure with a 6-day history of dyspnoea, productive cough and fever. Chest x ray showed a right upper lobe mass-like lesion compressing the large airways and right pleural effusion. She deteriorated in the Emergency Department and was intubated due to worsening hypoxaemic respiratory failure. The pleural fluid and bronchoscopic specimens were negative on microbiological and cytological examination. CT-guided right lung biopsy revealed chronic non-specific inflammation without granuloma and malignancy. COP was diagnosed on video-assisted thoracoscopic (VATS) lung biopsy. She was successfully treated with high dose steroids and discharged in a stable condition; her 3-month follow-up chest x rays showed complete resolution of the lung lesion with some residual fibrosis. PMID:21686529

  12. Chemical dependency: An occupational hazard in the field of anaesthesia

    International Nuclear Information System (INIS)

    Ismail, S.

    2010-01-01

    The medical personnel are vulnerable to substance abuse and dependence due to ready access to substance of abuse. Addiction is considered as an occupational hazard for those involved in the practice of anaesthesia for the same reason. Substance abuse is defined as a psychosocial biogenetic disease, which results from dynamic interplay between a susceptible host and favourable environment. According to the fifth and the last National Survey on Drug Abuse (NSDA) in 1993 by Pakistan Narcotic Control, there are nearly three million drug dependants Review Article Chemical dependency: An occupational hazard in the field of anaesthesia Samina Ismail Department of Anaesthesia, Aga Khan University Hospital, Karachi. in Pakistan, but no data is available to determine the prevalence among medical or anaesthesia personnel. In order to handle the rising trend of chemical abuse, we need to have more surveys and studies on this subject, written policy and educational programme in postgraduate training with proper control and frequent checking of narcotic dispensing. Reporting of drug abuse and rehabilitation of affected doctors are areas which need to be worked upon. (author)

  13. Acute vertebral fracture: differentiation of malignant and benign causes by diffusion weighted magnetic resonance imaging

    International Nuclear Information System (INIS)

    Mubarak, F.; Akhtar, W.

    2011-01-01

    Objective: To evaluate the sensitivity, specificity and accuracy of diffusion weighted (DWI) magnetic resonance imaging (MRI) in the diagnosis and differentiation between benign (osteoporotic/infectious) and malignant vertebral compression fractures in comparison with histology findings and clinical follow up. Methods: The study was conducted at the Radiology Department, Aga Khan University Hospital (AKUH) Karachi. It was a one year cross-sectional study from 01/01/2009 to 01/01/2010. Forty patients with sixty three vertebral compression fractures were included. Diffusion-weighted sequences and apparent diffusion coefficient (ADC) images on a 1.5 T MR scanner were obtained in all patients to identify the vertebral compression fracture along with benign and malignant causes. Imaging findings were compared with histopathologic results and clinical follow-up. Results: Diffusion-weighted MR imaging found to have, 92% sensitivity, 90% specificity and accuracy of 85% in differentiation of benign and malignant vertebral compression fracture while PPV and NPV were 78 % and 90% respectively. Conclusion: Diffusion weighted magnetic resonance imaging offers a safe, accurate and non invasive modality to differentiate between the benign and malignant vertebral compression fracture. (author)

  14. Burden of common mental disorders in patients with Functional Dyspepsia

    International Nuclear Information System (INIS)

    Sattar, A.; Salih, M.; Jafri, W.

    2010-01-01

    Objective: To assess the frequency of common mental disorders among diagnosed functional dyspepsia patients. Methods: A case-control study with 150 cases of functional dyspepsia (FD) and 150 healthy controls were recruited from Gastroenterology Clinic at the Aga Khan University Hospital Karachi from 1, March 2009 through 31, August 2009. Urdu version of WHO-developed Self-Reporting Questionnaire (SRQ) was administered to diagnose patients of FD and healthy controls. A cut off score of 8 on SRQ was used to confirm cases of Common mental disorders (CMD). Data was entered and analyzed by SPSS version 16.0. Result: There was significant difference in CMD i.e. 107 (71.33%) versus 23 (15.33%) in cases and controls respectively (p- <0.001). Among cases CMD was more common in females i.e. in 57 (80.3%) as compared 50 (63.3%) in males (p- 0.022). Conclusion: There is high prevalence of Common mental disorders among patients with functional dyspepsia and this needs to be addressed while treating patients. (author)

  15. Molecular Genealogy of a Mongol Queen’s Family and Her Possible Kinship with Genghis Khan

    Science.gov (United States)

    Lkhagvasuren, Gavaachimed; Shin, Heejin; Lee, Si Eun; Tumen, Dashtseveg; Kim, Jae-Hyun; Kim, Kyung-Yong; Kim, Kijeong; Park, Ae Ja; Lee, Ho Woon; Kim, Mi Jin; Choi, Jaesung; Choi, Jee-Hye; Min, Na Young

    2016-01-01

    Members of the Mongol imperial family (designated the Golden family) are buried in a secret necropolis; therefore, none of their burial grounds have been found. In 2004, we first discovered 5 graves belonging to the Golden family in Tavan Tolgoi, Eastern Mongolia. To define the genealogy of the 5 bodies and the kinship among them, SNP and/or STR profiles of mitochondria, autosomes, and Y chromosomes were analyzed. Four of the 5 bodies were determined to carry the mitochondrial DNA haplogroup D4, while the fifth carried haplogroup CZ, indicating that this individual had no kinship with the others. Meanwhile, Y-SNP and Y-STR profiles indicate that the males examined belonged to the R1b-M343 haplogroup. Thus, their East Asian D4 or CZ matrilineal and West Eurasian R1b-M343 patrilineal origins reveal genealogical admixture between Caucasoid and Mongoloid ethnic groups, despite a Mongoloid physical appearance. In addition, Y chromosomal and autosomal STR profiles revealed that the four D4-carrying bodies bore the relationship of either mother and three sons or four full siblings with almost the same probability. Moreover, the geographical distribution of R1b-M343-carrying modern-day individuals demonstrates that descendants of Tavan Tolgoi bodies today live mainly in Western Eurasia, with a high frequency in the territories of the past Mongol khanates. Here, we propose that Genghis Khan and his family carried Y-haplogroup R1b-M343, which is prevalent in West Eurasia, rather than the Y-haplogroup C3c-M48, which is prevalent in Asia and which is widely accepted to be present in the family members of Genghis Khan. Additionally, Tavan Tolgoi bodies may have been the product of marriages between the lineage of Genghis Khan’s Borjigin clan and the lineage of either the Ongud or Hongirad clans, indicating that these individuals were members of Genghis Khan’s immediate family or his close relatives. PMID:27627454

  16. Clinical relevancy and determinants of potential drug–drug interactions in chronic kidney disease patients: results from a retrospective analysis

    Directory of Open Access Journals (Sweden)

    Saleem A

    2017-02-01

    Full Text Available Ahsan Saleem,1,2 Imran Masood,1 Tahir Mehmood Khan3 1Department of Pharmacy, The Islamia University of Bahawalpur, Bahawalpur, Pakistan; 2Pharmacy Services Department, Integrated Medical Center, The Aga Khan University Hospital, Lahore, Pakistan; 3School of Pharmacy, Monash University, Sunway Campus, Selangor, Malaysia Background: Chronic kidney disease (CKD alters the pharmacokinetic and pharmacodynamic responses of various renally excreted drugs and increases the risk of drug-related problems, such as drug–drug interactions.Objectives: To assess the pattern, determinants, and clinical relevancy of potential drug–drug interactions (pDDIs in CKD patients.Materials and methods: This study retrospectively reviewed medical charts of all CKD patients admitted in the nephrology unit of a tertiary care hospital in Pakistan from January 2013 to December 2014. The Micromedex Drug-Reax® system was used to screen patient profiles for pDDIs, and IBM SPSS version 20 was used to carry out statistical analysis.Results: We evaluated 209 medical charts and found pDDIs in nearly 78.5% CKD patients. Overall, 541 pDDIs were observed, of which, nearly 60.8% patients had moderate, 41.1% had minor, 27.8% had major, and 13.4% had contraindicated interactions. Among those interactions, 49.4% had good evidence, 44.0% had fair, 6.3% had excellent evidence, and 35.5% interactions had delayed onset of action. The potential adverse outcomes of pDDIs included postural hypotension, QT prolongation, ceftriaxone–calcium precipitation, cardiac arrhythmias, and reduction in therapeutic effectiveness. The occurrence of pDDIs was found strongly associated with the age of <60 years, number of prescribed medicines ≥5, hypertension, and the lengthy hospitalization of patients.Conclusion: The occurrence of pDDIs was high in CKD patients. It was observed that CKD patients with an older age, higher number of prescribed medicines, lengthy hospitalization, and hypertension were at

  17. Meeting the Challenges of Personal Development and Character Building in University Students

    OpenAIRE

    Chong, Yen Wan; Hamid, Siti Norasyikin Binti Abdul

    2016-01-01

    Graduate unemployment and corruption are two major challenges faced by Malaysia. One of the top reasons for graduate unemployment in Malaysia, according to a recent survey of Malaysian employers, is poor character or attitude among university graduates. Despite intensifying anti-corruption efforts, corruption in Malaysia has remained a serious challenge. Character education and personal development programs which instil good values in our future leaders can be effective tools in the fight aga...

  18. MEASUREMENT OF RADON EXHALATION RATE, RADIUM ACTIVITY AND ANNUAL EFFECTIVE DOSE FROM BRICKS AND CEMENT SAMPLES COLLECTED FROM DERA ISMAIL KHAN

    OpenAIRE

    Nisar Ahmad; Mohamad Suhaimi Jaafar; Sohail Aziz Khan; Tabassum Nasir; Sajjad Ahmad; Muhammad Rahim

    2014-01-01

    Radon concentration, exhalation rate, radium activity and annual effective dose have been measured from baked and unbaked bricks and cement samples commonly used as construction material in the dwellings of Dera Ismail Khan City, Pakistan. CR-39 based NRPB radon dosimeters and RAD7 have been used as passive and active devises. The values of radon concentration for baked, unbaked bricks and cements obtained from passive and active techniques were found in good agreement. Average values of rado...

  19. Validation of the Arabic Version of the Group Personality Projective Test among university students in Bahrain.

    Science.gov (United States)

    Al-Musawi, Nu'man M

    2003-04-01

    Using confirmatory factor analytic techniques on data generated from 200 students enrolled at the University of Bahrain, we obtained some construct validity and reliability data for the Arabic Version of the 1961 Group Personality Projective Test by Cassel and Khan. In contrast to the 5-factor model proposed for the Group Personality Projective Test, a 6-factor solution appeared justified for the Arabic Version of this test, suggesting some variance between the cultural groups in the United States and in Bahrain.

  20. Parents’ Attitude toward Daughters’ Education in Tribal Area of Dera Ghazi Khan (Pakistan

    Directory of Open Access Journals (Sweden)

    Muhammad Ayub Buzdar

    2011-01-01

    Full Text Available The paper aimed to investigate the parents’ attitudes toward their daughters’ education in tribal areas of district Dera Ghazi Khan (Pakistan. To achieve the objectives four research questions were established. Focus of the questions was to examine the significance of girls’ education for tribal parents. Existing and expected role of tribal parents as well as contribution from government and community for girls’ education was also aimed to explore in research questions. Sample comprised thirty parents and five teachers/educational workers. The data was collected through semi-structured interviews and was analyzed using content analysis approach. The findings disclosed the parents’ positive perceptions toward their daughters’ education but at the same time severe scarcity of human and physical infrastructure for girls’ education was also presented in the area. The paper recommended several empirical steps to overcome these problems including provision of new school locations and ensuring the availability of school buildings, supporting infrastructure and teachers for already functioning schools in the area. Financial aid for poor students was also proposed in the study

  1. Parents’ Attitude toward Daughters’ Education in Tribal Area of Dera Ghazi Khan (Pakistan

    Directory of Open Access Journals (Sweden)

    Akhtar Ali

    2011-01-01

    Full Text Available The paper aimed to investigate the parents’ attitudes toward their daughters’ education in tribal areas of district Dera Ghazi Khan (Pakistan. To achieve the objectives four research questions were established. Focus of the questions was to examine the significance of girls’ education for tribal parents. Existing and expected role of tribal parents as well as contribution from government and community for girls’ education was also aimed to explore in research questions. Sample comprised thirty parents and five teachers/educational workers. The data was collected through semi-structured interviews and was analyzed using content analysis approach. The findings disclosed the parents’ positive perceptions toward their daughters’ education but at the same time severe scarcity of human and physical infrastructure for girls’ education was also presented in the area. The paper recommended several empirical steps to overcome these problems including provision of new school locations and ensuring the availability of school buildings, supporting infrastructure and teachers for already functioning schools in the area. Financial aid for poor students was also proposed in the study.

  2. Genotype-by-sowing date interaction effects on cotton yield and quality in irrigated condition of dera ismail khan, pakistan

    International Nuclear Information System (INIS)

    Usman, K.; Khan, S.; Ayatullah, A.

    2016-01-01

    Cotton is a major export commodity of Pakistan. It is affected by variable environmental conditions throughout the country which limits its production. A 2-year field study was conducted in 2012 and 2013 at Cotton Research Station, Dera Ismail Khan, Pakistan to evaluate the effects of six sowing dates on yield and quality attributes of four cotton genotypes. The experiments were laid out in split-plot within a randomized complete block design with three replications. Main plots treatments were six sowing dates, namely March 20, April 4, April 19, May 4, May 19, and June 3 while subplots treatments were four approved transgenic varieties of cotton (CIM-598, CIM-599, CIM-602, and Ali Akber-703). Results revealed that earlier planting produced more vegetative growth rather than lint yield while late planting induced flowering and boll formation when temperature was much cold that adversely affected cotton yield and quality. The results further indicate that the genotype CIM-599 scored first rank in number of bolls plant-1, boll weight, seed cotton yield, ginning out turn, fiber length, fiber strength, fiber fineness, and fiber uniformity when sown on April 19. CIM-598 was the next suitable genotype after CIM-599 which produced higher yield and quality traits in April 19 sowing. Earlier and later sowing than April 19 resulted in lower cotton yield and quality characters due to unfavorable environmental conditions and shorter growth period, respectively. Thus it is concluded that the genotype, CIM-599 sown on April 19 suits well to the study area and had the potential to optimize cotton yield and quality in irrigated condition of Dera Ismail Khan, Pakistan. (author)

  3. A.G.A. program gives utilities a leg up on benchmarking

    International Nuclear Information System (INIS)

    Share, J.

    1997-01-01

    In this era of downsizing, distribution companies are banding together under the aegis of the American Gas Association to improve their performance, ultimately saving money and jobs. The Best Practice Benchmarking program began in 1990 when New Orleans Public Service coordinated an effort by several utilities wanting to compare practices and data. It is not benchmarking in the traditional sense. Best Practices stresses functional rather than competitive or numerical benchmarking by focusing on what utilities have done to improve their operations. In a report on Best Practices, John Bayko, Director of System Operations for Consumers Gas in Toronto, noted these success stories: Building odorant storage and transport facilities were found to save one company $17,500 annually because it could buy odorant in bulk as opposed to 55-gallon drums. Upgrading its cathodic protection system helped a company realize a 40 percent reduction in corrosion leaks over a two-year period, saving $200,000 a year. Another company began studying partnering with contractors which would eliminate the need of a pipeline inspector in each crew. Those potential savings are over $2 million. This paper describes three other Best Practices related to worker safety, system mapping, and activity-based accounting. A.G.A.'s role is briefly discussed

  4. Urinary retention in unilateral total knee arthroplasty: comparison between continuous epidural analgesia and single-shot femoral nerve block

    International Nuclear Information System (INIS)

    Khan, A.A.; Khan, R.I.

    2018-01-01

    To compare the frequency of urinary retention and requirement of bladder catheterization in patients undergoing toatal knee arthroplasty while receiving either continuous epidural analgesia or single-shot femoral nerve block. Study Design: Randomized controlled study. Place and Duration of Study:Operating Rooms of Aga Khan University Hospital, Karachi, from January 2014 to January 2015. Methodology:Patients were randomized in two groups of 30 each, i.e. epidural group (group E) or femoral nerve block group (group F). Baseline parameters were recorded. Postoperatively, patients were followed for upto 24 hours to collect the data regarding urinary retention. Final outcome was taken at 24 hours postoperatively. Data was analyzed to compare the frequency of urinary retention between the two groups. Results:The average age of the patients was 59.58 +-5.85 years. There were 28 (46.7%) male and 32 (53.3%) female patients. Frequency of urinary retention was significantly high in Group E than Group F (46.7% vs. 6.7%; p=0.0005). Conclusion: Single-shot femoral nerve block offers a more favorable profile in terms of postoperative urinary retention when compared to continuous epidural analgesia. (author)

  5. To compare methods used in our operating room for alleviating tourniquet pain

    International Nuclear Information System (INIS)

    Ali, M. A.; Siddiqui, S.

    2013-01-01

    Objective: To compare the efficacy of different methods used to alleviate tourniquet pain in operating rooms as well as assess their effect on post-operative pain. Methods: The study was conducted at the Aga Khan University Hospital, Karachi from June to August 2010. All patients who came for elective orthopaedic surgery in whom a tourniquet application was planned were included in the study. Information was collected through a pre-designed data form. Qualitative data was expressed as mean standard deviation, while qualitative data was presented as frequency and percentage. Results: In the 106 patients studied, opioids were administered in 90 (85%) cases, paracetamol in 73 (69%) and non-steroidal anti-inflammatory drugs in 11 (10.4%) cases. Efficacy was determined by means of the effect on the blood pressure and heart rate of the patient before and after the drug administration. Intravenous paracetamol was found to be the most effective in reducing both blood pressure and heart rate (p<0.001). The effect on post-operative pain was insignificant. Conclusions: Intravenous paracetamol is a cost-effective and safe analgesic, especially when combined with a multi-modal regimen, and has potential effect on the alleviation of tourniquet pain. (author)

  6. Assessment of competence for caesarean section with global rating scale

    International Nuclear Information System (INIS)

    Qureshi, R.N.; Ali, S.K.

    2013-01-01

    Objective: To establish as reliable and valid the nine-point global rating scale for assessing residents' independent performance of Caesarean Section. Methods: The validation study was conducted at the Department of Obstetrics and Gynaecology, Aga Khan University Hospital, from April to December 2008, and comprised 15 residents during 40 Caesarean Sections over 9 months. Independently two evaluators rated each procedure and the difficulty of each case. Results: The observations per faculty ranged from 1-8 (mean 4.07+- 2.56). The Year 4 residents were observed the most i.e. 32 (40%), followed by Year 3, 30 (37.5%); Year 2; 14 (17.5%); and Year 1, 4 (5%). Mean time required for observation of the surgery was 43.81+-14.28 (range: 20-90) with a mode of 45 min. Mean aggregate rating on all items showed gradual progression with the year of residency. The assessment tool had an internal consistency reliability (Cronbach's alpha) of 0.9097 with low inter-rater reliability. Conclusion: The evaluation tool was found to be reliable and valid for evaluating a resident's competence for performing Caesarean Section. Training of the assessors is required for a better inter-rater agreement. (author)

  7. Severe combined immune deficiency syndrome

    International Nuclear Information System (INIS)

    Saleem, A.F.; Khawaja, R.D.A.; Shaikh, A.S.; Ali, S.A.; Zaidi, A.K.M.

    2013-01-01

    To determine the clinico-demographic features and laboratory parameters of children with severe combined immunodeficiency (SCID). Study Design: Case series. Place and Duration of Study: Department of Paediatrics and Child Health, the Aga Khan University, Karachi, from July 2006 to July 2011. Methodology: Thirteen infants who were discharged with a diagnosis of SCID were inducted in the study. Their clinicodemographic features and laboratory parameters were determined. Descriptive statistics has been used for computing frequency and percentage. Results: The median age at diagnosis was five months; 5 infants presented within 3 months of life. Three-fourth (77%) were males. Most of the infants were severely malnourished (85%) at the time of presentation. More than two-thirds (69%) were products of consanguineous marriages. All subjects had severe lymphopenia (absolute lymphocyte count (ALC) ranging between 170 – 2280) and low T and B lymphocyte counts. Conclusion: SCID should be considered in infants presenting with severe and recurrent infections. Low ALC (< 2500/mm3), is a reliable diagnostic feature of SCID. These infants should be promptly referred to a facility where stem cell transplant can be done. (author)

  8. Expression and Immunohistochemical Localisation of the G beta gamma activated and Calcineurin-inhibited Adenylyl Cyclase Isoforms in Rat Articular Chondrocytes

    International Nuclear Information System (INIS)

    Memon, I.; Khan, K.M.; Siddiqui, S.; Perveen, S.; Ishaq, M.

    2016-01-01

    Objective: To determine the expression and localisation of the Gβγ-activated adenylyl cyclase (AC) isoforms 2, 4, and 7 and calcineurin-inhibited AC isoform 9 in rat articular chondrocytes. Study Design: Experimental study. Place and Duration of Study: Jumma Research Laboratory and Histology Laboratory, The Aga Khan University, Karachi, from 2009 to 2011. Methodology: Fresh slices of articular cartilage were taken from various synovial joints of rats of different age groups. The expression of AC isoforms was determined by RT-PCR and immunohistochemistry was performed to localise these isoforms in articular chondrocytes. Tissue sections were processed for immunostaining with respective antibodies. The color was developed by diaminobenzidine. Results: All the studied AC isoforms were found to be differentially expressed in different zones of the rat articular cartilage. Generally, expression of all AC isoforms studied increased with age. The expression of the AC isoforms through PCR was almost consistent with the localisation of these isoforms by immunohistochemistry. Conclusion: These data add to the information about signalling cascades possibly involved in articular chondrocytes. Variable expression of AC isoforms 2, 4, 7, and 9 suggest a role for the signalling cascades regulated by the AC isoforms in articular chondrocytes. (author)

  9. Induction position for spinal anaesthesia: Sitting versus lateral position

    International Nuclear Information System (INIS)

    Shahzad, K.; Afshan, G.

    2013-01-01

    Objective: To compare the effect of induction position on block characteristics (sensory and motor nerves) and haemodynamic stability in elderly patients with isobaric bupivacaine. Patient comfort was also looked at. Methods: The randomized single blinded study was conducted at the Aga Khan University Hospital, Karachi, from September 2007 to August 2008. A total of 70 patients aged >60 years of both genders were included. Spinal anaesthesia was performed either in sitting or lateral position according to random allocation. Assessments of sensory, motor block and heart rate, systolic and diastolic blood pressure were recorded for 20 minutes. SPSS 16 was used for statistical analysis. Results: There was no significant difference for haemodynamic variables heart rate, systolic and diastolic blood pressure. The onset of anaesthesia was faster in the sitting group (4.5 minutes vs 5.4 minutes). The motor block characteristics were similar in both the groups. The majority of patients who reported 'very comfortable' for induction position belonged to the lateral group. Conclusion: Both sitting and lateral positions have similar effects on sensory and motor blockade and haemodynamic stability. However, patients generally found lateral position very comfortable. (author)

  10. To compare the accuracy of Prayer's sign and Mallampatti test in predicting difficult intubation in Diabetic patients

    International Nuclear Information System (INIS)

    Baig, M. M. A.; Khan, F. H.

    2014-01-01

    Objective: To determine the accuracy of Prayer's sign and Mallampatti test in predicting difficult endotracheal intubation in diabetic patients. Methods: The cross-sectional study was performed at Aga Khan University Hospital, Karachi, over a period from January 2009 to April 2010, and comprised 357 patients who required endotracheal intubation for elective surgical procedures. Prayer's sign and Mallampatti tests were performed for the assessment of airway by trained observers. Ease or difficulty of laryngoscopy after the patient was fully anaesthetised with standard technique were observed and laryngoscopic view of first attempt was rated according to Cormack-Lehan grade of intubation. SPSS 15 was used for statistical analysis. Results: Of the 357 patients, 125(35%) were classified as difficult to intubate. Prayer's sign showed significantly lower accuracy, positive and negative predictive values than Mallampatti test. The sensitivity of Prayer's sign was lower 29.6 (95% Confidence Interval, 21.9-38.5) than Mallampatti test 79.3 (95% confidence interval, 70.8-85.7) while specificity of both the tests was not found to be significantly different. Conclusion: Prayer's sign is not acceptable as a single best bedside test for prediction of difficult intubation. (author)

  11. Perceptions of nursing students of educational environment at a private undergraduate School of Nursing in Karachi.

    Science.gov (United States)

    Farooq, Salima; Rehman, Rehana; Hussain, Mehwish; Dias, Jacqueline Maria

    2018-02-01

    To assess educational environment at a nursing school.. The cross-sectional survey was carried out from May to October 2016 at Aga Khan University School of Nursing and Midwifery, Karachi, using the Dundee Ready Educational Environment Measure tool. The scores were obtained by merging five sub-scales of the inventory. The average scores of the scale and sub-scales were compared in terms of age, year of study, and living status using Mann-Whitney U test, and among years of study by Kruskal Wallis test.. Of the 442 students, 228(51.6%) had age below 20 years. Overall, 131(29.1%) subjects were in the first year, 152(33.8%) second year, 91(20.2%) third year and 76(16.9%) fourth year. The average Dundee Ready Educational Environment Measure score was 129.92±19.97 with reliability of 88.9%. Students aged 20 years and less had more positive perceptions than students over 20 years (pnursing students attained significant highest scores in all sub-scales compared to the rest (pnursing students, as well as those living in the hostel and those who were in their initial years of nursing education.

  12. Median survival time of patients after transcatheter chemo-embolization for hepatocellular carcinoma

    International Nuclear Information System (INIS)

    Haider, Z.; Haq, T.; Munir, K.; Usman, M.U.; Azeemuddin, M.

    2006-01-01

    Objective: To determine the effect on survival after trans arterial chemo embolization (TACE) in patients with unresectable hepatocellular carcinoma (HCC). Design: Longitudinal cohort study. Place and Duration of Study: Radiology Department, The Aga Khan University Hospital, Stadium Road, Karachi, from December 1997 to September 2005. Patients and Methods: Patients undergoing TACE procedure for HCC were prospectively followed. Forty three patients were enrolled from December 1997 to March 2003 in the study and subjected to chemo embolization therapy. Eight out of 43 patients were excluded from the study, who lost to follow-up. All the patients were followed till their death. Median and mean survival were calculated. Results: The median survival of these 35 patients was 410 days (13.6 months), with 95% confidence interval (236 days lower bound and 536 days upper bound). Mean survival time was 603 days (20.1 months) with 95% confidence interval (394 days lower bound and 812 days upper bound). There was significant difference in mean survival time (in days) by Child's Pugh class (X2 = 12.384; df=2, p-value=0.002). Conclusion: The study showed that TACE is an effective palliative treatment. TACE increases the median survival time. (author)

  13. New Onset Refractory Status Epilepticus as an Unusual Presentation of a Suspected Organophosphate Poisoning

    Directory of Open Access Journals (Sweden)

    Shahan Waheed

    2014-01-01

    Full Text Available New onset refractory status epilepticus (NORSE is a new entity in medical literature. It has different infectious and noninfectious etiologies showing a devastating impact onto the clinical outcome of patients. Therapy with anaesthetic and antiepileptic agents often fails to improve the condition, unless the primary cause is rectified. Here is presented the case of a young female with a history of depression who after a recent bereavement came to the Emergency Department of Aga Khan University Hospital with complaints of drowsiness that lasted for few hours. Though she had no history of organophosphate poisoning, her physical examination and further investigations were suggestive of the diagnosis. During her hospital stay, she developed refractory status epilepticus. Her seizures did not respond to standard antiepileptic and intravenous anesthetic agents and subsided only after intravenous infusion of atropine for a few days. Organophosphate poisoning is a very common presentation in the developing world and the associated status epilepticus poses a devastating problem for emergency physicians. In patients with suspected organophosphate poisoning with favoring clinical exam findings, the continuation of atropine intravenous infusion can be a safe option to abate seizures.

  14. Fictional Marriage Proposal of Anonymous Astrakhan Khan

    Directory of Open Access Journals (Sweden)

    Roman Hautala

    2017-03-01

    Full Text Available The following text is reproduced from a handwritten copy of the letter made by the Italian humanist Gian Vincenzo Pinelli (1535–1601 and contained in one codex of Ambrosiana Library in Milan (R 104 sup., fol. 194r [see the description of the codex in: 3, no. 341. p. 125]. This codex (588 folios contains Italian and Latin texts of the 16th century of extremely diverse content, which does not allow to determe neither the name of the author of the reproduced letter, nor the date of its writing. Nevertheless, a reference to the name of “Luther” in the letter suggests that it must have been written in the 16th century and an indication of the main purpose of the letter – matchmaking to anonymous queen – makes it possible to put forward quite a bold (but, for now, unproven hypothesis that this letter might be addressed to approximates of the Polish Queen Bona Sforza and the widow of King Sigismund I the Old starting with the April 1, 1548. Following this hypothesis, the alleged author of the letter could be the ruler of Astrakhan Yamgurchi or the Crimean khan Sahib Giray. However, this assumption remains only a hypothesis, and the author of this article hopes that future researchers will be able to identify both the author of the letter and its recipients. Be that as it may, this letter is of undoubtedly fictitious character since it does not indicate the name of its author and the date of writing and obviously differs from official form of the Tatar rulers’ letters. Undoubtedly, this letter refers to the literary genre of fictional letters of the rulers, which became extremely popular in Europe since the second half of the 15th century. As an illustration of this genre, the author of this article presents a “letter” of the Turkish sultan to the Tatars and their “response” from the fictional collection of “Letters of the Great Turk” [1, fol. 18r] of Laudivius Hierosolymitanus, which was a relatively widespread in Europe in the

  15. Climate change, poverty and agricultural resource degradation: a case study of district d.g. khan

    International Nuclear Information System (INIS)

    Imran, M.; Bano, S.; Dawood, M.; Tarar, M.A.; Ali, A.

    2012-01-01

    Global development agendas are now being bonded with adaptation to climate change. Sustainable biodiversity and community adaptation to climate change are closely associated as depletion of natural resources adversely affects the living standard of people. Rapid climatic changes and intervention to regulate water resources in Indus delta of Pakistan have put the lives of millions of people residing near the Indus river belt at the stake of climate change. Therefore, this study was designed to inquire the socio-economic conditions of the people residing near the Indus river bank and the perceived impact of climate change on river belt agricultural resources specifically in district D. G. Khan. Based on primary data study employed univariate and bivariate analysis which suggested flood, wind storm and temperature as the significant climate change parameters affecting the land fertility, forest and fisheries. The Foster Greer and Thorbeck technique for calculating the poverty indicated that majority (82%) of population was below poverty line and most of them entirely depend on river belt agricultural resources which were found to be depleting due to rapid climate change. (author)

  16. Maslyuzhenko D.N. Turko-Mongol Traditions in the “State of Nomadic Uzbeks” of Abu al-Khair Khan

    Directory of Open Access Journals (Sweden)

    D.N. Maslyuzhenko

    2014-09-01

    Full Text Available The author of this article identifies the daily and political traditions in the Khanate of Abu al-Khair, which researchers traditionally call the “State of nomadic Uzbeks”. This State was created in the south of Western Siberia in the 1430’s and annexed by military means to the land of Shiban’s (the younger brother of Batu descendants. The overwhelming majority of researchers consider it as a Muslim State since its very foundation, substantiating their allegations by indication both on the reading of khutba in honor of Khan after he took the “throne of Sain Khan” and on the presence of the sheikhs and Sufis in his entourage. At the same time, the authority of Abu al-Khair had the strong support of nomadic elite of more than twenty tribes. Precisely this elite, its inquiries and interests, which were advocated on the nobility councils, formed the existing political and daily traditions. These traditions reflect the preservation of Turko-Mongol customs among nomadic populations. We can find analogies of these practices in the earlier customs among the precursors of post-Golden Horde State, i.e., in the Mongol Empire and the ulus of Jochi. Traditions of the Abu al-Khair’s Khanate represented a phenomenon of cultural inertia, which were restored in the conditions of Islamization and could become the adats. This effect is particularly significant in view of the specific attitude of Sufi tariqats to the phenomena of social life. In political terms, of particular importance among these was the restoration of the Toy and the related kurultay that could take place in accordance with the existing steppe (animals calendar. The khans restored the ritual of robes and belts’ distribution as the main mechanism for redeployment of posts and responsibilities among the steppe aristocracy. Military tradition was also focused on samples of the previous time, which was particularly manifested in the selection of wings and avant-garde. In the course

  17. Studies on Plant Population and Stand Establishment Techniques for Increasing Productivity of Rice in Dera Ismail Khan, Pakistan

    Directory of Open Access Journals (Sweden)

    Mohammad Safdar BALOCH

    2007-06-01

    Full Text Available Rice production in Pakistan is constraint by many factors pertaining to prevalent planting techniques. A research on the feasibility of new planting techniques (direct seeding on flat, transplanting on flat, direct seeding on ridges, transplanting on ridges and parachute planting in transplanted and direct wet-seeded rice was undertaken at Dera Ismail Khan region of Pakistan's North West Frontier Province during 2002 and 2003. Among the planting techniques, the best performance for the yield formation and economic evaluation was noted for transplanting on flat during both years. Chinese parachute planting technology also showed very promising results in most of the parameters. Direct seeding on ridges could not excel transplanting on flat and parachute planting during both cropping seasons. The findings concluded the feasibility of parachute planting technology along with traditional rice transplanting on flat over all other planting techniques being practiced in the area.

  18. Acute respiratory failure in Pakistani patients: risk factors associated with mortality

    International Nuclear Information System (INIS)

    Hussain, S.F.; Irfan, M.; Naqi, Y.S.; Islam, M.; Akhtar, W.

    2006-01-01

    Objective: To assess the outcome and risk factors associated with mortality in patients with acute respiratory failure (ARF). Design: Observational study. Place and Duration of Study: The Aga Khan University Hospital, Karachi, between January 1997 and June 2001. Patients and Methods: All adult patients admitted with a medical cause of acute respiratory failure were reviewed. The primary outcome measure was mortality and secondary outcome measures were factors associated with mortality in ARF. Multiple logistic regression analysis was used to identify the independent risk factors for mortality. Results: A total of 270 patients were admitted with ARF. Hypercapnic respiratory failure was seen in 186 (69%) and hypoxemic in 84 (31%) cases. Pneumonia and COPD exacerbation were the most common underlying causes of ARF. Ventilator support was required in 93 (34.4%) patients. Hospital mortality was 28%. Chronic renal failure, malignancy, hypokalemia, severe acidosis (pH <7.25), septicemia and ARDS independently correlated with mortality. Mortality rate increased sharply (84%) with the presence of three or more risk factors. Conclusion: Acute respiratory failure has a high mortality rate (28%). Development of ARDS or septicemia was associated with high mortality. Presence of more than one risk factor significantly increased the mortality rate. (author)

  19. Sentinel node localisation using pre-operative lymphoscintigraphy and intraoperative gamma probe in early oral cavity cancer

    International Nuclear Information System (INIS)

    Ikram, M.; Akhtar, S.; Junaid, M.; Dhari, T.; Zaman, M.U.; Hussain, R.

    2013-01-01

    Objectives: To assess the diagnostic value of sentinel lymph node localisation using pre-operative lymphoscintigraphy and intra-operative gamma probe radio localisation in Pakistani patients suffering from early stage squamous cell carcinoma of the oral cavity. Methods: The prospective case series was conducted between September 2007 and April 2010 at the Aga Khan University Hospital, Karachi. It comprised patients with T1 and T2 oral cavity cancer with clinically and radiologically negative neck. Pre-operative lymphoscintigraphy was performed one day before surgery and intra-operative gamma probe was used to detect sentinel node. Final histo-pathological evaluation was taken as the gold standard. Results: The study comprised 42 patients: 32(76%) males and 10(24%) females. The primary tumour site was buccal mucosa in 25 (60%) patients, and tongue in 17 (40%). Sentinel lymph node was detected in 38 (90%) patients. On final histopathological identification, 7 (17%) patients had cancer in the neck nodes. In all patients with metastasis, sentinel lymph node technique correctly identified the involved neck level. None of the patients revealed metastasis in non-sentinel lymph nodes. Conclusion:Evidence suggested the use of sentinel node biopsy in patients with head and neck squamous cell carcinoma. (author)

  20. Comparison of fracture and deformation in the rotary endodontic instruments: Protaper versus K-3 system.

    Science.gov (United States)

    Nagi, Sana Ehsen; Khan, Farhan Raza; Rahman, Munawar

    2016-03-01

    This experimental study was done on extracted human teeth to compare the fracture and deformation of the two rotary endodontic files system namely K-3 and Protapers. It was conducted at the dental clinics of the Aga Khan University Hospital, Karachi, A log of file deformation or fracture during root canal preparation was kept. The location of fracture was noted along with the identity of the canal in which fracture took place. The fracture in the two rotary systems was compared. SPSS 20 was used for data analysis. Of the 172(80.4%) teeth possessing more than 15 degrees of curvature, fracture occurred in 7(4.1%) cases and deformation in 10(5.8%). Of the 42(19.6%) teeth possessing less than 15 degrees of curvature, fracture occurred in none of them while deformation was seen in 1(2.4%). There was no difference in K-3 and Protaper files with respect to file deformation and fracture. Most of the fractures occurred in mesiobuccal canals of maxillary molars, n=3(21.4%). The likelihood of file fracture increased 5.65-fold when the same file was used more than 3 times. Irrespective of the rotary system, apical third of the root canal space was the most common site for file fracture.

  1. Improvement in quality of lifesix months after primary total hip arthroplasty in a Pakistani population.

    Science.gov (United States)

    Zubairi, Akbar Jaleel; Bin Mahmood, Syed Usman; Ali, Moiz; Noordin, Shahryar

    2016-10-01

    This prospective, cohort study was carried out to assess the improvement in quality of life of patients undergoing elective primary total hip arthroplasty (THA). It was conducted at the orthopaedic department of the Aga Khan University Hospital, Karachi, from June 2014 to May 2015, and comprised patients who had undergone THA. A total of 89 patients having a mean age of 41.5±12.0 years with a baseline core outcomes measure index (COMI)-hip score of > 3.5 were included. A decrease in COMI-hip score by >3 points six months post-operatively was considered improvement in quality of life. Patient satisfaction with restriction to squatting was assessed separately. The mean reduction in COMI-hip was 4.9±1.3 with 83(93%) patients experiencing significant improvement in quality of life. Age >50 years and American Society of Anaesthesiologists (ASA) level >III was significantly associated with no improvement in quality of life. Most patients were satisfied with their disability to squat irrespective of COMI-hip score. THA was found to be associated with significant improvement in quality of life and COMI-hip score was applicable in our population despite its inability to assess disability with restriction in squatting.

  2. Bibliometric analysis of the Journal of Pakistan Medical Association form 2009 to 2013.

    Science.gov (United States)

    Ibrahim, Muhammad

    2015-09-01

    To conduct a bibliometric analysis of the Original articles published in the Journal of Pakistan Medical Association. The study was conducted in Peshawar and comprised all Original articles published in the Journal of Pakistan Medical Association between 2009 and2013. The articles were downloaded from the Journal website and bibliometric parameters were analysed. A total number of 913 Original articles were found in regular issues of the Journal, while leaving out six special supplements that were published during the period under study. The number of Original articles increased steadily from 148(16.2%) in 2009 to 214(23.4%) in 2013, In yearly terms, Original articles published each year ranged between 148 and 214; 510(55.9%) had 21-30 citations; 3-author contributions ranked the highest with 206(22.6%); 481(52.7%) authors were geographically affiliated to Sindh, Pakistan; Community Medicine was the most popular medical specialty with was 140(15.3%) articles; 17340(90.5%) citations were from journals; and the most productive institution was Aga Khan University, Karachi. The number of papers published in Journal of Pakistan Medical Association per issue increased from 2009 to 2013 and the main region in terms of contribution was Sindh.

  3. Case Series of Naegleria fowleri Primary Ameobic Meningoencephalitis from Karachi, Pakistan.

    Science.gov (United States)

    Ghanchi, Najia K; Jamil, Bushra; Khan, Erum; Ansar, Zeeshan; Samreen, Azra; Zafar, Afia; Hasan, Zahra

    2017-11-01

    Naegleria fowleri causes primary amoebic meningoencephalitis (PAM) which is almost always fatal. Naegleria fowleri is waterborne, and its infections are usually associated with aquatic activities but it can also be transmitted via the domestic water supply. An increasing number of N. fowleri cases have been reported from Pakistan. Improved methods for diagnosis are required. We report the utility of polymerase chain reaction (PCR) for the diagnosis of N. fowleri in patients suspected of PAM. One hundred and sixteen cases suspected of having PAM were examined. Cerebrospinal fluid (CSF) specimens were tested at the Aga Khan University Hospital, Karachi. Nineteen CSF specimens were positive for N. fowleri using PCR. Naegleria fowleri positive patients had a median age of 28 years and were 84% male and 16% female. Overall, CSF wet preparation microscopy was performed in 85 (73%) cases and identified that seven specimens were positive for motile trophozoites. The CSF wet preparation results were available for 15 of the 19 N. fowleri PCR positive CSF samples; seven (40%) wet preparations were positive. Our data highlight the threat of N. fowleri infection as a cause of PAM. It also emphasizes the utility of the PCR-based diagnosis of the amoeba for early diagnosis and management of the disease.

  4. Frequency of Cardiorenal Syndrome Type-I in Hospitalized Children with Acute Heart Failure in a Tertiary-Care Hospital

    International Nuclear Information System (INIS)

    Zaidi, M.; Rahman, A. J.; Haque, A.; Sadqani, S.; Maheshwari, P. K.

    2014-01-01

    Objective: To determine the frequency of cardiorenal syndrome in hospitalized children with acute heart failure. Study Design: Descriptive study. Place and Duration of Study: Paediatric Intensive Care Unit, The Aga Khan University Hospital, Karachi, from December 2010 to December 2011. Methodology: Sixty eight (68) children with acute heart failure fulfilling the selection criteria were evaluated for worsening of renal function (WRF). Serum creatinine was done at baseline and repeated at 72 hours to see the worsening of renal function. Estimated serum creatinine clearance was calculated by Schwartz formula. Results: Mean age of patients was 43.6 +- 55.2 months. There were 43 (63%) males, 70% were under 57 months of age. Mean weight on admission was 14.7 +- 19.13 kg and mean height was 83 cm (+- 31.08 SD). Mean serum creatinine on admission was 0.77 mg/dl (+- 1.18 SD). Worsening renal function was noted in 55 (81%) of children, out of those, majority 36 (70.5%) were under 5 years of age. Conclusion: Worsening renal function was found in 81% of children admitted with the diagnosis of acute heart failure. Majority (70.5%) were under 5 years of age indicating a closer observation of renal status in younger age group to reduce, morbidity and mortality. (author)

  5. Adjustment of the architecture to the bioclimatic conditions of the environment on case study of the monsoon modernism of architect Geoffrey Bawa

    Directory of Open Access Journals (Sweden)

    Danilović-Hristić Nataša

    2012-01-01

    Full Text Available Geoffrey Bawa (1919-2003, not well known in our ambience, was Sri Lanka's most influential architect and South Asia's leading guru of unique style, named tropical architecture. The distinction of his work is outstanding aesthetic sensitivity to site and context, especially to peculiar climatic conditions and demands. For his architectural opus he received in 2001 prestigious Aga Khan Award for Architecture, Special Chairman's Award. Although he started to engage in architecture late, in age of 38, soon he became a noted by his inventiveness in forming new canons and prototypes of modern architecture, based on traditional knowledge and perfectly fitted in local surrounding. Bawa created sustainable architecture even before the term started to be used and his masterpieces broke down the barrier between inside and outside space, designing of the interior and landscaping, reducing the building to a series of scenic spaces separated by courtyards and gardens. He is well known by his designs for private villas and hotels, but his portfolio contains public building, as schools and universities, new Sri Lanka's Parliament, sacral, office and industrial structures. Through the presentation of several projects, the paper analyzes his development path and basic characteristics of so called 'monsoon modernism' and special relationship to the bioclimatic conditions of the environment.

  6. Association between tumour volume and recurrence of squamous cell carcinoma of the head and neck

    International Nuclear Information System (INIS)

    Kazmi, F.N.; Adil, A.; Ghaffar, S.; Ahmed, F.

    2012-01-01

    Objective: To evaluate the prognostic significance of computerized tomography derived tumour volume for squamous cell cancers of the head and neck, treated primarily by surgery. Methods: The retrospective review study comprised 72 patients with head and neck malignancies who were treated primarily by surgery at Aga Khan University Hospital, Karachi, with/without adjuvant. It was done from May 2007 to November 2008. Each patient was followed up for a minimum of one year to check for recurrence. For statistical analysis SPSS 17 was used. Frequencies, cross-tabulations with chi square tests to find associations, binary logistic regression analysis, Cox regression analysis and receiver operating characteristic curve tests were run on the data. Results: Overall, the median tumour volume for patients with recurrent disease was 52 cm/sup 3/ compared to 22 cm/sup 3/ for those who did not have a recurrence. It was found that large tumour volume was associated with a significantly higher chance of recurrence (p = 0.009). Laryngeal cancers with volumes greater than 46 cm/sup 3/ and oral cancers with volumes greater than 23.1 cm/sup 3/ were associated with poor prognosis. Conclusions: The primary tumour volume can represent an important prognostic factor for treatment outcome. Patients with larger primary tumour volumes should be treated more aggressively. (author)

  7. How we developed a bioethics theme in an undergraduate medical curriculum.

    Science.gov (United States)

    Ghias, Kulsoom; Ali, Syeda Kauser; Khan, Kausar S; Khan, Robyna; Khan, Murad M; Farooqui, Arshi; Nayani, Parvez

    2011-01-01

    The 5-year undergraduate medical curriculum at Aga Khan University integrates basic sciences with clinical and community health sciences. Multimodal strategies of teaching and learning, with an emphasis on problem-based learning, are utilized to equip students with knowledge, skills, behaviours, attitudes and values necessary for a high-calibre medical graduate. Bioethics teaching was introduced in the medical curriculum in 1988 and has since undergone several changes. In 2009, a multidisciplinary voluntary group began review of undergraduate bioethics teaching and invested over 350 man-hours in curricular revision. This involved formulating terminal objectives, delineating specific objectives and identifying instructional methodologies and assessment strategies appropriate for the contents of each objective. Innovative strategies were specially devised to work within the time constraints of the existing medical curriculum and importantly, to increase student interest and engagement. The new bioethics curriculum is designed to be comprehensive and robust, and strives to develop graduates who, in addition to being technically skilled and competent, are well-versed in the history and philosophy of ethics and bioethics and are ethical in their thinking and practice, especially in the context of a developing country like Pakistan where health indicators are among the worst in the region, and clinical practices are not effectively regulated to ensure quality of care.

  8. Homeostatic Model Assessment for Insulin Resistance (HOMA-IR): A Better Marker for Evaluating Insulin Resistance Than Fasting Insulin in Women with Polycystic Ovarian Syndrome.

    Science.gov (United States)

    Majid, Hafsa; Masood, Qamar; Khan, Aysha Habib

    2017-03-01

    To assess the utility of HOMA-IR in assessing insulin resistance in patients with polycystic ovary syndrome (PCOS) and compare it with fasting insulin for assessing insulin resistance (IR). Observational study. Section of Clinical Chemistry, Department of Pathology and Laboratory Medicine, The Aga Khan University Hospital, Karachi, from January 2009 to September 2012. Medical chart review of all women diagnosed with PCOS was performed. Of the 400 PCOS women reviewed, 91 met the inclusion criteria. Insulin resistance was assessed by calculating HOMA-IR using the formula (fasting glucose x fasting insulin)/405, taking normal value HOMA-IR of women was 3.1 ±1.7, respectively with IR in 69% (n=63) women, while hyperinsulinemia was present in 60% (n=55) women (fasting Insulin 18.5 ±5.8 µIU/ml). Hyperandrogenism was present in 53.8% (n=49), whereas 38.5% (n=35) women had primary infertility or subfertility, while 65.9% (n=60) had menstrual irregularities; and higher frequencies were observed in women with IR. Eight subjects with IR and endocrine abnormalities were missed by fasting insulin. Insulin resistance is common in PCOS and it is likely a pathogenic factor for development of PCOS. HOMAIR model performed better than hyperinsulinemia alone for diagnosing IR.

  9. Frequency and characteristic features of portal hypertensive gastropathy in patients with viral cirrhosis

    International Nuclear Information System (INIS)

    Ahmed, S.; Mumtaz, K.; Ahmed, S.U.; Hamid, S.; Jafri, W.

    2010-01-01

    To determine the frequency and specific characteristic features of portal hypertensive gastropathy (PHG) in cirrhosis due to viral etiology. Study Design: Cross-sectional descriptive study. Place and Duration of Study: The Aga Khan University Hospital, Karachi, from June 2006 till June 2008. Methodology: Patients with hepatitis B and C cirrhosis were included who underwent screening esophago-gastroduodenoscopy (EGD) for varices. Baveno III consensus statement was used for diagnosing PHG on endoscopy and divided them into two subgroups i.e. mild and severe. Data related to platelet/spleen ratio, MELD score and Child Turcotte Pugh (CTP) score indicating severity of cirrhosis were recorded in all patients. Findings were compared by using independent sample t-test. Results: Out of 360 patients who underwent screening EGD, 226 (62.8%) were males. Two hundred and eighty one (78%) had hepatitis C while 79 (22%) suffered from hepatitis B related cirrhosis. Three hundred patients (83.3%) had PHG while 71 (24%) had severe PHG. Higher proportion of esophageal varices (89.7%) was present among those who had PHG (p 8 MELD score > 12 and platelets/spleen ratio 12, CTP score greater than 8 and platelets/spleen ratio < 900 were significant factors of severe PHG. (author)

  10. Paediatric innovation in Pakistan: our experience and a call to action.

    Science.gov (United States)

    Farooqi, Walid; Subhani, Faysal; Mian, Asad

    2017-10-01

    Standardisation in paediatric medicine may have the unintended effect of stifling innovation. Thinking outside the box becomes even more important in low-income to middle-income countries like Pakistan, where a large paediatric population requires healthcare. In addition, there is always a lack of funds, making an innovative, low-cost and high impact solution all the more necessary. While regulation and formal research is an integral part of the process, the local synthesis of a solution must start with a creative idea. To address the dearth of avenues promoting lateral thinking relevant to biomedicine and healthcare among students and faculty, the Critical Creative Innovative Thinking forum was formed at the Aga Khan University in Karachi, Pakistan, by a group consisting of students and faculty in 2014. The primary objective of the forum was to provide an arena conducive to lateral thinking and to equip biomedical professionals with the skill set to enable and promote creativity and innovation. This paper seeks to outline those efforts and discuss their potential impact on paediatric care for resource-limited settings. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  11. Dream of a conducive learning environment: One DREEM for all medical students!

    Science.gov (United States)

    Rehman, Rehana; Ghias, Kulsoom; Fatima, Syeda Sadia; Hussain, Mehwish; Alam, Faiza

    2017-01-01

    To compare students' response assessed by Dundee Ready Educational Environment Measure on the basis of the year of study, gender and pre-medical educational background. This cross-sectional study was carried out at the Aga Khan University Medical College, Karachi, Pakistan, from June 2014 to March 2015, and comprised medical students. The average scores of Dundee Ready Educational Environment Measure scales and subscales were compared between gender and educational background. Responses were also compared on the basis of year of study. Of the 416 participants, 184 (44%) were males and 232 (56%) were females. There were 100 (24%) students in the first year, 90 (21.6%) in second, 92 (22.1%) in third, 91 (21.9%) in fourth and 43 (10.3%) in the fifth year. The mean Dundee Ready Educational Environment Measure score was 125.7±16.8. The mean score of females and students with higher secondary school background was significantly better as compared to males and students in British General Certificate of Education background, respectively (plearning (pEnvironment Measure score responses by fourth-year students (pEnvironment Measure endorsed approval of conducive learning environment with reference to atmosphere, teaching, learning, sense of well-being, academic self-perception and achievement by all medical students.

  12. Surgical management of inflammatory bowel disease: A low prevalence, developing country perspective.

    Science.gov (United States)

    Nasim, Sana; Chawla, Tabish; Murtaza, Ghulam

    2016-03-01

    To determine the outcomes of surgical management of inflammatory bowel disease. The retrospective case series was conducted at Aga Khan University Hospital, Karachi, and comprised medical record of adult patients operated between January 1986 and December 2010 for inflammatory bowel disease. Outcomes consisted of complications till last follow-up and 30-day mortality (disease or procedure related). Functional status of patients with ileal pouch was determined via telephone. SPSS 16 was used to analyse data. Of the 36 patients whose records were reviewed, 21(58%) were males, and body mass index was less than 23 in 34(91%). A total of 27(75%) patients underwent elective surgery for their condition. Ileal pouch was formed in 9(25%). Overall mortality was 14(38.8%). Overall incidence of complications was 26(72%), with wound infection being the most common early morbidity in 11(30.5%). Late morbidity included pouchitisin 4/9 (44.9%) and strictures 2/36 (5.5%).On telephonic follow-up, 6 of the remaining 7patients (85%) with ileal pouch were satisfied with the functional results of the procedure. The retrospective case series represents results from a developing country with low prevalence of inflammatory bowel disease and hence limited experience.

  13. High Burden of Subclinical Lead Toxicity after Phase Out of Lead from Petroleum in Pakistan.

    Science.gov (United States)

    Majid, Hafsa; Khan, Aysha Habib; Khan, Nadeem Ullah; Siddiqui, Imran; Ghani, Farooq; Jafri, Lena

    2017-12-01

    To evaluate the frequency of subclinical lead toxicity. Cross-sectional study. Department of Pathology and Laboratory Medicine, The Aga Khan University Hospital, Karachi, from January 2011 to December 2014. Analysis of laboratory data for blood lead levels (BLL) was performed. Lead was tested by atomic absorption spectrometer. For all subjects, only initial test results were included while the results of repeated testing were excluded. Exemption was sought from institutional ethical review committee. BLL of 2-10 ug/dl and 10-70 ug/dl in children and adults, respectively were taken as subclinical lead toxicity. Amongst the total number of subjects tested (n=524), 26.5% (n=139) were children (lead level 16.9 ug/dl (36.1-4)] and lower level [4.2 ug/dl (6.8-2.6)] in children with lead levels while most had either subclinical (76%, n=106) or toxic lead levels (8%, n=11). In adults, (55%, n=212) subjects had desired lead levels, and 40% (n=154) and 4.99% (n=19) had subclinical and toxic lead levels. Presence of subclinical lead poisoning even after phasing out of lead petroleum in Pakistanis is alarming, especially in children. A national population-based study to determine the lead status and targeted intervention to identify potential sources is need of the time.

  14. Flipped classroom instructional approach in undergraduate medical education.

    Science.gov (United States)

    Fatima, Syeda Sadia; Arain, Fazal Manzoor; Enam, Syed Ather

    2017-01-01

    In this study we implemented the "flipped classroom" model to enhance active learning in medical students taking neurosciences module at Aga Khan University, Karachi. Ninety eight undergraduate medical students participated in this study. The study was conducted from January till March 2017. Study material was provided to students in form of video lecture and reading material for the non-face to face sitting, while face to face time was spent on activities such as case solving, group discussions, and quizzes to consolidate learning under the supervision of faculty. To ensure deeper learning, we used pre- and post-class quizzes, work sheets and blog posts for each session. Student feedback was recorded via a likert scale survey. Eighty four percent students gave positive responses towards utility of flipped classroom in terms of being highly interactive, thought provoking and activity lead learning. Seventy five percent of the class completed the pre-session preparation. Students reported that their queries and misconceptions were cleared in a much better way in the face-to-face session as compared to the traditional setting (4.09 ±1.04). Flipped classroom(FCR) teaching and learning pedagogy is an effective way of enhancing student engagement and active learning. Thus, this pedagogy can be used as an effective tool in medical schools.

  15. Effectiveness of a Formal Mentorship Program in Family Medicine Residency: The Residents’ Perspective

    Directory of Open Access Journals (Sweden)

    Marie Andrades

    2013-01-01

    Full Text Available Introduction. Mentoring is a recognized form of teaching learning strategy in postgraduate medical education. This paper describes the effectiveness of a formal mentorship program from the residents’ perspective after a year of implementation. Methods. The Aga Khan University Family Medicine Residency Program is the first program in Pakistan to our knowledge to implement formal mentorship for all four years of residency. A mentorship program was developed, implemented, and evaluated a year later using a rating scale. The 10-point Likert scale consisted of questions on academics, clinical work, research, administrative issues, and personal/social issues. Results. The response rate was 95% (. Eighty percent ( were women. Satisfaction level in seeking help was the highest for academics (75%. Residents scored mentorship as low in helping to tackle their personal problems (20%. Barriers reported in rapport building with mentor were time constraints and gender difference. The most useful attributes of the mentor which helped rapport building were accessibility, active listening, support for emotional needs, and trustworthiness. Conclusion. Mentoring has a role in trainees’ personal and professional growth especially when their needs are addressed. The effectiveness of the mentorship program in residency can improve if the residents are allowed to choose their own mentors.

  16. A Review of Comparison of Complications of Vaginal Hysterectomy with and without Concomitant Surgery for SUI: A 5 Years’ Experience at a Tertiary Care Hospital of Pakistan

    Directory of Open Access Journals (Sweden)

    Raheela Mohsin Rizvi

    2013-01-01

    Full Text Available Objective. The study was performed to review the complications of surgery for POP with or without surgery for SUI. This included the need for second procedure two years after the primary surgery. Study Design. We conducted a retrospective cross-sectional comparative study at the Aga Khan University, Karachi, Pakistan. International Classification of Diseases, 9th revision, Clinical Modification (ICD-9-CM was used to identify women who underwent vaginal hysterectomy with anterior/posterior repair alone and those with concomitant tension-free vaginal tape surgery for urodynamic stress incontinence. Results. The 28 cases of VH/repair combined with TVT were compared for complications with 430 cases of VH with repair alone. The basic characteristics like age, BMI, and degree of prolapse showed no statistical difference among two groups. The main comorbidities in both groups were hypertension, diabetes, and bronchial asthma. We observed no significant differences in intraoperative and postoperative complications except for cuff abscess, need for medical intervention, and readmission following discharge from hospital, which were higher in cases with vaginal hysterectomy with concomitant TVT. Conclusions. Vaginal hysterectomy is an efficient treatment for uterovaginal prolapse with a swift recovery, short length of hospital stay, and rare serious complications. The addition of surgery for USI does not appear to increase the morbidity.

  17. Focused abdominal CT scan for acute appendicitis in children: can it help in need

    International Nuclear Information System (INIS)

    Akhtar, W.; Ali, S.; Arshad, M.; Nadeem, M.

    2011-01-01

    Objective: To evaluate the focused abdominal CT scan [FACT] in clinically equivocal cases of acute appendicitis in paediatric population. Methods: A cross-sectional study was conducted at the Radiology Department of Aga Khan Hospital, from August 2007 to November 2008. A total of 84 patients (42 males and 42 females) with clinically equivocal signs and symptoms of acute appendicitis referred to radiology department for CT evaluation were studied. CT findings were compared with histopathology and clinical follow-up. Results: The sensitivity of focused CT for acute appendicitis was 91%; specificity was 69% and accuracy of 76% while PPV and NPV were 58%, 94% respectively. Conclusion: Focused unenhanced CT is a quick, accurate and non invasive modality for the assessment of clinically equivocal cases of acute appendicitis for ruling out patients and reducing negative appendectomies. (author)

  18. Body mass status of school children of Dera Ismail Khan, Pakistan.

    Science.gov (United States)

    Ramzan, Muhammad; Ali, Irshad; Khan, Abdus Salam

    2008-01-01

    Childhood obesity is a global epidemic involving both developed and developing countries. It is a stare of over-nutrition with long-term complications such as dyslipidemia, hypertension, and coronary artery disease and type-2 diabetes. Underweight is the result of under nutrition leading to reduction in growth and development of every body organ especially the Central Nervous System. Long-term under-nutrition causes failure in linear growth (height) of the child. Growth is further retarded by the repeated attacks of respiratory infections, diarrhea and anemia as a result of reduced immunity. This study was carried, out eight primary schools of Dera Ismail Khan (Private, semi government organizations, and welfare foundations) having mixed population with some of the wards belonging to high socioeconomic group. Thorough clinical examination excluded those suffering from chronic heath problems. Height and weight of each one was taken body mass index of determined according to 'Quatelet's' index. Body mass index number was plotted on the CDC S age and gender specific growth charts 2-20 years for BMI-for age percentile and body mass status (underweight, normal weight, overweight/at the risk of overweight and obese/overweight. Total 1338 school going children (6-11 years) were examined with 865 (67.75%) boys and 471 (35.25%) as girls. 13.39%, 72.15%, 8.83% and 5.61% as underweight, normal weight, overweight and obese respectively. Percentage of underweight was higher in girls (25%) than boys (13.22). Percentage of obesity was higher (5.17%) in boys than girls (1.39%). Awareness about balanced diet, improvement in the level of education and socioeconomic conditions, easy access to health facilities and prevention of the gender discrimination, are the remedial measures to be taken to redress the situation.

  19. Ethosomal nanocarriers: the impact of constituents and formulation techniques on ethosomal properties, in vivo studies, and clinical trials

    OpenAIRE

    Abdulbaqi, Ibrahim M; Darwis, Yusrida; Khan, Nurzalina Abdul Karim; Assi, Reem Abou; Khan, Arshad A

    2016-01-01

    Ibrahim M Abdulbaqi, Yusrida Darwis, Nurzalina Abdul Karim Khan, Reem Abou Assi, Arshad A Khan School of Pharmaceutical Sciences, Universiti Sains Malaysia, Penang, Malaysia Abstract: Ethosomal systems are novel lipid vesicular carriers containing a relatively high percentage of ethanol. These nanocarriers are especially designed for the efficient delivery of therapeutic agents with different physicochemical properties into deep skin layers and across the skin. Ethosomes have undergone exte...

