WorldWideScience

Sample records for actinium 226

  1. Purification of radium-226 for the manufacturing of actinium-225 in a cyclotron for alpha-immunotherapy

    The thesis describes the development of methods for the purification of Ra-226. The objective was to obtain the radionuclide in the quality that is needed to be used as starting material in the manufacturing process for Ac-225 via proton-irradiated Ra-226. The radionuclide has been gained efficiently out of huge excesses of impurities. The high purity of the obtained radium affords its use as staring material in a pharmaceutical manufacturing process.

  2. Purification of radium-226 for the manufacturing of actinium-225 in a cyclotron for alpha-immunotherapy; Radium-Aufreinigung zur Herstellung von Actinium-225 am Zyklotron fuer die Alpha-Immuntherapie

    Marx, Sebastian Markus

    2014-09-23

    The thesis describes the development of methods for the purification of Ra-226. The objective was to obtain the radionuclide in the quality that is needed to be used as starting material in the manufacturing process for Ac-225 via proton-irradiated Ra-226. The radionuclide has been gained efficiently out of huge excesses of impurities. The high purity of the obtained radium affords its use as staring material in a pharmaceutical manufacturing process.

  3. Production of Actinium-225 via High Energy Proton Induced Spallation of Thorium-232

    Harvey, James T.; Nolen, Jerry; Vandergrift, George; Gomes, Itacil; Kroc, Tom; Horwitz, Phil; McAlister, Dan; Bowers, Del; Sullivan, Vivian; Greene, John

    2011-12-30

    V protons available at Fermi National Accelerator Laboratory. Targets will be processed at Argonne National Laboratory to separate and purify the actinium-225 that will subsequently be transferred to NorthStar laboratory facilities for product quality testing and comparison to the product quality of ORNL produced actinium-225, which is currently the industry standard. The test irradiations at FNAL will produce 1-20 mCi per day which is more than sufficient for quantitative evaluation of the proposed production process. The beneficial outcome of this effort will be a new production route for actinium-225 that does not use or require any uranium-233 materials owned by DOE or use any radium-226 as an irradiation target but can supply the medical community's needs for actinium-225 now and in the future.

  4. Production of Actinium-225 via High Energy Proton Induced Spallation of Thorium-232

    available at Fermi National Accelerator Laboratory. Targets will be processed at Argonne National Laboratory to separate and purify the actinium-225 that will subsequently be transferred to NorthStar laboratory facilities for product quality testing and comparison to the product quality of ORNL produced actinium-225, which is currently the industry standard. The test irradiations at FNAL will produce 1-20 mCi per day which is more than sufficient for quantitative evaluation of the proposed production process. The beneficial outcome of this effort will be a new production route for actinium-225 that does not use or require any uranium-233 materials owned by DOE or use any radium-226 as an irradiation target but can supply the medical community's needs for actinium-225 now and in the future.

  5. Extraction of actinium with di-(2-ethylhexyl)phosphoric acid from hydrochloric and nitric acid solutions

    The extraction of actinium with HDEHP from Cl- and NO3- systems has been investigated. It was found that extraction of actinium from HCl solutions is much better than from HNO3 solutions. Stability constants of actinium complexes Ac(X-)+2 with Cl- and NO3- ligands were determined. Our results show that the actinium formed less stable complexes with Cl- than with NO3- ligands. 5 refs., 3 figs., 1 tab. (author)

  6. The sorption of polonium, actinium and protactinium onto geological materials

    This paper describes a combined experimental and modeling program of generic sorption studies to increase confidence in the performance assessment for a potential high-level radioactive waste repository in Japan. The sorption of polonium, actinium and protactinium onto geological materials has been investigated. Sorption of these radioelements onto bentonite, tuff and granodiorite from equilibrated de-ionized water was studied under reducing conditions at room temperature. In addition, the sorption of actinium and protactinium was investigated at 60 C. Thermodynamic chemical modeling was carried out to aid interpretation of the results

  7. Discovery of the actinium, thorium, protactinium, and uranium isotopes

    Fry, C; Thoennessen, M

    2012-01-01

    Currently, 31 actinium, 31 thorium, 28 protactinium, and 23 uranium isotopes have so far been observed; the discovery of these isotopes is discussed. For each isotope a brief summary of the first refereed publication, including the production and identification method, is presented.

  8. Separation of Actinium 227 from the uranium minerals

    The purpose of this work was to separate Actinium 227, whose content is 18%, from the mineral carnotite found in Gomez Chihuahua mountain range in Mexico. The mineral before processing is is pre-concentrated and passed, first through anionic exchange resins, later the eluate obtained is passed through cationic resins. The resins were 20-50 MESH QOWEX and 100-200 MESH 50 X 8-20 in some cased 200-400 MESH AG 50W-X8, 1X8 in other cases. The eluates from the ionic exchange were electrodeposited on stainless steel polished disc cathode and platinum electrode as anode; under a current ODF 10mA for 2.5 to 5 hours and of 100mA for .5 of an hour. it was possible to identify the Actinium 227 by means of its descendents, TH-227 and RA-223, through alpha spectroscopy. Due to the radiochemical purity which the electro deposits were obtained the Actinium 227 was low and was not quantitatively determined. A large majority of the members of the natural radioactive series 3 were identified and even alpha energies reported in the literature with very low percentages of non-identified emissions were observed. We conclude that a more precise study is needed concerning ionic exchange and electrodeposit to obtain an Actinium 227 of radiochemical purity. (Author)

  9. Spectroscopic and computational investigation of actinium coordination chemistry.

    Ferrier, Maryline G; Batista, Enrique R; Berg, John M; Birnbaum, Eva R; Cross, Justin N; Engle, Jonathan W; La Pierre, Henry S; Kozimor, Stosh A; Lezama Pacheco, Juan S; Stein, Benjamin W; Stieber, S Chantal E; Wilson, Justin J

    2016-01-01

    Actinium-225 is a promising isotope for targeted-α therapy. Unfortunately, progress in developing chelators for medicinal applications has been hindered by a limited understanding of actinium chemistry. This knowledge gap is primarily associated with handling actinium, as it is highly radioactive and in short supply. Hence, Ac(III) reactivity is often inferred from the lanthanides and minor actinides (that is, Am, Cm), with limited success. Here we overcome these challenges and characterize actinium in HCl solutions using X-ray absorption spectroscopy and molecular dynamics density functional theory. The Ac-Cl and Ac-OH2O distances are measured to be 2.95(3) and 2.59(3) Å, respectively. The X-ray absorption spectroscopy comparisons between Ac(III) and Am(III) in HCl solutions indicate Ac(III) coordinates more inner-sphere Cl(1-) ligands (3.2±1.1) than Am(III) (0.8±0.3). These results imply diverse reactivity for the +3 actinides and highlight the unexpected and unique Ac(III) chemical behaviour. PMID:27531582

  10. Production of high-purity radium-223 from legacy actinium-beryllium neutron sources.

    Soderquist, Chuck Z; McNamara, Bruce K; Fisher, Darrell R

    2012-07-01

    Radium-223 is a short-lived alpha-particle-emitting radionuclide with potential applications in cancer treatment. Research to develop new radiopharmaceuticals employing (223)Ra has been hindered by poor availability due to the small quantities of parent actinium-227 available world-wide. The purpose of this study was to develop innovative and cost-effective methods to obtain high-purity (223)Ra from (227)Ac. We obtained (227)Ac from two surplus actinium-beryllium neutron generators. We retrieved the actinium/beryllium buttons from the sources and dissolved them in a sulfuric-nitric acid solution. A crude actinium solid was recovered from the solution by coprecipitation with thorium fluoride, leaving beryllium in solution. The crude actinium was purified to provide about 40 milligrams of actinium nitrate using anion exchange in methanol-water-nitric acid solution. The purified actinium was then used to generate high-purity (223)Ra. We extracted (223)Ra using anion exchange in a methanol-water-nitric acid solution. After the radium was separated, actinium and thorium were then eluted from the column and dried for interim storage. This single-pass separation produces high purity, carrier-free (223)Ra product, and does not disturb the (227)Ac/(227)Th equilibrium. A high purity, carrier-free (227)Th was also obtained from the actinium using a similar anion exchange in nitric acid. These methods enable efficient production of (223)Ra for research and new alpha-emitter radiopharmaceutical development. PMID:22697483

  11. Radium-226

    This sheet belongs to a collection which relates to the use of radionuclides essentially in unsealed sources. Its goal is to gather on a single document the most relevant information as well as the best prevention practices to be implemented. These sheets are made for the persons in charge of radiation protection: users, radioprotection-skill persons, labor physicians. Each sheet treats of: 1 - the radio-physical and biological properties; 2 - the main uses; 3 - the dosimetric parameters; 4 - the measurement; 5 - the protection means; 6 - the areas delimitation and monitoring; 7 - the personnel classification, training and monitoring; 8 - the effluents and wastes; 9 - the authorization and declaration administrative procedures; 10 - the transport; and 11 - the right conduct to adopt in case of incident or accident. This sheet deals specifically with Radium-226

  12. Groundwater seepage from the Ranger uranium mine tailings dam: radioisotopes of radium, thorium and actinium. Supervising Scientist report 106

    Monitoring of bores near the Ranger uranium mine tailings dam has revealed deterioration in water quality in several bores since 1983. In a group of bores to the north of the dam, increases have been observed of up to 500 times for sulphate concentrations and of up to 5 times for 226Ra concentrations. Results are presented here of measurements of members of the uranium, thorium and actinium decay series in borewater samples collected between 1985 and 1993. In particular, measurements of all four naturally-occurring radium isotopes have been used in an investigation of the mechanism of radium concentration changes. For the most seepage-affected bores the major findings of the study include: 228Ra/226Ra 223Ra /226Ra and 224Ra/228Ra ratios all increased over the course of the study; barium concentrations show high seasonal variability, being lower in November than May, but strontium concentrations show a steady increase with time. Calculations show that the groundwater is probably saturated with respect to barite but not with respect to celestite or anglesite; sulphide concentrations are low in comparison with sulphate, and are higher in November than in May; and 227Ac concentrations have increased with time, but do not account for the high 223Ra/226Ra ratios. It is concluded on the basis of these observations that increases in Ra isotope concentrations observed in a number of seepage-affected bores arise from increases in salinity leading to desorption of radium from adsorption sites in the vicinity of the bore rather by direct transport of radium from the tailings. Increased salinity is also causing the observed increases in 227Ac and strontium concentrations, while formation of a barite solid phase in the groundwater is causing the removal of some radium from solution. This is the cause of the increasing radium isotope ratios noted above

  13. Radium, thorium, and actinium extraction from seawater using an improved manganese-oxide-coated fiber

    Laboratory experiments were conducted to determine the efficiency with which improved manganese-oxide-coated acrylic fibers extract radium, thorium, and actinium from seawater. Tests were made using surface seawater spiked with 227Ac, 227Th and 223Ra. For sample volumes of approximately 30 liters and flow rates up to 0.5 liters per minute, radium and actinium are removed quantitatively. Approximately 80-95% of the thorium is removed under these same conditions. (Auth.)

  14. ACC 226 Course Tutorial / tutorialrank

    welcome8888

    2015-01-01

    For more course tutorials visit www.tutorialrank.com Tutorial Purchased: 5 Times, Rating: A+     ACC 226 Week 1 CheckPoint Accounts Receivable and Uncollectible Accounts   ACC 226 Week 1 DQ 1 and DQ 2   ACC 226 Week 2 Assignment Accounting for Depreciation part   ACC 226 Week 2 CheckPoint Ethics and Computing   ACC 226 Week 3 CheckPoint Classifying Liabilities and Preparing Payroll Entries   ACC 226...

  15. Neutron-Induced Fission of Actinium-227, Protactinium-231 and Neptunium-237: Mass Distribution

    Results of radiochemical studies on the mass distribution in the neutron-induced fission of actinium-227, protactinium-231 and neptunium-237 have been presented. This work has been carried out as part of a programme to determine the mass distribution in the fission of heavy elements as a function of Z and A. All irradiations have been carried out in the core of the swimming-pool type reactor APSARA with cadmium shielding wherever necessary. Relative yields of several fission product nuclides have been obtained by a method involving a comparison of the fission product activities from the respective targets with those formed from uranium-235 simultaneously irradiated. Thermal-neutron fission yields of uranium-235 have been assumed. These results indicate a predominantly asymmetric mass distribution in all the three cases, and also a distinct though small symmetric peak in the case of actinium-227. (author)

  16. Comment: 226 [Taxonomy Icon

    Full Text Available Danio rerio Danio rerio Danio_rerio_L.png 226.png Hiroyuki Takeda (The University of Tokyo) lice ... nsed under CC Attribution2.1 Japan 写真 提供:武田洋幸(東京大学) bando 2010/02/15 16:26:21 ...

  17. A new method for the determination of low-level actinium-227 in geological samples

    We developed a new method for the determination of 227Ac in geological samples. The method uses extraction chromatographic techniques and alpha-spectrometry and is applicable for a range of natural matrices. Here we report on the procedure and results of the analysis of water (fresh and seawater) and rock samples. Water samples were acidified and rock samples underwent total dissolution via acid leaching. A DGA (N,N,N',N'-tetra-n-octyldiglycolamide) extraction chromatographic column was used for the separation of actinium. The actinium fraction was prepared for alpha spectrometric measurement via cerium fluoride micro-precipitation. Recoveries of actinium in water samples were 80 ± 8 % (number of analyses n = 14) and in rock samples 70 ± 12 % (n = 30). The minimum detectable activities (MDA) were 0.017-0.5 Bq kg-1 for both matrices. Rock sample 227Ac activities ranged from 0.17 to 8.3 Bq kg-1 and water sample activities ranged from below MDA values to 14 Bq kg-1of 227Ac. From the analysis of several standard rock and water samples with the method we found very good agreement between our results and certified values. (author)

  18. Analysis of the gamma spectra of the uranium, actinium, and thorium decay series

    Momeni, M.H.

    1981-09-01

    This report describes the identification of radionuclides in the uranium, actinium, and thorium series by analysis of gamma spectra in the energy range of 40 to 1400 keV. Energies and absolute efficiencies for each gamma line were measured by means of a high-resolution germanium detector and compared with those in the literature. A gamma spectroscopy method, which utilizes an on-line computer for deconvolution of spectra, search and identification of each line, and estimation of activity for each radionuclide, was used to analyze soil and uranium tailings, and ore.

  19. Analysis of the gamma spectra of the uranium, actinium, and thorium decay series

    This report describes the identification of radionuclides in the uranium, actinium, and thorium series by analysis of gamma spectra in the energy range of 40 to 1400 keV. Energies and absolute efficiencies for each gamma line were measured by means of a high-resolution germanium detector and compared with those in the literature. A gamma spectroscopy method, which utilizes an on-line computer for deconvolution of spectra, search and identification of each line, and estimation of activity for each radionuclide, was used to analyze soil and uranium tailings, and ore

  20. acc226uopcoursesTutorial /uophelp

    keller

    2015-01-01

    For more course tutorials visit www.uophelp.com     ACC 226 Week 1 CheckPoint Accounts Receivable and Uncollectible Accounts ACC 226 Week 1 DQ 1 and DQ 2 ACC 226 Week 2 Assignment Accounting for Depreciation part ACC 226 Week 2 CheckPoint Ethics and Computing ACC 226 Week 3 CheckPoint Classifying Liabilities and Preparing Payroll Entries ACC 226 Week 3 DQ 2 ACC 226 Week 4 Assignment Stocks and Earnings per Share part ACC 226 Week 4 CheckPo...

  1. ACC 226 UOP COURSE TUTORIAL/ UOPHELP

    balumgm

    2015-01-01

    For more course tutorials visit www.uophelp.com     ACC 226 Week 1 CheckPoint Accounts Receivable and Uncollectible Accounts ACC 226 Week 1 DQ 1 and DQ 2 ACC 226 Week 2 Assignment Accounting for Depreciation part ACC 226 Week 2 CheckPoint Ethics and Computing ACC 226 Week 3 CheckPoint Classifying Liabilities and Preparing Payroll Entries ACC 226 Week 3 DQ 2 ACC 226 Week 4 Assignment Stocks and Earnings per Share part ACC 226 Week 4 CheckPo...

  2. ACC 226 Ash Course tutorial/uophelp

    THNSSER

    2015-01-01

    For more course tutorials visit www.uophelp.com   ACC 226 Week 1 CheckPoint Accounts Receivable and Uncollectible Accounts ACC 226 Week 1 DQ 1 and DQ 2 ACC 226 Week 2 Assignment Accounting for Depreciation part ACC 226 Week 2 CheckPoint Ethics and Computing ACC 226 Week 3 CheckPoint Classifying Liabilities and Preparing Payroll Entries ACC 226 Week 3 DQ 2 ACC 226 Week 4 Assignment Stocks and Earnings per Share part ACC 226 Week 4 CheckPoint Stock I...

  3. In-source laser spectroscopy developments at TRILIS—towards spectroscopy on actinium and scandium

    Resonance Ionization Laser Ion Sources (RILIS) have become a versatile tool for production and study of exotic nuclides at Isotope Separator On-Line (ISOL) facilities such as ISAC at TRIUMF. The recent development and addition of a grating tuned spectroscopy laser to the TRIUMF RILIS solid state laser system allows for wide range spectral scans to investigate atomic structures on short lived isotopes, e.g., those from the element actinium, produced in uranium targets at ISAC. In addition, development of new and improved laser ionization schemes for rare isotope production at ISAC is ongoing. Here spectroscopic studies on bound states, Rydberg states and autoionizing (AI) resonances on scandium using the existing off-line capabilities are reported. These results allowed to identify a suitable ionization scheme for scandium via excitation into an autoionizing state at 58,104 cm − 1 which has subsequently been used for ionization of on-line produced exotic scandium isotopes.

  4. ACC 226 UOP Course Tutorial / Tutorialrank

    charles

    2015-01-01

    For more course tutorials visit www.tutorialrank.com Tutorial Purchased: 5 Times, Rating: A+       ACC 226 Week 1 CheckPoint Accounts Receivable and Uncollectible Accounts   ACC 226 Week 1 DQ 1 and DQ 2   ACC 226 Week 2 Assignment Accounting for Depreciation part   ACC 226 Week 2 CheckPoint Ethics and Computing   ACC 226 Week 3 CheckPoint Classifying Liabilities and Preparing Payroll Entries   ...

  5. SSL_226_Critical_Habitat_AK

    US Fish and Wildlife Service, Department of the Interior — Steller Sea Lion Critical Habitat: PART 226 -- Designated Critical Habitat, west of 144 degrees west . The 131 sites from PART 226 - Designated [SSL] Critical...

  6. 12 CFR 226.4 - Finance charge.

    2010-01-01

    ... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Finance charge. 226.4 Section 226.4 Banks and... LENDING (REGULATION Z) General § 226.4 Finance charge. (a) Definition. The finance charge is the cost of...) Charges by third parties. The finance charge includes fees and amounts charged by someone other than...

  7. 21 CFR 226.30 - Equipment.

    2010-04-01

    ... 21 Food and Drugs 4 2010-04-01 2010-04-01 false Equipment. 226.30 Section 226.30 Food and Drugs... Facilities and Equipment § 226.30 Equipment. Equipment used for the manufacture, processing, packaging, bulk... facilitate maintenance and operation for its intended purpose. The equipment shall: (a) Be so...

  8. 22 CFR 226.34 - Equipment.

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Equipment. 226.34 Section 226.34 Foreign... ORGANIZATIONS Post-award Requirements Property Standards § 226.34 Equipment. (a) Unless the agreement provides otherwise, title to equipment acquired by a recipient with Federal funds shall vest in the...

  9. 22 CFR 226.46 - Procurement records.

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Procurement records. 226.46 Section 226.46...-GOVERNMENTAL ORGANIZATIONS Post-award Requirements Procurement Standards § 226.46 Procurement records. Procurement records and files for purchases in excess of the small purchase threshold shall include...

  10. 22 CFR 226.31 - Insurance coverage.

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Insurance coverage. 226.31 Section 226.31...-GOVERNMENTAL ORGANIZATIONS Post-award Requirements Property Standards § 226.31 Insurance coverage. Recipients shall, at a minimum, provide the equivalent insurance coverage for real property and equipment...

  11. 32 CFR 226.4 - Responsibilities.

    2010-07-01

    ... 32 National Defense 2 2010-07-01 2010-07-01 false Responsibilities. 226.4 Section 226.4 National Defense Department of Defense (Continued) OFFICE OF THE SECRETARY OF DEFENSE (CONTINUED) MISCELLANEOUS SHELTER FOR THE HOMELESS § 226.4 Responsibilities. (a) The Deputy Assistant Secretary of...

  12. 7 CFR 226.3 - Administration.

    2010-01-01

    ... 7 Agriculture 4 2010-01-01 2010-01-01 false Administration. 226.3 Section 226.3 Agriculture... CHILD NUTRITION PROGRAMS CHILD AND ADULT CARE FOOD PROGRAM General § 226.3 Administration. (a) Within the Department, FNS shall act on behalf of the Department in the administration of the Program....

  13. 32 CFR 226.3 - Policy.

    2010-07-01

    ... 32 National Defense 2 2010-07-01 2010-07-01 false Policy. 226.3 Section 226.3 National Defense... THE HOMELESS § 226.3 Policy. (a) By Memorandum for the Secretaries of the Military Departments from... Secretary of Defense stated it is Department of Defense policy that shelters for the homeless may...

  14. 22 CFR 226.52 - Financial reporting.

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Financial reporting. 226.52 Section 226.52...-GOVERNMENTAL ORGANIZATIONS Post-award Requirements Reports and Records § 226.52 Financial reporting. USAID requires recipients to use the Standard Form 425 or Standard Form 425a, Federal Financial Report, or...

  15. 21 CFR 226.10 - Personnel.

    2010-04-01

    ... 21 Food and Drugs 4 2010-04-01 2010-04-01 false Personnel. 226.10 Section 226.10 Food and Drugs... CURRENT GOOD MANUFACTURING PRACTICE FOR TYPE A MEDICATED ARTICLES General Provisions § 226.10 Personnel. The key personnel and any consultants involved in the manufacture and control of the Type A...

  16. 31 CFR 226.5 - Examinations.

    2010-07-01

    ... 31 Money and Finance: Treasury 2 2010-07-01 2010-07-01 false Examinations. 226.5 Section 226.5... LOAN DEPOSITARIES § 226.5 Examinations. (a) Examinations by State regulatory authorities or audits by...) Examinations by State regulatory authorities or audits by CPA firms of insured financial institutions shall...

  17. 12 CFR 226.24 - Advertising.

    2010-01-01

    ... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Advertising. 226.24 Section 226.24 Banks and Banking FEDERAL RESERVE SYSTEM (CONTINUED) BOARD OF GOVERNORS OF THE FEDERAL RESERVE SYSTEM TRUTH IN LENDING (REGULATION Z) Closed-End Credit § 226.24 Advertising. (a) Actually available terms. If...

  18. 12 CFR 226.16 - Advertising.

    2010-01-01

    ... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Advertising. 226.16 Section 226.16 Banks and Banking FEDERAL RESERVE SYSTEM (CONTINUED) BOARD OF GOVERNORS OF THE FEDERAL RESERVE SYSTEM TRUTH IN LENDING (REGULATION Z) Open-End Credit § 226.16 Advertising. (a) Actually available terms. If...

  19. Developments towards in-gas-jet laser spectroscopy studies of actinium isotopes at LISOL

    Raeder, S.; Bastin, B.; Block, M.; Creemers, P.; Delahaye, P.; Ferrer, R.; Fléchard, X.; Franchoo, S.; Ghys, L.; Gaffney, L. P.; Granados, C.; Heinke, R.; Hijazi, L.; Huyse, M.; Kron, T.; Kudryavtsev, Yu.; Laatiaoui, M.; Lecesne, N.; Luton, F.; Moore, I. D.; Martinez, Y.; Mogilevskiy, E.; Naubereit, P.; Piot, J.; Rothe, S.; Savajols, H.; Sels, S.; Sonnenschein, V.; Traykov, E.; Van Beveren, C.; Van den Bergh, P.; Van Duppen, P.; Wendt, K.; Zadvornaya, A.

