WorldWideScience

Sample records for actinium 226

  1. Purification of radium-226 for the manufacturing of actinium-225 in a cyclotron for alpha-immunotherapy

    The thesis describes the development of methods for the purification of Ra-226. The objective was to obtain the radionuclide in the quality that is needed to be used as starting material in the manufacturing process for Ac-225 via proton-irradiated Ra-226. The radionuclide has been gained efficiently out of huge excesses of impurities. The high purity of the obtained radium affords its use as staring material in a pharmaceutical manufacturing process.

  2. Purification of radium-226 for the manufacturing of actinium-225 in a cyclotron for alpha-immunotherapy; Radium-Aufreinigung zur Herstellung von Actinium-225 am Zyklotron fuer die Alpha-Immuntherapie

    Marx, Sebastian Markus

    2014-09-23

    The thesis describes the development of methods for the purification of Ra-226. The objective was to obtain the radionuclide in the quality that is needed to be used as starting material in the manufacturing process for Ac-225 via proton-irradiated Ra-226. The radionuclide has been gained efficiently out of huge excesses of impurities. The high purity of the obtained radium affords its use as staring material in a pharmaceutical manufacturing process.

  3. Production of Actinium-225 via High Energy Proton Induced Spallation of Thorium-232

    available at Fermi National Accelerator Laboratory. Targets will be processed at Argonne National Laboratory to separate and purify the actinium-225 that will subsequently be transferred to NorthStar laboratory facilities for product quality testing and comparison to the product quality of ORNL produced actinium-225, which is currently the industry standard. The test irradiations at FNAL will produce 1-20 mCi per day which is more than sufficient for quantitative evaluation of the proposed production process. The beneficial outcome of this effort will be a new production route for actinium-225 that does not use or require any uranium-233 materials owned by DOE or use any radium-226 as an irradiation target but can supply the medical community's needs for actinium-225 now and in the future.

  4. Production of Actinium-225 via High Energy Proton Induced Spallation of Thorium-232

    Harvey, James T.; Nolen, Jerry; Vandergrift, George; Gomes, Itacil; Kroc, Tom; Horwitz, Phil; McAlister, Dan; Bowers, Del; Sullivan, Vivian; Greene, John

    2011-12-30

    V protons available at Fermi National Accelerator Laboratory. Targets will be processed at Argonne National Laboratory to separate and purify the actinium-225 that will subsequently be transferred to NorthStar laboratory facilities for product quality testing and comparison to the product quality of ORNL produced actinium-225, which is currently the industry standard. The test irradiations at FNAL will produce 1-20 mCi per day which is more than sufficient for quantitative evaluation of the proposed production process. The beneficial outcome of this effort will be a new production route for actinium-225 that does not use or require any uranium-233 materials owned by DOE or use any radium-226 as an irradiation target but can supply the medical community's needs for actinium-225 now and in the future.

  5. Extraction of actinium with di-(2-ethylhexyl)phosphoric acid from hydrochloric and nitric acid solutions

    The extraction of actinium with HDEHP from Cl- and NO3- systems has been investigated. It was found that extraction of actinium from HCl solutions is much better than from HNO3 solutions. Stability constants of actinium complexes Ac(X-)+2 with Cl- and NO3- ligands were determined. Our results show that the actinium formed less stable complexes with Cl- than with NO3- ligands. 5 refs., 3 figs., 1 tab. (author)

  6. The sorption of polonium, actinium and protactinium onto geological materials

    This paper describes a combined experimental and modeling program of generic sorption studies to increase confidence in the performance assessment for a potential high-level radioactive waste repository in Japan. The sorption of polonium, actinium and protactinium onto geological materials has been investigated. Sorption of these radioelements onto bentonite, tuff and granodiorite from equilibrated de-ionized water was studied under reducing conditions at room temperature. In addition, the sorption of actinium and protactinium was investigated at 60 C. Thermodynamic chemical modeling was carried out to aid interpretation of the results

  7. Separation of Actinium 227 from the uranium minerals

    The purpose of this work was to separate Actinium 227, whose content is 18%, from the mineral carnotite found in Gomez Chihuahua mountain range in Mexico. The mineral before processing is is pre-concentrated and passed, first through anionic exchange resins, later the eluate obtained is passed through cationic resins. The resins were 20-50 MESH QOWEX and 100-200 MESH 50 X 8-20 in some cased 200-400 MESH AG 50W-X8, 1X8 in other cases. The eluates from the ionic exchange were electrodeposited on stainless steel polished disc cathode and platinum electrode as anode; under a current ODF 10mA for 2.5 to 5 hours and of 100mA for .5 of an hour. it was possible to identify the Actinium 227 by means of its descendents, TH-227 and RA-223, through alpha spectroscopy. Due to the radiochemical purity which the electro deposits were obtained the Actinium 227 was low and was not quantitatively determined. A large majority of the members of the natural radioactive series 3 were identified and even alpha energies reported in the literature with very low percentages of non-identified emissions were observed. We conclude that a more precise study is needed concerning ionic exchange and electrodeposit to obtain an Actinium 227 of radiochemical purity. (Author)

  8. Spectroscopic and computational investigation of actinium coordination chemistry.

    Ferrier, Maryline G; Batista, Enrique R; Berg, John M; Birnbaum, Eva R; Cross, Justin N; Engle, Jonathan W; La Pierre, Henry S; Kozimor, Stosh A; Lezama Pacheco, Juan S; Stein, Benjamin W; Stieber, S Chantal E; Wilson, Justin J

    2016-01-01

    Actinium-225 is a promising isotope for targeted-α therapy. Unfortunately, progress in developing chelators for medicinal applications has been hindered by a limited understanding of actinium chemistry. This knowledge gap is primarily associated with handling actinium, as it is highly radioactive and in short supply. Hence, Ac(III) reactivity is often inferred from the lanthanides and minor actinides (that is, Am, Cm), with limited success. Here we overcome these challenges and characterize actinium in HCl solutions using X-ray absorption spectroscopy and molecular dynamics density functional theory. The Ac-Cl and Ac-OH2O distances are measured to be 2.95(3) and 2.59(3) Å, respectively. The X-ray absorption spectroscopy comparisons between Ac(III) and Am(III) in HCl solutions indicate Ac(III) coordinates more inner-sphere Cl(1-) ligands (3.2±1.1) than Am(III) (0.8±0.3). These results imply diverse reactivity for the +3 actinides and highlight the unexpected and unique Ac(III) chemical behaviour. PMID:27531582

  9. Discovery of the actinium, thorium, protactinium, and uranium isotopes

    Fry, C; Thoennessen, M

    2012-01-01

    Currently, 31 actinium, 31 thorium, 28 protactinium, and 23 uranium isotopes have so far been observed; the discovery of these isotopes is discussed. For each isotope a brief summary of the first refereed publication, including the production and identification method, is presented.

  10. Production of high-purity radium-223 from legacy actinium-beryllium neutron sources.

    Soderquist, Chuck Z; McNamara, Bruce K; Fisher, Darrell R

    2012-07-01

    Radium-223 is a short-lived alpha-particle-emitting radionuclide with potential applications in cancer treatment. Research to develop new radiopharmaceuticals employing (223)Ra has been hindered by poor availability due to the small quantities of parent actinium-227 available world-wide. The purpose of this study was to develop innovative and cost-effective methods to obtain high-purity (223)Ra from (227)Ac. We obtained (227)Ac from two surplus actinium-beryllium neutron generators. We retrieved the actinium/beryllium buttons from the sources and dissolved them in a sulfuric-nitric acid solution. A crude actinium solid was recovered from the solution by coprecipitation with thorium fluoride, leaving beryllium in solution. The crude actinium was purified to provide about 40 milligrams of actinium nitrate using anion exchange in methanol-water-nitric acid solution. The purified actinium was then used to generate high-purity (223)Ra. We extracted (223)Ra using anion exchange in a methanol-water-nitric acid solution. After the radium was separated, actinium and thorium were then eluted from the column and dried for interim storage. This single-pass separation produces high purity, carrier-free (223)Ra product, and does not disturb the (227)Ac/(227)Th equilibrium. A high purity, carrier-free (227)Th was also obtained from the actinium using a similar anion exchange in nitric acid. These methods enable efficient production of (223)Ra for research and new alpha-emitter radiopharmaceutical development. PMID:22697483

  11. Radium-226

    This sheet belongs to a collection which relates to the use of radionuclides essentially in unsealed sources. Its goal is to gather on a single document the most relevant information as well as the best prevention practices to be implemented. These sheets are made for the persons in charge of radiation protection: users, radioprotection-skill persons, labor physicians. Each sheet treats of: 1 - the radio-physical and biological properties; 2 - the main uses; 3 - the dosimetric parameters; 4 - the measurement; 5 - the protection means; 6 - the areas delimitation and monitoring; 7 - the personnel classification, training and monitoring; 8 - the effluents and wastes; 9 - the authorization and declaration administrative procedures; 10 - the transport; and 11 - the right conduct to adopt in case of incident or accident. This sheet deals specifically with Radium-226

  12. Groundwater seepage from the Ranger uranium mine tailings dam: radioisotopes of radium, thorium and actinium. Supervising Scientist report 106

    Monitoring of bores near the Ranger uranium mine tailings dam has revealed deterioration in water quality in several bores since 1983. In a group of bores to the north of the dam, increases have been observed of up to 500 times for sulphate concentrations and of up to 5 times for 226Ra concentrations. Results are presented here of measurements of members of the uranium, thorium and actinium decay series in borewater samples collected between 1985 and 1993. In particular, measurements of all four naturally-occurring radium isotopes have been used in an investigation of the mechanism of radium concentration changes. For the most seepage-affected bores the major findings of the study include: 228Ra/226Ra 223Ra /226Ra and 224Ra/228Ra ratios all increased over the course of the study; barium concentrations show high seasonal variability, being lower in November than May, but strontium concentrations show a steady increase with time. Calculations show that the groundwater is probably saturated with respect to barite but not with respect to celestite or anglesite; sulphide concentrations are low in comparison with sulphate, and are higher in November than in May; and 227Ac concentrations have increased with time, but do not account for the high 223Ra/226Ra ratios. It is concluded on the basis of these observations that increases in Ra isotope concentrations observed in a number of seepage-affected bores arise from increases in salinity leading to desorption of radium from adsorption sites in the vicinity of the bore rather by direct transport of radium from the tailings. Increased salinity is also causing the observed increases in 227Ac and strontium concentrations, while formation of a barite solid phase in the groundwater is causing the removal of some radium from solution. This is the cause of the increasing radium isotope ratios noted above

  13. Radium, thorium, and actinium extraction from seawater using an improved manganese-oxide-coated fiber

    Laboratory experiments were conducted to determine the efficiency with which improved manganese-oxide-coated acrylic fibers extract radium, thorium, and actinium from seawater. Tests were made using surface seawater spiked with 227Ac, 227Th and 223Ra. For sample volumes of approximately 30 liters and flow rates up to 0.5 liters per minute, radium and actinium are removed quantitatively. Approximately 80-95% of the thorium is removed under these same conditions. (Auth.)

  14. ACC 226 Course Tutorial / tutorialrank

    welcome8888

    2015-01-01

    For more course tutorials visit www.tutorialrank.com Tutorial Purchased: 5 Times, Rating: A+     ACC 226 Week 1 CheckPoint Accounts Receivable and Uncollectible Accounts   ACC 226 Week 1 DQ 1 and DQ 2   ACC 226 Week 2 Assignment Accounting for Depreciation part   ACC 226 Week 2 CheckPoint Ethics and Computing   ACC 226 Week 3 CheckPoint Classifying Liabilities and Preparing Payroll Entries   ACC 226...

  15. Neutron-Induced Fission of Actinium-227, Protactinium-231 and Neptunium-237: Mass Distribution

    Results of radiochemical studies on the mass distribution in the neutron-induced fission of actinium-227, protactinium-231 and neptunium-237 have been presented. This work has been carried out as part of a programme to determine the mass distribution in the fission of heavy elements as a function of Z and A. All irradiations have been carried out in the core of the swimming-pool type reactor APSARA with cadmium shielding wherever necessary. Relative yields of several fission product nuclides have been obtained by a method involving a comparison of the fission product activities from the respective targets with those formed from uranium-235 simultaneously irradiated. Thermal-neutron fission yields of uranium-235 have been assumed. These results indicate a predominantly asymmetric mass distribution in all the three cases, and also a distinct though small symmetric peak in the case of actinium-227. (author)

  16. Comment: 226 [Taxonomy Icon

    Full Text Available Danio rerio Danio rerio Danio_rerio_L.png 226.png Hiroyuki Takeda (The University of Tokyo) lice ... nsed under CC Attribution2.1 Japan 写真 提供:武田洋幸(東京大学) bando 2010/02/15 16:26:21 ...

  17. A new method for the determination of low-level actinium-227 in geological samples

    We developed a new method for the determination of 227Ac in geological samples. The method uses extraction chromatographic techniques and alpha-spectrometry and is applicable for a range of natural matrices. Here we report on the procedure and results of the analysis of water (fresh and seawater) and rock samples. Water samples were acidified and rock samples underwent total dissolution via acid leaching. A DGA (N,N,N',N'-tetra-n-octyldiglycolamide) extraction chromatographic column was used for the separation of actinium. The actinium fraction was prepared for alpha spectrometric measurement via cerium fluoride micro-precipitation. Recoveries of actinium in water samples were 80 ± 8 % (number of analyses n = 14) and in rock samples 70 ± 12 % (n = 30). The minimum detectable activities (MDA) were 0.017-0.5 Bq kg-1 for both matrices. Rock sample 227Ac activities ranged from 0.17 to 8.3 Bq kg-1 and water sample activities ranged from below MDA values to 14 Bq kg-1of 227Ac. From the analysis of several standard rock and water samples with the method we found very good agreement between our results and certified values. (author)

  18. Analysis of the gamma spectra of the uranium, actinium, and thorium decay series

    Momeni, M.H.

    1981-09-01

    This report describes the identification of radionuclides in the uranium, actinium, and thorium series by analysis of gamma spectra in the energy range of 40 to 1400 keV. Energies and absolute efficiencies for each gamma line were measured by means of a high-resolution germanium detector and compared with those in the literature. A gamma spectroscopy method, which utilizes an on-line computer for deconvolution of spectra, search and identification of each line, and estimation of activity for each radionuclide, was used to analyze soil and uranium tailings, and ore.

  19. Analysis of the gamma spectra of the uranium, actinium, and thorium decay series

    This report describes the identification of radionuclides in the uranium, actinium, and thorium series by analysis of gamma spectra in the energy range of 40 to 1400 keV. Energies and absolute efficiencies for each gamma line were measured by means of a high-resolution germanium detector and compared with those in the literature. A gamma spectroscopy method, which utilizes an on-line computer for deconvolution of spectra, search and identification of each line, and estimation of activity for each radionuclide, was used to analyze soil and uranium tailings, and ore

  20. acc226uopcoursesTutorial /uophelp

    keller

    2015-01-01

    For more course tutorials visit www.uophelp.com     ACC 226 Week 1 CheckPoint Accounts Receivable and Uncollectible Accounts ACC 226 Week 1 DQ 1 and DQ 2 ACC 226 Week 2 Assignment Accounting for Depreciation part ACC 226 Week 2 CheckPoint Ethics and Computing ACC 226 Week 3 CheckPoint Classifying Liabilities and Preparing Payroll Entries ACC 226 Week 3 DQ 2 ACC 226 Week 4 Assignment Stocks and Earnings per Share part ACC 226 Week 4 CheckPo...

  1. ACC 226 UOP COURSE TUTORIAL/ UOPHELP

    balumgm

    2015-01-01

    For more course tutorials visit www.uophelp.com     ACC 226 Week 1 CheckPoint Accounts Receivable and Uncollectible Accounts ACC 226 Week 1 DQ 1 and DQ 2 ACC 226 Week 2 Assignment Accounting for Depreciation part ACC 226 Week 2 CheckPoint Ethics and Computing ACC 226 Week 3 CheckPoint Classifying Liabilities and Preparing Payroll Entries ACC 226 Week 3 DQ 2 ACC 226 Week 4 Assignment Stocks and Earnings per Share part ACC 226 Week 4 CheckPo...

  2. ACC 226 Ash Course tutorial/uophelp

    THNSSER

    2015-01-01

    For more course tutorials visit www.uophelp.com   ACC 226 Week 1 CheckPoint Accounts Receivable and Uncollectible Accounts ACC 226 Week 1 DQ 1 and DQ 2 ACC 226 Week 2 Assignment Accounting for Depreciation part ACC 226 Week 2 CheckPoint Ethics and Computing ACC 226 Week 3 CheckPoint Classifying Liabilities and Preparing Payroll Entries ACC 226 Week 3 DQ 2 ACC 226 Week 4 Assignment Stocks and Earnings per Share part ACC 226 Week 4 CheckPoint Stock I...

  3. In-source laser spectroscopy developments at TRILIS—towards spectroscopy on actinium and scandium

    Resonance Ionization Laser Ion Sources (RILIS) have become a versatile tool for production and study of exotic nuclides at Isotope Separator On-Line (ISOL) facilities such as ISAC at TRIUMF. The recent development and addition of a grating tuned spectroscopy laser to the TRIUMF RILIS solid state laser system allows for wide range spectral scans to investigate atomic structures on short lived isotopes, e.g., those from the element actinium, produced in uranium targets at ISAC. In addition, development of new and improved laser ionization schemes for rare isotope production at ISAC is ongoing. Here spectroscopic studies on bound states, Rydberg states and autoionizing (AI) resonances on scandium using the existing off-line capabilities are reported. These results allowed to identify a suitable ionization scheme for scandium via excitation into an autoionizing state at 58,104 cm − 1 which has subsequently been used for ionization of on-line produced exotic scandium isotopes.

  4. ACC 226 UOP Course Tutorial / Tutorialrank

    charles

    2015-01-01

    For more course tutorials visit www.tutorialrank.com Tutorial Purchased: 5 Times, Rating: A+       ACC 226 Week 1 CheckPoint Accounts Receivable and Uncollectible Accounts   ACC 226 Week 1 DQ 1 and DQ 2   ACC 226 Week 2 Assignment Accounting for Depreciation part   ACC 226 Week 2 CheckPoint Ethics and Computing   ACC 226 Week 3 CheckPoint Classifying Liabilities and Preparing Payroll Entries   ...

  5. SSL_226_Critical_Habitat_AK

    US Fish and Wildlife Service, Department of the Interior — Steller Sea Lion Critical Habitat: PART 226 -- Designated Critical Habitat, west of 144 degrees west . The 131 sites from PART 226 - Designated [SSL] Critical...

  6. 7 CFR 226.3 - Administration.

    2010-01-01

    ... 7 Agriculture 4 2010-01-01 2010-01-01 false Administration. 226.3 Section 226.3 Agriculture... CHILD NUTRITION PROGRAMS CHILD AND ADULT CARE FOOD PROGRAM General § 226.3 Administration. (a) Within the Department, FNS shall act on behalf of the Department in the administration of the Program....

  7. 32 CFR 226.3 - Policy.

    2010-07-01

    ... 32 National Defense 2 2010-07-01 2010-07-01 false Policy. 226.3 Section 226.3 National Defense... THE HOMELESS § 226.3 Policy. (a) By Memorandum for the Secretaries of the Military Departments from... Secretary of Defense stated it is Department of Defense policy that shelters for the homeless may...

  8. 22 CFR 226.52 - Financial reporting.

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Financial reporting. 226.52 Section 226.52...-GOVERNMENTAL ORGANIZATIONS Post-award Requirements Reports and Records § 226.52 Financial reporting. USAID requires recipients to use the Standard Form 425 or Standard Form 425a, Federal Financial Report, or...

  9. 21 CFR 226.10 - Personnel.

    2010-04-01

    ... 21 Food and Drugs 4 2010-04-01 2010-04-01 false Personnel. 226.10 Section 226.10 Food and Drugs... CURRENT GOOD MANUFACTURING PRACTICE FOR TYPE A MEDICATED ARTICLES General Provisions § 226.10 Personnel. The key personnel and any consultants involved in the manufacture and control of the Type A...

  10. 31 CFR 226.5 - Examinations.

    2010-07-01

    ... 31 Money and Finance: Treasury 2 2010-07-01 2010-07-01 false Examinations. 226.5 Section 226.5... LOAN DEPOSITARIES § 226.5 Examinations. (a) Examinations by State regulatory authorities or audits by...) Examinations by State regulatory authorities or audits by CPA firms of insured financial institutions shall...

  11. 12 CFR 226.4 - Finance charge.

    2010-01-01

    ... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Finance charge. 226.4 Section 226.4 Banks and... LENDING (REGULATION Z) General § 226.4 Finance charge. (a) Definition. The finance charge is the cost of...) Charges by third parties. The finance charge includes fees and amounts charged by someone other than...

  12. 21 CFR 226.30 - Equipment.

    2010-04-01

    ... 21 Food and Drugs 4 2010-04-01 2010-04-01 false Equipment. 226.30 Section 226.30 Food and Drugs... Facilities and Equipment § 226.30 Equipment. Equipment used for the manufacture, processing, packaging, bulk... facilitate maintenance and operation for its intended purpose. The equipment shall: (a) Be so...

  13. 22 CFR 226.34 - Equipment.

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Equipment. 226.34 Section 226.34 Foreign... ORGANIZATIONS Post-award Requirements Property Standards § 226.34 Equipment. (a) Unless the agreement provides otherwise, title to equipment acquired by a recipient with Federal funds shall vest in the...

  14. 22 CFR 226.46 - Procurement records.

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Procurement records. 226.46 Section 226.46...-GOVERNMENTAL ORGANIZATIONS Post-award Requirements Procurement Standards § 226.46 Procurement records. Procurement records and files for purchases in excess of the small purchase threshold shall include...

  15. 22 CFR 226.31 - Insurance coverage.

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Insurance coverage. 226.31 Section 226.31...-GOVERNMENTAL ORGANIZATIONS Post-award Requirements Property Standards § 226.31 Insurance coverage. Recipients shall, at a minimum, provide the equivalent insurance coverage for real property and equipment...

  16. 32 CFR 226.4 - Responsibilities.

    2010-07-01

    ... 32 National Defense 2 2010-07-01 2010-07-01 false Responsibilities. 226.4 Section 226.4 National Defense Department of Defense (Continued) OFFICE OF THE SECRETARY OF DEFENSE (CONTINUED) MISCELLANEOUS SHELTER FOR THE HOMELESS § 226.4 Responsibilities. (a) The Deputy Assistant Secretary of...

  17. 12 CFR 226.24 - Advertising.

    2010-01-01

    ... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Advertising. 226.24 Section 226.24 Banks and Banking FEDERAL RESERVE SYSTEM (CONTINUED) BOARD OF GOVERNORS OF THE FEDERAL RESERVE SYSTEM TRUTH IN LENDING (REGULATION Z) Closed-End Credit § 226.24 Advertising. (a) Actually available terms. If...

  18. 12 CFR 226.16 - Advertising.

    2010-01-01

    ... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Advertising. 226.16 Section 226.16 Banks and Banking FEDERAL RESERVE SYSTEM (CONTINUED) BOARD OF GOVERNORS OF THE FEDERAL RESERVE SYSTEM TRUTH IN LENDING (REGULATION Z) Open-End Credit § 226.16 Advertising. (a) Actually available terms. If...

  19. Developments towards in-gas-jet laser spectroscopy studies of actinium isotopes at LISOL

    Raeder, S.; Bastin, B.; Block, M.; Creemers, P.; Delahaye, P.; Ferrer, R.; Fléchard, X.; Franchoo, S.; Ghys, L.; Gaffney, L. P.; Granados, C.; Heinke, R.; Hijazi, L.; Huyse, M.; Kron, T.; Kudryavtsev, Yu.; Laatiaoui, M.; Lecesne, N.; Luton, F.; Moore, I. D.; Martinez, Y.; Mogilevskiy, E.; Naubereit, P.; Piot, J.; Rothe, S.; Savajols, H.; Sels, S.; Sonnenschein, V.; Traykov, E.; Van Beveren, C.; Van den Bergh, P.; Van Duppen, P.; Wendt, K.; Zadvornaya, A.

    2016-06-01

    To study exotic nuclides at the borders of stability with laser ionization and spectroscopy techniques, highest efficiencies in combination with a high spectral resolution are required. These usually opposing requirements are reconciled by applying the in-gas-laser ionization and spectroscopy (IGLIS) technique in the supersonic gas jet produced by a de Laval nozzle installed at the exit of the stopping gas cell. Carrying out laser ionization in the low-temperature and low density supersonic gas jet eliminates pressure broadening, which will significantly improve the spectral resolution. This article presents the required modifications at the Leuven Isotope Separator On-Line (LISOL) facility that are needed for the first on-line studies of in-gas-jet laser spectroscopy. Different geometries for the gas outlet and extraction ion guides have been tested for their performance regarding the acceptance of laser ionized species as well as for their differential pumping capacities. The specifications and performance of the temporarily installed high repetition rate laser system, including a narrow bandwidth injection-locked Ti:sapphire laser, are discussed and first preliminary results on neutron-deficient actinium isotopes are presented indicating the high capability of this novel technique.

  20. Dicty_cDB: SHH226 [Dicty_cDB

    Full Text Available SH (Link to library) SHH226 (Link to dictyBase) - - - Contig-U11737-1 SHH226P (Link to Original site) SHH226...F 626 SHH226Z 574 SHH226P 1180 - - Show SHH226 Library SH (Link to library) Clone ID SHH226...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SH/SHH2-B/SHH226Q.Seq.d/ Representative seq. ID SHH226...P (Link to Original site) Representative DNA sequence >SHH226 (SHH226Q) /CSM/SH/SHH2-B/SHH226...ore E Sequences producing significant alignments: (bits) Value SHH226 (SHH226Q) /CSM/SH/SHH2-B/SHH226Q.Seq.d

  1. Dicty_cDB: SSI226 [Dicty_cDB

    Full Text Available SS (Link to library) SSI226 (Link to dictyBase) - - - Contig-U14708-1 SSI226E (Link... to Original site) - - - - - - SSI226E 573 Show SSI226 Library SS (Link to library) Clone ID SSI226 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SS/SSI2-B/SSI226Q.Seq.d/ Representative seq. ID SSI22...6E (Link to Original site) Representative DNA sequence >SSI226 (SSI226Q) /CSM/SS/SSI2-B/SSI226Q.Seq.d/ GAAAG...kk*kknk* tiiinkiify Translated Amino Acid sequence (All Frames) Frame A: erllyssi

  2. Dicty_cDB: AFH226 [Dicty_cDB

    Full Text Available AF (Link to library) AFH226 (Link to dictyBase) - - - - AFH226P (Link to Original site) AFH226F 262 AFH226...Z 655 AFH226P 917 - - Show AFH226 Library AF (Link to library) Clone ID AFH226 (Link ...ukuba.ac.jp/CSM/AF/AFH2-B/AFH226Q.Seq.d/ Representative seq. ID AFH226P (Link to ...Original site) Representative DNA sequence >AFH226 (AFH226Q) /CSM/AF/AFH2-B/AFH226Q.Seq.d/ ACTGTTGGCCTACTGGN...rsdppxxqxskgxpppfxsqikrx Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value AFH226 (AFH226

  3. Evaluation Of Radium-226 Pollution

    Full text: One of the applications of Radium-226 is in the obtaining of the radioactive gas Radon-222 used in therapeutic baths. The therapy of radon baths was widely used in the former Soviet Union, but it hasn't been used in Latvia since 1994. Nevertheless, the object where the Radon concentrate was obtained was not released from the state control until now. The previous tentative investigations have showed that territory and premises were polluted with Radium-226. It has gradually accumulated during more than 30 years of the object operation. Our aim was to carry out the systematic investigation of the radioactive pollution of the territory and buildings, to draw up the project of decontamination and decontaminate the object. Radiometers were used to measure the alpha and beta activities, and gamma spectrometers to measure gamma activities. Soil, different constructions materials, packed in the 200 liter metal barrels and hermetically sealed that were obtained after decontamination were measured with the γ spectrometer using the NaJ detector. On the basis of data obtained the project of decontamination of the object was drawn up and the decontamination was performed. It resulted in 125 m3 of the waste, 1/3 of which according to our measurements should be stored in the radioactive waste repository. (Authors)

  4. Dicty_cDB: VSH226 [Dicty_cDB

    Full Text Available VS (Link to library) VSH226 (Link to dictyBase) - - - Contig-U16444-1 VSH226Z (Link... to Original site) - - VSH226Z 729 - - - - Show VSH226 Library VS (Link to library) Clone ID VSH226 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/VS/VSH2-B/VSH226Q.Seq.d/ Representative seq. ID VSH226...Z (Link to Original site) Representative DNA sequence >VSH226 (VSH226Q) /CSM/VS/VSH2-B/VSH226Q.Seq.d/ XXXXX...M-cDNA Score E Sequences producing significant alignments: (bits) Value VSH226 (VSH226Q) /CSM/VS/VSH2-B/VSH226

  5. Dicty_cDB: SLH226 [Dicty_cDB

    Full Text Available SL (Link to library) SLH226 (Link to dictyBase) - - - Contig-U16444-1 SLH226Z (Link... to Original site) - - SLH226Z 516 - - - - Show SLH226 Library SL (Link to library) Clone ID SLH226 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLH2-B/SLH226Q.Seq.d/ Representative seq. ID SLH226...Z (Link to Original site) Representative DNA sequence >SLH226 (SLH226Q) /CSM/SL/SLH2-B/SLH226Q.Seq.d/ XXXXX...VSJ394Q.Seq.d/ 870 0.0 VSH226 (VSH226Q) /CSM/VS/VSH2-B/VSH226Q.Seq.d/ 870 0.0 VSF755 (VSF755Q) /CSM/VS/VSF7-

  6. Dicty_cDB: VFH226 [Dicty_cDB

    Full Text Available VF (Link to library) VFH226 (Link to dictyBase) - - - Contig-U11646-1 VFH226Z (Link... to Original site) - - VFH226Z 713 - - - - Show VFH226 Library VF (Link to library) Clone ID VFH226 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/VF/VFH2-B/VFH226Q.Seq.d/ Representative seq. ID VFH226...Z (Link to Original site) Representative DNA sequence >VFH226 (VFH226Q) /CSM/VF/VFH2-B/VFH226Q.Seq.d/ XXXXX...icant alignments: (bits) Value VFH226 (VFH226Q) /CSM/VF/VFH2-B/VFH226Q.Seq.d/ 1413 0.0 CHB686 (CHB686Q) /CSM

  7. 7 CFR 226.15 - Institution provisions.

    2010-01-01

    ....15, see the List of CFR Sections Affected, which appears in the Finding Aids section of the printed... 7 Agriculture 4 2010-01-01 2010-01-01 false Institution provisions. 226.15 Section 226.15... Institution provisions. (a) Tax exempt status. Except for for-profit centers and sponsoring organizations...

  8. 22 CFR 226.43 - Competition.

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Competition. 226.43 Section 226.43 Foreign Relations AGENCY FOR INTERNATIONAL DEVELOPMENT ADMINISTRATION OF ASSISTANCE AWARDS TO U.S. NON-GOVERNMENTAL.... The recipient shall be alert to organizational conflicts of interest as well as...

  9. 21 CFR 226.42 - Components.

    2010-04-01

    ... 21 Food and Drugs 4 2010-04-01 2010-04-01 false Components. 226.42 Section 226.42 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) DRUGS: GENERAL CURRENT GOOD MANUFACTURING PRACTICE FOR TYPE A MEDICATED ARTICLES Product Quality Control §...

  10. 31 CFR 226.6 - Financial reports.

    2010-07-01

    ... 31 Money and Finance: Treasury 2 2010-07-01 2010-07-01 false Financial reports. 226.6 Section 226.6 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) FISCAL SERVICE, DEPARTMENT OF THE TREASURY FINANCIAL MANAGEMENT SERVICE RECOGNITION OF INSURANCE COVERING TREASURY TAX...

  11. Dicty_cDB: CFH226 [Dicty_cDB

    Full Text Available CF (Link to library) CFH226 (Link to dictyBase) - G21772 DDB0219348 Contig-U02590-1 CFH226...Z (Link to Original site) - - CFH226Z 774 - - - - Show CFH226 Library CF (Link to library) Clone ID CFH226...riginal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/CF/CFH2-B/CFH226Q.Seq.d/ ...Representative seq. ID CFH226Z (Link to Original site) Representative DNA sequence >CFH226 (CFH226Q) /CSM/CF/CFH2-B/CFH226...*tnqtk*kqk* Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value CFH226 (CFH226

  12. Dicty_cDB: SSH226 [Dicty_cDB

    Full Text Available SS (Link to library) SSH226 (Link to dictyBase) - - - Contig-U15974-1 SSH226F (Link to Original site) SSH226...F 298 - - - - - - Show SSH226 Library SS (Link to library) Clone ID SSH226 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SS/SSH2-B/SSH226Q.Seq.d/ Representative seq. ID SSH226...F (Link to Original site) Representative DNA sequence >SSH226 (SSH226Q) /CSM/SS/SSH2-B/SSH226Q.Seq.d/ GAAAA...roducing significant alignments: (bits) Value VSG872 (VSG872Q) /CSM/VS/VSG8-C/VSG872Q.Seq.d/ 297 5e-80 SSH226 (SSH226

  13. Dicty_cDB: SFH226 [Dicty_cDB

    Full Text Available SF (Link to library) SFH226 (Link to dictyBase) - - - Contig-U11649-1 | Contig-U16366-1 SFH226...P (Link to Original site) SFH226F 637 SFH226Z 159 SFH226P 796 - - Show SFH226 Library SF (Link to library) Clone ID SFH226...49-1 | Contig-U16366-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SF/SFH2-B/SFH226...Q.Seq.d/ Representative seq. ID SFH226P (Link to Original site) Representative DNA sequence >SFH226 (SFH226...Q) /CSM/SF/SFH2-B/SFH226Q.Seq.d/ TAAACCAGNATTGTACAGAAGATGAATTAAAGAAAGCATATAGAAAGATGGCTGTTAAAT

  14. Conditioning of radium-226 sources in Peru

    The use of radium- 226 sources constitutes a high risk concerning its medical and sanitary applications. For this reason, Peruvian regulatory authorities are applying collection and conditioning policies. In Peru, after removing some radium-226 sources from hospital centers, with the support of the International Atomic Energy Agency through the Radioactive Wastes Management Plant of the 'RACSO' Nuclear Center, the first Ra-226 conditioning experience has been carried out. This document describes technical reasons, procedures used, sources characteristics, radiological protection mechanisms and motionless techniques used as well as provisional storage

  15. Dicty_cDB: VHH226 [Dicty_cDB

    Full Text Available VH (Link to library) VHH226 (Link to dictyBase) - - - Contig-U16477-1 - (Link to Original site) - - VHH226...Z 538 - - - - Show VHH226 Library VH (Link to library) Clone ID VHH226 (Link to dicty...iol.tsukuba.ac.jp/CSM/VH/VHH2-B/VHH226Q.Seq.d/ Representative seq. ID - (Link to ...Original site) Representative DNA sequence >VHH226 (VHH226Q) /CSM/VH/VHH2-B/VHH226Q.Seq.d/ XXXXXXXXXXCTATGTA...41Q) /CSM/VH/VHI5-B/VHI541Q.Seq.d/ 999 0.0 VHH226 (VHH226Q) /CSM/VH/VHH2-B/VHH226Q.Seq.d/ 999 0.0 VHE160 (VH

  16. Dicty_cDB: CHH226 [Dicty_cDB

    Full Text Available CH (Link to library) CHH226 (Link to dictyBase) - - - Contig-U16366-1 | Contig-U16429-1 CHH226...P (Link to Original site) CHH226F 563 CHH226Z 706 CHH226P 1249 - - Show CHH226 Library CH (Link to library) Clone ID CHH22...366-1 | Contig-U16429-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/CH/CHH2-B/CHH226...Q.Seq.d/ Representative seq. ID CHH226P (Link to Original site) Representative DNA sequence >CHH226 (CHH226...Q) /CSM/CH/CHH2-B/CHH226Q.Seq.d/ ATTAATTTTAATTTATATAAATTACCTTATTACTTAAAGATGACAACAAATAATCCATTT

  17. 21 CFR 226.58 - Laboratory controls.

    2010-04-01

    ...: GENERAL CURRENT GOOD MANUFACTURING PRACTICE FOR TYPE A MEDICATED ARTICLES Product Quality Control § 226.58...) Provisions for the maintenance of the results of any assays, including dates and endorsement of...

  18. Development of solid radium-226 reference materials

    Radium-226 reference materials having a matrix similar to soil or tailings samples are not available in sufficient quantity for use by remedial-action contractors to calibrate their laboratory gamma-ray spectrometers. Such reference materials are needed to provide uniform standardization among measurements made by remedial-action contractors. A task, therefore, was undertaken to prepare about 200 pounds each of three different concentrations of radium-226 reference materials by diluting tailings with high-purity silica. Target values for radium-226 content were 50, 15, and 5 pCi/g. The radium-226 content of the reference materials was measured by C.W. Sill of EG and G Idaho, Inc., Idaho Falls, using a high- resolution alpha spectrometry technique standardized with National Bureau of Standards (NBS) standard 4961. A summary of this technique is provided in Appendix A of this report. An independent measurement of the radium-226 content was conducted by Bendix Field Engineering Corporation (Bendix), Grand Junction, Colorado, using a high-resolution Ge(Li) detector, which was calibrated using the New Brunswick Laboratory (NBL) 100-A Series standards. The Ge(Li) detector has also been used to determine the radium-226 content in the calibration models at the Grand Junction facility; these models are used by remedial-action contractors for calibration of borehole logging gamma-ray probes. 8 references, 12 tables

  19. 21 CFR 226.1 - Current good manufacturing practice.

    2010-04-01

    ... 21 Food and Drugs 4 2010-04-01 2010-04-01 false Current good manufacturing practice. 226.1 Section...) DRUGS: GENERAL CURRENT GOOD MANUFACTURING PRACTICE FOR TYPE A MEDICATED ARTICLES General Provisions § 226.1 Current good manufacturing practice. (a) The criteria in §§ 226.10 through 226.115,...

  20. Purification of selenium from thorium, uranium, radium, actinium and potassium impurities for low background measurements

    A technique of selenium purification from 232Th, 238U, 226,228Ra, 227Ac and 40K was developed. This technique is simple to perform and employs a minimum number of highly pure reagents (bidistilled water, nitric acid). Operations carried out during purification (elution, evaporation) practically exclude losses of the target product (chemical yields of Se > 99%). A test purification of 100 g of selenium was carried out using this technique. The efficiency of this technique was confirmed by low background gamma spectrometry of the purified selenium sample. Distribution coefficients of Th, U, Ra and Ac on DOWEX 50W- x 8 cation-exchange resin at different concentrations of selenium and nitric acid were experimentally determinated. Instrumental neutron activation analysis of bidistilled water, deionized water and nitric acid was performed. (orig.)

  1. Purification of selenium from thorium, uranium, radium, actinium and potassium impurities for low background measurements

    Rakhimov, A.V. [Joint Institute for Nuclear Research (JINR), Dubna (Russian Federation); Uzbek Academy of Sciences, Tashkent (Uzbekistan). Inst. of Nuclear Physics (INP AS RUz); Warot, G. [CEA-CNRS, Modane (France). Laboratoire Souterrain de Modane (LSM); Karaivanov, D.V. [Joint Institute for Nuclear Research (JINR), Dubna (Russian Federation); Institute for Nuclear Research and Nuclear Energy (INRNE), Sofia (Bulgaria); Kochetov, O.I.; Lebedev, N.A.; Filosofov, D.V. [Joint Institute for Nuclear Research (JINR), Dubna (Russian Federation); Mukhamedshina, N.M.; Sadikov, I.I. [Uzbek Academy of Sciences, Tashkent (Uzbekistan). Inst. of Nuclear Physics (INP AS RUz)

    2013-07-01

    A technique of selenium purification from {sup 232}Th, {sup 238}U, {sup 226,228}Ra, {sup 227}Ac and {sup 40}K was developed. This technique is simple to perform and employs a minimum number of highly pure reagents (bidistilled water, nitric acid). Operations carried out during purification (elution, evaporation) practically exclude losses of the target product (chemical yields of Se > 99%). A test purification of 100 g of selenium was carried out using this technique. The efficiency of this technique was confirmed by low background gamma spectrometry of the purified selenium sample. Distribution coefficients of Th, U, Ra and Ac on DOWEX 50W- x 8 cation-exchange resin at different concentrations of selenium and nitric acid were experimentally determinated. Instrumental neutron activation analysis of bidistilled water, deionized water and nitric acid was performed. (orig.)

  2. The determination of radium-226 in urine

    The method for determining radium-226 in urine that is currently being used by the Bioassay Laboratory has been tested and documented. Radium-226 is coprecipitated from urine by alkaline calcium phosphate. This precipitate is redissolved in hydrochloric acid and the radium purified by cation exchange. Radium is collected by a barium sulphate coprecipitation and then estimated by alpha counting. The method has been tested using radium-226 and cross-contamination studies were performed using Am-24l, Pu-239, Np-237, Th-Nat and U-233. With the exception of Am-24l, cross-contaminations were found to be negligible. The method gives an overall chemical recovery of 80 +- 5α and the detection limit is estimated to be 0.39 mBq - counting time, 72 h; background, 0.05 counts per minute (cpm)

  3. Treatment of solid waste containing 226Ra

    This work is directed to the treatment of radioactive solid waste containing mainly radium (226Ra) produced from oil and gas production industries in Egypt. The treatment process has been carried out by suspending the clay fraction content in the solid waste in suitable leaching solutions. These compremise aqueous saline solution and aqueous saline solutions containing certain additives, namely, Washing Powder (W.P.), Shell and Span 20 surfactants. Treatment with saline solution containing either W.P. or Shell surfactants, showed an enhancement in the removal of 226Ra compared to that with saline solution alone or containing Span 20. Factors affect the treatment process have been investigated and discussed. The removal percentage of 226Ra was found to depend on the clay fines content in the solid waste. Further sequential treatment schemes have been tested and optimized

  4. Radiation exposure from radium-226 ingestion

    The contribution of radium to total radiation exposure resulting from the consumption of natural levels of 226Ra in several public water supplies in an Oklahoma county was determined. A pilot-level study of total dietary intake indicated that the culinary use of water anomalously high in radium and the consumption of water-based beverages contributed significantly to radiation exposure. The mean dietary intake of 226Ra was 20.6 pCi/day in one community and resulted in an estimated bone dose of 310 mrem/year

  5. 22 CFR 226.2 - Definitions.

    2010-04-01

    ... Identity (Identity) means the official marking for the United States Agency for International Development... Relations AGENCY FOR INTERNATIONAL DEVELOPMENT ADMINISTRATION OF ASSISTANCE AWARDS TO U.S. NON-GOVERNMENTAL... that receives a USAID subaward, as defined in 22 CFR 226.2. Supplies means all personal...

  6. 22 CFR 226.24 - Program income.

    2010-04-01

    ... Relations AGENCY FOR INTERNATIONAL DEVELOPMENT ADMINISTRATION OF ASSISTANCE AWARDS TO U.S. NON-GOVERNMENTAL ORGANIZATIONS Post-award Requirements Financial and Program Management § 226.24 Program income. (a) Recipients... project or program, and used to further eligible project or program objectives. (2) Used to finance...

  7. 22 CFR 226.27 - Allowable costs.

    2010-04-01

    ... Relations AGENCY FOR INTERNATIONAL DEVELOPMENT ADMINISTRATION OF ASSISTANCE AWARDS TO U.S. NON-GOVERNMENTAL ORGANIZATIONS Post-award Requirements Financial and Program Management § 226.27 Allowable costs. For each kind..., “Cost Principles for State and Local Governments.” The allowability of costs incurred by...

  8. 49 CFR 195.226 - Welding: Arc burns.

    2010-10-01

    ... 49 Transportation 3 2010-10-01 2010-10-01 false Welding: Arc burns. 195.226 Section 195.226 Transportation Other Regulations Relating to Transportation (Continued) PIPELINE AND HAZARDOUS MATERIALS SAFETY... PIPELINE Construction § 195.226 Welding: Arc burns. (a) Each arc burn must be repaired. (b) An arc burn...

  9. 22 CFR 226.42 - Codes of conduct.

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Codes of conduct. 226.42 Section 226.42 Foreign... ORGANIZATIONS Post-award Requirements Procurement Standards § 226.42 Codes of conduct. The recipient shall maintain written standards of conduct governing the performance of its employees engaged in the award...

  10. 12 CFR 226.23 - Right of rescission.

    2010-01-01

    ... obligation, the consumer shall have the right to rescind the transaction if: (i) A mortgage broker fee that... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Right of rescission. 226.23 Section 226.23... TRUTH IN LENDING (REGULATION Z) Closed-End Credit § 226.23 Right of rescission. (a) Consumer's right...

  11. 22 CFR 226.1002 - Local cost financing. [Reserved

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Local cost financing. 226.1002 Section 226.1002 Foreign Relations AGENCY FOR INTERNATIONAL DEVELOPMENT ADMINISTRATION OF ASSISTANCE AWARDS TO U.S. NON-GOVERNMENTAL ORGANIZATIONS USAID-Specific Requirements § 226.1002 Local cost financing....

  12. 25 CFR 226.22 - Prohibition of pollution.

    2010-04-01

    ... 25 Indians 1 2010-04-01 2010-04-01 false Prohibition of pollution. 226.22 Section 226.22 Indians... LANDS FOR OIL AND GAS MINING Operations § 226.22 Prohibition of pollution. (a) All operators... holes) in a manner that will prevent pollution and the migration of oil, gas, salt water or...

  13. 10 CFR 600.226 - Non-Federal audit.

    2010-01-01

    ... 10 Energy 4 2010-01-01 2010-01-01 false Non-Federal audit. 600.226 Section 600.226 Energy DEPARTMENT OF ENERGY (CONTINUED) ASSISTANCE REGULATIONS FINANCIAL ASSISTANCE RULES Uniform Administrative....226 Non-Federal audit. (a) Basic rule. Grantees and subgrantees are responsible for obtaining...

  14. 21 CFR 226.80 - Packaging and labeling.

    2010-04-01

    ... 21 Food and Drugs 4 2010-04-01 2010-04-01 false Packaging and labeling. 226.80 Section 226.80 Food...: GENERAL CURRENT GOOD MANUFACTURING PRACTICE FOR TYPE A MEDICATED ARTICLES Packaging and Labeling § 226.80 Packaging and labeling. (a) Packaging and labeling operations shall be adequately controlled: (1) To...

  15. 25 CFR 226.39 - Measurement of gas.

    2010-04-01

    ... 25 Indians 1 2010-04-01 2010-04-01 false Measurement of gas. 226.39 Section 226.39 Indians BUREAU OF INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR ENERGY AND MINERALS LEASING OF OSAGE RESERVATION LANDS FOR OIL AND GAS MINING Requirements of Lessees § 226.39 Measurement of gas. All gas, required to...

  16. 25 CFR 226.3 - Surrender of lease.

    2010-04-01

    ... 25 Indians 1 2010-04-01 2010-04-01 false Surrender of lease. 226.3 Section 226.3 Indians BUREAU OF... AND GAS MINING Leasing Procedure, Rental and Royalty § 226.3 Surrender of lease. Lessee may, with the approval of the Superintendent and payment of a $10 filing fee, surrender all or any portion of any...

  17. 25 CFR 226.10 - Term of lease.

    2010-04-01

    ... 25 Indians 1 2010-04-01 2010-04-01 false Term of lease. 226.10 Section 226.10 Indians BUREAU OF... AND GAS MINING Leasing Procedure, Rental and Royalty § 226.10 Term of lease. Leases issued hereunder..., and so stated in the notice of sale of such leases and so long thereafter as the minerals...

  18. New method for large scale production of medically applicable Actinium-225 and Radium-223

    Alpha-emitters (211At, 212Bi, 213Bi, 223Ra, 225Ac) are promising for targeted radiotherapy of cancer. Only two alpha decays near a cell membrane result in 50% death of cancer cell and only a single decay inside the cell is required for this. 225Ac may be used either directly or as a mother radionuclide in 213Bi isotope generator. Production of 225Ac is provided by three main suppliers - Institute for Transuranium Elements in Germany, Oak Ridge National Laboratory in USA and Institute of Physics and Power Engineering in Obninsk, Russia. The current worldwide production of 225Ac is approximately 1.7 Ci per year that corresponds to only 100-200 patients that could be treated annually. The common approach for 225Ac production is separation from mother 229Th or irradiation of 226Ra with protons in a cyclotron. Both the methods have some practical limitations to be applied routinely. 225Ac can be also produced by irradiation of natural thorium with medium energy protons . Cumulative cross sections of 225Ac, 227Ac, 227Th, 228Th formations have been obtained recently. Thorium targets (1-9 g) were irradiated by 114-91 MeV proton beam (1-50 μA) at INR linear accelerator. After dissolution in 8 M HNO3 + 0.004 M HF thorium was removed by double LLX by HDEHP in toluene (1:1). Ac and REE were pre-concentrated and separated from Ra and most fission products by DGA-Resin (Triskem). After washing out by 0.01 M HNO3 Ac was separated from REE by TRU Resin (Triskem) in 3 M HNO3 media. About 6 mCi 225Ac were separated in hot cell with chemical yield 85%. The method may be upscaled for production of Ci amounts of the radionuclide. The main impurity is 227Ac (0.1% at the EOB) but it does not hinder 225Ac from being used for medical 225Ac/213Bi generators. (author)

  19. Determination of radium-226 in environmental samples

    The analysis of soil and water samples for 226Ra by gamma spectrometry with a Ge(Li) detector was compared with that by radiochemical separation followed by 222Rn de-emanation. Lower limits of detection (LLD) for 226Ra were calculated for the two analytical techniques. The Ge(Li) system was found to have an LLD for soil comparable to that calculated for the de-emanation procedure, but the Ge(Li) system was found to have a significantly higher LLD for water samples. Cost analysis indicated that the cost of 222Ra determination with a Ge(Li) system can be less than with the de-emanation procedure if the Ge(Li) system can perform at least one other isotopic anaysis per sample

  20. Radium-226 on drinking water of Camaguey, Cuba; Radio-226 en agua potable de Camaguey, Cuba

    Montalvan Estrada, Adelmo; Brigido Flores, Osvaldo; Barrera Caballero, Aldo [Centro de Atencion a la Actividad Nuclear, Camaguey (Cuba)]. E-mail: sean@caonao.cmw.inf.cu; Escalante, Alexander [Centro Provincial de Higiene y Epidemiologia, Camaguey (Cuba)

    2001-07-01

    The specific activity of Ra-226 in drinking water of Camaguey city, Cuba, was measured using the emanometric method. The specific activity of Ra-226 in drinking water ranged from 15 {+-} 5 mBq.l{sup -1} to 39 {+-}12 mBq.l{sup -1}. The mean specific activity of Ra-226 was found to be 27 {+-} 8 mBq.l{sup -1}. No seasonal variation was found. Water samples were collected from the two main sources of drinking water: private wells and governmental water supply system, being the mean specific activities of Ra-226: 25 {+-} 7 mBq.l{sup -1} and 31 {+-} 9 mBq.l{sup -1} , respectively. Based upon measured concentrations the age-dependent associated effective doses due to the ingestion of Ra-226, as a consequence of direct consumption of drinking water, have been calculated. For the age interval 1 year to 5 years, the average effective dose was 6,2 {mu}Sv.y{sup -1}, and for adults the average effective dose was 5,2 {mu}Sv.y{sup -1}. (author)

  1. Radium-226 levels in Italian drinking waters and foods

    Levels of 226Ra in Italian waters and foods were measured. Results were similar to those found in other countries, except for some mineral waters with 226Ra concentrations above 1 pCi/liter andup to 19 pCi/liter. No difinite correlation was found between the 226Ra concentrations measured and the high natural background radiation levels determined in central Italy in previous work

  2. 50 CFR 226.207 - Critical habitat for leatherback turtle.

    2010-10-01

    ... 50 Wildlife and Fisheries 7 2010-10-01 2010-10-01 false Critical habitat for leatherback turtle. 226.207 Section 226.207 Wildlife and Fisheries NATIONAL MARINE FISHERIES SERVICE, NATIONAL OCEANIC AND... Critical habitat for leatherback turtle. Leatherback Sea Turtle (dermochelys coriacea) The waters...

  3. 50 CFR 226.209 - Critical habitat for hawksbill turtle.

    2010-10-01

    ... 50 Wildlife and Fisheries 7 2010-10-01 2010-10-01 false Critical habitat for hawksbill turtle. 226.209 Section 226.209 Wildlife and Fisheries NATIONAL MARINE FISHERIES SERVICE, NATIONAL OCEANIC AND... Critical habitat for hawksbill turtle. (a) Mona and Monito Islands, Puerto Rico—Waters surrounding...

  4. 50 CFR 226.208 - Critical habitat for green turtle.

    2010-10-01

    ... 50 Wildlife and Fisheries 7 2010-10-01 2010-10-01 false Critical habitat for green turtle. 226.208 Section 226.208 Wildlife and Fisheries NATIONAL MARINE FISHERIES SERVICE, NATIONAL OCEANIC AND ATMOSPHERIC... green turtle. (a) Culebra Island, Puerto Rico—Waters surrounding the island of Culebra from the...

  5. 20 CFR 226.31 - Reduction for public pension.

    2010-04-01

    ... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Reduction for public pension. 226.31 Section... § 226.31 Reduction for public pension. (a) The tier I annuity component of a spouse/divorced spouse... in receipt of a public pension. (b) When reduction is required. Unless the spouse or divorced...

  6. 22 CFR 226.15 - Metric system of measurement.

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Metric system of measurement. 226.15 Section....S. NON-GOVERNMENTAL ORGANIZATIONS Pre-award Requirements § 226.15 Metric system of measurement. (a...) declares that the metric system is the preferred measurement system for U.S. trade and commerce....

  7. 42 CFR 414.226 - Oxygen and oxygen equipment.

    2010-10-01

    ... 42 Public Health 3 2010-10-01 2010-10-01 false Oxygen and oxygen equipment. 414.226 Section 414... Equipment and Prosthetic and Orthotic Devices § 414.226 Oxygen and oxygen equipment. (a) Payment rules—(1) Oxygen equipment. Payment for rental of oxygen equipment is made based on a monthly fee schedule...

  8. 7 CFR 226.14 - Claims against institutions.

    2010-01-01

    ... 7 Agriculture 4 2010-01-01 2010-01-01 false Claims against institutions. 226.14 Section 226.14... against institutions. (a) State agencies shall disallow any portion of a claim for reimbursement and recover any payment to an institution not properly payable under this part. State agencies may...

  9. 7 CFR 226.5 - Donation of commodities.

    2010-01-01

    ... 7 Agriculture 4 2010-01-01 2010-01-01 false Donation of commodities. 226.5 Section 226.5... of commodities. (a) USDA foods available under section 6 of this Act, section 416 of the Agricultural... the Department shall be made available to each State. (b) The value of such commodities donated...

  10. Dicty_cDB: VHK226 [Dicty_cDB

    Full Text Available VH (Link to library) VHK226 (Link to dictyBase) - G02743 DDB0231318 Contig-U15510-1 VHK226P (Lin ... yfk wici*ikwdqfiliq*hfqkhmimvn*--- ---firsrq*nkclh*imc *tkdkskikfn*cnrrvyhlhflcfrfnrifnrlfndwfrf rw*r*yrrg ...

  11. 226Ra determination in phosphogypsum by alpha-particle spectrometry

    A radiochemical method for 226Ra determination by alpha-particle spectrometry in environmental samples has been developed in our laboratory. The method has been validated by measurements in samples with known concentrations of this radionuclide and it has been applied in studies related to 226Ra behaviour in phosphogypsum (the main by-product of producing phosphoric acid from phosphate rocks). (author)

  12. 12 CFR 226.2 - Definitions and rules of construction.

    2010-01-01

    ... Lending Act (15 U.S.C. 1601 et seq.). (2) Advertisement means a commercial message in any medium that... amount. § 226.2, Nt. Effective Date Note: At 74 FR 5398, Jan. 29, 2009, § 226.2 was revised, effective... definitions apply: (1) Act means the Truth in Lending Act (15 U.S.C. 1601 et seq. ). (2) Advertisement means...

  13. Dicty_cDB: VFJ226 [Dicty_cDB

    Full Text Available VF (Link to library) VFJ226 (Link to dictyBase) - G02600 DDB0186313 Contig-U09608-1 VFJ226P (Lin ... 0 8e-47 1 ( AF033921 ) Bactrocera xanthodes strain Fiji ... mitochondrial D-... 44 0.17 3 ( AF033928 ) Bactroc ...

  14. 21 CFR 226.40 - Production and control procedures.

    2010-04-01

    ... 21 Food and Drugs 4 2010-04-01 2010-04-01 false Production and control procedures. 226.40 Section 226.40 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) DRUGS: GENERAL CURRENT GOOD MANUFACTURING PRACTICE FOR TYPE A MEDICATED ARTICLES Product Quality...

  15. 25 CFR 226.19 - Use of surface of land.

    2010-04-01

    ... LANDS FOR OIL AND GAS MINING Operations § 226.19 Use of surface of land. (a) Lessee or his/her... routing shall be set by the Superintendent. The right to use water for lease operations is established by § 226.24. Lessee shall conduct his/her operations in a workmanlike manner, commit no waste and...

  16. 12 CFR Supplement I to Part 226 - Official Staff Interpretations

    2010-01-01

    ... print media, are covered by Regulation Z (12 CFR part 226). i. Examples include: A. Messages in a.... citizen residing or visiting abroad or to a foreign national abroad. 1(d) Organization. Paragraph 1(d)(1... with the final rules on co-branding in §§ 226.48(a) and (b) is mandatory for marketing occurring on...

  17. 48 CFR 952.226-74 - Displaced employee hiring preference.

    2010-10-01

    ... Displaced employee hiring preference. As prescribed in 48 CFR (DEAR) 926.7104, insert the following clause. Displaced Employee Hiring Preference (JUN 1997) (a) Definition. Eligible employee means a current or former... preference. 952.226-74 Section 952.226-74 Federal Acquisition Regulations System DEPARTMENT OF ENERGY...

  18. 12 CFR 226.11 - Treatment of credit balances.

    2010-01-01

    ... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Treatment of credit balances. 226.11 Section... SYSTEM TRUTH IN LENDING (REGULATION Z) Open-End Credit § 226.11 Treatment of credit balances. When a credit balance in excess of $1 is created on a credit account (through transmittal of funds to a...

  19. 12 CFR 226.21 - Treatment of credit balances.

    2010-01-01

    ... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Treatment of credit balances. 226.21 Section... SYSTEM TRUTH IN LENDING (REGULATION Z) Closed-End Credit § 226.21 Treatment of credit balances. When a credit balance in excess of $1 is created in connection with a transaction (through transmittal of...