  20. Khan Krum - ʺThe Fearsomeʺ: A Noble Bulgarian with Iris-Fibroma?

    Directory of Open Access Journals (Sweden)

    Georgi Tchernev

    2017-08-01

    Full Text Available A 40-year-old Caucasian, the otherwise healthy male patient, presented with 3-years history of a prominent tumor-like formation, located on his back, without subjective complaints. Initially, the lesion was 1-2 cm in size but gradually increased to a visible-pronounced tumor-like formation. No other dermatologic diseases, neither other known abnormalities were reported for the medical and family history.  Softly-elastic on palpation tumor-like formation was established in the left infrascapular area of the back, measuring 8/9 cm in diameter. The lesion was clinically suspected for lipoma or another soft-tissue tumour with benign nature, so the patient underwent planned surgical excision under local anaesthesia. A tumour was excited with deep elliptical excision and furthered for histological evaluation, while the wound edges were sutured with single cutaneous stitches. Additionally, a large black-colored tattoo of the Bulgarian historical noble Khan Krum was also observed within the clinical examination, covering almost the whole upper 1/3 part of the patient’s back Within the careful clinical observation of the tattoo, we noticed a fibroma-like lesion, affecting the noble’s right iris. Fibromas are common benign tumours in Caucasians, composed of fibrous or connective tissue. They can be seen in all organs from mesenchymal tissue, in varies size. Eyelids are often commonly affected in elderly. Although very commonly seen in every day dermatological practice, fibromas have been never reported, located in the iris. In the presented case, a small ʺiris-fibromaʺ, hidden within a black-colored tattoo was diagnosed in a patient with lipoma, as a sporadic clinical finding.

  1. Review of the Monograph: Seleznev Yu.V. Russkie knyaz’ya pri dvore khanov Zolotoy Ordy (Russian Princes at the Court of the Golden Horde Khans

    Directory of Open Access Journals (Sweden)

    Nesin M.A.

    2017-12-01

    Full Text Available This article contains a review of the monograph by Yu.V. Seleznev published in early 2017 and dedicated to the relations of Russian princes with the Golden Horde’s khans and their status among the Golden Horde’s nobility. This work is the first comprehensive study in the historiography of this issue for all two and a half centuries of the Tartar domination. The monograph was published for the first time in 2013 and served as the basis for a doctoral dissertation, which Seleznev defended in 2015. The book was reprinted with certain changes in 2017. The book commendably contains an abundance of factual material through the use of diverse sources and strands of historiography. Seleznev examines the social terminology of Golden Horde-Russian relations, the structure of the Golden Horde’s nobility and the trips of princes to the Horde, drawing attention not only to the status of the great Vladimir and Moscow princes, but also that of other great and appanage princes. He makes a significant contribution to the resolving the debate regarding the nature of the Golden Horde’s domination in Rus’ by examining in detail the relationship of the Russian princes with the Golden Horde’s authorities in different years. The book’s author proposed to divide the Golden Horde’s “yoke” into seven periods characterized by “changes in the degree of sovereignty and jurisdiction of the khan in relation to Russian principalities”. The author of this review agrees with the main conclusions of the book under review, but at the same time he notes some reservations and criticisms, which do not, however, reduce the academic caliber of the monograph.

  2. Morbility, clinical data and proteomic analysis of IUGR and AGA newborns at different gestational ages

    Directory of Open Access Journals (Sweden)

    M.D. Ruiz-González

    2016-12-01

    Full Text Available The data are related to the proteomic analysis of 43 newborns with intrauterine growth retardation (IUGR and 45 newborns with appropriate weight for gestational age (AGA carried out by separation via 2DE and analyzed by MS–TOF/TOF. All newborns were separated into three gestational age groups, "Very Preterm" 29–32 weeks, "Moderate Preterm" 33–36 weeks, and, "Term" ≥37weeks. From each newborn, blood was drawn three times from birth to 1 month life. High-abundant serum proteins were depleted, and the minority ones were separated by 2DE and analyzed for significant expression differences. The data reflect analytic and clinic variables analyzed globally and categorized by gestational age in relation to IUGR and the optimization of conditions for 2-DE separation. The data from this study are related to the research article entitled "Alterations of Protein Expression in Serum of Infants with Intrauterine Growth Restriction and Different Gestational Ages" (M.D. Ruis-González, M.D. Cañete, J.L. Gómez-Chaparro, N. Abril, R. Cañete, J. López-Barea, 2015 [1]. The present dataset of serum IUGR newborn proteome can be used as a reference for any study involving intrauterine growth restriction during the first month of life.

  3. Natural radioactivity, dose assessment and uranium uptake by agricultural crops at Khan Al-Zabeeb, Jordan

    International Nuclear Information System (INIS)

    Al-Kharouf, Samer J.; Al-Hamarneh, Ibrahim F.; Dababneh, Munir

    2008-01-01

    Khan Al-Zabeeb, an irrigated cultivated area lies above a superficial uranium deposits, is regularly used to produce vegetables and fruits consumed by the public. Both soil and plant samples collected from the study area were investigated for their natural radioactivity to determine the uranium uptake by crops and hence to estimate the effective dose equivalent to human consumption. Concentrations of 238 U, 235 U, 232 Th, 226 Ra, 222 Rn, 137 Cs and 40 K in nine soil profiles were measured by gamma-ray spectrometry whereas watermelon and zucchini crops were analyzed for their uranium content by means of alpha spectrometry after radiochemical separation. Correlations between measured radionuclides were made and their activity ratios were determined to evaluate their geochemical behavior in the soil profiles. Calculated soil-plant transfer factors indicate that the green parts (leaves, stems and roots) of the studied crops tend to accumulate uranium about two orders of magnitude higher than the fruits. The maximum dose from ingestion of 1 kg of watermelon pulp was estimated to be 3.1 and 4.7 nSv y -1 for 238 U and 234 U, respectively. Estimations of the annual effective dose equivalent due to external exposure showed extremely low values. Radium equivalent activity and external hazard index were seen to exceed the permissible limits of 370 Bq kg -1 and 1, respectively

  4. Pre-natal genetic counselling in a resource limited country - a single center geneticist's perspectives

    International Nuclear Information System (INIS)

    Afroze, B.; Jehan, F.

    2014-01-01

    Objective: To assess the needs related to prenatal genetic counselling in a developing country. Methods: The prospective observational study was conducted at the Prenatal-Genetic Counselling Clinic of Aga Khan University Hospital, Karachi, from October 2007 to September 2010. In-depth interviews were conducted and the data was stored in the form of patient charts. Information was then extracted from the charts and entered into a structured questionnaire. Results: Of the 93 couples in the study, 49(53%) were in the self-referral group and 44(47%) were in the physician-referral group. Diagnosis was not given for previously affected children by the paediatrician or by obstetrician for recurrent miscarriages in 68(73%)cases. Besides, 20(22%) couples had voluntarily terminated a pregnancy without any tests because of the fear of having a diseased child. Eleven (12%) couples were looking for amniocentensis or chorionic villus sampling. Death in previous children was the main reason to seek genetic counselling and was seen in 57(61%) couples. Consanguinity was seen in 77(83%) couples. Conclusion: A clear deficiency of knowledge of genetics was seen among the non-genetic healthcare providers. Demand of antenatal genetic testing among the public was also seen, highlighting the need of diagnostic facility for genetic and metabolic disorders. However, this needs to be explored in the context of the existing healthcare infrastructure. (author)

  5. Functional Outcome of Anorectal Malformations and Associated Anomalies in Era of Krickenbeck Classification

    International Nuclear Information System (INIS)

    Qazi, S. H.; Faruque, A. V.; Khan, M. A. M.

    2016-01-01

    Objective: To describe the management and functional outcome of anorectal malformations and associated anomalies according to Krickenbeck classification. Study Design: Case series. Place and Duration of Study: The Aga Khan University Hospital, Karachi, from January 2002 to December 2012. Methodology: Anorectal anomalies were classified according to Krickenbeck classification. Data was collected and proforma used regarding the primary disease associated anomalies, its management and functional outcome, according to Krickenbeck classification. Cases included were: all those children with imperforate anus managed during the study period. Qualitative variables like gender and functional outcome were reported as frequencies and percentages. Quantitative variables like age were reported as medians with interquartile ranges. Results: There were 84 children in study group. Most common associated anomaly was cardiac (38 percent), followed by urological anomaly (33 percent). All children were treated by Posterior Sagittal Anorectoplasty (PSARP). Fistula was present in 64 out of 84 (76 percent) cases. The most common fistula was rectourethral (33 percent), followed by recto vestibular (31 percent). According to Krickenbeck classification, continence was achieved in 62 percent children; however 27 percent children were constipated, followed by 12 percent children having fecal soiling. Conclusion: Functional outcome of anorectal malformation depends upon severity of disease. A thorough evaluation of all infants with ARM should be done with particular focus on cardiovascular (38 percent) and genitourinary abnormalities (33 percent). (author)

  6. Benzodiazepine use in medical out-patient clinics: a study from a developing country

    International Nuclear Information System (INIS)

    Patel, M.J.; Ahmer, S.; Khan, F.; Qureshi, A.W.A.; Shehzad, M.F.

    2013-01-01

    Objective: To estimate the prevalence of Benzodiazepine use in the outpatient setting of general medicine clinics at a single tertiary care centre. Methods: The prospective prevalence study was conducted in the outpatient setting of Internal Medicine Clinics at Aga Khan University Hospital, Karachi, from November to December 2009. All subjects were interviewed after informed consent and variables were recorded on a specially-designed proforma. Apart from basic demographics and comorbid conditions, duration, frequency and route of benzodiazepine use, as well as the reason and who initiated it was noted. Chi-square test and t test was applied to see the association of socio demographic or clinical factors with the use of benzodiazepine. Results: Of the 355 patients, 129 (36.33%) reported using the drug. The majority (n=86; 24.2%) were taking it on a daily basis. The highest numbers of patients using the drug were suffering from cardiovascular problems, 32 (25%) followed by 22 (17%) from endocrinology. Diazepam equivalent dose was around 7.04+-4, with a inter-quartile range of 3-96 weeks. Alprazolam (9%) was the most frequently prescribed Benzodiazepine. Conclusion: Benzodiazepine use is alarmingly high in the outpatient clinics of General Internal Medicine Department. There is no implementation of law to prevent its hazardous sale. In this regard all concerned should work collectively for awareness and irrational drug sale and use. (author)

  7. Subacute Sclerosing Panencephalitis: Clinical and Demographic Characteristics

    International Nuclear Information System (INIS)

    Rafique, A.; Amjad, N.; Chand, P.; Ahmed, K.; Ibrahim, S.; Zaidi, S. S. Z.; Rana, M. S.

    2014-01-01

    Objective: To determine the clinical and demographic characteristics of children diagnosed with Subacute sclerosing panencephalitis (SSPE). Study Design: Case series. Place and Duration of Study: The Aga Khan University Hospital, Karachi, from January 2000 to June 2012. Methodology: A retrospective analysis was done, regarding medical charts of 43 children under the age of 16 years with a discharge diagnosis of SSPE. Demographic and clinical characteristics were recorded. Results were expressed as percentages. Results: Most of the 43 patients were male (72%). The average age at presentation was 8.7 years with average duration of symptoms being 100.6 days. History of measles was present in 17 patients (39.5%). All children had seizures at presentation and 65% had cognitive impairment. Most patients required poly therapy for control of seizures. Sodium valproate was the most commonly used anti-epileptic agent; Isoprinosine was tried in 22 (51%) patients. CSF for antimeasles antibodies was positive in approximately 86% of the 40 (93%) children. EEG showed burst suppression pattern in 36 (83.7%) cases. Forty-two patients (97.6%) were discharged home in a vegetative state. Conclusion: SSPE is progressive neurodegenerative disorder. It can be prevented by timely immunization against measles. Measles antibody in the CSF is diagnostic for SSPE and is helpful in early diagnosis. Most patients experience a gradual but progressive decline in motor and cognitive functions. (author)

  8. Comparison between intravenous boluses versus infusion of tranexamic acid (TXA) to reduce bleeding in paediatric cyanotic congenital heart disease (CHD) surgeries

    International Nuclear Information System (INIS)

    Junejo, F.; Irfan, M.; Akhtar, M.I.; Hamid, M.; Ahmed, S.S.

    2018-01-01

    To compare the intravenous boluses and intravenous continuous infusion of tranexamic acid (TXA) to reduce postoperative bleeding in cyanotic congenital heart disease surgeries. Study Design:Single-blinded randomised clinical trial. Place and Duration of Study:Anaesthesia Department, The Aga Khan University Hospital, Karachi, from July 2016 to April 2017. Methodology:Sixty patients of cyanotic congenital heart disease, undergoing either palliative or corrective surgery involving cardiopulmonary bypass (CPB), were recruited. These 60 patients were divided randomly into two groups. The infusion group received intravenous infusion of TXA at 5 mg/kg/hour while the bolus group received three intravenous boluses of 10 mg/kg after induction, after going to bypass and after protamine reversal. Data was collected through predesigned proforma. There were two primary outcomes: postoperative bleeding in the first 24 hours, and chest closure time. Results:Postoperative bleeding was 13.94 (10.27-20.18) ml/kg in the first 24 hours in infusion group and 15.05 (9.04-23.50) ml/kg in the bolus group. Chest closure time was 38.5 (25-45) in infusion group and 30 (20-46.25) minutes in the bolus group. There was no statistically significant and clinical difference between both groups regarding postoperative bleeding in the first 24 hours and chest closure time. Conclusion:These infusion and bolus groups had comparable postoperative bleeding and chest closure time. (author)

  9. Flipped classroom instructional approach in undergraduate medical education

    Science.gov (United States)

    Fatima, Syeda Sadia; Arain, Fazal Manzoor; Enam, Syed Ather

    2017-01-01

    Objective: In this study we implemented the “flipped classroom” model to enhance active learning in medical students taking neurosciences module at Aga Khan University, Karachi. Methods: Ninety eight undergraduate medical students participated in this study. The study was conducted from January till March 2017. Study material was provided to students in form of video lecture and reading material for the non-face to face sitting, while face to face time was spent on activities such as case solving, group discussions, and quizzes to consolidate learning under the supervision of faculty. To ensure deeper learning, we used pre- and post-class quizzes, work sheets and blog posts for each session. Student feedback was recorded via a likert scale survey. Results: Eighty four percent students gave positive responses towards utility of flipped classroom in terms of being highly interactive, thought provoking and activity lead learning. Seventy five percent of the class completed the pre-session preparation. Students reported that their queries and misconceptions were cleared in a much better way in the face-to-face session as compared to the traditional setting (4.09 ±1.04). Conclusion: Flipped classroom(FCR) teaching and learning pedagogy is an effective way of enhancing student engagement and active learning. Thus, this pedagogy can be used as an effective tool in medical schools. PMID:29492071

  10. A comparison of WHO guidelines issued in 1997 and 2009 for dengue fever 1 single centre experience

    International Nuclear Information System (INIS)

    Khursheed, M.; Khan, U.R.; Fayyaz, J.; Qamar, I.; Razzak, J.A.

    2013-01-01

    Objective: To compare the original (1997) and revised (2009) versions of World Health Organization guidelines for dengue patients Methods: Adult patients with a positive dengue Immunoglobulin M serology, and a diagnosis of dengue were included in the study at Aga Khan University Hospital during a three-year period from January 2005 to December 2007. Data related to these dengue patients was collected from their medical records. Guidelines were then applied by the research assistant and correlation among these guidelines was computed. SPSS 19 was used for statistical analysis. Results: A total of 612 patients were found with a diagnosis of dengue, but only 439 (71.73%) had a positive IgM. The median age of these 439 patients was 28 (interquartile range: 18) years and majority of them were males, 295 (67%). According to the 1997 guidelines, 383 (87%) patients were classified as having dengue, while according to the 2009 guidelines, all the 439 (100%) patients were classified with a dengue infection. Under WHO 1997, 21 (5.5%) cases were classified as dengue shock syndrome, while 2009 guidelines labelled 88 (20%) cases as severe dengue. There was a consensus on only 11 severe cases by both the guidelines, showing different results between the two. Conclusion: By using 2009 guidelines, a physician would classify more dengue patients as having severe disease. (author)

  11. Rectal carcinoma under 40 years of age: seven-year post-treatment follow-up at a tertiary care hospital in Pakistan

    International Nuclear Information System (INIS)

    Haroon, N.; Khan, S.; Alvi, R.

    2013-01-01

    Objectives: To determine epidemiological characteristics, clinical presentation, histopathological features, and long-term follow-up of patients below 40 years of age with carcinoma rectum. Methods: The retrospective case series comprised all patients presenting with histopathological diagnosis of carcinoma rectum with age 15-40 years at the Aga Khan University Hospital between January 1994 and December 2004. Details regarding patient demographics, pre-operative assessment, management and tumour grade and stage were obtained from a prospectively maintained database. Continuous and categorical variables in the data were analysed. Results: Of the 23 patients in the study, 14 (60.89%) were male and 9 (39.13%) were female. Mean age of the subjects was 31+-5 years. Overall, 22 (95.6%) patients presented with rectal bleeding and 12 (52%) had altered bowel habit. The most common site for the tumour was lower rectum (n=20; 87%) and 13 (56.5%) required abdominoperineal resection. Local recurrence rate was 13% (n=3) and distant metastasis occurred in 2 (8.6%) patients during the seven year follow-up. Two (8.6%) patients died, and both had distant metastasis. Conclusion: Carcinoma rectum is uncommon but an important malignancy in patients aged below 40 years. The clinician should have a high index of suspicion in young patients presenting with bleeding per rectum, altered bowel habit and weight-loss. (author)

  12. Conformity to the surviving sepsis campaign international guidelines among physicians in a general intensive care unit in Nairobi.

    Science.gov (United States)

    Mung'ayi, V; Karuga, R

    2010-08-01

    There are emerging therapies for managing septic critically-ill patients. There is little data from the developing world on their usage. To determine the conformity rate for resuscitation and management bundles for septic patients amongst physicians in a general intensive care unit. Cross sectional observational study. The general intensive care unit, Aga Khan University Hospital,Nairobi. Admitting physicians from all specialties in the general intensive care unit. The physicians had high conformity rates of 92% and 96% for the fluid resuscitation and use of va so pressors respectively for the initial resuscitation bundle. They had moderate conformity rates for blood cultures prior to administering antibiotics (57%) and administration of antibiotics within first hour of recognition of septic shock (54%). There was high conformity rate to the glucose control policy (81%), use of protective lung strategy in acute lung injury/Acute respiratory distress syndrome, venous thromboembolism prophylaxis (100%) and stress ulcer prophylaxis (100%) in the management bundle. Conformity was moderate for use of sedation, analgesia and muscle relaxant policy (69%), continuous renal replacement therapies (54%) and low for steroid policy (35%), administration ofdrotrecogin alfa (0%) and selective digestive decontamination (15%). There is varying conformity to the international sepsis guidelines among physicians caring for patients in our general ICU. Since increased conformity would improve survival and reduce morbidity, there is need for sustained education and guideline based performance improvement.

  13. Risk factors predisposing to congenital heart defects

    International Nuclear Information System (INIS)

    Ul Haq, Faheem; Jalil, Fatima; Hashmi, Saman; Jumani, Maliha Iqbal; Imdad, Aamer; Jabeen, Mehnaz; Hashmi, Javad Tauseef; Irfan, Furqan Bin; Imran, Muhammad; Atiq, Mehnaz

    2011-01-01

    Congenital heart disease (CHD) is associated with multiple risk factors, consanguinity may be one such significant factor. The role of consanguinity in the etiology of CHD is supported by inbreeding studies, which demonstrate an autosomal recessive pattern of inheritance of some congenital heart defects. This study was done to find out the risk factors for CHD. A case-control study was done on pediatric patients at a tertiary care hospital, Aga Khan University Hospital, located in Karachi, Pakistan. A total of 500 patients, 250 cases and 250 controls were included in the study. Amongst the 250 cases (i.e. those diagnosed with CHD), 122 patients (48.8%) were born of consanguineous marriages while in the controls (i.e. non-CHD) only 72 patients (28.9%) showed a consanguinity amongst parents. On multivariate analysis, consanguinity emerged as an independent risk factor for CHD; adjusted odds ratio 2.59 (95% C. I. 1.73 - 3.87). Other risk factors included low birth weight, maternal co-morbidities, family history of CHD and first born child. On the other hand, medications used by the mother during the index pregnancy, maternal age and gender of the child did not significantly increase the risk of developing CHD. Analyses of our results show that parental consanguinity, family history of CHD, maternal co-morbidities, first born child and low birth weight are independent risk factors for CHD

  14. Role of serum angiotensin converting enzyme in sarcoidosis.

    Science.gov (United States)

    Khan, A H; Ghani, F; Khan, A; Khan, M A; Khurshid, M

    1998-05-01

    This study was conducted to determine the role of Serum Angiotensin Converting Enzyme (SACE) as a marker in the differential diagnosis of pulmonary diseases and prognosis of sarcoidosis. A retrospective analysis of 113 medical records of patients at The Aga Khan University Hospital, with laboratory investigation for SACE was performed. Among 113 patients, 51 cases were found to have sarcoidosis, 44 of them had SACE levels greater than 52 IU/L (mean ACE 104.44). SACE levels were also found elevated in other clinical conditions like tuberculosis (mean 58.64 IU/L), but the enzyme level were less (p 0.04) than those found in sarcoidosis (mean (92.97 IU/L). SACE activity was found to be considerably lower in other chronic lung diseases such as, fibrosing alveolitis (mean 43.98 IU/L), interstitial lung disease (mean 42.11 IU/L) and chronic obstructive lung disease (mean 40.85 IU/L). Twenty patients of sarcoidosis, who received steroid treatment subsequently showed a decline in the SACE levels. SACE is a useful marker in differential diagnosis as 37.2% cases of sarcoidosis compared to only 9.09% of tuberculosis had SACE levels greater than 100 IU/L. In addition, our data also suggest that serum ACE is useful for the diagnosis as well as monitoring prognosis in sarcoidosis.

  15. Trends of lipid abnormalities in Pakistani type-2 diabetes mellitus patients: a tertiary care centre data

    International Nuclear Information System (INIS)

    Bhatti, S.M.; Dhakam, S.; Khan, M.A.

    2009-01-01

    Objective: To ascertain trends of lipid abnormalities in Pakistani Type-2 Diabetes Mellitus patients. Methodology: Fasting lipid profiles of 328 outpatient adult type 2 diabetes mellitus patients visiting the Aga Khan University Hospital, from January 2005 to January 2006 were prospectively reviewed and abstracted on a pre-specified proforma. Demographic features, different patterns of dyslipidemia in accordance with specified risk categories, and the proportion of patients with none, one, two, or three lipid values outside clinical targets were noted. The influence of sex on dyslipidemia pattern was also assessed Results: Our patients had higher average HbA1c levels and higher total cholesterol, LDL and lower HDL levels. The triglycerides levels in our female patients were higher. The percentage of our patients with a high-, borderline-, or low-risk LDL cholesterol were 54, 29, and 16%, respectively (P = 0.51). On a percentage basis, 73% were in the high-risk HDL cholesterol group, 18% were in the borderline-risk group and 9% in the low-risk group, respectively (P 100mg/dl. Conclusion: Combination of high LDL and a low HDL cholesterol level was the commonest pattern of dyslipidemia found. Second was unfavorable levels of all three lipoproteins combined and the third was an isolated increase in LDL cholesterol. A greater proportion of women were found dyslipidemic. (author)

  16. Information on Genghis Khan, Berke, and Khan Uzbek in Bibliographic Collection of al-Safadi, Salah al-Din Khalil (d. 764 AH. Al-Wafi bi al-vafiyat (الوافي بالوفياب أو تاريخ الصفدي (Complete collection of biographies of deceased persons or the history of al-Safadi »

    Directory of Open Access Journals (Sweden)

    D.R. Zaynuddinov

    2015-09-01

    biographical dictionary “Complete Collection of Biographies of Deceased Persons” written by Mamluk historian al-Safadi (696 AH / 1297 – 764 AH / 1363. This article contains: I a brief examination of the life and creative activities of the historian and description of his works; II description of biographical collection “Al-Wafi bi al-vafiyat” (الوافي بالوفياب أو تاريخ الصفدي (Complete Collection of Biographies of Deceased Persons or the History of al-Safadi; III translation and facsimiles of biographies of such khans as Genghis Khan, khan Berke, and khan Uzbek.

  17. 2018-04-17T18:44:22Z https://www.ajol.info/index.php/all/oai oai:ojs ...

    African Journals Online (AJOL)

    ... University of Rajshahi, Rajshahi-6205, Bangladesh Astaq Mohal Khan, G.R.M.; BCSIR Laboratories, Rajshahi-6206, Bangladesh Sarmina Yeasmin, Mst.; Department of Applied Chemistry and Chemical Technology, University of Rajshahi, Rajshahi-6205, Bangladesh Mesua ferrea, Seed oil, Glyceride compositions, Fatty ...

  18. Environmental geochemistry of surface and subsurface water from Dera Ismail Khan Division, Khyber Pakhtunkhwa, Pakistan

    International Nuclear Information System (INIS)

    Shah, M.T.; Alizai, A.H.; Khan, S.D.

    2012-01-01

    The Dera Ismail Khan division is situated in the southern most part of the Khyber-Pakhtunkhwa province in Pakistan. Majority of population in this region obtain domestic water from tube wells, dug wells, ponds, stored run off of the Indus and Gomal rivers and perennial streams. This study is aimed to determine the physio-chemical contaminants in the surface and subsurface water which could cause environmental problem. For this purpose, representative water sample were collected from tube wells, dug wells, streams and rivers. These analyses were performed using Hach DR/2000 spectrophotometer and graphite furnace atomic absorption spectrometer. Chemically both surface and subsurface water samples of the area were classified as alkaline fresh water. The comparison of the data with standard limits set by Word Health Organization (WHO) for drinking water suggested that in certain areas of the division, the drinking water samples have high concentrations of Total Dissolved Solids, NO/sub 3//sup 2-/, SO/sub 4//sup 2-/, F-, Cl-, Fe/sup 2+/, Ca/sup 2+/, Mg/sup 2+/, Pb/sup 2+/, Ni/sup 2+/ and Cd/sup 2+/ while pH, EC, HCO/sub 3/-, PO/sub 4//sup 3-/, Na/sup +/, Mn/sup 2+/, K/sup +/, Cr/sup 3+/ and Zn/sup 2+/ were within the permissible limits. These contaminations could be attributed to the geogenic sources which might be responsible for the health related problems in certain areas of the division. (author)

  19. Natural radioactivity, dose assessment and uranium uptake by agricultural crops at Khan Al-Zabeeb, Jordan

    Energy Technology Data Exchange (ETDEWEB)

    Al-Kharouf, Samer J. [Royal Scientific Society, Amman 11941 (Jordan); Al-Hamarneh, Ibrahim F. [Prince Abdullah Bin Ghazi Faculty of Science and IT, Al-Balqa Applied University (BAU), Salt 19117 (Jordan)], E-mail: hamarnehibrahim@yahoo.com; Dababneh, Munir [Prince Abdullah Bin Ghazi Faculty of Science and IT, Al-Balqa Applied University (BAU), Salt 19117 (Jordan)

    2008-07-15

    Khan Al-Zabeeb, an irrigated cultivated area lies above a superficial uranium deposits, is regularly used to produce vegetables and fruits consumed by the public. Both soil and plant samples collected from the study area were investigated for their natural radioactivity to determine the uranium uptake by crops and hence to estimate the effective dose equivalent to human consumption. Concentrations of {sup 238}U, {sup 235}U, {sup 232}Th, {sup 226}Ra, {sup 222}Rn, {sup 137}Cs and {sup 40}K in nine soil profiles were measured by gamma-ray spectrometry whereas watermelon and zucchini crops were analyzed for their uranium content by means of alpha spectrometry after radiochemical separation. Correlations between measured radionuclides were made and their activity ratios were determined to evaluate their geochemical behavior in the soil profiles. Calculated soil-plant transfer factors indicate that the green parts (leaves, stems and roots) of the studied crops tend to accumulate uranium about two orders of magnitude higher than the fruits. The maximum dose from ingestion of 1 kg of watermelon pulp was estimated to be 3.1 and 4.7 nSv y{sup -1} for {sup 238}U and {sup 234}U, respectively. Estimations of the annual effective dose equivalent due to external exposure showed extremely low values. Radium equivalent activity and external hazard index were seen to exceed the permissible limits of 370 Bq kg{sup -1} and 1, respectively.

  20. Pesticides in shallow groundwater of Bahawalnagar, Muzafargarh, D.G. Khan and Rajan Pur districts of Punjab, Pakistan.

    Science.gov (United States)

    Tariq, Muhammad Ilyas; Afzal, Shahzad; Hussain, Ishtiaq

    2004-06-01

    In Pakistan there is little data on environmental contamination of rural water sources by pesticides. This study evaluated pesticide contamination of groundwater in four intensive cotton growing districts. Water samples were collected from 37 rural open wells in the areas of Bahwalnagar, Muzafargarh, D.G. Khan and Rajan Pur districts of Punjab and analysed for eight pesticides which are mostly used. Information on types of pesticide used and distance to nearest pesticide mixing area and application areas was obtained for each site. From the eight pesticides analysed, six pesticides were detected in the water samples. Only cypermethrin and cabosulfan were not detected. The percentage of detection of bifenthrin, lambda-cyhalothrin, carbofuran, endosulfan, methyl parathion and monocrotophos was, respectively 13.5%, 5.4%, 59.4%, 8%, 5.4% and 35.1% in July; 16.2%, 13.55%, 43.2%, 8%, N.D. (not detected) and 24.3% in October. Maximum contamination levels (MCLs) established by the U.S. Environmental Protection Agency for drinking water were not exceeded. The study has shown the need for monitoring pesticide contamination in rural water resources, and the development of drinking water quality standards for specific pesticides in Pakistan. The conclusions and recommendations will be disseminated to senior decision makers in central and local governments, extension agents and farmers.

  1. Synthesis and characterization of ZnO nanostructures with varying ...

    Indian Academy of Sciences (India)

    Author Affiliations. KHALIDA AKHTAR1 NAILA ZUBAIR1 SAIRA IKRAM2 ZIA ULLAH KHAN1 HINA KHALID1. National Centre of Excellence in Physical Chemistry, University of Peshawar, Peshawar 25120, Pakistan; Khyber College of Dentistry, Khyber Medical University, Peshawar 25120, Pakistan ...

  2. Collection d'entretiens avec des chercheurs participant à des ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Costa Rica, Guatemala, and Nicaragua). Ritesh Kumar Wetlands International - South Asia (India). Muhammad Shah Alam Khan Bangladesh University of Engineering and Technology (India, Bangladesh, Nepal, and Pakistan). Osvaldo Girardin

  3. Journal of Chemical Sciences | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Mohammad Sadiq1 Muhammad Ali1 Rashid Iqbal1 Khalid Saeed1 Aimal Khan1 Muhammad Naveed Umar1 Haroon Ur Rashid2. Department of Chemistry, University of Malakand, Chakdara, Dir (L), Khyber Pakhtunkhwa, Pakistan; Department of Chemistry, Sarhad University of Science and Information Technology, ...

  4. Visible-light-responsive ZnCuO nanoparticles: benign photodynamic killers of infectious protozoans

    Directory of Open Access Journals (Sweden)

    Nadhman A

    2015-11-01

    Full Text Available Akhtar Nadhman,1,2 Samina Nazir,2 Malik Ihsanullah Khan,1 Attiya Ayub,2,3 Bakhtiar Muhammad,3 Momin Khan,1 Dilawar Farhan Shams,4 Masoom Yasinzai1,5 1Department of Biotechnology, Quaid-i-Azam University, Islamabad, Pakistan; 2Nanosciences and Catalysis Division, National Centre for Physics, Quaid-i-Azam University Campus, Islamabad, Pakistan; 3Department of Chemistry, Hazara University, Dhodial, Pakistan; 4Department of Environmental Sciences, Abdul Wali Khan University Mardan, Mardan, Pakistan; 5Center of Interdisciplinary Research, International Islamic University, Islamabad, Pakistan Abstract: Human beings suffer from several infectious agents such as viruses, bacteria, and protozoans. Recently, there has been a great interest in developing biocompatible nanostructures to deal with infectious agents. This study investigated benign ZnCuO nanostructures that were visible-light-responsive due to the resident copper in the lattice. The nanostructures were synthesized through a size-controlled hot-injection process, which was adaptable to the surface ligation processes. The nanostructures were then characterized through transmission electron microscopy, X-ray diffraction, diffused reflectance spectroscopy, Rutherford backscattering, and photoluminescence analysis to measure crystallite nature, size, luminescence, composition, and band-gap analyses. Antiprotozoal efficiency of the current nanoparticles revealed the photodynamic killing of Leishmania protozoan, thus acting as efficient metal-based photosensitizers. The crystalline nanoparticles showed good biocompatibility when tested for macrophage toxicity and in hemolysis assays. The study opens a wide avenue for using toxic material in resident nontoxic forms as an effective antiprotozoal treatment. Keywords: zinc oxide, nanoparticles, doping, photodynamic therapy, Leishmania

  5. Bomb Blast and Its Consequences: Successful Intensive Care Management of Massive Pulmonary Embolsim.

    Science.gov (United States)

    Shamim, Faisal; Rizwan, Muhammad; Aziz, Adil

    2016-06-01

    A suicide bomb blast in 2013 at a distant city of Pakistan killed 84 and wounded more than 150 people. Some patients were transferred to our tertiary care hospital because of extreme load on medical services there. This patient arrived at the Aga Khan Hospital, 2 days after the bomb blast injury and underwent an orthopedic procedure. Next day, he developed sudden tachypnea, desaturation, and circulatory collapse. After initial cardiopulmonary resuscitation, he was immediately transferred to surgical intensive care unit. Based on history, echocardiography findings and patient parameters, a clinical diagnosis of massive pulmonary embolism was made and immediate thrombolytic therapy with alteplase was started. The immediate improvement in hemodynamic status was evident following 2 hours of alteplase infusion. This case also highlights the aggressiveness of resuscitation, decision making in initiating thrombolytic therapy on clinical grounds, importance of deep venous thrombosis prophylaxis, and exhaustion of health resources due to blast related mass destruction.

  6. Quaternary selenostannates Na{sub 2-x}Ga{sub 2-x}Sn{sub 1+x}Se{sub 6} and AGaSnSe{sub 4} (A=K, Rb, and Cs) through rapid cooling of melts. Kinetics versus thermodynamics in the polymorphism of AGaSnSe{sub 4}

    Energy Technology Data Exchange (ETDEWEB)

    Hwang, S -J; Iyer, R G; Kanatzidis, M G

    2004-10-01

    The quaternary alkali-metal gallium selenostannates, Na{sub 2-x}Ga{sub 2-x}Sn{sub 1+x}Se{sub 6} and AGaSnSe{sub 4} (A=K, Rb, and Cs), were synthesized by reacting alkali-metal selenide, Ga, Sn, and Se with a flame melting-rapid cooling method. Na{sub 2-x}Ga{sub 2-x}Sn{sub 1+x}Se{sub 6} crystallizes in the non-centrosymmetric space group C2 with cell constants a=13.308(3) A, b=7.594(2) A, c=13.842(3) A, {beta}=118.730(4) deg., V=1226.7(5) A{sup 3}. {alpha}-KGaSnSe{sub 4} crystallizes in the tetragonal space group I4/mcm with a=8.186(5) A and c=6.403(5) A, V=429.1(5) A{sup 3}. {beta}-KGaSnSe{sub 4} crystallizes in the space group P2{sub 1}/c with cell constants a=7.490(2) A, b=12.578(3) A, c=18.306(5) A, {beta}=98.653(5) deg., V=1705.0(8) A{sup 3}. The unit cell of isostructural RbGaSnSe{sub 4} is a=7.567(2) A, b=12.656(3) A, c=18.277(4) A, {beta}=95.924(4) deg., V=1741.1(7) A{sup 3}. CsGaSnSe{sub 4} crystallizes in the orthorhombic space group Pmcn with a=7.679(2) A, b=12.655(3) A, c=18.278(5) A, V=1776.1(8) A{sup 3}. The structure of Na{sub 2-x}Ga{sub 2-x}Sn{sub 1+x}Se{sub 6} consists of a polar three-dimensional network of trimeric (Sn,Ga){sub 3}Se{sub 9} units with Na atoms located in tunnels. The AGaSnSe{sub 4} possess layered structures. The compounds show nearly the same Raman spectral features, except for Na{sub 2-x}Ga{sub 2-x}Sn{sub 1+x}Se{sub 6}. Optical band gaps, determined from UV-Vis spectroscopy, range from 1.50 eV in Na{sub 2-x}Ga{sub 2-x}Sn{sub 1+x}Se{sub 6} to 1.97 eV in CsGaSnSe{sub 4}. Cooling of the melts of KGaSnSe{sub 4} and RbGaSnSe{sub 4} produces only kinetically stable products. The thermodynamically stable product is accessible under extended annealing, which leads to the so-called {gamma}-form (BaGa{sub 2}S{sub 4}-type) of these compounds.

  7. Diagnostic Accuracy of Diffusion Weighted Magnetic Resonance Imaging in the Detection of Myometrial Invasion in Endometrial Carcinoma

    International Nuclear Information System (INIS)

    Masroor, I.; Hussain, Z.; Taufiq, M.

    2016-01-01

    Objective: To determine the diagnostic accuracy of Diffusion-Weighted Magnetic Resonance Imaging (DWMRI) in the detection of myometrial invasion in endometrial cancer taking histopathology as gold standard. Study Design: Cross-sectional validation study. Place and Duration of Study: Department of Radiology, The Aga Khan University Hospital, Karachi, from January to December 2012. Methodology: DWMRI (b-value = 50,400 and 800 s/mm2) was performed in 85 patients of biopsy-proven endometrial carcinoma before hysterectomy using body and spine coil at 1.5 Tesla. DWI was evaluated for presence of myometrial invasion by tumor with histopathology as gold standard. Sensitivity, specificity, the negative predictive value and positive predictive value and accuracy of DWI were assessed against the gold standard. Results: On DWI, superficial myometrial invasion was found in 42 patients and deep myometrial invasion in 43. On histopathology, superficial myometrial invasion was found in 53 patients and deep myometrial invasion in 32. Hence sensitivity, specificity, positive predictive value, negative predictive value and accuracy for the assessment of myometrial invasion by endometrial tumor on DW images was 90 percentage, 73 percentage, 67 percentage, 92 percentage and 80 percentage, respectively. Diagnostic accuracy of diffusion-weighted magnetic resonance imaging in detection of myometrial invasion in endometrial cancer was 80 percentage. Conclusion: DWI is highly accurate in assessing myometrial invasion and can be used as an adjunct to routine MRI for pre-operative evaluation of myometrial invasion of endometrial cancer. (author)

  8. Nutritional status in patients with hepatitis C

    International Nuclear Information System (INIS)

    Ismail, F.W.; Khan, R.A.; Kamani, L.; Shah, H.A.; Jafri, W.

    2012-01-01

    To assess the nutritional status via the SGA (subjective global assessment) screening tool of patients at all stages of hepatitis C virus (HCV) liver disease. Study Design: Descriptive study. Place and Duration of Study: Out-patient Clinics of the Aga Khan University Hospital, Karachi, conducted from October 2009 to January 2011. Methodology: Patients with hepatitis C virus infection and their HCV-negative attendants were enrolled from the outpatient clinics, and categorized into 4 groups of 100 patients each: healthy controls (HC), those with chronic hepatitis C infection (CHC), compensated cirrhotics (CC) and decompensated cirrhotics (DC). The validated subjective global assessment (SGA) tool was used to assess nutritional status. Results: A total of 400 patients were enrolled. Most of the patients in the HC group were class 'A' (best nutritional status). In contrast, the majority (64%) in the DC group were in the class 'C' (worst status). The compensated cirrhosis (CC) group showed that 90% of patients were malnourished, while 98% of all patients were malnourished in the DC group, predominantly class 'C'. Most importantly, 14% of patients with chronic hepatitis C (CHC) also scored a 'B' on the SGA; which when compared to HC was statistically significant (p=0.005). As the groups progressed in their disease from CHC to DC, the transition in nutritional status from 'A' to 'C' between groups was statistically significant. Conclusion: Malnutrition occurs early in the course of HCV, and progresses relentlessly throughout the spectrum of HCV disease. (author)

  9. Pain associated with liver biopsies through percutaneous approach under sono-graphic guidance-a cross sectional pilot study in a tertiary care hospital

    International Nuclear Information System (INIS)

    Baig, M.A.

    2015-01-01

    Pain is one of the most common and feared complication of percutaneous liver biopsy under local anaesthesia using sonographic guidance. This observational study was set to judge the intensity of pain felt by adult patients presenting for percutaneous liver biopsy with known/suspected underlying hepatic pathology. Methods: This observational cross sectional study which was piloted on 10% of the original sample size was conducted at Aga Khan University Hospital, Karachi. Study population was the adult patients coming for percutaneous liver biopsy at the Department of Radiology. Descriptive statistics were run, data was checked for normality. Means and Standard deviations were done for continuous variables and where data was skewed, median with inter quartile range was computed. Later data was clumped in categories, frequency and percentages were reported for categorical variables. Graphical representation of data was done. Results: A total of 50 patients were recruited. Minimum pain reported on visual analogue scale (VAS) was 0 and maximum as 4.30% of patients rated 3 and similarly 30% of the people rated 4 on the VAS. Mean pain experienced was 2.7 ± 1.11 and a median of 3 on VAS. This indicates that a minority of patients in our survey had a complaint of mild pain during the procedure. Conclusions: Percutaneous liver biopsy is a very safe procedure and minimal pain was felt by a minority of patients whereas the rest showed satisfaction from the procedure with no post procedural complaints. (author)

  10. Effect of early release of tourniquet in total knee arthroplasty

    International Nuclear Information System (INIS)

    Abbas, K.; Raza, H.; Umer, M.; Hafiz, K.

    2013-01-01

    To evaluate whether tourniquet release intraoperatively is better than postoperative release in reducing overall blood loss, duration of surgery, duration of tourniquet, length of hospital stay, wound related complications and transfusion requirement. Study Design: Comparative study. Place and Duration of Study: Department of Surgery, The Aga Khan University Hospital, Karachi, from January 2004 to June 2007. Methodology: One hundred and thirty patient files were reviewed retrospectively. Patients were divided into two groups. Group-A consisted of 65 patients with early deflation of tourniquet and group-B comprised of 65 patients with the release of tourniquet after applying compressive dressing. Total blood loss (determined by Gross method) and other study variables were noted as per objective and computed. Results: There were 22 males and 108 females with comparable BMI. All had undergone posterior stabilized cemented total knee replacement. Calculated blood loss was 1.208 L and 1.108 L in group-A and B respectively (p = 0.27). Significant increase in duration of surgery was noted in group-A patients. Four patients in group-B showed complication related to wound with 3 being minor and 1 requiring additional operation room visit. Mean length of hospital stay was 9 days. Transfusion frequency was higher in group-B despite comparable postoperative haemoglobin values. Conclusion: Intraoperative tourniquet release does not reduce overall blood loss with no effect in conserving blood after total knee replacement, however, this group had relatively shorter hospital stay. (author)

  11. Factors that affect implementation of web-based faculty evaluation forms: residents' perspectives from a developing country.

    Science.gov (United States)

    Ibrahim, S H; Ali, S K; Sadaf, S

    2010-08-01

    A web-based evaluation system for residents to provide feedback on faculty was piloted in four training programs at the Aga Khan University prior to institution-wide implementation. Of the four programs, less than 50% of forms were submitted by residents of three programs while more than 70% of forms were submitted by the residents of one program. This study was conducted to identify reasons for the varying participation rates of the four programs with a view to improving the system. A qualitative approach was employed using focus group discussions (FGDs). Volunteers were invited and three groups of eight to ten residents each were formed. Participants for FGDs were selected from all residency years. FGDs were used to identify residents' perceptions regarding the web-based faculty evaluation system and to identify residents' problems and concerns with completing the web-based faculty evaluating forms. Technical issues in completing and submitting the forms online were identified to be the main deterrents to completing the evaluation forms. Non-accessibility of a resource person for resolving technical problems with the software and the burden of taking time out to complete the forms were considered as limiting factors by many residents. Residents recommended a focused orientation session to the new system within the departments. Residents' confidence and support are key to promoting adequate participation in web-based evaluations. Focused orientation sessions, reinforcement, reminders, assurances of confidentiality, and removal of technical glitches should help to improve resident participation.

  12. Risk factors associated with development of ventilator associated pneumonia.

    Science.gov (United States)

    Noor, Ahmed; Hussain, Syed Fayyaz

    2005-02-01

    To assess the risk factors associated with development of ventilator associated pneumonia (VAP). A case control study. Intensive Care Unit (ICU) at the Aga Khan University Hospital, Karachi, between January 1999 and June 2000. All patients with assisted mechanical ventilation were assessed for the development of VAP. Risk factors associated with development of VAP were determined. Adult patients who developed pneumonia, 48 hours after ventilation, were called cases while those who did not develop pneumonia were called controls. Seventy (28%) out of 250 mechanically ventilated patients developed VAP (rate of VAP was 26 cases per 1000 ventilator days). Shock during first 48 hours of ventilation (odds ratio (OR), 5.95; 95% confidence interval (CI), 2.83-12.52), transport out of ICU during mechanical ventilation (OR, 6.0; 95% CI, 2.92-12.37), re-intubation (OR, 4.23; 95% CI, 2.53-9.85), prior episode of aspiration of gastric content (OR, 3.07; 95% CI, 1.35-7.01), and use of antibiotics prior to intubation (OR,2.55; 95% CI, 1.20-5.41) were found to be independently associated with a higher risk of developing VAP. Gram negative organisms and Staphylococcus aureus were responsible for over 90% of cases. Patients with VAP had higher crude mortality rate (57.1%) compared with controls (32.2%). Ventilator associated pneumonia is associated with a high mortality. This study has identified risk factors associated with VAP.

  13. Homeostatic model assessment for insulin resistance (homa-ir): a better marker for evaluating insulin resistance than fasting insulin in women with polycystic ovarian syndrome

    International Nuclear Information System (INIS)

    Majid, H.; Khan, A.H.; Masood, Q.

    2017-01-01

    To assess the utility of HOMA-IR in assessing insulin resistance in patients with polycystic ovary syndrome (PCOS) and compare it with fasting insulin for assessing insulin resistance (IR). Study Design: Observational study. Place and Duration of Study: Section of Clinical Chemistry, Department of Pathology and Laboratory Medicine, The Aga Khan University Hospital, Karachi, from January 2009 to September 2012. Methodology: Medical chart review of all women diagnosed with PCOS was performed. Of the 400 PCOS women reviewed, 91 met the inclusion criteria. Insulin resistance was assessed by calculating HOMA-IR using the formula (fasting glucose x fasting insulin)/405, taking normal value =12 micro IU/ml. Results: A total of 91 premenopausal women diagnosed with PCOS were included. Mean age was 30 +-5.5 years. Mean HOMA-IR of women was 3.1 +-1.7, respectively with IR in 69% (n=63) women, while hyperinsulinemia was present in 60% (n=55) women (fasting Insulin 18.5 +-5.8 micro IU/ml). Hyperandrogenism was present in 53.8% (n=49), whereas 38.5% (n=35) women had primary infertility or subfertility, while 65.9% (n=60) had menstrual irregularities; and higher frequencies were observed in women with IR. Eight subjects with IR and endocrine abnormalities were missed by fasting insulin. Conclusion: Insulin resistance is common in PCOS and it is likely a pathogenic factor for development of PCOS. HOMA-IR model performed better than hyperinsulinemia alone for diagnosing IR. (author)

  14. Comparision between bed side testing of blood glucose by glucometer vs centralized testing in a tertiary care hospital.

    Science.gov (United States)

    Baig, Ayaz; Siddiqui, Imran; Jabbar, Abdul; Azam, Syed Iqbal; Sabir, Salman; Alam, Shahryar; Ghani, Farooq

    2007-01-01

    To determine the accuracy, turnaround time and cost effectiveness of bedside monitoring of blood glucose levels by non-laboratory health care workers and centralized testing of blood glucose by automated analyzer in a tertiary care hospital. The study was conducted in Section of Chemical Pathology, Department of Pathology and Microbiology and Section of Endocrinology Department of Medicine, Aga Khan University and Hospital Karachi, from April 2005 to March 2006. One hundred and ten patients were included in the study. The blood glucose levels were analyzed on glucometer (Precision Abbott) by finger stick, using Biosensor Technology. At the same time venous blood was obtained to analyze glucose in clinical laboratory on automated analyzer (SYNCHRON CX7) by glucose oxidase method. We observed good correlation between bed side glucometer and laboratory automated analyzer for glucose values between 3.3 mmol/L (60 mg/dl) and 16.7 (300 mg/dl). A significant difference was observed for glucose values less than 3.3 mmol/L (p = 0.002) and glucose values more than 16.67 mmol/l (p = 0.049). Mean Turnaround time for glucometer and automated analyzer were 0.08 hours and 2.49 hours respectively. The cost of glucose testing with glucometer was 48.8% lower than centralized lab based testing. Bedside glucometer testing, though less expensive does not have good accuracy in acutely ill patient with either very high or very low blood glucose levels.

  15. Assessment of psychosocial impact of dental aesthetics.

    Science.gov (United States)

    Khan, Munizeh; Fida, Mubassar

    2008-09-01

    To assess the psychosocial impact of dental aesthetics using the 'Psychosocial Impact of Dental Aesthetics Questionnaire' (PIDAQ) and self-rated Aesthetic Component (AC) of the Index of Orthodontic Treatment Need (IOTN). Cross-sectional study. Dental Section, the Aga Khan University Hospital, Karachi, from August to September 2006. Adults with no prior orthodontic treatment were asked to complete a modified version of the 'Psychosocial Impact of Dental Aesthetics Questionnaire' (PIDAQ). A total of four variables including 'Dental Self-confidence', 'Social impact', 'Psychological impact' and 'Perceived orthodontic treatment need' were assessed by a series of statements, whereas dental aesthetics were assessed by the respondents using the IOTN Aesthetic Component (self-rated IOTN-AC). Kruskal-Walli's test was applied to determine significance. The respondents were 120 adults (70 females and 50 males; mean age 25.8 years), all four of the above-mentioned variables measuring psychosocial impact showed positive and significant correlations with the perceived severity of malocclusion as depicted by the Aesthetic Component (AC) of Index of Orthodontic Treatment Need (IOTN), with p-value of less than 0.01 for all variables. The results indicate the strong psychosocial impact of altered dental aesthetics on the emotional state of an individual. The association between self-rated IOTN-AC grading with psychosocial well-being stands established, indicating that the perceived aesthetics of malocclusion may be as significant a factor in determining treatment need as the degree of malocclusion.

  16. Validation of a Food Frequency Questionnaire for Assessing Macronutrient and Calcium Intake in Adult Pakistani Population

    International Nuclear Information System (INIS)

    Iqbal, R.; Bano, G.; Dar, F. J.; Khan, A. H.; Bilgirami, M.

    2014-01-01

    Objective: To develop and validate a food frequency table (FFQ) for use in urban Pakistani population. Study Design: A validation study. Place and Duration of Study: The Aga Khan University, Karachi, from June to November 2008. Methodology: Healthy adult females, aged A 18 years who consented to be included in the study were inducted, while males, unhealthy females, aged below 18 years or who did not consent were excluded. The FFQ was administered once while 4, 24 hours recalls spread over a period of one year were administered as the reference method. Daily intakes for energy, protein, fat, and calcium intake were estimated for both the tools. Crude and energy adjusted correlations for nutrient intakes were computed for the FFQ and mean of 4, 24 hours recalls and serum N-telopeptide of type-I collagen (NTx). Results: The correlation coefficients for the FFQ with mean of 4, 24 hours recall ranged from 0.21 for protein to 0.36 for calcium, while the correlation for nutrient estimates from the FFQ with NTx ranged from -0.07 for calcium to 0.01 for energy. Conclusion: Highly significant correlations were found for nutrient intakes estimated from the FFQ vs. those estimated from the mean of 4, 24 hours recalls but no correlations was found between nutrient estimates from the FFQ and serum NTx levels. FFQ was concluded to be a valid tool for assessing dietary intake of adult females in Pakistan. (author)

  17. Increasing usage of rapid diagnostics for Dengue virus detection in Pakistan

    International Nuclear Information System (INIS)

    Hasan, Z.; Razzak, S.; Farhan, M.; Rahim, M.; Islam, N.; Samreen, A.; Khan, E.

    2017-01-01

    To evaluate the trends in usage of dengue virus diagnostics in Pakistan. Methods: This retrospective study was conducted at the Aga Khan University Hospital, Karachi, and comprised data for specimens tested for dengue virus from January 2012 to December 2015. Test for dengue virus ribonucleic acid by reverse transcription polymerase chain reaction, dengue virus antigen by immunochromatic assay and for human immunoglobulin M against dengue virus by enzyme-linked immunosorbent assay were reviewed. SPSS 17 was used for data analysis. Results: Overall, 33,577 specimens tested for dengue virus. Of them, 11,995 (35.7%) were positive. among them, 1,039(8.66%) were reported in 2012; 5,791(48.28%) in 2013; 1,027(8.56%) in 2014; and 4,138(34.49%) in 2015. In 2012, 966(93%) of the positive samples were diagnosed by immunoglobulin M-based method and 73(7%) by non-structural protein-1 antigen. In 2013, 4,401(76%) samples were tested positive by immunoglobulin M, 1,332(23%) by antigen and 58(1%) by polymerase chain reaction. The trend continued in 2014, but in 2015, 2,111(51%) of all dengue positive tests were determined by antigen testing, 1,969(47.6%) by immunoglobulin M and 58(1.4%) by polymerase chain reaction. Conclusion: There was a shift in usage of direct virus identification for rapid diagnosis of dengue virus compared with host immunoglobulin M testing. (author)

  18. Agreement Between Serology and Histology for Detection of Helicobacter pylori Infection

    International Nuclear Information System (INIS)

    Iqbal, S.; Fatima, S.; Raheem, A.; Khan, A. H.

    2013-01-01

    Objective: To determine the percentage agreement between serology and histology for detection of Helicobacter (H.) pylori infection. Study Design: Cross-sectional analytical study. Place and Duration of Study: Department of Pathology and Microbiology, The Aga Khan University and Hospital, Karachi, from January to December 2009. Methodology: Fifty subjects were selected by non-probability purposive sampling from laboratory data who had serological testing of H. pylori IgG antibody, prior to histological evaluation of endoscopic gastric or/and duodenal biopsies. Serological Quantification of H. pylori IgG was carried out with HpG screen ELISA kit (Genesis Diagnostics, UK), using an enzyme linked immunosorbent assay for detection of IgG antibodies against H. pylori. Manufacturer's recommended cutoff value was used and results were considered positive when greater than 7 U/ml. For histological diagnosis, an expert histopathologist characterized the presence of spiral bacteria in the mucosal layer or the surface of epithelial cells on microscopic examination, as a positive test. Results: An agreement of 0.72 was found by Kappa statistics between serology and histopathology results and a good diagnostic accuracy (86%) of serological testing was observed for the diagnosis of H. pylori infection. Conclusion: A substantial agreement was found between serology and histopathology results to detect the H. pylori infection. Laboratory-based serologic testing using ELISA technology to detect IgG antibodies is inexpensive, noninvasive and convenient method to detect the H. pylori infection in primary care setting. (author)

  19. Frequency of worsening liver function in severe dengue hepatitis patients receiving paracetamol: A retrospective analysis of hospital data

    International Nuclear Information System (INIS)

    Syed, A.A.; Aslam, F.; Hakeem, H.; Siddiqui, F.; Nasir, N.

    2017-01-01

    To determine the frequency of worsening liver function among hospital in-patients with severe dengue hepatitis receiving paracetamol. Methods: This retrospective study was conducted at the Department of Medicine, Aga Khan University Hospital, Karachi, and comprised records of dengue patients with severe hepatitis who received paracetamol for control of fever between June 2007 and December 2014. Alanine aminotransferase at baseline and following paracetamol administration was noted, as well as dosage and duration of paracetamol, along with participants' demographic details. Frequency of patients who developed worsening or improvement of alanine aminotransferase was also noted. SPSS 19 was used for data analysis. Results: Of the 113 subjects, 73(64.6%) were male and 40(35.4%) were female. Overall improvement was observed in subsequent alanine aminotransferase levels (491 units per litre, IQR 356.5 TO 775 vs 151 units per litre, IQR 49.5 to 299.5). Most commonly prescribed dose of paracetamol was 2g (IQR 1 to 5 grams), which was taken for a median duration of 1 day (IQR 1 to 3 days). Moreover, 100(88.5 %) patients showed improvement in alanine aminotransferase. Only 13(11.5 %) patients developed worsening of alanine aminotransferase. Of those with worsening liver function, 8(61.5 %) were discharged home with no clinical deterioration and 5(38.5 %) deaths were observed. However, causes of deaths were unrelated to liver dysfunction. Conclusion: The frequency of worsening liver function following paracetamol administration in patients with severe dengue hepatitis was relatively low. (author)

  20. Pancreaticoduodenectomy: a developing country perspective

    International Nuclear Information System (INIS)

    Pal, K.M.I.; Nasim, H.B.S.

    2011-01-01

    Objective: To review retrospectively, the results of Whipple's procedure from 1986 to December 2009 at the Aga Khan University Hospital. Methods: Patient's case notes were reviewed to extract information related to demographics, clinical and laboratory data, operative procedure and post operative period. Surgical mortality was defined as death within 30 days of procedure. Results: Hundred and twenty one patients underwent a successful pancreaticoduodenectomy during this period. There were 78 males and 43 females. Most presented with clinical features of obstructive jaundice. Perioperative evaluation in the majority included an abdominal ultrasound and contrast enhanced CT scan. A preoperative ERCP was performed in 64 (53%) patients and a stent was placed in 32 (26%). Stent related sepsis was noted in 8 patients (25 %). Eighty four (69%) patients underwent a standard resection, 31% had a pylorus preserving procedure. The commonest pathology was adenocarcinoma located in the pancreatic head or periampullary area. Post operative morbidity was noted in 54% of patients, the commonest being chest infection (20%) followed by delayed gastric emptying and pancreatic anastomotic leak. There were 12 perioperative deaths giving a surgical mortality of 10%. Conclusion: To our understanding this is the largest series of consecutive pancreaticoduodenectomies reported in Pakistan. Our morbidity and mortality rates compare favourably with international centers of similar yearly case volume. There is a need to establish regional centers to effectively manage complex disease conditions and improve the standard of care offered to our patients. (author)

  1. Lip line preference for variant face types.

    Science.gov (United States)

    Anwar, Nabila; Fida, Mubassar

    2012-06-01

    To determine the effect of altered lip line on attractiveness and to find preferred lip line for vertical face types in both genders. Cross-sectional analytical study. The Aga Khan University Hospital, Karachi, from May to July 2009. Photographs of two selected subjects were altered to produce three face types for the same individual with the aim of keeping the frame of the smile constant. Lip line was then altered for both the subjects as: both dentitions visible, upper incisors visible, upper incisors and 2 mm gum and 4 mm gum visible. The pictures were rated by different professionals for attractiveness. Descriptive statistics for the raters and multiple factor ANOVA was used to find the most attractive lip line. The total number of raters was 100 with the mean age of 30.3 ± 8 years. The alterations in the smile parameters produced statistically significant difference in the attractiveness of faces, whereas the perception difference was found to be insignificant amongst raters of different professions. Preferred lip line was the one showing only the upper incisors in dolico and mesofacial male and female genders whereas 2 mm gum show was preferred in brachyfacial subjects. The variability in lip line showed significant difference in the perceived attractiveness. Preferred lip lines as the one showing only the upper incisors in dolico and mesofacial male and female genders whereas 2 mm gum show was preferred in brachyfacial subjects.

  2. Awareness, use and perceptions about E-cigarettes among adult smokers in Karachi, Pakistan.

    Science.gov (United States)

    Sarfraz, Maryam; Rahim Khan, Hamza Abdur; Urooba, Amna; Manan, Zainab; Irfan, Omar; Nadeem, Ramlah; Baqir, Huma; Farooq, Saad; Khan, Zarrar; Khan, Javaid Ahmed; Saleem, Sarah

    2018-01-01

    To estimate the prevalence of awareness, current use and intention to use of e-cigarettes among adult smokers. This cross-sectional survey was carried out at the Aga Khan University Hospital, Karachi, from July to August 2016, and comprised people aged above 18 years who had smoked more than 100 cigarettes in their lifetime. Convenience sampling method was used. A self-administered questionnaire was used to collect data. SPSS 22 was used for data analysis.. Of the 387 participants, 359(92.8%) were male. The overall mean age was 32.4±12.6 years. Moreover, 215(55.5%) respondents belonged to the middle socio-economic class. Besides, 249(64.3%) respondents were aware of e-cigarettes while 39(10.1%) used them, and 81(20.9%) wanted to use them. Socio-economic status was the best predictor for awareness about e-cigarettes (p<0.001), while gender (p=0.001), occupation

  3. Long-term outcome of primary external dacryocystorhinostomy

    International Nuclear Information System (INIS)

    Baig, R.; Khan, Q.A.; Ahmad, K.