    2016-06-01

    To study exotic nuclides at the borders of stability with laser ionization and spectroscopy techniques, highest efficiencies in combination with a high spectral resolution are required. These usually opposing requirements are reconciled by applying the in-gas-laser ionization and spectroscopy (IGLIS) technique in the supersonic gas jet produced by a de Laval nozzle installed at the exit of the stopping gas cell. Carrying out laser ionization in the low-temperature and low density supersonic gas jet eliminates pressure broadening, which will significantly improve the spectral resolution. This article presents the required modifications at the Leuven Isotope Separator On-Line (LISOL) facility that are needed for the first on-line studies of in-gas-jet laser spectroscopy. Different geometries for the gas outlet and extraction ion guides have been tested for their performance regarding the acceptance of laser ionized species as well as for their differential pumping capacities. The specifications and performance of the temporarily installed high repetition rate laser system, including a narrow bandwidth injection-locked Ti:sapphire laser, are discussed and first preliminary results on neutron-deficient actinium isotopes are presented indicating the high capability of this novel technique.

  20. Dicty_cDB: SHH226 [Dicty_cDB

    Full Text Available SH (Link to library) SHH226 (Link to dictyBase) - - - Contig-U11737-1 SHH226P (Link to Original site) SHH226...F 626 SHH226Z 574 SHH226P 1180 - - Show SHH226 Library SH (Link to library) Clone ID SHH226...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SH/SHH2-B/SHH226Q.Seq.d/ Representative seq. ID SHH226...P (Link to Original site) Representative DNA sequence >SHH226 (SHH226Q) /CSM/SH/SHH2-B/SHH226...ore E Sequences producing significant alignments: (bits) Value SHH226 (SHH226Q) /CSM/SH/SHH2-B/SHH226Q.Seq.d

  1. Dicty_cDB: SSI226 [Dicty_cDB

    Full Text Available SS (Link to library) SSI226 (Link to dictyBase) - - - Contig-U14708-1 SSI226E (Link... to Original site) - - - - - - SSI226E 573 Show SSI226 Library SS (Link to library) Clone ID SSI226 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SS/SSI2-B/SSI226Q.Seq.d/ Representative seq. ID SSI22...6E (Link to Original site) Representative DNA sequence >SSI226 (SSI226Q) /CSM/SS/SSI2-B/SSI226Q.Seq.d/ GAAAG...kk*kknk* tiiinkiify Translated Amino Acid sequence (All Frames) Frame A: erllyssi

  2. Dicty_cDB: AFH226 [Dicty_cDB

    Full Text Available AF (Link to library) AFH226 (Link to dictyBase) - - - - AFH226P (Link to Original site) AFH226F 262 AFH226...Z 655 AFH226P 917 - - Show AFH226 Library AF (Link to library) Clone ID AFH226 (Link ...ukuba.ac.jp/CSM/AF/AFH2-B/AFH226Q.Seq.d/ Representative seq. ID AFH226P (Link to ...Original site) Representative DNA sequence >AFH226 (AFH226Q) /CSM/AF/AFH2-B/AFH226Q.Seq.d/ ACTGTTGGCCTACTGGN...rsdppxxqxskgxpppfxsqikrx Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value AFH226 (AFH226

  3. Evaluation Of Radium-226 Pollution

    Full text: One of the applications of Radium-226 is in the obtaining of the radioactive gas Radon-222 used in therapeutic baths. The therapy of radon baths was widely used in the former Soviet Union, but it hasn't been used in Latvia since 1994. Nevertheless, the object where the Radon concentrate was obtained was not released from the state control until now. The previous tentative investigations have showed that territory and premises were polluted with Radium-226. It has gradually accumulated during more than 30 years of the object operation. Our aim was to carry out the systematic investigation of the radioactive pollution of the territory and buildings, to draw up the project of decontamination and decontaminate the object. Radiometers were used to measure the alpha and beta activities, and gamma spectrometers to measure gamma activities. Soil, different constructions materials, packed in the 200 liter metal barrels and hermetically sealed that were obtained after decontamination were measured with the γ spectrometer using the NaJ detector. On the basis of data obtained the project of decontamination of the object was drawn up and the decontamination was performed. It resulted in 125 m3 of the waste, 1/3 of which according to our measurements should be stored in the radioactive waste repository. (Authors)

  4. Dicty_cDB: VSH226 [Dicty_cDB

    Full Text Available VS (Link to library) VSH226 (Link to dictyBase) - - - Contig-U16444-1 VSH226Z (Link... to Original site) - - VSH226Z 729 - - - - Show VSH226 Library VS (Link to library) Clone ID VSH226 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/VS/VSH2-B/VSH226Q.Seq.d/ Representative seq. ID VSH226...Z (Link to Original site) Representative DNA sequence >VSH226 (VSH226Q) /CSM/VS/VSH2-B/VSH226Q.Seq.d/ XXXXX...M-cDNA Score E Sequences producing significant alignments: (bits) Value VSH226 (VSH226Q) /CSM/VS/VSH2-B/VSH226

  5. Dicty_cDB: SLH226 [Dicty_cDB

    Full Text Available SL (Link to library) SLH226 (Link to dictyBase) - - - Contig-U16444-1 SLH226Z (Link... to Original site) - - SLH226Z 516 - - - - Show SLH226 Library SL (Link to library) Clone ID SLH226 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLH2-B/SLH226Q.Seq.d/ Representative seq. ID SLH226...Z (Link to Original site) Representative DNA sequence >SLH226 (SLH226Q) /CSM/SL/SLH2-B/SLH226Q.Seq.d/ XXXXX...VSJ394Q.Seq.d/ 870 0.0 VSH226 (VSH226Q) /CSM/VS/VSH2-B/VSH226Q.Seq.d/ 870 0.0 VSF755 (VSF755Q) /CSM/VS/VSF7-

  6. Dicty_cDB: VFH226 [Dicty_cDB

    Full Text Available VF (Link to library) VFH226 (Link to dictyBase) - - - Contig-U11646-1 VFH226Z (Link... to Original site) - - VFH226Z 713 - - - - Show VFH226 Library VF (Link to library) Clone ID VFH226 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/VF/VFH2-B/VFH226Q.Seq.d/ Representative seq. ID VFH226...Z (Link to Original site) Representative DNA sequence >VFH226 (VFH226Q) /CSM/VF/VFH2-B/VFH226Q.Seq.d/ XXXXX...icant alignments: (bits) Value VFH226 (VFH226Q) /CSM/VF/VFH2-B/VFH226Q.Seq.d/ 1413 0.0 CHB686 (CHB686Q) /CSM

  7. 22 CFR 226.43 - Competition.

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Competition. 226.43 Section 226.43 Foreign Relations AGENCY FOR INTERNATIONAL DEVELOPMENT ADMINISTRATION OF ASSISTANCE AWARDS TO U.S. NON-GOVERNMENTAL.... The recipient shall be alert to organizational conflicts of interest as well as...

  8. 21 CFR 226.42 - Components.

    2010-04-01

    ... 21 Food and Drugs 4 2010-04-01 2010-04-01 false Components. 226.42 Section 226.42 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) DRUGS: GENERAL CURRENT GOOD MANUFACTURING PRACTICE FOR TYPE A MEDICATED ARTICLES Product Quality Control §...

  9. 7 CFR 226.15 - Institution provisions.

    2010-01-01

    ....15, see the List of CFR Sections Affected, which appears in the Finding Aids section of the printed... 7 Agriculture 4 2010-01-01 2010-01-01 false Institution provisions. 226.15 Section 226.15... Institution provisions. (a) Tax exempt status. Except for for-profit centers and sponsoring organizations...

  10. 31 CFR 226.6 - Financial reports.

    2010-07-01

    ... 31 Money and Finance: Treasury 2 2010-07-01 2010-07-01 false Financial reports. 226.6 Section 226.6 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) FISCAL SERVICE, DEPARTMENT OF THE TREASURY FINANCIAL MANAGEMENT SERVICE RECOGNITION OF INSURANCE COVERING TREASURY TAX...

  11. Dicty_cDB: CFH226 [Dicty_cDB

    Full Text Available CF (Link to library) CFH226 (Link to dictyBase) - G21772 DDB0219348 Contig-U02590-1 CFH226...Z (Link to Original site) - - CFH226Z 774 - - - - Show CFH226 Library CF (Link to library) Clone ID CFH226...riginal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/CF/CFH2-B/CFH226Q.Seq.d/ ...Representative seq. ID CFH226Z (Link to Original site) Representative DNA sequence >CFH226 (CFH226Q) /CSM/CF/CFH2-B/CFH226...*tnqtk*kqk* Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value CFH226 (CFH226

  12. Dicty_cDB: SSH226 [Dicty_cDB

    Full Text Available SS (Link to library) SSH226 (Link to dictyBase) - - - Contig-U15974-1 SSH226F (Link to Original site) SSH226...F 298 - - - - - - Show SSH226 Library SS (Link to library) Clone ID SSH226 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SS/SSH2-B/SSH226Q.Seq.d/ Representative seq. ID SSH226...F (Link to Original site) Representative DNA sequence >SSH226 (SSH226Q) /CSM/SS/SSH2-B/SSH226Q.Seq.d/ GAAAA...roducing significant alignments: (bits) Value VSG872 (VSG872Q) /CSM/VS/VSG8-C/VSG872Q.Seq.d/ 297 5e-80 SSH226 (SSH226

  13. Dicty_cDB: SFH226 [Dicty_cDB

    Full Text Available SF (Link to library) SFH226 (Link to dictyBase) - - - Contig-U11649-1 | Contig-U16366-1 SFH226...P (Link to Original site) SFH226F 637 SFH226Z 159 SFH226P 796 - - Show SFH226 Library SF (Link to library) Clone ID SFH226...49-1 | Contig-U16366-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SF/SFH2-B/SFH226...Q.Seq.d/ Representative seq. ID SFH226P (Link to Original site) Representative DNA sequence >SFH226 (SFH226...Q) /CSM/SF/SFH2-B/SFH226Q.Seq.d/ TAAACCAGNATTGTACAGAAGATGAATTAAAGAAAGCATATAGAAAGATGGCTGTTAAAT

  14. Conditioning of radium-226 sources in Peru

    The use of radium- 226 sources constitutes a high risk concerning its medical and sanitary applications. For this reason, Peruvian regulatory authorities are applying collection and conditioning policies. In Peru, after removing some radium-226 sources from hospital centers, with the support of the International Atomic Energy Agency through the Radioactive Wastes Management Plant of the 'RACSO' Nuclear Center, the first Ra-226 conditioning experience has been carried out. This document describes technical reasons, procedures used, sources characteristics, radiological protection mechanisms and motionless techniques used as well as provisional storage

  15. Dicty_cDB: VHH226 [Dicty_cDB

    Full Text Available VH (Link to library) VHH226 (Link to dictyBase) - - - Contig-U16477-1 - (Link to Original site) - - VHH226...Z 538 - - - - Show VHH226 Library VH (Link to library) Clone ID VHH226 (Link to dicty...iol.tsukuba.ac.jp/CSM/VH/VHH2-B/VHH226Q.Seq.d/ Representative seq. ID - (Link to ...Original site) Representative DNA sequence >VHH226 (VHH226Q) /CSM/VH/VHH2-B/VHH226Q.Seq.d/ XXXXXXXXXXCTATGTA...41Q) /CSM/VH/VHI5-B/VHI541Q.Seq.d/ 999 0.0 VHH226 (VHH226Q) /CSM/VH/VHH2-B/VHH226Q.Seq.d/ 999 0.0 VHE160 (VH

  16. Dicty_cDB: CHH226 [Dicty_cDB

    Full Text Available CH (Link to library) CHH226 (Link to dictyBase) - - - Contig-U16366-1 | Contig-U16429-1 CHH226...P (Link to Original site) CHH226F 563 CHH226Z 706 CHH226P 1249 - - Show CHH226 Library CH (Link to library) Clone ID CHH22...366-1 | Contig-U16429-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/CH/CHH2-B/CHH226...Q.Seq.d/ Representative seq. ID CHH226P (Link to Original site) Representative DNA sequence >CHH226 (CHH226...Q) /CSM/CH/CHH2-B/CHH226Q.Seq.d/ ATTAATTTTAATTTATATAAATTACCTTATTACTTAAAGATGACAACAAATAATCCATTT

  17. 21 CFR 226.58 - Laboratory controls.

    2010-04-01

    ...: GENERAL CURRENT GOOD MANUFACTURING PRACTICE FOR TYPE A MEDICATED ARTICLES Product Quality Control § 226.58...) Provisions for the maintenance of the results of any assays, including dates and endorsement of...

  18. Development of solid radium-226 reference materials

    Radium-226 reference materials having a matrix similar to soil or tailings samples are not available in sufficient quantity for use by remedial-action contractors to calibrate their laboratory gamma-ray spectrometers. Such reference materials are needed to provide uniform standardization among measurements made by remedial-action contractors. A task, therefore, was undertaken to prepare about 200 pounds each of three different concentrations of radium-226 reference materials by diluting tailings with high-purity silica. Target values for radium-226 content were 50, 15, and 5 pCi/g. The radium-226 content of the reference materials was measured by C.W. Sill of EG and G Idaho, Inc., Idaho Falls, using a high- resolution alpha spectrometry technique standardized with National Bureau of Standards (NBS) standard 4961. A summary of this technique is provided in Appendix A of this report. An independent measurement of the radium-226 content was conducted by Bendix Field Engineering Corporation (Bendix), Grand Junction, Colorado, using a high-resolution Ge(Li) detector, which was calibrated using the New Brunswick Laboratory (NBL) 100-A Series standards. The Ge(Li) detector has also been used to determine the radium-226 content in the calibration models at the Grand Junction facility; these models are used by remedial-action contractors for calibration of borehole logging gamma-ray probes. 8 references, 12 tables

  19. 21 CFR 226.1 - Current good manufacturing practice.

    2010-04-01

    ... 21 Food and Drugs 4 2010-04-01 2010-04-01 false Current good manufacturing practice. 226.1 Section...) DRUGS: GENERAL CURRENT GOOD MANUFACTURING PRACTICE FOR TYPE A MEDICATED ARTICLES General Provisions § 226.1 Current good manufacturing practice. (a) The criteria in §§ 226.10 through 226.115,...

  20. Purification of selenium from thorium, uranium, radium, actinium and potassium impurities for low background measurements

    A technique of selenium purification from 232Th, 238U, 226,228Ra, 227Ac and 40K was developed. This technique is simple to perform and employs a minimum number of highly pure reagents (bidistilled water, nitric acid). Operations carried out during purification (elution, evaporation) practically exclude losses of the target product (chemical yields of Se > 99%). A test purification of 100 g of selenium was carried out using this technique. The efficiency of this technique was confirmed by low background gamma spectrometry of the purified selenium sample. Distribution coefficients of Th, U, Ra and Ac on DOWEX 50W- x 8 cation-exchange resin at different concentrations of selenium and nitric acid were experimentally determinated. Instrumental neutron activation analysis of bidistilled water, deionized water and nitric acid was performed. (orig.)

  1. Purification of selenium from thorium, uranium, radium, actinium and potassium impurities for low background measurements

    Rakhimov, A.V. [Joint Institute for Nuclear Research (JINR), Dubna (Russian Federation); Uzbek Academy of Sciences, Tashkent (Uzbekistan). Inst. of Nuclear Physics (INP AS RUz); Warot, G. [CEA-CNRS, Modane (France). Laboratoire Souterrain de Modane (LSM); Karaivanov, D.V. [Joint Institute for Nuclear Research (JINR), Dubna (Russian Federation); Institute for Nuclear Research and Nuclear Energy (INRNE), Sofia (Bulgaria); Kochetov, O.I.; Lebedev, N.A.; Filosofov, D.V. [Joint Institute for Nuclear Research (JINR), Dubna (Russian Federation); Mukhamedshina, N.M.; Sadikov, I.I. [Uzbek Academy of Sciences, Tashkent (Uzbekistan). Inst. of Nuclear Physics (INP AS RUz)

    2013-07-01

    A technique of selenium purification from {sup 232}Th, {sup 238}U, {sup 226,228}Ra, {sup 227}Ac and {sup 40}K was developed. This technique is simple to perform and employs a minimum number of highly pure reagents (bidistilled water, nitric acid). Operations carried out during purification (elution, evaporation) practically exclude losses of the target product (chemical yields of Se > 99%). A test purification of 100 g of selenium was carried out using this technique. The efficiency of this technique was confirmed by low background gamma spectrometry of the purified selenium sample. Distribution coefficients of Th, U, Ra and Ac on DOWEX 50W- x 8 cation-exchange resin at different concentrations of selenium and nitric acid were experimentally determinated. Instrumental neutron activation analysis of bidistilled water, deionized water and nitric acid was performed. (orig.)

  2. The determination of radium-226 in urine

    The method for determining radium-226 in urine that is currently being used by the Bioassay Laboratory has been tested and documented. Radium-226 is coprecipitated from urine by alkaline calcium phosphate. This precipitate is redissolved in hydrochloric acid and the radium purified by cation exchange. Radium is collected by a barium sulphate coprecipitation and then estimated by alpha counting. The method has been tested using radium-226 and cross-contamination studies were performed using Am-24l, Pu-239, Np-237, Th-Nat and U-233. With the exception of Am-24l, cross-contaminations were found to be negligible. The method gives an overall chemical recovery of 80 +- 5α and the detection limit is estimated to be 0.39 mBq - counting time, 72 h; background, 0.05 counts per minute (cpm)

  3. Treatment of solid waste containing 226Ra

    This work is directed to the treatment of radioactive solid waste containing mainly radium (226Ra) produced from oil and gas production industries in Egypt. The treatment process has been carried out by suspending the clay fraction content in the solid waste in suitable leaching solutions. These compremise aqueous saline solution and aqueous saline solutions containing certain additives, namely, Washing Powder (W.P.), Shell and Span 20 surfactants. Treatment with saline solution containing either W.P. or Shell surfactants, showed an enhancement in the removal of 226Ra compared to that with saline solution alone or containing Span 20. Factors affect the treatment process have been investigated and discussed. The removal percentage of 226Ra was found to depend on the clay fines content in the solid waste. Further sequential treatment schemes have been tested and optimized

  4. Radiation exposure from radium-226 ingestion

    The contribution of radium to total radiation exposure resulting from the consumption of natural levels of 226Ra in several public water supplies in an Oklahoma county was determined. A pilot-level study of total dietary intake indicated that the culinary use of water anomalously high in radium and the consumption of water-based beverages contributed significantly to radiation exposure. The mean dietary intake of 226Ra was 20.6 pCi/day in one community and resulted in an estimated bone dose of 310 mrem/year

  5. 22 CFR 226.27 - Allowable costs.

    2010-04-01

    ... Relations AGENCY FOR INTERNATIONAL DEVELOPMENT ADMINISTRATION OF ASSISTANCE AWARDS TO U.S. NON-GOVERNMENTAL ORGANIZATIONS Post-award Requirements Financial and Program Management § 226.27 Allowable costs. For each kind..., “Cost Principles for State and Local Governments.” The allowability of costs incurred by...

  6. 22 CFR 226.2 - Definitions.

    2010-04-01

    ... Identity (Identity) means the official marking for the United States Agency for International Development... Relations AGENCY FOR INTERNATIONAL DEVELOPMENT ADMINISTRATION OF ASSISTANCE AWARDS TO U.S. NON-GOVERNMENTAL... that receives a USAID subaward, as defined in 22 CFR 226.2. Supplies means all personal...

  7. 22 CFR 226.24 - Program income.

    2010-04-01

    ... Relations AGENCY FOR INTERNATIONAL DEVELOPMENT ADMINISTRATION OF ASSISTANCE AWARDS TO U.S. NON-GOVERNMENTAL ORGANIZATIONS Post-award Requirements Financial and Program Management § 226.24 Program income. (a) Recipients... project or program, and used to further eligible project or program objectives. (2) Used to finance...

  8. 22 CFR 226.42 - Codes of conduct.

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Codes of conduct. 226.42 Section 226.42 Foreign... ORGANIZATIONS Post-award Requirements Procurement Standards § 226.42 Codes of conduct. The recipient shall maintain written standards of conduct governing the performance of its employees engaged in the award...

  9. 12 CFR 226.23 - Right of rescission.

    2010-01-01

    ... obligation, the consumer shall have the right to rescind the transaction if: (i) A mortgage broker fee that... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Right of rescission. 226.23 Section 226.23... TRUTH IN LENDING (REGULATION Z) Closed-End Credit § 226.23 Right of rescission. (a) Consumer's right...

  10. 25 CFR 226.22 - Prohibition of pollution.

    2010-04-01

    ... 25 Indians 1 2010-04-01 2010-04-01 false Prohibition of pollution. 226.22 Section 226.22 Indians... LANDS FOR OIL AND GAS MINING Operations § 226.22 Prohibition of pollution. (a) All operators... holes) in a manner that will prevent pollution and the migration of oil, gas, salt water or...

  11. 49 CFR 195.226 - Welding: Arc burns.

    2010-10-01

    ... 49 Transportation 3 2010-10-01 2010-10-01 false Welding: Arc burns. 195.226 Section 195.226 Transportation Other Regulations Relating to Transportation (Continued) PIPELINE AND HAZARDOUS MATERIALS SAFETY... PIPELINE Construction § 195.226 Welding: Arc burns. (a) Each arc burn must be repaired. (b) An arc burn...

  12. 25 CFR 226.3 - Surrender of lease.

    2010-04-01

    ... 25 Indians 1 2010-04-01 2010-04-01 false Surrender of lease. 226.3 Section 226.3 Indians BUREAU OF... AND GAS MINING Leasing Procedure, Rental and Royalty § 226.3 Surrender of lease. Lessee may, with the approval of the Superintendent and payment of a $10 filing fee, surrender all or any portion of any...

  13. 25 CFR 226.10 - Term of lease.

    2010-04-01

    ... 25 Indians 1 2010-04-01 2010-04-01 false Term of lease. 226.10 Section 226.10 Indians BUREAU OF... AND GAS MINING Leasing Procedure, Rental and Royalty § 226.10 Term of lease. Leases issued hereunder..., and so stated in the notice of sale of such leases and so long thereafter as the minerals...

  14. 21 CFR 226.80 - Packaging and labeling.

    2010-04-01

    ... 21 Food and Drugs 4 2010-04-01 2010-04-01 false Packaging and labeling. 226.80 Section 226.80 Food...: GENERAL CURRENT GOOD MANUFACTURING PRACTICE FOR TYPE A MEDICATED ARTICLES Packaging and Labeling § 226.80 Packaging and labeling. (a) Packaging and labeling operations shall be adequately controlled: (1) To...

  15. 25 CFR 226.39 - Measurement of gas.

    2010-04-01

    ... 25 Indians 1 2010-04-01 2010-04-01 false Measurement of gas. 226.39 Section 226.39 Indians BUREAU OF INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR ENERGY AND MINERALS LEASING OF OSAGE RESERVATION LANDS FOR OIL AND GAS MINING Requirements of Lessees § 226.39 Measurement of gas. All gas, required to...

  16. 10 CFR 600.226 - Non-Federal audit.

    2010-01-01

    ... 10 Energy 4 2010-01-01 2010-01-01 false Non-Federal audit. 600.226 Section 600.226 Energy DEPARTMENT OF ENERGY (CONTINUED) ASSISTANCE REGULATIONS FINANCIAL ASSISTANCE RULES Uniform Administrative....226 Non-Federal audit. (a) Basic rule. Grantees and subgrantees are responsible for obtaining...

  17. 22 CFR 226.1002 - Local cost financing. [Reserved

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Local cost financing. 226.1002 Section 226.1002 Foreign Relations AGENCY FOR INTERNATIONAL DEVELOPMENT ADMINISTRATION OF ASSISTANCE AWARDS TO U.S. NON-GOVERNMENTAL ORGANIZATIONS USAID-Specific Requirements § 226.1002 Local cost financing....

