WorldWideScience

Sample records for window-based peak identification

  1. Peak thrust operation of linear induction machines from parameter identification

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Z.; Eastham, T.R.; Dawson, G.E. [Queen`s Univ., Kingston, Ontario (Canada). Dept. of Electrical and Computer Engineering

    1995-12-31

    Various control strategies are being used to achieve high performance operation of linear drives. To maintain minimum volume and weight of the power supply unit on board the transportation vehicle, peak thrust per unit current operation is a desirable objective. True peak thrust per unit current through slip control is difficult to achieve because the parameters of linear induction machines vary during normal operation. This paper first develops a peak thrust per unit current control law based on the per-phase equivalent circuit for linear induction machines. The algorithm for identification of the variable parameters in induction machines is then presented. Application to an operational linear induction machine (LIM) demonstrates the utility of this algorithm. The control strategy is then simulated, based on an operational transit LIM, to show the capability of achieving true peak thrust operation for linear induction machines.

  2. Identification of peaks in multidimensional coincidence {gamma}-ray spectra

    Energy Technology Data Exchange (ETDEWEB)

    Morhac, Miroslav E-mail: fyzimiro@savba.sk; Kliman, Jan; Matousek, Vladislav; Veselsky, Martin; Turzo, Ivan

    2000-03-21

    In the paper a new algorithm to find peaks in two, three and multidimensional spectra, measured in large multidetector {gamma}-ray arrays, is derived. Given the dimension m, the algorithm is selective to m-fold coincidence peaks. It is insensitive to intersections of lower-fold coincidences, hereinafter called ridges.

  3. Identification of peaks in multidimensional coincidence γ-ray spectra

    International Nuclear Information System (INIS)

    Morhac, Miroslav; Kliman, Jan; Matousek, Vladislav; Veselsky, Martin; Turzo, Ivan

    2000-01-01

    In the paper a new algorithm to find peaks in two, three and multidimensional spectra, measured in large multidetector γ-ray arrays, is derived. Given the dimension m, the algorithm is selective to m-fold coincidence peaks. It is insensitive to intersections of lower-fold coincidences, hereinafter called ridges

  4. Study on the man-operator characteristics in the peak identification problem in line spectra

    International Nuclear Information System (INIS)

    Gopych, P.M.; Sorokin, V.I.; Sotnikov, V.V.

    1992-01-01

    ATOS program complex (automatical test spectra processing) realizing all stages of investigation necessary to obtain qualitative characteristics of the man-operator in the peak identification problem is developed. Qualitative characteristics of identitication ion quality of peaks by operators searching for peaks in line spectra are determined due to simulation experiment. It is shown, that for trained operators reference possibility of false detection of peaks is equal to F=0.012±0.004, while for untrained ones - F≅0.3. Comparison of results with analogous data on on-line programs for identification of peaks in γ-spectra is conducted

  5. Peak fitting and identification software library for high resolution gamma-ray spectra

    International Nuclear Information System (INIS)

    Uher, Josef; Roach, Greg; Tickner, James

    2010-01-01

    A new gamma-ray spectral analysis software package is under development in our laboratory. It can be operated as a stand-alone program or called as a software library from Java, C, C++ and MATLAB TM environments. It provides an advanced graphical user interface for data acquisition, spectral analysis and radioisotope identification. The code uses a peak-fitting function that includes peak asymmetry, Compton continuum and flexible background terms. Peak fitting function parameters can be calibrated as functions of energy. Each parameter can be constrained to improve fitting of overlapping peaks. All of these features can be adjusted by the user. To assist with peak identification, the code can automatically measure half-lives of single or multiple overlapping peaks from a time series of spectra. It implements library-based peak identification, with options for restricting the search based on radioisotope half-lives and reaction types. The software also improves the reliability of isotope identification by utilizing Monte-Carlo simulation results.

  6. Fast Metabolite Identification in Nuclear Magnetic Resonance Metabolomic Studies: Statistical Peak Sorting and Peak Overlap Detection for More Reliable Database Queries.

    Science.gov (United States)

    Hoijemberg, Pablo A; Pelczer, István

    2018-01-05

    A lot of time is spent by researchers in the identification of metabolites in NMR-based metabolomic studies. The usual metabolite identification starts employing public or commercial databases to match chemical shifts thought to belong to a given compound. Statistical total correlation spectroscopy (STOCSY), in use for more than a decade, speeds the process by finding statistical correlations among peaks, being able to create a better peak list as input for the database query. However, the (normally not automated) analysis becomes challenging due to the intrinsic issue of peak overlap, where correlations of more than one compound appear in the STOCSY trace. Here we present a fully automated methodology that analyzes all STOCSY traces at once (every peak is chosen as driver peak) and overcomes the peak overlap obstacle. Peak overlap detection by clustering analysis and sorting of traces (POD-CAST) first creates an overlap matrix from the STOCSY traces, then clusters the overlap traces based on their similarity and finally calculates a cumulative overlap index (COI) to account for both strong and intermediate correlations. This information is gathered in one plot to help the user identify the groups of peaks that would belong to a single molecule and perform a more reliable database query. The simultaneous examination of all traces reduces the time of analysis, compared to viewing STOCSY traces by pairs or small groups, and condenses the redundant information in the 2D STOCSY matrix into bands containing similar traces. The COI helps in the detection of overlapping peaks, which can be added to the peak list from another cross-correlated band. POD-CAST overcomes the generally overlooked and underestimated presence of overlapping peaks and it detects them to include them in the search of all compounds contributing to the peak overlap, enabling the user to accelerate the metabolite identification process with more successful database queries and searching all tentative

  7. Binomial probability distribution model-based protein identification algorithm for tandem mass spectrometry utilizing peak intensity information.

    Science.gov (United States)

    Xiao, Chuan-Le; Chen, Xiao-Zhou; Du, Yang-Li; Sun, Xuesong; Zhang, Gong; He, Qing-Yu

    2013-01-04

    Mass spectrometry has become one of the most important technologies in proteomic analysis. Tandem mass spectrometry (LC-MS/MS) is a major tool for the analysis of peptide mixtures from protein samples. The key step of MS data processing is the identification of peptides from experimental spectra by searching public sequence databases. Although a number of algorithms to identify peptides from MS/MS data have been already proposed, e.g. Sequest, OMSSA, X!Tandem, Mascot, etc., they are mainly based on statistical models considering only peak-matches between experimental and theoretical spectra, but not peak intensity information. Moreover, different algorithms gave different results from the same MS data, implying their probable incompleteness and questionable reproducibility. We developed a novel peptide identification algorithm, ProVerB, based on a binomial probability distribution model of protein tandem mass spectrometry combined with a new scoring function, making full use of peak intensity information and, thus, enhancing the ability of identification. Compared with Mascot, Sequest, and SQID, ProVerB identified significantly more peptides from LC-MS/MS data sets than the current algorithms at 1% False Discovery Rate (FDR) and provided more confident peptide identifications. ProVerB is also compatible with various platforms and experimental data sets, showing its robustness and versatility. The open-source program ProVerB is available at http://bioinformatics.jnu.edu.cn/software/proverb/ .

  8. Displaced spectra techniques as a tool for peak identification in PSD-analysis

    International Nuclear Information System (INIS)

    Pineyro, J.; Behringer, K.

    1987-10-01

    Sharp peaks in the power spectral density function can be due to periodic components in the noise signal or due to narrowband random contributions. A novel method based on Fourier transform techniques is presented which allows under certain limitations to identify the peak type. (author)

  9. IDENTIFICATIONS PEAK HOURS ON INTERSECTIONS SET IN BIELSKO-BIAŁA CITY

    Directory of Open Access Journals (Sweden)

    Marcin KŁOS

    2016-03-01

    Full Text Available Traffic flow in cities is usually examined locally. This method is not effective for through traffic analysis. The paper discusses the problem of determining peak traffic hours taking into account vehicle distributions. Peak hours represent time periods of traffic flow which demand special treatment by traffic control systems. This is particularly important in the case of ITS. High values of traffic flow require relieving actions not only at the junctions but preferably along the transit routes. The north-south transit route in Bielsko-Biała was chosen for analysis. Instead of the usual two distinct peaks it is determined that the traffic flow is characterised by five peaks. This pattern is the result of specific location of the route, which links residential areas, industrial zones and shopping centres besides carrying through traffic. This multi peak graph more accurately models the traffic flow.

  10. Identification of Raman peaks of high-Tc cuprates in normal state through density of states

    International Nuclear Information System (INIS)

    Bishoyi, K.C.; Rout, G.C.; Behera, S.N.

    2007-01-01

    We present a microscopic theory to explain and identify the Raman spectral peaks of high-T c cuprates R 2-x M x CuO 4 in the normal state. We used electronic Hamiltonian prescribed by Fulde in presence of anti-ferromagnetism. Phonon interaction to the hybridization between the conduction electrons of the system and the f-electrons has been incorporated in the calculation. The phonon spectral density is calculated by the Green's function technique of Zubarev at zero wave vector and finite (room) temperature limit. The four Raman active peaks (P 1 -P 4 ) representing the electronic states of the atomic sub-systems of the cuprate system are identified by the calculated quasi-particle energy bands and electron density of states (DOS). The effect of interactions on these peaks are also explained

  11. Rapid and accurate identification of isolates of Candida species by melting peak and melting curve analysis of the internally transcribed spacer region 2 fragment (ITS2-MCA)

    NARCIS (Netherlands)

    Decat, E.; van Mechelen, E.; Saerens, B.; Vermeulen, S.J.T.; Boekhout, T.; de Blaiser, S.; Vaneechoutte, M.; Deschaght, P.

    2013-01-01

    Rapid identification of clinically important yeasts can facilitate the initiation of anti-fungal therapy, since susceptibility is largely species-dependent. We evaluated melting peak and melting curve analysis of the internally transcribed spacer region 2 fragment (ITS2-MCA) as an identification

  12. A window-based time series feature extraction method.

    Science.gov (United States)

    Katircioglu-Öztürk, Deniz; Güvenir, H Altay; Ravens, Ursula; Baykal, Nazife

    2017-10-01

    This study proposes a robust similarity score-based time series feature extraction method that is termed as Window-based Time series Feature ExtraCtion (WTC). Specifically, WTC generates domain-interpretable results and involves significantly low computational complexity thereby rendering itself useful for densely sampled and populated time series datasets. In this study, WTC is applied to a proprietary action potential (AP) time series dataset on human cardiomyocytes and three precordial leads from a publicly available electrocardiogram (ECG) dataset. This is followed by comparing WTC in terms of predictive accuracy and computational complexity with shapelet transform and fast shapelet transform (which constitutes an accelerated variant of the shapelet transform). The results indicate that WTC achieves a slightly higher classification performance with significantly lower execution time when compared to its shapelet-based alternatives. With respect to its interpretable features, WTC has a potential to enable medical experts to explore definitive common trends in novel datasets. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. A Parzen window-based approach for the detection of locally enriched transcription factor binding sites.

    Science.gov (United States)

    Vandenbon, Alexis; Kumagai, Yutaro; Teraguchi, Shunsuke; Amada, Karlou Mar; Akira, Shizuo; Standley, Daron M

    2013-01-21

    Identification of cis- and trans-acting factors regulating gene expression remains an important problem in biology. Bioinformatics analyses of regulatory regions are hampered by several difficulties. One is that binding sites for regulatory proteins are often not significantly over-represented in the set of DNA sequences of interest, because of high levels of false positive predictions, and because of positional restrictions on functional binding sites with regard to the transcription start site. We have developed a novel method for the detection of regulatory motifs based on their local over-representation in sets of regulatory regions. The method makes use of a Parzen window-based approach for scoring local enrichment, and during evaluation of significance it takes into account GC content of sequences. We show that the accuracy of our method compares favourably to that of other methods, and that our method is capable of detecting not only generally over-represented regulatory motifs, but also locally over-represented motifs that are often missed by standard motif detection approaches. Using a number of examples we illustrate the validity of our approach and suggest applications, such as the analysis of weaker binding sites. Our approach can be used to suggest testable hypotheses for wet-lab experiments. It has potential for future analyses, such as the prediction of weaker binding sites. An online application of our approach, called LocaMo Finder (Local Motif Finder), is available at http://sysimm.ifrec.osaka-u.ac.jp/tfbs/locamo/.

  14. Identification of a PEAK1/ZEB1 signaling axis during TGFβ/fibronectin-induced EMT in breast cancer

    Energy Technology Data Exchange (ETDEWEB)

    Agajanian, Megan; Runa, Farhana; Kelber, Jonathan A., E-mail: jonathan.kelber@csun.edu

    2015-09-25

    Transforming Growth Factor beta (TGFβ) is the archetypal member of the TGFβ superfamily of ligands and has pleiotropic functions during normal development, adult tissue homeostasis and pathophysiological processes such as cancer. In epithelial cancers TGFβ signaling can either suppress tumor growth or promote metastasis via the induction of a well-characterized epithelial–mesenchymal transition (EMT) program. We recently reported that PEAK1 kinase mediates signaling cross talk between TGFβ receptors and integrin/Src/MAPK pathways and functions as a critical molecular regulator of TGFβ-induced breast cancer cell proliferation, migration, EMT and metastasis. Here, we examined the breast cancer cell contexts in which TGFβ induces both EMT and PEAK1, and discovered this event to be unique to oncogene-transformed mammary epithelial cells and triple-negative breast cancer cells. Using the Cancer BioPortal database, we identified PEAK1 co-expressors across multiple malignancies that are also common to the TGFβ response gene signature (TBRS). We then used the ScanSite database to identify predicted protein–protein binding partners of PEAK1 and the PEAK1-TBRS co-expressors. Analysis of the Cytoscape interactome and Babelomics-derived gene ontologies for a novel gene set including PEAK1, CRK, ZEB1, IL11 and COL4A1 enabled us to hypothesize that PEAK1 may be regulating TGFβ-induced EMT via its interaction with or regulation of these other genes. In this regard, we have demonstrated that PEAK1 is necessary for TGFβ to induce ZEB1-mediated EMT in the context of fibronectin/ITGB3 activation. These studies and future mechanistic studies will pave the way toward identifying the context in which TGFβ blockade may significantly improve breast cancer patient outcomes. - Highlights: • PEAK1 is upregulated in mammary epithelial cells during TGFβ-induced EMT. • TGFβ-induced EMT upregulates PEAK1 in triple negative breast cancer. • PEAK1 is necessary for TGF

  15. From benchmarking HITS-CLIP peak detection programs to a new method for identification of miRNA-binding sites from Ago2-CLIP data.

    Science.gov (United States)

    Bottini, Silvia; Hamouda-Tekaya, Nedra; Tanasa, Bogdan; Zaragosi, Laure-Emmanuelle; Grandjean, Valerie; Repetto, Emanuela; Trabucchi, Michele

    2017-05-19

    Experimental evidence indicates that about 60% of miRNA-binding activity does not follow the canonical rule about the seed matching between miRNA and target mRNAs, but rather a non-canonical miRNA targeting activity outside the seed or with a seed-like motifs. Here, we propose a new unbiased method to identify canonical and non-canonical miRNA-binding sites from peaks identified by Ago2 Cross-Linked ImmunoPrecipitation associated to high-throughput sequencing (CLIP-seq). Since the quality of peaks is of pivotal importance for the final output of the proposed method, we provide a comprehensive benchmarking of four peak detection programs, namely CIMS, PIPE-CLIP, Piranha and Pyicoclip, on four publicly available Ago2-HITS-CLIP datasets and one unpublished in-house Ago2-dataset in stem cells. We measured the sensitivity, the specificity and the position accuracy toward miRNA binding sites identification, and the agreement with TargetScan. Secondly, we developed a new pipeline, called miRBShunter, to identify canonical and non-canonical miRNA-binding sites based on de novo motif identification from Ago2 peaks and prediction of miRNA::RNA heteroduplexes. miRBShunter was tested and experimentally validated on the in-house Ago2-dataset and on an Ago2-PAR-CLIP dataset in human stem cells. Overall, we provide guidelines to choose a suitable peak detection program and a new method for miRNA-target identification. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  16. Identification of a common single nucleotide polymorphism at the primer binding site of D2S1360 that causes heterozygote peak imbalance when using the Investigator HDplex Kit.

    Science.gov (United States)

    Inokuchi, Shota; Yamashita, Yasuhiro; Nishimura, Kazuma; Nakanishi, Hiroaki; Saito, Kazuyuki

    2017-11-01

    Phenomena known as null alleles and peak imbalance can occur because of mutations in the primer binding sites used for DNA typing. In these cases, an accurate statistical evaluation of DNA typing is difficult. The estimated likelihood ratio is incorrectly calculated because of the null allele and allele dropout caused by mutation-induced peak imbalance. Although a number of studies have attempted to uncover examples of these phenomena, few reports are available on the human identification kit manufactured by Qiagen. In this study, 196 Japanese individuals who were heterozygous at D2S1360 were genotyped using an Investigator HDplex Kit with optimal amounts of DNA. A peak imbalance was frequently observed at the D2S1360 locus. We performed a sequencing analysis of the area surrounding the D2S1360 repeat motif to identify the cause for peak imbalance. A point mutation (G>A transition) 136 nucleotides upstream from the D2S1360 repeat motif was discovered in a number of samples. The allele frequency of the mutation was 0.0566 in the Japanese population. Therefore, human identification or kinship testing using the Investigator HDplex Kit requires caution because of the higher frequency of single nucleotide polymorphisms at the primer binding site of D2S1360 locus in the Japanese population.

  17. Identification of Raman peaks of high-T{sub c} cuprates in normal state through density of states

    Energy Technology Data Exchange (ETDEWEB)

    Bishoyi, K.C. [P.G. Department of Physics, F.M. College (Auto.), Balasore 756 001 (India)]. E-mail: bishoyi@iopb.res.in; Rout, G.C. [Condensed Matter Physics Group, Govt. Science College, Chatrapur 761 020, Orissa (India); Behera, S.N. [Physics Enclave, H.I.G.-23/1, Housing Board Phase-I, Chandrasekharpur, Bhubaneswar 7510016 (India)

    2007-05-31

    We present a microscopic theory to explain and identify the Raman spectral peaks of high-T{sub c} cuprates R{sub 2-x}M{sub x}CuO{sub 4} in the normal state. We used electronic Hamiltonian prescribed by Fulde in presence of anti-ferromagnetism. Phonon interaction to the hybridization between the conduction electrons of the system and the f-electrons has been incorporated in the calculation. The phonon spectral density is calculated by the Green's function technique of Zubarev at zero wave vector and finite (room) temperature limit. The four Raman active peaks (P{sub 1}-P{sub 4}) representing the electronic states of the atomic sub-systems of the cuprate system are identified by the calculated quasi-particle energy bands and electron density of states (DOS). The effect of interactions on these peaks are also explained.

  18. Peak radiated power measurement of the DOE Mark II container tag with integrated ST-676 sensor radio frequency identification device.

    Energy Technology Data Exchange (ETDEWEB)

    Jursich, Mark

    2010-04-01

    The total peak radiated power of the Department of Energy Mark II container tag was measured in the electromagnetic reverberation chamber facility at Sandia National Laboratories. The tag's radio frequency content was also evaluated for possible emissions outside the intentional transmit frequency band. No spurious emissions of any significance were found, and the radiated power conformed to the manufacturer's specifications.

  19. A new method for the determination of peak distribution across a two-dimensional separation space for the identification of optimal column combinations.

    Science.gov (United States)

    Leonhardt, Juri; Teutenberg, Thorsten; Buschmann, Greta; Gassner, Oliver; Schmidt, Torsten C

    2016-11-01

    For the identification of the optimal column combinations, a comparative orthogonality study of single columns and columns coupled in series for the first dimension of a microscale two-dimensional liquid chromatographic approach was performed. In total, eight columns or column combinations were chosen. For the assessment of the optimal column combination, the orthogonality value as well as the peak distributions across the first and second dimension was used. In total, three different methods of orthogonality calculation, namely the Convex Hull, Bin Counting, and Asterisk methods, were compared. Unfortunately, the first two methods do not provide any information of peak distribution. The third method provides this important information, but is not optimal when only a limited number of components are used for method development. Therefore, a new concept for peak distribution assessment across the separation space of two-dimensional chromatographic systems and clustering detection was developed. It could be shown that the Bin Counting method in combination with additionally calculated histograms for the respective dimensions is well suited for the evaluation of orthogonality and peak clustering. The newly developed method could be used generally in the assessment of 2D separations. Graphical Abstract ᅟ.

  20. Enhanced Isotopic Ratio Outlier Analysis (IROA Peak Detection and Identification with Ultra-High Resolution GC-Orbitrap/MS: Potential Application for Investigation of Model Organism Metabolomes

    Directory of Open Access Journals (Sweden)

    Yunping Qiu

    2018-01-01

    Full Text Available Identifying non-annotated peaks may have a significant impact on the understanding of biological systems. In silico methodologies have focused on ESI LC/MS/MS for identifying non-annotated MS peaks. In this study, we employed in silico methodology to develop an Isotopic Ratio Outlier Analysis (IROA workflow using enhanced mass spectrometric data acquired with the ultra-high resolution GC-Orbitrap/MS to determine the identity of non-annotated metabolites. The higher resolution of the GC-Orbitrap/MS, together with its wide dynamic range, resulted in more IROA peak pairs detected, and increased reliability of chemical formulae generation (CFG. IROA uses two different 13C-enriched carbon sources (randomized 95% 12C and 95% 13C to produce mirror image isotopologue pairs, whose mass difference reveals the carbon chain length (n, which aids in the identification of endogenous metabolites. Accurate m/z, n, and derivatization information are obtained from our GC/MS workflow for unknown metabolite identification, and aids in silico methodologies for identifying isomeric and non-annotated metabolites. We were able to mine more mass spectral information using the same Saccharomyces cerevisiae growth protocol (Qiu et al. Anal. Chem 2016 with the ultra-high resolution GC-Orbitrap/MS, using 10% ammonia in methane as the CI reagent gas. We identified 244 IROA peaks pairs, which significantly increased IROA detection capability compared with our previous report (126 IROA peak pairs using a GC-TOF/MS machine. For 55 selected metabolites identified from matched IROA CI and EI spectra, using the GC-Orbitrap/MS vs. GC-TOF/MS, the average mass deviation for GC-Orbitrap/MS was 1.48 ppm, however, the average mass deviation was 32.2 ppm for the GC-TOF/MS machine. In summary, the higher resolution and wider dynamic range of the GC-Orbitrap/MS enabled more accurate CFG, and the coupling of accurate mass GC/MS IROA methodology with in silico fragmentation has great

  1. Enhanced Isotopic Ratio Outlier Analysis (IROA) Peak Detection and Identification with Ultra-High Resolution GC-Orbitrap/MS: Potential Application for Investigation of Model Organism Metabolomes.

    Science.gov (United States)

    Qiu, Yunping; Moir, Robyn D; Willis, Ian M; Seethapathy, Suresh; Biniakewitz, Robert C; Kurland, Irwin J

    2018-01-18

    Identifying non-annotated peaks may have a significant impact on the understanding of biological systems. In silico methodologies have focused on ESI LC/MS/MS for identifying non-annotated MS peaks. In this study, we employed in silico methodology to develop an Isotopic Ratio Outlier Analysis (IROA) workflow using enhanced mass spectrometric data acquired with the ultra-high resolution GC-Orbitrap/MS to determine the identity of non-annotated metabolites. The higher resolution of the GC-Orbitrap/MS, together with its wide dynamic range, resulted in more IROA peak pairs detected, and increased reliability of chemical formulae generation (CFG). IROA uses two different 13 C-enriched carbon sources (randomized 95% 12 C and 95% 13 C) to produce mirror image isotopologue pairs, whose mass difference reveals the carbon chain length (n), which aids in the identification of endogenous metabolites. Accurate m/z, n, and derivatization information are obtained from our GC/MS workflow for unknown metabolite identification, and aids in silico methodologies for identifying isomeric and non-annotated metabolites. We were able to mine more mass spectral information using the same Saccharomyces cerevisiae growth protocol (Qiu et al. Anal. Chem 2016) with the ultra-high resolution GC-Orbitrap/MS, using 10% ammonia in methane as the CI reagent gas. We identified 244 IROA peaks pairs, which significantly increased IROA detection capability compared with our previous report (126 IROA peak pairs using a GC-TOF/MS machine). For 55 selected metabolites identified from matched IROA CI and EI spectra, using the GC-Orbitrap/MS vs. GC-TOF/MS, the average mass deviation for GC-Orbitrap/MS was 1.48 ppm, however, the average mass deviation was 32.2 ppm for the GC-TOF/MS machine. In summary, the higher resolution and wider dynamic range of the GC-Orbitrap/MS enabled more accurate CFG, and the coupling of accurate mass GC/MS IROA methodology with in silico fragmentation has great potential in

  2. A novel configurable VLSI architecture design of window-based image processing method

    Science.gov (United States)

    Zhao, Hui; Sang, Hongshi; Shen, Xubang

    2018-03-01

    Most window-based image processing architecture can only achieve a certain kind of specific algorithms, such as 2D convolution, and therefore lack the flexibility and breadth of application. In addition, improper handling of the image boundary can cause loss of accuracy, or consume more logic resources. For the above problems, this paper proposes a new VLSI architecture of window-based image processing operations, which is configurable and based on consideration of the image boundary. An efficient technique is explored to manage the image borders by overlapping and flushing phases at the end of row and the end of frame, which does not produce new delay and reduce the overhead in real-time applications. Maximize the reuse of the on-chip memory data, in order to reduce the hardware complexity and external bandwidth requirements. To perform different scalar function and reduction function operations in pipeline, this can support a variety of applications of window-based image processing. Compared with the performance of other reported structures, the performance of the new structure has some similarities to some of the structures, but also superior to some other structures. Especially when compared with a systolic array processor CWP, this structure at the same frequency of approximately 12.9% of the speed increases. The proposed parallel VLSI architecture was implemented with SIMC 0.18-μm CMOS technology, and the maximum clock frequency, power consumption, and area are 125Mhz, 57mW, 104.8K Gates, respectively, furthermore the processing time is independent of the different window-based algorithms mapped to the structure

  3. Systematic evaluation of the impact of ChIP-seq read designs on genome coverage, peak identification, and allele-specific binding detection.

    Science.gov (United States)

    Zhang, Qi; Zeng, Xin; Younkin, Sam; Kawli, Trupti; Snyder, Michael P; Keleş, Sündüz

    2016-02-24

    Chromatin immunoprecipitation followed by sequencing (ChIP-seq) experiments revolutionized genome-wide profiling of transcription factors and histone modifications. Although maturing sequencing technologies allow these experiments to be carried out with short (36-50 bps), long (75-100 bps), single-end, or paired-end reads, the impact of these read parameters on the downstream data analysis are not well understood. In this paper, we evaluate the effects of different read parameters on genome sequence alignment, coverage of different classes of genomic features, peak identification, and allele-specific binding detection. We generated 101 bps paired-end ChIP-seq data for many transcription factors from human GM12878 and MCF7 cell lines. Systematic evaluations using in silico variations of these data as well as fully simulated data, revealed complex interplay between the sequencing parameters and analysis tools, and indicated clear advantages of paired-end designs in several aspects such as alignment accuracy, peak resolution, and most notably, allele-specific binding detection. Our work elucidates the effect of design on the downstream analysis and provides insights to investigators in deciding sequencing parameters in ChIP-seq experiments. We present the first systematic evaluation of the impact of ChIP-seq designs on allele-specific binding detection and highlights the power of pair-end designs in such studies.

  4. 'Peak oil' or 'peak demand'?

    International Nuclear Information System (INIS)

    Chevallier, Bruno; Moncomble, Jean-Eudes; Sigonney, Pierre; Vially, Rolland; Bosseboeuf, Didier; Chateau, Bertrand

    2012-01-01

    This article reports a workshop which addressed several energy issues like the objectives and constraints of energy mix scenarios, the differences between the approaches in different countries, the cost of new technologies implemented for this purposes, how these technologies will be developed and marketed, which will be the environmental and societal acceptability of these technical choices. Different aspects and issues have been more precisely presented and discussed: the peak oil, development of shale gases and their cost (will non conventional hydrocarbons modify the peak oil and be socially accepted?), energy efficiency (its benefits, its reality in France and other countries, its position in front of the challenge of energy transition), and strategies in the transport sector (challenges for mobility, evolution towards a model of sustainable mobility)

  5. ZAKI a windows-based k sub o standardization code for in-core INAA

    CERN Document Server

    Ojo, J O

    2002-01-01

    A new computer code ZAKI, for k sub o -based INAA standardization, written in Visual Basic for the WINDOWS environment is described. The parameter alpha measuring the deviation of the epithermal neutron spectrum shape from the ideal 1/E shape, and the thermal-to-epithermal flux ratio f, are monitored at each irradiation position for each irradiation using the ''triple bare monitor with k sub o '' technique. Stability of the irradiation position with respect to alpha and f is therefore assumed only for the duration of the irradiation. This now makes it possible to use k sub o standardization even for in-core reactor irradiation channels without an a priori knowledge of alpha and f values as required by existing commercial software. ZAKI is considerably versatile and contains features which allow for use of several detectors at different counting geometries, direct inputting of peak search output from GeniePc, and automatic nuclide identification of all gamma lines using an in-built library. Sample results for ...

  6. ZAKI: a windows-based ko standardization code for in-core INAA

    International Nuclear Information System (INIS)

    Ojo, J.O.; Filby, R.H.

    2002-01-01

    A new computer code ZAKI, for k o -based INAA standardization, written in Visual Basic for the WINDOWS environment is described. The parameter α measuring the deviation of the epithermal neutron spectrum shape from the ideal 1/E shape, and the thermal-to-epithermal flux ratio f, are monitored at each irradiation position for each irradiation using the ''triple bare monitor with k o '' technique. Stability of the irradiation position with respect to α and f is therefore assumed only for the duration of the irradiation. This now makes it possible to use k o standardization even for in-core reactor irradiation channels without an a priori knowledge of α and f values as required by existing commercial software. ZAKI is considerably versatile and contains features which allow for use of several detectors at different counting geometries, direct inputting of peak search output from GeniePc, and automatic nuclide identification of all gamma lines using an in-built library. Sample results for two certified reference materials are presented

  7. An Evaluation of Windows-Based Computer Forensics Application Software Running on a Macintosh

    Directory of Open Access Journals (Sweden)

    Gregory H. Carlton

    2008-09-01

    Full Text Available The two most common computer forensics applications perform exclusively on Microsoft Windows Operating Systems, yet contemporary computer forensics examinations frequently encounter one or more of the three most common operating system environments, namely Windows, OS-X, or some form of UNIX or Linux. Additionally, government and private computer forensics laboratories frequently encounter budget constraints that limit their access to computer hardware. Currently, Macintosh computer systems are marketed with the ability to accommodate these three common operating system environments, including Windows XP in native and virtual environments. We performed a series of experiments to measure the functionality and performance of the two most commonly used Windows-based computer forensics applications on a Macintosh running Windows XP in native mode and in two virtual environments relative to a similarly configured Dell personal computer. The research results are directly beneficial to practitioners, and the process illustrates affective pedagogy whereby students were engaged in applied research.

  8. Establishment of windows-based load management system for electricity cost savings in competitive electricity markets

    International Nuclear Information System (INIS)

    Chung, K.H.; Kim, B.H.; Hur, D.

    2007-01-01

    For electricity markets to function in a truly competitive and efficient manner, it is not enough to focus solely on improving the efficiencies of power supply. To recognize price-responsive load as a reliability resource, the customer must be provided with price signals and an instrument to respond to these signals, preferably automatically. This paper attempts to develop the Windows-based load management system in competitive electricity markets, allowing the user to monitor the current energy consumption or billing information, to analyze the historical data, and to implement the consumption strategy for cost savings with nine possible scenarios adopted. Finally, this modeling framework will serve as a template containing the basic concepts that any load management system should address. (author)

  9. A Microsoft Windows based application for acquisition and replay of cardiotocograph data.

    Science.gov (United States)

    Genevier, E S; Allman, A C; Danielian, P J; Deans, A C; Steer, P J

    1995-01-01

    The electronic fetal monitor or cardiotocograph is an integral part of all modern labour wards. It records fetal heart and uterine contractions and charts this data as a cardiotocogram (CTG). The CTG is used to assess fetal well-being by the labour attendants and in some circumstances for research. A means to acquire and display the CTG by microcomputer as an aid to archiving and to obstetric research is presented. A Microsoft Windows-based application was written using Microsoft C version 7.0 to acquire and replay the CTG data. The application acquires the CTG data by using the RS232 serial link fitted on most modern fetal monitors. Additionally, comments and events can be entered by the user throughout recording. The data are saved to disk files which can be replayed on screen in the manner of a CTG. The data replay functions of the application calculates the uterine activity integral and active pressure for each contraction and for 15 min intervals. This calculated data is not available from many fetal monitors but is widely used for research into the mechanics of labour. This application provides an easy, reliable and accurate means of acquiring the CTG data, for archiving and research. It also provides a framework for further CTG analysis.

  10. The development of Windows based control system for the tele-robotics

    International Nuclear Information System (INIS)

    Kim, Byung Soo; Kim, Seung Ho; Seo, Yong Chil; Kim, Ki Ho; Hwang, Suk Yeoung; Kim, Chang Hoi; Jung, Seung Ho; Lee, Young Kwang

    1998-03-01

    The WSCS (Windows-based Supervisory Control System) has been developed for the efficient control of the mobile robot in the hazardous area, such as reactor surroundings of HPWR (Heavy Pressurized Water Reactor). The WSCS is basically computer program which consists windows menu-program, socket-based communication program, force reflection joystick program, and OpenGL-based 3D graphic program. Also, the WSCS includes the force control algorithm of a master control device ( in this case, joystick) for the enhanced operability. To evaluate the effectiveness of the designed WSCS and the force reflection control algorithm, a series of experiments has been made in such a way that human operators command the desired motion of robot by manipulating the joystick in the virtual environment. As a result, it was proven that the designed WSCS is very easy-to-use and effective. Also, the developed force reflection algorithm is more efficient than that of general tele-operation, even though there are some difference in human dexterity. In near future, the WSCS will be applied in the next version of KAEROT. (author). 11 refs., 14 tabs., 1 fig

  11. [A peak recognition algorithm designed for chromatographic peaks of transformer oil].

    Science.gov (United States)

    Ou, Linjun; Cao, Jian

    2014-09-01

    In the field of the chromatographic peak identification of the transformer oil, the traditional first-order derivative requires slope threshold to achieve peak identification. In terms of its shortcomings of low automation and easy distortion, the first-order derivative method was improved by applying the moving average iterative method and the normalized analysis techniques to identify the peaks. Accurate identification of the chromatographic peaks was realized through using multiple iterations of the moving average of signal curves and square wave curves to determine the optimal value of the normalized peak identification parameters, combined with the absolute peak retention times and peak window. The experimental results show that this algorithm can accurately identify the peaks and is not sensitive to the noise, the chromatographic peak width or the peak shape changes. It has strong adaptability to meet the on-site requirements of online monitoring devices of dissolved gases in transformer oil.

  12. Automated asteroseismic peak detections

    Science.gov (United States)

    García Saravia Ortiz de Montellano, Andrés; Hekker, S.; Themeßl, N.

    2018-05-01

    Space observatories such as Kepler have provided data that can potentially revolutionize our understanding of stars. Through detailed asteroseismic analyses we are capable of determining fundamental stellar parameters and reveal the stellar internal structure with unprecedented accuracy. However, such detailed analyses, known as peak bagging, have so far been obtained for only a small percentage of the observed stars while most of the scientific potential of the available data remains unexplored. One of the major challenges in peak bagging is identifying how many solar-like oscillation modes are visible in a power density spectrum. Identification of oscillation modes is usually done by visual inspection that is time-consuming and has a degree of subjectivity. Here, we present a peak-detection algorithm especially suited for the detection of solar-like oscillations. It reliably characterizes the solar-like oscillations in a power density spectrum and estimates their parameters without human intervention. Furthermore, we provide a metric to characterize the false positive and false negative rates to provide further information about the reliability of a detected oscillation mode or the significance of a lack of detected oscillation modes. The algorithm presented here opens the possibility for detailed and automated peak bagging of the thousands of solar-like oscillators observed by Kepler.

  13. Statistical analysis of uncertainties of gamma-peak identification and area calculation in particulate air-filter environment radionuclide measurements using the results of a Comprehensive Nuclear-Test-Ban Treaty Organization (CTBTO) organized intercomparison, Part I: Assessment of reliability and uncertainties of isotope detection and energy precision using artificial spiked test spectra, Part II: Assessment of the true type I error rate and the quality of peak area estimators in relation to type II errors using large numbers of natural spectra

    International Nuclear Information System (INIS)

    Zhang, W.; Zaehringer, M.; Ungar, K.; Hoffman, I.

    2008-01-01

    In this paper, the uncertainties of gamma-ray small peak analysis have been examined. As the intensity of a gamma-ray peak approaches its detection decision limit, derived parameters such as centroid channel energy, peak area, peak area uncertainty, baseline determination, and peak significance are statistically sensitive. The intercomparison exercise organized by the CTBTO provided an excellent opportunity for this to be studied. Near background levels, the false-positive and false-negative peak identification frequencies in artificial test spectra have been compared to statistically predictable limiting values. In addition, naturally occurring radon progeny were used to compare observed variance against nominal uncertainties. The results infer that the applied fit algorithms do not always represent the best estimator. Understanding the statistically predicted peak-finding limit is important for data evaluation and analysis assessment. Furthermore, these results are useful to optimize analytical procedures to achieve the best results

  14. Improving quantitative dosimetry in (177)Lu-DOTATATE SPECT by energy window-based scatter corrections

    DEFF Research Database (Denmark)

    de Nijs, Robin; Lagerburg, Vera; Klausen, Thomas L

    2014-01-01

    and the activity, which depends on the collimator type, the utilized energy windows and the applied scatter correction techniques. In this study, energy window subtraction-based scatter correction methods are compared experimentally and quantitatively. MATERIALS AND METHODS: (177)Lu SPECT images of a phantom...... technique, the measured ratio was close to the real ratio, and the differences between spheres were small. CONCLUSION: For quantitative (177)Lu imaging MEGP collimators are advised. Both energy peaks can be utilized when the ESSE correction technique is applied. The difference between the calculated...

  15. Age spectrometry of infant death rates as a probe of immunity: Identification of two peaks due to viral and bacterial diseases respectively

    Science.gov (United States)

    Berrut, Sylvie; Richmond, Peter; Roehner, Bertrand M.

    2017-11-01

    After birth, setting up an effective immune system is a major challenge for all living organisms. In this paper we show that this process can be explored by using the age-specific infant death rate as a kind of sensor. This is made possible because, as shown by the authors in Berrut et al. (2016), between birth and a critical age tc, for all mammals the death rate decreases with age as a smooth hyperbolic function. For humans tc is equal to 10 years. It turns out that for some causes of deaths and specific ages the hyperbolic fall displays temporary spikes which, it is assumed, correspond to specific events in the organism's response to exogenous factors. One of these spikes occurs 10 days after birth and there is another at the age of 300 days. It is shown that the first spike is related to viral infections whereas the second is related to bacterial diseases. By going back to former time periods during which infant mortality was much higher than it is currently, one gets a magnified view of these peaks. They give us useful information about how an organism adapts to new conditions. Apart from the reaction to pathogens, the same methodology can be used to study the response to changes in other external conditions, e.g. temperature or oxygen level.

  16. Identification of time-to-peak on dynamic 18F-FET-PET as a prognostic marker specifically in IDH1/2 mutant diffuse astrocytoma.

    Science.gov (United States)

    Suchorska, Bogdana; Giese, Armin; Biczok, Annamaria; Unterrainer, Marcus; Weller, Michael; Drexler, Mark; Bartenstein, Peter; Schüller, Ulrich; Tonn, Jörg-Christian; Albert, Nathalie L

    2018-01-22

    Stratification of glioma according to isocitrate dehydrogenase 1/2 (IDH1/2) mutation and 1p/19q codeletion status has gained major importance in the new World Health Organization (WHO) classification. Parameters derived from uptake dynamics of 18F-fluoro-ethyl-tyrosine PET (18F-FET-PET) such as minimal time-to-peak (TTPmin) allow discrimination between different prognostic glioma subgroups, too. The present study is aimed at exploring whether TTPmin analysis provides prognostic information beyond the WHO classification. Three hundred patients with newly diagnosed WHO 2007 grades II-IV gliomas with 18F-FET-PET imaging at diagnosis were grouped into 4 subgroups (IDH1/2 mut-1p/19q codel; IDH1/2 mut-1p/19q non-codel; IDH1/2 wildtype WHO grade II and III tumors; and glioblastoma). Clinical and imaging factors such as age, Karnofsky performance score, treatment, TTPmin, and maximal tumor-to-brain ratio (TBRmax) were analyzed with regard to progression-free and overall survival (PFS and OS) via univariate and multivariate regression analysis. PFS and OS were longest in the IDH1/2 mut-1p/19q codel subgroup, followed by IDH1/2 mut-1p/19q non-codel, IDH1/2 wildtype, and GBM (P 17.5 minutes (P PET-derived dynamic analysis defines prognostically distinct subgroups of IDH1/2 mutant-1p/19q non-codel gliomas which cannot be distinguished as yet by molecular marker analysis. © The Author(s) 2017. Published by Oxford University Press on behalf of the Society for Neuro-Oncology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com

  17. Sliding Window-Based Region of Interest Extraction for Finger Vein Images

    Science.gov (United States)

    Yang, Lu; Yang, Gongping; Yin, Yilong; Xiao, Rongyang

    2013-01-01

    Region of Interest (ROI) extraction is a crucial step in an automatic finger vein recognition system. The aim of ROI extraction is to decide which part of the image is suitable for finger vein feature extraction. This paper proposes a finger vein ROI extraction method which is robust to finger displacement and rotation. First, we determine the middle line of the finger, which will be used to correct the image skew. Then, a sliding window is used to detect the phalangeal joints and further to ascertain the height of ROI. Last, for the corrective image with certain height, we will obtain the ROI by using the internal tangents of finger edges as the left and right boundary. The experimental results show that the proposed method can extract ROI more accurately and effectively compared with other methods, and thus improve the performance of finger vein identification system. Besides, to acquire the high quality finger vein image during the capture process, we propose eight criteria for finger vein capture from different aspects and these criteria should be helpful to some extent for finger vein capture. PMID:23507824

  18. Development of windows based software to analyze fluorescence decay with time-correlated single photon counting (TCSPC) setup

    International Nuclear Information System (INIS)

    Mallick, M.B.; Ravindranath, S.V.G.; Das, N.C.