    2013-01-01

    Objective: To assess the long-term functional outcome of external dacryocystorhinostomy (DCR) in terms of epiphora. Study Design: Single-group cohort study. Place and Duration of Study: Section of Ophthalmology, The Aga Khan University Hospital, Karachi, from January 2000 to June 2010. Methodology: This study included adults who underwent external DCR surgery at the AKUH during January 2000 to June 2010. The main outcome measure was the proportion of patients reporting to have developed epiphora after surgery. During the telephonic interviews participants were asked if they had a recurrence (symptoms such as watering or discharge) after surgery. Individuals answering in affirmative were asked when the symptoms started. Data on age at surgery, gender and pre-operative symptoms were collected from medical records. Recurrence-free curves were calculated according to the Kaplan-Meier method. Results: A total of 44 persons who underwent DCR surgery were contactable by telephone in 2011 and all agreed to participate in the study. The mean age of the patients at the time of surgery was 48.0 A+- 15.8 years. Overall, 38.6% (17/44) participants reported having developed epiphora after surgery. The overall median recurrence-free time was 1.7 years; there was no statistically significant difference in the median recurrence-free time between men and women. Conclusion: The long-term functional outcome of external DCR surgery does not appear to be optimal and, in fact, far worse than the short-term results reported in the international literature. (author)

  4. Four year experience of sarcoma of soft tissues and bones in a tertiary care hospital and review of literature

    Directory of Open Access Journals (Sweden)

    Ansari Tayyaba Z

    2011-05-01

    Full Text Available Abstract Background Sarcoma encompasses an uncommon group of cancer and the data is insufficient from Pakistan. We report our four years experience of Sarcoma of soft tissues and bones. Methods This cross sectional study was carried out at Aga Khan University Hospital from 2004 to 2008. The patients were divided into two groups from the outset i.e. initially diagnosed and relapsed group and separate sub group analysis was conducted. Results Out of 93 newly diagnosed patients, 58 belonged to bone sarcoma and 35 to soft tissue sarcoma group. While for relapsed patients, 5 had soft tissue sarcoma and 9 had bone sarcoma. Mean age was 32.5 years. At presentation, approximately two third patients had localised disease while remaining one third had metastatic disease. The Kaplan Meier estimate of median recurrence free survival was 25 months, 35 months, and 44 months for Osteogenic sarcoma, Ewing's sarcoma and Chondrosarcoma respectively. For Leiomyosarcoma and Synovial sarcoma, it was 20 and 19 months respectively. The grade of the tumour (p = 0.02 and surgical margin status (p = 0.001 were statistically significant for determination of relapse of disease. Conclusion The median recurrence free survival of patients in our study was comparable to the reported literature but with significant lost to follow rate. Further large-scale, multi centre studies are needed to have a more comprehensive understanding of this heterogeneous disease in our population.

  5. Clinical manifestations and treatment outcomes in HIV-1-infected children receiving antiretroviral therapy in Karachi, Pakistan.

    Science.gov (United States)

    Mir, Fatima; Qamar, Farah Naz; Baig-Ansari, Naila; Abro, Azra Ghayas; Abbas, Syed Qamar; Kazi, Mohammed Ahmed; Rizvi, Arjumand; Zaidi, Anita Kaniz Mehdi

    2014-04-15

    The impact of antiretroviral (ARV) therapy on immunological and growth parameters in HIV-positive children in Pakistan has not been reported to date. A retrospective chart review of children diagnosed with HIV at the Sindh AIDS Control Proigramme (SACP) and registered at the Aga Khan University, Karachi, between January 2005 and 2013 was conducted, evaluating clinical and laboratory profiles of HIV+ ARV+ children for ARV impact (serial height and weight CD4 and viral counts). Twenty-four children were diagnosed and registered as HIV positive over five years, and 20 were started on ARV. Six were excluded from analysis (ARV duration treatment failure at a median duration of 25 weeks (IQR 18-32) on ARV and underwent resistance genotyping. All nine had NNRTI resistance, two had high-grade NRTI resistance (≥ 4 thymidine analog mutations). Median age at start of ARV was 71.5 weeks (IQR 37.5-119). Median baseline weight for age (WAZ) and height for age (HAZ) z-scores changed from -1.94 to 1.69 and -1.99 to -1.59, respectively, after six months of therapy. Median CD4 percentage and viral load at baseline changed from 13.8 to 17.8, while viral load changed from 285 × 104 copies to zero at six months. ARV improved absolute CD4 and viral counts. Weight and height did not  improve significantly, highlighting the need for aggressive nutritional rehabilitation. Early development of ARV resistance in these children requires formal assessment.

  6. Evaluation of radon induced lung cancer risk in occupants of the old and new dwellings of the Dera Ismail Khan City, Pakistan

    International Nuclear Information System (INIS)

    Tabassum Nasir; Muhammad Khalil; Naveed Anwar; Matiullah; Muhammad Rafique; Saeed Ur Rahman

    2014-01-01

    In order to carry out indoor radon measurement in new and old buildings of the Dera Ismail Khan city, CR-39 based radon detectors were installed in bed rooms and sitting rooms/TV lounges in 25 (each) old and new houses and were exposed to indoor radon for 90 days. After processing, mean weighted average indoor radon concentrations in old and new houses were found to be 275 ± 33 and 86 ± 18 Bq m -3 whereas mean annual effective doses expected to be received by the occupants were 6.86 ± 0.79 and 2.1 ± 0.43 mSv year -1 , respectively. From the measured weighted average indoor radon concentration, excess relative risk factor was calculated using the risk model of BEIR VI for the age group of 35 and 55 years. Average excess lung cancer risk was found to be 1.63 ± 0.19 and 1.35 ± 0.16 and 0.5 ± 0.10 and 0.4 ± 0.08 for old and new houses, respectively. (author)

  7. Evaluation of radon induced lung cancer risk in occupants of the old and new dwellings of the Dera Ismail Khan City, Pakistan

    Energy Technology Data Exchange (ETDEWEB)

    Nasir, Tabassum; Khalil, Muhammad; Anwar, Naveed [Gomal University, Dera Ismail Khan (Pakistan). Department of Physics; Matiullah, [PINSTECH, Islamabad (Pakistan). Directorate of Systems and Services; Rafique, Muhammad [University of Azad Jammu and Kashmir, Azad Kashmir (Pakistan). Department of Physics; Rahman, Saeed Ur [Nuclear Medicine, Oncology and Radiotherapy Institute, Islamabad (Pakistan). Department of Medical Physics

    2014-06-15

    In order to carry out indoor radon measurement in new and old buildings of the Dera Ismail Khan city, CR-39 based radon detectors were installed in bed rooms and sitting rooms/TV lounges in 25 (each) old and new houses and were exposed to indoor radon for 90 days. After processing, mean weighted average indoor radon concentrations in old and new houses were found to be 275 ± 33 and 86 ± 18 Bq m{sup -3} whereas mean annual effective doses expected to be received by the occupants were 6.86 ± 0.79 and 2.1 ± 0.43 mSv year{sup -1}, respectively. From the measured weighted average indoor radon concentration, excess relative risk factor was calculated using the risk model of BEIR VI for the age group of 35 and 55 years. Average excess lung cancer risk was found to be 1.63 ± 0.19 and 1.35 ± 0.16 and 0.5 ± 0.10 and 0.4 ± 0.08 for old and new houses, respectively. (author)

  8. Glutathione role in gallium induced toxicity

    African Journals Online (AJOL)

    Asim

    2012-01-26

    Jan 26, 2012 ... 1Department of Pharmaceutical Chemistry, Faculty of Pharmacy, Gomal University, D.I. Khan, ... Decrease in GSH level was dependant on gallium nitrate concentration. .... This 2 ml mixture sample was centrifuged at 1000.

  9. Urology – a specialty that will be faced by all future doctors

    Directory of Open Access Journals (Sweden)

    Miah S

    2016-01-01

    Full Text Available Saiful Miah,1 Karl H Pang2 1Department of Urology, Royal Hallamshire Hospital, 2Academic Urology Unit, School of Medicine and Biomedical Sciences at the University of Sheffield, Sheffield, UKWe read with great interest the articles by Shah, and Ah-kee and Khan regarding the various potential methods that could increase the exposure of undergraduate medical students to smaller specialties.1,2 We would like to draw attention to a small but high clinical volume specialty, ie, urology.Read the original article by ShahRead the original article by Ah-kee and Khan 

  10. Effect of strong electrolytes on edible oils part II: vViscosity of maize ...

    African Journals Online (AJOL)

    DR. MIKE HORSFALL

    dioxane in the presence of HCl, NaOH and NaCl at different temperatures. 1A. RASHEED KHAN; 2SHAMA, REHANA SAEED; 2*FAHIM UDDIN. 1Department of Chemistry, Federal Urdu University of Arts, Science & Technology,. Karachi Pakistan.

  11. Identification of risk factors for hepatitis B and C in Peshawar, Pakistan

    Directory of Open Access Journals (Sweden)

    Shafiq M

    2015-08-01

    Full Text Available Muhammad Shafiq,1 Muhammad Nadeem,2 Zeeshan Sattar,3 Sohaib Mohammad Khan,2 Sheikh Muhammad Faheem,4 Irfan Ahsan,5 Rabia Naheed,6 Tahir Mehmood Khattak,2 Shahzad Akbar,7 Muhammad Talha Khan,3 Muhammad Ilyas Khan,1 Muhammad Zubair Khan8 1Department of Internal Medicine, Khyber Teaching Hospital, University Town, Peshawar, 2Department of General Surgery, Nishtar Medical College and Hospital, Dera Ghazi Khan, Punjab, 3Department of Internal Medicine, Khyber Medical College, University Campus, Peshawar, 4Department of Neurology, King Edward Medical University, Anarkali, Lahore, Pakistan; 5Department of Internal Medicine, Mayo Hospital, Phoenix, AZ, USA; 6Department of Internal Medicine, Fatima Memorial Hospital, Lahore, 7Department of Internal Medicine, Lady Reading Hospital, Andar Shehr, Peshawar, 8Department of Internal Medicine, Hayatabad Medical Complex, Hayat Abad, Pakistan Background: Hepatitis B and C need immediate worldwide attention as the infection rates are too high. More than 240 million people have chronic (long-term liver infections. Every year, about 600,000 people die globally due to the acute or chronic consequences of hepatitis B and more than 350,000 people die from hepatitis C-related liver diseases. Methods: Our study was designed as a case-control, descriptive study. It was conducted through formal interviews by using structured questionnaires. A total of 100 cases were included, with four controls for each case. Results: This study confirms household contact, history of dental work, history of surgery, sexual contact, and history of transfusion (blood and its components as the main risk factors which are responsible for the increased prevalence of hepatitis. Conclusion: The important risk factors, responsible for the high prevalence of hepatitis B and C in our society are household contact, history of dental work, history of surgery, sexual contact, and history of transfusion (blood and its components. The odds ratio of

  12. 77 FR 58006 - Addition of Certain Persons to the Entity List; Removal of Person From the Entity List Based on...

    Science.gov (United States)

    2012-09-19

    ... limited. DATES: Effective Date: This rule is effective September 19, 2012. FOR FURTHER INFORMATION CONTACT..., F-2, Khusal Khan Khattak Road, University Town, Peshawar, Pakistan. Annual Review of the Entity List...) 54th Research Institute; --Communication, Telemetry and Telecontrol Research Institute (CTI); and...

  13. THE TURKIC WORLD OF THE RUSSIAN WRITER: “LEGEND ABOUT THE SIBERIAN KHAN, OLD KUCHUM” BY D. N. MAMIN-SIBIRYAK

    Directory of Open Access Journals (Sweden)

    Valentina I. Gabdullina

    2017-06-01

    Full Text Available The article studies the special aspects of the author’s conception of the East and the principles of the reconstruction of the way of life and mentality of the Turks in “Eastern legends” by D. N. Mamin-Sibiryak within the context of the general interest the Russian literature of the turn of the 19th and 20th centuries experienced toward orientalism. Based on the “Legend of the Siberian Khan, Old Kuchum” the process of evolution of the poetic stylization into an individual and author’s version of the genre form is analyzed, as a result of comprehension, aesthetic mastering and the embodiment of the culture of another nation, folkloristic and mythological figurativeness in the artistic text of the Russian writer. In the “Legend…” there is clearly seen the aspiration of the author to show life of the nomadic people “internally”, to look beyond the existing estimative stereotypes about Siberian peoples set in the perception of the Russian in the period of the conquest of Siberia by the troops of the Russian Tsar with ataman Yermak at the head. For the purpose of a comparative analysis the annalistic sources are used (the Esipovsky chronicle. The research is conducted from the perspective of cultural and historical, imagological and motive approaches.

  14. An Analysis of Blood Utilization for Stem Cell Transplant Patients in a Tertiary Care Hospital.

    Science.gov (United States)

    Ali, Natasha

    2017-05-30

    Haematopoietic stem cell transplant is a potentially curative treatment option in various benign and malignant haematological diseases. Patients undergoing stem cell transplant procedure require blood transfusion on a daily basis. Currently, there is paucity of data from developing countries on transfusion practices. This audit was undertaken to determine the consumption of packed red blood cells (PRBCs) transfusion in the bone marrow transplant unit of the Aga Khan University Hospital. A retrospective audit was conducted for packed red cell transfusion ordering practice over a period from June 2014∼June 2015. All consecutive patients, admitted for stem cell transplant procedure for various underlying diseases were included. Outcome measures used in this study were (i) cross match to transfusion (C: T) ratio and (ii) transfusion trigger. During the study period, n=25 patients underwent haematopoietic stem cell transplant. There were n=19 males and n=6 females. One patient was less than 15 years of age while rests were adults. Median age±SD was 26.5±14.5 years (12∼54 years). The underlying diagnosis included Aplastic anemia (n=8), Thalassemia major (n=3), Multiple Myeloma (n=4), Acute leukemia (n=5), Hodgkin's lymphoma (n=4), PRCA (n=1). Grand total consumption of PRBCs during the study period was 204 while 258 products were crossmatch. The C:T ratio was 1.26. The transfusion trigger was Hb level of less than 8 gms/dl. The results of our BMT unit indicate that the C:T ratio and transfusion trigger is comparable to the international benchmark.

  15. Prevalence of Depression and Anxiety amongst Cancer Patients in a Hospital Setting: A Cross-Sectional Study

    Directory of Open Access Journals (Sweden)

    Anish Khalil

    2016-01-01

    Full Text Available Background. The biomedical care for cancer has not been complemented by psychosocial progressions in cancer care. Objectives. To find the prevalence of anxiety and depression amongst cancer patients in a hospital setting. Design and Setting. This cross-sectional study was conducted at the tertiary care hospitals Shifa International Hospital Islamabad and Nuclear Medicine, Oncology, and Radiotherapy Institute [NORI]. Patients and Methods. 300 patients were interviewed from both the outpatient and inpatient department using The Aga Khan University Anxiety and Depression Scale (AKUADS. Main Outcome Measures. Using a score of 20 and above on the AKUADS, 146 (48.7% patients were suffering from anxiety and depression. Results. When cross tabulation was done between different factors and the cancer patients with anxiety and depression, the following factors were found out to be significant with associated p value < 0.05: education of the patient, presence of cancer in the family, the severity of pain, and the patient’s awareness of his anxiety and depression. Out of 143 (47.7% uneducated patients, 85 (59.4% were depressed, hence making it the highest educational category suffering from depression and anxiety. Conclusion. The prevalence of anxiety and depression amongst cancer patients was high showing that importance should be given to screening and counseling cancer patients for anxiety and depression, to help them cope with cancer as a disease and its impact on their mental wellbeing. Limitations. The frequency of female patients in our research was higher than those of male patients.

  16. Implantable port devices in paediatric oncology patients: A clinical experience from a tertiary care hospital

    International Nuclear Information System (INIS)

    Dogar, S.A.; Khan, M.A.M.

    2013-01-01

    Objective: To assess the frequency of infection of portacath in children having malignant tumours and undergoing chemotherapy, and to assess the association of the infection with already known risk factors. Methods: The retrospective review was conducted at Aga Khan University Hospital, Karachi, and involved patient data related to the period between January 2005 to December 2010. A questionnaire was designed to collect the required data. A total of 67 children were included having portacath inserted for chemotherapy. Children in which portacath was inserted under local anaesthesia in Radiology department, reinserted or inserted because of a reason other than childhood malignancy were excluded. SPSS 19 was used for statistical analysis. Results: Of the total, 46 (67%) patients were males and a majority of the total (n=31; 46%) was between 6-10 years of age. Besides, 42 (63%) patients had leukaemia, 7(11%) had lymphoma and 18(26%) had various solid tumours. Six (8.95%) ports were removed due to infection. There was significant difference between infection and non-infection groups with respect to absolute neutrophilic count levels (p <0.001). Positive association was found between low absolute neutrophilic count level (<500) and the occurrence of port infection. Conclusions: Port infection rate is higher in children with low absolute neutrophilic count. The issue needs to be addressed and one may have to alter the timings of port insertion. It is recommended to insert port when absolute neutrophilic count is normal. To further evaluate the subject, a multicentre trial must be conducted. (author)

  17. Impact of prenatal ultrasound consultation on maternal anxiety

    International Nuclear Information System (INIS)

    Masroor, I.; Ajmal, F.; Ahmed, H.

    2008-01-01

    To determine whether ultrasound consultation reduces maternal anxiety and increases feto-maternal attachment ( the desire to care for the fetus and care for self). Patients coming for routine obstetric ultrasound at the Department of Radiology, Aga Khan University Hospital Karachi were recruited in the study. The study was carried out over the period of two months from January-February 2007 in which sixty patients were included in the study. Patients were randomly assigned to a standard care group or an ultrasound consultation group (30 patients in each arm). Both groups were required to fill a questionnaire before and after their ultrasound examination. The ultrasound consultation group in addition received counseling before they went in for the ultrasound regarding fetal development and maternal-fetal interaction. The two groups were then compared for difference of change in feto maternal attachment scores and change in anxiety levels regarding their pregnancies before and after the ultrasound. SPSS software (version 14) was used for compilation of the data and the statistical computations. Categorical data was compared using Chi-square test and continuous variables were analyzed with paired t-test. P value <0.05 was considered significant. A positive difference in feto-maternal attachment and reduction in anxiety levels was seen in both the groups but this difference was statistically significant in the ultrasound consultation group only. This study suggests that ultrasound examinations with prior consultation has a positive impact on patients as it strengthens bonding toward the fetus, reduces maternal anxiety and increases maternal investment in health during the pregnancy. (author)

  18. Diabetic ketoacidosis characteristics and differences in type 1 versus type 2 diabetes patients

    International Nuclear Information System (INIS)

    Rashid, M.O.; Sheikh, A.; Salam, A.; Farooq, S.; Kiran, Z.; Islam, N.

    2017-01-01

    Background: Diabetes is undoubtedly one of the most challenging health problems of the 21st century. It is well known that diabetes once develop can lead to several complications. Diabetic ketoacidosis (DKA) is one of the life-threatening complications of diabetes. This study was designed to determine the frequency of DKA in diabetes patients and find out the clinical and biochemical determinants of DKA. Methods: This descriptive study was conducted at Aga Khan University Hospital (AKUH) Karachi, Pakistan from January 2010 to February 2016. All known or newly diagnosed diabetic patients of >16 years of age irrespective of gender and type of diabetes were included. Information regarding patient’s demographics, presenting symptoms, precipitating causes of DKA, biochemical profiles and outcome at the time of discharge was collected. Results: Majority (54.7%) had moderate and 12.4% had severe DKA at presentation. Previous history of DKA was found higher in type 1 diabetes patients (T1DM) (14%) as compare to (4%) type 2 diabetes patients (T2DM) (p<0.05). DKA severity was observed more (12%) in newly diagnosed (T1DM) (p<0.05). Comorbidities were found more (81%) in (T2DM) (p<0.05) Mortality was also observed higher in Type 2 diabetes patients (p<0.05). Conclusion: Majority of the diabetics had moderate to severe DKA at presentation. Mortality and morbidity related with DKA was found considerably higher among patients with T2DM while infection, myocardial infarction and stroke found as triggering factors in these patients. (author)

  19. Role of endovascular treatment in vascular injuries

    International Nuclear Information System (INIS)

    Tahir, M.M.; Haq, T.U.

    2012-01-01

    Objective: To evaluate retrospectively the results, complications and follow-up of patients after endovascular treatment of vascular injuries. Methods: Fifty transcatheter embolisation procedures (TCE) were performed in 46 patients between 1999 and 2008 at the Aga Khan University Hospital, Karachi. Injuries in 14 (30.4%) patients were due to road traffic accident; iatrogenic in 13 (28%); accidental in 6 (13%). Firearms, bomb blasts and earthquake contributed to injuries in 8(17%), 4(8.8%) and 1(2.2%) patients respectively. All patients underwent angiography and had evidence of either active haemorrhage, pseudo-aneurysm, abnormal vascularity or arteriovenous fistula. Follow-up ranged from 1 day to 6 years with mean of 10.5 months. Medical record files, lab results and imaging reports were utilised for the study. Procedure was declared as technically successful when there was cessation of extravasation, occlusion of fistula or exclusion of pseudo-aneurysm in the post-embolisation angiograms. Treatment was deemed clinically successful if there was resolution of the indication for which the procedure was done. Results: Transcatheter embolisation was technically successful in occluding vascular lesions in all 46 (100%) patients. Lesions recurred in 4 (9%) patients who underwent initially successful TCE. These patients were treated effectively with repeated TCE. Three patients died during the same hospital stay and 3 patients died after being discharged from the hospital. All these patients were treated successfully with TCE and had factors other then TCE contributing to their mortality. Conclusion: Transcatheter embolisation for vascular injuries was found to be a satisfactory procedure, with low morbidity and mortality rates. (author)

  20. Improving outcomes of emergency bowel surgery using nela model

    International Nuclear Information System (INIS)

    Sultan, R.; Zafar, H.

    2018-01-01

    To find outcomes of emergency bowel surgery and review the processes involved in the care of these patients on the same template used in National Emergency Laparotomy Audit (NELA). Study Design:An audit. Place and Duration of Study:Surgery Department, The Aga Khan University Hospital, Karachi, from December 2013 to November 2014. Methodology:Patients undergone emergency bowel surgery during the review period were included. Demographic data, type of admission, ASA grade, urgency of surgery, P-POSSUM score, indication of surgery, length of stay and outcome was recorded. Data was then compared with the data published by NELA team in their first report. P-value for categorical variables was calculated using Chi-square tests. Results:Although the patients were younger with nearly same spectrum of disease, the mortality rate was significantly more than reported in NELA (24% versus 11%, p=0.004). Comparison showed that care at AKUH was significantly lacking in terms of proper preoperative risk assessment and documentation, case booking to operating room timing, intraoperative goal directed fluid therapy using cardiac output monitoring, postoperative intensive care for highest risk patients and review of elderly patients by MCOP specialist. Conclusion:This study helped in understanding the deficiencies in the care of patients undergoing emergency bowel surgery and alarmingly poor outcomes in a very systematic manner. In view of results of this study, it is planned to do interventions in the deficient areas to improve care given to these patients and their outcomes with the limited resources of a developing country. (author)

  1. Cell death induced by Morarah and Khaltita in hepatoma cancer cells (Huh-7).

    Science.gov (United States)

    Baig, Saeeda; Alamgir, Mohiuddin

    2009-10-01

    To compare the combined and isolated growth inhibitory effects of Morarah and Khaltita (herbs) on hepatoma cell lines (Huh-7), through induction of apoptosis or necrosis. Comparative controlled in-vitro study. The Molecular Biology Laboratory, The Aga Khan University, Karachi, from June to December 2006. The growth of hepatoma cell lines (Huh-7) was checked by adding Khaltita and Morarah to the cells before culture in a 24 well plate. Six wells were selected and labeled for each of the four variables (controls, Khaltita, Morarah and mixture). After 2 days, cells were studied under an inverted phase contrast microscope and fields were recorded. Approximately four fields per slide of higher intensity were selected randomly to determine the dead cell density, and the procedure was repeated 10 or more times. Frequency and percentages were calculated for dead or alive cells in controls, Morarah, Khaltita and their mixture. Chi-square was used to compare the qualitative variables. P-values < 0.05 were considered significant. Morarah and Khaltita were found to induce statistically significant (p < 0.001) cell death in hepatoma cell lines (Huh-7). At a magnification of 40x, the controls showed 1% dead cells compared to 91% in Morarah, 83% in Khaltita and 73% in combined mixture of Khaltita and Morarah. At magnification of 20x, the controls showed 4% dead cells compared to 44% in Morarah, 47% in Khaltita and 49% in the combined mixture of Khaltita and Morarah. Morarah and Khaltita induced cell death in cultured hepatoma cells (Huh-7).

  2. Comparison of foeto-maternal outcome in pregnant women with hepatitis E - A review of 12 years

    International Nuclear Information System (INIS)

    Naru, T.; Yousuf, F.; Malik, A.; Naz, S.; Ismail, H.

    2017-01-01

    To compare adverse maternal and foetal outcome in pregnant women with hepatitis E immunoglobulin M reactive versus non-reactive. Methods: This retrospective study was conducted at the Aga Khan University Hospital, Karachi, and comprised records of pregnant patients at any gestational age with clinical and biochemical evidence of hepatitis E from January 2002 and December 2014. . Maternal and perinatal outcome of the subjects were analysed. SPSS 20 was used for data analysis. Results: Out of the 200 subjects, 168(84 %) were hepatitis E immunoglobulin M reactive and 32(16%) were non-reactive. The overall mean age was 26.7+-4.5 years. Also, 12(7%) patients in the immunoglobulin M reactive group were admitted to intensive care unit compared to no one from the non-reactive group. Similarly fulminant hepatic failure was seen in 12(7.1%) patients in the immunoglobulin M reactive group compared to no one in the other group. Post-partum haemorrhage was more frequent in the immunoglobulin M reactive group compared to the non-reactive group. There were 5(3%) maternal deaths in the reactive group compared to no death in the other group. Moreover, 34(20.2%) neonates of the immunoglobulin M reactive group needed neonatal intensive care unit admission compared to none in the non-reactive group. There were 4(2.4%) neonatal deaths in the reactive group. Conclusion: Participants in the immunoglobulin M reactive group had a higher percentage of adverse foeto-maternal outcomes compared to the non-reactive group. (author)

  3. Effectiveness of behavioural management on migraine in adult patients visiting family practice clinics: a randomized controlled trial

    International Nuclear Information System (INIS)

    Bhombal, S. T.; Usman, A.; Ghufran, M.

    2014-01-01

    Objectives: To assess the effectiveness of behavioural management in the treatment of migraine among adult patients. Methods: The randomised control trial was conducted from August 2011 to August 2012 at the Aga Khan University Hospital, Karachi, in which adult patients aged 18-65 years were recruited with diagnosis of migraine from five outpatient sites. The patients were randomised into 2 equal groups. The controls were given pharmacological treatment, while the cases were given a structured behavioural management and pharmacological treatment. Primary outcome was the change in frequency of migraine attacks. Secondary outcome included change in severity of migraine and effect on the quality of life. SPSS 19 was used for statistical analysis. Results: Of the 90 subjects in the study, 72(80%) were female. A significant reduction in the average frequency of migraine attacks was observed from baseline up to 4 weeks (p<0.001) but no difference in the mean migraine attacks was observed in the two groups (p<0.945). In the average score of severity of pain, significant reduction was observed for time (p <0.001) as well as for the intervention status (p<0.034). There was no significant difference (p<0.450) between treatment type and duration of migraine, but a significantly better quality of life (p<0.001) was observed in the trial group compared to the controls. Conclusion: There was significant decrease in frequency, severity and duration of migraine attacks in the trial group compared to the control group. The quality of life also showed improvement in the trial group. (author)

  4. Evaluation of microleakage in single-rooted teeth obturated with thermoplasticized gutta-percha using various endodontic sealers: an in-vitrostudy

    International Nuclear Information System (INIS)

    Lone, M.M.; Khan, F.; Lone, M.A.

    2018-01-01

    Objective:To compare apical microleakage of extracted, single-rooted teeth obturated with thermoplasticized injectable gutta-percha using two different endodontic sealers (calcium-hydroxide and resin based). Study Design:An experimental study. Place and Duration of Study:The Aga Khan University Hospital (AKUH), Dental Clinics and Laboratory from June to September 2015. Methodology:The study was conducted using extracted teeth. After access cavities were made, cleaning and shaping of root canals was done in 70 teeth. Teeth were randomly allocated into two groups and obturated with thermoplasticized injectable gutta-percha (Obtura II) using two sealers (Sealapex vs.AH plus). After immersing the teeth in 2.0% methylene blue, they were split longitudinally, viewed under light microscope (magnification X4) and images were taken by a camera connected to microscope. The extent of dye penetration was assessed from apex to its coronal part and recorded in millimeters. Independent sample t-test was used to compare microleakage in the two groups. Pearson correlation coefficient was used for inter-examiner reliability of dye penetration measurements. A p-value of <0.05 was taken as statistically significant. Results:Teeth obturated with Obtura II gutta-percha with AH plus sealer had a mean dye penetration of 1.20 +- 0.79 mm. This was significantly better than Obtura II with Sealapex sealer (p=0.003). Conclusion:Obtura II-AH plus sealer was a better combination for obturation as it showed a lesser degree of microleakage. Obtura II with Sealapex group showed higher microleakage, so this combination should be avoided in single-rooted teeth. (author)

  5. Association of gestational weight gain and pre-pregnancy body mass index with adverse pregnancy outcome

    International Nuclear Information System (INIS)

    Munim, S.; Maheen, H.

    2012-01-01

    Objective: To determine the association between gestation weight gain (GWG) and adverse pregnancy outcome in a Pakistani population. Study Design: Analytical study. Place and Duration of Study: The Aga Khan University, Karachi, from February 2003 to 2007. Methodology: This study used secondary data of 4,735 women from a large cohort study on fetal growth. Pre-pregnancy BMI was categorized according to the recommendations from the institute of medicine (IOM, 2009) and gestation weight gain (GWG) was noted. Chi-square test was used to find the association of GWG and pre-pregnancy BMI with low birth, large for gestational age (LGA), and caesarean section. Logistic regression analysis was weight (LBW), preterm delivery performed to control for confounders like age, parity, working status and ethnicity. Results: The prevalence of LBW decreased with increasing BMI. GWG of the population was noted as 8.5 kg. LBW was omen below the age of 19 were twice more likely to have LBW than observed to have an inverse relationship with GWG. W above 35 years of age. Weight gain above the recommended range were twice more likely to have large for dates. Overweight women were 1.5 times more likely to deliver preterm whereas obese women were 1.4 times more likely to undergo caesarean section than women with normal BMI. Conclusion: The optimal weight gain was estimated to be 8.5 kg to prevent low birth weight in our population. Obese women are more likely to have LGA, caesarean sections and pre-term deliveries. (author)

  6. Efficacy of l-ornithine-l-aspartate as an adjuvant therapy in cirrhotic patients with hepatic encephalopathy

    International Nuclear Information System (INIS)

    Abid, S.; Jafri, W.; Mumtaz, K.; Islam, M.; Abbas, Z.

    2011-01-01

    To evaluate the efficacy of L-ornithine-L-aspartate (LOLA) as an adjuvant therapy in cirrhotic patients with hepatic encephalopathy (HE). Study Design: Randomized placebo controlled study. Place and Duration of Study: The Aga Khan University Hospital, Karachi in the year 2003-2004. Methodology: Patients with HE were randomized to receive LOLA or placebo medicine as an adjuvant to treatment of HE. Number connection test-A (NCT-A), ammonia level, clinical grade of HE and duration of hospitalization were assessed. Results: Out of 120 patients, there were 62 males with mean age of 57 +- 11 years. Improvement in HE was higher (n=40, 66.7%) in LOLA group as compared to the placebo group (n=28, 46.7%, p=0.027). In patients with grade I or less encephalopathy, improvement was seen in 6 (35.3%) and 3 (20%) patients in LOLA and placebo groups respectively (p=0.667). Patients with HE grade II and above showed improvement in 34 (79.1%) and 25 (55.6%) cases in LOLA and placebo group respectively (p=0.019). On multivariate analysis patients with HE of grade II and above showed prothrombin time, creatinine level and use of LOLA influencing the outcome. Duration of hospitalization was 93.6 +- 25.7 hours and 135.2 +- 103.5 hours in LOLA and placebo groups respectively (p=0.025). No side effects were observed in either groups. Conclusion: In cirrhotic patients with advanced hepatic encephalopathy treatment with LOLA was safe and associated with relatively rapid improvement and shorter hospital stay. (author)

  7. Morbidity and mortality assessment in acute hepatitis-e

    International Nuclear Information System (INIS)

    Kamani, L.; Ismail, F.W.; Haider, S.W.; Jafri, W.

    2015-01-01

    Hepatitis-E is an enterically transmitted virus causing acute hepatitis. Mostly it is a self-limiting clinical course, but can be life threatening in certain high risk groups. Pakistan is endemic for Hepatitis-E with limited published literature. The aim of this study is to evaluate the predictors of mortality in patients with acute Hepatitis-E. Methods: We analyzed the medical records of 369 adult patients with Hepatitis-E infection admitted at Aga khan University Hospital, from January 1996 to December 2010. Details of their laboratory investigations, clinical course and complications such as FHF and mortality were noted. The outcome was compared, and determinants of mortality were evaluated in important patient subgroups. Results: Out of 369 patients with Hepatitis-E, 326 (88.3%) were discharged after full recovery. Out of these 22 (6%) patients had chronic liver disease CLD in this study, of whom 10 (2.7%) expired (p-value <0.001). There were about 67 (18%) pregnant patients, with a mean gestational age of 29.19 ± 7.68 weeks and 5 (1.4%) pregnant patients died (p-value=0.23). A total of 58 (15.7%) patients were co-infected with other hepatotropic virus, and a comparison did not find an increased risk of mortality in this group. Conclusion: This study showed that Hepatitis-E is significantly associated with mortality in patients suffering from pre-existing chronic liver disease. Pregnancy was not a determinant of mortality in Hepatitis-E patients in this study, and neither was co-infection with other Hepatotropic viruses. (author)

  8. Knowledge, attitudes and practices around health research: the perspective of physicians-in-training in Pakistan

    Directory of Open Access Journals (Sweden)

    Khan Sadaf

    2009-07-01

    Full Text Available Abstract Background Health research training is an essential component of medical education and a vital exercise to help develop physician research skills. This study was carried out to assess the level of knowledge, attitudes and practices towards research amongst a group of Post Graduate Medical Trainees (PGMTs' at Aga Khan University (AKU, Pakistan. Methods A cross sectional health research survey was carried out on all PGMTs' at AKU Pakistan. AKU is a tertiary care health facility which offers residency in 28 specialties and fellowship in 16 programs. Knowledge, attitudes and practices related to health research were assessed using a pretested, structured and validated questionnaire. Health research related practices of the residents were examined using questions graded on Likert scale. Results Mean percentage score ± SD on the knowledge scale was 36.9% ± 20.2 and 47.19% ± 25.18 on the attitude scale. Of 104(55.6% who had previously participated in research 28(26.9% had been involved in basic science research only, 62(59.6% in clinical research and 14(13.5% had participated in both clinical and basic science research projects. 88(47.1% planned to pursue a future research career. Those who planned to pursue a future research career had more positive health research attitudes p Conclusion PGMTs' demonstrate inadequate knowledge, while they have moderate attitudes towards health research. Residency training and research facilities at the institution need to undergo major transformation in order to encourage meaningful research by resident trainees.

  9. Vitamin-D toxicity and other non-malignant causes of hypercalcemia: a retrospective study at a tertiary care hospital in pakistan

    International Nuclear Information System (INIS)

    Khan, M.N.

    2017-01-01

    Background: Hypercalcemia is a common clinical problem; primary hyperparathyroidism and malignancy is commonest causes of hypercalcemia. Aetiology of hypercalcemia are changing, causes that were diseases of the past like Vitamin-D toxicity and milk alkali syndrome are observed more often. Vitamin-D deficiency is an important problem and overzealous replacement of Vitamin-D has been observed, suspected to cause toxicity. Method: This was a retrospective review of patients admitted at the Aga Khan University Hospital from January 2008 to December 2013 with hypercalcemia. We reviewed the electronic health records for laboratory and radiological studies, and discharge summaries to establish the cause of hypercalcemia. Patients with solid tumour malignancy were excluded from the analysis. The treatment records and hospital course of patients diagnosed with Vitamin-D toxicity were also reviewed. Results: Primary hyperparathyroidism was the most common cause of hypercalcemia comprising 41 (28.2 %) patients. Vitamin-D toxicity was present in 25 (17.3%) and probable Vitamin-D toxicity 11 (7.6 %) in patients. Vitamin-D toxicity and probable Vitamin-D toxicity together comprised 36 (24.8%) cases. Other causes of hypercalcemia included multiple myeloma 18 (12.4%) patients, tuberculosis 6 (4.1%) patients, chronic kidney disease 6 (4.1%) cases, sarcoidosis 4 (2.7%) and lymphoma 3 (2.0%) patients. In 29(20%) patients a cause of hypercalcemia could not be determined and were labelled as undiagnosed cases. Conclusion: Vitamin-D toxicity was the second commonest cause of hypercalcemia after primary hyperparathyroidism. Knowledge of the prevalent and emerging causes of hypercalcemia is important for prompt diagnosis and treatment. (author)

  10. Non-operative management is superior to surgical stabilization in spine injury patients with complete neurological deficits: A perspective study from a developing world country, Pakistan.

    Science.gov (United States)

    Shamim, Muhammad Shahzad; Ali, Syed Faizan; Enam, Syed Ather

    2011-01-01

    Surgical stabilization of injured spine in patients with complete spinal cord injury is a common practice despite the lack of strong evidence supporting it. The aim of this study is to compare clinical outcomes and cost-effectiveness of surgical stabilization versus conservative management of spinal injury in patients with complete deficits, essentially from a developing country's point of view. A detailed analysis of patients with traumatic spine injury and complete deficits admitted at the Aga Khan University Hospital, Pakistan, from January 2004 till January 2010 was carried out. All patients presenting within 14 days of injury were divided in two groups, those who underwent stabilization procedures and those who were managed non-operatively. The two groups were compared with the endpoints being time to rehabilitation, length of hospital stay, 30 day morbidity/mortality, cost of treatment, and status at follow up. Fifty-four patients fulfilled the inclusion criteria and half of these were operated. On comparing endpoints, patients in the operative group took longer time to rehabilitation (P-value = 0.002); had longer hospital stay (P-value = 0.006) which included longer length of stay in special care unit (P-value = 0.002) as well as intensive care unit (P-value = 0.004); and were associated with more complications, especially those related to infections (P-value = 0.002). The mean cost of treatment was also significantly higher in the operative group (USD 6,500) as compared to non-operative group (USD 1490) (P-value managed non-operatively with a provision of surgery only if their rehabilitation is impeded due to pain or deformity.

  11. Surgical site infection following hernia repair in the day care setting of a developing country: a retrospective review

    International Nuclear Information System (INIS)

    Pardhan, A.; Mazahir, S.; Alvi, A.R.; Murtaza, G.

    2013-01-01

    Objective: To determine the incidence proportion of surgical site infection following hernia repair in a daycare setting at a tertiary care hospital of a low-income country. Methods: The retrospective audit was done at the Aga Khan University Hospital, Karachi, from June 1, 2008 to May 30, 2009. Patients with age >15 years who underwent Lichenstein's open mesh repair in daycare were included. Surgical Site Infection was labelled if the records revealed any of the following: opening of the wound by the primary surgeon; pain, tenderness and raised temperature of skin; purulent discharge from the wound; if the surgeon had documented it as a surgical site infection. SPSS 16 was used for data analysis. Results: After reviewing the retrieved files, 104 patients were found eligible. Of them, 102 (98%) were males. Overall wound-related complications were found in 13 (12.5%), whereas surgical site infection was found in 8 (7.7%) patients. The mean age of those with infections was 38.7+-18 year, while that of those with no surgical site infection was 47.8+-18 years. Smoking was found significantly associated with surgical site infection with 5.8 times higher incidence as compared to the non-smokers (OR with 95% CI: 5.6 (1.2, 25.3)). Conclusions: The incidence of surgical site infection after hernia repair with mesh in a daycare setting at a tertiary care hospital of a low-income country was higher than internationally reported incidence. Smoking was found to be a significant risk factor. (author)

  12. Needle stick injury in a radiology department: a decade analysis

    International Nuclear Information System (INIS)

    Sayani, R.; Rajani, A.

    2012-01-01

    Objectives: To determine the frequency of needle stick injury in health care workers of radiology department. Study type, settings and duration: Cross sectional, observational study conducted at the Radiology department of Aga Khan University hospital from January 2000 to May 2010. Subject and Methods: All self-reported needle stick injuries data of Health care workers of radiology department was recorded. The personnel involved (Radiologist, resident, radiographer, nurses etc), area of working and the causes of injury were identified including the procedural or post procedural details. Patient's status of hepatitis or blood borne infection was also noted. Data was recorded and analyzed in Excel worksheet. Results: A total of 55 health workers reported needle stick injuries at all sections of radiology departments with maximum number needle stick injuries at general radiography, fluoroscopy and IVP section. Radiographers and radiology residents received the maximum number of injuries. Major cause of injury was cannulation however, many injuries occurred during disposing or handling of bin. In majority of cases the patients were not infected with any known blood borne infections. Conclusions: Doctors and nurses get needle-stick injuries while carrying out clinical procedures, while, ancillary staff get infected post procedure during disposal of garbage. Policy message: Good occupational health and safety practices must be promoted to all staff. Safer disposal of needles is an important area where practice and procedure needs to be carefully reviewed. It is necessary to undertake a risk assessment, to offer counseling and Post Exposure Prophylaxis and treatment where necessary. (author)

  13. Plaque Index in Multi-Bracket Fixed Appliances

    International Nuclear Information System (INIS)

    Rahim, Z.H.; Shaikh, S.; Razak, F.A.

    2014-01-01

    To compare the plaque index in patients receiving multi-bracket fixed orthodontic treatment for various factors like age, gender, socio-economic status, brushing practices, meal habits, types of brackets, types of ligations, use of mouthwash and duration of treatment. Study Design: Cross-sectional analytical study. Place and Duration of Study: Orthodontics Clinic, The Aga Khan University Hospital, from September to November 2011. Methodology: Socio-demographic and clinical modalities were defined and recorded for 131 patients having multi-bracket fixed appliances. The plaque index of subjects were recorded according to the Silness and Loe plaque index method. Independent sample t-test was used to see difference in plaque index in factors having two variables. One way ANOVA and Post-Hoc Tukey tests were used to see difference in plaque index in factors having three variables. Kappa statistics was used to assess inter examiner reliability. P-value 0.05 was taken to be significant. Results: The sample comprised of 37% males (n = 48) and 63% females (n = 83). The plaque index had statistically significant association with practice of brushing i.e., timing of brushing (p=0.001), method of brushing (p=0.08), type of ligatures (p=0.05) and frequency of visits (p=0.01). Conclusion: The plaque accumulation is significantly decreased in subjects who brush the teeth twice or more than twice a day and those who brush their teeth after breakfast. The use of interdental brush and stainless steel ligatures had significantly low plaque. Subjects presenting with more frequent appointments of short-period had significantly less plaque. (author)

  14. Do clinical manifestations of Systemic Lupus Erythematosus in Pakistan correlate with rest of Asia?

    Science.gov (United States)

    Rabbani, Malik Anas; Siddiqui, Bilal Karim; Tahir, Muhammad Hammad; Ahmad, Bushra; Shamim, A; Majid, Shahid; Ali, Syed Sohail; Shah, Syed Mansoor Ahmed; Ahmad, Aasim

    2006-05-01

    Systemic Lupus Erythematosus (SLE) is known to be different among people with different racial, geographical and socio-economic back grounds. Asia has diverse ethnic groups broadly, Orientals in the East and Southeast Asia, Indians in South Asia and Arabs in the Middle East. These regions differ significantly from the Caucasians with reference to SLE. The purpose of this study was, therefore, to delineate the clinical pattern and disease course in Pakistani patients with SLE and compare it with Asian data. Patients with SLE fulfilling the clinical and laboratory criteria of the American Rheumatism Association admitted at the Aga Khan University Hospital between 1986 and 2001 were studied by means of a retrospective review of their records. The results were compared with various studies in different regions of Asia. Demographically, it was seen that SLE is a disease predominantly of females in their third decade, which is generally consistent with Asian data. There was less cutaneous manifestations, arthritis, serositis, haematological and renal involvement compared to various regions in Asia. The neurological manifestations of SLE, however, place Pakistani patients in the middle of a spectrum between South Asians and other Asian races. This study has shown that the clinical characteristics of SLE patients in our country may be different to those of other Asian races. Although our population is similar to South Asians, but clinical manifestations of our SLE patients are considerably different, suggesting some unknown etiology. Further studies are required to confirm the above results and to find statistically sounder associations.

  15. Association of Socio-demographic Characteristics with Pattern of Health Seeking Behavior among Hepatitis C Patients in Pakistan

    International Nuclear Information System (INIS)

    Pirani, S.; Ali, T.S.; Allana, S.; Ismail, F.W.

    2017-01-01

    Objectives: To identify association between socio-demographic characteristics and pattern of health seeking behavior among hepatitis C patients in Karachi, Pakistan. Study design, settings and duration: A descriptive, cross-sectional study done at Aga Khan University Hospital and the Civil Hospital Karachi between March and May 2013. Patients and Methods: Hepatitis C patients who were coming for treatment at the above 2 sites underwent a filling of questionnaire by the researcher. The questionnaire collected basic demographic information and their health seeking behavior i.e. visit to traditional healer or spiritual healer or medical doctor. Sample size of 250 patients was calculated. Analysis was done by using Chi square test and Fisher's exact test. p-value of 0.05 was considered as statistically significant. Results: A total of 250 hepatitis patients were interviewed. The study showed that patient's occupation and educational level had significant association with their first visit either to a spiritual healer or traditional healer. More educated group consulted the medical doctor while those with none or low education initially went to see spiritual healers (p < 0.008) and second visit was made to traditional healers (p < 0.002). Patients with larger number of children went less often to visit a medical doctor on their second visit (p = 0.007), and family members belonging to the medical field were more likely to make their first visit to doctors (p < 0.05). Conclusion: Socio-demographic characteristics greatly influence the pattern of health seeking behavior among hepatitis C patients. (author)

  16. Craniocerebral injuries in war against terrorism a contemporary series from Pakistan

    Directory of Open Access Journals (Sweden)

    Bashir Muhammad Umair

    2013-06-01

    Full Text Available 【Abstract】Objective: Terrorism-related bomb at-tacks on civilian population have increased dramatically over the last decade. Craniocerebral injuries secondary to impro-vised explosive devices have not been widely reported in the context of unarmored civilians. This series intends to report the spectrum of these injuries secondary to suicidal and implanted bombs as encountered at the Aga Khan Uni-versity Hospital, Pakistan (AKUH. Further, a few pertinent management guidelines have also been discussed. Methods: The hospital database and clinical coding during a 5-year period were examined for head injuries se-condary to terrorism-associated blasts. In addition to pa-tient demographics, data analysis for our series included initial Glasgow Coma Scale, presenting neurological complaints, associated non-neurological injuries, manage-ment (conservative or operative to associated complications, and discharge neurological status. Results: A total of 16 patients were included in this series. Among them 9 were victims of suicidal blasts while 7 were exposed to implanted devices. The patients presented with diverse patterns of injury secondary to a variety of shrapnel. A follow-up record was available for 12 of the 16 patients (mean follow-up: 7.8 months, with most patients having no active complaints. Conclusion: The results of this series show that civi-lian victims of suicidal and improvised bombings present with a wide range of neurological symptoms and injury patterns, which often differ from the neurological injuries incurred by military personnel in similar situations, and thereby often require individualized care. Key words: Brain injuries; Craniocerebral trauma; Decompressive craniectomy

  17. Factors predicting the recurrence of spontaneous bacterial peritonitis in patients with cirrhosis

    International Nuclear Information System (INIS)

    Jamil, S.; Shah, S.H.A.

    2011-01-01

    Objective: To evaluate the frequency of recurrence of spontaneous bacterial peritonitis (SBP) in patients with end stage liver disease and the factors responsible for it. Study Design: Descriptive study. Place and Duration of Study: The Aga Khan University Hospital, Karachi, from November 2008 till November 2009. Methodology: Patients with cirrhosis who were admitted at AKUH with diagnosis of SBP during the study period were included. Any episode of SBP after resolution of the first index case of SBP within one year was considered as recurrence. Results: Out of 238 cirrhotic patients, 157 (66%) had single, while 81 (34%) had recurrent episodes of SBP. History of using proton pump inhibitors (PPI) and diuretics was found in 113 (47.5%) and 139 (58.4%) patients respectively. Only 58 (24.4%) patients were on prophylactic antibiotic therapy. Univariate analysis revealed that the female gender (52%), and presence of porto-systemic encephalopathy (PSE, 31%) were statistically significant (p=0.03) among those who had re-current SBP. On multivariate analysis bilirubin level of > 1.0 mg (OR=7.03; 95%CI=1.55-32), protective factor of hepatitis B (OR 0.31; 95%CI=0.13-0.70) and presence of urinary tract infection (UTI) (OR=2.24; 95%CI=0.99-5.09) were significant in patients with recurrent SBP. Conclusion: Recurrent SBP was noticed in 34% patients. Serum bilirubin level of > 1.0 mg, protective factor of HBV and presence of UTI were significant factors present in patients with recurrent SBP. (author)

  18. Use of liquid nitrogen and albendazole in successfully treating cutaneous larva migrans.

    Science.gov (United States)

    Kapadia, Naseema; Borhany, Tasneem; Farooqui, Maria

    2013-05-01

    To determine the efficacy of combination treatment of Albendazole along with liquid nitrogen in cutaneous larva migrans. Quasi-experimental study. Abbasi Shaheed Hospital and The Aga Khan Hospital, Karachi, from December 2008 to December 2010. Eighteen cases of cutaneous larva migrans were collected and divided into two groups. Group-A was administered oral Albendazole 400 mg once per day along with topical steroid and oral cetrizine 10 mg once at night for 7 days. Group-B also received oral Albendazole 400 mg once per day along with cetrizine 10 mg once at night but they also received single application of liquid nitrogen to freeze the larva. It was found that in Group-A only 2 out of 9 (22%) showed improvement whereas 78% had to be given liquid nitrogen cryotherapy 3 - 7 days after Albendazole to prevent migration of larva. In Group-B, the improvement was 100% and all 9 patients were successfully treated. Use of liquid nitrogen along with oral anti-helminths is very effective in treating cutaneous larva migrans than Albendazole alone.

  19. Mobile Sensor System AGaMon for Breath Control: Numerical Signal Analysis of Ternary Gas Mixtures and First Field Tests

    Directory of Open Access Journals (Sweden)

    Rolf Seifert

    2018-01-01

    Full Text Available An innovative mobile sensor system for breath control in the exhaled air is introduced. In this paper, the application of alcohol control in the exhaled air is considered. This sensor system operates semiconducting gas sensor elements with respect to the application in a thermo-cyclic operation mode. This operation mode leads to so-called conductance-over-time-profiles (CTPs, which are fingerprints of the gas mixture under consideration and can be used for substance identification and concentration determination. Especially for the alcohol control in the exhaled air, ethanol is the leading gas component to be investigated. But, there are also other interfering gas components in the exhaled air, like H2 and acetone, which may influence the measurement results. Therefore, a ternary ethanol-H2-acetone gas mixture was investigated. The establishing of the mathematical calibration model and the data analysis was performed with a newly developed innovative calibration and evaluation procedure called ProSens 3.0. The analysis of ternary ethanol-H2-acetone gas samples with ProSens 3.0 shows a very good substance identification performance and a very good concentration determination of the leading ethanol component. The relative analysis errors for the leading component ethanol were in all considered samples less than 9 %. First field test performed with the sensor system AGaMon shows very promising results.

  20. Investigating Potential Artesian Aquifers in Rod-Kohi Area of DI Khan, NWFP using GIS and Geo-Processing Techniques

    Directory of Open Access Journals (Sweden)

    Arshad Ashraf

    2012-07-01

    Full Text Available The artesian aquifers provide economical and sustainable source of groundwater for irrigation and domestic use. GIS (Geographic Information System was used for development and integration of spatial databases, analysis and visualization of spatial data in two- and three-dimensional views. The aquifer system of Daraban Rod-Kohi area of DI Khan was analyzed to identify potential artesian aquifers using geological sections of the observation wells representing detail of subsurface lithology and strata encountered. According to an estimate, about 1,700 million m3 of extractable volume of groundwater exists in this part of rod-kohi area. Different profile sections were drawn to analyze the subsurface condition of the study area using Rockworks GIS-based software. The geo-processing technique of horizontal litho-blending was utilized for lithological modeling. Based on stratigraphic information of the area, three distinct aquifers were identified down to a depth of about 200 meters among which two are semi-confined to confined having prospects of artesian water. The 2D and 3D analysis show that characteristics of the confined aquifers vary spatially with the subsurface lithology and structural setup of the area. The depth range of confined layer-1 is found between 118 and 133 meters while of confined layer-2 between 182 and 195 meters. The output data indicated a close agreement with the observed data of the artesian wells. The study results can provide base for detail investigation of artesian resource and selection of potential sites for installation of artesian wells in the target area.

  1. Beliefs and perception about mental health issues: a meta-synthesis

    OpenAIRE

    Choudhry, Fahad Riaz; Mani, Vasudevan; Ming, Long Chiau; Khan, Tahir Mehmood

    2016-01-01

    Fahad Riaz Choudhry,1 Vasudevan Mani,2 Long Chiau Ming,3,4 Tahir Mehmood Khan5 1Psychology Department, Jeffrey Cheah School of Medicine and Health Sciences, Monash University Malaysia, Sunway City, Selangor, Malaysia; 2College of Pharmacy, Qassim University, Buraidah, Al-Qassim, Kingdom of Saudi Arabia; 3Vector-borne Diseases Research Group (VERDI), Pharmaceutical and Life Sciences CoRe, Universiti Teknologi MARA, Shah Alam; 4Brain Degeneration and Therapeutics Group, Faculty of Pharmacy, Un...

  2. Fulltext PDF

    Indian Academy of Sciences (India)

    see Reddy N Parvathala. 1065. Ahmad Irfan see Khan Ziauddin. 1011. Akhlaghi Parisa. The measurements of thermal neutron flux distribution in a paraffin phantom. 873. Amirhashchi Hassan. String cosmology in Bianchi type-VI0 dusty. Universe with electromagnetic field. 723. Aref Morteza see Feghhi Seyed Amir Hossein.

  3. Conventional and novel stem cell based therapies for androgenic alopecia

    Directory of Open Access Journals (Sweden)

    Talavera-Adame D

    2017-08-01

    Full Text Available Dodanim Talavera-Adame,1 Daniella Newman,2 Nathan Newman1 1American Advanced Medical Corp. (Private Practice, Beverly Hills, CA, 2Western University of Health Sciences, Pomona, CA, USA Abstract: The prevalence of androgenic alopecia (AGA increases with age and it affects both men and women. Patients diagnosed with AGA may experience decreased quality of life, depression, and feel self-conscious. There are a variety of therapeutic options ranging from prescription drugs to non-prescription medications. Currently, AGA involves an annual global market revenue of US$4 billion and a growth rate of 1.8%, indicating a growing consumer market. Although natural and synthetic ingredients can promote hair growth and, therefore, be useful to treat AGA, some of them have important adverse effects and unknown mechanisms of action that limit their use and benefits. Biologic factors that include signaling from stem cells, dermal papilla cells, and platelet-rich plasma are some of the current therapeutic agents being studied for hair restoration with milder side effects. However, most of the mechanisms exerted by these factors in hair restoration are still being researched. In this review, we analyze the therapeutic agents that have been used for AGA and emphasize the potential of new therapies based on advances in stem cell technologies and regenerative medicine. Keywords: stem cells, stem cell therapies, hair follicle, dermal papilla, androgenic alopecia, laser, hair regeneration

  4. Anirban Mukhopadhyay: Examining migration and adaptation in deltas

    International Development Research Centre (IDRC) Digital Library (Canada)

    Following master's degrees in marine science and remote sensing and GIS, Anirban completed his PhD in multi-hazard coastal vulnerability modeling. His last project was ... Shah Alam Khan est professeur à la Bangladesh University of Engineering and Technology et directeur de l'Institute of Water and Flood Managemen.

  5. Inde | Page 72 | CRDI - Centre de recherches pour le ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    The collection covers three critical dimensions of making evaluation matter in development processes and change in South Asia: context, methods, and use. ... Shah Alam Khan est professeur à la Bangladesh University of Engineering and Technology et directeur de l'Institute of Water and Flood Management de cet ...

  6. Translational Significance of p53 Loss of Heterozygosity in Breast Cancer

    Science.gov (United States)

    2017-09-01

    Like factors in carcinogenesis, inflammation, inflammation-induced tumorigenesis and obesity -related diseases. EDUCATION: 1997-2003 Ph. D...USA. 1994-1995 Teaching assistant at the Biology Dept., The American University at Cairo, El- Tahreer Square, Cairo, Egypt. Additional courses from...Diseases Week, San Diego, CA. 2010 Outstanding Achievement merit award from Emory University. 2008 The American Gastroenterological Association (AGA

  7. Measurement of waterborne radon in the drinking water of the Dera Ismail Khan city using active and passive techniques

    Directory of Open Access Journals (Sweden)

    Nasir Tabassum

    2015-01-01

    Full Text Available Groundwater is considered to be the second largest contributor to the indoor radon concentration after soil. Therefore, measurement of waterborne radon has remained a point of interest for many researchers. The main objective of this study is to study waterborne radon activity in the city of Dera Ismail Khan. In this context, water samples were collected from different locations of the city and waterborne radon was measured using a pylon vacuum water degassing system and CR-39 based radon detectors. The pylon system measured waterborne radon activities in samples of hand pumps and motor driven pumps varying from 0.015 to 0.066 Bq/L and 0.021 to 0.145 Bq/L with average values of 0.041 ± 0.015 Bq/L and 0.076 ± 0.024 Bq/L, respectively. Whereas CR-39 based measured values ranged from 0.042 to 0.125 Bq/L and 0.075 to 0.158 Bq/L with average values of 0.081 ± 0.021 Bq/L and 0.120 ± 0.020 Bq/L, respectively. The estimated average annual effective dose due to ingestion of radon from drinking water using pylon and CR-39 based radon detectors for hand and motor pump samples was found to be 1.055×10-4 mSv and 1.947×10-4 mSv, and 2.067×10-4 mSv and 3.058×10-4 mSv, respectively. The waterborne radon concentrations and as a result the annual effective dose expected to be received from it are within the recommended safe limits.

  8. Early psychosis symptoms

    International Nuclear Information System (INIS)

    Naqvi, H.A.; Hussain, S.; Islam, M.

    2014-01-01

    Objective: To determine the prodromal symptoms of schizophrenia in the pathways to help-seeking. Study Design: A cross-sectional study. Place and Duration of Study: The Department of Psychiatry, the Aga Khan University, Karachi, from 2008 to 2009. Methodology: A total of 93 patients were interviewed in the pathways to care of schizophrenia. The diagnosis was based on ICD-10 criteria. The pathways to care were assessed through a semi-structured questionnaire. The onset, course and symptoms of psychosis were assessed through Interview for Retrospective Assessment at Age at Onset of Psychosis (IROAS). Results: Fifty five (59%) participants were male while 41% (n=38%) were female. Using IROAS, 108 symptoms were identified as concerning behaviour. Alternatively, 60 (55%) concerning behaviours were reported in the open-ended inquiry of the reasons for help seeking as assessed by the pathways to care questionnaire with a statistically significant difference between most symptoms category. The difference was most pronounced (p < 0.001) for depressed mood (66%), worries (65%), tension (63%), withdrawal/mistrust (54%) and loss of self-confidence (53%). Thought withdrawal (22%) and passivity (15%) were elicited only through structured interview (IROAS). When symptoms were categorized together, about 83% of the subjects presented with affective and non-specific prodromal symptoms. Roughly, 10% of the subjects presented with positive symptoms and 3% presented with the negative symptoms of psychosis. The non-specific, affective symptoms appear to predominate the prodromal phase of the illness. Conclusion: Prodromal symptoms of schizophrenia include non-specific, affective symptoms. Attention needs to be paid on identifying the prodromal symptoms and change in social functioning in order to identify those who are at risk of long term psychosis. (author)

  9. Are our people health conscious? Results of a patients survey in Karachi, Pakistan.

    Science.gov (United States)

    Qidwai, Waris; Saleheen, Danish; Saleem, Sadia; Andrades, Marie; Azam, Syed Iqbal

    2003-01-01

    Life style is known to influence health and may be responsible for certain diseases. There is a need to document the life style on health among the Pakistani population. The study was conducted on patients visiting the Family Practice Center, the Aga Khan University, Karachi. A questionnaire was used to collect information on the demographic profile, and the life style on health. The ethical requirements for conducting the study were met. 393 patients were surveyed. The majority were young married men, in either private or government service. Preference for consumption of fats/oils, sweets, spicy foods, salt, fruits/vegetables, tea, coffee, cola drinks and alcohol was found among 103 (26%), 84 (22%), 86 (22%), 110 (28%), 239 (61%), 319 (81%), 117 (30%), 253 (64%) and 13 (03%) respondents respectively. Hand washing after defecation, before eating food and after work was seen among 341 (87%), 296 (75%) and 256 (65%) respondents respectively. Brushing of teeth after eating food, before breakfast and bedtime was seen in 56 (14%), 346 (88%) and 176 (45%) respondents respectively. Preventive dental check-up was practiced by 102 (26%) of the respondents. Sleep of less than 6 hours per day among 74 (19%), water consumption of less than 1 liter daily among 84 (21%) and fish consumption on once a week basis among 173 (44%) respondents was found. Tobacco and betel nuts use was found among 69 (17%) and 79 (20%) respondents. We have documented a clear need to raise public awareness on the issue of life style on health. There is a need and we strongly recommend debate and further research, along with interventional strategies in line with the available evidence on healthy life style.