  18. New method for large scale production of medically applicable Actinium-225 and Radium-223

    Alpha-emitters (211At, 212Bi, 213Bi, 223Ra, 225Ac) are promising for targeted radiotherapy of cancer. Only two alpha decays near a cell membrane result in 50% death of cancer cell and only a single decay inside the cell is required for this. 225Ac may be used either directly or as a mother radionuclide in 213Bi isotope generator. Production of 225Ac is provided by three main suppliers - Institute for Transuranium Elements in Germany, Oak Ridge National Laboratory in USA and Institute of Physics and Power Engineering in Obninsk, Russia. The current worldwide production of 225Ac is approximately 1.7 Ci per year that corresponds to only 100-200 patients that could be treated annually. The common approach for 225Ac production is separation from mother 229Th or irradiation of 226Ra with protons in a cyclotron. Both the methods have some practical limitations to be applied routinely. 225Ac can be also produced by irradiation of natural thorium with medium energy protons . Cumulative cross sections of 225Ac, 227Ac, 227Th, 228Th formations have been obtained recently. Thorium targets (1-9 g) were irradiated by 114-91 MeV proton beam (1-50 μA) at INR linear accelerator. After dissolution in 8 M HNO3 + 0.004 M HF thorium was removed by double LLX by HDEHP in toluene (1:1). Ac and REE were pre-concentrated and separated from Ra and most fission products by DGA-Resin (Triskem). After washing out by 0.01 M HNO3 Ac was separated from REE by TRU Resin (Triskem) in 3 M HNO3 media. About 6 mCi 225Ac were separated in hot cell with chemical yield 85%. The method may be upscaled for production of Ci amounts of the radionuclide. The main impurity is 227Ac (0.1% at the EOB) but it does not hinder 225Ac from being used for medical 225Ac/213Bi generators. (author)

  19. Determination of radium-226 in environmental samples

    The analysis of soil and water samples for 226Ra by gamma spectrometry with a Ge(Li) detector was compared with that by radiochemical separation followed by 222Rn de-emanation. Lower limits of detection (LLD) for 226Ra were calculated for the two analytical techniques. The Ge(Li) system was found to have an LLD for soil comparable to that calculated for the de-emanation procedure, but the Ge(Li) system was found to have a significantly higher LLD for water samples. Cost analysis indicated that the cost of 222Ra determination with a Ge(Li) system can be less than with the de-emanation procedure if the Ge(Li) system can perform at least one other isotopic anaysis per sample

  20. Radium-226 on drinking water of Camaguey, Cuba; Radio-226 en agua potable de Camaguey, Cuba

    Montalvan Estrada, Adelmo; Brigido Flores, Osvaldo; Barrera Caballero, Aldo [Centro de Atencion a la Actividad Nuclear, Camaguey (Cuba)]. E-mail: sean@caonao.cmw.inf.cu; Escalante, Alexander [Centro Provincial de Higiene y Epidemiologia, Camaguey (Cuba)

    2001-07-01

    The specific activity of Ra-226 in drinking water of Camaguey city, Cuba, was measured using the emanometric method. The specific activity of Ra-226 in drinking water ranged from 15 {+-} 5 mBq.l{sup -1} to 39 {+-}12 mBq.l{sup -1}. The mean specific activity of Ra-226 was found to be 27 {+-} 8 mBq.l{sup -1}. No seasonal variation was found. Water samples were collected from the two main sources of drinking water: private wells and governmental water supply system, being the mean specific activities of Ra-226: 25 {+-} 7 mBq.l{sup -1} and 31 {+-} 9 mBq.l{sup -1} , respectively. Based upon measured concentrations the age-dependent associated effective doses due to the ingestion of Ra-226, as a consequence of direct consumption of drinking water, have been calculated. For the age interval 1 year to 5 years, the average effective dose was 6,2 {mu}Sv.y{sup -1}, and for adults the average effective dose was 5,2 {mu}Sv.y{sup -1}. (author)

  1. Radium-226 levels in Italian drinking waters and foods

    Levels of 226Ra in Italian waters and foods were measured. Results were similar to those found in other countries, except for some mineral waters with 226Ra concentrations above 1 pCi/liter andup to 19 pCi/liter. No difinite correlation was found between the 226Ra concentrations measured and the high natural background radiation levels determined in central Italy in previous work

  2. Dicty_cDB: VHK226 [Dicty_cDB

    Full Text Available VH (Link to library) VHK226 (Link to dictyBase) - G02743 DDB0231318 Contig-U15510-1 VHK226P (Lin ... yfk wici*ikwdqfiliq*hfqkhmimvn*--- ---firsrq*nkclh*imc *tkdkskikfn*cnrrvyhlhflcfrfnrifnrlfndwfrf rw*r*yrrg ...

  3. 226Ra determination in phosphogypsum by alpha-particle spectrometry

    A radiochemical method for 226Ra determination by alpha-particle spectrometry in environmental samples has been developed in our laboratory. The method has been validated by measurements in samples with known concentrations of this radionuclide and it has been applied in studies related to 226Ra behaviour in phosphogypsum (the main by-product of producing phosphoric acid from phosphate rocks). (author)

  4. 12 CFR 226.2 - Definitions and rules of construction.

    2010-01-01

    ... Lending Act (15 U.S.C. 1601 et seq.). (2) Advertisement means a commercial message in any medium that... amount. § 226.2, Nt. Effective Date Note: At 74 FR 5398, Jan. 29, 2009, § 226.2 was revised, effective... definitions apply: (1) Act means the Truth in Lending Act (15 U.S.C. 1601 et seq. ). (2) Advertisement means...

  5. Dicty_cDB: VFJ226 [Dicty_cDB

    Full Text Available VF (Link to library) VFJ226 (Link to dictyBase) - G02600 DDB0186313 Contig-U09608-1 VFJ226P (Lin ... 0 8e-47 1 ( AF033921 ) Bactrocera xanthodes strain Fiji ... mitochondrial D-... 44 0.17 3 ( AF033928 ) Bactroc ...

  6. 21 CFR 226.40 - Production and control procedures.

    2010-04-01

    ... 21 Food and Drugs 4 2010-04-01 2010-04-01 false Production and control procedures. 226.40 Section 226.40 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) DRUGS: GENERAL CURRENT GOOD MANUFACTURING PRACTICE FOR TYPE A MEDICATED ARTICLES Product Quality...

  7. 25 CFR 226.19 - Use of surface of land.

    2010-04-01

    ... LANDS FOR OIL AND GAS MINING Operations § 226.19 Use of surface of land. (a) Lessee or his/her... routing shall be set by the Superintendent. The right to use water for lease operations is established by § 226.24. Lessee shall conduct his/her operations in a workmanlike manner, commit no waste and...

  8. 12 CFR Supplement I to Part 226 - Official Staff Interpretations

    2010-01-01

    ... print media, are covered by Regulation Z (12 CFR part 226). i. Examples include: A. Messages in a.... citizen residing or visiting abroad or to a foreign national abroad. 1(d) Organization. Paragraph 1(d)(1... with the final rules on co-branding in §§ 226.48(a) and (b) is mandatory for marketing occurring on...

  9. 48 CFR 952.226-74 - Displaced employee hiring preference.

    2010-10-01

    ... Displaced employee hiring preference. As prescribed in 48 CFR (DEAR) 926.7104, insert the following clause. Displaced Employee Hiring Preference (JUN 1997) (a) Definition. Eligible employee means a current or former... preference. 952.226-74 Section 952.226-74 Federal Acquisition Regulations System DEPARTMENT OF ENERGY...

  10. 50 CFR 226.207 - Critical habitat for leatherback turtle.

    2010-10-01

    ... 50 Wildlife and Fisheries 7 2010-10-01 2010-10-01 false Critical habitat for leatherback turtle. 226.207 Section 226.207 Wildlife and Fisheries NATIONAL MARINE FISHERIES SERVICE, NATIONAL OCEANIC AND... Critical habitat for leatherback turtle. Leatherback Sea Turtle (dermochelys coriacea) The waters...

  11. 50 CFR 226.209 - Critical habitat for hawksbill turtle.

    2010-10-01

    ... 50 Wildlife and Fisheries 7 2010-10-01 2010-10-01 false Critical habitat for hawksbill turtle. 226.209 Section 226.209 Wildlife and Fisheries NATIONAL MARINE FISHERIES SERVICE, NATIONAL OCEANIC AND... Critical habitat for hawksbill turtle. (a) Mona and Monito Islands, Puerto Rico—Waters surrounding...

  12. 50 CFR 226.208 - Critical habitat for green turtle.

    2010-10-01

    ... 50 Wildlife and Fisheries 7 2010-10-01 2010-10-01 false Critical habitat for green turtle. 226.208 Section 226.208 Wildlife and Fisheries NATIONAL MARINE FISHERIES SERVICE, NATIONAL OCEANIC AND ATMOSPHERIC... green turtle. (a) Culebra Island, Puerto Rico—Waters surrounding the island of Culebra from the...

  13. 20 CFR 226.31 - Reduction for public pension.

    2010-04-01

    ... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Reduction for public pension. 226.31 Section... § 226.31 Reduction for public pension. (a) The tier I annuity component of a spouse/divorced spouse... in receipt of a public pension. (b) When reduction is required. Unless the spouse or divorced...

  14. 22 CFR 226.15 - Metric system of measurement.

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Metric system of measurement. 226.15 Section....S. NON-GOVERNMENTAL ORGANIZATIONS Pre-award Requirements § 226.15 Metric system of measurement. (a...) declares that the metric system is the preferred measurement system for U.S. trade and commerce....

  15. 42 CFR 414.226 - Oxygen and oxygen equipment.

    2010-10-01

    ... 42 Public Health 3 2010-10-01 2010-10-01 false Oxygen and oxygen equipment. 414.226 Section 414... Equipment and Prosthetic and Orthotic Devices § 414.226 Oxygen and oxygen equipment. (a) Payment rules—(1) Oxygen equipment. Payment for rental of oxygen equipment is made based on a monthly fee schedule...

  16. 7 CFR 226.14 - Claims against institutions.

    2010-01-01

    ... 7 Agriculture 4 2010-01-01 2010-01-01 false Claims against institutions. 226.14 Section 226.14... against institutions. (a) State agencies shall disallow any portion of a claim for reimbursement and recover any payment to an institution not properly payable under this part. State agencies may...

  17. 7 CFR 226.5 - Donation of commodities.

    2010-01-01

    ... 7 Agriculture 4 2010-01-01 2010-01-01 false Donation of commodities. 226.5 Section 226.5... of commodities. (a) USDA foods available under section 6 of this Act, section 416 of the Agricultural... the Department shall be made available to each State. (b) The value of such commodities donated...

  18. 12 CFR 226.11 - Treatment of credit balances.

    2010-01-01

    ... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Treatment of credit balances. 226.11 Section... SYSTEM TRUTH IN LENDING (REGULATION Z) Open-End Credit § 226.11 Treatment of credit balances. When a credit balance in excess of $1 is created on a credit account (through transmittal of funds to a...

  19. 12 CFR 226.21 - Treatment of credit balances.

    2010-01-01

    ... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Treatment of credit balances. 226.21 Section... SYSTEM TRUTH IN LENDING (REGULATION Z) Closed-End Credit § 226.21 Treatment of credit balances. When a credit balance in excess of $1 is created in connection with a transaction (through transmittal of...

  20. Use of carriers for to electrodeposited radium 226; Utilizacion de portadores para electrodepositar radio 226

    Iturbe, J.L

    1991-10-15

    The form of the energy distribution of a monoenergetic alpha particle starting from some emitting source of these particles, it depends on the quantity of material that its cross before being detected. Some authors deposit to the radium-226 by means of direct evaporation of the solution on metallic supports, on millipore paper and by electrodeposition. Some other ones place the radium solution in scintillation liquid, to quantify it by this technique. The objective of the present work is using carriers with the same oxidation state of the radium, that is to say of 2{sup +}, for treating to be electrodeposited to the radium-226 with the biggest possible percentage for later use the alpha spectroscopy technique to quantify it. The carriers that have been used until its they are barium and zinc in form of barium chloride, zinc nitrate and zinc sulfate. The first results indicate that with the zinc solution a yield of 40% of electrodeposited radium has been reached. (Author)

  1. Radium 226 in the deep north-eastern Atlantic Ocean

    With reference to the distribution of radium-226 in the western equatorial and north-eastern deep Atlantic Ocean it was possible to establish structures in the correlations of radium-226 to its chemical homologue Ba and dissolved SiO2. An 11-box model of the deep Atlantic Ocean was used to obtain information on the size of the radium-226 and Ba sources. The soil source derives mainly from the dissolution of barite. For the first time, an evaluation of the radium-226 flow resulting from the dissolution of particulate matter is presented. The box model and the radium-226 concentrations measured put down the value as 23-46·10-21 mol/m2s. (DG)

  2. Leaching of 226Ra from components of uranium mill tailings

    Landa, E.R.

    1991-01-01

    A sequential extraction procedure was used to characterize the geochemical forms of 226Ra retained by mixtures of quartz sand and a variety of fine-grained rock and mineral species. These mixtures had previously been exposed to the sulfuric acid milling liquor of a simulated acid-leach uranium milling circuit. For most test cases, the major fraction of the 226Ra was extracted with 1 mol/1 NH4Cl and was deemed to be exchangeable. However, 226Ra retained by the barite-containing mixture was resistant to both 1 mol/1 NH4Cl and 1 mol/HCHCl extraction. ?? 1991.

  3. Toxicity of injected radium-226 in immature dogs

    This study was conducted to determine the toxicity of injected 226Ra in immature dogs and to compare the results with those from studies of injected 226Ra in young adult dogs. An historic objective of these studies, initiated at the University of Utah and continued at ITRI, was to compare the results in dogs to the population of dial painters who ingested 226Ra as young adults. Age at the time of exposure is considered to be an important factor in dosimetry and risk of developing radiation-induced disease, particularly bone cancer. In summary, dogs injected with 226Ra when immature had increased occurrences of bone tumors in a dose-related fashion

  4. Toxicity of injected radium-226 in immature dogs

    Muggenburg, B.A.; Hahn, F.F.; Griffith, W.C. [and others

    1995-12-01

    This study was conducted to determine the toxicity of injected {sup 226}Ra in immature dogs and to compare the results with those from studies of injected {sup 226}Ra in young adult dogs. An historic objective of these studies, initiated at the University of Utah and continued at ITRI, was to compare the results in dogs to the population of dial painters who ingested {sup 226}Ra as young adults. Age at the time of exposure is considered to be an important factor in dosimetry and risk of developing radiation-induced disease, particularly bone cancer. In summary, dogs injected with {sup 226}Ra when immature had increased occurrences of bone tumors in a dose-related fashion.

  5. 226Ra bioavailability of plants at urgeirica uranium mill tailings

    Large amounts of solid wastes (tailings) resulting from the exploitation and treatment of uranium ore at the Urgeirica mine (north of Portugal) have been accumulated in dams (tailing ponds). To reduce the dispersion of natural radionuclides into the environment some dams were revegetated with eucalyptus (Eucalyptus globolus) and pines (Pinus pinea). Besides, some shrubs (Cytisus s.p.) are growing at some of the dams. The objective of this study is to determine the 226Ra bioavailability from uranium mill tailings through the quantification of the total and available fraction of radium in the solid wastes and to estimate its transfer to the plants growing on the tailing piles. Plants and solid waste samples were randomly collected at dams. Activity concentration of 226Ra in plants (aerial part and roots) and solid wastes were measured by gamma spectrometry. The exchangeable fraction of radium in solid wastes was quantified using one single step extraction with 1 mol dm-3 ammonium acetate (pH=7) or 1 mol dm-3 calcium chloride solutions. The results obtained for the 226Ra uptake by plants show that 226Ra concentration ratios for eucalyptus and pines decrease at low 226Ra concentration in the solid wastes and appear relatively constant at higher radium concentrations. For shrubs, the concentration ratios increase at higher 226Ra solid waste concentrations approaching a saturation value. Percentage values of 16.0±8.3 and 12.9±8.9, for the fraction of radium extracted from the solid wastes, using 1 mol dm-3 ammonium acetate or calcium chloride solutions respectively, were obtained. The 226Ra concentration ratios determined on the basis of exchangeable radium are one order of magnitude higher than those based on total radium. It can be concluded that, within the standard error values, more consistent 226Ra concentration ratios were obtained when calculated on the basis of available radium than when total radium was considered, for all the dams. (author)

  6. Dicty_cDB: CFD226 [Dicty_cDB

    Full Text Available CF (Link to library) CFD226 (Link to dictyBase) - - - Contig-U16287-1 CFD226Z (Link to Original ... equence. 64 5e-07 2 CF514038 |CF514038.1 CAbud0007_IVF _G07 Vitis vinifera cv. cabernet sauvignon (Clone 8 ... ) Bud - CABUD Vitis vinifera cDNA clone CAbud0007_IVF _G07 5', mRNA sequence. 64 3e-06 1 CB910900 |CB9109 ...

  7. 31 CFR 800.226 - U.S. business.

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false U.S. business. 800.226 Section 800... TAKEOVERS BY FOREIGN PERSONS Definitions § 800.226 U.S. business. The term U.S. business means any entity... subsidiary is a U.S. business. Corporation A and its branch or subsidiary is each also a foreign...

  8. The chemistry of 226Ra in the uranium milling process

    Uranium mining, ore crushing, grinding and leaching can substantially redistribute radium in the environment. Solvent extraction or other separation processes leave mill tailings with high 226Ra concentration. Radium is readily adsorbed on the surfaces of leached solids or coprecipitated with barium sulfates. More solid ore phase studies are required to identify all the physico-chemical mechanisms controlling 226Ra dissolution from leaching ore-liquor systems. 29 refs, 5 figs, 4 tabs

  9. 226Ra in the western Indian Ocean

    Chung, Y.

    1987-09-01

    226Ra profiles have been measured in the western Indian Ocean as part of the 1977-1978 Indian Ocean GEOSECS program. These profiles show a general increase in deep and bottom water Ra concentration from the Circumpolar region to the Arabian Sea. A deep Ra maximum which originates in the Arabian Sea and in the Somali basin at about 3000 m depth spreads southward into the Mascarene basin and remains discernible in the Madagascar and Crozet basins. In the western Indian Ocean, the cold Antarctic Bottom Water spreads northward under the possibly southward-flowing deep water, forming a clear benthic front along the Crozet basin across the Southwest Indian Ridge into the Madagascar and Mascarene basins. The Antarctic Bottom Water continues to spread farther north to the Somali basin through the Amirante Passage at 10°S as a western boundary current. The benthic front and other characteristic features in the western Indian Ocean are quite similar to those observed in the western Pacific where the benthic front as a distinctive feature was first described by Craig et al. [15]. Across the Mid-Indian Ridge toward the Ceylon abyssal plain near the triple junction, Ra profiles display a layered structure, reflecting the topographic effect of the mid-ocean ridge system on the mixing and circulation of the deep and bottom waters. Both Ra and Si show a deep maximum north of the Madagascar basin. Linear relationships between these two elements are observed in the deep and bottom water with slopes increasing northward. This suggests a preferential input of Ra over Si from the bottom sediments of the Arabian Sea and also from the flank sediments of the Somali basin.

  10. Late excretion rates of 226Ra and 210Pb following occupational or iatrogenic exposure. I. 226Ra

    The urinary and fecal excretion rates of 226Ra have been determined for 53 subjects who had been exposed to 226Ra; 25 had been radium dial painters, 16 were iatrogenic (medical) cases and 12 were former radium chemists. The mean coefficient of elimination, CE (fraction of body content excreted annually), was significantly lower for the medical cases than for dial painters. The mean ratio of urinary-to-fecal excretion rates was 3.0 +- 0.7%

  11. Natural Radium-226 accumulation in the human thyroid gland

    Full text: Small amounts of Ra-226 and other radium isotopes routinely enter the human body through normal dietary intake and, in some cases, through occupational exposure. Currently accepted biokinetic models for radium in the human body assume a uniform distribution among all soft tissues and a short retention time in those tissues. These assumptions persist despite publications in the mid-1980s indicating that radium concentrations in tissue are related to calcium levels in each organ, implying that the thyroid gland could accumulate greater concentrations of radium isotopes than any other tissue. Moreover, the natural intake or production of sulfate or barium compounds in the body could serve to precipitate radium in the thyroid gland, thereby immobilizing it, with the result that the radionuclide stays resident for many years. Evidence of both accumulation and immobilization of Ra-226 in thyroids of grazing animals has been documented since the 1960s by one of us (LVM). Little is known, however, about the concentration and retention of radium in the human thyroid. Reported here, for the first time, are Ra-226 measurement data from about 100 human thyroids collected from over 95 persons with no known occupational exposure to radium with lifetime residences in the US and other countries, one person who routinely ingested a homeopathic preparation containing Ra-226, and three uranium miners. Sensitive measurements were made using the radon emanation technique. Regardless of the origin of the thyroid sample, Ra-226 activity was almost always detected above the detection limit of 0.65 mBq when at least 10 g of thyroid tissue were available. Our analyses to-date suggests a background concentration in human thyroids of about 0.1 ±0.01 Bq/kg, considerably greater than the commonly reported literature value of 0.003 Bq/kg in soft tissues. In addition, our measurements indicate concentrations of Ra-226 in the three uranium miners (whose exact job description was

  12. Radium-226 on drinking water of Camaguey, Cuba

    The specific activity of Ra-226 in drinking water of Camaguey city, Cuba, was measured using the emanometric method. The specific activity of Ra-226 in drinking water ranged from 15 ± 5 mBq.l-1 to 39 ±12 mBq.l-1. The mean specific activity of Ra-226 was found to be 27 ± 8 mBq.l-1. No seasonal variation was found. Water samples were collected from the two main sources of drinking water: private wells and governmental water supply system, being the mean specific activities of Ra-226: 25 ± 7 mBq.l-1 and 31 ± 9 mBq.l-1 , respectively. Based upon measured concentrations the age-dependent associated effective doses due to the ingestion of Ra-226, as a consequence of direct consumption of drinking water, have been calculated. For the age interval 1 year to 5 years, the average effective dose was 6,2 μSv.y-1, and for adults the average effective dose was 5,2 μSv.y-1. (author)

  13. Leaching of RA-226 contaminated gravel using different aqueous treatments

    Investigation of the efficiencies of different aqueous leaching treatments was carried out on gravel artificially contaminated with Ra-226. The extent of leaching efficiency was determined in terms of Ra-226 and its daughter Rn-222. Liquid scintillation counting using high efficiency mineral oil based liquid scintillator was the technique adopted for measuring Ra-226 and Rn-222 leached off the contaminated gravel. Water, dilute solutions of barium chloride and HCl were used as leachants. Different masses of gravel were leached with 200 mL of leachant for various contact time periods. The leached Rn-222 activity measured was plotted vs the decay factor e; from which Rn-222 and Ra-226 originally present in the sample were determined. Several leaching parameters were tested; namely type of leachant, leachant volume/gravel mass ratio, leachant contact time, effect of varying Ba Cl2 concentration, and successive leaching. Optimization of the leaching parameters for desorption of Ra-226 off the contaminated gravel under laboratory conditions may help determine the ideal conditions for remediating soil contaminated with radium or chemically similar radionuclides. 7 figs

  14. 226Ra i 228Ra in Croatian Rivers

    Results of 226Ra and 228Ra in Croatian river waters are presented in this paper. The presence of natural radionuclides in the Croatian rivers emphasizes the need for continuous monitoring. 226Ra and 228Ra were chosen as a possible source of human exposure to radioactivity due to their high radio-toxicity. River water samples (50 L) were collected from the Danube, Drava, Sava, Krka and Neretva rivers twice a year from 2002 to 2006. Activity concentrations of 226Ra ranged from 6.54 mBq L-1 to 59.44 mBq L-1 and 228Ra activity concentrations ranged from 2.57 mBq L-1 to 20.76 mBq L-1. The highest values of both 226Ra and 228Ra were measured in the Drava river, and the lowest values in the Sava river. Statistically significant differences were not observed between radium concentrations from two watersheds (the Black Sea and the Adriatic Sea watershed), nor between 226Ra/228Ra ratio in rivers individually. The number of collected samples is insufficient to make statistically significant conclusions. Further investigation is necessary to obtain larger number of samples. However, the data obtained in this study could be the baseline for evaluating possible future changes.(author)

  15. Past and present of risk assessment for RA-226 releases

    Some of the new concepts introduced by ICRP 26 seem to be difficult to apply to the case of dose limits concerning the 226Ra releases from the front end of the nuclear fuel cycle. Accordingly most national legislations have not been permeated yet by the 226Ra dose limits based on such concepts. This work calls the attention on the one hand that a loose concept of acceptable risk is implicitly used in a dose limitation system for 226Ra when such system is based on calculating the dose as a fraction of the (MPC) sub(w) introduced earlier by the ICRP 2, and on the other hand that the ALI currently recommended by the ICRP 30 should be used only in the framework of the recommendations published in the ICRP 26, which adopts a better defined concept of risk. (Author)

  16. The daily intake of 226 Radio by phosphatic region residents

    The uranium-phosphate region of northeastern Brazil comprehends a 4 km wide land strip that spans over 150 km of the coastal region of the states of Pernambuco and Paraiba. People that live in these region are subject to higher than normal levels of background radiation, due to the presence of natural uranium and their progeny in the environment. In this study, the concentrations of 226 Ra in locally grown produce, as well as in the water were determined. The mean concentration of 226 Ra in the food items included in this study was of 357.7 mBq/kg (wet weight). The mean 226 Ra concentration in the water was of 282.2 mBq/L. The annul rate, due to the combined consumption of food and water by the local population was estimated to be of 275.35 Bq

  17. Radium-226 in waters of the Amazon river

    Analysis of the Amazon river waters for 226Ra content is carried out. Exploration works are carried out in the framework of the soviet investigations of the Amazon river in 1983 by the Academy of Science of USSR on board a research ship ''Professor Schtokman'' with the agreement and participation of brazilian scientists. Radium determination has been carried out in reference with equilibrium radon preliminary accumulated in samples (30 y) tightly closed. The general 226Ra concentrations observed in the Amazon waters exceed 4-6 times the values known before relating to a ''diluted'' element fraction. It happens due to the presence of the river suspended matter in the water analysed; it is a carrier of additional quantities of 226Ra, and considerable. The mixture zone of river and ocean waters is shown to be no ''geochemical barrier'' on the way to the ocean for river radium inlike the other microelements of the river run-off

  18. Determination of Ra-226 by gamma-ray spectrometry

    This work deals with the method of determination of 226Ra by low energy photon spectrometry. For this purpose, the interference due to 235U, that emits a photon with a close energy, has to be considered. The contribution of 235U to the 186 KeV photopeak is studied through the 63 KeV 234Th and the 144 KeV 235U emissions. From the minimum detectable activity of 226Ra it is discussed the applicability of this method to several kind of samples. (Author)

  19. 12 CFR 226.33 - Requirements for reverse mortgages.