    2002-07-01

    A VUV spectroscopic facility for studies in photophysics and photochemistry is being set up at INDUS-I synchrotron source, CAT, Indore. For this purpose, a data acquisition system based on time-correlated single photon counting method is being developed for fluorescence lifetime measurement. To estimate fluorescence lifetime from the data collected with this sytem, a Windows based program has been developed using Visual Basic 5.0. It uses instrument response function (IRF) and observed decay curve and estimates parameters of single exponential decay by least square analysis and Marquardt method as convergence mechanism. Estimation of parameters was performed using data collected with a commercial setup. Goodness of fit was judged by evaluating χR 2 , weighted residuals and autocorrelation function. Performance is compared with two commercial software packages and found to be satisfactory. (author)

  19. Peak Experience Project

    Science.gov (United States)

    Scott, Daniel G.; Evans, Jessica

    2010-01-01

    This paper emerges from the continued analysis of data collected in a series of international studies concerning Childhood Peak Experiences (CPEs) based on developments in understanding peak experiences in Maslow's hierarchy of needs initiated by Dr Edward Hoffman. Bridging from the series of studies, Canadian researchers explore collected…

  20. Peak-interviewet

    DEFF Research Database (Denmark)

    Raalskov, Jesper; Warming-Rasmussen, Bent

    Peak-interviewet er en særlig effektiv metode til at gøre ubevidste menneskelige ressourcer bevidste. Fokuspersonen (den interviewede) interviewes om en selvvalgt, personlig succesoplevelse. Terapeuten/coachen (intervieweren) spørger ind til processen, som ledte hen til denne succes. Herved afdæk...... fokuspersonen ønsker at tage op (nye mål eller nye processer). Nærværende workingpaper beskriver, hvad der menes med et peak-interview, peakinterviwets teoretiske fundament samt metodikken til at foretage et tillidsfuldt og effektiv peak-interview....

  1. Peak power ratio generator

    Science.gov (United States)

    Moyer, R.D.

    A peak power ratio generator is described for measuring, in combination with a conventional power meter, the peak power level of extremely narrow pulses in the gigahertz radio frequency bands. The present invention in a preferred embodiment utilizes a tunnel diode and a back diode combination in a detector circuit as the only high speed elements. The high speed tunnel diode provides a bistable signal and serves as a memory device of the input pulses for the remaining, slower components. A hybrid digital and analog loop maintains the peak power level of a reference channel at a known amount. Thus, by measuring the average power levels of the reference signal and the source signal, the peak power level of the source signal can be determined.

  2. Peak Oil, Peak Coal and Climate Change

    Science.gov (United States)

    Murray, J. W.

    2009-05-01

    Research on future climate change is driven by the family of scenarios developed for the IPCC assessment reports. These scenarios create projections of future energy demand using different story lines consisting of government policies, population projections, and economic models. None of these scenarios consider resources to be limiting. In many of these scenarios oil production is still increasing to 2100. Resource limitation (in a geological sense) is a real possibility that needs more serious consideration. The concept of 'Peak Oil' has been discussed since M. King Hubbert proposed in 1956 that US oil production would peak in 1970. His prediction was accurate. This concept is about production rate not reserves. For many oil producing countries (and all OPEC countries) reserves are closely guarded state secrets and appear to be overstated. Claims that the reserves are 'proven' cannot be independently verified. Hubbert's Linearization Model can be used to predict when half the ultimate oil will be produced and what the ultimate total cumulative production (Qt) will be. US oil production can be used as an example. This conceptual model shows that 90% of the ultimate US oil production (Qt = 225 billion barrels) will have occurred by 2011. This approach can then be used to suggest that total global production will be about 2200 billion barrels and that the half way point will be reached by about 2010. This amount is about 5 to 7 times less than assumed by the IPCC scenarios. The decline of Non-OPEC oil production appears to have started in 2004. Of the OPEC countries, only Saudi Arabia may have spare capacity, but even that is uncertain, because of lack of data transparency. The concept of 'Peak Coal' is more controversial, but even the US National Academy Report in 2007 concluded only a small fraction of previously estimated reserves in the US are actually minable reserves and that US reserves should be reassessed using modern methods. British coal production can be

  3. Peak regulation right

    International Nuclear Information System (INIS)

    Gao, Z. |; Ren, Z.; Li, Z.; Zhu, R.

    2005-01-01

    A peak regulation right concept and corresponding transaction mechanism for an electricity market was presented. The market was based on a power pool and independent system operator (ISO) model. Peak regulation right (PRR) was defined as a downward regulation capacity purchase option which allowed PRR owners to buy certain quantities of peak regulation capacity (PRC) at a specific price during a specified period from suppliers. The PRR owner also had the right to decide whether or not they would buy PRC from suppliers. It was the power pool's responsibility to provide competitive and fair peak regulation trading markets to participants. The introduction of PRR allowed for unit capacity regulation. The PRR and PRC were rated by the supplier, and transactions proceeded through a bidding process. PRR suppliers obtained profits by selling PRR and PRC, and obtained downward regulation fees regardless of whether purchases are made. It was concluded that the peak regulation mechanism reduced the total cost of the generating system and increased the social surplus. 6 refs., 1 tab., 3 figs

  4. DR_SEQAN: a PC/Windows-based software to evaluate drug resistance using human immunodeficiency virus type 1 genotypes

    Directory of Open Access Journals (Sweden)

    Menéndez-Arias Luis

    2006-03-01

    coded in Visual Basic for use in PC/Windows-based platforms. The program is freely available under the General Public License. The program (including the integrated database, documentation and a sample sequence can be downloaded from http://www2.cbm.uam.es:8080/lmenendez/DR_SEQAN.zip

  5. Assessment of radionuclide databases in CAP88 mainframe version 1.0 and Windows-based version 3.0.

    Science.gov (United States)

    LaBone, Elizabeth D; Farfán, Eduardo B; Lee, Patricia L; Jannik, G Timothy; Donnelly, Elizabeth H; Foley, Trevor Q

    2009-09-01

    In this study the radionuclide databases for two versions of the Clean Air Act Assessment Package-1988 (CAP88) computer model were assessed in detail. CAP88 estimates radiation dose and the risk of health effects to human populations from radionuclide emissions to air. This program is used by several U.S. Department of Energy (DOE) facilities to comply with National Emission Standards for Hazardous Air Pollutants regulations. CAP88 Mainframe, referred to as version 1.0 on the U.S. Environmental Protection Agency Web site (http://www.epa.gov/radiation/assessment/CAP88/), was the very first CAP88 version released in 1988. Some DOE facilities including the Savannah River Site still employ this version (1.0) while others use the more user-friendly personal computer Windows-based version 3.0 released in December 2007. Version 1.0 uses the program RADRISK based on International Commission on Radiological Protection Publication 30 as its radionuclide database. Version 3.0 uses half-life, dose, and risk factor values based on Federal Guidance Report 13. Differences in these values could cause different results for the same input exposure data (same scenario), depending on which version of CAP88 is used. Consequently, the differences between the two versions are being assessed in detail at Savannah River National Laboratory. The version 1.0 and 3.0 database files contain 496 and 838 radionuclides, respectively, and though one would expect the newer version to include all the 496 radionuclides, 35 radionuclides are listed in version 1.0 that are not included in version 3.0. The majority of these has either extremely short or long half-lives or is no longer in production; however, some of the short-lived radionuclides might produce progeny of great interest at DOE sites. In addition, 122 radionuclides were found to have different half-lives in the two versions, with 21 over 3 percent different and 12 over 10 percent different.

  6. Make peak flow a habit

    Science.gov (United States)

    Asthma - make peak flow a habit; Reactive airway disease - peak flow; Bronchial asthma - peak flow ... 2014:chap 55. National Asthma Education and Prevention Program website. How to use a peak flow meter. ...

  7. Automated asteroseismic peak detections

    DEFF Research Database (Denmark)

    de Montellano, Andres Garcia Saravia Ortiz; Hekker, S.; Themessl, N.

    2018-01-01

    Space observatories such as Kepler have provided data that can potentially revolutionize our understanding of stars. Through detailed asteroseismic analyses we are capable of determining fundamental stellar parameters and reveal the stellar internal structure with unprecedented accuracy. However......, such detailed analyses, known as peak bagging, have so far been obtained for only a small percentage of the observed stars while most of the scientific potential of the available data remains unexplored. One of the major challenges in peak bagging is identifying how many solar-like oscillation modes are visible...... of detected oscillation modes. The algorithm presented here opens the possibility for detailed and automated peak bagging of the thousands of solar-like oscillators observed by Kepler....

  8. Peak reading detector circuit

    International Nuclear Information System (INIS)

    Courtin, E.; Grund, K.; Traub, S.; Zeeb, H.

    1975-01-01

    The peak reading detector circuit serves for picking up the instants during which peaks of a given polarity occur in sequences of signals in which the extreme values, their time intervals, and the curve shape of the signals vary. The signal sequences appear in measuring the foetal heart beat frequence from amplitude-modulated ultrasonic, electrocardiagram, and blood pressure signals. In order to prevent undesired emission of output signals from, e. g., disturbing intermediate extreme values, the circuit consists of the series connections of a circuit to simulate an ideal diode, a strong unit, a discriminator for the direction of charging current, a time-delay circuit, and an electronic switch lying in the decharging circuit of the storage unit. The time-delay circuit thereby causes storing of a preliminary maximum value being used only after a certain time delay for the emission of the output signal. If a larger extreme value occurs during the delay time the preliminary maximum value is cleared and the delay time starts running anew. (DG/PB) [de

  9. OccuPeak: ChIP-Seq peak calling based on internal background modelling

    NARCIS (Netherlands)

    de Boer, Bouke A.; van Duijvenboden, Karel; van den Boogaard, Malou; Christoffels, Vincent M.; Barnett, Phil; Ruijter, Jan M.

    2014-01-01

    ChIP-seq has become a major tool for the genome-wide identification of transcription factor binding or histone modification sites. Most peak-calling algorithms require input control datasets to model the occurrence of background reads to account for local sequencing and GC bias. However, the

  10. Establishment of peak bone mass.

    Science.gov (United States)

    Mora, Stefano; Gilsanz, Vicente

    2003-03-01

    Among the main areas of progress in osteoporosis research during the last decade or so are the general recognition that this condition, which is the cause of so much pain in the elderly population, has its antecedents in childhood and the identification of the structural basis accounting for much of the differences in bone strength among humans. Nevertheless, current understanding of the bone mineral accrual process is far from complete. The search for genes that regulate bone mass acquisition is ongoing, and current results are not sufficient to identify subjects at risk. However, there is solid evidence that BMD measurements can be helpful for the selection of subjects that presumably would benefit from preventive interventions. The questions regarding the type of preventive interventions, their magnitude, and duration remain unanswered. Carefully designed controlled trials are needed. Nevertheless, previous experience indicates that weight-bearing activity and possibly calcium supplements are beneficial if they are begun during childhood and preferably before the onset of puberty. Modification of unhealthy lifestyles and increments in exercise or calcium assumption are logical interventions that should be implemented to improve bone mass gains in all children and adolescents who are at risk of failing to achieve an optimal peak bone mass.

  11. Support Vector Data Description Model to Map Specific Land Cover with Optimal Parameters Determined from a Window-Based Validation Set

    Directory of Open Access Journals (Sweden)

    Jinshui Zhang

    2017-04-01

    Full Text Available This paper developed an approach, the window-based validation set for support vector data description (WVS-SVDD, to determine optimal parameters for support vector data description (SVDD model to map specific land cover by integrating training and window-based validation sets. Compared to the conventional approach where the validation set included target and outlier pixels selected visually and randomly, the validation set derived from WVS-SVDD constructed a tightened hypersphere because of the compact constraint by the outlier pixels which were located neighboring to the target class in the spectral feature space. The overall accuracies for wheat and bare land achieved were as high as 89.25% and 83.65%, respectively. However, target class was underestimated because the validation set covers only a small fraction of the heterogeneous spectra of the target class. The different window sizes were then tested to acquire more wheat pixels for validation set. The results showed that classification accuracy increased with the increasing window size and the overall accuracies were higher than 88% at all window size scales. Moreover, WVS-SVDD showed much less sensitivity to the untrained classes than the multi-class support vector machine (SVM method. Therefore, the developed method showed its merits using the optimal parameters, tradeoff coefficient (C and kernel width (s, in mapping homogeneous specific land cover.

  12. Relationships between electroencephalographic spectral peaks across frequency bands

    Directory of Open Access Journals (Sweden)

    Sacha Jennifer Van Albada

    2013-03-01

    Full Text Available The degree to which electroenencephalographic (EEG spectral peaks are independent, and the relationships between their frequencies have been debated. A novel fitting method was used to determine peak parameters in the range 2–35 Hz from a large sample of eyes-closed spectra, and their interrelationships were investigated. Findings were compared with a mean-field model of thalamocortical activity, which predicts near-harmonic relationships between peaks. The subject set consisted of 1424 healthy subjects from the Brain Resource International Database. Peaks in the theta range occurred on average near half the alpha peak frequency, while peaks in the beta range tended to occur near twice and three times the alpha peak frequency on an individual-subject basis. Moreover, for the majority of subjects, alpha peak frequencies were significantly positively correlated with frequencies of peaks in the theta and low and high beta ranges. Such a harmonic progression agrees semiquantitatively with theoretical predictions from the mean-field model. These findings indicate a common or analogous source for different rhythms, and help to define appropriate individual frequency bands for peak identification.

  13. Relationships between Electroencephalographic Spectral Peaks Across Frequency Bands

    Science.gov (United States)

    van Albada, S. J.; Robinson, P. A.

    2013-01-01

    The degree to which electroencephalographic spectral peaks are independent, and the relationships between their frequencies have been debated. A novel fitting method was used to determine peak parameters in the range 2–35 Hz from a large sample of eyes-closed spectra, and their interrelationships were investigated. Findings were compared with a mean-field model of thalamocortical activity, which predicts near-harmonic relationships between peaks. The subject set consisted of 1424 healthy subjects from the Brain Resource International Database. Peaks in the theta range occurred on average near half the alpha peak frequency, while peaks in the beta range tended to occur near twice and three times the alpha peak frequency on an individual-subject basis. Moreover, for the majority of subjects, alpha peak frequencies were significantly positively correlated with frequencies of peaks in the theta and low and high beta ranges. Such a harmonic progression agrees semiquantitatively with theoretical predictions from the mean-field model. These findings indicate a common or analogous source for different rhythms, and help to define appropriate individual frequency bands for peak identification. PMID:23483663

  14. State-of-the-art Hydrology Education: Development of Windows-based and Web-based Interactive Teaching-Learning Software

    Science.gov (United States)

    Chu, X.

    2011-12-01

    This study, funded by the NSF CAREER program, focuses on developing new methods to quantify microtopography-controlled overland flow processes and integrating the cutting-edge hydrologic research with all-level education and outreach activities. To achieve the educational goal, an interactive teaching-learning software package has been developed. This software, with enhanced visualization capabilities, integrates the new modeling techniques, computer-guided learning processes, and education-oriented tools in a user-friendly interface. Both Windows-based and web-based versions have been developed. The software is specially designed for three major user levels: elementary level (Level 1: K-12 and outreach education), medium level (Level 2: undergraduate education), and advanced level (Level 3: graduate education). Depending on the levels, users are guided to different educational systems. Each system consists of a series of mini "libraries" featured with movies, pictures, and documentation that cover fundamental theories, varying scale experiments, and computer modeling of overland flow generation, surface runoff, and infiltration processes. Testing and practical use of this educational software in undergraduate and graduate teaching demonstrate its effectiveness to promote students' learning and interest in hydrologic sciences. This educational software also has been used as a hydrologic demonstration tool for K-12 students and Native American students through the Nurturing American Tribal Undergraduate Research Education (NATURE) program and Science, Technology, Engineering and Mathematics (STEM) outreach activities.

  15. g-PRIME: A Free, Windows Based Data Acquisition and Event Analysis Software Package for Physiology in Classrooms and Research Labs.

    Science.gov (United States)

    Lott, Gus K; Johnson, Bruce R; Bonow, Robert H; Land, Bruce R; Hoy, Ronald R

    2009-01-01

    We present g-PRIME, a software based tool for physiology data acquisition, analysis, and stimulus generation in education and research. This software was developed in an undergraduate neurophysiology course and strongly influenced by instructor and student feedback. g-PRIME is a free, stand-alone, windows application coded and "compiled" in Matlab (does not require a Matlab license). g-PRIME supports many data acquisition interfaces from the PC sound card to expensive high throughput calibrated equipment. The program is designed as a software oscilloscope with standard trigger modes, multi-channel visualization controls, and data logging features. Extensive analysis options allow real time and offline filtering of signals, multi-parameter threshold-and-window based event detection, and two-dimensional display of a variety of parameters including event time, energy density, maximum FFT frequency component, max/min amplitudes, and inter-event rate and intervals. The software also correlates detected events with another simultaneously acquired source (event triggered average) in real time or offline. g-PRIME supports parameter histogram production and a variety of elegant publication quality graphics outputs. A major goal of this software is to merge powerful engineering acquisition and analysis tools with a biological approach to studies of nervous system function.

  16. Upper limit of peak area

    International Nuclear Information System (INIS)

    Helene, O.A.M.

    1982-08-01

    The determination of the upper limit of peak area in a multi-channel spectra, with a known significance level is discussed. This problem is specially important when the peak area is masked by the background statistical fluctuations. The problem is exactly solved and, thus, the results are valid in experiments with small number of events. The results are submitted to a Monte Carlo test and applied to the 92 Nb beta decay. (Author) [pt

  17. 21 CFR 868.1860 - Peak-flow meter for spirometry.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Peak-flow meter for spirometry. 868.1860 Section... (CONTINUED) MEDICAL DEVICES ANESTHESIOLOGY DEVICES Diagnostic Devices § 868.1860 Peak-flow meter for spirometry. (a) Identification. A peak-flow meter for spirometry is a device used to measure a patient's...

  18. Peak Oil and other threatening peaks-Chimeras without substance

    International Nuclear Information System (INIS)

    Radetzki, Marian

    2010-01-01

    The Peak Oil movement has widely spread its message about an impending peak in global oil production, caused by an inadequate resource base. On closer scrutiny, the underlying analysis is inconsistent, void of a theoretical foundation and without support in empirical observations. Global oil resources are huge and expanding, and pose no threat to continuing output growth within an extended time horizon. In contrast, temporary or prolonged supply crunches are indeed plausible, even likely, on account of growing resource nationalism denying access to efficient exploitation of the existing resource wealth.

  19. Electricity Portfolio Management: Optimal Peak / Off-Peak Allocations

    OpenAIRE

    Huisman, Ronald; Mahieu, Ronald; Schlichter, Felix

    2007-01-01

    textabstractElectricity purchasers manage a portfolio of contracts in order to purchase the expected future electricity consumption profile of a company or a pool of clients. This paper proposes a mean-variance framework to address the concept of structuring the portfolio and focuses on how to allocate optimal positions in peak and off-peak forward contracts. It is shown that the optimal allocations are based on the difference in risk premiums per unit of day-ahead risk as a measure of relati...

  20. Ultrasonic Transducer Peak-to-Peak Optical Measurement

    Directory of Open Access Journals (Sweden)

    Pavel Skarvada

    2012-01-01

    Full Text Available Possible optical setups for measurement of the peak-to-peak value of an ultrasonic transducer are described in this work. The Michelson interferometer with the calibrated nanopositioner in reference path and laser Doppler vibrometer were used for the basic measurement of vibration displacement. Langevin type of ultrasonic transducer is used for the purposes of Electro-Ultrasonic Nonlinear Spectroscopy (EUNS. Parameters of produced mechanical vibration have to been well known for EUNS. Moreover, a monitoring of mechanical vibration frequency shift with a mass load and sample-transducer coupling is important for EUNS measurement.

  1. Peaking-factor of PWR

    International Nuclear Information System (INIS)

    Morioka, Noboru; Kato, Yasuji; Yokoi, M.

    1975-01-01

    Output peaking factor often plays an important role in the safety and operation of nuclear reactors. The meaning of the peaking factor of PWRs is categorized into two features or the peaking factor in core (FQ-core) and the peaking factor on the basis of accident analysis (or FQ-limit). FQ-core is the actual peaking factor realized in nuclear core at the time of normal operation, and FQ-limit should be evaluated from loss of coolant accident and other abnormal conditions. If FQ-core is lower than FQ-limit, the reactor may be operated at full load, but if FQ-core is larger than FQ-limit, reactor output should be controlled lower than FQ-limit. FQ-core has two kinds of values, or the one on the basis of nuclear design, and the other actually measured in reactor operation. The first FQ-core should be named as FQ-core-design and the latter as FQ-core-measured. The numerical evaluation of FQ-core-design is as follows; FQ-core-design of three-dimensions is synthesized with FQ-core horizontal value (X-Y) and FQ-core vertical value, the former one is calculated with ASSY-CORE code, and the latter one with one dimensional diffusion code. For the evaluation of FQ-core-measured, on-site data observation from nuclear reactor instrumentation or off-site data observation is used. (Iwase, T.)

  2. Conserved PCR primer set designing for closely-related species to complete mitochondrial genome sequencing using a sliding window-based PSO algorithm.

    Directory of Open Access Journals (Sweden)

    Cheng-Hong Yang

    Full Text Available BACKGROUND: Complete mitochondrial (mt genome sequencing is becoming increasingly common for phylogenetic reconstruction and as a model for genome evolution. For long template sequencing, i.e., like the entire mtDNA, it is essential to design primers for Polymerase Chain Reaction (PCR amplicons which are partly overlapping each other. The presented chromosome walking strategy provides the overlapping design to solve the problem for unreliable sequencing data at the 5' end and provides the effective sequencing. However, current algorithms and tools are mostly focused on the primer design for a local region in the genomic sequence. Accordingly, it is still challenging to provide the primer sets for the entire mtDNA. METHODOLOGY/PRINCIPAL FINDINGS: The purpose of this study is to develop an integrated primer design algorithm for entire mt genome in general, and for the common primer sets for closely-related species in particular. We introduce ClustalW to generate the multiple sequence alignment needed to find the conserved sequences in closely-related species. These conserved sequences are suitable for designing the common primers for the entire mtDNA. Using a heuristic algorithm particle swarm optimization (PSO, all the designed primers were computationally validated to fit the common primer design constraints, such as the melting temperature, primer length and GC content, PCR product length, secondary structure, specificity, and terminal limitation. The overlap requirement for PCR amplicons in the entire mtDNA is satisfied by defining the overlapping region with the sliding window technology. Finally, primer sets were designed within the overlapping region. The primer sets for the entire mtDNA sequences were successfully demonstrated in the example of two closely-related fish species. The pseudo code for the primer design algorithm is provided. CONCLUSIONS/SIGNIFICANCE: In conclusion, it can be said that our proposed sliding window-based PSO

  3. How to use your peak flow meter

    Science.gov (United States)

    ... meter - how to use; Asthma - peak flow meter; Reactive airway disease - peak flow meter; Bronchial asthma - peak ... 2014:chap 55. National Asthma Education and Prevention Program website. How to use a peak flow meter. ...

  4. [A new peak detection algorithm of Raman spectra].

    Science.gov (United States)

    Jiang, Cheng-Zhi; Sun, Qiang; Liu, Ying; Liang, Jing-Qiu; An, Yan; Liu, Bing

    2014-01-01

    The authors proposed a new Raman peak recognition method named bi-scale correlation algorithm. The algorithm uses the combination of the correlation coefficient and the local signal-to-noise ratio under two scales to achieve Raman peak identification. We compared the performance of the proposed algorithm with that of the traditional continuous wavelet transform method through MATLAB, and then tested the algorithm with real Raman spectra. The results show that the average time for identifying a Raman spectrum is 0.51 s with the algorithm, while it is 0.71 s with the continuous wavelet transform. When the signal-to-noise ratio of Raman peak is greater than or equal to 6 (modern Raman spectrometers feature an excellent signal-to-noise ratio), the recognition accuracy with the algorithm is higher than 99%, while it is less than 84% with the continuous wavelet transform method. The mean and the standard deviations of the peak position identification error of the algorithm are both less than that of the continuous wavelet transform method. Simulation analysis and experimental verification prove that the new algorithm possesses the following advantages: no needs of human intervention, no needs of de-noising and background removal operation, higher recognition speed and higher recognition accuracy. The proposed algorithm is operable in Raman peak identification.

  5. Peak effect in twinned superconductors

    International Nuclear Information System (INIS)

    Larkin, A.I.; Marchetti, M.C.; Vinokur, V.M.

    1995-01-01

    A sharp maximum in the critical current J c as a function of temperature just below the melting point of the Abrikosov flux lattice has recently been observed in both low- and high-temperature superconductors. This peak effect is strongest in twinned crystals for fields aligned with the twin planes. We propose that this peak signals the breakdown of the collective pinning regime and the crossover to strong pinning of single vortices on the twin boundaries. This crossover is very sharp and can account for the steep drop of the differential resistivity observed in experiments. copyright 1995 The American Physical Society

  6. Hubbert's Peak -- A Physicist's View

    Science.gov (United States)

    McDonald, Richard

    2011-04-01

    Oil, as used in agriculture and transportation, is the lifeblood of modern society. It is finite in quantity and will someday be exhausted. In 1956, Hubbert proposed a theory of resource production and applied it successfully to predict peak U.S. oil production in 1970. Bartlett extended this work in publications and lectures on the finite nature of oil and its production peak and depletion. Both Hubbert and Bartlett place peak world oil production at a similar time, essentially now. Central to these analyses are estimates of total ``oil in place'' obtained from engineering studies of oil reservoirs as this quantity determines the area under the Hubbert's Peak. Knowing the production history and the total oil in place allows us to make estimates of reserves, and therefore future oil availability. We will then examine reserves data for various countries, in particular OPEC countries, and see if these data tell us anything about the future availability of oil. Finally, we will comment on synthetic oil and the possibility of carbon-neutral synthetic oil for a sustainable future.

  7. In a Peak Fitness Condition?

    DEFF Research Database (Denmark)

    Storm, Rasmus K.; Nielsen, Klaus

    2010-01-01

    managerial efforts with regard to Danish elite sports? The analysis finds the Danish elite sports organization, Team Danmark, well prepared and fit for the future challenges. Still, though, areas such as talent identification and development and division of roles and responsibilities, are in need...

  8. SPANISH PEAKS PRIMITIVE AREA, MONTANA.

    Science.gov (United States)

    Calkins, James A.; Pattee, Eldon C.

    1984-01-01

    A mineral survey of the Spanish Peaks Primitive Area, Montana, disclosed a small low-grade deposit of demonstrated chromite and asbestos resources. The chances for discovery of additional chrome resources are uncertain and the area has little promise for the occurrence of other mineral or energy resources. A reevaluation, sampling at depth, and testing for possible extensions of the Table Mountain asbestos and chromium deposit should be undertaken in the light of recent interpretations regarding its geologic setting.

  9. Neurofeedback training for peak performance

    OpenAIRE

    Marek Graczyk; Maria Pąchalska; Artur Ziółkowski; Grzegorz Mańko; Beata Łukaszewska; Kazimierz Kochanowicz; Andrzej Mirski; Iurii D. Kropotov

    2014-01-01

    [b]aim[/b]. One of the applications of the Neurofeedback methodology is peak performance in sport. The protocols of the neurofeedback are usually based on an assessment of the spectral parameters of spontaneous EEG in resting state conditions. The aim of the paper was to study whether the intensive neurofeedback training of a well-functioning Olympic athlete who has lost his performance confidence after injury in sport, could change the brain functioning reflected in changes in spontaneou...

  10. Power peaking nuclear reliability factors

    International Nuclear Information System (INIS)

    Hassan, H.A.; Pegram, J.W.; Mays, C.W.; Romano, J.J.; Woods, J.J.; Warren, H.D.

    1977-11-01

    The Calculational Nuclear Reliability Factor (CNRF) assigned to the limiting power density calculated in reactor design has been determined. The CNRF is presented as a function of the relative power density of the fuel assembly and its radial local. In addition, the Measurement Nuclear Reliability Factor (MNRF) for the measured peak hot pellet power in the core has been evaluated. This MNRF is also presented as a function of the relative power density and radial local within the fuel assembly

  11. Evaluation of concurrent peak responses

    International Nuclear Information System (INIS)

    Wang, P.C.; Curreri, J.; Reich, M.

    1983-01-01

    This report deals with the problem of combining two or more concurrent responses which are induced by dynamic loads acting on nuclear power plant structures. Specifically, the acceptability of using the square root of the sum of the squares (SRSS) value of peak values as the combined response is investigated. Emphasis is placed on the establishment of a simplified criterion that is convenient and relatively easy to use by design engineers

  12. Finding two-dimensional peaks

    International Nuclear Information System (INIS)

    Silagadze, Z.K.

    2007-01-01

    Two-dimensional generalization of the original peak finding algorithm suggested earlier is given. The ideology of the algorithm emerged from the well-known quantum mechanical tunneling property which enables small bodies to penetrate through narrow potential barriers. We merge this 'quantum' ideology with the philosophy of Particle Swarm Optimization to get the global optimization algorithm which can be called Quantum Swarm Optimization. The functionality of the newborn algorithm is tested on some benchmark optimization problems

  13. Drivers of peak sales for pharmaceutical brands

    NARCIS (Netherlands)

    Fischer, Marc; Leeflang, Peter S. H.; Verhoef, Peter C.

    2010-01-01

    Peak sales are an important metric in the pharmaceutical industry. Specifically, managers are focused on the height-of-peak-sales and the time required achieving peak sales. We analyze how order of entry and quality affect the level of peak sales and the time-to-peak-sales of pharmaceutical brands.

  14. Spatial peak-load pricing

    International Nuclear Information System (INIS)

    Arellano, M. Soledad; Serra, Pablo

    2007-01-01

    This article extends the traditional electricity peak-load pricing model to include transmission costs. In the context of a two-node, two-technology electric power system, where suppliers face inelastic demand, we show that when the marginal plant is located at the energy-importing center, generators located away from that center should pay the marginal capacity transmission cost; otherwise, consumers should bear this cost through capacity payments. Since electric power transmission is a natural monopoly, marginal-cost pricing does not fully cover costs. We propose distributing the revenue deficit among users in proportion to the surplus they derive from the service priced at marginal cost. (Author)

  15. Economic effects of peak oil

    International Nuclear Information System (INIS)

    Lutz, Christian; Lehr, Ulrike; Wiebe, Kirsten S.

    2012-01-01

    Assuming that global oil production peaked, this paper uses scenario analysis to show the economic effects of a possible supply shortage and corresponding rise in oil prices in the next decade on different sectors in Germany and other major economies such as the US, Japan, China, the OPEC or Russia. Due to the price-inelasticity of oil demand the supply shortage leads to a sharp increase in oil prices in the second scenario, with high effects on GDP comparable to the magnitude of the global financial crises in 2008/09. Oil exporting countries benefit from high oil prices, whereas oil importing countries are negatively affected. Generally, the effects in the third scenario are significantly smaller than in the second, showing that energy efficiency measures and the switch to renewable energy sources decreases the countries' dependence on oil imports and hence reduces their vulnerability to oil price shocks on the world market. - Highlights: ► National and sectoral economic effects of peak oil until 2020 are modelled. ► The price elasticity of oil demand is low resulting in high price fluctuations. ► Oil shortage strongly affects transport and indirectly all other sectors. ► Global macroeconomic effects are comparable to the 2008/2009 crisis. ► Country effects depend on oil imports and productivity, and economic structures.

  16. Library correlation nuclide identification algorithm

    International Nuclear Information System (INIS)

    Russ, William R.

    2007-01-01

    A novel nuclide identification algorithm, Library Correlation Nuclide Identification (LibCorNID), is proposed. In addition to the spectrum, LibCorNID requires the standard energy, peak shape and peak efficiency calibrations. Input parameters include tolerances for some expected variations in the calibrations, a minimum relative nuclide peak area threshold, and a correlation threshold. Initially, the measured peak spectrum is obtained as the residual after baseline estimation via peak erosion, removing the continuum. Library nuclides are filtered by examining the possible nuclide peak areas in terms of the measured peak spectrum and applying the specified relative area threshold. Remaining candidates are used to create a set of theoretical peak spectra based on the calibrations and library entries. These candidate spectra are then simultaneously fit to the measured peak spectrum while also optimizing the calibrations within the bounds of the specified tolerances. Each candidate with optimized area still exceeding the area threshold undergoes a correlation test. The normalized Pearson's correlation value is calculated as a comparison of the optimized nuclide peak spectrum to the measured peak spectrum with the other optimized peak spectra subtracted. Those candidates with correlation values that exceed the specified threshold are identified and their optimized activities are output. An evaluation of LibCorNID was conducted to verify identification performance in terms of detection probability and false alarm rate. LibCorNID has been shown to perform well compared to standard peak-based analyses

  17. Neurofeedback training for peak performance

    Directory of Open Access Journals (Sweden)

    Marek Graczyk

    2014-11-01

    Full Text Available [b]aim[/b]. One of the applications of the Neurofeedback methodology is peak performance in sport. The protocols of the neurofeedback are usually based on an assessment of the spectral parameters of spontaneous EEG in resting state conditions. The aim of the paper was to study whether the intensive neurofeedback training of a well-functioning Olympic athlete who has lost his performance confidence after injury in sport, could change the brain functioning reflected in changes in spontaneous EEG and event related potentials (ERPs. [b]case study[/b]. The case is presented of an Olympic athlete who has lost his performance confidence after injury in sport. He wanted to resume his activities by means of neurofeedback training. His QEEG/ERP parameters were assessed before and after 4 intensive sessions of neurotherapy. Dramatic and statistically significant changes that could not be explained by error measurement were observed in the patient. [b]conclusion[/b]. Neurofeedback training in the subject under study increased the amplitude of the monitoring component of ERPs generated in the anterior cingulate cortex, accompanied by an increase in beta activity over the medial prefrontal cortex. Taking these changes together, it can be concluded that that even a few sessions of neurofeedback in a high performance brain can significantly activate the prefrontal cortical areas associated with increasing confidence in sport performance.

  18. Reactor power peaking information display

    International Nuclear Information System (INIS)

    Book, T.L.; Kochendarfer, R.A.

    1986-01-01

    This patent describes a system for monitoring operating conditions within a nuclear reactor. The system consists of a method for measuring the operating parameters within the nuclear reactor, including the position of axial power shaping rods and regulating control rod. It also includes a method for determining from the operating parameters the operating limits before a power peaking condition exists within the nuclear reactor, and a method for displaying the operating limits which consists of a visual display permitting the continuous monitoring of the operating conditions within the nuclear reactor as a graph of the shaping rod position vs the regulating rod position having a permissible area and a restricted area. The permissible area is further divided into a recommended operating area for steady state operation and a cursor located on the graph to indicate the present operating condition of the nuclear reactor to allow an operator to view any need for corrective action based on the movement of the cursor out of the recommended operating area and to take any corrective transient action within the permissible area

  19. Neurofeedback training for peak performance.

    Science.gov (United States)

    Graczyk, Marek; Pąchalska, Maria; Ziółkowski, Artur; Mańko, Grzegorz; Łukaszewska, Beata; Kochanowicz, Kazimierz; Mirski, Andrzej; Kropotov, Iurii D

    2014-01-01

    One of the applications of the Neurofeedback methodology is peak performance in sport. The protocols of the neurofeedback are usually based on an assessment of the spectral parameters of spontaneous EEG in resting state conditions. The aim of the paper was to study whether the intensive neurofeedback training of a well-functioning Olympic athlete who has lost his performance confidence after injury in sport, could change the brain functioning reflected in changes in spontaneous EEG and event related potentials (ERPs). The case is presented of an Olympic athlete who has lost his performance confidence after injury in sport. He wanted to resume his activities by means of neurofeedback training. His QEEG/ERP parameters were assessed before and after 4 intensive sessions of neurotherapy. Dramatic and statistically significant changes that could not be explained by error measurement were observed in the patient. Neurofeedback training in the subject under study increased the amplitude of the monitoring component of ERPs generated in the anterior cingulate cortex, accompanied by an increase in beta activity over the medial prefrontal cortex. Taking these changes together, it can be concluded that that even a few sessions of neurofeedback in a high performance brain can significantly activate the prefrontal cortical areas associated with increasing confidence in sport performance.

  20. New Waste Beverage Cans Identification Method

    Directory of Open Access Journals (Sweden)

    Firmansyah Burlian

    2016-05-01

    Full Text Available The primary emphasis of this work is on the development of a new waste beverage cans identification method for automated beverage cans sorting systems known as the SVS system. The method described involved window-based subdivision of the image into X-cells, construction of X-candidate template for N-cells, calculation of matching scores of reference templates for the N-cells image, and application of matching score to identify the grade of the object. The SVS system performance for correct beverage cans grade identification is 95.17% with estimated throughput of 21,600 objects per hour with a conveyor belt width of 18˝. The weight of the throughput depends on the size and type of the objects.

  1. Passive radio frequency peak power multiplier

    Science.gov (United States)

    Farkas, Zoltan D.; Wilson, Perry B.

    1977-01-01

    Peak power multiplication of a radio frequency source by simultaneous charging of two high-Q resonant microwave cavities by applying the source output through a directional coupler to the cavities and then reversing the phase of the source power to the coupler, thereby permitting the power in the cavities to simultaneously discharge through the coupler to the load in combination with power from the source to apply a peak power to the load that is a multiplication of the source peak power.

  2. Practical load management - Peak shaving using photovoltaics

    International Nuclear Information System (INIS)

    Berger, W.

    2009-01-01

    This article takes a look at how photovoltaic (PV) power generation can be used in a practical way to meet peak demands for electricity. Advice is provided on how photovoltaics can provide peak load 'shaving' through the correlation between its production and the peak loads encountered during the day. The situation regarding feed-in tariffs in Italy is discussed, as are further examples of installations in Germany and Austria. Further, an initiative of the American Southern California Edison utility is discussed which foresees the installation of large PV plant on the roofs of commercial premises to provide local generation of peak energy and thus relieve demands on their power transportation network.

  3. The geomorphic structure of the runoff peak

    Directory of Open Access Journals (Sweden)

    R. Rigon

    2011-06-01

    Full Text Available This paper develops a theoretical framework to investigate the core dependence of peak flows on the geomorphic properties of river basins. Based on the theory of transport by travel times, and simple hydrodynamic characterization of floods, this new framework invokes the linearity and invariance of the hydrologic response to provide analytical and semi-analytical expressions for peak flow, time to peak, and area contributing to the peak runoff. These results are obtained for the case of constant-intensity hyetograph using the Intensity-Duration-Frequency (IDF curves to estimate extreme flow values as a function of the rainfall return period. Results show that, with constant-intensity hyetographs, the time-to-peak is greater than rainfall duration and usually shorter than the basin concentration time. Moreover, the critical storm duration is shown to be independent of rainfall return period as well as the area contributing to the flow peak. The same results are found when the effects of hydrodynamic dispersion are accounted for. Further, it is shown that, when the effects of hydrodynamic dispersion are negligible, the basin area contributing to the peak discharge does not depend on the channel velocity, but is a geomorphic propriety of the basin. As an example this framework is applied to three watersheds. In particular, the runoff peak, the critical rainfall durations and the time to peak are calculated for all links within a network to assess how they increase with basin area.