  20. Use of carriers for to electrodeposited radium 226; Utilizacion de portadores para electrodepositar radio 226

    Iturbe, J.L

    1991-10-15

    The form of the energy distribution of a monoenergetic alpha particle starting from some emitting source of these particles, it depends on the quantity of material that its cross before being detected. Some authors deposit to the radium-226 by means of direct evaporation of the solution on metallic supports, on millipore paper and by electrodeposition. Some other ones place the radium solution in scintillation liquid, to quantify it by this technique. The objective of the present work is using carriers with the same oxidation state of the radium, that is to say of 2{sup +}, for treating to be electrodeposited to the radium-226 with the biggest possible percentage for later use the alpha spectroscopy technique to quantify it. The carriers that have been used until its they are barium and zinc in form of barium chloride, zinc nitrate and zinc sulfate. The first results indicate that with the zinc solution a yield of 40% of electrodeposited radium has been reached. (Author)

  1. Radium 226 in the deep north-eastern Atlantic Ocean

    With reference to the distribution of radium-226 in the western equatorial and north-eastern deep Atlantic Ocean it was possible to establish structures in the correlations of radium-226 to its chemical homologue Ba and dissolved SiO2. An 11-box model of the deep Atlantic Ocean was used to obtain information on the size of the radium-226 and Ba sources. The soil source derives mainly from the dissolution of barite. For the first time, an evaluation of the radium-226 flow resulting from the dissolution of particulate matter is presented. The box model and the radium-226 concentrations measured put down the value as 23-46·10-21 mol/m2s. (DG)

  2. Leaching of 226Ra from components of uranium mill tailings

    Landa, E.R.

    1991-01-01

    A sequential extraction procedure was used to characterize the geochemical forms of 226Ra retained by mixtures of quartz sand and a variety of fine-grained rock and mineral species. These mixtures had previously been exposed to the sulfuric acid milling liquor of a simulated acid-leach uranium milling circuit. For most test cases, the major fraction of the 226Ra was extracted with 1 mol/1 NH4Cl and was deemed to be exchangeable. However, 226Ra retained by the barite-containing mixture was resistant to both 1 mol/1 NH4Cl and 1 mol/HCHCl extraction. ?? 1991.

  3. Toxicity of injected radium-226 in immature dogs

    This study was conducted to determine the toxicity of injected 226Ra in immature dogs and to compare the results with those from studies of injected 226Ra in young adult dogs. An historic objective of these studies, initiated at the University of Utah and continued at ITRI, was to compare the results in dogs to the population of dial painters who ingested 226Ra as young adults. Age at the time of exposure is considered to be an important factor in dosimetry and risk of developing radiation-induced disease, particularly bone cancer. In summary, dogs injected with 226Ra when immature had increased occurrences of bone tumors in a dose-related fashion

  4. Toxicity of injected radium-226 in immature dogs

    Muggenburg, B.A.; Hahn, F.F.; Griffith, W.C. [and others

    1995-12-01

    This study was conducted to determine the toxicity of injected {sup 226}Ra in immature dogs and to compare the results with those from studies of injected {sup 226}Ra in young adult dogs. An historic objective of these studies, initiated at the University of Utah and continued at ITRI, was to compare the results in dogs to the population of dial painters who ingested {sup 226}Ra as young adults. Age at the time of exposure is considered to be an important factor in dosimetry and risk of developing radiation-induced disease, particularly bone cancer. In summary, dogs injected with {sup 226}Ra when immature had increased occurrences of bone tumors in a dose-related fashion.

  5. 31 CFR 800.226 - U.S. business.

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false U.S. business. 800.226 Section 800... TAKEOVERS BY FOREIGN PERSONS Definitions § 800.226 U.S. business. The term U.S. business means any entity... subsidiary is a U.S. business. Corporation A and its branch or subsidiary is each also a foreign...

  6. 226Ra bioavailability of plants at urgeirica uranium mill tailings

    Large amounts of solid wastes (tailings) resulting from the exploitation and treatment of uranium ore at the Urgeirica mine (north of Portugal) have been accumulated in dams (tailing ponds). To reduce the dispersion of natural radionuclides into the environment some dams were revegetated with eucalyptus (Eucalyptus globolus) and pines (Pinus pinea). Besides, some shrubs (Cytisus s.p.) are growing at some of the dams. The objective of this study is to determine the 226Ra bioavailability from uranium mill tailings through the quantification of the total and available fraction of radium in the solid wastes and to estimate its transfer to the plants growing on the tailing piles. Plants and solid waste samples were randomly collected at dams. Activity concentration of 226Ra in plants (aerial part and roots) and solid wastes were measured by gamma spectrometry. The exchangeable fraction of radium in solid wastes was quantified using one single step extraction with 1 mol dm-3 ammonium acetate (pH=7) or 1 mol dm-3 calcium chloride solutions. The results obtained for the 226Ra uptake by plants show that 226Ra concentration ratios for eucalyptus and pines decrease at low 226Ra concentration in the solid wastes and appear relatively constant at higher radium concentrations. For shrubs, the concentration ratios increase at higher 226Ra solid waste concentrations approaching a saturation value. Percentage values of 16.0±8.3 and 12.9±8.9, for the fraction of radium extracted from the solid wastes, using 1 mol dm-3 ammonium acetate or calcium chloride solutions respectively, were obtained. The 226Ra concentration ratios determined on the basis of exchangeable radium are one order of magnitude higher than those based on total radium. It can be concluded that, within the standard error values, more consistent 226Ra concentration ratios were obtained when calculated on the basis of available radium than when total radium was considered, for all the dams. (author)

  7. Dicty_cDB: CFD226 [Dicty_cDB

    Full Text Available CF (Link to library) CFD226 (Link to dictyBase) - - - Contig-U16287-1 CFD226Z (Link to Original ... equence. 64 5e-07 2 CF514038 |CF514038.1 CAbud0007_IVF _G07 Vitis vinifera cv. cabernet sauvignon (Clone 8 ... ) Bud - CABUD Vitis vinifera cDNA clone CAbud0007_IVF _G07 5', mRNA sequence. 64 3e-06 1 CB910900 |CB9109 ...

  8. The chemistry of 226Ra in the uranium milling process

    Uranium mining, ore crushing, grinding and leaching can substantially redistribute radium in the environment. Solvent extraction or other separation processes leave mill tailings with high 226Ra concentration. Radium is readily adsorbed on the surfaces of leached solids or coprecipitated with barium sulfates. More solid ore phase studies are required to identify all the physico-chemical mechanisms controlling 226Ra dissolution from leaching ore-liquor systems. 29 refs, 5 figs, 4 tabs

  9. 226Ra in the western Indian Ocean

    Chung, Y.

    1987-09-01

    226Ra profiles have been measured in the western Indian Ocean as part of the 1977-1978 Indian Ocean GEOSECS program. These profiles show a general increase in deep and bottom water Ra concentration from the Circumpolar region to the Arabian Sea. A deep Ra maximum which originates in the Arabian Sea and in the Somali basin at about 3000 m depth spreads southward into the Mascarene basin and remains discernible in the Madagascar and Crozet basins. In the western Indian Ocean, the cold Antarctic Bottom Water spreads northward under the possibly southward-flowing deep water, forming a clear benthic front along the Crozet basin across the Southwest Indian Ridge into the Madagascar and Mascarene basins. The Antarctic Bottom Water continues to spread farther north to the Somali basin through the Amirante Passage at 10°S as a western boundary current. The benthic front and other characteristic features in the western Indian Ocean are quite similar to those observed in the western Pacific where the benthic front as a distinctive feature was first described by Craig et al. [15]. Across the Mid-Indian Ridge toward the Ceylon abyssal plain near the triple junction, Ra profiles display a layered structure, reflecting the topographic effect of the mid-ocean ridge system on the mixing and circulation of the deep and bottom waters. Both Ra and Si show a deep maximum north of the Madagascar basin. Linear relationships between these two elements are observed in the deep and bottom water with slopes increasing northward. This suggests a preferential input of Ra over Si from the bottom sediments of the Arabian Sea and also from the flank sediments of the Somali basin.

  10. Late excretion rates of 226Ra and 210Pb following occupational or iatrogenic exposure. I. 226Ra

    The urinary and fecal excretion rates of 226Ra have been determined for 53 subjects who had been exposed to 226Ra; 25 had been radium dial painters, 16 were iatrogenic (medical) cases and 12 were former radium chemists. The mean coefficient of elimination, CE (fraction of body content excreted annually), was significantly lower for the medical cases than for dial painters. The mean ratio of urinary-to-fecal excretion rates was 3.0 +- 0.7%

  11. Natural Radium-226 accumulation in the human thyroid gland

    Full text: Small amounts of Ra-226 and other radium isotopes routinely enter the human body through normal dietary intake and, in some cases, through occupational exposure. Currently accepted biokinetic models for radium in the human body assume a uniform distribution among all soft tissues and a short retention time in those tissues. These assumptions persist despite publications in the mid-1980s indicating that radium concentrations in tissue are related to calcium levels in each organ, implying that the thyroid gland could accumulate greater concentrations of radium isotopes than any other tissue. Moreover, the natural intake or production of sulfate or barium compounds in the body could serve to precipitate radium in the thyroid gland, thereby immobilizing it, with the result that the radionuclide stays resident for many years. Evidence of both accumulation and immobilization of Ra-226 in thyroids of grazing animals has been documented since the 1960s by one of us (LVM). Little is known, however, about the concentration and retention of radium in the human thyroid. Reported here, for the first time, are Ra-226 measurement data from about 100 human thyroids collected from over 95 persons with no known occupational exposure to radium with lifetime residences in the US and other countries, one person who routinely ingested a homeopathic preparation containing Ra-226, and three uranium miners. Sensitive measurements were made using the radon emanation technique. Regardless of the origin of the thyroid sample, Ra-226 activity was almost always detected above the detection limit of 0.65 mBq when at least 10 g of thyroid tissue were available. Our analyses to-date suggests a background concentration in human thyroids of about 0.1 ±0.01 Bq/kg, considerably greater than the commonly reported literature value of 0.003 Bq/kg in soft tissues. In addition, our measurements indicate concentrations of Ra-226 in the three uranium miners (whose exact job description was

  12. Radium-226 on drinking water of Camaguey, Cuba

    The specific activity of Ra-226 in drinking water of Camaguey city, Cuba, was measured using the emanometric method. The specific activity of Ra-226 in drinking water ranged from 15 ± 5 mBq.l-1 to 39 ±12 mBq.l-1. The mean specific activity of Ra-226 was found to be 27 ± 8 mBq.l-1. No seasonal variation was found. Water samples were collected from the two main sources of drinking water: private wells and governmental water supply system, being the mean specific activities of Ra-226: 25 ± 7 mBq.l-1 and 31 ± 9 mBq.l-1 , respectively. Based upon measured concentrations the age-dependent associated effective doses due to the ingestion of Ra-226, as a consequence of direct consumption of drinking water, have been calculated. For the age interval 1 year to 5 years, the average effective dose was 6,2 μSv.y-1, and for adults the average effective dose was 5,2 μSv.y-1. (author)

  13. Leaching of RA-226 contaminated gravel using different aqueous treatments

    Investigation of the efficiencies of different aqueous leaching treatments was carried out on gravel artificially contaminated with Ra-226. The extent of leaching efficiency was determined in terms of Ra-226 and its daughter Rn-222. Liquid scintillation counting using high efficiency mineral oil based liquid scintillator was the technique adopted for measuring Ra-226 and Rn-222 leached off the contaminated gravel. Water, dilute solutions of barium chloride and HCl were used as leachants. Different masses of gravel were leached with 200 mL of leachant for various contact time periods. The leached Rn-222 activity measured was plotted vs the decay factor e; from which Rn-222 and Ra-226 originally present in the sample were determined. Several leaching parameters were tested; namely type of leachant, leachant volume/gravel mass ratio, leachant contact time, effect of varying Ba Cl2 concentration, and successive leaching. Optimization of the leaching parameters for desorption of Ra-226 off the contaminated gravel under laboratory conditions may help determine the ideal conditions for remediating soil contaminated with radium or chemically similar radionuclides. 7 figs

  14. 226Ra i 228Ra in Croatian Rivers

    Results of 226Ra and 228Ra in Croatian river waters are presented in this paper. The presence of natural radionuclides in the Croatian rivers emphasizes the need for continuous monitoring. 226Ra and 228Ra were chosen as a possible source of human exposure to radioactivity due to their high radio-toxicity. River water samples (50 L) were collected from the Danube, Drava, Sava, Krka and Neretva rivers twice a year from 2002 to 2006. Activity concentrations of 226Ra ranged from 6.54 mBq L-1 to 59.44 mBq L-1 and 228Ra activity concentrations ranged from 2.57 mBq L-1 to 20.76 mBq L-1. The highest values of both 226Ra and 228Ra were measured in the Drava river, and the lowest values in the Sava river. Statistically significant differences were not observed between radium concentrations from two watersheds (the Black Sea and the Adriatic Sea watershed), nor between 226Ra/228Ra ratio in rivers individually. The number of collected samples is insufficient to make statistically significant conclusions. Further investigation is necessary to obtain larger number of samples. However, the data obtained in this study could be the baseline for evaluating possible future changes.(author)

  15. The daily intake of 226 Radio by phosphatic region residents

    The uranium-phosphate region of northeastern Brazil comprehends a 4 km wide land strip that spans over 150 km of the coastal region of the states of Pernambuco and Paraiba. People that live in these region are subject to higher than normal levels of background radiation, due to the presence of natural uranium and their progeny in the environment. In this study, the concentrations of 226 Ra in locally grown produce, as well as in the water were determined. The mean concentration of 226 Ra in the food items included in this study was of 357.7 mBq/kg (wet weight). The mean 226 Ra concentration in the water was of 282.2 mBq/L. The annul rate, due to the combined consumption of food and water by the local population was estimated to be of 275.35 Bq

  16. Past and present of risk assessment for RA-226 releases

    Some of the new concepts introduced by ICRP 26 seem to be difficult to apply to the case of dose limits concerning the 226Ra releases from the front end of the nuclear fuel cycle. Accordingly most national legislations have not been permeated yet by the 226Ra dose limits based on such concepts. This work calls the attention on the one hand that a loose concept of acceptable risk is implicitly used in a dose limitation system for 226Ra when such system is based on calculating the dose as a fraction of the (MPC) sub(w) introduced earlier by the ICRP 2, and on the other hand that the ALI currently recommended by the ICRP 30 should be used only in the framework of the recommendations published in the ICRP 26, which adopts a better defined concept of risk. (Author)

  17. Radium-226 in waters of the Amazon river

    Analysis of the Amazon river waters for 226Ra content is carried out. Exploration works are carried out in the framework of the soviet investigations of the Amazon river in 1983 by the Academy of Science of USSR on board a research ship ''Professor Schtokman'' with the agreement and participation of brazilian scientists. Radium determination has been carried out in reference with equilibrium radon preliminary accumulated in samples (30 y) tightly closed. The general 226Ra concentrations observed in the Amazon waters exceed 4-6 times the values known before relating to a ''diluted'' element fraction. It happens due to the presence of the river suspended matter in the water analysed; it is a carrier of additional quantities of 226Ra, and considerable. The mixture zone of river and ocean waters is shown to be no ''geochemical barrier'' on the way to the ocean for river radium inlike the other microelements of the river run-off

  18. Determination of Ra-226 by gamma-ray spectrometry

    This work deals with the method of determination of 226Ra by low energy photon spectrometry. For this purpose, the interference due to 235U, that emits a photon with a close energy, has to be considered. The contribution of 235U to the 186 KeV photopeak is studied through the 63 KeV 234Th and the 144 KeV 235U emissions. From the minimum detectable activity of 226Ra it is discussed the applicability of this method to several kind of samples. (Author)

  19. 40 CFR 98.226 - Data reporting requirements.

    2010-07-01

    ... (CONTINUED) MANDATORY GREENHOUSE GAS REPORTING Nitric Acid Production § 98.226 Data reporting requirements... specified in paragraphs (a) through (o) of this section for each nitric acid production train. (a) Train... nitric acid production from each nitric acid train (tons, 100 percent acid basis). (d) Annual......

  20. Radium-226 determination in different substances without preliminary chemical isolation

    A method of radium-226 determination, based on the measurement of radon-222 quantity, extracted from the substance analyzed, is developed. Determination limit of radium, equal to 6.6x10-15 mass.%, is achieved at the expense of application of low-background proportional counter and special vacuum installation to fill the detector with working gas mixture

  1. Production of U-230/Th-226 for targeted alpha therapy

    Morgenstern, A.; Abbas, K.; Bruchertseifer, F.; Lebeda, Ondřej; Simonelli, F.; Štursa, Jan; Apostolidis, C.

    2007-01-01

    Roč. 34, Suppl. 2 (2007), S260-S260. ISSN 1619-7070. [20th Annual Congress of the European-Association-of- Nuclear - Medicine . 13.10.2007–17.10.2007, Copenhagen] Institutional research plan: CEZ:AV0Z10480505 Keywords : U-230/Th-226 * alpha therapy Subject RIV: BG - Nuclear , Atomic and Molecular Physics, Colliders

  2. 226Ra and calcium in the human eye

    The left eye from each of two CHR cases, 01 to 144 (body burden 690 nCi) and 01-017 (body burden 1210 nCi) was analyzed for 226Ra and calcium. The total amounts in the eye were 1.80 pCi of 226Ra and 2.3 mg of Ca in case 01 to 144, and 5.4 pCi of 226Ra and 14.2 mg of calcium in case 01 to 017. For the latter case the eye was dissected and showed the highest concentrations of activity (on a wet basis) in the choroid, 3.8 pCi/g, sclera 3.4 pCi/g and iris 2.9 pCi/g. The radium content of the eye was 2.7 x 10-4 percent to 4.7 x 10-4 percent of the total body content at 50 to 55 yr after first exposure. The 226Ra/Ca ratios in the whole eye were 1/3 to 1/4 those in the whole body, but that for the choroid from the dissected eye was identical to that of the whole body

  3. 18 CFR 3b.226 - Accounting of disclosures.

    2010-04-01

    ... IDENTIFIABLE PERSONAL INFORMATION Rules for Disclosure of Records § 3b.226 Accounting of disclosures. (a) The... this section for at least five years from the date of disclosure for which the accounting is made, or... be maintained for disclosure of the accounting of disclosures....

  4. 12 CFR 226.33 - Requirements for reverse mortgages.

    2010-01-01

    ... this section or has signed an application for a reverse mortgage loan. (2) Total annual loan cost rates... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Requirements for reverse mortgages. 226.33....33 Requirements for reverse mortgages. (a) Definition. For purposes of this subpart, reverse...

  5. 12 CFR 226.12 - Special credit card provisions.

    2010-01-01

    ... both credit and electronic fund transfer aspects, refer to Regulation E, 12 CFR 205.12(a) regarding... Regulation E. For guidance on whether Regulation Z (12 CFR part 226) or Regulation E (12 CFR part 205... CFR 205.12(a) regarding issuance and liability for unauthorized use. On matters other than...

  6. Radium-226 removal by precipitation and sedimentation in settling ponds

    A recent pilot plant program carried out at Rio Algom's Quirke uranium mine at Elliot Lake, Ontario, is described. The goal was the production of tailings basin effluents which were low in total radium 226. The process tested involved precipitation of radium with barium chloride and sedimentation in plastic-lined settling ponds. Adjustment of the tailings basin overflow from its normal value of pH 9.5 by addition of sulphuric acid to about pH 7.5 was found to give approximately a five-fold improvement in total radium 226 removal. A five-month demonstration test resulted in an effluent with a mean total radium 226 activity of 44 pCi/l after 2.5 days settling time and 29 pCi/l after five days. The results are used to propose a schedule of achievable total radium 226 activities where precipitation and sedimentation are employed. The maximum suggested values after five days nominal settling time are: 30 pCi/l in an annual mean, 60 pCi/l in a monthly mean, 60 pCi/l in a weekly mean, and 80 pCi/l in any single grab sample. (auth)

  7. 12 CFR 226.13 - Billing error resolution. 27

    2010-01-01

    ..., 12 CFR 205.11 governing error resolution rather than those of paragraphs (a), (b), (c), (e), (f), and... account, the creditor shall comply with the requirements of Regulation E, 12 CFR 205.11 governing error... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Billing error resolution. 27 226.13 Section...

  8. 25 CFR 226.14 - Contracts and division orders.

    2010-04-01

    ... Indians BUREAU OF INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR ENERGY AND MINERALS LEASING OF OSAGE RESERVATION LANDS FOR OIL AND GAS MINING Leasing Procedure, Rental and Royalty § 226.14 Contracts and division.... Lessee shall be responsible for the correct measurement and reporting of all oil and/or gas taken...

  9. 40 CFR 180.226 - Diquat; tolerances for residues.

    2010-07-01

    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Diquat; tolerances for residues. 180... PROGRAMS TOLERANCES AND EXEMPTIONS FOR PESTICIDE CHEMICAL RESIDUES IN FOOD Specific Tolerances § 180.226 Diquat; tolerances for residues. (a) General. (1) Tolerances are established for residues of the...

  10. Estuarine geochemistry of 224Ra, 226Ra, and 222Rn

    Desorption from river borne sediments is the most likely source of the excess 226Ra. Laboratory mixing experiments on Pee Dee River sediments show an increase in 226Ra desorption with increasing salinities with maximum desorption occurring at or above 200/oo salinity. Desorption and diffusion are the sources for 226Ra in the estuarine systems. In Winyah Bay the 228Ra/226Ra activity ratio does not change significantly with salinity, averaging around 1.4, indicating desorption as the major source of 228Ra. In the Yangtze River the 228Ra/226Ra activity ratio is constant (approx.1.90) until increasing linearly above 160/oo. A diffusive flux from regeneration by 232Th decay in shelf sediments is the source of the increase. In Delaware Bay 228Ra increases faster than 226Ra in the less than or equal to220/oo water, indicating a source in addition to desorption. The increase can be balanced by a 0.33 dpm/cm2-year flux over the upper part of the Bay where fine grained sediments predominate. 224Ra behavior is controlled by its 3.64 day half-life. In Winyah Bay a flux of around 0.4 dpm/cm2-day is necessary to support the standing crop of non-desorbed 224Ra in the water column. In Delaware Bay the nearly constant 224Ra in concentration over the 2.50/oo to 120/oo salinity range are maintained by regeneration from 228Th in the turbidity maximum zones and diffusion from bottom sediments. Water leaving on ebb tide from a salt marsh on Delaware Bay had increases in all three radium isotopes (224Ra > 228Ra > 226Ra) compared to water coming in on the flood tide. Excess 222Rn concentrations in a fresh water section of the Pee Dee River show a decreasing downstream gradient. Using these gradients to determine evasion rates, stagnant film thicknesses range from 21μ to 62μ

  11. Removal of radium-226 from uranium mining effluents

    Uranium mining and milling operations usually generate large quantities of solid and liquid waste materials. A slurry, consisting of waste rock and chemical solutions from the milling operation, is discharged to impoundment areas (tailings basins). Most of the radioactive material dissolved in tailings slurries is precipitated by the addition of lime and limestone prior to discharge from the mill. However, the activity of one radioisotope, radium-226, remains relatively high in the tailings basin effluents. In Canada, radium-226 is removed from uranium mining and milling effluents by the addition of barium chloride to precipitate barium-radium sulphate [(Ba,Ra)SO4]. Although dissolved radium-226 activities are generally reduced effectively, the process is considered to have two undesirable characteristics: the first related to suspended radium-226 in the effluents and the second to ultimate disposal of the (Ba,Ra)SO4 sludge. A government-industry mining task force established a radioactivity sub-group in 1974 to assist in the development of effluent guidelines and regulations for the uranium mining industry (Radioactivity Sub-group, 1974). The investigation of more effective removal methods was recommended, including the development of mechanical treatment systems as alternatives to settling ponds. Environment Canada's Wastewater Technology Centre (WTC) initiated a bench scale study in March, 1976 which was designed to assess the feasibility of using precipitation, coagulation, flocculation and sedimentation for the removal of radium-226. In 1977, the study was accelerated with financial assistance from the Atomic Energy Control Board. The results were favourable, with improved radium removals obtained in bench scale batch tests using barium chloride as the precipitant and either alum or ferric chloride as the coagulant. A more comprehensive bench scale and pilot scale process development and demonstration program was formulated. The results of the joint study are

  12. Marine radioactivity concentration in the Exclusive Economic Zone of Peninsular Malaysia. 226Ra, 228Ra and 228Ra/226Ra

    The present occurrence of 226Ra and 228Ra in marine sediment core and fish from the Exclusive Economic Zone in the east coast of Peninsular Malaysia were studied. Sediment core and biota in respectively was collected using multicorer device and purchased from local fishermen at identified stations during the cruise expedition conducted in 2008. The purpose of this study was to determine and to make available an inventory of activity concentration levels and activity ratio for these radionuclides in this region. The activity concentrations of 226Ra and 228Ra in sediment core and edible part of fish were ranged between 15.9-46.5 and 27.7-87.1 Bq/kg dry wt and; 0.80-2.13 and 228Ra/226Ra in sediment core and fish were varied with the range between 1.63-2.09 and 0.45-2.38, respectively. Refer to those ranges the activity concentrations of radium isotopes were comparable with other region. Thus, it can be concluded that the occurrence of radium isotopes mainly supplied from terrestrial sources and the factors of assimilation efficiency and transfer coefficient of radium may probably effect to the variation activity concentration of 226Ra and 228Ra and its activity ratio in edible part of pelagic and demersal fish obtained in this study. (author)

  13. 10 CFR 431.226 - Energy conservation standards and their effective dates.

    2010-01-01

    ... 10 Energy 3 2010-01-01 2010-01-01 false Energy conservation standards and their effective dates. 431.226 Section 431.226 Energy DEPARTMENT OF ENERGY ENERGY CONSERVATION ENERGY EFFICIENCY PROGRAM FOR... Conservation Standards § 431.226 Energy conservation standards and their effective dates. Any traffic...

  14. 17 CFR 256.226 - Unamortized discount on long-term debt-debit.

    2010-04-01

    ... COMPANIES, PUBLIC UTILITY HOLDING COMPANY ACT OF 1935 6. Long-Term Debt § 256.226 Unamortized discount on... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Unamortized discount on long-term debt-debit. 256.226 Section 256.226 Commodity and Securities Exchanges SECURITIES AND...

  15. 50 CFR 226.215 - Critical habitat for the North Pacific Right Whale (Eubalaena japonica).

    2010-10-01

    ... Right Whale (Eubalaena japonica). 226.215 Section 226.215 Wildlife and Fisheries NATIONAL MARINE... DESIGNATED CRITICAL HABITAT § 226.215 Critical habitat for the North Pacific Right Whale (Eubalaena japonica). (a) Primary Constituent Elements. The primary constituent elements of the North Pacific right...

  16. 50 CFR 226.206 - Critical habitat for the Southern Resident killer whale (Orcinus orca).

    2010-10-01

    ... killer whale (Orcinus orca). 226.206 Section 226.206 Wildlife and Fisheries NATIONAL MARINE FISHERIES... CRITICAL HABITAT § 226.206 Critical habitat for the Southern Resident killer whale (Orcinus orca). Critical habitat is designated for the Southern Resident killer whale as described in this section. The...

  17. 77 FR 16890 - Second Meeting: RTCA Special Committee 226, Audio Systems and Equipment

    2012-03-22

    ... Federal Aviation Administration Second Meeting: RTCA Special Committee 226, Audio Systems and Equipment... meeting RTCA Special Committee 226, Audio Systems and Equipment. SUMMARY: The FAA is issuing this notice to advise the public of the second meeting of RTCA Special Committee 226, Audio Systems and...

  18. 76 FR 79755 - First Meeting: RTCA Special Committee 226 Audio Systems and Equipment

    2011-12-22

    ... Federal Aviation Administration First Meeting: RTCA Special Committee 226 Audio Systems and Equipment... RTCA Special Committee 226, Audio Systems and Equipment. SUMMARY: The FAA is issuing this notice to advise the public of a meeting of RTCA Special Committee 226, Audio Systems and Equipment, for the...

  19. 12 CFR 226.32 - Requirements for certain closed-end home mortgages.

    2010-01-01

    ... signed a loan application. If you obtain this loan, the lender will have a mortgage on your home. You... reverse mortgage transaction subject to § 226.33. (iii) An open-end credit plan subject to subpart B of... mortgages. 226.32 Section 226.32 Banks and Banking FEDERAL RESERVE SYSTEM (CONTINUED) BOARD OF GOVERNORS...

  20. 12 CFR 226.1 - Authority, purpose, coverage, organization, enforcement and liability.

    2010-01-01

    ... closed-end credit transactions and total annual loan cost rates for reverse mortgage transactions. (e..., including the total annual loan cost rate, for reverse mortgage transactions. Section 226.34 prohibits... connection with higher-priced mortgage loans, as defined in § 226.35(a). Section 226.36 prohibits...

  1. Increased levels of soluble CD226 in sera accompanied by decreased membrane CD226 expression on peripheral blood mononuclear cells from cancer patients

    Xu Zhuwei

    2009-06-01

    Full Text Available Abstract Background As a cellular membrane triggering receptor, CD226 is involved in the NK cell- or CTL-mediated lysis of tumor cells of different origin, including freshly isolated tumor cells and tumor cell lines. Here, we evaluated soluble CD226 (sCD226 levels in sera, and membrane CD226 (mCD226 expression on peripheral blood mononuclear cells (PBMC from cancer patients as well as normal subjects, and demonstrated the possible function and origin of the altered sCD226, which may provide useful information for understanding the mechanisms of tumor escape and for immunodiagnosis and immunotherapy. Results Soluble CD226 levels in serum samples from cancer patients were significantly higher than those in healthy individuals (P P Conclusion These findings suggest that sCD226 might be shed from cell membranes by certain proteases, and, further, sCD226 may be used as a predictor for monitoring cancer, and more important, a possible immunotherapy target, which may be useful in clinical application.

  2. Determination of Radium 226 in mexican phosphate fertilizers and gypsum by gamma spectrometry

    The 226 Ra isotope was determined in 17, 20 and 46% m/m phosphate fertilizers and gypsum. The samples of the fertilizers were dissolved in 10% v/v nitric acid solutions. The barium sulphate method was used for the precipitation of 226 Ra. On the other hand, alkaline fusion method was used to separate the 226 Ra from gypsum. The results indicated that 226 Ra was present in the phosphate fertilizers and gypsum. The 226 Ra concentrations present in these materials were between 10 -4 - 10 -5 μg g-1. (Author)

  3. Recalibration of the 226Ra emanation analysis system

    The 226Ra emanation system was found to require recalibration. The gain of the various counting systems was established to about +-0.5%. The variance introduced into the analysis by multiple counting systems was low and corresponded to a fractional standard deviation of +-0.5%. The variance introduced into the analysis by both multiple counting systems and multiple counting chambers needs to be redetermined but is less than a fractional standard deviation of +-2%. The newly established calibration factor of 5.66 cpm/pg 226Ra is about 6% greater than that used previously. The leakage of radon into the greased fittings of the emanation flask which was indicated in an earlier study was not confirmed

  4. Salinity dependence of 226Ra adsorption on montmorillonite and kaolinite

    The effect of NaCl concentration (10.0-1,000 mM) on 226Ra adsorption was investigated in the presence of montmorillonite and kaolinite. A positive correlation was observed between the dissolved 226Ra and NaCl concentrations in the presence of these adsorbents. Distribution coefficients decreased from the order of 104 to 100 (mL g-1) with an increase in NaCl concentration. Although the coefficients were higher for montmorillonite than kaolinite at lower NaCl concentrations, the trend was reversed at higher NaCl concentrations (≥500 mM) owing to the sharper reduction of the coefficient for montmorillonite with the increase in NaCl concentration. The rapid reduction was ascribed to higher negative charge density of montmorillonite, which leads the Ra2+ adsorption mechanism to approach charge-compensating ion exchange. (author)

  5. Use of carriers for to electrodeposited radium 226

    The form of the energy distribution of a monoenergetic alpha particle starting from some emitting source of these particles, it depends on the quantity of material that its cross before being detected. Some authors deposit to the radium-226 by means of direct evaporation of the solution on metallic supports, on millipore paper and by electrodeposition. Some other ones place the radium solution in scintillation liquid, to quantify it by this technique. The objective of the present work is using carriers with the same oxidation state of the radium, that is to say of 2+, for treating to be electrodeposited to the radium-226 with the biggest possible percentage for later use the alpha spectroscopy technique to quantify it. The carriers that have been used until its they are barium and zinc in form of barium chloride, zinc nitrate and zinc sulfate. The first results indicate that with the zinc solution a yield of 40% of electrodeposited radium has been reached. (Author)

  6. Radium - 226 levels in some sudanese plants and soils

    The natural levels of 226 Ra in plant and soil samples have been studied. The field study was mainly conducted in western Sudan (Darfur and Kurdofan) where areas of high natural background radiation have been identified and Khartoum area was taken as a control to (i) assess in natural setting the soil-to-plant concentration ratios (concentration in dry sample / concentration in dry soil) of the naturally occurring radionuclide 226 Ra, (ii) establish base-line data on Radium activity concentration levels in environmental materials and (iii) explore the area of high natural radiation background in western Sudan.Low level gamma spectrometry, employing high purity germanium detector (HPGe) of relative efficiency 12%, has been used for the determination of 226 Ra activity concentrations in plant and soil samples. The mean Radium activity concentration found in soil ranged from 14.41 Bq/Kg to 79.08 Bq/Kg, the values correspond to the reported normal background levels of 226 Ra in soils worldwide. Radium activity concentrations found in Sudanese plants were significantly higher compared to those related to plants from normal background regions and significantly lower than those reported for plants from high background regions in other countries. The mean soil/plant concentration ratios (CRs) found in this study were 0.12, 0.15, 0.17 and 0.08 for whole plants, fruits and leafy vegetables, root vegetables and grains, respectively. These ranges of CR values are comparable with overall range of CR where environmental conditions are normal. The estimated daily intakes by individuals consuming foods of local origin were 1.00, 10.4 and 7.91 Bq/Day of radium Khour Abu Habil, Arkuri and Dumpir, respectively. Since the dietary habits were different, as it was noticed, these results have been much lower in comparison with those obtained from some European countries and United States. (author), 44 refs., 18 tabs., 13 figs

  7. Radium 226 in waters of the Magela creek, Northern Australia

    Sauerland, C.; Medley, P.; Martin, P. [Environmental Research Institute of the Supervising Scientist, Darwin NT (Australia)

    2004-07-01

    The Magela Creek is located in the tropical monsoonal belt of Australia, which is characterised by contrasting wet (December to March) and dry (April to November) seasons. Magela Creek drains a catchment of which about half of the total area lies upstream of the open-cut Ranger uranium mine. The main risk identified for ecosystems surrounding this mine site is from dispersion of mine waste waters during the wet season. Monitoring of biological indicator organisms, water quality (physical and chemical) and radionuclide concentrations in surface water, groundwater and biota is conducted upstream and downstream of the Ranger mine to measure possible environmental impacts of mining. Of special interest is the radionuclide radium-226, as it is predicted to dominate the effective dose to members of the critical group (i.e. the Aboriginal population living downstream of the mining site) resulting from any release of waters from the mine site, in particular through intake of food items such as freshwater mussels and fish. Receiving water standards for radium-226 have been set for the mine on the basis of radiological dose assessments in accordance with the recommendations of the International Commission on Radiological Protection (ICRP 1996). It is proposed in this paper to compare trigger values based on ICRP recommendations with trigger values developed in line with the philosophy of the new Australian Water Quality Guidelines (ANZECC and ARMCANZ 2000). Total Ra-226 activity concentrations were determined in Magela creek both upstream and downstream of the Ranger uranium mine, using alpha spectrometry with a detection limit of about 0.5 mBq/L. According to the new Water Quality Guidelines site-specific trigger values for total Ra-226 activity concentrations were statistically derived from a reference dataset. They are intended to provide an early warning system for the management of a pollutant source for the purpose of environmental protection of downstream ecosystems

  8. Accumulation of 226-Ra by different plant species

    Soudek, Petr; Petrová, Šárka; Benešová, Dagmar; Vaněk, Tomáš

    Tsinghua: Tsinghua University Press, 2007 - (Zhu, Y.; Lepp, N.; Naidu, R.), s. 435-436 ISBN 978-7-302-15627-7. [International Conference for the Biogeochemistry of Trace Elements (ICOBTE). Beijing (CN), 15.07.2007-19.07.2007] R&D Projects: GA MŠk 1P05ME730 Institutional research plan: CEZ:AV0Z50380511 Keywords : 226 Ra * uptake * phytoremediation Subject RIV: CE - Biochemistry

  9. Study of uranium and 226Ra uptake by higher plants

    Soudek, Petr; Valenová, Šárka; Benešová, D.; Vaněk, Tomáš

    Santiago de Compostela : Universidade de Santiago de Compostela, 2006, s. 33. [Scientific Meeting of WG1 /1./ Root to shoot translocation of pollutants and nutrients. COST Action /859./. Santiago de Compostela (ES), 22.06.2006-24.06.2006] R&D Projects: GA MŠk(CZ) 1P05OC042 Institutional research plan: CEZ:AV0Z40550506 Keywords : 226radium * phytoremediation * uranium Subject RIV: DK - Soil Contamination ; De-contamination incl. Pesticides

  10. Radium 226 in waters of the Magela creek, Northern Australia

    The Magela Creek is located in the tropical monsoonal belt of Australia, which is characterised by contrasting wet (December to March) and dry (April to November) seasons. Magela Creek drains a catchment of which about half of the total area lies upstream of the open-cut Ranger uranium mine. The main risk identified for ecosystems surrounding this mine site is from dispersion of mine waste waters during the wet season. Monitoring of biological indicator organisms, water quality (physical and chemical) and radionuclide concentrations in surface water, groundwater and biota is conducted upstream and downstream of the Ranger mine to measure possible environmental impacts of mining. Of special interest is the radionuclide radium-226, as it is predicted to dominate the effective dose to members of the critical group (i.e. the Aboriginal population living downstream of the mining site) resulting from any release of waters from the mine site, in particular through intake of food items such as freshwater mussels and fish. Receiving water standards for radium-226 have been set for the mine on the basis of radiological dose assessments in accordance with the recommendations of the International Commission on Radiological Protection (ICRP 1996). It is proposed in this paper to compare trigger values based on ICRP recommendations with trigger values developed in line with the philosophy of the new Australian Water Quality Guidelines (ANZECC and ARMCANZ 2000). Total Ra-226 activity concentrations were determined in Magela creek both upstream and downstream of the Ranger uranium mine, using alpha spectrometry with a detection limit of about 0.5 mBq/L. According to the new Water Quality Guidelines site-specific trigger values for total Ra-226 activity concentrations were statistically derived from a reference dataset. They are intended to provide an early warning system for the management of a pollutant source for the purpose of environmental protection of downstream ecosystems

  11. Distribution of 226Ra in the Arctic Ocean and the Bering Sea and its hydrologic implications

    邢娜; 陈敏; 黄奕普; 蔡平河; 邱雨生

    2003-01-01

    Radium-226 (226Ra) activities were measured in the surface water samples collected from the Arctic Ocean and the Bering Sea during the First Chinese National Arctic Research Expedition. The results showed that 226Ra concentrations in the surface water ranged from 0.28 to 1.56 Bq/m3 with an average of 0.76 Bq/m3 in the Arctic Ocean, and from 0.25 to 1.26 Bq/m3 with an average of 0.71 Bq/m3 in the Bering Sea. The values were obviously lower than those from open oceans in middle and low latitudes, indicating that the study area may be partly influenced by sea ice meltwater. In the Bering Sea, 226Ra in the surface water decreased northward, probably as a result of the exchange between the 226Ra-deficientsea ice meltwater and the 226Ra-rich Pacific water. In the Arctic Ocean, 226Ra in the surface water increased northward and eastward. This spatial distributionof 226Ra reflected the variation of the 226Ra-enriched river component in the water mass of the Arctic Ocean. The vertical profiles of 226Ra in the Canadian Basin showed a concentration maximum at 200 m, which could be attributed to the inputs of the Pacific water or/and the bottom shelf water with high 226Ra concentration. This conclusion was consistent with the results from 2H, 18O tracers.

  12. Radium 226 and uranium isotopes simultaneously determination in water samples using liquid scintillation counter

    In this work a method has been developed to determine simultaneously Radium 226 and Uranium isotopes in water samples by low back ground Liquid Scintillation Counter. Radium 226 was determined by its progeny Polonium 214 after one month of sample storage in order to achieve the equilibrium between Radium 226 and Polonium 214. Uranium isotopes were determined by subtracting Radium 226 activity from total alpha activity. The method detection limits were 0.049 Bq/L and 0.176 Bq/L for Radium 226 and Uranium isotopes respectively. The repeatability limits were ± 0.32 Bq/L and ± 0.9 Bq/L for Radium 226 and Uranium isotopes respectively. While relative errors were % 9.5 and %18.2 for Radium 226 and Uranium isotopes respectively. On the other hand, the report presented the results of different standard and natural samples.(author)

  13. Possibility of rapidly reporting 226Ra activity in 226Ra-222Rn samples with unknown equilibrium factor by γ spectrometer

    SU Qiong; ZHENG Rui; CHEN Yong; CHENG Jian-Ping

    2004-01-01

    This paper reports the observed changes for equilibrium factors between 226Ra and 222Rn with sealing time of the samples. The samples include soil, raw coal, mineral water, cement, rock, etc. Especially the conceptions of "pre-equilibrium time" and "pre-equilibrium factor" have been put forward and methods of measuring and processing data have been given which can be used for rapidly reporting activity of 226Ra in samples with unknown equilibrium factor. It is definitely concluded that, using methods given in the paper, a test report will be completed in 3~7days, instead of one month, after receiving the sample whose activity is not lower than LLD of the spectrometer.

  14. Water to swamp morning glory transfer of radium-226

    A study of the uptake of 226Ra by swamp morning glory was carried out in Bangkhen canal where is the pathway releases from the Office of Atoms for Peace (OAP). This aquatic plant is an important diet of the Thai population and is grown widespread in various canals. Its consumption represents a significant pathway for the intake of radionuclides including radium and for the delivery of the internal dose to man from those radionuclides. Water and vegetable samples were collected four times a year from 1998 to 2002 inclusive from four stations along Bangkhen canal. Samples were determined by radiochemical separation. Data obtained by 5 year-analysis were compiled to explain the mechanism of radium-226 transfer from water to swamp morning glory (Ipomoea Aquatica Forsk). The concentration factors (CFs), relative to fresh weight of vegetable, for 226Ra uptake from water into swamp morning glory ranged from 23 to 120, mean average 44. In general, these data are comparable to the lower values found in the literatures. This may be due partly to the fact that the study area was an uncontaminated zone with little or no contamination by the OAP and swamp morning glory appeared to concentrate radium from the water to a lower deg.ree than other aquatic plant. Radium-226 uptake depends on its concentration in water as its concentration in the vegetables being a linear function of its concentration in water, r20.715. The CFs or the rate constants of uptake and loss rate coefficient were found to be of first order kinetics and approximately equal to slope of the equation. Mechanism of radium-226 transfer from water to swamp morning glory grown in the study zones can be expressed as an equation Cp = a Cwb where the parameter a and b are dependent on the aquatic plant species, in case of swamp morning glory a = 64.326 and b = 0.46. The equation shown good agreement with values obtained from difference stations in the same canal. The equation could be applied in a number of ways as it

  15. Concentration of 226Ra in Iranian bottled mineral water

    Naturally radioactivity in particular those emitting alpha particles, make the largest contribution to the world population exposure. The sources of these radionuclides initiated from the uranium and thorium decay series. 226Ra is one the most important radionuclides that comes through ground water to food chain. In recent years the consumption of mineral water in many countries including Iran has increased to a great extent. Therefore the 226Ra concentrations of different types of bottled mineral water were determined and the committed effective dose for adults is calculated. In this work the concentration levels of 226Ra were measured in 42 samples related to 14 types of bottled natural mineral water commercially available in supermarkets. The applied method for this measurement was emanation method with a minimum detection limit of 2 mBq L-1. For each experiment 3 bottles mineral water (each bottle contains 1.5 L) were used. After adjusting the pH below 2 by concentrated HCl, the Radium was coprecipitated with barium and lead as sulfate. The precipitation was dissolved in alkaline EDTA (C10H14N2O8.2H2O) and placed in 20 mL bubbler. The nitrogen gas with a purity of 99.99% was passed through the bubbler to remove any existing of 222Rn before the ingrowth. The bubbler was sealed and stored for 21 days at 5 deg. C for ingrowth of 222Rn. for calculation the committed effective dose for adults from drinking 40 l a-1 of bottled mineral water the ingestion dose conversion coefficients from the IAEA publications is used. Concentration of 226Ra ranged from 2.0 to 12.3 mBq L-1. In one case 12.3 mBq L-1 was measured, which provides 0.138 μSv committed effective dose for adults in the case of consumption rate of 40 L a-1. As it is shown in 61.5% of the investigated bottled water the concentration levels were between 2-10 mBq L-1, in 23% less than 2 mBq L-1 and in 15.5% more than 10 mBq L-1 was found)

  16. Efficient, Tightly-Confined Trapping of 226Ra

    Parker, R H; Bailey, K; Greene, J P; Holt, R J; Kalita, M R; Korsch, W; Lu, Z -T; Mueller, P; O'Connor, T P; Singh, J; Sulai, I A; Trimble, W L

    2013-01-01

    We demonstrate a technique for transferring $^{226}$Ra atoms from a 3-dimensional magneto-optical-trap (MOT) into a standing wave optical dipole trap (ODT) in an adjacent chamber. The resulting small trapping volume (120 $\\mu$m in diameter) allows for high control of the electric and magnetic fields applied to the atoms. The atoms are first transferred to a traveling-wave optical dipole trap, which is then translated 46 cm to a science chamber. The atoms are subsequently transferred into an orthogonal standing-wave ODT by application of a 1-dimensional MOT along the traveling-wave axis. For each stage, transfer efficiencies exceeding 60% are demonstrated.

  17. Decay of 226Ra by 14C emission

    Since the pioneering experiment by Rose and Jones in 1984 demonstrating 14C decay of 223Ra, spontaneous emission of clusters heavier than α particles but lighter than fission products could be found in several cases to be a rare decay mode of heavy nuclei. This new kind of radioactivity has branching ratios relative to α decay well below 10-9. For energetical reasons the emitted fragments are even-even and the daughter nucleus lies close to the doubly magic 208Pb. Polycarbonate track-recording foils which are sensitive to energetic carbon nuclei but not to α particles are very well suited detectors for the study of 14C emission radioactivity. The tracks are made visible under a microscope by etching techniques. Observation of spontaneous emission of 14C from 226Ra claimed by Hourani et al. and Barwick et al. has been confirmed. Since thick sources of 226Ra were used in these experiments the experimental definitions of decay energy and mass were not very accurate. The experiment described in the thesis measured for the first time charge and energy of the emitted fragments by using thin 226Ra sources and polycarbonate track-recording films. The decay mode could thus be identified unambiguously. The track detector was calibrated with tandem-accelerated 14C and 16O ions and tested by observing the now well established 14C emission from 223Ra; for this decay mode a branching ratio of (5,0 ± 1,0).10-10 relative to α decay was found in agreement with values from the literature. In the case of 226Ra the result for 14C/α ratio is (2,3 ± 1,2).10-11. The order of magnitude of the branching ratios can be reproduced by theoretical models. Estimates of partial half-lifes of Ra and other heavy isotopes for rare decay modes are discussed in the theoretical section of the thesis. 100 refs., 3 tabs., 30 figs. (Author)

  18. Removal of radium-226 from radium-contaminated soil using humic acid by column leaching method

    In this study, evaluation of radium-226 removal from radium-contaminated soil using humic acid extracted from peat soil by column leaching method was carried out. Humic acid of concentration 100 ppm and pH 7 was leached through a column packed with radium-contaminated soil and leachates collected were analysed with gamma spectrometer to determine the leached radium-226. Results obtained indicated low removal of radium-226 between 1 - 4 %. Meanwhile, leaching profile revealed that radium-226 was bound to soil components with three different strength, thus resulting in three phases of radium-226 removal. It was estimated that the total removal of radium-226 from 10 g radium-contaminated soil sample studied could be achieved using approximately 31500 - 31850 ml HA solutions with leaching rate of 1 ml/ min. (author)

  19. Accumulation of Radium-226 from phosphate fertilizers in cultivated soils and transfer to crops

    Actual values of the 226Ra content of soils sampled in various experimental plots with well-known fertilization histories and the 226Ra levels in crops produced are given. The statistical analysis led to the conclusion that there is nof significant difference in the 226Ra content of straw or grain harvested in the plots fertilized, respectively, at low level (343 kg/ha) or at highest level (1356 kg/ha) of P2O5. The 226Ra contamination due to the application of phosphate fertilizer represents only 0.25 and 1.08%, respectively, of the activity o 226Ra observed in the upper layer of soil. The 226Ra ingested annually by man from cereals and milk is estimated

  20. Study of soil-plant transfer of {sup 226}Ra under greenhouse conditions

    Soudek, Petr; Petrova, Sarka [Laboratory of Plant Biotechnologies, Joint Laboratory of Institute of Experimental Botany AS CR, v.v.i. and Crop Research Institute, v.v.i., Drnovska 507, 161 06 Prague 6 (Czech Republic); Benesova, Dagmar; Kotyza, Jan [Laboratory of Plant Biotechnologies, Joint Laboratory of Institute of Experimental Botany AS CR, v.v.i. and Crop Research Institute, v.v.i., Drnovska 507, 161 06 Prague 6 (Czech Republic); Faculty of Environment Technology, Institute of Chemical Technology, Technicka 5, 166 28 Prague 6 (Czech Republic); Vagner, Martin [Laboratory of Biologically Active Compounds, Institute of Experimental Botany AS CR, v.v.i., Rozvojova 263, Prague 6 (Czech Republic); Vankova, Radomira [Laboratory of Hormonal Regulations in Plants, Institute of Experimental Botany AS CR, v.v.i., Rozvojova 263, Prague 6 (Czech Republic); Vanek, Tomas, E-mail: vanek@ueb.cas.c [Laboratory of Plant Biotechnologies, Joint Laboratory of Institute of Experimental Botany AS CR, v.v.i. and Crop Research Institute, v.v.i., Drnovska 507, 161 06 Prague 6 (Czech Republic)

    2010-06-15

    A soil-plant transfer study was performed using soil from a former uranium ore processing factory in South Bohemia. We present the results from greenhouse experiments which include estimates of the time required for phytoremediation. The accumulation of {sup 226}Ra by different plant species from a mixture of garden soil and contaminated substrate was extremely variable, ranging from 0.03 to 2.20 Bq {sup 226}Ra/g DW. We found differences in accumulation of {sup 226}Ra between plants from the same genus and between cultivars of the same plant species. The results of {sup 226}Ra accumulation showed a linear relation between concentration of {sup 226}Ra in plants and concentration of {sup 226}Ra in soil mixtures. On the basis of these results we estimated the time required for phytoremediation, but this appears to be too long for practical purposes.

  1. Study of soil-plant transfer of 226Ra under greenhouse conditions.

    Soudek, Petr; Petrová, Sárka; Benesová, Dagmar; Kotyza, Jan; Vágner, Martin; Vanková, Radomíra; Vanek, Tomás

    2010-06-01

    A soil-plant transfer study was performed using soil from a former uranium ore processing factory in South Bohemia. We present the results from greenhouse experiments which include estimates of the time required for phytoremediation. The accumulation of (226)Ra by different plant species from a mixture of garden soil and contaminated substrate was extremely variable, ranging from 0.03 to 2.20 Bq (226)Ra/g DW. We found differences in accumulation of (226)Ra between plants from the same genus and between cultivars of the same plant species. The results of (226)Ra accumulation showed a linear relation between concentration of (226)Ra in plants and concentration of (226)Ra in soil mixtures. On the basis of these results we estimated the time required for phytoremediation, but this appears to be too long for practical purposes. PMID:18823682

  2. A multicenter study confirms CD226 gene association with systemic sclerosis-related pulmonary fibrosis

    Bossini-Castillo, L.; Simeon, C. P.; Beretta, L; Broen, J.C.A.; Vonk, M.C.; Rios-Fernandez, R.; Espinosa, G.; Carreira, P; Camps, M T; Castillo, M.J.; Gonzalez-Gay, M A; Beltran, E.; Carmen Freire, M.; Narvaez, J; Tolosa, C

    2012-01-01

    Abstract Introduction CD226 genetic variants have been associated with a number of autoimmune diseases and recently with systemic sclerosis (SSc). The aim of this study was to test the influence of CD226 loci in SSc susceptibility, clinical phenotypes and autoantibody status in a large multicenter European population. Methods A total of seven European populations of Caucasian ancestry were included, comprising 2,131 patients with SSc and 3,966 healthy controls. Three CD226 single nucleotide p...

  3. Ionizable (Thia)calix[4]crowns as Highly Selective 226Ra2+ Ionophores

    Leeuwen, van Fijs W.B.; Beijleveld, Hans; Miermans, Cornelis J.H.; Huskens, Jurriaan; Verboom, Willem; Reinhoudt, David N.

    2005-01-01

    The 226Ra2+ selectivity of the ionizable (thia)calix[4]crowns 1-4 was determined in the presence of a large excess of the most common alkali and alkaline earth cations. Selective 226Ra2+ (2.9 × 10-8 M) extraction occurs even at extremely high Mn+/226Ra2+ ratios of 3.5 × 107 [Mn+ = Na+, K+, Rb+, Cs+,

  4. Determination of 226Ra in mineral waters by liquid scintillation spectrometry

    The aim of this work was the determination of volume activity of Ra-226 in mineral waters by liquid scintillation spectrometry on TRICARB 2900TR spectrometer and determination of Ra-226 in packed mineral and table waters and comparison of determination of Ra-226 after co-precipitation Ba(Ra)SO4 by two methods: by measurement with scintillation detector NA 6201 II; by liquid scintillation spectrometry on TRICARB 2900TR with the software QuantaSmart

  5. 25 CFR 226.34 - Wells and tank batteries to be marked.

    2010-04-01

    ... 25 Indians 1 2010-04-01 2010-04-01 false Wells and tank batteries to be marked. 226.34 Section 226.34 Indians BUREAU OF INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR ENERGY AND MINERALS LEASING OF OSAGE RESERVATION LANDS FOR OIL AND GAS MINING Requirements of Lessees § 226.34 Wells and tank batteries to be marked. Lessee shall clearly...

  6. Comparison of Activity Determination of Radium 226 in FUSRAP Soil using Various Energy Lines - 12299

    Tucker, Brian [Shaw Environmental and Infrastructure, Stoughton, MA 02072 (United States); Donakowski, Jough [Unites States Army Corps of Engineers, Kansas City, MO 64106 (United States); Hays, David [United States Army Corps of Engineers, Maywood, NJ 07607 (United States)

    2012-07-01

    Gamma spectroscopy is used at the Formerly Utilized Sites Remedial Action Program (FUSRAP) Maywood Superfund Site as the primary radioanalytical tool for quantization of activities of the radionuclides of concern in site soil. When selecting energy lines in gamma spectroscopy, a number of factors are considered including assumptions concerning secondary equilibrium, interferences, and the strength of the lines. The case of the Maywood radionuclide of concern radium-226 (Ra-226) is considered in this paper. At the FUSRAP Maywood Superfund Site, one of the daughters produced from radioactive decay of Ra-226, lead-214 (Pb- 214), is used to quantitate Ra-226. Another Ra-226 daughter, bismuth-214 (Bi-214), also may be used to quantitate Ra-226. In this paper, a comparison of Ra-226 to Pb-214 activities and Ra-226 to Bi-214 activities, obtained using gamma spectrometry for a large number of soil samples, was performed. The Pb-214, Bi-214, and Ra-226 activities were quantitated using the 352 kilo electron volt (keV), 609 keV, and 186 keV lines, respectively. The comparisons were made after correcting the Ra-226 activities by a factor of 0.571 and both ignoring and accounting for the contribution of a U-235 interfering line to the Ra-226 line. For the Pb-214 and Bi-214 activities, a mean in-growth factor was employed. The gamma spectrometer was calibrated for efficiency and energy using a mixed gamma standard and an energy range of 59 keV to 1830 keV. The authors expect other sites with Ra-226 contamination in soil may benefit from the discussions and points in this paper. Proper use of correction factors and comparison of the data from three different gamma-emitting radionuclides revealed agreement with expectations and provided confidence that using such correction factors generates quality data. The results indicate that if contamination is low level and due to NORM, the Ra-226 can be measured directly if corrected to subtract the contribution from U-235. If there is

  7. 226Ra and 228Ra activities in French foodstuffs

    The activities of 228Ac and 214Bi in French foodstuffs acquired during the last 15 years allow one to obtain reference values of 228Ra and 226Ra activities which are usable to assess the dose to the French population due to the intake of these two natural radionuclides. As expected, because of similar 238U and 232Th activities in French soils (around 40 Bq.kg-1), the 226Ra/228Ra activity ratio in French terrestrial foodstuffs is close to 1. Most kinds of foodstuffs present similar mean activities: from 0.1 to 0.2 Bq.kg-1 fresh for cereals, leafy vegetables, root vegetables, eggs and fishes (marine and freshwater). The activity in fruits is lower, around 0.05 Bq.kg-1, similar to that of meat calculated on the basis of the numerous grass measurement results. The lowest activities are noticeable for milk: around 0.015 Bq.L-1. All these values are in good agreement with the data from various countries, but most often 2 to 3 times higher than the reference values proposed by UNSCEAR. This study also shows that due to the large variability of foodstuff activities reported by a large amount of data, it is not possible to distinguish the activities of samples from regions with a gap of only a factor of 2 between their soil activities. (authors)

  8. Conditioning of disused Ra-226 radioactive sealed sources in Egypt

    The present work describes the technical information on issues associated with the management of disused Ra-226 radioactive sources. The different settings needed to condition these sources in stainless steel capsules, working area setup, packaging preparation, Ra-226 source characterization, capsule welding, leakage test and data information are completely described. The radium sources addressed in the present work are mainly those which have been used in medicine and for industrial applications, in the form of sealed radiation sources. In Egypt hospitals are among the largest users of sealed radium radioactive sources which are mostly used for brachytherapy. The inventory of radium sources in large hospitals could be in the hundreds. There is a real risk that sources may be lost or mishandled, if very restricted procedures are not followed. An additional problem with these sources is that they are often leaking, due to internal overpressure. The small size of the sources, portability and high apparent value (due to the materials of encapsulation) increase the risk of theft. (authors)

  9. Sanitary quality of castor bean seeds (cv. IAC-226

    Andréia Márcia Santos de Souza David

    2014-09-01

    Full Text Available The objective of this work was to evaluate the fungicides efficacy on the castor seeds IAC-226 sanitary quality. The seeds were treated with two doses of the fungicides captan (250 and 300 g ai 100 kg-1 seed, thiophanate-methyl (100 and 150 g ai 100 kg-1 seed and thiabendazole (100 and 150 g kg ai 100 seeds. Seeds without fungicide treatment were the control. The seeds sanitary quality was evaluated by sanity test, using 10 replications of 20 seeds per treatment/lot, superficially sterilized (sodium hypochlorite and placed in plastic boxes (gerbox with filter paper and sterilized distilled water, under controlled temperature 25°C for 20 days. Seeds were examinated individually using a stereoscopic microscope and optical microscope. The results were expressed as percentage of infected seeds. The experimental design was completely randomized in a factorial arrangement (2 x 7, two lots and seven treatments, with ten repetitions. The fungicides captan, tiabendazol and tiofanato-metílico reduced the incidence of fungi, being recommended for the castor seeds IAC-226 treatment. There was a predominance of fungi Alternaria alternata, Aspergillus flavus, Aspergillus niger, Bipolar, Botrytis ricini, Curvularia sp., Penicillium sp. and Rhizopus sp.