    2010-01-01

    ... this section or has signed an application for a reverse mortgage loan. (2) Total annual loan cost rates... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Requirements for reverse mortgages. 226.33....33 Requirements for reverse mortgages. (a) Definition. For purposes of this subpart, reverse...

  20. 40 CFR 98.226 - Data reporting requirements.

    2010-07-01

    ... (CONTINUED) MANDATORY GREENHOUSE GAS REPORTING Nitric Acid Production § 98.226 Data reporting requirements... specified in paragraphs (a) through (o) of this section for each nitric acid production train. (a) Train... nitric acid production from each nitric acid train (tons, 100 percent acid basis). (d) Annual......

  1. Radium-226 determination in different substances without preliminary chemical isolation

    A method of radium-226 determination, based on the measurement of radon-222 quantity, extracted from the substance analyzed, is developed. Determination limit of radium, equal to 6.6x10-15 mass.%, is achieved at the expense of application of low-background proportional counter and special vacuum installation to fill the detector with working gas mixture

  2. Production of U-230/Th-226 for targeted alpha therapy

    Morgenstern, A.; Abbas, K.; Bruchertseifer, F.; Lebeda, Ondřej; Simonelli, F.; Štursa, Jan; Apostolidis, C.

    2007-01-01

    Roč. 34, Suppl. 2 (2007), S260-S260. ISSN 1619-7070. [20th Annual Congress of the European-Association-of- Nuclear - Medicine . 13.10.2007–17.10.2007, Copenhagen] Institutional research plan: CEZ:AV0Z10480505 Keywords : U-230/Th-226 * alpha therapy Subject RIV: BG - Nuclear , Atomic and Molecular Physics, Colliders

  3. 226Ra and calcium in the human eye

    The left eye from each of two CHR cases, 01 to 144 (body burden 690 nCi) and 01-017 (body burden 1210 nCi) was analyzed for 226Ra and calcium. The total amounts in the eye were 1.80 pCi of 226Ra and 2.3 mg of Ca in case 01 to 144, and 5.4 pCi of 226Ra and 14.2 mg of calcium in case 01 to 017. For the latter case the eye was dissected and showed the highest concentrations of activity (on a wet basis) in the choroid, 3.8 pCi/g, sclera 3.4 pCi/g and iris 2.9 pCi/g. The radium content of the eye was 2.7 x 10-4 percent to 4.7 x 10-4 percent of the total body content at 50 to 55 yr after first exposure. The 226Ra/Ca ratios in the whole eye were 1/3 to 1/4 those in the whole body, but that for the choroid from the dissected eye was identical to that of the whole body

  4. 18 CFR 3b.226 - Accounting of disclosures.

    2010-04-01

    ... IDENTIFIABLE PERSONAL INFORMATION Rules for Disclosure of Records § 3b.226 Accounting of disclosures. (a) The... this section for at least five years from the date of disclosure for which the accounting is made, or... be maintained for disclosure of the accounting of disclosures....

  5. 12 CFR 226.12 - Special credit card provisions.

    2010-01-01

    ... both credit and electronic fund transfer aspects, refer to Regulation E, 12 CFR 205.12(a) regarding... Regulation E. For guidance on whether Regulation Z (12 CFR part 226) or Regulation E (12 CFR part 205... CFR 205.12(a) regarding issuance and liability for unauthorized use. On matters other than...

  6. 12 CFR 226.13 - Billing error resolution. 27

    2010-01-01

    ..., 12 CFR 205.11 governing error resolution rather than those of paragraphs (a), (b), (c), (e), (f), and... account, the creditor shall comply with the requirements of Regulation E, 12 CFR 205.11 governing error... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Billing error resolution. 27 226.13 Section...

  7. Radium-226 removal by precipitation and sedimentation in settling ponds

    A recent pilot plant program carried out at Rio Algom's Quirke uranium mine at Elliot Lake, Ontario, is described. The goal was the production of tailings basin effluents which were low in total radium 226. The process tested involved precipitation of radium with barium chloride and sedimentation in plastic-lined settling ponds. Adjustment of the tailings basin overflow from its normal value of pH 9.5 by addition of sulphuric acid to about pH 7.5 was found to give approximately a five-fold improvement in total radium 226 removal. A five-month demonstration test resulted in an effluent with a mean total radium 226 activity of 44 pCi/l after 2.5 days settling time and 29 pCi/l after five days. The results are used to propose a schedule of achievable total radium 226 activities where precipitation and sedimentation are employed. The maximum suggested values after five days nominal settling time are: 30 pCi/l in an annual mean, 60 pCi/l in a monthly mean, 60 pCi/l in a weekly mean, and 80 pCi/l in any single grab sample. (auth)

  8. 25 CFR 226.14 - Contracts and division orders.

    2010-04-01

    ... Indians BUREAU OF INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR ENERGY AND MINERALS LEASING OF OSAGE RESERVATION LANDS FOR OIL AND GAS MINING Leasing Procedure, Rental and Royalty § 226.14 Contracts and division.... Lessee shall be responsible for the correct measurement and reporting of all oil and/or gas taken...

  9. 40 CFR 180.226 - Diquat; tolerances for residues.

    2010-07-01

    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Diquat; tolerances for residues. 180... PROGRAMS TOLERANCES AND EXEMPTIONS FOR PESTICIDE CHEMICAL RESIDUES IN FOOD Specific Tolerances § 180.226 Diquat; tolerances for residues. (a) General. (1) Tolerances are established for residues of the...

  10. Estuarine geochemistry of 224Ra, 226Ra, and 222Rn

    Desorption from river borne sediments is the most likely source of the excess 226Ra. Laboratory mixing experiments on Pee Dee River sediments show an increase in 226Ra desorption with increasing salinities with maximum desorption occurring at or above 200/oo salinity. Desorption and diffusion are the sources for 226Ra in the estuarine systems. In Winyah Bay the 228Ra/226Ra activity ratio does not change significantly with salinity, averaging around 1.4, indicating desorption as the major source of 228Ra. In the Yangtze River the 228Ra/226Ra activity ratio is constant (approx.1.90) until increasing linearly above 160/oo. A diffusive flux from regeneration by 232Th decay in shelf sediments is the source of the increase. In Delaware Bay 228Ra increases faster than 226Ra in the less than or equal to220/oo water, indicating a source in addition to desorption. The increase can be balanced by a 0.33 dpm/cm2-year flux over the upper part of the Bay where fine grained sediments predominate. 224Ra behavior is controlled by its 3.64 day half-life. In Winyah Bay a flux of around 0.4 dpm/cm2-day is necessary to support the standing crop of non-desorbed 224Ra in the water column. In Delaware Bay the nearly constant 224Ra in concentration over the 2.50/oo to 120/oo salinity range are maintained by regeneration from 228Th in the turbidity maximum zones and diffusion from bottom sediments. Water leaving on ebb tide from a salt marsh on Delaware Bay had increases in all three radium isotopes (224Ra > 228Ra > 226Ra) compared to water coming in on the flood tide. Excess 222Rn concentrations in a fresh water section of the Pee Dee River show a decreasing downstream gradient. Using these gradients to determine evasion rates, stagnant film thicknesses range from 21μ to 62μ

  11. Removal of radium-226 from uranium mining effluents

    Uranium mining and milling operations usually generate large quantities of solid and liquid waste materials. A slurry, consisting of waste rock and chemical solutions from the milling operation, is discharged to impoundment areas (tailings basins). Most of the radioactive material dissolved in tailings slurries is precipitated by the addition of lime and limestone prior to discharge from the mill. However, the activity of one radioisotope, radium-226, remains relatively high in the tailings basin effluents. In Canada, radium-226 is removed from uranium mining and milling effluents by the addition of barium chloride to precipitate barium-radium sulphate [(Ba,Ra)SO4]. Although dissolved radium-226 activities are generally reduced effectively, the process is considered to have two undesirable characteristics: the first related to suspended radium-226 in the effluents and the second to ultimate disposal of the (Ba,Ra)SO4 sludge. A government-industry mining task force established a radioactivity sub-group in 1974 to assist in the development of effluent guidelines and regulations for the uranium mining industry (Radioactivity Sub-group, 1974). The investigation of more effective removal methods was recommended, including the development of mechanical treatment systems as alternatives to settling ponds. Environment Canada's Wastewater Technology Centre (WTC) initiated a bench scale study in March, 1976 which was designed to assess the feasibility of using precipitation, coagulation, flocculation and sedimentation for the removal of radium-226. In 1977, the study was accelerated with financial assistance from the Atomic Energy Control Board. The results were favourable, with improved radium removals obtained in bench scale batch tests using barium chloride as the precipitant and either alum or ferric chloride as the coagulant. A more comprehensive bench scale and pilot scale process development and demonstration program was formulated. The results of the joint study are

  12. Marine radioactivity concentration in the Exclusive Economic Zone of Peninsular Malaysia. 226Ra, 228Ra and 228Ra/226Ra

    The present occurrence of 226Ra and 228Ra in marine sediment core and fish from the Exclusive Economic Zone in the east coast of Peninsular Malaysia were studied. Sediment core and biota in respectively was collected using multicorer device and purchased from local fishermen at identified stations during the cruise expedition conducted in 2008. The purpose of this study was to determine and to make available an inventory of activity concentration levels and activity ratio for these radionuclides in this region. The activity concentrations of 226Ra and 228Ra in sediment core and edible part of fish were ranged between 15.9-46.5 and 27.7-87.1 Bq/kg dry wt and; 0.80-2.13 and 228Ra/226Ra in sediment core and fish were varied with the range between 1.63-2.09 and 0.45-2.38, respectively. Refer to those ranges the activity concentrations of radium isotopes were comparable with other region. Thus, it can be concluded that the occurrence of radium isotopes mainly supplied from terrestrial sources and the factors of assimilation efficiency and transfer coefficient of radium may probably effect to the variation activity concentration of 226Ra and 228Ra and its activity ratio in edible part of pelagic and demersal fish obtained in this study. (author)

  13. 17 CFR 256.226 - Unamortized discount on long-term debt-debit.

    2010-04-01

    ... COMPANIES, PUBLIC UTILITY HOLDING COMPANY ACT OF 1935 6. Long-Term Debt § 256.226 Unamortized discount on... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Unamortized discount on long-term debt-debit. 256.226 Section 256.226 Commodity and Securities Exchanges SECURITIES AND...

  14. 50 CFR 226.215 - Critical habitat for the North Pacific Right Whale (Eubalaena japonica).

    2010-10-01

    ... Right Whale (Eubalaena japonica). 226.215 Section 226.215 Wildlife and Fisheries NATIONAL MARINE... DESIGNATED CRITICAL HABITAT § 226.215 Critical habitat for the North Pacific Right Whale (Eubalaena japonica). (a) Primary Constituent Elements. The primary constituent elements of the North Pacific right...

  15. 50 CFR 226.206 - Critical habitat for the Southern Resident killer whale (Orcinus orca).

    2010-10-01

    ... killer whale (Orcinus orca). 226.206 Section 226.206 Wildlife and Fisheries NATIONAL MARINE FISHERIES... CRITICAL HABITAT § 226.206 Critical habitat for the Southern Resident killer whale (Orcinus orca). Critical habitat is designated for the Southern Resident killer whale as described in this section. The...

  16. 77 FR 16890 - Second Meeting: RTCA Special Committee 226, Audio Systems and Equipment

    2012-03-22

    ... Federal Aviation Administration Second Meeting: RTCA Special Committee 226, Audio Systems and Equipment... meeting RTCA Special Committee 226, Audio Systems and Equipment. SUMMARY: The FAA is issuing this notice to advise the public of the second meeting of RTCA Special Committee 226, Audio Systems and...

  17. 76 FR 79755 - First Meeting: RTCA Special Committee 226 Audio Systems and Equipment

    2011-12-22

    ... Federal Aviation Administration First Meeting: RTCA Special Committee 226 Audio Systems and Equipment... RTCA Special Committee 226, Audio Systems and Equipment. SUMMARY: The FAA is issuing this notice to advise the public of a meeting of RTCA Special Committee 226, Audio Systems and Equipment, for the...

  18. 12 CFR 226.32 - Requirements for certain closed-end home mortgages.

    2010-01-01

    ... signed a loan application. If you obtain this loan, the lender will have a mortgage on your home. You... reverse mortgage transaction subject to § 226.33. (iii) An open-end credit plan subject to subpart B of... mortgages. 226.32 Section 226.32 Banks and Banking FEDERAL RESERVE SYSTEM (CONTINUED) BOARD OF GOVERNORS...

  19. 12 CFR 226.1 - Authority, purpose, coverage, organization, enforcement and liability.

    2010-01-01

    ... closed-end credit transactions and total annual loan cost rates for reverse mortgage transactions. (e..., including the total annual loan cost rate, for reverse mortgage transactions. Section 226.34 prohibits... connection with higher-priced mortgage loans, as defined in § 226.35(a). Section 226.36 prohibits...

  20. 10 CFR 431.226 - Energy conservation standards and their effective dates.

    2010-01-01

    ... 10 Energy 3 2010-01-01 2010-01-01 false Energy conservation standards and their effective dates. 431.226 Section 431.226 Energy DEPARTMENT OF ENERGY ENERGY CONSERVATION ENERGY EFFICIENCY PROGRAM FOR... Conservation Standards § 431.226 Energy conservation standards and their effective dates. Any traffic...

  1. Increased levels of soluble CD226 in sera accompanied by decreased membrane CD226 expression on peripheral blood mononuclear cells from cancer patients

    Xu Zhuwei

    2009-06-01

    Full Text Available Abstract Background As a cellular membrane triggering receptor, CD226 is involved in the NK cell- or CTL-mediated lysis of tumor cells of different origin, including freshly isolated tumor cells and tumor cell lines. Here, we evaluated soluble CD226 (sCD226 levels in sera, and membrane CD226 (mCD226 expression on peripheral blood mononuclear cells (PBMC from cancer patients as well as normal subjects, and demonstrated the possible function and origin of the altered sCD226, which may provide useful information for understanding the mechanisms of tumor escape and for immunodiagnosis and immunotherapy. Results Soluble CD226 levels in serum samples from cancer patients were significantly higher than those in healthy individuals (P P Conclusion These findings suggest that sCD226 might be shed from cell membranes by certain proteases, and, further, sCD226 may be used as a predictor for monitoring cancer, and more important, a possible immunotherapy target, which may be useful in clinical application.

  2. Determination of Radium 226 in mexican phosphate fertilizers and gypsum by gamma spectrometry

    The 226 Ra isotope was determined in 17, 20 and 46% m/m phosphate fertilizers and gypsum. The samples of the fertilizers were dissolved in 10% v/v nitric acid solutions. The barium sulphate method was used for the precipitation of 226 Ra. On the other hand, alkaline fusion method was used to separate the 226 Ra from gypsum. The results indicated that 226 Ra was present in the phosphate fertilizers and gypsum. The 226 Ra concentrations present in these materials were between 10 -4 - 10 -5 μg g-1. (Author)

  3. Use of carriers for to electrodeposited radium 226

    The form of the energy distribution of a monoenergetic alpha particle starting from some emitting source of these particles, it depends on the quantity of material that its cross before being detected. Some authors deposit to the radium-226 by means of direct evaporation of the solution on metallic supports, on millipore paper and by electrodeposition. Some other ones place the radium solution in scintillation liquid, to quantify it by this technique. The objective of the present work is using carriers with the same oxidation state of the radium, that is to say of 2+, for treating to be electrodeposited to the radium-226 with the biggest possible percentage for later use the alpha spectroscopy technique to quantify it. The carriers that have been used until its they are barium and zinc in form of barium chloride, zinc nitrate and zinc sulfate. The first results indicate that with the zinc solution a yield of 40% of electrodeposited radium has been reached. (Author)

  4. Recalibration of the 226Ra emanation analysis system

    The 226Ra emanation system was found to require recalibration. The gain of the various counting systems was established to about +-0.5%. The variance introduced into the analysis by multiple counting systems was low and corresponded to a fractional standard deviation of +-0.5%. The variance introduced into the analysis by both multiple counting systems and multiple counting chambers needs to be redetermined but is less than a fractional standard deviation of +-2%. The newly established calibration factor of 5.66 cpm/pg 226Ra is about 6% greater than that used previously. The leakage of radon into the greased fittings of the emanation flask which was indicated in an earlier study was not confirmed

  5. Salinity dependence of 226Ra adsorption on montmorillonite and kaolinite

    The effect of NaCl concentration (10.0-1,000 mM) on 226Ra adsorption was investigated in the presence of montmorillonite and kaolinite. A positive correlation was observed between the dissolved 226Ra and NaCl concentrations in the presence of these adsorbents. Distribution coefficients decreased from the order of 104 to 100 (mL g-1) with an increase in NaCl concentration. Although the coefficients were higher for montmorillonite than kaolinite at lower NaCl concentrations, the trend was reversed at higher NaCl concentrations (≥500 mM) owing to the sharper reduction of the coefficient for montmorillonite with the increase in NaCl concentration. The rapid reduction was ascribed to higher negative charge density of montmorillonite, which leads the Ra2+ adsorption mechanism to approach charge-compensating ion exchange. (author)

  6. Study of uranium and 226Ra uptake by higher plants

    Soudek, Petr; Valenová, Šárka; Benešová, D.; Vaněk, Tomáš

    Santiago de Compostela : Universidade de Santiago de Compostela, 2006, s. 33. [Scientific Meeting of WG1 /1./ Root to shoot translocation of pollutants and nutrients. COST Action /859./. Santiago de Compostela (ES), 22.06.2006-24.06.2006] R&D Projects: GA MŠk(CZ) 1P05OC042 Institutional research plan: CEZ:AV0Z40550506 Keywords : 226radium * phytoremediation * uranium Subject RIV: DK - Soil Contamination ; De-contamination incl. Pesticides

  7. Radium 226 in waters of the Magela creek, Northern Australia

    The Magela Creek is located in the tropical monsoonal belt of Australia, which is characterised by contrasting wet (December to March) and dry (April to November) seasons. Magela Creek drains a catchment of which about half of the total area lies upstream of the open-cut Ranger uranium mine. The main risk identified for ecosystems surrounding this mine site is from dispersion of mine waste waters during the wet season. Monitoring of biological indicator organisms, water quality (physical and chemical) and radionuclide concentrations in surface water, groundwater and biota is conducted upstream and downstream of the Ranger mine to measure possible environmental impacts of mining. Of special interest is the radionuclide radium-226, as it is predicted to dominate the effective dose to members of the critical group (i.e. the Aboriginal population living downstream of the mining site) resulting from any release of waters from the mine site, in particular through intake of food items such as freshwater mussels and fish. Receiving water standards for radium-226 have been set for the mine on the basis of radiological dose assessments in accordance with the recommendations of the International Commission on Radiological Protection (ICRP 1996). It is proposed in this paper to compare trigger values based on ICRP recommendations with trigger values developed in line with the philosophy of the new Australian Water Quality Guidelines (ANZECC and ARMCANZ 2000). Total Ra-226 activity concentrations were determined in Magela creek both upstream and downstream of the Ranger uranium mine, using alpha spectrometry with a detection limit of about 0.5 mBq/L. According to the new Water Quality Guidelines site-specific trigger values for total Ra-226 activity concentrations were statistically derived from a reference dataset. They are intended to provide an early warning system for the management of a pollutant source for the purpose of environmental protection of downstream ecosystems

  8. Radium - 226 levels in some sudanese plants and soils

    The natural levels of 226 Ra in plant and soil samples have been studied. The field study was mainly conducted in western Sudan (Darfur and Kurdofan) where areas of high natural background radiation have been identified and Khartoum area was taken as a control to (i) assess in natural setting the soil-to-plant concentration ratios (concentration in dry sample / concentration in dry soil) of the naturally occurring radionuclide 226 Ra, (ii) establish base-line data on Radium activity concentration levels in environmental materials and (iii) explore the area of high natural radiation background in western Sudan.Low level gamma spectrometry, employing high purity germanium detector (HPGe) of relative efficiency 12%, has been used for the determination of 226 Ra activity concentrations in plant and soil samples. The mean Radium activity concentration found in soil ranged from 14.41 Bq/Kg to 79.08 Bq/Kg, the values correspond to the reported normal background levels of 226 Ra in soils worldwide. Radium activity concentrations found in Sudanese plants were significantly higher compared to those related to plants from normal background regions and significantly lower than those reported for plants from high background regions in other countries. The mean soil/plant concentration ratios (CRs) found in this study were 0.12, 0.15, 0.17 and 0.08 for whole plants, fruits and leafy vegetables, root vegetables and grains, respectively. These ranges of CR values are comparable with overall range of CR where environmental conditions are normal. The estimated daily intakes by individuals consuming foods of local origin were 1.00, 10.4 and 7.91 Bq/Day of radium Khour Abu Habil, Arkuri and Dumpir, respectively. Since the dietary habits were different, as it was noticed, these results have been much lower in comparison with those obtained from some European countries and United States. (author), 44 refs., 18 tabs., 13 figs

  9. Radium 226 in waters of the Magela creek, Northern Australia

    Sauerland, C.; Medley, P.; Martin, P. [Environmental Research Institute of the Supervising Scientist, Darwin NT (Australia)

    2004-07-01

    The Magela Creek is located in the tropical monsoonal belt of Australia, which is characterised by contrasting wet (December to March) and dry (April to November) seasons. Magela Creek drains a catchment of which about half of the total area lies upstream of the open-cut Ranger uranium mine. The main risk identified for ecosystems surrounding this mine site is from dispersion of mine waste waters during the wet season. Monitoring of biological indicator organisms, water quality (physical and chemical) and radionuclide concentrations in surface water, groundwater and biota is conducted upstream and downstream of the Ranger mine to measure possible environmental impacts of mining. Of special interest is the radionuclide radium-226, as it is predicted to dominate the effective dose to members of the critical group (i.e. the Aboriginal population living downstream of the mining site) resulting from any release of waters from the mine site, in particular through intake of food items such as freshwater mussels and fish. Receiving water standards for radium-226 have been set for the mine on the basis of radiological dose assessments in accordance with the recommendations of the International Commission on Radiological Protection (ICRP 1996). It is proposed in this paper to compare trigger values based on ICRP recommendations with trigger values developed in line with the philosophy of the new Australian Water Quality Guidelines (ANZECC and ARMCANZ 2000). Total Ra-226 activity concentrations were determined in Magela creek both upstream and downstream of the Ranger uranium mine, using alpha spectrometry with a detection limit of about 0.5 mBq/L. According to the new Water Quality Guidelines site-specific trigger values for total Ra-226 activity concentrations were statistically derived from a reference dataset. They are intended to provide an early warning system for the management of a pollutant source for the purpose of environmental protection of downstream ecosystems

  10. Accumulation of 226-Ra by different plant species

    Soudek, Petr; Petrová, Šárka; Benešová, Dagmar; Vaněk, Tomáš

    Tsinghua: Tsinghua University Press, 2007 - (Zhu, Y.; Lepp, N.; Naidu, R.), s. 435-436 ISBN 978-7-302-15627-7. [International Conference for the Biogeochemistry of Trace Elements (ICOBTE). Beijing (CN), 15.07.2007-19.07.2007] R&D Projects: GA MŠk 1P05ME730 Institutional research plan: CEZ:AV0Z50380511 Keywords : 226 Ra * uptake * phytoremediation Subject RIV: CE - Biochemistry

  11. Distribution of 226Ra in the Arctic Ocean and the Bering Sea and its hydrologic implications

    邢娜; 陈敏; 黄奕普; 蔡平河; 邱雨生

    2003-01-01

    Radium-226 (226Ra) activities were measured in the surface water samples collected from the Arctic Ocean and the Bering Sea during the First Chinese National Arctic Research Expedition. The results showed that 226Ra concentrations in the surface water ranged from 0.28 to 1.56 Bq/m3 with an average of 0.76 Bq/m3 in the Arctic Ocean, and from 0.25 to 1.26 Bq/m3 with an average of 0.71 Bq/m3 in the Bering Sea. The values were obviously lower than those from open oceans in middle and low latitudes, indicating that the study area may be partly influenced by sea ice meltwater. In the Bering Sea, 226Ra in the surface water decreased northward, probably as a result of the exchange between the 226Ra-deficientsea ice meltwater and the 226Ra-rich Pacific water. In the Arctic Ocean, 226Ra in the surface water increased northward and eastward. This spatial distributionof 226Ra reflected the variation of the 226Ra-enriched river component in the water mass of the Arctic Ocean. The vertical profiles of 226Ra in the Canadian Basin showed a concentration maximum at 200 m, which could be attributed to the inputs of the Pacific water or/and the bottom shelf water with high 226Ra concentration. This conclusion was consistent with the results from 2H, 18O tracers.