  4. Improved peak detection in mass spectrum by incorporating continuous wavelet transform-based pattern matching.

    Science.gov (United States)

    Du, Pan; Kibbe, Warren A; Lin, Simon M

    2006-09-01

    A major problem for current peak detection algorithms is that noise in mass spectrometry (MS) spectra gives rise to a high rate of false positives. The false positive rate is especially problematic in detecting peaks with low amplitudes. Usually, various baseline correction algorithms and smoothing methods are applied before attempting peak detection. This approach is very sensitive to the amount of smoothing and aggressiveness of the baseline correction, which contribute to making peak detection results inconsistent between runs, instrumentation and analysis methods. Most peak detection algorithms simply identify peaks based on amplitude, ignoring the additional information present in the shape of the peaks in a spectrum. In our experience, 'true' peaks have characteristic shapes, and providing a shape-matching function that provides a 'goodness of fit' coefficient should provide a more robust peak identification method. Based on these observations, a continuous wavelet transform (CWT)-based peak detection algorithm has been devised that identifies peaks with different scales and amplitudes. By transforming the spectrum into wavelet space, the pattern-matching problem is simplified and in addition provides a powerful technique for identifying and separating the signal from the spike noise and colored noise. This transformation, with the additional information provided by the 2D CWT coefficients can greatly enhance the effective signal-to-noise ratio. Furthermore, with this technique no baseline removal or peak smoothing preprocessing steps are required before peak detection, and this improves the robustness of peak detection under a variety of conditions. The algorithm was evaluated with SELDI-TOF spectra with known polypeptide positions. Comparisons with two other popular algorithms were performed. The results show the CWT-based algorithm can identify both strong and weak peaks while keeping false positive rate low. The algorithm is implemented in R and will be

  5. Employer Attitudes towards Peak Hour Avoidance

    NARCIS (Netherlands)

    Vonk Noordegraaf, D.M.; Annema, J.A.

    2012-01-01

    Peak Hour Avoidance is a relatively new Dutch mobility management measure. To reduce congestion frequent car drivers are given a financial reward for reducing the proportion of trips that they make during peak hours on a specific motorway section. Although previous studies show that employers are

  6. Employer attitudes towards peak hour avoidance

    NARCIS (Netherlands)

    Noordegraaf, D.M.V.; Annema, J.A.

    2012-01-01

    Peak Hour Avoidance is a relatively new Dutch mobility management measure. To reduce congestion frequent car drivers are given a financial reward for reducing the proportion of trips that they make during peak hours on a specific motorway section. Although previous studies show that employers are

  7. Peak load pricing lowers generation costs

    International Nuclear Information System (INIS)

    Lande, R.H.

    1980-01-01

    Before a utility implements peak load pricing for different classes of consumers, the costs and the benefits should be compared. The methodology described enables a utility to determine whether peak load pricing should be introduced for specific users. Cost-benefit analyses for domestic consumers and commercial/industrial consumers, showing break-even points are presented. (author)

  8. Peak Shaving Considering Streamflow Uncertainties | Iwuagwu ...

    African Journals Online (AJOL)

    The main thrust of this paper is peak shaving with a Stochastic hydro model. In peak sharing, the amount of hydro energy scheduled may be a minimum but it serves to replace less efficient thermal units. The sample system is die Kainji hydro plant and the thermal units of the National Electric Power Authority. The random ...

  9. The peak in neutron powder diffraction

    International Nuclear Information System (INIS)

    Laar, B. van; Yelon, W.B.

    1984-01-01

    For the application of Rietveld profile analysis to neutron powder diffraction data a precise knowledge of the peak profile, in both shape and position, is required. The method now in use employs a Gaussian shaped profile with a semi-empirical asymmetry correction for low-angle peaks. The integrated intensity is taken to be proportional to the classical Lorentz factor calculated for the X-ray case. In this paper an exact expression is given for the peak profile based upon the geometrical dimensions of the diffractometer. It is shown that the asymmetry of observed peaks is well reproduced by this expression. The angular displacement of the experimental profile with respect to the nominal Bragg angle value is larger than expected. Values for the correction to the classical Lorentz factor for the integrated intensity are given. The exact peak profile expression has been incorporated into a Rietveld profile analysis refinement program. (Auth.)

  10. Peak tree: a new tool for multiscale hierarchical representation and peak detection of mass spectrometry data.

    Science.gov (United States)

    Zhang, Peng; Li, Houqiang; Wang, Honghui; Wong, Stephen T C; Zhou, Xiaobo

    2011-01-01

    Peak detection is one of the most important steps in mass spectrometry (MS) analysis. However, the detection result is greatly affected by severe spectrum variations. Unfortunately, most current peak detection methods are neither flexible enough to revise false detection results nor robust enough to resist spectrum variations. To improve flexibility, we introduce peak tree to represent the peak information in MS spectra. Each tree node is a peak judgment on a range of scales, and each tree decomposition, as a set of nodes, is a candidate peak detection result. To improve robustness, we combine peak detection and common peak alignment into a closed-loop framework, which finds the optimal decomposition via both peak intensity and common peak information. The common peak information is derived and loopily refined from the density clustering of the latest peak detection result. Finally, we present an improved ant colony optimization biomarker selection method to build a whole MS analysis system. Experiment shows that our peak detection method can better resist spectrum variations and provide higher sensitivity and lower false detection rates than conventional methods. The benefits from our peak-tree-based system for MS disease analysis are also proved on real SELDI data.

  11. Multiscale peak detection in wavelet space.

    Science.gov (United States)

    Zhang, Zhi-Min; Tong, Xia; Peng, Ying; Ma, Pan; Zhang, Ming-Jin; Lu, Hong-Mei; Chen, Xiao-Qing; Liang, Yi-Zeng

    2015-12-07

    Accurate peak detection is essential for analyzing high-throughput datasets generated by analytical instruments. Derivatives with noise reduction and matched filtration are frequently used, but they are sensitive to baseline variations, random noise and deviations in the peak shape. A continuous wavelet transform (CWT)-based method is more practical and popular in this situation, which can increase the accuracy and reliability by identifying peaks across scales in wavelet space and implicitly removing noise as well as the baseline. However, its computational load is relatively high and the estimated features of peaks may not be accurate in the case of peaks that are overlapping, dense or weak. In this study, we present multi-scale peak detection (MSPD) by taking full advantage of additional information in wavelet space including ridges, valleys, and zero-crossings. It can achieve a high accuracy by thresholding each detected peak with the maximum of its ridge. It has been comprehensively evaluated with MALDI-TOF spectra in proteomics, the CAMDA 2006 SELDI dataset as well as the Romanian database of Raman spectra, which is particularly suitable for detecting peaks in high-throughput analytical signals. Receiver operating characteristic (ROC) curves show that MSPD can detect more true peaks while keeping the false discovery rate lower than MassSpecWavelet and MALDIquant methods. Superior results in Raman spectra suggest that MSPD seems to be a more universal method for peak detection. MSPD has been designed and implemented efficiently in Python and Cython. It is available as an open source package at .

  12. Peptide Peak Detection for Low Resolution MALDI-TOF Mass Spectrometry.

    Science.gov (United States)

    Yao, Jingwen; Utsunomiya, Shin-Ichi; Kajihara, Shigeki; Tabata, Tsuyoshi; Aoshima, Ken; Oda, Yoshiya; Tanaka, Koichi

    2014-01-01

    A new peak detection method has been developed for rapid selection of peptide and its fragment ion peaks for protein identification using tandem mass spectrometry. The algorithm applies classification of peak intensities present in the defined mass range to determine the noise level. A threshold is then given to select ion peaks according to the determined noise level in each mass range. This algorithm was initially designed for the peak detection of low resolution peptide mass spectra, such as matrix-assisted laser desorption/ionization Time-of-Flight (MALDI-TOF) mass spectra. But it can also be applied to other type of mass spectra. This method has demonstrated obtaining a good rate of number of real ions to noises for even poorly fragmented peptide spectra. The effect of using peak lists generated from this method produces improved protein scores in database search results. The reliability of the protein identifications is increased by finding more peptide identifications. This software tool is freely available at the Mass++ home page (http://www.first-ms3d.jp/english/achievement/software/).

  13. Isotope resolution of the iron peak

    International Nuclear Information System (INIS)

    Henke, R.P.; Benton, E.V.

    1977-01-01

    A stack of Lexan detectors from the Apollo 17 mission has been analyzed to obtain Z measurements of sufficient accuracy to resolve the iron peak into its isotopic components. Within this distribution several peaks are present. With the centrally located, most populated peak assumed to be 56 Fe, the measurements imply that the abundances of 54 Fe and 58 Fe are appreciable fractions of the 56 Fe abundance. This result is in agreement with those of Webber et al. and Siegman et al. but in disagreement with the predictions of Tsao et al. (Auth.)

  14. Peak load arrangements : Assessment of Nordel guidelines

    Energy Technology Data Exchange (ETDEWEB)

    2009-07-01

    Two Nordic countries, Sweden and Finland, have legislation that empowers the TSO to acquire designated peak load resources to mitigate the risk for shortage situations during the winter. In Denmark, the system operator procures resources to maintain a satisfactory level of security of supply. In Norway the TSO has set up a Regulation Power Option Market (RKOM) to secure a satisfactory level of operational reserves at all times, also in winter with high load demand. Only the arrangements in Finland and Sweden fall under the heading of Peak Load Arrangements defined in Nordel Guidelines. NordREG has been invited by the Electricity Market Group (EMG) to evaluate Nordel's proposal for 'Guidelines for transitional Peak Load Arrangements'. The EMG has also financed a study made by EC Group to support NordREG in the evaluation of the proposal. The study has been taken into account in NordREG's evaluation. In parallel to the EMG task, the Swedish regulator, the Energy Markets Inspectorate, has been given the task by the Swedish government to investigate a long term solution of the peak load issue. The Swedish and Finnish TSOs have together with Nord Pool Spot worked on finding a harmonized solution for activation of the peak load reserves in the market. An agreement accepted by the relevant authorities was reached in early January 2009, and the arrangement has been implemented since 19th January 2009. NordREG views that the proposed Nordel guidelines have served as a starting point for the presently agreed procedure. However, NordREG does not see any need to further develop the Nordel guidelines for peak load arrangements. NordREG agrees with Nordel that the market should be designed to solve peak load problems through proper incentives to market players. NordREG presumes that the relevant authorities in each country will take decisions on the need for any peak load arrangement to ensure security of supply. NordREG proposes that such decisions should be

  15. Automated Peak Picking and Peak Integration in Macromolecular NMR Spectra Using AUTOPSY

    Science.gov (United States)

    Koradi, Reto; Billeter, Martin; Engeli, Max; Güntert, Peter; Wüthrich, Kurt

    1998-12-01

    A new approach for automated peak picking of multidimensional protein NMR spectra with strong overlap is introduced, which makes use of the program AUTOPSY (automatedpeak picking for NMRspectroscopy). The main elements of this program are a novel function for local noise level calculation, the use of symmetry considerations, and the use of lineshapes extracted from well-separated peaks for resolving groups of strongly overlapping peaks. The algorithm generates peak lists with precise chemical shift and integral intensities, and a reliability measure for the recognition of each peak. The results of automated peak picking of NOESY spectra with AUTOPSY were tested in combination with the combined automated NOESY cross peak assignment and structure calculation routine NOAH implemented in the program DYANA. The quality of the resulting structures was found to be comparable with those from corresponding data obtained with manual peak picking.

  16. Bayesian Peak Picking for NMR Spectra

    KAUST Repository

    Cheng, Yichen

    2014-02-01

    Protein structure determination is a very important topic in structural genomics, which helps people to understand varieties of biological functions such as protein-protein interactions, protein–DNA interactions and so on. Nowadays, nuclear magnetic resonance (NMR) has often been used to determine the three-dimensional structures of protein in vivo. This study aims to automate the peak picking step, the most important and tricky step in NMR structure determination. We propose to model the NMR spectrum by a mixture of bivariate Gaussian densities and use the stochastic approximation Monte Carlo algorithm as the computational tool to solve the problem. Under the Bayesian framework, the peak picking problem is casted as a variable selection problem. The proposed method can automatically distinguish true peaks from false ones without preprocessing the data. To the best of our knowledge, this is the first effort in the literature that tackles the peak picking problem for NMR spectrum data using Bayesian method.

  17. Peak-Seeking Control for Trim Optimization

    Data.gov (United States)

    National Aeronautics and Space Administration — Innovators have developed a peak-seeking algorithm that can reduce drag and improve performance and fuel efficiency by optimizing aircraft trim in real time. The...

  18. Instream flow needs below peaking hydroelectric projects

    International Nuclear Information System (INIS)

    Milhous, R.T.

    1991-01-01

    This paper reports on a method developed to assist in the determination of instream flow needs below hydroelectric projects operated in a peaking mode. Peaking hydroelectric projects significantly change streamflow over a short period of time; consequently, any instream flow methodology must consider the dual flows associated with peaking projects. The dual flows are the lowest flow and the maximum generation flow of a peaking cycle. The methodology is based on elements of the Physical Habitat Simulation System of the U.S. Fish and Wildlife Service and uses habitat, rather than fish numbers or biomas, as at basic response variable. All aquatic animals are subject to the rapid changes in streamflow which cause rapid swings in habitat quality. Some aquatic organisms are relatively fixed in location in the stream while others can move when flows change. The habitat available from a project operated in peaking mode is considered to be the minimum habitat occurring during a cycle of habitat change. The methodology takes in to consideration that some aquatic animals can move and others cannot move during a peaking cycle

  19. Study on the influence of lipid peak to the results of MR spectroscopy in the central gland of prostate

    International Nuclear Information System (INIS)

    Dong Yanjun; Wang Xiaoying; Li Feiyu; Jiang Xuexiang

    2007-01-01

    Objective: To study the influence of lipid peak to MRS in central gland of prostate gland. Methods: Seventeen patients performed transurethral resection of prostate (TURP) for benign prostate hyperplasia (BPH) were enrolled in this study. Three groups were divided according to the pathological findings: glandular-BPH (GBPH) (7 cases), stromal-BPH (SBPH) (6 cases), and incidentally detected prostate carcinoma (IDPC) (4 cases). The voxel with lipid peak in the field of volume was counted. Compared with pathology, the following studies were performed: (1) The location of the voxels that more frequently presented lipid peak in the central gland. (2) Whether the appearance of the lipid peak would obscure the identification of the peaks of the endogenous metabolites. Results: The ratio of voxels with lipid peak in central gland was about 22.8% (834/3567). There were 1477 (397 voxels with lipid peak), 1434(396 voxels with lipid peak), and 656(41 voxels with lipid peak) voxels in CBPH, SBPH, and IDPC groups, respectively. The percentage in GBPH, SBPH, and IDPC groups was 23.6%, 27.2%, and 6.4%, respectively. The percentage of voxels with lipid peak at the edge of the central gland (79.6%, 68.6% and 72.4%, respectively) was higher than that in other regions. The lipid peak in most of the voxels didn't influence the identification of the citrate and choline peak (82.8%, 98.0%, and 96.4%, respectively). Conclusion: The lipid peak in the central gland may result from the lipid tissues near the gland, and most lipid peak had no influence on the identification of endogenous metabolites. (authors)

  20. ASPeak: an abundance sensitive peak detection algorithm for RIP-Seq.

    Science.gov (United States)

    Kucukural, Alper; Özadam, Hakan; Singh, Guramrit; Moore, Melissa J; Cenik, Can

    2013-10-01

    Unlike DNA, RNA abundances can vary over several orders of magnitude. Thus, identification of RNA-protein binding sites from high-throughput sequencing data presents unique challenges. Although peak identification in ChIP-Seq data has been extensively explored, there are few bioinformatics tools tailored for peak calling on analogous datasets for RNA-binding proteins. Here we describe ASPeak (abundance sensitive peak detection algorithm), an implementation of an algorithm that we previously applied to detect peaks in exon junction complex RNA immunoprecipitation in tandem experiments. Our peak detection algorithm yields stringent and robust target sets enabling sensitive motif finding and downstream functional analyses. ASPeak is implemented in Perl as a complete pipeline that takes bedGraph files as input. ASPeak implementation is freely available at https://sourceforge.net/projects/as-peak under the GNU General Public License. ASPeak can be run on a personal computer, yet is designed to be easily parallelizable. ASPeak can also run on high performance computing clusters providing efficient speedup. The documentation and user manual can be obtained from http://master.dl.sourceforge.net/project/as-peak/manual.pdf.

  1. Limitation of peak fitting and peak shape methods for determination of activation energy of thermoluminescence glow peaks

    CERN Document Server

    Sunta, C M; Piters, T M; Watanabe, S

    1999-01-01

    This paper shows the limitation of general order peak fitting and peak shape methods for determining the activation energy of the thermoluminescence glow peaks in the cases in which retrapping probability is much higher than the recombination probability and the traps are filled up to near saturation level. Right values can be obtained when the trap occupancy is reduced by using small doses or by post-irradiation partial bleaching. This limitation in the application of these methods has not been indicated earlier. In view of the unknown nature of kinetics in the experimental samples, it is recommended that these methods of activation energy determination should be applied only at doses well below the saturation dose.

  2. Statistics of peaks of Gaussian random fields

    International Nuclear Information System (INIS)

    Bardeen, J.M.; Bond, J.R.; Kaiser, N.; Szalay, A.S.; Stanford Univ., CA; California Univ., Berkeley; Cambridge Univ., England; Fermi National Accelerator Lab., Batavia, IL)

    1986-01-01

    A set of new mathematical results on the theory of Gaussian random fields is presented, and the application of such calculations in cosmology to treat questions of structure formation from small-amplitude initial density fluctuations is addressed. The point process equation is discussed, giving the general formula for the average number density of peaks. The problem of the proper conditional probability constraints appropriate to maxima are examined using a one-dimensional illustration. The average density of maxima of a general three-dimensional Gaussian field is calculated as a function of heights of the maxima, and the average density of upcrossing points on density contour surfaces is computed. The number density of peaks subject to the constraint that the large-scale density field be fixed is determined and used to discuss the segregation of high peaks from the underlying mass distribution. The machinery to calculate n-point peak-peak correlation functions is determined, as are the shapes of the profiles about maxima. 67 references

  3. Peak Oil, threat or energy worlds' phantasm?

    International Nuclear Information System (INIS)

    Favennec, Jean-Pierre

    2011-01-01

    The concept of Peak Oil is based on the work of King Hubbert, a petroleum geologist who worked for Shell in the USA in the 1960's. Based on the fact that discoveries in America reached a maximum in the 1930's, he announced that American production would reach a maximum in 1969, which did actually occur. Geologists members of the Association for the Study of Peak Oil have extrapolated this result to a worldwide scale and, since oil discoveries reached a peak in the 1960's, argued that production will peak in the very near future. It is clear that hydrocarbon reserves are finite and therefore exhaustible. But little is known regarding the level of ultimate (i.e. total existing) reserves. There are probably very large reserves of non conventional oil in addition to the reserves of conventional oil. An increasing number of specialists put maximum production at less than 100 Mb/d more for geopolitical than physical reasons. Attainable peak production will probably vary from year to year and will depend on how crude oil prices develop

  4. Electric peak power forecasting by year 2025

    International Nuclear Information System (INIS)

    Alsayegh, O.A.; Al-Matar, O.A.; Fairouz, F.A.; Al-Mulla Ali, A.

    2005-01-01

    Peak power demand in Kuwait up to the year 2025 was predicted using an artificial neural network (ANN) model. The aim of the study was to investigate the effect of air conditioning (A/C) units on long-term power demand. Five socio-economic factors were selected as inputs for the simulation: (1) gross national product, (2) population, (3) number of buildings, (4) imports of A/C units, and (5) index of industrial production. The study used socio-economic data from 1978 to 2000. Historical data of the first 10 years of the studied time period were used to train the ANN. The electrical network was then simulated to forecast peak power for the following 11 years. The calculated error was then used for years in which power consumption data were not available. The study demonstrated that average peak power rates increased by 4100 MW every 5 years. Various scenarios related to changes in population, the number of buildings, and the quantity of A/C units were then modelled to estimate long-term peak power demand. Results of the study demonstrated that population had the strongest impact on future power demand, while the number of buildings had the smallest impact. It was concluded that peak power growth can be controlled through the use of different immigration policies, increased A/C efficiency, and the use of vertical housing. 7 refs., 2 tabs., 6 figs

  5. Electric peak power forecasting by year 2025

    Energy Technology Data Exchange (ETDEWEB)

    Alsayegh, O.A.; Al-Matar, O.A.; Fairouz, F.A.; Al-Mulla Ali, A. [Kuwait Inst. for Scientific Research, Kuwait City (Kuwait). Div. of Environment and Urban Development

    2005-07-01

    Peak power demand in Kuwait up to the year 2025 was predicted using an artificial neural network (ANN) model. The aim of the study was to investigate the effect of air conditioning (A/C) units on long-term power demand. Five socio-economic factors were selected as inputs for the simulation: (1) gross national product, (2) population, (3) number of buildings, (4) imports of A/C units, and (5) index of industrial production. The study used socio-economic data from 1978 to 2000. Historical data of the first 10 years of the studied time period were used to train the ANN. The electrical network was then simulated to forecast peak power for the following 11 years. The calculated error was then used for years in which power consumption data were not available. The study demonstrated that average peak power rates increased by 4100 MW every 5 years. Various scenarios related to changes in population, the number of buildings, and the quantity of A/C units were then modelled to estimate long-term peak power demand. Results of the study demonstrated that population had the strongest impact on future power demand, while the number of buildings had the smallest impact. It was concluded that peak power growth can be controlled through the use of different immigration policies, increased A/C efficiency, and the use of vertical housing. 7 refs., 2 tabs., 6 figs.

  6. Using Signal Detection Theory and Time Window-based Human-In-The-Loop simulation as a tool for assessing the effectiveness of different qualitative shapes in continuous monitoring tasks.

    Science.gov (United States)

    Kim, Jung Hyup; Rothrock, Ling; Laberge, Jason

    2014-05-01

    This paper provides a case study of Signal Detection Theory (SDT) as applied to a continuous monitoring dual-task environment. Specifically, SDT was used to evaluate the independent contributions of sensitivity and bias to different qualitative gauges used in process control. To assess detection performance in monitoring the gauges, we developed a Time Window-based Human-In-The-Loop (TWHITL) simulation bed. Through this test bed, we were able to generate a display similar to those monitored by console operators in oil and gas refinery plants. By using SDT and TWHITL, we evaluated the sensitivity, operator bias, and response time of flow, level, pressure, and temperature gauge shapes developed by Abnormal Situation Management(®) (ASM(®)) Consortium (www.asmconsortium.org). Our findings suggest that display density influences the effectiveness of participants in detecting abnormal shapes. Furthermore, results suggest that some shapes elicit better detection performance than others. Copyright © 2013 Elsevier Ltd and The Ergonomics Society. All rights reserved.

  7. Optical and near-infrared imaging of faint Gigahertz Peaked Spectrum sources

    NARCIS (Netherlands)

    Snellen, IAG; Schilizzi, RT; de Bruyn, AG; Miley, GK; Rottgering, HJA; McMahon, RG; Fournon, IP

    1998-01-01

    A sample of 47 faint Gigahertz Peaked Spectrum (GPS) radio sources selected from the Westerbork Northern Sky Survey (WENSS) has been imaged in the optical and near-infrared, resulting in an identification fraction of 87 per cent. The R - I and R - K colours of the faint optical counterparts are as

  8. Cervical vertebral maturation method and mandibular growth peak: a longitudinal study of diagnostic reliability.

    Science.gov (United States)

    Perinetti, Giuseppe; Primozic, Jasmina; Sharma, Bhavna; Cioffi, Iacopo; Contardo, Luca

    2018-03-28

    The capability of the cervical vertebral maturation (CVM) method in the identification of the mandibular growth peak on an individual basis remains undetermined. The diagnostic reliability of the six-stage CVM method in the identification of the mandibular growth peak was thus investigated. From the files of the Oregon and Burlington Growth Studies (data obtained between early 1950s and middle 1970s), 50 subjects (26 females, 24 males) with at least seven annual lateral cephalograms taken from 9 to 16 years were identified. Cervical vertebral maturation was assessed according to the CVM code staging system, and mandibular growth was defined as annual increments in Co-Gn distance. A diagnostic reliability analysis was carried out to establish the capability of the circumpubertal CVM stages 2, 3, and 4 in the identification of the imminent mandibular growth peak. Variable durations of each of the CVM stages 2, 3, and 4 were seen. The overall diagnostic accuracy values for the CVM stages 2, 3, and 4 were 0.70, 0.76, and 0.77, respectively. These low values appeared to be due to false positive cases. Secular trends in conjunction with the use of a discrete staging system. In most of the Burlington Growth Study sample, the lateral head film at age 15 was missing. None of the CVM stages 2, 3, and 4 reached a satisfactorily diagnostic reliability in the identification of imminent mandibular growth peak.

  9. SPANISH PEAKS WILDERNESS STUDY AREA, COLORADO.

    Science.gov (United States)

    Budding, Karin E.; Kluender, Steven E.

    1984-01-01

    A geologic and geochemical investigation and a survey of mines and prospects were conducted to evaluate the mineral-resource potential of the Spanish Peaks Wilderness Study Area, Huerfano and Las Animas Counties, in south-central Colorado. Anomalous gold, silver, copper, lead, and zinc concentrations in rocks and in stream sediments from drainage basins in the vicinity of the old mines and prospects on West Spanish Peak indicate a substantiated mineral-resource potential for base and precious metals in the area surrounding this peak; however, the mineralized veins are sparse, small in size, and generally low in grade. There is a possibility that coal may underlie the study area, but it would be at great depth and it is unlikely that it would have survived the intense igneous activity in the area. There is little likelihood for the occurrence of oil and gas because of the lack of structural traps and the igneous activity.

  10. Analysis of fuel end-temperature peaking

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Z.; Jiang, Q.; Lai, L.; Shams, M. [CANDU Energy Inc., Fuel Engineering Dept., Mississauga, Ontario (Canada)

    2013-07-01

    During normal operation and refuelling of CANDU® fuel, fuel temperatures near bundle ends will increase due to a phenomenon called end flux peaking. Similar phenomenon would also be expected to occur during a postulated large break LOCA event. The end flux peaking in a CANDU fuel element is due to the fact that neutron flux is higher near a bundle end, in contact with a neighbouring bundle or close to heavy water coolant, than in the bundle mid-plane, because of less absorption of thermal neutrons by Zircaloy or heavy water than by the UO{sub 2} material. This paper describes Candu Energy experience in analysing behaviour of bundle due to end flux peaking using fuel codes FEAT, ELESTRES and ELOCA. (author)

  11. A non-parametric peak calling algorithm for DamID-Seq.

    Directory of Open Access Journals (Sweden)

    Renhua Li

    Full Text Available Protein-DNA interactions play a significant role in gene regulation and expression. In order to identify transcription factor binding sites (TFBS of double sex (DSX-an important transcription factor in sex determination, we applied the DNA adenine methylation identification (DamID technology to the fat body tissue of Drosophila, followed by deep sequencing (DamID-Seq. One feature of DamID-Seq data is that induced adenine methylation signals are not assured to be symmetrically distributed at TFBS, which renders the existing peak calling algorithms for ChIP-Seq, including SPP and MACS, inappropriate for DamID-Seq data. This challenged us to develop a new algorithm for peak calling. A challenge in peaking calling based on sequence data is estimating the averaged behavior of background signals. We applied a bootstrap resampling method to short sequence reads in the control (Dam only. After data quality check and mapping reads to a reference genome, the peaking calling procedure compromises the following steps: 1 reads resampling; 2 reads scaling (normalization and computing signal-to-noise fold changes; 3 filtering; 4 Calling peaks based on a statistically significant threshold. This is a non-parametric method for peak calling (NPPC. We also used irreproducible discovery rate (IDR analysis, as well as ChIP-Seq data to compare the peaks called by the NPPC. We identified approximately 6,000 peaks for DSX, which point to 1,225 genes related to the fat body tissue difference between female and male Drosophila. Statistical evidence from IDR analysis indicated that these peaks are reproducible across biological replicates. In addition, these peaks are comparable to those identified by use of ChIP-Seq on S2 cells, in terms of peak number, location, and peaks width.

  12. A non-parametric peak calling algorithm for DamID-Seq.

    Science.gov (United States)

    Li, Renhua; Hempel, Leonie U; Jiang, Tingbo

    2015-01-01

    Protein-DNA interactions play a significant role in gene regulation and expression. In order to identify transcription factor binding sites (TFBS) of double sex (DSX)-an important transcription factor in sex determination, we applied the DNA adenine methylation identification (DamID) technology to the fat body tissue of Drosophila, followed by deep sequencing (DamID-Seq). One feature of DamID-Seq data is that induced adenine methylation signals are not assured to be symmetrically distributed at TFBS, which renders the existing peak calling algorithms for ChIP-Seq, including SPP and MACS, inappropriate for DamID-Seq data. This challenged us to develop a new algorithm for peak calling. A challenge in peaking calling based on sequence data is estimating the averaged behavior of background signals. We applied a bootstrap resampling method to short sequence reads in the control (Dam only). After data quality check and mapping reads to a reference genome, the peaking calling procedure compromises the following steps: 1) reads resampling; 2) reads scaling (normalization) and computing signal-to-noise fold changes; 3) filtering; 4) Calling peaks based on a statistically significant threshold. This is a non-parametric method for peak calling (NPPC). We also used irreproducible discovery rate (IDR) analysis, as well as ChIP-Seq data to compare the peaks called by the NPPC. We identified approximately 6,000 peaks for DSX, which point to 1,225 genes related to the fat body tissue difference between female and male Drosophila. Statistical evidence from IDR analysis indicated that these peaks are reproducible across biological replicates. In addition, these peaks are comparable to those identified by use of ChIP-Seq on S2 cells, in terms of peak number, location, and peaks width.

  13. Osteoporosis: Peak Bone Mass in Women

    Science.gov (United States)

    ... bone density are seen even during childhood and adolescence. Hormonal factors. The hormone estrogen has an effect on peak bone mass. For example, women who had their first menstrual cycle at an early age and those who use oral contraceptives, which contain estrogen, often have high bone mineral ...

  14. Facility Location with Double-peaked Preferences

    DEFF Research Database (Denmark)

    Filos-Ratsikas, Aris; Li, Minming; Zhang, Jie

    2015-01-01

    ; this makes the problem essentially more challenging. As our main contribution, we present a simple truthful-in-expectation mechanism that achieves an approximation ratio of 1+b=c for both the social and the maximum, cost, where b is the distance of the agent from the peak and c is the minimum cost...

  15. Robust Peak Recognition in Intracranial Pressure Signals

    Directory of Open Access Journals (Sweden)

    Bergsneider Marvin

    2010-10-01

    Full Text Available Abstract Background The waveform morphology of intracranial pressure pulses (ICP is an essential indicator for monitoring, and forecasting critical intracranial and cerebrovascular pathophysiological variations. While current ICP pulse analysis frameworks offer satisfying results on most of the pulses, we observed that the performance of several of them deteriorates significantly on abnormal, or simply more challenging pulses. Methods This paper provides two contributions to this problem. First, it introduces MOCAIP++, a generic ICP pulse processing framework that generalizes MOCAIP (Morphological Clustering and Analysis of ICP Pulse. Its strength is to integrate several peak recognition methods to describe ICP morphology, and to exploit different ICP features to improve peak recognition. Second, it investigates the effect of incorporating, automatically identified, challenging pulses into the training set of peak recognition models. Results Experiments on a large dataset of ICP signals, as well as on a representative collection of sampled challenging ICP pulses, demonstrate that both contributions are complementary and significantly improve peak recognition performance in clinical conditions. Conclusion The proposed framework allows to extract more reliable statistics about the ICP waveform morphology on challenging pulses to investigate the predictive power of these pulses on the condition of the patient.

  16. Liquid waste processing at Comanche Peak

    International Nuclear Information System (INIS)

    Hughes-Edwards, L.M.; Edwards, J.M.

    1996-01-01

    This article describes the radioactive waste processing at Comanche Peak Steam Electric Station. Topics covered are the following: Reduction of liquid radioactive discharges (system leakage, outage planning); reduction of waste resin generation (waste stream segregation, processing methodology); reduction of activity released and off-site dose. 8 figs., 2 tabs

  17. Avoiding the False Peaks in Correlation Discrimination

    International Nuclear Information System (INIS)

    Awwal, A.S.

    2009-01-01

    Fiducials imprinted on laser beams are used to perform video image based alignment of the 192 laser beams in the National Ignition Facility (NIF) of Lawrence Livermore National Laboratory. In many video images, matched filtering is used to detect the location of these fiducials. Generally, the highest correlation peak is used to determine the position of the fiducials. However, when the signal to-be-detected is very weak compared to the noise, this approach totally breaks down. The highest peaks act as traps for false detection. The active target images used for automatic alignment in the National Ignition Facility are examples of such images. In these images, the fiducials of interest exhibit extremely low intensity and contrast, surrounded by high intensity reflection from metallic objects. Consequently, the highest correlation peaks are caused by these bright objects. In this work, we show how the shape of the correlation is exploited to isolate the valid matches from hundreds of invalid correlation peaks, and therefore identify extremely faint fiducials under very challenging imaging conditions

  18. Hubbert's Peak: the Impending World oil Shortage

    Science.gov (United States)

    Deffeyes, K. S.

    2004-12-01

    Global oil production will probably reach a peak sometime during this decade. After the peak, the world's production of crude oil will fall, never to rise again. The world will not run out of energy, but developing alternative energy sources on a large scale will take at least 10 years. The slowdown in oil production may already be beginning; the current price fluctuations for crude oil and natural gas may be the preamble to a major crisis. In 1956, the geologist M. King Hubbert predicted that U.S. oil production would peak in the early 1970s.1 Almost everyone, inside and outside the oil industry, rejected Hubbert's analysis. The controversy raged until 1970, when the U.S. production of crude oil started to fall. Hubbert was right. Around 1995, several analysts began applying Hubbert's method to world oil production, and most of them estimate that the peak year for world oil will be between 2004 and 2008. These analyses were reported in some of the most widely circulated sources: Nature, Science, and Scientific American.2 None of our political leaders seem to be paying attention. If the predictions are correct, there will be enormous effects on the world economy. Even the poorest nations need fuel to run irrigation pumps. The industrialized nations will be bidding against one another for the dwindling oil supply. The good news is that we will put less carbon dioxide into the atmosphere. The bad news is that my pickup truck has a 25-gallon tank.

  19. Peak picking multidimensional NMR spectra with the contour geometry based algorithm CYPICK

    International Nuclear Information System (INIS)

    Würz, Julia M.; Güntert, Peter

    2017-01-01

    The automated identification of signals in multidimensional NMR spectra is a challenging task, complicated by signal overlap, noise, and spectral artifacts, for which no universally accepted method is available. Here, we present a new peak picking algorithm, CYPICK, that follows, as far as possible, the manual approach taken by a spectroscopist who analyzes peak patterns in contour plots of the spectrum, but is fully automated. Human visual inspection is replaced by the evaluation of geometric criteria applied to contour lines, such as local extremality, approximate circularity (after appropriate scaling of the spectrum axes), and convexity. The performance of CYPICK was evaluated for a variety of spectra from different proteins by systematic comparison with peak lists obtained by other, manual or automated, peak picking methods, as well as by analyzing the results of automated chemical shift assignment and structure calculation based on input peak lists from CYPICK. The results show that CYPICK yielded peak lists that compare in most cases favorably to those obtained by other automated peak pickers with respect to the criteria of finding a maximal number of real signals, a minimal number of artifact peaks, and maximal correctness of the chemical shift assignments and the three-dimensional structure obtained by fully automated assignment and structure calculation.

  20. Peak picking multidimensional NMR spectra with the contour geometry based algorithm CYPICK

    Energy Technology Data Exchange (ETDEWEB)

    Würz, Julia M.; Güntert, Peter, E-mail: guentert@em.uni-frankfurt.de [Goethe University Frankfurt am Main, Institute of Biophysical Chemistry, Center for Biomolecular Magnetic Resonance (Germany)

    2017-01-15

    The automated identification of signals in multidimensional NMR spectra is a challenging task, complicated by signal overlap, noise, and spectral artifacts, for which no universally accepted method is available. Here, we present a new peak picking algorithm, CYPICK, that follows, as far as possible, the manual approach taken by a spectroscopist who analyzes peak patterns in contour plots of the spectrum, but is fully automated. Human visual inspection is replaced by the evaluation of geometric criteria applied to contour lines, such as local extremality, approximate circularity (after appropriate scaling of the spectrum axes), and convexity. The performance of CYPICK was evaluated for a variety of spectra from different proteins by systematic comparison with peak lists obtained by other, manual or automated, peak picking methods, as well as by analyzing the results of automated chemical shift assignment and structure calculation based on input peak lists from CYPICK. The results show that CYPICK yielded peak lists that compare in most cases favorably to those obtained by other automated peak pickers with respect to the criteria of finding a maximal number of real signals, a minimal number of artifact peaks, and maximal correctness of the chemical shift assignments and the three-dimensional structure obtained by fully automated assignment and structure calculation.

  1. Prediction of peak overlap in NMR spectra

    International Nuclear Information System (INIS)

    Hefke, Frederik; Schmucki, Roland; Güntert, Peter

    2013-01-01

    Peak overlap is one of the major factors complicating the analysis of biomolecular NMR spectra. We present a general method for predicting the extent of peak overlap in multidimensional NMR spectra and its validation using both, experimental data sets and Monte Carlo simulation. The method is based on knowledge of the magnetization transfer pathways of the NMR experiments and chemical shift statistics from the Biological Magnetic Resonance Data Bank. Assuming a normal distribution with characteristic mean value and standard deviation for the chemical shift of each observable atom, an analytic expression was derived for the expected overlap probability of the cross peaks. The analytical approach was verified to agree with the average peak overlap in a large number of individual peak lists simulated using the same chemical shift statistics. The method was applied to eight proteins, including an intrinsically disordered one, for which the prediction results could be compared with the actual overlap based on the experimentally measured chemical shifts. The extent of overlap predicted using only statistical chemical shift information was in good agreement with the overlap that was observed when the measured shifts were used in the virtual spectrum, except for the intrinsically disordered protein. Since the spectral complexity of a protein NMR spectrum is a crucial factor for protein structure determination, analytical overlap prediction can be used to identify potentially difficult proteins before conducting NMR experiments. Overlap predictions can be tailored to particular classes of proteins by preparing statistics from corresponding protein databases. The method is also suitable for optimizing recording parameters and labeling schemes for NMR experiments and improving the reliability of automated spectra analysis and protein structure determination.

  2. The peak in anomalous magnetic viscosity

    International Nuclear Information System (INIS)

    Collocott, S.J.; Watterson, P.A.; Tan, X.H.; Xu, H.

    2014-01-01

    Anomalous magnetic viscosity, where the magnetization as a function of time exhibits non-monotonic behaviour, being seen to increase, reach a peak, and then decrease, is observed on recoil lines in bulk amorphous ferromagnets, for certain magnetic prehistories. A simple geometrical approach based on the motion of the state line on the Preisach plane gives a theoretical framework for interpreting non-monotonic behaviour and explains the origin of the peak. This approach gives an expression for the time taken to reach the peak as a function of the applied (or holding) field. The theory is applied to experimental data for bulk amorphous ferromagnet alloys of composition Nd 60−x Fe 30 Al 10 Dy x , x = 0, 1, 2, 3 and 4, and it gives a reasonable description of the observed behaviour. The role played by other key magnetic parameters, such as the intrinsic coercivity and fluctuation field, is also discussed. When the non-monotonic behaviour of the magnetization of a number of alloys is viewed in the context of the model, features of universal behaviour emerge, that are independent of alloy composition. - Highlights: • Development of a simple geometrical model based on the Preisach model which gives a complete explanation of the peak in the magnetic viscosity. • Geometrical approach is extended by considering equations that govern the motion of the state line. • The model is used to deduce the relationship between the holding field and the time it takes to reach the peak. • The model is tested with experimental results for a range of Nd–Fe–Al–Dy bulk amorphous ferromagnets. • There is good agreement between the model and the experimental data

  3. The spatial resolution of epidemic peaks.

    Directory of Open Access Journals (Sweden)

    Harriet L Mills

    2014-04-01

    Full Text Available The emergence of novel respiratory pathogens can challenge the capacity of key health care resources, such as intensive care units, that are constrained to serve only specific geographical populations. An ability to predict the magnitude and timing of peak incidence at the scale of a single large population would help to accurately assess the value of interventions designed to reduce that peak. However, current disease-dynamic theory does not provide a clear understanding of the relationship between: epidemic trajectories at the scale of interest (e.g. city; population mobility; and higher resolution spatial effects (e.g. transmission within small neighbourhoods. Here, we used a spatially-explicit stochastic meta-population model of arbitrary spatial resolution to determine the effect of resolution on model-derived epidemic trajectories. We simulated an influenza-like pathogen spreading across theoretical and actual population densities and varied our assumptions about mobility using Latin-Hypercube sampling. Even though, by design, cumulative attack rates were the same for all resolutions and mobilities, peak incidences were different. Clear thresholds existed for all tested populations, such that models with resolutions lower than the threshold substantially overestimated population-wide peak incidence. The effect of resolution was most important in populations which were of lower density and lower mobility. With the expectation of accurate spatial incidence datasets in the near future, our objective was to provide a framework for how to use these data correctly in a spatial meta-population model. Our results suggest that there is a fundamental spatial resolution for any pathogen-population pair. If underlying interactions between pathogens and spatially heterogeneous populations are represented at this resolution or higher, accurate predictions of peak incidence for city-scale epidemics are feasible.