  10. Distribution of 226Ra Radionuclide in Upwelling Event Off Ulsan, Gampo and Pohang, Korea

    Muslim

    2009-07-01

    Full Text Available Upwelling is an important event in the sea for it makes the area to become more productive. The objective of this study is to determine the distribution of radium-226 as radiotoxic in the upwelling area in the summer season. Measurements of the horizontal and vertical activities of 226Ra in the Ulsan, Gampo and Pohang waters were conducted in June, August 1999 and June 2000 when the upwelling event was expected to occur. Water temperature, salinity and dissolved oxygen (DO were also measured concurrently. The thermocline layer or the layer where the temperature decreased drastically occurred at a depth between 30 m to 100 m for samples dated June 1999 and 30 m to more than 100 m for samples dated August 1999 and June 2000. The salinity decreased with depth but the DO concentration increased in this layer. The condition affected the vertical distribution of 226Ra in the study area, where the 226Ra activities showed to be relatively homogeneous vertically in each station. This indicates that the upwelling which occurred in the study area was capable to distribute the 226Ra activities from the bottom to the surface. Thus, the 226Ra distribution at that time did not increase with depth, opposite to what usually occurs in the ocean at normal condition. The 226Ra activities also did not decrease after elapsed time of one year, in fact, it increased. However, horizontally the 226Ra activities decreased with increasing distance from the coastal zone. Based on these results, it can be concluded that the upwelling event in the Ulsan, Gampo and Pohang was effective for increasing the 226Ra activities and was capable to create homogeneous 226Ra activities from the bottom to the surface in the water column, and the source of 226Ra was likely to originate from outside area (i.e. coastal zone and bottom area.

  11. Radium-226-induced dental disease in Beagles: a radiographic study

    Evaluation of dental radiographs made at necropsy and during the life of the dogs clearly shows age dependent changes within the control dogs. Periodontal diseases, loss of lamina dura, root ankylosis, and loss of pulp cavity were all commonly noted. Tooth loss and dental caries were rare in the control dogs. In injected Beagles loss of lamina dura was noted earlier and was dose dependent. Tooth loss and dental carried increased with dose level and appeared earlier. Tooth loss was common by 1600-1800 days of age while dental caries were common in almost all dogs by 1600-1800 days of age in the R40 level. Dental caries was the most accurate indication of the level of 226Ra toxicity. 18 reference, 1 table

  12. 12 CFR 226.46 - Special disclosure requirements for private education loans.

    2010-01-01

    ... GOVERNORS OF THE FEDERAL RESERVE SYSTEM TRUTH IN LENDING (REGULATION Z) Special Rules for Private Education Loans § 226.46 Special disclosure requirements for private education loans. (a) Coverage. The... inaccuracy is not a violation of Regulation Z (12 CFR part 226), although new disclosures may be...

  13. Occurrence of natural radium-226 radioactivity in ground water of Sarasota County, Florida

    Miller, R.L.; Sutcliffe, Horace

    1985-01-01

    Water that contains radium-226 radioactivity in excess of the 5.0-picocurie-per-liter limit set in the National Interim Primary Drinking Water Regulations was found in the majority of wells sampled throughout Sarasota County. Highest levels were found areally near the coast or near rivers and vertically in the Tamiami-upper Hawthorn aquifer where semiconsolidated phosphate pebbles occur. Analysis of data suggests that part of the radium-226 in ground water of Sarasota County is dissolved by alpha particle recoil. In slightly mineralized water, radium-226 concentrations are decreased by ion exchange or sorption. In more mineralized water, other ions compete with radium-226 for ion exchange or sorption sites. Dissolution of minerals containing radium-226 by mineralized water probably contributes a significant fraction of the dissolved radium-226. Two types of mineralized water were present in Sarasota County. One type is a marine-like water, presumably associated with saltwater encroachment in coastal areas; the other is a calcium magnesium strontium surfate bicarbonate type. In general, water that contains high radium-226 radioactivities also contains too much water hardness or dissolved solids to be used for public supply without treatment that would also reduce radium-226 radioactivities. (USGS)

  14. 21 CFR 226.102 - Master-formula and batch-production records.

    2010-04-01

    ... 21 Food and Drugs 4 2010-04-01 2010-04-01 false Master-formula and batch-production records. 226... Records and Reports § 226.102 Master-formula and batch-production records. (a) For each Type A medicated... batch size, or of appropriate size in the case of continuous systems to be produced from the...

  15. 78 FR 18416 - Sixth Meeting: RTCA Special Committee 226, Audio Systems and Equipment

    2013-03-26

    ... Federal Aviation Administration Sixth Meeting: RTCA Special Committee 226, Audio Systems and Equipment... Notice of RTCA Special Committee 226, Audio Systems and Equipment. SUMMARY: The FAA is issuing this... Equipment. DATES: The meeting will be held April 15-17, 2013 from 9:00 a.m.-5:00 p.m. ADDRESSES: The...

  16. 77 FR 37733 - Third Meeting: RTCA Special Committee 226, Audio Systems and Equipment

    2012-06-22

    ... Federal Aviation Administration Third Meeting: RTCA Special Committee 226, Audio Systems and Equipment... Notice of RTCA Special Committee 226, Audio Systems and Equipment. SUMMARY: The FAA is issuing this... Equipment. DATES: The meeting will be held July 10-12, 2012, from 9 a.m.-5 p.m. ADDRESSES: The meeting...

  17. 78 FR 57673 - Eighth Meeting: RTCA Special Committee 226, Audio Systems and Equipment

    2013-09-19

    ... Federal Aviation Administration Eighth Meeting: RTCA Special Committee 226, Audio Systems and Equipment... Notice of RTCA Special Committee 226, Audio Systems and Equipment. SUMMARY: The FAA is issuing this... Equipment. DATES: The meeting will be held October 8-10, 2012 from 9:00 a.m.-5:00 p.m. ADDRESSES:...

  18. 78 FR 38093 - Seventh Meeting: RTCA Special Committee 226, Audio Systems and Equipment

    2013-06-25

    ... Federal Aviation Administration Seventh Meeting: RTCA Special Committee 226, Audio Systems and Equipment... Notice of RTCA Special Committee 226, Audio Systems and Equipment. SUMMARY: The FAA is issuing this... Equipment ] DATES: The meeting will be held July 15-19, 2013 from 9:00 a.m.-5:00 p.m. ADDRESSES: The...

  19. 77 FR 58209 - Fourth Meeting: RTCA Special Committee 226, Audio Systems and Equipment

    2012-09-19

    ... Federal Aviation Administration Fourth Meeting: RTCA Special Committee 226, Audio Systems and Equipment... notice of RTCA Special Committee 226, Audio Systems and Equipment. SUMMARY: The FAA is issuing this... Equipment. DATES: The meeting will be held October 16-18, 2012 from 9 a.m.-5 p.m. ADDRESSES: The...

  20. Leachable 226Ra in Philippine phosphogypsum and its implication in groundwater contamination in Isabel, Leyte Philippines

    Phosphogypsum (PG), the major waste material in phosphate fertilizer processing, has been known to contain enhanced levels of naturally-occurring radionuclides especially 226Ra. The lack of radioactivity data regarding Philippine phosphogypsum and its environmental behavior in the Philippine setting has brought concern on possible contamination of groundwater beneath the phosphogypsum ponds in Isabel, Leyte, Philippines. The radioactivity of Philippine phosphogypsum was determined and the leaching of 226Ra from phosphogypsum and through local soil was quantified. Level of 226Ra in groundwater samples in Isabel, Leyte, Philippines was also quantified to address the primary concern. It was found that the 226Ra activity in Philippine phosphogypsum is distributed in a wide range from 91.5 to 935 Bq/kg. As much as 5% of 226Ra can be leached from Philippine PG with deionized water. In vitro soil leach experiments suggest that the soil in the phosphate fertilizer plant area would be able to deter the intrusion of 226Ra into the water table. Compared to reported values of natural groundwater levels of 226Ra, the concentration of this radionuclide in Isabel, Leyte groundwater suggest that there is no 226Ra intrusion brought about by the presence of phosphogypsum ponds in the area. (Authors)

  1. 48 CFR 226.370-8 - Goals and incentives for subcontracting with HBCU/MIs.

    2010-10-01

    ... subcontracting with HBCU/MIs. 226.370-8 Section 226.370-8 Federal Acquisition Regulations System DEFENSE... subcontracting with HBCU/MIs. (a) In reviewing subcontracting plans submitted under the clause at FAR 52.219-9... included anticipated awards to HBCU/MIs in the small disadvantaged business goal; and (2) Consider...

  2. 7 CFR Appendix C to Part 226 - Child Nutrition (CN) Labeling Program

    2010-01-01

    ... 7 Agriculture 4 2010-01-01 2010-01-01 false Child Nutrition (CN) Labeling Program C Appendix C to.... C Appendix C to Part 226—Child Nutrition (CN) Labeling Program 1. The Child Nutrition (CN) Labeling... 7 CFR 210.10, 225.21, and 226.20 and are served in the main dish. (b) Juice drinks and juice...

  3. Spreading of water masses and regeneration of silica and sup(226)Ra in the Indian Ocean

    DileepKumar, M.; Yuan-Hui, Li

    The magnitudes of silica and sup(226) RA inputs to water (through particle regeneration, in situ, and from sediments) and the validity of observed Si and sup(226) Ra as tracers of water masses and advective processes were examined in the Indian...

  4. 12 CFR 226.5b - Requirements for home equity plans.

    2010-01-01

    ... published by the Board or a suitable substitute shall be provided. (f) Limitations on home equity plans. No... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Requirements for home equity plans. 226.5b... RESERVE SYSTEM TRUTH IN LENDING (REGULATION Z) Open-End Credit § 226.5b Requirements for home equity...

  5. Quantification of 235 U and 226 Ra in soil samples by means of Gamma spectroscopy

    In this work it is presented the Gamma Spectroscopy method which is realized in the Environmental Radiological Surveillance Laboratory using the option of deconvolution of a commercial software for the quantification of 235 U and 226 Ra; also is presented the method for the 226 Ra correction activity. (Author)

  6. 50 CFR 226.203 - Critical habitat for northern right whales.

    2010-10-01

    ... 50 Wildlife and Fisheries 7 2010-10-01 2010-10-01 false Critical habitat for northern right whales. 226.203 Section 226.203 Wildlife and Fisheries NATIONAL MARINE FISHERIES SERVICE, NATIONAL OCEANIC AND... Critical habitat for northern right whales. (a) Great South Channel. The area bounded by 41°40′ N/69°45′...

  7. Radium-226 accumulation by the waterlily, Nymphaea violacea

    A study of the accumulation of radium-226 by the aquatic macrophyte Nymphaea violacea Lehm was undertaken at Jabiru. N. violacea may be exposed to elevated environmental radium concentrations due to releases of mine wastes, or to surface expressed groundwater seepage from the tailings dam. Portions of this plant are eaten by the local Aborigines and the results of this study will be used to make an assessment of the radiological dose from radium-226 to these people. Field studies were carried out to identify the patterns of radium distribution between the plant and its environment. In the laboratory, flow-through techniques were developed to investigate radium accumulation from sediment and kinetics of foliar uptake and loss over a range of likely water qualities. The foliar experiments showed that radium accumulation from water by healthy laminae, consisted of uptake into at least two compartments. Uptake kinetics suggested that the larger of these was surface adsorption with equilibrium between water and lamina concentrations being established within 5 days. The major influences on accumulation were the degree of tissue senescence and the concentration of cations in the supporting media. Tissue senescence was related to plant and tissue ages and exponentially increased radium accumulation. Increases in cation concentration reduced radium uptake and supported the hypothesis that radium was accumulated by the mechanisms involved in uptake of calcium and magnesium. These results were supported by the field studies. Radium uptake by N. violacea from sediments was studied in the laboratory using a flow-through apparatus specially designed to minimise contamination of the water column due to radium leaching from the labelled sediment

  8. A Study on Sorption of (226)Ra on Different Clay Matrices.

    Alhajji, E; Al-Masri, M S; Khalily, H; Naoum, B E; Khalil, H S; Nashawati, A

    2016-08-01

    The sorption of radium 226 ((226)Ra) on different clay materials (bentonite, illite and a mixture of bentonite-illite) was studied. Clay materials are used in the construction of disposal pits for technically enhanced naturally occurring radioactive materials (TENORM) wastes (i.e., contaminated soil and sludge) generated by the oil and gas industry operations. Experimental conditions (pH, clay materials quantity, and activity concentrations of (226)Ra) were changed in order to determine the optimal state for adsorption of (226)Ra. The results showed that the concentration of adsorbed (226)Ra on clay materials increased with time to reach an equilibrium state after approximately 5 h. More than 95 % of the radium was adsorbed. The mixture of bentonite-illite (1/9) exhibited the greatest adsorption of radium under all experimental conditions. PMID:27329110

  9. Normal dietary levels of 226Ra, 228Ra, 210Pb, and 210Po for man

    A review of the literature and the results of some recent measurements were presented on the levels in man's diet of the naturally-occurring radionuclides 226Ra, 228Ra, 210Pb, and 210Po. The mean intakes for standard U.S. diets for these nuclides are tabulated. Intakes in other countries are similar to those in the U.S., but in localized populations the 226Ra intake may be 8 or more pCi/day. The contents of 226Ra in diets chosen by individuals ranged from 0.4 to 7 pCi/day. The few data on 228Ra show intake of this nuclide to be about 80% that of 226Ra, except in monazite areas where intakes of up to 160 pCi/day 228Ra are reported, which may be 50 to 100 times that of 226Ra. Drinking water contributes less than 5% of the daily intake, except in special areas

  10. Ra-226 collective dosimetry for surface waters in the uranium mining region of Pocos de Caldas

    Graphs of the collective dose equivalent for the whole body, bone, gastro-intestinal tract (lower large intestine), kidneys, and liver, via the pathways of drinking water and ingestion of food grown in irrigated fields are presented as a function of the 226Ra concentrations in the surface waters of the Pocos de Caldas region. The collective dose equivalent calculated from the 226Ra concentrations measured in the baseline studies are compared with those collective dose equivalent estimated from the projected higher 226Ra concentrations in the river waters. The 226Ra concentrations in river waters of the region are expected to be enhanced due to 226Ra releases from uranium mining and milling operations. The dose equivalent commitment for the exposed population for the referred pathways is also estimated for the contribution of the mine during its predicted time of operation. The assumptions for the dose calculations are presented and the results obtained are discussed. (H.K.)

  11. Biogeochemistry of 226Ra in contaminated bottom sediments and oilfield waste pits

    Solubility of 226Ra in sediments contaminated by produced water discharges was investigated using integrated microcosm, geochemical modelling and field sampling techniques. These studies strongly indicate that the biogeochemical control on 226Ra solubility in these sediments is coprecipitation with barite (BaSO4). The role of barite was confirmed by selective extractions of contaminated sediments, geochemical measurements of solution saturation, theoretical coprecipitation calculations, and direct measurement of barite using X-ray diffraction. Despite elevated activities that are three orders of magnitude higher than background, fluxes of 226Ra from these contaminated sediments are of the same order of magnitude as those measured in natural systems. Remobilization of 226Ra was observed in the Humble Bayou sediment under anaerobic, sulfate-reducing conditions. Management of these contaminated sites will involve understanding the role of barite solid-solution chemistry on the fate and mobility of 226Ra. (Copyright (c) 1998 Elsevier Science B.V., Amsterdam. All rights reserved.)

  12. 12 CFR Appendix K to Part 226 - Total Annual Loan Cost Rate Computations for Reverse Mortgage Transactions

    2010-01-01

    ... Reverse Mortgage Transactions K Appendix K to Part 226 Banks and Banking FEDERAL RESERVE SYSTEM (CONTINUED) BOARD OF GOVERNORS OF THE FEDERAL RESERVE SYSTEM TRUTH IN LENDING (REGULATION Z) Pt. 226, App. K Appendix K to Part 226—Total Annual Loan Cost Rate Computations for Reverse Mortgage Transactions...

  13. 20 CFR 408.226 - What happens if you begin receiving other benefit income after you become entitled to SVB?

    2010-04-01

    ... benefit income after you become entitled to SVB? 408.226 Section 408.226 Employees' Benefits SOCIAL... Entitlement Other Benefit Income § 408.226 What happens if you begin receiving other benefit income after you become entitled to SVB? If you begin receiving other benefit income after you become entitled to SVB,...

  14. 48 CFR 252.226-7000 - Notice of historically black college or university and minority institution set-aside.

    2010-10-01

    ... black college or university and minority institution set-aside. 252.226-7000 Section 252.226-7000... Notice of historically black college or university and minority institution set-aside. As prescribed in 226.370—9(a), use the following clause: Notice of Historically Black College or University...

  15. Activity concentrations of 226Ra and 228Ra in drilled well water in Finland

    The activity concentrations of 226Ra and 228Ra in drinking water were determined in water samples from 176 drilled wells. 226Ra activity concentrations were in the range of -1 and 228Ra activity concentrations in the range of -1. The mean activity concentration of 226 Ra and 228 Ra were 0.041 and 0.034 Bq l-1, respectively. High radium activity concentrations in drinking water were rare. Only 2-4% of the drilled wells exceeded a 226Ra concentration of 0.5 Bq l-1 and 1-2% of the wells exceeded a 228Ra concentration of 0.2 Bq l-1. These are the activity concentrations that cause a 0.1 mSv annual effective dose for users of drinking water. The maximum annual effective doses from 226Ra and 228Ra for users of drilled wells were 0.21 mSv, and 0.16 mSv respectively. The elevated activity concentrations of 226Ra and 228Ra did not occur simultaneously in the same groundwaters and the correlation between 226Ra and 228Ra was small. (authors)

  16. [Uptake of radionuclides from soil to plant and the discovery of 226Ra, 232Th hyperaccumulator].

    Zhang, Zhi-Qiang; Chen, Di-Yun; Song, Gang; Yue, Yu-Mei

    2011-04-01

    11 sorts of plant samples and corresponding soil samples were collected in Conghua and Taishan, Pearl River Delta. The specific activity of 238U, 226Ra, 232Th and 40K of samples were investigated by using HPGe-gamma-ray spectra analysis. The results showed that the average specific activity of 238U, 226Ra, 232Th and 40K in soil samples were 151.8, 146.3, 226.6, 665.5 Bq/kg, which were higher than the average values of China and the world. The concentration of 238U in all sort of plants are very low and most of them are lower than detection limit, while the values of 226Ra, 232Th and 40K were high. The contents of 226Ra and 232Th in Dicranopteris dichotoma were the highest, whose average specific activity is 285.9, 986.2 Bq/kg respectively. The average bioconcentration factors (BFs)of 26Ra, 232Th of Dicranopteris dichotoma were 2.20, 4.23, respectively, the other 10 sort of plants have BFs of 2266Ra, 232Th were in the range of 10(-1)-10(-2). The bioconcentration factors and the translocation factors of 226Ra, 232Th of Dicranopteris dichotoma. were all bigger than 1, so Dicranopteris dichotoma can be defined as hyperaccumulator of 226Ra and 232Th. PMID:21717763

  17. The determination of radium-226 in uranium ores and mill products by alpha energy spectrometry

    A reliable routine procedure for determining 226Ra by alpha energy spectrometry is described. Radium is isolated as sulphate from the sample matrix by co-precipitation with a small mass of barium and analysed using a ruggedized silicon surface barrier detector. The method is capable of providing high accuracy over a large 226Ra concentration range and is applicable to materials such as uranium ores, uranium mill products and effluent streams. Samples resulting from nitric acid leach experiments with Elliot Lake ores were examined using the procedure. The distribution of 223Ra, 224Ra and 226Ra between the leach products, (residue and leach liquor), is discussed. (author)

  18. 228Ra/226Ra activity ratio in groundwater around Mount Fuji, Japan

    Tagami Keiko

    2012-04-01

    Full Text Available We estimated the groundwater age from 228Ra/226Ra ratios in young groundwater and relevant rocks in the volcanic area of the Kakitagawa River around Mount Fuji, Japan, and compared our results with those from 3H/3He age determination. The groundwater residence time estimated from the 228Ra/226Ra activity ratio in groundwater and relevant rocks agreed well with the 3H/3He age, suggesting that the 228Ra/226Ra ratio of groundwater can be used to estimate residence time of young groundwater in volcanic areas.

  19. Determination of radium-226 in environmental and personal monitoring samples

    Radium-226 is a member of the Uranium-238 natural decay series and is the most hazardous radionuclide released to the environment from uranium mining and milling. Due to its long half-life (1600 years) and radiological effects it is one of the most important isotopes to be determined among the naturally occurring nuclides in environmental samples. It is also among the most toxic long-lived alpha-emitters present in environmental samples, as well as one of the most widespread. The requirement for the determination of radium has become a matter of interest in public health due to its hazardous nature with respect to internal exposure. It is concentrated in bones, thus increasing the internal radiation dose of individuals. The methodology developed involves dissolving solid samples by microwave digestion. The radium is then separated from matrix interferents by cation exchange chromatography and subsequently electrodeposited onto a stainless steel disc. α-Spectrometry is employed to determine the activity in the sample. A limit of detection of 20 mBq l-1 for ground water samples (100 ml) and 20 mBq g-1 for solid samples (0.1 g) is achievable. The method has been validated via an intercomparison exercise and analysis of a marine sediment reference material. Samples analysed include run off waters from uranium mines, coal and fly ash and also trapping media such as silica gel, charcoal and activated carbon

  20. Determination of radium-226 in environmental and personal monitoring samples.

    Lawrie, W C; Desmond, J A; Spence, D; Anderson, S; Edmondson, C

    2000-01-01

    Radium-226 is a member of the Uranium-238 natural decay series and is the most hazardous radionuclide released to the environment from uranium mining and milling. Due to its long half-life (1600 years) and radiological effects it is one of the most important isotopes to be determined among the naturally occurring nuclides in environmental samples. It is also among the most toxic long-lived alpha-emitters present in environmental samples, as well as one of the most widespread. The requirement for the determination of radium has become a matter of interest in public health due to its hazardous nature with respect to internal exposure. It is concentrated in bones, thus increasing the internal radiation dose of individuals. The methodology developed involves dissolving solid samples by microwave digestion. The radium is then separated from matrix interferents by cation exchange chromatography and subsequently electrodeposited onto a stainless steel disc. Alpha-Spectrometry is employed to determine the activity in the sample. A limit of detection of 20 mBq l(-1) for ground water samples (100 ml) and 20 mBq g(-1) for solid samples (0.1 g) is achievable. The method has been validated via an intercomparison exercise and analysis of a marine sediment reference material. Samples analysed include run off waters from uranium mines, coal and fly ash and also trapping media such as silica gel, charcoal and activated carbon. PMID:10879851

  1. Improved method for the determination of dissolved radium-226

    Most of the current techniques for radium determination involve chemical separation of radium from major sample constituents by coprecipitation with barium or lead sulfate, followed by further radium purification. However, when samples contain biological materials, such as algae in wastewater from uranium millponds, or brine water from oil fields, the precipitation and purification processes become tedious and time-consuming. An improved method has been developed for the determination of radium-226 in such water samples, which also is applicable to natural waters. This method is based on a radon determination of alpha activity of the radon and its short-lived daughters in an alpha-scintillation cell. The radon-bubbler volume is either 90 millimeters for concentrated samples or 800 milliliters for dilute samples. For radium concentrations less than 1 picocurie per liter, 2 liters of water sample can be concentrated several-fold by simple evaporation, and decreased to 800 milliliters prior to deemanation. Because the process involves no chemical separations, chemical recoveries are nearly 100 percent. The lower limit of detection is 0.05 picocurie per liter for a 1-liter water sample and a counting time of 1000 minutes. 19 references, 3 figures, 3 tables

  2. 226Ra evidence for the ecosystem shift over the past 40 years in the North Pacific Subtropical Gyre

    YANG JunHong; CHEN Min; QIU YuSheng; LI YanPing; MA Qiang; L(U) E; ZHANG Run; HUANG YiPu

    2007-01-01

    Surface seawater was collected for 226Ra measurement in the North Pacific Subtropical Gyre from July to October, 1999 and October to December, 2003. Combined with the historical data reported for this sea area, a declined trend of surface 226Ra concentrations was observed since 1960s, indicating the ecosystem shift in response to global warming. On one side, the enhanced stratification of the upper water column resulting from global warming reduced the 226Ra input from the depth, on the other, the temporal increase of biological production resulting from the climate-related ecosystem structure change strengthened the 226Ra removal from the surface ocean. Both the physical and biological processes resulted in the decrease of surface 226Ra concentrations in the North Pacific Subtropical Gyre. The temporal trend of surface 226Ra concentrations was consistent with the trends of chlorophyll a, silicate, phosphate and primary production previously reported. This study provided 226Ra evidence for the ecosystem shift under global change.

  3. Selection criteria for the measurement of Radium-226 in environmental samples

    Radium-226 is routinely analysed in variety of environmental samples for many investigation and specific studies like dating sediments, water quality measurements, estimation of age of fish etc. Radium-226 is a α-emitters which has the half life of 1620 years. Alpha spectrometry and high resolution gamma spectrometry are some available techniques for the measurement of 226Ra. The properties of each technique are studied. Each technique has different background levels, geometric efficiency, preparation procedure and recoveries of 226Ra. This gives wide range of options with some restrictions imposed on sample size and activity. The paper discusses the selection criteria, optimum procedure and its dependency on sensitivity, precision and lower limit of detection of each technique. The process of method selection is illustrated here with reference to sediments. (author)

  4. Geochemical controls on the solubility of Ra-226 in uranium mine tailings

    The mine tailings at the Key Lake uranium mill have been continuously emplaced in the Deilmann Tailings Management Facility (DTMF) since 1996. At the start of emplacement, the concentration of dissolved Ra-226 in the tailings supernatant in the DTMF was predicted to be less than 150 Bq/l. In 2001, the concentration of dissolved Ra-226 in the tailings supernatant was measured to be 280 Bq/l. Results of bench scale experiments showed that the addition of barium chloride to the tailings slurry would result in the precipitation of dissolved Ra-226 through the formation of a Ba/Ra-SO4 co-precipitate with a resulting concentration of 50 Bq/l. Implementation of a barium chloride addition system in the mine tailings processing circuit was completed in July 2002. Since its implementation, the concentration of dissolved Ra-226 in the tailings supernatant has decreased to about 18 Bq/l. (author)

  5. Determination of 226Ra in water samples using sorbent MnO2-PAN

    The aim of our study was to determine 226Ra using alpha spectrometer in water samples. The method of separation based on the principle of extraction chromatography was applied by the separation of the natural radionuclides 226Ra from samples of natural mineral, spring, natural medicinal and drinking water from the Slovak Republic, the Czech Republic and Slovenia. The proposed method uses a new selective commercial sorbent MnO2-PAN. The advantage of separating of 226Ra on a given sorbent is the speed of separation, simple sample preparation before the analysis and mainly the high efficiency of the proposed method. The sample was adjusted by coprecipitation with Ba2+ for alpha spectrometric measurements of 226Ra. The radiochemical yield was monitored by radionuclide tracer 133Ba.

  6. Elimination of natural uranium and 226Ra from contaminated waters by rhizofiltration using Helianthus annuus L

    The elimination of natural uranium and 226Ra from contaminated waters by rhizofiltration was tested using Helianthus annuus L. (sunflower) seedlings growing in a hydroponic medium. Different experiments were designed to determine the optimum age of the seedlings for the remediation process, and also to study the principal way in which the radionuclides are removed from the solution by the sunflower roots. In every trial a precipitate appeared which contained a major fraction of the natural uranium and 226Ra. The results indicated that the seedlings themselves induced the formation of this precipitate. When four-week-old seedlings were exposed to contaminated water, a period of only 2 days was sufficient to remove the natural uranium and 226Ra from the solution: about 50% of the natural uranium and 70% of the 226Ra were fixed in the roots, and essentially the rest was found in the precipitate, with only very small percentages fixed in the shoots and left in solution

  7. Assessment of 226Ra age-dependent dose from water intake

    The radioactivity in canal and ground waters collected in a 2-year long observation from the vicinity of the Rare Earth Research and Development Center (RRDC), Phathumthani Province, Thailand, was measured in order to determine the concentration of 226Ra and to estimate the age-dependent effective dose to humans due to consumption. 226Ra activities in both canal and ground waters were well below the WHO guidance level for drinking water quality of 1 Bq L-1. The highest 226Ra effective doses per year were found for infants and teens. However, the observed levels of calculated 226Ra effective doses for all age groups in both canal and ground waters show satisfactory low values (less than 15 μSv yr-1). These values are acceptable in accordance with the WHO recommended reference dose level of 100 μSv yr-1 from water intake of 2 L day-1

  8. Microdistribution of 226Ra and radiation dose to bone target cells

    With the development of a computerized scanning technique it was possible to perform extensive analysis of autoradiographs from bone samples of Beagle dogs injected with 226Ra at levels from 370 to 12.5 kBq/kg body weight. The results on the 226Ra distribution and dosimetry in the lumbar vertebra from dogs injected with 370 kBq/kg are summarized here. (author)

  9. The determination of radium-226 in the tailings of gold mines and their environment

    Radium-226, a daughter product in the uranium-238 decay series, is present in ore mined for the production of both gold and uranium. In this way the radium-226 finds its way into the tailings of mines and is therefore present in all the mine sand dumps and slimes dams in the Republic. Although this radium-226 is in a relatively stable and practically insoluble matrix, it is nevertheless possible for it to migrate from such slimes dams or sand dumps under the influence of various mechanisms. In order to make a survey in these mining environments, it was necessary to adapt an existing emanometric method. In this method radium-226 is co-precipitated from 5 dm3 water samples with barium sulphate. An investigation was carried out on the recoverability of the radium-226 in this way and it was found that the best results were achieved at a pH of 1 with co-precipitation from a homogenous or a simulated homogenous medium. The barium sulphate precipitate was dissolved by a sodium carbonate fusion with the resulting carbonates dissolving in hydrochloric acid. The back-ground reading due to the presence of radium-266 in the reagents used and the radium-226 slightly contaminating the glassware, was determined with blank measurements. This mean background value was used to determine the detection limit. In the survey, samples of water, slimes, sand and sediment were taken in the main gold-mining areas of the RSA. From the results of the survey it appears that radium-226 is definitely present in the abovementioned environments, but that the concentrations are very low. It was, furthermore, evident that, in contrast with the relatively high concentrations measured near the pollution source, the measured quantity of radium-226 decreases rapidly with increasing distance from the source

  10. 226Ra bioavailability to plants at the Urgeiriça uranium mill tailings site.

    Madruga, M J; Brogueira, A; Alberto, G; Cardoso, F

    2001-01-01

    Large amounts of solid wastes (tailings) resulting from the exploitation and treatment of uranium ore at the Urgeiriça mine (north of Portugal) have been accumulated in dams (tailing ponds). To reduce the dispersion of natural radionuclides into the environment, some dams were revegetated with eucalyptus (Eucalyptus globolus) and pines (Pinus pinea). Besides these plants, some shrubs (Cytisus spp.) are growing in some of the dams. The objective of this study is to determine the 226Ra bioavailability from uranium mill tailings by quantifying the total and available fraction of radium in the tailings and to estimate its transfer to plants growing on the tailing piles. Plant and tailing samples were randomly collected and the activity concentration of 226Ra in plants (aerial part and roots) and tailings was measured by gamma-spectrometry. The exchangeable fraction of radium in tailings was quantified using one single step extraction with 1 mol dm-3 ammonium acetate (pH = 7) or 1 mol dm-3 calcium chloride solutions. The results obtained for 226Ra uptake by plants show that 226Ra concentration ratios for eucalyptus and pines decrease at low 226Ra concentrations in the tailings and appear relatively constant at higher radium concentrations. For shrubs, the concentration ratios increase at higher 226Ra solid waste concentrations approaching a saturation value. Percentage values of 16.0 +/- 8.3 and 12.9 +/- 8.9, for the fraction of radium extracted from the tailings, using 1 mol dm-3 ammonium acetate or calcium chloride solutions, respectively, were obtained. The 226Ra concentration ratios determined on the basis of exchangeable radium are one order of magnitude higher than those based on total radium. It can be concluded that, at a 95% confidence level, more consistent 226Ra concentration ratios were obtained when calculated on the basis of available radium than when total radium was considered, for all the dams. PMID:11379070

  11. Radiochemical determination and separation or total radium, 226Ra and 224Ra

    Radiochemical purification and separation of radium has been carried out and the determination of total radium solubilized in aqueous samples has been studied assuming that all the alpha emitters of the sample have their origin in the 226Ra and elements of its desintegration chain. Also, the activities of 22Ra and 226 Ra have been evaluated separately doing a measurement after the chemical separation of the radium and another one 10 days after. (Author) 9 refs

  12. Influence of modification on structure, fluidity and strength of 226D aluminium alloy

    A. Dolata-Grosz; M. Dyzia; J. Śleziona

    2008-01-01

    In the article the fluidity, solidification conditions, microstructure and tensile properties have been studied for the non-modified and modified 226D aluminium silicon alloy.Realized investigations concerned modification of alloy 226D for application as the matrix to carbon fibre reinforcement composite (MMC-Cf). One of main factors determining to good connection between metal matrix and fibres reinforcement is good wettability. It is possible to obtain suitable conditions of wettability by ...

  13. 50 CFR Table 2 to Part 226 - Major Stellar Sea Lion Haulout Sites in Alaska

    2010-10-01

    ... 50 Wildlife and Fisheries 7 2010-10-01 2010-10-01 false Major Stellar Sea Lion Haulout Sites in.... 226, Table 2 Table 2 to Part 226—Major Stellar Sea Lion Haulout Sites in Alaska Major Steller sea lion...: Northeast Point 1 57 15.0N 170 06.5W Sea Lion Rock 1 57 06.0N 170 17.5W St. George I: S Rookery 1 56...

  14. Dating hapuka otoliths using 210 Pb/226 Ra, with comments on dating orange roughy otoliths

    It is shown that Hapuka otoliths cannot be reliably dated using the 210 Pb/ 226 Ra method because contrary to previous assumptions, excess 210 Pb is incorporated into the outer layers of otoliths which have been taken from old fish, though the 226 Ra incorporation remains normal. This is shown to apply also to Orange Roughy otoliths. Ages based on calculations using previously published methods will be artificially old. (author). 13 refs., 2 tabs., 3 figs

  15. /sup 226/Ra in the western Indian Ocean

    Chung, Y.

    1987-09-01

    /sup 226/Ra profiles have been measured in the western Indian Ocean as part of the 1977-78 Indian Ocean GEOSECS program. These profiles show a general increase in deep and bottom water Ra concentration from the Circumpolar region to the Arabian Sea. A deep Ra maximum which originates in the Arabian Sea and in the Somali basin at about 3000 m depth spreads southward into the Mascarene basin and remains discernible in the Madagascar and Crozet basins. In the western Indian Ocean, the cold Antarctic Bottom Water spreads northward under the possibly southward-flowing deep water, forming a clear benthic front along the Crozet basin across the Southwest Indian Ridge into the Madagascar and Mascarene basins. The Antarctic Bottom Water continues to spread farther north to the Somali basin through the Amirante Passage at 10/sup 0/S as a western boundary current. The benthic front and other characteristic features in the western Indian Ocean are quite similar to those observed in the western Pacific where the benthic front as a distinctive feature was first described by Craig et al. Across the Mid-Indian Ridge toward the Ceylon abyssal plain near the triple junction, Ra profiles display a layered structure, reflecting the topographic effect of the mid-ocean ridge system on the mixing and circulation of the deep and bottom waters. Both Ra and Si show a deep maximum north of the Madagascar Basin. Linear relationships between these two elements are observed in the deep and bottom water with slopes increasing northward. This suggests a preferential input of Ra over Si from the bottom sediments of the Arabian Sea and also from the flank sediments of the Somali basin.

  16. Distribution and retention in bone of 226Ra and comparison with the ICRP 20 model

    Analyses are presented of the ratios of 226Ra to calcium in over 650 samples of compact and cancellous bone from 66 female and 26 male subjects who had died from less than one to 60 years after first exposure to radium. The 226Ra/Ca ratios were normalized to the terminal 226Ra skeletal content. The 226Ra/Ca ratios for vertebrae were essentialy identical to those for other cancellous bone for a given subject. Comparisons of the data with predictions of the ICRP model of alkaline earth metabolism show that for female cancellous bone the normalized 226Ra/Ca ratios tended to be greater than predicted, while those for female cortical bone (femoral and tibial shaft) tended to be less. The data for males were fitted better by the model. A modification of the model to reduce the amount of radium deposited in soft tissue fitted the data better in some respects. A straight line linear least squares fit to the data appeared to fit as well as, or better than, the models. A radiation effect was suggested in that the normalized 226Ra/Ca ratio for vertebrae relative to the ratio expected increased with skeletal absorbed dose for vertebra. However, no such effect was apparent for compact bone or for the cancellous bone as a whole

  17. Determination of {sup 226}Ra Isotope in the Leachate around Phosphogypsum Stack Using Ethylenediaminetetraacetic Acid (EDTA)

    Kim, Geun Ho; Kim, Yong Jae; Chang, Byung Uck [University of Science and Tecknology, Korea Institute of Nuclear Safety, Daejeon (Korea, Republic of)

    2011-12-15

    Ba is the most useful element to get the Ba(Ra)SO{sub 4} precipitate. However, when the high concentrations of ions such as sulfate, calcium are existed in the leachate of phosphogypsum stack, it is difficult to get the Ba(Ra)SO{sub 4} precipitate. Since this reason, the developed method for the Ba coprecipitate using EDTA was performed to determine the {sup 226}Ra concentration in the high sulfate sample. The average concentration of {sup 226}Ra in a leachate of phosphogypsum using this method was 0.102 Bq{center_dot}kg{sup -1} and the minimal detectable activity is 3.4 mBq{center_dot}kg{sup -1}. The mBq{center_dot}kg{sup -1} method was 0.102 Bq{center_dot}kg{sup -1} and the minimal detectable activity is 3.4 mBq{center_dot}kg{sup -1}. The {sup 226}Ra stock solution and the CRM (Certified Reference Material) were analyzed to verify this method. In analyzed {sup 226}Ra stock solution, bias with added concentration was approximately 1% and the correlation curve between {sup 226}Ra concentration in simulated standard sample and measured {sup 226}Ra concentration showed good agreement with a correlation coefficient (R{sup 2}) of 0.99. In analyzed CRM, maximum bias with reference value was 5.8% (k=1) and the analytical results were in good agreement with the reference value.

  18. Leaching of 60Co, 137Cs and 226Ra in lysimeter experiments

    The present report describes the first results obtained from lysimeter experiments started in 1990. The lysimeter plant consists of twelve soil monoliths from four different sites (three replicates each). Since 1990 the following agricultural crops were grown: endive, corn, winter wheat, mustard, sugar beet and potato. Gravitational water ranged from 3.9 % to 18.3 % of precipitation plus irrigation water, calculated as half years average values excluding the first six months of operation. The two Cambisols on sediments exhibited a mean percentage of approx. 10 %. The Dystric Cambisol on silicate rock and the Gleysol showed average values of 20 %. In 1990 the top layers (20 cm) were contaminated with three radionuclides. The leaching of the contaminants 60Co, 137Cs and 226Ra differed distinctly between the elements. The lowest leaching rates were observed for 137Cs, followed by 60Co. The 226Ra-concentrations in the gravitational water were clearly highest of all. However, the comparison of the 226Ra/2228Ra ratios in deep soil layers and in gravitational water showed that the 226Ra measured in the leachate originates from the natural contents in the subsoil and not from the artificial 226Ra contamination of the topsoil. The mobility of the artificial radionuclides decreased therefore in the following order: 60Co > (226Ra) > 137Cs. (author)

  19. Oral administration of FAK inhibitor TAE226 inhibits the progression of peritoneal dissemination of colorectal cancer

    Highlights: ► A novel FAK inhibitor TAE226 suppressed FAK activity in HCT116 colon cancer cells. ► TAE226 suppressed proliferation and migration, with a modest effect on adhesion. ► Silencing of FAK by siRNA made no obvious difference on cancer cell attachment. ► TAE226 treatment suppressed the progression of peritoneal dissemination. ► Oral administration of TAE226 prolonged the survival of tumor-bearing mice. -- Abstract: Peritoneal dissemination is one of the most terrible types of colorectal cancer progression. Focal adhesion kinase (FAK) plays a crucial role in the biological processes of cancer, such as cell attachment, migration, proliferation and survival, all of which are essential for the progression of peritoneal dissemination. Since we and other groups have reported that the inhibition of FAK activity exhibited a potent anticancer effect in several cancer models, we hypothesized that TAE226, a novel ATP-competitive tyrosine kinase inhibitor designed to target FAK, can prevent the occurrence and progression of peritoneal dissemination. In vitro, TAE226 greatly inhibited the proliferation and migration of HCT116 colon cancer cells, while their adhesion on the matrix surface was minimally inhibited when FAK activity and expression was suppressed by TAE226 and siRNA. In vivo, when HCT116 cells were intraperitoneally inoculated in mice, the cells could attach to the peritoneum and begin to grow within 24 h regardless of the pretreatment of cells with TAE226 or FAK-siRNA, suggesting that FAK is not essential, at least for the initial integrin-matrix contact. Interestingly, the treatment of mice before and after inoculation significantly suppressed cell attachment to the peritoneum. Furthermore, oral administration of TAE226 greatly reduced the size of disseminated tumors and prolonged survival in tumor-bearing mice. Taken together, a possible strategy for inhibiting peritoneal dissemination by targeting FAK with TAE226 appears to be applicable

  20. Oral administration of FAK inhibitor TAE226 inhibits the progression of peritoneal dissemination of colorectal cancer

    Hao, Hui-fang [Department of Gastroenterological Surgery, Graduate School of Medicine, Dentistry, and Pharmaceutical Sciences, Okayama University, 2-5-1 Shikatacho, Kita-ku, Okayama 700-8558 (Japan); Takaoka, Munenori [Department of General Surgery, Kawasaki Medical School, 2-1-80 Nakasange, Kita-ku, Okayama 700-8505 (Japan); Bao, Xiao-hong [Department of Gastroenterological Surgery, Graduate School of Medicine, Dentistry, and Pharmaceutical Sciences, Okayama University, 2-5-1 Shikatacho, Kita-ku, Okayama 700-8558 (Japan); Wang, Zhi-gang [College of Life Science, Inner Mongolia University, The Key Laboratory of Mammal Reproductive Biology and Biotechnology, Ministry of Education, Hohhot 010021 (China); Tomono, Yasuko [Division of Molecular and Cell Biology, Shigei Medical Research Institute, 2117 Yamada, Okayama 700-0202 (Japan); Sakurama, Kazufumi; Ohara, Toshiaki [Department of Gastroenterological Surgery, Graduate School of Medicine, Dentistry, and Pharmaceutical Sciences, Okayama University, 2-5-1 Shikatacho, Kita-ku, Okayama 700-8558 (Japan); Fukazawa, Takuya; Yamatsuji, Tomoki [Department of General Surgery, Kawasaki Medical School, 2-1-80 Nakasange, Kita-ku, Okayama 700-8505 (Japan); Fujiwara, Toshiyoshi [Department of Gastroenterological Surgery, Graduate School of Medicine, Dentistry, and Pharmaceutical Sciences, Okayama University, 2-5-1 Shikatacho, Kita-ku, Okayama 700-8558 (Japan); Naomoto, Yoshio, E-mail: ynaomoto@med.kawasaki-m.ac.jp [Department of General Surgery, Kawasaki Medical School, 2-1-80 Nakasange, Kita-ku, Okayama 700-8505 (Japan)

    2012-07-13

    Highlights: Black-Right-Pointing-Pointer A novel FAK inhibitor TAE226 suppressed FAK activity in HCT116 colon cancer cells. Black-Right-Pointing-Pointer TAE226 suppressed proliferation and migration, with a modest effect on adhesion. Black-Right-Pointing-Pointer Silencing of FAK by siRNA made no obvious difference on cancer cell attachment. Black-Right-Pointing-Pointer TAE226 treatment suppressed the progression of peritoneal dissemination. Black-Right-Pointing-Pointer Oral administration of TAE226 prolonged the survival of tumor-bearing mice. -- Abstract: Peritoneal dissemination is one of the most terrible types of colorectal cancer progression. Focal adhesion kinase (FAK) plays a crucial role in the biological processes of cancer, such as cell attachment, migration, proliferation and survival, all of which are essential for the progression of peritoneal dissemination. Since we and other groups have reported that the inhibition of FAK activity exhibited a potent anticancer effect in several cancer models, we hypothesized that TAE226, a novel ATP-competitive tyrosine kinase inhibitor designed to target FAK, can prevent the occurrence and progression of peritoneal dissemination. In vitro, TAE226 greatly inhibited the proliferation and migration of HCT116 colon cancer cells, while their adhesion on the matrix surface was minimally inhibited when FAK activity and expression was suppressed by TAE226 and siRNA. In vivo, when HCT116 cells were intraperitoneally inoculated in mice, the cells could attach to the peritoneum and begin to grow within 24 h regardless of the pretreatment of cells with TAE226 or FAK-siRNA, suggesting that FAK is not essential, at least for the initial integrin-matrix contact. Interestingly, the treatment of mice before and after inoculation significantly suppressed cell attachment to the peritoneum. Furthermore, oral administration of TAE226 greatly reduced the size of disseminated tumors and prolonged survival in tumor-bearing mice. Taken

  1. Growth patterns of craniopharyngiomas: clinical analysis of 226 patients.

    Pan, Jun; Qi, Songtao; Liu, Yi; Lu, Yuntao; Peng, Junxiang; Zhang, XiAn; Xu, YiKai; Huang, Guang-Long; Fan, Jun

    2016-04-01

    OBJECT Craniopharyngiomas (CPs) are rare epithelial tumors that are often associated with an enigmatic and unpredictable growth pattern. Understanding the growth patterns of these tumors has a direct impact on surgical planning and may enhance the safety of radical tumor removal. The aim of this study was to analyze the growth patterns and surgical treatment of CPs with a focus on the involvement of the hypothalamopituitary axis and the relationship of the tumor to the arachnoid membrane and surrounding structures. METHODS Clinical data from 226 consecutive patients with primary CP were retrospectively reviewed. Tumor location and the relationship of the tumor to the third ventricle floor and the pituitary stalk were evaluated using preoperative MRI and intraoperative findings. A topographic classification scheme was proposed based on the site of tumor origin and tumor development. The clinical relevance of this classification on patient presentation and outcomes was also analyzed. RESULTS The growth of CPs can be broadly divided into 3 groups based on the site of tumor origin and on tumor-meningeal relationships: Group I, infrasellar/infradiaphragmatic CPs (Id-CPs), which mainly occurred in children; Group II, suprasellar subarachnoid extraventricular CPs (Sa-CPs), which were mainly observed in adults and rarely occurred in children; and Group III, suprasellar subpial ventricular CPs (Sp-CPs), which commonly occurred in both adults and children. Tumors in each group may develop complex growth patterns during vertical expansion along the pituitary stalk. Tumor growth patterns were closely related to both clinical presentation and outcomes. Patients with Sp-CPs had more prevalent weight gain than patients with Id-CPs or Sa-CPs; the rates of significant weight gain were 41.7% for children and 16.7% for adults with Sp-CPs, 2.2% and 7.1% for those with Id-CPs, and 12.5% and 2.6% for those with Sa-CPs (p tumor. More tailored, individualized surgical strategies based on

  2. Behavior of 210Pb and 226Ra in tailing samples at Jaduguda

    Several investigation at various parts of the world as well as in different parts of India reported wide variation in activity of 210Pb and 226Ra in environmental matrices. Since 210Pb occurs in decay chain of 226Ra one would expect that in isolated and undisturbed domain the ratio to be nearly unity. However such a ratio is rarely reached. In the actual experience this ratio is influenced to different degree by several environmental parameters such as soil porosity, particle size distribution, and chemical nature of soil and subsurface and surface movement of water. A thorough study on 226Ra and 210Pb ratio can in principle be used as tool to evaluate some environmental parameters in the tailing ponds. A study of natural radioactivity levels including 226Ra and 210Pb in tailing sample around tailing pond area of uranium mining and milling complex located in the Singhbhum regions of Eastern India were undertaken. Tailing pond is covered with the normal background soil known as capping soil. This also reduces the emanation of radon and exposure due 226Ra and its daughter products. Tailings samples were collected after removing the top capping soil. Samples were processed as described by Environmental Measurement Laboratory (EML 1990). Activity concentration of natural 238U series radionuclide like thorium isotopes (234Th and 228Th), lead isotopes (210Pb and 212Pb), radium isotopes (226Ra and 228Ra) and 234mPa were measured using HPGe based high resolution gamma spectrometric technique after attaining secular equilibrium between 226Ra and its daughters. IAEA standard sources RGTh-1 (800 μg/g of 232Th), RGU-1 (400μg/g of 238U), were used for energy and efficiency calibration of the spectrometer in the same geometry (plastic containers of 6.5 cm dia x 7.5 cm ht) as that of the samples. (author)

  3. 238U-230Th-226Ra radioactive disequilibria in the products from 1707 eruption of Fuji volcano, Japan

    Time scale of magmatic processes in the 1707 eruptive activity of Fuji volcano, Japan, was estimated by the 238U-230Th-226Ra disequilibria observed in the 1707 volcanic products. The activity ratios of 226Ra/230Th in the products were larger than unity, being enriched in 226Ra relative to 230Th. The decay-corrected 226Ra/230Th activity ratio to the time of the eruption versus 238U/230Th activity ratio diagram for the 1707 volcanic products showed a positive correlation, suggesting that the 238U/230Th-226Ra disequilibria occurred during the magma genesis of Fuji volcano. The 230Th-226Ra disequilibria in the 1707 volcanic products suggested that the time scale from the magma genesis to the eruption, including the melting of the mantle wedge, magma storage and magmatic differentiation from basalt to andesite, was less than 8000 years. (author)

  4. Ra-226 and Rn-222 in saline water compartments of the Aral Sea region

    Highlights: • 222Rn and 226Ra concentrations in different water compartments of the Aral Sea region. • 226Ra-analysis based on 222Rn-ingrowth versus MS-analysis after solid-phase extraction. • 226Ra in different groundwater types of the Aral Sea Basin. • 222Rn distribution in the Aral Sea, western basin. - Abstract: The Aral Sea has been shrinking since 1963 due to extensive irrigation and the corresponding decline in the river water inflow. Understanding of the current hydrological situation demands an improved understanding of the surface water/groundwater dynamics in the region. 222Rn and 226Ra measurements can be used to trace groundwater discharge into surface waters. Data of these radiometric parameters were not previously available for the study region. We determined 222Rn activities after liquid phase extraction using Liquid Scintillation Counting (LSC) with peak-length discrimination and analyzed 226Ra concentrations in different water compartments of the Amu Darya Delta (surface waters, unconfined groundwater, artesian water, and water profiles from the closed Large Aral Sea (western basin). The water samples comprise a salinity range between 1 and 263 g/l. The seasonal dynamics of solid/water interaction under an arid climate regime force the hydrochemical evolution of the unconfined groundwater in the Amu Darya Delta to high-salinity Na(Mg)Cl(SO4) water types. The dissolved radium concentrations in the waters were mostly very low due to mineral over-saturation, extensive co-precipitation of radium and adsorption of radium on coexisting solid substrates. The analysis of very low 226Ra concentrations (<10 ppq) at remote study sites is a challenge. We used the water samples to test and improve different analytical methods. In particular, we modified a procedure developed for the α-spectrometric determination of 226Ra after solid phase extraction of radium using 3M Empore™ High Performance Extraction Disks (Purkl, 2002) for the analysis of the

  5. Survey of the occurrence of Ra-226 in the Rio Algom Quirke I uranium mill, Elliot Lake

    The main solution ore and residue pulp streams in the Rio Algom Quirke I uranium mill at Elliot Lake have been sampled and analyzed for radium-226. Analysis of the ore and leached residues indicates that Ra-226 dissolves and precipitates within the first pachuca tank. A maximum of approximately 0.2% of the Ra-226 in the ore remains in solution during leaching. (author)

  6. Lifetime effects of long-term exposures to strontium-90 and radium-226 in beagle dogs

    Graded doses of injected 226Ra or ingested 90Sr were given to 804 beagles in early life. The median survival times of the various irradiated groups at higher exposures were lower than the control value of 14.7 years. The 226Ra group with the highest total skeletal dose had a median survival of 4.5 years. For 90Sr the highest group had a median survival of 2.2 years. Normal life spans were evident in treatment groups with average skeletal doses of 226Ra or of 2600 rads from 90Sr. The life-shortening effects of 226Ra and 90Sr are related to the tumors produced from the radionuclide exposure. The significant causes of death among the 226Ra-treated beagles were primary bone cancers, mostly osteosarcomas. Among dogs exposed to 90Sr, significant numbers of deaths were from primary bone cancer, myeloproliferative disease, and squamous-cell carcinoma of the gingiva. In general, more of these effects were produced in the groups receiving higher doses and dose rates; at lower doses the effects, when present, appeared later than they did at higher doses. 9 refs., 6 figs., 4 tabs

  7. Sorption of (226)Ra from oil effluents onto synthetic cation exchangers.

    Al Attar, Lina; Safia, Bassam

    2013-07-30

    Increasing environmental awareness is being urged for the safe disposal of (226)Ra-contaminated production water generated in the oil industry. Birnessite, antimony silicate and their cationic derivatives were studied for the take-up of (226)Ra using the batch-type method under experimentally determined parameters, viz. contact time, solution-solid ratio and (226)Ra concentration. Data was expressed in terms of distribution coefficients. Sorption experiments were performed in different concentrations of nitric acid in order to speculate the mechanism of (226)Ra uptake. Variation in the magnitude of sorption efficiency of the materials in the presence of the major components of waste streams, i.e. Na(+), K(+) and Ca(2+), revealed that K(+) was the greatest competitor and Na(+) the least. The application of the materials to sorb (226)Ra from actual oil co-production water samples, collected from Der Ezzor and Al Fourat petroleum companies (DEZPC and AFPC), was interpreted in terms of the exchange properties of the materials and water characterisation. Of the parameters studied, the selectivity of materials was shown to be greatly dependent on the pH of wastewater to be treated. PMID:23623032

  8. Rapid estimation of 226Ra in soil for the Grand Junction RASA/UMTRA project

    The Radiological Survey Activities (RASA) Group of the Health and Safety Research Division at Oak Ridge National Laboratory (ORNL) is an Inclusion Survey Contractor (ISC) for the Uranium Mill Tailings Remedial Action Program (UMTRAP). The purpose of the ISC is to survey designated sites potentially contaminated with radioactive material originating from the 24 inactive uranium mill sites and make recommendations as to whether the site should be included in or excluded from further consideration by UMTRAP. An important aspect of the program is a prompt and inexpensive estimation of Radium-226 (226Ra) concentration in soil samples. A large sodium iodide (NaI) well crystal coupled to a multichannel analyzer is used to count soil samples. Count data are currently analyzed with an algorithm that utilizes three regions of interest (ROI). A lack of agreement was observed when samples were also analyzed with lithium-drifted germanium (GeLi) spectrometers. The average estimate of 226Ra obtained using the current algorithm was 19% greater than the GeLi determination. Some possible reasons for these differences were examined. In 8.5% of the samples, the relative concentration of Cesium-137 (137Cs) was highly correlated to the extent of error. Using alternative analysis techniques, the error for 226Ra estimations may be reduced by a factor of 2 for randomly selected samples and by a factor of 4 for samples containing high concentrations of 137Cs relative to the concentrations of 226Ra. 9 refs., 4 figs., 3 tabs

  9. The precipitation of radioactive radium-226 from acidic chloride leach liquors with barium chloride

    The conventional barium chloride (BaClsub(2)) precipitation has been effective in the 99+ percent removal of radium-226 as radium-barium sulphate [RaBa(SOsub(4))sub(2)] sludge, from HCl liquors produced by laboratory and pilot leaches of Canadian uranium ores. Radium-226, due to its low-level radiation characteristics, is removed as it has been identified as an environmental and long-term health problem. The formation of the RaBa(SOsub(4))sub(2) sludge was aided due to adequate sulphate (SOsub(4)) concentrations in the HCl pilot liquors produced. Recyclable Rasup(226) concentrations of about 66 pCi/L, in treated effluents, will cost about 1/10 that of effluents below federal environmental guidelines of 10 pCi Rasup(226)/L. Toxic barium (Ba) will potentially build up in effluents as recyclable Rasup(226) concentrations around 66 pCi/L. Barium, in addition to being added to liquors as BaClsub(2) precipitant, is present in the radioactive ore and HCl leach liquors

  10. Spatial distribution of U-238, Ra-226 and Pb-210 at Urgeirica uranium mill tailings

    The extensive exploitation and treatment of the uranium ore in the Urgeirica mine, Portugal, where exists a chemical treatment plant, led to an accumulation of large amounts of solid wastes (tailings) deposited in piles or dams. The objective of this work is to investigate the extent of the contamination at the oldest dams (more than 40 years old) taking into account the U-238, Ra-226 and Pb-210 distribution at those dams. Tailings core and surface samples were randomly collected at the dams. Tailings samples were dried and the activity in U-238 (through the peaks of Th-234), Ra-226 (through the progenies Pb-214 and Bi-214) and Pb-210 were determined by gamma spectrometry. The results show a big variability (by a factor of 5 to 10) if the U-238, Ra-226 and Pb-210 concentrations at the surface tailings, which indicates a heterogeneity of the radionuclides distribution at the dams area. A good correlation between Ra-226 and U-238 concentrations at the sampling site (dam D2) that presents lower Ra-226 concentrations was obtained. As expected, the most important contribution to the high natural radioactivity at the oldest dams is due to the radium rejected as a waste product from the uranium ore treatment (author)

  11. Evaluation of the variation of 226Ra and Ca uptake by plant and their relationship

    The transfer of 226Ra from soil to plant has been studied for wild trees and grasses to identify the site- and the plant-specific variability in relation to the transfer of Ca. Twelve species of plants and soils were sampled from three different forests and one flood plain in Okayama, Japan. The concentrations of 226Ra in plant varied about 60 times by species and sites, while those in soil were not different significantly among sites. The transfer factors defined as the concentration ratio of 226Ra between plant and soil were linearly correlated with that of Ca, implying that the ability of Ca uptake by plant reflect the ability of 226Ra uptake. The Ca concentrations in plant showed species-specific value and varied 22 times. The range of transfer factor (plant/soil) for Ca increased by the variability of the Ca concentration in soil among sites. These results suggest that the wide variability of 226Ra concentration in plant can be ascribed to both the differences in plant and soil factors of Ca concentration. (author)

  12. Measurement of radium - 226 in rock phosphate used as low cost fertilizer using gamma spectroscopy

    This study was carried out to determine the concentration of radium - 226 in rock phosphate (used as low cost fertilizer), soil and plant. Two types of rock phosphates were examined, namely, Uro and kurun area in the Nuba mountains located in the western part of the sudan. The work included the determination of 226 Ra levels in soil after applying different concentration of rock phosphate in pot experiments. The plant used was Abu sabien a sorghum which used for the animal feed. 226 Ra in the soil using 20 g/pot (1000 kg/fed). of rock phosphate was found to be 88 and 104 Bq/kg for and 45 and 72 Bq/kg for kurun for season one and three respectively. As for the plant the concentration was found to be 1.2 and 1.4 Bq/kg for Uro and 0.4 and 0.6 Bq/kg for kurun for the first and third seasons respectively. The transfer factor of 226 Ra from soil to plant was estimated to be (0.01). The concentration of 226 Ra in the plant was found to be below the recommended values of contamination. 4 figs

  13. Transfer of radium-226 from soil to rice. A comparison of sampling area differences

    Due to limited numbers of radium-226 (226Ra) soil-to-plant transfer data, it has been difficult to analyze the sampling area differences. In this study, we measured 226Ra concentrations in brown rice and associated soils collected from 61 locations throughout Japan and obtained soil-to-rice transfer factors (TFs). Concentrations of 226Ra in the soils collected in southwestern Japan were higher than those in northeastern Japan (t-test, p226Ra in southwestern Japan was 40.4 Bq/kg-dry (N=33) and it was 27.8 Bq/kg (N=28) in northeastern Japan, reflecting geological differences between these areas. Using the measured data, we compared TFs in these two areas and found no difference, i.e., the GM in southwest was 4.6x10-4 and it was 4.9x10-4 in northeast. The observed TFs were about one order of magnitude lower than the previously reported TF values for cereals (maize, wheat, and rice), but in the same range for previously reported data for white rice. Among the alkaline earth metals, TF for Ba was well correlated to TF for Ra, but because Ba and Ra concentrations in brown rice were highly correlated, the TF would also be expected to correlate. (author)

  14. Bioaccumulation of 226Ra by plants growing in fresh water ecosystem around the uranium industry at Jaduguda, India

    A field study has been conducted to evaluate the 226Ra bioaccumulation among aquatic plants growing in the stream/river adjoining the uranium mining and ore-processing complex at Jaduguda, India. Two types of plant group have been investigated namely free floating algal species submerged into water and plants rooted in stream and riverbed. The highest 226Ra activity concentration (9850 Bq kg-1) was found in filamentous algae growing in the residual water of tailings pond. The concentration ratios of 226Ra in filamentous algae (activity concentration of 226Ra in plant Bq kg-1 fresh weight/activity concentration of 226Ra in water Bq l-1) widely varied i.e. from 1.1 x 103 to 8.6 x 104. Other aquatic plants were also showing wide variability in the 226Ra activity concentration. The ln-transformed filamentous algae 226Ra activity concentration was significantly correlated with that of ln-transformed water concentration (r = 0.89, p 226Ra in stream/riverbed rooted plants and the substrate. For this group, correlation between 226Ra activity concentration and Mn, Fe, Cu concentration in plants were statistically significant.