  10. Pediatric critical incidents reported over 15 years at a tertiary care teaching hospital of a developing country.

    Science.gov (United States)

    Abbasi, Shemila; Khan, Fauzia Anis; Khan, Sobia

    2018-01-01

    The role of critical incident (CI) reporting is well established in improving patient safety but only a limited number of available reports relate to pediatric incidents. Our aim was to analyze the reported CIs specific to pediatric patients in our database and to reevaluate the value of this program in addressing issues in pediatric anesthesia practice. Incidents related to pediatric population from neonatal period till the age of 12 years were selected. A review of all CI records collected between January 1998 and December 2012, in the Department of Anaesthesiology of Aga Khan University hospital was done. This was retrospective form review. The Department has a structured CI form in use since 1998 which is intermittently evaluated and modified if needed. A total of 451 pediatric CIs were included. Thirty-four percent of the incidents were reported in infants. Ninety-six percent of the reported incidents took place during elective surgery and 4% during emergency surgery. Equipment-related events (n = 114), respiratory events (n = 112), and drug events (n = 110) were equally distributed (25.6%, 25.3%, and 24.7%). Human factors accounted for 74% of reports followed by, equipment failure (10%) and patient factors (8%). Only 5% of the incidents were system errors. Failure to check (equipment/drugs/doses) was the most common cause for human factors. Poor outcome was seen in 7% of cases. Medication and equipment are the clinical areas that need to be looked at more closely. We also recommend quality improvement projects in both these areas as well as training of residents and staff in managing airway-related problems in pediatric patients.

  11. Mobile-based blended learning for capacity building of health providers in rural Afghanistan.

    Science.gov (United States)

    Tirmizi, Syeda Nateela; Khoja, Shariq; Patten, Scott; Yousafzai, Abdul Wahab; Scott, Richard E; Durrani, Hammad; Khoja, Wafa; Husyin, Nida

    2017-01-01

    Mobile-based blended learning initiative was launched in November 2014 in Badakshan province of Afghanistan by Tech4Life Enterprises, Aga Khan Health Service, Afghanistan (AKHS, A), and the University of Calgary, Canada. The goal of this initiative was to improve knowledge of health providers related to four major mental health problems, namely depression, psychosis, post-traumatic stress disorder (PTSD) and drug abuse. This paper presents the results of quasi-experimental study conducted in 4 intervention districts in Badakshan for improvement in the knowledge among health providers about depression. The results were compared with three control districts for the change in knowledge scores. Sixty-two health providers completed pre and post module questionnaires from case district, while 31 health providers did so from the control sites. Significant change was noticed in the case districts, where overall knowledge scores changed from 45% in pre-intervention test to 63% in post-intervention test. Overall background knowledge of pre to post module test scores changed from 30% to 40%, knowledge of symptoms showed correct responses raised from 25% to 44%, knowledge related to causes of depression from overall districts showed change from 22% to 51%, and treatment knowledge of depression improved from 29% to 35%. Average gain in scores among cases was 16.06, compared to 6.8 in controls. The study confirms that a blended Learning approach with multiple learning techniques for health providers in Badakshan, Afghanistan, enhanced their knowledge and offers an effective solution to overcome challenges in continuing education. Further research is needed to confirm that the gains in knowledge reported here translate into better practice and improved mental health.

  12. Preload versus coload and vasopressor requirement for the prevention of spinal anesthesia induced hypotension in non-obstetric patients

    International Nuclear Information System (INIS)

    Khan, M.U.; Aqil, M.

    2015-01-01

    To compare the effectiveness of preload and coload for the prevention of Spinal Induced Hypotension (SIH) and vasopressor requirements. Study Design: Randomized trial. Place and Duration of Study: Department of Anesthesia, The Aga Khan University Hospital, Karachi, Pakistan, from June 2007 - June 2010. Methodology: Sixty patients were randomly divided into preload and coload group of 30 each. Patients with ASA1 - 3, aged 20 - 60 years were included. Patients with history of IHD, COPD, BMI > 30 and surgical procedure TURP were excluded. All patients received crystalloid 10 ml/kg before induction of spinal anesthesia in preload group and at the time of spinal anesthesia in coload group. Blood pressure and heart rate were recorded at different time intervals till 45 minutes. Patients received ephedrine 5 mg when systolic blood pressure dropped below 90 mmHg and heart rate was less than 60 beats/minute and/or phenylephrine 50 micrograms when systolic blood pressure dropped below 90 mmHg and heart rate was more than 60 beats/minute. Results: There was no statistically significant difference at different time intervals in heart rate, systolic and mean arterial pressure between the groups. Diastolic blood pressure was significantly different in both groups at 6 - 15 minutes after spinal anesthesia. SIH occurred (21) 70% and (15) 50% in preload and coload groups, respectively (p=0.187). Ephedrine requirement for SIH was significantly high in preload group (p=0.017). Phenylephrine requirement for SIH was high in preload group which was statistically non-significant (p=0.285). Conclusion: Coload group has lower incidence of spinal induced hypotension and significantly less vasopressor requirement than the preload group. (author)

  13. Self-reported feeding advice by physicians for common childhood illnesses.

    Science.gov (United States)

    Nizami, S Q; Bhutta, Z A

    1999-12-01

    A nutritious diet is important for recovery during illnesses. Dietary advice by physicians and consumption of food by the patients are often based upon their hot and cold concepts and beliefs about various foods rather than on scientific basis. To look at the food-advising behaviour of physicians during illnesses and to know the maternal concepts about various foods being hot or cold. A questionnaire was served to the physicians participating in a continuous medical education session held at the Aga Khan University and Hospital, asking them to write the foods they advise or restrict during different illnesses such as fever, jaundice etc. Mothers of sick children suffering from diarrhea and other illnesses were also interviewed to know their concepts about various foods. Six (10%) out of sixty physicians believed in hot and cold concepts of the food. A variety of common foods were either restricted or strongly recommended by 10% to 50% of these physicians without any scientific basis, 23% physicians restricted fatty foods in jaundice, 17% physicians restricted in cough and cold. Although the interviewed mothers believed in hot-cold concepts of food but 55-63% of them were not sure what is meant by hot or cold food. In spite of that 70-80% of these mothers classified chicken, meat, egg, brinjal, masoor and mangoes are hot foods and rice, yogurt, moong, banana and orange as cold foods. Hot-Cold concept of food exists not only in mothers but also in physicians. Proper education regarding food intake is mandatory for both mothers and physicians to ascertain adequate intake of calories during sickness.

  14. Phenotypic low-level isoniazid resistance as a marker to predict ethionamide resistance in Mycobacterium tuberculosis

    Directory of Open Access Journals (Sweden)

    Salima Qamar

    2017-01-01

    Full Text Available Background: Tuberculosis is one of the most prevalent diseases in Pakistan. Pakistan has the highest burden of MDR-TB in the Eastern Mediterranean region. Ethionamide is an anti-tuberculous drug frequently used to treat MDR-TB. Its drug susceptibility testing is not easily available in resource limited settings. Since it acts on the same target protein as isoniazid (inhA protein encoded by inhA gene, we sought to find out if phenotypic isoniazid resistance can be a marker of ethionamide resistance. Materials and Methods: This was a retrospective observational study conducted at the Aga Khan University hospital section of microbiology. Data was retrieved between 2011 to 2014 for all culture positive MTB strains. All culture positive MTB isolates with susceptibilities to isoniazid and ethionamide recorded were included in the study. Isoniazid and ethionamide susceptibilities were performed using agar proportion method on Middlebrook 7H10 agar. Rate of Ethionamide resistance between low-level isoniazid resistant, high level isoniazid resistant and isoniazid sensitive MTB was compared. Results: A total of 11,274 isolates were included in the study. A statistically significant association (P < 0.001 was found between Ethionamide resistance and low-level isoniazid resistance (26.6% as compared to high-level isoniazid resistance (8.85% and isoniazid sensitivity (0.71% in MTB strains. However this association was not seen in XDR-TB strains. Conclusion: Low level isoniazid resistance may be used as marker for phenotypic ethionamide resistance and hence guide clinicians' choice of antituberculous agent for MDR-TB in Pakistan. Further studies involving detection of genotypic association of isoniazid and ethionamide susceptibilities are needed before a final conclusion can be derived.

  15. Death certificate completion skills of hospital physicians in a developing country.

    Science.gov (United States)

    Haque, Ahmed Suleman; Shamim, Kanza; Siddiqui, Najm Hasan; Irfan, Muhammad; Khan, Javaid Ahmed

    2013-06-06

    Death certificates (DC) can provide valuable health status data regarding disease incidence, prevalence and mortality in a community. It can guide local health policy and help in setting priorities. Incomplete and inaccurate DC data, on the other hand, can significantly impair the precision of a national health information database. In this study we evaluated the accuracy of death certificates at a tertiary care teaching hospital in a Karachi, Pakistan. A retrospective study conducted at Aga Khan University Hospital, Karachi, Pakistan for a period of six months. Medical records and death certificates of all patients who died under adult medical service were studied. The demographic characteristics, administrative details, co-morbidities and cause of death from death certificates were collected using an approved standardized form. Accuracy of this information was validated using their medical records. Errors in the death certificates were classified into six categories, from 0 to 5 according to increasing severity; a grade 0 was assigned if no errors were identified, and 5, if an incorrect cause of death was attributed or placed in an improper sequence. 223 deaths occurred during the study period. 9 certificates were not accessible and 12 patients had incomplete medical records. 202 certificates were finally analyzed. Most frequent errors pertaining to patients' demographics (92%) and cause/s of death (87%) were identified. 156 (77%) certificates had 3 or more errors and 124 (62%) certificates had a combination of errors that significantly changed the death certificate interpretation. Only 1% certificates were error free. A very high rate of errors was identified in death certificates completed at our academic institution. There is a pressing need for appropriate intervention/s to resolve this important issue.

  16. Tramadol-Paracetamol Combination for Postoperative Pain Relief in Elective Single-level Microdisectomy Surgery.

    Science.gov (United States)

    Dogar, Samie A; Khan, Fauzia A

    2017-04-01

    The tramadol and paracetamol combination is used frequently for postoperative pain management. The literature on the use of this combination for vertebral surgery is limited. Our objective was to compare a combination of paracetamol 1 g and a lower dose of tramadol (1 mg/kg: group 1T) with a combination of paracetamol 1 g and a higher dose of tramadol (1.5 mg/kg: group 1.5T) for postoperative pain after microdisectomy surgery. Our main outcome measure was Visual Analogue Scale pain scores for 4 hours postoperatively. This prospective randomized triple-blind clinical trial was conducted at Aga Khan University Hospital, Karachi. Ninety-four patients aged between 18 and 50 years scheduled for elective single-level microdisectomy were allocated randomly into 1 of 2 groups. Twenty minutes before the end of the surgery, patients received the study drugs. There was no significant demographic difference between groups. None of the patients experienced severe pain (VAS>6). There was no significant difference in the mean pain score between groups. The mean score at 4 hours was 2.17 (1.38) in group 1.5T and 1.74 (1.37) in group 1T. The difference was not statistically significant (P=0.14). In group 1.5T, 13 patients reported having nausea and vomiting compared with 2 patients in group 1T. This was a statistically significant difference (P=0.004). The sedation score was similar between groups. The combination of low-dose tramadol (1 mg/kg) and paracetamol has comparable analgesia and a decreased incidence of nausea and vomiting compared with the higher dose of tramadol (1.5 mg/kg) and paracetamol combination.

  17. Nuclear Medicine Practice in Kenya

    International Nuclear Information System (INIS)

    Ndrirangu, T.T.

    2017-01-01

    Nuclear medicine is a medical specialty that relies on the use of nuclear technology in the diagnosis and treatment (therapy) of diseases. Nuclear medicine uses the principle that a certain radiopharmaceutical (tracer) will at a certain point in time have a preferential uptake by a particular body, tissue or cell. Unlike other radiation applications for medical use, nuclear medicine uses open (unsealed) sources of radiation. The tracer is introduced into the body of the patient through several routes (oral, intravenous, percutaneous, intradermally, inhalation, intracapsular etc) and s/he becomes the source of radiation. Early diagnosis of diseases coupled with associated timely therapeutic intervention will lead to better prognosis. In a country with an estimated population of 42 million in 2017, Kenya has only two (2) nuclear medicine facilities (units) that is Kenyatta National Hospital - Public facility and Aga Khan University Hospital which is a Private facility. Being a relatively new medical discipline in Kenya, several measures have been taken by the clinical nuclear medicine team to create awareness at various levels. Kenya does not manufacture radiopharmaceuticals. We therefore have to import them from abroad and this makes them quite expensive, and the process demanding. There is no local training in nuclear medicine and staff have to be sent abroad for training, making this quite expensive and cumbersome and the IAEA has been complimenting in this area. With concerted effort by all stakeholders at the individual, national and international level, it is possible for Kenya to effectively sustain clinical nuclear medicine service not only as a diagnostic tool in many disease entities, but also play an increasingly important role in therapy

  18. The financial burden of cancer: Estimates from patients undergoing cancer care in a tertiary care hospital

    Directory of Open Access Journals (Sweden)

    Zaidi Adnan A

    2012-10-01

    Full Text Available Abstract Introduction The emotional burden associated with the diagnosis of cancer is sometimes overshadowed by financial burden sustained by patient and the family. This is especially relevant for a developing country as there is limited state support for cancer treatment. We conducted this study to estimate the cost of cancer care for two major types of cancer and to assess the perception of patients and families regarding the burden of the cost for undergoing cancer treatment at a private tertiary care hospital. Methods This cross-sectional study was conducted at day care and radiotherapy unit of Aga Khan University, Hospital (AKUH Karachi, Pakistan. All adult patients with breast and head & neck cancers diagnosed for 3 months or more were included. Data was collected using a structured questionnaire and analysed using SPSS. Results Sixty seven patients were interviewed during the study period. The mean and median monthly income of these patients was 996.4 USD and 562.5 USD respectively. Comparatively the mean and median monthly cost of cancer care was 1093.13 USD and 946.42 USD respectively. The cost of the treatment either fully or partially was borne by the family in most cases (94%. The financial burden of cancer was perceived as significant by 28 (42% patients and unmanageable by 18 (27% patients. This perceived level of burden was associated significantly with average monthly income (p = Conclusion Our study indicates that the financial burden of cancer care is substantial and can be overwhelming. There is a desperate need for treatment support programs either by the government or other welfare organisations to support individuals and families who are already facing a difficult and challenging situation.

  19. Predictive Model for Blood Product Use in Coronary Artery Bypass Grafting

    International Nuclear Information System (INIS)

    Sharif, H.; Ansari, H.Z.; Ashfaq, A.; Rawasia, W.F.; Bano, G.; Hashmi, S.

    2016-01-01

    Objective: To build a clinical predictive model to determine the need for transfusing blood and its products in coronary artery bypass grafting (CABG) procedures in South East Asian population. Study Design: Analytical study. Place and Duration of Study: Section of Cardiothoracic Surgery, Aga Khan University Hospital, Karachi, from January 2006 to October 2014. Methodology: Information on pre-, intra- and postoperative variables were collected for all adult patients who underwent on-pump CABG. The patients grouped into those who received blood and its components, and those who did not. A univariate as well as multivariate logistic model was built to determine the predictors of transfusion. Result: A total of 3,550 patients underwent CABG and males were dominant in both groups (75 vs. 93 percent). The transfusion rate was 56.4 percent (n=2001). Age (adjusted OR 1.03, p < 0.001), obesity (1.50, p=0.001), tobacco use (1.29, p=0.001), and male gender (4.51, p < 0.001) found to be a stronger predictor. Among preoperative comorbidities, diabetes (1.20, p=0.016), myocardial infarction (1.22, p=0.009), preoperative creatinine (1.12, p=0.033), and left main vessel disease of > 50 percent (1.49, p < 0.001) were independently associated with the outcome. Compared to elective cases, transfusion rates were high in urgent and emergent cases (OR: 1.93 and 3.36 respectively, p < 0.001 for both). Conclusion: Age, male gender, obesity, tobacco use, diabetes, myocardial infarction, high creatinine, urgent and emergent cases were independent predictors of transfusion in CABG procedure. This model can be utilized for preoperative risk stratification of patients and their management to improve the outcomes. (author)

  20. Comparison of choroidal thickness measurements between spectral-domain OCT and swept-source OCT in normal and diseased eyes

    Directory of Open Access Journals (Sweden)

    Zafar S

    2016-11-01

    Full Text Available Sidra Zafar,1 MA Rehman Siddiqui,2,3 Rida Shahzad1 1Medical College, Aga Khan University Hospital, 2Department of Ophthalmology, Shahzad Eye Hospital, 3South City Hospital, Karachi, Pakistan Purpose: Sub-foveal choroidal thickness (SFCT is affected in many ocular diseases. The aim of this study was to compare SFCT measurements between Topcon 3D 2000 spectral-domain optical coherence tomography (SD-OCT and Topcon swept-source OCT (SS-OCT, with different laser wavelengths, in normal and diseased populations. Materials and methods: This was a prospective, cross-sectional, noninterventional study including 27 normal volunteers and 27 participants with retinal disease. OCT scans were performed sequentially and under standardized conditions using both SD-OCT and SS-OCT. The OCT scans were evaluated by two independent graders. Paired t-tests and intraclass correlation coefficients (ICCs were used to assess the statistically significant difference between SFCT measurements as measured by the two devices. Results: Mean SFCT measurements for all 54 participants were 264.9±103.1 µm using SD-OCT (range: 47–470 µm and 278.5±110.5 µm using SS-OCT (range: 56–502 µm, with an inter-device ICC of 0.850. Greater variability was noted in the diseased eyes. Inter-device ICCs were 0.870 (95% CI; 0.760–0.924 and 0.840 (95% CI; 0.654–0.930 for normal and diseased eyes, respectively. However, the difference was not statistically significant (P=0.132. Conclusion: Both machines reliably measure SFCT. Larger studies are needed to confirm these findings. Keywords: choroidal imaging, diseased, normal, SD-OCT, SS-OCT

  1. Positive Association of Vitamin E Supplementation with Hemoglobin Levels in Mildly Anemic Healthy Pakistani Adults.

    Science.gov (United States)

    Jilani, Tanveer; Azam, Iqbal; Moiz, Bushra; Mehboobali, Naseema; Perwaiz Iqbal, Mohammad

    2015-01-01

    Hemoglobin levels slightly below the lower limit of normal are common in adults in the general population in developing countries. A few human studies have suggested the use of antioxidant vitamins in the correction of mild anemia. The objective of the present study was to investigate the association of vitamin E supplementation in mildly anemic healthy adults with post-supplemental blood hemoglobin levels in the general population of Karachi, Pakistan. In a single-blinded and placebo-controlled randomized trial, 124 mildly anemic subjects from the General Practitioners' Clinics and personnel of the Aga Khan University were randomized into intervention (n = 82) and control (n = 42) group. In the intervention group, each subject was given vitamin E (400 mg) everyday for a period of three months, while control group subjects received a placebo. Eighty six subjects completed the trial. Fasting venous blood was collected at baseline and after three months of supplementation. Hemoglobin levels and serum/plasma concentrations of vitamin E, vitamin B12, folate, ferritin, serum transferrin receptor (sTfR), glucose, total cholesterol, triglycerides, LDL-cholesterol, HDL-cholesterol, creatinine, total-antioxidant-status and erythropoietin were measured and analyzed using repeated measures ANOVA and multiple linear regression. The adjusted regression coefficients (β) and standard error [SE(β)] of the significant predictors of post-supplemental hemoglobin levels were serum concentration of vitamin E (0.983[0.095]), gender (- 0.656[0.244]), sTfR (- 0.06[0.02]) and baseline hemoglobin levels (0.768[0.077]). The study showed a positive association between vitamin E supplementation and enhanced hemoglobin levels in mildly anemic adults.

  2. One hundred injured patients a day: multicenter emergency room surveillance of trauma in Pakistan.

    Science.gov (United States)

    Hyder, A A; He, S; Zafar, W; Mir, M U; Razzak, J A

    2017-07-01

    Injuries increasingly contribute to the global burden of disease in low- and middle-income countries. This study presents results from a large-scale surveillance study on injury from several urban emergency departments (EDs) in Pakistan. The objective is to document the burden of injuries that present to the healthcare system in Pakistan and to test the feasibility of an ED-based injury and trauma surveillance system. Cross-sectional study conducted using active surveillance approach. This study included EDs of seven tertiary care hospitals in Pakistan. The data were collected between November 2010 and March 2011. All patients presenting with injuries to the participating EDs were enrolled. The study was approved by the Institutional Review Boards of the Johns Hopkins School of Public Health, Aga Khan University, and all participating sites. The study recorded 68,390 patients; 93.8% were from the public hospitals. There were seven male for every three female patients, and 50% were 20-39 years of age. About 69.3% were unintentional injuries. Among injuries with a known mechanism (19,102), 51.1% were road traffic injuries (RTIs) and 17.5% were falls. Female, patients aged 60 years or older, patients transferred by ambulance, patients who had RTIs, and patients with intentional injuries were more likely to be hospitalized. The study is the first to use standardized methods for regular collection of multiple ED data in Pakistan. It explored the pattern of injuries and the feasibility to develop and implement facility-based systems for injury and acute illness in countries like Pakistan. Copyright © 2017 The Royal Society for Public Health. Published by Elsevier Ltd. All rights reserved.

  3. Journal of Astrophysics and Astronomy | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    2016-01-27

    Jan 27, 2016 ... Home; Journals; Journal of Astrophysics and Astronomy; Volume 27; Issue 4. Volume 27, Issue 4. December 2006, pages 373-472. pp 373-379. Gravitational Clustering of Galaxies in an Expanding Universe · Naseer Iqbal Farooq Ahmad M. S. Khan · More Details Abstract Fulltext PDF. We inquire the ...

  4. Use of liquid nitrogen and albendazole in successfully treating cutaneous larva migrans

    International Nuclear Information System (INIS)

    Kapadia, N.; Farooqui, M.; Borhany, T.

    2013-01-01

    Objective: To determine the efficacy of combination treatment of Albendazole along with liquid nitrogen in cutaneous larva migrans. Study Design: Quasi-experimental study. Place and Duration of Study: Abbasi Shaheed Hospital and The Aga Khan Hospital, Karachi, from December 2008 to December 2010. Methodology: Eighteen cases of cutaneous larva migrans were collected and divided into two groups. Group-A was administered oral Albendazole 400 mg once per day along with topical steroid and oral cetrizine 10 mg once at night for 7 days. Group-B also received oral Albendazole 400 mg once per day along with cetrizine 10 mg once at night but they also received single application of liquid nitrogen to freeze the larva. Results: It was found that in Group-A only 2 out of 9 (22%) showed improvement whereas 78% had to be given liquid nitrogen cryotherapy 3 - 7 days after Albendazole to prevent migration of larva. In Group-B, the improvement was 100% and all 9 patients were successfully treated. Conclusion: Use of liquid nitrogen along with oral anti-helminths is very effective in treating cutaneous larva migrans than Albendazole alone. (author)

  5. Rational use of antibiotics: a quality improvement initiative in hospital setting

    International Nuclear Information System (INIS)

    Nausheen, S.; Hammad, R.; Khan, A.

    2013-01-01

    Objectives: To minimise irrational use of antibiotics by implementing guidelines for antibiotic usage in obstetrics and Gynaecology. Methods: The observational study was conducted from January to December 2010 at the maternity unit of Aga Khan Hospital for Women and children, Kharadar, a secondary care facility in Karachi, Pakistan. Data was collected from medical records related to the study period. Prophylactic antibiotics were given according to the American College of Obstetricians and Gynaecologists recommendation 2009. Surveillance was done by surgical site infection rates and infectious morbidity. Data was analysed on SPSS 13. Results: Therapeutic antibiotic use was rationalized, reducing the use of therapeutic antibiotics from 97% (n= 160/165) in January 2010 to 8% (n=10/125) in December 2010. Surgical site infection rates were less than 5%. Cost of antibiotics per patient decreased by 90%. Decrease in the length of stay and workload on nursing staff was also observed. Conclusion: Implementing guidelines for antibiotic use in obstetrics and gynaecology and translating it into our protocols was effective in decreasing the irrational antibiotic consumption and increasing the rational use of antibiotics in the hospital. (author)

  6. Clinical Practice Update: The Use of Per-Oral Endoscopic Myotomy in Achalasia: Expert Review and Best Practice Advice From the AGA Institute.

    Science.gov (United States)

    Kahrilas, Peter J; Katzka, David; Richter, Joel E

    2017-11-01

    The purpose of this review is to describe a place for per-oral endoscopic myotomy (POEM) among the currently available robust treatments for achalasia. The recommendations outlined in this review are based on expert opinion and on relevant publications from PubMed and EMbase. The Clinical Practice Updates Committee of the American Gastroenterological Association proposes the following recommendations: 1) in determining the need for achalasia therapy, patient-specific parameters (Chicago Classification subtype, comorbidities, early vs late disease, primary or secondary causes) should be considered along with published efficacy data; 2) given the complexity of this procedure, POEM should be performed by experienced physicians in high-volume centers because an estimated 20-40 procedures are needed to achieve competence; 3) if the expertise is available, POEM should be considered as primary therapy for type III achalasia; 4) if the expertise is available, POEM should be considered as treatment option comparable with laparoscopic Heller myotomy for any of the achalasia syndromes; and 5) post-POEM patients should be considered high risk to develop reflux esophagitis and advised of the management considerations (potential indefinite proton pump inhibitor therapy and/or surveillance endoscopy) of this before undergoing the procedure. Copyright © 2017 AGA Institute. Published by Elsevier Inc. All rights reserved.

  7. Analysis of chemical constituents in medicinal plants of selected ...

    African Journals Online (AJOL)

    Analysis of chemical constituents in medicinal plants of selected districts of Pakhtoonkhwa, Pakistan. I Hussain, R Ullah, J Khan, N Khan, M Zahoor, N Ullah, MuR Khattak, FA Khan, A Baseer, M Khurram ...

  8. Willet M. Hays, great benefactor to plant breeding and the founder of our association.

    Science.gov (United States)

    Troyer, A F; Stoehr, H

    2003-01-01

    Willet M. Hays was a great benefactor to plant breeding and the founder of the American Genetic Association (AGA). We commemorate the AGA's centennial. We mined university archives, U.S. Department of Agriculture (USDA) yearbooks, plant breeding textbooks, scientific periodicals, and descendants for information. Willet Hays first recognized the individual plant as the unit of selection and started systematic pure-line selection and progeny tests in 1888. He developed useful plant breeding methods. He selected superior flax (Linum usitatissimum L.), wheat (Triticum vulgare L.), corn (Zea mays L.), barley (Hordeum vulgare L.), and oat (Avena sativa L.) varieties, and discovered Grimm alfalfa (Medicago sativa L.); all became commercially important. He initiated branch stations for better performance testing. Willet Hays befriended colleagues in other universities, in federal stations, in a London conference, and in Europe. He gathered and spread the scientific plant breeding gospel. He also improved rural roads and initiated animal breeding records and agricultural economics records. He started the AGA in 1903, serving as secretary for 10 years. He became assistant secretary of agriculture in 1904. He introduced the project system for agricultural research. He authored or coauthored the Nelson Amendment, the Smith-Lever Act, the Smith-Hughes Act, and the protocol leading to the United Nations Food and Agriculture Organization-all involved teaching agricultural practices that improved the world.

  9. Nanogel-crosslinked nanoparticles increase the inhibitory effects of W9 synthetic peptide on bone loss in a murine bone resorption model

    OpenAIRE

    Sato, Toshimi; Alles, Neil; Khan, Masud; Nagano, Kenichi; Takahashi, Mariko; Tamura, Yukihiko; Shimoda, Asako; Ohya, Keiichi; Akiyoshi, Kazunari; Aoki, Kazuhiro

    2015-01-01

    Toshimi Sato,1 Neil Alles,1,2 Masud Khan,1,3 Kenichi Nagano,1,4 Mariko Takahashi,1 Yukihiko Tamura,1 Asako Shimoda,5,6 Keiichi Ohya,1 Kazunari Akiyoshi,5,6 Kazuhiro Aoki1 1Department of Bio-Matrix (Pharmacology), Graduate School, Tokyo Medical and Dental University, Tokyo, Japan; 2Department of Biochemistry, Faculty of Medicine, University of Peradeniya, Peradeniya, Sri Lanka; 3Department of Dental Pharmacology, City Dental College and Hospital, Dhaka, Bangladesh; 4Department of Oral Medicin...

  10. Violence permeating daily life: a qualitative study investigating perspectives on violence among women in Karachi, Pakistan

    Directory of Open Access Journals (Sweden)

    Ali TS

    2012-11-01

    Full Text Available Tazeen S Ali,1,2,* Gunilla Krantz,3 Ingrid Mogren4,*1School of Nursing, Aga Khan University, Karachi, Pakistan; 2Department of Public Health Sciences, Division of Global Health, Karolinska Institute, Stockholm, 3Department of Public Health and Community Medicine/Social Medicine, The Sahlgrenska Academy at University of Gothenburg, Gothenburg, 4Department of Clinical Sciences, Obstetrics and Gynecology, Umeå University, Umeå, Sweden *These authors contributed equally to this workBackground: This study explored how married women perceive situations which create family conflicts and lead to different forms of violence in urban Pakistan. In addition, it examines perceptions of consequences of violence, their adverse health effects, and how women resist violence within marital life.Methods: Five focus group discussions were conducted with 28 women in Karachi. Purposive sampling, aiming for variety in age, employment status, education, and socioeconomic status, was employed. The focus group discussions were conducted in Urdu and translated into English. Manifest and latent content analysis were applied.Results: One major theme emerged during the analysis, ie, family violence through the eyes of females. This theme was subdivided into three main categories. The first category, ie, situations provoking violence and their manifestations, elaborates on circumstances that provoke violence and situations that sustain violence. The second category, ie, actions and reactions to exposure to violence, describes consequences of ongoing violence within the family, including those that result in suicidal thoughts and actions. The final category, ie, resisting violence, describes how violence is avoided through women’s awareness and actions.Conclusion: The current study highlights how female victims of abuse are trapped in a society where violence from a partner and family members is viewed as acceptable, where divorce is unavailable to the majority, and where

  11. Androgenetic alopecia in men aged 40-69 years: prevalence and risk factors.

    Science.gov (United States)

    Severi, G; Sinclair, R; Hopper, J L; English, D R; McCredie, M R E; Boyle, P; Giles, G G

    2003-12-01

    The epidemiology of androgenetic alopecia (AGA) is not fully understood. Although a strong genetic basis has long been identified, little is known of its non-genetic causes. To estimate the prevalence of and to determine risk factors for AGA in men aged 40-69 years in Australia. Men (n = 1390) were recruited at random from the electoral rolls to serve as controls in a population-based case-control study of prostate cancer. All were interviewed in person and direct observations of AGA were made. Men were grouped into the following categories; no AGA, frontal AGA, vertex AGA and full AGA (frontal and vertex AGA). Epidemiological data collected from these men were used for an analysis of risk factors for each AGA category using unconditional logistic regression with AGA category as the response variable adjusting for age, education and country of birth. The prevalence of vertex and full AGA increased with age from 31% (age 40-55 years) to 53% (age 65-69 years). Conversely, the proportion of men with only frontal AGA was very similar across all age groups (31-33%). No associations were found between pubertal growth spurt or acne, reports of adult body size at time of interview, urinary symptom score, marital status, or current smoking status or duration of smoking and the risk of any form of AGA. The consumption of alcohol was associated with a significant increase in risk of frontal and vertex AGA but not full AGA. Men with vertex AGA had fewer female sexual partners but average ejaculatory frequency did not differ between men in different AGA categories. Reported weight and lean body mass at reaching maturity at about 21 years of age were negatively associated with vertex balding (P for trend body mass at age 21 years would be worthy of further research if they were able to be replicated in other studies.

  12. Medical students' experiences of resuscitation: a medical student’s perspective

    Directory of Open Access Journals (Sweden)

    Bhanot R

    2018-05-01

    Full Text Available Ravina BhanotBarts and The London School of Medicine and Dentistry, Queen Mary University of London, London, UKI read with great interest the study by Aggarwal and Khan1 exploring students’ experiences of cardiopulmonary resuscitation (CPR and witnessing discussion on resuscitation status. The duties of a UK doctor, as outlined in “Tomorrows’ Doctors”, indicate the requirement to provide, manage or direct CPR, yet the article suggests many are unconfident in performing CPR in emergency situations.2 As a fourth-year medical student and president of Barts and The London Objective Structured Clinical Examination (OSCE society in 2017, three methods are proposed with the aim to instill confidence in medical students, which involve the following: performing CPR, retaining skills, and improving discussion on Do Not Attempt Cardiopulmonary Resuscitation (DNACPR.View the original paper by Aggarwal and Khan.

  13. Search Results | Page 87 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Results 861 - 870 of 9602 ... Household cost-benefit equations and sustainable universal childhood immunization : a randomised cluster controlled trial in South Pakistan ... The agricultural sector plays a key role in Central America's economy and social fabric. ... This research project, a collaboration between IDRC and Aga ...

  14. Journal of Genetics | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Genetic analysis of a consanguineous Pakistani family with Leber congenital amaurosis identifies a novel mutation in GUCY2D gene. Muzammil Ahmad Khan Verena Rupp Muhammad Ayaz Khan Muhammad Pervaiz Khan Muhammad Ansar Christian Windpassinger. Research Note Volume 93 Issue 2 August 2014 pp ...

  15. Study of the International Epidemiology of Androgenetic Alopecia in Young Caucasian Men Using Photographs From the Internet.

    Science.gov (United States)

    Avital, Yaniv Shalom; Morvay, Marta; Gaaland, Magdolna; Kemény, Lajos

    2015-01-01

    The epidemiological evaluation of androgenetic alopecia (AGA) is based mainly on direct observation and questionnaires. The international epidemiology and environmental risk factors of AGA in young Caucasian men remain unknown. To use photographs and data from the Internet to evaluate severe AGA and generate greater understanding of the international epidemiology of the disorder in young Caucasian men. A population-based cross-sectional study design was used. The sample included 26,340 Caucasian men aged 30 to 40 years who had uploaded profiles to two dating websites. Their photographs were evaluated for AGA and graded as follows: severe AGA (Norwood type VI-VII), non-severe AGA, and unknown. Epidemiological data were collected from the sites. Logistic regression was used to analyze the effect of risk factors on the prevalence of severe AGA. The overall success rate for identifying severe AGA by indirect evaluation of Internet photographs was 94%. The prevalence of severe AGA was 15.33% overall and varied significantly by geographical region. The risk of having severe AGA was increased by 1.092 for every year of age between 30 and 40 years. Severe AGA was more prevalent in subjects with higher body mass index. Photographs from the Internet can be used to evaluate severe AGA in epidemiological studies. The prevalence of severe AGA in young Caucasian men increases with age and varies by geographical region. Body mass index is an environmental risk factor for severe AGA.

  16. Study of the international epidemiology of androgenetic alopecia in young caucasian men using photographs from the internet

    Directory of Open Access Journals (Sweden)

    Yaniv Shalom Avital

    2015-01-01

    Full Text Available Background: The epidemiological evaluation of androgenetic alopecia (AGA is based mainly on direct observation and questionnaires. The international epidemiology and environmental risk factors of AGA in young Caucasian men remain unknown. Aim: To use photographs and data from the Internet to evaluate severe AGA and generate greater understanding of the international epidemiology of the disorder in young Caucasian men. Materials and Methods: A population-based cross-sectional study design was used. The sample included 26,340 Caucasian men aged 30 to 40 years who had uploaded profiles to two dating websites. Their photographs were evaluated for AGA and graded as follows: severe AGA (Norwood type VI-VII, non-severe AGA, and unknown. Epidemiological data were collected from the sites. Logistic regression was used to analyze the effect of risk factors on the prevalence of severe AGA. Results : The overall success rate for identifying severe AGA by indirect evaluation of Internet photographs was 94%. The prevalence of severe AGA was 15.33% overall and varied significantly by geographical region. The risk of having severe AGA was increased by 1.092 for every year of age between 30 and 40 years. Severe AGA was more prevalent in subjects with higher body mass index. Conclusions: Photographs from the Internet can be used to evaluate severe AGA in epidemiological studies. The prevalence of severe AGA in young Caucasian men increases with age and varies by geographical region. Body mass index is an environmental risk factor for severe AGA.

  17. Compliance to antihypertensive therapy

    International Nuclear Information System (INIS)

    Almas, A.; Hameed, A.; Ahmed, B.; Islam, M.

    2006-01-01

    Objective: To determine compliance, factors affecting compliance to antihypertensive therapy and to compare compliant and non-compliant groups, in a tertiary care setting. Study Design: Analytical (cross-sectional) study. Place and Duration of Study: The outpatient clinics at the Aga Khan University from May 2004 to February 2005. Patients and Methods: Two hundred patients presenting to the outpatients clinic were included. All patients 18 years and above, who had stage 1 and 2 hypertension, had one clinic visit to a medicine clinic, 6 months prior to presentation and started on antihypertensive medicines, were included. Results: Sixty-six percent were males and 33.5 % were females. Mean age was 58.1 ( +- 12) years and mean duration of hypertension was 7.2 (+- 6.7) years. Fifty-seven percent were compliant and 43% were noncompliant. In the noncompliant group, 53.4 % had mild noncompliance, 24.4 % had severe non-compliance, while 22% had moderate noncompliance. Factors of noncompliance were 56.8% missed doses due to forgetfulness, 12.7% deliberately missed their doses, 11.6% could not take the medicine due to side effects, 10.4% did not take the dose due to increased number of tablets, 4.6% were not properly counseled by the physician and 3.48% did not take medicines due to cost issues. The mean systolic blood pressure was 126 +- 19.2 mmHg in the compliant group while it was 133 +- 16.5 mmHg in the noncompliant group (p-value 0.004). The mean diastolic blood pressure in the compliant group was 76 +- 11.9 mmHg, while in the noncompliant group it was 81.9 +- 10.9 mmHg (p-value 0.001). Conclusion: Compliance to antihypertensive therapy in a tertiary care center is significantly good. Forgetfulness was the major reason for noncompliance. The mean blood pressure control was better in the compliant group. (author)

  18. Functional and Clinical Outcome of Ileal (Studer) Neo-bladder Reconstruction: Single Centre Experience from Pakistan

    International Nuclear Information System (INIS)

    Nazim, S. M.; Ather, M. H.; Abbas, F.

    2014-01-01

    Objective: To determine the medium and long-term outcome of orthotopic continent urinary diversion with ileal (Studer) neo-bladder following radical cystectomy. Study Design: Case series. Place and Duration of Study: Department of Surgery, The Aga Khan University Hospital, Karachi, from January 1998 to September 2010. Methodology: Thirty eight patients underwent radical cystectomy for invasive bladder tumor with ileal neo-bladder (Studer type) reconstruction. Peri-operative and late complications, functional outcome of neo-bladder, urinary continence, metabolic and upper urinary tract status and overall survival were evaluated in all patients. Results: A total of 29 patients (23 males and 6 females) with mean age of 59 +- 12 years were included for the final analysis. The mean duration of surgery (both radical cystectomy and urinary diversion) was 520 +- 70 minutes. Perioperative complication rate was 24% (n=7) with surgical site infection in 4 patients, sepsis in 1 patient and 2 had ureteroileal leak. At 6 months follow-up, 22 patients were fully continent while 7 patients had minimal stress / nocturnal incontinence. The continence rate was 93% (n=27) at one year follow-up. The mean capacity of neo-bladder at 6 months was 384 +- 66 mLs. The late complication rate was 17% (n=5). Three patients developed anastomotic stricture requiring transurethral incision of neo bladder neck, one formed stone in neo-bladder and one developed incision hernia. All patients had preserved renal functions on follow-up. The survival rate was 80% (n=23) at a median follow-up of 66.4 +- 36 months. Two patients developed local recurrence and four developed distant metastasis. Conclusion: Studer ileal neo-bladder is a safe and effective option for urinary diversion in select patients with good oncological and functional outcomes comparable to contemporary literature, even in a low volume center. (author)

  19. Age related clinical manifestation of acute bacterial meningitis in children presenting to emergency department of a tertiary care hospital

    International Nuclear Information System (INIS)

    Fayyaz, J.; Khursheed, M.; Feroze, A.

    2014-01-01

    Objective: To determine the signs and symptoms of acute bacterial meningitis (ABM) in different age groups of a paediatric population. Methods: The retrospective study comprised patients who had been admitted through the Emergency Department of Aga Khan University Hospital, Karachi with the relevant diagnosis from September 2009 to September 2011. Case record forms were used to collect data from patient files. Data was collected using variables such as age, gender, presenting complaints, clinical signs and symptoms, computed tomography scan findings and final outcome of patients. There was a minimal risk of breach in patient confidentiality. SPSS 19 was used for data analysis. Results: A total of 192 patients were enrolled. The presenting complaint in 165 (86%) patients was fever; vomiting in 93 (48.43%); and 49 (52.68%) of them were more than 5 years old. Irritability was present in 54 (28.12%) children, of whom 27 (50%) were less than one year. Fits were present in 47 (24.47%) cases out of which 21 (44.68%) were less than one year. Neck stiffness and signs of meningeal irritation, Kerning's sign and Brudzincski's sign, were present in 53 (27.60%) patients; 26 (13.54%); and 18 (9.3%) respectively. These signs were more common in children over 5 years of age, reflected by 29 (54.7%), 16 (61.5%) and 11 (61.11%) patients respectively. On presentation, headache was found in 77 (40.10%) children among whom 56 (72.72%) were over 5 years. Besides, 151 (78.6%) patients required admission to the ward, while 40 (20.8%) were admitted in High Dependancy Unit/critical care units. Adverse outcome was observed in 6 (3.12%) patients. Conclusion: Younger children with acute bacterial meningitis presented with non-specific signs and symptoms. Headache and signs of meningeal irritation were common findings in children over 5 years. (author)

  20. Frequency of hospital acquired hyponatremia in a pediatric tertiary care setting

    International Nuclear Information System (INIS)

    Bibi, S.; Haq, A.U.; Billo, A.G.; Bibi, S.; Gilani, S.Y.H.; Shah, S.R.A.

    2015-01-01

    Background: Hyponatremia is the most commonly encountered electrolyte disorder in children. In our country the epidemiology of hospital acquired hyponatremia has hardly ever been explored whereas the administration of hypotonic IV fluids is widely practiced here. Therefore we pioneered to conduct this study to determine the frequency of hospital acquired hyponatremia. Method: This was a cross sectional study carried out at Aga Khan University Hospital, Karachi in paediatric ward and ICU over a period of 12 months. All children (>1 month and <15 years of age) admitted in paediatric units and on maintenance IV fluids who had serum sodium level measured on admission were included in the study and followed to identify patients who had a drop in serum sodium during hospitalization. Informed consent was taken from parents and collected data was recorded on a proforma. Results: A total of 865 patients were enrolled in the study. Hyponatremia was recorded in 405 patients on admission (46.8 percentage) while hospital acquired hyponatremia was documented in 240. children (27.7 percentage). Out of these 142 (59.2 percentage) were male and 98 (40.8 percentage) were female. Mean age of children in hospital acquired hyponatremia group was 60.67 months. Severity of hospital acquired hyponatremia was recorded as mild in 191 (79.6 percentage), moderate in 35 (14.6 percentage) and severe in 14 (5.8) children. Major disease categories included gastrointestinal disorder (30.4 percentage), respiratory illness (12.5 percentage), oncological disease (16.3 percentage), cardiovascular disease (11.7 percentage), infectious disease (9.2 percentage) and neurological illness (8.3 percentage). Conclusion: Hospital acquired hyponatremia is frequently encountered in our hospitalized children with majority of them receiving hypotonic IV solutions. (author)

  1. Comparison between Greulich-Pyle and Girdany-Golden methods for estimating skeletal age of children in Pakistan.

    Science.gov (United States)

    Awais, Muhammad; Nadeem, Naila; Husen, Yousuf; Rehman, Abdul; Beg, Madiha; Khattak, Yasir Jamil

    2014-12-01

    To compare Greulich-Pyle (GP) and Girdany-Golden (GG) methods for estimation of Skeletal Age (SA) in children referred to a tertiary care hospital in Karachi, Pakistan. Cross-sectional study. Department of Radiology, The Aga Khan University Hospital, Karachi, Pakistan, from July 2010 to June 2012. Children up to the age of 18 years, who had undergone X-ray for the evaluation of trauma were included. Each X-ray was interpreted using both methods by two consultant paediatric radiologists having at least 10 years experience, who were blinded to the actual Chronologic Age (CA) of children. A total of 283 children were included. No significant difference was noted in mean SA estimated by GP method and mean CA for female children (p=0.695). However, a significant difference was noted between mean CA and mean SA by GG method for females (p=0.011). For males, there was a significant difference between mean CA and mean SA estimated by both GP and GG methods. A stronger correlation was found between CA and SA estimated by GP method (r=0.943 for girls, r=0.915 for boys) as compared to GG method (r=0.909 for girls, r=0.865 for boys) respectively. Bland- Altman analysis also revealed that the two methods cannot be used interchangeably. Excellent correlation was seen between the two readers for both GP and GG methods. There was no additional benefit of using GP and GG methods simultaneously over using GP method alone. Moreover, although GP was reliable in estimating SA in girls, it was unable to accurately assess SA in boys. Therefore, it would be ideal to develop indigenous standards of bone age estimation based on a representative sample of healthy native children.

  2. Comparison between greulich-pyle and girdany-golden methods for estimating skeletal age of children in pakistan

    International Nuclear Information System (INIS)

    Awais, M.; Nadeem, N.; Rehman, A.

    2014-01-01

    Objective: To compare Greulich-Pyle (GP) and Girdany-Golden (GG) methods for estimation of Skeletal Age (SA) in children referred to a tertiary care hospital in Karachi, Pakistan. Study Design: Cross-sectional study. Place and Duration of Study: Department of Radiology, The Aga Khan University Hospital, Karachi, Pakistan, from July 2010 to June 2012. Methodology: Children up to the age of 18 years, who had undergone X-ray for the evaluation of trauma were included. Each X-ray was interpreted using both methods by two consultant paediatric radiologists having at least 10 years experience, who were blinded to the actual Chronologic Age (CA) of children. Results: A total of 283 children were included. No significant difference was noted in mean SA estimated by GP method and mean CA for female children (p=0.695). However, a significant difference was noted between mean CA and mean SA by GG method for females (p=0.011). For males, there was a significant difference between mean CA and mean SA estimated by both GP and GG methods. A stronger correlation was found between CA and SA estimated by GP method (r=0.943 for girls, r=0.915 for boys) as compared to GG method (r=0.909 for girls, r=0.865 for boys) respectively. Bland- Altman analysis also revealed that the two methods cannot be used interchangeably. Excellent correlation was seen between the two readers for both GP and GG methods. Conclusion: There was no additional benefit of using GP and GG methods simultaneously over using GP method alone. Moreover, although GP was reliable in estimating SA in girls, it was unable to accurately assess SA in boys. Therefore, it would be ideal to develop indigenous standards of bone age estimation based on a representative sample of healthy native children. (author)

  3. Negative predictive value of ultrasound in predicting tumor-free margins in specimen sonography

    International Nuclear Information System (INIS)

    Naz, S.; Hafeez, S.; Hussain, Z.; Hilal, K.

    2017-01-01

    Objective: To evaluate the success of ultrasound in post-excision specimen visualization, and negative predictive value of ultrasound for estimation of tumor-free margins using histopathology as the gold standard. Study Design: Cross-sectional analytical study. Place and Duration of Study: The Aga Khan University Hospital, Karachi, Pakistan, from May 2010 till January 2013. Methodology: Sonography of all breast nodules was done before and after exicision by two female radiologists with at least five years clinical experience. All surgeries were performed by the same referring breast surgeons. All nodules were non-palpable and had histopathology as well as specimen sonography performed at AKUH. Subjects were excluded, if histopathology was not available, post-procedure sonogram not done or done in another hospital and nodules that were not seen on ultrasound. After needle localization in 47 patients using ultrasound and in 7 patients using mammogram was done, sonogram was conducted in all 54 lesions. These were then assessed by ultrasound for detection of lesion and tumor-free margins in malignant lesion. Post-excision ultrasound was performed for the evaluation of lesion whether visualized or absent with localizing needle in situ, lesion dimensions, depth measurement between the superior margin of the lesion and its edge. Results: All 54 lesions were present on post-exicison scan, out of which 28 were documented as malignant and 26 as benign. Ultrasound declared all specimens as tumor-free. On histopathology, two lesions were documented as having tumor-positive margins and were proven to be invasive lobular carcinoma. Therefore, the negative predictive value of the specimen sonography for margin detection was 26/28 (92.8%). Conclusion: Ultrasound of the excised breast tumor specimen is a simple and reliable technique for confirmation of the tumor-free margins in non-palpable breast lesions. (author)

  4. Contrast nephropathy in high-risk patients undergoing coronary angiography and intervention

    International Nuclear Information System (INIS)

    Uddin, M.A.; Rabbani, M.A.; Jafary, F.H.; Bhatti, M.A.; Islam, M.

    2005-01-01

    Objective: To determine the incidence of contrast nephropathy in high-risk patients undergoing coronary angiography and percutaneous coronary intervention (PCI), and to define the characteristics of this cohort. Design: Descriptive study. Place and Duration of Study: The Aga Khan University Hospital, Karachi from January to December 2002. Patients and Methods: One hundred and fifteen patients with serum creatinine greater than 1.4mg/dl who underwent coronary angiography or PCI were included. All patients received non-ionic contrast dye. Acute contrast nephropathy was defined as rise in serum creatinine of >0.5mg/dl within 48 hours following the index procedure. Means and standard deviations were calculated for continuous variables and frequencies for categorical variables. Results: Mean age of patients was 62.3 year + 8.83. Mean pre-contrast creatinine was 1.9+0.9mg/dl. Eleven (9.65%) patients developed contrast nephropathy. 4.4% of patients with serum creatinine 4.0(p-value 0.001). 11.9% diabetic patients developed nephropathy compared to 6.3% of non-diabetics (p-value 0.355). 11.4% of hypertensive and 3.7% of non-hypertensive patients developed contrast-nephropathy (p-value 0.454). 12.9% of low dose group ( 100ml) developed nephropathy (p-value 0.188). Mean serum creatinine in low dose group was higher (3.0mg/dl vs. 1.7 mg/dl). Conclusion: The incidence of contrast nephropathy in this study was similar to that reported in literature. Risk of CIN was found to be significantly proportional to the severity of baseline renal disease. Trends towards higher risk of CIN were seen in patients with diabetes and hypertension. Higher incidence of CIN in patients receiving low-dose contrast was confounded by higher baseline serum creatinine in that group. (author)

  5. Electrophysiological changes in patients with liver cirrhosis in a tertiary care hospital in karachi, pakistan

    International Nuclear Information System (INIS)

    Parkash, O.; Mohyuddin, G.R.; Ayub, A.; Nazir, I.

    2017-01-01

    Electrophysiological changes in cirrhosis are well known but least investigated especially in our country hence we wanted to see electrophysiological changes especially QT interval in cirrhotic patients. Methods: A cross-sectional study was conducted at Aga Khan University Hospital Karachi (AKUH) in which medical records (duration 2008-2010) of cirrhotic patients were reviewed. Results: Three hundred and eighty cirrhotic patients' charts were studied, 227 (59.7 percent) were male and mean age of this cohort was 52.8+-12.6 years. The most common cause for CLD was Hepatitis C (CHC) in 260 (68.4 percent), NBNC in 56(14.7 percent) and HBV in 51 (13.4 percent). Only 225 had complete ECG workup, the mean corrected QT interval was 0.44+-0.067 sec. Among the electrophysiological abnormalities, 79 (35 percent) had a prolonged corrected QT interval, 7 (3.1 percent) had a prolonged PR interval (>0.22s) and prolonged QRS duration was seen in 23 (10.4 percent) patients. QT prolongation was seen in 1 of the 5 patients with Child Class A (20 percent), 22 of the 73 patients with Child Class B (30.1 percent), and 25 of the 61 patients with Child Class C (41 percent). However, this difference however was not statistically significant. (p value=.331). Conclusion: We conclude that QT prolongation is more frequent in patients with liver cirrhosis especially when the disease is more advanced like in Child C hence these patients are more prone to sudden cardiac death. Moreover, this study shows that the risk associated with QT prolongation is present through all classes of liver cirrhosis. We recommend that routine cardiac screening with ECG of all cirrhotic patients be performed. (author)

  6. Increased level of morning surge in blood pressure in normotensives: A cross-sectional study from Pakistan

    International Nuclear Information System (INIS)

    Almas, A.; Sultan, F. T.; Kazmi, K.

    2016-01-01

    Objective: To determine the mean morning surge (MS) in blood pressure, the frequency of increased morning surge in normotensive subjects, and to compare those with morning surge with those without MS. Study Design: A cross-sectional, comparative study. Place and Duration of Study: The Department of Medicine, The Aga Khan University Hospital, Karachi, from April 2011 to March 2012. Methodology: Adult normotensive healthy volunteers aged 35 to 65 years were inducted. Their ambulatory blood pressure (ABP) was measured over a 24-hour period, using digital ambulatory blood pressure monitors. Morning surge was calculated as the average of four readings after waking minus the lowest three nocturnal readings. Increased morning surge was defined as > 11 mm Hg in systolic (SBP) or > 12 mm Hg in diastolic (DBP). Dipping was defined as > 10% dipping in blood pressure. Results: Eighty-two healthy volunteers were recruited. Their mean age was 36.9 ± 1.2 years; 74.4 (61%) were men, and 58.5 (48%) woke up for morning prayers. Mean overall SBP was 113 ± 1.6 mm Hg, overall DBP was 73.9 ± 0.7 mm Hg, and overall heart rate was 75 (10) beats/minute. Mean morning surge was 17.6 ± 1.0 mm Hg in SBP and 16.0 ± 0.8 mm Hg in DBP. The frequency of increased morning surge was 66 (80.5%) in SBP, and 57 (69%) in DBP. On comparison of participants with normal morning surge and increased morning surge in SBP, there was a significant difference in non-dipping status (13.4% in normal vs. 18.3% in increased morning surge, p= 0.001). Conclusion: Mean morning surge in SBP and DBP are relatively higher in this subset population in a tertiary care center in Pakistan. These values are higher than those reported in the literature. (author)

  7. Conversion from laparoscopic to open cholecystectomy: Multivariate analysis of preoperative risk factors

    Directory of Open Access Journals (Sweden)

    Khan M

    2005-01-01

    Full Text Available BACKGROUND: Laparoscopic cholecystectomy has become the gold standard in the treatment of symptomatic cholelithiasis. Some patients require conversion to open surgery and several preoperative variables have been identified as risk factors that are helpful in predicting the probability of conversion. However, there is a need to devise a risk-scoring system based on the identified risk factors to (a predict the risk of conversion preoperatively for selected patients, (b prepare the patient psychologically, (c arrange operating schedules accordingly, and (d minimize the procedure-related cost and help overcome financial constraints, which is a significant problem in developing countries. AIM: This study was aimed to evaluate preoperative risk factors for conversion from laparoscopic to open cholecystectomy in our setting. SETTINGS AND DESIGNS: A case control study of patients who underwent laparoscopic surgery from January 1997 to December 2001 was conducted at the Aga Khan University Hospital, Karachi, Pakistan. MATERIALS AND METHODS: All those patients who were converted to open surgery (n = 73 were enrolled as cases. Two controls who had successful laparoscopic surgery (n = 146 were matched with each case for operating surgeon and closest date of surgery. STATISTICAL ANALYSIS USED: Descriptive statistics were computed and, univariate and multivariate analysis was done through multiple logistic regression. RESULTS: The final multivariate model identified two risk factors for conversion: ultrasonographic signs of inflammation (adjusted odds ratio [aOR] = 8.5; 95% confidence interval [CI]: 3.3, 21.9 and age > 60 years (aOR = 8.1; 95% CI: 2.9, 22.2 after adjusting for physical signs, alkaline phosphatase and BMI levels. CONCLUSION: Preoperative risk factors evaluated by the present study confirm the likelihood of conversion. Recognition of these factors is important for understanding the characteristics of patients at a higher risk of conversion.

  8. Comparison of Micro-Leakage around Temporary Restorative Materials Placed in Complex Endodontic Access Cavities: An In-Vitro Study

    International Nuclear Information System (INIS)

    Adnan, S.; Khan, F. R.

    2016-01-01

    Objective: To compare mean micro-leakage around 3 types of temporary restorative materials in-vitro, when placed adjacent to permanent restorations (amalgam) in complex endodontic access cavities. Study Design: Randomized controlled trial. Place and Duration of Study: Dental Clinics, Dental Laboratory and Research Laboratory at The Aga Khan University Hospital, Karachi, from January to Jun 2014. Methodology: After random allocation of 60 teeth into 3 experimental groups, each group had conventional class II cavities prepared and amalgam placed. After 14 days, endodontic access cavities were made in these teeth, followed byplacement of Cavit, IRM and CLIP (depth of 4 mm each). After thermo-cycling and immersion in 0.5 percentage methylene blue dye, the teeth were sectioned mesio-distally and observed under stereoscopic microscope (magnification * 4) along 2 interfaces 'a' and 'b' (tooth-temporary restoration and temporary restoration-primary restoration), respectively. Depth of dye penetration was measured in millimeters. Results: IRM was leakiest at interface 'a', cavit had highest dye penetration at interface 'b', while CLIP exhibited least micro-leakage at 'a' and 'b'. The mean dye penetration for Cavit was 0.80 ± 0.23 mm at 'a', and 2.24 ± 0.48 mm at 'b'. For IRM, it was 1.82 ± 0.09 mm at 'a', and 0.44 ± 0.13 mm at 'b'. For CLIP, the mean dye penetration was 0.43 ± 0.05 mm at 'a', and 0.32 ± 0.12 mm at 'b'. The difference in dye penetration observed between the 3 groups at both interfaces was statistically significant. Conclusion: In a complex access cavity made adjacent to a pre-existing amalgam restoration, CLIP exhibits the least micro-leakage, followed by IRM and Cavit. (author)

  9. Targeted Ultrasound of an Indeterminate Breast Lesion on Mammography: When Does It Influence Management?

    Science.gov (United States)

    Sohail, Saba; Masroor, Imrana; Afzal, Shaista

    2015-08-01

    To determine the change over mammographic diagnosis, BI-RADS category and management following targeted ultrasound of an indeterminate lesion seen on mammography and associated factors, if any. Descriptive, analytical study. Radiology Department, The Aga Khan University Hospital and Clifton Medical Services, Karachi, from April 2010 to May 2011. Patients referred for targeted breast ultrasound following X-ray mammography were selected regardless of age. Targeted Ultrasound (TUS) was defined as a limited ultrasound of a specific lesion or breast part as indicated by the referring source. Comparison was made between the post mammography and post TUS lesion characterization, diagnosis and BI-RADS category (0-5) which was taken as a measure of management change. Those were evaluated to determine significance of age, marital status, parity, breast parenchymal pattern ( dense, fatty, heterogeneous), referring source for the TUS (radiology resident, radiologist or surgeon), lesion characteristics (density, echogenecity, shape, location, margins, size, depth-to-width ratio, enhancement or shadowing), presenting symptoms or signs and reason for TUS. Ap-value of 0.05 or less was taken as significant. There were a total of 342 patients with mean age of 49.7 ±13.5 years. It assigned a definite category in 232 patients with an indefinite category (0) on mammography requiring further investigation. It decreased the suspicion for malignancy in 180 (77.58%) by assigning a low BI-RADS category and increased the suspicion in 52 (22.41%). The factors significantly associated with this changes included clinical indication being diagnostic (p management of an indeterminate breast lesion in a high number of patients, particularly when there was a lump as indication for imaging in the presence of risk factors in a patient with otherwise heterogeneously dense breast parenchyma.

  10. Impact of age on outcome after colorectal cancer surgery in the elderly - a developing country perspective

    Directory of Open Access Journals (Sweden)

    Zafar Syed

    2011-08-01

    Full Text Available Abstract Background Colorectal cancer (CRC is a major source of morbidity and mortality in the elderly population and surgery is often the only definitive management option. The suitability of surgical candidates based on age alone has traditionally been a source of controversy. Surgical resection may be considered detrimental in the elderly solely on the basis of advanced age. Based on recent evidence suggesting that age alone is not a predictor of outcomes, Western societies are increasingly performing definitive procedures on the elderly. Such evidence is not available from our region. We aimed to determine whether age has an independent effect on complications after surgery for colorectal cancer in our population. Methods A retrospective review of all patients who underwent surgery for pathologically confirmed colorectal cancer at Aga Khan University Hospital, Karachi between January 1999 and December 2008 was conducted. Using a cut-off of 70 years, patients were divided into two groups. Patient demographics, tumor characteristics and postoperative complications and 30-day mortality were compared. Multivariate logistic regression analysis was performed with clinically relevant variables to determine whether age had an independent and significant association with the outcome. Results A total of 271 files were reviewed, of which 56 belonged to elderly patients (≥ 70 years. The gender ratio was equal in both groups. Elderly patients had a significantly higher comorbidity status, Charlson score and American society of anesthesiologists (ASA class (all p Conclusion Older patients have more co-morbid conditions and higher ASA scores, but increasing age itself is not independently associated with complications after surgery for CRC. Therefore patient selection should focus on the clinical status and ASA class of the patient rather than age.

  11. Effect of Raised Body Fat on Vitamin D, Leptin and Bone Mass

    International Nuclear Information System (INIS)

    Fatima, S. S.; Alam, F.