  4. RESEARCH NOTE Parentage identification of Odontobutis ...

    Indian Academy of Sciences (India)

    44738

    Microsatellite-based parentage identification technology has been widely used .... (201505059), Jiangsu Province Six Talent Peaks of High Level Talents Project ... Kalinowski S. T., Taper M. L., Marshall T. C. 2007 Revising how the computer.

  5. Modelling of peak temperature during friction stir processing of magnesium alloy AZ91

    Science.gov (United States)

    Vaira Vignesh, R.; Padmanaban, R.

    2018-02-01

    Friction stir processing (FSP) is a solid state processing technique with potential to modify the properties of the material through microstructural modification. The study of heat transfer in FSP aids in the identification of defects like flash, inadequate heat input, poor material flow and mixing etc. In this paper, transient temperature distribution during FSP of magnesium alloy AZ91 was simulated using finite element modelling. The numerical model results were validated using the experimental results from the published literature. The model was used to predict the peak temperature obtained during FSP for various process parameter combinations. The simulated peak temperature results were used to develop a statistical model. The effect of process parameters namely tool rotation speed, tool traverse speed and shoulder diameter of the tool on the peak temperature was investigated using the developed statistical model. It was found that peak temperature was directly proportional to tool rotation speed and shoulder diameter and inversely proportional to tool traverse speed.

  6. Stereotactic Bragg peak proton radiosurgery method

    International Nuclear Information System (INIS)

    Kjellberg, R.N.

    1979-01-01

    A brief description of the technical aspects of a stereotactic Bragg peak proton radiosurgical method for the head is presented. The preparatory radiographic studies are outlined and the stereotactic instrument and positioning of the patient are described. The instrument is so calibrated that after corrections for soft tissue and bone thickness, the Bragg peak superimposes upon the intracranial target. The head is rotated at specific intervals to allow predetermined portals of access for the beam path, all of which converge on the intracranial target. Normally, portals are arranged to oppose and overlap from both sides of the head. Using a number of beams (in sequence) on both sides of the head, the target dose is far greater than the path dose. The procedure normally takes 3/2-2 hours, following which the patient can walk away. (Auth./C.F.)

  7. Central peaking of magnetized gas discharges

    International Nuclear Information System (INIS)

    Chen, Francis F.; Curreli, Davide

    2013-01-01

    Partially ionized gas discharges used in industry are often driven by radiofrequency (rf) power applied at the periphery of a cylinder. It is found that the plasma density n is usually flat or peaked on axis even if the skin depth of the rf field is thin compared with the chamber radius a. Previous attempts at explaining this did not account for the finite length of the discharge and the boundary conditions at the endplates. A simple 1D model is used to focus on the basic mechanism: the short-circuit effect. It is found that a strong electric field (E-field) scaled to electron temperature T e , drives the ions inward. The resulting density profile is peaked on axis and has a shape independent of pressure or discharge radius. This “universal” profile is not affected by a dc magnetic field (B-field) as long as the ion Larmor radius is larger than a

  8. Peak Oil, Food Systems, and Public Health

    Science.gov (United States)

    Parker, Cindy L.; Kirschenmann, Frederick L.; Tinch, Jennifer; Lawrence, Robert S.

    2011-01-01

    Peak oil is the phenomenon whereby global oil supplies will peak, then decline, with extraction growing increasingly costly. Today's globalized industrial food system depends on oil for fueling farm machinery, producing pesticides, and transporting goods. Biofuels production links oil prices to food prices. We examined food system vulnerability to rising oil prices and the public health consequences. In the short term, high food prices harm food security and equity. Over time, high prices will force the entire food system to adapt. Strong preparation and advance investment may mitigate the extent of dislocation and hunger. Certain social and policy changes could smooth adaptation; public health has an essential role in promoting a proactive, smart, and equitable transition that increases resilience and enables adequate food for all. PMID:21778492

  9. Hanford Site peak gust wind speeds

    International Nuclear Information System (INIS)

    Ramsdell, J.V.

    1998-01-01

    Peak gust wind data collected at the Hanford Site since 1945 are analyzed to estimate maximum wind speeds for use in structural design. The results are compared with design wind speeds proposed for the Hanford Site. These comparisons indicate that design wind speeds contained in a January 1998 advisory changing DOE-STD-1020-94 are excessive for the Hanford Site and that the design wind speeds in effect prior to the changes are still appropriate for the Hanford Site

  10. Commodity hydrogen from off-peak electricity

    Energy Technology Data Exchange (ETDEWEB)

    Darrow, K.; Biederman, N.; Konopka, A.

    1977-01-01

    This paper considers the use of off-peak electrical power as an energy source for the electrolytic production of hydrogen. The present industrial uses for hydrogen are examined to determine if hydrogen produced in this fashion would be competitive with the industry's onsite production or existing hydrogen prices. The paper presents a technical and economic feasibility analysis of the various components required and of the operation of the system as a whole including production, transmission, storage, and markets.

  11. Some practical aspects of peak kilovoltage measurements

    International Nuclear Information System (INIS)

    Irfan, A.Y.; Pugh, V.I.; Jeffery, C.D.

    1985-01-01

    The peak kilovoltage (kVsub(p)) across the X-ray tube electrodes in diagnostic X-ray machines is a most important parameter, affecting both radiation output and beam quality. Four commercially available non-invasive devices used for kVsub(p) measurement were tested using a selection of generator waveforms. The majority of the devices provided satisfactory measurements of the kVsub(p) to within approximately +- kV provided certain operating conditions are observed. (U.K.)

  12. METing SUSY on the Z peak

    Energy Technology Data Exchange (ETDEWEB)

    Barenboim, G.; Bernabeu, J.; Vives, O. [Universitat de Valencia, Departament de Fisica Teorica, Burjassot (Spain); Universitat de Valencia-CSIC, Parc Cientific U.V., IFIC, Paterna (Spain); Mitsou, V.A.; Romero, E. [Universitat de Valencia-CSIC, Parc Cientific U.V., IFIC, Paterna (Spain)

    2016-02-15

    Recently the ATLAS experiment announced a 3 σ excess at the Z-peak consisting of 29 pairs of leptons together with two or more jets, E{sub T}{sup miss} > 225 GeV and HT > 600 GeV, to be compared with 10.6 ± 3.2 expected lepton pairs in the Standard Model. No excess outside the Z-peak was observed. By trying to explain this signal with SUSY we find that only relatively light gluinos, m{sub g} or similar 400 GeV decaying predominantly to Z-boson plus a light gravitino, such that nearly every gluino produces at least one Z-boson in its decay chain, could reproduce the excess. We construct an explicit general gauge mediation model able to reproduce the observed signal overcoming all the experimental limits. Needless to say, more sophisticated models could also reproduce the signal, however, any model would have to exhibit the following features: light gluinos, or heavy particles with a strong production cross section, producing at least one Z-boson in its decay chain. The implications of our findings for the Run II at LHC with the scaling on the Z peak, as well as for the direct search of gluinos and other SUSY particles, are pointed out. (orig.)

  13. Acquisition of peak responding: what is learned?

    Science.gov (United States)

    Balci, Fuat; Gallistel, Charles R; Allen, Brian D; Frank, Krystal M; Gibson, Jacqueline M; Brunner, Daniela

    2009-01-01

    We investigated how the common measures of timing performance behaved in the course of training on the peak procedure in C3H mice. Following fixed interval (FI) pre-training, mice received 16 days of training in the peak procedure. The peak time and spread were derived from the average response rates while the start and stop times and their relative variability were derived from a single-trial analysis. Temporal precision (response spread) appeared to improve in the course of training. This apparent improvement in precision was, however, an averaging artifact; it was mediated by the staggered appearance of timed stops, rather than by the delayed occurrence of start times. Trial-by-trial analysis of the stop times for individual subjects revealed that stops appeared abruptly after three to five sessions and their timing did not change as training was prolonged. Start times and the precision of start and stop times were generally stable throughout training. Our results show that subjects do not gradually learn to time their start or stop of responding. Instead, they learn the duration of the FI, with robust temporal control over the start of the response; the control over the stop of response appears abruptly later.

  14. METing SUSY on the Z peak

    International Nuclear Information System (INIS)

    Barenboim, G.; Bernabeu, J.; Vives, O.; Mitsou, V.A.; Romero, E.

    2016-01-01

    Recently the ATLAS experiment announced a 3 σ excess at the Z-peak consisting of 29 pairs of leptons together with two or more jets, E T miss > 225 GeV and HT > 600 GeV, to be compared with 10.6 ± 3.2 expected lepton pairs in the Standard Model. No excess outside the Z-peak was observed. By trying to explain this signal with SUSY we find that only relatively light gluinos, m g or similar 400 GeV decaying predominantly to Z-boson plus a light gravitino, such that nearly every gluino produces at least one Z-boson in its decay chain, could reproduce the excess. We construct an explicit general gauge mediation model able to reproduce the observed signal overcoming all the experimental limits. Needless to say, more sophisticated models could also reproduce the signal, however, any model would have to exhibit the following features: light gluinos, or heavy particles with a strong production cross section, producing at least one Z-boson in its decay chain. The implications of our findings for the Run II at LHC with the scaling on the Z peak, as well as for the direct search of gluinos and other SUSY particles, are pointed out. (orig.)

  15. Monitoring device for local power peaking coefficients

    International Nuclear Information System (INIS)

    Mihashi, Ishi

    1987-01-01

    Purpose: To determine and monitor the local power peaking coefficients by a method not depending on the combination of fuel types. Constitution: Representative values for the local power distribution can be obtained by determining corresponding burn-up degrees based on the burn-up degree of each of fuel assembly segments obtained in a power distribution monitor and by the interpolation and extrapolation of void coefficients. The typical values are multiplied with compensation coefficients for the control rod effect and coefficients for compensating the effect of adjacent fuel assemblies in a calculation device to obtain typical values for the present local power distribution compensated with all of the effects. Further, the calculation device compares them with typical values of the present local power distribution to obtain an aimed local power peaking coefficient as the maximum value thereof. According to the present invention, since the local power peaking coefficients can be determined not depending on the combination of the kind of fuels, if the combination of fuel assemblies is increased upon fuel change, the amount of operation therefor is not increased. (Kamimura, M.)

  16. Chinese emissions peak: Not when, but how

    International Nuclear Information System (INIS)

    Spencer, Thomas; Colombier, Michel; Wang, Xin; Sartor, Oliver; Waisman, Henri

    2016-07-01

    It seems highly likely that China will overachieve its 2020 and 2030 targets, and peak its emissions before 2030 and possibly at a lower level than often assumed. This paper argues that the debate on the timing of the peak is misplaced: what matters is not when by why. For the peak to be seen as a harbinger of deep transformation, it needs to be based on significant macro-economic reform and restructuring, with attendant improvement in energy intensity. The Chinese economic model has been extraordinarily investment and resource intensive, and has driven the growth in GHG emissions. That model is no longer economically or environmentally sustainable. Therefore Chinese policy-makers are faced with a trade-off between slower short-term growth and economic reform, versus supporting short-term growth but slowing economic reform. The outcome will be crucial for the transition to a low-carbon economy. Overall, the 13. FYP (2016-2020) gives the impression of a cautious reflection of the new normal paradigm on the economic front, and a somewhat conservative translation of this shift into the energy and climate targets. Nonetheless, the 13. FYP targets set China well on the way to overachieving its 2020 pledge undertaken at COP15 in Copenhagen, and to potentially overachieving its INDC. It thus seems likely that China will achieve its emissions peak before 2030. However, the crucial question is not when China peaks, but whether the underlying transformation of the Chinese economy and energy system lays the basis for deep decarbonization thereafter. Thorough assessments of the implications of the 'new normal' for Chinese emissions and energy system trajectories, taking into account the link with the Chinese macro-economy, are needed. Scenarios provide a useful framework and should focus on a number of short-term uncertainties. Most energy system and emissions scenarios published today assume a continuity of trends between 2010-2015 and 2015-2020, which is at odds with clear

  17. ICPD-a new peak detection algorithm for LC/MS.

    Science.gov (United States)

    Zhang, Jianqiu; Haskins, William

    2010-12-01

    The identification and quantification of proteins using label-free Liquid Chromatography/Mass Spectrometry (LC/MS) play crucial roles in biological and biomedical research. Increasing evidence has shown that biomarkers are often low abundance proteins. However, LC/MS systems are subject to considerable noise and sample variability, whose statistical characteristics are still elusive, making computational identification of low abundance proteins extremely challenging. As a result, the inability of identifying low abundance proteins in a proteomic study is the main bottleneck in protein biomarker discovery. In this paper, we propose a new peak detection method called Information Combining Peak Detection (ICPD ) for high resolution LC/MS. In LC/MS, peptides elute during a certain time period and as a result, peptide isotope patterns are registered in multiple MS scans. The key feature of the new algorithm is that the observed isotope patterns registered in multiple scans are combined together for estimating the likelihood of the peptide existence. An isotope pattern matching score based on the likelihood probability is provided and utilized for peak detection. The performance of the new algorithm is evaluated based on protein standards with 48 known proteins. The evaluation shows better peak detection accuracy for low abundance proteins than other LC/MS peak detection methods.

  18. Particle creation by peak electric field

    Energy Technology Data Exchange (ETDEWEB)

    Adorno, T.C. [Tomsk State University, Department of Physics, Tomsk (Russian Federation); Gavrilov, S.P. [Tomsk State University, Department of Physics, Tomsk (Russian Federation); Herzen State Pedagogical University of Russia, Department of General and Experimental Physics, St. Petersburg (Russian Federation); Gitman, D.M. [Tomsk State University, Department of Physics, Tomsk (Russian Federation); P. N. Lebedev Physical Institute, Moscow (Russian Federation); University of Sao Paulo, Institute of Physics, CP 66318, Sao Paulo, SP (Brazil)

    2016-08-15

    The particle creation by the so-called peak electric field is considered. The latter field is a combination of two exponential parts, one exponentially increasing and another exponentially decreasing. We find exact solutions of the Dirac equation with the field under consideration with appropriate asymptotic conditions and calculate all the characteristics of particle creation effect, in particular, differential mean numbers of created particle, total number of created particles, and the probability for a vacuum to remain a vacuum. Characteristic asymptotic regimes are discussed in detail and a comparison with the pure asymptotically decaying field is considered. (orig.)

  19. Octant vectorcardiography - the evaluation by peaks.

    Science.gov (United States)

    Laufberger, V

    1982-01-01

    From the Frank lead potentials a computer prints out an elementary table. Therein, the electrical space of left ventricle depolarization is divided into eight spatial parts labelled by numbers 1-8 and called octants. Within these octants six peaks are determined labelled with letters ALPR-IS. Their localization is described by six-digit topograms characteristic for each patient. From 300 cases of patients after myocardial infarction, three data bases were compiled enabling every case to be classified into classes, subclasses and types. The follow up of patients according to these principles gives an objective and detailed image about the progress of coronary artery disease.

  20. Energy peaks: A high energy physics outlook

    Science.gov (United States)

    Franceschini, Roberto

    2017-12-01

    Energy distributions of decay products carry information on the kinematics of the decay in ways that are at the same time straightforward and quite hidden. I will review these properties and discuss their early historical applications, as well as more recent ones in the context of (i) methods for the measurement of masses of new physics particle with semi-invisible decays, (ii) the characterization of Dark Matter particles produced at colliders, (iii) precision mass measurements of Standard Model particles, in particular of the top quark. Finally, I will give an outlook of further developments and applications of energy peak method for high energy physics at colliders and beyond.

  1. Method and apparatus for current-output peak detection

    Science.gov (United States)

    De Geronimo, Gianluigi

    2017-01-24

    A method and apparatus for a current-output peak detector. A current-output peak detector circuit is disclosed and works in two phases. The peak detector circuit includes switches to switch the peak detector circuit from the first phase to the second phase upon detection of the peak voltage of an input voltage signal. The peak detector generates a current output with a high degree of accuracy in the second phase.

  2. Computation of peak discharge at culverts

    Science.gov (United States)

    Carter, Rolland William

    1957-01-01

    Methods for computing peak flood flow through culverts on the basis of a field survey of highwater marks and culvert geometry are presented. These methods are derived from investigations of culvert flow as reported in the literature and on extensive laboratory studies of culvert flow. For convenience in computation, culvert flow has been classified into six types, according to the location of the control section and the relative heights of the head-water and tail-water levels. The type of flow which occurred at any site can be determined from the field data and the criteria given in this report. A discharge equation has been developed for each flow type by combining the energy and continuity equations for the distance between an approach section upstream from the culvert and a terminal section within the culvert barrel. The discharge coefficient applicable to each flow type is listed for the more common entrance geometries. Procedures for computing peak discharge through culverts are outlined in detail for each of the six flow types.

  3. Comparison of five portable peak flow meters.

    Science.gov (United States)

    Takara, Glaucia Nency; Ruas, Gualberto; Pessoa, Bruna Varanda; Jamami, Luciana Kawakami; Di Lorenzo, Valéria Amorim Pires; Jamami, Mauricio

    2010-05-01

    To compare the measurements of spirometric peak expiratory flow (PEF) from five different PEF meters and to determine if their values are in agreement. Inaccurate equipment may result in incorrect diagnoses of asthma and inappropriate treatments. Sixty-eight healthy, sedentary and insufficiently active subjects, aged from 19 to 40 years, performed PEF measurements using Air Zone, Assess, Galemed, Personal Best and Vitalograph peak flow meters. The highest value recorded for each subject for each device was compared to the corresponding spirometric values using Friedman's test with Dunn's post-hoc (pmeters were 428 (263-688 L/min), 450 (350-800 L/min), 420 (310-720 L/min), 380 (300-735 L/min), 400 (310-685 L/min) and 415 (335-610 L/min), respectively. Significant differences were found when the spirometric values were compared to those recorded by the Air Zone(R) (pmeters. There was no agreement between the spirometric values and the five PEF meters. The results suggest that the values recorded from Galemed meters may underestimate the actual value, which could lead to unnecessary interventions, and that Air Zone meters overestimate spirometric values, which could obfuscate the need for intervention. These findings must be taken into account when interpreting both devices' results in younger people. These differences should also be considered when directly comparing values from different types of PEF meters.

  4. Monitoring device for local power peaking coefficient

    International Nuclear Information System (INIS)

    Mitsuhashi, Ishi

    1987-01-01

    Purpose: To monitor the local power peaking coefficients obtained by the method not depending on the combination of fuel types. Method: A plurality of representative values for the local power distribution determined by the nuclear constant calculation for one fuel assembly are memorized regarding each of the burn-up degree and the void coefficient on every positions and fuel types in fuel rod assemblies. While on the other hand, the representative values for the local power distribution as described above are compensated by a compensation coefficient considering the effect of adjacent segments and a control rod compensation coefficient considering the effect due to the control rod insertion relative to the just-mentioned compensation coefficient. Then, the maximum value among them is selected to determine the local power peaking coefficient at each of the times and each of the segments, which is monitored. According to this system, the calculation and the working required for the fitting work depending on the combination of fuel types are no more required at all to facilitate the maintenance as well. (Horiuchi, T.)

  5. Peak capacity and peak capacity per unit time in capillary and microchip zone electrophoresis.

    Science.gov (United States)

    Foley, Joe P; Blackney, Donna M; Ennis, Erin J

    2017-11-10

    The origins of the peak capacity concept are described and the important contributions to the development of that concept in chromatography and electrophoresis are reviewed. Whereas numerous quantitative expressions have been reported for one- and two-dimensional separations, most are focused on chromatographic separations and few, if any, quantitative unbiased expressions have been developed for capillary or microchip zone electrophoresis. Making the common assumption that longitudinal diffusion is the predominant source of zone broadening in capillary electrophoresis, analytical expressions for the peak capacity are derived, first in terms of migration time, diffusion coefficient, migration distance, and desired resolution, and then in terms of the remaining underlying fundamental parameters (electric field, electroosmotic and electrophoretic mobilities) that determine the migration time. The latter expressions clearly illustrate the direct square root dependence of peak capacity on electric field and migration distance and the inverse square root dependence on solute diffusion coefficient. Conditions that result in a high peak capacity will result in a low peak capacity per unit time and vice-versa. For a given symmetrical range of relative electrophoretic mobilities for co- and counter-electroosmotic species (cations and anions), the peak capacity increases with the square root of the electric field even as the temporal window narrows considerably, resulting in a significant reduction in analysis time. Over a broad relative electrophoretic mobility interval [-0.9, 0.9], an approximately two-fold greater amount of peak capacity can be generated for counter-electroosmotic species although it takes about five-fold longer to do so, consistent with the well-known bias in migration time and resolving power for co- and counter-electroosmotic species. The optimum lower bound of the relative electrophoretic mobility interval [μ r,Z , μ r,A ] that provides the maximum

  6. Peak Wind Tool for General Forecasting

    Science.gov (United States)

    Barrett, Joe H., III

    2010-01-01

    The expected peak wind speed of the day is an important forecast element in the 45th Weather Squadron's (45 WS) daily 24-Hour and Weekly Planning Forecasts. The forecasts are used for ground and space launch operations at the Kennedy Space Center (KSC) and Cape Canaveral Air Force Station (CCAFS). The 45 WS also issues wind advisories for KSC/CCAFS when they expect wind gusts to meet or exceed 25 kt, 35 kt and 50 kt thresholds at any level from the surface to 300 ft. The 45 WS forecasters have indicated peak wind speeds are challenging to forecast, particularly in the cool season months of October - April. In Phase I of this task, the Applied Meteorology Unit (AMU) developed a tool to help the 45 WS forecast non-convective winds at KSC/CCAFS for the 24-hour period of 0800 to 0800 local time. The tool was delivered as a Microsoft Excel graphical user interface (GUI). The GUI displayed the forecast of peak wind speed, 5-minute average wind speed at the time of the peak wind, timing of the peak wind and probability the peak speed would meet or exceed 25 kt, 35 kt and 50 kt. For the current task (Phase II ), the 45 WS requested additional observations be used for the creation of the forecast equations by expanding the period of record (POR). Additional parameters were evaluated as predictors, including wind speeds between 500 ft and 3000 ft, static stability classification, Bulk Richardson Number, mixing depth, vertical wind shear, temperature inversion strength and depth and wind direction. Using a verification data set, the AMU compared the performance of the Phase I and II prediction methods. Just as in Phase I, the tool was delivered as a Microsoft Excel GUI. The 45 WS requested the tool also be available in the Meteorological Interactive Data Display System (MIDDS). The AMU first expanded the POR by two years by adding tower observations, surface observations and CCAFS (XMR) soundings for the cool season months of March 2007 to April 2009. The POR was expanded

  7. Emissions Scenarios and Fossil-fuel Peaking

    Science.gov (United States)

    Brecha, R.

    2008-12-01

    Intergovernmental Panel on Climate Change (IPCC) emissions scenarios are based on detailed energy system models in which demographics, technology and economics are used to generate projections of future world energy consumption, and therefore, of greenhouse gas emissions. Built into the assumptions for these scenarios are estimates for ultimately recoverable resources of various fossil fuels. There is a growing chorus of critics who believe that the true extent of recoverable fossil resources is much smaller than the amounts taken as a baseline for the IPCC scenarios. In a climate optimist camp are those who contend that "peak oil" will lead to a switch to renewable energy sources, while others point out that high prices for oil caused by supply limitations could very well lead to a transition to liquid fuels that actually increase total carbon emissions. We examine a third scenario in which high energy prices, which are correlated with increasing infrastructure, exploration and development costs, conspire to limit the potential for making a switch to coal or natural gas for liquid fuels. In addition, the same increasing costs limit the potential for expansion of tar sand and shale oil recovery. In our qualitative model of the energy system, backed by data from short- and medium-term trends, we have a useful way to gain a sense of potential carbon emission bounds. A bound for 21st century emissions is investigated based on two assumptions: first, that extractable fossil-fuel resources follow the trends assumed by "peak oil" adherents, and second, that little is done in the way of climate mitigation policies. If resources, and perhaps more importantly, extraction rates, of fossil fuels are limited compared to assumptions in the emissions scenarios, a situation can arise in which emissions are supply-driven. However, we show that even in this "peak fossil-fuel" limit, carbon emissions are high enough to surpass 550 ppm or 2°C climate protection guardrails. Some

  8. Online Reliable Peak Charge/Discharge Power Estimation of Series-Connected Lithium-Ion Battery Packs

    Directory of Open Access Journals (Sweden)

    Bo Jiang

    2017-03-01

    Full Text Available The accurate peak power estimation of a battery pack is essential to the power-train control of electric vehicles (EVs. It helps to evaluate the maximum charge and discharge capability of the battery system, and thus to optimally control the power-train system to meet the requirement of acceleration, gradient climbing and regenerative braking while achieving a high energy efficiency. A novel online peak power estimation method for series-connected lithium-ion battery packs is proposed, which considers the influence of cell difference on the peak power of the battery packs. A new parameter identification algorithm based on adaptive ratio vectors is designed to online identify the parameters of each individual cell in a series-connected battery pack. The ratio vectors reflecting cell difference are deduced strictly based on the analysis of battery characteristics. Based on the online parameter identification, the peak power estimation considering cell difference is further developed. Some validation experiments in different battery aging conditions and with different current profiles have been implemented to verify the proposed method. The results indicate that the ratio vector-based identification algorithm can achieve the same accuracy as the repetitive RLS (recursive least squares based identification while evidently reducing the computation cost, and the proposed peak power estimation method is more effective and reliable for series-connected battery packs due to the consideration of cell difference.

  9. Peak Electric Load Relief in Northern Manhattan

    Directory of Open Access Journals (Sweden)

    Hildegaard D. Link

    2014-08-01

    Full Text Available The aphorism “Think globally, act locally,” attributed to René Dubos, reflects the vision that the solution to global environmental problems must begin with efforts within our communities. PlaNYC 2030, the New York City sustainability plan, is the starting point for this study. Results include (a a case study based on the City College of New York (CCNY energy audit, in which we model the impacts of green roofs on campus energy demand and (b a case study of energy use at the neighborhood scale. We find that reducing the urban heat island effect can reduce building cooling requirements, peak electricity loads stress on the local electricity grid and improve urban livability.

  10. Tim Peake and Britain's road to space

    CERN Document Server

    Seedhouse, Erik

    2017-01-01

    This book puts the reader in the flight suit of Britain’s first male astronaut, Tim Peake. It chronicles his life, along with the Principia mission and the down-to-the-last-bolt descriptions of life aboard the ISS, by way of the hurdles placed by the British government and the rigors of training at Russia’s Star City military base. In addition, this book discusses the learning curves required in astronaut and mission training and the complexity of the technologies required to launch an astronaut and keep them alive for months on end. This book underscores the fact that technology and training, unlike space, do not exist in a vacuum; complex technical systems, like the ISS, interact with the variables of human personality, and the cultural background of the astronauts. .

  11. Complex behavior of elevators in peak traffic

    Science.gov (United States)

    Nagatani, Takashi

    2003-08-01

    We study the dynamical behavior of elevators in the morning peak traffic. We present a stochastic model of the elevators to take into account the interactions between elevators through passengers. The dynamics of the elevators is expressed in terms of a coupled nonlinear map with noises. The number of passengers carried by an elevator and the time-headway between elevators exhibit the complex behavior with varying elevator trips. It is found that the behavior of elevators exhibits a deterministic chaos even if there are no noises. The chaotic motion depends on the loading parameter, the maximum capacity of an elevator, and the number of elevators. When the loading parameter is superior to the threshold, each elevator carries a full load of passengers throughout its trip. The dependence of the threshold (transition point) on the elevator capacity is clarified.

  12. Equivalence principle and the baryon acoustic peak

    Science.gov (United States)

    Baldauf, Tobias; Mirbabayi, Mehrdad; Simonović, Marko; Zaldarriaga, Matias

    2015-08-01

    We study the dominant effect of a long wavelength density perturbation δ (λL) on short distance physics. In the nonrelativistic limit, the result is a uniform acceleration, fixed by the equivalence principle, and typically has no effect on statistical averages due to translational invariance. This same reasoning has been formalized to obtain a "consistency condition" on the cosmological correlation functions. In the presence of a feature, such as the acoustic peak at ℓBAO, this naive expectation breaks down for λLexplicitly applied to the one-loop calculation of the power spectrum. Finally, the success of baryon acoustic oscillation reconstruction schemes is argued to be another empirical evidence for the validity of the results.

  13. Comparison of five portable peak flow meters

    Directory of Open Access Journals (Sweden)

    Glaucia Nency Takara

    2010-01-01

    Full Text Available OBJECTIVE: To compare the measurements of spirometric peak expiratory flow (PEF from five different PEF meters and to determine if their values are in agreement. Inaccurate equipment may result in incorrect diagnoses of asthma and inappropriate treatments. METHODS: Sixty-eight healthy, sedentary and insufficiently active subjects, aged from 19 to 40 years, performed PEF measurements using Air Zone®, Assess®, Galemed®, Personal Best® and Vitalograph® peak flow meters. The highest value recorded for each subject for each device was compared to the corresponding spirometric values using Friedman's test with Dunn's post-hoc (p<0.05, Spearman's correlation test and Bland-Altman's agreement test. RESULTS: The median and interquartile ranges for the spirometric values and the Air Zone®, Assess®, Galemed®, Personal Best® and Vitalograph® meters were 428 (263-688 L/min, 450 (350-800 L/min, 420 (310-720 L/min, 380 (300-735 L/min, 400 (310-685 L/min and 415 (335-610 L/min, respectively. Significant differences were found when the spirometric values were compared to those recorded by the Air Zone® (p<0.001 and Galemed ® (p<0.01 meters. There was no agreement between the spirometric values and the five PEF meters. CONCLUSIONS: The results suggest that the values recorded from Galemed® meters may underestimate the actual value, which could lead to unnecessary interventions, and that Air Zone® meters overestimate spirometric values, which could obfuscate the need for intervention. These findings must be taken into account when interpreting both devices' results in younger people. These differences should also be considered when directly comparing values from different types of PEF meters.

  14. Amorphous chalcogenides as random octahedrally bonded solids: I. Implications for the first sharp diffraction peak, photodarkening, and Boson peak

    Science.gov (United States)

    Lukyanov, Alexey; Lubchenko, Vassiliy

    2017-09-01

    We develop a computationally efficient algorithm for generating high-quality structures for amorphous materials exhibiting distorted octahedral coordination. The computationally costly step of equilibrating the simulated melt is relegated to a much more efficient procedure, viz., generation of a random close-packed structure, which is subsequently used to generate parent structures for octahedrally bonded amorphous solids. The sites of the so-obtained lattice are populated by atoms and vacancies according to the desired stoichiometry while allowing one to control the number of homo-nuclear and hetero-nuclear bonds and, hence, effects of the mixing entropy. The resulting parent structure is geometrically optimized using quantum-chemical force fields; by varying the extent of geometric optimization of the parent structure, one can partially control the degree of octahedrality in local coordination and the strength of secondary bonding. The present methodology is applied to the archetypal chalcogenide alloys AsxSe1-x. We find that local coordination in these alloys interpolates between octahedral and tetrahedral bonding but in a non-obvious way; it exhibits bonding motifs that are not characteristic of either extreme. We consistently recover the first sharp diffraction peak (FSDP) in our structures and argue that the corresponding mid-range order stems from the charge density wave formed by regions housing covalent and weak, secondary interactions. The number of secondary interactions is determined by a delicate interplay between octahedrality and tetrahedrality in the covalent bonding; many of these interactions are homonuclear. The present results are consistent with the experimentally observed dependence of the FSDP on arsenic content, pressure, and temperature and its correlation with photodarkening and the Boson peak. They also suggest that the position of the FSDP can be used to infer the effective particle size relevant for the configurational equilibration in

  15. A wavelet transform algorithm for peak detection and application to powder x-ray diffraction data.

    Science.gov (United States)

    Gregoire, John M; Dale, Darren; van Dover, R Bruce

    2011-01-01

    Peak detection is ubiquitous in the analysis of spectral data. While many noise-filtering algorithms and peak identification algorithms have been developed, recent work [P. Du, W. Kibbe, and S. Lin, Bioinformatics 22, 2059 (2006); A. Wee, D. Grayden, Y. Zhu, K. Petkovic-Duran, and D. Smith, Electrophoresis 29, 4215 (2008)] has demonstrated that both of these tasks are efficiently performed through analysis of the wavelet transform of the data. In this paper, we present a wavelet-based peak detection algorithm with user-defined parameters that can be readily applied to the application of any spectral data. Particular attention is given to the algorithm's resolution of overlapping peaks. The algorithm is implemented for the analysis of powder diffraction data, and successful detection of Bragg peaks is demonstrated for both low signal-to-noise data from theta-theta diffraction of nanoparticles and combinatorial x-ray diffraction data from a composition spread thin film. These datasets have different types of background signals which are effectively removed in the wavelet-based method, and the results demonstrate that the algorithm provides a robust method for automated peak detection.

  16. Cloud-based solution to identify statistically significant MS peaks differentiating sample categories.

    Science.gov (United States)

    Ji, Jun; Ling, Jeffrey; Jiang, Helen; Wen, Qiaojun; Whitin, John C; Tian, Lu; Cohen, Harvey J; Ling, Xuefeng B

    2013-03-23

    Mass spectrometry (MS) has evolved to become the primary high throughput tool for proteomics based biomarker discovery. Until now, multiple challenges in protein MS data analysis remain: large-scale and complex data set management; MS peak identification, indexing; and high dimensional peak differential analysis with the concurrent statistical tests based false discovery rate (FDR). "Turnkey" solutions are needed for biomarker investigations to rapidly process MS data sets to identify statistically significant peaks for subsequent validation. Here we present an efficient and effective solution, which provides experimental biologists easy access to "cloud" computing capabilities to analyze MS data. The web portal can be accessed at http://transmed.stanford.edu/ssa/. Presented web application supplies large scale MS data online uploading and analysis with a simple user interface. This bioinformatic tool will facilitate the discovery of the potential protein biomarkers using MS.

  17. Norwegian hydropower a valuable peak power source

    Energy Technology Data Exchange (ETDEWEB)

    Brekke, Hermod

    2010-07-01

    given on a possible increase of the Norwegian hydropower peak power production to meet the growing the European demand for peak power caused by the growing non stationary production from wind mills and ocean energy from waves and sea current. Also building of reversible pump turbine power plants will be discussed even if approximately 10% power will be consumed by loss in the pumping phase compared to direct use of the water from reservoirs. (Author)

  18. Can You Hear That Peak? Utilization of Auditory and Visual Feedback at Peak Limb Velocity

    Science.gov (United States)

    Loria, Tristan; de Grosbois, John; Tremblay, Luc

    2016-01-01

    Purpose: At rest, the central nervous system combines and integrates multisensory cues to yield an optimal percept. When engaging in action, the relative weighing of sensory modalities has been shown to be altered. Because the timing of peak velocity is the critical moment in some goal-directed movements (e.g., overarm throwing), the current study…

  19. Prediction of iodine activity peak during refuelling

    International Nuclear Information System (INIS)

    Hozer, Z.; Vajda, N.

    2001-01-01

    The increase of fission product activities in the primary circuit of a nuclear power plant indicates the existence of defects in some fuel rods. The power change leads to the cooling down of the fuel and results in the fragmentation of the UO 2 pellets, which facilitates the release of fission products from the intergranular regions. Furthermore the injection of boric acid after shutdown will increase the primary activity, due to the solution of deposited fission products from the surface of the core components. The calculation of these phenomena usually is based on the evaluation of activity measurements and power plant data. The estimation of iodine spiking peak during reactor transients is based on correlation with operating parameters, such as reactor power and primary pressure. The approach used in the present method was applied for CANDU reactors. The VVER-440 specific correlations were determined using the activity measurements of the Paks NPP and the data provided by the Russian fuel supplier. The present method is used for the evaluation of the iodine isotopes, as well as the noble gases. A numerical model has been developed for iodine spiking simulation and has been validated against several shutdown transients, measured at Paks NPP. (R.P.)

  20. Fast clustering using adaptive density peak detection.

    Science.gov (United States)

    Wang, Xiao-Feng; Xu, Yifan

    2017-12-01

    Common limitations of clustering methods include the slow algorithm convergence, the instability of the pre-specification on a number of intrinsic parameters, and the lack of robustness to outliers. A recent clustering approach proposed a fast search algorithm of cluster centers based on their local densities. However, the selection of the key intrinsic parameters in the algorithm was not systematically investigated. It is relatively difficult to estimate the "optimal" parameters since the original definition of the local density in the algorithm is based on a truncated counting measure. In this paper, we propose a clustering procedure with adaptive density peak detection, where the local density is estimated through the nonparametric multivariate kernel estimation. The model parameter is then able to be calculated from the equations with statistical theoretical justification. We also develop an automatic cluster centroid selection method through maximizing an average silhouette index. The advantage and flexibility of the proposed method are demonstrated through simulation studies and the analysis of a few benchmark gene expression data sets. The method only needs to perform in one single step without any iteration and thus is fast and has a great potential to apply on big data analysis. A user-friendly R package ADPclust is developed for public use.

  1. A NEW METHOD OF PEAK DETECTION FOR ANALYSIS OF COMPREHENSIVE TWO-DIMENSIONAL GAS CHROMATOGRAPHY MASS SPECTROMETRY DATA.

    Science.gov (United States)

    Kim, Seongho; Ouyang, Ming; Jeong, Jaesik; Shen, Changyu; Zhang, Xiang

    2014-06-01

    We develop a novel peak detection algorithm for the analysis of comprehensive two-dimensional gas chromatography time-of-flight mass spectrometry (GC×GC-TOF MS) data using normal-exponential-Bernoulli (NEB) and mixture probability models. The algorithm first performs baseline correction and denoising simultaneously using the NEB model, which also defines peak regions. Peaks are then picked using a mixture of probability distribution to deal with the co-eluting peaks. Peak merging is further carried out based on the mass spectral similarities among the peaks within the same peak group. The algorithm is evaluated using experimental data to study the effect of different cut-offs of the conditional Bayes factors and the effect of different mixture models including Poisson, truncated Gaussian, Gaussian, Gamma, and exponentially modified Gaussian (EMG) distributions, and the optimal version is introduced using a trial-and-error approach. We then compare the new algorithm with two existing algorithms in terms of compound identification. Data analysis shows that the developed algorithm can detect the peaks with lower false discovery rates than the existing algorithms, and a less complicated peak picking model is a promising alternative to the more complicated and widely used EMG mixture models.

  2. A NEW METHOD OF PEAK DETECTION FOR ANALYSIS OF COMPREHENSIVE TWO-DIMENSIONAL GAS CHROMATOGRAPHY MASS SPECTROMETRY DATA*

    Science.gov (United States)

    Kim, Seongho; Ouyang, Ming; Jeong, Jaesik; Shen, Changyu; Zhang, Xiang

    2014-01-01

    We develop a novel peak detection algorithm for the analysis of comprehensive two-dimensional gas chromatography time-of-flight mass spectrometry (GC×GC-TOF MS) data using normal-exponential-Bernoulli (NEB) and mixture probability models. The algorithm first performs baseline correction and denoising simultaneously using the NEB model, which also defines peak regions. Peaks are then picked using a mixture of probability distribution to deal with the co-eluting peaks. Peak merging is further carried out based on the mass spectral similarities among the peaks within the same peak group. The algorithm is evaluated using experimental data to study the effect of different cut-offs of the conditional Bayes factors and the effect of different mixture models including Poisson, truncated Gaussian, Gaussian, Gamma, and exponentially modified Gaussian (EMG) distributions, and the optimal version is introduced using a trial-and-error approach. We then compare the new algorithm with two existing algorithms in terms of compound identification. Data analysis shows that the developed algorithm can detect the peaks with lower false discovery rates than the existing algorithms, and a less complicated peak picking model is a promising alternative to the more complicated and widely used EMG mixture models. PMID:25264474

  3. Research Opportunities at Storm Peak Laboratory

    Science.gov (United States)

    Hallar, A. G.; McCubbin, I. B.

    2006-12-01

    The Desert Research Institute (DRI) operates a high elevation facility, Storm Peak Laboratory (SPL), located on the west summit of Mt. Werner in the Park Range near Steamboat Springs, Colorado at an elevation of 3210 m MSL (Borys and Wetzel, 1997). SPL provides an ideal location for long-term research on the interactions of atmospheric aerosol and gas- phase chemistry with cloud and natural radiation environments. The ridge-top location produces almost daily transition from free tropospheric to boundary layer air which occurs near midday in both summer and winter seasons. Long-term observations at SPL document the role of orographically induced mixing and convection on vertical pollutant transport and dispersion. During winter, SPL is above cloud base 25% of the time, providing a unique capability for studying aerosol-cloud interactions (Borys and Wetzel, 1997). A comprehensive set of continuous aerosol measurements was initiated at SPL in 2002. SPL includes an office-type laboratory room for computer and instrumentation setup with outside air ports and cable access to the roof deck, a cold room for precipitation and cloud rime ice sample handling and ice crystal microphotography, a 150 m2 roof deck area for outside sampling equipment, a full kitchen and two bunk rooms with sleeping space for nine persons. The laboratory is currently well equipped for aerosol and cloud measurements. Particles are sampled from an insulated, 15 cm diameter manifold within approximately 1 m of its horizontal entry point through an outside wall. The 4 m high vertical section outside the building is capped with an inverted can to exclude large particles.