  15. Life-span studies in 226Ra-injected animals: Effect of low doses, effect of a decorporative treatment

    A life-span radiation effects study was performed in mice injected with several doses of 226Ra. The study included 788 male C57Bl mice. For the removal of the 226Ra, half the mice were treated daily with a diet 5% of which was sodium-alginate. The experiment revealed that mice that received the lowest dose of 226Ra lived significantly longer than controls, and, despite appreciable skeletal removal of 226Ra as a result of decorporative treatment, no biological benefit was observed in treated animals. 19 refs., 4 figs., 3 tabs

  16. 238U, 226Ra and 210Pb in some vent waters of the Galapagos spreading center

    The concentrations of 226Ra, 238U and 210Pb have been measured in waters from the Mussel Bed and the Rose Garden thermal fields at the Galapagos spreading center over a temperature range of approx.2.5--16 0C. The 226Ra-T plots yield slopes of 0.112 and 0.036 dpm/kg 0C for the Mussel Bed and the Rose Garden respectively yielding a global hydrothermal 226Ra flux less than 5% of that required to sustain the oceanic inventory. 238U concentration in waters 0C is the same as that in ambient sea water whereas water hotter than approx.9 0C shows a decreasing trend with temperature to zero 238U at approx.29 0C. 210Pb concentration in Mussel Bed increases with temperature, and extrapolated to approx.350 0C yields a 210Pb concentration considerably less than that expected from 222Rn decay and basalt alteration

  17. Summary of dosimetry, pathology, and dose response for bone sarcomas in beagles injected with radium-226

    In the completed 226Ra portion of a 30-year-long experiment to determine the relative radiotoxicity of injected 226Ra and 239Pu, 42 of 116 animals injected with 226Ra developed 63 bone sarcomas; none were observed in 44 controls. Average alpha plus beta dose to the skeleton to death was calculated on the basis of mathematical functions developed from sequential measurements of radium and radon retention in each dog. Bone sarcomas were identified radiographically or clinically, with subsequent histopathological confirmation and classification. Most primary bone tumors were classified as osteosarcomas if osteoid arose from a malignant stroma. The dose-response curve over the six lowest injected dose levels fits well to a linear, no-threshold, least squares fit, through a control incidence of 0.8%, and with a slope of 0.042% incidence per rad. 19 refs., 5 figs., 2 tabs

  18. 226Ra and 228Ra in consumable marine organisms from different coastal regions of India

    Marine organism samples were collected from different regions of India. The edible portions after drying and homogenizing kept for 1 month to achieve equilibrium between Radium and its daughter products, were analysed by gamma spectrometry using 50 % HPGe. 226Ra activity was found to be in the range of <0.07-0.736 Bq kg-1 (wet) and 228Ra in the range of <0.082-2.5 Bq kg-1. 228Ra and 226Ra concentrations in different species of organism were different even in the same marine environment. To assess the impact of this activity to human, ingestion dose due to consumption of organisms was calculated and the maximum dose of 2.8 μSv year-1 due to 226Ra and 25.24 μSv year-1 due to 228Ra was observed. (author)

  19. 224Ra and 226Ra experimentally induced dental changes in rats

    Sprague-Dawley rats received intragastrically a single dose of 226Ra or 224Ra once weekly for 21 weeks. During this period the animals of both groups were thus exposed to comparable doses. After 12 weeks, a shortening of the maxillary incisors was observed, and this progressed during the course of the 55-week experiment. Radiologically, a loss of pulpal transparency and an apical irregular opacity in the maxillary incisors were demonstrable. Histologically, dysplastic changes of the maxillary incisors and multiple resorptions at the cemento-enamel junction of the molars were seen. The observed alterations were more pronounced in the 226Ra group than in the 224Ra treated group. The experimentally induced resorptions were comparable to those observed in patients who had incorporated 224Ra or 226Ra. Clinical, radiological, histological, γspecrometrical, and autoradiographical findings, as well as dose-estimations, are described. (author)

  20. Systematic study of heavy cluster emission from {210-226}^Ra isotopes

    Santhosh, K P; Priyanka, B; Unnikrishnan, M S

    2012-01-01

    The half lives for various clusters lying in the cold reaction valleys of {210-226}^Ra isotopes are computed using our Coulomb and proximity potential model (CPPM). The computed half lives of 4^He and 14^C clusters from {210-226}^Ra isotopes are in good agreement with experimental data. Half lives are also computed using the Universal formula for cluster decay (UNIV) of Poenaru et al., and are found to be in agreement with CPPM values. Our study reveals the role of doubly magic 208^Pb daughter in cluster decay process. Geiger - Nuttall plots for all clusters up to 62^Fe are studied and are found to be linear with different slopes and intercepts. {12,14}^C emission from 220^Ra; 14^C emission from {222,224}^Ra; 14^C and 20^O emission from 226^Ra are found to be most favourable for measurement and this observation will serve as a guide to the future experiments.

  1. Naturally enhanced radium-226 at the Hammam Pharaon hot spring area

    A radiological study was conducted for Hammam Pharaon hot spring and the surrounding area. The naturally occurring 226Ra was determined using HpGe spectrometer. Gamma emissions 351.9 keV of the 214Pb and 609.3 keV, 1120.3 keV and 1764.5 keV of the 214Bi, in equilibrium with their 226Ra parent were used to calculate its specific activity in the water, soil and rock samples. The analysis revealed the presence of some hot spots in the studied area. Elevated values of 226Ra were found to be as high as 32,000 Bq/kg (∼ 0.9 nCi/gm). The absorbed dose rates, hazard indices, and radium equivalent values were calculated on the basis of the results obtained. The resulted high doses due to the elevated radium content necessitate controlled recreational activities in this area

  2. Adsorption of 241Am and 226Ra from natural water by wood charcoal

    The adsorption of 241Am and 226Ra from natural water by a granulated wood charcoal was investigated as a function of the solution pH, in the range 4-10, and of the water flow, in the range 3.5-42 cm3/min. The percentage adsorption of 241Am (fairly constant at >80% for all pHs) was greater than that of 226Ra (which increased with increasing pH from ∼40% up to >80%). The results are explained by considering the different species of each radionuclide present at the pH values of the solution at the end of the adsorbent column, and the pH of the point of zero charge of the adsorbent. At pH 6, the elimination of 241Am from natural water was independent of the water flow, while the elimination of 226Ra declined linearly as the flow rate was increased

  3. Diffusion of 226Ra and 4K radionuclides reproduced in underwater sedimentary columns in laboratory

    The potential radiological impact of the increase of radioactive substances in the environment makes interesting the study of the migration of the contaminant radionuclides in soils and sediments, which are the last receiver system of these substances. By using a battery of sedimentary columns controlled in the laboratory, the diffusion of the 226Ra and 4K radionuclides has been studied, assessing their respective effective diffusion coefficients in a similar sedimentary medium. A decreasing temporal evolution is obtained, associated to the progressive 'fixation' of the radionuclides by the clay minerals of the sediment, followed by a constant tendency. A timescale of the 'fixation' by the sediment is determined, being of the order of days for 226Ra and of the order of months for 4K, so the progressive 'fixation' of 4K by the clay minerals of the sediments is slower than in the case of 226Ra

  4. Sorption properties of peat for U(VI) and 226Ra in U mining areas

    Understanding the environmental behavior of U and 226Ra is important for remediation of former mining sites and assessment of their durability. The aim of this study is to determine the sorption properties of an acidic peat for U and 226Ra, located near a former U mine. A 90% retention of U over a pH range of 3 to 10 was observed in Na-conditioned peat samples issued from the mesotelm, with a Rd between 1000 and 12000 mL/g. It seems that U sorption in peat is not only governed by organic matter. The Kd for 226Ra adsorption increases with pH from zero to 4849 mL/g. However in this mining environment, the peat bog proved to be significantly impacted by anthropogenic activities, with the presence of detrital components in the peat material that can also contribute to U and Ra sorption. (authors)

  5. The concentrations of 226 Ra and 210 Pb in food cultivated in Pocos de Caldas

    The aim of this study is to determine the average concentrations of 226 Ra and 210 Pb in vegetables widely cultivated in the region, mainly potatoes, carrots, beans and corn which are the main agricultural products (considering production and human consume) in the region and estimation of the average transfer factors soil-foodstuff for both radionuclides. The total 226 Ra and 210 Pb content in the soil was determined by gamma spectrometry. The exchangeable fraction was obtained by ammonium acetate solution extraction. The 226 Ra was analysed by the classical radon emanation procedure and the 210 Pb was isolated by a radiochemical procedure and determined by radiometry of its daughter 210 Bi beta emissions with a Geiger Mueller counter. (author)

  6. Ra-226 concentrations in otter, Lutra canadensis, trapped near uranium tailings at Elliot Lake, Ontario

    The Elliot Lake area of Ontario, is currently the major uranium producing region of Canada. It is estimated there are 120 million tons of uranium tailings spread over 600 ha in the vicinity of Elliot Lake. The transfer and fate of uranium-series radionuclides from tailing sites remain primary ecological concerns in these areas. It has been demonstrated that the levels of radionuclides, including Ra-226, are elevated in vegetation, small mammals and fish living on or near tailing disposal sites. However, the transfer potential of Ra-226 to predatory species has not been examined in detail. The objective of this study was to measure Ra-226 levels in otters (Lutra canadensis), captured near tailing sites, to provide further information on the fate of radionuclides in the environment

  7. Radiological impact from atmospheric releases of 238U and 226Ra from phosphate rock processing plants

    Phosphate rocks are used extensively, mainly as a source of phosphorus for fertilizers and secondly for phosphoric acid and gypsum (phosphogypsum). Phosphates are, therefore one of the sources of technologically enhanced exposure to man from natural radionuclides (TENR). Emissions from phosphate rocks processing plants in gaseous and particulate form contain radioisotopes, such as 238U and 226Ra, which are discharged into the environment causing radiation exposures to the population. About 10 MBq of 238U and 226Ra, respectively, are discharged to the environment each year from a phosphate rocks processing plant in Thessaloniki area, Northern Greece. The collective dose commitment to lung tissue resulting from atmospheric release was estimated to be ∼2x10-9 man Gy t-1 for 238U and ∼0.1x10-9 Plan Gy t-1 for 226Ra, i.e. about 2 times higher than that reported in UNSCEAR 1992 Report. (author)

  8. Distribution and flux of 226Ra and 228Ra in the Amazon River estuary

    Measurements of 226Ra and 228Ra in the Amazon River estuary show that desorption from riverborne suspended particulate matter in the estuary increases the riverine flux of both isotopes to the ocean by a factor of approximately 5 over the flux attributable to radium dissolved in the river water alone. The total Amazon flux supplies approximately 0.20% of the 226Ra and approximately 2.6% of the 228Ra standing crops in the near-surface Atlantic (0-200 m). Diffusive flux from estuarine and shelf sediments and desorption from resuspended sediments in the region of the estuary approximately double the estuarine 226Ra concentration and quadruple the estuarine 228Ra concentration above that caused by the dissolved and desorbed river components alone

  9. Radium-226 dose to a boy from playing on mill tailings

    Two boys born in September 1949 played on uranium mill tailings from about ages 8 to 12. One of these boys was diagnosed as having leukemia at age 15.5. The 226Ra body burden of the survivor was measured at age 38. The whole-body 226Ra content measured by counting in vivo was 0 ± 17 Bq and independently by Rn breath analysis as 4.3 ± 2.1 Bq. At the same time, a control subject with no known exposure to 226Ra, matched in age, height, and weight, was also measured. The whole-body content was estimated as 4 ± 15 Bq and independently by Rn breath analysis as 5.5 ± 3.7 Bq. The body burden of the control subject was not significantly different from that of the exposed person. The radiation dose to the marrow-free skeleton assuming a constant 226Ra:Ca ratio since birth was 0.49 and 1.33 mGy at ages 14 and 38, respectively. The radiation dose to the marrow-free skeleton assuming 226Ra intake only between ages 8 to 12 was 1.4 and 2.8 mGy at ages 14 and 38, respectively. The best estimate is the mean of these two estimates: 0.9 and 2.1 mGy at ages 14 and 38, respectively. The alpha-particle dose to the red marrow from 226Ra and its decay products was 0.05 mGy at age 14 and 0.10 mGy at age 38. Since no excess was found for the radium dial painters whose doses were much higher, the induction of leukemia by doses of this magnitude would seem quite unlikely

  10. Specific activities of radium-226 in vegetables grown in Na Mom District, Songkhla Province

    Angkunrat, S.

    2007-09-01

    Full Text Available Specific activity of radium-226 in 13 types of vegetables grown in Namom district, Songkhla province, were analyzed using a low background gamma-ray spectrometer. The analyzed vegetables included Ivy Gourd, Yellow Cassia, White Popinac, Yard Long Bean, Rice, Peanut, Egg Plant, Spineless Amaranth, Swamp Cabbage, Mustart, Chinese Cabbage, Collards and Cucumbers. The control vegetables were taken from Bangklum district, 40 km south of Namom district. The samples were weighed, dried in an oven and finally burnt to ash in a furnace before being analyzed for a gamma ray of 186.2 keV emitted from Radium-226. The results showed that the geometrical means of specific activity of radium-226 of vegetables grown in Pijit, Namom, Klongrang and Thungkamin sub-district and over the Namom district were 1082, 1220, 1457, 1253 and 1250 mBq/kg, respectively. The highest and lowest values were 7882 and 26 mBq/kg, found in Ivy Gourd and Yard Long Bean, respectively. The high specific activities of radium-226 in vegetables were found to be distributed uniformly in the area. This probably indicated the source of radium-226 was also distributed uniformly in the shallow granitic bedrock throughout the area. We concluded that the radium-226 contents in vegetables grown in Namom district depended on the absorbability of alkaline earth metals in vegetables themselves, geographic features and radium content in natural water in the area. The estimated annual effective dose averaged over Namom district was 21 μSv. Consumption of Ivy Gourd may receive the maximum annual effective dose of 132 μSv.

  11. An excess Ra-226 chronology for deep-sea sediments from Saanich Inlet, British Columbia

    Grayson, R.P.; Plater, A.J.

    2007-01-01

    To further explore the efficacy of 226Ra(excess) dating for deep-sea sediments, previously dated varve sediments from Saanich Inlet were investigated. Ages obtained using 226Ra(excess) are comparable to the varve ages in the upper 20-25 m of the sedimentary record, but radiometric ages for those sediments older than c. 4000 yr BP are significant underestimates. This results from major changes in sedimentation within Saanich Inlet around 4000 yr BP linked to rising sea levels, with younger sed...

  12. 226 Ra committed effective dose assessment for osteoporosis treatment with 'Gran-White' dolomite

    A total of 6 dolomite samples were prepared for activity concentration measurement by using high resolution gamma-ray spectrometry. The calculated average specific activity of 226 Ra was 4.34 Bq/kg. The committed effective dose due to the Ra-226 specific activity in dolomite was performed following the ICRP 30 and ICRP 61 procedures and dose conversion factors. Values of 1.95 x 10-6 Sv were obtained for committed effective dose and 5.93 x 10-5 Sv for committed dose equivalent in the bone surface. (author). 9 refs., 2 tabs

  13. The mobility of radium-226 and trace metals in pre-oxidized subaqueous uranium mill tailings

    Martin, A.J.; Crusius, J.; Jay McNee, J.; Yanful, E.K

    2003-07-01

    The exchange of {sup 226}Ra and trace metals across the tailings-water interface and the mechanisms governing their mobility were assessed via sub-centimetre resolution profiling of dissolved constituents across the tailings-water interface in Cell 14 of the Quirke Waste Management Area at Rio Algom's Quirke Mine, near Elliot Lake, Ontario, Canada. Shallow zones (<1.5 m water depth) are characterized by sparse filamentous vegetation, well-mixed water columns and fully oxygenated bottom waters. Profiles of dissolved O{sub 2}, Fe and Mn indicate that the tailings deposits in these areas are sub-oxic below tailings depths of {approx}3 cm. These zones exhibit minor remobilization of Ra in the upper 5 cm of the tailings deposit; {sup 226}Ra fluxes at these sites are relatively small, and contribute negligibly to the water column activity of {sup 226}Ra. The shallow areas also exhibit minor remobilization of Ni, As, Mo and U. The release of these elements to the water cover is, however, limited by scavenging mechanisms in the interfacial oxic horizons. The presence of thick vegetation (Chara sp.) in the deeper areas (>2 m water depth) fosters stagnant bottom waters and permits the development of anoxia above the benthic boundary. These anoxic tailings are characterized by substantial remobilization of {sup 226}Ra, resulting in a relatively large flux of {sup 226}Ra from the tailings to the water column. The strong correlation between the porewater profiles of {sup 226}Ra and Ba (r{sup 2}=0.99), as well as solubility calculations, indicate that the mobility of Ra is controlled by saturation with respect to a poorly ordered and/or impure barite phase [(Ra,Ba)SO{sub 4}]. In the anoxic zones, severe undersaturation with respect to barite is sustained by microbial SO{sub 4} reduction. Flux calculations suggest that the increase in {sup 226}Ra activity in the water cover since 1995 (from <0.5 to 2.5 Bq l{sup -1}) can be attributed to an increase in the spatial

  14. The mobility of radium-226 and trace metals in pre-oxidized subaqueous uranium mill tailings

    The exchange of 226Ra and trace metals across the tailings-water interface and the mechanisms governing their mobility were assessed via sub-centimetre resolution profiling of dissolved constituents across the tailings-water interface in Cell 14 of the Quirke Waste Management Area at Rio Algom's Quirke Mine, near Elliot Lake, Ontario, Canada. Shallow zones (2, Fe and Mn indicate that the tailings deposits in these areas are sub-oxic below tailings depths of ∼3 cm. These zones exhibit minor remobilization of Ra in the upper 5 cm of the tailings deposit; 226Ra fluxes at these sites are relatively small, and contribute negligibly to the water column activity of 226Ra. The shallow areas also exhibit minor remobilization of Ni, As, Mo and U. The release of these elements to the water cover is, however, limited by scavenging mechanisms in the interfacial oxic horizons. The presence of thick vegetation (Chara sp.) in the deeper areas (>2 m water depth) fosters stagnant bottom waters and permits the development of anoxia above the benthic boundary. These anoxic tailings are characterized by substantial remobilization of 226Ra, resulting in a relatively large flux of 226Ra from the tailings to the water column. The strong correlation between the porewater profiles of 226Ra and Ba (r2=0.99), as well as solubility calculations, indicate that the mobility of Ra is controlled by saturation with respect to a poorly ordered and/or impure barite phase [(Ra,Ba)SO4]. In the anoxic zones, severe undersaturation with respect to barite is sustained by microbial SO4 reduction. Flux calculations suggest that the increase in 226Ra activity in the water cover since 1995 (from -1) can be attributed to an increase in the spatial distribution of anoxic bottom waters caused by increased density of benthic flora. The anoxic, vegetated areas also exhibit minor remobilization with respect to dissolved As, Ni and Zn. The removal of trace metals in the anoxic bottom waters appears to be limited

  15. 226Ra lovels in surface and drinking waters in selected localities in Slovakia

    Samples were taken in the West Slovakia region from local water mains, wells and artesian wells. 226Ra was determined from samples immediately following separation from water by coprecipitation with lead sulphate and barium sulphate. From each sample two parallel separations were made with non-active carriers and one with an internal 226Ra standard. The volume activities of the samples were found to be relatively low, 73% within the range of 0 to 10 mBq/l. Activity in samples taken from artesian wells was 30 to 35 mBq/l. (M.D.)

  16. Quantification of {sup 235} U and {sup 226} Ra in soil samples by means of Gamma spectroscopy; Cuantificacion de {sup 235} U y {sup 226} Ra en muestras de suelo por medio de espectrometria gamma

    Quintero P, E.; Rojas M, V.P.; Montes M, F.R.; Gaso P, M.I.; Cervantes N, M.L. [Gerencia de Innovacion Tecnologica, A.P. 18-1027, C.P. 11801 Mexico D.F. (Mexico)

    2000-07-01

    In this work it is presented the Gamma Spectroscopy method which is realized in the Environmental Radiological Surveillance Laboratory using the option of deconvolution of a commercial software for the quantification of {sup 235} U and {sup 226} Ra; also is presented the method for the {sup 226} Ra correction activity. (Author)

  17. Behavior of 226Ra in the aquatic environment of the uranium mine region of Pocos de Caldas, MG, Brazil

    A sampling and analytical program for 238U, 226Ra and 210Pb was started, at first, in the uranium mine region, at Pocos de Caldas, MG, Brazil. Afterwards, the interaction was studied between 226Ra and local river sediments and waters. Peliminary studies were also done on the mobility of 226Ra retained on solid matter or soil, induced by local waters. Above normal concentrations of 238U, 226Ra and 210Pb were found in local waters, sediments and plants collected on the imediate vicinity of the mine. 226Ra distribution coefficients are on the order of 103 for the different samples assayed. It was concluded that, in the future, 226Ra discharged into liquid environment should be only temporarily retained by sediments. Its transport by surface waters should be predominantly in the soluble form. 226Ra should become the critical radionuclide in terms of internal radiation dose on the local population, due to its ingestion with water. 226Ra retained on solid supports is mobilized by local waters and its solubilization is dependent on the volume of water passed through. (M.A.)

  18. 48 CFR 252.226-7001 - Utilization of Indian organizations, Indian-owned economic enterprises, and native Hawaiian small...

    2010-10-01

    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Utilization of Indian... Clauses 252.226-7001 Utilization of Indian organizations, Indian-owned economic enterprises, and native Hawaiian small business concerns. As prescribed in 226.104, use the following clause: Utilization of...

  19. Optical behaviour of XTE J1550-564 and XTE J1859+226 from outburst to quiescence

    Sanchez-Fernandez, C.; Castro-Tirado, A.J.; Gimenez, A.;

    2001-01-01

    We present here the optical light curves of the Soft X-ray Transients XTE J1550-564 and XTEJ1859+226 from outburst to quiescence.......We present here the optical light curves of the Soft X-ray Transients XTE J1550-564 and XTEJ1859+226 from outburst to quiescence....

  20. 29 CFR 779.226 - Exception for an independently owned retail or service establishment under certain franchise and...

    2010-07-01

    ... establishment under certain franchise and other arrangements. 779.226 Section 779.226 Labor Regulations Relating... OR SERVICES Employment to Which the Act May Apply; Enterprise Coverage Leased Departments, Franchise... establishment under certain franchise and other arrangements. While certain franchise and other arrangements...

  1. Quantitative laws governing the migration of magnesium, calcium, radium-226, thorium-228 in the link between soils and plants

    Concentrations of magnesium, calcium, radium 226 and thorium 228 in podsolized chernozem and medium-loamy soils and in agricultural plants (wheat, barley, peas, potatoes, beets, and carrots) were determined. Transition coefficients of magnesium, calcium and radium 226 from soils to plants were calculated

  2. Partitioning and redistribution of exogenous Ra226 in farm soils from the vicinity of the First Brazilian Mine and Mill

    A sequential selective extration method was employed to assess the partitioning and redistribution of exogenous 226Ra into geochemical fractions of farm soils collected around the first Brazilian Uranium Mine and Mill. Six soil samples were contaminated in the laboratory by 226a solution, simulating an irrigation procedure. After selective extractions, 226Ra was analysed in six geochemical fractions: soluble (A); exchangeable (E); bound to carbonates (C); reducible (R); oxidizable (O); residual or matricial (M). The same method was also used in these soils before and after cultivation. The exogenous 226Ra was mainly associated to the (R) and (O) fractions followed by the (E) and (C) ones. Exchangeable 226Ra (fractions (A) + (E)) represents 21.8%. Statistically significant differences before and after cultivation were obtained only in the fractions (C) and (M). (Author)

  3. A fast and simple method for the determination of radium-226 in aqueous samples (drinking water, mineral water)

    A method is described which allows direct determination of the radium-226 content in aqueous samples within a few hours. An exchanger for specific ions on a PAC basis is used in a special application. The evaluation is based on the measurement of the 4.78 MeV α-particles of radium-226. The method is described, and its application to over 200 samples of drinking water and mineral water in the Federal Republic of Germany is reported. The average radium-226 concentration in drinking water from the Saarland is appr. 0.12 pCi of radium-226 per litre, and appr. 1.8 pCiof radium-226 per litre in mineral water from German mineral springs. (orig.)

  4. 226Ra concentrations in crayfish tissues, water, and sediments from the Serpent River Basin in Northeastern Ontario, Canada

    Lower Serpent River, as well as Elliot, McCarthy and McCabe lakes had highest 226Ra contamination, Chrisman, Quirke and Whiskey lakes a moderate one, Flack and Semiwhite lakes and the 'distant' control, Lake Wanapitei, the lowest. 226Ra activity in Cambarus robustus tissues was directly related to their background levels. Thus, concentration coefficient (tissue/sediment concentrations) for 226Ra ranged from 0.53 to 0.74 in highly contaminated Elliot and McCarthy lakes, 0.28 to 0.59 in moderately contaminated Quirke and Whiskey lakes, and from 0.27 to 3.44 in least contaminated Semiwhite and Flack lakes. Among various organs analysed, exoskeleton showed the highest (43.04 - 90.69%) and the tail muscles the lowest (2.95 -17.14%) 226Ra activity. 226Ra concentrations in the alimentary canal were considered a part of the ambient environment as they had not been absorbed

  5. Comparative observations on intersitial treatment of lower lip carcinoma with radium226 and iridium192

    Three methods of interstitial radiotherapy of lower lip carcinoma were compared. The material included 155 patients treated with radium by the method of vertical application of Ra226 needles, 445 patients with treatment by the method of transverse application of Ra226 needles and 35 patients treated by the after-loading with iridium192. As comparative criteria the authors accepted: the frequency of recurrences, the duration of radiation-induced reaction, the frequency of necrosis and the cosmetic effect after treatment. In Ra226 treatment after vertical application recurrences developed in 6 out of 155 patients (4%), after translowing iridium192 application no recurrences of neoplasm were observed in any out of 35 cases. Immediate post-radiation reactions lasted on the average 5.8; 6.4; and 7.7 weeks with these 3 methods respectively. Necrosis developed in 6 out of 155 cases (4%) after vertical application, in 23 out of 445 cases (5.2%) after transverse application and in 4 out of 35 cases (11%) after iridium192 application. The best cosmetic effects were obtained with iridium192 with 34.6% of very good results, 65.4% of good results and 0% of scars. The method of interstitial treatment with iridium192 by the after-loading technique provides a better protection of personnel against irradiation as compared with other methods of radium226 treatment. (author)

  6. A new two-phase media method for 226Ra activity measurement in water

    A new two-phase media method was developed for determination of 226Ra activity in water. The method was calibrated by applying 7 standard 226Ra waters with known activities. The method detects alphas in two media; 80 ml of water in a glass bottle with air or a non-polar liquid such as olive oil on top of the water. Alpha particles from 226Ra, 222Rn and progeny were detected by two polycarbonate track detectors (PCTDs) which were mounted on a holder inserted in the bottle so that one PCTD is placed in water and the other in air or in the non-polar liquid. The bottles were hermetically sealed and kept for 40 or 48 d. The PCTDs in the bottles shaken every other day enhanced the sensitivity of the measurements. The Calibration Factors for the standard 226Ra waters, air and olive oil above water are, respectively, (7.85 ± 0.25) x 10-3, (7.94 ± 0.13) x 10-3 and 3.02 x 10-2 tracks.cm-2 kBq-1 h-1 m3. (authors)

  7. Assessment of {sup 226}Ra age-dependent dose from water intake

    Porntepkasemsan, Boonsom [Research and Development Group, Thailand Institute of Nuclear Technology, Vibhavadi Rangsit Road, Bangkok 10900 (Thailand)], E-mail: boonsom@oaep.go.th; Srisuksawad, Kanitha [Research and Development Group, Thailand Institute of Nuclear Technology, Vibhavadi Rangsit Road, Bangkok 10900 (Thailand)

    2008-11-15

    The radioactivity in canal and ground waters collected in a 2-year long observation from the vicinity of the Rare Earth Research and Development Center (RRDC), Phathumthani Province, Thailand, was measured in order to determine the concentration of {sup 226}Ra and to estimate the age-dependent effective dose to humans due to consumption. {sup 226}Ra activities in both canal and ground waters were well below the WHO guidance level for drinking water quality of 1 Bq L{sup -1}. The highest {sup 226}Ra effective doses per year were found for infants and teens. However, the observed levels of calculated {sup 226}Ra effective doses for all age groups in both canal and ground waters show satisfactory low values (less than 15 {mu}Sv yr{sup -1}). These values are acceptable in accordance with the WHO recommended reference dose level of 100 {mu}Sv yr{sup -1} from water intake of 2 L day{sup -1}.

  8. 30 CFR 250.226 - What Coastal Zone Management Act (CZMA) information must accompany the EP?

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What Coastal Zone Management Act (CZMA... and Information Contents of Exploration Plans (ep) § 250.226 What Coastal Zone Management Act (CZMA...)(3)(B)) and 15 CFR 930.76(d) stating that the proposed exploration activities described in detail...

  9. Intake of 226Ra, 210Pb and 210Po with food in Poland

    Intake with food and water of 226Ra, 210Pb and 210Po was determined for an adult population in regions of central, northern and northeastern Poland. The content of radionuclides was determined in the daily diet and, in the central region, also in foodstuffs and drinking water. The annual intake with foodstuffs was estimated on the basis of their average annual consumption. The 226Ra intake in northeastern Poland was approximately 17% higher than the overall average, correlating well with the higher concentration of this radionuclide in the soil. The 210Po/210Pb ratio was close to unity in the continental regions, whereas at the Baltic Sea coast it was approximately 1.5. The latter value can be ascribed to a larger consumption of fish for which the 210Po/210Pb ratio was found to be approximately 10. In central Poland the largest intake of 226Ra was with flour and vegetables (contribution approx. 60%), the largest intake of 210Pb was with flour and meat (approx. 50%) and the largest intake of 210Po was with fish (approx. 34%). From the intake and dose coefficient, annual effective doses were calculated. The dose from 210Pb and 210Po was approx. 54 μSv year-1, and the dose from 226Ra was approx. 4 μSv year-1

  10. 226Ra, 210Pb and 210Po in food and in population in Poland

    Content of 226Ra, 210Pb and 210Po was determined in daily diet, foodstuffs and drinking water in various regions in Poland. The annual intake of the radionuclides with foodstuffs for an adult population was estimated on the basis of the average annual consumption. The 226Ra intake was in all the places similar; variations between the samples from a locality were bigger than the differences between various localities. Slightly higher 226Ra intake was observed in Suwalki, evidently being associated with the higher concentration of this radionuclide in the soil. The average 210Po/210Pb ratios was below and close to unity in the daily diet of continental regions, whereas at the Baltic Sea coast it was about 1.5. The latter value can be ascribed to a larger consumption of fish for which the 210Po/210Pb ratio was close to 10. The calculated body burden for an adult man was 1.6 Bq for 226Ra, 6.8 Bq for210Pb and 6.8 Bq for 210Po. (author)

  11. Selective 226Ra2+ Ionophores Provided by Self-Assembly of Guanosine and Isoguanosine Derivatives

    Leeuwen, van Fijs W.B.; Verboom, Willem; Shi, Xiaodong; Davis, Jeffery T.; Reinhoudt, David N.

    2004-01-01

    The self-assembled guanosine (G 1)-based hexadecamers and isoguanosine (isoG 2)-based decamers are excellent 226Ra2+ selective ionophores even in the presence of excess alkali (Na+, K+, Rb+, and Cs+) and alkaline earth (Mg2+, Ca2+, Sr2+, and Ba2+) cations over the pH range 3-11. G 1 requires additio

  12. RADIU-226 CONTENT IN SOIL OF THE HIGH NATURAL BACKGROUND RADIATION AREA OF RAMSAR (IRAN

    B.Khademi

    1978-11-01

    Full Text Available The existence of a high natural radiation area in the northern part of Iran (Ramsar is proved. Ra 226 in soil is measured. The results are: minimum 23.5 pCi/g and maximum 999 pCi/g soil. Environmental radioactivity is from 0.1 to 5 mr/h.

  13. 226Ra and 228Ra in consumable marine organisms from different coastal regions of India

    Marine organism samples were collected from different collection centers of eastern and western coastal regions of India. Edible and non edible portions of the organisms were separated. The edible portions were freeze dried, ground, homogenized and filled in air tight plastic boxes and kept for one month to achieve equilibrium between Radium and it daughter products. Later the samples were gamma counted using 50% HPGe and 226Ra and 228Ra activity concentration in the samples were calculated. 226Ra activity was found to be in the range of 0.001 to 0.69 Bq.kg-1 (wet) and 228Ra in the range of 0.001 to 2.5 Bq.kg-1 (wet). 228Ra concentration was observed to be more than 226Ra concentration in the organisms. To follow the impact of this activity to human, dose due to ingestion by consuming the organisms was calculated and was observed as the maximum dose due to 226Ra as 1.93X10-1 μSvy-1 and 1.73 μSvy-1 due to 228Ra. (author)

  14. RA-226 concentration in water samples near uranium mines and in marine fishes

    Radium-226 and calcium were measured in water samples from the vicinity of three uranium mines and in fish samples collected from Puget sound, Washington State. The radium content of the samples were below the maximum permissible concentration 3 pCi/L for drinking water recommended by the Public Health Service and U.S. Environmental Protection Agency. The mean value of Ra-226 in water was 0.428 pCi/L and ranged from 0.043 to 1.552 pCi/L, whereas calcium content ranged from 3.0 to 190.0 mg/L. Ra-226 concentrations and calcium content in whole fish were 0.833-20.328 pCi/kg wet wt. and 114.1-259.3 mg/g ash, respectively. Results of the study indicated that Ra-226 concentration in water was correlated with calcium concentration but that this correlation was not observed in fish sample except English sole

  15. 48 CFR 52.226-1 - Utilization of Indian Organizations and Indian-Owned Economic Enterprises.

    2010-10-01

    ... 48 Federal Acquisition Regulations System 2 2010-10-01 2010-10-01 false Utilization of Indian... CLAUSES Text of Provisions and Clauses 52.226-1 Utilization of Indian Organizations and Indian-Owned Economic Enterprises. As prescribed in 26.104, insert the following clause: Utilization of...

  16. 48 CFR 952.226-71 - Utilization of Energy Policy Act target entities.

    2010-10-01

    ... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Utilization of Energy... Clauses 952.226-71 Utilization of Energy Policy Act target entities. As prescribed in 926.7007(b), insert the following clause: Utilization of Energy Policy Act Target Entities (JUN 1996) (a)...

  17. Anticancer mechanisms of YC-1 in human lung cancer cell line, NCI-H226.

    Chen, Chun-Jen; Hsu, Mei-Hua; Huang, Li-Jiau; Yamori, Takao; Chung, Jing-Gung; Lee, Fang-Yu; Teng, Che-Ming; Kuo, Sheng-Chu

    2008-01-15

    As part of a continuing search for potential anticancer drug candidates, 1-benzyl-3-(5-hydroxymethyl-2-furyl)indazole (YC-1) was evaluated in the Japanese Cancer Institute's (JCI) in vitro disease-oriented anticancer screen. The results indicated that YC-1 showed impressive selective toxicity against the NCI-H226 cell line. Therefore, the molecular mechanism by which YC-1 affects NCI-H226 cell growth was studied. YC-1 inhibited NCI-H226 cell growth in a time- and a concentration-dependent manner. YC-1 suppressed the protein levels of cyclin D1, CDK2 and cdc25A, up-regulated p16, p21 and p53, increased the number of NCI-H226 cells in the G0/G1 phase of the cell cycle. Long exposure to YC-1 induced apoptosis by mitochondrial-dependent pathway. In addition, YC-1 inhibited MMP-2 and MMP-9 protein activities to abolish tumor cells metastasis. These findings suggest a mechanism of cytotoxic action of YC-1 and indicate that YC-1 may be a promising chemotherapy agent against lung cancer. PMID:17880926

  18. Energy levels and reduced probabilities of electric dipole, quadrupole and octupole transitions of 226Ra

    The energy levels and reduced probabilities of electric dipole, quadrupole and octupole transitions measured in the Coulomb excitation of 226Ra are analyzed in the framework of the soft axial-symmetric rotator model with quadrupole and octupole deformations. The calculated values are in good agreement with experimental data. (author). 11 refs., 2 figs

  19. Intake of {sup 226}Ra, {sup 210}Pb and {sup 210}Po with food in Poland

    Pietrzak-Flis, Z.; Chrzanowski, E.; Dembinska, S. [Department of Radiation Hygiene, Central Laboratory for Radiological Protection, Warsaw (Poland)

    1997-09-06

    Intake with food and water of {sup 226}Ra, {sup 210}Pb and {sup 210}Po was determined for an adult population in regions of central, northern and northeastern Poland. The content of radionuclides was determined in the daily diet and, in the central region, also in foodstuffs and drinking water. The annual intake with foodstuffs was estimated on the basis of their average annual consumption. The {sup 226}Ra intake in northeastern Poland was approximately 17% higher than the overall average, correlating well with the higher concentration of this radionuclide in the soil. The {sup 210}Po/{sup 210}Pb ratio was close to unity in the continental regions, whereas at the Baltic Sea coast it was approximately 1.5. The latter value can be ascribed to a larger consumption of fish for which the {sup 210}Po/{sup 210}Pb ratio was found to be approximately 10. In central Poland the largest intake of {sup 226}Ra was with flour and vegetables (contribution approx. 60%), the largest intake of {sup 210}Pb was with flour and meat (approx. 50%) and the largest intake of {sup 210}Po was with fish (approx. 34%). From the intake and dose coefficient, annual effective doses were calculated. The dose from {sup 210}Pb and {sup 210}Po was approx. 54 {mu}Sv year{sup -1}, and the dose from {sup 226}Ra was approx. 4 {mu}Sv year{sup -1}.

  20. 25 CFR 226.30 - Lessees subject to Superintendent's orders; books and records open to inspection.

    2010-04-01

    ... 25 Indians 1 2010-04-01 2010-04-01 false Lessees subject to Superintendent's orders; books and... Lessees § 226.30 Lessees subject to Superintendent's orders; books and records open to inspection. Lessee.... Lessee's books and records shall be available to the Superintendent for inspection....

  1. 226Ra translocation from soil to selected vegetation in the Crucea (Romania) uranium mining area

    Popa, K.; Tykva, Richard; Podracká, Eva; Humelnicu, D.

    2008-01-01

    Roč. 278, č. 1 (2008), s. 211-213. ISSN 0236-5731 Grant ostatní: MEdC-ANCS(RO) CNCSIS160/2007 Institutional research plan: CEZ:AV0Z40550506 Keywords : translocation 226Ra * soil * vegetation * mining area Subject RIV: DK - Soil Contamination ; De-contamination incl. Pesticides Impact factor: 0.659, year: 2008

  2. 48 CFR 952.226-73 - Energy Policy Act target group certification.

    2010-10-01

    ....226-73 Energy Policy Act target group certification. As prescribed in 926.7007(d), insert the following provision: Energy Policy Act Target Group Certification (SEP 1997) (a) Certification. The offeror is: (1) __ An institution of higher education that meets the requirements of 34 CFR 600.4(a), and...

  3. Determination of ''226Ra by Alpha Spectrometry by Using ''225Ra as Yield Tracer

    A method for the determination of low-level ''226 Ra in environmental and geological samples by alpha spectrometry is described. The method is based on the use of ''225 Ra from ''229 Th as yield tracer and has been developed to analyze U, Th and Ra in the same sample. (Author) 12 refs

  4. The 226 Ra, 210 Pb and essential elements bioavailability to pines at Urgeirica uranium mill tailings

    The objective of this study is to correlate the uptake of the natural radionuclides 226Ra and 210Pb with the essential elements, potassium, calcium and magnesium in the pines growing at the 'Urgeirica uranium mill tailings. It can be concluded that the potassium, calcium and magnesium mean concentration ratio values are, about two to three orders of magnitude, higher than the values obtained to 226Ra and 210Pb for pines growing on the Urgeirica uranium mill tailings. The concentration ratio values higher than 1 obtained to the potassium, calcium and magnesium elements indicate that pines are behaving as accumulators to these elements. Contrarily, the 226Ra and 210Pb concentration ratio values lower than 1 indicates that pines are behaving as excluders to these radionuclides. So, it can be concluded that this kind of plants is not suitable to a phyto remediation strategy. In general, a marginally significant correlation was observed between the potassium, calcium and magnesium concentrations, the cation-exchange capacity and the ph in the tailings and the 226Ra and 210Pb pines/tailings concentration ratios. (N.C.)

  5. 7 CFR 226.13 - Food service payments to sponsoring organizations for day care homes.

    2010-01-01

    ... CARE FOOD PROGRAM Payment Provisions § 226.13 Food service payments to sponsoring organizations for day... amount of food service payments shall be disbursed to each day care home on the basis of the number of meals served, by type, to enrolled children. For tier II day care homes, the full amount of food...

  6. 12 CFR Appendix M1 to Part 226 - Generic Repayment Estimates

    2010-01-01

    ... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Generic Repayment Estimates M1 Appendix M1 to... Estimates Effective Date Note: At 74 FR 5441, Jan. 29, 2009, appendix M1 to part 226 was added, effective July 1, 2010. (a) Calculating generic repayment estimates. (1) Definitions. (i) “Retail credit...

  7. Radium 226 and lead 210 water extraction from mill tailings samples

    Depositories for waste from the processing of uranium ore may release seepage waters into the environment through their impoundments. Seepage waters, when percolating through the wastes, extract radium 226. In the design or rehabilitation stage of such depositories, the exposure of critical groups of the population to radium 226 from the ground water pathway must be assessed. The same applies to lead 210. The first step is to assess the possibility of extracting the radium 226 and the lead 210 from samples of solid wastes and sludges in laboratory tests using water from the site. Extensive tests of this type were carried out in our laboratories between 1982 and 1991 on samples of mill tailings which had been collected in six installations of COGEMA and its subsidiaries. The main results are presented and analyzed. Physical, chemical and mineralogical factors influencing the leaching rates and the total quantity of water-extractable radium 226 are identified. In the case of a wet storage option, a tentative modelling of the water extraction phenomenon is proposed for the prediction of the source term both in the short term, and in the long term when all more or less soluble salts have been eliminated from the solid wastes

  8. 48 CFR 52.226-2 - Historically Black College or University and Minority Institution Representation.

    2010-10-01

    ... CONTRACT CLAUSES Text of Provisions and Clauses 52.226-2 Historically Black College or University and... Black College or University and Minority Institution Representation (OCT 2008) (a) Definitions. As used in this provision— Historically black college or university means an institution determined by...

  9. Radium-226 content and emanating power of some timepieces manufactured in the years 1926--1951

    Thirty-two radium-dial timepieces manufactured in the years 1926 to 1951 by a company in Connecticut were individually sealed in small steel cans for determination of radium-C (214Bi) activity by γ-ray spectroscopy. Each can was counted within a few hours after sealing and again 5 or 6 days later; from the two observations, radium-C activities at time of sealing (nonemanating radium content) and at equilibrium (total radium content) were calculated. The mean radium-226 content of 22 pocket watches was 348 nCi (range, 159 to 606), and the mean emanating power (1-nonemanating Ra/total Ra) was 0.175 (range, 0.09 to 0.33). The mean radium-226 content of 9 wrist watches was 150 nCi (range, 54 to 449), and the mean emanating power was 0.242 (range, 0.12 to 0.34). The radium-226 content of the one small clock was 633 nCi, and its emanating power was 0.15. The concentration of radon-222 in the air of a sealed room of dimensions 3 x 3 x 3 m would be increased by about 3 pCi/l if a watch containing 400 nCi of radium-226 with an emanating power of 0.2 were left in the room for a few weeks. (U.S.)

  10. Bioaccumulation of 226Ra in the plants growing near uranium facilities

    Tykva, Richard; Podracká, Eva

    Warsaw : Warsaw University, 2005. s. 13. [Conference: Mechanism of radionuclides and heavy metals bioaccumulation and their relevance for biomonitoring . 07.10.2005-08.10.2005, Warsaw] Institutional research plan: CEZ:AV0Z40550506 Keywords : bioaccumulation * 226Ra in soil * uranium facilities Subject RIV: DL - Nuclear Waste, Radioactive Pollution ; Quality

  11. Protein Profile of Human Lung Squamous Carcinoma Cell Line NCI-H226

    HAO ZHANG; NA LI; YUE CHEN; LING-YUN HUANG; YI-CHING WANG; GANG FANG; DA-CHENG HE; XUE-YUAN XIAO

    2007-01-01

    Objective To construct a database of human lung squamous carcinoma cell line NCI-H226 and to facilitate discovery of novel subtypes markers of lung cancer. Method Proteomic technique was used to analyze human lung squamous carcinoma cell line NCI-H226. The proteins of the NCI-H226 cells were separated by two-dimensional gel electrophoresis and identified by mass spectrometry. Results The results showed that a good reproducibility of the 2-D gel pattern was attained. The position deviation of matched spots among three 2-D gels was 1.95±0.53 mm in the isoelectric focusing direction,and 1.73±0.45 mm in the sodium dodecyl sulfate-polyacrylamide gel electrophoresis direction. One hundred and twenty-seven proteins, including enzymes, signal transduction proteins, structure proteins, transport proteins, etc. were characterized, of which, 29 identified proteins in NCI-H226 cells were reported for the first time to be involved in lung cancer carcinogenesis.Conclusion The information obtained from this study could provide some valuable clues for further study on the carcinogenetic mechanism of different types of lung cancer, and may help us to discover some potential subtype-specific biomarkers of lung cancer.

  12. 27 CFR 28.226 - Removals of beer by agent on behalf of brewer.

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Removals of beer by agent... TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS EXPORTATION OF ALCOHOL Exportation of Beer With Benefit of Drawback Execution of Claims § 28.226 Removals of beer by agent on behalf of...

  13. Ra-226 concentrations in the hydrographic basins near uranium mining and milling in Brazil

    A monitoring survey of the 226Ra concentrations in river waters in the vicinity of the mining area and future milling facilities in the Pocos de Caldas region began in January 1977. The objective of the monitoring survey is to establish a baseline to allow future comparisons between the 226Ra concentrations in waters of the hydrographic basins of the Pocos de Caldas plateau before and after the beginning of full scale commercial operations. Open pit mining started in July 1977 in the uranium deposits of Campo do Cercado, but the main uranium body has not been reached yet. Seasonal variations in riverflow are apparently accompanied by little variations in the 226Ra concentrations in river waters. A crude calculational dosimetric model is in the process of being developed to estimate annual dose equivalent to an individual from 226Ra via drinking water and irrigation patterns as a first step to calculate the collective dose equivalent commitment to the population of the Pocos de Caldas plateau and surroundings

  14. Radium-226 and calcium uptake by crops grown in mixtures of sand and cay tailings from phosphate mining

    Radium-226 is a naturally occurring radionuclide found in reclaimed clay and sand tailing from phosphate mining. Field studies were conducted to investigate the effects of sand/clay ratio (SCR), Ca supplement and organic amendments on the 226Ra concentration in turnip, banana pepper, cabbage, yellow squash, mustard, and alfalfa. For vegetables, treatment effects included SCR (2:1, 4:1, 6:1, and 8:1), phosphogypsum (PG) 0,22, and 134 Mg ha-1, and peat 0,100, and 200 Mg ha-1. For alfalfa grown in a 1:1 SCR mixture, treatments included organic amendments (control, peat, sewage slude, sawdust, composted sewage sludge, composted garbage and humate) applied at 44.8 Mg ha-1 (2.2 Mg ha-1 for humate). Plant 226Ra concentration tended to be higher in the 4:1 than in the 2:1 SCR mix but this depended on the crop an d the season. Organic amendments and PG had no effect (p226Ra concentration in vegetables and alfalfa. Mean 226Ra concentration in plant tissues ranged from 3.4 Bq kg-1 in banana pepper fruit to 31.1 Bq kg-1. A quadratic relationship based on 631 observations was observed between 226Ra and Ca concentration in plant tissues. The 226Ra/Ca ratio in plant tissues ranged from 0.85 to 2.13 kBq 226Ra kg-1 Ca and decreased with increasing plant 226Ra. Results indicated that wide differences in plant 226Ca concentration were related more to differences in plant Ca levels than to soil factors. 21 refs., 1 fig., 6 tabs

  15. 226Ra and 210Pb relationship in solid wastes and plants at Uranium mill tailing

    After the uranium extraction from the ore, the waste residues (tailings) contain several radionuclides in elevated levels comparing to normal soils. Nearly all of the uranium progenies (230Th, 226Ra, 210Pb and 210Po) and the unextracted uranium fraction are present in tailings. These large quantities of tailings may provide a significant source of environmental and food chain contamination. The transfer of radioisotopes between different ecological compartments is frequently evaluated using ratios which relate the radionuclide content in one ecosystem compartment to that of another. For instance, the concentration ratio (CR), i.e., the ratio between radionuclide concentrations in tailings and plants can be evaluated. Radium-226, a long-lived alfa emitter, is a chemical analog of calcium. The 226Ra uptake is similar to calcium in biological and ecological systems. The uptake of 210Pb will follow the same pattern as natural lead. Plants do not require lead but in contrast they require the Ra/Ca group elements. The uptake of lead is mainly a function of the lead tolerance of the plant and the hydrogen ion concentration of the soil. Kalin and Sharma (1982) reported that 226Ra and 210Pb uptake by indigenous species from inactive uranium mill tailings in Canada differ from the uptake of the elements by the same plants growing in soil. Ibrahim and Whicker (1992) reported that tailing acidity tends to enhance radionuclide availability for plant uptake. The transport of radionuclides to foliage and subsequent retention and absorption may play a role in plant contamination. The main goal of this study is to evaluate the 226Ra and 210Pb relationship in tailings and plants growing at uranium mill tailings

  16. Critical reappraisal of the A226V mutation in Chikungunya outbreaks: possible role in increased pathogenesis?

    Licia Bordi

    2009-12-01

    Full Text Available CHIKV is a mosquito-transmitted alphavirus responsible for the first autochthonous Italian outbreak in 2007.We previously analyzed 7 CHIKV isolates (5 imported and 2 autochthonous with respect to the presence of A226V mutation in E1gp. All the isolates showed this mutation except the one imported from India in 2006. Since this mutation has been associated with enhanced replication and fitness in A. albopictus vector, we investigated the possible involvement of A226V mutation in enhanced infection capability in primate cells. To this aim,Vero E6 and C6/36 cells were infected with two CHIKV isolates, one carrying the A226V mutation and one wild type, using single replication cycle conditions. Progeny virus was measured by both quantitative real time RT-PCR and viral infectivity assay. No significant differences were observed between the two isolates either in terms of replication kinetic or in virus yield, on both Vero E6 and C6/36 cells. Moreover, experiment of inhibition of virus replication were performed for both isolates on Vero E6 cells using increasing amounts of recombinant IFN-alpha and virus yield was measured. A dose-dependent inhibition of virus yield for both CHIK isolates was observed, with a different sensitivity to IFN-alpha between the isolate carrying the A226V mutation and the wild type one. Our results suggest i that A226V mutation does not influence replication ability in both host species, when using single replication cycle conditions; ii the differences between wild type and mutated strains may be due to different sensitivity and/or activation ability of innate immune mechanisms.

  17. Uptake and kinetics of 226Ra, 210Pb and 210Po in big sage brush

    Root uptake of 226Pb and 210Po by mature sage brush was studied using a soil injection method for spiking the soil with minimal root disturbance. The main objective was to measure vegetation concentrations and determine concentration ratios (CR's) due to root uptake as a function of time in mature big sage brush. Concentration ratios obtained in mature vegetation and in steady-state situations may be valuable in assessing the impact of uranium mining and milling. The vegetation was sampled approximately every 3 mo for A 2 y period. Significant levels of activity were detected in the vegetation beginning at the first sampling (81 d after soil injection for 226Ra, 28 d for 210Pb and 210Po). There was an exponential decrease in concentration to an apparent steady state value. Mean values (geometric) of the data pooled over the second year period indicated that steady-state Cr's for 226Ra, 210Pb and 210Po, as determined in mature sage brush, were 0.04, 0.009, and 0.08, respectively. Investigations were also carried out to verify the suitability of soil injection for uptake studies and to evaluate the time dependence of 226Ra leaching from sage brush leaves. The soil injection method was determined to produce, on the average, uptake equivalent to that produce by a uniform soil distribution, however, the variety of uptake for plants growing in injected soil was higher than for plants growing in uniformly contaminated soil. A three compartment mathematical model was formulated to help understand mechanisms of plant uptake and to predict, if possible, the concentration of 226Ra, 210Po in vegetation as a function of time after soil spiking

  18. Rapid estimation of /sup 226/Ra in soil for the Grand Junction RASA/UMTRA project

    Kark, J.B.; Borak, T.B.; Kearney, P.D.; Rood, A.S.

    1986-01-01

    The Radiological Survey Activities (RASA) Group of the Health and Safety Research Division at Oak Ridge National Laboratory (ORNL) is an Inclusion Survey Contractor (ISC) for the Uranium Mill Tailings Remedial Action Program (UMTRAP). The purpose of the ISC is to survey designated sites potentially contaminated with radioactive material originating from the 24 inactive uranium mill sites and make recommendations as to whether the site should be included in or excluded from further consideration by UMTRAP. An important aspect of the program is a prompt and inexpensive estimation of Radium-226 (/sup 226/Ra) concentration in soil samples. A large sodium iodide (NaI) well crystal coupled to a multichannel analyzer is used to count soil samples. Count data are currently analyzed with an algorithm that utilizes three regions of interest (ROI). A lack of agreement was observed when samples were also analyzed with lithium-drifted germanium (GeLi) spectrometers. The average estimate of /sup 226/Ra obtained using the current algorithm was 19% greater than the GeLi determination. Some possible reasons for these differences were examined. In 8.5% of the samples, the relative concentration of Cesium-137 (/sup 137/Cs) was highly correlated to the extent of error. Using alternative analysis techniques, the error for /sup 226/Ra estimations may be reduced by a factor of 2 for randomly selected samples and by a factor of 4 for samples containing high concentrations of /sup 137/Cs relative to the concentrations of /sup 226/Ra. 9 refs., 4 figs., 3 tabs.