    2015-01-01

    Objectives: To estimate leptin, vitamin D and bone mineral density levels in individuals with high fat mass, and to assess any correlation. Methods: The cross-sectional study was conducted at the Basic Medical Sciences Institute, Jinnah Post Graduate Medical Centre, Karachi, and Aga Khan University, Karachi, from August 2012 to July 2014, and comprised healthy male volunteers between the ages of 18-60 years. Body fat percentage was determined using bioelectrical impedance analysis and the participants were classified as: Group A (15-21.9); Group B (22-27.9); and Group C (>28). Bone mineral density was calculated by ultrasound bone densitometer (T-score between +1 and -1 considered normal). Enzyme-linked immunosorbent assay kits were used to determine the levels of vitamin D and leptin. SPSS 19 was used for statistical analysis. Results: A total of 132 male subjects participated in this study, with each of the 3 groups having 44(33.3 percent). Despite all groups having low Vitamin D, a marked decrease was observed in group C compared to groups A and B (p <0.018). Bone mineral density T-score was <-1; total calcium was within normal range in all three groups. Serum leptin was raised in Group C compared to group A and B (p=0.03). Body fat percentage was negatively associated with vitamin D (p=0.004; r = -0.351), while it was positively correlated with leptin (p =0.038; r = 0.256). Conclusion: Excess of body fat percentage led to decreased vitamin D and raised leptin. However, bone mineral density and calcium levels were within normal range, suggesting that other factors might have played a role in maintaining bone mass in obese individuals, such as leptin. (author)

  12. Research-retreat-recovery: A potential model for organization and completion of research projects. Experience from a neurosurgery department in a developing country.

    Science.gov (United States)

    Godil, Saniya Siraj; Kazim, Syed Faraz; Shamim, Muhammad Shahzad

    2010-10-30

    In the current era of biomedical research, it is imperative that every research study at an institution is properly organized, and frequently audited to streamline efforts and maintain standards. Recently, a research retreat was organized by the Section of Neurosurgery at Aga Khan University Hospital, Karachi, Pakistan, and following that a recovery team was made with the aim of recovering "lost in translation" research projects. In the realm of our experience, the current model is being proposed as a means for organization of departmental research. The "research" component of the model comprised compilation of an abstract book of all research work done within the section during the last five years. The "retreat" component of the model was intended with objectives of analysis of past research and generation of fresh ideas. The "recovery" component of the model was accomplished by formation of a research recovery team with the aim of recovering unfinished, and/or unpublished research projects. The abstract book comprised 103 abstracts: 52.4% original research studies, 12.6% review articles, and 34.9% case report/series. Only 8.7% abstracts were of basic science research whereas the remaining 91.3% were clinical research papers. Only 34% had been published in an article form in a biomedical research journal (51.4% in international journals and 48.6% in national journals); remaining papers were either in submission/preparation process or had been abandoned. As part of research recovery, 29.4% projects were recovered within 12 weeks of the retreat component. We conclude that the model of "research-retreat-recovery" is highly successful in the context of neurosurgery departments in developing countries without a proper research unit, and can result in better organization of departmental research, recovery of unfinished projects, and initiation of new research studies.

  13. Diabetes and hypertension: public awareness and lifestyle-findings of a health mela

    International Nuclear Information System (INIS)

    Rafique, G.; Khuwaja, A.K.

    2003-01-01

    Objective: To determine the frequencies of diabetes, hypertension and their established lifestyle risk factors and to assess the level of awareness about diabetes and hypertension amongst persons attending a health mela at the Aga Khan University Hospital (AKUH), Karachi. Subjects and methods: A total of 264 participants were administered structured questionnaire to obtain demographic data and perceptions about diabetes and hypertension after taking verbal informed consent. Height, weight, blood pressure and random blood glucose were measured. Results: Overall frequency of type-2 diabetes was 13.5%, impaired glucose tolerance (IGT) 8.3% and hypertension 24%. Frequency of diabetes and hypertension in both men and women increased with increasing age (p< .001) and body mass index (p=0.02). Over half the men and women with type 2 diabetes (53% and 57% respectively) and 42% men and 60% women with IGT also had hypertension. Diabetes and hypertension were correctly defined by 52% and 37% subjects respectively and this was significantly associated with educational level (p=.001). Lack of physical exercise was observed in 59% participants, while 53.6% men and 67.5% women were overweight/obese. As compared to women, men used more additional salt (p = 0.03) and had more outside meals (p<0.001) and lack of physical exercise was observed in 59% participants, while 53.6% men and 67% women were overweight/obese. As compared to women, men used more additional salts (p=0.03) and had a more outside meals (p<0.001) and snacks (p=0.01). Conclusion: High frequencies of diabetes, hypertension, obesity, unhealthy nutrition and lack of exercise were observed in the study population. Emphasis on health education is needed to increase public awareness of the warming signs and risk factors of these common conditions. (author)

  14. Aplastic anemia: clinico haematological features, treatment and outcome analysis

    International Nuclear Information System (INIS)

    Wali, R.; Fadoo, Z.; Naqvi, M.A.

    2011-01-01

    To determine the clinico haematological features, treatment and outcome of children diagnosed with aplastic anemia at a single institution. Study Design: Observational study. Place and Duration of Study: The Aga Khan University Hospital, Karachi, from January 1999 till December 2008. Methodology: Medical records of children aged less than 15 years of age diagnosed with aplastic anemia were reviewed. Clinico haematological features, treatment and its response to therapy and outcome were recorded. Results were described in percentages. Results: Ninety patients were diagnosed to have aplastic anemia (AA); 65 were male during the study period. Age ranged from 1 to 15 years. Fever in 65 patients (72.2%), pallor in 53 (58.8%), skin bleeding in 49 (54.4%) and epistaxis in 31(34.4%) were the most common and frequent presenting features. Congenital (Fanconi's) anemia was found in 15 (16.6%) and acquired idiopathic in 75 (83.4%) of patients. Very severe aplastic anemia (VSAA) was seen in 29 (32.2%), 26 (28.9%) had severe AA and 17 (18.9%) had moderate AA. Eight patients (8.9%) underwent haematopoietic stem cell transplantation (HSCT), 12 (13.3%) received immunosuppressive therapy (IST) and 70 patients (77.7%) received other and supportive therapy. Five (62.5%) patients showed complete response to HSCT and 3 (37.5%) failed to engraft. IST showed complete response in 3 (25%), partial response in 5 (41.6%) and no response in 4 (33.3%). Twenty two patients (24.4%) expired either due to infection in 16 (72.7%, fungal in 6, bacterial in 10) and intracranial haemorrhage in 6 (27.3%) cases. Conclusion: Majority of cases with AA were acquired and idiopathic in etiology. VSAA and SAA were frequent. Response to HSCT and IST was sub-optimal. (author)

  15. Male hypogonadism at a tertiary care hospital in Karachi, Pakistan.

    Science.gov (United States)

    Ram, Nanik; Asghar, Ali; Hashmi, Fauzan; Islam, Najmul

    2012-01-01

    Male hypogonadism is defined as 'inadequate gonadal function, manifested by deficiency in gametogenesis and/or secretion of gonadal hormones'. Signs and symptoms of hypogonadism depend primarily on the age of onset. It can be classified according to the site primarily involved: the gonads, the hypothalamus, or the pituitary gland. The objective this study was to determine the presentation and aetiology of male hypogonadism seen in a tertiary care hospital. This cross-sectional study was conducted at Endocrine Clinics, Aga Khan University Hospital Karachi. Data of male patients with hypogonadism who attended clinics during January 2009 to August 2011 were reviewed. All male patients with clinical and biochemical evidence of hypogonadism were included in the study. Patients with Diabetes Mellitus, Metabolic Syndrome, Andropause, AIDS, Chronic Renal Failure, and Cirrhosis were excluded. Mean +/- SD were computed for quantitative variables. Frequency and percentages were computed for qualitative variables. Aetiology of male hypogonadism was categorised as primary and secondary hypogonadism. A total of 85 patients with male hypogonadism attended the endocrine clinic. Mean age of patients was 25 +/- 10 years. Clinical presentations were small genitalia (65%), absent secondary sexual characteristics (53%), not attained puberty (47%), infertility (53%), erectile dysfunction (41%) and loss of libido (29%). Seventy-three (86%) patients had hypogonadotrophic hypogonadism (secondary hypogonadism) and 12 (14%) patients had hypergonadotrophic hypogonadism (primary hypogonadism). Among the patients with hypogonadotrophic hypogonadism 38 had idiopathic hypogonadotrophic hypogonadsim, 7 had pituitary adenoma, 6 had empty sella syndrome, 3 had Kallman's syndrome, and 1 patient had haemosiderosis due to thalassaemia major; 18 patients did not undergo brain imaging. Small genitalia, absent secondary sexual characteristics and infertility were the main presenting features of hypogonad

  16. Trends of lipid abnormalities in Pakistani type-2 diabetes mellitus patients: a tertiary care centre data

    Energy Technology Data Exchange (ETDEWEB)

    Bhatti, S M; Dhakam, S; Khan, M.A., E-mail: drsehran@yahoo.co

    2009-10-15

    Objective: To ascertain trends of lipid abnormalities in Pakistani Type-2 Diabetes Mellitus patients. Methodology: Fasting lipid profiles of 328 outpatient adult type 2 diabetes mellitus patients visiting the Aga Khan University Hospital, from January 2005 to January 2006 were prospectively reviewed and abstracted on a pre-specified proforma. Demographic features, different patterns of dyslipidemia in accordance with specified risk categories, and the proportion of patients with none, one, two, or three lipid values outside clinical targets were noted. The influence of sex on dyslipidemia pattern was also assessed Results: Our patients had higher average HbA1c levels and higher total cholesterol, LDL and lower HDL levels. The triglycerides levels in our female patients were higher. The percentage of our patients with a high-, borderline-, or low-risk LDL cholesterol were 54, 29, and 16%, respectively (P = 0.51). On a percentage basis, 73% were in the high-risk HDL cholesterol group, 18% were in the borderline-risk group and 9% in the low-risk group, respectively (P< 0.0001). Regarding triglyceride concentrations, 16% had high-risk triglyceride levels, 34% were in the borderline-risk category, whereas 50% had a low-risk triglyceride levels (P< 0.0001). Patient proportion with None, One, Two, or Three Values outside clinical targets on percentage basis were 2, 16, 48, and 34%, respectively (P< 0.0001). Women were found to have greater odds of having LDL cholesterol above the target level i.e. >100mg/dl. Conclusion: Combination of high LDL and a low HDL cholesterol level was the commonest pattern of dyslipidemia found. Second was unfavorable levels of all three lipoproteins combined and the third was an isolated increase in LDL cholesterol. A greater proportion of women were found dyslipidemic. (author)

  17. Biochemical characterization and comparison of aspartylglucosaminidases secreted in venom of the parasitoid wasps Asobara tabida and Leptopilina heterotoma.

    Directory of Open Access Journals (Sweden)

    Quentin Coulette

    Full Text Available Aspartylglucosaminidase (AGA is a low-abundance intracellular enzyme that plays a key role in the last stage of glycoproteins degradation, and whose deficiency leads to human aspartylglucosaminuria, a lysosomal storage disease. Surprisingly, high amounts of AGA-like proteins are secreted in the venom of two phylogenetically distant hymenopteran parasitoid wasp species, Asobara tabida (Braconidae and Leptopilina heterotoma (Cynipidae. These venom AGAs have a similar domain organization as mammalian AGAs. They share with them key residues for autocatalysis and activity, and the mature α- and β-subunits also form an (αβ2 structure in solution. Interestingly, only one of these AGAs subunits (α for AtAGA and β for LhAGA is glycosylated instead of the two subunits for lysosomal human AGA (hAGA, and these glycosylations are partially resistant to PGNase F treatment. The two venom AGAs are secreted as fully activated enzymes, they have a similar aspartylglucosaminidase activity and are both also efficient asparaginases. Once AGAs are injected into the larvae of the Drosophila melanogaster host, the asparaginase activity may play a role in modulating their physiology. Altogether, our data provide new elements for a better understanding of the secretion and the role of venom AGAs as virulence factors in the parasitoid wasps' success.

  18. Kucuker et al., Afr J Tradit Complement Altern Med. (2014) 11(6):105 ...

    African Journals Online (AJOL)

    cadewumi

    common growth regulators used for extending post-harvest storage life of horticultural crops (Jobling et al., 2003; Khan and Singh, 2007; Khan et al.,. 2007; Khan and Singh, 2010). Methyl jasmonate (MeJA), a natural plant growth regulator, is a phytohormone with ubiquitous distribution among plants. Depending upon the.

  19. We can do it ourselves

    International Nuclear Information System (INIS)

    Henderson, S.

    1993-01-01

    This article includes an interview with Abdul Qader Khan, the father of Pakistan's nuclear program. The interview is prefaced with the story of Pakistan's efforts to match the nuclear expertise of its neighbor India, a description of the Khahuta nuclear facility, and anecdotes about Khan. The interview shows that Khan maintains that Kahuta is a peaceful nuclear facility and that Pakistan does not see any need for nuclear weapons. In the interview, Khan acknowledges that Kahuta's capabilities give Pakistanis self-respect and a sense of security

  20. BIBLIOMETRICS ON ONE OF THE LARGEST TERMITE INVENTORIES IN THE CERRADO: "STUDIES ON TERMITES FROM THE MATO GROSSO STATE, BRAZIL BY AGA MATHEWS 1977"

    Directory of Open Access Journals (Sweden)

    HÉLIDA FERREIRA DA CUNHA

    2015-01-01

    Full Text Available ABSTRACT This paper consists on a bibliometric analysis of the international influences of the book "Studies on termites from the Mato Grosso State, Brazil", by AGA Mathews (1977. The number of citations has increased over the years after the first citation. Mathews book was cited in articles, reviews, theses, dissertations, books, book chapters, abstracts in conference proceedings, comments and scientific notes. Most these studies are empirical and descriptive. The studies were conducted in 35 countries of the Neotropical, Palearctic, Afrotropical, Nearctic, Australasia and Indomalaya regions. 55% of the studies were carried out in Brazil. The journals Sociobiology and Insectes Sociaux, have social insect studies within its scope, and the highest number of articles citing Mathews. Most of the 71 authors that cited Mathews more than twice are Brazilian. Constrictotermes cyphergaster was the most studied in over 80% of the studies addressing Isoptera. The most frequent keywords were termite, Isoptera and taxonomy, generalist terms indexed in most publications carried out in different countries. Most of the research studies were carried out in laboratories and native vegetation areas. Studies in agroecosystems were implemented predominantly in Brazil. This study shows the diversity of application (citations of Mathews' book, and that the number of citations will continue to increase due to the large amount of information presented by the author.

  1. African Journal of Biotechnology - Vol 10, No 80 (2011)

    African Journals Online (AJOL)

    Effect of wheat cultivars on aphids and their predator populations · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. AA Khan, AM Khan, HM Tahir, M Afzal, A Khaliq, SY Khan, I Raza, 18399-18402. http://dx.doi.org/10.5897/AJB11.2961 ...

  2. Distribution and interannual variability of supraglacial lakes on debris-covered glaciers in the Khan Tengri-Tumor Mountains, Central Asia

    International Nuclear Information System (INIS)

    Qiao, Liu; Mayer, Christoph; Liu, Shiyin

    2015-01-01

    Supraglacial lakes are widely formed on debris-covered glaciers in the Khan Tengri-Tumor Mountains (KTTM), Tianshan, Central Asia. Study of their distribution characters based on regional-wide remote sensing investigations is still lacking, but it can promote our understanding about the influence of supraglacial lakes on the surface melting, hydrology and dynamics of debris-covered glaciers in this region. This study presents results of the supraglacial lake inventory in the KTTM region, based on multi-year Landsat images. We focus on the glacio-geomorphological characters of the supraglacial lakes and their late summer conditions, since all suitable Landsat images were acquired between August and September during 1990–2011. With a minimum threshold extent of 3600 m 2 for conservative mapping results, we totally mapped 775 supraglacial lakes and 38 marginal glacial lakes on eight huge debris-covered glaciers. Supraglacial lakes are concentrated on the Tumor Glacier and the South Inylchek Glacier, two biggest glaciers in this region. Although most supraglacial lakes are short-lived, a number of lakes can be repeatedly identified between different Landsat images. Detailed investigation of these ‘perennial’ lakes on the Tumor Glacier indicates that their filling frequency and area contributions have increased since 2005. Analysis of the area-elevation distributions for all mapped supraglacial lakes shows that they predominantly occur close to the altitude of 3250 m a.s.l., as high as the lowest reach of clean ice where surface debris begins to appear, and can further develop upglacier to a limit of about 3950 m a.s.l.. Total and mean area of supraglacial lakes in the KTTM region during the late summer seasons show great variability between years. Correlation analysis between the annual lake area and the observed nearby meteorological conditions suggests that warmer springs seem related to the draining of some supraglacial lakes during the following seasons, due

  3. Management of Clostridium difficile Infection in Inflammatory Bowel Disease: Expert Review from the Clinical Practice Updates Committee of the AGA Institute.

    Science.gov (United States)

    Khanna, Sahil; Shin, Andrea; Kelly, Ciarán P

    2017-02-01

    The purpose of this expert review is to synthesize the existing evidence on the management of Clostridium difficile infection in patients with underlying inflammatory bowel disease. The evidence reviewed in this article is a summation of relevant scientific publications, expert opinion statements, and current practice guidelines. This review is a summary of expert opinion in the field without a formal systematic review of evidence. Best Practice Advice 1: Clinicians should test patients who present with a flare of underlying inflammatory bowel disease for Clostridium difficile infection. Best Practice Advice 2: Clinicians should screen for recurrent C difficile infection if diarrhea or other symptoms of colitis persist or return after antibiotic treatment for C difficile infection. Best Practice Advice 3: Clinicians should consider treating C difficile infection in inflammatory bowel disease patients with vancomycin instead of metronidazole. Best Practice Advice 4: Clinicians strongly should consider hospitalization for close monitoring and aggressive management for inflammatory bowel disease patients with C difficile infection who have profuse diarrhea, severe abdominal pain, a markedly increased peripheral blood leukocyte count, or other evidence of sepsis. Best Practice Advice 5: Clinicians may postpone escalation of steroids and other immunosuppression agents during acute C difficile infection until therapy for C difficile infection has been initiated. However, the decision to withhold or continue immunosuppression in inflammatory bowel disease patients with C difficile infection should be individualized because there is insufficient existing robust literature on which to develop firm recommendations. Best Practice Advice 6: Clinicians should offer a referral for fecal microbiota transplantation to inflammatory bowel disease patients with recurrent C difficile infection. Copyright © 2017 AGA Institute. Published by Elsevier Inc. All rights reserved.

  4. Report on the International Workshop “Networks, Regions and Institutions in Mongol Eurasia: A Meso-Historical Analysis”, Jerusalem, 17–18 May, 2017

    Directory of Open Access Journals (Sweden)

    Roman Hautala

    2017-09-01

    Full Text Available On May 17–18, 2017, an international workshop “Networks, Regions and Institutions in Mongol Eurasia: A Meso-Historical Analysis” was held at the Hebrew University in Jerusalem with the participation of researchers from Israel, Japan, Britain, United States, Russia, China, Hungary and Finland. The main goal of the workshop was to reveal the potential of the “meso-historical analysis” in the study of the Mongol Empire, including the simultaneous consideration of global changes in Eurasia caused by the creation of the empire of Chinggis Khan, and the impact of these changes on each of its separate regions as recorded in the available primary sources. The keynote speech by Akinobu Kuroda (The University of Tokyo was entitled “A Global Monetary History of Mongol Eurasia: A Mesoscopic Perspective”. The first panel “Networks of the Empire and Beyond” included the following talks: Yoichi Isahaya (The Hebrew University of Jerusalem, “Hulaguid Appanages as Mesoscale Agency in Cross-Cultural Exchange”; Elizabeth Lambourn (De Montfort University, “Mongol Eurasia at Sea: Peninsular South India in Networks of Maritime Trade and Tribute (Thirteenth and Fourteenth Centuries”. In the framework of the second panel “Decentralizing the Empire through Mesoscale Regions” the following talks were presented: Francesca Fiaschetti (The Hebrew University of Jerusalem, “Empires within the Empire: Governance and Dynastic Space in Eastern Eurasia under Mongol Rule”; Christopher Eirkson (University of Pittsburgh, “Mongol Appanages and Ming Chinese Frontier Princedoms: A Comparison of Autonomous Territorial Units in Northern China, 1200–1500 CE”; Nikolay Kradin (Russian Academy of Sciences, “North-Eastern Margin of Mongolian Empire: Hinterland Urbanization of Chinggis Khan Brother”. The third panel “Sources Narrate Eurasia” saw presentations by: Roman Hautala (Tatarstan Academy of Sciences, “Catholic Missionary Sources on the

  5. eHealth for Remote Regions: Findings from Central Asia Health Systems Strengthening Project.

    Science.gov (United States)

    Sajwani, Afroz; Qureshi, Kiran; Shaikh, Tehniat; Sayani, Saleem

    2015-01-01

    Isolated communities in remote regions of Afghanistan, Kyrgyz Republic, Pakistan and Tajikistan lack access to high-quality, low-cost health care services, forcing them to travel to distant parts of the country, bearing an unnecessary financial burden. The eHealth Programme under Central Asia Health Systems Strengthening (CAHSS) Project, a joint initiative between the Aga Khan Foundation, Canada and the Government of Canada, was initiated in 2013 with the aim to utilize Information and Communication Technologies to link health care institutions and providers with rural communities to provide comprehensive and coordinated care, helping minimize the barriers of distance and time. Under the CAHSS Project, access to low-cost, quality health care is provided through a regional hub and spoke teleconsultation network of government and non-government health facilities. In addition, capacity building initiatives are offered to health professionals. By 2017, the network is expected to connect seven Tier 1 tertiary care facilities with 14 Tier 2 secondary care facilities for teleconsultation and eLearning. From April 2013 to September 2014, 6140 teleconsultations have been provided across the project sites. Additionally, 52 new eLearning sessions have been developed and 2020 staff members have benefitted from eLearning sessions. Ethics and patient rights are respected during project implementation.

  6. Browse Title Index

    African Journals Online (AJOL)

    Items 801 - 850 of 11090 ... Issue, Title. Vol 10, No 61 (2011), Analysis of chemical constituents in medicinal plants of selected districts of Pakhtoonkhwa, Pakistan, Abstract PDF. I Hussain, R Ullah, J Khan, N Khan, M Zahoor, N Ullah, MuR Khattak, FA Khan, A Baseer, M Khurram. Vol 10, No 77 (2011), Analysis of chloroplast ...

  7. ORF Alignment: NC_002678 [GENIUS II[Archive

    Lifescience Database Archive (English)

    Full Text Available NC_002678 gi|13475930 >1el5A 6 379 7 420 7e-42 ... ref|NP_107500.1| AgaE protein, conversion of agropini...c acid to mannopinic acid ... [Mesorhizobium loti MAFF303099] dbj|BAB53286.1| AgaE

  8. Transethosomal gels as carriers for the transdermal delivery of colchicine: statistical optimization, characterization, and ex vivo evaluation

    OpenAIRE

    Abdulbaqi,Ibrahim M; Darwis,Yusrida; Abou Assi,Reem; Abdul Karim Khan,Nurzalina

    2018-01-01

    Ibrahim M Abdulbaqi, Yusrida Darwis, Reem Abou Assi, Nurzalina Abdul Karim Khan School of Pharmaceutical Sciences, Universiti Sains Malaysia, Minden, Penang, Malaysia Introduction: Colchicine is used for the treatment of gout, pseudo-gout, familial Mediterranean fever, and many other illnesses. Its oral administration is associated with poor bioavailability and severe gastrointestinal side effects. The drug is also known to have a low therapeutic index. Thus to overcome these drawbacks, the...

  9. Diatom-Based Material Production Demonstration

    Science.gov (United States)

    2016-03-14

    Haeger 0.02 Sean Hoban 0.05 Leila Kamakele 0.06 Jeff Kataoka 0.08 Randi Keipper 0.16 Brendan Lagather 0.17 Stephen Woods 0.10 Rodney Corpuz 0.13 Aga...to Cathleen Fischer at Dresden University of Technology for testing as a substrate for catalysis. Material is available for any other testing...also thank Dr. Pat Kociolek from University of Colorado for help with identifying girdle bands of GAI-216. Bibliography Jantschke A., C. Fischer

  10. Characterization of Streptomyces spp. isolated from the rhizosphere of oil palm and evaluation of their ability to suppress basal stem rot disease in oil palm seedlings when applied as powder formulations in a glasshouse trial.

    Science.gov (United States)

    Shariffah-Muzaimah, S A; Idris, A S; Madihah, A Z; Dzolkhifli, O; Kamaruzzaman, S; Maizatul-Suriza, M

    2017-12-18

    Ganoderma boninense, the main causal agent of oil palm (Elaeis guineensis) basal stem rot (BSR), severely reduces oil palm yields around the world. To reduce reliance on fungicide applications to control BSR, we are investigating the efficacy of alternative control methods, such as the application of biological control agents. In this study, we used four Streptomyces-like actinomycetes (isolates AGA43, AGA48, AGA347 and AGA506) that had been isolated from the oil palm rhizosphere and screened for antagonism towards G. boninense in a previous study. The aim of this study was to characterize these four isolates and then to assess their ability to suppress BSR in oil palm seedlings when applied individually to the soil in a vermiculite powder formulation. Analysis of partial 16S rRNA gene sequences (512 bp) revealed that the isolates exhibited a very high level of sequence similarity (> 98%) with GenBank reference sequences. Isolates AGA347 and AGA506 showed 99% similarity with Streptomyces hygroscopicus subsp. hygroscopicus and Streptomyces ahygroscopicus, respectively. Isolates AGA43 and AGA48 also belonged to the Streptomyces genus. The most effective formulation, AGA347, reduced BSR in seedlings by 73.1%. Formulations using the known antifungal producer Streptomyces noursei, AGA043, AGA048 or AGA506 reduced BSR by 47.4, 30.1, 54.8 and 44.1%, respectively. This glasshouse trial indicates that these Streptomyces spp. show promise as potential biological control agents against Ganoderma in oil palm. Further investigations are needed to determine the mechanism of antagonism and to increase the shelf life of Streptomyces formulations.

  11. Optimal management of steroid-dependent ulcerative colitis

    Directory of Open Access Journals (Sweden)

    Khan HMW

    2015-11-01

    Full Text Available Hafiz M Waqas Khan,1 Faisal Mehmood,1 Nabeel Khan2 1Department of Medicine, King Edward Medical University, Lahore, Pakistan; 2Section of Gastroenterology, University of Pennsylvania Perelman School of Medicine, Philadelphia VA Medical Center, Philadelphia, PA, USA Abstract: Ulcerative colitis (UC is a chronic inflammatory condition that is variable in both extent and severity of disease as well as response to therapy. Corticosteroids (CSs were the first drugs used in the management of UC and are still used for induction of remission. However, because of their extensive side-effect profile, they are not utilized for maintenance of remission. In view of this, CS-free remission has become an important end point while evaluating therapeutic agents used in the management of UC. This review highlights the results of various studies conducted to evaluate the efficacy of different medications to attain CS-free remission in the setting of active UC. The drugs reviewed include established agents such as thiopurines, methotrexate, infliximab, adalimumab, vedolizumab, golimumab, and newer experimental agents, and if all else fails, colectomy will be performed. The efficacy of these drugs is evaluated individually. Our aim is to provide a synopsis of the work done in this field to date. Keywords: ulcerative colitis, steroid dependent, thiopurines, MTX, adalimumab, infliximab

  12. Flower-shaped ZnO nanoparticles synthesized by a novel approach at near-room temperatures with antibacterial and antifungal properties

    Directory of Open Access Journals (Sweden)

    Khan MF

    2014-02-01

    Full Text Available Mohd Farhan Khan,1,2 M Hameedullah,1 Akhter H Ansari,1 Ejaz Ahmad,3 MB Lohani,2 Rizwan Hasan Khan,3 M Mezbaul Alam,4 Wasi Khan,5 Fohad Mabood Husain,6 Iqbal Ahmad6 1NanoSolver Lab, Department of Mechanical Engineering, Zakir Hussain College of Engineering and Technology, Aligarh Muslim University, Aligarh, India; 2Department of Applied Chemistry, Integral University, Lucknow, India; 3Interdisciplinary Biotechnology Unit, Aligarh Muslim University, Aligarh, India; 4Chemistry Department, College of Science, King Saud University, Riyadh, Kingdom of Saudi Arabia; 5Centre of Excellence in Materials Science (Nanomaterials, Department of Applied Physics, Zakir Hussain College of Engineering and Technology, Aligarh Muslim University Aligarh, India; 6Department of Agricultural Microbiology, Faculty of Agricultural Sciences, Aligarh Muslim University, Aligarh, India Abstract: Due to enormous applications of metal oxide nanoparticles in research and health-related applications, metal oxide nanoparticles are increasingly being developed through cheaper and more user-friendly approaches. We have formulated a simple route to synthesize zinc oxide nanoparticles (ZNPs by a sol–gel method at near-room temperatures 25°C, 35°C, 55°C, and 75°C. The results are analyzed by X-ray diffraction, scanning electron microscopy with energy-dispersive X-ray spectroscopy, and ultraviolet-visible absorption spectroscopy. The effect of different temperature conditions (25°C–75°C on the particulate sizes (23.7–88.8 nm, pH levels (11.7–11.9, and morphologies (slender needle–broad arrow of flower-shaped ZNP colonies is studied. A possible mechanism depicting the growth rates at different temperatures and of different facets, mainly towards the <0 0 0 I> and <0 I Ī0> planes of the ZNPs has also been discussed. The values of λmax (293–298 nm suggest that ZNPs prepared at 55°C are the most effective ultraviolet B absorbers, and that they can be used in sunscreens

  13. Social and Political Consequences of Reza Shah’s Acquisition

    Directory of Open Access Journals (Sweden)

    Morteza Mirdar

    2017-09-01

    Full Text Available In this research, the effects and social and political consequences of the acquisition of land and property by Reza Khan have been addressed. The importance of the issue was due to the small amount of ownership of property and land, and consequently the change in the social and political relations of previous landowners and the replacement of Reza Khan's trusted individuals. The main issue of this research is the explanation of some social and political events in the field of land and property acquisition. In this regard, the role of taking possession of property in advancing Reza Khan's autocratic thoughts on the diminution of religion in social life, as well as the weakening of the power of the constitutional and opposition leaders of Reza Khan has been explained. The result of this study was the wide-ranging consequences of the acquisition of land and property in the social form of people's lives and the transformation of the social classes on the basis of Reza Khan's ambitious policies. This form of appropriation has changed the course of government and parliament besides it came to the end of a decade that led to the power and influence of the politician in favor of Reza Khan.

  14. Operational Design: Distilling Clarity from Complexity for Decisive Action

    Science.gov (United States)

    2012-08-01

    de Hartog, Genghis Khan, 86–98. 3. Greene , 33 Strategies of War, 181. 4. US Army, Army Strategic Planning Guidance, 14–15. 5. Thayer, War without...the Course of World His- tory. New York: Universe Publishing, 2011. Greene , Robert. The 33 Strategies of War. New York: Penguin, 2007. Harari, Michal...Piaget, Jean, and Bärbel Inhelder. Memory and Intelligence. London: Routledge and Kegan Paul, 1973. Pike, Douglas. The Viet-Cong Strategy of Terror

  15. Emergency treatment of complicated colorectal cancer

    OpenAIRE

    Tebala,Giovanni Domenico; Natili,Andrea; Gallucci,Antonio; Brachini,Gioia; Khan,Abdul Qayyum; Tebala,Domenico; Mingoli,Andrea

    2018-01-01

    Giovanni Domenico Tebala,1 Andrea Natili,1,2 Antonio Gallucci,1 Gioia Brachini,2 Abdul Qayyum Khan,1 Domenico Tebala,3 Andrea Mingoli2 1Colorectal Team, Noble’s Hospital, Strang, Douglas, Isle of Man, UK; 2Emergency Surgery Unit, “P.Valdoni” Department of Surgery, “Umberto I” University Hospital, Rome, Italy; 3National Institute of Statistics (ISTAT), Catanzaro, Italy Aim: To find evidence to suggest the best approach in patients admitted as ...

  16. Higher body mass index is associated with greater severity of alopecia in men with male-pattern androgenetic alopecia in Taiwan: a cross-sectional study.

    Science.gov (United States)

    Yang, Chao-Chun; Hsieh, Fu-Nien; Lin, Li-Yu; Hsu, Chao-Kai; Sheu, Hamm-Ming; Chen, WenChieh

    2014-02-01

    Obesity is a risk factor for multiple health problems, but its association with androgenetic alopecia (AGA) remains controversial. We sought to determine the association between body mass index (BMI) and alopecia severity in men with AGA and early-onset AGA. A cross-sectional study was conducted. The medical charts and photographs of men with a clinical diagnosis of AGA were reviewed. In all, 189 men were enrolled with a mean age of 30.8 years. In male-pattern AGA (n = 142), men with severe alopecia (grade V-VII) had higher BMI than those with mild to moderate alopecia (grade I-IV) (25.1 vs 22.8 kg/m(2), P = .01). After multivariate adjustments, the risk for severe alopecia was higher in the overweight or obese (BMI ≥24 kg/m(2)) subjects with male-pattern AGA (odds ratio 3.52, P < .01). In early-onset male-pattern AGA (n = 46), the risk for having severe alopecia was also higher in the overweight or obese subjects (odds ratio 4.97, P = .03). Parameters used to evaluate obesity were limited because of the retrospective nature of the study. Higher BMI was significantly associated with greater severity of hair loss in men with male-pattern AGA, especially in those with early-onset AGA. Copyright © 2013 American Academy of Dermatology, Inc. Published by Mosby, Inc. All rights reserved.

  17. Deamidated gliadin peptide antibodies as a routine test for celiac disease: a prospective analysis.

    Science.gov (United States)

    Volta, Umberto; Granito, Alessandro; Parisi, Claudia; Fabbri, Angela; Fiorini, Erica; Piscaglia, Maria; Tovoli, Francesco; Grasso, Valentina; Muratori, Paolo; Pappas, Georgios; De Giorgio, Roberto

    2010-03-01

    This study was designed to establish whether deamidated gliadin peptide antibodies (DGP-AGA) could improve the serologic workup for celiac disease (CD). The best serologic approach for CD screening is currently based on the combined detection of tissue transglutaminase (tTGA), endomysial (EmA), and gliadin antibodies (AGA). One hundred forty-four consecutive patients with gastrointestinal and extraintestinal signs suggestive for CD were investigated using serologic tests, that is, IgG and IgA DGP-AGA, IgA tTGA, IgA EmA, and duodenal biopsy. Forty-eight out of 144 patients (33%) had CD with different severity of villous atrophy. IgA tTGA showed 93.7% sensitivity compared with 91.6% for IgA EmA, 84.3% for IgA DGP-AGA, and 82.3% for IgG DGP-AGA. Of the 3 cases negative for IgA tTGA, IgA EmA, and IgA DGP-AGA, 2 had total IgA deficiency, although both were positive for IgG DGP-AGA. IgG DGP-AGA showed a very high specificity for CD (98.9%), not only superior to IgA DGP-AGA (79.8%), but also to IgA tTGA (96.6%) and very close to IgA EmA (100%). Our prospective study shows that the combined search for IgA tTGA and IgG DGP-AGA provides the best diagnostic accuracy for CD, allowing the identification of all CD cases---except one---with a very high specificity. The serologic workup for CD screening could be significantly improved by the routine introduction of IgG DGP-AGA together with IgA tTGA, thus reducing the number of tests and with an obvious advantage in terms of cost-efficacy.

  18. Skin resurfacing procedures: new and emerging options

    OpenAIRE

    Loesch MM; Somani AK; Kingsley MM; Travers JB; Spandau DF

    2014-01-01

    Mathew M Loesch,1 Ally-Khan Somani,1 Melanie M Kingsley,1 Jeffrey B Travers,1–3 Dan F Spandau1,41Department of Dermatology, 2Department of Pharmacology and Toxicology, 3Department of Pediatrics, 4Department of Biochemistry and Molecular Biology, Indiana University School of Medicine, Indianapolis, IN, USAAbstract: The demand for skin resurfacing and rejuvenating procedures has progressively increased in the last decade and has sparked several advances within the skin resurfacing fie...

  19. Ibrahim, Son of Mahmoudek: Accession to Power and Purses (1 »

    Directory of Open Access Journals (Sweden)

    A.L. Ponomarev

    2014-01-01

    Full Text Available The death of the Crimean khan Haji Giray on 25 August 1466 was followed by two months of the political turmoil. Sons of the late ruler, Mengli Giray and Nur Dawlat, were two pretenders well-known to the historians. But numismatic material and newly found archival documents prove that there was one more claimant khan. He was the protege of the Shirin bek Mamak and the copper puls of Caffa with the forked tamga testify that the Genoeses were inclined to accept his supremacy. The said heraldic symbol didn’t belong to Giray khans and it was never more used for the coins of Caffa or the khanate after 1441, when Tartar beks elected Haji Giray to be their lord. These puls were the fractional currency that became necessary after there had happened the monetary reform in the khanate and those old silver dangs started to circulate side by side with a new silver denomination – aqcha. The author has discovered that these puls have die links with aqche coins of Nur Dawlat and moreover he has found that the third «Emperor» had been mentioned in the unpublished accounts of the Genoese treasury, composed in September and October 1466. The shape of his tamga as well the steady political predilections of the Shirin beks demonstrate his kinship with Ulugh Muhammad. The name of this previously unbeknown Crimean khan, who became next year the khan of the Kazan khanate, was Ibrahim. The name of this khan is written on those coins which were earlier attributed to the Siberian khan Ibrahim (Ibak without real, only on far-fetched and untutored grounds.

  20. Ibrahim, Son of Mahmoudek: Accession to Power and Purses (2 »

    Directory of Open Access Journals (Sweden)

    A.L. Ponomarev

    2014-07-01

    Full Text Available The death of the Crimean khan Haij Garey on 25 August 1466 was followed by two months of the political turmoil. Sons of the late ruler, Mengli Garey and Nur Dawlat, were two pretenders well-known to the historians. But numismatic material and newly found archival documents prove that there was one more claimant khan. He was the protege of the Shirin bek Mamak and the copper puls of Caffa with the forked tamga testify that the Genoeses were inclined to accept his supremacy. The said heraldic symbol didn’t belong to Garey khans and it was never more used for the coins of Caffa or the khanate after 1441, when Tartar beks elected Haji Garey to be their lord. These puls were the fractional currency that became necessary after there had happened the monetary reform in the khanate and those old silver dangs started to circulate side by side with a new silver denomination – aqcha. The author has discovered that these puls have die links with aqcha coins of Nur Dawlat and moreover he has found that the third «Emperor» had been mentioned in the unpublished accounts of the Genoese treasury, composed in September and October 1466. The shape of his tamga as well the steady political predilections of the Shirin beks demonstrate his kinship with Ulugh Muhammad. The name of this previously unbeknown Crimean khan, who became next year the khan of the Kazan khanate, was Ibrahim. The name of this khan is written on those coins which were earlier attributed to the Siberian khan Ibrahim (Ibak without real, only on far-fetched and untutored grounds.

  1. Service quality in contracted facilities.

    Science.gov (United States)

    Rabbani, Fauziah; Pradhan, Nousheen Akber; Zaidi, Shehla; Azam, Syed Iqbal; Yousuf, Farheen

    2015-01-01

    The purpose of this paper is to explore the readiness of contracted and non-contracted first-level healthcare facilities in Pakistan to deliver quality maternal and neonatal health (MNH) care. A balanced scorecard (BSC) was used as the assessment framework. Using a cross-sectional study design, two rural health centers (RHCs) contracted out to Aga Khan Health Service, Pakistan were compared with four government managed RHCs. A BSC was designed to assess RHC readiness to deliver good quality MNH care. In total 20 indicators were developed, representing five BSC domains: health facility functionality, service provision, staff capacity, staff and patient satisfaction. Validated data collection tools were used to collect information. Pearson χ2, Fisher's Exact and the Mann-Whitney tests were applied as appropriate to detect significant service quality differences among the two facilities. Contracted facilities were generally found to be better than non-contracted facilities in all five BSC domains. Patients' inclination for facility-based delivery at contracted facilities was, however, significantly higher than non-contracted facilities (80 percent contracted vs 43 percent non-contracted, p=0.006). The study shows that contracting out initiatives have the potential to improve MNH care. This is the first study to compare MNH service delivery quality across contracted and non-contracted facilities using BSC as the assessment framework.

  2. Equivalence of the theories of reciprocity and general relativity

    International Nuclear Information System (INIS)

    Qadir, A.

    1976-01-01

    Khan's theory (Nuovo Cimento; 57B:321 (1968) and Int. J. Theor. Phys.; 6:383 (1972)) of reciprocity has been shown to be equivalent to the theory of general relativity (in a conformally flat space-time) in that the same predictions are made physically. It is is proved that, since 'centrifugal forces' are used by Khan, gravitational phenomena are being considered equal in status to electromagnetic phenomena, and hence the difference claimed to exist between Milne's theory and Khan's theory disappears. (author)

  3. Androgenetic alopecia as an indicator of metabolic syndrome and cardiovascular risk.

    Science.gov (United States)

    Ertas, Ragip; Orscelik, Ozcan; Kartal, Demet; Dogan, Ali; Ertas, Sule Ketenci; Aydogdu, Ebru Guler; Ascioglu, Ozcan; Borlu, Murat

    2016-06-01

    Numerous studies have investigated a probable association between androgenetic alopecia (AGA) and cardiovascular disease (CVD) by researching limited and dispersed parameters. We aimed to evaluate both traditional and non-traditional cardiovascular risk factors in male patients with early-onset AGA. This case-control study included 68 participants: 51 male patients with early-onset AGA and 17 healthy male controls. Patients with AGA were classified into three groups according to the Hamilton-Norwood scale and the presence of vertex hair loss. Traditional and non-traditional cardiovascular risk factors were examined in all study subjects. Metabolic syndrome was diagnosed in 25 patients with AGA and in two control subjects (p baldness and controls (p < 0.05). The pulse-wave velocity values were also found to be significantly higher in patients (p < 0.001). A limitation of this study was the small study population. In conclusion, vertex pattern AGA appears to be a marker for early atherosclerosis. This finding supports the hypothesis that early-onset AGA alone could be an independent risk factor for CVD and metabolic syndrome.

  4. The “Majmu al-tawarikh” as a Source on the History of the Jochid Ulus.

    Directory of Open Access Journals (Sweden)

    Zh.M. Sabitov

    2017-09-01

    Full Text Available Research objective: To study information about the Golden Horde contained in a historical source called the “Majmu al-tawarikh” and to analyze the information found in that source about the lives of amirs and khans of the Golden Horde. Research materials: The study was conducted on the basis of an analysis of published and unpublished sections of the “Majmu al-tawarikh” which have been translated. Results and novelty of the research: The “Majmu al-tawarikh” is a valuable source for the history of the Golden Horde. There are a number of anachronisms in the “Majmu al-tawarikh”, but it also contains unique and original information about the history of the Golden Horde. There are three copies of the source. The first copy (B 667 is stored at the Institute of Oriental Manuscripts of the Academy of Sciences in St. Petersburg. The second copy (№ 693 is stored in the Oriental department of St. Petersburg State University library. The third copy (№ 167a stored in the fund of the National Academy of Sciences of the Kyrgyz Republic (Bishkek. A translation in Kyrghyz of the third copy was published in 1996. This source contains unique information about the life and family of such khans of the Golden Horde as Toktamysh, Kara-Nogai, Pulad. This work contains stories about the lives of such amirs as Mamai (from the Kiyat tribe, Teginya (Tegin, Dekne from the Shirin tribe, Temir-khodzha (Dair-Khodzha and his son Kara-Khodzha from the Argyn tribe, Hussain Aq-Sufi from Kungirat tribe and his son Ak Nogai, Mamai from the Saray tribe, Baba Ali from the Khitai tribe, etc. Baba Ali from Khitai tribe was the main source of information for “Majmu al-tawarikh” about the Jochid ulus. He served Abd al-Kerim, the khan of Astrakhan, and the Khwarezm’s khan, Sultan-Ghazi. This same Baba Ali was also the informant of Ötemish-Hajji, who recorded stories about Tokhtamysh, Kara-Nogay and Hussain Aq-Sufi.

  5. Tezkire-i Buğra Han’ın Çağatayca Yazılmış Bir Nüshası Metin- Dil İncelemesi- Tıpkıbasım A Manuscript Of Tazkira-i Bughra Khan Written In Chagatay Turkısh Texte- Grammar Notes- Facsimile

    Directory of Open Access Journals (Sweden)

    B. Erdem DAĞISTANLIOĞLU

    2012-12-01

    Full Text Available The information is quite restricted which is about the first periodsof Islamic adoption by Turks. Unknown counterparts about this periodare the same with Satuq Bughra Khan who is in the huge role ofdiffusion of Islam between Turks and has legendary singularity.This article includes the translation and the examination of thelanguage of the transcript of Tazkira-i Bughra Khan which is indited in19th century in Chagatay Turkish and recounts Turkish people’sembracing İslam in indiscrete and the legendary lives of the first MuslimTurkish emperor.The artifact that in our labour not only has the feature of thelanguage of Classical Chagatay Turkish, but has the feature ofphonetics and grammatical structure of Uzbek and Modern Uigur. Thebook of Tazkira-i Bughra Khan includes examples of archaic pre-Chagatay Turkish either phonetics or grammatical structure. Theartifact attracts attention with these features not only representspassage from Chagatay Turkish to modern Turk idioms, but alsoincludes archaic structures.The writing gets the most of language features of Modern Uigurapart from Chagatay Turkish. The statements are written comlicatedand we could spot that are in the first page of the book, tārįħķa bir min giki yüz yėtmiş ….. inal aķsuluķ taĥrįri āħ ir boldı, also explain, thissentence is related with the Modern Uigur.The paper gives information about the whole text, writer, thecentury it is written in, and the other copies of the written work; alsothe translation of the written text about the legand of Satuq BughraKhan is given. Beside, the facsimile of the part inspected is attached tothe end of the article.Altough grounded on the Satuq Bughra Khan narrative whichtakes place in British Library in the Or. 8161 numbered text betweenthe 83a-102b pages; also, when examination of the language is needed,some explanations are given considering the whole text. Türklerin İslamiyet’e intisaplarının ilk dönemleri hakk

  6. Hunlar’da Sosyal, Siyâsî Hayat Ve Devlet- Halk İlişkileri

    OpenAIRE

    ÇERÇİ, Faris

    2012-01-01

    In the begining of thousand years of B.C, Khuns that appeared in the stage of history as the oldest of Turk states established the greatest nomadic rulerness (khan) of Asia.In Turk history, Mete Khan who importandly infliunced a historic beginning brought the first understanding about modern state and army and indicated the sacredness of love of motherland and nation.China administration educated its armies according to system of Turks and employed weapons of Khuns to stop KhunsÇi-çi Khan lon...

  7. Tire Kutu Khan Excavation, Principalities And Ottoman Periods Ceramics / Tire Kutu Han Kazısı, Beylikler Ve Osmanlı Dönemi Seramikleri

    Directory of Open Access Journals (Sweden)

    Hasan UÇAR

    2018-04-01

    Full Text Available Tire is a city, which was the capital city of Aydınoğulları Principality. The development of the city, which started to become a Turk-Islam settlement in this period, accelerated in the Ottoman period. The numerous religious, social and civil architectural structures built in those days in the city have reached the present day with great preservation of their originality. Kutu Khan, which carries the unique characteristics of the Ottoman city-inns, dating back to 1429. It was a remarkable structure in Ottoman trade life and it continued its function for centuries. Recently, excavations were carried out in the courtyard and barn area of the inn for restoration. A large number of ceramics reflecting the characteristics of both the Principalities and the Ottoman period were brought to the surface from underground. The presentations and evaluations of the red dough ceramics of both periods during the excavations are the contents of this article. When the ceramic finds are classified in chronological order, it is understood that the ones dated to the first half of the 14th-15th C. and those dated to the 18th-19th C. are high in number. The number of ceramics dated between these two periods is rather limited. This leads to different results. The first is that the area where the inn was built was also a settlement area in the Principalities Period; secondly, from the date of its construction until 18th-19th C., the inn was regularly operated; the third is that the centuries the cleaning work in the inn has not been given much importance and the broken ceramics have been sprinkled on the floor. Ceramics spreading for about 600 years were evaluated in two main groups; glazed and unglazed. All lined ceramics belonging to glazed ceramics belong to Ottoman period and these ceramics are similar to those ceramics produced in Eyüp and Çanakkale. Underglazed painted ceramics belong to both periods. In these ceramics, in which style differences are observed

  8. White Paper AGA: An Episode-of-Care Framework for the Management of Obesity-Moving Toward High Value, High Quality Care: A Report From the American Gastroenterological Association Institute Obesity Episode of Care and Bundle Initiative Work Group.

    Science.gov (United States)

    Brill, Joel V; Ashmore, Jamile A; Brengman, Matthew L; Buffington, Daniel E; Feldshon, S David; Friedman, Kelli E; Margolis, Peter S; Markus, Danielle; Narramore, Leslie; Rastogi, Amita; Starpoli, Anthony A; Strople, Kenneth; White, Jane V; Streett, Sarah E

    2017-05-01

    The American Gastroenterological Association acknowledges the need for gastroenterologists to participate in and provide value-based care for both cognitive and procedural conditions. Episodes of care are designed to engage specialists in the movement toward fee for value, while facilitating improved outcomes and patient experience and a reduction in unnecessary services and overall costs. The episode of care model puts the patient at the center of all activity related to their particular diagnosis, procedure, or health care event, rather than on a physician's specific services. It encourages and incents communication, collaboration, and coordination across the full continuum of care and creates accountability for the patient's entire experience and outcome. This paper outlines a collaborative approach involving multiple stakeholders for gastrointestinal practices to assess their ability to participate in and implement an episode of care for obesity and understand the essentials of coding and billing for these services. Copyright © 2017 AGA Institute. Published by Elsevier Inc. All rights reserved.

  9. ORF Alignment: NC_002678 [GENIUS II[Archive

    Lifescience Database Archive (English)

    Full Text Available NC_002678 gi|13475854 >1el5A 4 378 18 430 4e-33 ... ref|NP_107424.1| agaE protein, conversion of agropini...c acid to mannopinic acid ... [Mesorhizobium loti MAFF303099] dbj|BAB53210.1| Aga

  10. ORF Alignment: NC_002679 [GENIUS II[Archive

    Lifescience Database Archive (English)

    Full Text Available NC_002679 gi|13488188 >1el5A 4 377 26 437 3e-36 ... ref|NP_085608.1| agaE(conversion of agropini...c acid to mannopinic acid) ... [Mesorhizobium loti MAFF303099] dbj|BAB54449.1| AgaE ...

  11. Understanding patient and physician perceptions of male androgenetic alopecia treatments in Asia-Pacific and Latin America.

    Science.gov (United States)

    Lulic, Zrinka; Inui, Shigeki; Sim, Woo-Young; Kang, Hoon; Choi, Gwang Seong; Hong, Woosung; Hatanaka, Toshiki; Wilson, Timothy; Manyak, Michael

    2017-08-01

    This survey aimed to explore patient and physician attitudes towards male androgenetic alopecia (AGA), satisfaction with currently available male AGA treatments and investigate the factors affecting treatment choice. The survey was carried out in five countries (Japan, South Korea, Taiwan, Mexico and Brazil) between November and December 2015 using a standard market research methodology. Questionnaires were completed by patients with male AGA or hair loss/thinning and practicing physicians who were responsible for prescribing AGA treatment. In total, 835 patients and 338 physicians completed the questionnaire. Overall, 37.6% of patients reported satisfaction with the treatments they had used. The highest patient satisfaction was reported for 5-alpha-reductase inhibitors (53.9% of patients satisfied). In all countries, physicians were more likely than patients to think that male AGA has a major impact on patient confidence (89.3% vs 70.4%, respectively). There was agreement by physicians and patients that male AGA patients who are involved in their treatment decisions have better outcomes. Patients who were satisfied with AGA treatments were more likely to have the level of involvement they desired in treatment decisions (69.1% of satisfied patients) than dissatisfied patients (56.4% of dissatisfied patients). This survey provides valuable insights into the attitudes of patients and physicians in Asia and Latin America about male AGA and its treatments. The survey identified areas of disconnect between physicians and patients regarding the impact of male AGA, treatment consultations and the importance of treatment attributes. It also highlights the need for physicians to spend sufficient time with patients discussing AGA treatment approaches. © 2017 GlaxoSmithKline. The Journal of Dermatology published by John Wiley & Sons Australia, Ltd on behalf of Japanese Dermatological Association.

  12. Nadvid Ubushiev, About Great Kalmyk Noblemen

    OpenAIRE

    Okonov, Andzhur; Oshaev, Nikolai

    2015-01-01

    Nadvid talks about the following historical figures: Kho Orlyuk, Dalai Baatr, Donduk Ombo Khan, Guvzh Dorzh Noyon Khan, Ayuka Khan and Mazan Baatr. Kho Orlyuk had 7 territorial units, whereas Dalai Baatr had only 1. In 1609, the two signed an agreement but soon afterwards fell out with each other. In 1623 in the Year of the Rabbit, Dalai Baatr separated from the rest and took his people with him. He built a temple in a place called Okn Gazryn Kobe Tosn Bura and invited monks from Tibet. In ...

  13. A meta-synthesis on parenting a child with autism

    OpenAIRE

    Ooi, Khim Lynn; Ong, Yin Sin; Jacob, Sabrina Anne; Khan, Tahir Mehmood

    2016-01-01

    Khim Lynn Ooi, Yin Sin Ong, Sabrina Anne Jacob, Tahir Mehmood Khan School of Pharmacy, Monash University Malaysia, Bandar Sunway, Selangor, Malaysia Background: The lifelong nature of autism in a child has deep implications on parents as they are faced with a range of challenges and emotional consequences in raising the child. The aim of this meta-synthesis was to explore the perspectives of parents in raising a child with autism in the childhood period to gain an insight of the adaptations...

  14. African Journal of Biotechnology - Vol 10, No 39 (2011)

    African Journals Online (AJOL)

    Studies on Buddleja asiatica antibacterial, antifungal, antispasmodic and Ca antagonist activities · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. F Ali, I Ali, HU Khan, AU Khan, AH Gilani, 7679-7683 ...

  15. Missing the boat: odds for the patients who leave ED without being seen

    Directory of Open Access Journals (Sweden)

    Fayyaz Jabeen

    2013-01-01

    Full Text Available Abstract Background A patient left without being seen is a well-recognized indicator of Emergency Department overcrowding. The aim of this study was to define the characteristics of LWBS patients, their rates and associated factors from a tertiary care hospital of Pakistan. Methods A retrospective patient record review was undertaken. All patients presenting to the Aga Khan University Hospital, Karachi, between April and December of the year 2010, were included in the study. Information was collected on age, sex, presenting complaints, ED capacity, month, time, shift, day of the week, and waiting times in the ED. A basic descriptive analysis was made and the rates of LWBS patients were determined among the patient subgroups. Logistic regression analysis was used to assess the risk factors associated with a patient not being seen in the ED. Results A total of 38,762 patients visited ED during the study period. Among them 5,086 (13% patients left without being seen. Percentage of leaving was highest in the night shift (20%. The percentage was twice as high when the ED was on diversion (19.8% compared to regular periods of operation (9.8%. Mean waiting time before leaving the ED in pediatric patients was 154 minutes while for adults it was 171 minutes. More than 32% of patients had waited for more than 180 minutes before they left without being seen, compared to the patients who were seen in ED. Important predictors for LWBS included; Triage category P4 i.e. walk –in-patients had an OR of 13.62(8.72-21.3, Diversion status, OR 1.49(1.26-1.76, night shift , OR 2.44(1.95-3.05 and Pediatric age, OR 0.57(0.48-0.66. Conclusions Our study elucidates the LWBS population characteristics and identifies the risk factors for this phenomenon. Targeted interventions should be planned and implemented to decrease the waiting time and alternate services should be provided for high-risk patients (for LWBS to minimize their number.

  16. Vitamin B12 deficiency - a major cause of megaloblastic anaemia in patients attending a tertiary care hospital

    International Nuclear Information System (INIS)

    Iqbal, S.P.; Kakepoto, G.N.; Iqbal, S.P.

    2009-01-01

    Folate and vitamin B12 deficiencies have been known to cause megaloblastic anaemia. Since the deficiencies of these two vitamins are very common in Pakistani population, it would be imperative to investigate their role in causing megaloblastic anaemia. The objective of this study was to find out the contribution of folate and vitamin B12 deficiencies in causing megaloblastic anaemia in our patient population. Methods: In this retrospective cohort study, clinical records of 220 patients (101 females and 119 males with an age range of 1 - 80 years) who presented themselves with macrocytic anaemia at the Aga Khan University Hospital were collected. Data pertaining to complete blood count and serum levels of folate and vitamin B12 were analysed. Results: The mean haemoglobin (Hb) level was 6.8 +- 0.2 gm/dl. Sixty-nine percent of the patients had severe anaemia (Hb<8 gm/dl). Mean +- SEM values of haemoglobin, serum folate and serum B12 were not significantly different between males and females (Hb 6.4 +- 0.3 gm/dl vs 6.3 +- 0.3 gm/dl; folate 6.9 +- 0.8 mu g/ml vs 7.8 +- 1 mu g/ml; B12 259 +- 65 mu g/ml vs 225 +- 45 mu g/ml, respectively). Linear regression analysis showed that serum folate was inversely related with the mean corpuscular volume (MCV, p=0.04). Spearman's correlation analysis indicated an inverse mild association between MCV and serum folate (correlation coefficient= -0.18). Folate deficiency was 43.4%, while vitamin B12 deficiency was 78.5% in these patients. Seventy-one percent of folate-deficient patients had vitamin B12 deficiency as well, while 26.1% of patients with B12 deficiency had a co-occurrence of folate deficiency. Conclusion: Vitamin B12 deficiency appears to be the major factor leading to megaloblastic anaemia in our study population. Inadequate dietary intake, over-cooking of our food and poor absorption might be contributing to high prevalence of vitamin B12 deficiency in this population. (author)

  17. Focused abdominal sonography for trauma (FAST) in blunt paediatric abdominal trauma

    International Nuclear Information System (INIS)

    Faruque, A. V.; Qazi, S. H.; Khan, M. A. M.

    2013-01-01

    Objective: To evaluate the role of focussed abdominal sonography for trauma in blunt paediatric abdominal trauma patients, and to see if the role of computed tomography scan could be limited to only those cases in which sonography was positive. Methods: The retrospective study covered 10 years, from January 1, 2000 to December 31, 2009, and was conducted at the Department of Radiology and Department of Emergency Medicine, Aga Khan University Hospital, Karachi. It comprised cases of 174 children from birth to 14 years who had presented with blunt abdominal trauma and had focussed abdominal sonography for trauma done at the hospital. The findings were correlated with computed tomography scan of the abdomen and clinical follow-up. Sensitivity, specificity, positive predictive value, negative predictive value and accuracy of focussed abdominal sonography for trauma were calculated for blunt abdominal trauma. SPSS 17 was used for statistical analysis. Results: Of the total 174 cases, 31 (17.81%) were later confirmed by abdominal scan. Of these 31 children, sonography had been positive in 29 (93.54%) children. In 21 (67.74%) of the 31 children, sonography had been true positive; 8 (25%) (8/31) were false positive; and 2 (6%) (2/31) were false negative. There were 6 (19.3%) children in which sonography was positive and converted to laparotomy. There was no significant difference on account of gender (p>0.356). Focussed abdominal sonography for trauma in the study had sensitivity of 91%, specificity of 95%, positive predictive value of 73%, and negative predictive value of 73% with accuracy of 94%. All patients who had negative sonography were discharged later, and had no complication on clinical follow-up. Conclusions: Focussed abdominal sonography for trauma is a fairly reliable mode to assess blunt abdominal trauma in children. It is a useful tool to pick high-grade solid and hollow viscous injury. The results suggest that the role of computed tomography scan can be

  18. Focused abdominal sonography for trauma (FAST) in blunt paediatric abdominal trauma.

    Science.gov (United States)

    Faruque, Ahmad Vaqas; Qazi, Saqib Hamid; Khan, Muhammad Arif Mateen; Akhtar, Wassem; Majeed, Amina

    2013-03-01

    To evaluate the role of focussed abdominal sonography for trauma in blunt paediatric abdominal trauma patients, and to see if the role of computed tomography scan could be limited to only those cases in which sonography was positive. The retrospective study covered 10 years, from January 1,2000 to December 31,2009, and was conducted at the Department of Radiology and Department of Emergency Medicine, Aga Khan University Hospital, Karachi. It comprised cases of 174 children from birth to 14 years who had presented with blunt abdominal trauma and had focussed abdominal sonography for trauma done at the hospital. The findings were correlated with computed tomography scan of the abdomen and clinical follow-up. Sensitivity, specificity, positive predictive value, negative predictive value and accuracy of focussed abdominal sonography for trauma were calculated for blunt abdominal trauma. SPSS 17 was used for statistical analysis. Of the total 174 cases, 31 (17.81%) were later confirmed by abdominal scan. Of these 31 children, sonography had been positive in 29 (93.54%) children. In 21 (67.74%) of the 31 children, sonograpy had been true positive; 8 (25%) (8/31) were false positive; and 2 (6%) (2/31) were false negative. There were 6 (19.3%) children in which sonography was positive and converted to laparotomy. There was no significant difference on account of gender (p>0.356). Focussed abdominal sonography for trauma in the study had sensitivity of 91%, specificity of 95%, positive predictive value of 73%, and negative predictive value of 73% with accuracy of 94%. All patients who had negative sonography were discharged later, and had no complication on clinical follow-up. Focussed abdominal sonography for trauma is a fairly reliable mode to assess blunt abdominal trauma in children. It is a useful tool to pick high-grade solid and hollow viscous injury. The results suggest that the role of computed tomography scan can be limited to those cases in which focussed

  19.  Knowledge, Attitude and Practice of Vitamin Supplementation among Patients visiting Out-Patient Physicians in a Teaching Hospital in Karachi

    Directory of Open Access Journals (Sweden)

    Iqbal Azam

    2012-03-01

    Full Text Available  Objective: To determine the knowledge, attitude and practices regarding the use of vitamin supplements among patients visiting Out-Patient clinics of a teaching hospital.Methods: Four hundred patients were interviewed during the period of July to September 2008, at the Out-patient clinics, Aga Khan University hospital, Karachi. A pre-tested and structured questionnaire was used to collect information. It consisted of questions regarding demographics, awareness of vitamin supplements and its consumption, reasons for usage and its effects. The purpose of the study was explained and assurance of confidentiality was given. After obtaining written consent, eligible individuals were interviewed. Statistical Package for the Social Sciences version 19.0 was used to analyze the data.Results: The results revealed that 98�0of the respondents were aware of vitamin supplements. The most known vitamin was found to be Vitamin C (16.9�20with Vitamin K being the least well known(0.4� while 51.8�0of the respondents were unaware of the harmful effects of vitamin supplements. The results also showed that 84.8�0of the study population had taken vitamin supplements, and 79�0of the participants considered that vitamin supplementsto be helpful. Taking vitamin supplements as a compensation for the deficiencies in the body was the most frequently chosen answer (17.7�20as the reason for use of vitamin supplements. On the other hand, a majority of the population was unaware of the indications for use of vitamin supplements.Conclusion: This study highlights a very significant yet ignored issue of vitamin supplementation in Pakistan. A need exists to inform the general population about the use of vitamin supplementation. The media and the medical community are required to play their role in this regard. Short/ refresher training courses are needed for doctors to update and disseminate adequate knowledge of vitamin supplementation to their patients.