  12. Radium 226 and uranium isotopes simultaneously determination in water samples using liquid scintillation counter

    In this work a method has been developed to determine simultaneously Radium 226 and Uranium isotopes in water samples by low back ground Liquid Scintillation Counter. Radium 226 was determined by its progeny Polonium 214 after one month of sample storage in order to achieve the equilibrium between Radium 226 and Polonium 214. Uranium isotopes were determined by subtracting Radium 226 activity from total alpha activity. The method detection limits were 0.049 Bq/L and 0.176 Bq/L for Radium 226 and Uranium isotopes respectively. The repeatability limits were ± 0.32 Bq/L and ± 0.9 Bq/L for Radium 226 and Uranium isotopes respectively. While relative errors were % 9.5 and %18.2 for Radium 226 and Uranium isotopes respectively. On the other hand, the report presented the results of different standard and natural samples.(author)

  13. Possibility of rapidly reporting 226Ra activity in 226Ra-222Rn samples with unknown equilibrium factor by γ spectrometer

    SU Qiong; ZHENG Rui; CHEN Yong; CHENG Jian-Ping

    2004-01-01

    This paper reports the observed changes for equilibrium factors between 226Ra and 222Rn with sealing time of the samples. The samples include soil, raw coal, mineral water, cement, rock, etc. Especially the conceptions of "pre-equilibrium time" and "pre-equilibrium factor" have been put forward and methods of measuring and processing data have been given which can be used for rapidly reporting activity of 226Ra in samples with unknown equilibrium factor. It is definitely concluded that, using methods given in the paper, a test report will be completed in 3~7days, instead of one month, after receiving the sample whose activity is not lower than LLD of the spectrometer.

  14. Water to swamp morning glory transfer of radium-226

    A study of the uptake of 226Ra by swamp morning glory was carried out in Bangkhen canal where is the pathway releases from the Office of Atoms for Peace (OAP). This aquatic plant is an important diet of the Thai population and is grown widespread in various canals. Its consumption represents a significant pathway for the intake of radionuclides including radium and for the delivery of the internal dose to man from those radionuclides. Water and vegetable samples were collected four times a year from 1998 to 2002 inclusive from four stations along Bangkhen canal. Samples were determined by radiochemical separation. Data obtained by 5 year-analysis were compiled to explain the mechanism of radium-226 transfer from water to swamp morning glory (Ipomoea Aquatica Forsk). The concentration factors (CFs), relative to fresh weight of vegetable, for 226Ra uptake from water into swamp morning glory ranged from 23 to 120, mean average 44. In general, these data are comparable to the lower values found in the literatures. This may be due partly to the fact that the study area was an uncontaminated zone with little or no contamination by the OAP and swamp morning glory appeared to concentrate radium from the water to a lower deg.ree than other aquatic plant. Radium-226 uptake depends on its concentration in water as its concentration in the vegetables being a linear function of its concentration in water, r20.715. The CFs or the rate constants of uptake and loss rate coefficient were found to be of first order kinetics and approximately equal to slope of the equation. Mechanism of radium-226 transfer from water to swamp morning glory grown in the study zones can be expressed as an equation Cp = a Cwb where the parameter a and b are dependent on the aquatic plant species, in case of swamp morning glory a = 64.326 and b = 0.46. The equation shown good agreement with values obtained from difference stations in the same canal. The equation could be applied in a number of ways as it

  15. Efficient, Tightly-Confined Trapping of 226Ra

    Parker, R H; Bailey, K; Greene, J P; Holt, R J; Kalita, M R; Korsch, W; Lu, Z -T; Mueller, P; O'Connor, T P; Singh, J; Sulai, I A; Trimble, W L

    2013-01-01

    We demonstrate a technique for transferring $^{226}$Ra atoms from a 3-dimensional magneto-optical-trap (MOT) into a standing wave optical dipole trap (ODT) in an adjacent chamber. The resulting small trapping volume (120 $\\mu$m in diameter) allows for high control of the electric and magnetic fields applied to the atoms. The atoms are first transferred to a traveling-wave optical dipole trap, which is then translated 46 cm to a science chamber. The atoms are subsequently transferred into an orthogonal standing-wave ODT by application of a 1-dimensional MOT along the traveling-wave axis. For each stage, transfer efficiencies exceeding 60% are demonstrated.

  16. Decay of 226Ra by 14C emission

    Since the pioneering experiment by Rose and Jones in 1984 demonstrating 14C decay of 223Ra, spontaneous emission of clusters heavier than α particles but lighter than fission products could be found in several cases to be a rare decay mode of heavy nuclei. This new kind of radioactivity has branching ratios relative to α decay well below 10-9. For energetical reasons the emitted fragments are even-even and the daughter nucleus lies close to the doubly magic 208Pb. Polycarbonate track-recording foils which are sensitive to energetic carbon nuclei but not to α particles are very well suited detectors for the study of 14C emission radioactivity. The tracks are made visible under a microscope by etching techniques. Observation of spontaneous emission of 14C from 226Ra claimed by Hourani et al. and Barwick et al. has been confirmed. Since thick sources of 226Ra were used in these experiments the experimental definitions of decay energy and mass were not very accurate. The experiment described in the thesis measured for the first time charge and energy of the emitted fragments by using thin 226Ra sources and polycarbonate track-recording films. The decay mode could thus be identified unambiguously. The track detector was calibrated with tandem-accelerated 14C and 16O ions and tested by observing the now well established 14C emission from 223Ra; for this decay mode a branching ratio of (5,0 ± 1,0).10-10 relative to α decay was found in agreement with values from the literature. In the case of 226Ra the result for 14C/α ratio is (2,3 ± 1,2).10-11. The order of magnitude of the branching ratios can be reproduced by theoretical models. Estimates of partial half-lifes of Ra and other heavy isotopes for rare decay modes are discussed in the theoretical section of the thesis. 100 refs., 3 tabs., 30 figs. (Author)

  17. Concentration of 226Ra in Iranian bottled mineral water

    Naturally radioactivity in particular those emitting alpha particles, make the largest contribution to the world population exposure. The sources of these radionuclides initiated from the uranium and thorium decay series. 226Ra is one the most important radionuclides that comes through ground water to food chain. In recent years the consumption of mineral water in many countries including Iran has increased to a great extent. Therefore the 226Ra concentrations of different types of bottled mineral water were determined and the committed effective dose for adults is calculated. In this work the concentration levels of 226Ra were measured in 42 samples related to 14 types of bottled natural mineral water commercially available in supermarkets. The applied method for this measurement was emanation method with a minimum detection limit of 2 mBq L-1. For each experiment 3 bottles mineral water (each bottle contains 1.5 L) were used. After adjusting the pH below 2 by concentrated HCl, the Radium was coprecipitated with barium and lead as sulfate. The precipitation was dissolved in alkaline EDTA (C10H14N2O8.2H2O) and placed in 20 mL bubbler. The nitrogen gas with a purity of 99.99% was passed through the bubbler to remove any existing of 222Rn before the ingrowth. The bubbler was sealed and stored for 21 days at 5 deg. C for ingrowth of 222Rn. for calculation the committed effective dose for adults from drinking 40 l a-1 of bottled mineral water the ingestion dose conversion coefficients from the IAEA publications is used. Concentration of 226Ra ranged from 2.0 to 12.3 mBq L-1. In one case 12.3 mBq L-1 was measured, which provides 0.138 μSv committed effective dose for adults in the case of consumption rate of 40 L a-1. As it is shown in 61.5% of the investigated bottled water the concentration levels were between 2-10 mBq L-1, in 23% less than 2 mBq L-1 and in 15.5% more than 10 mBq L-1 was found)

  18. Accumulation of Radium-226 from phosphate fertilizers in cultivated soils and transfer to crops

    Actual values of the 226Ra content of soils sampled in various experimental plots with well-known fertilization histories and the 226Ra levels in crops produced are given. The statistical analysis led to the conclusion that there is nof significant difference in the 226Ra content of straw or grain harvested in the plots fertilized, respectively, at low level (343 kg/ha) or at highest level (1356 kg/ha) of P2O5. The 226Ra contamination due to the application of phosphate fertilizer represents only 0.25 and 1.08%, respectively, of the activity o 226Ra observed in the upper layer of soil. The 226Ra ingested annually by man from cereals and milk is estimated

  19. Removal of radium-226 from radium-contaminated soil using humic acid by column leaching method

    In this study, evaluation of radium-226 removal from radium-contaminated soil using humic acid extracted from peat soil by column leaching method was carried out. Humic acid of concentration 100 ppm and pH 7 was leached through a column packed with radium-contaminated soil and leachates collected were analysed with gamma spectrometer to determine the leached radium-226. Results obtained indicated low removal of radium-226 between 1 - 4 %. Meanwhile, leaching profile revealed that radium-226 was bound to soil components with three different strength, thus resulting in three phases of radium-226 removal. It was estimated that the total removal of radium-226 from 10 g radium-contaminated soil sample studied could be achieved using approximately 31500 - 31850 ml HA solutions with leaching rate of 1 ml/ min. (author)

  20. Study of soil-plant transfer of {sup 226}Ra under greenhouse conditions

    Soudek, Petr; Petrova, Sarka [Laboratory of Plant Biotechnologies, Joint Laboratory of Institute of Experimental Botany AS CR, v.v.i. and Crop Research Institute, v.v.i., Drnovska 507, 161 06 Prague 6 (Czech Republic); Benesova, Dagmar; Kotyza, Jan [Laboratory of Plant Biotechnologies, Joint Laboratory of Institute of Experimental Botany AS CR, v.v.i. and Crop Research Institute, v.v.i., Drnovska 507, 161 06 Prague 6 (Czech Republic); Faculty of Environment Technology, Institute of Chemical Technology, Technicka 5, 166 28 Prague 6 (Czech Republic); Vagner, Martin [Laboratory of Biologically Active Compounds, Institute of Experimental Botany AS CR, v.v.i., Rozvojova 263, Prague 6 (Czech Republic); Vankova, Radomira [Laboratory of Hormonal Regulations in Plants, Institute of Experimental Botany AS CR, v.v.i., Rozvojova 263, Prague 6 (Czech Republic); Vanek, Tomas, E-mail: vanek@ueb.cas.c [Laboratory of Plant Biotechnologies, Joint Laboratory of Institute of Experimental Botany AS CR, v.v.i. and Crop Research Institute, v.v.i., Drnovska 507, 161 06 Prague 6 (Czech Republic)

    2010-06-15

    A soil-plant transfer study was performed using soil from a former uranium ore processing factory in South Bohemia. We present the results from greenhouse experiments which include estimates of the time required for phytoremediation. The accumulation of {sup 226}Ra by different plant species from a mixture of garden soil and contaminated substrate was extremely variable, ranging from 0.03 to 2.20 Bq {sup 226}Ra/g DW. We found differences in accumulation of {sup 226}Ra between plants from the same genus and between cultivars of the same plant species. The results of {sup 226}Ra accumulation showed a linear relation between concentration of {sup 226}Ra in plants and concentration of {sup 226}Ra in soil mixtures. On the basis of these results we estimated the time required for phytoremediation, but this appears to be too long for practical purposes.

  1. Study of soil-plant transfer of 226Ra under greenhouse conditions.

    Soudek, Petr; Petrová, Sárka; Benesová, Dagmar; Kotyza, Jan; Vágner, Martin; Vanková, Radomíra; Vanek, Tomás

    2010-06-01

    A soil-plant transfer study was performed using soil from a former uranium ore processing factory in South Bohemia. We present the results from greenhouse experiments which include estimates of the time required for phytoremediation. The accumulation of (226)Ra by different plant species from a mixture of garden soil and contaminated substrate was extremely variable, ranging from 0.03 to 2.20 Bq (226)Ra/g DW. We found differences in accumulation of (226)Ra between plants from the same genus and between cultivars of the same plant species. The results of (226)Ra accumulation showed a linear relation between concentration of (226)Ra in plants and concentration of (226)Ra in soil mixtures. On the basis of these results we estimated the time required for phytoremediation, but this appears to be too long for practical purposes. PMID:18823682

  2. Determination of 226Ra in mineral waters by liquid scintillation spectrometry

    The aim of this work was the determination of volume activity of Ra-226 in mineral waters by liquid scintillation spectrometry on TRICARB 2900TR spectrometer and determination of Ra-226 in packed mineral and table waters and comparison of determination of Ra-226 after co-precipitation Ba(Ra)SO4 by two methods: by measurement with scintillation detector NA 6201 II; by liquid scintillation spectrometry on TRICARB 2900TR with the software QuantaSmart

  3. 25 CFR 226.34 - Wells and tank batteries to be marked.

    2010-04-01

    ... 25 Indians 1 2010-04-01 2010-04-01 false Wells and tank batteries to be marked. 226.34 Section 226.34 Indians BUREAU OF INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR ENERGY AND MINERALS LEASING OF OSAGE RESERVATION LANDS FOR OIL AND GAS MINING Requirements of Lessees § 226.34 Wells and tank batteries to be marked. Lessee shall clearly...

  4. A multicenter study confirms CD226 gene association with systemic sclerosis-related pulmonary fibrosis

    Bossini-Castillo, L.; Simeon, C. P.; Beretta, L; Broen, J.C.A.; Vonk, M.C.; Rios-Fernandez, R.; Espinosa, G.; Carreira, P; Camps, M T; Castillo, M.J.; Gonzalez-Gay, M A; Beltran, E.; Carmen Freire, M.; Narvaez, J; Tolosa, C

    2012-01-01

    Abstract Introduction CD226 genetic variants have been associated with a number of autoimmune diseases and recently with systemic sclerosis (SSc). The aim of this study was to test the influence of CD226 loci in SSc susceptibility, clinical phenotypes and autoantibody status in a large multicenter European population. Methods A total of seven European populations of Caucasian ancestry were included, comprising 2,131 patients with SSc and 3,966 healthy controls. Three CD226 single nucleotide p...

  5. Ionizable (Thia)calix[4]crowns as Highly Selective 226Ra2+ Ionophores

    Leeuwen, van Fijs W.B.; Beijleveld, Hans; Miermans, Cornelis J.H.; Huskens, Jurriaan; Verboom, Willem; Reinhoudt, David N.

    2005-01-01

    The 226Ra2+ selectivity of the ionizable (thia)calix[4]crowns 1-4 was determined in the presence of a large excess of the most common alkali and alkaline earth cations. Selective 226Ra2+ (2.9 × 10-8 M) extraction occurs even at extremely high Mn+/226Ra2+ ratios of 3.5 × 107 [Mn+ = Na+, K+, Rb+, Cs+,

  6. Comparison of Activity Determination of Radium 226 in FUSRAP Soil using Various Energy Lines - 12299

    Tucker, Brian [Shaw Environmental and Infrastructure, Stoughton, MA 02072 (United States); Donakowski, Jough [Unites States Army Corps of Engineers, Kansas City, MO 64106 (United States); Hays, David [United States Army Corps of Engineers, Maywood, NJ 07607 (United States)

    2012-07-01

    Gamma spectroscopy is used at the Formerly Utilized Sites Remedial Action Program (FUSRAP) Maywood Superfund Site as the primary radioanalytical tool for quantization of activities of the radionuclides of concern in site soil. When selecting energy lines in gamma spectroscopy, a number of factors are considered including assumptions concerning secondary equilibrium, interferences, and the strength of the lines. The case of the Maywood radionuclide of concern radium-226 (Ra-226) is considered in this paper. At the FUSRAP Maywood Superfund Site, one of the daughters produced from radioactive decay of Ra-226, lead-214 (Pb- 214), is used to quantitate Ra-226. Another Ra-226 daughter, bismuth-214 (Bi-214), also may be used to quantitate Ra-226. In this paper, a comparison of Ra-226 to Pb-214 activities and Ra-226 to Bi-214 activities, obtained using gamma spectrometry for a large number of soil samples, was performed. The Pb-214, Bi-214, and Ra-226 activities were quantitated using the 352 kilo electron volt (keV), 609 keV, and 186 keV lines, respectively. The comparisons were made after correcting the Ra-226 activities by a factor of 0.571 and both ignoring and accounting for the contribution of a U-235 interfering line to the Ra-226 line. For the Pb-214 and Bi-214 activities, a mean in-growth factor was employed. The gamma spectrometer was calibrated for efficiency and energy using a mixed gamma standard and an energy range of 59 keV to 1830 keV. The authors expect other sites with Ra-226 contamination in soil may benefit from the discussions and points in this paper. Proper use of correction factors and comparison of the data from three different gamma-emitting radionuclides revealed agreement with expectations and provided confidence that using such correction factors generates quality data. The results indicate that if contamination is low level and due to NORM, the Ra-226 can be measured directly if corrected to subtract the contribution from U-235. If there is

  7. 226Ra and 228Ra activities in French foodstuffs

    The activities of 228Ac and 214Bi in French foodstuffs acquired during the last 15 years allow one to obtain reference values of 228Ra and 226Ra activities which are usable to assess the dose to the French population due to the intake of these two natural radionuclides. As expected, because of similar 238U and 232Th activities in French soils (around 40 Bq.kg-1), the 226Ra/228Ra activity ratio in French terrestrial foodstuffs is close to 1. Most kinds of foodstuffs present similar mean activities: from 0.1 to 0.2 Bq.kg-1 fresh for cereals, leafy vegetables, root vegetables, eggs and fishes (marine and freshwater). The activity in fruits is lower, around 0.05 Bq.kg-1, similar to that of meat calculated on the basis of the numerous grass measurement results. The lowest activities are noticeable for milk: around 0.015 Bq.L-1. All these values are in good agreement with the data from various countries, but most often 2 to 3 times higher than the reference values proposed by UNSCEAR. This study also shows that due to the large variability of foodstuff activities reported by a large amount of data, it is not possible to distinguish the activities of samples from regions with a gap of only a factor of 2 between their soil activities. (authors)

  8. Sanitary quality of castor bean seeds (cv. IAC-226

    Andréia Márcia Santos de Souza David

    2014-09-01

    Full Text Available The objective of this work was to evaluate the fungicides efficacy on the castor seeds IAC-226 sanitary quality. The seeds were treated with two doses of the fungicides captan (250 and 300 g ai 100 kg-1 seed, thiophanate-methyl (100 and 150 g ai 100 kg-1 seed and thiabendazole (100 and 150 g kg ai 100 seeds. Seeds without fungicide treatment were the control. The seeds sanitary quality was evaluated by sanity test, using 10 replications of 20 seeds per treatment/lot, superficially sterilized (sodium hypochlorite and placed in plastic boxes (gerbox with filter paper and sterilized distilled water, under controlled temperature 25°C for 20 days. Seeds were examinated individually using a stereoscopic microscope and optical microscope. The results were expressed as percentage of infected seeds. The experimental design was completely randomized in a factorial arrangement (2 x 7, two lots and seven treatments, with ten repetitions. The fungicides captan, tiabendazol and tiofanato-metílico reduced the incidence of fungi, being recommended for the castor seeds IAC-226 treatment. There was a predominance of fungi Alternaria alternata, Aspergillus flavus, Aspergillus niger, Bipolar, Botrytis ricini, Curvularia sp., Penicillium sp. and Rhizopus sp.

  9. Conditioning of disused Ra-226 radioactive sealed sources in Egypt

    The present work describes the technical information on issues associated with the management of disused Ra-226 radioactive sources. The different settings needed to condition these sources in stainless steel capsules, working area setup, packaging preparation, Ra-226 source characterization, capsule welding, leakage test and data information are completely described. The radium sources addressed in the present work are mainly those which have been used in medicine and for industrial applications, in the form of sealed radiation sources. In Egypt hospitals are among the largest users of sealed radium radioactive sources which are mostly used for brachytherapy. The inventory of radium sources in large hospitals could be in the hundreds. There is a real risk that sources may be lost or mishandled, if very restricted procedures are not followed. An additional problem with these sources is that they are often leaking, due to internal overpressure. The small size of the sources, portability and high apparent value (due to the materials of encapsulation) increase the risk of theft. (authors)

  10. Distribution of 226Ra Radionuclide in Upwelling Event Off Ulsan, Gampo and Pohang, Korea

    Muslim

    2009-07-01

    Full Text Available Upwelling is an important event in the sea for it makes the area to become more productive. The objective of this study is to determine the distribution of radium-226 as radiotoxic in the upwelling area in the summer season. Measurements of the horizontal and vertical activities of 226Ra in the Ulsan, Gampo and Pohang waters were conducted in June, August 1999 and June 2000 when the upwelling event was expected to occur. Water temperature, salinity and dissolved oxygen (DO were also measured concurrently. The thermocline layer or the layer where the temperature decreased drastically occurred at a depth between 30 m to 100 m for samples dated June 1999 and 30 m to more than 100 m for samples dated August 1999 and June 2000. The salinity decreased with depth but the DO concentration increased in this layer. The condition affected the vertical distribution of 226Ra in the study area, where the 226Ra activities showed to be relatively homogeneous vertically in each station. This indicates that the upwelling which occurred in the study area was capable to distribute the 226Ra activities from the bottom to the surface. Thus, the 226Ra distribution at that time did not increase with depth, opposite to what usually occurs in the ocean at normal condition. The 226Ra activities also did not decrease after elapsed time of one year, in fact, it increased. However, horizontally the 226Ra activities decreased with increasing distance from the coastal zone. Based on these results, it can be concluded that the upwelling event in the Ulsan, Gampo and Pohang was effective for increasing the 226Ra activities and was capable to create homogeneous 226Ra activities from the bottom to the surface in the water column, and the source of 226Ra was likely to originate from outside area (i.e. coastal zone and bottom area.

  11. Radium-226-induced dental disease in Beagles: a radiographic study

    Evaluation of dental radiographs made at necropsy and during the life of the dogs clearly shows age dependent changes within the control dogs. Periodontal diseases, loss of lamina dura, root ankylosis, and loss of pulp cavity were all commonly noted. Tooth loss and dental caries were rare in the control dogs. In injected Beagles loss of lamina dura was noted earlier and was dose dependent. Tooth loss and dental carried increased with dose level and appeared earlier. Tooth loss was common by 1600-1800 days of age while dental caries were common in almost all dogs by 1600-1800 days of age in the R40 level. Dental caries was the most accurate indication of the level of 226Ra toxicity. 18 reference, 1 table

  12. 21 CFR 226.102 - Master-formula and batch-production records.

    2010-04-01

    ... 21 Food and Drugs 4 2010-04-01 2010-04-01 false Master-formula and batch-production records. 226... Records and Reports § 226.102 Master-formula and batch-production records. (a) For each Type A medicated... batch size, or of appropriate size in the case of continuous systems to be produced from the...