  4. Peak MSC—Are We There Yet?

    Directory of Open Access Journals (Sweden)

    Timothy R. Olsen

    2018-06-01

    Full Text Available Human mesenchymal stem cells (hMSCs are a critical raw material for many regenerative medicine products, including cell-based therapies, engineered tissues, or combination products, and are on the brink of radically changing how the world of medicine operates. Their unique characteristics, potential to treat many indications, and established safety profile in more than 800 clinical trials have contributed to their current consumption and will only fuel future demand. Given the large target patient populations with typical dose sizes of 10's to 100's of millions of cells per patient, and engineered tissues being constructed with 100's of millions to billions of cells, an unprecedented demand has been created for hMSCs. The fulfillment of this demand faces an uphill challenge in the limited availability of large quantities of pharmaceutical grade hMSCs for the industry—fueling the need for parallel rapid advancements in the biomanufacturing of this living critical raw material. Simply put, hMSCs are no different than technologies like transistors, as they are a highly technical and modular product that requires stringent control over manufacturing that can allow for high quality and consistent performance. As hMSC manufacturing processes are optimized, it predicts a future time of abundance for hMSCs, where scientists and researchers around the world will have access to a consistent and readily available supply of high quality, standardized, and economical pharmaceutical grade product to buy off the shelf for their applications and drive product development—this is “Peak MSC.”

  5. Peak-valley-peak pattern of histone modifications delineates active regulatory elements and their directionality

    DEFF Research Database (Denmark)

    Pundhir, Sachin; Bagger, Frederik Otzen; Lauridsen, Felicia Kathrine Bratt

    2016-01-01

    Formation of nucleosome free region (NFR) accompanied by specific histone modifications at flanking nucleosomes is an important prerequisite for enhancer and promoter activity. Due to this process, active regulatory elements often exhibit a distinct shape of histone signal in the form of a peak......-valley-peak (PVP) pattern. However, different features of PVP patterns and their robustness in predicting active regulatory elements have never been systematically analyzed. Here, we present PARE, a novel computational method that systematically analyzes the H3K4me1 or H3K4me3 PVP patterns to predict NFRs. We show...... four ENCODE cell lines and four hematopoietic differentiation stages, we identified several enhancers whose regulatory activity is stage specific and correlates positively with the expression of proximal genes in a particular stage. In conclusion, our results demonstrate that PVP patterns delineate...

  6. NMRNet: A deep learning approach to automated peak picking of protein NMR spectra.

    Science.gov (United States)

    Klukowski, Piotr; Augoff, Michal; Zieba, Maciej; Drwal, Maciej; Gonczarek, Adam; Walczak, Michal J

    2018-03-14

    Automated selection of signals in protein NMR spectra, known as peak picking, has been studied for over 20 years, nevertheless existing peak picking methods are still largely deficient. Accurate and precise automated peak picking would accelerate the structure calculation, and analysis of dynamics and interactions of macromolecules. Recent advancement in handling big data, together with an outburst of machine learning techniques, offer an opportunity to tackle the peak picking problem substantially faster than manual picking and on par with human accuracy. In particular, deep learning has proven to systematically achieve human-level performance in various recognition tasks, and thus emerges as an ideal tool to address automated identification of NMR signals. We have applied a convolutional neural network for visual analysis of multidimensional NMR spectra. A comprehensive test on 31 manually-annotated spectra has demonstrated top-tier average precision (AP) of 0.9596, 0.9058 and 0.8271 for backbone, side-chain and NOESY spectra, respectively. Furthermore, a combination of extracted peak lists with automated assignment routine, FLYA, outperformed other methods, including the manual one, and led to correct resonance assignment at the levels of 90.40%, 89.90% and 90.20% for three benchmark proteins. The proposed model is a part of a Dumpling software (platform for protein NMR data analysis), and is available at https://dumpling.bio/. michaljerzywalczak@gmail.compiotr.klukowski@pwr.edu.pl. Supplementary data are available at Bioinformatics online.

  7. Combining multiple ChIP-seq peak detection systems using combinatorial fusion.

    Science.gov (United States)

    Schweikert, Christina; Brown, Stuart; Tang, Zuojian; Smith, Phillip R; Hsu, D Frank

    2012-01-01

    Due to the recent rapid development in ChIP-seq technologies, which uses high-throughput next-generation DNA sequencing to identify the targets of Chromatin Immunoprecipitation, there is an increasing amount of sequencing data being generated that provides us with greater opportunity to analyze genome-wide protein-DNA interactions. In particular, we are interested in evaluating and enhancing computational and statistical techniques for locating protein binding sites. Many peak detection systems have been developed; in this study, we utilize the following six: CisGenome, MACS, PeakSeq, QuEST, SISSRs, and TRLocator. We define two methods to merge and rescore the regions of two peak detection systems and analyze the performance based on average precision and coverage of transcription start sites. The results indicate that ChIP-seq peak detection can be improved by fusion using score or rank combination. Our method of combination and fusion analysis would provide a means for generic assessment of available technologies and systems and assist researchers in choosing an appropriate system (or fusion method) for analyzing ChIP-seq data. This analysis offers an alternate approach for increasing true positive rates, while decreasing false positive rates and hence improving the ChIP-seq peak identification process.

  8. Characteristic of 120 degree C thermoluminescence peak of iceland spar

    International Nuclear Information System (INIS)

    Lu Xinwei; Han Jia

    2006-01-01

    The basic characteristic of 120 degree C thermoluminescence peak of iceland spar was studied. The experimental result indicates the longevity of 120 degree C thermoluminescence peak of iceland spar is about 2 h under 30 degree C. The thermoluminescence peak moves to the high temperature when the heating speed increasing. The intensity of 120 degree C thermoluminescence peak of iceland spar is directly proportional to radiation dose under 15 Gy. (authors)

  9. Assessing peak aerobic capacity in Dutch law enforcement officers

    NARCIS (Netherlands)

    Wittink, Harriet; Takken, Tim; de Groot, Janke; Reneman, Michiel; Peters, Roelof; Vanhees, Luc

    2015-01-01

    Objectives: To cross-validate the existing peak rate of oxygen consumption (VO2peak) prediction equations in Dutch law enforcement officers and to determine whether these prediction equations can be used to predict VO2peak for groups and in a single individual. A further objective was to report

  10. Determination of the upper limit of a peak area

    International Nuclear Information System (INIS)

    Helene, O.

    1990-03-01

    This paper reports the procedure to extract an upper limit of a peak area in a multichannel spectrum. This procedure takes into account the finite shape of the peak and the uncertanties in the background and in the expected position of the peak. (author) [pt

  11. PEAK TRACKING WITH A NEURAL NETWORK FOR SPECTRAL RECOGNITION

    NARCIS (Netherlands)

    COENEGRACHT, PMJ; METTING, HJ; VANLOO, EM; SNOEIJER, GJ; DOORNBOS, DA

    1993-01-01

    A peak tracking method based on a simulated feed-forward neural network with back-propagation is presented. The network uses the normalized UV spectra and peak areas measured in one chromatogram for peak recognition. It suffices to train the network with only one set of spectra recorded in one

  12. Assessing peak aerobic capacity in Dutch law enforcement officers.

    NARCIS (Netherlands)

    Wittink, H.; Takken, T.; Groot, J.F. de; Reneman, M.; Peters, R.; Vanhees, L.

    2015-01-01

    Objectives: To cross-validate the existing peak rate of oxygen consumption (VO2peak) prediction equations in Dutch law enforcement officers and to determine whether these prediction equations can be used to predict VO2peak for groups and in a single individual. A further objective was to report

  13. 7 CFR 457.163 - Nursery peak inventory endorsement.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 6 2010-01-01 2010-01-01 false Nursery peak inventory endorsement. 457.163 Section... CORPORATION, DEPARTMENT OF AGRICULTURE COMMON CROP INSURANCE REGULATIONS § 457.163 Nursery peak inventory endorsement. Nursery Crop Insurance Peak Inventory Endorsement This endorsement is not continuous and must be...

  14. Bayesian approach for peak detection in two-dimensional chromatography

    NARCIS (Netherlands)

    Vivó-Truyols, G.

    2012-01-01

    A new method for peak detection in two-dimensional chromatography is presented. In a first step, the method starts with a conventional one-dimensional peak detection algorithm to detect modulated peaks. In a second step, a sophisticated algorithm is constructed to decide which of the individual

  15. Determination of the upper limit of a peak area

    International Nuclear Information System (INIS)

    Helene, O.

    1991-01-01

    This article reports the procedure to extract an upper limit of a peak area in a multichannel spectrum. This procedure takes into account the finite shape of the peak and the uncertainties both in the background and in the expected position of the peak. (orig.)

  16. Peak-by-peak correction of Ge(Li) gamma-ray spectra for photopeaks from background

    International Nuclear Information System (INIS)

    Cutshall, N.H.; Larsen, I.L.

    1980-01-01

    Background photopeaks can interfere with accurate measurement of low levels of radionuclides by gamma-ray spectrometry. A flowchart for peak-by-peak correction of sample spectra to produce accurate results is presented. (orig.)

  17. Peak-by-peak correction of Ge(Li) gamma-ray spectra for photopeaks from background

    Energy Technology Data Exchange (ETDEWEB)

    Cutshall, N H; Larsen, I L [Oak Ridge National Lab., TN (USA)

    1980-12-01

    Background photopeaks can interfere with accurate measurement of low levels of radionuclides by gamma-ray spectrometry. A flowchart for peak-by-peak correction of sample spectra to produce accurate results is presented.

  18. Isotope Identification

    Energy Technology Data Exchange (ETDEWEB)

    Karpius, Peter Joseph [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2017-09-18

    The objective of this training modules is to examine the process of using gamma spectroscopy for radionuclide identification; apply pattern recognition to gamma spectra; identify methods of verifying energy calibration; and discuss potential causes of isotope misidentification.

  19. Automatic Peak Selection by a Benjamini-Hochberg-Based Algorithm

    KAUST Repository

    Abbas, Ahmed; Kong, Xin-Bing; Liu, Zhi; Jing, Bing-Yi; Gao, Xin

    2013-01-01

    A common issue in bioinformatics is that computational methods often generate a large number of predictions sorted according to certain confidence scores. A key problem is then determining how many predictions must be selected to include most of the true predictions while maintaining reasonably high precision. In nuclear magnetic resonance (NMR)-based protein structure determination, for instance, computational peak picking methods are becoming more and more common, although expert-knowledge remains the method of choice to determine how many peaks among thousands of candidate peaks should be taken into consideration to capture the true peaks. Here, we propose a Benjamini-Hochberg (B-H)-based approach that automatically selects the number of peaks. We formulate the peak selection problem as a multiple testing problem. Given a candidate peak list sorted by either volumes or intensities, we first convert the peaks into p-values and then apply the B-H-based algorithm to automatically select the number of peaks. The proposed approach is tested on the state-of-the-art peak picking methods, including WaVPeak [1] and PICKY [2]. Compared with the traditional fixed number-based approach, our approach returns significantly more true peaks. For instance, by combining WaVPeak or PICKY with the proposed method, the missing peak rates are on average reduced by 20% and 26%, respectively, in a benchmark set of 32 spectra extracted from eight proteins. The consensus of the B-H-selected peaks from both WaVPeak and PICKY achieves 88% recall and 83% precision, which significantly outperforms each individual method and the consensus method without using the B-H algorithm. The proposed method can be used as a standard procedure for any peak picking method and straightforwardly applied to some other prediction selection problems in bioinformatics. The source code, documentation and example data of the proposed method is available at http://sfb.kaust.edu.sa/pages/software.aspx. © 2013

  20. Automatic Peak Selection by a Benjamini-Hochberg-Based Algorithm

    KAUST Repository

    Abbas, Ahmed

    2013-01-07

    A common issue in bioinformatics is that computational methods often generate a large number of predictions sorted according to certain confidence scores. A key problem is then determining how many predictions must be selected to include most of the true predictions while maintaining reasonably high precision. In nuclear magnetic resonance (NMR)-based protein structure determination, for instance, computational peak picking methods are becoming more and more common, although expert-knowledge remains the method of choice to determine how many peaks among thousands of candidate peaks should be taken into consideration to capture the true peaks. Here, we propose a Benjamini-Hochberg (B-H)-based approach that automatically selects the number of peaks. We formulate the peak selection problem as a multiple testing problem. Given a candidate peak list sorted by either volumes or intensities, we first convert the peaks into p-values and then apply the B-H-based algorithm to automatically select the number of peaks. The proposed approach is tested on the state-of-the-art peak picking methods, including WaVPeak [1] and PICKY [2]. Compared with the traditional fixed number-based approach, our approach returns significantly more true peaks. For instance, by combining WaVPeak or PICKY with the proposed method, the missing peak rates are on average reduced by 20% and 26%, respectively, in a benchmark set of 32 spectra extracted from eight proteins. The consensus of the B-H-selected peaks from both WaVPeak and PICKY achieves 88% recall and 83% precision, which significantly outperforms each individual method and the consensus method without using the B-H algorithm. The proposed method can be used as a standard procedure for any peak picking method and straightforwardly applied to some other prediction selection problems in bioinformatics. The source code, documentation and example data of the proposed method is available at http://sfb.kaust.edu.sa/pages/software.aspx. © 2013

  1. Optical identification of A0620-00

    International Nuclear Information System (INIS)

    Wolfson, R.; Boley, F.

    1976-01-01

    Identification of the optical counterpart to the transient x-ray source A0620-00 was made on August 16, 1975, using image tube photography at the McGraw-Hill Observatory on Kitt Peak, Arizona. Spectra taken subsequent to the identification showed no stellar absorption or emission features. Photometric data gave a V magnitude of 11.2 +- 0.1. This is about 8 magnitudes brighter than the object appears on the Palomar Sky Survey

  2. Gamma-Ray Peak Integration: Accuracy and Precision

    International Nuclear Information System (INIS)

    Richard M. Lindstrom

    2000-01-01

    The accuracy of singlet gamma-ray peak areas obtained by a peak analysis program is immaterial. If the same algorithm is used for sample measurement as for calibration and if the peak shapes are similar, then biases in the integration method cancel. Reproducibility is the only important issue. Even the uncertainty of the areas computed by the program is trivial because the true standard uncertainty can be experimentally assessed by repeated measurements of the same source. Reproducible peak integration was important in a recent standard reference material certification task. The primary tool used for spectrum analysis was SUM, a National Institute of Standards and Technology interactive program to sum peaks and subtract a linear background, using the same channels to integrate all 20 spectra. For comparison, this work examines other peak integration programs. Unlike some published comparisons of peak performance in which synthetic spectra were used, this experiment used spectra collected for a real (though exacting) analytical project, analyzed by conventional software used in routine ways. Because both components of the 559- to 564-keV doublet are from 76 As, they were integrated together with SUM. The other programs, however, deconvoluted the peaks. A sensitive test of the fitting algorithm is the ratio of reported peak areas. In almost all the cases, this ratio was much more variable than expected from the reported uncertainties reported by the program. Other comparisons to be reported indicate that peak integration is still an imperfect tool in the analysis of gamma-ray spectra

  3. Particle in cell simulation of peaking switch for breakdown evaluation

    Energy Technology Data Exchange (ETDEWEB)

    Umbarkar, Sachin B.; Bindu, S.; Mangalvedekar, H.A.; Saxena, A.; Singh, N.M., E-mail: sachin.b.umbarkar@gmail.com [Department of Electric Engineering, Veermata Jijabai Technological Institute, Mumbai (India); Sharma, Archana; Saroj, P.C.; Mittal, K.C. [Accelerator Pulse Power Division, Bhabha Atomic Research Centre, Mumbai (India)

    2014-07-01

    Marx generator connected to peaking capacitor and peaking switch can generate Ultra-Wideband (UWB) radiation. A new peaking switch is designed for converting the existing nanosecond Marx generator to a UWB source. The paper explains the particle in cell (PIC) simulation for this peaking switch, using MAGIC 3D software. This peaking switch electrode is made up of copper tungsten material and is fixed inside the hermitically sealed derlin material. The switch can withstand a gas pressure up to 13.5 kg/cm{sup 2}. The lower electrode of the switch is connected to the last stage of the Marx generator. Initially Marx generator (without peaking stage) in air; gives the output pulse with peak amplitude of 113.75 kV and pulse rise time of 25 ns. Thus, we design a new peaking switch to improve the rise time of output pulse and to pressurize this peaking switch separately (i.e. Marx and peaking switch is at different pressure). The PIC simulation gives the particle charge density, current density, E counter plot, emitted electron current, and particle energy along the axis of gap between electrodes. The charge injection and electric field dependence on ionic dissociation phenomenon are briefly analyzed using this simulation. The model is simulated with different gases (N{sub 2}, H{sub 2}, and Air) under different pressure (2 kg/cm{sup 2}, 5 kg/cm{sup 2}, 10 kg/cm{sup 2}). (author)

  4. QRS peak detection for heart rate monitoring on Android smartphone

    Science.gov (United States)

    Pambudi Utomo, Trio; Nuryani, Nuryani; Darmanto

    2017-11-01

    In this study, Android smartphone is used for heart rate monitoring and displaying electrocardiogram (ECG) graph. Heart rate determination is based on QRS peak detection. Two methods are studied to detect the QRS complex peak; they are Peak Threshold and Peak Filter. The acquisition of ECG data is utilized by AD8232 module from Analog Devices, three electrodes, and Microcontroller Arduino UNO R3. To record the ECG data from a patient, three electrodes are attached to particular body’s surface of a patient. Patient’s heart activity which is recorded by AD8232 module is decoded by Arduino UNO R3 into analog data. Then, the analog data is converted into a voltage value (mV) and is processed to get the QRS complex peak. Heart rate value is calculated by Microcontroller Arduino UNO R3 uses the QRS complex peak. Voltage, heart rate, and the QRS complex peak are sent to Android smartphone by Bluetooth HC-05. ECG data is displayed as the graph by Android smartphone. To evaluate the performance of QRS complex peak detection method, three parameters are used; they are positive predictive, accuracy and sensitivity. Positive predictive, accuracy, and sensitivity of Peak Threshold method is 92.39%, 70.30%, 74.62% and for Peak Filter method are 98.38%, 82.47%, 83.61%, respectively.

  5. Solid state cathodoluminescence and the properties of its two emission peaks

    International Nuclear Information System (INIS)

    Xu Xurong

    2007-01-01

    We discovered solid state cathodoluminescence (SSCL). For its identification we excluded all artifacts, carried out its cross proof and studied its generality. Its spectrum is characterized by the appearance of short wavelength peak when the applied voltage is increased. Three voltage ranges are distinguished, in the lower voltage range we have the long wavelength emission, in the middle range we have both long and short wavelength emissions, and in the higher voltage range we have only the short wavelength emission. The mechanism of this spectral shift lies in the electrical field ionization of excitons. This effect initiates the applicability of band model besides molecular excitons theory. The temporal behaviors of both peaks in SSCL are studied with a method of estimating lifetime by means of frequency dependence on intensity. The lifetime of short wavelength emission is found to be 5 ms and that of long wavelength emission is less than 0.05 ms

  6. A Hybrid Wavelet-Based Method for the Peak Detection of Photoplethysmography Signals

    Directory of Open Access Journals (Sweden)

    Suyi Li

    2017-01-01

    Full Text Available The noninvasive peripheral oxygen saturation (SpO2 and the pulse rate can be extracted from photoplethysmography (PPG signals. However, the accuracy of the extraction is directly affected by the quality of the signal obtained and the peak of the signal identified; therefore, a hybrid wavelet-based method is proposed in this study. Firstly, we suppressed the partial motion artifacts and corrected the baseline drift by using a wavelet method based on the principle of wavelet multiresolution. And then, we designed a quadratic spline wavelet modulus maximum algorithm to identify the PPG peaks automatically. To evaluate this hybrid method, a reflective pulse oximeter was used to acquire ten subjects’ PPG signals under sitting, raising hand, and gently walking postures, and the peak recognition results on the raw signal and on the corrected signal were compared, respectively. The results showed that the hybrid method not only corrected the morphologies of the signal well but also optimized the peaks identification quality, subsequently elevating the measurement accuracy of SpO2 and the pulse rate. As a result, our hybrid wavelet-based method profoundly optimized the evaluation of respiratory function and heart rate variability analysis.

  7. A Hybrid Wavelet-Based Method for the Peak Detection of Photoplethysmography Signals.

    Science.gov (United States)

    Li, Suyi; Jiang, Shanqing; Jiang, Shan; Wu, Jiang; Xiong, Wenji; Diao, Shu

    2017-01-01

    The noninvasive peripheral oxygen saturation (SpO 2 ) and the pulse rate can be extracted from photoplethysmography (PPG) signals. However, the accuracy of the extraction is directly affected by the quality of the signal obtained and the peak of the signal identified; therefore, a hybrid wavelet-based method is proposed in this study. Firstly, we suppressed the partial motion artifacts and corrected the baseline drift by using a wavelet method based on the principle of wavelet multiresolution. And then, we designed a quadratic spline wavelet modulus maximum algorithm to identify the PPG peaks automatically. To evaluate this hybrid method, a reflective pulse oximeter was used to acquire ten subjects' PPG signals under sitting, raising hand, and gently walking postures, and the peak recognition results on the raw signal and on the corrected signal were compared, respectively. The results showed that the hybrid method not only corrected the morphologies of the signal well but also optimized the peaks identification quality, subsequently elevating the measurement accuracy of SpO 2 and the pulse rate. As a result, our hybrid wavelet-based method profoundly optimized the evaluation of respiratory function and heart rate variability analysis.

  8. A Hybrid Wavelet-Based Method for the Peak Detection of Photoplethysmography Signals

    Science.gov (United States)

    Jiang, Shanqing; Jiang, Shan; Wu, Jiang; Xiong, Wenji

    2017-01-01

    The noninvasive peripheral oxygen saturation (SpO2) and the pulse rate can be extracted from photoplethysmography (PPG) signals. However, the accuracy of the extraction is directly affected by the quality of the signal obtained and the peak of the signal identified; therefore, a hybrid wavelet-based method is proposed in this study. Firstly, we suppressed the partial motion artifacts and corrected the baseline drift by using a wavelet method based on the principle of wavelet multiresolution. And then, we designed a quadratic spline wavelet modulus maximum algorithm to identify the PPG peaks automatically. To evaluate this hybrid method, a reflective pulse oximeter was used to acquire ten subjects' PPG signals under sitting, raising hand, and gently walking postures, and the peak recognition results on the raw signal and on the corrected signal were compared, respectively. The results showed that the hybrid method not only corrected the morphologies of the signal well but also optimized the peaks identification quality, subsequently elevating the measurement accuracy of SpO2 and the pulse rate. As a result, our hybrid wavelet-based method profoundly optimized the evaluation of respiratory function and heart rate variability analysis. PMID:29250135

  9. Estimation of the peak factor based on watershed characteristics

    Energy Technology Data Exchange (ETDEWEB)

    Gauthier, Jean; Nolin, Simon; Ruest, Benoit [BPR Inc., Quebec, (Canada)

    2010-07-01

    Hydraulic modeling and dam structure design require the river flood flow as a primary input. For a given flood event, the ratio of peak flow over mean daily flow defines the peak factor. The peak factor value is dependent on the watershed and location along the river. The main goal of this study consisted in finding a relationship between watershed characteristics and this peak factor. Regression analyses were carried out on 53 natural watersheds located in the southern part of the province of Quebec using data from the Centre d'expertise hydrique du Quebec (CEHQ). The watershed characteristics included in the analyses were the watershed area, the maximum flow length, the mean slope, the lake proportion and the mean elevation. The results showed that watershed area and length are the major parameters influencing the peak factor. Nine natural watersheds were also used to test the use of a multivariable model in order to determine the peak factor for ungauged watersheds.

  10. Evaluation of peak power prediction equations in male basketball players.

    Science.gov (United States)

    Duncan, Michael J; Lyons, Mark; Nevill, Alan M

    2008-07-01

    This study compared peak power estimated using 4 commonly used regression equations with actual peak power derived from force platform data in a group of adolescent basketball players. Twenty-five elite junior male basketball players (age, 16.5 +/- 0.5 years; mass, 74.2 +/- 11.8 kg; height, 181.8 +/- 8.1 cm) volunteered to participate in the study. Actual peak power was determined using a countermovement vertical jump on a force platform. Estimated peak power was determined using countermovement jump height and body mass. All 4 prediction equations were significantly related to actual peak power (all p jump prediction equations, 12% for the Canavan and Vescovi equation, and 6% for the Sayers countermovement jump equation. In all cases peak power was underestimated.

  11. Peak experiences of psilocybin users and non-users.

    Science.gov (United States)

    Cummins, Christina; Lyke, Jennifer

    2013-01-01

    Maslow (1970) defined peak experiences as the most wonderful experiences of a person's life, which may include a sense of awe, well-being, or transcendence. Furthermore, recent research has suggested that psilocybin can produce experiences subjectively rated as uniquely meaningful and significant (Griffiths et al. 2006). It is therefore possible that psilocybin may facilitate or change the nature of peak experiences in users compared to non-users. This study was designed to compare the peak experiences of psilocybin users and non-users, to evaluate the frequency of peak experiences while under the influence of psilocybin, and to assess the perceived degree of alteration of consciousness during these experiences. Participants were recruited through convenience and snowball sampling from undergraduate classes and at a musical event. Participants were divided into three groups, those who reported a peak experience while under the influence of psilocybin (psilocybin peak experience: PPE), participants who had used psilocybin but reported their peak experiences did not occur while they were under the influence of psilocybin (non-psilocybin peak experience: NPPE), and participants who had never used psilocybin (non-user: NU). A total of 101 participants were asked to think about their peak experiences and complete a measure evaluating the degree of alteration of consciousness during that experience. Results indicated that 47% of psilocybin users reported their peak experience occurred while using psilocybin. In addition, there were significant differences among the three groups on all dimensions of alteration of consciousness. Future research is necessary to identify factors that influence the peak experiences of psilocybin users in naturalistic settings and contribute to the different characteristics of peak experiences of psilocybin users and non-users.

  12. Extragalactic Peaked-spectrum Radio Sources at Low Frequencies

    Energy Technology Data Exchange (ETDEWEB)

    Callingham, J. R.; Gaensler, B. M.; Sadler, E. M.; Lenc, E. [Sydney Institute for Astronomy (SIfA), School of Physics, The University of Sydney, NSW 2006 (Australia); Ekers, R. D.; Bell, M. E. [CSIRO Astronomy and Space Science (CASS), Marsfield, NSW 2122 (Australia); Line, J. L. B.; Hancock, P. J.; Kapińska, A. D.; McKinley, B.; Procopio, P. [ARC Centre of Excellence for All-Sky Astrophysics (CAASTRO) (Australia); Hurley-Walker, N.; Tingay, S. J.; Franzen, T. M. O.; Morgan, J. [International Centre for Radio Astronomy Research (ICRAR), Curtin University, Bentley, WA 6102 (Australia); Dwarakanath, K. S. [Raman Research Institute (RRI), Bangalore 560080 (India); For, B.-Q. [International Centre for Radio Astronomy Research (ICRAR), The University of Western Australia, Crawley, WA 6009 (Australia); Hindson, L.; Johnston-Hollitt, M. [School of Chemical and Physical Sciences, Victoria University of Wellington, Wellington 6140 (New Zealand); Offringa, A. R., E-mail: joseph.callingham@sydney.edu.au [Netherlands Institute for Radio Astronomy (ASTRON), Dwingeloo (Netherlands); and others

    2017-02-20

    We present a sample of 1483 sources that display spectral peaks between 72 MHz and 1.4 GHz, selected from the GaLactic and Extragalactic All-sky Murchison Widefield Array (GLEAM) survey. The GLEAM survey is the widest fractional bandwidth all-sky survey to date, ideal for identifying peaked-spectrum sources at low radio frequencies. Our peaked-spectrum sources are the low-frequency analogs of gigahertz-peaked spectrum (GPS) and compact-steep spectrum (CSS) sources, which have been hypothesized to be the precursors to massive radio galaxies. Our sample more than doubles the number of known peaked-spectrum candidates, and 95% of our sample have a newly characterized spectral peak. We highlight that some GPS sources peaking above 5 GHz have had multiple epochs of nuclear activity, and we demonstrate the possibility of identifying high-redshift ( z > 2) galaxies via steep optically thin spectral indices and low observed peak frequencies. The distribution of the optically thick spectral indices of our sample is consistent with past GPS/CSS samples but with a large dispersion, suggesting that the spectral peak is a product of an inhomogeneous environment that is individualistic. We find no dependence of observed peak frequency with redshift, consistent with the peaked-spectrum sample comprising both local CSS sources and high-redshift GPS sources. The 5 GHz luminosity distribution lacks the brightest GPS and CSS sources of previous samples, implying that a convolution of source evolution and redshift influences the type of peaked-spectrum sources identified below 1 GHz. Finally, we discuss sources with optically thick spectral indices that exceed the synchrotron self-absorption limit.

  13. The sharp peak-flat trough pattern and critical speculation

    OpenAIRE

    Roehner, B. M.; Sornette, D.

    1998-01-01

    We find empirically a characteristic sharp peak-flat trough pattern in a large set of commodity prices. We argue that the sharp peak structure reflects an endogenous inter-market organization, and that peaks may be seen as local ``singularities'' resulting from imitation and herding. These findings impose a novel stringent constraint on the construction of models. Intermittent amplification is not sufficient and nonlinear effects seem necessary to account for the observations.

  14. Gamma-ray peak shapes from cadmium zinc telluride detectors

    Energy Technology Data Exchange (ETDEWEB)

    Namboodiri, M.N.; Lavietes, A.D.; McQuaid, J.H.

    1996-09-01

    We report the results of a study of the peak shapes in the gamma spectra measured using several 5 x 5 x 5 mm{sup 3} cadmium zinc telluride (CZT) detectors. A simple parameterization involving a Gaussian and an exponential low energy tail describes the peak shapes sell. We present the variation of the parameters with gamma energy. This type of information is very useful in the analysis of complex gamma spectra consisting of many peaks.

  15. Statistics of peaks in cosmological nonlinear density fields

    International Nuclear Information System (INIS)

    Suginohara, Tatsushi; Suto, Yasushi.

    1990-06-01

    Distribution of the high-density peaks in the universe is examined using N-body simulations. Nonlinear evolution of the underlying density field significantly changes the statistical properties of the peaks, compared with the analytic results valid for the random Gaussian field. In particular, the abundances and correlations of the initial density peaks are discussed in the context of biased galaxy formation theory. (author)

  16. Environmental impacts of public transport. Why peak-period travellers cause a greater environmental burden than off-peak travellers

    International Nuclear Information System (INIS)

    Rietveld, P.

    2002-01-01

    Given the difference between peak and off-peak occupancy rates in public transport, emissions per traveller kilometre are lower in the peak than in the off-peak period, whereas the opposite pattern is observed for cars. It is argued that it is much more fruitful to analyse environmental effects in marginal terms. This calls for a careful analysis of capacity management policies of public transport suppliers that are facing increased demand during both peak and off-peak periods. A detailed analysis of capacity management by the Netherlands Railways (NS) revealed that off-peak capacity supply is mainly dictated by the demand levels during the peak period. The analysis included the effects of increased frequency and increased vehicle size on environmental impacts, while environmental economies of vehicle size were also taken into account. The main conclusion is that the marginal environmental burden during the peak hours is much higher than is usually thought, whereas it is almost zero during the off-peak period. This implies a pattern that is the precise opposite of the average environmental burden. Thus, an analysis of environmental effects of public transport based on average performance would yield misleading conclusions [nl

  17. The dislocation-internal friction peak γ in tantalum

    International Nuclear Information System (INIS)

    Baur, J.; Benoit, W.; Schultz, H.

    1989-01-01

    Torsion-pendulum measurements were carried out on high-purity single crystal specimens of tantalum, having extremely low oxygen contents ( 2 peak, which appears close to γ is small traces of oxygen are presents. The γ 2 peak was formerly explained as a ''dislocation-enhanced Snoek peak''. The γ peak recovers at the peak temperature, whereas the γ 2 peak is more stable. On the basis of their results, and making use of earlier investigations of Rodrian and Schultz, the authors suggest that γ 2 is modified γ relaxation, related to screw-dislocation segments, stabilized by oxygen-decorated kinks. The stability of the γ 2 peak allows an accurate determination of the activation energy, found to be 1.00 +- 0.03 eV. This value is distinctly lower than the activation energy of the oxygen Snoek effect (1.10 eV) and is related here to the mechanism of ''kink-pair formation'' in screw dislocations, as the original γ peak. The numerical value is compatible with recent values derived from flow-stress measurements. The peak γ 2 shows increasing stability with increasing oxygen content. This is explained by single- and multi-decorated kinks

  18. Evaluation of peak-fitting software for gamma spectrum analysis

    International Nuclear Information System (INIS)

    Zahn, Guilherme S.; Genezini, Frederico A.; Moralles, Mauricio

    2009-01-01

    In all applications of gamma-ray spectroscopy, one of the most important and delicate parts of the data analysis is the fitting of the gamma-ray spectra, where information as the number of counts, the position of the centroid and the width, for instance, are associated with each peak of each spectrum. There's a huge choice of computer programs that perform this type of analysis, and the most commonly used in routine work are the ones that automatically locate and fit the peaks; this fit can be made in several different ways - the most common ways are to fit a Gaussian function to each peak or simply to integrate the area under the peak, but some software go far beyond and include several small corrections to the simple Gaussian peak function, in order to compensate for secondary effects. In this work several gamma-ray spectroscopy software are compared in the task of finding and fitting the gamma-ray peaks in spectra taken with standard sources of 137 Cs, 60 Co, 133 Ba and 152 Eu. The results show that all of the automatic software can be properly used in the task of finding and fitting peaks, with the exception of GammaVision; also, it was possible to verify that the automatic peak-fitting software did perform as well as - and sometimes even better than - a manual peak-fitting software. (author)

  19. Individual vision and peak distribution in collective actions

    Science.gov (United States)

    Lu, Peng

    2017-06-01

    People make decisions on whether they should participate as participants or not as free riders in collective actions with heterogeneous visions. Besides of the utility heterogeneity and cost heterogeneity, this work includes and investigates the effect of vision heterogeneity by constructing a decision model, i.e. the revised peak model of participants. In this model, potential participants make decisions under the joint influence of utility, cost, and vision heterogeneities. The outcomes of simulations indicate that vision heterogeneity reduces the values of peaks, and the relative variance of peaks is stable. Under normal distributions of vision heterogeneity and other factors, the peaks of participants are normally distributed as well. Therefore, it is necessary to predict distribution traits of peaks based on distribution traits of related factors such as vision heterogeneity and so on. We predict the distribution of peaks with parameters of both mean and standard deviation, which provides the confident intervals and robust predictions of peaks. Besides, we validate the peak model of via the Yuyuan Incident, a real case in China (2014), and the model works well in explaining the dynamics and predicting the peak of real case.

  20. Bayesian approach for peak detection in two-dimensional chromatography.

    Science.gov (United States)

    Vivó-Truyols, Gabriel

    2012-03-20

    A new method for peak detection in two-dimensional chromatography is presented. In a first step, the method starts with a conventional one-dimensional peak detection algorithm to detect modulated peaks. In a second step, a sophisticated algorithm is constructed to decide which of the individual one-dimensional peaks have been originated from the same compound and should then be arranged in a two-dimensional peak. The merging algorithm is based on Bayesian inference. The user sets prior information about certain parameters (e.g., second-dimension retention time variability, first-dimension band broadening, chromatographic noise). On the basis of these priors, the algorithm calculates the probability of myriads of peak arrangements (i.e., ways of merging one-dimensional peaks), finding which of them holds the highest value. Uncertainty in each parameter can be accounted by adapting conveniently its probability distribution function, which in turn may change the final decision of the most probable peak arrangement. It has been demonstrated that the Bayesian approach presented in this paper follows the chromatographers' intuition. The algorithm has been applied and tested with LC × LC and GC × GC data and takes around 1 min to process chromatograms with several thousands of peaks.

  1. Assessing peak aerobic capacity in Dutch law enforcement officers

    Directory of Open Access Journals (Sweden)

    Harriet Wittink

    2015-06-01

    Full Text Available Objectives: To cross-validate the existing peak rate of oxygen consumption (VO2peak prediction equations in Dutch law enforcement officers and to determine whether these prediction equations can be used to predict VO2peak for groups and in a single individual. A further objective was to report normative absolute and relative VO2peak values of a sample of law enforcement officers in the Netherlands. Material and Methods: The peak rate of oxygen consumption (ml×kg–1×min–1 was measured using a maximal incremental bicycle test in 1530 subjects, including 1068 male and 461 female police officers. Validity of the prediction equations for groups was assessed by comparing predicted VO2peak with measured VO2peak using paired t-tests. For individual differences limits of agreement (LoA were calculated. Equations were considered valid for individuals when the difference between measured and predicted VO2peak did not exceed ±1 metabolic equivalent (MET in 95% of individuals. Results: None of the equations met the validity criterion of 95% of individuals having ±1 MET difference or less than the measured value. Limits of agreement (LoAs were large in all predictions. At the individual level, none of the equations were valid predictors of VO2peak (ml×kg–1×min–1. Normative values for Dutch law enforcement officers were presented. Conclusions: Substantial differences between measured and predicted VO2peak (ml×kg–1×min–1 were found. Most tested equations were invalid predictors of VO2peak at group level and all were invalid at individual levels.

  2. Constraining the shape of the CMB: A peak-by-peak analysis

    International Nuclear Information System (INIS)

    Oedman, Carolina J.; Hobson, Michael P.; Lasenby, Anthony N.; Melchiorri, Alessandro

    2003-01-01

    The recent measurements of the power spectrum of cosmic microwave background anisotropies are consistent with the simplest inflationary scenario and big bang nucleosynthesis constraints. However, these results rely on the assumption of a class of models based on primordial adiabatic perturbations, cold dark matter and a cosmological constant. In this paper we investigate the need for deviations from the Λ-CDM scenario by first characterizing the spectrum using a phenomenological function in a 15 dimensional parameter space. Using a Monte Carlo Markov chain approach to Bayesian inference and a low curvature model template we then check for the presence of new physics and/or systematics in the CMB data. We find an almost perfect consistency between the phenomenological fits and the standard Λ-CDM models. The curvature of the secondary peaks is weakly constrained by the present data, but they are well located. The improved spectral resolution expected from future satellite experiments is warranted for a definitive test of the scenario

  3. Limitations of middle cerebral artery peak systolic velocity in the ...

    African Journals Online (AJOL)

    We present a case of a mother with severe pre-eclampsia at 32 weeks' gestation and non-immune fetal hydrops without obvious cause. Since the. MCA peak systolic velocity (PSV) was ... Limitations of middle cerebral artery peak systolic velocity .... [7] found MCA PSV of value in 9 women with chronic abruption, but in 5.

  4. Daily Nigerian peak load forecasting using artificial neural network ...

    African Journals Online (AJOL)

    A daily peak load forecasting technique that uses artificial neural network with seasonal indices is presented in this paper. A neural network of relatively smaller size than the main prediction network is used to predict the daily peak load for a period of one year over which the actual daily load data are available using one ...

  5. Diffraction peaks in x-ray spectroscopy: Friend or foe?

    International Nuclear Information System (INIS)

    Tissot, R.G.; Goehner, R.P.

    1992-01-01

    Diffraction peaks can occur as unidentifiable peaks in the energy spectrum of an x-ray spectrometric analysis. Recently, there has been increased interest in oriented polycrystalline films and epitaxial films on single crystal substrates for electronic applications. Since these materials diffract x-rays more efficiently than randomly oriented polycrystalline materials, diffraction peaks are being observed more frequently in x-ray fluorescent spectra. In addition, micro x-ray spectrometric analysis utilizes a small, intense, collimated x-ray beam that can yield well defined diffraction peaks. In some cases these diffraction peaks can occur at the same position as elemental peaks. These diffraction peaks, although a possible problem in qualitative and quantitative elemental analysis, can give very useful information about the crystallographic structure and orientation of the material being analyzed. The observed diffraction peaks are dependent on the geometry of the x-ray spectrometer, the degree of collimation and the distribution of wavelengths (energies) originating from the x-ray tube and striking the sample

  6. Quality Assurance in the Determination of Overlapping Peak Areas

    DEFF Research Database (Denmark)

    Christensen, L.H.; Heydorn, K.

    1987-01-01

    The ability of different computer programs to yield accurate peak areas in statistical control in the case of partially overlapping photopeaks has been tested by the Analysis of Precision. A modified Covell method, two commercially available peak-fitting programs from Nuclear Data and Ortec, and ...

  7. Peak effect in surface resistance at microwave frequencies in Dy ...

    Indian Academy of Sciences (India)

    In the measurements at both frequencies the induced microwave current was always less than the critical current of the films. The reason for observation of this peak effect in these films has been explained in our earlier publication [5]. Comparing figures 1 and 2, it is observed that the peaks in sample S1 are broader and.