  20. Empyema Thoracis in Children: Clinical Presentation, Management and Complications

    International Nuclear Information System (INIS)

    Saleem, A. F.; Shaikh, A. S.; Khan, R. S.; Khan, F.; Faruque, A. V.; Khan, M. A. M.

    2014-01-01

    Objective: To determine the etiology, clinical manifestation, management (medical and surgical) and complications of children with empyema thoracis in a tertiary care hospital from Karachi, Pakistan. Study Design: Descriptive, analytical study. Place and Duration of Study: Department of Surgery, The Aga Khan University Hospital, Karachi, from January 1996 to December 2010. Methodology: Medical records of admitted children aged > a month to 15 years with discharge diagnosis of empyema thoracis and data was collected on demographic features, clinical manifestation, management and complications. Children managed medically were compared with those managed surgically by using interquartile range and median comparison. Mann-Whitney U test was used to compare age in months, weight (kg) and length of stay in days and presenting complaint, duration of illness; chi-square test was used to compare thrombocytosis in between groups and p-value was calculated. Results: Among the 112 patients, 59 (53%) were younger than 5 years of age. Males (n=83, 74%) were predominant. Fifty (45%) children were admitted in winter. Thirty (27%) children found unvaccinated and one fourth (n=27; 24%) were severely malnourished. Fever, cough, and dyspnea were the major presenting symptoms. Sixty-six (59%) were on some antibiotics prior to admission. Staphylococcus aureus (n=13) and Streptococcus pneumoniae (n=5) were the commonest organism isolated from blood and pleural fluid cultures. Majority of the children required some surgical intervention (n=86). Surgically managed children were younger (p=0.01); had less weight (p=0.01) and prolonged fever (p=0.02); and stayed longer in hospital (p < 0.001) as compared to medically managed children. Requiring readmission (n=8), subcutaneous emphysema (n=5) and recollection of pus (n=5) were the major complications. Conclusion: Staphylococcus aureus was the major organism associated with paediatric empyema thoracis. Early identification and empiric

  1. Fistulotomy versus fistulectomy for simple fistula in ano: a retrospective cohort study

    International Nuclear Information System (INIS)

    Murtaza, G; Shaikh, F.A.; Chawla, T.; Rajput, B.U.; Shahzad, N.; Ansari, S.

    2017-01-01

    To compare fistulotomy with fistulectomy for wound healing, duration of surgery, post-operative pain, incontinence and recurrence in patients with fistula in ano. Methods: This retrospective cohort study was conducted at the Aga Khan University Hospital, Karachi, and comprised data of adults who had undergone fistulotomy/fistulectomy for simple fistula in ano from January 2007 to August 2012. Data collection was done in August 2013 using questionnaire and telephonic interviews. Outcome variables like duration of wound healing, recurrence, incontinence, duration of surgery and post-operative pain were compared in both the groups. SPSS 19 was used for data analysis. Results: Of the 192 cases, there were 96(50%) in each group. The mean age was 40.51 years (range: 21-72 years) in the fistulotomy group and 41.14 years (range: 21-66 years) in the fistulectomy group (p=0.66). Both groups were comparable for baseline demographic variables. The median duration of wound healing was shorter in the fistulotomy group 15 days (Interquartile range: 7-20 days) compared to the fistulectomy group 30 days (Interquartile range: 15-42 days) (p<0.001). The incidence of recurrence was comparable in fistulotomy vs. fistulectomy (3[3.12%] vs. 4[4.16%]; p=0.70). The incidence of incontinence was higher in fistulotomy compared to fistulectomy (5[5.3%] vs. 12[12.5%]; p=0.07). The severity of incontinence was also compared but the difference was insignificant (p=0.06). The median duration of surgery was significantly shorter in fistulotomy group 17 minutes (Interquartile range: 12-25 minutes) compared to fistulectomy group 25 minutes Interquartile range: 20-35 minutes (p<0.001). The median post-operative pain in the surgical day care unit and at the first follow-up in clinic was zero for both groups. Conclusion: Fistulotomy yielded better results than fistulectomy since it significantly decreased the duration of wound healing and duration of surgery without increasing the incidence of

  2. Factors affecting anastomotic leak after colorectal anastomosis in patients without protective stoma in tertiary care hospital

    International Nuclear Information System (INIS)

    Sultan, R.; Chawla, T.; Zaidi, M.

    2014-01-01

    Objective: To determine the factors associated with clinically significant anastomotic leak in patients having undergone large intestinal anastomosis. Method: The retrospective study at the Aga Khan University Hospital, Karachi, comprised data between January 2000 and March 2010, related to patients who underwent colorectal anastomosis. Demographic details of the patients, as well as preop, intraop and postop risk factors were recorded. Anastomotic leak was identified as per the defined criteria. Outcome of patients was recorded as postop hospital stay and mortality. Univariate and Multivariate analyses were applied to identify risk factors for anastomotic leakage. Results: Among the total 127 patients in the study, anastomotic leak occurred in 19 (15%) patients (Group 1), while there was no clinical leak in 108 (85%) patients (Group 2). Univariate analysis showed 8 factors to be affecting the anastomotic leak: operation time (p=0.003), intraoperative blood loss (p=0.006), intraoperative blood transfusion (p=0.013), indication of surgery malignancy vs. benign (p=0.049), type of surgery elective vs. emergency (p=0.037), intraop use of vasopressor (p=0.019), segment of bowel anastomosed left side vs. right side (p=0.012), and drain placement vs. no drain placed (p=0.035). Preop immunosuppressive therapy was borderline significant (p=0.089). Multivariate analysis showed that left vs. right sided anastomosis (p=0.068), blood transfusion >2 pack cells (p=0.028), smoker vs. non-smoker (p=0.049), elective vs. emergency surgery (p=0.012) were the independent risk factors which significantly affected the outcome of bowel anastomosis. Mortality rate was 15.79% (n=3/19) in Group 1, while it was 1.85% (n=2/108) in Group 2 (p=0.02). The postop hospital stay was 15+-5.44 days in Group 1, while it was 7.51+-4.04 days in Group 2 (p>0.001). Conclusion: In colorectal anastomotic surgeries temporary diversion stoma formation needs to be considered on the basis of risk factors to

  3. Do community medicine residency trainees learn through journal club? An experience from a developing country

    Directory of Open Access Journals (Sweden)

    Kadir Muhammad

    2006-08-01

    Full Text Available Abstract Background Journal clubs are an internationally recognized teaching tool in many postgraduate medical education fields. In developing countries lack of funds for current print materials may have limited journal club use. But with advancing information technology trainees in developing countries increasingly have more access to high quality journals online. However, we are aware of no studies describing journal club existence and effectiveness in postgraduate medical training in Pakistan. Also we have found no published effectiveness studies of this teaching modality in Community Medicine (Public Health in any country. This study evaluated the effectiveness of Community Medicine (Public Health Resident Journal Club (CMR-JC in Aga Khan University, Pakistan using international criteria for successful journal clubs (2 years continuous existence and more than 50% attendance and examining resident and alumni satisfaction. Methods Journal club effectiveness criteria were searched using electronic search databases. Departmental records were reviewed from September1999–September 2005. Ninety percent of residents and alumni of Community Medicine Residency Programme participated voluntarily in a confidential survey. Results The CMR-JC was regularly conducted. More than 95% of residents attended. (Total residents in the CMR-Programme: 32. Twenty-seven out of 29 current residents/alumni responded to the anonymous questionnaire. Acquisition of critical appraisal skills (23 respondents and keeping up with current literature (18 respondents were the two most important objectives achieved. Respondents recommended improved faculty participation and incorporating a structured checklist for article review. Conclusion CMR-JC fulfils criteria for effective journal clubs. Residents and alumni agree CMR-JC meets its objectives. Incorporating suggested recommendations will further improve standards. The journal club learning modality should be included in

  4. Association of plasma leptin with coronary artery calcium (CAC) in adults

    International Nuclear Information System (INIS)

    Imran, S.; Jafri, L.; Majid, H.; Sajjad, Z.; Khan, A.H.

    2018-01-01

    To determine the correlation between leptin and CAC in scores subjects without cardiovascular disease (CVD) risk. Study Design: Cross sectional study. Place and Duration of Study: Aga Khan University Hospital, from Mar 2014 to Jun 2015. Material and Methods: Total 128 subjects were included. The study was approved by ethical review committee. After informed consent a predesigned questionnaire was documented. Subjects without known cardiac disease history, coming for non-contrast CT scan for abdominal indications were included. Leptin levels were measured by Enzyme immunoassay. CAC scores were assessed on a 64 slice non-contrast CT scan. Data analyzed by SPSS version 20. Results: Total 128 subjects were included with mean age 42.82 +- 13.1 years and 78.1% (n=100) were males. Mean BMI and waist circumference was 27.1 +- 5.4 kg/m2 and 94.8 +- 9.0cm respectively. High median leptin levels were seen in 11.7% (n=15) of study subjects. Leptin levels were also significantly higher in female compared to male [12.5ng/ml (0.3-60.9) vs. 2.5ng/ml (0.1-50); p-value=0.001]. High CAC score was present in 15% (n=19) of study subjects. Statistically significant correlation of leptin was found with waist circumference, (r 0.50; p=0.001), positive correlation with BMI (r 0.51, p<0.05) with higher levels noted in obese subjects compared to overweight and normal BMI subjects [median 7.5ng/ml (0.3-60.9) vs. 3.3ng/ml (0.1-40) and 0.1 ng/ml (0.1-0.1)]; No correlation was found between CAC score and serum leptin levels (r 0.073; p=0.41). Conclusions: Leptin levels are not correlated with CAC scores in subjects with low CVD risk. However, leptin was significantly higher in females and subjects with increased waist circumference. (author)

  5. Risk factors for deliberate self-harm in patients presenting to the emergency departments of karachi

    International Nuclear Information System (INIS)

    Shahid, M.; Iqbal, R.

    2015-01-01

    To determine the risk factors for Deliberate Self-Harm (DSH) in patients presenting to the Emergency Departments (EDs) of three tertiary care hospitals of Karachi, Pakistan. Study Design: Multicentre matched case control study. Place and Duration of Study: EDs of the Aga Khan University Hospital, Karachi, Civil Hospital, Karachi and Jinnah Postgraduate Medical Centre, Karachi, from March 2011 to February 2012. Methodology: A total of 201 cases and 201 matched controls were taken from three hospitals situated in Karachi. All patients of 16 years and above presenting to the EDs of the hospitals with DSH attempt were invited to participate in the study. Controls were ED patients with complaints other than DSH. A control was matched with case for hospital, gender and age. Two questionnaires were used to collect information on the risk factors of DSH. Conditional Logistic Regression (CLR) was used to assess the association of various risk factors with DSH. Results: Risk factors of DSH in Karachi included current history of mental disorder (OR = 4.53, 95% CI = 1.59 - 12.92), not sharing problems with someone (OR = 4.67, 95% CI = 2.4 - 9.0), living in rented houses (OR = 2.58, 95% CI = 1.37 - 4.84), Pathan ethnicity (OR = 5.05, 95% CI = 1.01-25.38) followed by others (OR = 3.88, 95% CI = 0.77 - 19.69) and Urdu speaking (OR = 2.71, 95% CI = 0.59 - 12.45). Absence of physical illness in the past month had an inverse association with DSH (OR = 0.17, 95% CI = 0.07 - 0.37). Conclusion: Mental illnesses, low socio-economic status and loneliness were the risk factors of DSH patients presenting to the three EDs of Karachi. Physical illness in the last month was protective against DSH in these patients. Psychiatric evaluation of DSH patients in the ED is important for early diagnosis and management of mental disorders. (author)

  6. Use of N-Acetylcysteine in Children with Fulminant Hepatic Failure Caused by Acute Viral Hepatitis

    International Nuclear Information System (INIS)

    Saleem, A. F.; Abbas, Q.; Haque, A.

    2015-01-01

    Objective: To determine the efficacy of N-acetylcysteine (NAC) in children aged > 1 month to 16 years admitted with Fulminant Hepatic Failure (FHF) secondary to Acute Viral Hepatitis (AVH) in a tertiary care center of a developing country. Study Design: Analytical study. Place and Duration of Study: Department of Paediatrics, The Aga Khan University Hospital, Karachi, Pakistan, from January 2007 to December 2011. Methodology: Medical records of children (> 1 month - 16 years) with FHF admitted with AVH of known etiology who received NAC were reviewed retrospectively. Liver function tests (mean ± SD) at baseline, 24 hours after NAC and before or at the time of discharge/death were recorded and compared via using repeated measures ANOVA(r-ANOVA). Efficacy of NAC is defined in improvement in biochemical markers, liver function test and discharge disposition (survived or died). Mortality associated risk factors were identified by using logistic regression analysis. P-value and 95 percentage confidence interval were recorded. Results: Forty children (mean age was 80 ± 40 months) with FHF secondary to AVH received NAC. Majority were males (n=25; 63 percentage). Vomiting (75 percentage) and jaundice (65 percentage) were the main presenting symptoms, one-third had hypoglycemic, while 40 percentage had altered sensorium at the time of admission. There was significant statistical difference in liver enzymes and prothrombin time on admission comparing at discharge in children received NAC (p < 0.001). Fifteen (38 percentage) children died. Severe vomiting (Odds Ratio (OR) 0.22, 95 percentage Confidence Interval (CI) 0.05 - 0.8), jaundice (OR 9.3, CI 1.1 - 82.6), inotropic support (OR 20.6, CI 3.5 - 118.3) and mechanical ventilation (OR 4.3, CI 1.1 - 16.6) at the time of admission are associated with risk factors for mortality in children with FHF secondary to AVH. Conclusion: NAC used in children with FHF secondary to AVH is associated with markedly improved liver function

  7. Severity of acute hepatitis and its outcome in patients with dengue fever in a tertiary care hospital Karachi, Pakistan (South Asia

    Directory of Open Access Journals (Sweden)

    Akhtar Jaweed

    2010-05-01

    Full Text Available Abstract Background Liver injury due to dengue viral infection is not uncommon. Acute liver injury is a severe complicating factor in dengue, predisposing to life-threatening hemorrhage, Disseminated Intravascular Coagulation (DIC and encephalopathy. Therefore we sought to determine the frequency of hepatitis in dengue infection and to compare the outcome (length of stay, in hospital mortality, complications between patients of Dengue who have mild/moderate (ALT 23-300 IU/L v/s severe acute hepatitis (ALT > 300 IU/L. Methods A Cohort study of inpatients with dengue viral infection done at Aga Khan University Hospital Karachi. All patients (≥ 14 yrs age admitted with diagnosis of Dengue Fever (DF, Dengue Hemorrhagic Fever (DHF or Dengue Shock Syndrome (DSS were included. Chi square test was used to compare categorical variables and fischer exact test where applicable. Survival analysis (Cox regression and log rank for primary outcome was done. Student t test was used to compare continuous variables. A p value of less than or equal to 0.05 was taken as significant. Results Six hundred and ninety nine patients were enrolled, including 87% (605 patients with DF and 13% (94 patients with DHF or DSS. Liver functions tests showed median ALT of 88.50 IU/L; IQR 43.25-188 IU/L, median AST of 174 IU/L; IQR 87-371.5 IU/L and median T.Bil of 0.8 mg/dl; IQR 0.6-1.3 mg/dl. Seventy one percent (496 had mild to moderate hepatitis and 15% (103 had severe hepatitis. Mean length of stay (LOS in patients with mild/moderate hepatitis was 3.63 days v.s 4.3 days in those with severe hepatitis (P value 0.002. Overall mortality was 33.3% (n = 6 in mild/moderate hepatitis vs 66.7% (n = 12 in severe hepatitis group (p value Conclusion Severe hepatitis (SGPT>300IU in Dengue is associated with prolonged LOS, mortality, bleeding and RF.

  8. Impact of age on outcome after colorectal cancer surgery in the elderly - a developing country perspective.

    Science.gov (United States)

    Khan, Muhammad Rizwan; Bari, Hassaan; Zafar, Syed Nabeel; Raza, Syed Ahsan

    2011-08-17

    Colorectal cancer (CRC) is a major source of morbidity and mortality in the elderly population and surgery is often the only definitive management option. The suitability of surgical candidates based on age alone has traditionally been a source of controversy. Surgical resection may be considered detrimental in the elderly solely on the basis of advanced age. Based on recent evidence suggesting that age alone is not a predictor of outcomes, Western societies are increasingly performing definitive procedures on the elderly. Such evidence is not available from our region. We aimed to determine whether age has an independent effect on complications after surgery for colorectal cancer in our population. A retrospective review of all patients who underwent surgery for pathologically confirmed colorectal cancer at Aga Khan University Hospital, Karachi between January 1999 and December 2008 was conducted. Using a cut-off of 70 years, patients were divided into two groups. Patient demographics, tumor characteristics and postoperative complications and 30-day mortality were compared. Multivariate logistic regression analysis was performed with clinically relevant variables to determine whether age had an independent and significant association with the outcome. A total of 271 files were reviewed, of which 56 belonged to elderly patients (≥ 70 years). The gender ratio was equal in both groups. Elderly patients had a significantly higher comorbidity status, Charlson score and American society of anesthesiologists (ASA) class (all p < 0.001). Upon multivariate analysis, factors associated with more complications were ASA status (95% CI = 1.30-6.25), preoperative perforation (95% CI = 1.94-48.0) and rectal tumors (95% CI = 1.21-5.34). Old age was significantly associated with systemic complications upon univariate analysis (p = 0.05), however, this association vanished upon multivariate analysis (p = 0.36). Older patients have more co-morbid conditions and higher ASA scores

  9. BRCA1 status in Pakistani breast cancer patients with moderate family history

    International Nuclear Information System (INIS)

    Moatter, T.; Pervez, S.; Khan, S.; Azam, I.

    2011-01-01

    Objective: To determine BRCA1 status in breast carcinoma patients of Pakistani origin. Study Design: Observational study. Place and Duration of Study: The Oncology Clinics of the Aga Khan University Hospital, Karachi, between May 2005 and December 2009. Methodology: Fifty three breast cancer patients based on clinical and laboratory diagnosis were recruited for this study. Moderate family history was defined as having a close relative (mother, daughter, sister) diagnosed with breast cancer under 45 years. Peripheral blood samples were collected from each patient in a 5 ml tube containing EDTA as anticoagulant. Subsequent to DNA extraction, mutational analysis of BRCA1 exons 2, 5, 6, 16, 20 and 22 was carried out using single strand conformation polymorphism (SSCP) assay while protein truncation test (PTT) was used to examine mutations in exon 11. All BRCA1 sequence variants were confirmed by DNA sequencing. Results: Twenty-three patients were diagnosed with early onset breast cancer, 30 patients had moderate family history. At the time of diagnosis, the median age of enrolled patients was 39 years (range 24-65 years). Out of 53 patients, analyzed by SSCP assay, mobility shift was detected in exon 6, 16 and 20 of three patients, whereas one patient was tested positive for mutation in exon 11 by PTT assays. All patients with BRCA1 mutations were further confirmed by DNA sequencing analysis. In exon 16 c.4837A > G was confirmed, which is a common polymorphism reported in several populations including Asians. Moreover, mutations in exon 6 (c.271T > G), exon 20 (c.5231 del G) and exon 11 (c.1123 T > G) were reported first time in the Pakistani population. Several BRCA1 mutations were observed in Pakistani breast cancer patients with moderate family history. Therefore, mutation-based genetic counselling for patients with moderate family history can facilitate management, if one first or second degree relative or early onset disease is apparent. (author)

  10. Enterocutaneous fistulae in children-a management challenge

    International Nuclear Information System (INIS)

    Amjad, A.I.; Zafar, N.

    2008-01-01

    We report a case series of seven children with EF to highlight the difficulties encountered in management in developing world. Seven patients (age ranging from 14 days to 13 years; mean 7.1 years) with EF were admitted to paediatric surgical service at the Aga Khan University Hospital (AKUH), Karachi, from January 2003 to December 2006. Patients were self-referred after an initial treatment at other healthcare facilities. Important clinical features of patients are summarized in Table 1. At presentation, 6 out of the 7 patients had fluidelectrolyte imbalance and sepsis (positive blood cultures). Initial management included correction of fluid-electrolyte imbalance and control of sepsis (drainage of intra-abdominal abscesses under CT or ultrasound guidance in four children and broadspectrum antibiotics). All patients were malnourished (weight loss >10%, low serum albumin; ranging from 1.2 to 2.3 g/dl) and received Total Parenteral Nutrition (TPN) for a mean duration of 32.5 days (ranging from 16 to 55 days). Somatostatin analogue (10 mcg/kg subcutaneously every 12 hours) was used in 2 patients, which reduced the fistula output substantially. None of the fistulae healed spontaneously. Six patients underwent surgical procedures including adhesiolysis (n=6), closure of perforation (n=3), and resection and anastomosis of small bowel (n=3). The operative time ranged from 7 to 10 hours (mean 8.8 hours) due to extensive intra-abdominal and inter-loop fibrotic adhesions. One patient died of uncontrolled sepsis (multi-drug resistant Pseudomonas aeruginosa) and liver dysfunction (total bilirubin 8.8 mg/dl) and albumin 1.2 g/dl) before surgery during the initial stabilization phase. Six patients were discharged after 23 to 93 days (mean 56 days) of hospitalization. The treatment costs ranged from PKR 325,435 to PKR 744,430 (US$ 5,388 to US$ 12,325). These figures, however, do not include the personal expenses by the family on illness before presenting to the hospital. (author)

  11. Perceptions about the cause of schizophrenia and the subsequent help seeking behavior in a Pakistani population – results of a cross-sectional survey

    Directory of Open Access Journals (Sweden)

    Yousaf Wajeeha

    2008-07-01

    Full Text Available Abstract Background There is a cultural variability around the perception of what causes the syndrome of schizophrenia. Generally patients with schizophrenia are considered dangerous. They are isolated and treatment is delayed. Studies have shown favorable prognosis with good family and social support, early diagnosis and management. Duration of untreated psychosis is a bad prognostic indicator. We aimed to determine the perceptions regarding the etiology of schizophrenia and the subsequent help seeking behavior. Methods This cross-sectional study was carried out on a sample of 404 people at the out patient departments of Aga Khan University Hospital Karachi. Data was collected via a self-administered questionnaire. Questions were related to a vignette of a young man displaying schizophrenic behavior. Data was analyzed on SPSS v 14. Results The mean age of the participants was 31.4 years (range = 18–72 and 77% of them were males. The majorities were graduates (61.9% and employed (50%. Only 30% of the participants attributed 'mental illness' as the main cause of psychotic symptoms while a large number thought of 'God's will' (32.3%, 'superstitious ideas' (33.1%, 'loneliness' (24.8% and 'unemployment' (19.3% as the main cause. Mental illness as the single most important cause was reported by only 22%. As far as management is concerned, only 40% reported psychiatric consultation to be the single most important management step. Other responses included spiritual healing (19.5% and Sociachanges (10.6 while 14.8% of respondents said that they would do nothing. Gender, age, family system and education level were significantly associated with the beliefs about the cause of schizophrenia (p Conclusion Despite majority of the study population being well educated, only a few recognized schizophrenia as a mental illness and many held superstitious beliefs. A vast majority of Pakistanis have non-biomedical beliefs about the cause of schizophrenia. Their

  12. SU-C-BRB-02: Symmetric and Asymmetric MLC Based Lung Shielding and Dose Optimization During Translating Bed TBI

    Energy Technology Data Exchange (ETDEWEB)

    Ahmed, S; Kakakhel, MB [Pakistan Institute of Engineering & Applied Sciences (PIEAS), Islamabad (Pakistan); Ahmed, SBS; Hussain, A [Aga Khan University Hospital (AKUH), Karachi (Pakistan)

    2015-06-15

    Purpose: The primary aim was to introduce a dose optimization method for translating bed total body irradiation technique that ensures lung shielding dynamically. Symmetric and asymmetric dynamic MLC apertures were employed for this purpose. Methods: The MLC aperture sizes were defined based on the radiological depth values along the divergent ray lines passing through the individual CT slices. Based on these RD values, asymmetrically shaped MLC apertures were defined every 9 mm of the phantom in superior-inferior direction. Individual MLC files were created with MATLAB™ and were imported into Eclipse™ treatment planning system for dose calculations. Lungs can be shielded to an optimum level by reducing the MLC aperture width over the lungs. The process was repeated with symmetrically shaped apertures. Results: Dose-volume histogram (DVH) analysis shows that the asymmetric MLC based technique provides better dose coverage to the body and optimum shielding of the lungs compared to symmetrically shaped beam apertures. Midline dose homogeneity is within ±3% with asymmetric MLC apertures whereas it remains within ±4.5% with symmetric ones (except head region where it drops down to −7%). The substantial over and under dosage of ±5% at tissue interfaces has been reduced to ±2% with asymmetric MLC technique. Lungs dose can be reduced to any desired limit. In this experiment lungs dose was reduced to 80% of the prescribed dose, as was desired. Conclusion: The novel asymmetric MLC based technique assures optimum shielding of OARs (e.g. lungs) and better 3-D dose homogeneity and body-dose coverage in comparison with the symmetric MLC aperture optimization. The authors acknowledge the financial and infrastructural support provided by Pakistan Institute of Engineering & Applied Sciences (PIEAS), Islamabad and Aga Khan University Hospital (AKUH), Karachi during the course of this research project. Authors have no conflict of interest with any national / international

  13. Continuation of metformin reduces early pregnancy loss in obese Pakistani women with polycystic ovarian syndrome.

    Science.gov (United States)

    Nawaz, Fauzia Haq; Rizvi, Javed

    2010-01-01

    Polycystic ovarian syndrome (PCOS) is the most common cause of anovulatory infertility worldwide. In addition to a poor conception rate, pregnancy loss rates are significantly higher (30-50%) during the first trimester in women with PCOS. Insulin resistance (IR) in this syndrome is not only implicated toward early pregnancy loss (EPL) but also pathognomic for various obstetrical complications during pregnancy. We evaluated the role of Metformin in the reduction of EPL in women with PCOS who conceived spontaneously or after induction ovulation with or without Metformin. The primary objective was to evaluate the effectiveness of Metformin in the reduction of EPL in women with PCOS. Secondary outcomes like gestational diabetes, pregnancy-induced hypertension and intrauterine growth restriction were also analyzed at the end of the study. This case-control study was conducted from March 2005 to March 2008 in the infertility and antenatal clinics of the Department of Obstetrics and Gynecology of Aga Khan University Hospital, Karachi, Pakistan. A total of 197 infertile women with PCOS were included. 'Cases' were women with PCOS who conceived while taking Metformin and it whom it was continued throughout pregnancy. 'Controls' were women in whom Metformin was either stopped in first trimester after confirmation of pregnancy (by serum betaHCG or by ultrasound) or they conceived spontaneously without the use of Metformin. All 197 women in this study had a confirmed diagnosis of PCOS (Rotterdam criteria). These women were followed till the final outcome of pregnancy was achieved. Both groups were compared for risk of EPL. It was found that continuation of Metformin during pregnancy reduces EPL, i.e. 8.8 vs. 29.4% in cases and controls, respectively (p pregnancy loss rate was 12.5% in the Metformin versus 49.4% in control group (p = 0.002). Metformin continuation during pregnancy significantly reduces EPL in women with PCOS. IR may play a significant role in EPL. Copyright 2009

  14. The Math of Khan

    Science.gov (United States)

    Schaffhauser, Dian

    2013-01-01

    It's like a dream come true for educators: free resources available wherever a web browser can operate and with nary an iota of advertising. What's not to like? What is it about this organization, whose mission is "to provide a free, world-class education for anyone anywhere," that has provoked such vitriol? Part of it is that when its videos have…

  15. N-acetylgalatosamine-Mediated Regulation of the aga Operon by AgaR in Streptococcus pneumoniae

    NARCIS (Netherlands)

    Afzal, Muhammad; Shafeeq, Sulman; Ahmed, Hifza; Kuipers, Oscar P

    2016-01-01

    Here, we analyze the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylgalactosamine (NAGa). Transcriptome comparison of S. pneumoniae D39 grown in NAGaM17 (0.5% NAGa + M17) to that grown in GM17 (0.5% Glucose + M17) revealed the elevated expression of various carbon metabolic

  16. Androgenetic alopecia: An update

    Directory of Open Access Journals (Sweden)

    Feroze Kaliyadan

    2013-01-01

    Full Text Available Androgenetic alopecia (AGA is one of the commonest reasons for dermatological consultation. Over the last few years our understanding of the pathophysiology of AGA has improved and this has paved way for better diagnostic and therapeutic options. Recent research has dwelled on the role of stem cells in the pathophysiology of AGA and has also identified newer genetic basis for the condition. Dermoscopy/trichoscopy has emerged as a useful diagnostic tool for AGA. While the major treatment options continue to be topical minoxidil, systemic Finasteride and hair transplantations, newer modalities are under investigation. Specific diagnostic and treatment recommendations have also been developed on evidence based principles. This article reviews the recent concepts in relation to AGA. With regards to the pathophysiology we have tried to stress on recent knowledge of the molecular and genetic basis of AGA. We have emphasized on an evidence based approach for treatment and diagnosis.

  17. FINASTERIDE AS A TREATMENT FOR MALE ANDROGENETIC ALOPECIA

    Directory of Open Access Journals (Sweden)

    Ni Komang Tristiana Dewi

    2013-04-01

    Full Text Available Androgenetic alopecia (AGA is a type of alopecia non sikatrik that most often occur, especially in men. AGA is hereditary baldness and form distinctive patterns. Causes related to AGA estimated serum androgen levels, especially 5-?-dehydrotestosterone (DHT, which can lead to miniaturization of the hair follicle. Finasteride is one of drugs that proven effective in treating hair loss caused by AGA. Finasteride is a 4-azasteroid components that are competitive and specific inhibitor of the enzyme 5-?-reductase type II, an enzyme that converts testosteron into intracellular DHT. By inhibiting the enzyme 5-?-reductase type II, conversion of testosteron to DHT inhibited, thereby causing a significant decrease in serum and tissue DHT concentrations. The use of finasteride 1 mg per day proven to effectively treat AGA in men.  

  18. Pramana – Journal of Physics | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Home; Journals; Pramana – Journal of Physics. AYUB KHAN. Articles written in Pramana – Journal of Physics. Volume 88 Issue 3 March 2017 pp 47 Research Article. Multiswitching combination–combination synchronization of chaotic systems · AYUB KHAN DINESH KHATTAR NITISH PRAJAPATI · More Details Abstract ...

  19. Blood Plasma-Derived Anti-Glycan Antibodies to Sialylated and Sulfated Glycans Identify Ovarian Cancer Patients.

    Science.gov (United States)

    Pochechueva, Tatiana; Chinarev, Alexander; Schoetzau, Andreas; Fedier, André; Bovin, Nicolai V; Hacker, Neville F; Jacob, Francis; Heinzelmann-Schwarz, Viola

    2016-01-01

    Altered levels of naturally occurring anti-glycan antibodies (AGA) circulating in human blood plasma are found in different pathologies including cancer. Here the levels of AGA directed against 22 negatively charged (sialylated and sulfated) glycans were assessed in high-grade serous ovarian cancer (HGSOC, n = 22) patients and benign controls (n = 31) using our previously developed suspension glycan array (SGA). Specifically, the ability of AGA to differentiate between controls and HGSOC, the most common and aggressive type of ovarian cancer with a poor outcome was determined. Results were compared to CA125, the commonly used ovarian cancer biomarker. AGA to seven glycans that significantly (P<0.05) differentiated between HGSOC and control were identified: AGA to top candidates SiaTn and 6-OSulfo-TF (both IgM) differentiated comparably to CA125. The area under the curve (AUC) of a panel of AGA to 5 glycans (SiaTn, 6-OSulfo-TF, 6-OSulfo-LN, SiaLea, and GM2) (0.878) was comparable to CA125 (0.864), but it markedly increased (0.985) when combined with CA125. AGA to SiaTn and 6-OSulfo-TF were also valuable predictors for HGSOC when CA125 values appeared inconclusive, i.e. were below a certain threshold. AGA-glycan binding was in some cases isotype-dependent and sensitive to glycosidic linkage switch (α2-6 vs. α2-3), to sialylation, and to sulfation of the glycans. In conclusion, plasma-derived AGA to sialylated and sulfated glycans including SiaTn and 6-OSulfo-TF detected by SGA present a valuable alternative to CA125 for differentiating controls from HGSOC patients and for predicting the likelihood of HGSOC, and may be potential HGSOC tumor markers.

  20. Golden Horde History in the Works of A.N. Kurat

    Directory of Open Access Journals (Sweden)

    I.М. Mirgaleev

    2014-07-01

    Full Text Available The article examines main works of the famous Turkish historian A.N. Kurat, his views and assessments of the Golden Horde history. It is known that A.N. Kurat introduced into scholarly circulation yarlyks-letters of the Golden Horde khans, which he found in the archives of the Topkapi Palace in Istanbul. A number of his works and articles are devoted to the Golden Horde and its rulers. The article discusses the works of A.N. Kurat that are dedicated to the Golden Horde, as well as his main ideas, sources of the author. The works of A.N. Kurat still have not lost their significance. His works on the Golden Horde topics are mainly devoted to the source study, his reconstruction of events is based on primary sources of the Golden Horde origin. Kurat also noted the special importance of his own sources. In his works, he explored the following three Golden Horde documents: Bitik of Ulugh Muhammad Murad II, letter of Mahmud Khan bin Muhammad Khan bin Timur Khan to Fatih Sultan Mehmed, and letter of Ahmad Khan ibn Muhammad ibn Timur Khan to Fatih Sultan Mehmed. Kurat studied yarlyks and bitiks at a high scholarly level of source studies. They still are the basis for the study of the Golden Horde documents. Thanks to the good knowledge of the Ottoman, Russian, European sources, and historiography A.N. Kurat analyzed in detail the political situation in the Golden Horde; especially valuable are his works on the 15th century. His works on the period of Ulug Muhammad are still among the most important works devoted to this outstanding personage of the late Golden Horde. In his works Kurat asked himself: why the Golden Horde disintegrated? In search of answers to this question he put to the first place the confrontation between Tokhtamysh Khan and Timur Aksak. His conclusions about relationship between the Golden Horde and the Ottoman Empire are confirmed by the latest works on this topic.

  1. Rõve kuubis, aga... / Tiit Tuumalu

    Index Scriptorium Estoniae

    Tuumalu, Tiit, 1971-

    2006-01-01

    Dokumentaalfilm "Aristokraadid", kus ühte roppu habemega anekdooti jutustavad meelelahutustööstusest tuntud tegijad : režissöör Paul Provenza : Ameerika Ühendriigid 2006. Filmi näitab Tallinna Kinomaja

  2. Usalda, aga kontrolli / Manuela Pihlap

    Index Scriptorium Estoniae

    Pihlap, Manuela

    2008-01-01

    Uuest isikuandmete kaitse seadusest. Ilmunud ka Harju Ekspress 22. veeb. 2008, lk. 6 ; Meie Maa 26. veeb. 2008, lk. 2 ; Pärnu Postimees 28. veeb. 2008, lk. 15 ; LõunaLeht 28. veeb. 2008, lk. 4 ; Valgamaalane 28. veeb. 2008, lk. 2

  3. Changes in the sebaceous gland in patients with male pattern hair loss (androgenic alopecia).

    Science.gov (United States)

    Kure, Katsuhiro; Isago, Tsukasa; Hirayama, Takeshi

    2015-09-01

    The sebaceous gland and the follicular bulge region have important role in biology of the hair. They initiate destruction of the hair follicle both in human and animal models in certain conditions. The morphometric feature of the sebaceous gland is not well understood so as the distribution of the bulge stem cells in pathological conditions of male pattern hair loss or androgenic alopecia (AGA). The authors perform morphometric analysis of the sebaceous gland in AGA patients and also study distribution of the follicular stem cells in the bulge region in these populations. Two hundred and fifty cases of glass slide specimen from Japanese patients with male pattern hair loss were reviewed. Among these, 23 cases of the longitudinal (vertical) sections of the scalp skin with diagnosis of AGA were found and analyzed for the morphometric characteristics. Each sebaceous gland area was measured using NIH imagej system and statistically analyzed. For the identification of the follicular bulge region, an immunohistochemistry using anticytokeratin 15 (C8/144B clone) was carried out in the cases of AGA. The sebaceous gland area of the AGA group was noticeably increased, while the size of each sebaceous gland remains unchanged. It has more lobules in the hair follicular unit in the AGA population. In the immunohistochemistry, the follicular stem cells are present in the bulge regions in cases of AGA. The overgrowth (multilobulation) of the sebaceous gland and relative preservation of the follicular stem cells suggest that the changes in the sebaceous gland could be an important factor in the pathology of AGA. © 2015 Wiley Periodicals, Inc.

  4. Bulletin of Materials Science | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    G MURTAZA MAZHAR ULLAH NAEEM ULLAH MALIKA RANI M MUZAMMIL R KHENATA SHAHID M RAMAY UMAIR KHAN · More Details Abstract ... I HATRAF O MERABIHA T SEDDIK H BALTACHE R KHENATA R AHMED SALEEM A KHAN A BOUHEMADOU SIKANDER AZAM S BIN OMRAN · More Details Abstract ...

  5. Тіе Modern treatment of androgenetic alopecia

    Directory of Open Access Journals (Sweden)

    V. K. Karnaukhov

    2017-01-01

    Full Text Available Androgenetic alopecia (AGA is the most common reason for hair loss. Its frequency in Caucasian population is up to 80% in men and 42% in women. Current gold standard for AGA treatment includes minoxidil and/or finasteride. Both drugs have moderate treatment efficacy and can cause significant side effects. Minoxidil is the only option for treatment of AGA in women since finasteride has no efficacy. This review considers actual concepts of molecular mechanisms of pathogenesis and current treatment options of AGA with their limitations and shortcomings. Current state and perspectives of novel approaches to AGA treatment, potentially more effective and safe than minoxidil and finasteride, are described. The review discusses growth factors and cytokines, topical 5-alpha-reductase inhibitors, androgen receptor antagonists, prostaglandin analogs and antagonists, Wnt signaling activators and platelet-rich plasma injections.

  6. Genetic variants at 20p11 confer risk to androgenetic alopecia in the Chinese Han population.

    Directory of Open Access Journals (Sweden)

    Bo Liang

    Full Text Available BACKGROUND: Androgenetic alopecia (AGA is a well-characterized type of progressive hair loss commonly seen in men, with different prevalences in different ethnic populations. It is generally considered to be a polygenic heritable trait. Several susceptibility genes/loci, such as AR/EDA2R, HDAC9 and 20p11, have been identified as being involved in its development in European populations. In this study, we aim to validate whether these loci are also associated with AGA in the Chinese Han population. METHODS: We genotyped 16 previously reported single nucleotide polymorphisms (SNPs with 445 AGA cases and 546 healthy controls using the Sequenom iPlex platform. The trend test was used to evaluate the association between these loci and AGA in the Chinese Han population. Conservatively accounting for multiple testing by the Bonferroni correction, the threshold for statistical significance was P ≤ 3.13 × 10(-3. RESULTS: We identified that 5 SNPs at 20p11 were significantly associated with AGA in the Chinese Han population (1.84 × 10(-11 ≤ P ≤ 2.10 × 10(-6. CONCLUSIONS: This study validated, for the first time, that 20p11 also confers risk for AGA in the Chinese Han population and implicated the potential common genetic factors for AGA shared by both Chinese and European populations.

  7. Understanding unintentional childhood home injuries: pilot surveillance data from Karachi, Pakistan.

    Science.gov (United States)

    Zia, Nukhba; Khan, Uzma R; Razzak, Junaid A; Puvanachandra, Prasanthi; Hyder, Adnan A

    2012-01-19

    Childhood injuries, an important public health issue, globally affects more than 95% of children living in low-and middle-income countries. The objective of this study is to describe the epidemiology of childhood unintentional injuries in Karachi, Pakistan with a specific focus on those occurring within the home environment. This was a secondary analysis of a childhood unintentional injury surveillance database setup in the emergency department of the Aga Khan Hospital, Karachi, Pakistan for 3 months. The data was collected by interviewing caretakers of children under 12 years of age presenting with an unintentional injury to the emergency departments of the four major tertiary care hospitals of Karachi, Pakistan. The surveillance included 566 injured children of which 409 (72%) injuries had taken place at/around home. Of 409 children, 66% were males and mostly between 5 and 11 years of age. Injuries commonly occurred during play time (51%). Fall (59%), dog bites (11%) and burns (9%) were the commonest mechanisms of injury. The majority of the children (78%) were directly discharged from the emergency room with predicted short term disability (42%). There were 2 deaths in the emergency department both due to falls. Childhood injury surveillance system provides valuable in-depth information on child injuries. The majority of these unintentional childhood injuries occur at home; with falls, dog bites and burns being the most common types of unintentional childhood home injuries. Specific surveillance systems for child injuries can provide new and valuable information for countries like Pakistan.

  8. Damage by insect pests to the Djingarey Ber Mosque in Timbuktu: detection and control

    Directory of Open Access Journals (Sweden)

    Lara Maistrello

    2011-08-01

    Full Text Available The Djingarey Ber Mosque in Timbuktu (Mali is one of the most significant earthen construction in West Africa. Originally constructed in 1327, it was included in 1988 on the World Heritage UNESCO List for its unique architecture and historical importance. During its restoration, recently undertaken by the Aga Khan Trust for Culture, the wooden parts of the roof and architraves showed clear signs of threatening insect presence. In order to identify the pests responsible of the damage, evaluate its extent and suggest a proper control strategy, a detailed survey was performed inside the Mosque complex and in its immediate surroundings. The entomological inspection, performed in the dry-cold season, allowed to detect signs of insect damage in most of the wooden elements, even in the recently replaced beams, but also in walls, pillars and the precious decorated panels. Damages in the wood elements could be attributed to Amitermes evuncifer Silvestri (Termitidae, Bostrychoplites zycheli Marseuli (Bostrichidae and Lyctus africanus Lesne (Lyctidae, which were collected alive on site. Injures in the walls and decorated panels appeared to be performed by hymenopterans such as “plasterer bees” (Colletidae and Sphecidae. From the evaluation of the type and extent of damage in relation to the architecture and materials used in its construction and decoration, the most serious pest and the worse threat for the mosque is represented by termites. Control and preventive measures, in the view of a sustainable, long-lasting integrated management are suggested.

  9. Browse Title Index

    African Journals Online (AJOL)

    Items 9851 - 9900 of 11090 ... Vol 10, No 39 (2011), Studies on Buddleja asiatica antibacterial, antifungal, antispasmodic and Ca++ antagonist activities, Abstract PDF. F Ali, I Ali, HU Khan, AU Khan, AH Gilani. Vol 9, No 22 (2010), Studies on Meloidogyne javanica infestation on roma tomato (Lycopersicon esculentum Mill) ...

  10. Z. ASTAL

    African Journals Online (AJOL)

    6(20C3) 9- 14. The Inhibitory Action of Aqueous Garlic Extract -oh the Growth of Certain Pathogenic Bacteria. Z. ASTAL. Khan Younis Hospital Laboratory, Khan Younis, Gaza-Palestinian Authority. This work reports the antibacterial effect of aqueous garlic (Allium sativum) extract on certain pathogenic Gram positive bacteria ...

  11. Resonance – Journal of Science Education | Indian Academy of ...

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education. Yasmin Khan. Articles written in Resonance – Journal of Science Education. Volume 7 Issue 1 January 2002 pp 4-10 Series Article. Glial Cells: The Other Cells of the Nervous System - An Introduction to Glial Cells · Medha S Rajadhyaksha Yasmin Khan.

  12. Ghrelin and obestatin plasma levels and ghrelin/obestatin prepropeptide gene polymorphisms in small for gestational age infants.

    Science.gov (United States)

    Zhang, Shulian; Zhai, Guanpeng; Zhang, Jinping; Zhou, Jianguo; Chen, Chao

    2014-12-01

    To investigate plasma ghrelin and obestatin levels, and ghrelin/obestatin prepropeptide gene polymorphisms, in sequentially enrolled small for gestational age (SGA) infants. Neonates were sequentially enrolled into this study and were then subdivided into different groups, according to different study aims and availability of study materials. Consequently, plasma ghrelin and obestatin levels were measured in term SGA, term appropriate for gestational age (AGA), term large for gestational age (LGA), preterm SGA and preterm AGA neonates. Levels of both peptides were also measured in AGA infants of different gestational ages, and in term AGA neonates at different days following birth. Three ghrelin/obestatin prepropeptide gene single nucleotide polymorphisms (SNPs), Arg51Gln, Leu72Met, and Gln90Leu, were measured in neonates. The study involved a total cohort of 581 neonates. Out of 150 neonates (30 term AGA, 30 term SGA, 30 term LGA, 30 preterm AGA, and 30 preterm SGA), plasma obestatin levels were significantly higher in term SGA versus term LGA neonates (0.21 ± 0.02 ng/ml versus 0.17 ± 0.01 ng/ml, respectively). Out of a wider cohort, there were no significant differences in genotypes and allele frequencies of Arg51Gln, Leu72Met, and Gln90Leu SNPs between term SGA and AGA neonates, or between preterm SGA and AGA neonates. Ghrelin/obestatin prepropeptide polymorphisms were not found to be associated with SGA status in neonates; however, ghrelin and obestatin levels may be involved in growth and development. Further studies are required to understand the relationship between ghrelin, obestatin and prenatal development. © The Author(s) 2014 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav.

  13. Development of silver impregnated alumina for iodine separation from off-gas streams

    Energy Technology Data Exchange (ETDEWEB)

    Funabashi, Kiyomi; Fukasawa, Tetsuo; Kikuchi, Makoto [Energy Research Laboratory, Hitachi (Japan)] [and others

    1995-02-01

    An inorganic iodine adsorbent, silver impregnated alumina (AgA), has been developed to separate iodine effectively from off-gas streams of nuclear facilities and to decrease the volume of waste (spent adsorbent). Iodine removal efficiency was improved at relatively high humidity by using alumina carrier with two different pore diameters. Waste volume reduction was achieved by impregnating relatively large amounts of silver into the alumina pores. The developed adsorbent was tested first with simulated off-gas streams under various experimental conditions and finally with actual off-gas streams of the Karlsruhe reprocessing plant. The decontamination factor (DF) was about 100 with the AgA bed depth of 2cm at 70% relative humidity, which was a DF one order higher than that when AgA with one pore size was used. Iodine adsorption capacity was checked by passing excess iodine into the AgA bed. Values were about 0.12 and 0.35 g-I/cm`-AgA bed for 10 and 24wt% silver impregnated AgA, respectively. The results obtained in this study demonstrated the applicability of the developed AgA to the off-gas treatment system of nuclear facilities.

  14. A Comparison of Hybrid Approaches for Turbofan Engine Gas Path Fault Diagnosis

    Science.gov (United States)

    Lu, Feng; Wang, Yafan; Huang, Jinquan; Wang, Qihang

    2016-09-01

    A hybrid diagnostic method utilizing Extended Kalman Filter (EKF) and Adaptive Genetic Algorithm (AGA) is presented for performance degradation estimation and sensor anomaly detection of turbofan engine. The EKF is used to estimate engine component performance degradation for gas path fault diagnosis. The AGA is introduced in the integrated architecture and applied for sensor bias detection. The contributions of this work are the comparisons of Kalman Filters (KF)-AGA algorithms and Neural Networks (NN)-AGA algorithms with a unified framework for gas path fault diagnosis. The NN needs to be trained off-line with a large number of prior fault mode data. When new fault mode occurs, estimation accuracy by the NN evidently decreases. However, the application of the Linearized Kalman Filter (LKF) and EKF will not be restricted in such case. The crossover factor and the mutation factor are adapted to the fitness function at each generation in the AGA, and it consumes less time to search for the optimal sensor bias value compared to the Genetic Algorithm (GA). In a word, we conclude that the hybrid EKF-AGA algorithm is the best choice for gas path fault diagnosis of turbofan engine among the algorithms discussed.

  15. Russian Chronicles on the Religious Policy of Uzbek Khan (1313–1341 and His Relations with the Principalities of the North-Eastern Rus’.

    Directory of Open Access Journals (Sweden)

    Hautala R.

    2017-12-01

    Full Text Available Research objectives: The author of present article examines the overall response of Russian medieval scribes to the ascension to power of Uzbek Khan – the Golden Horde’s Muslim ruler who made a major effort to spread Islam in the Jochid Empire. Analyzing Russian sources, the author tries to answer the question regarding to what extent we can trust the reliability of their information about the impact of Uzbek’s religious affiliation on the anticipated change in his relations with the Russian principalities. Research materials: Russian sources are of paramount importance for the study of the Golden Horde’s history. On the one hand, Russian chronicles contain a wealth of relevant factual material. The abundance of this material can be explained by the fact that medieval Rus’ was subordinated to the Golden Horde, although its numerous and disjointed princes enjoyed considerable autonomy within the Jochid Empire. On the other hand, the accuracy of Russian chronicles’ information should not be overestimated for several reasons. The preserved chronicle collections were often composed several centuries after the described events. Therefore, their information underwent the influence of significant ideological changes. In addition, the authors of Russian chronicles focused on the description of only those events that were directly related to the Russian principalities and their rulers. The novelty of this study emerges from a comparison of the Russian chronicles’ content with information found in little-known written sources. In particular, Latin sources compiled within the ulus of Jochi in a relatively large amount exactly during the period under study compensate to some extent for the complete absence of Jochid written sources. In this case, the content of the Latin sources will allow us to reconsider the established opinion about the total Islamization of the ulus of Jochi during Uzbek’s reign. Research results: The use of

  16. Serum androgens and prostate-specific antigen levels in androgenetic alopecia: is there a difference between frontal and vertex baldness?

    Science.gov (United States)

    Lis-Święty, A; Arasiewicz, H; Ranosz-Janicka, I; Brzezińska-Wcisło, L

    2017-12-13

    Androgenetic alopecia (AGA) seems to be a marker of increased risk of prostate cancer (PCa). We sought to investigate potential pathophysiological differences between frontal and vertex balding that might have the impact on the incidence of PCa. Serum concentrations of testosterone (T), dihydrotestosterone (DHT) and prostate-specific antigen (PSA) were measured in 88 subjects with AGA. We have examined sixty patients with frontal baldness and 28 patients with vertex baldness. The subgroups did not differ significantly in age, BMI and as regards age of AGA onset, duration of AGA and comorbidities. The mean value of DHT in serum of the men with vertex baldness was higher than those in the men with frontal baldness with statistical significance (P baldness may signal higher exposures to circulating DHT. Serum PSA level cannot serve as surrogate diagnostic marker of increased androgenic activity in men with AGA. © 2017 European Academy of Dermatology and Venereology.

  17. Role of magnetic resonance planimetry and magnetic resonance parkinsonism index in discriminating Parkinson’s disease and progressive supranuclear palsy: a retrospective study based on 1.5 and 3 T MRI

    Directory of Open Access Journals (Sweden)

    Nizamani WM

    2017-10-01

    Full Text Available Waseem Mehmood Nizamani,1 Fatima Mubarak,1 Muhammad Danish Barakzai,1 Muhammad Saad Ahmed2 1Department of Radiology, Aga Khan University Hospital, Karachi, Pakistan, 2Department of Radiology, Ziauddin University Hospital, Karachi, Pakistan Objective: The objective of the study was to assess magnetic resonance (MR planimetric measurements and MR parkinsonism index (MRPI in differentiating progressive supranuclear palsy (PSP from Parkinson’s disease (PD using 1.5 and 3 T MRI scanner. Subjects and methods: After ethical approval was obtained, analysis of 34 consecutive patients with PSP, 34 patients with PD and 34 healthy controls (HCs was performed. HCs were age-matched adults without any history of neurodegenerative disease or movement disorders. Retrospective data from the past 10 years (from January 2006 to December 2015 were obtained from the Hospital Information Management System, and informed consent was obtained from all participants. The measurements of pons area–midbrain area ratio (P/M and MCP width–superior cerebellar peduncle (SCP width ratio (MCP/SCP were used, and MRPI was calculated by the formula ([P/M]×[MCP/SCP]. Results: Midbrain area and SCP width in patients with PSP (19 males, 15 females; mean age =66.7 years were significantly (P<0.001 smaller than in patients with PD (20 males, 14 females; mean age =66.7 years and control participants (17 males, 17 females; mean age =66.1 years. P/M and MCP/SCP were significantly higher in patients with PSP than in patients with PD and control participants. All measurements showed some overlap of values between patients with PSP and patients from PD group and control participants. MRPI value was significantly higher in patients with PSP (mean 21.00 than in patients with PD (mean 9.50; P<0.001 and control participants (mean 9.6; P<0.001, without any overlap of values among groups. No correlation was found between the duration of disease, PSP rating scale, PSP staging system and MRPI in

  18. Virological and clinical characteristics of hepatitis delta virus in South Asia

    Directory of Open Access Journals (Sweden)

    Moatter Tariq

    2011-06-01

    Full Text Available Abstract Background & Aims There is a paucity of data on the impact of hepatitis D virus (HDV in patients with hepatitis B virus (HBV infection from South Asia. We studied the impact of HDV co-infection on virological and clinical characteristics. Methods We collected data of 480 patients with HBsAg positive and a detectable HBV DNA PCR, who presented to the Aga Khan University, Karachi and Isra University in Hyderabad, Pakistan in the last 5 years. HDV co-infection was diagnosed on the basis of anti-HDV. ALT, HBeAg, HBeAb and HBV DNA PCR quantitative levels were checked in all patients. We divided all patients into two groups based on anti-HDV, and compared their biochemical, serological & virological labs and clinical spectrum. Clinical spectrum of disease included asymptomatic carrier (AC, chronic active hepatitis (CAH, immuno-tolerant phase (IP, and compensated cirrhosis (CC. Results HDV co-infection was found in 169 (35.2%. There were 164 (34.6% HBeAg positive and 316 (65.4% HBeAg negative patients. Mean ALT level was 66 ± 73 IU. 233 (48.5% had raised ALT. HBV DNA level was ≥ 10e5 in 103(21.5% patients. Overall, among HBV/HDV co-infection, 146/169 (86.4% had suppressed HBV DNA PCR as compared to 231/311 (74.3% patients with HBV mono-infection; p-value = 0.002. Among HBeAg negative patients 71/128(55.5% had raised ALT levels among HBV/HDV co-infection as compared to 71/188 (37.8% with HBV mono-infection (p-value = 0.002; levels of HBV DNA were equal in two groups; there were 27/128 (21% patients with CC among HBV/HDV co-infection as compared to 23 (12% in HBV mono-infection (p-value = 0.009; there were less AC (p-value = 0.009 and more CAH (p-value = 0.009 among HBV/HDV co-infection patients. Among HBeAg positive patients, serum ALT, HBV DNA levels and the spectrum of HBV were similar in the two groups. Conclusions HBV/HDV co-infection results in the suppression of HBV DNA. A fair proportion of HBV/HDV co-infected patients with HBe

  19. Geometry correction Algorithm for UAV Remote Sensing Image Based on Improved Neural Network

    Science.gov (United States)

    Liu, Ruian; Liu, Nan; Zeng, Beibei; Chen, Tingting; Yin, Ninghao

    2018-03-01

    Aiming at the disadvantage of current geometry correction algorithm for UAV remote sensing image, a new algorithm is proposed. Adaptive genetic algorithm (AGA) and RBF neural network are introduced into this algorithm. And combined with the geometry correction principle for UAV remote sensing image, the algorithm and solving steps of AGA-RBF are presented in order to realize geometry correction for UAV remote sensing. The correction accuracy and operational efficiency is improved through optimizing the structure and connection weight of RBF neural network separately with AGA and LMS algorithm. Finally, experiments show that AGA-RBF algorithm has the advantages of high correction accuracy, high running rate and strong generalization ability.

  20. Endothelial progenitor cells in mothers of low-birthweight infants: a link between defective placental vascularization and increased cardiovascular risk?

    Science.gov (United States)

    King, Thomas F J; Bergin, David A; Kent, Etaoin M; Manning, Fiona; Reeves, Emer P; Dicker, Patrick; McElvaney, Noel G; Sreenan, Seamus; Malone, Fergal D; McDermott, John H

    2013-01-01

    Offspring birthweight is inversely associated with future maternal cardiovascular mortality, a relationship that has yet to be fully elucidated. Endothelial progenitor cells (EPCs) are thought to play a key role in vasculogenesis, and EPC numbers reflect cardiovascular risk. Our objective was to ascertain whether EPC number or function was reduced in mothers of low-birthweight infants. This was a prospective cohort study in a general antenatal department of a university maternity hospital. Twenty-three mothers of small for gestational age (SGA) infants (birthweight mothers of appropriate for gestational age (AGA) infants (birthweight ≥ 10th centile) were recruited. Maternal EPC number and function, conventional cardiovascular risk markers, and cord blood adiponectin were measured. Median EPC count was lower (294 vs. 367, P = 0.005) and EPC migration was reduced (0.91 vs. 1.59, P < 0.001) in SGA compared with AGA infants, with no difference in EPC adhesion (0.221 vs. 0.284 fluorescence units, P = 0.257). Maternal triglyceride levels were higher in SGA than AGA infants (0.98 vs. 0.78 mmol/liter, P = 0.006), but there was no difference in cholesterol, glucose, insulin, glycosylated hemoglobin, adiponectin, or blood pressure. There was a moderate monotone (increasing) relationship between birthweight and umbilical cord blood adiponectin (r = 0.475, P = 0.005). Giving birth to an SGA infant was associated with lower maternal EPC number and reduced migratory function. Cord blood adiponectin was significantly correlated with birthweight.

  1. Androgenic alopecia and dutasteride in hair mesotherapy: A short review

    Directory of Open Access Journals (Sweden)

    Estela B Busanello

    2018-02-01

    Full Text Available Androgenic alopecia (AGA is the most common cause of patterned hair loss in predisposed men and women. AGA is a multifactorial and polygenetic condition, affecting up to 80% of men and 40-50% of women during life. AGA is characterized by a gradual reduction of the anagen and increase in telagen phase, leading to a progressive follicle miniaturization. As a consequence, terminal hairs are converted into vellus hairs decreasing hair density. The pathophysiology of AGA is heterogeneous and highly complex. A diverse combination of genetical factors, endocrine abnormalities, circulating androgens, drugs, diet and microinflammation in hair follicles of each individual are related to this condition. However, it is well known that androgens are the major modulators of male AGA but their specific action on female AGA is still under debate. Circulating testosterone is converted by 5a-reductase in 5a-dihydrotestosterone (DHT in the periphery, a decrease of anagen phase occur, anticipating catagen phase in a complex process involving apoptosis as probably microinflammation. In AGA treatment, mesotherapy is being used with 5a-reductase inhibitors, especially dutasteride, injected directly on scalp. Thus, this updated review summarized the injectable use of dutasteride based on data available on PubMed until March 2017. Dutasteride, a second-generation inhibitor of 5a-reductase is more potent than finasteride due to the capability of inhibit types 1 and 2 of the enzyme. The efficacy and safety of hair mesotherapy with dutasteride were reported by distinct groups and the best results were achieved when this compound was used in combination with other substances, increasing hair growth. This result could be explained by the multifactorial pathophysiology of AGA, involving hair follicle sensitivity to DHT and microinflammation. Therefore, a multi-therapeutic approach seems to be more effective in AGA management. In conclusion, more studies are needed to

  2. Association of asthma therapy and Churg-Strauss syndrome: an analysis of postmarketing surveillance data.

    Science.gov (United States)

    DuMouchel, William; Smith, Eric T; Beasley, Richard; Nelson, Harold; Yang, Xionghu; Fram, David; Almenoff, June S

    2004-07-01

    Churg-Strauss syndrome (CSS), also known as allergic granulomatous angiitis (AGA), is a rare vasculitis that occurs in patients with bronchial asthma. The nature of the association of CSS with various asthma therapies is unclear. This study investigated the associations of different multidrug asthma therapy regimens and the reporting of AGA (the preferred code for CSS in the coding dictionary for the Adverse Event Reporting System [AERS]) by applying an iterative method of disproportionally analysis to th AERS database maintained by the US Food and Drug Administration. The public-release version of the AERS database was used to identify reports of AGA in patients receiving asthma therapy. Reporting of AGA was examined using iterative disproportionality methods in patients receiving > or =1 of the following drug classes: inhaled corticosteroid (ICS), leukotriene receptor antagonist (LTRA), short-acting beta(2)-agonist (SABA), or long-acting beta(2)-agonist (LABA). The Bayesian data-mining algorithm known as the multi-item gamma poisson shrinker was used to determine the relative reporting rates by calculation of the empirical Bayes geometric mean (EBGM) and its 90% CI (EB05 = lower limit and EB95 = upper limit) for each drug. Subset analyses were performed for each drug with different medication combinations to differentiate the relative reporting of AGA for each. A strong association was found between LTRA use and AGA (EBGM = 104.0, EB05 = 95.0, EB95 = 113.8) that persisted with all combinations of therapy studied. AGA was also associated with the ICS, SABA and LABA classes (EBGM values of 27.8, 14.6 and 40.4, respectively). However, the latter associations were mostly dependent on the presence of concurrent LTRA and, to a lesser extemt, oral corticosteroid therapy and became negligible (ie, EB05 < 2) for patients who were not receiving these concurrent treatments. Differences based on relative reporting were observed in the patterns of association of AGA with LTRA

  3. A comparison of the metabolism of the abortifacient compounds from Ponderosa pine needles in conditioned versus naive cattle.