  13. 78 FR 18416 - Sixth Meeting: RTCA Special Committee 226, Audio Systems and Equipment

    2013-03-26

    ... Federal Aviation Administration Sixth Meeting: RTCA Special Committee 226, Audio Systems and Equipment... Notice of RTCA Special Committee 226, Audio Systems and Equipment. SUMMARY: The FAA is issuing this... Equipment. DATES: The meeting will be held April 15-17, 2013 from 9:00 a.m.-5:00 p.m. ADDRESSES: The...

  14. 77 FR 37733 - Third Meeting: RTCA Special Committee 226, Audio Systems and Equipment

    2012-06-22

    ... Federal Aviation Administration Third Meeting: RTCA Special Committee 226, Audio Systems and Equipment... Notice of RTCA Special Committee 226, Audio Systems and Equipment. SUMMARY: The FAA is issuing this... Equipment. DATES: The meeting will be held July 10-12, 2012, from 9 a.m.-5 p.m. ADDRESSES: The meeting...

  15. 78 FR 57673 - Eighth Meeting: RTCA Special Committee 226, Audio Systems and Equipment

    2013-09-19

    ... Federal Aviation Administration Eighth Meeting: RTCA Special Committee 226, Audio Systems and Equipment... Notice of RTCA Special Committee 226, Audio Systems and Equipment. SUMMARY: The FAA is issuing this... Equipment. DATES: The meeting will be held October 8-10, 2012 from 9:00 a.m.-5:00 p.m. ADDRESSES:...

  16. 78 FR 38093 - Seventh Meeting: RTCA Special Committee 226, Audio Systems and Equipment

    2013-06-25

    ... Federal Aviation Administration Seventh Meeting: RTCA Special Committee 226, Audio Systems and Equipment... Notice of RTCA Special Committee 226, Audio Systems and Equipment. SUMMARY: The FAA is issuing this... Equipment ] DATES: The meeting will be held July 15-19, 2013 from 9:00 a.m.-5:00 p.m. ADDRESSES: The...

  17. 77 FR 58209 - Fourth Meeting: RTCA Special Committee 226, Audio Systems and Equipment

    2012-09-19

    ... Federal Aviation Administration Fourth Meeting: RTCA Special Committee 226, Audio Systems and Equipment... notice of RTCA Special Committee 226, Audio Systems and Equipment. SUMMARY: The FAA is issuing this... Equipment. DATES: The meeting will be held October 16-18, 2012 from 9 a.m.-5 p.m. ADDRESSES: The...

  18. Leachable 226Ra in Philippine phosphogypsum and its implication in groundwater contamination in Isabel, Leyte Philippines

    Phosphogypsum (PG), the major waste material in phosphate fertilizer processing, has been known to contain enhanced levels of naturally-occurring radionuclides especially 226Ra. The lack of radioactivity data regarding Philippine phosphogypsum and its environmental behavior in the Philippine setting has brought concern on possible contamination of groundwater beneath the phosphogypsum ponds in Isabel, Leyte, Philippines. The radioactivity of Philippine phosphogypsum was determined and the leaching of 226Ra from phosphogypsum and through local soil was quantified. Level of 226Ra in groundwater samples in Isabel, Leyte, Philippines was also quantified to address the primary concern. It was found that the 226Ra activity in Philippine phosphogypsum is distributed in a wide range from 91.5 to 935 Bq/kg. As much as 5% of 226Ra can be leached from Philippine PG with deionized water. In vitro soil leach experiments suggest that the soil in the phosphate fertilizer plant area would be able to deter the intrusion of 226Ra into the water table. Compared to reported values of natural groundwater levels of 226Ra, the concentration of this radionuclide in Isabel, Leyte groundwater suggest that there is no 226Ra intrusion brought about by the presence of phosphogypsum ponds in the area. (Authors)

  19. 48 CFR 226.370-8 - Goals and incentives for subcontracting with HBCU/MIs.

    2010-10-01

    ... subcontracting with HBCU/MIs. 226.370-8 Section 226.370-8 Federal Acquisition Regulations System DEFENSE... subcontracting with HBCU/MIs. (a) In reviewing subcontracting plans submitted under the clause at FAR 52.219-9... included anticipated awards to HBCU/MIs in the small disadvantaged business goal; and (2) Consider...

  20. 7 CFR Appendix C to Part 226 - Child Nutrition (CN) Labeling Program

    2010-01-01

    ... 7 Agriculture 4 2010-01-01 2010-01-01 false Child Nutrition (CN) Labeling Program C Appendix C to.... C Appendix C to Part 226—Child Nutrition (CN) Labeling Program 1. The Child Nutrition (CN) Labeling... 7 CFR 210.10, 225.21, and 226.20 and are served in the main dish. (b) Juice drinks and juice...

  1. 12 CFR 226.46 - Special disclosure requirements for private education loans.

    2010-01-01

    ... GOVERNORS OF THE FEDERAL RESERVE SYSTEM TRUTH IN LENDING (REGULATION Z) Special Rules for Private Education Loans § 226.46 Special disclosure requirements for private education loans. (a) Coverage. The... inaccuracy is not a violation of Regulation Z (12 CFR part 226), although new disclosures may be...

  2. Occurrence of natural radium-226 radioactivity in ground water of Sarasota County, Florida

    Miller, R.L.; Sutcliffe, Horace

    1985-01-01

    Water that contains radium-226 radioactivity in excess of the 5.0-picocurie-per-liter limit set in the National Interim Primary Drinking Water Regulations was found in the majority of wells sampled throughout Sarasota County. Highest levels were found areally near the coast or near rivers and vertically in the Tamiami-upper Hawthorn aquifer where semiconsolidated phosphate pebbles occur. Analysis of data suggests that part of the radium-226 in ground water of Sarasota County is dissolved by alpha particle recoil. In slightly mineralized water, radium-226 concentrations are decreased by ion exchange or sorption. In more mineralized water, other ions compete with radium-226 for ion exchange or sorption sites. Dissolution of minerals containing radium-226 by mineralized water probably contributes a significant fraction of the dissolved radium-226. Two types of mineralized water were present in Sarasota County. One type is a marine-like water, presumably associated with saltwater encroachment in coastal areas; the other is a calcium magnesium strontium surfate bicarbonate type. In general, water that contains high radium-226 radioactivities also contains too much water hardness or dissolved solids to be used for public supply without treatment that would also reduce radium-226 radioactivities. (USGS)

  3. Quantification of 235 U and 226 Ra in soil samples by means of Gamma spectroscopy

    In this work it is presented the Gamma Spectroscopy method which is realized in the Environmental Radiological Surveillance Laboratory using the option of deconvolution of a commercial software for the quantification of 235 U and 226 Ra; also is presented the method for the 226 Ra correction activity. (Author)

  4. 50 CFR 226.203 - Critical habitat for northern right whales.

    2010-10-01

    ... 50 Wildlife and Fisheries 7 2010-10-01 2010-10-01 false Critical habitat for northern right whales. 226.203 Section 226.203 Wildlife and Fisheries NATIONAL MARINE FISHERIES SERVICE, NATIONAL OCEANIC AND... Critical habitat for northern right whales. (a) Great South Channel. The area bounded by 41°40′ N/69°45′...

  5. Spreading of water masses and regeneration of silica and sup(226)Ra in the Indian Ocean

    DileepKumar, M.; Yuan-Hui, Li

    The magnitudes of silica and sup(226) RA inputs to water (through particle regeneration, in situ, and from sediments) and the validity of observed Si and sup(226) Ra as tracers of water masses and advective processes were examined in the Indian...

  6. 12 CFR 226.5b - Requirements for home equity plans.

    2010-01-01

    ... published by the Board or a suitable substitute shall be provided. (f) Limitations on home equity plans. No... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Requirements for home equity plans. 226.5b... RESERVE SYSTEM TRUTH IN LENDING (REGULATION Z) Open-End Credit § 226.5b Requirements for home equity...

  7. Radium-226 accumulation by the waterlily, Nymphaea violacea

    A study of the accumulation of radium-226 by the aquatic macrophyte Nymphaea violacea Lehm was undertaken at Jabiru. N. violacea may be exposed to elevated environmental radium concentrations due to releases of mine wastes, or to surface expressed groundwater seepage from the tailings dam. Portions of this plant are eaten by the local Aborigines and the results of this study will be used to make an assessment of the radiological dose from radium-226 to these people. Field studies were carried out to identify the patterns of radium distribution between the plant and its environment. In the laboratory, flow-through techniques were developed to investigate radium accumulation from sediment and kinetics of foliar uptake and loss over a range of likely water qualities. The foliar experiments showed that radium accumulation from water by healthy laminae, consisted of uptake into at least two compartments. Uptake kinetics suggested that the larger of these was surface adsorption with equilibrium between water and lamina concentrations being established within 5 days. The major influences on accumulation were the degree of tissue senescence and the concentration of cations in the supporting media. Tissue senescence was related to plant and tissue ages and exponentially increased radium accumulation. Increases in cation concentration reduced radium uptake and supported the hypothesis that radium was accumulated by the mechanisms involved in uptake of calcium and magnesium. These results were supported by the field studies. Radium uptake by N. violacea from sediments was studied in the laboratory using a flow-through apparatus specially designed to minimise contamination of the water column due to radium leaching from the labelled sediment

  8. Normal dietary levels of 226Ra, 228Ra, 210Pb, and 210Po for man

    A review of the literature and the results of some recent measurements were presented on the levels in man's diet of the naturally-occurring radionuclides 226Ra, 228Ra, 210Pb, and 210Po. The mean intakes for standard U.S. diets for these nuclides are tabulated. Intakes in other countries are similar to those in the U.S., but in localized populations the 226Ra intake may be 8 or more pCi/day. The contents of 226Ra in diets chosen by individuals ranged from 0.4 to 7 pCi/day. The few data on 228Ra show intake of this nuclide to be about 80% that of 226Ra, except in monazite areas where intakes of up to 160 pCi/day 228Ra are reported, which may be 50 to 100 times that of 226Ra. Drinking water contributes less than 5% of the daily intake, except in special areas

  9. Ra-226 collective dosimetry for surface waters in the uranium mining region of Pocos de Caldas

    Graphs of the collective dose equivalent for the whole body, bone, gastro-intestinal tract (lower large intestine), kidneys, and liver, via the pathways of drinking water and ingestion of food grown in irrigated fields are presented as a function of the 226Ra concentrations in the surface waters of the Pocos de Caldas region. The collective dose equivalent calculated from the 226Ra concentrations measured in the baseline studies are compared with those collective dose equivalent estimated from the projected higher 226Ra concentrations in the river waters. The 226Ra concentrations in river waters of the region are expected to be enhanced due to 226Ra releases from uranium mining and milling operations. The dose equivalent commitment for the exposed population for the referred pathways is also estimated for the contribution of the mine during its predicted time of operation. The assumptions for the dose calculations are presented and the results obtained are discussed. (H.K.)

  10. A Study on Sorption of (226)Ra on Different Clay Matrices.

    Alhajji, E; Al-Masri, M S; Khalily, H; Naoum, B E; Khalil, H S; Nashawati, A

    2016-08-01

    The sorption of radium 226 ((226)Ra) on different clay materials (bentonite, illite and a mixture of bentonite-illite) was studied. Clay materials are used in the construction of disposal pits for technically enhanced naturally occurring radioactive materials (TENORM) wastes (i.e., contaminated soil and sludge) generated by the oil and gas industry operations. Experimental conditions (pH, clay materials quantity, and activity concentrations of (226)Ra) were changed in order to determine the optimal state for adsorption of (226)Ra. The results showed that the concentration of adsorbed (226)Ra on clay materials increased with time to reach an equilibrium state after approximately 5 h. More than 95 % of the radium was adsorbed. The mixture of bentonite-illite (1/9) exhibited the greatest adsorption of radium under all experimental conditions. PMID:27329110

  11. Biogeochemistry of 226Ra in contaminated bottom sediments and oilfield waste pits

    Solubility of 226Ra in sediments contaminated by produced water discharges was investigated using integrated microcosm, geochemical modelling and field sampling techniques. These studies strongly indicate that the biogeochemical control on 226Ra solubility in these sediments is coprecipitation with barite (BaSO4). The role of barite was confirmed by selective extractions of contaminated sediments, geochemical measurements of solution saturation, theoretical coprecipitation calculations, and direct measurement of barite using X-ray diffraction. Despite elevated activities that are three orders of magnitude higher than background, fluxes of 226Ra from these contaminated sediments are of the same order of magnitude as those measured in natural systems. Remobilization of 226Ra was observed in the Humble Bayou sediment under anaerobic, sulfate-reducing conditions. Management of these contaminated sites will involve understanding the role of barite solid-solution chemistry on the fate and mobility of 226Ra. (Copyright (c) 1998 Elsevier Science B.V., Amsterdam. All rights reserved.)

  12. 12 CFR Appendix K to Part 226 - Total Annual Loan Cost Rate Computations for Reverse Mortgage Transactions

    2010-01-01

    ... Reverse Mortgage Transactions K Appendix K to Part 226 Banks and Banking FEDERAL RESERVE SYSTEM (CONTINUED) BOARD OF GOVERNORS OF THE FEDERAL RESERVE SYSTEM TRUTH IN LENDING (REGULATION Z) Pt. 226, App. K Appendix K to Part 226—Total Annual Loan Cost Rate Computations for Reverse Mortgage Transactions...

  13. 48 CFR 252.226-7000 - Notice of historically black college or university and minority institution set-aside.

    2010-10-01

    ... black college or university and minority institution set-aside. 252.226-7000 Section 252.226-7000... Notice of historically black college or university and minority institution set-aside. As prescribed in 226.370—9(a), use the following clause: Notice of Historically Black College or University...

  14. 20 CFR 408.226 - What happens if you begin receiving other benefit income after you become entitled to SVB?

    2010-04-01

    ... benefit income after you become entitled to SVB? 408.226 Section 408.226 Employees' Benefits SOCIAL... Entitlement Other Benefit Income § 408.226 What happens if you begin receiving other benefit income after you become entitled to SVB? If you begin receiving other benefit income after you become entitled to SVB,...

  15. Activity concentrations of 226Ra and 228Ra in drilled well water in Finland

    The activity concentrations of 226Ra and 228Ra in drinking water were determined in water samples from 176 drilled wells. 226Ra activity concentrations were in the range of -1 and 228Ra activity concentrations in the range of -1. The mean activity concentration of 226 Ra and 228 Ra were 0.041 and 0.034 Bq l-1, respectively. High radium activity concentrations in drinking water were rare. Only 2-4% of the drilled wells exceeded a 226Ra concentration of 0.5 Bq l-1 and 1-2% of the wells exceeded a 228Ra concentration of 0.2 Bq l-1. These are the activity concentrations that cause a 0.1 mSv annual effective dose for users of drinking water. The maximum annual effective doses from 226Ra and 228Ra for users of drilled wells were 0.21 mSv, and 0.16 mSv respectively. The elevated activity concentrations of 226Ra and 228Ra did not occur simultaneously in the same groundwaters and the correlation between 226Ra and 228Ra was small. (authors)

  16. [Uptake of radionuclides from soil to plant and the discovery of 226Ra, 232Th hyperaccumulator].

    Zhang, Zhi-Qiang; Chen, Di-Yun; Song, Gang; Yue, Yu-Mei

    2011-04-01

    11 sorts of plant samples and corresponding soil samples were collected in Conghua and Taishan, Pearl River Delta. The specific activity of 238U, 226Ra, 232Th and 40K of samples were investigated by using HPGe-gamma-ray spectra analysis. The results showed that the average specific activity of 238U, 226Ra, 232Th and 40K in soil samples were 151.8, 146.3, 226.6, 665.5 Bq/kg, which were higher than the average values of China and the world. The concentration of 238U in all sort of plants are very low and most of them are lower than detection limit, while the values of 226Ra, 232Th and 40K were high. The contents of 226Ra and 232Th in Dicranopteris dichotoma were the highest, whose average specific activity is 285.9, 986.2 Bq/kg respectively. The average bioconcentration factors (BFs)of 26Ra, 232Th of Dicranopteris dichotoma were 2.20, 4.23, respectively, the other 10 sort of plants have BFs of 2266Ra, 232Th were in the range of 10(-1)-10(-2). The bioconcentration factors and the translocation factors of 226Ra, 232Th of Dicranopteris dichotoma. were all bigger than 1, so Dicranopteris dichotoma can be defined as hyperaccumulator of 226Ra and 232Th. PMID:21717763

  17. The determination of radium-226 in uranium ores and mill products by alpha energy spectrometry

    A reliable routine procedure for determining 226Ra by alpha energy spectrometry is described. Radium is isolated as sulphate from the sample matrix by co-precipitation with a small mass of barium and analysed using a ruggedized silicon surface barrier detector. The method is capable of providing high accuracy over a large 226Ra concentration range and is applicable to materials such as uranium ores, uranium mill products and effluent streams. Samples resulting from nitric acid leach experiments with Elliot Lake ores were examined using the procedure. The distribution of 223Ra, 224Ra and 226Ra between the leach products, (residue and leach liquor), is discussed. (author)

  18. 228Ra/226Ra activity ratio in groundwater around Mount Fuji, Japan

    Tagami Keiko

    2012-04-01

    Full Text Available We estimated the groundwater age from 228Ra/226Ra ratios in young groundwater and relevant rocks in the volcanic area of the Kakitagawa River around Mount Fuji, Japan, and compared our results with those from 3H/3He age determination. The groundwater residence time estimated from the 228Ra/226Ra activity ratio in groundwater and relevant rocks agreed well with the 3H/3He age, suggesting that the 228Ra/226Ra ratio of groundwater can be used to estimate residence time of young groundwater in volcanic areas.

  19. Determination of radium-226 in environmental and personal monitoring samples

    Radium-226 is a member of the Uranium-238 natural decay series and is the most hazardous radionuclide released to the environment from uranium mining and milling. Due to its long half-life (1600 years) and radiological effects it is one of the most important isotopes to be determined among the naturally occurring nuclides in environmental samples. It is also among the most toxic long-lived alpha-emitters present in environmental samples, as well as one of the most widespread. The requirement for the determination of radium has become a matter of interest in public health due to its hazardous nature with respect to internal exposure. It is concentrated in bones, thus increasing the internal radiation dose of individuals. The methodology developed involves dissolving solid samples by microwave digestion. The radium is then separated from matrix interferents by cation exchange chromatography and subsequently electrodeposited onto a stainless steel disc. α-Spectrometry is employed to determine the activity in the sample. A limit of detection of 20 mBq l-1 for ground water samples (100 ml) and 20 mBq g-1 for solid samples (0.1 g) is achievable. The method has been validated via an intercomparison exercise and analysis of a marine sediment reference material. Samples analysed include run off waters from uranium mines, coal and fly ash and also trapping media such as silica gel, charcoal and activated carbon

  20. Determination of radium-226 in environmental and personal monitoring samples.

    Lawrie, W C; Desmond, J A; Spence, D; Anderson, S; Edmondson, C

    2000-01-01

    Radium-226 is a member of the Uranium-238 natural decay series and is the most hazardous radionuclide released to the environment from uranium mining and milling. Due to its long half-life (1600 years) and radiological effects it is one of the most important isotopes to be determined among the naturally occurring nuclides in environmental samples. It is also among the most toxic long-lived alpha-emitters present in environmental samples, as well as one of the most widespread. The requirement for the determination of radium has become a matter of interest in public health due to its hazardous nature with respect to internal exposure. It is concentrated in bones, thus increasing the internal radiation dose of individuals. The methodology developed involves dissolving solid samples by microwave digestion. The radium is then separated from matrix interferents by cation exchange chromatography and subsequently electrodeposited onto a stainless steel disc. Alpha-Spectrometry is employed to determine the activity in the sample. A limit of detection of 20 mBq l(-1) for ground water samples (100 ml) and 20 mBq g(-1) for solid samples (0.1 g) is achievable. The method has been validated via an intercomparison exercise and analysis of a marine sediment reference material. Samples analysed include run off waters from uranium mines, coal and fly ash and also trapping media such as silica gel, charcoal and activated carbon. PMID:10879851

  1. Improved method for the determination of dissolved radium-226

    Most of the current techniques for radium determination involve chemical separation of radium from major sample constituents by coprecipitation with barium or lead sulfate, followed by further radium purification. However, when samples contain biological materials, such as algae in wastewater from uranium millponds, or brine water from oil fields, the precipitation and purification processes become tedious and time-consuming. An improved method has been developed for the determination of radium-226 in such water samples, which also is applicable to natural waters. This method is based on a radon determination of alpha activity of the radon and its short-lived daughters in an alpha-scintillation cell. The radon-bubbler volume is either 90 millimeters for concentrated samples or 800 milliliters for dilute samples. For radium concentrations less than 1 picocurie per liter, 2 liters of water sample can be concentrated several-fold by simple evaporation, and decreased to 800 milliliters prior to deemanation. Because the process involves no chemical separations, chemical recoveries are nearly 100 percent. The lower limit of detection is 0.05 picocurie per liter for a 1-liter water sample and a counting time of 1000 minutes. 19 references, 3 figures, 3 tables

  2. 226Ra evidence for the ecosystem shift over the past 40 years in the North Pacific Subtropical Gyre

    YANG JunHong; CHEN Min; QIU YuSheng; LI YanPing; MA Qiang; L(U) E; ZHANG Run; HUANG YiPu

    2007-01-01

    Surface seawater was collected for 226Ra measurement in the North Pacific Subtropical Gyre from July to October, 1999 and October to December, 2003. Combined with the historical data reported for this sea area, a declined trend of surface 226Ra concentrations was observed since 1960s, indicating the ecosystem shift in response to global warming. On one side, the enhanced stratification of the upper water column resulting from global warming reduced the 226Ra input from the depth, on the other, the temporal increase of biological production resulting from the climate-related ecosystem structure change strengthened the 226Ra removal from the surface ocean. Both the physical and biological processes resulted in the decrease of surface 226Ra concentrations in the North Pacific Subtropical Gyre. The temporal trend of surface 226Ra concentrations was consistent with the trends of chlorophyll a, silicate, phosphate and primary production previously reported. This study provided 226Ra evidence for the ecosystem shift under global change.

  3. Elimination of natural uranium and 226Ra from contaminated waters by rhizofiltration using Helianthus annuus L

    The elimination of natural uranium and 226Ra from contaminated waters by rhizofiltration was tested using Helianthus annuus L. (sunflower) seedlings growing in a hydroponic medium. Different experiments were designed to determine the optimum age of the seedlings for the remediation process, and also to study the principal way in which the radionuclides are removed from the solution by the sunflower roots. In every trial a precipitate appeared which contained a major fraction of the natural uranium and 226Ra. The results indicated that the seedlings themselves induced the formation of this precipitate. When four-week-old seedlings were exposed to contaminated water, a period of only 2 days was sufficient to remove the natural uranium and 226Ra from the solution: about 50% of the natural uranium and 70% of the 226Ra were fixed in the roots, and essentially the rest was found in the precipitate, with only very small percentages fixed in the shoots and left in solution

  4. Selection criteria for the measurement of Radium-226 in environmental samples

    Radium-226 is routinely analysed in variety of environmental samples for many investigation and specific studies like dating sediments, water quality measurements, estimation of age of fish etc. Radium-226 is a α-emitters which has the half life of 1620 years. Alpha spectrometry and high resolution gamma spectrometry are some available techniques for the measurement of 226Ra. The properties of each technique are studied. Each technique has different background levels, geometric efficiency, preparation procedure and recoveries of 226Ra. This gives wide range of options with some restrictions imposed on sample size and activity. The paper discusses the selection criteria, optimum procedure and its dependency on sensitivity, precision and lower limit of detection of each technique. The process of method selection is illustrated here with reference to sediments. (author)

  5. Geochemical controls on the solubility of Ra-226 in uranium mine tailings

    The mine tailings at the Key Lake uranium mill have been continuously emplaced in the Deilmann Tailings Management Facility (DTMF) since 1996. At the start of emplacement, the concentration of dissolved Ra-226 in the tailings supernatant in the DTMF was predicted to be less than 150 Bq/l. In 2001, the concentration of dissolved Ra-226 in the tailings supernatant was measured to be 280 Bq/l. Results of bench scale experiments showed that the addition of barium chloride to the tailings slurry would result in the precipitation of dissolved Ra-226 through the formation of a Ba/Ra-SO4 co-precipitate with a resulting concentration of 50 Bq/l. Implementation of a barium chloride addition system in the mine tailings processing circuit was completed in July 2002. Since its implementation, the concentration of dissolved Ra-226 in the tailings supernatant has decreased to about 18 Bq/l. (author)

  6. Assessment of 226Ra age-dependent dose from water intake

    The radioactivity in canal and ground waters collected in a 2-year long observation from the vicinity of the Rare Earth Research and Development Center (RRDC), Phathumthani Province, Thailand, was measured in order to determine the concentration of 226Ra and to estimate the age-dependent effective dose to humans due to consumption. 226Ra activities in both canal and ground waters were well below the WHO guidance level for drinking water quality of 1 Bq L-1. The highest 226Ra effective doses per year were found for infants and teens. However, the observed levels of calculated 226Ra effective doses for all age groups in both canal and ground waters show satisfactory low values (less than 15 μSv yr-1). These values are acceptable in accordance with the WHO recommended reference dose level of 100 μSv yr-1 from water intake of 2 L day-1

  7. Determination of 226Ra in water samples using sorbent MnO2-PAN

    The aim of our study was to determine 226Ra using alpha spectrometer in water samples. The method of separation based on the principle of extraction chromatography was applied by the separation of the natural radionuclides 226Ra from samples of natural mineral, spring, natural medicinal and drinking water from the Slovak Republic, the Czech Republic and Slovenia. The proposed method uses a new selective commercial sorbent MnO2-PAN. The advantage of separating of 226Ra on a given sorbent is the speed of separation, simple sample preparation before the analysis and mainly the high efficiency of the proposed method. The sample was adjusted by coprecipitation with Ba2+ for alpha spectrometric measurements of 226Ra. The radiochemical yield was monitored by radionuclide tracer 133Ba.