  19. Volume activity 226Ra mine waters of Ostrava-Karvina coal mines

    The State Office for Nuclear Safety, Regional Center Kamenna administers, within the framework of supervision, an inspection on workplaces of mines and discharge radionuclides into the environment from mines of Ostrava-Karvina coal mines. Join-stock company OKD exploit coal in next mines Paskov, Darkov, Lazy and CSA. Join -stock company CMD exploit coal in mine CSM. In 2002 DIAMO, state enterprise took over a part of Ostrava-Karvina coal mines and its division ODRA pump mine waters on Water-pumping shaft Jeremenko, Water- pumping shaft Zofie and close Mine Barbora. A water samples were take on main outflow mine water of mine. The presentation summarizes results from monitoring mine waters from 1999 to 2004 years. Volume activity 226Ra mine waters of Mine Lazy-locality Dukla and Water-pumping shaft Zofie are higher then clearance level from Regulation No.307/2002 Coll. On Radiation Protection. They are comparable with mine waters of uranium mines. Volume activity 226Ra surface waters under outflow perform, without stream Petrvaldska struzka under outflow Water-pumping shaft Zofie, guidance level for contamination surface waters from Government regulation No.61/2003 Coll. Volume activity 226Ra surface waters under outflow coal mines are higher then volume in surface waters under uranium mines, because mine waters from uranium mines are decontaminate on decontamination stations. Considering that volume activities 226Ra surface water of Orlovska struzka stream are under guidance level for contamination surface waters from Government regulation No.61/2003 Coll.. don't urgency arrangement to decontamination mine waters. Mass activity 226Ra in bed sediment under outflow Mine Lazy-locality Dukla are comparable with exemption level from Regulation No.307 /2002 Coll. On Radiation Protection. (authors)

  20. Determination of 226Ra Concentration in the Drinking Water and Internal Dose estimation From Several Locations in Java and Sumatra

    Random samples or drinking water have been collected from 51 locations in Java (27 locations) and Sumatra (24 locations). lndonesia. The samples were counted for 17 hours and analyzed for 226Ra (609 keV and 352KeV) using gamma spectrometry with H P-Ge detector. The data were evaluated by the statistical method with 68% confidence level. The 226Ra concentrations in drinking water were within a range of undetectable to ( 177.6 + 3.1) mBq/l and the average concentration was (34.8 + 8.2) mBq/l. The data of 226Ra concentration in Sumatra area was about 10 times higher than 226Ra concentration in Java area, except 226Ra concentration at the hot spring water area. The maximum permissible concentration (4000 mBq/l). These data were comparatively lower than 226Ra concentration in drinking water generally observed in other countries (USA, India, Brazil and Japan). The annual internal dose of 226Ra for the public was also estimated

  1. Evaluation of the radius-226 doses incorporated with the consumption waters, which is receive by the City of Havana inhabitants

    Because of the relatively good solubility of radium compounds contained in the crust of the earths, frequently is this possible to find in spring waters concentration of radium 226 which may be significant. Taking in account that person consumer important volumes of waters annually, it is necessary to assess the dose to population due to the intake of radium 226 by this pathway. Samples were taking in the principal water sources in Havana City and for each samples the radium 226 concentration was determined

  2. 210Pb/226Ra disequilibria in otoliths of blue grenadier, (Macruronus novaezelandiae); problems associated with radiometric aging

    Otoliths from blue grenadier (Macruronus novaezelandiae), which had been aged previously by annuli analysis, were analysed for the naturally occurring radionuclides 210Pb and 226Ra in an attempt to independently verify their age. It is concluded that the radiometric technique could not be applied to determine age because the results showed that 226Ra was not incorporated at a constant rate throughout the life of M. novaezelandiae. Uptake of 226Ra was greater in juveniles than in adult fish. This was probably due to the juvenile phase inhabiting inshore/estuarine waters. 20 refs., 1 tab., 2 figs

  3. Effect of adsorbants on in vitro biohydrogenation of 22:6n-3 by mixed cultures of rumen microorganisms.

    Escobar, M; Vlaeminck, B; Jeyanathan, J; Thanh, L P; Shingfield, K J; Wallace, R J; Fievez, V

    2016-09-01

    Studies on microbial biohydrogenation of fatty acids in the rumen are of importance as this process lowers the availability of nutritionally beneficial unsaturated fatty acids for incorporation into meat and milk but also might result in the accumulation of biologically active intermediates. The impact was studied of adsorption of 22:6n-3 (DHA) to particulate material on its disappearance during 24 h in vitro batch incubations with rumen inoculum. Four adsorbants were used in two doses (1 and 5 mg/ml of mucin, gum arabic, bentonite or silicic acid). In addition, the distribution of 22:6n-3 in the pellet and supernatant of diluted rumen fluid was measured. Bentonite and silicic acid did not alter the distribution of 22:6n-3 between pellet and supernatant nor increased the disappearance of 22:6n-3 during the incubation. Both mucin and gum arabic increased the recovery of 22:6n-3 in the supernatant, indicating that these compounds lowered the adsorption of the fatty acid to ruminal particles. This was associated with an increased disappearance of 22:6n-3, when initial 22:6n-3 was 0.06 or 0.10 mg/ml, and an increased formation of 22:0, when initial 22:6n-3 was 0.02 mg/ml, during the 24 h batch culture experiment. Addition of gum arabic to pure cultures of Butyrivibrio fibrisolvens or Butyrivibrio proteoclasticus did not negate the inhibitory effect of 22:6n-3 on growth. As both mucin and gum arabic provide fermentable substrate for ruminal bacteria, an additional experiment was performed in which mucin and gum arabic were replaced by equal amounts of starch, cellulose or xylan. No differences in disappearance of 22:6n-3 were observed, suggesting that the stimulatory effect of mucin and gum arabic on disappearance of 22:6n-3 most probably is not due to provision of an alternative site of adsorption but related to stimulation of bacterial growth. A relatively high proportion of 22:6n-3 can be reduced to 22:0 provided the initial concentration is low. PMID:26965186

  4. Vegetation composition and 226Ra uptake by native plant species at a uranium mill tailings impoundment in South China

    A field investigation was conducted for the vegetation composition and 226Ra uptake by native plant species at a uranium mill tailings impoundment in South China. 80 species belonging to 67 genera in 32 families were recorded in the sampling sites. The Poaceae and Asteraceae were the dominant families colonizing the impoundment. The number of the plant species and vegetation community composition in the sampling sites seemed most closely related to the activities of 226Ra and the pH value of the uranium tailings. The plant species in the sampling sites with relatively low activities of 226Ra and relatively high pH value formed a relatively stable vegetation community. The plant species in the sampling sites with medium activities of 226Ra and medium pH value formed the transitional vegetation community. The plant species in the sampling sites with relatively high activities of 226Ra and relatively low pH value formed a simple unstable vegetation community that was similar to that on the unused grassland. The activities of 226Ra and transfer factors (TFs) varied greatly with the plant species. The high activities of 226Ra and TFs were found in the leaves of Pteris multifida (150.6 Bq/g of AW; 9.131), Pteridium aquilinum (122.2 Bq/g of AW; 7.409), and Dryopteris scottii (105.7 Bq/g of AW; 6.408). They satisfied the criteria for a hyperaccumulator for 226Ra. They may be the candidates for phytoremediation of 226Ra in the uranium mill tailings impoundment areas and the contaminated soils around. - Highlights: • Vegetation composition of native plant species at an impoundment was analyzed. • 226Ra uptake by native plant species at the impoundment was investigated. • Poaceae and Asteraceae were the dominated families colonizing this impoundment. • The plant species and composition were related to activities of 226Ra and pH. • Three plant species were found to be hyperaccumulators for 226Ra

  5. Transfer of some artificial (226Sr and 137Cs) and natural (40K and 226Ra) radionuclides from milk to its products

    Transfer of some artificial radionuclides ( 137 Cs and 85 Sr) and natural radionuclides (226 Ra and 40K) from milk (cheep and cows) to its products processed according to local manufacturing procedures (home made cheese, kashkawan cheese, shelal cheese, haloom cheese, kareshah cheese, sharkasiah cheese, liquid cheese, yogurt, butter and keshdah) has been studied. The results showed that the retention percent of radium 226 in milk products has reached %100 in the home made cheese and %72 for strontium 85 in the shelal cheese and %40 for cesium 137 in yogurt and %46 for potassium 40 also in yogurt. In addition, most of the retention percent ratios of the studied radionuclides in yogurt were relatively low (about %25 and % 40 in the yogurt processed from the milk of the cows and cheep respectively) with a high processing efficiency, so that making yogurt from the contaminated milk is the best way to reduce the contamination ratio and to make use of the contaminated milk. Furthermore, home made cheese was processed with salty solutions of different concentrations and the results showed that about %90 of cesium and potassium has transferred to the salty solution of %5 soaked for 48 hours, while %40 of the radium and %80 of strontium were removed from the contaminated cheese after 48 hours soaking in a salty solution of %2.5. However, the results of the present work can be used for processing of contaminated milk with artificial radionuclides in order to be utilized. (Authors)

  6. 226Ra, 232Th and 40K analysis in water samples from Assiut, Egypt

    The activity concentrations of 226Ra, 232Th and 40K were determined in water samples, using 2”x 2” NaI(Tl) scintillation detector. Water activity ranges from 0.07 to 0.59 Bq L−1 for 226Ra, 0.05 to 0.37 Bq L−1 for 232Th and 3.25 to 8.72 Bq L−1 for 40K with mean values of 2.64, 2.22 and 119.50 Bq L−1, respectively. As far as the measured gamma radionuclides is concerned, the mean annual effective doses for all analyzed samples of water are in the range of 0.02–0.08, 0.03-0.17 and 0.03-0.10 mSv yr-1 for infants, children and adults, respectively, all being lower than the reference level of the committed effective dose recommended by the WHO.

  7. Leachability of 226Ra from spiked soil as a function of time

    The bioavailability of 226Ra for plant uptake may be dependent on its solubility from the soil components. Solubility of radium from soil may change with time due to chemical and physical binding. A laboratory study was designed to provide data on the water leachable fraction of 226Ra from spiked soil as a function of time. A decreasing trend in the percent leachable fraction was observed over time. The data was modeled by non-linear regression to be a decreasing exponential to a constant value. This information may be helpful in providing an understanding of a similar trend observed in plant uptake studies. The value for the available amount of radium determined in this investigation may help to provide a more meaningful measurement of concentration ratios in plants. 22 references, 3 figures, 5 tables

  8. Investigation of 224Ra in the 226Ra (α,α'2n) reaction

    Positive and negative parity bands have been followed up to 10+ (possibly 12+) and 11- in 224Ra and are compared to the corresponding bands in the isotone 226Th. If a constant value of the intrinsic quadrupole moment is assumed for all E2 transitions in 224Ra the E1/E2 branching ratios are consistent with an intrinsic dipole moment of vertical strokeQ1vertical stroke=0.032(3) e.fm. This small value, as compared to vertical strokeQ1vertical stroke=0.30(2) e.fm for 226Th, can be explained by an almost complete cancellation of large positive liquid-drop and negative shell-model contributions. (orig.)

  9. 226Ra, 228Ra and 40K in scales from boilers of industrial installations

    The purpose of this work was to determine concentrations of 226Ra, 228Ra and 40K in scales generated inside industrial boilers. Radionuclide activities were determined by high resolution gamma-ray spectrometry. Activity concentrations of 226Ra were in the range of 3.0 (22) to 1300 (6) Bq kg-1 and 228Ra activity concentrations varied from /2.0 Bq kg-1 (Minimum detectable activity concentration) to 266 (3) Bq kg-1. Activity concentrations of 40K were in the range of /15 Bq kg-1 (Minimum detectable activity concentration) to 290 (5) Bq kg-1. Activity concentrations were lower than the limits established by the Brazilian Commission of Nuclear Energy. (author)

  10. Determination of radium-226 in different substances without prior chemical separation

    A method is developed for the determination of radium-226, based on the measurement of the amount of radium-222, extracted from the substance being analyzed. The limit of detection of radium, equal to 6.6 X 10-15 mass%, is achieved because of the use of a low-background proportional counter and a special vacuum facility for filling the detector with the working gas mixture

  11. Examination of express determination of 226Ra in buildings materials using gamma spectrometry

    In the article is presented the proposal of express method for evaluation of radium concentration in building material. The method is based on estimation function of time dependence of achievement of equilibrium radon daughter products radioactivity with the 226Ra. The obtained results from one selected sample of building material (porous concrete brick) show, that estimation of radium concentration on acceptable confidence level is possible obtain during some days. (authors)

  12. Normal dietary levels of radium-226, radium-228, lead-210, and polonium-210 for man

    A review of the literature and the results of some recent measurements on the levels in man's diet of the naturally occurring radionuclides 226Ra, 228Ra, 210Pb, and 210Po are presented. Intakes in other countries are similar to those in the United States, but in localized populations the 226Ra intake can be 8 or more pCi/day. The few data on 228Ra show that intake of this nuclide is about 80% that of 226Ra except in monazite areas where intakes of up to 160 pCi 228Ra/day are reported. Drinking water contributes less than 5% to daily intake except in special areas. For 210Pb, higher levels have been noted for Germany and the Union of Soviet Socialist Republics than for the United States. Persons in the Arctic who consume reindeer or caribou meat may ingest 210Pb at the rate of 10 to 40 pCi/day. Normal dietary levels of 210Po are about 20 to 30% higher than those of 210Pb, except in the Arctic. The levels of these nuclides in classes of foods are compared to show that the higher levels observed in certain diets are due to the levels in particular foods. Because of the high levels of 210Pb intake in Japan, total skeletal dose rates in that country are estimated to be more than twice those in the United States. The use of dietary intake for estimating metabolic parameters, such as intestinal absorption of 226Ra and 210Pb, is discussed

  13. Retention and distribution of 226Ra in beagles: a comparison between multiple and single injections

    Skeletal uptake, retention, and distribution of 226Ra were studied in 330 beagles administered eight semi-monthly i.v. injections of radium starting at 2, 4, and 14 months of age. Skeletal uptake, the ratio of body burden at 35 days post-injection (A35) to the total injected dose (A0) was 71.7 percent, 78.1 percent and 38.5 percent, for a dose of 10 μCi/kg body weight administered starting at 2, 4, and 14 months of age, respectively. Skeletal retention of radium 350 days post-injection (A350/A0) was 67.2 percent, 73.3 percent, and 27.7 percent. Comparison of 226Ra retention from single and multiple injections of radium shows that at dose level 6.064 μCi/kg the retention functions for periods 35 days after injection are identical; for dose level 10 μCi/kg, a larger retention is observed for multiple-injection groups. Comparison of 226Ra retention in man with that in beagles shows that within a period between 35 days and 6000 days post--injection, the body burden in dog decreases by about 6 times in contrast with 43 times in man. Regional distribution of 226Ra in bone matrix at proximal, midshaft, and distal humeri from 21 beagles shows the highest concentration of the radionuclide at proximal regions. Radium distribution on autoradiograms shows a uniform distribution in 4-month-old beagles in contrast to ''hot spots'' superimposed on a diffuse background for the 14-month age group. Radium in the latter group is located mostly on periosteum and endosteum surfaces

  14. Transfer of 226Ra, 85Sr and 137Cs from milk to milk products

    Transfer of 226Ra, 85Sr and 137Cs from cow and sheep milk to various Syrian dairy products has been evaluated. Dairy products include Kashkivan cheese, braided cheese, Haloom cheese, Sircassian cheese, liquid cheese, native cheese, cottage, thick yogurt, butter and milk cream. The results showed that the percentage of 226Ra, 85Sr and 137Cs transferred from cow milk to milk cream (Pt = food processing retention factor x processing efficiency x 100%) has reached 32%, 16% and 7%, respectively. Butter and liquid cheese were found to have the lowest percentage of transferred 226Ra, 85Sr and 137Cs. Most of the obtained Pt values of the studied radionuclides in thick yogurt were relatively low in spite of the high processing efficiencies of thick yogurt. Moreover, the transfer, Pt, of the studied radionuclides from cow milk to the prepared cheese was higher than those values determined for sheep milk. This is due to differences in chemical compositions of each type of milk. On the other hand, the treatment of Native cheese, most commonly consumed cheese in Syria, with different concentrations of NaCl solutions showed that 137Cs was completely removed from cheese soaking in 5% NaCl solution (soaking time of 48 hours), while 40% of 226Ra and 80% of 85Sr were also decontaminated using 0-2.5% NaCl solutions and soaking time of 48 hours. Based on the obtained results, industrialization processes of the dairy products that resulted the removal of radionuclides have been identified. (author)

  15. 50 CFR Table 1 to Part 226 - Major Stellar Sea Lion Rookery Sites

    2010-10-01

    ... 50 Wildlife and Fisheries 7 2010-10-01 2010-10-01 false Major Stellar Sea Lion Rookery Sites 1... Table 1 to Part 226—Major Stellar Sea Lion Rookery Sites Major Steller sea lion rookery sites are... 168 02.0W Ogchul I.1 53 00.0N 168 24.0W Sea Lion Rocks. (Amak) 1 55 28.0N 163 12.0W Ugamak I.1 54...

  16. Reflection Asymmetric Relativistic Mean Field Approach and Its Application to the Octupole Deformed Nucleus 226Ra

    GENG Li-Sheng; MENG Jie; Toki Hiroshi

    2007-01-01

    A reflection asymmetric relativistic mean field (RAS-RMF) approach is developed by expanding the equations of motion for both the nucleons and the mesons on the eigenfunctions of the two-centre harmonic-oscillator potential.The efficiency and reliability of the RAS-RMF approach are demonstrated in its application to the well-known octupole deformed nucleus 226Ra and the available data, including the binding energy and the deformation parameters, are well reproduced.

  17. Comparative toxicity of strontium-90 and radium-226 in beagle dogs

    The authors are completing a 30-year study of the biologic effects of 90Sr and 226Ra in the beagle in order to predict the possible long-term hazards to people from chronic exposure to low levels of irradiation. Animals received either radionuclide by several means of administration: (a) continual ingestion of 90Sr, (b) a single intravenous injection of 90Sr, or (c) a series of eight intravenous injections of 226Ra. Although administration of 90Sr and 226Ra ended at 540 days of age, the animals continued to receive chronic, low-level radiation doses from these bone-seeking radionuclides throughout life. This project is the largest single cohort study in beagles of internally deposited radionuclides. It is unique in use of the ingestion route for 90Sr and in exposures that began before birth and continued throughout development to adulthood with uniform labeling of the skeletons with 90Sr. The last of the dogs died in 1986 at age 18.5, but the authors are continuing to investigate the significance of these long-term exposures given at low dose rates with regard to cancer production, physiologic well-being, and shortening of life through the detailed records that were kept and by study of preserved materials. All the data have been successfully accumulated and entered into a main-frame computer data base management system. Current work is exclusively directed at preparing research papers summarizing the results and the associated biostatistical and survival analyses

  18. Comparative toxicity of strontium-90 and radium-226 in beagle dogs

    The authors are completing a 30-year study of the biological effects of 90Sr and 226Ra in the beagle in order to predict the possible long-term hazards to people from chronic exposure to low levels of irradiation. Animals received either radionuclide by several means of administration: (a) continual ingestion of 90Sr, (b) a single intravenous injection of 90Sr, or (c) a series of eight intravenous injections of 226Ra. Although administration of 90Sr and 226Ra ended at 540 days of age, the animals continued to receive chronic, low-level radiation doses from these bone-seeking radionuclides throughout life. This project is the largest single cohort study in beagles of internally deposited radionuclides. It is unique in use of the ingestion route for 90Sr and in exposures that began before birth and continued throughout development to adulthood with uniform labeling of the skeletons with 90Sr. The last of the dogs died in 1986 at age 18.5 years, but the authors are continuing to investigate the significance of these long-term exposures given at low dose rates with regard to cancer production, physiologic well-being, and shortening of life through the detailed records that were kept and by study of preserved materials. All the data have been successfully accumulated and entered into a main-frame computer data base management system. Current work is exclusively directed at preparing research papers summarizing the results and the associated biostatistical and survival analyses

  19. Comparative kinetics of 47Ca, 85Sr and 226Ra in the freshwater turtle, Trachemys scripta

    The kinetics of 47Ca, 85Sr and 226Ra were compared in the yellow-bellied slider, a common freshwater turtle of the southeastern USA. The absorption and elimination processes were examined as a function of stable dietary Ca, season, age and sex of the animals. Turtles were gavaged with radionuclides and serial whole-body analyses were performed on the live animals for up to 480 days. Only in the juvenile age class did reduced dietary Ca cause a significant increase in 85Sr absorption. The absorption of 85Sr and 226Ra in the adult male, adult female and hatchling groups was unaffected by dietary Ca. Mean absorption was greater than that which has been reported for other organisms and significantly differed among isotopes. The high absorption values were not restricted to immatures, but continued into maturity. Elimination rates were not affected by the dietary treatment, nor were isotopic differences in elimination observed. Annual mean elimination rate constants pooled among animal groups, were 0.22 ± 0.07 for 85Sr and 0.26 ± 0.18 for 226Ra. Retention was strongly affected by season with the greatest elimination occurring in the summer and declining to levels that were not distinguishable from zero in the winter. Elimination rate constants for hatchlings were greater than for the other age groups. (author)

  20. Radiological impact from atmospheric releases of 226Ra from coal-fired power plants

    Lignite contains naturally occurring radionuclides arising from the uranium and thorium series and also 40K. Lignite burning is, therefore, one of the sources of technologically enhanced exposure to man from natural radionuclides. Emissions from thermal power stations in gaseous and particulate form contain radioisotopes, such as 226Ra, which are discharged to the environment causing radiation exposures to the population. About 11672 Mbq of 226Ra per year are discharged to the environment from four coal-fired power plants, totalling 3.62 GW electrical energy, at the Valley of Ptolemais, Northern Greece, in which the combustion of 1.1 x 1010 kg lignite is required to produce an electrical energy of 1 GW year. The collective effective dose equivalent commitment to lung tissue per unit power generated resulting from atmospheric releases of 226Ra was estimated to be 1.1 x 10-2 manSv (GW year)-1, i.e. more than 15 times higher than that corresponding to a modern-type coal-fired power plant according to the UNSCEAR (1988) data. (author)

  1. 18O and 226Ra in the Minjiang River estuary, China and their hydrological implications

    Liu, Huatai; Guo, Zhanrong; Gao, Aiguo; Yuan, Xiaojie; Zhang, Bin

    2016-05-01

    In this work, the 2H, 18O and 226Ra values in groundwater and surface water in the Minjiang River estuary were investigated in the dry and wet seasons. The δ18O values in the dry season were always higher than those in the wet season in both groundwater and surface water because of the presence of evaporation in the water cycle process. During the dry season, the δ18O values in groundwater on the southern bank of the Minjiang River are much higher than those on the northern bank because evaporation is more intense in the farmland of the southern bank than in the urbanized northern bank. The δ18O values in the estuarine water exhibit a good positive correlation with salinity, with a coefficient of 0.96 (p = 0.05) in both seasons. The 226Ra activities in the estuarine water increase with increasing salinity because of desorption from riverine suspended particles. The 226Ra activity reaches a peak value at a salinity of 20.5. Based on a three-endmember model, the average proportions of the estuarine water are calculated to be 0.02 for groundwater, 0.39 for river water and 0.59 for seawater. From this mixing ratio, the groundwater discharge into the estuary is estimated to be 9.31 × 106 m3 d-1 in the wet season.

  2. 137Cs and 226Ra determination in soil and land snails from a radioactive waste site

    Environmental radioactivity studies related to nuclear facilities can provide information concerning the transfer of radionuclides to the surrounding soils, water and the local biota. A study of 226Ra, 137Cs and 40K content in soils and in land snails, Helix aspersa Mueller, has been performed at the confined Storage Centre for Radioactive Waste (Maquixco, Mexico). At this site, solid and liquid radioactive waste has been stored for two decades; tailing piles of radiometric ore also stood for some time before being buried in specific containers. The nuclear technique used was gamma spectrometry. Atomic absorption spectrophotometry was used for soil and land snails chemical analysis. The preliminary results obtained in soil samples show 226Ra and 137Cs values ranging from 88 to 19979? and from 89 to 4961 Bq/kg (dry wt.), respectively, depending on the sampling region. For the snails, 226Ra levels in shell samples up to a factor of 9 greater were obtained for the site samples as compared with reference samples collected 100 km away. The results are discussed as a function of the uranium ore tailings localization at the site; a preliminary estimation of concentration factors (soil/snail) is also intended

  3. 226Ra and 228Ra activity measurement on soil surface in Bagan Lalang, Selangor

    Six stations had selected from Sungai Sepang Kechil, Selangor during Mac, September and October 2004 for sediment analysis. The results showed a significant difference among the 226Ra and 228Ra activities (P 226Ra and 228Ra have obtained during the sampling on Mac, which show the average activities 161.30 Bq kg-1 and 466.88 Bq kg-1, respectively. Meanwhile, 226Ra activities obtained on September and October are in the average of 24.77 Bq kg-1 and 69.22 Bq kg-1, respectively. Average activities of 228Ra are 73.13 Bq kg-1 and 1284.58 Bq kg-1, respectively for September and October. Northeast Monsoon effect might cause the higher activities of radium isotopes during sampling on Mac. Sediments from Bagan Lalang are sandy type with a limited size variation. Furthermore, radium isotopes are more adsorbed on the particles sediments between size 63 - 125 μm, which usually rich in alkaline feldspar.(author)

  4. An easy method for Ra-226 determination in river waters by liquid-scintillation counting

    226Ra activity concentration in river water was determined using a low background liquid scintillation counter. Radium was extracted from the samples as Ra-BaSO4 precipitate which, afterwards, was dissolved with EDTA in ammonia medium. Solution was transferred into a low potassium glass vial and then mixed with a scintillation cocktail. Two different scintillation cocktails were selected for comparison. Efficiency, recovery yield and α/β separation were studied with both liquid scintillation cocktails. One single measurement, made one month after radium separation, allows to calculate the 226Ra concentration as well as to assess the presence of alpha contamination of the sample. In the case of negligible interferences, 224Ra concentrations can be subsequently evaluated in the same sample by the measurement made just after chemical separation of radium. This method has been applied for the determination of 226Ra and 224Ra activity concentrations in river water collected from different locations along the Odiel river estuary area (south-west of Spain). The presence of chemical industry, the wastes of which are released into the river, could be connected with radium activity concentration enhancements in the water. (author)

  5. Validation of a method for measuring 226Ra in drinking waters by LSC

    A simple method for measuring 226Ra in drinking waters has been validated and validation parameters are provided. It is based on the measurement by LSC of 222Rn, at equilibrium with 226Ra, which is absorbed into a water immiscible scintillation cocktail (Ultima Gold F) inside the counting vial. The validated application field ranges between the detection limit (2·10−3 Bq/kg) to 150 Bq/kg. The method has proven to be reliable, effective and suitable for wide-range measuring campaigns. A summary of results obtained in recent years is also given. - Highlights: • Liquid scintillation counting (LSC) double-phase technique has been used for 226Ra analysis. • Teflon coated vials and a water immiscible scintillation cocktail (Ultima Gold F) have been used. • The method has been validate under ISO 17025 requirements and validation data reported in the paper. • Repeatability has been evaluated and its contribution has been used in uncertainty calculation. • The method has been widely applied in measuring drinking water in Italy

  6. Concentration Of 228Th, 226Ra, And 40K Radionuclides In Drinking Water In Southern Sumatera

    Measurements of 228 Th, 226 Ra, and 40 K concentrations in drinking water on several places in Southern Sumatera (1997-1999) have been carried out. The sample were collected from the Province of Lampung (Kalianda, Bandar Lampung, Kotabumi, Talangpadang, Kotaagung, Liwa, Manggala, and Pakuanratu), and the Province of Southern Sumatera (Palembang-1, Palembang-2, Plaju, Lahat, and Sekayu). Measurements of 228 Th, 226 Ra, and 40 K concentrations in drinking water using the gamma spectrometer with the HP-Ge detector. The results of measurement showed that the concentration was the range of undetectable (228 Th concentration, the range of undetectable (226 Ra, radionuclide and the range of undetectable (< 128.96 mBq/l) to (880.54 n 22.75) mBq/l with average of (412.12 n 5.02) mBq/l, and the data mentioned above were still far under the maximum permissible concentration. The estimated of annual dose equivalent effective in drinking water was 0.03 mSv/year for public (5 mSv/year)

  7. Removal of Radium-226 from Radium-contaminated soil using distilled water and humic acid: Effect of pH

    Effect of washing solutions pH on removal of radium-226 from radium-contaminated soil using distilled water and humic acid extracted from Malaysian peat soil was studied by a single batch washing method. The study encompassed the extraction of humic acid and the washing of radium-contaminated soil using distilled water and humic acid solutions of varying pH in the range between 3 to 11. Activity of radium-226 was determined by gamma spectrometer. In the pH range studied, the removal of radium-226 was greater when humic acid solutions were used compared to distilled water. Greater removal of radium-226 was obtained using highly basic pH washing solutions compared to neutral and acidic solutions. (author)

  8. 226Ra contamination of soil and foliage as a function of distance downwind from uranium mill tailings

    This study concerned 226Ra contamination of soils and foliage as a function of distance downwind from a uranium mill tailings pile. In soils the radium contamination was primarily associated with particle sizes 226Ra contamination in Artemisia tridentata. Internal contamination appeared to be a larger contributor to total contamination at distances less than or equal to 0.16 km downwind from the tailings pile. At distances > 0.16 km, external contamination became a larger contributor to the total 226Ra contamination. In most soil samples 226Ra concentrations approached background levels at a distance of 1.1 km from the tailings pile. Total vegetation contamination approached background at 6.6 km. This study suggested that a combination of root uptake and foliar absorption were responsible for internal contamination and further studies were suggested. 19 references, 5 figures, 2 tables

  9. Removal of Radium-226 from Radium-Contaminated Soil using Distilled Water and Humic Acid: Effect of pH

    Effect of washing solutions' pH removal of radium-226 from radium-contaminated soil using distilled water and humic acid extracted from Malaysian peat soil was studied by batch washing method. The study encompassed the extraction of humic acid and the washing of radium-contaminated soil using distilled water and humic acid solutions of 100 ppm, both with varying pHs in the range of 3 to 11. The radioactivity concentration of radium-226 was determined by gamma spectrometer.The removal of radium-226 was greater when humic acid solutions were used compared to distilled water at the pH range studied and both washing solutions showed greater removal of radium-226 when basic solutions were used. Nevertheless, comparable removal efficiencies were observed when neutral and highly basic humic acid solutions were used. (author)

  10. Intake of 226 Ra in osteoporosis prevention and therapy with gran-white dolomite as calcium supplement

    A 226 Ra average specific activity of 4.3 Bq.kg-1 was determined by passive high resolution gamma-ray spectrometry in six samples of 'Gran White' dolomite. The committed effective dose and committed equivalent dose at bone surface were calculated through the Ana Comp code, using 226 Ra intake and radium metabolic model from ICRP 67. The doses were calculated for patients submitted to osteoporosis prevention and osteoporosis therapy. (author)

  11. Low impact of exposure to environmentally relevant doses of 226Ra in Atlantic cod (Gadus morhua) embryonic cells

    The aim of this study was to investigate whether 226Ra, a radionuclide present in produced water from oil platforms in the North Sea and other offshore drilling areas, could affect vulnerable early life stages of Atlantic cod (Gadus morhua). Blastula-stage embryonic cells (EC) from fertilized eggs of Atlantic cod were isolated and exposed to environmental relevant concentrations of 226Ra and transcription of selected genes quantified. The results showed a weak, but significant up-regulation of GPx3 and HSP70 transcripts after 48 h of exposure to 2.11 Bq/L. In EC exposed to three 226Ra concentrations (2.11, 23 and 117 Bq/L) for 12 h, metallothionein, HSP90AA, thioredoxin and caspase 8 were significantly up-regulated in cells exposed to 117 Bq/L, whereas thioredoxin was also significantly up-regulated in EC exposed to 23 Bq/L. When EC were exposed to the same 226Ra concentrations for 48 h, only heme oxygenase was significantly up-regulated in the 23 Bq/L exposure group. The results suggest that environmentally relevant activities of 226Ra may induce oxidative stress and apoptosis in fish ECs. Exposure of Atlantic cod EC to Cd, selected as a model toxicant, supported the ability of EC around blastula stage to respond to toxicants by altered transcription. Due to dilution, environmentally relevant concentrations of radionuclides present in produced water would be expected to pose a minor threat to early life stages of fish. - Highlights: ► 226Ra affects the transcription of genes in Atlantic cod embryonic cells. ► 226Ra may induce oxidative stress and apoptosis in fish embryonic cells. ► 226Ra not expected to pose a major threat to early life stages of marine fish.

  12. Comparative toxicity of strontium-90 and radium-226 in beagle dogs

    We are completing a 30-year study of the biological effects of 90Sr and 226Ra in the beagle in order to predict the possible long-term hazards to people from chronic exposure to low levels of irradiation. Animals received either radionuclide by several means of administration: (a) continual ingestion of 90Sr, (b) a single intravenous injection of 90Sr, or (c) a series of eight intravenous injections of 226Ra. Although administration of 90Sr and 226Ra ended at 540 days of age, the animals continued to receive chronic, low-level radiation doses from these bone-seeking radionuclides throughout life. This project is the largest single cohort study in beagles of internally deposited radionuclides. It is unique in use of the ingestion route for 90Sr and in exposure that began before birth and continued throughout development to adulthood with uniform labeling of the skeletons with 90Sr. The last of the dogs died in 1986 at age 18.5 years, but we are continuing to investigate the significance of these long-term exposures given at low dose rates with regard to cancer production, physiologic well-being, and shortening of life through the detailed records that were kept and by study of preserved materials. All the data have been successfully accumulated and entered into a main-frame computer data base management system. Current work is exclusively directed at preparing research papers summarizing the results and the associated biostatistical and survival analyses. 15 refs., 1 fig., 4 tabs

  13. Non-stochastic effects of 226Ra and 228Ra in the human skeleton

    Results are reported of a comparative evaluation of the non-neoplastic changes that have been observed radiographically in the bones of two groups of former radium dial workers, one comprising 201 women exposed predominantly to 226Ra and the other comprising 159 women exposed predominantly to 228Ra at a median age of 18 years. The characteristic changes range through progressively larger and more frequent foci of both decreased and increased bone density (radiolucent and dense bone necrosis). Criteria developed in earlier studies were used to assign a numerical score to the changes seen in each individual. The score was used as a quantitative measure of bone necrosis. The long bones contributed the major portion of the total score for the skeleton, with the radii and ulnae showing the highest score on the basis of relative bone mass. The ribs and vertebrae, which account for 20% of the total bone mass, contributed 25 advanced degree of severity. At intakes of either radium isotope below 10 μCi, no changes above minimal were observed, and the mean score was about the same as the mean of about 0.2 observed in a group of 120 matched control subjects. At intakes below 100 μCi, mean scores per year post exposure were predicted by 0.0016 I, where I is the systemic intake in μCi of either 226Ra or 228Ra. For 50 year 226Ra or 228Ra workers with annual systemic intakes at the ICRP limit of about 0.4 μCi, the predicted mean score at about 50 years is 1.0. (author)

  14. Migration of 226 Ra, 228 Ra, 210 Pb, U and Th from phosphogypsum

    The physico-chemical availability of radioactive elements (210 Pb, 226 Ra, 228 Ra, Th and U) in Brazilian phosphogypsum was investigated in a large scale leaching experiment carried out in lysimeters, using phosphogypsum samples (approximately 1.2 tons) from two phosphoric acid industries. Lysimeters were built using cylindrical concrete containers with 0.9 m inner diameter and 2 m depth. The bottom of the lysimeter was filled with a 10 cm layer of gravel covered with geomembrane sheet. Under this layer a pipe was designed to drain the percolated water. Three lysimeters were filled with phosphogypsum from each industry and a mixture of both. As percolated water comes exclusively from the rain, sample was collected daily when available. Samples were then pooled weekly, carefully prepared and submitted to radiochemical analysis. Radiochemical characterization of phosphogypsum and percolated water was performed by radiochemical separation followed by gross alpha and beta counting (226 Ra, 228 Ra and 210 Pb) and UV-Vis spectrophotometry with Arsenazo III (U and Th). This experiment was carried out from 12/01/1999 to 01/22/2001, with a precipitation of 2,732 mm. It was observed that approximately 40% (534 L) of the rain fall percolated through the lysimeter 1. The analysis of 22 samples of percolated water from lysimeter 1 showed mean radionuclides activities of 70±30 mBqL-1, 70±50 mBqL-1, 100±60 mBqL-1 and 110±55 mBqL-1 for U, 226 Ra, 228 Ra and 210 Pb, respectively. Thorium activities were below detection limit. (author)

  15. Effect of calcium silicate slag application on radium-226 concentrations in plant tissues

    A greenhouse pot experiment was conducted to determine if plants absorb Ra from slag applied to soil. Slag at rates equivalent to 0 and 22 mt/ha was mixed with Mountview silt loam (Typic Paleudults) limed to pH 5.8 and 7.2. Three clippings each of fescue (Festuca arundiancea Schreb.), and Swiss chard (Beta vulgaris L.), and one harvest of wheat (Triticum aestivum L.) for grain and straw were grown on separate series of treated soil, and plant samples were analyzed for radioactivity due to 226Ra uptake. Samples of sugarcane (Saccharum officinarum L.) forage and extracted juice from field experiments in Florida testing this slage as a Si source also were analyzed for radioactivity. Dry forage yields of fescue and wheat were not affected by slag applications, but those of Swiss chard were somewhat higher on slag-treated soil at pH 5.8. Wheat grain and straw yields were higher on soil at pH 7.2 than at pH 5.8 regardless of slag treatment. Uptake of 226Ra by fescue forage and wheat grain and straw was not affected by slag application. Concentrations of 226Ra were similar in forage and extracted juice from untreated sugarcane or that treated with slag at rates up to 5.6 mt/ha. These results suggest that plant uptake of radionuclides is negligible from calcium silicate slag applied at the recommended rates for liming acid soils or as a source of Si for sugarcane

  16. Radiation-Induced Neoplasms in Beagles after Administrations of 90Sr and 226Ra

    The comparative carcinogenic efficiency of two bone-seeking radionuclides is under study in a colony of several hundred beagles. The toxicity of internally deposited alpha emitters (226Ra and its daughters) and of beta irradiation (90Sr) at comparable dosage rates indicates marked differences in site of appearance and mode of action in litters studied up to 7 years of age. Radiation carcinogenesis in beagles exposed to 90Sr daily from midgestation to adulthood (1.5 yr) is at present confined to dogs fed 4 μCi 90Sr/d or higher. The 20 cases constitute a spectrum of myeloproliferative disorders characterized by terminal anaemias, and ranging from myeloid metaplasia to granulocytic leukaemia. Continuous high-level 90Sr irradiation to bone and marrow from early life onward causes a thickened hypocellular bone ('pachyostosis'), some instances of myelofibrosis, and persistent mild leukopenia on which the final spectrum of terminal disoideis is superimposed. In contrast, up to 100 μCl 226Ra given intravenously (8 equally spaced injections at 14 to 18 months of age) to young adults is not a potent marrow cell carcinogen. The higher LET, shorter-range alpha particles are efficient in inducing bone cancers (14 cases) and skeletal lesions similar to those documented in watch-dial luminizers exposed to 226Ra in the early 1900's. The incidence of haematopoietic and skeletal neoplasms observed is dose-rate related, and the morphologic characteristics have several analogues in human cancer. The use of identically treated litters rather than individuals affords additional opportunity to study possible familial factors in the distribution of the neoplasms. Pathogenic evaluation at this juncture strongly indicates that continued bone and marrow irradiation in early life is more likely to induce haematopoietic neoplasms than is skeletal irradiation starting in young adulthood, which induces osseous neoplasms. (author)

  17. Minimum speed limit for ocean ridge magmatism from 210Pb-226Ra-230Th disequilibria.

    Rubin, K H; van der Zander, I; Smith, M C; Bergmanis, E C

    2005-09-22

    Although 70 per cent of global crustal magmatism occurs at mid-ocean ridges-where the heat budget controls crustal structure, hydrothermal activity and a vibrant biosphere-the tempo of magmatic inputs in these regions remains poorly understood. Such timescales can be assessed, however, with natural radioactive-decay-chain nuclides, because chemical disruption to secular equilibrium systems initiates parent-daughter disequilibria, which re-equilibrate by the shorter half-life in a pair. Here we use 210Pb-226Ra-230Th radioactive disequilibria and other geochemical attributes in oceanic basalts less than 20 years old to infer that melts of the Earth's mantle can be transported, accumulated and erupted in a few decades. This implies that magmatic conditions can fluctuate rapidly at ridge volcanoes. 210Pb deficits of up to 15 per cent relative to 226Ra occur in normal mid-ocean ridge basalts, with the largest deficits in the most magnesium-rich lavas. The 22-year half-life of 210Pb requires very recent fractionation of these two uranium-series nuclides. Relationships between 210Pb-deficits, (226Ra/230Th) activity ratios and compatible trace-element ratios preclude crustal-magma differentiation or daughter-isotope degassing as the main causes for the signal. A mantle-melting model can simulate observed disequilibria but preservation requires a subsequent mechanism to transport melt rapidly. The likelihood of magmatic disequilibria occurring before melt enters shallow crustal magma bodies also limits differentiation and heat replenishment timescales to decades at the localities studied. PMID:16177787

  18. Sequential Extraction and Measurement of 226Ra, 210Po, U and Th Isotopes in NORM Matrices

    Phosphate rock is a Naturally Occurring Radioactive Material containing high concentrations of radioisotopes from the 238U and/or 232Th natural decay series (up to 5·103 Bq·kg-1). This is the reason why several products and by-products of the phosphate industry (e.g. phosphoric acid, phosphate fertilizers, dicalcium phosphate and phosphogypsum) retain large fractions of those radionuclides. A vast amount of radiochemical methods have been proposed in the literature to extract, concentrate and analyze the content of these natural radionuclides in those samples. Unfortunately, many of these methods were originally developed for their application in environmental samples, thus their application to highly complex industrial matrices often decreases their chemical performance. Hence it is advisable to develop radiochemical ad hoc methods for those samples. In this work a sequential chemical extraction method for the determination of 226Ra, 210Po, U-isotopes and Th-isotopes in raw material, products and by-products from the phosphate industry is presented. In a first step, 226Ra is measured through Liquid Scintillation Counting following barium sulphate precipitation. Due to the difficulty of the matrices, recovery must be carefully controlled, thus 133Ba (T1/2 = 10.53 y) is used as internal tracer for 226Ra. Afterwards, 210Po, U and Th isotopes are determined using alpha spectrometry after a selective separation scheme which combines liquid-liquid extraction (TBP) and anion exchange techniques. The high concentration of uranium and thorium in those kinds of samples sometimes leads to crossover contamination after the radiochemical separation. For a successful uranium-thorium separation, after several anion exchange schemes trials, purification in hydrochloric acid media is suggested. (author)

  19. Radiochemical determination of 210 Pb and 226Ra in petroleum sludges and scales

    The oil extraction and production, both onshore and offshore, can generate different types of residues, such as sludge, that is deposited in the water/oil separators, valves and storage tanks and scales, which form i the inner surface of ducts and equipment. Analyses already carried out through gamma spectrometry indicated the existence of high radioisotope concentration. However, radionuclides emitting low-energy gamma-rays, such as 210 Pb, are hardly detected by that technique. Consequently, there is a need to test alternative techniques to determine this and other radionuclides from the 238 U series. This work, therefore, focuses on the radiochemical determination of the concentration of 210Pb, and 226 Ra in samples of sludge and scale from the oil processing stations of the UN-SEAL, a PETROBRAS unit responsible for the exploration and production of petroleum in Sergipe and Alagoas. The sludge and scale samples went through a preliminary process of extraction of oil, in order to separate the solid phase, where the largest fraction of the radioactivity is concentrated. After oil removal, the samples were digested using alkaline fusion as an option for dissolution. Finally, their activity concentration was determined for the samples of sludge and scales, using and alternative radiochemical method, which is based on ionic exchange. The activity concentration found for 210Pb varied from 1,14 to 507,3 kBq kg-1. The values for 226Ra were higher, varying from 4,36 to 3.445 kBq kg-1. The results for 226Ra were then compared with the ones found for the same samples of sludge and scales using gamma spectrometry. The results of the comparison confirm the efficiency of the methodology used int hi work, that is, radiochemical determination by means of ionic exchange. (author)

  20. Radiological impact assessment of the 226-Ra in phosphogypsum wastes used as amendment in agriculture soils

    The phosphate fertilizer industry produces an important amount of Phosphogypsum (PG) as a residue of its activity. It is well known that such wastes contain significant amounts of natural radionuclides from the U, Th and K series. The raw material for the production (phosphate rock) has uranium activity concentrations of around 1 kBq kg-1 from which about 15% passes to the PG. At the Huelva industrial area (SW Spain) the wastes produced per year can reach some 3x106 Mg, but in spite of the recent scientific efforts its accumulation still being a problem of great concern for the area. In the other hand, reclamation of sodic soils for agricultural uses requires a Ca amendment to diminish Na saturation. Then, PG (with a high proportion of CaSO4·2H2O) is an effective amendment that has been widely used in the saline-sodic marsh soils from SW Spain. Using PG as an amendment dilutes the radionuclides down to background levels, becoming this practice a possible way to eliminate these wastes with a considerable additional value for the agricultural process. However, it is necessary to study the amount of radioisotopes that can move to water and plants to ensure the radiological safety of the amendment. PG has relatively high concentrations of 226Ra and other radionuclides, with an special concern due to the 222Rn emissions. These wastes could be used to improve the fertility of agriculture soils in a large former marsh area of the Guadalquivir river. Thus, it is interesting to study the levels and behaviour of natural radionuclides within this system to evaluate the radioactive impact of this amendment. An agronomical test is being conducted by one of the authors in an experimental farm in Lebrija (Seville). The soils are treated with 13 and 26 t ha-1 of PG, 30 t ha-1 of manure. Each treatment was repeated twice and continued for two years with beetroot and cotton plant production. We are measuring 226Ra (by alpha counting and gamma spectrometry) and U isotopes (by alpha

  1. Determination of 226Ra and 224Ra in drinking waters by liquid scintillation counting

    A method for the determination of Ra-isotopes in water samples has been developed. Ra is coprecipitated with Ba as sulphate. The precipitate is then dissolved with EDTA and counted with a liquid scintillation system after mixing with a scintillation cocktail. The study of the temporal evolution of the separated activity gives the isotopic composition of the sample, i.e. the 224Ra and 226Ra contribution to the total activity. The method has been applied to some Spanish drinking waters. (author)

  2. Modeling 226Ra behaviour in a Spanish estuary affected by the phosphate industry

    The behaviour of 226Ra in a system like this estuary is complex since radionuclides are affected by tidal actions and interactions with sediments through adsorption/desorption reactions and erosion/deposition processes. A numerical 2D depth-averaged model of the estuary has been developed, including processes mentioned above. It has been applied to reproduce experimental data measured after a release from the industrial complex in the Odiel River and after an accidental release in the Tinto River from the gypsum piles. The model has also been applied to simulate the self-cleaning process observed in the estuary after the direct releases from the fertilizer complex were stopped

  3. Radium-226 and radon-222 in domestic water of Houston-Harris County, Texas

    This study showed that anomalous concentrations of Ra-226 and Rn-222 exist in parts of the upper Texas Gulf Coast. While all factors influencing the distribution and fate of pollutants in underground porous media might not be easy to measure or even identify, often the very expectation of this great complexity prevents one from observing patterns that otherwise might be quite helpful. The findings summarized in this communication present an encouraging picture for predicting depths and locations in the Gulf Coast where elevated Ra and Rn concentrations may be encountered. Two to four key variables accounted for the statistically significant variation (from 38 to 74 percent) in concentrations observed under field conditions

  4. Leaching of radionuclides from uranium ore and mill tailings ( Ra- 226, Tn-230).

    Landa, E.R.

    1982-01-01

    The major part of the extractable uranium is associated with a readily acid-soluble fraction in both ore and tailings. The major part of the extractable 226Ra was associated with an iron, manganese hydrous-oxide fraction in the ore and tailings. Thorium-230 was the least leachable of the radionuclides studied. The major portion of the extractable 230Th was associated with alkaline-earth sulphate precipitates, organic matter, or both. The specific effects of milling on each of the nuclides are discussed.-Author

  5. Laser-trapping of Ra-225 and Ra-226 with repumping by room temperature blackbody radiation

    Guest, J R; Scielzo, N. D.; Ahmad, I.; Bailey, K.; Greene, J. P.; Holt, R J; Lu, Z. -T.; O'Connor, T. P.; Potterveld, D. H.

    2007-01-01

    We have demonstrated Zeeman slowing and capture of neutral Ra-225 and Ra-226 atoms in a magneto-optical trap (MOT). The intercombination transition 1S0-3P1 is the only quasi-cycling transition in radium and was used for laser-cooling and trapping. Repumping along the 3D1-1P1 transition extended the lifetime of the trap from milliseconds to seconds. Room-temperature blackbody radiation was demonstrated to provide repumping from the metastable 3P0 level. We measured the isotope shift and hyperf...

  6. Comparative evaluation of endogenous and exogenous 226 Ra partitioning and uptake in farm soils of Pocos de Caldas, MG: way of occurrence and plant availability

    In order to understand some aspects of 226 Ra pathways through food chains, this radionuclide was investigated in the soil-plant interface. A selective chemical extraction was performed in six farm soils, in order to extract the 226 Ra linked to six geochemical fractions: soluble; exchangeable; bound to carbonates; to iron and manganese oxides or reducible; bound to organic matter or oxidizable and residual or matrical ones. At the same time, kale, carrot and brown-bean were grew up in these soils, by means of greenhouses experiments. To evaluate the influence of the agriculture practices in the partitioning of 226 Ra, the same selective technique was carried out in these soils before and after a brown bean crop. In order to characterize an anthropogenic discharge, the behaviour of 226 Ra naturally existent - endogenous 226 Ra- was compared to the same radionuclide experimentally added to these soils - exogenous 226 Ra-, to mock an irrigation with contaminated water. (author)

  7. Evaluation of the received dose by the Ra-226 incorporation due to the consumption of ground waters in Cuba

    Due to the good solubility of radium compounds in the earth core, concentrations of Ra-226 in ground water may be significant. Some countries, like France and Finland, have reported Ra-226 concentrations in ground water up to 2700 and 5300 mBq/L, respectively. Due to to these reasons, the control of the concentrations of Ra-226 in water for human consumption became a practice in various countries. Sampling and analysis of Ra-226 in water from the principal springs and sources in Cuba have been organized since 1992, taking into account the volumes and primary features of each source. Radium-226 concentrations in analyzed waters are in the range of 26-144 mBq/L. These concentrations correspond to values reported in the literature for sources in other countries. Committed dose for water consumption in a year are in the order of nano Sievert. Determined concentrations are below the values established by corresponding Cuban Standard and no restriction have been recommended. (authors). 5 refs., 2 figs

  8. Surface water mixing estimated from {sup 228}Ra and {sup 226}Ra in the northwestern North Pacific

    Kawakami, Hajime [Mutsu Institute for Oceanography, Japan Agency for Marine-Earth Science and Technology, 690 Aza-kitasekine Oaza-sekine, Mutsu, Aomori 035-0022 (Japan)], E-mail: kawakami@jamstec.go.jp; Kusakabe, Masashi [Department of Ocean Research, Japan Agency for Marine-Earth Science and Technology, 2-15 Natsushimacho, Yokosuka 237-0061 (Japan)], E-mail: masashi@nirs.go.jp

    2008-08-15

    We investigated the horizontal distributions of {sup 228}Ra and {sup 226}Ra in surface waters of the northwestern North Pacific Ocean and Okhotsk Sea. Ratios of {sup 228}Ra/{sup 226}Ra were relatively large in the Tsugaru Current (0.6-0.8) and Okhotsk Sea (0.4-0.5), and small in the Western Subarctic Gyre (<0.2) and the Oyashio (0.25-0.3). {sup 228}Ra/{sup 226}Ra ratios in western Subarctic Water (SAW) rose slightly upon mixing with Okhotsk Water (OKW), before becoming the Oyashio Water (OYW). Also, ratios in the OYW increased during mixing with Tsugaru Current Water (TCW). Estimating from {sup 228}Ra/{sup 226}Ra ratios and {sup 226}Ra activities with a simple two-end members-mixing model, we assumed that approximately 23% of the OYW originated from the OKW and the coastal region off northern Honshu (Japan) was strongly influenced by the TCW. From a diagram of {sup 228}Ra activities against salinity, we could roughly divide surface seawater in the study area into the five water masses, which were SAW, OYW, OKW, TCW, and Subtropical Water (STW)

  9. {sup 226}Ra concentration in the teeth of habitants of areas with high level of natural radioactivity in Ramsar

    Aghamiri, S. Mahmoud Reza [Department of Radiation Medicine, Shahid Beheshti University, Tehran (Iran, Islamic Republic of); Ghorbani, Zahra [Iranian Center of Dental Research, Faculty of Dentistry, Shahid Beheshti University of Medical Science, Tehran (Iran, Islamic Republic of); Darafsheh, Arash [Department of Radiation Medicine, Shahid Beheshti University, Tehran (Iran, Islamic Republic of)]. E-mail: ardaraf@gmail.com; Torabzadeh, Hasan [Department of Operative Dentistry, Faculty of Dentistry, Shahid Beheshti University of Medical Science, Tehran (Iran, Islamic Republic of); Fathivand, Ali Asghar [National Radiation Protection Department (NRPD), Iranian Nuclear Regulatory Authority, Tehran (Iran, Islamic Republic of); Minuchehr, Abdulhamid [Department of Radiation Medicine, Shahid Beheshti University, Tehran (Iran, Islamic Republic of); Jalinoos, Alireza [Nuclear Immunity and Protection Center, Iranian Atomic Energy Organization, Tehran (Iran, Islamic Republic of)

    2006-07-01

    The level of natural radiation in some regions of Ramsar, a northern coastal city of Iran, is known to be among the highest levels of natural radiation in the world. {sup 226}Ra existing in high concentrations in the soil of this region is washed by underground water and transferred to the surface. In this way, {sup 226}Ra enters the food chain of residents and substitutes within the hard body tissues of humans. {sup 226}Ra is one of the so-called bone seekers as its metabolic processes in the human body are similar to calcium and remains in hard tissues of body because of its long half-life, and being an {alpha} emitter causes dangerous effects on human health. The purpose of this study is to determine the concentration of {sup 226}Ra in the teeth of residents of these high-level natural radiation areas, compared with a control group. Thirteen teeth in five groups were studied as the case group and thirteen teeth in five corresponding control groups were inspected. The mean values of the activity of {sup 226}Ra in the case group and in the control group were 0.32 and 0.18 mBq g{sup -1}, respectively.