  8. Peak heart rate decreases with increasing severity of acute hypoxia

    DEFF Research Database (Denmark)

    Lundby, C; Araoz, M; Van Hall, Gerrit

    2001-01-01

    , 459, and 404 mmHg) in a hypobaric chamber and while breathing 9% O(2) in N(2). These conditions were equivalent to altitudes of 3300, 4300, 5300, and 6300 m above sea level, respectively. At 4300 m, maximal exercise was also repeated after 4 and 8 h. Peak heart rate (HR) decreased from 191 (182......-202) (mean and range) at sea level to 189 (179-200), 182 (172-189), 175 (166-183), and 165 (162-169) in the acute hypoxic conditions. Peak HR did not decrease further after 4 and 8 h at 4300 m compared to the acute exposure at this altitude. Between barometric pressures of 518 and 355 mmHg (approximately...... 3300 and 6300 m), peak HR decreased linearly: peak HR(hypobaria) = peak HR(sea level) - 0.135 x [hypobaria(3100) - hypobaria (mmHg)]; or peak HR(altitude) = peak HR(sea level) - 0.15 x (altitude - 3100 m). This corresponds to approximately 1-beat x min(-1) reduction in peak HR for every 7-mmHg decrease...

  9. Determination of gaussian peaks in gamma spectra by iterative regression

    International Nuclear Information System (INIS)

    Nordemann, D.J.R.

    1987-05-01

    The parameters of the peaks in gamma-ray spectra are determined by a simple iterative regression method. For each peak, the parameters are associated with a gaussian curve (3 parameters) located above a linear continuum (2 parameters). This method may produces the complete result of the calculation of statistical uncertainties and an accuracy higher than others methods. (author) [pt

  10. Peak Expiratory Flow Rate In Cigarette Smokers | Ukoli | Highland ...

    African Journals Online (AJOL)

    Objective: To compare lung function between smokers and non-smokers using Peak Expiratory Flow Rate (PEFR). Methods: This study examines the peak expiratory flow rate (PEFR) of three hundred and forty cigarette smokers, age and sex-matched with PEFR of equal number of non-smokers. Results: The mean PEFR of ...

  11. Online junction temperature measurement using peak gate current

    DEFF Research Database (Denmark)

    Baker, Nick; Munk-Nielsen, Stig; Iannuzzo, Francesco

    2015-01-01

    A new method for junction temperature measurement of MOS-gated power semiconductor switches is presented. The measurement method involves detecting the peak voltage over the external gate resistor of an IGBT or MOSFET during turn-on. This voltage is directly proportional to the peak gate current...

  12. Psychological Preparation for Peak Performance in Sports Competition

    Science.gov (United States)

    Ohuruogu, Ben; Jonathan, Ugwuanyi I.; Ikechukwu, Ugwu Jude

    2016-01-01

    This paper attempts to make an overview of various techniques, sport psychologist adopt in psychological preparation of athletes for peak performance. To attain peak performance in sports competitions, coaches and athletes should not base their prospect on physical training on sport skills alone rather should integrate both the mental and physical…

  13. Probabilistic peak detection for first-order chromatographic data

    NARCIS (Netherlands)

    Lopatka, M.; Vivó-Truyols, G.; Sjerps, M.J.

    2014-01-01

    We present a novel algorithm for probabilistic peak detection in first-order chromatographic data. Unlike conventional methods that deliver a binary answer pertaining to the expected presence or absence of a chromatographic peak, our method calculates the probability of a point being affected by

  14. A new automatic fixed peak technology of microcontroller

    International Nuclear Information System (INIS)

    Huang Liguo; Wang Dequan; Zhang Damin; Li Jun; Liu Yuwen; Guo Qingxue; Wang Guifeng

    1999-01-01

    The microcontroller automatic fixed peak technology which differs from fashion half channel fixed peak is described. It bases on the principles of selecting double single channel and readjusting the voltage of power source. This technology is suitable to the industrial isotope instruments with various radioactive sources

  15. Impact of Smart Grid Technologies on Peak Load to 2050

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2011-07-01

    The IEA's Smart Grids Technology Roadmap identified five global trends that could be effectively addressed by deploying smart grids. These are: increasing peak load (the maximum power that the grid delivers during peak hours), rising electricity consumption, electrification of transport, deployment of variable generation technologies (e.g. wind and solar PV) and ageing infrastructure. Along with this roadmap, a new working paper -- Impact of Smart Grid Technologies on Peak Load to 2050 -- develops a methodology to estimate the evolution of peak load until 2050. It also analyses the impact of smart grid technologies in reducing peak load for four key regions; OECD North America, OECD Europe, OECD Pacific and China. This working paper is a first IEA effort in an evolving modelling process of smart grids that is considering demand response in residential and commercial sectors as well as the integration of electric vehicles.

  16. Peak broadening in paper chromatography and related techniques : III. Peak broadening in thin-layer chromatography on cellulose powder

    NARCIS (Netherlands)

    Ligny, C.L. de; Remijnse, A.G.

    1968-01-01

    The mechanism of peak broadening in thin-layer chromatography on cellulose powder was investigated by comparing the peak widths obtained in chromatography with those caused only by diffusion in the cellulose powder, for a set of amino acids of widely differing RF values and six kinds of cellulose

  17. Evaluation of different time domain peak models using extreme learning machine-based peak detection for EEG signal.

    Science.gov (United States)

    Adam, Asrul; Ibrahim, Zuwairie; Mokhtar, Norrima; Shapiai, Mohd Ibrahim; Cumming, Paul; Mubin, Marizan

    2016-01-01

    Various peak models have been introduced to detect and analyze peaks in the time domain analysis of electroencephalogram (EEG) signals. In general, peak model in the time domain analysis consists of a set of signal parameters, such as amplitude, width, and slope. Models including those proposed by Dumpala, Acir, Liu, and Dingle are routinely used to detect peaks in EEG signals acquired in clinical studies of epilepsy or eye blink. The optimal peak model is the most reliable peak detection performance in a particular application. A fair measure of performance of different models requires a common and unbiased platform. In this study, we evaluate the performance of the four different peak models using the extreme learning machine (ELM)-based peak detection algorithm. We found that the Dingle model gave the best performance, with 72 % accuracy in the analysis of real EEG data. Statistical analysis conferred that the Dingle model afforded significantly better mean testing accuracy than did the Acir and Liu models, which were in the range 37-52 %. Meanwhile, the Dingle model has no significant difference compared to Dumpala model.

  18. System dynamics model of Hubbert Peak for China's oil

    International Nuclear Information System (INIS)

    Tao Zaipu; Li Mingyu

    2007-01-01

    American geophysicist M. King Hubbert in 1956 first introduced a logistic equation to estimate the peak and lifetime production for oil of USA. Since then, a fierce debate ensued on the so-called Hubbert Peak, including also its methodology. This paper proposes to use the generic STELLA model to simulate Hubbert Peak, particularly for the Chinese oil production. This model is demonstrated as being robust. We used three scenarios to estimate the Chinese oil peak: according to scenario 1 of this model, the Hubbert Peak for China's crude oil production appears to be in 2019 with a value of 199.5 million tonnes, which is about 1.1 times the 2005 output. Before the peak comes, Chinese oil output will grow by about 1-2% annually, after the peak, however, the output will fall. By 2040, the annual production of Chinese crude oil would be equivalent to the level of 1990. During the coming 20 years, the crude oil demand of China will probably grow at the rate of 2-3% annually, and the gap between domestic supply and total demand may be more than half of this demand

  19. Core fueling to produce peaked density profiles in large tokamaks

    International Nuclear Information System (INIS)

    Mikkelsen, D.R.; McGuire, K.M.; Schmidt, G.L.; Zweben, S.J.

    1994-06-01

    Peaking the density profile increases the usable bootstrap current and the average fusion power density; this could reduce the current drive power and increase the net output of power producing tokamaks. The use of neutral beams and pellet injection to produce peaked density profiles is assessed. We show that with radially ''hollow'' diffusivity profiles (and no particle pinch) moderately peaked density profiles can be produced by particle source profiles which are peaked off-axis. The fueling penetration requirements can therefore be relaxed and this greatly improves the feasibility of generating peaked density profiles in large tokamaks. In particular, neutral beam fueling does not require MeV particle energy. Even with beam voltages of ∼200 keV, however, exceptionally good particle confinement, τ p much-gt τ E is required to achieve net electrical power generation. In system with no power production requirement (e.g., neutron sources) neutral beam fueling should be capable of producing peaked density profiles in devices as large as ITER. Fueling systems with low energy cost per particle (such as cryogenic pellet injection) must be used in power producing tokamaks when τ p ∼ τ E . Simulations with pellet injection speeds of 7 km/sec show the peaking factor, n eo /left-angle n e right-angle, approaching 2

  20. Probabilistic peak detection for first-order chromatographic data.

    Science.gov (United States)

    Lopatka, M; Vivó-Truyols, G; Sjerps, M J

    2014-03-19

    We present a novel algorithm for probabilistic peak detection in first-order chromatographic data. Unlike conventional methods that deliver a binary answer pertaining to the expected presence or absence of a chromatographic peak, our method calculates the probability of a point being affected by such a peak. The algorithm makes use of chromatographic information (i.e. the expected width of a single peak and the standard deviation of baseline noise). As prior information of the existence of a peak in a chromatographic run, we make use of the statistical overlap theory. We formulate an exhaustive set of mutually exclusive hypotheses concerning presence or absence of different peak configurations. These models are evaluated by fitting a segment of chromatographic data by least-squares. The evaluation of these competing hypotheses can be performed as a Bayesian inferential task. We outline the potential advantages of adopting this approach for peak detection and provide several examples of both improved performance and increased flexibility afforded by our approach. Copyright © 2014 Elsevier B.V. All rights reserved.

  1. Core fuelling to produce peaked density profiles in large tokamaks

    International Nuclear Information System (INIS)

    Mikkelsen, D.R.; McGuire, K.M.; Schmidt, G.L.; Zweben, S.J.

    1995-01-01

    Peaking the density profile increases the usable bootstrap current and the average fusion power density; this could reduce the current drive power and increase the net output of power producing tokamaks. The use of neutral beams and pellet injection to produce peaked density profiles is assessed. It is shown that with radially 'hollow' diffusivity profiles (and no particle pinch) moderately peaked density profiles can be produced by particle source profiles that are peaked off-axis. The fuelling penetration requirements can therefore be relaxed and this greatly improves the feasibility of generating peaked density profiles in large tokamaks. In particular, neutral beam fuelling does not require Megavolt particle energies. Even with beam voltages of ∼ 200 keV, however, exceptionally good particle confinement is needed to achieve net electrical power generation. The required ratio of particle to thermal diffusivities is an order of magnitude outside the range reported for tokamaks. In a system with no power production requirement (e.g., neutron sources) neutral beam fuelling should be capable of producing peaked density profiles in devices as large as ITER. Fuelling systems with low energy cost per particle - such as cryogenic pellet injection - must be used in power producing tokamaks when τ P ∼ τ E . Simulations with pellet injection speeds of 7 km/s show that the peaking factor, n e0 / e >, approaches 2. (author). 65 refs, 8 figs

  2. Peak loads and network investments in sustainable energy transitions

    Energy Technology Data Exchange (ETDEWEB)

    Blokhuis, Erik, E-mail: e.g.j.blokhuis@tue.nl [Eindhoven University of Technology, Department of Architecture, Building and Planning, Vertigo 8.11, P.O. Box 513, 5600MB Eindhoven (Netherlands); Brouwers, Bart [Eindhoven University of Technology, Department of Architecture, Building and Planning, Vertigo 8.11, P.O. Box 513, 5600MB Eindhoven (Netherlands); Putten, Eric van der [Endinet, Gas and Electricity Network Operations, P.O. Box 2005, 5600CA Eindhoven (Netherlands); Schaefer, Wim [Eindhoven University of Technology, Department of Architecture, Building and Planning, Vertigo 8.11, P.O. Box 513, 5600MB Eindhoven (Netherlands)

    2011-10-15

    Current energy distribution networks are often not equipped for facilitating expected sustainable transitions. Major concerns for future electricity networks are the possibility of peak load increases and the expected growth of decentralized energy generation. In this article, we focus on peak load increases; the effects of possible future developments on peak loads are studied, together with the consequences for the network. The city of Eindhoven (the Netherlands) is used as reference city, for which a scenario is developed in which the assumed future developments adversely influence the maximum peak loads on the network. In this scenario, the total electricity peak load in Eindhoven is expected to increase from 198 MVA in 2009 to 591-633 MVA in 2040. The necessary investments for facilitating the expected increased peak loads are estimated at 305-375 million Euros. Based upon these projections, it is advocated that - contrary to current Dutch policy - choices regarding sustainable transitions should be made from the viewpoint of integral energy systems, evaluating economic implications of changes to generation, grid development, and consumption. Recently applied and finished policies on energy demand reduction showed to be effective; however, additional and connecting policies on energy generation and distribution should be considered on short term. - Highlights: > Sustainable energy transitions can result in major electricity peak load increases. > Introduction of heat pumps and electrical vehicles requires network expansion. > Under worst case assumptions, peak loads in Eindhoven increase with 200% until 2040. > The necessary investment for facilitating this 2040 peak demand is Euro 305-375 million. > Future policy choices should be made from the viewpoint of the integral energy system.

  3. Peak loads and network investments in sustainable energy transitions

    International Nuclear Information System (INIS)

    Blokhuis, Erik; Brouwers, Bart; Putten, Eric van der; Schaefer, Wim

    2011-01-01

    Current energy distribution networks are often not equipped for facilitating expected sustainable transitions. Major concerns for future electricity networks are the possibility of peak load increases and the expected growth of decentralized energy generation. In this article, we focus on peak load increases; the effects of possible future developments on peak loads are studied, together with the consequences for the network. The city of Eindhoven (the Netherlands) is used as reference city, for which a scenario is developed in which the assumed future developments adversely influence the maximum peak loads on the network. In this scenario, the total electricity peak load in Eindhoven is expected to increase from 198 MVA in 2009 to 591-633 MVA in 2040. The necessary investments for facilitating the expected increased peak loads are estimated at 305-375 million Euros. Based upon these projections, it is advocated that - contrary to current Dutch policy - choices regarding sustainable transitions should be made from the viewpoint of integral energy systems, evaluating economic implications of changes to generation, grid development, and consumption. Recently applied and finished policies on energy demand reduction showed to be effective; however, additional and connecting policies on energy generation and distribution should be considered on short term. - Highlights: → Sustainable energy transitions can result in major electricity peak load increases. → Introduction of heat pumps and electrical vehicles requires network expansion. → Under worst case assumptions, peak loads in Eindhoven increase with 200% until 2040. → The necessary investment for facilitating this 2040 peak demand is Euro 305-375 million. → Future policy choices should be made from the viewpoint of the integral energy system.

  4. Comparative Analysis of Mass Spectral Similarity Measures on Peak Alignment for Comprehensive Two-Dimensional Gas Chromatography Mass Spectrometry

    Science.gov (United States)

    2013-01-01

    Peak alignment is a critical procedure in mass spectrometry-based biomarker discovery in metabolomics. One of peak alignment approaches to comprehensive two-dimensional gas chromatography mass spectrometry (GC×GC-MS) data is peak matching-based alignment. A key to the peak matching-based alignment is the calculation of mass spectral similarity scores. Various mass spectral similarity measures have been developed mainly for compound identification, but the effect of these spectral similarity measures on the performance of peak matching-based alignment still remains unknown. Therefore, we selected five mass spectral similarity measures, cosine correlation, Pearson's correlation, Spearman's correlation, partial correlation, and part correlation, and examined their effects on peak alignment using two sets of experimental GC×GC-MS data. The results show that the spectral similarity measure does not affect the alignment accuracy significantly in analysis of data from less complex samples, while the partial correlation performs much better than other spectral similarity measures when analyzing experimental data acquired from complex biological samples. PMID:24151524

  5. Relaxation peak near 200 K in NiTi alloy

    Science.gov (United States)

    Zhu, J. S.; Schaller, R.; Benoit, W.

    1989-10-01

    Internal friction (IF), frequency ( f), electrical resistance ( R) and zero point movement of the torsion pendulum (ɛ) have been measured in near equi-atomic NiTi alloy in order to clarify the mechanism for the relaxation peak near 200 K. The height of the relaxation peak decreases successively with thermal cycling and settles down to a lower stable value in running 15 cycles. However, the electrical resistance of the sample shows a variation in contrast with the internal friction. Both of them will return to the initial state after a single annealing at 773 K for 1 h. The probable mechanism of this relaxation peak was discussed.

  6. National energy peak leveling program (NEPLP). Final report

    Energy Technology Data Exchange (ETDEWEB)

    None

    1977-12-01

    This three-volume report is responsive to the requirements of Contract E (04-3)-1152 to provide a detailed methodology, to include management, technology, and socio-economic aspects, of a voluntary community program of computer-assisted peak load leveling and energy conservation in commercial community facilities. The demonstration project established proof-of-concept in reducing the kW-demand peak by the unofficial goal of 10%, with concurrent kWh savings. This section of the three volume report is a final report appendix with information on the National Energy Peak Leveling Program (NEPLP).

  7. The environmental impacts of peaking at hydropower plants

    International Nuclear Information System (INIS)

    Halleraker, Jo Halvard

    2001-01-01

    A recent energy act in Norway allows hydropower plants to be operated so that hydro peaking is permitted. However, it is uncertain how fish react to the variations in discharge and depth that follow hydro peaking. SINTEF Energy Research is cooperating with other research institutions to investigate the consequences of these variations on the biota. Among the research tools is an aqua channel which is an indoor laboratory flume where fish behaviour can be studied in detail. It has been constructed to provide the hydropower industry and public authorities with means of better determining the effects of hydro peaking. (author)

  8. PolyaPeak: Detecting Transcription Factor Binding Sites from ChIP-seq Using Peak Shape Information

    Science.gov (United States)

    Wu, Hao; Ji, Hongkai

    2014-01-01

    ChIP-seq is a powerful technology for detecting genomic regions where a protein of interest interacts with DNA. ChIP-seq data for mapping transcription factor binding sites (TFBSs) have a characteristic pattern: around each binding site, sequence reads aligned to the forward and reverse strands of the reference genome form two separate peaks shifted away from each other, and the true binding site is located in between these two peaks. While it has been shown previously that the accuracy and resolution of binding site detection can be improved by modeling the pattern, efficient methods are unavailable to fully utilize that information in TFBS detection procedure. We present PolyaPeak, a new method to improve TFBS detection by incorporating the peak shape information. PolyaPeak describes peak shapes using a flexible Pólya model. The shapes are automatically learnt from the data using Minorization-Maximization (MM) algorithm, then integrated with the read count information via a hierarchical model to distinguish true binding sites from background noises. Extensive real data analyses show that PolyaPeak is capable of robustly improving TFBS detection compared with existing methods. An R package is freely available. PMID:24608116

  9. The peak of oil production-Timings and market recognition

    International Nuclear Information System (INIS)

    Almeida, Pedro de; Silva, Pedro D.

    2009-01-01

    Energy is essential for present societies. In particular, transportation systems depend on petroleum-based fuels. That world oil production is set to pass a peak is now a reasonably accepted concept, although its date is far from consensual. In this work, we analyze the true expectations of the oil market participants about the future availability of this fundamental energy source. We study the evolution through time of the curves of crude oil futures prices, and we conclude that the market participants, among them the crude oil producers, already expect a near-term peak of oil production. This agrees with many technical predictions for the date of peak production, including our own, that point to peak dates around the end of the present decade. If this scenario is confirmed, it can cause serious social and economical problems because societies will have little time to perform the necessary adjustments

  10. Reducing Electricity Demand Peaks by Scheduling Home Appliances Usage

    DEFF Research Database (Denmark)

    Rossello Busquet, Ana; Kardaras, Georgios; Iversen, Villy Bæk

    2011-01-01

    Nowadays there is a tendency to consume electricity during the same period of the day leading to demand peaks. Regular energy consumption habits lead to demand peaks at specific temporal intervals, because users consume power at the same time. In order to avoid demand peaks, users’ appliances...... should consume electricity in a more temporarily distributed way. A new methodology to schedule the usage of home appliances is proposed and analyzed in this paper. The main concept behind this approach is the aggregation of home appliances into priority classes and the definition of a maximum power...... consumption limit, which is not allowed to be exceeded during peak hours. The scenario simulated describes a modern household, where the electrical devices are classified in low and high priority groups. The high priority devices are always granted power in order to operate without temporal restrictions...

  11. Advancements of ultra-high peak power laser diode arrays

    Science.gov (United States)

    Crawford, D.; Thiagarajan, P.; Goings, J.; Caliva, B.; Smith, S.; Walker, R.

    2018-02-01

    Enhancements of laser diode epitaxy in conjunction with process and packaging improvements have led to the availability of 1cm bars capable of over 500W peak power at near-infrared wavelengths (770nm to 1100nm). Advances in cooler design allow for multi-bar stacks with bar-to-bar pitches as low as 350μm and a scalable package architecture enabled a single diode assembly with total peak powers of over 1MegaWatt of peak power. With the addition of micro-optics, overall array brightness greater than 10kW/cm2 was achieved. Performance metrics of barbased diode lasers specifically engineered for high peak power and high brightness at wavelengths and pulse conditions commonly used to pump a variety of fiber and solid-state materials are presented.

  12. Improving EEG signal peak detection using feature weight learning ...

    Indian Academy of Sciences (India)

    Asrul Adam

    4 School of Psychology and Counseling, Queensland University of Technology, Brisbane 4000, Australia. 5 QIMR ... The groups of Acir et al .... difference between the peak and the floating mean, which is ..... Thus, the individual features were.

  13. Energy and public health: the challenge of peak petroleum.

    Science.gov (United States)

    Frumkin, Howard; Hess, Jeremy; Vindigni, Stephen

    2009-01-01

    Petroleum is a unique and essential energy source, used as the principal fuel for transportation, in producing many chemicals, and for numerous other purposes. Global petroleum production is expected to reach a maximum in the near future and to decline thereafter, a phenomenon known as "peak petroleum." This article reviews petroleum geology and uses, describes the phenomenon of peak petroleum, and reviews the scientific literature on the timing of this transition. It then discusses how peak petroleum may affect public health and health care, by reference to four areas: medical supplies and equipment, transportation, energy generation, and food production. Finally, it suggests strategies for anticipating and preparing for peak petroleum, both general public health preparedness strategies and actions specific to the four expected health system impacts.

  14. OECD : Euroopa peaks laenuraha odava hoidma / Sirje Rank

    Index Scriptorium Estoniae

    Rank, Sirje, 1966-

    2002-01-01

    USA majanduse kiire toibumine võib varsti tuua laenuintresside tõusu, Euroopa Keskpank peaks vähemalt aasta lõpuni ootama ja laskma kasvul juurduda. Diagramm: OECD tõstis majanduskasvu prognoosi. Maksukoormus

  15. Hubbert's Oil Peak Revisited by a Simulation Model

    International Nuclear Information System (INIS)

    Giraud, P.N.; Sutter, A.; Denis, T.; Leonard, C.

    2010-01-01

    As conventional oil reserves are declining, the debate on the oil production peak has become a burning issue. An increasing number of papers refer to Hubbert's peak oil theory to forecast the date of the production peak, both at regional and world levels. However, in our views, this theory lacks micro-economic foundations. Notably, it does not assume that exploration and production decisions in the oil industry depend on market prices. In an attempt to overcome these shortcomings, we have built an adaptative model, accounting for the behavior of one agent, standing for the competitive exploration-production industry, subjected to incomplete but improving information on the remaining reserves. Our work yields challenging results on the reasons for an Hubbert type peak oil, lying mainly 'above the ground', both at regional and world levels, and on the shape of the production and marginal cost trajectories. (authors)

  16. Peak globalization. Climate change, oil depletion and global trade

    Energy Technology Data Exchange (ETDEWEB)

    Curtis, Fred [Department of Economics, Drew University, Madison, NJ 07940 (United States)

    2009-12-15

    The global trade in goods depends upon reliable, inexpensive transportation of freight along complex and long-distance supply chains. Global warming and peak oil undermine globalization by their effects on both transportation costs and the reliable movement of freight. Countering the current geographic pattern of comparative advantage with higher transportation costs, climate change and peak oil will thus result in peak globalization, after which the volume of exports will decline as measured by ton-miles of freight. Policies designed to mitigate climate change and peak oil are very unlikely to change this result due to their late implementation, contradictory effects and insufficient magnitude. The implication is that supply chains will become shorter for most products and that production of goods will be located closer to where they are consumed. (author)

  17. Brian Eno Hollandi Festivali peakülaliseks

    Index Scriptorium Estoniae

    1999-01-01

    Inglise helilooja, videokunstnik ja muusikaprodutsent Brian Eno on 5.-26. juunini Amsterdamis toimuva avangardse Hollandi Festivali peakülaline, kelle videoinstallatsioon seatakse üles Stedelijki Muuseumis. Festivali programmist

  18. FHWA operations support : port peak pricing program evaluation

    Science.gov (United States)

    2009-01-01

    This report evaluates the applicability, Federal policy implications, and possible public and private sector roles related to peak pricing strategies at ports and intermodal facilities in the U.S. A number of ports and intermodal terminals are consid...

  19. Peak globalization. Climate change, oil depletion and global trade

    International Nuclear Information System (INIS)

    Curtis, Fred

    2009-01-01

    The global trade in goods depends upon reliable, inexpensive transportation of freight along complex and long-distance supply chains. Global warming and peak oil undermine globalization by their effects on both transportation costs and the reliable movement of freight. Countering the current geographic pattern of comparative advantage with higher transportation costs, climate change and peak oil will thus result in peak globalization, after which the volume of exports will decline as measured by ton-miles of freight. Policies designed to mitigate climate change and peak oil are very unlikely to change this result due to their late implementation, contradictory effects and insufficient magnitude. The implication is that supply chains will become shorter for most products and that production of goods will be located closer to where they are consumed. (author)

  20. The simple method of determination peaks areas in multiplets

    International Nuclear Information System (INIS)

    Loska, L.; Ptasinski, J.

    1991-01-01

    Semiconductor germanium detectors used in γ-spectrometry give spectra with well-separated peaks. However, in some cases, energies of γ-lines are too near, to produce resolved and undisturbed peaks. Then, there is a necessity to perform a mathematical separation. The method proposed here is based on the assumption, that areas of peaks composing the analysed multiplet are proportional to their heights. The method can be applied for any number of interfering peaks, providing, that the function of the background under the multiplet is accurately determined. The results of testing calculations performed on a simulated spectrum are given. The method works successfully in a computer program used for neutron activation analysis data processing. (author). 9 refs, 1 fig, 1 tab

  1. Heavy Ion Testing at the Galactic Cosmic Ray Energy Peak

    Science.gov (United States)

    Pellish, Jonathan A.; Xapsos, M. A.; LaBel, K. A.; Marshall, P. W.; Heidel, D. F.; Rodbell, K. P.; Hakey, M. C.; Dodd, P. E.; Shaneyfelt, M. R.; Schwank, J. R.; hide

    2009-01-01

    A 1 GeV/u Fe-56 Ion beam allows for true 90 deg. tilt irradiations of various microelectronic components and reveals relevant upset trends for an abundant element at the galactic cosmic ray (GCR) flux-energy peak.

  2. Bedrock Geologic Map of the Jay Peak, VT Quadrangle

    Data.gov (United States)

    Vermont Center for Geographic Information — Digital data from VG99-1 Compilation bedrock geologic map of the Jay Peak quadrangle, Compiled by B. Doolan, 1999: VGS Open-File Report VG99-1, 1 plate, scale...

  3. Neutron-induced peaks in Ge detectors from evaporation neutrons

    International Nuclear Information System (INIS)

    Gete, E.; Measday, D.F.; Moftah, B.A.; Saliba, M.A.; Stocki, T.J.

    1997-01-01

    We have studied the peak shapes at 596 and 691 keV resulting from fast neutron interactions inside germanium detectors. We have used neutrons from a 252 Cf source, as well as from the 28 Si(μ - , nν), and 209 Bi(π - , xn) reactions to compare the peaks and to check for a dependence of peak shape on the incoming neutron energy. In our investigation, no difference between these three measurements has been observed. In a comparison of these peak shapes with other studies, we found similar results to ours except for those measurements using monoenergetic neutrons in which a significant variation with neutron energy has been observed. (orig.)

  4. Desert Peak East Enhanced Geothermal Systems (EGS) Project

    Energy Technology Data Exchange (ETDEWEB)

    Zemach, Ezra [Ormat Technologies Inc., Reno, NV (United States); Drakos, Peter [Ormat Technologies Inc., Reno, NV (United States); Spielman, Paul [Ormat Technologies Inc., Reno, NV (United States); Akerley, John [Ormat Technologies Inc., Reno, NV (United States)

    2013-09-30

    This manuscript is a draft to replaced with a final version at a later date TBD. A summary of activities pertaining to the Desert Peak EGS project including the planning and resulting stimulation activities.

  5. Effects of equipment and technique on peak flow measurements

    Directory of Open Access Journals (Sweden)

    O'Driscoll B Ronan

    2006-06-01

    Full Text Available Abstract Background Different lung function equipment and different respiratory manoeuvres may produce different Peak Expiratory Flow (PEF results. Although the PEF is the most common lung function test, there have been few studies of these effects and no previous study has evaluated both factors in a single group of patients. Methods We studied 36 subjects (PEF range 80–570 l/min. All patients recorded PEF measurements using a short rapid expiration following maximal inspiration (PEF technique or a forced maximal expiration to residual volume (FVC technique. Measurements were made using a Wright's peak flow meter, a turbine spirometer and a Fleisch pneumotachograph spirometer. Results The mean PEF was 8.7% higher when the PEF technique was used (compared with FVC technique, p Conclusion Peak flow measurements are affected by the instruction given and by the device and Peak Flow scale used. Patient management decisions should not be based on PEF measurement made on different instruments.

  6. Periodic transmission peak splitting in one dimensional disordered photonic structures

    Science.gov (United States)

    Kriegel, Ilka; Scotognella, Francesco

    2016-08-01

    In the present paper we present ways to modulate the periodic transmission peaks arising in disordered one dimensional photonic structures with hundreds of layers. Disordered structures in which the optical length nd (n is the refractive index and d the layer thickness) is the same for each layer show regular peaks in their transmission spectra. A proper variation of the optical length of the layers leads to a splitting of the transmission peaks. Notably, the variation of the occurrence of high and low refractive index layers, gives a tool to tune also the width of the peaks. These results are of highest interest for optical application, such as light filtering, where the manifold of parameters allows a precise design of the spectral transmission ranges.

  7. Effects of peatland drainage management on peak flows

    OpenAIRE

    C. E. Ballard; N. McIntyre; H. S. Wheater

    2011-01-01

    Open ditch drainage has historically been a common land management practice in upland blanket peats, particularly in the UK. However, peatland drainage is now generally considered to have adverse effects on the upland environment, including increased peak flows. As a result, drain blocking has become a common management strategy in the UK over recent years, although there is only anecdotal evidence to suggest that this might decrease peak flows. The change in the hydrologica...

  8. Peak-load management, the security of supply warranty

    International Nuclear Information System (INIS)

    2010-01-01

    Even if France owns an efficient power generation park, largely exporting and clean (90% with no CO 2 emission), it encounters some difficulties during peak-load periods. The successive peak power demand records which are recorded each year represent as many alerts about a possible collapse of the power system. In order to warrant the electricity supply, the present day regulatory framework must be changed to allow the industrial players to carry out the necessary investments

  9. Improvements to science operations at Kitt Peak National Observatory

    Science.gov (United States)

    Bohannan, Bruce

    1998-07-01

    In recent years Kitt Peak National Observatory has undertaken a number of innovative projects to optimize science operations with the suite of telescopes we operate on Kitt Peak, Arizona. Changing scientific requirements and expectations of our users, evolving technology and declining budgets have motivated the changes. The operations improvements have included telescope performance enhancements--with the focus on the Mayall 4-m--modes of observing and scheduling, telescope control and observing systems, planning and communication, and data archiving.

  10. Several peaks of total current in Trichel pulse

    International Nuclear Information System (INIS)

    Bolotov, O.; Golota, V.; Kadolin, B.; Mankovskyi, S.; Ostroushko, V.; Pashchenko, I.; Taran, G.; Zavada, L.

    2015-01-01

    The numerical simulations of negative corona at constant voltage in Trichel pulse mode are carried out in assumptions of presence and absence of photoemission from cathode. In absence of photoemission two peaks of total current or the step before the main peak were obtained for very small values of ion-electron emission coefficient. In presence of photoemission there were observed several maximums, connected with instability development of the process based on radiation of photons, photoemission, and avalanche multiplication

  11. Converter for Measurement of non-sinusoidal current peak value

    DEFF Research Database (Denmark)

    Butvin, P.; Nielsen, Otto V; Brauer, Peter

    1997-01-01

    A linear-response toroid with core wound of rapidly quenched soft magnetic metallic ribbon and fitted with two windings is used to enable correct measurement of mean peak value of non-sinusoidal and not noise-free alternating current.......A linear-response toroid with core wound of rapidly quenched soft magnetic metallic ribbon and fitted with two windings is used to enable correct measurement of mean peak value of non-sinusoidal and not noise-free alternating current....

  12. Generation of narrow peaks in spectroscopy of charged particles

    Energy Technology Data Exchange (ETDEWEB)

    Dubbers, Dirk, E-mail: dubbers@physi.uni-heidelberg.de; Schmidt, Ulrich, E-mail: ulrich.schmidt@physi.uni-heidelberg.de

    2016-11-21

    In spectroscopy of charged particles, narrow peaks may appear in continuous spectra if magnetic transport of the particles is involved. These artefacts, which so far have escaped the attention of investigators, can develop whenever geometric detection efficiency is less than 100%. As such peaks may be misinterpreted as new physics, their generation is investigated, both analytically and experimentally, for various detector configurations, including those used in searches for the spontaneous decay of the vacuum in heavy-ion collisions.

  13. Modeling the probability distribution of peak discharge for infiltrating hillslopes

    Science.gov (United States)

    Baiamonte, Giorgio; Singh, Vijay P.

    2017-07-01

    Hillslope response plays a fundamental role in the prediction of peak discharge at the basin outlet. The peak discharge for the critical duration of rainfall and its probability distribution are needed for designing urban infrastructure facilities. This study derives the probability distribution, denoted as GABS model, by coupling three models: (1) the Green-Ampt model for computing infiltration, (2) the kinematic wave model for computing discharge hydrograph from the hillslope, and (3) the intensity-duration-frequency (IDF) model for computing design rainfall intensity. The Hortonian mechanism for runoff generation is employed for computing the surface runoff hydrograph. Since the antecedent soil moisture condition (ASMC) significantly affects the rate of infiltration, its effect on the probability distribution of peak discharge is investigated. Application to a watershed in Sicily, Italy, shows that with the increase of probability, the expected effect of ASMC to increase the maximum discharge diminishes. Only for low values of probability, the critical duration of rainfall is influenced by ASMC, whereas its effect on the peak discharge seems to be less for any probability. For a set of parameters, the derived probability distribution of peak discharge seems to be fitted by the gamma distribution well. Finally, an application to a small watershed, with the aim to test the possibility to arrange in advance the rational runoff coefficient tables to be used for the rational method, and a comparison between peak discharges obtained by the GABS model with those measured in an experimental flume for a loamy-sand soil were carried out.

  14. Peak oil: The four stages of a new idea

    Energy Technology Data Exchange (ETDEWEB)

    Bardi, Ugo [Dipartimento di Chimica, Universita di Firenze, Association for the Study of Peak Oil and Gas (ASPO), Polo Scientifico di Sesto Fiorentino, Via della Lastruccia 3, 50019 Sesto Fiorentino (Fi) (Italy)

    2009-03-15

    The present paper reviews the reactions and the path of acceptance of the theory known as ''peak oil''. The theory was proposed for the first time by M.K. Hubbert in the 1950s as a way to describe the production pattern of crude oil. According to Hubbert, the production curve is ''bell shaped'' and approximately symmetric. Hubbert's theory was verified with good approximation for the case of oil production in the United States that peaked in 1971, and is now being applied to the worldwide oil production. It is generally believed that the global peak of oil production (''peak oil'') will take place during the first decade of the 21st century, and some analysts believe that it has already occurred in 2005 or 2006. The theory and its consequences have unpleasant social and economical implications. The present paper is not aimed at assessing the peak date but offers a discussion on the factors that affect the acceptance and the diffusion of the concept of ''peak oil'' with experts and with the general public. The discussion is based on a subdivision of ''four stages of acceptance'', loosely patterned after a sentence by Thomas Huxley. (author)

  15. Peaking of world oil production: Impacts, mitigation, & risk management

    Energy Technology Data Exchange (ETDEWEB)

    Hirsch, R.L. (SAIC); Bezdek, Roger (MISI); Wendling, Robert (MISI)

    2005-02-01

    The peaking of world oil production presents the U.S. and the world with an unprecedented risk management problem. As peaking is approached, liquid fuel prices and price volatility will increase dramatically, and, without timely mitigation, the economic, social, and political costs will be unprecedented. Viable mitigation options exist on both the supply and demand sides, but to have substantial impact, they must be initiated more than a decade in advance of peaking.... The purpose of this analysis was to identify the critical issues surrounding the occurrence and mitigation of world oil production peaking. We simplified many of the complexities in an effort to provide a transparent analysis. Nevertheless, our study is neither simple nor brief. We recognize that when oil prices escalate dramatically, there will be demand and economic impacts that will alter our simplified assumptions. Consideration of those feedbacks will be a daunting task but one that should be undertaken. Our aim in this study is to-- • Summarize the difficulties of oil production forecasting; • Identify the fundamentals that show why world oil production peaking is such a unique challenge; • Show why mitigation will take a decade or more of intense effort; • Examine the potential economic effects of oil peaking; • Describe what might be accomplished under three example mitigation scenarios. • Stimulate serious discussion of the problem, suggest more definitive studies, and engender interest in timely action to mitigate its impacts.

  16. Peak energy consumption and CO2 emissions in China

    International Nuclear Information System (INIS)

    Yuan, Jiahai; Xu, Yan; Hu, Zheng; Zhao, Changhong; Xiong, Minpeng; Guo, Jingsheng

    2014-01-01

    China is in the processes of rapid industrialization and urbanization. Based on the Kaya identity, this paper proposes an analytical framework for various energy scenarios that explicitly simulates China's economic development, with a prospective consideration on the impacts of urbanization and income distribution. With the framework, China's 2050 energy consumption and associated CO 2 reduction scenarios are constructed. Main findings are: (1) energy consumption will peak at 5200–5400 million tons coal equivalent (Mtce) in 2035–2040; (2) CO 2 emissions will peak at 9200–9400 million tons (Mt) in 2030–2035, whilst it can be potentially reduced by 200–300 Mt; (3) China's per capita energy consumption and per capita CO 2 emission are projected to peak at 4 tce and 6.8 t respectively in 2020–2030, soon after China steps into the high income group. - Highlights: • A framework for modeling China's energy and CO 2 emissions is proposed. • Scenarios are constructed based on various assumptions on the driving forces. • Energy consumption will peak in 2035–2040 at 5200–5400 Mtce. • CO 2 emissions will peak in 2030–2035 at about 9300 Mt and be cut by 300 Mt in a cleaner energy path. • Energy consumption and CO 2 emissions per capita will peak soon after China steps into the high income group

  17. Whale Identification

    Science.gov (United States)

    1991-01-01

    R:BASE for DOS, a computer program developed under NASA contract, has been adapted by the National Marine Mammal Laboratory and the College of the Atlantic to provide and advanced computerized photo matching technique for identification of humpback whales. The program compares photos with stored digitized descriptions, enabling researchers to track and determine distribution and migration patterns. R:BASE is a spinoff of RIM (Relational Information Manager), which was used to store data for analyzing heat shielding tiles on the Space Shuttle Orbiter. It is now the world's second largest selling line of microcomputer database management software.

  18. PeakAnalyzer: Genome-wide annotation of chromatin binding and modification loci

    Directory of Open Access Journals (Sweden)

    Tammoja Kairi

    2010-08-01

    Full Text Available Abstract Background Functional genomic studies involving high-throughput sequencing and tiling array applications, such as ChIP-seq and ChIP-chip, generate large numbers of experimentally-derived signal peaks across the genome under study. In analyzing these loci to determine their potential regulatory functions, areas of signal enrichment must be considered relative to proximal genes and regulatory elements annotated throughout the target genome Regions of chromatin association by transcriptional regulators should be distinguished as individual binding sites in order to enhance downstream analyses, such as the identification of known and novel consensus motifs. Results PeakAnalyzer is a set of high-performance utilities for the automated processing of experimentally-derived peak regions and annotation of genomic loci. The programs can accurately subdivide multimodal regions of signal enrichment into distinct subpeaks corresponding to binding sites or chromatin modifications, retrieve genomic sequences encompassing the computed subpeak summits, and identify positional features of interest such as intersection with exon/intron gene components, proximity to up- or downstream transcriptional start sites and cis-regulatory elements. The software can be configured to run either as a pipeline component for high-throughput analyses, or as a cross-platform desktop application with an intuitive user interface. Conclusions PeakAnalyzer comprises a number of utilities essential for ChIP-seq and ChIP-chip data analysis. High-performance implementations are provided for Unix pipeline integration along with a GUI version for interactive use. Source code in C++ and Java is provided, as are native binaries for Linux, Mac OS X and Windows systems.