  8. Dating hapuka otoliths using 210 Pb/226 Ra, with comments on dating orange roughy otoliths

    It is shown that Hapuka otoliths cannot be reliably dated using the 210 Pb/ 226 Ra method because contrary to previous assumptions, excess 210 Pb is incorporated into the outer layers of otoliths which have been taken from old fish, though the 226 Ra incorporation remains normal. This is shown to apply also to Orange Roughy otoliths. Ages based on calculations using previously published methods will be artificially old. (author). 13 refs., 2 tabs., 3 figs

  9. The determination of radium-226 in the tailings of gold mines and their environment

    Radium-226, a daughter product in the uranium-238 decay series, is present in ore mined for the production of both gold and uranium. In this way the radium-226 finds its way into the tailings of mines and is therefore present in all the mine sand dumps and slimes dams in the Republic. Although this radium-226 is in a relatively stable and practically insoluble matrix, it is nevertheless possible for it to migrate from such slimes dams or sand dumps under the influence of various mechanisms. In order to make a survey in these mining environments, it was necessary to adapt an existing emanometric method. In this method radium-226 is co-precipitated from 5 dm3 water samples with barium sulphate. An investigation was carried out on the recoverability of the radium-226 in this way and it was found that the best results were achieved at a pH of 1 with co-precipitation from a homogenous or a simulated homogenous medium. The barium sulphate precipitate was dissolved by a sodium carbonate fusion with the resulting carbonates dissolving in hydrochloric acid. The back-ground reading due to the presence of radium-266 in the reagents used and the radium-226 slightly contaminating the glassware, was determined with blank measurements. This mean background value was used to determine the detection limit. In the survey, samples of water, slimes, sand and sediment were taken in the main gold-mining areas of the RSA. From the results of the survey it appears that radium-226 is definitely present in the abovementioned environments, but that the concentrations are very low. It was, furthermore, evident that, in contrast with the relatively high concentrations measured near the pollution source, the measured quantity of radium-226 decreases rapidly with increasing distance from the source

  10. 226Ra bioavailability to plants at the Urgeiriça uranium mill tailings site.

    Madruga, M J; Brogueira, A; Alberto, G; Cardoso, F

    2001-01-01

    Large amounts of solid wastes (tailings) resulting from the exploitation and treatment of uranium ore at the Urgeiriça mine (north of Portugal) have been accumulated in dams (tailing ponds). To reduce the dispersion of natural radionuclides into the environment, some dams were revegetated with eucalyptus (Eucalyptus globolus) and pines (Pinus pinea). Besides these plants, some shrubs (Cytisus spp.) are growing in some of the dams. The objective of this study is to determine the 226Ra bioavailability from uranium mill tailings by quantifying the total and available fraction of radium in the tailings and to estimate its transfer to plants growing on the tailing piles. Plant and tailing samples were randomly collected and the activity concentration of 226Ra in plants (aerial part and roots) and tailings was measured by gamma-spectrometry. The exchangeable fraction of radium in tailings was quantified using one single step extraction with 1 mol dm-3 ammonium acetate (pH = 7) or 1 mol dm-3 calcium chloride solutions. The results obtained for 226Ra uptake by plants show that 226Ra concentration ratios for eucalyptus and pines decrease at low 226Ra concentrations in the tailings and appear relatively constant at higher radium concentrations. For shrubs, the concentration ratios increase at higher 226Ra solid waste concentrations approaching a saturation value. Percentage values of 16.0 +/- 8.3 and 12.9 +/- 8.9, for the fraction of radium extracted from the tailings, using 1 mol dm-3 ammonium acetate or calcium chloride solutions, respectively, were obtained. The 226Ra concentration ratios determined on the basis of exchangeable radium are one order of magnitude higher than those based on total radium. It can be concluded that, at a 95% confidence level, more consistent 226Ra concentration ratios were obtained when calculated on the basis of available radium than when total radium was considered, for all the dams. PMID:11379070

  11. Radiochemical determination and separation or total radium, 226Ra and 224Ra

    Radiochemical purification and separation of radium has been carried out and the determination of total radium solubilized in aqueous samples has been studied assuming that all the alpha emitters of the sample have their origin in the 226Ra and elements of its desintegration chain. Also, the activities of 22Ra and 226 Ra have been evaluated separately doing a measurement after the chemical separation of the radium and another one 10 days after. (Author) 9 refs

  12. Microdistribution of 226Ra and radiation dose to bone target cells

    With the development of a computerized scanning technique it was possible to perform extensive analysis of autoradiographs from bone samples of Beagle dogs injected with 226Ra at levels from 370 to 12.5 kBq/kg body weight. The results on the 226Ra distribution and dosimetry in the lumbar vertebra from dogs injected with 370 kBq/kg are summarized here. (author)

  13. 50 CFR Table 2 to Part 226 - Major Stellar Sea Lion Haulout Sites in Alaska

    2010-10-01

    ... 50 Wildlife and Fisheries 7 2010-10-01 2010-10-01 false Major Stellar Sea Lion Haulout Sites in.... 226, Table 2 Table 2 to Part 226—Major Stellar Sea Lion Haulout Sites in Alaska Major Steller sea lion...: Northeast Point 1 57 15.0N 170 06.5W Sea Lion Rock 1 57 06.0N 170 17.5W St. George I: S Rookery 1 56...

  14. Influence of modification on structure, fluidity and strength of 226D aluminium alloy

    A. Dolata-Grosz; M. Dyzia; J. Śleziona

    2008-01-01

    In the article the fluidity, solidification conditions, microstructure and tensile properties have been studied for the non-modified and modified 226D aluminium silicon alloy.Realized investigations concerned modification of alloy 226D for application as the matrix to carbon fibre reinforcement composite (MMC-Cf). One of main factors determining to good connection between metal matrix and fibres reinforcement is good wettability. It is possible to obtain suitable conditions of wettability by ...

  15. /sup 226/Ra in the western Indian Ocean

    Chung, Y.

    1987-09-01

    /sup 226/Ra profiles have been measured in the western Indian Ocean as part of the 1977-78 Indian Ocean GEOSECS program. These profiles show a general increase in deep and bottom water Ra concentration from the Circumpolar region to the Arabian Sea. A deep Ra maximum which originates in the Arabian Sea and in the Somali basin at about 3000 m depth spreads southward into the Mascarene basin and remains discernible in the Madagascar and Crozet basins. In the western Indian Ocean, the cold Antarctic Bottom Water spreads northward under the possibly southward-flowing deep water, forming a clear benthic front along the Crozet basin across the Southwest Indian Ridge into the Madagascar and Mascarene basins. The Antarctic Bottom Water continues to spread farther north to the Somali basin through the Amirante Passage at 10/sup 0/S as a western boundary current. The benthic front and other characteristic features in the western Indian Ocean are quite similar to those observed in the western Pacific where the benthic front as a distinctive feature was first described by Craig et al. Across the Mid-Indian Ridge toward the Ceylon abyssal plain near the triple junction, Ra profiles display a layered structure, reflecting the topographic effect of the mid-ocean ridge system on the mixing and circulation of the deep and bottom waters. Both Ra and Si show a deep maximum north of the Madagascar Basin. Linear relationships between these two elements are observed in the deep and bottom water with slopes increasing northward. This suggests a preferential input of Ra over Si from the bottom sediments of the Arabian Sea and also from the flank sediments of the Somali basin.

  16. Distribution and retention in bone of 226Ra and comparison with the ICRP 20 model

    Analyses are presented of the ratios of 226Ra to calcium in over 650 samples of compact and cancellous bone from 66 female and 26 male subjects who had died from less than one to 60 years after first exposure to radium. The 226Ra/Ca ratios were normalized to the terminal 226Ra skeletal content. The 226Ra/Ca ratios for vertebrae were essentialy identical to those for other cancellous bone for a given subject. Comparisons of the data with predictions of the ICRP model of alkaline earth metabolism show that for female cancellous bone the normalized 226Ra/Ca ratios tended to be greater than predicted, while those for female cortical bone (femoral and tibial shaft) tended to be less. The data for males were fitted better by the model. A modification of the model to reduce the amount of radium deposited in soft tissue fitted the data better in some respects. A straight line linear least squares fit to the data appeared to fit as well as, or better than, the models. A radiation effect was suggested in that the normalized 226Ra/Ca ratio for vertebrae relative to the ratio expected increased with skeletal absorbed dose for vertebra. However, no such effect was apparent for compact bone or for the cancellous bone as a whole

  17. Determination of {sup 226}Ra Isotope in the Leachate around Phosphogypsum Stack Using Ethylenediaminetetraacetic Acid (EDTA)

    Kim, Geun Ho; Kim, Yong Jae; Chang, Byung Uck [University of Science and Tecknology, Korea Institute of Nuclear Safety, Daejeon (Korea, Republic of)

    2011-12-15

    Ba is the most useful element to get the Ba(Ra)SO{sub 4} precipitate. However, when the high concentrations of ions such as sulfate, calcium are existed in the leachate of phosphogypsum stack, it is difficult to get the Ba(Ra)SO{sub 4} precipitate. Since this reason, the developed method for the Ba coprecipitate using EDTA was performed to determine the {sup 226}Ra concentration in the high sulfate sample. The average concentration of {sup 226}Ra in a leachate of phosphogypsum using this method was 0.102 Bq{center_dot}kg{sup -1} and the minimal detectable activity is 3.4 mBq{center_dot}kg{sup -1}. The mBq{center_dot}kg{sup -1} method was 0.102 Bq{center_dot}kg{sup -1} and the minimal detectable activity is 3.4 mBq{center_dot}kg{sup -1}. The {sup 226}Ra stock solution and the CRM (Certified Reference Material) were analyzed to verify this method. In analyzed {sup 226}Ra stock solution, bias with added concentration was approximately 1% and the correlation curve between {sup 226}Ra concentration in simulated standard sample and measured {sup 226}Ra concentration showed good agreement with a correlation coefficient (R{sup 2}) of 0.99. In analyzed CRM, maximum bias with reference value was 5.8% (k=1) and the analytical results were in good agreement with the reference value.

  18. Leaching of 60Co, 137Cs and 226Ra in lysimeter experiments

    The present report describes the first results obtained from lysimeter experiments started in 1990. The lysimeter plant consists of twelve soil monoliths from four different sites (three replicates each). Since 1990 the following agricultural crops were grown: endive, corn, winter wheat, mustard, sugar beet and potato. Gravitational water ranged from 3.9 % to 18.3 % of precipitation plus irrigation water, calculated as half years average values excluding the first six months of operation. The two Cambisols on sediments exhibited a mean percentage of approx. 10 %. The Dystric Cambisol on silicate rock and the Gleysol showed average values of 20 %. In 1990 the top layers (20 cm) were contaminated with three radionuclides. The leaching of the contaminants 60Co, 137Cs and 226Ra differed distinctly between the elements. The lowest leaching rates were observed for 137Cs, followed by 60Co. The 226Ra-concentrations in the gravitational water were clearly highest of all. However, the comparison of the 226Ra/2228Ra ratios in deep soil layers and in gravitational water showed that the 226Ra measured in the leachate originates from the natural contents in the subsoil and not from the artificial 226Ra contamination of the topsoil. The mobility of the artificial radionuclides decreased therefore in the following order: 60Co > (226Ra) > 137Cs. (author)

  19. Oral administration of FAK inhibitor TAE226 inhibits the progression of peritoneal dissemination of colorectal cancer

    Highlights: ► A novel FAK inhibitor TAE226 suppressed FAK activity in HCT116 colon cancer cells. ► TAE226 suppressed proliferation and migration, with a modest effect on adhesion. ► Silencing of FAK by siRNA made no obvious difference on cancer cell attachment. ► TAE226 treatment suppressed the progression of peritoneal dissemination. ► Oral administration of TAE226 prolonged the survival of tumor-bearing mice. -- Abstract: Peritoneal dissemination is one of the most terrible types of colorectal cancer progression. Focal adhesion kinase (FAK) plays a crucial role in the biological processes of cancer, such as cell attachment, migration, proliferation and survival, all of which are essential for the progression of peritoneal dissemination. Since we and other groups have reported that the inhibition of FAK activity exhibited a potent anticancer effect in several cancer models, we hypothesized that TAE226, a novel ATP-competitive tyrosine kinase inhibitor designed to target FAK, can prevent the occurrence and progression of peritoneal dissemination. In vitro, TAE226 greatly inhibited the proliferation and migration of HCT116 colon cancer cells, while their adhesion on the matrix surface was minimally inhibited when FAK activity and expression was suppressed by TAE226 and siRNA. In vivo, when HCT116 cells were intraperitoneally inoculated in mice, the cells could attach to the peritoneum and begin to grow within 24 h regardless of the pretreatment of cells with TAE226 or FAK-siRNA, suggesting that FAK is not essential, at least for the initial integrin-matrix contact. Interestingly, the treatment of mice before and after inoculation significantly suppressed cell attachment to the peritoneum. Furthermore, oral administration of TAE226 greatly reduced the size of disseminated tumors and prolonged survival in tumor-bearing mice. Taken together, a possible strategy for inhibiting peritoneal dissemination by targeting FAK with TAE226 appears to be applicable

  20. Oral administration of FAK inhibitor TAE226 inhibits the progression of peritoneal dissemination of colorectal cancer

    Hao, Hui-fang [Department of Gastroenterological Surgery, Graduate School of Medicine, Dentistry, and Pharmaceutical Sciences, Okayama University, 2-5-1 Shikatacho, Kita-ku, Okayama 700-8558 (Japan); Takaoka, Munenori [Department of General Surgery, Kawasaki Medical School, 2-1-80 Nakasange, Kita-ku, Okayama 700-8505 (Japan); Bao, Xiao-hong [Department of Gastroenterological Surgery, Graduate School of Medicine, Dentistry, and Pharmaceutical Sciences, Okayama University, 2-5-1 Shikatacho, Kita-ku, Okayama 700-8558 (Japan); Wang, Zhi-gang [College of Life Science, Inner Mongolia University, The Key Laboratory of Mammal Reproductive Biology and Biotechnology, Ministry of Education, Hohhot 010021 (China); Tomono, Yasuko [Division of Molecular and Cell Biology, Shigei Medical Research Institute, 2117 Yamada, Okayama 700-0202 (Japan); Sakurama, Kazufumi; Ohara, Toshiaki [Department of Gastroenterological Surgery, Graduate School of Medicine, Dentistry, and Pharmaceutical Sciences, Okayama University, 2-5-1 Shikatacho, Kita-ku, Okayama 700-8558 (Japan); Fukazawa, Takuya; Yamatsuji, Tomoki [Department of General Surgery, Kawasaki Medical School, 2-1-80 Nakasange, Kita-ku, Okayama 700-8505 (Japan); Fujiwara, Toshiyoshi [Department of Gastroenterological Surgery, Graduate School of Medicine, Dentistry, and Pharmaceutical Sciences, Okayama University, 2-5-1 Shikatacho, Kita-ku, Okayama 700-8558 (Japan); Naomoto, Yoshio, E-mail: ynaomoto@med.kawasaki-m.ac.jp [Department of General Surgery, Kawasaki Medical School, 2-1-80 Nakasange, Kita-ku, Okayama 700-8505 (Japan)

    2012-07-13

    Highlights: Black-Right-Pointing-Pointer A novel FAK inhibitor TAE226 suppressed FAK activity in HCT116 colon cancer cells. Black-Right-Pointing-Pointer TAE226 suppressed proliferation and migration, with a modest effect on adhesion. Black-Right-Pointing-Pointer Silencing of FAK by siRNA made no obvious difference on cancer cell attachment. Black-Right-Pointing-Pointer TAE226 treatment suppressed the progression of peritoneal dissemination. Black-Right-Pointing-Pointer Oral administration of TAE226 prolonged the survival of tumor-bearing mice. -- Abstract: Peritoneal dissemination is one of the most terrible types of colorectal cancer progression. Focal adhesion kinase (FAK) plays a crucial role in the biological processes of cancer, such as cell attachment, migration, proliferation and survival, all of which are essential for the progression of peritoneal dissemination. Since we and other groups have reported that the inhibition of FAK activity exhibited a potent anticancer effect in several cancer models, we hypothesized that TAE226, a novel ATP-competitive tyrosine kinase inhibitor designed to target FAK, can prevent the occurrence and progression of peritoneal dissemination. In vitro, TAE226 greatly inhibited the proliferation and migration of HCT116 colon cancer cells, while their adhesion on the matrix surface was minimally inhibited when FAK activity and expression was suppressed by TAE226 and siRNA. In vivo, when HCT116 cells were intraperitoneally inoculated in mice, the cells could attach to the peritoneum and begin to grow within 24 h regardless of the pretreatment of cells with TAE226 or FAK-siRNA, suggesting that FAK is not essential, at least for the initial integrin-matrix contact. Interestingly, the treatment of mice before and after inoculation significantly suppressed cell attachment to the peritoneum. Furthermore, oral administration of TAE226 greatly reduced the size of disseminated tumors and prolonged survival in tumor-bearing mice. Taken

  1. Growth patterns of craniopharyngiomas: clinical analysis of 226 patients.

    Pan, Jun; Qi, Songtao; Liu, Yi; Lu, Yuntao; Peng, Junxiang; Zhang, XiAn; Xu, YiKai; Huang, Guang-Long; Fan, Jun

    2016-04-01

    OBJECT Craniopharyngiomas (CPs) are rare epithelial tumors that are often associated with an enigmatic and unpredictable growth pattern. Understanding the growth patterns of these tumors has a direct impact on surgical planning and may enhance the safety of radical tumor removal. The aim of this study was to analyze the growth patterns and surgical treatment of CPs with a focus on the involvement of the hypothalamopituitary axis and the relationship of the tumor to the arachnoid membrane and surrounding structures. METHODS Clinical data from 226 consecutive patients with primary CP were retrospectively reviewed. Tumor location and the relationship of the tumor to the third ventricle floor and the pituitary stalk were evaluated using preoperative MRI and intraoperative findings. A topographic classification scheme was proposed based on the site of tumor origin and tumor development. The clinical relevance of this classification on patient presentation and outcomes was also analyzed. RESULTS The growth of CPs can be broadly divided into 3 groups based on the site of tumor origin and on tumor-meningeal relationships: Group I, infrasellar/infradiaphragmatic CPs (Id-CPs), which mainly occurred in children; Group II, suprasellar subarachnoid extraventricular CPs (Sa-CPs), which were mainly observed in adults and rarely occurred in children; and Group III, suprasellar subpial ventricular CPs (Sp-CPs), which commonly occurred in both adults and children. Tumors in each group may develop complex growth patterns during vertical expansion along the pituitary stalk. Tumor growth patterns were closely related to both clinical presentation and outcomes. Patients with Sp-CPs had more prevalent weight gain than patients with Id-CPs or Sa-CPs; the rates of significant weight gain were 41.7% for children and 16.7% for adults with Sp-CPs, 2.2% and 7.1% for those with Id-CPs, and 12.5% and 2.6% for those with Sa-CPs (p tumor. More tailored, individualized surgical strategies based on

  2. Behavior of 210Pb and 226Ra in tailing samples at Jaduguda

    Several investigation at various parts of the world as well as in different parts of India reported wide variation in activity of 210Pb and 226Ra in environmental matrices. Since 210Pb occurs in decay chain of 226Ra one would expect that in isolated and undisturbed domain the ratio to be nearly unity. However such a ratio is rarely reached. In the actual experience this ratio is influenced to different degree by several environmental parameters such as soil porosity, particle size distribution, and chemical nature of soil and subsurface and surface movement of water. A thorough study on 226Ra and 210Pb ratio can in principle be used as tool to evaluate some environmental parameters in the tailing ponds. A study of natural radioactivity levels including 226Ra and 210Pb in tailing sample around tailing pond area of uranium mining and milling complex located in the Singhbhum regions of Eastern India were undertaken. Tailing pond is covered with the normal background soil known as capping soil. This also reduces the emanation of radon and exposure due 226Ra and its daughter products. Tailings samples were collected after removing the top capping soil. Samples were processed as described by Environmental Measurement Laboratory (EML 1990). Activity concentration of natural 238U series radionuclide like thorium isotopes (234Th and 228Th), lead isotopes (210Pb and 212Pb), radium isotopes (226Ra and 228Ra) and 234mPa were measured using HPGe based high resolution gamma spectrometric technique after attaining secular equilibrium between 226Ra and its daughters. IAEA standard sources RGTh-1 (800 μg/g of 232Th), RGU-1 (400μg/g of 238U), were used for energy and efficiency calibration of the spectrometer in the same geometry (plastic containers of 6.5 cm dia x 7.5 cm ht) as that of the samples. (author)

  3. 238U-230Th-226Ra radioactive disequilibria in the products from 1707 eruption of Fuji volcano, Japan

    Time scale of magmatic processes in the 1707 eruptive activity of Fuji volcano, Japan, was estimated by the 238U-230Th-226Ra disequilibria observed in the 1707 volcanic products. The activity ratios of 226Ra/230Th in the products were larger than unity, being enriched in 226Ra relative to 230Th. The decay-corrected 226Ra/230Th activity ratio to the time of the eruption versus 238U/230Th activity ratio diagram for the 1707 volcanic products showed a positive correlation, suggesting that the 238U/230Th-226Ra disequilibria occurred during the magma genesis of Fuji volcano. The 230Th-226Ra disequilibria in the 1707 volcanic products suggested that the time scale from the magma genesis to the eruption, including the melting of the mantle wedge, magma storage and magmatic differentiation from basalt to andesite, was less than 8000 years. (author)

  4. Ra-226 and Rn-222 in saline water compartments of the Aral Sea region

    Highlights: • 222Rn and 226Ra concentrations in different water compartments of the Aral Sea region. • 226Ra-analysis based on 222Rn-ingrowth versus MS-analysis after solid-phase extraction. • 226Ra in different groundwater types of the Aral Sea Basin. • 222Rn distribution in the Aral Sea, western basin. - Abstract: The Aral Sea has been shrinking since 1963 due to extensive irrigation and the corresponding decline in the river water inflow. Understanding of the current hydrological situation demands an improved understanding of the surface water/groundwater dynamics in the region. 222Rn and 226Ra measurements can be used to trace groundwater discharge into surface waters. Data of these radiometric parameters were not previously available for the study region. We determined 222Rn activities after liquid phase extraction using Liquid Scintillation Counting (LSC) with peak-length discrimination and analyzed 226Ra concentrations in different water compartments of the Amu Darya Delta (surface waters, unconfined groundwater, artesian water, and water profiles from the closed Large Aral Sea (western basin). The water samples comprise a salinity range between 1 and 263 g/l. The seasonal dynamics of solid/water interaction under an arid climate regime force the hydrochemical evolution of the unconfined groundwater in the Amu Darya Delta to high-salinity Na(Mg)Cl(SO4) water types. The dissolved radium concentrations in the waters were mostly very low due to mineral over-saturation, extensive co-precipitation of radium and adsorption of radium on coexisting solid substrates. The analysis of very low 226Ra concentrations (<10 ppq) at remote study sites is a challenge. We used the water samples to test and improve different analytical methods. In particular, we modified a procedure developed for the α-spectrometric determination of 226Ra after solid phase extraction of radium using 3M Empore™ High Performance Extraction Disks (Purkl, 2002) for the analysis of the