  10. Ra-226 concentrations in blueberries Vaccinium angustifolium Ait. near an inactive uranium tailings site in Elliot Lake, Ontario, Canada

    Ra-226 concentrations were measured in blueberries growing around the Stanrock uranium tailings area near Elliot Lake, Ontario, Canada. Elevated levels of total Ra-226 ranging between 20 to 290 mBq g-1 were observed in samples collected within 500 m from the tailings. Highest levels, approx. 285 mBq g-1, were observed in a sample collected on a tailings spill. For sites located more than 500 m away in the upwind direction, and those situated at distances greater than 1 km downwind from the waste pile, the total Ra-226 concentrations approached background levels which were measured as 2 to 6 mBq g-1. Approximately 17% of the total Ra-226 measured was removable by washing the samples with distilled water. Wind dispersal of the tailings material and its deposition in the form of dust on blueberries was believed to be responsible for the external contamination. Based on the ICRP recommended dose limits for oral intake of Ra-226, it was calculated that approximately 160 kg a-1, 3350 kg a-1 and 47 kg a-1 of washed blueberries from inside and outside the influenced zone, and from the tailings spill site, respectively, would need to be consumed before the individual annual limit for the general public was exceeded. (author)

  11. Determination of 226 Ra and 228 Ra in mineral spring waters of the Aguas da Prata region

    Concentration levels of 226 Ra and 228 Ra have been analysed in most of the mineral spring waters available in the Aguas da Prata region. The 226 Ra and 228 Ra were determined by coprecipitation with barium sulphate. The 226 Ra was determined by gross alpha counting of the Ba(Ra)SO4 precipitate. The determination of 228 Ra was done by measuring the gross beta activity of the same precipitate. Both measurements were carried out in a low background gas flow proportional counter. Dose calculations were performed in order to evaluate the relative importance of such radionuclides to the radiation exposure due to the ingestion of these waters. Based upon measured concentrations, committed effective doses up to 5.5 x 10-1 mSv/y and 1.0 x 10-2 mSv/y were observed for 226 Ra and 228 Ra, respectively. These results show that 226 Ra is the main contributor to radiation exposure. (author)

  12. 226Ra concentration in the teeth of habitants of areas with high level of natural radioactivity in Ramsar

    The level of natural radiation in some regions of Ramsar, a northern coastal city of Iran, is known to be among the highest levels of natural radiation in the world. 226Ra existing in high concentrations in the soil of this region is washed by underground water and transferred to the surface. In this way, 226Ra enters the food chain of residents and substitutes within the hard body tissues of humans. 226Ra is one of the so-called bone seekers as its metabolic processes in the human body are similar to calcium and remains in hard tissues of body because of its long half-life, and being an α emitter causes dangerous effects on human health. The purpose of this study is to determine the concentration of 226Ra in the teeth of residents of these high-level natural radiation areas, compared with a control group. Thirteen teeth in five groups were studied as the case group and thirteen teeth in five corresponding control groups were inspected. The mean values of the activity of 226Ra in the case group and in the control group were 0.32 and 0.18 mBq g-1, respectively

  13. Transfer of 226Ra and 210Pb to forage and milk in a Brazilian high natural radioactivity region

    The Pocos de Caldas plateau, where the Brazilian uranium mine and mill facilities are located, is a natural high radioactivity region. A study has been carried out in order to assess the environmental transport of the natural radionuclides in the region. The present work is concerned with the transfer of 226Ra and 210Pb to forage and milk. Similar concentrations for both radionuclides were found in soil samples. In forage 210Pb concentrations are one order of magnitude higher than those of 226Ra, however, the milk samples presented higher values for 226Ra concentrations. The average forage to milk concentration factors are of the order of 10-4 d.l-1 for 226Ra and 10-5 d.l-1 for 210Pb. Regarding transfer mechanisms, the results suggest the foliar deposition as the main pathway for 210Pb uptake by the forage. In contrast, for 226Ra the root uptake appears as the main transfer pathway. (author)

  14. Field analyses of 238U and 226Ra in two uranium mill tailings piles from Niger using portable HPGe detector

    The radioactivities of 238U and 226Ra in mill tailings from the U mines of COMINAK and SOMAÏR in Niger were measured and quantified using a portable High-Purity Germanium (HPGe) detector. The 238U and 226Ra activities were measured under field conditions on drilling cores with 600s measurements and without any sample preparation. Field results were compared with those obtained by Inductive Coupled Plasma Atomic Emission Spectroscopy (ICP-AES) and emanometry techniques. This comparison indicates that gamma-ray absorption by such geological samples does not cause significant deviations. This work shows the feasibility of using portable HPGe detector in the field as a preliminary method to observe variations of radionuclides concentration with the aim of identifying samples of interest. The HPGe is particularly useful for samples with strong secular disequilibrium such as mill tailings. - Highlights: • A portable HPGe was used in the field to quantify 238U and 226Ra in mill tailings. • 238U and 226Ra quantification was performed on samples with strong radioactive disequilibrium. • HPGe measurements are compared with results obtained on the same samples by ICP-AES and emanometry. • We show the vertical distributions of U and 226Ra measured in two ∼30 m mill tailings piles. • Portable HPGe can be used directly in the field to observe slight variations of content

  15. Radium-226 transfer factors for various crop samples collected in Japan

    The soil-to-plant transfer factor (TF) is a key parameter that directly affects the internal dose assessment for the ingestion pathway of radionuclides. We measured the concentrations of 226Ra in crops and associated soils collected from 80 fields throughout Japan in order to obtain their TFs. The radioactivity of 226Ra was measured with a Ge detector system for soil samples and a liquid scintillation counting system for crop samples after radiochemical separation. We also measured concentrations of Ca, Sr and Ba which are in the same alkaline earth metal group for comparison. Radiochemical separation was used for crop samples, but due to low concentrations, 9 upland field crop samples and 9 brown rice samples could not be measured. Using the 68 measured data, we calculated TFs (dry weight basis); the geometric means of the TFs were 5.7E-4 for brown rice (n=28) and 1.2E-2 for green vegetables (n=12). TFs of Ca, Sr and Ba were similar to TF-Ra. (author)

  16. Adopted levels and derived limits for Ra-226 and the decision making processes concerning TENORM releases

    A fraction of a primary dose limit can be, in general, agreed upon as a dose related level to be adopted in decision-making processes. In the case of TENORM releases, fractions of primary dose levels for 226Ra, 228Ra, and 210Po may be of particular importance to establish adopted levels for 226Ra could be adopted at the highest portion of the natural background variation. Above such level, intervention and remedial action levels could also be adopted. All those levels would be fractions of the primary level, but translated in terms of derived limits expressed in practical units. Derived limits would then be calculated by using environmental models. In such approach 'critical groups' would have to be carefully defined and identified. In addition, the size of a critical group would be chosen to be used in environmental modeling. Site specific environmental models and parameters are desirable, though unavailable, or very difficult to obtain, in most cases. Thus, mathematical models and parameters of more generic nature are often used. A sensitive parametric analysis can make a ranking of the parameters used in a model, allowing one to choose how important each parameter will be for the model output. The paper will point out that when using the adopted levels and derived limits, as suggested above, the uncertainties and importance of the parameters entering an environmental model can make the difference for decision makers to take the right or wrong decision, as far as radiological protection is concerned. (author)

  17. New dosimetry for childhood skin hemangioma treatments with 226Ra needles or tubes

    Background: The Stockholm Hemangioma Cohort is important for evaluation of late effects after exposure to ionizing radiation during childhood. Dose estimates in this cohort were based on both measurements and calculations using an old treatment planning system. Methods: We compare previously published and calculated dose estimates with new ones, obtained by Monte Carlo simulations, which mimic the hemangioma treatments with 226Ra needles and tubes. The distances between the 226Ra sources and the thyroid and breasts, respectively, were reassessed. Result: The Monte Carlo calculations showed significantly lower dose values than those obtained earlier. The differences depended both on the modeling of the sources and on further individualized distances from the sources. The mean value of the new calculated doses was 25% of the old breast doses and 46% of the old thyroid doses. Conclusion: New dosimetry for hemangioma treatments gives significantly lower organ doses for the few cases receiving the highest absorbed dose values. This implies that radiation risk estimates will increase and have to be recalculated. For retrospective studies it is now possible to calculate organ doses from radium treatments using modern treatment planning systems by modeling the source geometry carefully and apply the TG-43 formalism. It is important to be aware of the large uncertainties in calculated absorbed dose values

  18. Self-cleaning in an estuarine area formerly affected by 226Ra anthropogenic enhancements. Numerical simulations

    A numerical model of the Odiel-Tinto estuary (Spain) has been developed to study the self-cleaning process that was evidenced from 226Ra measurements in water and sediments collected in the period 1999-2002, after direct releases from a fertilizer complex ceased (in 1998). The hydrodynamic model is first calibrated, and standard tidal analysis is carried out to calculate tidal constants required by the dispersion code to determine instantaneous water currents and elevations over the estuary. In this way, long-term simulations may be carried out. The dispersion code includes advective/diffusive transport of radionuclides plus exchanges with bottom sediments described through a kinetic approach. The dispersion model is first tested by comparing computed and measured 226Ra concentrations over the estuary resulting after releases in the Odiel and Tinto rivers. Next, it is applied to simulate the self-cleaning process of the estuary. The time evolution of radium concentrations in bed sediments is in generally good agreement with observations. The computed sediment halving time of the estuary is 510 days, which also is in good agreement with that estimated from measurements

  19. Data base development for the design of a radium-226 removal process

    A joint government-industry program has been established in Canada to develop a physical-chemical treatment process that reduces the radium content of uranium mining and milling effluents. Target effluent activities of 0.37 Bq/1(10 pCi/l) total radium-226 and 0.11 Bq/1 (3 pCi/l) dissolved radium-226 were established for this project. Two treatment options are under investigation at bench and pilot scale. Both incorporate barium chloride addition to achieve barium-radium co-precipitation in series-connected stirred tank reactors. In the clarification process, precipitation is followed by rapid mixing of a chemical coagulant, flocculation in series-connected mechanical flocculators, and solid/liquid separation in a clarifier. In the filtration process, precipitation is followed directly by solid/liquid separation using chemically aided granular media filtration. Process development work has been completed, and a preliminary design data base has been established. The two treatment processes will be demonstrated over a period of several months

  20. Measurement by liquid scintillation of 226 Ra coprecipitated in BaSO4

    The 226 Ra is one of the more radio toxic nuclides since when entering to the organism it continues metabolically to the calcium, accumulating mainly in the bone tissue where it becomes in an internal radiation source. For the analysis of radium in water the methods of radon emanation are generally applied and coprecipitation with barium sulfate. This last is quick and efficient, and the radium in the precipitate can be measured by alpha or gamma spectrometry, or liquid scintillation dissolving the precipitate one with EDTA. In this work it is proposed a procedure for the radium measurement in water based on the coprecipitation with barium sulfate and in the detection by liquid scintillation. The precipitate of Ba(Ra)SO4 it is carried with water and blended with the liquid scintillator OptiPhase Hi Safe 3, avoiding the dissolution with EDTA. A 92± 1.4% of radium it was recovered and it was reached a minimum activity detectable of 4.2 ± 0.9 mBq-1. The procedure was essayed with natural mineral water with a knew activity in concentration of 226 Ra. The analytic result it coincided with the reported value with a relative error of 9%. (Author)

  1. Uranium and radium-226 in the environment of the post-uranium mining areas in Poland

    Kardas, M.; Suplinska, M.; Ciupek, K. [Central Laboratory for Radiological Protection (Poland)

    2014-07-01

    The work carried out under the project NCBiR - 'Technologies Supporting Development of Safe Nuclear Power Engineering'; Task 3: Meeting the Polish nuclear power engineering's demand for fuel - fundamental aspects. Depending on location, environmental components may have different concentration levels of radionuclides. Main source of uranium and radium in the natural environment is atmospheric precipitation of the material resulting weathering and erosion of older rocks, enhanced due to human activity by fertilizers used in agriculture and fossil fuel combustion. The waste heaps and dumps, especially derived from post-uranium mining and phosphate fertilizer industry are the another source of uranium and radium in the environment. Our studies include post-uranium mining areas (inactive mines and waste dumps) and those adjacent meadows and grassland at the area of the Giant Mountains (Karkonosze Mountains) in the south-west Poland. Samples of soil and mineral material from mine shafts, water samples from ponds, streams and small rivers and vegetation samples (grass, alfalfa, birch leaves) were analyzed. Also, similar samples from agricultural regions of Poland were examined as a reference level. Uranium isotopes were determined by radiochemical method (ion exchange and extraction) and activity measurement using alpha spectrometry. Concentration of {sup 226}Ra was determined radiochemically using emanation method. For the validation of the method, determinations of uranium isotopes and radium-226 in reference samples were performed. Depending on location, the different levels of activity concentration of analyzed radionuclides were detected. Samples from the mine shafts and dumps, both water and soil, were characterized by the activity concentrations of {sup 238}U and {sup 226}Ra even by several orders higher than outside of those areas. The concentrations of the radionuclides in the areas located in further distances from mine and dumps are similar to

  2. Uranium and radium-226 in the environment of the post-uranium mining areas in Poland

    The work carried out under the project NCBiR - 'Technologies Supporting Development of Safe Nuclear Power Engineering'; Task 3: Meeting the Polish nuclear power engineering's demand for fuel - fundamental aspects. Depending on location, environmental components may have different concentration levels of radionuclides. Main source of uranium and radium in the natural environment is atmospheric precipitation of the material resulting weathering and erosion of older rocks, enhanced due to human activity by fertilizers used in agriculture and fossil fuel combustion. The waste heaps and dumps, especially derived from post-uranium mining and phosphate fertilizer industry are the another source of uranium and radium in the environment. Our studies include post-uranium mining areas (inactive mines and waste dumps) and those adjacent meadows and grassland at the area of the Giant Mountains (Karkonosze Mountains) in the south-west Poland. Samples of soil and mineral material from mine shafts, water samples from ponds, streams and small rivers and vegetation samples (grass, alfalfa, birch leaves) were analyzed. Also, similar samples from agricultural regions of Poland were examined as a reference level. Uranium isotopes were determined by radiochemical method (ion exchange and extraction) and activity measurement using alpha spectrometry. Concentration of 226Ra was determined radiochemically using emanation method. For the validation of the method, determinations of uranium isotopes and radium-226 in reference samples were performed. Depending on location, the different levels of activity concentration of analyzed radionuclides were detected. Samples from the mine shafts and dumps, both water and soil, were characterized by the activity concentrations of 238U and 226Ra even by several orders higher than outside of those areas. The concentrations of the radionuclides in the areas located in further distances from mine and dumps are similar to the concentrations present in the

  3. 238U, 234U, 226Ra, 210Po concentrations of bottled mineral waters in Italy and their dose contribution

    Due to the importance of bottled mineral water in human diet with special regard to children in lactation period, a monitoring of natural radioactivity in some bottled mineral waters produced in Italy was performed. Gross alpha and beta activities and 226Ra, 238U, 234U, and 210Po concentrations were measured. Gross alpha and beta activities were determined by standards ISO 9696 and ISO 9697; for 226Ra determination liquid scintillation was used. The 238U and 234U concentrations were determined by alpha spectrometry after their separation from matrix by extraction chromatography and electroplating. 210Po was measured by alpha spectrometry. The results revealed that the concentrations (mBq L-1) of 226Ra, 238U, 234U, and 210Po ranged from -1; for infants (-1

  4. Concentration Of Th-228, Ra-226, Cs-137, and K-40 In Soil At Several Places In West Java Province

    Analysis of 228 Th, 226 Ra, 137 Cs, and 40K in the soil samples at several places in West Java Propince have been conducted. The measurements of 228 Th, 226 Ra, 137 Cs, and 40K concentration were done using gamma spectrometer with HP-Ge detector. The aim of the analysis is to obtain base line data on environmental radioactivity at several places in West Java Propince. The results of analysis showed that 228 Th concentration ranges from undetectable (226 Ra concentration ranges from undetectable (137Cs concentration ranges undetectable (40K concentration ranges from undetectable (< 1,36 Bq/kg) to (26,58 Bq/kg) with the average of (15,27 n 0,27 Bq/kg)

  5. Specific Activity of Radium-226 in Vegetables Grown in Na Mom District, Songkhla Province Using Gamma-ray Spectrometry

    Leaf vegetables were collected from Na Mom and Bang Klam Districts of Songkhla province. Samples were dried and then burned to be ash. The vegetable ashes were measured for Ra-226 using a gamma-ray spectrometer. Result showed that vegetables grown in Pijit, Thungkamin, Na mom and Klongrang sub-districts had the average Ra-226 specific activity of 759, 1,253, 810, and 937 mBq/kg, respectively. In comparison, this maximum Ra-226 content in vegetables from Na Mom sub-district is 7 times higher than those from Bang Klam sub-district (178 mBq/kg) and 20 times higher than the world average (50 mBq/kg)

  6. Biological characterization of PM226, a chromenoisoxazole, as a selective CB2 receptor agonist with neuroprotective profile.

    Gómez-Cañas, M; Morales, P; García-Toscano, L; Navarrete, C; Muñoz, E; Jagerovic, N; Fernández-Ruiz, J; García-Arencibia, M; Pazos, M R

    2016-08-01

    Cannabinoids have emerged as promising neuroprotective agents due to their capability to activate specific targets, which are involved in the control of neuronal homeostasis and survival. Specifically, those ligands that selectively target and activate the CB2 receptor may be useful for their anti-inflammatory and neuroprotective properties in various neurological disorders, with the advantage of being devoid of psychotropic effects associated with the activation of CB1 receptors. The aim of this work has been to investigate the neuroprotective properties of 7-(1,1-dimethylheptyl)-4,4-dimethyl-9-methoxychromeno[3,4-d]isoxazole (PM226), a compound derived from a series of chromeno-isoxazoles and -pyrazoles, which seems to have a promising profile related to the CB2 receptor. The compound binds selectively to this receptor with an affinity in the nanomolar range (Ki=12.8±2.4nM). It has negligible affinity for the CB1 receptor (Ki>40000nM) and no activity at the GPR55. PM226 was also evaluated in GTPγS binding assays specific to the CB2 receptor showing agonist activity (EC50=38.67±6.70nM). In silico analysis of PM226 indicated that it has a good pharmacokinetic profile and a predicted ability to cross the blood-brain barrier. Next, PM226 was investigated in an in vitro model to explore its anti-inflammatory/neuroprotective properties. Conditioned media were collected from LPS-stimulated cultures of BV2 microglial cell line in the absence or presence of different doses of PM226, and then media were added to cultured M213-2O neuronal cells to record their influence on cell viability evaluated using MTT assays. As expected, cell viability was significantly reduced by the exposure to these conditioned media, while the addition of PM226 attenuated this reduction in a dose-dependent manner. This effect was reversed by co-incubating with the CB2 antagonist SR144528, thus confirming the involvement of CB2 receptors, whereas the addition of PM226 to neuronal cultures

  7. Study of radon exhalation rate from different types of surfaces of building and activity of 226Ra in building materials

    Radon exhalation rate from different surfaces of ground floor vary from 0.95 -3.2 mBq.m-2.s-1. The average value in the first floor surface is 1.2 mBq.m-2.s-1 and exhalation from walls vary from 0.752 - 3.85 mBq.m-2s-1 and with a bare surface it is 5.49 mBq.m-2.s-1. The activity of 226Ra in building materials is estimated by using emanometer. The activity of 226Ra is low in sand (4.01 Bq.kg-1) and is high for granite (55 Bq.kg-1), and almost same in concrete and brick. The activity of 226 Ra in building materials is low compared to the global average. (author)

  8. An evaluation of 226Ra and 228Ra in drinking water in several counties in Texas, USA

    Naturally Occurring Radioactive Material (NORM) or Technology Enhanced Naturally Occurring Radioactive Material (TENORM) can be a potential health risk. It is now well known that the underlying geology in many parts of Texas has given rise to levels of 226Ra and 228Ra that often exceed the limits set by the US Environmental Protection Agency. A detailed literature search was undertaken to assess the levels of 226Ra and 228Ra in all of the Texas counties. Several statistical evaluations of the data were performed. The Hickory aquifer in the Llano Uplift region of Texas has consistently had the highest number of 226Ra and 228Ra concentrations above the legal limit. As well many of the affected rural communities may not have the financial resources to rectify the problem

  9. Concentration of natural radionuclides (40K, 228Ra and 226Ra) in vegetables and fruits collected around Kudankulam, South India

    Baseline activity concentration of the natural radio nuclides 40K, 228Ra and 226Ra in vegetables and fruits was determined around Kudankulam. In many of the samples, 228Ra and 226Ra was below minimum detection limit. 40K was found to be more in leafy vegetables followed by pods, tubers and fleshy fruits. The highest accumulator among the matrices was the leafy vegetables with the geometric mean of 189.47 Bq.kg-1 fresh for vegetables and fruits with the geometric mean of 128.95 Bq.kg-1 fresh. 228Ra activity in vegetables and fruits ranged from 0.074 to 1.153 and 0.074 to 0.131 Bq.kg-l fresh respectively. 226Ra in vegetables and fruits ranged from BDL to 0.07 and BDL-.044 Bq.kg-l fresh respectively. 40K in vegetables and fruits followed a log normal distribution. (author)

  10. Characterizing the transport of natural uranium and its decay product 226Ra, downstream from former mines in France

    Surface waters downstream from former uranium mines have been studied in order to characterize U and 226Ra transport and to assess their bioavailability. Filtrations and ultra-filtrations (UF) have been performed (0.45 μm / 0.2 μm / 500 kDa / 100 kDa / 10 kDa) and compared to the in situ technique, diffusive gradients in thin films (DGT). One of the study sites, a stream passing through a peat bog located in the vicinity of a former U mine, shows an increase in total U and a slight increase in 226Ra concentrations. While 226Ra is completely dissolved, U is mainly present as particles and colloids, the dissolved fraction reaching only about 5-20%. (authors)

  11. Measurement of the Natural Content of Th228, Ra226 and their Daughters in the Human Body

    The purpose of these investigations was the determination of both the content and the distribution of the alpha emitters radium-226, thorium-228 and polonium-210 in the human body. The content of radium-226 in human bones and soft tissues was determined by the emanation method, the content of polonium-210 by chemical enrichment followed by measuring the activity in a methane flow counter. The thorium-228 content as well as the total alpha activity was measured by means of a specially- developed scintillation method, the so-called mixing method. The content of radium-226 in human bones and organs related to the patient's age is performed in order to get information on the incorporation of this nuclide at continuous administration of extremely low amounts. As to bones and soft tissues the specific activity of radium-226 in man showed to be constant from the fourth month of pregnancy up to an age as high as 80 yr. The content of polonium-210 and lead-210 in femur and tibia bones was measured in order to determine the ratio of polonium-210 and lead-210 in the human skeleton of the living organism. This ratio is 0.8 on the average. The ratio of thorium-228 and radium-226 in human bone ashes is about 0.4. The age of the examined persons ranged from 5 to 70 yr. As a result of these investigations the human radiation burden caused by the radium-226, thorium-228 and polonium-210 content was estimated. (author)

  12. Transfer of 226Ra, 228Ra, 210Pb and 210Po in aquatic organisms and food chain

    Objective: To find out the transfer regularities of 226Ra, 228Ra, 210Pb and 210Po, which are natural radionuclides in the aquatic organisms and food chain. Methods: Large amount of breed of representative aquatic products and their living waters and sediments were collected and treated according to routine experimental procedures. The contents of 226Ra, 228Ra, 210Pb and 210Po were detected in each sample. Measured data were analyzed statistically and pairwise comparisons were made to determine the differences between groups. Results: 226Ra, 228Ra and 210Pb were mainly deposited in the bones (or shells), their concentration factors (CF) ranged from 102 to 103; the CF ranged only from 100 to 102 in the flesh. 210Po was mainly deposited in the soft tissues, CF ranged from 102 to 104; especially in the stomachs and intestines of fishes, the value reached 104. The cooking process did not impinge significantly on the transfer of 226Ra, 228Ra and 210Pb in the food chain (P>0.05), but did significantly influence the transfer of 210Po, especially in the freshwater fishes and shrimps. Paired comparison test of the activities between raw flesh and cooked flesh showed very significant difference (P226Ra, 228Ra, 210Pb and 210Po. Even though the bones (or shells) of aquatic organisms contained relatively higher levels of 226Ra, 228Ra and 210Pb, the cooking process does not significantly increase the radioactive contents in the foodstuffs. However, the cooking process does significantly influence the transfer of 210Po. It does significantly increase the content of 210Po in foodstuffs

  13. [CD226 monoclonal antibody induces variation of intracytosolic free calcium level in human umbilical vein endothelial cells].

    Chen, Li-Hua; Liu, Xue-Song; Liu, Fei; Jin, Bo-Quan

    2003-06-25

    In order to study the possible mechanism of CD226 monoclonal antibody (mAb)-mediated intracellular message transduction in human umbilical vein endothelial cells (HUVECs), the influence of CD226 mAb and its cross-linking by secondary antibody (II Ab) on the concentration changes in [Ca(2+)](i) in the HUVECs under different conditions were determined by confocal laser scanning microscopy. The main results are as follows. (1) When the culture medium was balanced by Hanks Buffer, [Ca(2+)](i) in HUVECs increased slowly after stimulation by CD226 mAb, whereas [Ca(2+)](i) increase was accompanied by [Ca(2+)](o) decrease after the mAb was cross-linked by goat anti-mouse IgG. Then [Ca(2+)](i) and [Ca(2+)](o) all returned to the normal level. (2) When the culture medium was balanced by D-Hanks buffer, [Ca(2+)](i) in HUVECs showed little variation when the cells were stimulated by CD226 mAb, but [Ca(2+)](i) decreased markedly after cross-linking. (3) When HUVECs were pretreated with EGTA, there was no variation in [Ca(2+)](i) of HUVECs after CD226 mAb stimulation alone or cross-linking of the mAb. Our results suggest that stimulation by CD226 mAb and cross-linking by goat anti-mouse IgG induce the variation of [Ca(2+)](i) in HUVECs under different conditions and the variation of [Ca(2+)](i) in HUVECs may play an important role in many physiological and pathological processes. PMID:12817306

  14. Simultaneous determination of gross alpha, gross beta and 226Ra in natural water by liquid scintillation counting

    The determination of gross alpha, gross beta and 226Ra activity in natural waters is useful in a wide range of environmental studies. Furthermore, gross alpha and gross beta parameters are included in international legislation on the quality of drinking water [Council Directive 98/83/EC]. In this work, a low-background liquid scintillation counter (Wallac, Quantulus 1220) was used to simultaneously determine gross alpha, gross beta and 226Ra activity in natural water samples. Sample preparation involved evaporation to remove 222Rn and its short-lived decay daughters. The evaporation process concentrated the sample ten-fold. Afterwards, a sample aliquot of 8 mL was mixed with 12 mL of Ultima Gold AB scintillation cocktail in low-diffusion vials. In this study, a theoretical mathematical model based on secular equilibrium conditions between 226Ra and its short-lived decay daughters is presented. The proposed model makes it possible to determine 226Ra activity from two measurements. These measurements also allow determining gross alpha and gross beta simultaneously. To validate the proposed model, spiked samples with different activity levels for each parameter were analysed. Additionally, to evaluate the model's applicability in natural water, eight natural water samples from different parts of Spain were analysed. The eight natural water samples were also characterised by alpha spectrometry for the naturally occurring isotopes of uranium (234U, 235U and 238U), radium (224Ra and 226Ra), 210Po and 232Th. The results for gross alpha and 226Ra activity were compared with alpha spectrometry characterization, and an acceptable concordance was obtained

  15. Risk of 226 Ra ingestion due to water consumption from phosphatic regions of the Northeast of Brazil

    Geological survey performed in the coastal region of the Northeast of Brazil showed presence of uranium phosphate deposits in a land strip corresponding to the Pernambuco-Paraiba sedimentary basin. The local population uses the water that crosses phosphate area, with higher than normal concentration of uranium and its progeny. this work is aimed to determine the cancer risk, based on the rate of ingestion the 226 Ra due to water consumption. The results of the analyses showed increments of 7% for head sarcoma and 3% for osteosarcomas occurrences due to 226 Ra ingestion for the local population. (author)

  16. Radioactivity of Natural Nuclides (40K, 238U, 232Th, 226Ra) in Coals from Eastern Yunnan, China

    Xin Wang; Qiyan Feng; Ruoyu Sun; Guijian Liu

    2015-01-01

    The naturally occurring primordial radionuclides in coals might exhibit high radioactivity, and can be exported to the surrounding environment during coal combustion. In this study, nine coal samples were collected from eastern Yunnan coal deposits, China, aiming at characterizing the overall radioactivity of some typical nuclides (i.e., 40K, 238U, 232Th, 226Ra) and assessing their ecological impact. The mean activity concentrations of 238U, 232Th, 40K and 226Ra are 63.86 (17.70–92.30 Bq· kg-...

  17. ANNEXIN A1 N-TERMINAL DERIVED PEPTIDE AC2-26 EXERTS CHEMOKINETIC EFFECTS ON HUMAN NEUTROPHILS

    MauroPerretti

    2012-02-01

    Full Text Available It is postulated that peptides derived from the N-terminal region of Annexin A1, a glucocorticoid-regulated 37-kDa protein, could act as biomimetics of the parent protein. However, recent evidence, amongst which the ability to interact with distinct receptors other then that described for Annexin A1, suggest that these peptides might fulfil other functions at variance to those reported for the parent protein. Here we tested the ability of peptide Ac2-26 to induce chemotaxis of human neutrophils, showing that this peptide can elicit responses comparable to those produced by the canonical activator formyl-Met-Leu-Phe (or FMLP. However, whilst disruption of the chemical gradient abolished the FMLP response, addition of peptide Ac2-26 in the top well of the chemotaxis chamber did not affect (10 µM or augmented (at 30 µM the neutrophil locomotion to the bottom well, as elicited by 10 µM peptide Ac2-26. Intriguingly, the sole addition of peptide Ac2-26 in the top wells produced a marked migration of neutrophils. A similar behaviour was observed when human primary monocytes were used. Thus, peptide Ac2-26 is a genuine chemokinetic agent towards human blood leukocytes. Neutralization strategies indicated that engagement of either the GPCR termed FPR1 or its cognate receptor FPR2/ALX was sufficient to sustain peptide Ac2-26 induced neutrophil migration. Similarly, application of pharmacological inhibitors showed that cell locomotion to peptide Ac2-26 was mediated primarily by the ERK, but not the JNK and p38 pathways. In conclusion, we report here novel in vitro properties for peptide Ac2-26, promoting neutrophil and monocyte chemokinesis, a process that may contribute to accelerate the resolution phase of inflammation. Here we postulate that the generation Annexin A1 N-terminal peptides at the site of inflammation may expedite the egress of migrated leukocytes thus promoting the return to homeostasis.

  18. A comparative study of 226Ra determination using total counting and alpha spectrometry in environmental water samples

    The quick determination of natural radionuclides is very important in emergency situations, supporting decisions of environmental contamination prevention. A quick methodology for determination of the 226Ra was applied in water samples and the results were compared to those obtained by the conventional method. The technique is based on the microprecipitation of radio barium sulfate and subsequent quantification of 226Ra by alpha spectrometry. The procedure used presented high chemical recoveries and good sensitivity. The main advantage is to obtain the results in 3 days. (author)

  19. The average concentrations of 226Ra and 210Pb in foodstuff cultivated in the Pocos de Caldas plateau

    The average concentrations of 226Ra and 210Pb in vegetables cultivated in the Pocos de Caldas plateau, mainly potatoes, carrots, beans and corn and the estimation of the average transfer factors soil-foodstuff for both radionuclides, were performed. The total 226Ra and 210Pb content in the soil was determined by gamma spectrometry. The exchangeable fraction was obtained by the classical radon emanation procedure and the 210Pb was isolated by a radiochemical procedure and determined by radiometry of its daughter 210Bi beta emissions with a Geiger Muller Counter. (M.A.C.)

  20. A computer program integrating a multichannel analyzer with gamma analysis for the estimation of 226 Ra concentration in soil samples

    A new hardware/software system has been implemented using the existing three-regions-of-interest method for determining the concentration of 226Ra in soil samples for the Pollutant Assessment Group of the Oak Ridge National Laboratory. Consisting of a personal computer containing a multichannel analyzer, the system utilizes a new program combining the multichannel analyzer with a program analyzing gamma-radiation spectra for 226Ra concentrations. This program uses a menu interface to minimize and simplify the tasks of system operation

  1. Determination of 228Th, 226Ra and 40K in Soil Using In-Situ GammaSpectrometer

    Determination of natural radionuclide in latosol soil at six locationsaround PPTN Serpong by using Inspector portable gamma spectrometer with highpurity Germanium detector (HPGe) which has 26% relative efficiency had beenobtained. Radionuclides data of 228Th, 226Ra and 40K were obtained in4 hours, shorter than laboratories analysis which needed 3 weeks. Thedifferences between in-situ measurement and laboratory were 3.6% to 56.2% forsix conditions of soil measured. According to the specific activity dataanalysis using statistic hypothesis, the result shows that the activity of228Th and 226Ra are independent on location, but 40K is dependent onlocation. (author)

  2. A226V mutation in virus during the 2007 chikungunya outbreak in Kerala, India.

    Kumar, N Pradeep; Joseph, Rajan; Kamaraj, T; Jambulingam, P

    2008-08-01

    Kerala State in India was gripped by a renewed and widespread outbreak of Chikungunya virus (CHIKV) infection during 2007. Here, we report the A226V mutation in the glycoprotein envelope 1 (E1) gene of the virus among isolates collected from the three worst-affected districts of the state during this outbreak. This mutation had already been suggested to be directly responsible for a significant increase in CHIKV infectivity in Aedes albopictus. The badly affected districts in Kerala State during 2007 have abundant rubber plantations, which supported prolific breeding of Ae. albopictus mosquitoes. The abundance of Ae. albopictus in the region and molecular evolution of CHIKV may be contributing factors for the renewed epidemic of chikungunya fever during 2007. PMID:18632966

  3. Oscillator strengths for Fe II transitions at 224.918 and 226.008 nanometers

    Bergeson, S. D.; Mullman, K. L.; Lawler, J. E.

    1994-01-01

    We report accurate experimental absorption oscillator strengths (f-values) for transitions out of the ground level of Fe II to the Z(sup 4)D(sup 0 sub 7/2) and z(sup 4)F(sup 0 sub 9/2) levels at 224.918 and 226.008 nm (air wavelengths) to be 0.00182(14) and 0.00244(19), respectively. The number in parenthesis is the uncertainty in the last digits. These two lines are important for studying Fe abundances and grain depletions in the interstellar medium. These f-values are determined by combining emission branching fractions with radiative lifetimes. Branching fractions are measured using classical spectroradiometry on an optically thin source. Radiative lifetimes are from the literature.

  4. Concentration of Ra-226 in Malaysian Drinking and Bottled Mineral Water

    The concentration of the radionuclide 226Ra was determined in the drinking water which was taken from various sources. It was found that the concentration varies from non-detectable (ND) to highest value of 0.30 Bq per liter. The concentration was found to be high in mineral water as compare with surface water such as domestic pipe water. Some of these values have exceeded the EPA (Environmental Protection Agency) of America regulations. The activity concentrations obtained are compared with data from other countries. The estimated annual effective doses from drinking the water are determined. The values obtained range from 0.02 mSv to about 0.06 mSv per year.

  5. Soil to plant transfer of 226Ra in a marsh area; Modelling application

    The Odiel river forms an estuarine system which surrounds a large marsh area. A phosphate fertilizer processing complex releases its wastes into the estuary. The presence of 226Ra in soils and plants (Spartina Densiflora) from the marsh has been investigated. Concentrations up to 700 and 15 mBq g-1 have been detected in soil and plant samples, respectively. Soil to plant concentration ratios have been calculated and some activity ratios have also been investigated. A model which is able to simulate the dispersion of radionuclides in the marsh has been applied. The model includes the exchange of radionuclides between water and the solid phase (suspended matter and bottom sediments) and the transfer of radionuclides to the plants. Model results are, in general, in good agreement with measurements. (Copyright (c) 1998 Elsevier Science B.V., Amsterdam. All rights reserved.)

  6. Assessment of radium-226 in two cases of radium luminizers using whole-body counting

    Two technicians from Kuwait working in dial painting were measured by the Egyptian A.E.E. whole-body counter in order to assess radium luminizers' activity and the corresponding dose delivered. In this case, the fraction of radon built up in the body had expired and the quoted values of radium were obtained by the measured content of 214Bi. Also, two normal persons from the same area having the same body build were measured to assess their levels of 137Cs and potassium to be taken as background for the incorporated persons. In spite of the decrease in radium-226 activity with time, there was an increase of the activity of its products which led to the increase of the assessed dose. The dose estimated has been calculated after 50 yr representing the life span of the individuals. (author)

  7. Radium-226-induced bone lesions in beagle dogs treated by amputation: clinical, radiological, and histologic observations

    Within a colony of beagle dogs that had received intravenous injections of 226Ra there was a subgroup of dogs, each of which developed a painful lesion of a long bone. These bone lesions had their inception in bizarre, progressively expansile resorption cavities in which the process of normal bone tissue replacement was defective. On occasion, bone sarcomas arose in some of the sites of perturbed bone repair. This radiation-induced disturbance of the normal bone remodeling process with its preneoplastic spectrum of radiographic and histologic lesions was termed radiation-osteodystrophy. Lesions were studied by sequential radiography prior to the onset of clinical signs. Because of the painful nature of the lesion and difficulty experienced by the dogs in walking, full leg amputations were performed. This not only provided relief from clinical signs, but also permitted the dog to continue to live, allowing study of subsequently identified radiation-induced lesions

  8. Radon tightness of different sample sealing methods for gamma spectrometric measurements of 226Ra

    Different methods for sealing sample containers for 222Rn when measuring 226Ra through its progenies 214Pb and 214Bi using gamma-ray spectrometry have been investigated. Results show that a method consisting of vacuum packaging of the sample container in a sealed aluminium lined bag gives excellent results for ensuring radon tightness. However, care should be taken to fill the sample container completely in order to avoid systematic errors due to radon accumulating in the void volume. - Highlights: • Simple and practical sample container sealing methods for 222Rn have been studied. • A novel vacuum packaging method is accurate, practical and cost-effective. • Void volumes in the container should be avoided to prevent systematic influences

  9. Prompt γ-rays emitted in fission of 226Ra by 12 MeV protons

    The total energy associated with the emission of prompt γ-rays in fission of 226Ra induced by 12 MeV protons was measured in correlation with the fragment mass and kinetic energy. The dependence of the average total γ-ray energy on fragment mass and total kinetic energy resembles the corresponding dependence of the average number of neutrons. Using these results and the results for the average number of neutrons, the excitation energy of the fragments at the scission point was calculated. The results support the view that the scission-point configuration for the symmetric fission mode is more elongated than that for the asymmetric mode. (B.G.)

  10. Method for determination of radium-226 in water by liquid scintillation counting

    The chemical procedure involves the isolation or radium from the sample solution by co-precipitation with lead sulphate. The precipitate is dissolved in alkaline DTPA. The radium isotopes are separated from other radionuclides by co-precipitation with barium sulphate. The barium/radium precipitate is dissolved in alkaline EDTA, the solution is transfered to a liquid scintillation vial and the organic scintillant is added. After sealing, the sample is left until equilibrium between Ra-226 and Rn-222 is established or until a suitable ingrowth time has elapsed. The alpha activity of Rn-222 and its short-lived daughters, Po-218 and Po-214, are measured by the use of a commercial liquid scintillation counter. By using the following procedure and a low level LSC a lover limit of detection of 2 mBq/sample can be achieved

  11. Computer-controlled system for rapid soil analysis of 226Ra

    A computer-controlled multichannel analysis system has been developed by the Radiological Survey Activities Group at Oak Ridge National Laboratory (ORNL) for the Department of Energy (DOE) in support of the DOE's remedial action programs. The purpose of this system is to provide a rapid estimate of the 226Ra concentration in soil samples using a 6 x 9-in. NaI(Tl) crystal containing a 3.25-in. deep by 3.5-in. diameter well. This gamma detection system is controlled by a mini-computer with a dual floppy disk storage medium. A two-chip interface was also designed at ORNL which handles all control signals generated from the computer keyboard. These computer-generated control signals are processed in machine language for rapid data transfer and BASIC language is used for data processing

  12. Transfer of radium-228, thorium-228 and radium-226 from forage to cattle and reindeer

    Concentrations of radium-228, thorium-228 and radium-226 were measured in different natural forage materials and in feed supplements. The activity concentrations of these nuclides were then determined in the bones of domestic farm animals, with emphasis on their distributions within the skeleton and humerus. Feeds added in recent years to the forage of domestic animals alter the concentrations of the naturally occurring radionuclides. The modified daily radium uptakes associated with the various feeds are reflected in the radium concentrations observed in the different layers of the humerus. Radium uptake and retention are highly dependent on calcium metabolism. We propose a method for calculation of nuclide retention coefficients via an approach which simplifies their assessment and provides important information on radium metabolism. The data obtained here are of value in dosimetric assessments related to these natural radionuclides. (author)

  13. Laser-trapping of Ra-225 and Ra-226 with repumping by room temperature blackbody radiation

    Guest, J R; Bailey, K; Greene, J P; Holt, R J; Lu, Z T; O'Connor, T P; Potterveld, D H; Scielzo, N D

    2007-01-01

    We have demonstrated Zeeman slowing and capture of neutral Ra-225 and Ra-226 atoms in a magneto-optical trap (MOT). The intercombination transition 1S0-3P1 is the only quasi-cycling transition in radium and was used for laser-cooling and trapping. Repumping along the 3D1-1P1 transition extended the lifetime of the trap from milliseconds to seconds. Room-temperature blackbody radiation was demonstrated to provide repumping from the metastable 3P0 level. We measured the isotope shift and hyperfine splittings on the 3D1-1P1 transition with the laser-cooled atoms, and set a limit on the lifetime of the 3D1 level based on the measured blackbody repumping rate. Laser-cooled and trapped radium is an attractive system for studying fundamental symmetries.

  14. Laser trapping of 225Ra and 226Ra with repumping by room-temperature blackbody radiation.

    Guest, J R; Scielzo, N D; Ahmad, I; Bailey, K; Greene, J P; Holt, R J; Lu, Z-T; O'Connor, T P; Potterveld, D H

    2007-03-01

    We have demonstrated Zeeman slowing and capture of neutral 225Ra and 226Ra atoms in a magneto-optical trap. The intercombination transition 1S0-->3P1 is the only quasicycling transition in radium and was used for laser-cooling and trapping. Repumping along the 3D1-->1P1 transition extended the lifetime of the trap from milliseconds to seconds. Room-temperature blackbody radiation was demonstrated to provide repumping from the metastable 3P0 level. We measured the isotope shift and hyperfine splittings on the 3D1-->1P1 transition with the laser-cooled atoms, and set a limit on the lifetime of the 3D1 level based on the measured blackbody repumping rate. Laser-cooled and trapped radium is an attractive system for studying fundamental symmetries. PMID:17359153

  15. Adopted levels and derived limits for Ra-226 and the decision making processes concerning TENORM releases

    A fraction of a primary dose limit can be, in general, agreed upon as a dose related level to be adopted in decision-making processes. In the case of TENORM releases, fractions of primary dose levels for 226Ra, 228Ra, and 210Po may be of particular importance to establish adopted levels and derived limits to guide decision making processes. Thus, for example, a registration level for 226Ra could be adopted at the highest portion of the natural background variation. Above such level, intervention and remedial action levels could also be adopted. All those levels would be fractions of the primary level, but translated in terms of derived limits expressed in practical units. Derived limits would then be calculated by using environmental models. In such approach 'critical groups' would have to be carefully defined and identified. In addition, the size of a critical group would be chosen to be used in environmental modeling. Site specific environmental models and parameters are desirable, though unavailable, or very difficult to obtain, in most cases. Thus, mathematical models and parameters of more generic nature are often used. A sensitive parametric analysis can make a ranking of the parameters used in a model, allowing one to choose how important each parameter will be for the model output. The paper will point out that when using the adopted levels and derived limits, as suggested above, the uncertainties and importance of the parameters entering an environmental model can make the difference for decision makers to take the right or wrong decision, as far as radiological protection is concerned. (author)

  16. 226Ra and 222Rn in geothermal waters of the Carpathian Basin

    Complete text of publication follows. Due to favourable geology of the Carpathian many natural springs and drilled wells produce geothermal waters enriched in minerals. They represent significant economic and therapeutic value on which world famous bathing places developed in past centuries. Chemical composition of these waters has been extensively studied but less attention was paid to their radioactivity. Radon and radium content of waters may be interesting from different points of view. First, too much radon and radium in drinking water may pose health risk for humans. Second, radon and radium can be useful in tracing underground water transport. Therefore, cheap, reliable and accurate measurement of their concentrations has a great value. Etched track detector based simple method was developed in the Institute of Nuclear Research, Debrecen in the las years [1, 2]. In this work the radium and radon contents of thermal water of the springs and wells of the Gellert, Rac and Lukacs Baths as well as of the Rudas Drinking Hall in Budapest were measured. Samples from drinking-water wells of Feked, Szebeny, Vemend (near the Mecsek Mountain in Transdanubian region of Hungary) and about 50 mineral water samples were collected in Hargitha Country, Transylvania of Romania; in Slovenia and in the Great Hungarian Plain. The majority of the Romanian and Slovenian mineral waters have from low to moderate 226Ra activity concentration (-3). The Hungarian geothermal waters show higher values up to some kBqm-3. 222Rn and 226Ra determination of other well-known medical waters are planned. Further studies of commercially available bottled mineral waters and of dosimetric consequences due to daily consume of these measured waters are in progress. This work was supported by the National Scientific Research Fund, No. T-22985. (author)

  17. 228Ra and 226Ra measurement on a BaSO4 co-precipitation source

    One of the most commonly-used methods for determination of 226Ra, particularly in water samples, utilises co-precipitation of Ra with BaSO4, followed by microfiltration to produce a source for alpha counting. This paper describes two extensions to BaSO4 co-precipitation methods which enable determination of 228Ra using the same source. The adaptations presented here do not introduce any contaminants that will affect the separation of radium or alpha counting for 226Ra, and can be used for re-analysis of already existing sources prepared by BaSO4 co-precipitation. The first adaptation uses detection of 228Ac on the source by gamma spectrometry. The detection efficiency is high, allowing analysis of water samples at sufficiently low activity to be suitable in testing for compliance with drinking water quality standards. As 228Ac grows in quickly, taking less than 2 days to reach equilibrium with the 228Ra parent, this can also be useful in radiological emergency response situations. The second adaptation incorporates a method for the digestion of BaSO4 sources, allowing separation of thorium and subsequent determination of 228Th activity. Although ingrowth periods for 228Th can be lengthy, very low detection limits for 228Ra can be achieved with this technique. - Highlights: • We developed two methods for 228Ra measurement on Ba(Ra)SO4 co-precipitation sources. • Measurement by gamma spectrometry using the daughter 228Ac is rapid. • Detection limits are suitable for assessment of drinking water quality. • The second approach uses alpha spectrometry on a separated Th fraction. • This is more sensitive than gamma spectrometry after an ingrowth period greater than about 1 month

  18. Radiation safety in Radium-226 spent sources conditioning operations in Cuba

    Full text: In the past Radium-226 sources have been used in several applications all over the world. Because of their unfavourable radioactive characteristics and those of their progeny, specially of Radon-222 radioactive gas, the conditioning of them for safe storage until disposal can be made, have been recommended. In 1991 the International Atomic Energy Agency (IAEA) established a Spent Radiation Sources Programme, with the purpose to assist Member States. This program includes one activity specifically related to the spent radium sources conditioning for safe storage. This radium spent sources conditioning methodology consists on encapsulation of sources in a stainless steel capsule, which become then a new sealed radioactive source. In that way the future retrieval of the capsule for disposal is possible. Recently our country received Agency's technical assistance, through the provision of the necessary equipment and devices to perform the operations and an IAEA expert mission to supervise these operations, which were carried out on July 2007. This paper describes the Radiation Protection Program (RPP) designed to carry out the conditioning works of more than 1000 Radium-226 spent sources, with an estimated total activity of 178 GBq. The operations were performed in the Radioactive Waste Management facilities of the Centre for Radiation Protection and Hygiene (CPHR). The designed program allowed CPHR to get the Cuban Regulatory Body authorization to carry out operations for conditioning the whole planned source inventory. The results of the application of RPP demonstrate its effectiveness, as the operations were carried out without radiological events that could cause impact on workers, on members of the public or on the environment. The individual monitoring performed, covered the internal and external dosimetry (Hp(10), Hp(0,07), Hp(0,03)) and the values estimated did not exceed in any case the dose constraints for these works. (author)

  19. Microbial release of 226Ra2+ from (Ba,Ra)SO4 sludges from uranium mine wastes

    226Ra2+ is removed from uranium mine effluents by coprecipitation with BaSO4. (Ba,Ra)SO4 sludge samples from two Canadian mine sites were found to contain active heterotrophic populations of aerobic, anaerobic, denitrifying, and sulfate-reducing bacteria. Under laboratory conditions, sulfate reduction occurred in batch cultures when carbon sources such as acetate, glucose, glycollate, lactate, or pyruvate were added to samples of (Ba,Ra)SO4 sludge. No external sources of nitrogen or phosphate were required for this activity. Further studies with lactate supplementation showed that once the soluble SO4(2-) in the overlying water was depleted, Ba2+ and 226Ra2+ were dissolved from the (Ba,Ra)SO4 sludge, with the concurrent production of S2-. Levels of dissolved 226Ra2+ reached approximately 400 Bq/liter after 10 weeks of incubation. Results suggest that the ultimate disposal of these sludges must maintain conditions to minimize the activity of the indigenous sulfate-reducing bacteria to ensure that unacceptably high levels of 226Ra2+ are not released to the environment

  20. 226Ra Concentration of Hungarian Bottled Mineral Waters and Estimation of the Dose Deriving from Their Consumption

    Full text: The concentration of 226Ra was measured in most of the bottled mineral waters commercially available in Hungary. The 226Ra concentration exceeded the 100 mBqL-1 value in six cases out of the investigated 29 types of mineral waters. In most of the cases, 226Ra concentration does not reach the 100 mBqL-1 value. 100-800 mBqL-1 values were found in five cases and 3 BqL-1 was measured in one case. This concentration means 0.3 mSvyear-1 dose load in case of 1 Lday-1 consumption, but in case of children (12-17 years old populace) it can reach the 1.6 mSvyear-1. When measuring the 226Ra concentration in soft drinks made from this latter mineral water, 2.6 BqL-1 concentration was determined which means 1.4 mSvyear-1 dose load in the 12-17 years age-group when 1 Lday-1 is consumed from these drinks. (author)

  1. 12 CFR Appendix J to Part 226 - Annual Percentage Rate Computations for Closed-End Credit Transactions

    2010-01-01

    ... Method (1) General Rule The annual percentage rate shall be the nominal annual percentage rate determined... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Annual Percentage Rate Computations for Closed... Appendix J to Part 226—Annual Percentage Rate Computations for Closed-End Credit Transactions...

  2. 12 CFR Appendix L to Part 226 - Assumed Loan Periods for Computations of Total Annual Loan Cost Rates

    2010-01-01

    ... borrower to become obligated on the reverse mortgage loan, as shown in the U.S. Decennial Life Tables for... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Assumed Loan Periods for Computations of Total Annual Loan Cost Rates L Appendix L to Part 226 Banks and Banking FEDERAL RESERVE SYSTEM...

  3. Geochemical Speciation of Soil 7Be,137Cs,226Ra and 228Ra as Tracers to Particle Trnsport

    BALZHANGUO; WANGUOJIANG; 等

    1997-01-01

    A brunisolic soil collected from an erosive forest land(HF-1-1) and a yellow soil from and accumulative shallow basin(HF-6-1) in the watershed of Lake Hongfeng (HF) were used for activity measurements of 7Be,137Cs,226Ra and 228Ra in different geochemical speciation.More than 85% of 7Be,137Cs,226Ra and 228Ra in the soils were bound to organic Fe-Mn oxy-hydroxide and residual fractions.They could move with soil particlesw and be used as tracers for the erosion and /or accumulation of soil particles.7Be gohemical specition in the soils agreed with its trace for seasonal particle transport.137Cs geohemial speciaiton was suitable for tracing soil particle accumulation and for sediment aating.226Ra and 228Ra were ombined in crystalline skeleton of clay minerals and mainly remained as residues in the soils and little was bound to the soluble,exchangeable and carbonate fractions.The differentiation of 226 Ra/228Ra activity ratios in different geoheical fractions in the soils could be used as a parameter to trace accumulation and /or erosion of soil particles.

  4. Activity concentrations of 226Ra, 232Th and 40K in brands of fertilisers used in Nigeria

    The activity concentration of naturally occurring radionuclides 40K, 226Ra and 232Th have been measured in different brands of fertiliser samples sold to farmers in retail markets in six commercial cities in southwestern Nigeria. Gamma ray spectroscopy was employed in the measurements of these radionuclides. The results of measurements showed that the average activity concentration of 40K in the nitrogen, phosphorus and potassium fertilisers across the cities varied from 3972.0 ±416.9 to 5089.3 ±111.3 Bq kg-1, 9.9 ±7.3 to 450.6 ±14.3 Bq kg-1 for 226Ra, while for 232Th it varied from less than lower limit of detection to 15.1 ±2.8 Bq kg-1. The activity concentrations of 40K, 226Ra and 232Th in single super phosphate (SSP) fertilisers and phosphate rocks were also determined. However, high activity concentrations of 226Ra were obtained in the SSP fertiliser and phosphate rocks and in particular, two brands of fertilisers from ITL/TAK and F and C companies. The values of the activity concentration of the radionuclides in the brands of fertilisers used in Nigeria are within the range of values reported in several other countries except 40K. (authors)

  5. 27 CFR 70.226 - Suspension of running of period of limitation; taxpayer outside of United States.

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 2 2010-04-01 2010-04-01 false Suspension of running of... Limitations § 70.226 Suspension of running of period of limitation; taxpayer outside of United States. The running of the period of limitations on collection after assessment prescribed in 26 U.S.C. 6502...

  6. Elimination of natural uranium and {sup 226}Ra from contaminated waters by rhizofiltration using Helianthus annuus L

    Vera Tome, F. [Departamento de Fisica Aplicada, Facultad de Ciencias, Universidad de Extremadura, 06071 Badajoz (Spain)], E-mail: fvt@unex.es; Blanco Rodriguez, P. [Departamento de Fisica, Facultad de Ciencias, Universidad de Extremadura, 06071 Badajoz (Spain); Lozano, J.C. [Laboratorio de Radiactividad Ambiental, Facultad de Ciencias, Universidad de Salamanca, 37008 Salamanca (Spain)

    2008-04-15

    The elimination of natural uranium and {sup 226}Ra from contaminated waters by rhizofiltration was tested using Helianthus annuus L. (sunflower) seedlings growing in a hydroponic medium. Different experiments were designed to determine the optimum age of the seedlings for the remediation process, and also to study the principal way in which the radionuclides are removed from the solution by the sunflower roots. In every trial a precipitate appeared which contained a major fraction of the natural uranium and {sup 226}Ra. The results indicated that the seedlings themselves induced the formation of this precipitate. When four-week-old seedlings were exposed to contaminated water, a period of only 2 days was sufficient to remove the natural uranium and {sup 226}Ra from the solution: about 50% of the natural uranium and 70% of the {sup 226}Ra were fixed in the roots, and essentially the rest was found in the precipitate, with only very small percentages fixed in the shoots and left in solution.

  7. 226Ra, 210Pb and 210Po levels in marine biota and surface coastal sediments from the Red sea, Sudan

    This paper presents data on 226Ra, 210Pb and 210Po activity concentration levels in multicellular marine algae, molluscs, coral as well as in surface marine sediments collected from the shallower waters of the fringing reefs area extending towards north and south (flamingo bay) of Port Sudan harbour. The analyses were performed adopting a simple time efficient method combining alpha-spectrometry, liquid scintillation and Cerenkov counting technique. generally speaking, surface sediments from this coastal region are poor in their radioactivity content in contrast to similar data reported form different coastal areas around the globe. There is surface enrichment of 210Pb and 210Po with respect to their progenitor 226Ra as it is evident form the activity ratios of 210Pb/226Ra (3.03±1.79) and 210Pb/226Ra (2.23±1.56). Among marine plants and animals investigated, the green algae species, Halimeda, and coral species, Favites, show substantial concentration of radium at 8.2 Bq/kg and 21.9 Bq/kg dry weight, respectively. Similarly, the highest concentration of 210Po was met in the favites at 38.7 Bq/kg followed by brown algae, cytoseria sp., at 32.6 Bq/kg. There is no variation seen among algal species for 210Pb uptake, however, converse to radium and polonium, favites (coral) was found to contain the minimum concentration of lead (3.88). In most species there is preferential accumulation of polonium over its parent radium as indicated by 210Po:226Ra activity ratio with cytoseria (brown algae) showing the highest value at 8.81. On the other hand, 210Po:220Pb activity concentration ratio revealed that coral species favites (9.97) and the brown algae sargassum (1.85) have a greater tendency to accumulate 210Po over220Pb, while in the rest of the species; this ratio is less than unity. (Author)

  8. Review of the distribution of 210Pb in the world oceans and 210Pb/226Ra ratio as scavenging tracer

    It was first shown by Rama et al. (1961) that 210Pb has a very short residence time and is remove quickly from the surface waters by suspended particulate matter. Since the first application of the daughter-parent pair in the 238U series (210Pb/226Ra) for deep-scavenging studies by Craig et al (1973), a number of vertical profiles from major ocean basins have been published to investigate the residence time and scavenging rates of 210Pb. The vertical distributions of 210Pb in the deep-ocean vary widely, depending on its supply rates (the atmospheric deposition rate of 210Pb and production from 226Ra) and the intensity of scavenging. The inventories of 210Pb in the 3 distinct zones of the deep ocean (epipelagic, mesopelagic and bathypelagic zones) will be assessed and compared to the total supply rates. The variations in the scavenging intensities in these three zones will be assessed and presented. The inventory of 210Pb in the euphotic zone will be compared to the global atmospheric fallout data and the relative contribution of advection, production from 226Ra and atmospheric depositional input to the 210Pb inventory will be discussed. Evaluation of the distinct differences between different ocean basins in the supply rates as well as the scavenging intensities of 210Pb is assessed and the results will be presented. Using the 210Pb/226Ra ratios in the water column the scavenging residence times obtained for different ocean basins will be compared. The utility of 210Pb-226Ra pair towards studying boundary scavenging, sediment focusing/erosion, and settling velocity of particles based on the water column profiles, sediment trap data and inventories of 210Pb in sediments will also be presented. The utility of 210Pb as a tracer for other lithogenic elements in the marine environment will be discussed and the results will be summarized. (author)

  9. Analysis of radium-226 in high salinity wastewater from unconventional gas extraction by inductively coupled plasma-mass spectrometry.

    Zhang, Tieyuan; Bain, Daniel; Hammack, Richard; Vidic, Radisav D

    2015-03-01

    Elevated concentration of naturally occurring radioactive material (NORM) in wastewater generated from Marcellus Shale gas extraction is of great concern due to potential environmental and public health impacts. Development of a rapid and robust method for analysis of Ra-226, which is the major NORM component in this water, is critical for the selection of appropriate management approaches to properly address regulatory and public concerns. Traditional methods for Ra-226 determination require long sample holding time or long detection time. A novel method combining Inductively Coupled Mass Spectrometry (ICP-MS) with solid-phase extraction (SPE) to separate and purify radium isotopes from the matrix elements in high salinity solutions is developed in this study. This method reduces analysis time while maintaining requisite precision and detection limit. Radium separation is accomplished using a combination of a strong-acid cation exchange resin to separate barium and radium from other ions in the solution and a strontium-specific resin to isolate radium from barium and obtain a sample suitable for analysis by ICP-MS. Method optimization achieved high radium recovery (101 ± 6% for standard mode and 97 ± 7% for collision mode) for synthetic Marcellus Shale wastewater (MSW) samples with total dissolved solids as high as 171,000 mg/L. Ra-226 concentration in actual MSW samples with TDS as high as 415,000 mg/L measured using ICP-MS matched very well with the results from gamma spectrometry. The Ra-226 analysis method developed in this study requires several hours for sample preparation and several minutes for analysis with the detection limit of 100 pCi/L with RSD of 45% (standard mode) and 67% (collision mode). The RSD decreased to below 15% when Ra-226 concentration increased over 500 pCi/L. PMID:25642997

  10. Functional characterisation of the regulation of CAAT enhancer binding protein alpha by GSK-3 phosphorylation of Threonines 222/226

    Hastie CJ

    2006-04-01

    Full Text Available Abstract Background Glycogen Synthase Kinase-3 (GSK3 activity is repressed following insulin treatment of cells. Pharmacological inhibition of GSK3 mimics the effect of insulin on Phosphoenolpyruvate Carboxykinase (PEPCK, Glucose-6 Phosphatase (G6Pase and IGF binding protein-1 (IGFBP1 gene expression. CAAT/enhancer binding protein alpha (C/EBPα regulates these gene promoters in liver and is phosphorylated on two residues (T222/T226 by GSK3, although the functional outcome of the phosphorylation has not been established. We aimed to establish whether CEBPα is a link between GSK3 and these gene promoters. Results C/EBPα represses the IGFBP1 thymine-rich insulin response element (TIRE, but mutation of T222 or T226 of C/EBPα to non-phosphorylatable alanines has no effect on C/EBPα activity in liver cells (towards the TIRE or a consensus C/EBP binding sequence. Phosphorylation of T222/T226 is decreased by GSK3 inhibition, suggesting GSK3 does phosphorylate T222/226 in intact cells. However, phosphorylation was not altered by treatment of liver cells with insulin. Meanwhile C/EBPα activity in 3T3 L1 preadipocytes was enhanced by mutation of T222/T226 and/or S230 to alanine residues. Finally, we demonstrate that C/EBPα is a very poor substrate for GSK3 in vitro and in cells. Conclusion The work demonstrates an important role for this domain in the regulation of C/EBPα activity in adipocytes but not hepatocytes, however GSK3 phosphorylation of these residues does not mediate regulation of this C/EBP activity. In short, we find no evidence that C/EBPα activity is regulated by direct phosphorylation by GSK3.