  19. [Identification of irradiated abalone by ESR spectroscopy].

    Science.gov (United States)

    Song, Yeping; Wang, Chuanxian; Yang, Zhenyu; Zhong, Weike; Geng, Jinpei; Lu, Di; Ding, Zhuoping

    2012-05-01

    To establish an analytical method for the detection and identification of irradiated abalone by electron spin resonance spectroscopy. Electron spin resonance (ESR) was used to study the spectral characteristics of abalone and the characteristic peak for quantitation. There were obvious different ESR spectra between unirradiated and irradiated abalone. The g factor for unirradiated abalone was 2.0055-2.0060, the g1 and g2 factor for irradiated abalone were (2.0027 +/- 0.0001) and (1.9994 +/- 0.0001), respectively. The ESR signal intensity of characteristic peak was positively correlated with absorbed dose in the range of 0.5 - 10 kGy, left peak was the characteristic peak for quantitation and the detection limit was abalone. ESR spectroscopy is an effective method to determine whether the abalone being irradiated or not.

  20. Simultaneous collection method of on-peak window image and off-peak window image in Tl-201 imaging

    International Nuclear Information System (INIS)

    Murakami, Tomonori; Noguchi, Yasushi; Kojima, Akihiro; Takagi, Akihiro; Matsumoto, Masanori

    2007-01-01

    Tl-201 imaging detects the photopeak (71 keV, in on-peak window) of characteristic X-rays of Hg-201 formed from Tl-201 decay. The peak is derived from 4 rays of different energy and emission intensity and does not follow in Gaussian distribution. In the present study, authors made an idea for the method in the title to attain the more effective single imaging, which was examined for its accuracy and reliability with phantoms and applied clinically to Tl-201 scintigraphy in a patient. The authors applied the triple energy window method for data acquisition: the energy window setting was made on Hg-201 X-rays photopeak in three of the lower (3%, L), main (72 keV, M) and upper (14%, U) windows with the gamma camera with 2-gated detector (Toshiba E. CAM/ICON). L, M and U images obtained simultaneously were then constructed to images of on-peak (L+M, Mock on-peak) and off-peak (M+U) window settings for evaluation. Phantoms for line source with Tl-201-containing swab and for multi-defect with acrylic plate containing Tl-201 solution were imaged in water. The female patient with thyroid cancer was subjected to preoperative scintigraphy under the defined conditions. Mock on-, off-peak images were found to be equivalent to the true (ordinary, clinical) on-, off-peak ones, and the present method was thought usable for evaluation of usefulness of off-peak window data. (R.T.)

  1. Automatic fitting of Gaussian peaks using abductive machine learning

    Science.gov (United States)

    Abdel-Aal, R. E.

    1998-02-01

    Analytical techniques have been used for many years for fitting Gaussian peaks in nuclear spectroscopy. However, the complexity of the approach warrants looking for machine-learning alternatives where intensive computations are required only once (during training), while actual analysis on individual spectra is greatly simplified and quickened. This should allow the use of simple portable systems for fast and automated analysis of large numbers of spectra, particularly in situations where accuracy may be traded for speed and simplicity. This paper proposes the use of abductive networks machine learning for this purpose. The Abductory Induction Mechanism (AIM) tool was used to build models for analyzing both single and double Gaussian peaks in the presence of noise depicting statistical uncertainties in collected spectra. AIM networks were synthesized by training on 1000 representative simulated spectra and evaluated on 500 new spectra. A classifier network determines the multiplicity of single/double peaks with an accuracy of 5.8%. With statistical uncertainties corresponding to a peak count of 100, average percentage absolute errors for the height, position, and width of single peaks are 4.9, 2.9, and 4.2%, respectively. For double peaks, these average errors are within 7.0, 3.1, and 5.9%, respectively. Models have been developed which account for the effect of a linear background on a single peak. Performance is compared with a neural network application and with an analytical curve-fitting routine, and the new technique is applied to actual data of an alpha spectrum.

  2. The duration of pubertal growth peak among three skeletal classes

    Directory of Open Access Journals (Sweden)

    Waqar Jeelani

    Full Text Available ABSTRACT Introduction: Pubertal growth peak is closely associated with a rapid increase in mandibular length and offers a wide range of therapeutic modifiability. Objective: The aim of the present study was to determine and compare the mean ages of onset and duration of pubertal growth peak among three skeletal classes. Methods: A retrospective cross-sectional study was conducted using lateral cephalograms of 230 subjects with growth potential (110 males, 120 females. Subjects were categorized into three classes (Class I = 81, Class II = 82, Class III = 67, according to the sagittal relationship established between the maxilla and the mandible. The cervical vertebral maturation stage was recorded by means of Baccetti's method. The mean ages at CS3 and CS4 and the CS3-CS4 age interval were compared between boys and girls and among three skeletal classes. Results: Pubertal growth peak occurred on average four months earlier in girls than boys (p = 0.050. The average duration of pubertal growth peak was 11 months in Class I, seven months in Class II and 17 months in Class III subjects. Interclass differences were highly significant (Cohen's d > 0.08. However, no significant difference was found in the timing of pubertal growth peak onset among three skeletal classes (p = 0.126 in boys, p = 0.262 in girls. Conclusions: Girls enter pubertal growth peak on average four months earlier than boys. Moreover, the duration of pubertal growth peak is on average four months shorter in Class II and six months longer in Class III subjects as compared to Class I subjects.

  3. Peak Operation of Cascaded Hydropower Plants Serving Multiple Provinces

    Directory of Open Access Journals (Sweden)

    Jianjian Shen

    2015-10-01

    Full Text Available The bulk hydropower transmission via trans-provincial and trans-regional power networks in China provides great operational flexibility to dispatch power resources between multiple power grids. This is very beneficial to alleviate the tremendous peak load pressure of most provincial power grids. This study places the focus on peak operations of cascaded hydropower plants serving multiple provinces under a regional connected AC/DC network. The objective is to respond to peak loads of multiple provincial power grids simultaneously. A two-stage search method is developed for this problem. In the first stage, a load reconstruction strategy is proposed to combine multiple load curves of power grids into a total load curve. The purpose is to deal with different load features in load magnitudes, peaks and valleys. A mutative-scale optimization method is then used to determine the generation schedules of hydropower plants. In the second stage, an exterior point search method is established to allocate the generation among multiple receiving power grids. This method produces an initial solution using the load shedding algorithm, and further improves it by iteratively coordinating the generation among different power grids. The proposed method was implemented to the operations of cascaded hydropower plants on Xin-Fu River and another on Hongshui River. The optimization results in two cases satisfied the peak demands of receiving provincial power grids. Moreover, the maximum load difference between peak and valley decreased 12.67% and 11.32% in Shanghai Power Grid (SHPG and Zhejiang Power Grid (ZJPG, exceeding by 4.85% and 6.72% those of the current operational method, respectively. The advantage of the proposed method in alleviating peak-shaving pressure is demonstrated.

  4. Superoxide dismutase levels and peak expiratory flow in asthmatic children

    Directory of Open Access Journals (Sweden)

    Arie Kurniasih

    2016-11-01

    Full Text Available Background Asthma is a chronic inflammatory process which involve variety of cells such as inflammatory mediators, reactive oxygen species (ROS, and cytokines. The inflammatory process would be exacerbated in the presence of oxidative stress. Superoxide dismutase (SOD is the first important enzyme to protect the respiratory tract against oxidative stress. The decreased of SOD has a correlation with increased of airway obstruction and bronchospasm. Objective To assess for a correlation between superoxide dismutase (SOD levels and peak expiratory flow, as well as to determine the impact of SOD levels for predicting asthma attacks. Methods We conducted a prospective cohort study at Dr. Sardjito Hospital, Yogyakarta, between February and April 2011 involving asthmatic children aged 5-18 years. Subjects’ serum SOD levels and peak expiratory flow were measured at the same time point. We then performed a prospective study following up on the same subjects to find out if they had a recurrent asthma attack within one month of the tests. We also reassessed their peak expiratory flow one month after blood specimens were obtained. Results Thirty-nine patients were enrolled in this study. There was no significant correlation between SOD level and peak expiratory flow [r=0.289; 95%CI -0.025 to 0.47; P=0.074]. However, older age was significantly associated with higher peak expiratory flow (=0.5; 95%CI 3.10 to 11.57; P=0.01. Lower levels of SOD increased the risk of asthma attacks in a month following the initial measurements (RR=5.5; 95%CI 1.6 to 18.9; P=0.009. Conclusion Superoxide dismutase (SOD level is not significantly associated with peak expiratory flow. However, we find a relationship between older age and higher peak expiratory flow and a relationship between lower SOD levels and risk of asthma attacks within one month following the tests.

  5. Managing peak loads in energy grids: Comparative economic analysis

    International Nuclear Information System (INIS)

    Zhuk, A.; Zeigarnik, Yu.; Buzoverov, E.; Sheindlin, A.

    2016-01-01

    One of the key issues in modern energy technology is managing the imbalance between the generated power and the load, particularly during times of peak demand. The increasing use of renewable energy sources makes this problem even more acute. Various existing technologies, including stationary battery energy storage systems (BESS), can be employed to provide additional power during peak demand times. In the future, integration of on-board batteries of the growing fleet of electric vehicles (EV) and plug-in hybrid electric vehicles (PHEV) into the grid can provide power during peak demand hours (vehicle-to-grid, or V2G technology). This work provides cost estimates of managing peak energy demands using traditional technologies, such as maneuverable power plants, conventional hydroelectric, pumped storage plants and peaker generators, as well as BESS and V2G technologies. The derived estimates provide both per kWh and kW year of energy supplied to the grid. The analysis demonstrates that the use of battery storage is economically justified for short peak demand periods of <1 h. For longer durations, the most suitable technology remains the use of maneuverable steam gas power plants, gas turbine,reciprocating gas engine peaker generators, conventional hydroelectric, pumped storage plants. - Highlights: • Cost of managing peak energy demand employing different technologies are estimated. • Traditional technologies, stationary battery storage and V2G are compared. • Battery storage is economically justified for peak demand periods of <1 h. • V2G appears to have better efficiency than stationary battery storage in low voltage power grids.

  6. Automatic fitting of Gaussian peaks using abductive machine learning

    International Nuclear Information System (INIS)

    Abdel-Aal, R.E.

    1998-01-01

    Analytical techniques have been used for many years for fitting Gaussian peaks in nuclear spectroscopy. However, the complexity of the approach warrants looking for machine-learning alternatives where intensive computations are required only once (during training), while actual analysis on individual spectra is greatly simplified and quickened. This should allow the use of simple portable systems for fast and automated analysis of large numbers of spectra, particularly in situations where accuracy may be traded for speed and simplicity. This paper proposes the use of abductive networks machine learning for this purpose. The Abductory Induction Mechanism (AIM) tool was used to build models for analyzing both single and double Gaussian peaks in the presence of noise depicting statistical uncertainties in collected spectra. AIM networks were synthesized by training on 1,000 representative simulated spectra and evaluated on 500 new spectra. A classifier network determines the multiplicity of single/double peaks with an accuracy of 98%. With statistical uncertainties corresponding to a peak count of 100, average percentage absolute errors for the height, position, and width of single peaks are 4.9, 2.9, and 4.2%, respectively. For double peaks, these average errors are within 7.0, 3.1, and 5.9%, respectively. Models have been developed which account for the effect of a linear background on a single peak. Performance is compared with a neural network application and with an analytical curve-fitting routine, and the new technique is applied to actual data of an alpha spectrum

  7. flowPeaks: a fast unsupervised clustering for flow cytometry data via K-means and density peak finding.

    Science.gov (United States)

    Ge, Yongchao; Sealfon, Stuart C

    2012-08-01

    For flow cytometry data, there are two common approaches to the unsupervised clustering problem: one is based on the finite mixture model and the other on spatial exploration of the histograms. The former is computationally slow and has difficulty to identify clusters of irregular shapes. The latter approach cannot be applied directly to high-dimensional data as the computational time and memory become unmanageable and the estimated histogram is unreliable. An algorithm without these two problems would be very useful. In this article, we combine ideas from the finite mixture model and histogram spatial exploration. This new algorithm, which we call flowPeaks, can be applied directly to high-dimensional data and identify irregular shape clusters. The algorithm first uses K-means algorithm with a large K to partition the cell population into many small clusters. These partitioned data allow the generation of a smoothed density function using the finite mixture model. All local peaks are exhaustively searched by exploring the density function and the cells are clustered by the associated local peak. The algorithm flowPeaks is automatic, fast and reliable and robust to cluster shape and outliers. This algorithm has been applied to flow cytometry data and it has been compared with state of the art algorithms, including Misty Mountain, FLOCK, flowMeans, flowMerge and FLAME. The R package flowPeaks is available at https://github.com/yongchao/flowPeaks. yongchao.ge@mssm.edu Supplementary data are available at Bioinformatics online.

  8. Analysis of Peak-to-Peak Current Ripple Amplitude in Seven-Phase PWM Voltage Source Inverters

    Directory of Open Access Journals (Sweden)

    Gabriele Grandi

    2013-08-01

    Full Text Available Multiphase systems are nowadays considered for various industrial applications. Numerous pulse width modulation (PWM schemes for multiphase voltage source inverters with sinusoidal outputs have been developed, but no detailed analysis of the impact of these modulation schemes on the output peak-to-peak current ripple amplitude has been reported. Determination of current ripple in multiphase PWM voltage source inverters is important for both design and control purposes. This paper gives the complete analysis of the peak-to-peak current ripple distribution over a fundamental period for multiphase inverters, with particular reference to seven-phase VSIs. In particular, peak-to-peak current ripple amplitude is analytically determined as a function of the modulation index, and a simplified expression to get its maximum value is carried out. Although reference is made to the centered symmetrical PWM, being the most simple and effective solution to maximize the DC bus utilization, leading to a nearly-optimal modulation to minimize the RMS of the current ripple, the analysis can be readily extended to either discontinuous or asymmetrical modulations, both carrier-based and space vector PWM. A similar approach can be usefully applied to any phase number. The analytical developments for all different sub-cases are verified by numerical simulations.

  9. Explanation of the surface peak in charge integrated LEIS spectra

    CERN Document Server

    Draxler, M; Taglauer, E; Schmid, K; Gruber, R; Ermolov, S N; Bauer, P

    2003-01-01

    Low energy ion scattering is very surface sensitive if scattered ions are analyzed. By time-of-flight (TOF) techniques, also neutral and charge integrated spectra (ions plus neutrals) can be obtained, which yield information about deeper layers. In the literature, the observation of a more or less pronounced surface peak was reported for charge integrated spectra, the intensity of the surface peak being higher at low energies and for heavy projectiles. Aiming at a more profound physical understanding of this surface peak, we performed TOF-experiments and computer simulations for He projectiles and a copper target. Experiments were done in the range 1-9 keV for a scattering angle of 129 deg. . The simulation was performed using the MARLOWE code for the given experimental parameters and a polycrystalline target. At low energies, a pronounced surface peak was observed, which fades away at higher energies. This peak is quantitatively reproduced by the simulation, and corresponds to scattering from approx 2 atomic...

  10. PEAK SHIFTS PRODUCED BY CORRELATED RESPONSE TO SELECTION.

    Science.gov (United States)

    Price, Trevor; Turelli, Michael; Slatkin, Montgomery

    1993-02-01

    Traits may evolve both as a consequence of direct selection and also as a correlated response to selection on other traits. While correlated response may be important for both the production of evolutionary novelty and in the build-up of complex characters, its potential role in peak shifts has been neglected empirically and theoretically. We use a quantitative genetic model to investigate the conditions under which a character, Y, which has two alternative optima, can be dragged from one optimum to the other as a correlated response to selection on a second character, X. High genetic correlations between the two characters make the transition, or peak shift, easier, as does weak selection tending to restore Y to the optimum from which it is being dragged. When selection on Y is very weak, the conditions for a peak shift depend only on the location of the new optimum for X and are independent of the strength of selection moving it there. Thus, if the "adaptive valley" for Y is very shallow, little reduction in mean fitness is needed to produce a shift. If the selection acts strongly to keep Y at its current optimum, very intense directional selection on X, associated with a dramatic drop in mean fitness, is required for a peak shift. When strong selection is required, the conditions for peak shifts driven by correlated response might occur rarely, but still with sufficient frequency on a geological timescale to be evolutionarily important. © 1993 The Society for the Study of Evolution.

  11. Pediatric Exercise Testing: Value and Implications of Peak Oxygen Uptake

    Directory of Open Access Journals (Sweden)

    Paolo T. Pianosi

    2017-01-01

    Full Text Available Peak oxygen uptake (peak V ˙ O 2 measured by clinical exercise testing is the benchmark for aerobic fitness. Aerobic fitness, estimated from maximal treadmill exercise, is a predictor of mortality in adults. Peak V ˙ O 2 was shown to predict longevity in patients aged 7–35 years with cystic fibrosis over 25 years ago. A surge of exercise studies in young adults with congenital heart disease over the past decade has revealed significant prognostic information. Three years ago, the first clinical trial in children with pulmonary arterial hypertension used peak V ˙ O 2 as an endpoint that likewise delivered clinically relevant data. Cardiopulmonary exercise testing provides clinicians with biomarkers and clinical outcomes, and researchers with novel insights into fundamental biological mechanisms reflecting an integrated physiological response hidden at rest. Momentum from these pioneering observations in multiple disease states should impel clinicians to employ similar methods in other patient populations; e.g., sickle cell disease. Advances in pediatric exercise science will elucidate new pathways that may identify novel biomarkers. Our initial aim of this essay is to highlight the clinical relevance of exercise testing to determine peak V ˙ O 2 , and thereby convince clinicians of its merit, stimulating future clinical investigators to broaden the application of exercise testing in pediatrics.

  12. Effects of peatland drainage management on peak flows

    Directory of Open Access Journals (Sweden)

    C. E. Ballard

    2012-07-01

    Full Text Available Open ditch drainage has historically been a common land management practice in upland blanket peats, particularly in the UK. However, peatland drainage is now generally considered to have adverse effects on the upland environment, including increased peak flows. As a result, drain blocking has become a common management strategy in the UK over recent years, although there is only anecdotal evidence to suggest that this might decrease peak flows. The change in the hydrological regime associated with the drainage of blanket peat and the subsequent blocking of drains is poorly understood, therefore a new physics-based model has been developed that allows the exploration of the associated hydrological processes. A series of simulations is used to explore the response of intact, drained and blocked drain sites at field scales. While drainage is generally found to increase peak flows, the effect of drain blocking appears to be dependent on local conditions, sometimes decreasing and sometimes increasing peak flows. Based on insights from these simulations we identify steep smooth drains as those that would experience the greatest reduction in field-scale peak flows if blocked and recommend that future targeted field studies should be focused on examining surface runoff characteristics.

  13. Group Elevator Peak Scheduling Based on Robust Optimization Model

    Directory of Open Access Journals (Sweden)

    ZHANG, J.

    2013-08-01

    Full Text Available Scheduling of Elevator Group Control System (EGCS is a typical combinatorial optimization problem. Uncertain group scheduling under peak traffic flows has become a research focus and difficulty recently. RO (Robust Optimization method is a novel and effective way to deal with uncertain scheduling problem. In this paper, a peak scheduling method based on RO model for multi-elevator system is proposed. The method is immune to the uncertainty of peak traffic flows, optimal scheduling is realized without getting exact numbers of each calling floor's waiting passengers. Specifically, energy-saving oriented multi-objective scheduling price is proposed, RO uncertain peak scheduling model is built to minimize the price. Because RO uncertain model could not be solved directly, RO uncertain model is transformed to RO certain model by elevator scheduling robust counterparts. Because solution space of elevator scheduling is enormous, to solve RO certain model in short time, ant colony solving algorithm for elevator scheduling is proposed. Based on the algorithm, optimal scheduling solutions are found quickly, and group elevators are scheduled according to the solutions. Simulation results show the method could improve scheduling performances effectively in peak pattern. Group elevators' efficient operation is realized by the RO scheduling method.

  14. Energy Saving by Chopping off Peak Demand Using Day Light

    Directory of Open Access Journals (Sweden)

    Ashok Kumar Maitra

    2011-08-01

    Full Text Available An artificial intelligent technique has been implemented in this research using real time datas to calculate how much energy can be chopped from peak load demand. The results are based on real time data that are taken from power delivering centers. These datas do reflect the present condition of power and a solution to those critical conditions during the peak period. These are done in such a way such that helps in judicious scheduling of load. The time based load scheduling has been done so as to understand the basic criteria for solving power crisis during morning peak and early evening peak. The sunray availability and percentage of load that will use day light saving (DLS technique has been taken into account in this work. The results shows that about 0.5% to 1% of load can be shedded off from the peak load period which otherwise is reduction of power. Thus it otherwise also means that an equivalent amount of energy is saved which amounts to a large saving of national money. This result is obtained on monthly and even daily basis. Thus this paper justifies DLS gives a new renewable technique to save energy.

  15. Enhanced vegetation growth peak and its key mechanisms

    Science.gov (United States)

    Huang, K.; Xia, J.; Wang, Y.; Ahlström, A.; Schwalm, C.; Huntzinger, D. N.; Chen, J.; Cook, R. B.; Fang, Y.; Fisher, J. B.; Jacobson, A. R.; Michalak, A.; Schaefer, K. M.; Wei, Y.; Yan, L.; Luo, Y.

    2017-12-01

    It remains unclear that whether and how the vegetation growth peak has been shifted globally during the past three decades. Here we used two global datasets of gross primary productivity (GPP) and a satellite-derived Normalized Difference Vegetation Index (NDVI) to characterize recent changes in seasonal peak vegetation growth. The attribution of changes in peak growth to their driving factors was examined with several datasets. We demonstrated that the growth peak of global vegetation has been linearly increasing during the past three decades. About 65% of this trend is evenly explained by the expanding croplands (21%), rising atmospheric [CO2] (22%), and intensifying nitrogen deposition (22%). The contribution of expanding croplands to the peak growth trend was substantiated by measurements from eddy-flux towers, sun-induced chlorophyll fluorescence and a global database of plant traits, all of which demonstrated that croplands have a higher photosynthetic capacity than other vegetation types. The contribution of rising atmospheric [CO2] and nitrogen deposition are consistent with the positive response of leaf growth to elevated [CO2] (25%) and nitrogen addition (8%) from 346 manipulated experiments. The positive effect of rising atmospheric [CO2] was also well captured by 15 terrestrial biosphere models. However, most models underestimated the contributions of land-cover change and nitrogen deposition, but overestimated the positive effect of climate change.

  16. Non-Gaussian bias: insights from discrete density peaks

    CERN Document Server

    Desjacques, Vincent; Riotto, Antonio

    2013-01-01

    Corrections induced by primordial non-Gaussianity to the linear halo bias can be computed from a peak-background split or the widespread local bias model. However, numerical simulations clearly support the prediction of the former, in which the non-Gaussian amplitude is proportional to the linear halo bias. To understand better the reasons behind the failure of standard Lagrangian local bias, in which the halo overdensity is a function of the local mass overdensity only, we explore the effect of a primordial bispectrum on the 2-point correlation of discrete density peaks. We show that the effective local bias expansion to peak clustering vastly simplifies the calculation. We generalize this approach to excursion set peaks and demonstrate that the resulting non-Gaussian amplitude, which is a weighted sum of quadratic bias factors, precisely agrees with the peak-background split expectation, which is a logarithmic derivative of the halo mass function with respect to the normalisation amplitude. We point out tha...

  17. Rotational and peak torque stiffness of rugby shoes.

    Science.gov (United States)

    Ballal, Moez S; Usuelli, Federico Giuseppe; Montrasio, Umberto Alfieri; Molloy, Andy; La Barbera, Luigi; Villa, Tomaso; Banfi, Giuseppe

    2014-09-01

    Sports people always strive to avoid injury. Sports shoe designs in many sports have been shown to affect traction and injury rates. The aim of this study is to demonstrate the differing stiffness and torque in rugby boots that are designed for the same effect. Five different types of rugby shoes commonly worn by scrum forwards were laboratory tested for rotational stiffness and peak torque on a natural playing surface generating force patterns that would be consistent with a rugby scrum. The overall internal rotation peak torque was 57.75±6.26 Nm while that of external rotation was 56.55±4.36 Nm. The Peak internal and external rotational stiffness were 0.696±0.1 and 0.708±0.06 Nm/deg respectively. Our results, when compared to rotational stiffness and peak torques of football shoes published in the literature, show that shoes worn by rugby players exert higher rotational and peak torque stiffness compared to football shoes when tested on the same natural surfaces. There was significant difference between the tested rugby shoes brands. In our opinion, to maximize potential performance and lower the potential of non-contact injury, care should be taken in choosing boots with stiffness appropriate to the players main playing role. Copyright © 2014 Elsevier Ltd. All rights reserved.

  18. Accuracy of portable devices in measuring peak cough flow

    International Nuclear Information System (INIS)

    Kulnik, Stefan Tino; Kalra, Lalit; MacBean, Victoria; Birring, Surinder Singh; Moxham, John; Rafferty, Gerrard Francis

    2015-01-01

    Peak cough flow (PCF) measurements can be used as indicators of cough effectiveness. Portable peak flow meters and spirometers have been used to measure PCF, but little is known about their accuracy compared to pneumotachograph systems. The aim of this study was to compare the accuracy of four portable devices (Mini–Wright and Assess peak flow meters, SpiroUSB and Microlab spirometers) in measuring PCF with a calibrated laboratory based pneumotachograph system. Twenty healthy volunteers (mean (SD) age 45 (16) years) coughed through a pneumotachograph connected in series with each portable device in turn, and the differences in PCF readings were analysed. In addition, mechanically generated flow waves of constant peak flow were delivered through each device both independently and when connected in series with the pneumotachograph. Agreement between PCF readings obtained with the pneumotachograph and the portable devices was poor. Peak flow readings were on average lower by approximately 50 L min −1 when measured using the portable devices; 95% limits of agreement spanned approximately 150 L min −1 . The findings highlight the potential for inaccuracy when using portable devices for the measurement of PCF. Depending on the measurement instrument used, absolute values of PCF reported in the literature may not be directly comparable. (paper)

  19. Variable threshold method for ECG R-peak detection.

    Science.gov (United States)

    Kew, Hsein-Ping; Jeong, Do-Un

    2011-10-01

    In this paper, a wearable belt-type ECG electrode worn around the chest by measuring the real-time ECG is produced in order to minimize the inconvenient in wearing. ECG signal is detected using a potential instrument system. The measured ECG signal is transmits via an ultra low power consumption wireless data communications unit to personal computer using Zigbee-compatible wireless sensor node. ECG signals carry a lot of clinical information for a cardiologist especially the R-peak detection in ECG. R-peak detection generally uses the threshold value which is fixed. There will be errors in peak detection when the baseline changes due to motion artifacts and signal size changes. Preprocessing process which includes differentiation process and Hilbert transform is used as signal preprocessing algorithm. Thereafter, variable threshold method is used to detect the R-peak which is more accurate and efficient than fixed threshold value method. R-peak detection using MIT-BIH databases and Long Term Real-Time ECG is performed in this research in order to evaluate the performance analysis.

  20. Statistical analysis of the low-temperature dislocation peak of internal friction (Bordoni peak) in nanostructured copper

    International Nuclear Information System (INIS)

    Vatazhuk, E.N.; Natsik, V.D.

    2011-01-01

    The temperature-frequency dependence of internal friction in the nanostructured samples of Cu and fibred composite C-32 vol.%Nb with the sizes of structure fragments approx 200 nm is analyzed. Experiments are used as initial information for such analysis. The characteristic for the heavily deformed copper Bordoni peak, located nearby a temperature 90 K, was recorded on temperature dependence of vibration decrement (frequencies 73-350 kHz) in previous experiments. The peak is due to the resonance interaction of sound with the system of thermal activated relaxators, and its width considerably greater in comparison with the width of standard internal friction peak with the single relaxation time. Statistical analysis of the peak is made in terms of assumption that the reason of broadening is random activation energy dispersion of relaxators as a result of intense distortion of copper crystal structure. Good agreement of experimental data and Seeger theory considers thermal activated paired kinks at linear segments of dislocation lines, placed in potential Peierls relief valley, as relaxators of Bordoni peak, was established. It is shown that the registered peak height in experiment correspond to presence at the average one dislocation segment in the interior of crystalline grain with size of 200 nm. Empirical estimates for the critical Peierls stress σp ∼ 2x10 7 Pa and integrated density of the interior grain dislocations ρ d ∼ 10 13 m -2 are made. Nb fibers in the composite Cu-Nb facilitate to formation of nanostructured copper, but do not influence evidently on the Bordoni peak.

  1. An internal friction peak caused by hydrogen in maraging steel

    International Nuclear Information System (INIS)

    Usui, Makoto; Asano, Shigeru

    1996-01-01

    Internal friction in hydrogen-charged iron and steel has so far been studied by a large number of investigators. For pure iron, a well-defined peak of internal friction has been observed under the cold-worked and hydrogen-charged conditions. This is called the hydrogen cold-work peak, or the Snoek-Koester relaxation, which originates from the hydrogen-dislocation interaction. In the present study, a high-strength maraging steel (Fe-18Ni-9Co-5Mo) was chosen as another high-alloy steel which is known to be very susceptible to hydrogen embrittlement. The purpose of this paper is to show a new internal friction peak caused by hydrogen in the maraging steel and to compare it with those found in stainless steels which have so far been studied as typical engineering high-alloy materials

  2. Electron-electron Thomas peak in fast transfer ionization

    International Nuclear Information System (INIS)

    Tolmanov, S. G.; McGuire, J. H.

    2000-01-01

    ''Thomas process'' is a name used for a family of singular two-step processes that can lead to electron transfer. The Thomas process of the ''second kind,'' occurring in reactions with both transfer and ionization, utilizes the e-e scattering in the second step, so this Thomas process requires the dynamics of the electron-electron interaction. We calculate numerically the second order element of an S matrix and corresponding cross sections for the transfer ionization process. We find that the position and shape of the Thomas peak depend on both electron-electron and the electron-nucleus interaction. Also the direct and exchange amplitudes are equal at the peak position. We test the peaking approximation used for transfer ionization. Our results can be compared to experimental results for p + +He→H+He 2+ +e - . (c) 2000 The American Physical Society

  3. Distribution network planning method considering distributed generation for peak cutting

    International Nuclear Information System (INIS)

    Ouyang Wu; Cheng Haozhong; Zhang Xiubin; Yao Liangzhong

    2010-01-01

    Conventional distribution planning method based on peak load brings about large investment, high risk and low utilization efficiency. A distribution network planning method considering distributed generation (DG) for peak cutting is proposed in this paper. The new integrated distribution network planning method with DG implementation aims to minimize the sum of feeder investments, DG investments, energy loss cost and the additional cost of DG for peak cutting. Using the solution techniques combining genetic algorithm (GA) with the heuristic approach, the proposed model determines the optimal planning scheme including the feeder network and the siting and sizing of DG. The strategy for the site and size of DG, which is based on the radial structure characteristics of distribution network, reduces the complexity degree of solving the optimization model and eases the computational burden substantially. Furthermore, the operation schedule of DG at the different load level is also provided.

  4. On dealing with multiple correlation peaks in PIV

    Science.gov (United States)

    Masullo, A.; Theunissen, R.

    2018-05-01

    A novel algorithm to analyse PIV images in the presence of strong in-plane displacement gradients and reduce sub-grid filtering is proposed in this paper. Interrogation windows subjected to strong in-plane displacement gradients often produce correlation maps presenting multiple peaks. Standard multi-grid procedures discard such ambiguous correlation windows using a signal to noise (SNR) filter. The proposed algorithm improves the standard multi-grid algorithm allowing the detection of splintered peaks in a correlation map through an automatic threshold, producing multiple displacement vectors for each correlation area. Vector locations are chosen by translating images according to the peak displacements and by selecting the areas with the strongest match. The method is assessed on synthetic images of a boundary layer of varying intensity and a sinusoidal displacement field of changing wavelength. An experimental case of a flow exhibiting strong velocity gradients is also provided to show the improvements brought by this technique.

  5. Correlation Filter Learning Toward Peak Strength for Visual Tracking.

    Science.gov (United States)

    Sui, Yao; Wang, Guanghui; Zhang, Li

    2018-04-01

    This paper presents a novel visual tracking approach to correlation filter learning toward peak strength of correlation response. Previous methods leverage all features of the target and the immediate background to learn a correlation filter. Some features, however, may be distractive to tracking, like those from occlusion and local deformation, resulting in unstable tracking performance. This paper aims at solving this issue and proposes a novel algorithm to learn the correlation filter. The proposed approach, by imposing an elastic net constraint on the filter, can adaptively eliminate those distractive features in the correlation filtering. A new peak strength metric is proposed to measure the discriminative capability of the learned correlation filter. It is demonstrated that the proposed approach effectively strengthens the peak of the correlation response, leading to more discriminative performance than previous methods. Extensive experiments on a challenging visual tracking benchmark demonstrate that the proposed tracker outperforms most state-of-the-art methods.

  6. Gnevyshev peaks in solar radio emissions at different frequencies

    Directory of Open Access Journals (Sweden)

    R. P. Kane

    2009-04-01

    Full Text Available Sunspots have a major 11-year cycle, but the years near the sunspot maximum show two or more peaks called GP (Gnevyshev Peaks. In this communication, it was examined whether these peaks in sunspots are reflected in other parameters such as Lyman-α (the chromospheric emission 121.6 nm, radio emissions 242–15 400 MHz emanating from altitude levels 2000–12 000 km, the low latitude (+45° to −45° solar open magnetic flux and the coronal green line emission (Fe XIV, 530.3 nm. In the different solar cycles 20–23, the similarity extended at least upto the level of 609 MHz, but in cycle 22, the highest level was of 242 MHz. The extension to the higher level in cycle 22 does not seem to be related to the cycle strength Rz(max, or to the cycle length.

  7. Order Tracking Based on Robust Peak Search Instantaneous Frequency Estimation

    International Nuclear Information System (INIS)

    Gao, Y; Guo, Y; Chi, Y L; Qin, S R

    2006-01-01

    Order tracking plays an important role in non-stationary vibration analysis of rotating machinery, especially to run-up or coast down. An instantaneous frequency estimation (IFE) based order tracking of rotating machinery is introduced. In which, a peak search algorithms of spectrogram of time-frequency analysis is employed to obtain IFE of vibrations. An improvement to peak search is proposed, which can avoid strong non-order components or noises disturbing to the peak search work. Compared with traditional methods of order tracking, IFE based order tracking is simplified in application and only software depended. Testing testify the validity of the method. This method is an effective supplement to traditional methods, and the application in condition monitoring and diagnosis of rotating machinery is imaginable

  8. Bayesian Peptide Peak Detection for High Resolution TOF Mass Spectrometry.

    Science.gov (United States)

    Zhang, Jianqiu; Zhou, Xiaobo; Wang, Honghui; Suffredini, Anthony; Zhang, Lin; Huang, Yufei; Wong, Stephen

    2010-11-01

    In this paper, we address the issue of peptide ion peak detection for high resolution time-of-flight (TOF) mass spectrometry (MS) data. A novel Bayesian peptide ion peak detection method is proposed for TOF data with resolution of 10 000-15 000 full width at half-maximum (FWHW). MS spectra exhibit distinct characteristics at this resolution, which are captured in a novel parametric model. Based on the proposed parametric model, a Bayesian peak detection algorithm based on Markov chain Monte Carlo (MCMC) sampling is developed. The proposed algorithm is tested on both simulated and real datasets. The results show a significant improvement in detection performance over a commonly employed method. The results also agree with expert's visual inspection. Moreover, better detection consistency is achieved across MS datasets from patients with identical pathological condition.

  9. The Peak Pairs algorithm for strain mapping from HRTEM images

    Energy Technology Data Exchange (ETDEWEB)

    Galindo, Pedro L. [Departamento de Lenguajes y Sistemas Informaticos, CASEM, Universidad de Cadiz, Pol. Rio San Pedro s/n. 11510, Puerto Real, Cadiz (Spain)], E-mail: pedro.galindo@uca.es; Kret, Slawomir [Institute of Physics, PAS, AL. Lotnikow 32/46, 02-668 Warsaw (Poland); Sanchez, Ana M. [Departamento de Ciencia de los Materiales e Ing. Metalurgica y Q. Inorganica, Facultad de Ciencias, Universidad de Cadiz, Pol. Rio San Pedro s/n. 11510, Puerto Real, Cadiz (Spain); Laval, Jean-Yves [Laboratoire de Physique du Solide, UPR5 CNRS-ESPCI, Paris (France); Yanez, Andres; Pizarro, Joaquin; Guerrero, Elisa [Departamento de Lenguajes y Sistemas Informaticos, CASEM, Universidad de Cadiz, Pol. Rio San Pedro s/n. 11510, Puerto Real, Cadiz (Spain); Ben, Teresa; Molina, Sergio I. [Departamento de Ciencia de los Materiales e Ing. Metalurgica y Q. Inorganica, Facultad de Ciencias, Universidad de Cadiz, Pol. Rio San Pedro s/n. 11510, Puerto Real, Cadiz (Spain)

    2007-11-15

    Strain mapping is defined as a numerical image-processing technique that measures the local shifts of image details around a crystal defect with respect to the ideal, defect-free, positions in the bulk. Algorithms to map elastic strains from high-resolution transmission electron microscopy (HRTEM) images may be classified into two categories: those based on the detection of peaks of intensity in real space and the Geometric Phase approach, calculated in Fourier space. In this paper, we discuss both categories and propose an alternative real space algorithm (Peak Pairs) based on the detection of pairs of intensity maxima in an affine transformed space dependent on the reference area. In spite of the fact that it is a real space approach, the Peak Pairs algorithm exhibits good behaviour at heavily distorted defect cores, e.g. interfaces and dislocations. Quantitative results are reported from experiments to determine local strain in different types of semiconductor heterostructures.

  10. Households' hourly electricity consumption and peak demand in Denmark

    DEFF Research Database (Denmark)

    Møller Andersen, Frits; Baldini, Mattia; Hansen, Lars Gårn

    2017-01-01

    consumption, we analyse the contribution of appliances and new services, such as individual heat pumps and electric vehicles, to peak consumption and the need for demand response incentives to reduce the peak.Initially, the paper presents a new model that represents the hourly electricity consumption profile...... of households in Denmark. The model considers hourly consumption profiles for different household appliances and their contribution to annual household electricity consumption. When applying the model to an official scenario for annual electricity consumption, assuming non-flexible consumption due...... to a considerable introduction of electric vehicles and individual heat pumps, household consumption is expected to increase considerably, especially peak hour consumption is expected to increase.Next the paper presents results from a new experiment where household customers are given economic and/or environmental...

  11. Diamond identification

    International Nuclear Information System (INIS)

    Lang, A.R.

    1979-01-01

    Methods of producing sets of records of the internal defects of diamonds as a means of identification of the gems by x-ray topography are described. To obtain the records one can either use (a) monochromatic x-radiation reflected at the Bragg angle from crystallographically equivalent planes of the diamond lattice structure, Bragg reflections from each such plane being recorded from a number of directions of view, or (b) white x-radiation incident upon the diamond in directions having a constant angular relationship to each equivalent axis of symmetry of the diamond lattice structure, Bragg reflections being recorded for each direction of the incident x-radiation. By either method an overall point-to-point three dimensional representation of the diamond is produced. (U.K.)

  12. Study of peak broadening effect in floor time histories

    International Nuclear Information System (INIS)

    Soni, R.S.; Kushwaha, H.S.; Mahajan, S.C.; Kakodkar, A.

    1996-01-01

    Seismic design of secondary systems such components and piping is usually carried out by using the floor motions at their support points. These floor motions can be in the form of Floor Response Spectra (FRS) or the Floor Time Histories (FTH). In order to account for the various uncertainties in generating these floor motions, these motions should be peak broadened and smoothened as per the regulatory codes. Presented here in this paper is the methodology to account for such peak broadening effect in the FTH. Results of this study have been compared with the FRS approach and various important conclusions have been arrived at based on the study

  13. CO2 emissions: a peak level in 2010

    International Nuclear Information System (INIS)

    Anon.

    2011-01-01

    After a reduction of CO 2 emissions in 2009 due to the financial crisis, these emissions have again reached a peak in 2010: 30.6 Gt, it means an increase by 5% compared to the previous peak. According to IEA (International Energy Agency): 44% of the emissions come from coal, 36% from oil and 20% from natural gas, and OECD countries are responsible of 40% of the CO 2 global emissions but only of 25% of their increase since 2009. For China and India the emissions of CO 2 have increased sharply due to their strong economic growth. (A.C.)