  5. Survey of the occurrence of Ra-226 in the Rio Algom Quirke I uranium mill, Elliot Lake

    The main solution ore and residue pulp streams in the Rio Algom Quirke I uranium mill at Elliot Lake have been sampled and analyzed for radium-226. Analysis of the ore and leached residues indicates that Ra-226 dissolves and precipitates within the first pachuca tank. A maximum of approximately 0.2% of the Ra-226 in the ore remains in solution during leaching. (author)

  6. The precipitation of radioactive radium-226 from acidic chloride leach liquors with barium chloride

    The conventional barium chloride (BaClsub(2)) precipitation has been effective in the 99+ percent removal of radium-226 as radium-barium sulphate [RaBa(SOsub(4))sub(2)] sludge, from HCl liquors produced by laboratory and pilot leaches of Canadian uranium ores. Radium-226, due to its low-level radiation characteristics, is removed as it has been identified as an environmental and long-term health problem. The formation of the RaBa(SOsub(4))sub(2) sludge was aided due to adequate sulphate (SOsub(4)) concentrations in the HCl pilot liquors produced. Recyclable Rasup(226) concentrations of about 66 pCi/L, in treated effluents, will cost about 1/10 that of effluents below federal environmental guidelines of 10 pCi Rasup(226)/L. Toxic barium (Ba) will potentially build up in effluents as recyclable Rasup(226) concentrations around 66 pCi/L. Barium, in addition to being added to liquors as BaClsub(2) precipitant, is present in the radioactive ore and HCl leach liquors

  7. Spatial distribution of U-238, Ra-226 and Pb-210 at Urgeirica uranium mill tailings

    The extensive exploitation and treatment of the uranium ore in the Urgeirica mine, Portugal, where exists a chemical treatment plant, led to an accumulation of large amounts of solid wastes (tailings) deposited in piles or dams. The objective of this work is to investigate the extent of the contamination at the oldest dams (more than 40 years old) taking into account the U-238, Ra-226 and Pb-210 distribution at those dams. Tailings core and surface samples were randomly collected at the dams. Tailings samples were dried and the activity in U-238 (through the peaks of Th-234), Ra-226 (through the progenies Pb-214 and Bi-214) and Pb-210 were determined by gamma spectrometry. The results show a big variability (by a factor of 5 to 10) if the U-238, Ra-226 and Pb-210 concentrations at the surface tailings, which indicates a heterogeneity of the radionuclides distribution at the dams area. A good correlation between Ra-226 and U-238 concentrations at the sampling site (dam D2) that presents lower Ra-226 concentrations was obtained. As expected, the most important contribution to the high natural radioactivity at the oldest dams is due to the radium rejected as a waste product from the uranium ore treatment (author)

  8. Evaluation of the variation of 226Ra and Ca uptake by plant and their relationship

    The transfer of 226Ra from soil to plant has been studied for wild trees and grasses to identify the site- and the plant-specific variability in relation to the transfer of Ca. Twelve species of plants and soils were sampled from three different forests and one flood plain in Okayama, Japan. The concentrations of 226Ra in plant varied about 60 times by species and sites, while those in soil were not different significantly among sites. The transfer factors defined as the concentration ratio of 226Ra between plant and soil were linearly correlated with that of Ca, implying that the ability of Ca uptake by plant reflect the ability of 226Ra uptake. The Ca concentrations in plant showed species-specific value and varied 22 times. The range of transfer factor (plant/soil) for Ca increased by the variability of the Ca concentration in soil among sites. These results suggest that the wide variability of 226Ra concentration in plant can be ascribed to both the differences in plant and soil factors of Ca concentration. (author)

  9. Measurement of radium - 226 in rock phosphate used as low cost fertilizer using gamma spectroscopy

    This study was carried out to determine the concentration of radium - 226 in rock phosphate (used as low cost fertilizer), soil and plant. Two types of rock phosphates were examined, namely, Uro and kurun area in the Nuba mountains located in the western part of the sudan. The work included the determination of 226 Ra levels in soil after applying different concentration of rock phosphate in pot experiments. The plant used was Abu sabien a sorghum which used for the animal feed. 226 Ra in the soil using 20 g/pot (1000 kg/fed). of rock phosphate was found to be 88 and 104 Bq/kg for and 45 and 72 Bq/kg for kurun for season one and three respectively. As for the plant the concentration was found to be 1.2 and 1.4 Bq/kg for Uro and 0.4 and 0.6 Bq/kg for kurun for the first and third seasons respectively. The transfer factor of 226 Ra from soil to plant was estimated to be (0.01). The concentration of 226 Ra in the plant was found to be below the recommended values of contamination. 4 figs

  10. Lifetime effects of long-term exposures to strontium-90 and radium-226 in beagle dogs

    Graded doses of injected 226Ra or ingested 90Sr were given to 804 beagles in early life. The median survival times of the various irradiated groups at higher exposures were lower than the control value of 14.7 years. The 226Ra group with the highest total skeletal dose had a median survival of 4.5 years. For 90Sr the highest group had a median survival of 2.2 years. Normal life spans were evident in treatment groups with average skeletal doses of 226Ra or of 2600 rads from 90Sr. The life-shortening effects of 226Ra and 90Sr are related to the tumors produced from the radionuclide exposure. The significant causes of death among the 226Ra-treated beagles were primary bone cancers, mostly osteosarcomas. Among dogs exposed to 90Sr, significant numbers of deaths were from primary bone cancer, myeloproliferative disease, and squamous-cell carcinoma of the gingiva. In general, more of these effects were produced in the groups receiving higher doses and dose rates; at lower doses the effects, when present, appeared later than they did at higher doses. 9 refs., 6 figs., 4 tabs

  11. Sorption of (226)Ra from oil effluents onto synthetic cation exchangers.

    Al Attar, Lina; Safia, Bassam

    2013-07-30

    Increasing environmental awareness is being urged for the safe disposal of (226)Ra-contaminated production water generated in the oil industry. Birnessite, antimony silicate and their cationic derivatives were studied for the take-up of (226)Ra using the batch-type method under experimentally determined parameters, viz. contact time, solution-solid ratio and (226)Ra concentration. Data was expressed in terms of distribution coefficients. Sorption experiments were performed in different concentrations of nitric acid in order to speculate the mechanism of (226)Ra uptake. Variation in the magnitude of sorption efficiency of the materials in the presence of the major components of waste streams, i.e. Na(+), K(+) and Ca(2+), revealed that K(+) was the greatest competitor and Na(+) the least. The application of the materials to sorb (226)Ra from actual oil co-production water samples, collected from Der Ezzor and Al Fourat petroleum companies (DEZPC and AFPC), was interpreted in terms of the exchange properties of the materials and water characterisation. Of the parameters studied, the selectivity of materials was shown to be greatly dependent on the pH of wastewater to be treated. PMID:23623032

  12. Rapid estimation of 226Ra in soil for the Grand Junction RASA/UMTRA project

    The Radiological Survey Activities (RASA) Group of the Health and Safety Research Division at Oak Ridge National Laboratory (ORNL) is an Inclusion Survey Contractor (ISC) for the Uranium Mill Tailings Remedial Action Program (UMTRAP). The purpose of the ISC is to survey designated sites potentially contaminated with radioactive material originating from the 24 inactive uranium mill sites and make recommendations as to whether the site should be included in or excluded from further consideration by UMTRAP. An important aspect of the program is a prompt and inexpensive estimation of Radium-226 (226Ra) concentration in soil samples. A large sodium iodide (NaI) well crystal coupled to a multichannel analyzer is used to count soil samples. Count data are currently analyzed with an algorithm that utilizes three regions of interest (ROI). A lack of agreement was observed when samples were also analyzed with lithium-drifted germanium (GeLi) spectrometers. The average estimate of 226Ra obtained using the current algorithm was 19% greater than the GeLi determination. Some possible reasons for these differences were examined. In 8.5% of the samples, the relative concentration of Cesium-137 (137Cs) was highly correlated to the extent of error. Using alternative analysis techniques, the error for 226Ra estimations may be reduced by a factor of 2 for randomly selected samples and by a factor of 4 for samples containing high concentrations of 137Cs relative to the concentrations of 226Ra. 9 refs., 4 figs., 3 tabs

  13. Transfer of radium-226 from soil to rice. A comparison of sampling area differences

    Due to limited numbers of radium-226 (226Ra) soil-to-plant transfer data, it has been difficult to analyze the sampling area differences. In this study, we measured 226Ra concentrations in brown rice and associated soils collected from 61 locations throughout Japan and obtained soil-to-rice transfer factors (TFs). Concentrations of 226Ra in the soils collected in southwestern Japan were higher than those in northeastern Japan (t-test, p226Ra in southwestern Japan was 40.4 Bq/kg-dry (N=33) and it was 27.8 Bq/kg (N=28) in northeastern Japan, reflecting geological differences between these areas. Using the measured data, we compared TFs in these two areas and found no difference, i.e., the GM in southwest was 4.6x10-4 and it was 4.9x10-4 in northeast. The observed TFs were about one order of magnitude lower than the previously reported TF values for cereals (maize, wheat, and rice), but in the same range for previously reported data for white rice. Among the alkaline earth metals, TF for Ba was well correlated to TF for Ra, but because Ba and Ra concentrations in brown rice were highly correlated, the TF would also be expected to correlate. (author)

  14. Life-span studies in 226Ra-injected animals: Effect of low doses, effect of a decorporative treatment

    A life-span radiation effects study was performed in mice injected with several doses of 226Ra. The study included 788 male C57Bl mice. For the removal of the 226Ra, half the mice were treated daily with a diet 5% of which was sodium-alginate. The experiment revealed that mice that received the lowest dose of 226Ra lived significantly longer than controls, and, despite appreciable skeletal removal of 226Ra as a result of decorporative treatment, no biological benefit was observed in treated animals. 19 refs., 4 figs., 3 tabs

  15. Bioaccumulation of 226Ra by plants growing in fresh water ecosystem around the uranium industry at Jaduguda, India

    A field study has been conducted to evaluate the 226Ra bioaccumulation among aquatic plants growing in the stream/river adjoining the uranium mining and ore-processing complex at Jaduguda, India. Two types of plant group have been investigated namely free floating algal species submerged into water and plants rooted in stream and riverbed. The highest 226Ra activity concentration (9850 Bq kg-1) was found in filamentous algae growing in the residual water of tailings pond. The concentration ratios of 226Ra in filamentous algae (activity concentration of 226Ra in plant Bq kg-1 fresh weight/activity concentration of 226Ra in water Bq l-1) widely varied i.e. from 1.1 x 103 to 8.6 x 104. Other aquatic plants were also showing wide variability in the 226Ra activity concentration. The ln-transformed filamentous algae 226Ra activity concentration was significantly correlated with that of ln-transformed water concentration (r = 0.89, p 226Ra in stream/riverbed rooted plants and the substrate. For this group, correlation between 226Ra activity concentration and Mn, Fe, Cu concentration in plants were statistically significant.

  16. 224Ra and 226Ra experimentally induced dental changes in rats

    Sprague-Dawley rats received intragastrically a single dose of 226Ra or 224Ra once weekly for 21 weeks. During this period the animals of both groups were thus exposed to comparable doses. After 12 weeks, a shortening of the maxillary incisors was observed, and this progressed during the course of the 55-week experiment. Radiologically, a loss of pulpal transparency and an apical irregular opacity in the maxillary incisors were demonstrable. Histologically, dysplastic changes of the maxillary incisors and multiple resorptions at the cemento-enamel junction of the molars were seen. The observed alterations were more pronounced in the 226Ra group than in the 224Ra treated group. The experimentally induced resorptions were comparable to those observed in patients who had incorporated 224Ra or 226Ra. Clinical, radiological, histological, γspecrometrical, and autoradiographical findings, as well as dose-estimations, are described. (author)

  17. Systematic study of heavy cluster emission from {210-226}^Ra isotopes

    Santhosh, K P; Priyanka, B; Unnikrishnan, M S

    2012-01-01

    The half lives for various clusters lying in the cold reaction valleys of {210-226}^Ra isotopes are computed using our Coulomb and proximity potential model (CPPM). The computed half lives of 4^He and 14^C clusters from {210-226}^Ra isotopes are in good agreement with experimental data. Half lives are also computed using the Universal formula for cluster decay (UNIV) of Poenaru et al., and are found to be in agreement with CPPM values. Our study reveals the role of doubly magic 208^Pb daughter in cluster decay process. Geiger - Nuttall plots for all clusters up to 62^Fe are studied and are found to be linear with different slopes and intercepts. {12,14}^C emission from 220^Ra; 14^C emission from {222,224}^Ra; 14^C and 20^O emission from 226^Ra are found to be most favourable for measurement and this observation will serve as a guide to the future experiments.

  18. Naturally enhanced radium-226 at the Hammam Pharaon hot spring area

    A radiological study was conducted for Hammam Pharaon hot spring and the surrounding area. The naturally occurring 226Ra was determined using HpGe spectrometer. Gamma emissions 351.9 keV of the 214Pb and 609.3 keV, 1120.3 keV and 1764.5 keV of the 214Bi, in equilibrium with their 226Ra parent were used to calculate its specific activity in the water, soil and rock samples. The analysis revealed the presence of some hot spots in the studied area. Elevated values of 226Ra were found to be as high as 32,000 Bq/kg (∼ 0.9 nCi/gm). The absorbed dose rates, hazard indices, and radium equivalent values were calculated on the basis of the results obtained. The resulted high doses due to the elevated radium content necessitate controlled recreational activities in this area

  19. The concentrations of 226 Ra and 210 Pb in food cultivated in Pocos de Caldas

    The aim of this study is to determine the average concentrations of 226 Ra and 210 Pb in vegetables widely cultivated in the region, mainly potatoes, carrots, beans and corn which are the main agricultural products (considering production and human consume) in the region and estimation of the average transfer factors soil-foodstuff for both radionuclides. The total 226 Ra and 210 Pb content in the soil was determined by gamma spectrometry. The exchangeable fraction was obtained by ammonium acetate solution extraction. The 226 Ra was analysed by the classical radon emanation procedure and the 210 Pb was isolated by a radiochemical procedure and determined by radiometry of its daughter 210 Bi beta emissions with a Geiger Mueller counter. (author)

  20. 238U, 226Ra and 210Pb in some vent waters of the Galapagos spreading center

    The concentrations of 226Ra, 238U and 210Pb have been measured in waters from the Mussel Bed and the Rose Garden thermal fields at the Galapagos spreading center over a temperature range of approx.2.5--16 0C. The 226Ra-T plots yield slopes of 0.112 and 0.036 dpm/kg 0C for the Mussel Bed and the Rose Garden respectively yielding a global hydrothermal 226Ra flux less than 5% of that required to sustain the oceanic inventory. 238U concentration in waters 0C is the same as that in ambient sea water whereas water hotter than approx.9 0C shows a decreasing trend with temperature to zero 238U at approx.29 0C. 210Pb concentration in Mussel Bed increases with temperature, and extrapolated to approx.350 0C yields a 210Pb concentration considerably less than that expected from 222Rn decay and basalt alteration

  1. Summary of dosimetry, pathology, and dose response for bone sarcomas in beagles injected with radium-226

    In the completed 226Ra portion of a 30-year-long experiment to determine the relative radiotoxicity of injected 226Ra and 239Pu, 42 of 116 animals injected with 226Ra developed 63 bone sarcomas; none were observed in 44 controls. Average alpha plus beta dose to the skeleton to death was calculated on the basis of mathematical functions developed from sequential measurements of radium and radon retention in each dog. Bone sarcomas were identified radiographically or clinically, with subsequent histopathological confirmation and classification. Most primary bone tumors were classified as osteosarcomas if osteoid arose from a malignant stroma. The dose-response curve over the six lowest injected dose levels fits well to a linear, no-threshold, least squares fit, through a control incidence of 0.8%, and with a slope of 0.042% incidence per rad. 19 refs., 5 figs., 2 tabs

  2. 226Ra and 228Ra in consumable marine organisms from different coastal regions of India

    Marine organism samples were collected from different regions of India. The edible portions after drying and homogenizing kept for 1 month to achieve equilibrium between Radium and its daughter products, were analysed by gamma spectrometry using 50 % HPGe. 226Ra activity was found to be in the range of <0.07-0.736 Bq kg-1 (wet) and 228Ra in the range of <0.082-2.5 Bq kg-1. 228Ra and 226Ra concentrations in different species of organism were different even in the same marine environment. To assess the impact of this activity to human, ingestion dose due to consumption of organisms was calculated and the maximum dose of 2.8 μSv year-1 due to 226Ra and 25.24 μSv year-1 due to 228Ra was observed. (author)

  3. Diffusion of 226Ra and 4K radionuclides reproduced in underwater sedimentary columns in laboratory

    The potential radiological impact of the increase of radioactive substances in the environment makes interesting the study of the migration of the contaminant radionuclides in soils and sediments, which are the last receiver system of these substances. By using a battery of sedimentary columns controlled in the laboratory, the diffusion of the 226Ra and 4K radionuclides has been studied, assessing their respective effective diffusion coefficients in a similar sedimentary medium. A decreasing temporal evolution is obtained, associated to the progressive 'fixation' of the radionuclides by the clay minerals of the sediment, followed by a constant tendency. A timescale of the 'fixation' by the sediment is determined, being of the order of days for 226Ra and of the order of months for 4K, so the progressive 'fixation' of 4K by the clay minerals of the sediments is slower than in the case of 226Ra

  4. Sorption properties of peat for U(VI) and 226Ra in U mining areas

    Understanding the environmental behavior of U and 226Ra is important for remediation of former mining sites and assessment of their durability. The aim of this study is to determine the sorption properties of an acidic peat for U and 226Ra, located near a former U mine. A 90% retention of U over a pH range of 3 to 10 was observed in Na-conditioned peat samples issued from the mesotelm, with a Rd between 1000 and 12000 mL/g. It seems that U sorption in peat is not only governed by organic matter. The Kd for 226Ra adsorption increases with pH from zero to 4849 mL/g. However in this mining environment, the peat bog proved to be significantly impacted by anthropogenic activities, with the presence of detrital components in the peat material that can also contribute to U and Ra sorption. (authors)

  5. Adsorption of 241Am and 226Ra from natural water by wood charcoal

    The adsorption of 241Am and 226Ra from natural water by a granulated wood charcoal was investigated as a function of the solution pH, in the range 4-10, and of the water flow, in the range 3.5-42 cm3/min. The percentage adsorption of 241Am (fairly constant at >80% for all pHs) was greater than that of 226Ra (which increased with increasing pH from ∼40% up to >80%). The results are explained by considering the different species of each radionuclide present at the pH values of the solution at the end of the adsorbent column, and the pH of the point of zero charge of the adsorbent. At pH 6, the elimination of 241Am from natural water was independent of the water flow, while the elimination of 226Ra declined linearly as the flow rate was increased

  6. Ra-226 concentrations in otter, Lutra canadensis, trapped near uranium tailings at Elliot Lake, Ontario

    The Elliot Lake area of Ontario, is currently the major uranium producing region of Canada. It is estimated there are 120 million tons of uranium tailings spread over 600 ha in the vicinity of Elliot Lake. The transfer and fate of uranium-series radionuclides from tailing sites remain primary ecological concerns in these areas. It has been demonstrated that the levels of radionuclides, including Ra-226, are elevated in vegetation, small mammals and fish living on or near tailing disposal sites. However, the transfer potential of Ra-226 to predatory species has not been examined in detail. The objective of this study was to measure Ra-226 levels in otters (Lutra canadensis), captured near tailing sites, to provide further information on the fate of radionuclides in the environment

  7. Radiological impact from atmospheric releases of 238U and 226Ra from phosphate rock processing plants

    Phosphate rocks are used extensively, mainly as a source of phosphorus for fertilizers and secondly for phosphoric acid and gypsum (phosphogypsum). Phosphates are, therefore one of the sources of technologically enhanced exposure to man from natural radionuclides (TENR). Emissions from phosphate rocks processing plants in gaseous and particulate form contain radioisotopes, such as 238U and 226Ra, which are discharged into the environment causing radiation exposures to the population. About 10 MBq of 238U and 226Ra, respectively, are discharged to the environment each year from a phosphate rocks processing plant in Thessaloniki area, Northern Greece. The collective dose commitment to lung tissue resulting from atmospheric release was estimated to be ∼2x10-9 man Gy t-1 for 238U and ∼0.1x10-9 Plan Gy t-1 for 226Ra, i.e. about 2 times higher than that reported in UNSCEAR 1992 Report. (author)

  8. Distribution and flux of 226Ra and 228Ra in the Amazon River estuary

    Measurements of 226Ra and 228Ra in the Amazon River estuary show that desorption from riverborne suspended particulate matter in the estuary increases the riverine flux of both isotopes to the ocean by a factor of approximately 5 over the flux attributable to radium dissolved in the river water alone. The total Amazon flux supplies approximately 0.20% of the 226Ra and approximately 2.6% of the 228Ra standing crops in the near-surface Atlantic (0-200 m). Diffusive flux from estuarine and shelf sediments and desorption from resuspended sediments in the region of the estuary approximately double the estuarine 226Ra concentration and quadruple the estuarine 228Ra concentration above that caused by the dissolved and desorbed river components alone

  9. Specific activities of radium-226 in vegetables grown in Na Mom District, Songkhla Province

    Angkunrat, S.

    2007-09-01

    Full Text Available Specific activity of radium-226 in 13 types of vegetables grown in Namom district, Songkhla province, were analyzed using a low background gamma-ray spectrometer. The analyzed vegetables included Ivy Gourd, Yellow Cassia, White Popinac, Yard Long Bean, Rice, Peanut, Egg Plant, Spineless Amaranth, Swamp Cabbage, Mustart, Chinese Cabbage, Collards and Cucumbers. The control vegetables were taken from Bangklum district, 40 km south of Namom district. The samples were weighed, dried in an oven and finally burnt to ash in a furnace before being analyzed for a gamma ray of 186.2 keV emitted from Radium-226. The results showed that the geometrical means of specific activity of radium-226 of vegetables grown in Pijit, Namom, Klongrang and Thungkamin sub-district and over the Namom district were 1082, 1220, 1457, 1253 and 1250 mBq/kg, respectively. The highest and lowest values were 7882 and 26 mBq/kg, found in Ivy Gourd and Yard Long Bean, respectively. The high specific activities of radium-226 in vegetables were found to be distributed uniformly in the area. This probably indicated the source of radium-226 was also distributed uniformly in the shallow granitic bedrock throughout the area. We concluded that the radium-226 contents in vegetables grown in Namom district depended on the absorbability of alkaline earth metals in vegetables themselves, geographic features and radium content in natural water in the area. The estimated annual effective dose averaged over Namom district was 21 μSv. Consumption of Ivy Gourd may receive the maximum annual effective dose of 132 μSv.

  10. Radium-226 dose to a boy from playing on mill tailings

    Two boys born in September 1949 played on uranium mill tailings from about ages 8 to 12. One of these boys was diagnosed as having leukemia at age 15.5. The 226Ra body burden of the survivor was measured at age 38. The whole-body 226Ra content measured by counting in vivo was 0 ± 17 Bq and independently by Rn breath analysis as 4.3 ± 2.1 Bq. At the same time, a control subject with no known exposure to 226Ra, matched in age, height, and weight, was also measured. The whole-body content was estimated as 4 ± 15 Bq and independently by Rn breath analysis as 5.5 ± 3.7 Bq. The body burden of the control subject was not significantly different from that of the exposed person. The radiation dose to the marrow-free skeleton assuming a constant 226Ra:Ca ratio since birth was 0.49 and 1.33 mGy at ages 14 and 38, respectively. The radiation dose to the marrow-free skeleton assuming 226Ra intake only between ages 8 to 12 was 1.4 and 2.8 mGy at ages 14 and 38, respectively. The best estimate is the mean of these two estimates: 0.9 and 2.1 mGy at ages 14 and 38, respectively. The alpha-particle dose to the red marrow from 226Ra and its decay products was 0.05 mGy at age 14 and 0.10 mGy at age 38. Since no excess was found for the radium dial painters whose doses were much higher, the induction of leukemia by doses of this magnitude would seem quite unlikely