    Science.gov (United States)

    Welch, K D; Gardner, D R; Pfister, J A; Panter, K E; Zieglar, J; Hall, J O

    2012-12-01

    Isocupressic acid (ICA) is the abortifacient compound in ponderosa pine (Pinus ponderosa L.) needles, which can cause late-term abortions in cattle (Bos taurus). However, cattle rapidly metabolize ICA to agathic acid (AGA) and subsequent metabolites. When pine needles are dosed orally to cattle, no ICA is detected in their serum, whereas AGA is readily detected. Recent research has demonstrated that AGA is also an abortifacient compound in cattle. The observation has been made that when cattle are dosed with labdane acids for an extended time, the concentration of AGA in serum increases for 1 to 2 d but then decreases to baseline after 5 to 6 d even though they are still being dosed twice daily. Therefore, in this study we investigated whether cattle conditioned to pine needles metabolize ICA, and its metabolites, faster than naïve cattle. Agathic acid was readily detected in the serum of naïve cattle fed ponderosa pine needles, whereas very little AGA was detected in the serum of cattle conditioned to pine needles. We also compared the metabolism of ICA in vitro using rumen cultures from pine-needle-conditioned and naïve cattle. In the rumen cultures from conditioned cattle, AGA concentrations were dramatically less than rumen cultures from naïve cattle. Thus, an adaptation occurs to cattle conditioned to pine needles such that the metabolism AGA by the rumen microflora is altered.

  4. Study of gene expression alteration in male androgenetic alopecia: evidence of predominant molecular signalling pathways.

    Science.gov (United States)

    Michel, L; Reygagne, P; Benech, P; Jean-Louis, F; Scalvino, S; Ly Ka So, S; Hamidou, Z; Bianovici, S; Pouch, J; Ducos, B; Bonnet, M; Bensussan, A; Patatian, A; Lati, E; Wdzieczak-Bakala, J; Choulot, J-C; Loing, E; Hocquaux, M

    2017-11-01

    Male androgenetic alopecia (AGA) is the most common form of hair loss in men. It is characterized by a distinct pattern of progressive hair loss starting from the frontal area and the vertex of the scalp. Although several genetic risk loci have been identified, relevant genes for AGA remain to be defined. To identify biomarkers associated with AGA. Molecular biomarkers associated with premature AGA were identified through gene expression analysis using cDNA generated from scalp vertex biopsies of hairless or bald men with premature AGA, and healthy volunteers. This monocentric study reveals that genes encoding mast cell granule enzymes, inflammatory mediators and immunoglobulin-associated immune mediators were significantly overexpressed in AGA. In contrast, underexpressed genes appear to be associated with the Wnt/β-catenin and bone morphogenic protein/transforming growth factor-β signalling pathways. Although involvement of these pathways in hair follicle regeneration is well described, functional interpretation of the transcriptomic data highlights different events that account for their inhibition. In particular, one of these events depends on the dysregulated expression of proopiomelanocortin, as confirmed by polymerase chain reaction and immunohistochemistry. In addition, lower expression of CYP27B1 in patients with AGA supports the notion that changes in vitamin D metabolism contributes to hair loss. This study provides compelling evidence for distinct molecular events contributing to alopecia that may pave the way for new therapeutic approaches. © 2017 British Association of Dermatologists.

  5. The analysis of Rostam’s personality in “Seven Khan” story based on the views of Jung and Freud

    Directory of Open Access Journals (Sweden)

    Mirjalaladin Kazazi

    2016-12-01

    Haft Khan is, in fact, Rostam’s battle of existential ego with different aspects and negative shades and Anima, to achieve being and perfection. Thus, to enter into his unconsciousness arena, he is forced to get away from the secular world and his conscious entity to the ego and from there to the superego. Obviously after every Khan (In fact, after leaving behind a test in the discharge of their belonging and demonic forces, Rostam returned to the entity and self-aware state again. And again before entering the next Khan, by providing the necessary conditions, he gradually leaves the entity and takes a step toward the superego and the coming test.

  6. University Internationalization and University Autonomy

    DEFF Research Database (Denmark)

    Turcan, Romeo V.; Gulieva, Valeria

    2016-01-01

    Turcan and Gulieva deepen our theoretical understanding of the process of university internationalisation by exploring the relationship between university internationalisation and university autonomy. They conjecture that the process of university internationalisation and its sustainability are d......, dissimilar, and sometimes conflicting dimensions of the financial, legal, organisational, staffing, and academic autonomy of the host country, are compromising key aspects of their own autonomy and core mission?......Turcan and Gulieva deepen our theoretical understanding of the process of university internationalisation by exploring the relationship between university internationalisation and university autonomy. They conjecture that the process of university internationalisation and its sustainability...... are determined by the structure and exercise of university autonomy settings at home and in the host countries, and that the process itself cannot be successfully achieved and maintained without changes in the autonomy settings. The key question the authors ask is to what degree universities, in embracing new...

  7. Just in Time to Flip Your Classroom

    Science.gov (United States)

    Lasry, Nathaniel; Dugdale, Michael; Charles, Elizabeth

    2014-01-01

    With advocates like Sal Khan and Bill Gates, flipped classrooms are attracting an increasing amount of media and research attention. We had heard Khan's TED talk and were aware of the concept of inverted pedagogies in general. Yet it really hit home when we accidentally flipped our classroom. Our objective was to better prepare our students…

  8. Characteristics of Androgenetic Alopecia in Asian

    OpenAIRE

    Lee, Won-Soo; Lee, Hae-Jin

    2012-01-01

    Androgenetic alopecia (AGA), or pattern hair loss, is a common disorder in Asian men and women, with a reported incidence of up to 73% among general population. There are several descriptions regarding the characteristics of AGA in patients of European descent. Asian patients with AGA have different types of hair loss and family histories from Europeans, which may affect treatment response. Therefore, in this review, prevalence, hair loss patterns, familial factors, androgen receptor gene pol...

  9. Engineering Task Plan to Expand the Environmental Operational Envelope of Core Sampling

    International Nuclear Information System (INIS)

    BOGER, R.M.

    1999-01-01

    This Engineering Task Plan authorizes the development of an Alternative Generation and Analysis (AGA). The AGA will determine how to expand the environmental operating envelope during core sampling operations

  10. Northern Black Sea Region in 1400–1442 and the Origin of the Crimean Khanate

    Directory of Open Access Journals (Sweden)

    V.P. Gulevych

    2013-09-01

    Full Text Available The history of the Crimean Khanate’s foundation still remains poorly studied. Also, little is known about the early years of the first Crimean khan Haci I Giray whose ancestors ruled in the Crimea and the Golden Horde. In the 20s of the 15th century the Grand Duke of Lithuania Vytautas actively intervened in the affairs of the Crimea and the Golden Horde trying to establish his sovereignty in the city of Caffa, where he strove to nominate subordinated khans. However, at the end of his reign, he could not exert a serious military pressure because until he died, he was occupied with his coronation. The boundaries of the Crimean tumen extended from the river Dniester in the West to the Volga River in the East, from the mean flow of the Dnieper and Southern Bug River in the North to the coastal cities of the Crimean peninsula in the south. In the first half of 15th century, there were many stationary settlements of Tatars in the Black Sea steppes. Thus, the tumen occupied a large territory. Having a great military power, the Crimean rulers did not separate the Crimean Ulus from the Golden Horde, but used the peninsula as a staging area for the seizure of power in the state capital city of Sarai. The Tatar nobility also sought to enthrone those khans who would be dependent on them. One of their strongest representatives was Tehene-bey who had a residence in Solkhat on the Crimean peninsula. He persuaded Vytautas to give them Ulugh Muhammad as a khan. In response, the khan nominated Tehene-bey as his deputy in the Crimea. A few years later, Ulugh Muhammad quarreled both with Tehene-bey and the Lithuanian ruler Švitrigaila. In 1433, the Grand Duke of Lithuania helped Khan Sayid Ahmad II both to split the Golden Horde and to seize power on the right bank of the Dnieper. According to many historians, Haci Giray seized power in the Crimea and defeated a Genoese military detachment in 1434, but this statement is not confirmed by the written sources and

  11. SYNTHESIS, CHARACTERIZATION AND CRYSTAL STRUCTURES ...

    African Journals Online (AJOL)

    B. S. Chandravanshi

    Cambridge CB2 1EZ, UK (e-mail for deposition: deposit@ccdc.cam.ac.uk). REFERENCES. 1. Guilherme, L.R.; Massabni, A.C.; Cuin, A.; Oliveira, L.A.A.; Castellano, E.E.; Heinrich,. T.A.; Costa-Neto, C.M. J. Coord. Chem. 2009, 62, 1561. 2. Ashiq, U.; Ara, R.; Mahroof-Tahir, M.; Maqsood, Z.T.; Khan, K.M.; Khan, S.N.; Siddiqui,.

  12. Effect of increased plant density and fertilizer dose on the yield of rice variety IR-6

    International Nuclear Information System (INIS)

    Amin, M.; Khan, M.A.; Khan, E.A.; Ramazan, M.

    2004-01-01

    An experiment to evaluate the effect of increased plant density and fertilizer dose on yield of rice variety IR-6 was conducted at the farm of Faculty of Agriculture, Gomal University Dera Ismail Khan. Increase plant density significantly increase number of panicles per square meter, sterility and straw yield while increased fertilizer dose of NPK increase plant height, sterility, normal kernels, and 1000 grain weight. Interaction of increased plant density and fertilizer dose was found to be non significant except sterility percentage and straw yield. However efforts are required for increasing yield per unit area of rice. (author)

  13. International Conference on Nitride Semiconductors (10th) Held in Washington, DC on August 25-30, 2013

    Science.gov (United States)

    2014-08-17

    Honorary Chair: M. Asif Khan, University of South Carolina, US ’ Program Chair - Russell Dupuis , Georgia Institute of Technology, US - Subject Chair...Russel D. Dupuis 11:00 am-11:15am B4.04 Andrew Armstrong 11:15am-11:30am B4.05 H/lichael Binder 11:30 am-11:46 am B4.06 Marco Ulises...00 pm 87.03 Xiang Zhou 4:00pm-4:15pm B7.04 Christopher J.Lewis 4:15 pm-4:30 pm B7.06 Yamina Andre 4:30 pm-4:45 pm B7.06 Hideaki

  14. Conventional and novel stem cell based therapies for androgenic alopecia.

    Science.gov (United States)

    Talavera-Adame, Dodanim; Newman, Daniella; Newman, Nathan

    2017-01-01

    The prevalence of androgenic alopecia (AGA) increases with age and it affects both men and women. Patients diagnosed with AGA may experience decreased quality of life, depression, and feel self-conscious. There are a variety of therapeutic options ranging from prescription drugs to non-prescription medications. Currently, AGA involves an annual global market revenue of US$4 billion and a growth rate of 1.8%, indicating a growing consumer market. Although natural and synthetic ingredients can promote hair growth and, therefore, be useful to treat AGA, some of them have important adverse effects and unknown mechanisms of action that limit their use and benefits. Biologic factors that include signaling from stem cells, dermal papilla cells, and platelet-rich plasma are some of the current therapeutic agents being studied for hair restoration with milder side effects. However, most of the mechanisms exerted by these factors in hair restoration are still being researched. In this review, we analyze the therapeutic agents that have been used for AGA and emphasize the potential of new therapies based on advances in stem cell technologies and regenerative medicine.

  15. Birth weight and long-term metabolic outcomes: does the definition of smallness matter?

    Science.gov (United States)

    Verkauskiene, R; Figueras, F; Deghmoun, S; Chevenne, D; Gardosi, J; Levy-Marchal, M

    2008-01-01

    To establish the role of individual definition of smallness at birth in the association between birth weight and long-term metabolic outcomes. Lipid profile and oral glucose tolerance test were performed in young adults (22 years) born either small (SGA) or appropriate for gestational age (AGA). AGA/SGA were defined by both population-based and customized methods adjusting for individual maternal/pregnancy characteristics. 825 individuals were classified as AGA and 575 as SGA by both methods, 131 were SGA by the population-based method only (SGA(pop)) and 22 were SGA by the customized method only (SGA(cust)). SGA(cust) subjects had higher total cholesterol and triglyceride levels and lower high-density lipoprotein cholesterol concentrations than SGA(pop) and AGA subjects, however, insignificantly when adjusted for age, gender and body mass index. The homeostasis model assessment for insulin resistance (HOMA-IR) index was higher in the SGA(cust) (p = 0.05) and SGA(pop) (p = 0.02) versus the AGA group. Controlling for the HOMA-IR index, the insulinogenic index was significantly lower in the SGA(cust) versus SGA(pop) (p = 0.001) and AGA (p = 0.003) groups. In SGA(cust) individuals, the HOMA-IR index was clearly shifted to higher, while the insulinogenic index to lower tertiles of AGA distribution; SGA(pop) subjects had the HOMA-IR and insulinogenic index predominantly in the highest tertiles. Individualized birth weight standards allow to better identify subjects who failed to reach their genetic potential of intrauterine growth and are at higher risk of metabolic disturbances and impaired insulin secretion later in life. Copyright 2008 S. Karger AG, Basel.

  16. Association between anti-endomysial antibody and total intestinal villous atrophy in children with coeliac disease.

    Directory of Open Access Journals (Sweden)

    Ozgenc F

    2003-01-01

    Full Text Available BACKGROUND: There is growing evidence to suggest that detection of anti-gliadin antibody (AGA and anti-endomysial antibody (EmA can serve as sensitive markers of the degree of histological abnormalities in patients with coeliac disease. AIM: To evaluate the association between the presence of AGA and EmA and villous atrophy in intestinal biopsies of children with suspected coeliac disease. SETTINGS AND DESIGN: Intestinal samples of 46 children with failure to thrive, chronic diarrhoea, malabsorption and short stature with either AGA and/or EmA positivity were evaluated, retrospectively. The diagnosis of coeliac disease was based on ESPGHAN criteria. METHODS AND MATERIAL: Patients with total villous atrophy who fulfilled the ESPGHAN criteria for the diagnosis of coeliac disease were diagnosed to have coeliac disease. Nine patients without villous atrophy were taken as negative controls for this study. AGA-IgA was measured both by immunoflourescence (IF and ELISA and EmA-IgA by IF while patients were on normal diet. Relationship between autoantibody positivity and intestinal total villous atrophy was evaluated. RESULTS: Overall positivity for AGA IgA was 85% (39/46 by IF+ELISA and EmA positivity was 85% (39/46 by IF within the study group. Histological examination revealed total villous atrophy with lymphocyte infiltration and crypt hyperplasia in 37 (80% patients. AGA IgA was positive in 14 (38% and 31 (84% of these children by ELISA and IF, respectively. EmA positivity was detected in 35/37 (95% cases with atrophy and 4/9 (44% without atrophy (p=0.002. Thirty out of 37 (81% patients with villous atrophy had both AGA IgA (IF and EmA positivity (p=0.186. All of the sixteen patients that had both positive AGA IgA (ELISA+IF and EmA had total villous atrophy (p=0.037. CONCLUSION: A significant association between total villous atrophy and EmA positivity has been documented in this study.

  17. Evolving Techniques of Documentation of a World Heritage Site in Lahore

    Science.gov (United States)

    Arif, R.; Essa, K.

    2017-08-01

    Lahore is an ancient, culturally rich city amidst which are embedded two world heritage sites. The state of historic preservation in the country is impoverished with a dearth of training and poor documentation skills, thus these monuments are decaying and in dire need of attention. The Aga Khan Cultural Service - Pakistan is one of the first working in heritage conservation in the country. AKCSP is currently subjecting the UNESCO World Heritage site of the Mughal era Lahore Fort to an intensive and multi-faceted architectural documentation process. This is presented here as a case study to chart the evolution of documentation techniques and enunciate the spectrum of challenges faced in the documentation of an intricate Mughal heritage site for conservation in the Pakistani context. 3D - laser scanning is used for the purpose of heritage conservation for the first time, and since has been utilised on heritage buildings and urban fabric in ongoing projects. These include Lahore Fort, Walled city of Lahore as well as the Baltit Fort, a project restored in the past, assisting in the maintenance of conserved buildings. The documentation team is currently discovering the full potential of this technology especially its use in heritage conservation simultaneously overcoming challenges faced. Moreover negotiating solutions to auto-generate 2D architectural drawings from the 3D pointcloud output. The historic architecture is juxtaposed with contemporary technology in a region where such a combination is rarely found. The goal is to continually develop the documentation methodologies whilst investigating other technologies in the future.

  18. EVOLVING TECHNIQUES OF DOCUMENTATION OF A WORLD HERITAGE SITE IN LAHORE

    Directory of Open Access Journals (Sweden)

    R. Arif

    2017-08-01

    Full Text Available Lahore is an ancient, culturally rich city amidst which are embedded two world heritage sites. The state of historic preservation in the country is impoverished with a dearth of training and poor documentation skills, thus these monuments are decaying and in dire need of attention. The Aga Khan Cultural Service - Pakistan is one of the first working in heritage conservation in the country. AKCSP is currently subjecting the UNESCO World Heritage site of the Mughal era Lahore Fort to an intensive and multi-faceted architectural documentation process. This is presented here as a case study to chart the evolution of documentation techniques and enunciate the spectrum of challenges faced in the documentation of an intricate Mughal heritage site for conservation in the Pakistani context. 3D - laser scanning is used for the purpose of heritage conservation for the first time, and since has been utilised on heritage buildings and urban fabric in ongoing projects. These include Lahore Fort, Walled city of Lahore as well as the Baltit Fort, a project restored in the past, assisting in the maintenance of conserved buildings. The documentation team is currently discovering the full potential of this technology especially its use in heritage conservation simultaneously overcoming challenges faced. Moreover negotiating solutions to auto-generate 2D architectural drawings from the 3D pointcloud output. The historic architecture is juxtaposed with contemporary technology in a region where such a combination is rarely found. The goal is to continually develop the documentation methodologies whilst investigating other technologies in the future.

  19. Gender and livelihoods in northern Pakistan.

    Science.gov (United States)

    Joekes, S

    1995-01-01

    This article reports on findings from a study in 1993-94 on women and sustainable development in Hunza and Nagar districts in the Karakorum mountains of northern Pakistan. The study aims to explore the impact of development on women's work burden and sustainable use of natural resources. Local natural resource management has been a complex system of agro-pastoralist use, with poor yields. Modernization resulted in construction of the Karakorum Highway in 1978 and the Aga Khan Support Program, which mobilized the community in irrigation and agricultural projects. Village organizations were formed as a forum for community decision making and information exchange. These changes resulted in the doubling of household income during 1983-92. Agricultural productivity increased without compromising soil fertility. Livestock herds doubled during 1976-86. The road created the opportunity for new strategies for improving income. Wholesale markets became accessible. Tourism increased, the economy diversified in ways that increased women's income and control of income, and demand for education increased. Women reported that the increased demands on workload were worth the improved standard of living. Gendered work was reallocated, and division of labor changed among women of various ages. Village councils began protecting depleted forest reserves. Men collected wood on the higher slopes, according to anthropomorphic and spiritual beliefs. Women's knowledge of the environment was greater with age and specific to the tasks performed. Men and women did not have permanently fixed gender roles. Women were not exclusive managers of the environment. Women benefited the most from technology that was in their interest and not controlled by men.

  20. Hiilgav, aga... / Alar Niineväli

    Index Scriptorium Estoniae

    Niineväli, Alar

    2008-01-01

    Ameerika telesarjad, mis on heatasemelised, kuid tootjate poolt liiga vara ära lõpetatud, enamasti kasumlikkusest lähtudes : "Earth 2" (1994), "EZ Streets" (1996), "Profit" (1996), "Strange World" (1999), "The Inside" (2005), "Drive" (2007), "Aliens in America" (2007)

  1. Edasi loodusesse! Aga kuhu? / Riina Oruaas

    Index Scriptorium Estoniae

    Oruaas, Riina

    2007-01-01

    Tantsulavastustest: Oksana Titova, Päär Pärenson ja Juhan Ulfsak "Roots", Kaja Kanni sooloetendus "There are Laika dogs living in Estonia", Tiina Mölder, Kaja Kann ja Bush Hartshor "Naine ja Hunt"

  2. Coronary artery bypass grafting and sensorineural hearing loss, a cohort study

    Directory of Open Access Journals (Sweden)

    Ashraf Omer

    2005-12-01

    Full Text Available Abstract Background Sudden sensorineural hearing loss is routinely encountered by the otologist. The etiology is varied and often identifiable. One of the relatively less frequent causes is surgery. Apart from being an established entity with otological surgeries, sensorineural hearing loss has also been known to occur after non-otological procedures under general anesthesia. Commonest amongst these procedures is cardiopulmonary bypass, an association that has long been recognized. However, despite the proposition of diverse hypotheses in the past, the pathophysiology remains unclear. Methods The study is a prospective matched cohort study that will be carried out in Aga Khan University Hospital, Karachi, Pakistan. Participants among exposed would include all those patients who would be undergoing coronary artery bypass surgery in the hospital who fall under the criteria for inclusion. Unexposed group would comprise of patients undergoing a non-bypass procedure of similar duration under the same type of anesthesia who meet the selection criteria. Both these groups will undergo audiometric testing at our hospital on three different occasions during the course of this study. Initially before the procedure to test the baseline hearing capacity; then one week after the procedure to assess any changes in hearing ability following the surgery; and finally a third audiogram at six weeks follow-up to assess further changes in any hearing deficits noted during the second phase of testing. Certain variables including the subjects' demographics and those concerning the procedure itself will be noted and used later for risk factors analysis. A detailed past medical and surgical history will also be obtained. Data analysis would include calculation of relative risk and significance of the results, by running the chi-square test. Other statistical tests like Fisher exact test may then be employed to facilitate data interpretation. Continuous scale may then be

  3. Assessment of depression and anxiety in adult cancer outpatients: a cross-sectional study

    International Nuclear Information System (INIS)

    Jadoon, Nauman A; Munir, Waqar; Shahzad, Mohammad A; Choudhry, Zeshan S

    2010-01-01

    The prevalence of anxiety and depressive disorders in cancer patients and its associated factors in Pakistan is not known. There is a need to develop an evidence base to help introduce interventions as untreated depression and anxiety can lead to significant morbidity. We assessed the prevalence of depression and anxiety among adult outpatients with and without cancer as well as the effect of various demographic, clinical and behavioral factors on levels of depression and anxiety in cancer patients. This cross-sectional study was carried out in outpatient departments of Multan Institute of Nuclear Medicine and Radiotherapy and Nishtar Medical College Hospital, Multan. Aga Khan University Anxiety and Depression Scale (AKUADS) was used to define the presence of depression and anxiety in study participants. The sample consisted of 150 diagnosed cancer patients and 268 participants without cancer (control group). The mean age of cancer patients was 40.85 years (SD = 16.46) and median illness duration was 5.5 months, while the mean age of the control group was 39.58 years (SD = 11.74). Overall, 66.0% of the cancer patients were found to have depression and anxiety using a cutoff score of 20 on AKUADS. Among the control group, 109 subjects (40.7%) had depression and anxiety. Cancer patients were significantly more likely to suffer from distress compared to the control group (OR = 2.83, 95% CI = 1.89-4.25, P = 0.0001). Performing logistic regression analysis showed that age up to 40 years significantly influenced the prevalence of depression and anxiety in cancer patients. There was no statistically significant difference between gender, marital status, locality, education, income, occupation, physical activity, smoking, cancer site, illness duration and mode of treatment, surgery related to cancer and presence of depression and anxiety. Cancers highly associated with depression and anxiety were gastrointestinal malignancies, chest tumors and breast cancer. This study

  4. Selective Screening for Organic Acidurias and Amino Acidopathies in Pakistani Children

    International Nuclear Information System (INIS)

    Sherazi, N. A.; Khan, A. H.; Jafri, L.; Jamil, A.; Khan, N. A.; Afroze, B.

    2017-01-01

    Objective: To determine the frequency of organic acidurais (OA) and amino acidopathies (AA) in selected high-risk patients screened in two years. Study Design: Retrospective Observational study. Place and Duration of Study: The Aga Khan University Hospital (AKUH), Karachi, from January 2013 to December 2014. Methodology: Patients with OA and AA were included in the study and patients with IMDs other than OA and AA were excluded. Amino acids and organic acids were analyzed on high performance liquid chromatography and gas chromatography-mass spectrometry respectively. Clinical data and chromatograms of patients screened for IMDs were reviewed by chemical pathologist and metabolic physician. Results: Eighty-eight cases (4.7 percent) were diagnosed including 41 OA (46.5 percent), 28 AA (31.8 percent) and 19 others (21.5 percent) from 1,866 specimens analyzed. Median age of the patients was 1.1 years, with high consanguinity rate (64.8 percent). Among OA, methyl CoA mutase deficiency was diagnosed in 9 (10.2 percent) and was suspected in 2 (2.3 percent) cases. Five (5.7 percent) cases of MHBD (2-methyl-3-hydroxybutyryl-CoA), 4 (4.5 percent) each of PPA (propionic aciduria) and HMG-CoA lyase deficiency, 3 (3.4 percent) cases each of IVA (isovaleric aciduria), multiple carboxylase deficiency, fructose-1, 6-biphosphatase deficiency, fumarase deficiency, GA-1 (glutaric aciduria type 1) and 2 (2.3 percent) cases of EMA (ethyl-malonic aciduria). AA included 8 (9.1 percent) cases of MSUD (maple syrup urine disease), 6 (6.8 percent) cases of CBS (cystathionine beta-synthetase) and UCDs (urea cycle disorders) each, 5 (5.7 percent) cases of hyperphenylalaninemia and 3 (3.4 percent) cases of hyperprolinemia were reported. Other inherited metabolic disorders included: 9 (10.2 percent) cases of intracellular cobalamin defects, 2 (2.3 percent) cases each of alkaptonuria, Canavan's disease, SUCL (succinate CoA ligase) deficiency, and 1 (1.1 percent) case each of DPD

  5. Hemoptysis, a developing world perspective.

    Science.gov (United States)

    Ashraf, Omer

    2006-01-13

    Hemoptysis is a significant clinical presentation in respiratory medicine. Often a life threatening emergency, it mandates prompt assessment and intervention. Various investigations and management protocols are proposed globally, to advocate a standardized approach towards patients presenting with hemoptysis. It is the etiology, however, that has been known to influence clinical outcome and prognosis. With marked contrast in geographical patterns of pulmonary pathologies, etiological agents for hemoptysis vary over the world. Studies in West, usually demonstrate neoplastic and non-granulomatous causes to be the leading agents for hemoptysis. The diagnostic accuracy of various investigations and efficacy of management alternatives has been established there. Developing nations differ in their burden of diseases of lung. Lack of health resources and initiative often prevent quality research in critical areas. This is a retrospective observational study with a cross-sectional design in which charts of all patients admitted with the presentation of haemoptysis in the past ten years will be reviewed, at Aga Khan University Hospital, Karachi, Pakistan. A series of variables, based on previous literature on haemoptysis related to the objectives of present study, will be determined in the study. Demographics, co-morbids and etiology will be determined. Findings of various investigation modalities and their accuracy in localizing the bleeding site will be determined. Efficacy of different management strategies will also be observed. Also observed will be any complications and follow-up. Pakistan is a third world nation of over 150 million, established as highly endemic for pulmonary tuberculosis. To date no study has been generated to look into hemoptysis patterns, in this nation. Lack of evidence based medicine poses a major hindrance towards confident decision-making in the approach towards a patient presenting with hemoptysis in this country. This study is devised to

  6. Hemoptysis, a developing world perspective

    Directory of Open Access Journals (Sweden)

    Ashraf Omer

    2006-01-01

    Full Text Available Abstract Background Hemoptysis is a significant clinical presentation in respiratory medicine. Often a life threatening emergency, it mandates prompt assessment and intervention. Various investigations and management protocols are proposed globally, to advocate a standardized approach towards patients presenting with hemoptysis. It is the etiology, however, that has been known to influence clinical outcome and prognosis. With marked contrast in geographical patterns of pulmonary pathologies, etiological agents for hemoptysis vary over the world. Studies in West, usually demonstrate neoplastic and non-granulomatous causes to be the leading agents for hemoptysis. The diagnostic accuracy of various investigations and efficacy of management alternatives has been established there. Developing nations differ in their burden of diseases of lung. Lack of health resources and initiative often prevent quality research in critical areas. Design This is a retrospective observational study with a cross-sectional design in which charts of all patients admitted with the presentation of haemoptysis in the past ten years will be reviewed, at Aga Khan University Hospital, Karachi, Pakistan. A series of variables, based on previous literature on haemoptysis related to the objectives of present study, will be determined in the study. Demographics, co-morbids and etiology will be determined. Findings of various investigation modalities and their accuracy in localizing the bleeding site will be determined. Efficacy of different management strategies will also be observed. Also observed will be any complications and follow-up. Discussion Pakistan is a third world nation of over 150 million, established as highly endemic for pulmonary tuberculosis. To date no study has been generated to look into hemoptysis patterns, in this nation. Lack of evidence based medicine poses a major hindrance towards confident decision-making in the approach towards a patient presenting

  7. Inculcating health awareness in Karachi, Pakistan: How innovative, socially acceptable methods can help combat communicable diseases of poverty

    Directory of Open Access Journals (Sweden)

    Maryam Huda

    2017-06-01

    Full Text Available In the megacity of Karachi, which has a population of more than 24 million, more than 9.2 million people (approximately 40 per cent live in squatter settlements. Communities here are characterised by low socioeconomic settings, crowded living conditions, inadequate water and sanitation facilities, and poor health-related behaviours. Such conditions create an environment favourable to the spread of communicable diseases like tuberculosis (TB, hepatitis and dengue. Since 1985, the Department of Community Health Sciences at the Aga Khan University, Karachi, Pakistan has run the Urban Health Program (UHP, a community-campus partnership operating in these disadvantaged squatter settlements. Recent explosive increases in the spread of dengue, hepatitis and TB, however, necessitated special attention and activities on a scale and pace that was greater than could be accommodated as part of UHP’s core work. Thus, having an already well-established collaborative model with social accountability measures in place, a dedicated mass awareness program was initiated over the course of one year, from mid 2015: the AGAHI project. This article describes AGAHI’s innovative, low-cost, collaborative activities conducted in partnership with two squatter communities, Sultanabad and Rehri Goth, to build health awareness, improved care-seeking and compliance to treatment. Activities ranged from school sessions, role plays and awareness walks to laneway meetings, training of health care workers, door-to-door campaigns and collaboration with local religious leaders, public sector groups and NGOs. Building on the collaborative work of the UHP, in just 12 months AGAHI was able to conduct 80 health awareness sessions with 4000 participants. Moreover, high-risk and vulnerable populations were identified and referred for further treatment. A comparative cross-sectional survey afterwards revealed a significant increase in knowledge among Sultanabad residents as compared to

  8. Dietary Almonds Increase Serum HDL Cholesterol in Coronary Artery Disease Patients in a Randomized Controlled Trial.

    Science.gov (United States)

    Jamshed, Humaira; Sultan, Fateh Ali Tipoo; Iqbal, Romaina; Gilani, Anwar Hassan

    2015-10-01

    More than one-half of coronary artery disease (CAD) patients have low HDL cholesterol despite having well-managed LDL cholesterol. Almond supplementation has not been shown to elevate circulating HDL cholesterol concentrations in clinical trials, perhaps because the baseline HDL cholesterol of trial subjects was not low. This clinical trial was designed to test the effect of almond supplementation on low HDL cholesterol in CAD patients. A total of 150 CAD patients (50 per group), with serum LDL cholesterol ≤100 mg/dL and HDL cholesterol ≤40 mg/dL in men and ≤50 mg/dL in women, were recruited from the Aga Khan University Hospital. After recording vital signs and completing a dietary and physical activity questionnaire, patients were randomly assigned to 1 of the following 3 groups: the no-intervention group (NI), the Pakistani almonds group (PA), and the American almonds group (AA). The respective almond varieties (10 g/d) were given to patients with instructions to soak them overnight, remove the skin, and eat them before breakfast. Blood samples for lipid profiling, body weight, and blood pressure were collected, and assessment of dietary patterns was done at baseline, week 6, and week 12. Almonds significantly increased HDL cholesterol. At weeks 6 and 12, HDL cholesterol was 12-14% and 14-16% higher, respectively, in the PA and AA than their respective baselines. In line with previous reports, serum concentrations of total cholesterol, triglycerides, LDL cholesterol, and VLDL cholesterol; total-to-HDL and LDL-to-HDL cholesterol ratios, and the atherogenic index were reduced in both the PA and AA at weeks 6 and 12 compared with baseline (P almond groups. Dietary patterns, body weight, and blood pressure did not change in any of the 3 groups during the trial. A low dose of almonds (10 g/d) consumed before breakfast can increase HDL cholesterol, in addition to improving other markers of abnormal lipid metabolism in CAD patients with low initial HDL cholesterol

  9. Post partum anxiety and depression in peri-urban communities of Karachi, Pakistan: a quasi-experimental study

    Directory of Open Access Journals (Sweden)

    Azam Iqbal S

    2009-10-01

    Full Text Available Abstract Background Postpartum anxiety and depression is a major public health concern because of its adverse effects on the cognitive and social development of the infant. Globally postpartum depression has been widely investigated but as anxiety is a more prominent feature of postpartum depression we assessed the prevalence of anxiety and depression and their associated factors in post partum women. Methods A quasi-experimental study investigating the impact of postpartum anxiety and depression on child growth and development was conducted in two peri-urban, multiethnic, communities of Karachi, a mega city of Pakistan. A house to house questionnaire based survey was done by trained field workers; 420 consenting pregnant women were identified and data for socio-demographic, home environment and family relationship variables was collected between 36 weeks of pregnancy and within 10 days of childbirth. Mother's levels of anxiety and depression were assessed after one month, two months, six months and twelve months of childbirth; this was two step process: initially an indigenous, validated screening instrument Aga Khan University Anxiety and Depression Scale was used and diagnostic confirmation was done through a psychologist's interview based on DSM IV criteria. Women found to be anxious and depressed at least once out of four assessments were considered for the computation of overall prevalence of postpartum anxiety and depression as well as its risk factors. However, point prevalence's of postpartum anxiety and depression were also reported at each assessment time. Two sixty seven women could be followed for one year. Data was analyzed using SPSS. Chi-square test, simple and multiple logistic regression were used to see the association of different factors. Results The overall prevalence of postpartum anxiety and depression was found to be 28.8 percent. Domestic violence, difficulty in breast feeding at birth and unplanned current pregnancy

  10. Comments on “An economic order quantity (EOQ for items with imperfect quality and inspection errors”

    Directory of Open Access Journals (Sweden)

    Hui-Ming Teng

    2013-01-01

    Full Text Available The purpose of these comments is to serve as a revision to the article by Khan, Jaber, & Bonney [2011, An economic order quantity (EOQ for items with imperfect quality and inspection errors, International Journal of Production Economics, 133: 113–118]. This commenting paper first suggests that the revenue function derived in Khan et al. (2011 is unrealistic, and then offers revisions to complement the shortcomings.

  11. Protsessijuhtimine suurendab kliendikesksust / Verner Mättas

    Index Scriptorium Estoniae

    Mättas, Verner

    2003-01-01

    Protsessijuhtimise ja funktsioonipõhise juhtimise võrdlus. Autor tutvustab protsessimudelit AGA tööstuslike gaaside ärivaldkonnas. Skeem: Erinevate huvigruppide ootuste ja rahulolu seosed (Eesti AGA näitel); Vt. samas: Protsessijuhtimine keskendub eri huvigruppide ootustele

  12. Androgenetic alopecia and risk of coronary artery disease

    Directory of Open Access Journals (Sweden)

    Lata Sharma

    2013-01-01

    Full Text Available Background: Androgenetic alopecia (AGA or male pattern baldness (MPB has been found to be associated with the risk of coronary artery disease (CAD. The well-known risk factors are family history of CAD, hypertension, increased body mass index (BMI, central obesity, hyperglycemia, and dyslipidemia. The newer risk factors are serum lipoprotein-a (SL-a, serum homocysteine (SH, and serum adiponectin (SA. Aim : Identifying individuals at risk of CAD at an early age might help in preventing CAD and save life. Hence, a comparative study of CAD risk factors was planned in 100 males of AGA between the age of 25 and 40 years with equal number of age- and sex-matched controls. Materials and Methods : Patients of AGA grade II or more of Hamilton and Norwood (HN Scale and controls were examined clinically and advised blood test. The reports were available for fasting blood sugar (FBS, serum total serum cholesterol (SC in 64 cases, 64 controls; lipoproteins (high, low, very low density, HDL, LDL, VLDL, serum triglycerides (ST in 63 cases, 63 controls; SL-a in 63 cases, 74 controls; SH in 56 cases, 74 controls; and SA in 62 cases, 74 controls. Results : In these cases family history (FH of AGA and CAD was significantly high. The blood pressure (BP was also found to be significantly high in the cases. The difference of mean serum HDL, LDL, VLDL, ST, SH, and SL-a in cases and controls were statistically significant and with increasing grade of AGA, the risk factors also increased. Conclusion : Patients with AGA appear to be at an increased risk of developing CAD, therefore, clinical evaluation of cases with AGA of grade II and above may be of help in preventing CAD in future.

  13. Role of adiponectin and leptin on body development in infants during the first year of life

    Directory of Open Access Journals (Sweden)

    Gasparoni Antonella

    2010-03-01

    Full Text Available Abstract Background The control of growth and nutritional status in the foetus and neonate is a complex mechanism, in which also hormones produced by adipose tissue, such as adiponectin and leptin are involved. The aim of this study was to evaluate levels of adiponectin, leptin and insulin in appropriate (AGA and small for gestational age (SGA children during the 1st year of life and to correlate these with auxological parameters. Methods In 33 AGA and 29 SGA infants, weight, length, head circumference, glucose, insulin, adiponectin and leptin levels were evaluated at the second day of life, and at one, six and twelve months, during which a portion of SGA could show catch-up growth (rapid growth in infants born small for their gestational age. Results Both total and isoform adiponectin levels were comparable between AGA and SGA infants at birth and until age one year. These levels significantly increased from birth to the first month of life and then decreased to lower values at 1 year of age in all subjects. Circulating leptin concentrations were higher in AGA (2.1 ± 4.1 ng/ml than in SGA neonates (0.88 ± 1.03 ng/ml, p st and the 6th month of age, but they increased in SGA from six months to one year, when they showed catch-up growth. Circulating insulin levels were not statistically different in AGA and SGA neonates at any study time point. Insulin levels in both AGA and SGA infants increased over the study period, and were significantly lower at birth compared to one, six and 12 months of age. Conclusions During the first year of life, in both AGA and SGA infants a progressive decrease in adiponectin levels was observed, while a difference in leptin values was correlated with the nutritional status.

  14. Sequence Classification: 378135 [

    Lifescience Database Archive (English)

    Full Text Available Non-TMB TMH TMB Non-TMB Non-TMB Non-TMB >gi|13475854|ref|NP_107424.1| agaE protein, conversion of agropini...c acid to mannopinic acid || http://www.ncbi.nlm.nih.gov/protein/13475854 ...

  15. Hunting the genes in male-pattern alopecia: how important are they, how close are we and what will they tell us?

    Science.gov (United States)

    Heilmann-Heimbach, Stefanie; Hochfeld, Lara M; Paus, Ralf; Nöthen, Markus M

    2016-04-01

    Androgenetic alopecia (AGA) is a highly heritable condition, and the most common form of hair loss in men. The phenotype is characterized by an androgen-dependent, progressive loss of hair from the scalp, which may commence during puberty. Up to 80% of European men experience some degree of androgen-dependent hair loss during their lifetime. Current treatment options for AGA have limited efficacy, and improved understanding of the underlying biological causes is required to facilitate novel therapeutic approaches. To date, molecular genetic studies have implicated 12 genomic regions in AGA and identified a number of candidate genes. The latter include those encoding the androgen receptor (AR), the histone deacetylases (HDAC) 4 and 9, and the WNT molecule WNT10A. However, the majority of contributing genetic risk factors still await identification. This review describes the current status of AGA genetic research. We discuss the strength of the genetic approach and anticipated developments in the field, and how these will facilitate the systematic unravelling of AGA pathobiology, a process which may lead to the identification of new therapeutic targets. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  16. تصاویر الثوار والخارجین عن حکم الأباطرة المغول فی الهند (932-1273هـ/1526-1857م

    Directory of Open Access Journals (Sweden)

    DR. Amal Abdul Salam Al Sayed

    2017-01-01

    Full Text Available The aim of this research is to study the portrayal of the revolutionaries and the outlaws of the Mongol emperors in India, highlighting the most important revolutions and stages of each revolution and how to eliminate them and their main leaders, whether these revolutions inside the Mongol house of the emperor's brothers or cousins or revolutions The leaders of the Mughal army, such as the Uzbek officers' revolutions led by the brothers Ali Qali Khan and Bahadir Khan al-Shaibani, or revolutions that are a popular uprising of the Indian people, the Mongol emperors, Such as the revolution of merahta in the era of the Emperor Orangzip, and research is concerned with the study of the regions in which these revolutions and their geographical nature, such as the province of Bengal and Gujarat, as well as the most important strongholds and fortresses of the rebels such as Fort Sourt and the Castle of Uzbeks, Was carried out by some members of the Mongol house, such as Adham Khan, Akbar's brother Akbar's breast, or Perm Khan, Emperor Akbar's minister, Khan Jahan, the minister of Emperor Shahghan, and other prominent figures in the Mongol court, And of course, through a number of images that illustrated the stages of these revolutions and the way followed by the emperors of the Mongols in the elimination of such revolutions and rebel movements, and through the researcher was able to reach a number of important results through which to know the history of India's political and social history is documented by the affirmation of events and historical and military events

  17. Sequence Classification: 378211 [

    Lifescience Database Archive (English)

    Full Text Available nic acid to mannopinic acid || http://www.ncbi.nlm.nih.gov/protein/13475930 ... ...Non-TMB TMH Non-TMB Non-TMB Non-TMB Non-TMB >gi|13475930|ref|NP_107500.1| AgaE protein, conversion of agropi

  18. Erratum: Erratum to: "New Data on the Age and Nature of the Khan-Bogd Alkaline Granites, Mongolia"

    Science.gov (United States)

    Gerdes, A.; Kogarko, L. N.; Vladykin, N. V.

    2018-01-01

    The list of authors and their affiliations should read as follows: A. Gerdes a , Academician L. N. Kogarko b,*, and N. V. Vladykin c a Institute of Earth Sciences, Goethe University, Frankfurt, Germany b Vernadsky Institute of Geochemistry and Analytical Chemistry, Russian Academy of Sciences, Moscow, 119991 Russia c Vinogradov Institute of Geochemistry, Siberian Branch, Russian Academy of Sciences, Irkutsk, 664033 Russia * e-mail: kogarko@geochi.ru

  19. Comparison of serum 25-hydroxy vitamin D levels between mothers with small for gestational age and appropriate for gestational age newborns in Kerman.

    Science.gov (United States)

    Mirzaei, Fatemeh; Amiri Moghadam, Tayebeh; Arasteh, Peyman

    2015-04-01

    Vitamin D deficiency during pregnancy is associated with some adverse pregnancy outcomes but its relationship with fetal growth is unknown. We compared the 25-hydroxy vitamin D levels between mothers and their small for gestational age (SGA) newborns with mothers and their appropriate for gestational age (AGA) newborns. The study population included pregnant women that referred to Afzalipour Hospital in Kerman from 2012 to 2013. The case and control group consisted of 40 pregnant mothers with SGA and AGA newborns, respectively. The maternal and infants 25-hydroxy vitamin D levels were measured in the two groups. 25-hydroxy vitamin D deficiency (mothers and infants in both the SGA group and the AGA group was significant. Our study reveals a high prevalence of vitamin D deficiency in women with SGA infants in comparison to women with AGA children. In addition, maternal vitamin D deficiency is associated with its deficiency in newborns.

  20. [Relationship of plasma ghrelin, IGF-1 and insulin with the growth and development of 2 -7 year-old children with small for gestational age at birth].

    Science.gov (United States)

    Cheng, Yaying; Song, Guangyao; Zhou, Lixia; Cai, Baoping; Zhao, Xiumian; Yin, Jianying

    2012-01-01

    To explore the relationship of Ghrelin, insulin-like growth factor-1 (IGF-1) and insulin with the growth and development of 2 -7 year-old children with small for gestational age (SGA) at birth. The levels of ghrelin, IGF-1, IGFBP-3, insulin and glucose were measured in the children with preterm SGA and term SGA and compared with the children with preterm appropriate for gestational age (AGA) and term AGA. The correlation of ghrelin with IGF-1, IGFBP-3 and insulin was analyzed. Plasma ghrelin in preterm SGA was higher than that in term SGA (P 0.05). Plasma ghrelin in preterm AGA and term SGA was higher than that in term AGA (P development of preterm and SGA children, regardless of the magnitude of their catch up growth. As a re-regulatory factor to insulin, ghrelin regulates the energy metabolism in a form of negative feedback.

  1. Therapeutic deep brain stimulation worsening dysprosody in Parkinson’s disease – an unexplored entity

    Directory of Open Access Journals (Sweden)

    Shoaib M

    2018-03-01

    Full Text Available Maria Shoaib,1 Muhammad Taimoor Khan2 1Department of Medicine, Dow Medical College, Karachi, Pakistan; 2Department of Neurology, Charleston Area Medical Center/West Virginia University, Charleston, WV, USA  We read this article, “Altered emotional recognition and expression in patients with Parkinson’s disease” by Jin et al1 with great interest and appreciate the novel information provided on altered emotional processing in pre-deep brain stimulation (DBS Parkinson’s disease (PD patients and we would like to add our feedback on the role of DBS on nonmotor and emotional components of PD.View the original paper by Jin and colleagues. 

  2. Androgenic alopecia is associated with less dietary soy, lower [corrected] blood vanadium and rs1160312 1 polymorphism in Taiwanese communities.

    Directory of Open Access Journals (Sweden)

    Ching-Huang Lai

    Full Text Available Although the genetic basis of androgenic alopecia has been clearly established, little is known about its non-genetic causes, such as environmental and lifestyle factors.This study investigated blood and urine heavy metals concentrations, environmental exposure factors, personal behaviors, dietary intakes and the genotypes of related susceptibility genes in patients with androgenic alopecia (AGA.Age, AGA level, residence area, work hours, sleep patterns, cigarette usage, alcohol consumption, betel nut usage, hair treatments, eating habits, body heavy metals concentrations and rs1998076, rs913063, rs1160312 and rs201571 SNP genotype data were collected from 354 men. Logistic regression analysis was performed to examine whether any of the factors displayed odds ratios (ORs indicating association with moderate to severe AGA (≥ IV. Subsequently, Hosmer-Lemeshow, Nagelkerke R(2 and accuracy tests were conducted to help establish an optimal model.Moderate to severe AGA was associated with the AA genotype of rs1160312 (22.50, 95% CI 3.99-126.83, blood vanadium concentration (0.02, 95% CI 0.01-0.04, and regular consumption of soy bean drinks (0.23, 95% CI 0.06-0.85, after adjustment for age. The results were corroborated by the Hosmer-Lemeshow test (P = 0.73, Nagelkerke R(2 (0.59, accuracy test (0.816 and area under the curve (AUC; 0.90, 0.847-0.951 analysis.Blood vanadium and frequent soy bean drink consumption may provide protect effects against AGA. Accordingly, blood vanadium concentrations, the AA genotype of rs1160312 and frequent consumption of soy bean drinks are associated with AGA.

  3. Androgenic alopecia is associated with less dietary soy, lower [corrected] blood vanadium and rs1160312 1 polymorphism in Taiwanese communities.

    Science.gov (United States)

    Lai, Ching-Huang; Chu, Nain-Feng; Chang, Chi-Wen; Wang, Shu-Li; Yang, Hsin-Chou; Chu, Chi-Ming; Chang, Chu-Ting; Lin, Ming-Huang; Chien, Wu-Chien; Su, Sui-Lung; Chou, Yu-Ching; Chen, Kang-Hua; Wang, Wei-Ming; Liou, Saou-Hsing

    2013-01-01

    Although the genetic basis of androgenic alopecia has been clearly established, little is known about its non-genetic causes, such as environmental and lifestyle factors. This study investigated blood and urine heavy metals concentrations, environmental exposure factors, personal behaviors, dietary intakes and the genotypes of related susceptibility genes in patients with androgenic alopecia (AGA). Age, AGA level, residence area, work hours, sleep patterns, cigarette usage, alcohol consumption, betel nut usage, hair treatments, eating habits, body heavy metals concentrations and rs1998076, rs913063, rs1160312 and rs201571 SNP genotype data were collected from 354 men. Logistic regression analysis was performed to examine whether any of the factors displayed odds ratios (ORs) indicating association with moderate to severe AGA (≥ IV). Subsequently, Hosmer-Lemeshow, Nagelkerke R(2) and accuracy tests were conducted to help establish an optimal model. Moderate to severe AGA was associated with the AA genotype of rs1160312 (22.50, 95% CI 3.99-126.83), blood vanadium concentration (0.02, 95% CI 0.01-0.04), and regular consumption of soy bean drinks (0.23, 95% CI 0.06-0.85), after adjustment for age. The results were corroborated by the Hosmer-Lemeshow test (P = 0.73), Nagelkerke R(2) (0.59), accuracy test (0.816) and area under the curve (AUC; 0.90, 0.847-0.951) analysis. Blood vanadium and frequent soy bean drink consumption may provide protect effects against AGA. Accordingly, blood vanadium concentrations, the AA genotype of rs1160312 and frequent consumption of soy bean drinks are associated with AGA.

  4. Topical adenosine increases thick hair ratio in Japanese men with androgenetic alopecia.

    Science.gov (United States)

    Watanabe, Y; Nagashima, T; Hanzawa, N; Ishino, A; Nakazawa, Y; Ogo, M; Iwabuchi, T; Tajima, M

    2015-12-01

    Hair thickness is more important than hair density in the appearance of baldness in male with androgenetic alopecia (AGA). Adenosine improves hair loss by stimulating hair growth and by thickening hair shafts in women. The objective of this study was to evaluate the hair growth efficacy and safety of topical adenosine in men with AGA. A lotion containing either adenosine or niacinamide was administered to the scalps of 102 Japanese men twice daily for 6 months in a double-blind, randomized study. Efficacy was evaluated by dermatologists who assessed the quality of the hair and by calculating the percentages of vellus-like and thick hairs among the vertex hairs, as well as hair density. Adenosine was significantly (P < 0.05) superior to niacinamide in terms of global improvement of AGA, increase in the percentage of thick hairs (at least 60 μm) and self-assessment of hair thickness by the study participants. No causal adverse event due to the adenosine lotion was observed. These data indicate that adenosine increases thick hair ratio in Japanese men with AGA, and this compound is useful for the improvement of AGA. © 2015 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

  5. Differential effect of assisted reproductive technology and small-for-gestational age on fetal cardiac remodeling.

    Science.gov (United States)

    Valenzuela-Alcaraz, B; Crispi, F; Cruz-Lemini, M; Bijnens, B; García-Otero, L; Sitges, M; Balasch, J; Gratacós, E

    2017-07-01

    Fetuses conceived by assisted reproductive technology (ART) and those that are small-for-gestational age (SGA) show cardiovascular remodeling in utero; however, these two conditions are often associated. We aimed to evaluate the differential effect of ART and SGA on fetal cardiac remodeling. This was a prospective cohort study of term singleton pregnancies seen at our department between April 2011 and September 2013. The cohort was divided according to fetal growth and mode of conception into the following four groups: 102 appropriate-for-gestational-age (AGA) fetuses conceived spontaneously (controls), 72 AGA fetuses conceived by ART (ART-AGA), 31 SGA fetuses conceived by ART (ART-SGA) and 28 SGA fetuses conceived naturally (Spont-SGA). SGA was defined as birth weight Fetal echocardiography was performed at 28-32 weeks to assess cardiac dimensions, geometry and function. ART fetuses had dilated atria (mean left atrium-to-heart area ratio: controls, 15 ± 2.7%; ART-AGA, 18 ± 4.1%; Spont-SGA, 14 ± 3.7%) and more globular ventricles (left ventricular sphericity index: controls, 1.77 ± 0.2; ART-AGA, 1.68 ± 0.2; Spont-SGA, 1.72 ± 0.2), with normally sized hearts. In contrast, SGA fetuses had enlarged hearts (cardiothoracic ratio: controls, 24 ± 3%; ART-AGA, 24 ± 4%; Spont-SGA, 29 ± 6%), preserved atrial size, more globular and concentric hypertrophic ventricles (left ventricle relative wall thickness: controls, 0.48 ± 0.17; ART-AGA, 0.54 ± 0.13; Spont-SGA, 0.63 ± 0.23). Both ART and SGA fetuses had decreased longitudinal motion (tricuspid annular ring displacement: controls, 6.5 ± 0.8 mm; ART-AGA, 5.5 ± 0.7 mm; Spont-SGA, 5.9 ± 0.6 mm) and impaired relaxation (left isovolumetric relaxation time: controls, 47.0 ± 7.3 ms; ART-AGA, 50.0 ± 7.9 ms; Spont-SGA, 49.5 ± 9.3 ms). ART-SGA fetuses presented a combination of features from both ART and SGA groups. SGA and conception with ART

  6. Russian Chronicles and Diplomatic Documents on the Moscow-Crimean-Kazan Relations at the end of the 15th – the first half of the 16th centuries

    Directory of Open Access Journals (Sweden)

    A.V. Aksanov

    2016-12-01

    Full Text Available Research objective: The article analyzes chronicles’ and diplomatic information about joining of the Kazan Khanate to the Moscow-Crimean alliance in 1487, about the joint actions of these three states against the Great Horde in 1491–1492 and about the Moscow-Crimean-Kazan peace negotiations of 1537–1542. Research materials: Special attention is given to inconsistencies in the sources that often has not been considered in the historiography. In official chronicles the campaign of 1487 marks the submission of Kazan. Whereas diplomatic documents represent the expedition of the Moscow troops of 1487 as the military aid of Ivan III to the khan Mahomed-Amin in his struggle for the Kazan throne. According to official chronicles, in 1491 the Kazan khan warred against the Horde on the side of the Crimea by the order of the Moscow sovereign. In turn, in the Novgorod chronicle the campaign of 1491 is represented as the act of the help of Ivan III to the sultan Satylgan and khan Mahomed-Amin in their fight against the Great Horde. The data of diplomatic documents are consistent with the estimate of the Novgorod chronicle. Research results and novelty: Therefore, it can be assumed that Mahomed-Amin participated in the war against the Great Horde as he was in allied relations with Moscow and the Crimea. Diplomatic documents confirm the point of view of official chroniclers of rather intermediary role of the Crimean khan in the Moscow-Kazan negotiations of 1537–1542. Thus, they display a completely different character of the relations between Moscow, the Crimea and Kazan. The Moscow boyars demanded from the Kazan khan to recognize the supremacy of the Moscow sovereign. In turn, the governors of the Crimea and Kazan called for equal relations. Possibly, this contradiction was the main reason for a failure of the peace negotiations.

  7. Viagens, tremores e conchas: aspectos da natureza da América em escritos de José Bonifácio de Andrada e Silva, José Hipólito Unanúe e Dámaso Antonio Larrañaga

    Directory of Open Access Journals (Sweden)

    Maria Margaret Lopes

    Full Text Available Este artigo apresenta aspectos da produção científica de três ilustrados que atuaram na América do Sul: José Bonifácio de Andrada e Silva (1763-1838, José Hipólito Unanúe (1755-1833 e Dámaso Antonio Larrañaga (1771-1848. Os três naturalistas - de trajetórias, territórios e crenças diferenciadas - construíram suas versões sobre aspectos da natureza da América. Em comum, contribuíram com seus trabalhos científicos para a construção da geohistória americana. Foram escolhidos para análise por critérios de dispersão territorial e por suas diferentes abordagens sobre aspectos específicos das Ciências da Terra - temas que ainda hoje têm merecido menor atenção, mesmo entre os historiadores latino-americanos das ciências. Este artigo argumenta que estes personagens não só construíram seus próprios conhecimentos sobre temperamentos (climas e territórios, como também utilizaram seu conhecimento científico no implemento de ações políticas para os seus respectivos países em conformação.

  8. Cord Blood Ischemia-Modified Albumin Levels in Normal and Intrauterine Growth Restricted Pregnancies

    Directory of Open Access Journals (Sweden)

    Nicoletta Iacovidou

    2008-01-01

    Full Text Available Ischemia-modified albumin (IMA is a sensitive biomarker of cardiac ischemia. Intrauterine growth restriction (IUGR may imply fetal hypoxia, resulting in blood flow centralization in favour of vital organs (brain, heart, adrenals—‘‘brain sparing effect’’. Based on the latter, we hypothesized that cord blood IMA levels should not differ between IUGR and appropriate-for-gestational-age (AGA full-term pregnancies. IMA was measured in blood samples from doubly-clamped umbilical cords of 110 AGA and 57 asymmetric IUGR pregnancies. No significant differences in IMA levels were documented between AGA and IUGR groups. IMA levels were elevated in cases of elective cesarean section (P = .035, and offspring of multigravidas (P = .021. In conclusion, ‘‘brain sparing effect’’ is possibly responsible for the lack of differences in cord blood IMA levels at term, between IUGR and AGA groups. Furthermore, higher oxidative stress could account for the elevated IMA levels in cases of elective cesarean section, and offspring of multigravidas.

  9. Risk of hearing loss in small for gestational age neonates

    Directory of Open Access Journals (Sweden)

    Melani Rakhmi Mantu

    2011-02-01

    Full Text Available Background Small for gestational age (SGA neonates often have intrauterine growth restriction due to placental insufficiency and chronic hypoxia. These conditions may cause developmental impairment, psychosocial disabilities, or metabolic dysfunction in later life. Previous studies have shown greater incidence of speech and language disabilities, learning impairment, and neuromotor dysfunction in term SGA infants compared to term appropriate for gestational age (AGA infants. Objective To compare hearing loss in SGA and AGA neonates using otoocoustic emission (OAE tests and to study correlations between maternal risk factors and hearing loss in SGA neonates. Methods A cross-sectional study was performed in St. Borromeus Hospital, Limijati Hospital, and Melinda Hospital in Bandung from February to May 2010. Study subjects consisted of full-term neonates born in these three hospitals. A retrospective medical record review was performed for this study. Statistical analysis was done by multivariable logistic-regression. Results There was a total of 4279 subjects in our study, including 100 SGA neonates and 4179 AGA neonates. We observed a greater percentage of OAE 'refer' (indicating abnormal OAE results in the SGA group compared to the AGA group (P<0.001, Z=13.247. For suhjects with OAE 'refer' results, we also analyzed the correlation to the following maternal risk factors: smoking, hypertension, diabetes mellitus and asthma. We also found significant differences between  those with and without each of the four maternal risk factors studied (P< 0.001. By using multivariant analysis to compare SGA and AGA neonates, we found the odds ratio (OR to he 4.34 (95% CI 2.52 to 7.49, P=0.001, meaning the SGA group had a 4.34 times higher risk of hearing loss than the AGA group. Conclusion SGA neonates had a higher risk of hearing loss than AGA neonates. In addition, maternal smoking, hypertension, diabetes mellitus and asthma significantly correlated to

  10. case study: khan school in shiraz

    African Journals Online (AJOL)

    J. MahdiNejad, A. Sadeghi HabibAbad

    2016-09-01

    Sep 1, 2016 ... This paper, while examining the impact of Islamic thought .... Today, it is proven in psychology and sociology that nature as a ... Colors and other patterns in decorations in Islamic art have certain implications, and applied.

  11. Comparing American Gastroenterological Association Pancreatic Cyst Management Guidelines with Fukuoka Consensus Guidelines as Predictors of Advanced Neoplasia in Patients with Suspected Pancreatic Cystic Neoplasms.