  11. Di-22:6-bis(monoacylglycerol)phosphate: A clinical biomarker of drug-induced phospholipidosis for drug development and safety assessment

    Liu, Nanjun; Tengstrand, Elizabeth A.; Chourb, Lisa; Hsieh, Frank Y., E-mail: frank.hsieh@nextcea.com

    2014-09-15

    The inability to routinely monitor drug-induced phospholipidosis (DIPL) presents a challenge in pharmaceutical drug development and in the clinic. Several nonclinical studies have shown di-docosahexaenoyl (22:6) bis(monoacylglycerol) phosphate (di-22:6-BMP) to be a reliable biomarker of tissue DIPL that can be monitored in the plasma/serum and urine. The aim of this study was to show the relevance of di-22:6-BMP as a DIPL biomarker for drug development and safety assessment in humans. DIPL shares many similarities with the inherited lysosomal storage disorder Niemann–Pick type C (NPC) disease. DIPL and NPC result in similar changes in lysosomal function and cholesterol status that lead to the accumulation of multi-lamellar bodies (myeloid bodies) in cells and tissues. To validate di-22:6-BMP as a biomarker of DIPL for clinical studies, NPC patients and healthy donors were classified by receiver operator curve analysis based on urinary di-22:6-BMP concentrations. By showing 96.7-specificity and 100-sensitivity to identify NPC disease, di-22:6-BMP can be used to assess DIPL in human studies. The mean concentration of di-22:6-BMP in the urine of NPC patients was 51.4-fold (p ≤ 0.05) above the healthy baseline range. Additionally, baseline levels of di-22:6-BMP were assessed in healthy non-medicated laboratory animals (rats, mice, dogs, and monkeys) and human subjects to define normal reference ranges for nonclinical/clinical studies. The baseline ranges of di-22:6-BMP in the plasma, serum, and urine of humans and laboratory animals were species dependent. The results of this study support the role of di-22:6-BMP as a biomarker of DIPL for pharmaceutical drug development and health care settings. - Highlights: • A reliable biomarker of drug-induced phospholipidosis (DIPL) is needed for humans. • Di-22:6-BMP is specific/sensitive for DIPL in animals as published in literatures. • The di-22:6-BMP biomarker can be validated for humans via NPC patients. • DIPL

  12. Di-22:6-bis(monoacylglycerol)phosphate: A clinical biomarker of drug-induced phospholipidosis for drug development and safety assessment

    The inability to routinely monitor drug-induced phospholipidosis (DIPL) presents a challenge in pharmaceutical drug development and in the clinic. Several nonclinical studies have shown di-docosahexaenoyl (22:6) bis(monoacylglycerol) phosphate (di-22:6-BMP) to be a reliable biomarker of tissue DIPL that can be monitored in the plasma/serum and urine. The aim of this study was to show the relevance of di-22:6-BMP as a DIPL biomarker for drug development and safety assessment in humans. DIPL shares many similarities with the inherited lysosomal storage disorder Niemann–Pick type C (NPC) disease. DIPL and NPC result in similar changes in lysosomal function and cholesterol status that lead to the accumulation of multi-lamellar bodies (myeloid bodies) in cells and tissues. To validate di-22:6-BMP as a biomarker of DIPL for clinical studies, NPC patients and healthy donors were classified by receiver operator curve analysis based on urinary di-22:6-BMP concentrations. By showing 96.7-specificity and 100-sensitivity to identify NPC disease, di-22:6-BMP can be used to assess DIPL in human studies. The mean concentration of di-22:6-BMP in the urine of NPC patients was 51.4-fold (p ≤ 0.05) above the healthy baseline range. Additionally, baseline levels of di-22:6-BMP were assessed in healthy non-medicated laboratory animals (rats, mice, dogs, and monkeys) and human subjects to define normal reference ranges for nonclinical/clinical studies. The baseline ranges of di-22:6-BMP in the plasma, serum, and urine of humans and laboratory animals were species dependent. The results of this study support the role of di-22:6-BMP as a biomarker of DIPL for pharmaceutical drug development and health care settings. - Highlights: • A reliable biomarker of drug-induced phospholipidosis (DIPL) is needed for humans. • Di-22:6-BMP is specific/sensitive for DIPL in animals as published in literatures. • The di-22:6-BMP biomarker can be validated for humans via NPC patients. • DIPL

  13. Estimation of annual effective dose from 226Ra and 228Ra due to consumption of foodstuffs by inhabitants of Ramsar city, Iran

    226Ra and 228Ra contents in foodstuffs of Ramsar which is a coastal city in the northern part of lran were determined by gamma spectrometry. Measurement results together with food consumption rates were used to estimate annual effective dose from 226Ra and 228Ra, due to consumption of food stuffs by inhabitants of Ramsar city. Materials and methods: a total of 33 samples from 11 different foodstuffs including root vegetables (beetroot), leafy vegetables (lettuce, parsley and spinach) and tea, meat, chicken, pea, broad bean, rice, and cheese were purchased from markets of Ramsar city and were analyzed for their 226Ra and 228Ra concentration. 1-8 kg of fresh weight sample was placed in Marinnelli beaker and sealed. The measurement of natural radioactivity levels as performed by gamma-spectrometry system, using a high purity germanium detector with 40% relative efficiency. Results: The highest concentrations of 226Ra and 228Ra were determined in tea samples with 1570 and 1140 mBq/kg, respectively, and the lowest concentration of 226Ra was in pea, cheese, chicken, broad bean, and beetroot. Conclusion:The maximum estimated annual effective dose from 226Ra and 228Ra due to consumption, foodstuffs were determined to be 19.22 and 0.71 mSv from rice and meat samples respectively, where as, minimum estimated annual effective dose for 226Ra was 0.017, 0.018 and 0.019 mSv from beetroot, cheese and pea samples respectively

  14. Anti-tumor effect in human breast cancer by TAE226, a dual inhibitor for FAK and IGF-IR in vitro and in vivo

    Kurio, Naito [Department of Oral and Maxillofacial Surgery, Okayama University Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Okayama, 700-8525 (Japan); Shimo, Tsuyoshi, E-mail: shimotsu@md.okayama-u.ac.jp [Department of Oral and Maxillofacial Surgery, Okayama University Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Okayama, 700-8525 (Japan); Fukazawa, Takuya; Takaoka, Munenori [Department of General Surgery, Kawasaki Medical School, Okayama, 700-0821 (Japan); Okui, Tatsuo; Hassan, Nur Mohammad Monsur; Honami, Tatsuki [Department of Oral and Maxillofacial Surgery, Okayama University Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Okayama, 700-8525 (Japan); Hatakeyama, Shinji [Novartis Institutes for BioMedical Research, Basel (Switzerland); Ikeda, Masahiko [Department of Surgery, Fukuyama City Hospital, Fukuyama, 720-8511 (Japan); Naomoto, Yoshio [Department of General Surgery, Kawasaki Medical School, Okayama, 700-0821 (Japan); Sasaki, Akira [Department of Oral and Maxillofacial Surgery, Okayama University Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Okayama, 700-8525 (Japan)

    2011-05-01

    Focal adhesion kinase (FAK) is a 125-kDa non-receptor type tyrosine kinase that localizes to focal adhesions. FAK overexpression is frequently found in invasive and metastatic cancers of the breast, colon, thyroid, and prostate, but its role in osteolytic metastasis is not well understood. In this study, we have analyzed anti-tumor effects of the novel FAK Tyr{sup 397} inhibitor TAE226 against bone metastasis in breast cancer by using TAE226. Oral administration of TAE226 in mice significantly decreased bone metastasis and osteoclasts involved which were induced by MDA-MB-231 breast cancer cells and increased the survival rate of the mouse models of bone metastasis. TAE226 also suppressed the growth of subcutaneous tumors in vivo and the proliferation and migration of MDA-MB-231 cells in vitro. Significantly, TAE226 inhibited the osteoclast formation in murine pre-osteoclastic RAW264.7 cells, and actin ring and pit formation in mature osteoclasts. Moreover, TAE226 inhibited the receptor activator for nuclear factor {kappa} B Ligand (RANKL) gene expression induced by parathyroid hormone-related protein (PTHrP) in bone stromal ST2 cells and blood free calcium concentration induced by PTHrP administration in vivo. These findings suggest that FAK was critically involved in osteolytic metastasis and activated in tumors, pre-osteoclasts, mature osteoclasts, and bone stromal cells and TAE226 can be effectively used for the treatment of cancer induced bone metastasis and other bone diseases.

  15. Anti-tumor effect in human breast cancer by TAE226, a dual inhibitor for FAK and IGF-IR in vitro and in vivo

    Focal adhesion kinase (FAK) is a 125-kDa non-receptor type tyrosine kinase that localizes to focal adhesions. FAK overexpression is frequently found in invasive and metastatic cancers of the breast, colon, thyroid, and prostate, but its role in osteolytic metastasis is not well understood. In this study, we have analyzed anti-tumor effects of the novel FAK Tyr397 inhibitor TAE226 against bone metastasis in breast cancer by using TAE226. Oral administration of TAE226 in mice significantly decreased bone metastasis and osteoclasts involved which were induced by MDA-MB-231 breast cancer cells and increased the survival rate of the mouse models of bone metastasis. TAE226 also suppressed the growth of subcutaneous tumors in vivo and the proliferation and migration of MDA-MB-231 cells in vitro. Significantly, TAE226 inhibited the osteoclast formation in murine pre-osteoclastic RAW264.7 cells, and actin ring and pit formation in mature osteoclasts. Moreover, TAE226 inhibited the receptor activator for nuclear factor κ B Ligand (RANKL) gene expression induced by parathyroid hormone-related protein (PTHrP) in bone stromal ST2 cells and blood free calcium concentration induced by PTHrP administration in vivo. These findings suggest that FAK was critically involved in osteolytic metastasis and activated in tumors, pre-osteoclasts, mature osteoclasts, and bone stromal cells and TAE226 can be effectively used for the treatment of cancer induced bone metastasis and other bone diseases.

  16. Effects of Al3+, Ca2+, Cu2+ and Fe2+ on removal of radium-226 from radium-contaminated soil using humic acid

    Effect of Al3+, Ca2+, Cu2+ and Fe2+ on the removal of radium-226 from radium-contaminated soil using humic acid extracted from a Malaysian peat soil was investigated using batch washing method. The concentration of Al3+, Ca2+, Cu2+ and Fe2+ ranged from 0 to 100 ppm. The radioactivity concentration of radium-226 was determined by gamma spectrometer. The removal of radium-226 was enhanced in the presence of Al3+ with concentration between 20 - 60 ppm. Meanwhile, higher concentration of 80 - 100 ppm did not lead to further increase in the removal of radium-226. The removal of radium-226 was decreased in the presence of Ca2+ and Cu2+. In the presence of Fe2+ with concentration between 20 - 60 ppm, decrease in the removal of radium-226 was also observed. Nevertheless, at concentration between 80 - 100 ppm, the presence of Fe2+ led to increase in the removal of radium-226. (Author)

  17. Radium-226 in vegetation and substrates at inactive uranium mill sites

    Marple, M.L.

    1980-01-01

    Results of a study of the content of radium-226 in plants growing on inactive uranium mill tailings sites in the Four Corners Region of the southwestern United States and in plants grown under greenhouse conditions with minimal surficial contamination are reported. Field plant samples and associated substrates were analyzed from two carbonate tailings sites in the Grants Mineral Belt of New Mexico. Radium activities in air-cleaned samples ranged from 5 to 368 pCi/g (dry weight) depending on species and location: activities in plants growing on local soils averaged 1.0 pCi/g. The talings and local soils contain 140 to 1400 pCi/g and 2.1 pCi/g, respectively. An evaluation of cleaning methods on selected samples showed that from 17 to 79% of the radium activity measured in air-cleaned samples was due to surficial contamination, which varied with species and location. A survey of 18 inactive uranium mill sites in the Four Corners Region was performed. Radium activity in plant tissues from nine species ranged from 2 to 210 pCi/g on bare tailings and from 0.3 to 30 pCi/g on covered tailings The radium content in most of the soil overburdens on the covered tailings piles was 10 to 17 pCi/g. An experiment was performed to measure radium-226 uptake by two species grown on tailings covered with a shallow (5 cm) soil layer. A grass, Sporobolus airoides (alkali sacaton) and a shrub, Atriplex canescens (four-wing saltbush), were studied. The tailings were a mixture of sands and slimes from a carbonate pile. The tailings treatments were plants grown in a soil cover over tailings; the controls were plants grown only in soil. Three soil types, dune sand, clay loam, and loam, were used. The radium activity of the plant tissue from the tailings treatment compared to that of the appropriate control was 1 to 19 times greater for the grass and 4 to 27 times greater for the shrub.

  18. Radium-226 in vegetation and substrates at inactive uranium mill sites

    Results of a study of the content of radium-226 in plants growing on inactive uranium mill tailings sites in the Four Corners Region of the southwestern United States and in plants grown under greenhouse conditions with minimal surficial contamination are reported. Field plant samples and associated substrates were analyzed from two carbonate tailings sites in the Grants Mineral Belt of New Mexico. Radium activities in air-cleaned samples ranged from 5 to 368 pCi/g (dry weight) depending on species and location: activities in plants growing on local soils averaged 1.0 pCi/g. The talings and local soils contain 140 to 1400 pCi/g and 2.1 pCi/g, respectively. An evaluation of cleaning methods on selected samples showed that from 17 to 79% of the radium activity measured in air-cleaned samples was due to surficial contamination, which varied with species and location. A survey of 18 inactive uranium mill sites in the Four Corners Region was performed. Radium activity in plant tissues from nine species ranged from 2 to 210 pCi/g on bare tailings and from 0.3 to 30 pCi/g on covered tailings The radium content in most of the soil overburdens on the covered tailings piles was 10 to 17 pCi/g. An experiment was performed to measure radium-226 uptake by two species grown on tailings covered with a shallow (5 cm) soil layer. A grass, Sporobolus airoides (alkali sacaton) and a shrub, Atriplex canescens (four-wing saltbush), were studied. The tailings were a mixture of sands and slimes from a carbonate pile. The tailings treatments were plants grown in a soil cover over tailings; the controls were plants grown only in soil. Three soil types, dune sand, clay loam, and loam, were used. The radium activity of the plant tissue from the tailings treatment compared to that of the appropriate control was 1 to 19 times greater for the grass and 4 to 27 times greater for the shrub

  19. Influence of the physico-chemical properties of Selangor soil series on the distribution coefficient (Kd-value) of 226Ra

    226Ra is a member of the 238U natural decay series and is one of the most important isotope to be determined among the naturally occurring nuclides in environmental samples. In order to evaluate the radiation dose from 226Ra, it is important to know its mobility in different types of soils. The aim of the present study is to quantify the influence of physico-chemical soil properties on 226Ra adsorption. The distribution coefficients (Kd-value) of 226Ra in Selangor soil series samples were measured in one core, at three depth levels to evaluate the adsorbability of 226Ra. The soil samples were spiked with 226Ra tracer and the activities of 226Ra in the separated phase from batch sorption test were measured by a low background but high efficiency well-type HPGe detector. Several physico-chemical soil properties were also characterised for each soil samples. Pearson's correlation and stepwise multiple regression test were applied at the 0.05 level of significance throughout all analysis to determine the relationships and influences between distribution coefficients (Kd-value) of 226Ra with physicochemical soil properties for the Selangor soil series. The observed Kd value was in the range of 50.55-172.28 mL g-1 (mean: 93.20 ± 46.99 mL g-1). The regression showed that the highest positive correlations were observed for organic matter (OM) and cation exchange capacity (CEC) (r 0.96**, 0.81**, respectively) with Kd-values. The results indicate that the stepwise multiple regression model incorporating the soil's OM and CEC accounts for 98% of the variability in distribution coefficients of 226Ra. (author)

  20. Simultaneous determination of Ra-226, natural uranium and natural thorium by gamma-ray spectrometry INa(Ti), in solid samples.; Determinacion de U (Natural), Th (Natural) y Ra-226 en diversos materiales, mediante espectrometria con INa (TI)

    Salvador, S.; Navarro, T.; Alvarez, A.

    1991-07-01

    A method has been developed to determine activities of Ra-226, natural uranium and natural thorium by gamma-ray spectrometry. The measurement system has been calibrated using standards specially prepared at the laboratory. It is necessary to assume secular equilibrium in the samples, between Ra-226 and Th-232 and its daughters nuclides, and between U-238 and its immediate daughter Th-234, as the photo peaks measured are those of the daughters. The results obtained indicate that this method can of ter replace the radiochemical techniques used to measure activities in this type of sample. The method has been successfully used to determine these natural isotopes in samples from uranium mills. (Author) 9 refs.

  1. Determination of Pb-210 and Ra-226 in sediments from Acude de Apipucos - Recife, Pernambuco, Brazil; Determinacao de chumbo-210 e radio-226 em sedimentos do Acude de Apipucos - Recife - Brasil

    Souza, Vivianne Lucia Bormann de; Melo, Roberto Teodozio de; Figueiredo, Marcela Durao Cesar de; Rodrigues, Kelia Rejane Goncalves; Cunha, Manuela Silva da; Silva, Danubia B. da; Pedroza, Eryka de H., E-mail: vlsouza@cnen.gov.b, E-mail: rtmelo@cnen.gov.b [Centro Regional de Ciencias Nucleares (CRCN-NE/CNEN-PE), Recife, PE (Brazil); Oliveira, Aristides [Hospital de Cancer de Pernambuco, Recife, PE (Brazil)

    2011-07-01

    This study aims to determine the age of sediment layers in Apipucos Reservoir, located in Recife, Brazil. Dating with {sup 210}Pb and {sup 226}Ra concentrations found in these sediments was used. A core with length of 70 cm and internal diameter of 5 cm was used for sediment sampling and each obtained profile was sectioned. Lead and radium were extracted from these samples by adding acids. {sup 210}Pb and {sup 226}Ra were determined in a gas flow proportional detector, based on the activities of their daughters. It was found that the CRS model (Constant Rate of Supply) to calculate the ages of sediment was more appropriate than CIC (Constant Initial Concentration). The chronology showed that the first sediment layers were 30 years old. (author)

  2. Radium isotopes (226Ra and 228Ra) in Na–Cl type groundwaters from Tohoku District (Aomori, Akita and Yamagata Prefectures) in Japan

    A total of 28 Na–Cl type groundwater samples were collected from Aomori, Akita and Yamagata Prefectures, in the Tohoku District of Japan, and their radium isotope (226Ra and 228Ra) concentrations were measured along with their chemical components and stable isotope ratios (δ2H and δ18Os). The 226Ra concentrations in groundwater samples varied widely, ranging from 8.8 to 1587 mBq kg−1. These concentrations showed an increasing tendency with the increase of the total dissolved solid (TDS) contents. The 228Ra/226Ra activity ratios were in the range from 0.3 to 4.2, with most data being around 0.5–2. These ratios were within those of 232Th/238U found in granitic and related rocks and so on in Japan, indicating that Ra isotopes mainly ejected into the groundwater by the alpha-recoil process. The relationship between 226Ra and other parameters suggested that Ra isotopes in groundwater samples in this study were mainly constrained by adsorption–desorption reactions depending on salinity with wide variation. Clear correlation between 226Ra-Ca, 226Ra-Sr, 226Ra–Ba and 226Ra–TDS observed in sulfate-free groundwater samples indicated that Ra isotopes of them were constrained by adsorption–desorption reactions depending on salinity under reducing condition. In contrast, relationship of 226Ra-Ca, 226Ra-Sr, 226Ra–Ba and 226Ra–TDS in sulfate-containing groundwater samples varied widely, and then, removal or enhanced mobility of Ra isotopes of them were observed. - Highlights: • Twenty-eight Na–Cl type groundwater samples were collected from Tohoku District in Japan. • Most of the groundwater samples were seawater (fossil seawater) in origin. • Ra isotopes in groundwaters were supplied by alpha-recoil from aquifer rock surface. • Adsorption–desorption reaction depending on the salinity constrained Ra activities in groundwater samples

  3. Ultrasonography in the diagnosis of acute appendicitis. A study of 226 cases

    To determine the clinical value of ultrasound in the diagnosis of acute appendicitis. Graded-compression ultrasound was performed in 226 patients with atypical or unclear clinical signs of appendicitis. Twenty-three patients were excluded from study because of an inconclusive examination due to inadequate compression. Appendicitis was considered to be present when the appendix was non compressible and measured over 6 mn in anteroposterior diameter or the patient presented an abscess in right iliac fossa. The findings were confirmed by pathological study of surgically resected tissue or by clinical follow-up. The operative features and the predictive capacity of ultrasound in the diagnosis of acute appendicitis were calculated. In 98 cases, acute appendicitis was confirmed intraoperatively. In 103, this diagnosis was ruled out by the clinical course or intraoperative findings. Ninety-four patients presented ultrasonographic signs compatible with appendiceal inflammation. The sensitivity of ultrasound in the diagnosis of these doubtful cases of appendicitis was, 93.9%; the specificity, 98.1%; reliability, 96%; positive value, 9%; negative predictive value, 94.5%, and the positive probability rate, 49.3%. Our results indicate that high-resolution ultrasonography is indicated in all cases in which the clinical diagnosis of appendiceal inflammation id doubtful. (Author) 64 refs

  4. Experience gained during remedial action at residential properties contaminated with Th-232 and Ra-226

    Seventeen residential properties contaminated with Th-232 and Ra-226 were decontaminated and restored by Bechtel National, Inc., during 1984 as part of the US Department of Energy's Formerly Utilized Sites Remedial Action Program. The extent of contamination varied from only a few cubic yards of material in the edge of one lawn to extensive contamination around foundations and under basement floors. Three unusual case histories will be described in detail. In the first case, a few cubic yards of contamination were expected, but more than 100 cubic yards were found. In Case 2, contamination was found under the floor of an addition to a house. Case 3 involved a home built on a lot where contaminated soils had been used as fill material to depths of up to 10 feet. The remedial action included the removal of the basement, including the floor slab and foundation. This paper will provide details about several lessons learned during remedial action at residential properties: (a) radiological characterization surveys must be thorough; (b) interviews with owners can provide helpful information about unusual or unexpected contamination problems; (c) radiological monitoring during construction is necessary for efficient and thorough remedial action; and (d) good public relations are an important element of residential remedial action projects. While these lessons may seem to be common sense items, the circumstances that require their use are often very subtle. As the case histories show, successful remedial action requires constant vigilance and careful attention to details

  5. Measurements of Ra-226 content of water and drinks in West Germany

    The contamination of the population by Ra 226 in water and drinks can be excluded as a potential source of danger. Average values in pCi/litre: Mineral water - 1.17, spa water - 2.55, beer - 0.57, wine - 0.92, milk - 0.08, tapwater - 0.11, waste water a) incoming - 0.22 b) outgoing - 0.14, activation basin - 1.2. The whole body equivalent doses and annual activity supply for an intake of 440 litres/annum to be expected are: Mineral water - 1.6x10-4 Sv/a, 5.1x10-10 Ci/a, spa water - 3.5x10-4 Sv/a, 1.1x10-9 Ci/a, beer - 7.8x10-5 Sv/a, 2.5x10-10 Ci/a, wine - 1.3x10-4 Sv/a, 4.0x10-10 Ci/a, milk - 1.1x10-5 Sv/a, 3.5x10-11 Ci/a, tapwater - 1.5x10-5 Sv/a, 4.8x10-4 Ci/a. (HP)

  6. Standardization of the radiochemical method to determine Ra-226 in the Chillon River

    The present work shows the development of five radiochemical methods in order to determine Ra-226 in river waters for human consumption, through gamma spectrometry. These methods are used in order to obtain this radionuclide as Ba(Ra)S04. The method tested was found to be the most appropriate due to its lower cost, high radiochemical yield obtained (83,53 %) on average and the obtained results show smaller variability. This standardized method is applied to water samples of the Chillon River, outcoming an activity of 0,1526 Bq/L. Assuming inhabitants of Huarangal Valley consume 2 liters of this river water daily. The annual ingest is about 111,398 Bq on average, which constitutes the 1,58 % of the allowed radioactivity limit given by the regulation on sanitary protection against ionizing radiation. Furthermore physical chemical analysis in waters of the Chillon River were performed. The results found are within the allowed ranges considered by the World Health Organization (WHO), the Technical Standards National Institute (ITINTEC - PERU) and Law of Waters. Chillon River waters can be destined for the human consumption according to the physical-chemical analysis performed. The results obtained about radioactivity levels in these samples do not show radio-sanitarian hazards for inhabitants of Huarangal Valley

  7. Determination of 226Ra and 224Ra in sediments samples by liquid scintillation counting

    An experimental procedure has been developed for a rapid determination of the activity concentration of 226Ra and 224Ra in sediments by liquid scintillation counting. The importance of the method lies in its application to the measurement of sediments where the Ra-isotopes activity concentration has been increased due to an anthropomorphic enhancement based on releases of naturally occurring radioactive material (NORM). A sample pre-treatment, including a digestion with aqua regia and a precipitation of hydroxides, was applied to samples before the radium extraction, which was made by co-precipitation with barium. Measurements were done in a low background scintillation spectrometer Quantulus 1220, which can separate and detect simultaneously α and β particles. Additionally, some improvements are suggested for a better α and β interference correction of the results. The obtaining of radiochemical yields is also improved using 133Ba as tracer, which decays by emission of conversion electrons and γ-rays; the wide range of radiochemical yields obtained confirms the need of this analyses. The procedure has been applied to the measurement of riverbed sediments from an estuary in the south-west of Spain, affected in the past by direct and indirect phosphogypsum discharges

  8. Modeling of 226Ra behavior in a Spanish estuary affected by the phosphate industry

    The Odiel and Tinto rivers, southwest Spain, form a fully mixed estuary. An industrial area that includes a complex dedicated to the production of phosphate fertilizers is located by the Odiel River. This complex released phosphogypsum wastes directly to the Odiel River and also disposed them on open air piles located by the Tinto River. Due to new EU regulations, wastes are not directly released to the Odiel from 1998 on, although they are still disposed on the open air piles. The behavior of 226Ra in a system like this estuary is complex, since radionuclides are affected by tidal actions and interactions with sediments through adsorption/desorption reactions and erosion/deposition processes. A numerical 2D depth-averaged model of the estuary has been developed, including processes mentioned above. It has been applied to reproduce experimental data measured after a release from the industrial complex in the Odiel River and after an accidental release in the Tinto River from the gypsum piles. The model has also been applied to simulate the self-cleaning process observed in the estuary after the direct releases from the fertilizer complex were stopped. (author)

  9. Evaluation of radium-226 body burden by in vivo measurement of bismuth-214

    An indirect method of estimation of radium-226 body burden has been developed to overcome the difficulties of direct measurement of radium on account of low emission of 186 KeV gamma radiation that too in a region where the background count rate is high. The method is based on in vivo measurement of sup(214)Bi content of the body by a shadow shield whole body counter [102 mm (dia) x 76 mm (thick) NaI(Tl) detector]. sup(214)Bi emits gamma rays of 0.609, 1.120 and 1.764 MeV of which the last one is suitable for whole body counting because in that energy region there is no contribution from naturally occurring radioisotopes in the body (e.g. sup(40)K) and the response is independent of variation in body build. The ratio of the minimum detectable radium body burden for the whole body monitor at Jaduguda uranium mines using the indirect and direct methods for the same counting periods works out to be 0.85, indicating that the indirect method is somewhat superior to the direct method. (M.G.B.)

  10. Certified Reference Material IAEA-448: Soil from Oil Field Contaminated with Technically Enhanced Radium-226

    To ensure reliable evaluation of potential radiological hazards and proper decision making related to radiation protection measures, the IAEA, through the IAEA Environment Laboratories, supports Member State laboratories in their efforts to maintain readiness and to improve the quality of analytical results. It does so by producing reference materials, by developing standardized methods for sample collection and analysis, and by conducting interlaboratory comparisons and proficiency tests as tools for external quality control of analytical results. The problem of naturally occurring radioactive material (NORM) contamination is known to be widespread, occurring in oil and gas production facilities throughout the world. It has become a subject of attention in many IAEA Member States. In response to this radiological concern, facilities in many Member States have been characterizing the nature and extent of NORM in oil and gas installations and in the surrounding environment, evaluating the potential for exposure to workers and the public, and developing methods for properly managing these relatively high massic activity residues. Within this context, the IAEA Environment Laboratories, in cooperation with the Atomic Energy Commission of Syria, an IAEA Collaborating Centre, have prepared a new certified reference material of soil contaminated with NORM, identified as IAEA-448, certified for the massic activity of 226Ra. This report presents the methodologies used for the production and certification of IAEA-448

  11. Pattern of distribution of radium 226 in drinking water of Texas

    Concentrations of radium (Ra) as high as 65 pCi/L have been reported in some of the public water wells in Texas. Yet, the overall pattern of the geographic distribution of Ra or its decay products has not been determined or mapped. The present study is a step in this direction. The distribution of 226Ra in domestic water, public and individual, in selected regions of the state of Texas was investigated to identify areas where water may contain naturally occurring elevated concentrations of Ra and to provide much need information for well development and water quality management. Two regions with anomalously high Ra concentrations were identified, one in the gulf coast, with some concentrations over 20 pCi/L downdip from uranium deposits, and the other in west-central Texas, with some concentrations up to 65 pCi/L on the periphery of an igneous uplift. Otherwise, the concentrations of Ra were low,particularly in the west and northwest of the state

  12. Indoor radiation exposure due to radium-226 in Florida phosphate lands. Technical report

    This report was prepared by the Environmental Protection Agency in response to a request from the governor of Florida to provide recommendation on indoor radiation exposure due to radium-226 in Florida phosphate lands. The report evaluates radiation levels in existing structures, the health impact of this radiation exposure, the cost-effectiveness of controls, the social and economic impact of potential radiation controls, and the alternatives available for radiation protection to minimize adverse risk to the public. The report concludes that the major exposure problem is associated with bulid-up of radon in residences constructed on land containing radium-bearing materials related to phosphate ores. The principal radiation health threat is an increased risk of lung cancer, which is dependent both on the indoor concentration of radon decay products and the period of exposure. The analysis projects that over a normal lifetime, persons residing in homes on phosphate lands in the study area experience and average lung cancer risk 35 percent greater than normal, and that those residing in homes exhibiting the highest levels measured experience a risk of lung cancer 2-4 times the U.S. average

  13. Estimation of age dependent effective dose due to intake of 226Ra from drinking water in Vizag, India

    As a part of the ongoing baseline survey, present work deals with the measurement of 226Ra concentration in ground water samples collected around Bhabha Atomic Research Center (BARC) site Vizag by emanometry technique and subsequent estimation of age dependent effective dose to the people inhabited in that area. The mean activity concentration of 226Ra was 15.8 mBq/L which is much lower than the WHO guideline value of 1 Bq/L. The highest dose was observed for the age group of 14-18 yr (male). The dose for all age group are ranged between 2.2-56 which is well below the WHO recommended dose level of 100 μSv/y. (author)

  14. Interlaboratory comparison of the determination of 226Ra and 228Ra in samples simulating coal mine water

    The aim of the experiment organized by the National Atomic Energy Agency of Poland, was to carry out an interlaboratory comparison on the determination of long-lived radium isotopes in waste waters from Polish coal mines. It was expected that the experiment would allow to evaluate the proficiency of the national participants, and to eliminate possible errors in their work. 9 participating laboratories have determined the concentrations of 226Ra and 228Ra (or only 226Ra) in 6 synthetic samples containing from 0 to 300 Bq/dm3 of each isotope. The results have been evaluated according to recent recommendations of IUPAC, ISO and AOAC. It is concluded that a significant majority of the results meet the proficiency criterium at the selected target accuracy. In some cases small systematic errors appear. Only a few laboratories meet a rigorous proficiency criterium. Analytical methods used for radium determination have also been evaluated. (author)

  15. Radium 226 and other natural radionuclides in drinking water and in beverages in the Federal Republic of Germany

    Ra-226 was detected in tap water from public water supply plants, commercial bottled mineral water, springs, wells and also in milk, beer and wine; Rn-222 was detected in tap water, springs and wells. For these kinds of water and mineral waters, exploratory measurements on the content of Pb-210, Po-210 and uranium isotopes were carried out, too. While using the new dose concept of the ICRP and with standard quantities for mineral water consumption with the highest concentration measured, only in few cases the partial body doses of 0.9 mSv/a in the critical organs is exceeded, i.e. for Ra-226 and uranium. Even in these cases, effective dose equivalents of 0.3 mSv are not reached. The resulting health hazard lies in the range which is predetermined by external exposure to terrestrial radiation. (orig./DG) With 18 tabs., 7 figs

  16. Using 226Ra/228Ra disequilibrium to determine the residence half-lives of radium in vegetation compartments

    The concentrations of 226Ra and 228Ra were studied in different vegetation compartments and in available and non-available soil fractions in a Mediterranean scrubland ecosystem. A high percentage of the plant samples showed an apparent discrimination in favour of 226Ra over 228Ra. A linear compartmental model was applied to the soil-plant system. It allowed us to explain why these discrimination coefficients differed from unity, to obtain the residence half-lives of radium in the different compartments, to estimate the age of the plants, and to simulate the temporal evolution of the radioactive concentrations in each compartment. (Copyright (c) 1999 Elsevier Science B.V., Amsterdam. All rights reserved.)

  17. Radiochemical analysis of 210Pb e 226Ra in samples of sludges and scales in petroleum industry

    The exploration and production of oil can generate different types of waste, such as scales, which are formed in the internal surface of pipes and equipment, sludges that is deposited in water/oil separators, storage tanks and valves and water that is removed along with the oil, which bring to the surface some of the radionuclides present in the rock matrix. From a radiological point of view, the most important radionuclides, which appear in sludges and scales are 228Ra, 226Ra, 210Pb and 228Th, since the exposure to these radionuclides can represent a significant dose on workers. The analysis already performed using gamma spectrometry in samples of sludge and scales indicated the presence of high concentrations of radio isotopes, showing the need to enlarge the radiometric survey including other elements of the 238U series. This work focuses on radiochemical determination of 210Pb and 226Ra concentrations in samples of sludge and scales

  18. Radium-226 in certified uranium reference ores DL-1a, BL-4a, DH-1a and BL-5

    Radium-226 radioactivity in uranium reference ores BL-4a and BL-5 and uranium-thorium reference ores DL-1a and DH-1a was determined in an interlaboratory program. Twelve of thirteen participants used certified radium solutions from the United States National Bureau of Standards (NBS) for calibration purposes. Recommended values of sup(226)Ra activity and associated parameters were calculated by statistical treatment of the results. In all cases, the recommended values are within 2 percent of activities predicted assuming secular equilibrium in the sup(238)U decay series. The recommended values for radium activity are 1.40, 15.5, 31.5 and 857 Bq/ for DL-1a, BL-4a, DH-1a and BL-5, respectively

  19. The dose exposure of the environmental population caused by natural Ra-226 and Pb-210 and released from uraniferous heaps

    The concentrations of Ra-226 and Pb-210 in samples of air, soil, surface water, and foods from Wittichen agree well with the average environmental concentrations. Higher values are found in soil samples from old heaps, in surface waters being in contact with these heaps and in grass and mushrooms grown on such heaps. On the supposition that only locally produced foods are used for annual intake, an annual activity intake of 925 pCi Ra-226 and 2 772 pCi Pb-210 is determined. These annual intakes are higher by a factor of 2.1 compared with the maximum permissible intakes given by the Radiation Protection Ordinance. The transfer factors determined in other parts of the Black Forest are in accordance with these values. The Pb-210 concentrations in grass and leafy vegetables are pretty high; the contamination of this kind of samples is caused by the deposition of Pb-210 from ground level air. Using Pb-210 concentrations in air and plants, one achieves deposition velocities and effective half-lives, respectively, which agree very well with values already known. For depth profiles of Ra-226, Pb-210, and Po-210 in soil of a meadow and a heap, the interpretation of the results achieved is difficult, since the processes of contamination and decontamination are very complicated. Still after more than one and a half century the transport of Ra-226 from the uraniferous material to deeper soil layers is negligible. The transport of Pb-210 and Po-210 is much faster. (orig./HP)

  20. Bioavailability of radionuclides 226Ra, 228Ra and 210Pb present in the brazilian phosphate fertilizers and phosphogypsum

    Phosphogypsum, also called gypsum, by-product of the phosphate fertilizer industry, can be used as soil conditioner since it provides improvements in the soil-plant system. However, this by-product concentrates radionuclides of the U and Th series, present in the phosphate rock used as raw material, which can impact the environment. In order to study the bioavailability of radionuclides, samples of phosphogypsum and phosphate fertilizers (monoammonium phosphate and triple superphosphate) were analyzed. The concentration of 226Ra, 228Ra and 210Pb were determined by gamma spectrometry. The samples were leached with a mild EDTA solution and the radionuclides present in the final solution were determined by total alpha and beta counting on a gas flow proportional counter. The percentage of extraction varied from 1.6% to 1.7% for 210Pb, from 0.5% to 1.4% for 226Ra and from 0.1% to 1.0% for the 228Ra in phosphogypsum samples. The low percentage of extraction obtained for the radionuclides can be partly explained by the low solubility of phosphogypsum, which ranged from 7.7% to 16%. For the monoammonium phosphate samples the percentage of extraction were less than 26% for 226Ra, less than 10% for '228Ra and less than 10% for 210Pb. In spite of the high solubility of 77% of monoammonium phosphate in the EDTA solution, low concentrations of radionuclides were observed in the leached solution. For the triple superphosphate samples, the percentage of extraction was 2.3% for 226Ra, 1.2% for 228Ra and 11.3% for 210Pb. In spite of the high solubility of 66% of triple superphosphate in the EDTA solution, low concentrations of radionuclides were observed in the leached solution. (author)

  1. Soil-to-root vegetable transfer factors for 226Ra, 232Th, 40K, and 88Y in Malaysia

    Soil-to-plant transfer factors (TFs) are of fundamental importance in assessing the environmental impact due to the presence of radioactivity in soil and agricultural crops. Tapioca and sweet potato, both root crops, are popular foodstuffs for a significant fraction of the Malaysian population, and result in intake of radionuclides. For the natural field conditions experienced in production of these foodstuffs, TFs and the annual effective dose were evaluated for the natural radionuclides 226Ra, 232Th, 40K, and for the anthropogenic radionuclide 88Y, the latter being a component of fallout. An experimental tapioca field was developed for study of the time dependence of plant uptake. For soil samples from all study locations other than the experimental field, it has been shown that these contain the artificial radionuclide 88Y, although the uptake of 88Y has only been observed in the roots of the plant Manihot esculenta (from which tapioca is derived) grown in mining soil. The estimated TFs for 226Ra and 232Th for tapioca and sweet potato are very much higher than that reported by the IAEA. For all study areas, the annual effective dose from ingestion of tapioca and sweet potato are estimated to be lower than the world average (290 μSv y−1). - Highlights: • Transfer factors of 226Ra, 232Th, 40K, and 88Y radionuclides were estimated for widely consumed root vegetables in Malaysia. • An experimental tapioca field was developed for study of the time dependence of plant uptakes. • The estimated TF values of 226Ra and 232Th for tapioca and sweet potato are higher than the IAEA reported values. • These site-specific TFs are of importance for model derivations for tropical regions

  2. Seasonal variation of 226Ra and 222Rn in mineral spring waters of Aguas da Prata-Brazil

    Concentration levels of 226Ra and 222Rn have been analysed in most of the mineral spring waters available in the Aguas da Prata region, which is located in the Pocos de Caldas plateau, one of the biggest weathered alkaline intrusions of the world. In this plateau can be found many health resorts[based on springs of thermal and mineral waters. The Aguas da Prata spring waters show a large variety of composition. It has been observed bicarbonates, carbonates and sulphates salts in these mineral waters. The 226Ra was determined by gross alpha counting of a Ba(Ra)SO4 precipitate. The measurement was carried out in a low background gas flow proportional counter. The 222Rn concentrations were determined by liquid scintillation method. Water samples were randomly collected at 9 spring sites over a period of one year, in order to evaluate the seasonal variation of these radionuclides. Lower concentrations were found mostly in the rainy season (summer), which presents 80% of the annual rainfall of the region (1500 mm/year). Higher concentrations up to 2223 mBq/L for 226Ra and 131 Bq/L for 222Rn have been observed in waters with low level of soluble salts. Waters which present high levels of carbonate and sulphate salts showed maximum values of 316 mBq/L for 226Ra and 30 Bq/L for 222Rn. This behaviour is mainly due to the physicochemical properties of these radionuclides in water as well as to the lithologic structure of the aquifers. (authors). 6 refs., 2 figs., 1 tab

  3. Concentration factors for 226Ra in the mullet (Mugilidae) species Mugil cephalus from the South Adriatic Sea

    226Ra activity concentration in the mullet (Mugilidae) species Mugil cephalus whole individuals, and some organs (gills, gastrointestinal system, fins, muscle and bones), was measured by the γ-coincidence spectrometer PRIPYAT-2M. 226Ra transfer parameters [concentration factors (CFs)] from seawater, sediment and mud with detritus to fish tissues, and annual intake by humans consuming this fish species, have been estimated. Minimum detected radium activity concentration in whole M. cephalus individuals was found to be 0.89 ± 0.42 to 3.09 ± 0.41 Bq kg-1, with arithmetic mean of 1.65 ± 0.39 Bq kg-1. An average concentration in muscles is found to be 2.28 ± 0.84 Bq kg-1, in gills - 5.02 ± 1.85 Bq kg-1, in gastrointestinal system - 12.88 ± 1.71 Bq kg-1, and in bones - 14.72 ± 3.75 Bq kg-1. No one fins showed radium activity above minimum detectable one. Annual intake of 226Ra by human consumers of this fish species is estimated to provide an effective dose of 0.006 mSv year-1. CFs for 226Ra indicating transfer from seawater to whole individuals ranged from 8.9 to 30.9, and those indicating transfer from the sediment and mud with detritus - from 0.11 to 0.39 and from 0.08 to 0.3, respectively. The seawater to bones CFs varied from 97.9 to 197.3, to gastrointestinal system - from 59 to 178.8, to gills - from 22.5 to 68.3, to muscles - from 17 to 30.8. (author)

  4. Speciation of 226Ra, 238U and 228Ra in an upland organic soil overlying a uraniferous granite

    A sequential chemical extraction procedure was implemented in order to ascertain the chemical speciation of 226Ra, 238U and 228Ra within fractions of an upland organic soil. A number of samples and depth cores were taken from a region where the soil contains elevated levels of these radionuclides. Sequential chemical extractions were employed to identify within which of the three soil phases, namely exchangeable cations, easily oxidisable organic matter or iron oxides, the radionuclides were incorporated. The primary analytical technique was high-resolution gamma ray spectrometry. A number of other chemical parameters likely to affect the mode of occurrence of the radionuclides were also analysed. These included humic acid content, iron and manganese content and cation exchange capacity. Results indicate that the average amount of radionuclides bound as exchangeable cations, expressed as a percentage of the specific activities of each radionuclide, are: 226Ra - 2.13% (S.D. 2.15), 238U - 5.2% (S.D. 4.6) and 228Ra - 12.2% (S.D. 7.0). For easily oxidisable organic matter, the average percentages are: 236Ra - 3.2% (S.D. 3.2), 238U - 21.9% (S.D. 18.4), and 228Ra - 8.5% (S.D. 8.7). Percentages for iron oxides are 226Ra - 8.7% (S.D. 7.5), 238U - 54.8% (S.D. 22.2) and 228Ra - 19.7% (S.D. 12.9). N equals 17 in all cases. The results indicate that the primary factor controlling U238 accumulation, and to a lesser extent 226Ra and 228Ra, is the redox condition of the peat. Release of radionuclides from the peat could possibly occur via changes in the redox status as a result of activities such as forestry or drainage of the peat. (orig.)

  5. Investigation of $\\alpha$-decay rates of $^{221}$Fr, $^{224}$Ra and $^{226}$Ra in different environments

    2007-01-01

    It has recently been suggested, and indicated experimentally, that $\\alpha$- decay half-lives are modified by solid state effects in the surrounding environment. We propose here to measure with high accuracy the $\\alpha$-decay half-life of $^{221}$Fr, $^{224}$Ra and $^{226}$Ra in insulators and metals. Furthermore we plan to investigate the temperature dependency of the half-life in these materials (room temperature, 4 K and 10 mK).

  6. RNA-Seq analysis of urea nutrition responsive transcriptome of Oryza sativa elite indica cultivar RP Bio 226.

    Reddy, Mettu Madhavi; Ulaganathan, Kandasamy

    2015-12-01

    Rice yield is greatly influenced by the nitrogen and rice varieties show variation in yield. For understanding the role of urea nutrition in the yield of elite indica rice cultivar RPBio-226, the urea responsive transcriptome was sequenced and analyzed. The raw reads and the Transcriptome Shotgun Assembly project has been deposited at DDBJ/EMBL/GenBank under the accession GDKM00000000. The version described in this paper is the first version, GDKM01000000. PMID:26697348

  7. Sampling errors associated with soil composites used to estimate mean Ra-226 concentrations at an UMTRA remedial-action site

    The decision whether to take additional remedial action (removal of soil) from regions contaminated by uranium mill tailings involves collecting 20 plugs of soil from each 10-m by 10-m plot in the region and analyzing a 500-g portion of the mixed soil for 226Ra. A soil sampling study was conducted in the windblown mill-tailings flood plain area at Shiprock, New Mexico, to evaluate whether reducing the number of soil plugs to 9 would have any appreciable impact on remedial-action decisions. The results of the Shiprock study are described and used in this paper to develop a simple model of the standard deviation of 226Ra measurements on composite samples formed from 21 or fewer plugs. This model is used to predict as a function of the number of soil plugs per composite, the percent accuracy with which the mean 226Ra concentration in surface soil can be estimated, and the probability of making incorrect remedial action decisions on the basis of statistical tests. 8 refs., 15 figs., 9 tabs

  8. Radium-226-contaminated drinking water: Hypothesis on an exposure pathway in a population with elevated childhood leukemia

    A recent epidemiological survey on childhood malignant disease in the region of Ellweiler, Rheinland-Pfalz, Germany, revealed a significantly increased incidence of childhood leukemia, but observed incidences of lymphoma and solid tumors were normal. Established risk factors such as individual exposure to chemicals as well as hereditary genetic disorders were ruled out in interviews with the patients or their families. The general population in the region, however, is subjected to considerable doses of ionizing radiation due to high levels of external γ radiation and high activities of indoor radon. Radiation-specific chromosome aberrations were found in one of two healthy siblings and one father of leukemia patients as well as in any of three probands living in houses with high indoor radon activities. Radon and natural γ radiation, however, cannot explain the geographical pattern of the cases. Four out of seven cases were observed in two particular villages near a uranium processing plant. The drinking water of these villages partly came from a small river that was contaminated with radium-226 washed out from the dumps of the uranium plant. Only sparse measurements of 226Ra are available, but derived red bone marrow doses for children in the two villages obtained from a simple radio-ecological model show the significance of the drinking water pathway. Prenatal 226Ra exposure of fetuses due to placental transfer and accumulation may have led to significant doses and may explain the excess cases of childhood leukemia in the region even in quantitative terms. 11 refs., 6 tabs

  9. Comparative full genome analysis revealed E1: A226V shift in 2007 Indian Chikungunya virus isolates.

    Santhosh, S R; Dash, P K; Parida, M M; Khan, M; Tiwari, M; Lakshmana Rao, P V

    2008-07-01

    The resurgence of Chikungunya virus (CHIKV) in the form of unprecedented explosive epidemic after a gap of 32 years in India is a point of major public health concern. In 2007 again there was outbreak in Kerala, India, affecting more than 25,000 cases with many reported mortalities. To understand the molecular basis of this high virulence and its implication in large-scale epidemic, a detailed systematic serological, virological and molecular investigation was undertaken with the epidemic samples of Kerala-2007. The comparative analysis of full genome sequence of Chikungunya virus isolate of 2007 with 2006 revealed three unique substitutions in structural and non-structural genes of 2007 isolate [two in E1 region (V14A and A226V) and one in Nsp1 (M184T)]. Our finding further substantiates the association of A226V shift in E1 gene with evolutionary success possibly due to adaptation in the mosquito vector with progression of epidemic, as observed in Reunion Island. This A226V shift which was absent in all 2006 Indian isolates, is found to be present in the four 2007 isolates, analysed in this study. These unique molecular features of the 2007 isolates with the progression of the epidemic from 2005 to 2007 demonstrate their high evolutionary and epidemic potential and thereby suggesting possible implication in higher magnitude and virulence of this outbreak. PMID:18384900

  10. Application of ion exchange and extraction chromatography for 226Ra determination in natural waters using HR-ICP-MS

    We describe a chemical separation procedure for determination of 226Ra in natural water samples with high-resolution ICP-MS (HR-ICP-MS). The proposed procedure is focused on the application of ion exchange and extraction chromatography for pre-concentration and separation of Ra from water samples. It was clear that the sensitivity of HR-ICP-MS was sufficient for 226Ra determination in natural water after selective extraction of the analyte. The Diphonix ion-exchange resin was used for alkali earth cations extraction from natural water samples, followed by the separation of Ba and Ra from Mg, Ca and most of Sr using the Muromac cation exchange resin. Final separation of Ra from Ba and the rest of Sr was performed by the selective retention of Ba and Sr on the Sr-Spec extraction chromatographic resin. Overall chemical recovery was estimated to be >95%, and 226Ra pre-concentration factor of 200 was achieved by the developed procedure. (author)

  11. State of disequilibrium between 238U, 234U, 226Ra and 222Rn in groundwater from bedrock

    Approximately one thousand drilled wells were investigated for their natural radioactivity. The determinations of 238U, 234U, 226Ra and 222Rn from 310 samples showed a high state of radioactive disequilibrium between the members of the uranium series present in water. The 238U/226Ra activity ratio usually fell in the range 1 to 20 and the 238U/222Rn activity ratio in the range 1 to 20 x 10-4, the highest activity ratios being from samples with an elevated uranium content. The 234U/238U activity ratio varied between 0.76 and 4.67, the most frequent values showing a 60% excess of 234U in the samples. Most of the 234U/238U activity ratios near unity were found in samples with a high uranium content. Several drilled wells with anomalously high uranium contents were found in southern Finland. The average 226Ra and 222Rn contents of these wells were not exceptionally high, which suggests high mobility of uranium in groundwater from the areas involved. (author)

  12. 222Rn and 226Ra activity concentrations in groundwaters of southern Poland. New data and selected genetic relations

    Since 2008, the authors have been conducting research into 222Rn and 226Ra activity concentrations in shallow circulation groundwaters in southern Poland. Measurements have been performed with a liquid-scintillation method and ultra low-level liquid-scintillation spectrometers α/β Quantulus 1220. The research carried out so far has demonstrated that in the Sudetes groundwaters with high activity concentrations of 222Rn and 226Ra are common. In other studied areas in southern Poland no shallow circulation groundwaters with high radon or radium concentrations have been found yet. The conducted research has demonstrated that the activity concentration of 222Rn dissolved in shallow circulation groundwaters in the Sudetes depends chiefly on the amount of radon, which after being released as gas from reservoir rocks is dissolved in waters flowing through these rocks. At the same time, the concentration of 222Rn dissolved in some shallow circulation groundwaters in the Carpathians is influenced significantly by the amount of radon produced from the decay of its parent ion 226Ra2+ dissolved in these waters. (author)

  13. Distribution of naturally occurring radionuclides uranium and 226Ra in groundwater adjoining uranium complex of Turamdih, Jharkhand, India

    Estimation of radionuclide content is essential for assessment of individual exposure in areas where groundwater is the principal source of drinking water. Elevated levels can be expected in areas known for radioactive mineral deposits and anthropogenic activities like mining and ore processing industry. The aim of this study is to determine the uranium and 226Ra in groundwater sources adjoining and away from uranium mining and ore processing industry at Turamdih, Jharkhand. The concentration of uranium in well/tubewell samples analysed nearby and away from the tailings ponds ranged from 0.1 to 8.4 μgI-1 and 226Ra varied from 4 to 269 mBqI-1. The wide variation of activity concentration is due to regions of uranium deposits with elevated level of radium in the earth's crust and geological faults, when compared to lower concentration profile of radium in earth crust. The ingestion of uranium and 226Ra in the adult population residing around Turamdih mining complex through drinking water sources ranged from 0.81 μSv year-1 to 3.8 μSv year-1 respectively. This is much lower than 100 μSv year-1, that is recommended by WHO for ingestion from intake of a single radionuclide. The groundwater monitoring carried out over four years around Turamdih mining complex indicates that there has been no observable impact on groundwater sources due to mining and ore processing activities in this region. (author)

  14. Transfer of Radionuclides K-40, Th-232 and Ra-226 from Mining Soil to Sawi (Japanese Mustard)

    Hariandra, M.; Amin, Y. M.

    2008-05-01

    The uptake of naturally occurring thorium, radium and potassium by sawi (Japanese Mustard) from disused tin mining was studied. Both soil and sawi sample were collected from a vegetable farm located 15 km from Kuala Lumpur, Malaysia where the farm has been operating for 22 years on a disused tin mining. By using a gamma spectroscopy system, the transfers of radionuclides from soil to plants were investigated. The highest values of radionuclides in the soil was K-40 which is 52.8 Bq kg-1 and the lowest was Ra-226 which is 6.51 Bq kg-1. The activity of Th-232 is 18.5 Bq kg-1. The activity of radionuclides in the sawi sample shows higher values as compared to the soil sample. The highest values of radionuclides in the sawi were K-40 which is 446 Bq kg-1 and the lowest was Ra-226 which is 17.5 Bq kg-1. The activity of Th-232 is 65.2 Bq kg-1. The concentration of radionuclides in soils and plants can be used for the determination of soil-to-plant transfer factors. The soil to plant transfer factors (TF) were calculated and observed to be 2.68 for radium-226, 3.52 for thorium-232 and the highest which is 3.97 for potassium-40.

  15. Determination of 226Ra, 224Ra, 223Ra and 228Ra in mineral water samples of the Slovak Republic

    The Slovak Republic is very rich in mineral water sources. In recent years, it has been discovered that a number of mineral waters in the Slovak Republic contain high levels of 226Ra and 228Ra. Moreover, there is a lack of information on 224Ra and 223Ra concentrations in mineral waters as well. The currently approved techniques for alpha emitting radium isotopes are based on radon emanation methods. Due to the long ingrowth periods required by these techniques, any 224Ra and 223Ra in the sample decay away and go undetected. For this reason, we have used an alpha spectrometric method for the simultaneous determination of 226Ra, 223Ra and 224Ra. Radium was concentrated by a lead sulphate co-precipitation. The precipitate was dissolved in EDTA and the radium isotopes were separated from possible interfering radionuclides using barium sulphate micro precipitation. The radium-barium precipitate was filtered and counted by alpha spectrometry. 133Ba was used to quantify the yield by gamma spectrometry. In our laboratory, gamma spectrometry was also used for the determination of 228Ra in mineral water samples. Radium was concentrated by a lead-barium sulphate co-precipitation. 133Ba was used to quantify the yield, found to be 97 % on the average, by gamma spectrometry. Furthermore, the committed effective doses for 226Ra, 224Ra, 223Ra, 228Ra intake via ingestion of mineral waters for the members of public were calculated. (author)

  16. Long-term effects of an intracavitary treatment with californium-252 on normal tissue. [Swine, /sup 226/Ra

    Sullivan, M.F.; Beamer, J.L.; Mahony, T.D.; Cross, F.T.; Lund, J.E.; Endres, G.W.R.

    1976-01-01

    About one hundred fifty swine were exposed to either radium-226 or californium-252 sources in the uterine cervix to determine an RBE for both acute and long-term effects. That value for early changes in the tissues at risk in the treatment of cervical cancer was between 6.2 and 6.8. The incidence of complications increased with time after exposure, especially among animals treated with /sup 252/Cf. Analysis of rectal injury showed that ulceration occurred frequently within a year postexposure at doses between 1600 and 2400 rad calculated at 2 cm lateral to the source midline. Fat necrosis and smooth muscle atrophy, resulting in a local rectal stricture, were delayed changes observed in some animals. The lower ureter was the site for a greater frequency of complications than the GI tract. Ureteral stricture often occurred at doses of 1200 rad from /sup 252/Cf and 7000 rad from /sup 226/Ra. Observation of delayed effects in the uterine-cervix in animals held up to 4 years postexposure indicate that the RBE for /sup 252/Cf may be increased to a value as high as 18, while repair may have even decreased it to about 5.6 in the rectum. Fifty swine are still being observed for long-term effects after doses above 800 rad from /sup 252/Cf and 5000 rad from /sup 226/Ra.

  17. Intake of uranium and radium-226 due to food crops consumption in the phosphate region of Pernambuco - Brazil

    The phosphate region located in the Northeast of Brazil covers an area of approximately 150 km long with an average width of 4 km, along the coast of the states of Pernambuco and Paraiba. The inhabitants of this area are exposed to natural radioactivity levels higher than the background values recorded in the literature, mainly due to the presence of uranium and its decay products in the phosphatic sediments. The main aim of this study was to determine the activity concentration of uranium and 226Ra in foodstuffs cultivated in this area, where the phosphate mineral has been extracted. The activity concentrations found for uranium and 226Ra in the foodstuffs analyzed varied from 13 to 186 mBq kg-1 (wet weight), with a mean value of 46 mBq kg-1 and from 43 to 2209 mBq kg-1 (wet weight), with a mean value of 358 mBq kg-1, respectively. The annual intake of these radionuclides, for rural residents, was 7.45 Bq for uranium and 69.3 Bq for 226Ra

  18. Determination of Ra-226 in Soil Samples Collected from Filters of Underground Water Treatment Stations by Inductively Coupled Plasma Mass Spectrometry

    An analytical procedure has been proposed for the determination of 226Ra at the low picogram per gram concentration level in soil samples using Inductively Coupled Plasma Mass Spectrometer (ICP-MS). 226Ra is pre-concentrated from sand filters using inorganic acids after optimizing different parameters. Sand filters are used in underground water treatment stations to remove particulate matter from underground water, where iron and manganese are collected and form thin films covers sands. Iron and manganese oxides adsorb radium from underground water. By time, radium concentrations increase in the filters, and consequently the level of radioactivity increases in the station. Separation of radium from Barium, lanthanum, cerium and strontium soils is obtained by using dowex 50w-X8 and Eichrom Sr-resin. The limit of detection for 226Ra determination is 0.02 ppt. 226Ra concentrations are found between 17.9-198 ppt. In addition, uranium concentration and uranium isotope ratios are measured.

  19. Comparison of {sup 226}Ra nuclide from soil by three woody species Betula pendula, Sambucus nigra and Alnus glutinosa during the vegetation period

    Soudek, Petr; Petrova, Sarka; Benesova, Dagmar [Laboratory of Plant Biotechnologies, Joint Laboratory of Institute of Experimental Botany AS CR and Crop Research Institute, Rozvojova 263, 165 02 Prague 6 (Czech Republic); Tykva, Richard [Department of Radioisotopes, Institute of Organic Chemistry and Biochemistry AS CR, Flemingovo nam. 2, 166 10 Prague 6 (Czech Republic); Vankova, Radomira [Laboratory of Hormonal Regulations in Plants, Institute of Experimental Botany AS CR, Rozvojova 263, 165 02 Prague 6 (Czech Republic); Vanek, Tomas [Laboratory of Plant Biotechnologies, Joint Laboratory of Institute of Experimental Botany AS CR and Crop Research Institute, Rozvojova 263, 165 02 Prague 6 (Czech Republic)], E-mail: vanek@ueb.cas.cz

    2007-09-15

    The uptake of {sup 226}Ra from the contaminated soil was compared in three woody species: alder (Alnus glutinosa), birch (Betula pendula) and elder (Sambucus nigra). The {sup 226}Ra activities increased during the vegetation periods (in 2003, 2004 and 2005) both in the leaves and flowers + seeds. The highest accumulation was found in birch, reaching 0.41 Bq/g DW in the leaves (at the end of the vegetation period in 2003). The lowest {sup 226}Ra accumulation was determined in alder. The extent of {sup 226}Ra accumulation in the leaves of woody species demonstrates that these pioneer woody species can be used as remediation alternative to the use of herbs, provided that the removal of fallen leaves could be achieved in the end of vegetation period.