    Science.gov (United States)

    Ma, Gene K; Goldberg, David S; Thiruvengadam, Nikhil; Chandrasekhara, Vinay; Kochman, Michael L; Ginsberg, Gregory G; Vollmer, Charles M; Ahmad, Nuzhat A

    2016-11-01

    In 2015, the American Gastroenterological Association (AGA) published guidelines to provide recommendations for management of suspected pancreatic cystic neoplasms (PCNs). The aim of this study was to compare efficacy of these with the Fukuoka consensus guidelines in predicting advanced neoplasia (AN) in patients with suspected PCNs. We performed a retrospective study of 239 patients who underwent surgical resection for suspected mucinous PCN at a tertiary care center from 2000 to 2014. Surgical pathology was the gold standard. The AGA and Fukuoka criteria were applied, and their performance in predicting AN, defined as invasive cancer or high-grade dysplasia (HGD), was assessed. Advanced neoplasia was found in 71 of 239 (29.7%) patients (28 invasive cancer, 43 HGD). The Fukuoka "high-risk" (FG-HR) and AGA "high-risk" (AGA-HR) criteria identified patients with AN with sensitivities of 28.2% and 35.2%, specificities of 95.8% and 94.0%, positive predictive values of 74.1% and 71.4%, and negative predictive values of 75.9% and 77.5%, respectively. Overall, there was no significant difference between the guidelines for prediction of AN. There were 7 and 6 cases with invasive cancer, and 23 and 24 cases with HGD missed by the FG-HR and AGA-HR guidelines, respectively. In a retrospective analysis, the AGA guidelines are not superior to the Fukuoka guidelines in identifying AN in suspected PCNs. Both sets of guidelines have fair PPV for detection of AN, which would lead to avoidable resections in patients without AN. Additionally, the high-risk features of both guidelines do not accurately identify all patients with AN. Copyright © 2016 American College of Surgeons. Published by Elsevier Inc. All rights reserved.

  12. Carboxyhemoglobin levels in umbilical cord blood of women with pre-eclampsia and intrauterine growth restriction.

    Science.gov (United States)

    Yusuf, Kamran; Kamaluddeen, Majeeda; Wilson, R Douglas; Akierman, Albert

    2012-11-01

    Pre-eclampsia (PE) and intrauterine growth restriction (IUGR) are associated with abnormal placentation. Heme oxygenase (HO) and carbon monoxide (CO) are involved in normal placental development and function and vasomotor control in the placenta. The objective of our study was to measure CO levels, as assessed by carboxyhemoglobin (COHb) levels in the umbilical cord arterial blood of women with PE, normotensive IUGR (<10th percentile for birth weight), and normotensive pregnancies with appropriate-for-gestational age (AGA) infants. We prospectively analyzed COHb levels in the umbilical arterial blood of women with PE, normotensive IUGR, and normotensive AGA pregnancies. Exclusion criteria included cigarette smoke exposure, hemolytic disorders, a positive direct anti-globulin test, chronic hypertension, fever, and any significant medical illness. COHb levels were measured using the ABL 725 blood gas analyzer. There were 41 women in the normotensive AGA group, 42 in the PE group, and 36 in the normotensive IUGR group. Maternal age, mode of delivery, gravidity, parity, and gender of the infants were similar in the three groups. Gestational age and birth weight were significantly higher in the normotensive AGA group compared with the other two groups. COHb levels were significantly lower in the PE group compared with the normotensive AGA group (0.38±0.06% vs. 0.77±0.11%, P<0.05). COHb levels, although lower in the normotensive IUGR group compared with the normotensive AGA group, did not reach statistical significance. Our data suggests the HO-CO system may have a role in the pathogenesis of PE. We also, for the first time, provide information on umbilical arterial COHb levels in normotensive IUGR pregnancies.

  13. One world schoolhouse education reimagined

    CERN Document Server

    Khan, Salman

    2013-01-01

    A free, world-class education for anyone, anywhere: this is the goal of the Khan Academy, a passion project that grew from an ex-engineer and hedge funder's online tutoring sessions with his niece, who was struggling with algebra, into a worldwide phenomenon. Today millions of students, parents, and teachers use the Khan Academy's free videos and software, which have expanded to encompass nearly every conceivable subject; and Academy techniques are being employed with exciting results in a growing number of classrooms around the globe. Like many innovators, Khan rethinks existing assumptions and imagines what education could be if freed from them. And his core idea - liberating teachers from lecturing and state-mandated calendars and opening up class time for truly human interaction - has become his life's passion. Schools seek his advice about connecting to students in a digital age, and people of all ages and backgrounds flock to the site to utilise this fresh approach to learning. In THE ONE WORLD SCHOOL...

  14. Frequency of Anaemia in Married Women in Jutial, Gilgit

    International Nuclear Information System (INIS)

    Hassan, U.

    2013-01-01

    Objectives: To determine the frequency of anaemia in married women in Jutial, and to find out the relationship of risk factors of anaemia with levels of anaemia. Study Design: Cross-sectional study. Place and Duration of Study: Household survey carried out in Jutial, Gilgit 1st February 2008 to 30th April 2009. Patients and Method: Interview administered questionnaire along with blood sample collection using sterilized disposable syringes was used in this study on a total of 382 randomly selected, willing, married, non-pregnant, non-lactating women with one or more children. Results were considered significant if r-value was more than 0.5 with p-value less than 0.05. Results: Clinical analysis of the blood samples showed that the average haemoglobin (Hb) level was 12.8 g/dl. According to WHO standards, no woman had severe anaemia with Hb level below 7 g/dl. Majority of the women (77.5%) had normal Hb >= 12 g/dl. The calculated anaemia frequency of 22.5% was found to be little lower than that of national anaemia frequency of around 29 to 33%. Conclusion: Frequency of anaemia 22.5% can be attributed to good education system in Northern Area and the awareness of people towards health concerns. Another reason can be the initiatives by different NGOs working in the area specially Aga Khan Foundation to eradicate anaemia by developing a vast network of health facilities. Further research on the native foods, their extract nutritional values / iron contents and any special foods at higher altitudes may be more than 1500 meters can open new horizon to our understanding of anaemia in the northern areas. (author)

  15. The role of family configuration in early childhood intellectual development in the context of an extended family system in Pakistan

    Directory of Open Access Journals (Sweden)

    Avan B

    2007-01-01

    Full Text Available Context: The confluence theory of intelligence by Zajonc and Markus emphasizes that individual intellectual difference of children manifests itself in the context of family configuration. Instead of assuming its generalizability, careful scientific work is required before applying the model to South Asian cultures where, predominantly, an extended family type exists. Aims: To assess the role of extended family configuration on the child′s intellectual development in a South Asian setting. Settings and Design: A cross-sectional study was conducted on 4-5-year-old preschool children residing in Karachi, Pakistan. Materials and Methods: Three hundred and forty-two child and mother dyads were assessed through a validated cognitive psychometric tool and through a structured questionnaire. Children who were registered at the main Mother and Child Health Centres (MCH of the Aga Khan Health Services, Pakistan (AKHSP Karachi and who were born between July 1st 1993-June 30th 1994 with traceable birth records at the maternity homes, were considered for this study. Statistical Analysis: Multivariate linear regression models were used to identify the individual effect of family configuration on the intellectual scores. Results: Family configuration variables such as number of co-residents ( P < 0.05 and the number of siblings ( P < 0.01 in the house were significantly correlated with the psychometric score. Even after controlling for gender, socio-economic status, birth order and birth intervals, significant differentials were observed in favor of an extended family system on a child′s intellectual development. Conclusion: The findings suggest the positive role of co-residents of an extended family environment on the intellectual development in early childhood.

  16. Maternal and neonatal outcome in obstetric cholestasis: a comparison of early versus late term delivery

    International Nuclear Information System (INIS)

    Anjum, N.; Babar, N.; Sheikh, S.

    2015-01-01

    To evaluate maternal and neonatal outcome in Obstetric Cholestasis (OC) in early versus late term delivery. Study Design: Retrospective cohort study. Place and Duration of Study: Aga khan hospital for women (AKHW) Karimabad, Karachi, from 1st Jan, 2011 to 31st Oct, 2012. Patient and Methods: This was a retrospective cohort study. All patients of OC with singleton pregnancy, admitted for labor induction between Jan 2011 to Oct 2012 were included in the study. At or after 37 week of gestation, patient is offered labor induction. Patients were divided in two groups as in early term delivery (Group A) and late term delivery (Group B). Early term delivery is taken from 37+o to 37+6 and late term delivery at or after 38 weeks of gestation. The demographic, laboratory and clinical data of these patients were collected from their medical record. Maternal and neonatal outcome were analyzed using SPSS version 19. Results: The study found that in obstetric cholestasis patients admitted for labor induction, the risk of caesarean delivery was higher in group A (before 38 weeks) as compared to group B (after 38 weeks). There was no difference in postpartum hemorrhage and drop in hemoglobin between two groups. Obstetric cholestasis was not associated with adverse perinatal outcome such as intrauterine death (IUD), low Apgar Scores, respiratory distress and neonatal intensive care admission in both the groups. However more cases of neonatal jaundice were observed in babies born after 38 weeks. Conclusion: OC patients who deliver after 38 weeks of gestation have a higher chance of vaginal delivery without increasing the risk of IUD. (author)

  17. A double base change in alternate base pairs induced by ultraviolet irradiation in a glycine transfer RNA gene

    International Nuclear Information System (INIS)

    Coleman, R.D.; Dunst, R.W.; Hill, C.W.; Pennsylvania State Univ., Hershey

    1980-01-01

    The glyUsusub(AGA) mutation affects Escherichia coli tRNAsup(Gly)sub(GGG), changing it to an AGA missense suppressor tRNA. Sequence studies have shown that the mutation involves a double base substitution at the first and third positions of the tRNA anticodon, the result being a change in the anticodon from CCC to UCU. A system has been developed to facilitate the detection of this novel mutation, and we have shown that ultraviolet irradiation and N-methyl-N'-nitro-N-nitrosoguanidine (MNNG) are effective in causing the double base change. A single observation of the mutation occuring spontaneously has been made also. The frequency of MNNG-induced glyUsusub(AGA) mutations is compatible with their being caused by two separate mutagenic events. The frequency of UV-induced glyUsusub(AGA) mutations, however, strongly suggests that the occurence of one base substitution strongly enhances the chance of finding the second substitution at the alternate position. In addition to the double change in the anticodon, the glyUsusub(AGA) tRNA differs from tRNAsup(gly)sub(GGG) in that it bears a modification of the A adjacent to the 3' position of the anticodon. Most likely, this modified base is N-[9-(β-D-ribofuranosyl)-purin-6-ylcarbamoyl] threonine. (orig.) 891 AJ/orig. 892 BRE [de

  18. Evaluation of hyperandrogenemia and metabolic risk profile in women with postadolescent acne

    Directory of Open Access Journals (Sweden)

    Leyla Baykal Selçuk

    2016-06-01

    Full Text Available Background and Design: Postadolescent acne is a disease with relapses frequently seen in women. Treatment is difficult. In our study, we aimed to investigate the clinical and biochemical characteristics of hyperandrogenism and the prevalence of metabolic disorders, such as metabolic syndrome (MS and dyslipidemia in women with postadolescent acne. Materials and Methods: This study was conducted on 50 women who attended our department with the complaint of postadolescent acne between July 2014 and December 2014. The presence of androgenetic alopecia (AGA, hirsutism, polycystic ovary syndrome (PCOS, MS, dyslipidemia, and obesity was evaluated. Results: Seborrhea was present in 56%, hirsutism in 40%, AGA in 26%, and PCOS in 24% of women with postadolescent acne. The prevalence of MS and dyslipidemia was 24% and 44%, respectively. The prevalence of MS was significantly higher in patients with AGA and hirsutism. There was no association of MS with menstrual irregularity and PCOS. There was no significant association of dyslipidemia with AGA, hirsutism, PCOS, and menstrual irregularity. Conclusion: Clinical symptoms of hyperandrogenism, such as hirsutism, AGA, and PCOS were more common in women with postadolescent acne but androgenic hormone profile abnormalities were minimal. As a result, postadolescent acne resistant to treatment may be considered as an early marker in the early diagnosis of PCOS in women to prevent the development of type 2 diabetes mellitus, MS and hypercholesterolemia.

  19. Just in Time to Flip Your Classroom

    OpenAIRE

    Lasry, Nathaniel; Dugdale, Michael; Charles, Elizabeth

    2013-01-01

    With advocates like Sal Khan and Bill Gates, flipped classrooms are attracting an increasing amount of media and research attention. We had heard Khan's TED talk and were aware of the concept of inverted pedagogies in general. Yet, it really hit home when we accidentally flipped our classroom. Our objective was to better prepare our students for class. We set out to effectively move some of our course content outside of class and decided to tweak the Just-in-Time-Teaching approach (JiTT). To ...

  20. Sheet universes and the shapes of Friedmann universes

    International Nuclear Information System (INIS)

    Lynden-Bell, D.; Redmount, I.H.

    1989-01-01

    Unless Ω>1,the Big Bang did not start from a point. Consideration shows sheet universes in which matter is confined to a homogeneous universe. Sheet universes and the corresponding embeddings of FRW universes into Minkowski space are drawn. Their initial singularities are shown to be point-like for the 'closed' case, line-like for the 'flat' (Ω=1) case and surface-like for the 'open' case. In contrast to the cross-sections at constant comoving proper time, typical spacelike cross-sections of the 'flat' universes are closed and encounter their extensive singularities. All cross-sections of the 'closed' universe are closed and only very special cross-sections encounter the point singularities at the Big Bang or the Big Crunch. (author)

  1. CRM system benefits : A case study of banking sector

    OpenAIRE

    Murrawat, Adnan; Nasershariati, Foroozan

    2011-01-01

    Seminar Date: 05-11-2011 Level: Master Thesis in Information Technology Management,   15ECTS Institution: School of Sustainable Development of Society and Technology, Malardalen University Authors: Adnan Murrawat Khan [amt1001]         Foroozan Nasershariati [fni10002]                                              Title: CRM system benefits, a case study of banking sector Supervisor: Dr Ole Liljefors Problem statement: Customer relationship management (CRM) systems have been adopted to have b...

  2. Memories of Statehood in the “Defter-i Genghis-name” »

    Directory of Open Access Journals (Sweden)

    Maria Ivanics

    2016-09-01

    Full Text Available The Turkic peoples of the Volga Region lost their statehood for centuries due to the Russian occupation of the Khanate of Kazan and Astrakhan in the mid–16th century. The memory of statehood among these peoples has been maintained and preserved for posterity through the oral historiography of the steppe. It comes as no surprise then that there has been an effort to create and strengthen the national identities in the post-Soviet Turkic republics with the successive publication of the latest editions of national epics and collections of historical stories. Research objectives and materials: This investigation focuses on one such source that forms part of the oral historiography of the steppe, a Genghis-name compiled and re­corded by an unknown author in the late 17th century. The chapter on Genghis Khan contains two stories that depict the various forms of organisational practices in nomadic states. The first was characteristic of the Golden Horde and the Nogai Horde at its zenith; it concerns the joint rule of the khan and the beglerbeg. The second depicts relations in the late Golden Horde and its successor states, in which the khan and the four chieftains constituted and led the country together. In the Genghis-name we could set the type of a super complex chiefdom headed by Temir Kutlu Khan with his four karačı biy’s of the clans Kiyat, Kongrat, Cathay, Saldzhut. Research results and novelty: It was possible to give an answer to the question why are so different the karačı biy’s of the Great Horde of those in the other late Golden Horde states. A historian can glean information from this story both on the age in which the source was created and on practices of nomadic rule: What stands out above all is that the clans had the right to resist and that they were able to shift away from their tyrannical rulers without any consequences and seek a new ruler for themselves. The steppe lacked the po­wer of law that would have enabled the

  3. Aga miks mitte panustada teraviljale? / Tarvo Vaarmets

    Index Scriptorium Estoniae

    Vaarmets, Tarvo

    2007-01-01

    Üha populaarsust koguvate ETFide ehk börsil kaubeldavate fondide hulka on lisandunud ka viimaste variatsioonid ETCd ehk börsil kaubeldavad toorained, nende perspektiivikust tõstab tarbimise kasv maailmas. Tabel: Millistel börsidel tehakse tehinguid ETF-idega

  4. Pension tõuseb - aga edasi? / Eiki Nestor

    Index Scriptorium Estoniae

    Nestor, Eiki, 1953-

    2008-01-01

    Pensionide uuest indekseerimise korrast. Ilmunud ka Nädaline 20. märts 2008, lk. 4 ; Valgamaalane 20. märts 2008, lk. 2 ; LõunaLeht 20. märts 2008, lk. 4 ; Põhjarannik 20. märts 2008, lk. 4 ; Võrumaa Teataja 25. märts 2008, lk. 2 ; Vali Uudised 26. märts 2008, lk. 2 ; Sõnumitooja 26. märts 2008, lk. 6 ; Meie Maa 25. märts 2008, lk. 2 ; Lääne Elu 25. märts 2008, lk. 2 ; Kuulutaja 28. märts 2008, lk. 4 ; Türi Rahvaleht 28. märts 2008, lk. 4 ; Oma Saar 28. märts 2008, lk. 5 ; Vooremaa 22. märts 2008, lk. 2 ; Pärnu Postimees 27. märts 2008, lk. 15 ; Narva Postiljon 5. aprill 2008, lk. 2 ; Videvik 3. aprill 2008, lk. 2 ; Virumaa Teataja 8. aprill 2008, lk. 11 ; Nädalaleht 20. märts 2008, lk. 5

  5. Lack of concordance and linkage disequilibrium among brothers for androgenetic alopecia and CAG/GGC haplotypes of the androgen receptor gene in Mexican families.

    Science.gov (United States)

    Arteaga-Vázquez, Jazmín; López-Hernández, María A; Svyryd, Yevgeniya; Mutchinick, Osvaldo M

    2015-12-01

    Androgenetic alopecia (AGA) or common baldness is the most prevalent form of hair loss in males. Familial predisposition has been recognized, and heritability estimated in monozygotic twins suggests an important genetic predisposition. Several studies indicate that the numbers of CAG/GGC repeats in exon 1 of the androgen receptor gene (AR) maybe associated with AGA susceptibility. To investigate a possible correlation between AR CAG/GGC haplotypes and the presence or not of alopecia in sibships with two or more brothers among them at least one of them has AGA. Thirty-two trios including an alopecic man, one brother alopecic or not, and their mother were enrolled. Sanger sequencing of the exon 1 of the AR gene was conducted to ascertain the number of CAG/GGC repeats in each individual. Heterozygous mother for the CAG/GGC haplotypes was an inclusion criterion to analyze the segregation haplotype patterns in the family. Concordance for the number of repeats and AGA among brothers was evaluated using kappa coefficient and the probability of association in the presence of genetic linkage between CAG and GGC repeats and AGA estimated by means of the family-based association test (FBAT). The median for the CAG and GGC repeats in the AR is similar to that reported in other populations. The CAG/GGC haplotypes were less polymorphic than that reported in other studies, especially due to the GGC number of repeats found. Kappa coefficient resulted in a concordance of 37.3% (IC 95%, 5.0-69.0%) for the AGA phenotype and identical CAG/GGC haplotypes. There was no evidence of linkage disequilibrium. Our results do not confirm a possible correlation or linkage disequilibrium between the CAG/GGC haplotypes of the AR gene and androgenetic alopecia in Mexican brothers. © 2015 Wiley Periodicals, Inc.

  6. Aminoglycoside antibiotics as a tool for the study of the biological role of calcium ions. Historical overview.

    Science.gov (United States)

    Corrado, A P; de Morais, I P; Prado, W A

    1989-01-01

    Beginning with the pioneering work of Vital-Brazil and Corrado (1957), which suggested a possible interaction between aminoglycoside antibiotics (AGA) and calcium ions at the neuromuscular junction, the authors review the studies that demonstrated the existence of a competitive antagonism between AGA and calcium ions. In view of the low liposolubility of AGA and their inability to cross biological membranes, this antagonism seems to occur exclusively at calcium-binding sites at the level of the outer opening of calcium channels of the N-subtype, which are also the sites of interaction of omega-conotoxin. Being highly water soluble, AGA are easily removed from their binding sites with a consequent rapid reversal of their effects, a factor of primary importance to explain their wide use as tools in the pharmacological analysis of the study of the biological role of calcium ion on the membrane's outer surface. This use has advantages over the use of inorganic di- and trivalent cations such as Mg2+, Mn2+, Cd2+, Ni2+, La3+, etc., since the latter, though they are considered to be the most specific competitive antagonists of calcium ions, may induce biphasic effects due to their ability to cross the membranes and replace calcium and/or increase intracellular calcium concentration. The performance of AGA is also superior when compared with the so-called "specific" organic calcium antagonists--verapamil and nifedipine derivatives--since the latter, in addition to inducing possible biphasic effects, antagonize calcium in a non-competitive manner. Finally, the authors remark that AGA-Ca2+ antagonism relevance is not limited only to basic aspects and that it may have therapeutic implications since it provides alternatives for reducing the toxic adverse effects of this important group of antibiotics.

  7. American Gastroenterological Association guidelines are inaccurate in detecting pancreatic cysts with advanced neoplasia: a clinicopathologic study of 225 patients with supporting molecular data.

    Science.gov (United States)

    Singhi, Aatur D; Zeh, Herbert J; Brand, Randall E; Nikiforova, Marina N; Chennat, Jennifer S; Fasanella, Kenneth E; Khalid, Asif; Papachristou, Georgios I; Slivka, Adam; Hogg, Melissa; Lee, Kenneth K; Tsung, Allan; Zureikat, Amer H; McGrath, Kevin

    2016-06-01

    The American Gastroenterological Association (AGA) recently reported evidence-based guidelines for the management of asymptomatic neoplastic pancreatic cysts. These guidelines advocate a higher threshold for surgical resection than prior guidelines and imaging surveillance for a considerable number of patients with pancreatic cysts. The aims of this study were to assess the accuracy of the AGA guidelines in detecting advanced neoplasia and present an alternative approach to pancreatic cysts. The study population consisted of 225 patients who underwent EUS-guided FNA for pancreatic cysts between January 2014 and May 2015. For each patient, clinical findings, EUS features, cytopathology results, carcinoembryonic antigen analysis, and molecular testing of pancreatic cyst fluid were reviewed. Molecular testing included the assessment of hotspot mutations and deletions for KRAS, GNAS, VHL, TP53, PIK3CA, and PTEN. Diagnostic pathology results were available for 41 patients (18%), with 13 (6%) harboring advanced neoplasia. Among these cases, the AGA guidelines identified advanced neoplasia with 62% sensitivity, 79% specificity, 57% positive predictive value, and 82% negative predictive value. Moreover, the AGA guidelines missed 45% of intraductal papillary mucinous neoplasms with adenocarcinoma or high-grade dysplasia. For cases without confirmatory pathology, 27 of 184 patients (15%) with serous cystadenomas (SCAs) based on EUS findings and/or VHL alterations would continue magnetic resonance imaging (MRI) surveillance. In comparison, a novel algorithmic pathway using molecular testing of pancreatic cyst fluid detected advanced neoplasias with 100% sensitivity, 90% specificity, 79% positive predictive value, and 100% negative predictive value. The AGA guidelines were inaccurate in detecting pancreatic cysts with advanced neoplasia. Furthermore, because the AGA guidelines manage all neoplastic cysts similarly, patients with SCAs will continue to undergo unnecessary MRI

  8. Lean body mass in small for gestational age and appropriate for gestational age infants

    International Nuclear Information System (INIS)

    Petersen, S.; Gotfredsen, A.; Knudsen, F.U.

    1988-01-01

    Dual photon absorptiometry using 153 Gd in a whole-body scanner was used to measure lean body mass (LBM) in 51 newborn infants. LBM% decreased exponentially with increasing gestational age in both small for gestational age (SGA) and appropriate for gestational age (AGA) infants. In preterm SGA and AGA infants LBM was 104% and 103%, respectively, indicating that no fat was detectable. In term SGA infants LBM was 98%, which corresponded to 48 gm fat on average, and in term AGA infants LBM was 87%, which corresponded to 452 gm fat on average. The LBM%, ponderal index, and skinfold thickness were significantly different between AGA and SGA infants. Infants with clinical signs of intrauterine wastage had significantly higher LBM% than did infants without signs of weight loss. Our results on LBM% by dual photon absorptiometry agree with earlier dissection data; the clinically applicable methods of (1) height combined with weight (i.e., ponderal index), (2) skinfold thickness, and (3) scoring by clinical observations are useful for the estimation of lack of fat as an indicator of intrauterine growth retardation

  9. Genetics and other factors in the aetiology of female pattern hair loss.

    Science.gov (United States)

    Redler, Silke; Messenger, Andrew G; Betz, Regina C

    2017-06-01

    Pattern hair loss is the most common form of hair loss in both women and men. Male pattern hair loss, also termed male androgenetic alopecia (M-AGA), is an androgen-dependent trait that is predominantly genetically determined. Androgen-mediated mechanisms are probably involved in female pattern hair loss (FPHL) in some women but the evidence is less strong than in M-AGA; other non-androgenic pathways, including environmental influences, may contribute to the aetiology. Genome-wide association studies have identified several genetic loci for M-AGA and have provided better insight into the underlying biology. However, the role of heritable factors in Female Pattern Hair Loss (FPHL) is largely unknown. Recently published studies have been restricted to candidate gene approaches and could not clearly identify any susceptibility locus/gene for FPHL but suggest that the aetiology differs substantially from that of M-AGA. Hypotheses about possible pathomechanisms of FPHL as well as the results of the genetic studies performed to date are summarized. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  10. Evaluation of the relationship between androgenetic alopecia and demodex infestation

    Directory of Open Access Journals (Sweden)

    Zari Javidi

    2008-01-01

    Full Text Available Introduction: Androgenetic alopecia (AGA is one of the most common dermatologic disorders with a multifactorial etiology. Inflammatory activators such as Demodex infestation may play a role in the pathogenesis of some cases of androgenetic alopecia that do not respond to common treatments such as minoxidil and finasteride. The goal of this study is to evaluate the relationship between Demodex infestation and AGA. Materials and Methods: In this case-control study, 41 patients with AGA referred to the Dermatology Clinic of Imam Reza Hospital and 33 healthy individuals were evaluated as control. All of them were between 20 and 40 years old men. In order to identify Demodex infestation they were referred to the Parasitology laboratory. Results: Demodex was detected in 19.5% of patients and 15.2% of controls; therefore, there was no significant relationship between them statistically ( P = 0.0787. Most of patients (85.4% had greasy hair. The most common pattern of baldness was II degree in Hamilton scale. Conclusion: There is no relation between AGA and Demodex.

  11. X-ray induction of immortalization in primary rat embryo cells associated with and without tumorigenicity

    International Nuclear Information System (INIS)

    Sierra, E.; Oberley, L.W.; Guernsey, D.L.

    1985-01-01

    Cultures of primary rat embryo fibroblasts were irradiated with X-rays (3 Gy). After 14 days the majority of colonies in both irradiated and control plates had senesced. Surviving clones were ring isolated from irradiated and control plates and grown in culture. A phase of rapid proliferation after isolation was observed, followed by a decline (crisis) leading to senescence. Several clones from the irradiated plates were able to recover from this crisis and gave rise to continuous cell lines, while all colonies from control plates senesced. Three types of cells have been identified among the irradiated survivors: (1) immortal fully transformed, capable of growth in soft agar (Aga/sup +/) and tumor formation, (2) immortal normal, not able to grow in soft agar (Aga/sup -/) and nontumorigenic, and (3) immortal Aga/sup -/ cells which progressed to malignancy (Aga/sup +/, tumorigenicity) after further sub-culture. These data support the suggestion that X-rays can induce immortalization of mammalian cells in the absence of tumorigenicity, in addition to (and separate from) the fully tumorigenetic state

  12. Inflammatory markers in umbilical cord blood from small-for-gestational-age newborns

    DEFF Research Database (Denmark)

    Lausten-Thomsen, Ulrik; Olsen, Marianne; Greisen, Gorm

    2014-01-01

    This study investigates the role of inflammation in intrauterine growth retardation by exploring the levels of inflammatory markers in umbilical cord blood from neonates who were born small-for-gestational-age (SGA) and comparing them to neonates who were born appropriate-for-gestational-age (AGA...... of elevated inflammatory markers in the cord blood from SGA infants compared to AGA infants, and consequently the results suggest an inflammatory component in intrauterine growth restriction (IUGR).......This study investigates the role of inflammation in intrauterine growth retardation by exploring the levels of inflammatory markers in umbilical cord blood from neonates who were born small-for-gestational-age (SGA) and comparing them to neonates who were born appropriate-for-gestational-age (AGA...

  13. University-Community Engagement: Case Study of University Social Responsibility

    Science.gov (United States)

    Chile, Love M.; Black, Xavier M.

    2015-01-01

    Corporatisation of universities has drawn parallels between contemporary universities and business corporations, and extended analysis of corporate social responsibility to universities. This article reports on a case study of university-community engagement with schools and school communities through youth engagement programmes to enhance…

  14. モンゴル帝国期東トルキスタンの宗教 : 新疆イスラム教小史2

    OpenAIRE

    丸山, 鋼二

    2008-01-01

    After Islam was brought into the west area of the Eastern Turkistan (Xinjiang) by the Qara-Khan Dynasty in the 10th century, it took 500 years until the establishment of Islamization in the Eastern Turkistan when the Buddhism power was expelled from Hami (the east of Xinjiang) in 1513. At the beeginning of the 12th century, the Qara-Khan Dynasty was driven away from the eastern Central Asia by non-Islam Qara Khitay. From the beginning of the 13th century the eastern Central Asia was also unde...

  15. Exploring the relationship between university internationalization and university autonomy

    DEFF Research Database (Denmark)

    Turcan, Romeo V.; Gullieva, Valeria

    This paper explores a research gap at the intersection of university internationalization and university autonomy. A process model of university internationalization is put forward whereby the process of university internationalization is mediated by university internationalization capacity...... and moderated by target country institutional autonomy and globalization; and entry modes, timing and pace, as well as product mix of internationalization define university’s internationalization pattern. A systematic review is conducted to identify empirical studies at this intersection. One of the questions...

  16. Study of university students' attitudes toward office space at universities

    Directory of Open Access Journals (Sweden)

    S.M. Eteadifard

    2017-06-01

    Full Text Available Office space is the space where students first experience the university. In this paper, the attitude of students toward office space in the public sphere of university is discussed. This article is the result of the research conducted for the “Institute for Social and Cultural Studies” by the author. The main issues in this paper are: university students' attitudes towards quality office space at the universities and mental basis of common issues among students at the universities. Data were collected through individual and group interviews. More than eighty interviews with activists and students of University of Tehran, Shahid Beheshti University, Allameh Tabataba’i University, Sharif University of Technology and Kharazmi University were done. The main indicators of office space in this study include: students’ satisfaction of office space, students’ welfare affairs and students’ feedback about this space. Problems and obstacles relating to the office space and their solutions were also studied in this paper.

  17. Efficacy of a cosmetic phyto-caffeine shampoo in female androgenetic alopecia.

    Science.gov (United States)

    Bussoletti, Carolina; Tolaini, Maria V; Celleno, Leonardo

    2018-03-06

    Androgenetic alopecia (AGA) is the most common type of hair loss in both males as well as females, occurring in up to 57% of women by the age of 80 years. Androgenetic alopecia is associated with a high psychological burden and often results in substantially reduced quality of life, poor body image and low self-esteem, particularly in women. Caffeine-based products have shown promise, both in vitro and in vivo, as potential treatments for AGA. This study was performed to determine the efficacy of a phyto-caffeine- containing shampoo used over a 6-month period in female subjects with AGA. This was a single-centre, double-blind parallel trial in which female subjects with AGA were randomized to either a phyto-caffeine-containing shampoo or a control shampoo. The primary endpoint was the change from baseline in the number of hairs pulled in a hair pull test at 6 months. Hair loss intensity, hair strength, subject satisfaction and tolerability were also assessed. Subjects using the phyto-caffeine-containing shampoo had significantly fewer hairs pulled in a hair pull test at 6 months, compared with subjects using the control shampoo (-3.1 vs -0.5 hairs; pshampoo, compared with controls. Both products were very well tolerated. Compared with a control shampoo, a phyto-caffeine-containing shampoo was more efficacious, with respect to the number of hairs being pulled out at 6 months, hair loss intensity and hair strength in subjects with AGA.

  18. Quantitative Shear-Wave Elastography of the Liver in Preterm Neonates with Intra-Uterine Growth Restriction.

    Directory of Open Access Journals (Sweden)

    Marianne Alison

    Full Text Available The feasibility and reproducibility of liver stiffness measurements using Supersonic Shear-wave Imaging (SSI in preterm neonate have not been reported. Our aim was to determine if liver stiffness differs between intra-uterine growth restriction (IUGR and appropriate for gestational age (AGA preterm infants with/without cholestasis. We measured liver stiffness (in kPa in 45 AGA and 18 IUGR preterm infants, and assessed reproducibility in 26 preterms using Intraclass Correlation Coefficients (ICC and Bland-Altman tests. Liver stiffness values were compared between AGA and IUGR with and without cholestasis and correlated with birth weight. Measurements showed high reproducibility (ICC = 0.94-0.98 for intra-operator, 0.86 for inter-operator with good agreement (95% limits: -1.24 to 1.24 kPa. During the first postnatal week, liver stiffness was higher in IUGR (7.50 ±1.53 kPa than in AGA infants (5.11 ±0.80 kPa, p<0.001. After day 8, liver stiffness remained unchanged in AGA but increased progressively in IUGR infants (15.57 ±6.49 kPa after day 21. Liver stiffness was higher in IUGR neonates with cholestasis (19.35 ± 9.80 kPa than without cholestasis (7.72 ± 1.27 kPa, p<0.001. In conclusion, quantitative liver SSI in preterms is feasible and reproducible. IUGR preterms who will develop cholestasis present high liver stiffness even at birth, before biological cholestasis occurs.

  19. Overweight and Obesity Based on Four Reference Systems in 18,382 Paediatric Patients with Type 1 Diabetes from Germany and Austria

    Directory of Open Access Journals (Sweden)

    M. Flechtner-Mors

    2015-01-01

    Full Text Available Aim. To evaluate the prevalence of overweight and obesity in paediatric type 1 diabetes (T1D subjects, based on four commonly used reference populations. Methods. Using WHO, IOTF, AGA (German pediatric obesity, and KiGGS (German Health Interview and Examination Survey for Children and Adolescents reference populations, prevalence of overweight (≥90th percentile and obesity (≥97th percentile and time trend between 2000 (n = 9,461 and 2013 (n = 18,382 were determined in 2–18-year-old T1D patients documented in the German/Austrian DPV database. Results. In 2000, the overweight prevalence was the highest according to IOTF (22.3%, followed by WHO (20.8%, AGA (15.5%, and KiGGS (9.4%. The respective rates in 2013 were IOTF (24.8%, WHO (22.9%, AGA (18.2%, and KiGGS (11.7%. Obesity prevalence in 2000 was the highest according to WHO (7.9%, followed by AGA (4.5%, IOTF (3.1%, and KiGGS (1.8%. In 2013, the respective rates were WHO (9.6%, AGA (6.2%, IOTF (4.5%, and KiGGS (2.6%. Overall, the prevalence of overweight and obesity increased from 2000 to 2006 (p < 0.001 but showed stabilization thereafter in girls and overweight in boys. Conclusion. Overweight and obesity prevalence in T1D subjects differs significantly if it is assessed by four separate reference populations. More detailed assessment of each child is required to determine obesity-related risks.

  20. A Comparison of the Hormonal Profile of Early Androgenetic Alopecia in Men With the Phenotypic Equivalent of Polycystic Ovarian Syndrome in Women.

    Science.gov (United States)

    Sanke, Sarita; Chander, Ram; Jain, Anju; Garg, Taru; Yadav, Pravesh

    2016-09-01

    Early androgenetic alopecia (AGA) is patterned hair loss occurring before age 30 years. Early AGA in men is frequently reported as the phenotypic equivalent of polycystic ovarian syndrome (PCOS) in women, which carries the risk of developing obesity, metabolic syndrome, and cardiovascular diseases. Very few studies have been conducted to evaluate this. To study the hormonal profile of men with early AGA and to evaluate if early AGA in men can be considered as the phenotypic equivalent of PCOS, the associated risks of which are well known. This case-control study was conducted from January 1, 2014, to March 31, 2015, in a tertiary care government hospital. Fifty-seven men aged 19 to 30 years presenting with patterned hair loss were recruited as study participants. Thirty-two age-matched men with no evidence of hair loss were recruited as controls. Men who had any established endocrine disorder, diabetes mellitus, or cardiovascular disease and those who took any oral medication or hormonal treatment for hair loss were excluded from the study. The serum concentrations of total testosterone, sex hormone-binding globulin (SHBG), dehydroepiandrosterone sulfate (DHEAS), luteinizing hormone (LH), follicle-stimulating hormone (FSH), prolactin, fasting plasma glucose, and insulin levels were measured. Insulin resistance (IR) and free androgen index (FAI) were calculated and compared with age- and sex-matched controls. The primary outcome was to measure the clinico-endocrinological profiles (LH, FSH, SHBG, DHEAS, and testosterone levels) of men with early AGA and to compare it with the PCOS profile; the secondary outcome was to establish a relationship between this endocrinological profile and IR. Compared with the 32 controls, the 57 participants with AGA showed significantly increased mean (SD) levels of testosterone (24.61 [7.97] vs 20.57 [4.9] nmol/L; P = .04), DHEAS (3.63 [2.19] vs 2.64 [1.49] µg/mL; P = .02), LH (7.78 [3.19] vs 4.56 [2.01] mIU/mL; P PCOS. The

  1. Our Universe

    Science.gov (United States)

    Stern, Alan

    2001-03-01

    The Universe in which we live is unimaginably vast and ancient, with countless star systems, galaxies, and extraordinary phenomena such as black holes, dark matter, and gamma ray bursts. What phenomena remain mysteries, even to seasoned scientists? Our Universe is a fascinating collection of essays by some of the world's foremost astrophysicists. Some are theorists, some computational modelers, some observers, but all offer their insights into the most cutting-edge, difficult, and curious aspects of astrophysics. Compiled, the essays describe more than the latest techniques and findings. Each of the ten contributors offers a more personal perspective on their work, revealing what motivates them and how their careers and lives have been shaped by their desire to understand our universe. S. Alan Stern is Director of the Department of Space Studies at Southwest Research Institute in Boulder, Colorado. He is a planetary scientist and astrophysicist with both observational and theoretical interests. Stern is an avid pilot and a principal investigator in NASA's planetary research program, and he was selected to be a NASA space shuttle mission specialist finalist. He is the author of more than 100 papers and popular articles. His most recent book is Pluto & Charon (Wiley, 1997). Contributors: Dr. John Huchra, Harvard University Dr. Esther Hu, University of Hawaii, Honolulu Dr. John Mather, NASA Goddard Space Flight Center Dr. Nick Gnedin, University of Colorado, Boulder Dr. Doug Richstone, University of Michigan, Ann Arbor Dr. Bohdan Paczynski, Princeton University, NJ Dr. Megan Donahue, Space Telescope Science Institute, Baltimore, MD Dr. Jerry Ostriker, Princeton University, New Jersey G. Bothun, University of Oregon, Eugene

  2. An efficient and secure dynamic ID-based authentication scheme for telecare medical information systems.

    Science.gov (United States)

    Chen, Hung-Ming; Lo, Jung-Wen; Yeh, Chang-Kuo

    2012-12-01

    The rapidly increased availability of always-on broadband telecommunication environments and lower-cost vital signs monitoring devices bring the advantages of telemedicine directly into the patient's home. Hence, the control of access to remote medical servers' resources has become a crucial challenge. A secure authentication scheme between the medical server and remote users is therefore needed to safeguard data integrity, confidentiality and to ensure availability. Recently, many authentication schemes that use low-cost mobile devices have been proposed to meet these requirements. In contrast to previous schemes, Khan et al. proposed a dynamic ID-based remote user authentication scheme that reduces computational complexity and includes features such as a provision for the revocation of lost or stolen smart cards and a time expiry check for the authentication process. However, Khan et al.'s scheme has some security drawbacks. To remedy theses, this study proposes an enhanced authentication scheme that overcomes the weaknesses inherent in Khan et al.'s scheme and demonstrated this scheme is more secure and robust for use in a telecare medical information system.

  3. دراسات في علوم القرآن المعاصرة: موقف السر أحمد خان من إعجاز القرآن الكريم

    Directory of Open Access Journals (Sweden)

    Hamdan Maghribi

    2016-12-01

    Full Text Available This paper deals with the I’jaz Alquran according to Sir Syed Ahmad Khan. It is concluded that Khan toughly emphasized his interpretation concept on rationalism. Khan also applied it for Quranic studies, such as emphasizing on rational and scientific facts that negate several metaphysical and invisible issues contained in Qur’an. Following his view on the prophets’ miracle which is irrational and unacceptable for human mind. Again, the concept of I’jaz Alquran is also one of Khan’s thought on rationality, though he acknowledged the great literary contents of Quran, as well he uncategorized it as a miracle. He then said that God’s challenge human to afford the similar verses to Qur’an is unclassified among I’jaz Qur’an, since God did the similar thing to the book of Torah as well. Unlike the opinion of majority Tafseer scholars, among the Salaf and Khalaf, they viewed that God’s challenge and the Quran high literature are evidence of I’jaz Quran

  4. Euroopa netomaksjad tallavad Lissaboni sihil / Krister Paris

    Index Scriptorium Estoniae

    Paris, Krister, 1977-

    2005-01-01

    Kuus EL-i nn. netomaksjat on seisukohal, et EL-i ühiste kulutuste määr ei tohiks ületada 1% SKT-st. Euroopa Komisjon ja Euroopa Parlament aga leiavad, et rahaeraldised peavad olema suuremad, muidu satub ohtu ühiste eesmärkide saavutamine. Graafik: Eelarve järjest kahanenud. Vt. samas: Rohkem Euroopat, aga vähem raha selle jaoks?

  5. The Learning University.

    Science.gov (United States)

    Patterson, Glenys

    1999-01-01

    As universities make cross-sectoral alliances, various models for integrating postsecondary education into universities arise: contract, brokerage, collaborative, validation, joint program, dual-sector institution, tertiary university, metaphoric, and federal. The integrated, comprehensive university is the learning university of the 21st century.…

  6. Between universalism and regionalism: universal systematics from imperial Japan.

    Science.gov (United States)

    Lee, Jung

    2015-12-01

    Historiographic discussions of the universality and regionality of science have to date focused on European cases for making regional science universal. This paper presents a new perspective by moving beyond European origins and illuminating a non-European scientist's engagement with the universality and regionality of science. It will examine the case of the Japanese botanist Nakai Takenoshin (1882-1952), an internationally recognized authority on Korean flora based at Tokyo Imperial University. Serving on the International Committee on Botanical Nomenclature in 1926, Nakai endorsed and acted upon European claims of universal science, whilst simultaneously unsettling them with his regionally shaped systematics. Eventually he came to promote his own systematics, built regionally on Korean flora, as the new universal. By analysing his shifting claims in relation to those of other European and non-European botanists, this paper makes two arguments. First, universalism and regionalism were not contradictory foundations of scientific practice but useful tools used by this non-European botanist in maintaining his scientific authority as a representative Japanese systematist. Second, his claims to universality and regionalism were both imperially charged. An imperially monopolized study of Korean plants left a regional imprint on Nakai's systematics. In order to maintain his scientific authority beyond its region of origin he had to assert either the expanding regionalism of 'East Asia' or universalism.

  7. Universe symmetries

    International Nuclear Information System (INIS)

    Souriau, J.M.

    1984-01-01

    The sky uniformity can be noticed in studying the repartition of objects far enough. The sky isotropy description uses space rotations. The group theory elements will allow to give a meaning at the same time precise and general to the word a ''symmetry''. Universe models are reviewed, which must have both of the following qualities: - conformity with the physic known laws; - rigorous symmetry following one of the permitted groups. Each of the models foresees that universe evolution obeys an evolution equation. Expansion and big-bang theory are recalled. Is universe an open or closed space. Universe is also electrically neutral. That leads to a work hypothesis: the existing matter is not given data of universe but it appeared by evolution from nothing. Problem of matter and antimatter is then raised up together with its place in universe [fr

  8. Clinically Significant Contrast Induced Acute Kidney Injury after Non-Emergent Cardiac Catheterization - Risk Factors and Impact on Length of Hospital Stay

    International Nuclear Information System (INIS)

    Kashif, W.; Yaqub, S.; Khawaja, A.

    2013-01-01

    Objective: To evaluate the frequency and risk factors associated with clinically significant contrast-induced nephropathy (CIN) in patients undergoing non-emergent coronary angiography. Study Design: Descriptive study. Place and Duration of Study: The Aga Khan University Hospital, Karachi, from January 2005 to December 2007. Methodology: Case records of patients who underwent coronary angiography with a serum creatinine of >= 1.5 mg/dl at the time of procedure were evaluated. Clinically significant contrast induced nephropathy (CSCIN) was defined as either doubling of serum creatinine from baseline value within a week following the procedure or need for emergency hemodialysis after the procedure. Results: One hundred and sixteen patients met the inclusion criteria. Mean age was 64.0 +- 11.5 years, 72% were males. Overall prevalence of CIN was 17% (rise of serum creatinine by A= 0.5 mg/dl) while that of clinically significant CIN (CSCIN) was 9.5% (11 patients). Patients with CSCIN had significantly lower left ventricular ejection fraction (p = 0.03, OR: 0.24; 95% CI = 0.06 A= 0.91) and higher prevalence of cerebrovascular disease (p < 0.001, OR: 14.66; 95% CI = 3.30 - 65.08). Mean baseline serum creatinine was significantly higher, 3.0 +- 1.5 vs. 2.0 +- 1.1 mg/dl (p = 0.03, OR: 1.47; 95% CI = 1.03 - 2.11) whereas mean GFR estimated by Cockcroft-Gault formula was significantly lower at 25 +- 7.4 vs. 41.0 +- 14.6 ml/minute (p = 0.001, OR = 0.89, 95% CI = 0.84 A= 0.95) at the time of procedure in patients with CSCIN. Mean length of hospital stay was significantly higher in this group compared to those without CIN, 9.0 +- 5.1 vs. 3.0 +- 3.2 days (p = 0.001, OR = 1.31, 95% CI = 1.12 - 1.54). Multivariate analysis revealed low GFR (p = 0.001, OR = 0.88; 95% CI = 0.82 - 0.95) and low ejection fraction (p = 0.03, OR = 0.20; 95% CI = 0.04 - 0.91) to be independent factors associated with CSCIN. No significant differences were noted between the two groups in patients with

  9. Value of Adjusted Blood Requirement Index in determining failure to control bleed in patients with variceal bleeding.

    Science.gov (United States)

    Abid, Shahab; Khalid, Abdullah B; Awan, Safia; Shah, Hasnain A; Hamid, Saeed; Jafri, Wasim

    2015-03-01

    Variceal bleeding is a serious complication in patients with cirrhosis. Among the criteria that were proposed in Baveno conferences, the Adjusted Blood Requirement Index (ABRI) has not been validated prospectively in clinical practice. We therefore aim to evaluate the measurement of ABRI as a marker of failure to control bleeding and to evaluate the consistency of ABRI in relation to other criteria of failure to control variceal bleeding. All patients with variceal bleeding who presented to Aga Khan University Hospital from January 2010 to December 2012 who were administered transfusion of packed red blood cells were included after obtaining informed consent. All patients were managed as per the standard protocol with intravenous terlipressin along with band ligation and injection of cyanoacrylate in cases of esophageal and fundal varices, respectively. Hemoglobin and hematocrit were measured every 6 h for 48 h and then every 12 h until 5 days of index bleed in each patient. Packed cells were transfused if hemoglobin decreased below 8 g/dl. The number of blood units transfused, change in hemoglobin values, and ABRI were calculated after each unit of blood transfusion till 120 h. In patients in whom bleed could not be controlled, an ABRI value of 0.75 or more was compared with other Baveno IV-based parameters that define failure to control variceal bleeding. During the study period, 137 eligible patients with variceal bleed were admitted. The mean age of the patients was 52±12 years. The majority of patients (50.4%) were in Child-Pugh class B, followed by 38% in Child-Pugh class C. According to the Baveno IV criteria, overall failure to control acute variceal bleeding occurred in 52 (37.9%) patients. Excluding ABRI, failure to control bleeding was found in 22/137 (16%) patients, whereas ABRI-based criteria showed that in 34/137 (24.8%) patients, bleeding could not be controlled. There were only four (2.9%) patients with variceal bleeding in whom ABRI and

  10. Importance of measuring Non-HDL cholesterol in type 2 diabetes patients

    International Nuclear Information System (INIS)

    Ram, N.; Hashmi, F.; Jabbar, A

    2014-01-01

    Objective: To study the correlation between Non-high-density lipoprotein and low-density lipoprotein cholesterol in patients with Type 2 diabetes mellitus and the proportion of patients achieving Adult Treatment Panel III recommended goals. Methods: The cross sectional study was conducted at the Diabetic Clinic, Aga Khan University Hospital, Karachi. Data of Type 2 diabetes mellitus patients who attended the clinic between 2007 and 2011 was reviewed. All Type 2 diabetic patients of either gender with fasting lipid profile irrespective of taking lipid lowering therapy were included. Type-1 DM, gestational diabetes, type 2 diabetes patients with pregnancy and those with incomplete data were excluded. Correlation between the low-density lipoprotein and Non- high-density lipoprotein was assessed by applying Cramer V and phi. Proportion of patients achieving Adult Treatment Panel III recommended goals was checked. Multivariable regression was done to identify common factors associated with elevated Non- high-density lipoprotein cholesterol. Results: A total of 1352 patients fulfilling the eligibility criteria were included in the study. Mean age of the patients was 54.5+-11.3 years; 797 (59%) were males; 1122 (83%) had Body Mass Index above 25; and 1016 (75%) had HbA1c >7%. Mean Non-high-density lipoprotein cholesterol was 129+-42mg/dl. Mean low-density lipoprotein cholesterol was 100+-37mg/dl. Both low-density lipoprotein 130mg/dl (p 100mg/dl was independently associated with having Non-high-density lipoprotein cholesterol >130mg/dl (Adjusted Odds Ratio 38.6; 95% Confidance Interval 28.1-53.1). Similarly, age 130 mg/dl (Adjusted Odds Ratio 1.6; 95% Confidance Interval = 1.01 - 2.3). Whereas having obesity Body Mass Index >25 was 3.6 times more associated to have Non-high-density lipoprotein >130mg/dl (Adjusted Odds Ratio 3.6; 95% Confidance Interval = 1.6-7.7). In patients with coronary artery disease, combined goal achievement of low-density lipoprotein 100mg/dl (p <0

  11. Does continuous use of metformin throughout pregnancy improve pregnancy outcomes in women with polycystic ovarian syndrome?

    Science.gov (United States)

    Nawaz, Fauzia Haq; Khalid, Roha; Naru, Tahira; Rizvi, Javed

    2008-10-01

    Polycystic ovarian syndrome (PCOS) is one of the most common endocrinopathies in women of reproductive age. It is associated with hyperinsulinemia and insulin resistance which is further aggravated during pregnancy. This mechanism has a pivotal role in the development of various complications during pregnancy. In the past few years, metformin, an insulin sensitizer, has been extensively evaluated for induction of ovulation. Its therapeutic use during pregnancy is, however, a recent strategy and is a debatable issue. At present, evidence is inadequate to support the long-term use of insulin-sensitizing agents during pregnancy. It is a challenge for both clinicians and researchers to provide good evidence of the safety of metformin for long-term use and during pregnancy. This study aimed to evaluate pregnancy outcomes in women with PCOS who conceived while on metformin treatment, and continued the medication for a variable length of time during pregnancy. This case-control study was conducted from January 2005 to December 2006 at the antenatal clinics of the Department of Obstetrics and Gynecology, Aga Khan University, Karachi, Pakistan. The sample included 137 infertile women with PCOS; of these, 105 conceived while taking metformin (cases), while 32 conceived spontaneously without metformin (controls). Outcomes were measured in three groups of cases which were formed according to the duration of use of metformin during pregnancy. Comparison was made between these groups and women with PCOS who conceived spontaneously. All 137 women in this study had a confirmed diagnosis of PCOS (Rotterdam criteria). These women were followed up during their course of pregnancy; data forms were completed once they had delivered. Cases were divided into three groups: group A, 40 women who stopped metformin between 4-16 weeks of pregnancy; group B, 20 women who received metformin up until 32 weeks of gestation; and group C; 45 women who continued metformin throughout pregnancy. All

  12. Critique of An Analysis of the Blast Overpressure Study Data Comparing Three Exposure Criteria, by Murphy, Khan, and Shaw

    Science.gov (United States)

    2010-08-01

    actual determination of a risk threshold and (2) the article has laid the groundwork for such a determination. These statements misrepresent what...applied as a limit. This is a small point, but one that pervades the article and leads the authors to miss their main finding— namely, that an LAEQ8 of...WESTERN MICHIGAN UNIVERSITY G A FLAMME ASSOCIATE PROFESSOR DEPARTMENT OF SPEECH PATHOLOGY AND AUDIOLOGY 1903 W MICHIGAN AVE

  13. The use of low-level light therapy in the treatment of androgenetic alopecia and female pattern hair loss.

    Science.gov (United States)

    Gupta, Aditya K; Daigle, Deanne

    2014-04-01

    Androgenetic alopecia (AGA) or female pattern hair loss (FPHL) is the most common form of hair loss in men and women. Despite its common occurrence, our understanding of the etiology of AGA and FPHL remains incomplete. As such, traditional therapies demonstrate modest efficacies and new therapies continue to be sought. Low-level light therapy (LLLT) is a relatively new technique used to promote hair growth in both men and women with AGA and FPHL. Currently, there exist several LLLT devices marketed for the treatment of alopecia, which claim to stimulate hair growth; yet marketing these devices only requires that safety, not efficacy, be established. A handful of studies have since investigated the efficacy of LLLT for alopecia with mixed results. These studies suffered from power, confounding and analysis issues which resulted in a high risk of bias in LLLT studies. Due to the paucity of well-conducted randomized controlled trials, the efficacy of LLLT devices remains unclear. Randomized controlled trials of LLLT conducted and reported according to the Consolidated Standards of Reporting Trials (CONSORT) statement would greatly increase the credibility of the evidence and clarify the ambiguity of the effectiveness of LLLT in the treatment of AGA and FPHL.

  14. Use of low-level laser therapy as monotherapy or concomitant therapy for male and female androgenetic alopecia.

    Science.gov (United States)

    Munck, Andréia; Gavazzoni, Maria Fernanda; Trüeb, Ralph M

    2014-04-01

    Androgenetic alopecia (AGA) is the most common form of hair loss in men and in women. Currently, minoxidil and finasteride are the treatments with the highest levels of medical evidence, but patients who exhibit intolerance or poor response to these treatments are in need of additional treatment modalities. The aim was to evaluate the efficacy and safety of low-level laser therapy (LLLT) for AGA, either as monotherapy or as concomitant therapy with minoxidil or finasteride, in an office-based setting. Retrospective observational study of male and female patients with AGA, treated with the 655 nm-HairMax Laser Comb(®), in an office-based setting. Efficacy was assessed with global photographic imaging. Of 32 patients (21 female, 11 male), 8 showed significant, 20 moderate, and 4 no improvement. Improvement was seen both with monotherapy and with concomitant therapy. Improvement was observed as early as 3 months and was sustained up to a maximum observation time of 24 months. No adverse reactions were reported. LLLT represents a potentially effective treatment for both male and female AGA, either as monotherapy or concomitant therapy. Combination treatments with minoxidil, finasteride, and LLLT may act synergistic to enhance hair growth.

  15. Application of nonlinear regression analysis for ammonium exchange by natural (Bigadic) clinoptilolite

    International Nuclear Information System (INIS)

    Gunay, Ahmet

    2007-01-01

    The experimental data of ammonium exchange by natural Bigadic clinoptilolite was evaluated using nonlinear regression analysis. Three two-parameters isotherm models (Langmuir, Freundlich and Temkin) and three three-parameters isotherm models (Redlich-Peterson, Sips and Khan) were used to analyse the equilibrium data. Fitting of isotherm models was determined using values of standard normalization error procedure (SNE) and coefficient of determination (R 2 ). HYBRID error function provided lowest sum of normalized error and Khan model had better performance for modeling the equilibrium data. Thermodynamic investigation indicated that ammonium removal by clinoptilolite was favorable at lower temperatures and exothermic in nature

  16. Disease: H00377 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available H00377 Rabies Rabies is an old zoonotic disease which has been known for more than...om it. Dogs are the major vectors. Rabies affects the central nervous system and causes fatal encephalomyeli...Africa die every year due to rabies. Infectious disease ... Rabies virus (RABV) [GN:T40022] ... Rabies vaccine [DR:D06504 D05248] Rabies... ... Yousaf MZ, Qasim M, Zia S, Khan Mu, Ashfaq UA, Khan S ... TITLE ... Rabies molecular virology, diagnosis, p... ... Leung AK, Davies HD, Hon KL ... TITLE ... Rabies: epidemiology, pathogenesis, and prophylaxis. ... JOURNAL ... Adv Ther 24:1340-7 (2007) DOI:10.1007/BF02877781

  17. The effect of two fixation methods (TAF and DESS) on morphometric parameters of Aphelenchoides ritzemabosi.

    Science.gov (United States)

    Chałańska, Aneta; Bogumił, Aleksandra; Malewski, Tadeusz; Kowalewska, Katarzyna

    2016-02-19

    Identification of nematode species by using conventional methods requires fixation of the isolated material and a suitable preparation for further analyses. Tentative identification using microscopic methods should also be performed prior to initiating molecular studies. In the literature, various methods are described for the preparation of nematodes from the genus Aphelenchoides for identification and microscopic studies. The most commonly used fixatives are formalin (Timm 1969; Szczygieł & Cid del Prado Vera 1981, Crozzoli et al. 2008, Khan et al. 2008), FAA (Wasilewska 1969; Vovlas et al. 2005, Khan et al. 2007) and TAF (Hooper 1958, Chizhov et al. 2006, Jagdale & Grewal 2006).

  18. Comparison of bone age in small-for-gestationalage children vs appropriate-for-getational-age children

    Directory of Open Access Journals (Sweden)

    Lionardus Edward

    2010-04-01

    Full Text Available BackgroundAbout 10-15% small-for-gestational-age children are in higher risk for having linear growth retardation due to growth hormone-insulin like growth factor 1 axis defect (GH-IGF 1 which causes bone age delay.ObjectivesTo compare bone age in 24-36 month old children born small-for-gestational-age (SGA to that in children born appropriate-for-gestational-age (AGA.MethodsA cross-sectional study was conducted in Hasan Sadikin General Hospital, Bandung, from January to April 2009.Subjects consisted of50 healthy children of 24-36 months old (25 children born at term, SGA, 25 children born at term, AGA. We compared the appropriateness and delay of bone age between the two groups. ResultsMean bone age in the SGA group was 20.8 (SD 7.7 months, and in the AGA group was 25.7 (SD 7.1 months (P=0.022. Mean bone age deficit was -10.5 (6.5 months in the SGA group and -5.5 (SD 5.7 months in the AGA group (P=0.009. The prevalence ratio was 1.77 (95% CI: 1.19–2.62. Bone age delay was found to be higher in children born SGA than that in children of the other group (23 vs 13. On the contrary, appropriate bone age was found more in children born AGA (12 vs 2 (P=0.002.Conclusion Bone age delay in 24-36 months old children born small-for-gestational-age was found to be higher than in those born appropriate-for-gestational-age.

  19. Influences of impurities on iodine removal efficiency of silver alumina adsorbent

    Energy Technology Data Exchange (ETDEWEB)

    Fukasawa, Tetsuo; Funabashi, Kiyomi [Hitachi, Ltd., Ibaraki (Japan); Kondo, Yoshikazu [Hitachi, Ltd., Ibaraki (Japan)

    1997-08-01

    Silver impregnated alumina adsorbent (AgA), which was developed for iodine removal from off-gas of nuclear power and reprocessing plants has been tested laying emphasis on investigation of the influences gaseous impurities have on adsorbent chemical stability and iodine removal efficiency. The influences of the major impurities such as nitrogen oxides and water vapor were checked on the chemical state of impregnated silver compound (AgNO{sub 3}) and decontamination factor (DF) value. At 150{degrees}C, a forced air flow with 1.5% nitrogen oxide (NO/NO{sub 2}=1/1) reduced silver nitrate to metallic silver, whereas pure air and air with 1.5% NO{sub 2} had no effect on the chemical state of silver. Metallic silver showed a lower DF value for methyl iodide in pure air (without impurities) than silver nitrate and the lower DF of metallic silver was improved when impurities were added. At 40{degrees}C, a forced air flow with 1.5% nitrogen dioxide (NO{sub 2}) increased the AgA weight by about 20%, which was caused by the adsorption of nitric acid solution on the AgA surface. AgA with l0wt% silver showed higher weight increase than that with 24wt% silver which had lower porosity. Adsorption of acid solution lowered the DF value, which would be due to the hindrance of contact between methyl iodide and silver. The influences of other gaseous impurities were also investigated and AgA showed superior characteristics at high temperatures. 14 refs., 11 figs.

  20. 1961 / Eiki Nestor

    Index Scriptorium Estoniae

    Nestor, Eiki, 1953-

    2007-01-01

    Hollandis või Taanis oli 1961. aastal Teise maailmasõja lõpust möödas 16 aastat, Eestis aga aastal 2007. Eesti ühiskonnas pakitsevatest probleemidest: ühtede jaoks on tähtis otsustada, kummal pool rindejoont Teises maailmasõjas eestlased sõdisid, teistele aga näib möödapääsmatu ja vajalik välja vabandada okupatsiooniaja kaasajooksiklust