  20. Radon leakage as a source of additional uncertainty in simultaneous determination of 226Ra and 228Ra by gamma spectrometry—Validation of analysis procedure

    A series of validation experiments was carried out to assess robustness, repeatability, and trueness of an analysis procedure for simultaneous determination of 226Ra and 228Ra in water samples. The study revealed instabilities in the radon holding capacity of the sample matrix (epoxy resin). The discovered effect is a new additional component in the uncertainty budget which should be considered when 226Ra is measured via its progeny in similar sample matrices. - Highlights: • 226Ra and 228Ra determined gamma spectrometrically via 214Pb and 228Ac. • Procedure proved to be robust for conserved water samples of pH 226Ra is determined via progeny in similar matrices. • Results of an intercomparison study proved the procedure to be fit for its purpose

  1. Distribution of uranium, Ra-226, Pb-210 and Po-21a in the ecological cycle in mountain regions of central Yugoslavia

    The distributions of U, 226Ra, 210Pb and 210Po in the ecological cycle: soil-hay-domestic animals-meat-cheese-milk were investigated. The levels of radioactivity in soil were found to be normal. The highest result found for U in hay was 100 ug/kg. The amount of 226Ra was highest in beef bones, where the contamination reached 190 pCi/kg. The amount of 210Pb in bones never exceeded 30 pCi/kg and in meat, 5 pCi/kg. In most samples 210Po was below the detection level, but one bone sample reached 90 pCi/kg. U, 226Ra, 210Pb and 210Po in milk all vary from 0 - 2.45 pCi/l. Only 210Pb in cheese was as high as 60 pCi/kg, 226Ra, 210Po and U were hardly detectable. (H.K.)

  2. Sequential survey of the occurrence and the possible effects of a 226Ra surplus in harbour slurry polder grounds: Definition study

    Sediments in the harbors of Rotterdam contain relatively large amounts of naturally occurring radionuclides resulting from emissions of the ore-processing industries (88Be, 92Be). Using harbour sludge as a landfill for polders has locally caused the 226Ra contents of the soil to be a factor of 4 higher than the expected 226Ra background. In polders where 226Ra was measured, the 226Ra surplus was found to be proportional to the cadmium contents (92Mo). Data on cadmium contents are available for many polders and therefore, cadmium may be useful as a tracer for enhanced levels of 226Ra. Enhanced levels of 226Ra may cause higher radon concentrations in dwellings that are built on these soils. Therefore, an extensive research programme is started to study the relation between the 226Ra contents of the soil and radon concentrations in dwellings. The Laboratory of Radiation Research of RIVM has proposed to set up a sub-programme, focusing on the sites where harbour sludges have been dumped, with the following goals: 1) to investigate if there are dwellings with enhanced radon concentrations as a result of a 226Ra surplus and 2) to investigate if the relation between the 226Ra-surplus and the cadmium contents found is generally valid and useful. In this report we describe how this sub-programme may be set up and we give specific advice on the answers to various choices. We propose a.o. to use soil samples from 30 polders to investigate the relation between the 226Ra surplus and the cadmium contents and to study in eight polders the possible consequences of enhanced 226Ra levels for the radon concentrations in dwellings. Because the radon measurements take one year (four measurements averaged over three month) we propose that simple diagnostic measurements are made simultaneously with the radon measurements. These additional measurements include measurements of the groundwater table and of the effective ventilation pattern in the dwelling. 1 fig., 5 tabs., 16 refs

  3. 226Ra and 228Ra activity levels in potable drinking water supplied to pharmaceutical companies in India

    The low level 226Ra and 228Ra activities were measured in Potable water samples received by pharmaceutical companies located in Maharashtra, Goa, Gujarat, Madhya Pradesh and Himachal Pradesh through private Borewell Supply and Municipal water Supply units. Radium in drinking water and food enhances the ingestion dose due to its long radiological and biological half-life. The Radium activity level in the fresh water was supposed to be within the limits prescribed by USEPA Guideline for Drinking Water Quality, 40 CFR 141,a Code of Federal Regulation. Higher concentration of Radium can be easily measured by Gamma spectrometry. The paper gives the low levels of radium isotopes present in the water samples which are not detectable successfully by simple gamma spectrometry. A separation chemistry considering Radium isotopes decay scheme and chemical similarity to Calcium was adapted to measure the activity with sequential chemical separation method followed by determining the alpha and beta activity of individual radium isotopes. In bore well water 226Ra activity level was in the range of 0.21 to 60±3.7 mBq/l and 228Ra level was in the range of 5.48 to 111.9±12.2 mBq/l while in Municipal water supply 226Ra and 228Ra was observed to be in the range of 0.32 to 28.89 mBq/l and 2.19 to 117.43 mBq/l respectively. A combined 226Ra+228Ra activity was observed to be in the range of 2.63 to 171.9±12.75 mBq/l which is very much within the prescribed limits. The investigation indicated that 228Ra activity is comparatively more than 226Ra indicating the water source to be from Thorium rich locations.The expected dose assessed was in the range of 13.18 to 0.04 μSv/y which is well within the limit of 0.1 mSv/y. (author)

  4. Annexin A1 N-terminal derived peptide Ac2-26 stimulates fibroblast migration in high glucose conditions.

    Valentina Bizzarro

    Full Text Available Deficient wound healing in diabetic patients is very frequent, but the cellular and molecular causes are poorly defined. In this study, we have evaluated whether Annexin A1 derived peptide Ac2-26 stimulates fibroblast migration in high glucose conditions. Using normal human skin fibroblasts WS1 in low glucose (LG or high glucose (HG we observed the enrichment of Annexin A1 protein at cell movement structures like lamellipodial extrusions and interestingly, a significant decrease in levels of the protein in HG conditions. The analysis of the translocation of Annexin A1 to cell membrane showed lower levels of Annexin A1 in both membrane pool and supernatants of WS1 cells treated with HG. Wound-healing assays using cell line transfected with Annexin A1 siRNAs indicated a slowing down in migration speed of cells suggesting that Annexin A1 has a role in the migration of WS1 cells. In order to analyze the role of extracellular Annexin A1 in cell migration, we have performed wound-healing assays using Ac2-26 showing that peptide was able to increase fibroblast cell migration in HG conditions. Experiments on the mobilization of intracellular calcium and analysis of p-ERK expression confirmed the activity of the FPR1 following stimulation with the peptide Ac2-26. A wound-healing assay on WS1 cells in the presence of the FPR agonist fMLP, of the FPR antagonist CsH and in the presence of Ac2-26 indicated that Annexin A1 influences fibroblast cell migration under HG conditions acting through FPR receptors whose expression was slightly increased in HG. In conclusion, these data demonstrate that (i Annexin A1 is involved in migration of WS1 cells, through interaction with FPRs; (ii N- terminal peptide of Annexin A1 Ac2-26 is able to stimulate direct migration of WS1 cells in high glucose treatment possibly due to the increased receptor expression observed in hyperglycemia conditions.

  5. U-isotopes and (226)Ra as tracers of hydrogeochemical processes in carbonated karst aquifers from arid areas.

    Guerrero, José Luis; Vallejos, Ángela; Cerón, Juan Carlos; Sánchez-Martos, Francisco; Pulido-Bosch, Antonio; Bolívar, Juan Pedro

    2016-07-01

    Sierra de Gádor is a karst macrosystem with a highly complex geometry, located in southeastern Spain. In this arid environment, the main economic activities, agriculture and tourism, are supported by water resources from the Sierra de Gádor aquifer system. The aim of this work was to study the levels and behaviour of some of the most significant natural radionuclides in order to improve the knowledge of the hydrogeochemical processes involved in this groundwater system. For this study, 28 groundwater and 7 surface water samples were collected, and the activity concentrations of the natural U-isotopes ((238)U, (235)U and (234)U) and (226)Ra by alpha spectrometry were determined. The activity concentration of (238)U presented a large variation from around 1.1 to 65 mBq L(-1). Elevated groundwater U concentrations were the result of oxidising conditions that likely promoted U dissolution. The PHREEQC modelling code showed that dissolved U mainly existed as uranyl carbonate complexes. The (234)U/(238)U activity ratios were higher than unity for all samples (1.1-3.8). Additionally, these ratios were in greater disequilibrium in groundwater than surface water samples, the likely result of greater water-rock contact time. (226)Ra presented a wide range of activity concentrations, (0.8 up to about 4 × 10(2) mBq L(-1)); greatest concentrations were detected in the thermal area of Alhama. Most of the samples showed (226)Ra/(234)U activity ratios lower than unity (median = 0.3), likely the result of the greater mobility of U than Ra in the aquifer system. The natural U-isotopes concentrations were strongly correlated with dissolution of sulphate evaporites (mainly gypsum). (226)Ra had a more complex behaviour, showing a strong correlation with water salinity, which was particularly evident in locations where thermal anomalies were detected. The most saline samples showed the lowest (234)U/(238)U activity ratios, probably due to fast uniform bulk mineral dissolution

  6. Chromosome breakage in lymphocytes from humans with body burdens of 226Ra

    Peripheral lymphocytes from 10 controls and 40 patients with body burdens of 226Ra ranging from below the limit of detection to 8.6 μCi were scored for unstable chromosome aberrations. The patient population was divided into four groups: a group with body burdens below the limit of detection (less than 0.003 μCi, 12 patients); a low-burden group (0.003 to 0.099 μCi, 13 patients); a moderate-burden group (0.1 to 0.99 μCi, 11 patients); and a high-burden group (greater than 1.0 μCi, 4 patients). In none of these groups was the frequency of cells with unstable aberrations significantly elevated above that in the controls. The rate of occurrence of dicentric and ring chromosomes was above the control frequency in only the two patients with the highest burdens (3.55 and 8.6 μCi). Our results are consistent with the expectation derived from a recent calculation of alpha dose delivered to blood by bone-deposited radium and its decay products. Marshall and Hoegerman have estimated that the blood dose for an individual with a radium burden of 1.0 μCi is 0.09 +- 0.03 rad/year. The value is compared with the dose estimate used by Boyd et al. in their study of British radium-dial painters, and the relevance of the blood dose to the lymphocyte dose is discussed

  7. 222Rn, 226Ra, and U in drinking water in Hungary

    Among radionuclides ingested by drinking water the most important ones are radon, radium and uranium, causing radiation exposure of the lungs, bones, and gastro-intestinal organs, mainly kidneys. For this reason, as a part of the National Environmental Health Program to determine the main risk factors of the Hungarian population from environmental substances, 222Rn, 226Ra, and U concentrations were measured in domestic water supplies. Water samples were taken from all of the 19 Hungarian counties. Three cities were chosen from each county by the criteria of number of the population. Samples were taken from the communal drinking water supplies. Radon was determined by short lived daughter products using scintillation technique after water degassing into Lucas cells. Radium and uranium were determined after chemical separation, by Lucas scintillation method and by liquid scintillation technique. The obtained results were compared to the available literature data. Radioactivity levels were assessed for conformity with the Hungarian standards, WHO guidelines, and used for dose calculations. It was concluded that the radioactivity of the drinking water in Hungary is in the order of magnitude of the worldwide average. The measured radioactivity levels never exceeded the limits of the valid Hungarian standards for annual intake limits and were adequate to WHO guidelines. It was found that public doses from radon, radium, and uranium ingestion by drinking water were 12.7, 8.8, and 7.3 μSv y-1 , respectively. Summarizing the results of the survey it was concluded that comparing these doses to the public dose from other natural sources of radiation are negligibly small. (author)

  8. Optimized measurement of radium-226 concentration in liquid samples with radon-222 emanation.

    Perrier, Frédéric; Aupiais, Jean; Girault, Frédéric; Przylibski, Tadeusz A; Bouquerel, Hélène

    2016-06-01

    Measuring radium-226 concentration in liquid samples using radon-222 emanation remains competitive with techniques such as liquid scintillation, alpha or mass spectrometry. Indeed, we show that high-precision can be obtained without air circulation, using an optimal air to liquid volume ratio and moderate heating. Cost-effective and efficient measurement of radon concentration is achieved by scintillation flasks and sufficiently long counting times for signal and background. More than 400 such measurements were performed, including 39 dilution experiments, a successful blind measurement of six reference test solutions, and more than 110 repeated measurements. Under optimal conditions, uncertainties reach 5% for an activity concentration of 100 mBq L(-1) and 10% for 10 mBq L(-1). While the theoretical detection limit predicted by Monte Carlo simulation is around 3 mBq L(-1), a conservative experimental estimate is rather 5 mBq L(-1), corresponding to 0.14 fg g(-1). The method was applied to 47 natural waters, 51 commercial waters, and 17 wine samples, illustrating that it could be an option for liquids that cannot be easily measured by other methods. Counting of scintillation flasks can be done in remote locations in absence of electricity supply, using a solar panel. Thus, this portable method, which has demonstrated sufficient accuracy for numerous natural liquids, could be useful in geological and environmental problems, with the additional benefit that it can be applied in isolated locations and in circumstances when samples cannot be transported. PMID:26998570

  9. Effects of Cx43 gene modification on the proliferation and migration of the human lung squamous carcinoma cell line NCI-H226.

    Zang, J-P; Wei, R

    2015-01-01

    In this study, the human lung squamous carcinoma cell line NCI-H226 was transfected with the recombinant plasmid pBudCE4.1_Cx43 to explore the role of the Cx43 gene in cell growth, cell cycle, and tumor migration. pBudCE4.1-Cx43 was transfected into human lung squamous carcinoma NCI-H226 cells using Lipofectamine TM2000. The mRNA and protein expressions of Cx43 in the transfected cells were detected by reverse transcriptase polymerase chain reaction and western blot analysis. The cell-cell communication was detected using the scratch dye tracer method and the cell cycle was detected by flow cytometry. The CCK-8 proliferation, scratch healing, and cell invasion assays were performed to evaluate the effect of the Cx43 gene transfection on the proliferation, migration, and invasive abilities of NCI-H226 cells. Cx43 mRNA and protein expressions and the fluorescence intensity in the scratch healing test were significantly higher in the experimental group than those in the control and blank groups (P H226 cell proliferation (especially 72 h after incubation) and cell migration, respectively, in the experimental group, compared to the control and blank groups (P H226 cells in the experimental group (P H226, thereby inhibiting tumor cell proliferation. PMID:26535624

  10. Seasonal variation of 228Ra/226Ra ratio in seaweed: implications for water circulation patterns in coastal areas of the Noto Peninsula, Japan

    To examine water circulation patterns of coastal water, 72 seaweed (Sargasso) samples and 27 coastal water samples were collected from coastal areas of the Noto Peninsula, Japan, during the period from December 1998 to June 2002. The 228Ra and 226Ra activities of those samples were measured by low-background γ-ray spectrometry. There was a wide range of activities of 228Ra (0.5-2 Bq/kg-fresh) and 226Ra (0.5-1.2 Bq/kg-fresh) in the Sargasso samples. The 228Ra/226Ra activity ratio of Sargasso samples exhibited seasonal variation with minimum values in June (228Ra/226Ra = ∼1) and maximum values in December (1.5-2.5), which was mainly governed by changes in 228Ra activity. It is also notable that the seasonal variation of the 228Ra/226Ra ratio of Sargasso is in approximate agreement with that of the ambient coastal water. Sargasso samples appear to have retained the 228Ra/226Ra ratio of the ambient coastal waters, and the temporal variations in that ratio provide insight into seasonal changes in water circulation in the Noto Peninsula coastal area

  11. Gross alpha activity as an estimator of radium-226 activity in soils and tailings at an inactive uranium mill tailings site

    Dreesen, D.R.; Wienke, C.L.

    1978-10-01

    Gross alpha activity in surface tailings and surface soils from one inactive uranium mill site has been shown to be an accurate estimator of /sup 226/Ra activity. An exponential regression, /sup 226/Ra = 387(e/sup 0.00166..cap alpha../ - 1), where /sup 226/Ra activity is in picoCuries per gram and gross alpha activity is in counts per minute per sample, gave a good fit for samples ranging in gross alpha activity from 3 to 1082 cpm/sample. A linear regression, /sup 226/Ra = 1.05 ..cap alpha.. + 1.78, has been calculated, which shows gross alpha activity to be an excellent estimator of /sup 226/Ra activity in soils contaminated with tailings. The percentage of gross alpha activity attributable to /sup 226/Ra activity has been calculated to be 7.2, 17.6, 18.3, and 17.0 for uncontaminated soils, contaminated soils, tailings, and the total set of samples, respectively.

  12. Aluminum hydroxide associated to Schistosoma mansoni 22.6 kDa protein abrogates partial protection against experimental infection but not alter interleukin-10 production

    Lucila GG Pacífico

    2006-10-01

    Full Text Available The need to develop a vaccine against schistosomiasis led several researches and our group to investigate proteins from Schistosoma mansoni as vaccine candidates. Sm22.6 is a protein from S. mansoni that shows high identity with Sj22.6 and Sh22.6 (79 and 91%, respectively. These proteins are associated with high levels of IgE and protection to reinfection. Previously, we have shown that Sm22.6 induced a partial protection of 34.5% when used together with Freund's adjuvant and produced a Th0 type of immune response with interferon-g and interleukin-4. In this work, mice were immunized with Sm22.6 alone or with aluminum hydroxide adjuvant and high levels of IgG, IgG1, and IgG2a were measured. Unfortunately, no protection was detected. Since IL-10 is a modulating cytokine in schistosomiasis, we also observed a high level of this molecule in splenocytes of vaccinated mice. In conclusion, we did not observe the adjuvant effect of aluminum hydroxide associated with rSm22.6 in protective immunity.

  13. The removal of radioactive radium (Ra226) from chloride liquors by columnar ion exchange in the presence of calcium, magnesium and iron cations

    The purpose of this work was to study the feasibility of controlling the discharge of soluble Ra226, in the presence of Ca, Mg and Fe cations in synthetic chloride effluents, by adsorption on cation exchange resins to decrease Ra226-concentrations to federal environmental levels of 10 pCi Ra226/litre. Environmentally acceptable effluents were produced from synthetic chloride feed liquors containing 10 ppm Ca, 5 ppm Mg, 120 ppm Fe plus 20,000 pCi Ra226/litre. Environmentally acceptable effluents were not produced, by cation exchange, from a synthetic chloride liquor containing 490 ppm Ca, 97 ppm Mg, 720 ppm Fe in addition to 20,000 pCi Ra226/litre. The mass interference of the Ca + Mg + Fe cation concentrations in the feed liquor was in over-powering competition, for resin sites, with the Ra226-cations. To obtain realistic data, the adsorption process should be reexamined using a chloride liquor produced under optimal chloride leaching conditions of an Elliot Lake uranium ore. This would, in all probability, reveal other cations unavailable in the synthetic chloride liquors

  14. Radiochemical determination of {sup 210} Pb and {sup 226}Ra in petroleum sludges and scales; Determinacao radioquimica de {sup 210} Pb e {sup 226}Ra em borras e incrustacoes de petroleo

    Araujo, Andressa Arruda de

    2005-07-01

    The oil extraction and production, both onshore and offshore, can generate different types of residues, such as sludge, that is deposited in the water/oil separators, valves and storage tanks and scales, which form i the inner surface of ducts and equipment. Analyses already carried out through gamma spectrometry indicated the existence of high radioisotope concentration. However, radionuclides emitting low-energy gamma-rays, such as {sup 210} Pb, are hardly detected by that technique. Consequently, there is a need to test alternative techniques to determine this and other radionuclides from the {sup 238} U series. This work, therefore, focuses on the radiochemical determination of the concentration of {sup 210}Pb, and {sup 226} Ra in samples of sludge and scale from the oil processing stations of the UN-SEAL, a PETROBRAS unit responsible for the exploration and production of petroleum in Sergipe and Alagoas. The sludge and scale samples went through a preliminary process of extraction of oil, in order to separate the solid phase, where the largest fraction of the radioactivity is concentrated. After oil removal, the samples were digested using alkaline fusion as an option for dissolution. Finally, their activity concentration was determined for the samples of sludge and scales, using and alternative radiochemical method, which is based on ionic exchange. The activity concentration found for {sup 210}Pb varied from 1,14 to 507,3 kBq kg{sup -1}. The values for {sup 226}Ra were higher, varying from 4,36 to 3.445 kBq kg{sup -1}. The results for {sup 226}Ra were then compared with the ones found for the same samples of sludge and scales using gamma spectrometry. The results of the comparison confirm the efficiency of the methodology used int hi work, that is, radiochemical determination by means of ionic exchange. (author)

  15. Development and evaluation of a technique for the determination of 226Ra and 228Ra by liquid scintillation in biological samples

    Radium isotopes are dispersed in the environment according to their physicochemical characteristics. Considering their long half-lives and radiological effects, 226Ra and 228Ra are very important issues to radiological protection. In Brazil, radium isotopes represent an exposure problem both in the nuclear fuel cycle installations and in high natural radiation background areas. The experimental part of this work includes the development of a technique for the determination of 226Ra and 228Ra by liquid scintillation in biological samples. Radium was concentrated and then separated from the others constituents of the sample by coprecipitation/ precipitation with Ba(Ra)SO4. The precipitate was filtered and weighted to calculate the chemical yield. The filter containing the precipitate of Ba(Ra)SO4 was transferred to a scintillation vial. Two methods were used to prepare the sources. The first one consisted gel suspension and the second one, phases method. The solutions obtained were counted in a low background scintillation spectrometry system (Quantulus) suitable for the detection and identification of both alpha and beta particles for the determination of 226Ra and 228Ra. The activity values of 226Ra and 228Ra calculated by the two methods are in good agreement with the reference value indicating that both methods are suitable for the determination of 226Ra and 228Ra. The values of minimum detectable activity (MDA) for the gel suspension method were 2.5 mBq.L-1 for 226Ra and 53 mBq.L-1 for 228Ra and for the method of phases were 2.6 mBq.L-1 for 226Ra and 66 mBq.L-1 for 228Ra. (author)

  16. Development and evaluation of a technique for the determination of {sup 226}Ra and {sup 228}Ra by liquid scintillation in biological samples

    Fernandes, Paulo Cesar P.; Sousa, Wanderson O.; Dantas, Bernardo M.; Juliao, Ligia M.Q.C. [Instituto de Radioprotecao e Dosimetria (IRD/CNEN-RJ), Rio de Janeiro, RJ (Brazil)], e-mail: pcesar@ird.gov.br

    2009-07-01

    Radium isotopes are dispersed in the environment according to their physicochemical characteristics. Considering their long half-lives and radiological effects, {sup 226}Ra and {sup 228}Ra are very important issues to radiological protection. In Brazil, radium isotopes represent an exposure problem both in the nuclear fuel cycle installations and in high natural radiation background areas. The experimental part of this work includes the development of a technique for the determination of {sup 226}Ra and {sup 228}Ra by liquid scintillation in biological samples. Radium was concentrated and then separated from the others constituents of the sample by coprecipitation/ precipitation with Ba(Ra)SO{sub 4}. The precipitate was filtered and weighted to calculate the chemical yield. The filter containing the precipitate of Ba(Ra)SO{sub 4} was transferred to a scintillation vial. Two methods were used to prepare the sources. The first one consisted gel suspension and the second one, phases method. The solutions obtained were counted in a low background scintillation spectrometry system (Quantulus) suitable for the detection and identification of both alpha and beta particles for the determination of {sup 226}Ra and {sup 228}Ra. The activity values of {sup 226}Ra and {sup 228}Ra calculated by the two methods are in good agreement with the reference value indicating that both methods are suitable for the determination of {sup 226}Ra and {sup 228}Ra. The values of minimum detectable activity (MDA) for the gel suspension method were 2.5 mBq.L{sup -1} for {sup 226}Ra and 53 mBq.L{sup -1} for {sup 228}Ra and for the method of phases were 2.6 mBq.L{sup -1} for {sup 226}Ra and 66 mBq.L{sup -1} for {sup 228}Ra. (author)

  17. 226Ra and 228Ra activities associated with agricultural drainage ponds and wetland ponds in the Kankakee Watershed, Illinois-Indiana, USA

    Background radioactivity is elevated in many agricultural drainage ponds and also constructed wetland ponds in the Kankakee watershed. During 1995-1999, gross-α and -β activities were measured up to 455 and 1650 mBq L-1, respectively. 226Ra and 228Ra averaged 139 and 192 mBq L-1 in controlled drainage ponds compared to 53 and 58 mBq L-1 for 226Ra and 228Ra, respectively, in native wetland ponds. Analyses of applied ammonium phosphate fertilizers near both native and controlled ponds indicate comparable 226Ra/228Ra and 228Ra/232Th activity ratios with only the surface waters in the controlled ponds. For example, 226Ra/ 228Ra activity ratios in controlled ponds ranged from 0.79 to 0.91 and group with a local fertilizer batch containing FL phosphate compounds with 226Ra/228Ra activity ratios of 0.83-1.04. Local soils of the Kankakee watershed have 226Ra/228Ra activity ratios of 0.54-0.70. Calculated Ra fluxes of waters, in drainage ditches associated with these controlled ponds, for 226Ra ranged from 0.77 to 9.00 mBq cm-2 d-1 and for 228Ra ranged from 1.22 to 8.43 mBq cm-2 d-1. Ra activity gradients were measured beneath these controlled ponds both in agricultural landscapes and in constructed wetlands, all being associated with drainage ditches. Ra had infiltrated to the local water table but was below regulatory maximum contaminant limits. Still, measurable Ra activity was measured downgradient of even the constructed wetlands in the Kankakee watershed, suggesting that the attenuation of Ra was low. However, no Ra excess was observed in the riparian zone or the Kankakee River downgradient of the native wetland ponds

  18. 226Ra and 222Rn contents of Galapagos rift hydrothermal waters - the importance of low-temperature interactions with crustal rocks

    Hydrothermal waters collected by 'Alvin' from the Galapagos Spreading Center are enriched in 222Rn by factors of 50-200 over bottom waters. The 226Ra in the same samples, however, is enriched by less than a factor of four over bottom waters. Enrichments of 222Rn result primarily from α-recoil from rock surfaces while 226Ra enrichments are dominantly produced by high-temperature alteration of cooling ridge volcanics. The abundances of both nuclides exhibit positive correlations with temperature. The data extrapolate to bottom water temperatures and compositions, demonstrating the importance of seawater mixing. Different vents, however, have different mixing lines, and vents with high 222Rn have low 226Ra. We propose these pattern result from variations in the extent of low-temperature crustal interaction with the hydrothermal fluids. Low-temperature crustal waters, can maintain high steady state 222Rn contents due to the α-recoil additions to the fluids. The 226Ra, however, is strongly adsorbed at low-temperatures resulting in low concentrations of this nuclide in low-temperature crustal waters. Thus, physical mixing of a crustal water component with hydrothermal waters or variable crustal path lengths of the hydrothermal fluids can account for the variable mixing lines and 222Rn/226Ra values of the hot springs. The 222Rn/226Ra value appears to be a sensitive indicator of low-temperature crustal interaction. Values > 100 have experienced extensive crustal interaction and are indicative of diffuse hydrothermal flow. Values between 1 and 10 are indicative of primary hydrothermal fluids which have not experienced significant interaction with the crust. Values of 222Rn/226Ra between 103 and 104 are indicative of interaction of the hydrothermal fluids with sediments. Such values are observed in water samples from the Galapagos hydrothermal mounds. (orig.)

  19. Inventory of 226Ra, 228Ra and 210Pb in marine sediments cores of Southwest Atlantic Ocean

    210Pb (22.3 y) is a radioactive isotope successfully applied as tracer of sediment dating of the last 100-150 years. The application of 226Ra and 228Ra as paleoceanographic tracers (half-lives of 1,600 y and 5.7 y, respectively) also gives some information of ocean's role in past climate change. In this work, it was analyzed 2 sediment cores collect at Southwest Atlantic Ocean. The sediments samples were freeze-dried and acid digested in microwave. It was carried out a radiochemical separation of 226Ra, 228Ra and 210Pb and performed a gross alpha and gross beta measurement of both precipitates Ba(Ra)SO4 and PbCrO4 in a low background gas-flow proportional counter. Activity concentrations of 226Ra ranged from 45 Bq kg-1 to 70 Bq kg-1 in NAP-62 and from 57 Bq kg-1 to 82 Bq kg-1 in NAP-63 samples. The concentration of 228Ra varied between 37 Bq kg-1 and 150 Bq kg-1 in NAP-62 and between 23 Bq kg-1 and 111 Bq kg-1 in NAP-63 samples. The concentration of total 210Pb ranged from 126 Bq kg-1 to 256 Bq kg-1 in NAP-62 and from 63 Bq kg-1 to 945 Bq kg-1 in NAP-63 samples. Results of 210Pbuns varied from 68 Bq kg-1 to 192 Bq kg-1 for NAP-62, while varied from <4.9 Bq kg-1 to 870 Bq kg-1 in NAP-63 profile. Increased values of 210Pbuns were found on the top of both NAP-62 and NAP- 63 sediment profile. (author)

  20. Micro-extraction procedures for the determination of Ra-226 in well waters by SF-ICP-MS

    The radium-226 (t1/2 = 1622 years) content of highly alkaline well water collected from the United Arab Emirates (UAE) was measured by double focusing sector-field inductively coupled plasma-mass spectrometry (SF-ICP-MS) after separation of the radium from other alkaline earth elements using a newly developed procedure. The results were comparable with those obtained by α-spectrometry for samples with concentrations ranging from 6.75 to 459 pg/L (0.25 to 17 Bq/L). Instrumental sensitivity on matrix-free samples was compared for two sample introduction systems, i.e. an Apex-Q high sensitivity system and a concentric nebulizer. A 12-fold improvement in sensitivity (instrumental detection limit = 1.5 pg/L or 55 mBq/L) was found when the Apex-Q system was used. Two chromatographic methods were tested for the sequential separation of the alkaline earth elements contained in the well water samples in order to reduce matrix and polyatomic interference effects. Optimal elution parameters were determined and used for the separation and pre-concentration of Ra-226 in those samples. A method detection limit of 0.189 pg/L (7 mBq/L), which corresponds to a mass of 0.38 fg of Ra-226 in the sample, was achieved. Only 2 mL of sample is necessary when a combination of 50 W-X8 and Sr*Spec resin, which are reusable, are utilized for the separation. This new analytical protocol significantly reduces sample preparation time resulting in a throughput rate of approximately 20 samples in only 8 h; faster than the other published extraction procedures

  1. Sequential determination of U and Th isotopes and 226Ra by alpha spectrometry in phosphate fertilizer samples and phosphogypsum

    The Brazilian phosphate fertilizer is obtained by wet reaction of igneous phosphate rock with concentrated sulphuric acid, giving as final product phosphoric acid and calcium sulphate (phosphogypsum) as by-product. Phosphoric acid is the starting material for the production of the majors' phosphate fertilizers: triple superphosphate (TSP), single superphosphate (SSP), monoammonium phosphate (MAP) and diammonium phosphate (DAP). The phosphate rock used as raw material is enriched in radionuclides of the U and Th natural series. During the chemical attack these radionuclides are distributed among products and by-products. A sequential procedure was implemented to determine the content of radionuclides alpha emitters (234U, 238U, 230Th, 232Th, 228Th and 226Ra) in samples of phosphate rock, phosphogypsum and phosphate fertilizers produced by the Brazilian industries. The experimental procedure consisted of a chemical attack with strong acids, followed by sequential chromatography extractions in column with ionic resins. Depending upon the conditions of percolation U isotopes are separated, followed by Th isotopes and 226Ra. The solutions containing U and Th are electroplated on stainless steel disks and counted on a surface barrier detector for alpha spectrometry. To the Ra final solution, a BaSO4 seeding suspension was added to allow the formation of a micro precipitated of BaRaSO4. This precipitate is filtered in a polypropylene membrane and counted on the same detector. The precision and accuracy of the method were determined by analyzing reference materials: soil IAEA-326 and sediment IAEA-300. SSP and TSP, which are obtained by reacting phosphoric acid with phosphate rock in different proportions, presented higher concentrations of all studied radionuclides. Brazilian phosphate fertilizers, which are produced directly from phosphoric acid, MAP and DAP, present in their composition low concentrations of radionuclide 226Ra. As for the radionuclides U and Th, the

  2. MSFIA-LOV system for (226)Ra isolation and pre-concentration from water samples previous radiometric detection.

    Rodríguez, Rogelio; Borràs, Antoni; Leal, Luz; Cerdà, Víctor; Ferrer, Laura

    2016-03-10

    An automatic system based on multisyringe flow injection analysis (MSFIA) and lab-on-valve (LOV) flow techniques for separation and pre-concentration of (226)Ra from drinking and natural water samples has been developed. The analytical protocol combines two different procedures: the Ra adsorption on MnO2 and the BaSO4 co-precipitation, achieving more selectivity especially in water samples with low radium levels. Radium is adsorbed on MnO2 deposited on macroporous of bead cellulose. Then, it is eluted with hydroxylamine to transform insoluble MnO2 to soluble Mn(II) thus freeing Ra, which is then coprecipitated with BaSO4. The (226)Ra can be directly detected in off-line mode using a low background proportional counter (LBPC) or through a liquid scintillation counter (LSC), after performing an on-line coprecipitate dissolution. Thus, the versatility of the proposed system allows the selection of the radiometric detection technique depending on the detector availability or the required response efficiency (sample number vs. response time and limit of detection). The MSFIA-LOV system improves the precision (1.7% RSD), and the extraction frequency (up to 3 h(-1)). Besides, it has been satisfactorily applied to different types of water matrices (tap, mineral, well and sea water). The (226)Ra minimum detectable activities (LSC: 0.004 Bq L(-1); LBPC: 0.02 Bq L(-1)) attained by this system allow to reach the guidance values proposed by the relevant international agencies e.g. WHO, EPA and EC. PMID:26893088

  3. A Procedure for the Rapid Determination of 226Ra and 228Ra in Drinking Water by Liquid Scintillation Counting

    Since 2004, the environment programme of the IAEA has included activities aimed at the development of a set of procedures for the determination of radionuclides in terrestrial environmental samples. Reliable, comparable and ‘fit for purpose’ results are essential requirements for any decision based on analytical measurements. For the analyst, tested and validated analytical procedures are extremely important tools for the production of such data. For maximum utility, such procedures should be comprehensive, clearly formulated and readily available to both the analyst and the customer. This publication describes a procedure for the rapid determination of 226Ra and 228Ra in drinking water. The determination of radium in drinking water is important for protecting human health, since the consumption of drinking water containing radium may lead to an accumulation in the body, contributing to the radiological dose. The method is based on the separation of 226Ra and 228Ra from interfering elements using PbSO4 and Ba(Ra)SO4 coprecipitation steps. The isotopes 226Ra and 228Ra are then determined by liquid scintillation counting. The procedure is expected to be of general use to a wide range of laboratories, including the laboratories of the Analytical Laboratories for the Measurement of Environmental Radioactivity (ALMERA) network, both in emergency situations and for routine environmental monitoring purposes. The method was established after an extensive review of papers from the scientific literature, and was tested and validated in terms of repeatability and trueness (relative bias) in accordance with International Organization for Standardization guidelines. Reproducibility tests were performed at expert laboratories. The calculation of massic activities, uncertainty budget, decision threshold and detection limit are also described

  4. Seasonal changes in submarine groundwater discharge to coastal salt ponds estimated using 226Ra and 228Ra as tracers

    Hougham, A.L.; Moran, S.B.; Masterson, J.P.; Kelly, R.P.

    2008-01-01

    Submarine groundwater discharge (SGD) to coastal southern Rhode Island was estimated from measurements of the naturally-occurring radioisotopes 226Ra (t1/2 = 1600??y) and 228Ra (t1/2 = 5.75??y). Surface water and porewater samples were collected quarterly in Winnapaug, Quonochontaug, Ninigret, Green Hill, and Pt. Judith-Potter Ponds, as well as nearly monthly in the surface water of Rhode Island Sound, from January 2002 to August 2003; additional porewater samples were collected in August 2005. Surface water activities ranged from 12-83??dpm 100??L- 1 (60??dpm = 1??Bq) and 21-256??dpm 100??L- 1 for 226Ra and 228Ra, respectively. Porewater 226Ra activities ranged from 16-736??dpm 100??L- 1 (2002-2003) and 95-815??dpm 100??L- 1 (2005), while porewater 228Ra activities ranged from 23-1265??dpm 100??L- 1. Combining these data with a simple box model provided average 226Ra-based submarine groundwater fluxes ranging from 11-159??L m- 2 d- 1 and average 228Ra-derived fluxes of 15-259??L m- 2 d- 1. Seasonal changes in Ra-derived SGD were apparent in all ponds as well as between ponds, with SGD values of 30-472??L m- 2 d- 1 (Winnapaug Pond), 6-20??L m- 2 d- 1 (Quonochontaug Pond), 36-273??L m- 2 d- 1 (Ninigret Pond), 29-76??L m- 2 d- 1 (Green Hill Pond), and 19-83??L m- 2 d- 1 (Pt. Judith-Potter Pond). These Ra-derived fluxes are up to two orders of magnitude higher than results predicted by a numerical model of groundwater flow, estimates of aquifer recharge for the study period, and values published in previous Ra-based SGD studies in Rhode Island. This disparity may result from differences in the type of flow (recirculated seawater versus fresh groundwater) determined using each technique, as well as variability in porewater Ra activity. ?? 2007 Elsevier B.V. All rights reserved.

  5. Determination of Ra-224, Ra-226 and Ra-228 by gamma-ray spectrometry with radon retention

    Full text: The purpose of this work is to improve the determination, through gamma-ray spectrometry, of radium isotopes 228Ra, 226Ra and 224Ra in water. This improvement has been developed after the participation in the IAEA Proficiency test: 'Determination of radium and Uranium radionuclides in water' in December 2002, and applied to the same samples of this proficiency test. The aim of this new procedure is the determination of 228Ra, 226Ra and 224Ra activities by measuring the gamma-ray emissions of their decay products 228Ac, 214Pb and 212Pb, respectively. In the search for these activities, radiochemical separation of radium and lead are required. A coprecipitation method with stable barium and lead was carried out to obtain two different precipitates, both of them as sulphate. However emanation of unknown quantities of 222Rn and 220Rn is produced from the fine precipitate of the radium sulphate obtained which leads to wrong determinations of 224Ra and 226Ra activities. To avoid this radon exhalation effect the mentioned deposit, once the chemical yield has been calculated, is dissolved with EDTA and the resulting liquid incorporated into charcoal, and then it is dried and introduced into a suitable container. Afterwards the container is sealed and stored in a freezer. Different configurations of charcoal sizes and types as well as containers have been analysed. To perform this analysis several samples of those mentioned above containing 226Ra were used in order to test its equilibrium with the progeny, 214Pb and 214Bi, through gamma-ray spectrometry. The following results for contaminated samples with less than 50 Bq of 226Ra and using 30 ∼ 50 g of charcoal have been obtained: 1) There is a slight tendency to obtain better results using metallic containers rather than plastic ones 2) In general, specific activated charcoals, prepared to retain radon or noble gases allow better results than unspecific charcoals, but cannot be considered as better in a clear

  6. Measurement by liquid scintillation of {sup 226} Ra coprecipitated in BaSO{sub 4}; Medicion por centelleo liquido de {sup 226} Ra coprecipitado en BaSO{sub 4}

    Lopez del Rio, H.; Davila R, J.I.; Badillo A, V.E.; Mireles G, F.; Quirino T, L.; Lugo R, J.F.; Pinedo V, J.L.; Rios M, C. [UAEN-UAZ, A.P. 579C, Cipres 10, Fracc. La Penuela, 98068 Zacatecas (Mexico)]. e-mail: idavila@cantera.reduaz.mx

    2003-07-01

    The {sup 226} Ra is one of the more radio toxic nuclides since when entering to the organism it continues metabolically to the calcium, accumulating mainly in the bone tissue where it becomes in an internal radiation source. For the analysis of radium in water the methods of radon emanation are generally applied and coprecipitation with barium sulfate. This last is quick and efficient, and the radium in the precipitate can be measured by alpha or gamma spectrometry, or liquid scintillation dissolving the precipitate one with EDTA. In this work it is proposed a procedure for the radium measurement in water based on the coprecipitation with barium sulfate and in the detection by liquid scintillation. The precipitate of Ba(Ra)SO{sub 4} it is carried with water and blended with the liquid scintillator OptiPhase Hi Safe 3, avoiding the dissolution with EDTA. A 92{+-} 1.4% of radium it was recovered and it was reached a minimum activity detectable of 4.2 {+-} 0.9 mBq{sup -1}. The procedure was essayed with natural mineral water with a knew activity in concentration of {sup 226} Ra. The analytic result it coincided with the reported value with a relative error of 9%. (Author)

  7. Determination of long-lived natural Ra isotopes, 226Ra, in mineral and spring waters from Caxambu (MG) and Aguas de Lindoia (SP) spas

    The aim of this work was to study the long-lived Ra isotopes, 226Ra and 228Ra, natural distribution in mineral and spring waters from Caxambu (MG) and Aguas de Lindoia (SP) water parks. In Caxambu mineral waters it was observed 228Ra activity concentrations slightly higher than those of 226Ra. The elevated content of carbonates and bicarbonates of these waters can result in an increased solubility of the both Ra isotopes and may play an important role for the fate of 228Ra and its equilibrium distribution between solid and liquid phases. In Caxambu Thermal Spa, arithmetic mean activities ranged from 83 mBq L-1 to 3599 mBq L-1 and from 60 mBq L-1 to 4481 mBq L-1 for 226Ra and 228Ra, respectively. The highest 226Ra activity was found in Venancio Spring, while the maximum 228Ra activity value was determined in Ernestina Guedes. 228Ra/ 226Ra activity ratios varied from 0.079 (Conde D'Eau and Princesa Isabel Spring) to 4.2 (Mairink II Spring). In Aguas de Lindoia, arithmetic mean activities ranged from 4.6 mBq L-1 to 41 mBq L-1 and from 30 mBq L-1 to 54 mBq L-1 for 226Ra and 228Ra, respectively. The maximum 226Ra activity concentration was found in the bottled mineral water Sao Jorge, while the higher 228Ra activity concentration was determined in Santa Filomena Spring (public station 2). 228Ra/ 226Ra activity ratios varied from 1.2 (bottled mineral water Sao Jorge) to 9.1 (bottled mineral water Jatoba 1). This work also performed the dose assessment due to the ingestion of 226Ra and 228Ra in Caxambu and Aguas de Lindoia mineral and spring waters. The committed effective doses were estimated by using a conservative dosimetric model and taking into account the results over a lifetime (70 years) following intake of both long-lived Ra isotopes. The results from this radiological evaluation showed that the guidance committed effective dose level of 0.1 mSv y-1 recommended by World Health Organization was exceeded in almost all samples studied in Caxambu, except for Viotti

  8. Measurement of 226Ra in soil from oil field: Advantages of γ-ray spectrometry and application to the IAEA-448 CRM

    The analytical performance of gamma-ray spectrometry for the measurement of 226Ra in TENORM (Technically Enhanced Naturally Occurring Radioactive Material) soil was investigated by the IAEA. Fast results were obtained for characterization and certification of a new TENORM Certified Reference Material (CRM), identified as IAEA-448 (soil from oil field). The combined standard uncertainty of the gamma-ray spectrometry results is of the order of 2–3% for massic activity measurement values ranging from 16500 Bq kg−1 to 21500 Bq kg−1. Methodologies used for the production and certification of the IAEA-448 CRM are presented. Analytical results were confirmed by alpha spectrometry. The “t” test showed agreement between alpha and gamma results at 95% confidence level. - Highlights: • Accurate and fast determination of 226Ra in TENORM soil by gamma-ray spectrometry. • Production of a new Certified Reference Material, IAEA-448, soil from oil field. • Characterization campaign by gamma-ray spectrometry for determination of 226Ra. • Assignment of certified property value and associated uncertainty for 226Ra. • Confirmation of 226Ra certified value by alpha spectrometry

  9. Soil to leaf transfer factor for the radionuclides 226Ra, 40K, 137Cs and 90Sr at Kaiga region, India

    Transfer factors are the most important parameters required for mathematical modeling used for environmental impact assessment of radioactive contamination in the environment. In this paper soil to leaf transfer factor for the radionuclides 40K, 226Ra, 137Cs and 90Sr is estimated for Kaiga region in Karnataka state, India. Among the plants in which study is carried out, 226Ra, 40K, 137Cs and 90Sr activity in leaves of herbaceous plants is higher than that of tree leaves. Soil to leaf transfer factor for 226Ra, 40K, 137Cs and 90Sr was found to be in the range of 0.03-0.65, 0.32-8.04, 0.05-3.03 and 0.42-2.67 respectively. - Highlights: → Study region is Kaiga, Karnataka, India. → 226Ra, 40K, 137Cs and 90Sr activity in soil and leaf samples are reported. → 226Ra, 40K, 137Cs activity is higher in herbaceous plant leaves, than tree leaves. → In most of the plants transfer factor varies in the order K > Sr > Cs > Ra.

  10. 3D cell cultures of human head and neck squamous cell carcinoma cells are radiosensitized by the focal adhesion kinase inhibitor TAE226

    Background and purpose: Focal adhesion kinase (FAK), a main player in integrin signaling and survival, is frequently overexpressed in human cancers and therefore postulated as potential target in cancer therapy. The aim of this study was to evaluate the radiosensitizing potential of the FAK inhibitor TAE226 in three-dimensional (3D) tumor cell cultures. Materials and methods: Head and neck squamous cell carcinoma (HNSCC) cells (FaDu, UT-SCC15, UT-SCC45), lung cancer cells (A549), colorectal carcinoma cells (DLD-1, HCT-116) and pancreatic tumor cells (MiaPaCa2, Panc1) were treated with different concentrations of TAE226 (0-1 μm; 1 or 24 h) without or in combination with irradiation (0-6 Gy, X-ray, single dose). Subsequently, 3D clonogenic survival assays (laminin-rich extracellular matrix) and Western blotting (expression/phosphorylation, e.g. FAK, Akt, ERK1/2) were performed. Results: All investigated 3D cell cultures showed a dose-dependent reduction in clonogenic survival by TAE226. Intriguingly, TAE226 only significantly radiosensitized 3D HNSCC cell cultures accompanied by a pronounced dephosphorylation of FAK, Akt and ERK1/2. Conclusions: Our data demonstrate TAE226 as potent FAK inhibitor that enhances the cellular radiosensitivity particularly of HNSCC cells grown in a 3D cell culture model. Future in vitro and in vivo investigations will clarify, to which extent this approach might be clinically relevant for radiotherapy of HNSCC.

  11. Tree density on a vegetated uranium mill tailings site and associated estimates of Ra-226 in above ground biomass

    The transfer of Ra-226 to the terrestrial pathway will depend on the uptake by indigenous species which colonize dry areas of inactive or abandoned uranium mill tailings sites. The density of trembling aspen and white birch, their heights and biomass values, have been determined 10 to 15 years after revegetation. In addition the percentage composition of the ground cover for herbs, shrubs and grasses is evaluated. For aspens of less than 1 m in height, the density of 0.0536 trees/m2 was considerably higher than for birches of the same height with 0.0097 trees/m2. As tree heights increase the number of trees/m2 decrease to 0.0049 and 0.0010 respectively for 3 to 4 m tall trees. Trees taller than 4 m were rarely found. The ground cover biomass (approximately 125 g/m2) consisted generally of two types; either shrubs were dominant or herbs and grasses prevailed. From Ra-226 concentrations in different above-ground biomass components and the average composition of the vegetation on one square metre, transfer values were estimated. Annual transfer by herbal biomass (leaves, herbs and grasses) ranged from 330 to 760 pCi/m2. The standing crop of woody biomass was estimated to range from 450 to 1700 pCi/m2

  12. Distribution of 226Ra, 232Th, and 40K in soils of Rio Grande do Norte (Brazil)

    A survey programme aimed at studying the environmental radioactivity in the Brazilian state of Rio Grande do Norte was undertaken. Fifty-two soil samples, together with two rock and two uraniferrous ore samples were collected from the eastern and central regions of this state. Concentrations of radioelements in samples were determined by γ-ray spectrometry. The average concentrations of 226Ra, 232Th, and 40K in the surveyed soils were 29.2 ± 19.5 (SD), 47.8 ± 37.3, and 704 ± 437 Bq kg-1, respectively. Higher values were found in the rock samples. The distributions of 226Ra and 232Th were fitted by log-normal curves. Radiological measurements carried out with a portable scintillometer at the sampled sites revealed an average absorbed dose rate of 55 ± 27 (SD) nGy h-1. Computed dose rates obtained through the Beck formula ranged from 15-179 nGy h-1, with a mean value of 72.6 ± 38.7 (SD) nGy h-1, and their distribution fitted a log-normal curve. An annual average effective dose equivalent of 552 μSν (range: 117-1361 μSν) was estimated for 51 sites in Rio Grande do Norte. (author)

  13. Appearance of E1: A226V mutant Chikungunya virus in Coastal Karnataka, India during 2008 outbreak

    Khan Mohasin

    2009-10-01

    Full Text Available Abstract Chikungunya has resurged in the form of unprecedented explosive epidemic in 2006 after a long gap in India affecting 1.39 million of persons. The disease continued for the next two consecutive years affecting 59,535 and 64,548 persons during 2007 and 2008 respectively. The 2008 outbreak being the second largest among these three years the information regarding the etiology and the mutations involved are useful for further control measures. Among the 2008 outbreaks the Coastal Karnataka accounts for the 46,510 persons. An in-depth investigation of Chikungunya epidemic of Coastal Karnataka, India, 2008 by serology, virus isolation, RT-PCR and genome sequencing revealed the presence and continued circulation of A226V mutant Chikungunya virus. The appearance of this mutant virus was found to be associated with higher prevalence of vector Aedes albopictus and the geographical proximity of coastal Karnataka with the adjoining Kerala state. This is the first report regarding the appearance of this mutation in Karnataka state of India. The present study identified the presence and association of A226V mutant virus with Chikungunya outbreak in India during 2008.

  14. Appearance of E1: A226V mutant Chikungunya virus in Coastal Karnataka, India during 2008 outbreak.

    Santhosh, S R; Dash, Paban Kumar; Parida, Manmohan; Khan, Mohasin; Rao, Putcha V L

    2009-01-01

    Chikungunya has resurged in the form of unprecedented explosive epidemic in 2006 after a long gap in India affecting 1.39 million of persons. The disease continued for the next two consecutive years affecting 59,535 and 64,548 persons during 2007 and 2008 respectively. The 2008 outbreak being the second largest among these three years the information regarding the etiology and the mutations involved are useful for further control measures. Among the 2008 outbreaks the Coastal Karnataka accounts for the 46,510 persons. An in-depth investigation of Chikungunya epidemic of Coastal Karnataka, India, 2008 by serology, virus isolation, RT-PCR and genome sequencing revealed the presence and continued circulation of A226V mutant Chikungunya virus. The appearance of this mutant virus was found to be associated with higher prevalence of vector Aedes albopictus and the geographical proximity of coastal Karnataka with the adjoining Kerala state. This is the first report regarding the appearance of this mutation in Karnataka state of India. The present study identified the presence and association of A226V mutant virus with Chikungunya outbreak in India during 2008. PMID:19857273

  15. Study of in vivo generators Pb-212/Bi--212 and U-230/Th-226 for alpha radioimmunotherapy

    Alpha-radioimmunotherapy is a promising cancer therapy that uses a-particles vectorized by monoclonal antibody to break down cancerous tumors. The notion of in vivo generator was introduced in 1989 by Leonard Mausner. The concept involves labeling of various molecular carriers (antibodies, peptides, etc) with intermediate half-life generator parents, which after accumulation in the desired tissue generate much shorter half-life daughter radionuclide. This thesis focuses on the study of two in vivo generators potentially interesting for alpha-radioimmunotherapy: Pb-212 / Bi-212 generator and U-230 / Th-226 generator. The first part of this work presents the Pb-212 / Bi-212 generator, two approaches allowing the vectorization. Chelation approach on a protein and an approach by encapsulation in liposomes have been proposed. This last approach appears to be the most interesting. In vitro stability studies have been performed on these labeling. The second part of this work presents the U-230 / Th-226 generator. Studies have first been made to achieve a theoretical model to describe the speciation of Th(IV) in human serum. The efficacy of DTPA as chelating agent for complexation of Th(IV) in human serum could thus be estimated. (author)

  16. Tl-208, Pb-212, Bi-212, Ra-226 and Ac-228 adsorption onto polyhydroxyethylmethacrylate-bentonite composite

    The adsorption of naturally occurring radionuclides (208Tl+, 212Pb2+, 226Ra2+, 212Bi3+ and 228Ac3+) onto Polyhydroxyethylmethacrylate-bentonite (PHEMA-B) composite was investigated. Experimentally obtained isotherms were evaluated with reference to Langmuir, Freundlich and Dubinin-Radushkevich (DR) models. The adsorption isotherms were L type of Giles classification proving that PHEMA-B had a high affinity adsorbent for the studied radionuclides. The Langmuir adsorption capacities (XL) were in the order of 226Ra (2.8 MBq kg-1)>212Bi (0.4 MBq kg-1)>212Pb (0.3 MBq kg-1)>228Ac and 208Tl (0.2 MBq kg-1). The adsorption process was physical via complex formation after proton exchanger for which the adsorption energies obtained from DR model was evidence. The enthalpy and entropy changes were positive and the negative free enthalpy change was proof for the spontaneity of adsorption. The reusability tests for PHEMA-B for five uses demonstrated that the adsorbent could be reused after complete recovery of the loaded radionuclide ions by 1 M HCl. The chemical structure of the composite did not change after the reuses and storage foregoing.

  17. Soil-to-root vegetable transfer factors for (226)Ra, (232)Th, (40)K, and (88)Y in Malaysia.

    Asaduzzaman, Kh; Khandaker, Mayeen Uddin; Amin, Y M; Bradley, D A; Mahat, R H; Nor, R M

    2014-09-01

    Soil-to-plant transfer factors (TFs) are of fundamental importance in assessing the environmental impact due to the presence of radioactivity in soil and agricultural crops. Tapioca and sweet potato, both root crops, are popular foodstuffs for a significant fraction of the Malaysian population, and result in intake of radionuclides. For the natural field conditions experienced in production of these foodstuffs, TFs and the annual effective dose were evaluated for the natural radionuclides (226)Ra, (232)Th, (40)K, and for the anthropogenic radionuclide (88)Y, the latter being a component of fallout. An experimental tapioca field was developed for study of the time dependence of plant uptake. For soil samples from all study locations other than the experimental field, it has been shown that these contain the artificial radionuclide (88)Y, although the uptake of (88)Y has only been observed in the roots of the plant Manihot esculenta (from which tapioca is derived) grown in mining soil. The estimated TFs for (226)Ra and (232)Th for tapioca and sweet potato are very much higher than that reported by the IAEA. For all study areas, the annual effective dose from ingestion of tapioca and sweet potato are estimated to be lower than the world average (290 μSv y(-1)). PMID:24814722

  18. Determination of 226Ra and 228Ra concentrations in foodstuffs consumed by inhabitants of Tehran city of Iran

    The presence of primordial radionuclide in human habitats has always been a source of prolonged exposure. Measurement of naturally occurring radionuclides in the environment can be used as baseline to evaluate the impact of non-nuclear activities and also routine releases from nuclear installations. Materials and Methods: A total of 56 samples from 18 different foodstuff including root vegetables (beetroot, carrot, onion, potato, radish and turnip), leafy vegetables (lettuce, parsley, spinach and white cabbage) and lentil, kidney bean, Soya, eggs, rice, meat, tomato and cooking oil were purchased and analyzed by low level gamma spectrometry. Results: The 226Ra concentrations from root vegetables varied from 13-62 mBqkg-1 with turnip of highest concentration, i.e. 62mBqkg-1. Among leafy vegetables; parsley showed the maximum concentration of 228Ra equal to 173 mBqkg-1. 226Rand 228Ra contents in the soya, 394 and 578 mBq kg-1 was much higher than those of other samples respectively. Conclusion : Results indicate that foodstuff consumed by Tehran inhabitants have low radium content and are safe, as far as radium concentrations is concerned

  19. Measurement of 226Ra, 228Ra and 40K in soil in district of Kuala Krai using gamma spectrometry

    The granitic region is known to have high natural radionuclides content. The natural background of the area will be elevated and the exposure rate also will be higher as compared to other region. The present study is focusing on the presence of natural uranium isotopes using its progenies in soils belong to the river basin of the granitic region of Kuala Krai district, Malaysia. Granitic characteristics of the region were believed to produce significant concentrations of natural radionuclide such as uranium and thorium. This paper presents the results of measurement activity concentration 226Ra, 228Ra and 40K in soil using Gamma Spectrometry to estimate activity concentration of radionuclides in fourteen soil samples collected from this study area. The range of activity concentration of 226Ra, 228Ra and 40K is 40.2-264.0, 49.2-312.9 and 491.1-1184.2 Bq/ kg respectively. These results were used to estimate the hazards index and annual exposure rate to the member of public. (author)

  20. Evaluation of the environmental radiological impact of Brazilian phosphogypsum and leachability of Ra-226 and Pb-210

    Phosphogypsum is a by-product produced by the phosphoric acid industry, it is formed by precipitation during wet sulphuric acid processing of phosphate rock. Although phosphogypsum is mainly calcium sulphate dihydrate, it contains elevated levels of impurities, which originate from the source phosphate rock used in the phosphoric acid production. Among these impurities, radionuclides from 238U and 232Th decay series, particularly 226Ra, 228Ra, 210Pb and Th isotopes are of most concern due to their radiotoxicity. Elemental characterization of stockpiled phosphogypsum from the two main producers of phosphoric acid, Copebras Ltda and Ultrafertil S.A. named A and C respectively, located in Cubatao, was performed by instrumental neutron activation analysis (INAA). Phosphogypsum samples are enriched in rare earths elements, specifically Ce, Eu, La, Nd, Sm, Tb and Yb and the elements Ba and Th. Radiological characterization of stockpiled phosphogypsum was performed by gamma-ray spectrometry. Activity concentrations (2,3 +- 0,5) x 102 Bq kg-1 for 228Ra, (8,5 +- 2,4) x 102 Bq kg-1 for 226Ra and (8,4 +- 2,4) x 102 Bq kg-1 for 210Pb were observed for industry A phosphogypsum. For industry C phosphogypsum, activity concentrations obtained were (1,6 +- 0,6) x 102 Bq kg-''1 for 226Ra, (3,6 +- 1,2) x 102 Bq kg-1 for 226Ra and (3,4 +- 1,2) x 102 Bq kg-1 for 210Pb. The radiochemical and elemental characterization of the phosphogypsum from industry A and C show that the stacks are quite homogeneous and mainly dependent upon the origin of the phosphatic rock used as raw material. The environmental radiological impact assessment of stockpiled phosphogypsum from industry C was evaluated by taking into account internal and external doses. The critical pathways considered were contamination of groundwater, emanation of radon and direct external exposure due to the radionuclides present in the phosphogypsum. The activity concentrations obtained in the monitor wells water were (1,5 +- 0