  14. Peak Oil and the Everyday Complexity of Human Progress Narratives

    Directory of Open Access Journals (Sweden)

    John C. Pruit

    2012-11-01

    Full Text Available The “big” story of human progress has polarizing tendencies featuring the binary options of progress or decline. I consider human progress narratives in the context of everyday life. Analysis of the “little” stories from two narrative environments focusing on peak oil offers a more complex picture of the meaning and contours of the narrative. I consider the impact of differential blog site commitments to peak oil perspectives and identify five narrative types culled from two narrative dimensions. I argue that the lived experience complicates human progress narratives, which is no longer an either/or proposition.

  15. National energy peak leveling program (NEPLP). Final report

    Energy Technology Data Exchange (ETDEWEB)

    None

    1977-12-01

    This multisectioned three-Volume report is responsive to the requirements of Contract E (04-3)-1152 to provide a detailed methodology, to include management, technology, and socio-economic aspects, of a voluntary community program of computer-assisted peak load leveling and energy conservation in commercial community facilities. The demonstration project established proof-of-concept in reducing the kW-demand peak by the unofficial goal of 10%, with concurrent kWh savings. This section of volume III contains appendixes of information on load shedding determination, analysis, socio-economic study, contractual cross references, and definitions.

  16. Prediction of a Photon Peak in Heavy Ion Collisions

    Energy Technology Data Exchange (ETDEWEB)

    Casalderrey-Solana, Jorge; Mateos, David

    2008-07-01

    We show that if a flavour-less vector meson remains bound after deconfinement, and if its limiting velocity in the quark-gluon plasma is subluminal, then this meson produces a distinct peak in the spectrum of thermal photons emitted by the plasma. We also demonstrate that this effect is a universal property of all strongly coupled, large-Nc plasmas with a gravity dual. For the J/psi the corresponding peak lies between 3 and 5 GeV and could be observed at LHC.

  17. National energy peak leveling program (NEPLP). Final report

    Energy Technology Data Exchange (ETDEWEB)

    None

    1977-12-01

    This three-volume report is responsive to the requirements of contract E (04-3)-1152 to provide a detailed methodology, to include management, technology, and socio-economic aspects, of a voluntary community program for computer-assisted peak load leveling and energy conservation in commercial community facilities. The demonstration project established proof-of-concept in reducing the kW-demand peak by the unofficial goal of 10%, with concurrent kWh savings. The report consists of the following three volumes: Volume I: management overview; Volume II: methodology and technology; and Volume III; appendices.

  18. High-Average, High-Peak Current Injector Design

    CERN Document Server

    Biedron, S G; Virgo, M

    2005-01-01

    There is increasing interest in high-average-power (>100 kW), um-range FELs. These machines require high peak current (~1 kA), modest transverse emittance, and beam energies of ~100 MeV. High average currents (~1 A) place additional constraints on the design of the injector. We present a design for an injector intended to produce the required peak currents at the injector, eliminating the need for magnetic compression within the linac. This reduces the potential for beam quality degradation due to CSR and space charge effects within magnetic chicanes.

  19. Demand Side Management: An approach to peak load smoothing

    Science.gov (United States)

    Gupta, Prachi

    A preliminary national-level analysis was conducted to determine whether Demand Side Management (DSM) programs introduced by electric utilities since 1992 have made any progress towards their stated goal of reducing peak load demand. Estimates implied that DSM has a very small effect on peak load reduction and there is substantial regional and end-user variability. A limited scholarly literature on DSM also provides evidence in support of a positive effect of demand response programs. Yet, none of these studies examine the question of how DSM affects peak load at the micro-level by influencing end-users' response to prices. After nearly three decades of experience with DSM, controversy remains over how effective these programs have been. This dissertation considers regional analyses that explore both demand-side solutions and supply-side interventions. On the demand side, models are estimated to provide in-depth evidence of end-user consumption patterns for each North American Electric Reliability Corporation (NERC) region, helping to identify sectors in regions that have made a substantial contribution to peak load reduction. The empirical evidence supports the initial hypothesis that there is substantial regional and end-user variability of reductions in peak demand. These results are quite robust in rapidly-urbanizing regions, where air conditioning and lighting load is substantially higher, and regions where the summer peak is more pronounced than the winter peak. It is also evident from the regional experiences that active government involvement, as shaped by state regulations in the last few years, has been successful in promoting DSM programs, and perhaps for the same reason we witness an uptick in peak load reductions in the years 2008 and 2009. On the supply side, we estimate the effectiveness of DSM programs by analyzing the growth of capacity margin with the introduction of DSM programs. The results indicate that DSM has been successful in offsetting the

  20. Universal parametric correlations of conductance peaks in quantum dots

    International Nuclear Information System (INIS)

    Alhassid, Y.; Attias, H.

    1996-01-01

    We compute the parametric correlation function of the conductance peaks in chaotic and weakly disordered quantum dots in the Coulomb blockade regime and demonstrate its universality upon an appropriate scaling of the parameter. For a symmetric dot we show that this correlation function is affected by breaking time-reversal symmetry but is independent of the details of the channels in the external leads. We derive a new scaling which depends on the eigenfunctions alone and can be extracted directly from the conductance peak heights. Our results are in excellent agreement with model simulations of a disordered quantum dot. copyright 1996 The American Physical Society

  1. Detection of Golden apples' climacteric peak by laser biospeckle measurements.

    Science.gov (United States)

    Nassif, Rana; Nader, Christelle Abou; Afif, Charbel; Pellen, Fabrice; Le Brun, Guy; Le Jeune, Bernard; Abboud, Marie

    2014-12-10

    In this paper, we report a study in which a laser biospeckle technique is used to detect the climacteric peak indicating the optimal ripeness of fruits. We monitor two batches of harvested Golden apples going through the ripening phase in low- and room-temperature environments, determine speckle parameters, and measure the emitted ethylene concentration using gas chromatography as reference method. Speckle results are then correlated to the emitted ethylene concentration by a principal component analysis. From a practical point of view, this approach allows us to validate biospeckle as a noninvasive and alternative method to respiration rate and ethylene production for climacteric peak detection as a ripening index.

  2. Online peak power prediction based on a parameter and state estimator for lithium-ion batteries in electric vehicles

    International Nuclear Information System (INIS)

    Pei, Lei; Zhu, Chunbo; Wang, Tiansi; Lu, Rengui; Chan, C.C.

    2014-01-01

    The goal of this study is to realize real-time predictions of the peak power/state of power (SOP) for lithium-ion batteries in electric vehicles (EVs). To allow the proposed method to be applicable to different temperature and aging conditions, a training-free battery parameter/state estimator is presented based on an equivalent circuit model using a dual extended Kalman filter (DEKF). In this estimator, the model parameters are no longer taken as functions of factors such as SOC (state of charge), temperature, and aging; instead, all parameters will be directly estimated under the present conditions, and the impact of the temperature and aging on the battery model will be included in the parameter identification results. Then, the peak power/SOP will be calculated using the estimated results under the given limits. As an improvement to the calculation method, a combined limit of current and voltage is proposed to obtain results that are more reasonable. Additionally, novel verification experiments are designed to provide the true values of the cells' peak power under various operating conditions. The proposed methods are implemented in experiments with LiFePO 4 /graphite cells. The validating results demonstrate that the proposed methods have good accuracy and high adaptability. - Highlights: • A real-time peak power/SOP prediction method for lithium-ion batteries is proposed. • A training-free method based on DEKF is presented for parameter identification. • The proposed method can be applied to different temperature and aging conditions. • The calculation of peak power under the current and voltage limits is improved. • Validation experiments are designed to verify the accuracy of prediction results

  3. American video peak store gives fuel a better image

    International Nuclear Information System (INIS)

    Anon.

    1989-01-01

    A new American image enhancement system using a video peak frame store aims to overcome the common problems of viewing serial numbers on irradiated fuel assemblies within the reactor core whilst reducing operator exposure at the same time. Other nuclear plant inspection applications are envisaged. (author)

  4. Detection of Mg spinel lithologies on central peak of crater ...

    Indian Academy of Sciences (India)

    identified Fe bearing Mg-spinel-rich rock types are defined by their strong 2-μm ... The Modified Gaussian Modeling (MGM) analysis ... study the deep crustal and/or upper mantle composition and may lead to a fresh ... Lunar surface; Mg-spinel; central peak; Theophilus; remote sensing. .... The explanation of these spec-.

  5. High precision 16K, 16 channel peak sensing CAMAC ADC

    International Nuclear Information System (INIS)

    Jain, Mamta; Subramaniam, E.T

    2013-01-01

    A high density, peak sensing, analog to digital converter (ADC) double width module with CAMAC back plane has been developed for nuclear physics experiments with a large number of detectors. This module has sixteen independent channels in plug-in daughter card mother board mode

  6. Standardization of I-125. Sum-Peak Coincidence Counting

    International Nuclear Information System (INIS)

    Grau Carles, A.; Grau Malonda, A.

    2011-01-01

    I-125 is a nuclide which presents difficulties for standardization. The sum-peak method is one of the procedures used to standardize this radionuclide. Initially NaI (Tl)detectors and then the semiconductor detectors with higher resolution have been used.This paper describes the different methods based on the sum-peak procedure and the different expressions used to calculate the activity are deduced. We describe a general procedure for obtaining all of the above equations and many more. We analyze the influence of uncertainties in the used parameters in the uncertainty of the activity. We give a complete example of the transmission of uncertainty and the effects of correlations in the uncertainty of the activity of the sample. High-resolution spectra show an unresolved doublet of 62.0 keV and 62.8 keV. The paper presents two approaches to solve this problem. One is based on the calculation of area ratio and the sum of peak areas obtained from atomic and nuclear data, in the other we modify the equations so that the sum of the peak areas doublet, rather than its components, is present. (Author) 19 refs.

  7. Focal F0 peak shape and sentence mode in Swedish

    DEFF Research Database (Denmark)

    Ambrazaitis, Gilbert; Buanzur, Tuarik C.; Niebuhr, Oliver

    2015-01-01

    Shape characteristics of rising-falling accentual F0 peaks of Stockholm Swedish Accent I words in narrow focus are studied in a corpus of 287 read sentences. The corpus includes statements and three types of polar questions. Results reveal a clear effect of sentence mode on the shape of the accen...

  8. factors influencing peak expiratory flow in teenage boys

    African Journals Online (AJOL)

    smoked. Regression analysis suggested peak flow differenct.s ... Medical Research Council Centre for Molecular and Cellular Biology, Department ... J leasure of lung function and a tool for asthma management.'.2 ... by the subjects were assigned a numerical value based on how .... Our data differ marginally from data.

  9. Size-independent peak shift between normal and upconversion ...

    Indian Academy of Sciences (India)

    2014-02-12

    Feb 12, 2014 ... In this article, we report size-dependent measurement of the shift in peak of upconversion photoluminescence spectra compared to that of normal photoluminescence using a 800 nm femtosecond laser and its second harmonic. It has been shown that the upconversion photoluminescence is always ...

  10. Scheduling Non-Preemptible Jobs to Minimize Peak Demand

    Directory of Open Access Journals (Sweden)

    Sean Yaw

    2017-10-01

    Full Text Available This paper examines an important problem in smart grid energy scheduling; peaks in power demand are proportionally more expensive to generate and provision for. The issue is exacerbated in local microgrids that do not benefit from the aggregate smoothing experienced by large grids. Demand-side scheduling can reduce these peaks by taking advantage of the fact that there is often flexibility in job start times. We focus attention on the case where the jobs are non-preemptible, meaning once started, they run to completion. The associated optimization problem is called the peak demand minimization problem, and has been previously shown to be NP-hard. Our results include an optimal fixed-parameter tractable algorithm, a polynomial-time approximation algorithm, as well as an effective heuristic that can also be used in an online setting of the problem. Simulation results show that these methods can reduce peak demand by up to 50% versus on-demand scheduling for household power jobs.

  11. Bragg peak and relative biological efficiency of different ions

    Czech Academy of Sciences Publication Activity Database

    Lokajíček st., Miloš; Judas, Libor; Kundrát, Pavel

    2002-01-01

    Roč. 64, Suppl. 1 (2002), S309-S309 ISSN 0167-8140 R&D Projects: GA AV ČR(CZ) KSK4055109 Keywords : Bragg peak * relative biological efficisncy * radiological mechanism Subject RIV: CC - Organic Chemistry Impact factor: 2.838, year: 2002

  12. Measurement of peak temperature along an optical fiber

    International Nuclear Information System (INIS)

    Fox, R.J.

    1983-01-01

    A multimode silica-clad optical fiber with a liquid silicone core was used as a distributed-line peak-temperature sensor over a temperature range from ambient to 190 0 C. The maximum error was 2 0 C and was essentially independent of the length or position of the hot zone

  13. Biomechanical aspects of peak performance in human swimming

    NARCIS (Netherlands)

    Toussaint, H.M.; Truijens, M.J.

    2005-01-01

    Peak performances in sport require the full deployment of all the powers an athlete possesses. How factors such as mechanical power output, technique and drag, each individually, but also in concert, determine swimming performance is the subject of this enquiry. This overview of swimming

  14. T(peak)T(end) interval in long QT syndrome

    DEFF Research Database (Denmark)

    Kanters, Jørgen Kim; Haarmark, Christian; Vedel-Larsen, Esben

    2008-01-01

    BACKGROUND: The T(peak)T(end) (T(p)T(e)) interval is believed to reflect the transmural dispersion of repolarization. Accordingly, it should be a risk factor in long QT syndrome (LQTS). The aim of the study was to determine the effect of genotype on T(p)T(e) interval and test whether it was relat...

  15. Peak Communication Experiences: Concept, Structure, and Sex Differences.

    Science.gov (United States)

    Gordon, Ron; Dulaney, Earl

    A study was conducted to test a "peak communication experience" (PCE) scale developed from Abraham Maslow's theory of PCE's, a model of one's highest interpersonal communication moments in terms of perceived mutual understanding, happiness, and personal fulfillment. Nineteen items, extrapolated from Maslow's model but rendered more…

  16. Analysis of multibeam-hydrosweep echo peaks for seabed characterisation

    Digital Repository Service at National Institute of Oceanography (India)

    Chakraborty, B.; Schenke, H.W.; Kodagali, V.N.; Hagen, R.

    , in general, Gaussian in nature except in the case of the Kainan Maru seamount summit (area D). The outer beams of the Enderby abyssal plain (area C) echo-peak PDF statistics reveal the highest possible large-scale feature dominance. Interestingly, Extremal...

  17. Characteristics of peaks of inhalation exposure to organic solvents

    NARCIS (Netherlands)

    Preller, L.; Burstyn, I.; Pater, N. de; Kromhout, H.

    2004-01-01

    Objectives: To determine which exposure metrics are sufficient to characterize 'peak' inhalation exposure to organic solvents (OS) during spraying operations. Methods: Personal exposure measurements (n = 27; duration 5-159 min) were collected during application of paints, primers, resins and glues

  18. A new sample of faint Gigahertz Peaked Spectrum radio sources

    NARCIS (Netherlands)

    Snellen, IAG; Schilizzi, RT; de Bruyn, AG; Miley, GK; Rengelink, RB; Rottgering, HJ

    The Westerbork Northern Sky Survey (WENSS) has been used to select a sample of Gigahertz Peaked Spectrum (GPS) radio sources at flux densities one to two orders of magnitude lower than bright GPS sources investigated in earlier studies. Sources with inverted spectra at frequencies above 325 MHz have

  19. Efficient protection of mercury peaks; Effizienter Schutz vor Quecksilberspitzen

    Energy Technology Data Exchange (ETDEWEB)

    Esser-Schmittmann, Wolfgang; Schmitz, Simone [Carbon Service und Consulting GmbH und Co. KG, Vettweiss (Germany)

    2010-07-15

    Exhaust gases from the combustion of wastes and substitute fuels temporarily exhibit again and again emission peaks of mercury which in individual cases cannot be caught by the exhaust after-treatment system designed for the stationary plant operation. The problem can be solved inexpensively by dosage of small quantities of chemisorptive powder activated charcoal.

  20. predicted peak expiratory flow in human and the clinical implication ...

    African Journals Online (AJOL)

    DR. AMINU

    predicted PEF varied widely across formulae and choice of a particular formula may alter guideline- base care. This work has therefore accepted a recently published population-base equation proposed as the reference standard for future asthma guidelines. Keywords: Peak expiratory flow, Asthma, Practice guidelines, ...

  1. Analytical construction of peaked solutions for the nonlinear ...

    African Journals Online (AJOL)

    These results demonstrate the existence of peaked pulses propagating through a pair plasma. The algebraic decay rate of the pulses are determined analytically, as well. The method discussed here can be applied to approximate solutions to similar nonlinear partial differential equations of nonlinear Schrödinger type.

  2. A 62GHz inductor-peaked rectifier with 7% efficiency

    NARCIS (Netherlands)

    Gao, H.; Matters - Kammerer, M.; Milosevic, D.; Roermund, van A.H.M.; Baltus, P.G.M.

    2013-01-01

    This paper presents the first 62 GHz fully onchip RF-DC rectifier in 65nm CMOS technology. The rectifier is the bottleneck in realizing on-chip wireless power receivers. In this paper, efficiency problems of the mm-wave rectifier are discussed and the inductor-peaked rectifier structure is proposed

  3. Peak metamorphic temperatures from cation diffusion zoning in garnet

    DEFF Research Database (Denmark)

    Smit, Matthijs Arjen; Scherer, Erik; Mezger, Klaus

    2013-01-01

    ) to develop a tool that uses the diffusion zoning of these cations in garnet to constrain peak temperature conditions for garnet-bearing rocks. The thermometric approach was externally tested by applying it to garnet crystals from various metamorphic terranes worldwide and comparing the results to published...

  4. Measurement of peak discharge at dams by indirect methods

    Science.gov (United States)

    Hulsing, Harry

    1967-01-01

    This chapter describes procedures for measuring peak discharges using dams, weirs, and embankments. Field and office procedures limited to this method are described. Discharge coefficients and formulas are given for three general classes of weirs-sharp-crested, broad-crested, and round-crested-and for highway embankments and weirs of unusual shape. The effects of submergence are defined for most forms.

  5. Comparative LC-MS: A landscape of Peaks and Valleys

    NARCIS (Netherlands)

    America, A.H.P.; Cordewener, J.H.G.

    2008-01-01

    Quantitative proteomics approaches using stable isotopes are well-known and used in many labs nowadays. More recently, high resolution quantitative approaches are reported that rely on LC-MS quantitation of peptide concentrations by comparing peak intensities between multiple runs obtained by

  6. Robust peak-shaving for a neighborhood with electric vehicles

    NARCIS (Netherlands)

    Gerards, Marco Egbertus Theodorus; Hurink, Johann L.

    2016-01-01

    Demand Side Management (DSM) is a popular approach for grid-aware peak-shaving. The most commonly used DSM methods either have no look ahead feature and risk deploying flexibility too early, or they plan ahead using predictions, which are in general not very reliable. To counter this, a DSM approach

  7. Climate Change Impacts on Peak Electricity Consumption: US vs. Europe.

    Science.gov (United States)

    Auffhammer, M.

    2016-12-01

    It has been suggested that climate change impacts on the electric sector will account for the majority of global economic damages by the end of the current century and beyond. This finding is at odds with the relatively modest increase in climate driven impacts on consumption. Comprehensive high frequency load balancing authority level data have not been used previously to parameterize the relationship between electric demand and temperature for any major economy. Using statistical models we analyze multi-year data from load balancing authorities in the United States of America and the European Union, which are responsible for more than 90% of the electricity delivered to residential, industrial, commercial and agricultural customers. We couple the estimated response functions between total daily consumption and daily peak load with an ensemble of downscaled GCMs from the CMIP5 archive to simulate climate change driven impacts on both outcomes. We show moderate and highly spatially heterogeneous changes in consumption. The results of our peak load simulations, however, suggest significant changes in the intensity and frequency of peak events throughout the United States and Europe. As the electricity grid is built to endure maximum load, which usually occurs on the hottest day of the year, our findings have significant implications for the construction of costly peak generating and transmission capacity.

  8. Knowledge, attitude and practice of nurses toward peak expiratory ...

    African Journals Online (AJOL)

    Background: Peak expiratory flow meter (PEFM) is an easy to use, relatively cheap device that can be used for guiding management of bronchial asthma by the patients at home according to a preset plan by health care workers. Objective: The aim of the study is to reveal the extent of knowledge and perception of nurses ...

  9. Knowledge, attitude and practice of physicians toward peak ...

    African Journals Online (AJOL)

    Background: Peak expiratory flow meter (PEFM) may reduce diagnostic delay and improve decision-making in asthma by providing an objective assessment of their flow and hence identify air flow variability that is essential for management of air way diseases. Objectives: This study was designed to reveal extent of ...

  10. Family practitioners perception of, knowledge about and use of peak ...

    African Journals Online (AJOL)

    Background The purpose of this paper was to determine the availability of peak flow meters, perceptions about their usefulness and the perceptions of clinical indications for their use. Methods A questionnaire was administered to private and public sector practitioners (n=72) working in three urban areas of greater ...

  11. Knowledge of spacer device, peak flow meter and inhaler technique ...

    African Journals Online (AJOL)

    Background: Metered dose inhalers are cornerstone in effective management of bronchial asthma when correctly used. Most studies hitherto have focused on assessing patient's knowledge of inhaler technique. We sought to assess the knowledge of inhaler technique, spacer device and peak flow meter among doctors and ...

  12. quasi hyperrigidity and weak peak points for non-commutative ...

    Indian Academy of Sciences (India)

    7

    Abstract. In this article, we introduce the notions of weak boundary repre- sentation, quasi hyperrigidity and weak peak points in the non-commutative setting for operator systems in C∗-algebras. An analogue of Saskin's theorem relating quasi hyperrigidity and weak Choquet boundary for particular classes of C∗-algebras is ...

  13. Simple area determination of strongly overlapping ion mobility peaks

    Czech Academy of Sciences Publication Activity Database

    Borovcová, L.; Hermannová, M.; Pauk, V.; Šimek, M.; Havlíček, Vladimír; Lemr, Karel

    2017-01-01

    Roč. 981, AUG 15 (2017), s. 71-79 ISSN 0003-2670 Grant - others:GA MŠk(CZ) LO1305 Institutional support: RVO:61388971 Keywords : Ion mobility-mass spectrometry * Fitting of mobility peaks * Analysis of isomers Subject RIV: CB - Analytical Chemistry, Separation OBOR OECD: Analytical chemistry Impact factor: 4.950, year: 2016

  14. Standardization of I-125. Sum-Peak Coincidence Counting

    Energy Technology Data Exchange (ETDEWEB)

    Grau Carles, A.; Grau Malonda, A.

    2011-07-01

    I-125 is a nuclide which presents difficulties for standardization. The sum-peak method is one of the procedures used to standardize this radionuclide. Initially NaI (Tl)detectors and then the semiconductor detectors with higher resolution have been used.This paper describes the different methods based on the sum-peak procedure and the different expressions used to calculate the activity are deduced. We describe a general procedure for obtaining all of the above equations and many more. We analyze the influence of uncertainties in the used parameters in the uncertainty of the activity. We give a complete example of the transmission of uncertainty and the effects of correlations in the uncertainty of the activity of the sample. High-resolution spectra show an unresolved doublet of 62.0 keV and 62.8 keV. The paper presents two approaches to solve this problem. One is based on the calculation of area ratio and the sum of peak areas obtained from atomic and nuclear data, in the other we modify the equations so that the sum of the peak areas doublet, rather than its components, is present. (Author) 19 refs.

  15. Factors influencing peak expiratory flow in teenage boys | van ...

    African Journals Online (AJOL)

    Background. Peak expiratory flow (PEF) is a useful measure of pulmonary health status and is frequently utilised in asthm, management. Reduction in PEF is usually indicative of onset (of asthma symptoms. However, use can be made of PEF values only if normal values are known. The definition of normal range is always ...

  16. Automatic Locking of Laser Frequency to an Absorption Peak

    Science.gov (United States)

    Koch, Grady J.

    2006-01-01

    An electronic system adjusts the frequency of a tunable laser, eventually locking the frequency to a peak in the optical absorption spectrum of a gas (or of a Fabry-Perot cavity that has an absorption peak like that of a gas). This system was developed to enable precise locking of the frequency of a laser used in differential absorption LIDAR measurements of trace atmospheric gases. This system also has great commercial potential as a prototype of means for precise control of frequencies of lasers in future dense wavelength-division-multiplexing optical communications systems. The operation of this system is completely automatic: Unlike in the operation of some prior laser-frequency-locking systems, there is ordinarily no need for a human operator to adjust the frequency manually to an initial value close enough to the peak to enable automatic locking to take over. Instead, this system also automatically performs the initial adjustment. The system (see Figure 1) is based on a concept of (1) initially modulating the laser frequency to sweep it through a spectral range that includes the desired absorption peak, (2) determining the derivative of the absorption peak with respect to the laser frequency for use as an error signal, (3) identifying the desired frequency [at the very top (which is also the middle) of the peak] as the frequency where the derivative goes to zero, and (4) thereafter keeping the frequency within a locking range and adjusting the frequency as needed to keep the derivative (the error signal) as close as possible to zero. More specifically, the system utilizes the fact that in addition to a zero crossing at the top of the absorption peak, the error signal also closely approximates a straight line in the vicinity of the zero crossing (see Figure 2). This vicinity is the locking range because the linearity of the error signal in this range makes it useful as a source of feedback for a proportional + integral + derivative control scheme that

  17. Reducing electricity demand peaks by scheduling home appliances usage

    Energy Technology Data Exchange (ETDEWEB)

    Rossello-Busquet, A.; Kardaras, G.; Baek Iversen, V.; Soler, J.; Dittmann, L.

    2011-05-15

    Nowadays there is a tendency to consume electricity during the same period of the day leading to demand peaks. Regular energy consumption habits lead to demand peaks at specific temporal intervals, because users consume power at the same time. In order to avoid demand peaks, users' appliances should consume electricity in a more temporarily distributed way. A new methodology to schedule the usage of home appliances is proposed and analyzed in this paper. The main concept behind this approach is the aggregation of home appliances into priority classes and the definition of a maximum power consumption limit, which is not allowed to be exceeded during peak hours. The scenario simulated describes a modern household, where the electrical devices are classified in low and high priority groups. The high priority devices are always granted power in order to operate without temporal restrictions. On the contrary, the low priority devices have to pause their operation, when the algorithm dictates it, and resume it in the future. This can become beneficial for both energy companies and users. The electricity suppliers companies will be capable of regulating power generation during demand peaks periods. Moreover, users can be granted lower electricity bill rates for accepting delaying the operation of some of their appliances. In order to analyze this scenario, teletraffic engineering theory, which is used in evaluating the performance of telecommunication networks, is used. A reversible fair scheduling (RFS) algorithm, which was originally developed for telecommunication networks, is applied. The purpose is to analyze how a power consumption limit and priorities for home appliances will affect the demand peak and the users' everyday life. Verification of the effectiveness of the RFS algorithm is done by means of simulation and by using real data for power consumption and operation hours. The defined maximum power limit of 750 and 1000 Watt was not exceeded during

  18. Peak Dose Assessment for Proposed DOE-PPPO Authorized Limits

    International Nuclear Information System (INIS)

    Maldonado, Delis

    2012-01-01

    The Oak Ridge Institute for Science and Education (ORISE), a U.S. Department of Energy (DOE) prime contractor, was contracted by the DOE Portsmouth/Paducah Project Office (DOE-PPPO) to conduct a peak dose assessment in support of the Authorized Limits Request for Solid Waste Disposal at Landfill C-746-U at the Paducah Gaseous Diffusion Plant (DOE-PPPO 2011a). The peak doses were calculated based on the DOE-PPPO Proposed Single Radionuclides Soil Guidelines and the DOE-PPPO Proposed Authorized Limits (AL) Volumetric Concentrations available in DOE-PPPO 2011a. This work is provided as an appendix to the Dose Modeling Evaluations and Technical Support Document for the Authorized Limits Request for the C-746-U Landfill at the Paducah Gaseous Diffusion Plant, Paducah, Kentucky (ORISE 2012). The receptors evaluated in ORISE 2012 were selected by the DOE-PPPO for the additional peak dose evaluations. These receptors included a Landfill Worker, Trespasser, Resident Farmer (onsite), Resident Gardener, Recreational User, Outdoor Worker and an Offsite Resident Farmer. The RESRAD (Version 6.5) and RESRAD-OFFSITE (Version 2.5) computer codes were used for the peak dose assessments. Deterministic peak dose assessments were performed for all the receptors and a probabilistic dose assessment was performed only for the Offsite Resident Farmer at the request of the DOE-PPPO. In a deterministic analysis, a single input value results in a single output value. In other words, a deterministic analysis uses single parameter values for every variable in the code. By contrast, a probabilistic approach assigns parameter ranges to certain variables, and the code randomly selects the values for each variable from the parameter range each time it calculates the dose (NRC 2006). The receptor scenarios, computer codes and parameter input files were previously used in ORISE 2012. A few modifications were made to the parameter input files as appropriate for this effort. Some of these changes

  19. SAMPO80, Ge(Li) Detector Gamma Spectra Unfolding with Isotope Identification

    International Nuclear Information System (INIS)

    Koskelo, M.J.; Aarnio, P.A.; Routti, J.T.

    1998-01-01

    1 - Description of problem or function: Analysis of gamma spectra measured with Ge(Li) or HPGe detectors. 2 - Method of solution: - Shape calibration using a non-linear least squares algorithm with a variable metric method. - Peak location with a smoothed second difference method. - Peak area calculation with a linear least squares fit to predefined peak shapes. - Nuclide identification with a linear least squares fit based on associated lines. 3 - Restrictions on the complexity of the problem: Number of shape calibration points allowed: 20; Number of energy calibration points allowed: 20; Number of efficiency calibration points allowed: 20; Maximum number of found peaks: 100; Maximum number of fitted peaks: 100; Maximum number of peaks in a multiplet: 5; Maximum number of channels in a fitting interval: 50; Maximum number of peaks for nuclide identification: 80; Maximum number of identified nuclides: 30; Maximum number of lines per nuclide: 30

  20. Forecasting Strategies for Predicting Peak Electric Load Days

    Science.gov (United States)

    Saxena, Harshit

    Academic institutions spend thousands of dollars every month on their electric power consumption. Some of these institutions follow a demand charges pricing structure; here the amount a customer pays to the utility is decided based on the total energy consumed during the month, with an additional charge based on the highest average power load required by the customer over a moving window of time as decided by the utility. Therefore, it is crucial for these institutions to minimize the time periods where a high amount of electric load is demanded over a short duration of time. In order to reduce the peak loads and have more uniform energy consumption, it is imperative to predict when these peaks occur, so that appropriate mitigation strategies can be developed. The research work presented in this thesis has been conducted for Rochester Institute of Technology (RIT), where the demand charges are decided based on a 15 minute sliding window panned over the entire month. This case study makes use of different statistical and machine learning algorithms to develop a forecasting strategy for predicting the peak electric load days of the month. The proposed strategy was tested for a whole year starting May 2015 to April 2016 during which a total of 57 peak days were observed. The model predicted a total of 74 peak days during this period, 40 of these cases were true positives, hence achieving an accuracy level of 70 percent. The results obtained with the proposed forecasting strategy are promising and demonstrate an annual savings potential worth about $80,000 for a single submeter of RIT.

  1. Peak Running Intensity of International Rugby: Implications for Training Prescription.

    Science.gov (United States)

    Delaney, Jace A; Thornton, Heidi R; Pryor, John F; Stewart, Andrew M; Dascombe, Ben J; Duthie, Grant M

    2017-09-01

    To quantify the duration and position-specific peak running intensities of international rugby union for the prescription and monitoring of specific training methodologies. Global positioning systems (GPS) were used to assess the activity profile of 67 elite-level rugby union players from 2 nations across 33 international matches. A moving-average approach was used to identify the peak relative distance (m/min), average acceleration/deceleration (AveAcc; m/s 2 ), and average metabolic power (P met ) for a range of durations (1-10 min). Differences between positions and durations were described using a magnitude-based network. Peak running intensity increased as the length of the moving average decreased. There were likely small to moderate increases in relative distance and AveAcc for outside backs, halfbacks, and loose forwards compared with the tight 5 group across all moving-average durations (effect size [ES] = 0.27-1.00). P met demands were at least likely greater for outside backs and halfbacks than for the tight 5 (ES = 0.86-0.99). Halfbacks demonstrated the greatest relative distance and P met outputs but were similar to outside backs and loose forwards in AveAcc demands. The current study has presented a framework to describe the peak running intensities achieved during international rugby competition by position, which are considerably higher than previously reported whole-period averages. These data provide further knowledge of the peak activity profiles of international rugby competition, and this information can be used to assist coaches and practitioners in adequately preparing athletes for the most demanding periods of play.

  2. Peak-locking reduction for particle image velocimetry

    International Nuclear Information System (INIS)

    Michaelis, Dirk; Wieneke, Bernhard; Neal, Douglas R

    2016-01-01

    A parametric study of the factors contributing to peak-locking, a known bias error source in particle image velocimetry (PIV), is conducted using synthetic data that are processed with a state-of-the-art PIV algorithm. The investigated parameters include: particle image diameter, image interpolation techniques, the effect of asymmetric versus symmetric window deformation, number of passes and the interrogation window size. Some of these parameters are found to have a profound effect on the magnitude of the peak-locking error. The effects for specific PIV cameras are also studied experimentally using a precision turntable to generate a known rotating velocity field. Image time series recorded using this experiment show a linear range of pixel and sub-pixel shifts ranging from 0 to  ±4 pixels. Deviations in the constant vorticity field (ω z ) reveal how peak-locking can be affected systematically both by varying parameters of the detection system such as the focal distance and f -number, and also by varying the settings of the PIV analysis. A new a priori technique for reducing the bias errors associated with peak-locking in PIV is introduced using an optical diffuser to avoid undersampled particle images during the recording of the raw images. This technique is evaluated against other a priori approaches using experimental data and is shown to perform favorably. Finally, a new a posteriori anti peak-locking filter (APLF) is developed and investigated, which shows promising results for both synthetic data and real measurements for very small particle image sizes. (paper)

  3. Background Reduction around Prompt Gamma-ray Peaks from Korean White Ginseng

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Y. N.; Sun, G. M.; Moon, J. H.; Chung, Y. S. [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of); Kim, Y. E. [Chung-buk National University, Chungju (Korea, Republic of)

    2007-10-15

    Prompt gamma-ray activation analysis (PGAA) is recognized as a very powerful and unique nuclear method in terms of its non-destruction, high precision, and no time-consuming advantages. This method is used for the analysis of trace elements in various types of sample matrix such as metallurgical, environmental, biological samples, etc. When a spectrum is evaluated, background continuum is a major disturbing factor for a precise and accurate analysis. Furthermore, a prompt gamma spectrum is complicate with a wide range. To make the condition free from this limitation, a reduction of the background is important for the PGAA analysis. The background-reducing methods are divided into using the electronic equipment like a suppression mode and principal component analysis (PCA) based on a multivariate statistical method. In PGAA analysis, Lee et al. compared the background reduction methods like PCA and wavelet transform for the prompt gamma-ray spectra. Lim et al. have applied the multivariate statistical method to the identification of the peaks with low-statistics from the explosives. In this paper, effective reduction of background in the prompt gamma spectra using the PCA is applied to the prompt gammaray peaks from Korean Baeksam (Korean white ginseng)

  4. The EEG Split Alpha Peak: Phenomenological Origins and Methodological Aspects of Detection and Evaluation.

    Science.gov (United States)

    Olejarczyk, Elzbieta; Bogucki, Piotr; Sobieszek, Aleksander

    2017-01-01

    Electroencephalographic (EEG) patterns were analyzed in a group of ambulatory patients who ranged in age and sex using spectral analysis as well as Directed Transfer Function, a method used to evaluate functional brain connectivity. We tested the impact of window size and choice of reference electrode on the identification of two or more peaks with close frequencies in the spectral power distribution, so called "split alpha." Together with the connectivity analysis, examination of spatiotemporal maps showing the distribution of amplitudes of EEG patterns allowed for better explanation of the mechanisms underlying the generation of split alpha peaks. It was demonstrated that the split alpha spectrum can be generated by two or more independent and interconnected alpha wave generators located in different regions of the cerebral cortex, but not necessarily in the occipital cortex. We also demonstrated the importance of appropriate reference electrode choice during signal recording. In addition, results obtained using the original data were compared with results obtained using re-referenced data, using average reference electrode and reference electrode standardization techniques.

  5. Development of windows based on highly insulating aerogel glazings

    DEFF Research Database (Denmark)

    Jensen, Karsten Ingerslev; Schultz, Jørgen Munthe; Kristiansen, Finn Harken

    2004-01-01

    of buildings, the window area is the weakest part with respect to the heat loss, but at the same time, it also provides e.g. solar energy gain. Glazing prototypes have been made of aerogel tiles of about 55 cm sq. (elaborated within the projects). Those tiles are quickly evacuated and easily sealed between two...... glass panes and a specific rim seal. A heat treatment phase (after the supercritical CO2 drying) of the aerogel is currently being developed in order to improve its optical quality. This step increases the solar transmittance about 6 percent points. For glazing prototypes with an aerogel thickness...... of approx. 15 mm, a centre heat loss coefficient of below 0.7 W/m² K and a solar transmittance of 76% have been obtained. The research is funded in part by the European Commission within the frameworks of the Non-Nuclear Energy Programme – JOULE III and the Energy, Environment and Sustainable Development...

  6. Implementation of a window-based software for distillation process ...

    African Journals Online (AJOL)

    Global Journal of Engineering Research. Journal Home · ABOUT THIS JOURNAL · Advanced Search · Current Issue · Archives · Journal Home > Vol 5, No 1 (2006) >. Log in or Register to get access to full text downloads.

  7. Energy performance of windows based on the net energy gain

    DEFF Research Database (Denmark)

    Svendsen, Svend; Kragh, Jesper; Laustsen, Jacob Birck

    2005-01-01

    The paper presents a new method to set up energy performance requirements and energy classes for windows of all dimensions and configurations. The net energy gain of windows is the solar gain minus the heat loss integrated over the heating season. The net energy gain can be calculated for one...... be expressed as a function of two parameters representing the energy performance and two parameters representing the geometry of the window. The two energy performance parameters are the net energy gain per area of the glazing unit and the sum of the heat losses through the frame and the assembly per length...... of the frame. The two geometry numbers are the area of the glazing unit relative to the window area and the length of the frame profiles relative to the window area. Requirements and classes for the energy performance of the window can be given by assigning values to the two energy performance parameters...

  8. Novel Smart Windows Based on Transparent Phosphorescent OLEDs

    Energy Technology Data Exchange (ETDEWEB)

    Brian D' Andrade; Stephen Forest

    2006-09-15

    In this program, Universal Display Corporation (UDC) and Princeton University developed the use of white transparent phosphorescent organic light emitting devices (PHOLEDs{trademark}) to make low-cost ''transparent OLED (TOLED) smart windows'', that switch rapidly from being a highly efficient solid-state light source to being a transparent window. PHOLEDs are ideal for large area devices, and the UDC-Princeton team has demonstrated white PHOLEDs with efficiencies of >24 lm/W at a luminance of 1,000 cd/m{sup 2}. TOLEDs have transparencies >70% over the visible wavelengths of light, but their transparency drops to less than 5% for wavelengths shorter than 350 nm, so they can also be used as ultraviolet (UV) light filters. In addition to controlling the flow of UV radiation, TOLEDs coupled with an electromechanical or electrically activated reflecting shutter on a glass window can be employed to control the flow of heat from infrared (IR) radiation by varying the reflectance/transparency of the glass for wavelengths greater than 800nm. One particularly attractive shutter technology is reversible electrochromic mirrors (REM). Our goal was therefore to integrate two innovative concepts to meet the U.S. Department of Energy goals: high power efficiency TOLEDs, plus electrically controlled reflectors to produce a ''smart window''. Our efforts during this one year program have succeeded in producing a prototype smart window shown in the Fig. I, below. The four states of the smart window are pictured: reflective with lamp on, reflective with lamp off, transparent with lamp on, and transparent with lamp off. In the transparent states, the image is an outdoor setting viewed through the window. In the reflective states, the image is an indoor setting viewed via reflection off the window. We believe that the integration of our high efficiency white phosphorescent TOLED illumination source, with electrically activated shutters represents an innovative low-cost approach to conserving energy, and such innovative approaches are required to drive towards the DOE's goal of a 50% reduction in electric lighting consumption by 2020, and an energy efficient building. Furthermore, the team of UDC and Princeton University is ideally suited to develop and demonstrate this technical approach because of our recognized expertise in the fields of PHOLED and OLED technologies.

  9. Emulating conventional operator interfaces on window-based workstations

    International Nuclear Information System (INIS)

    Carr, G.P.

    1990-01-01

    This paper explores an approach to support the LAMPF and PSR control systems on VAX/VMS workstations using DECwindows and VI Corporation Data Views as the operator interface. The PSR control system was recently turned over to MP division and the two control-system staffs were merged into one group. One of the goals of this new group is to develop a common workstation-based operator console and interface which can be used in a single control room controlling both the linac and proton storage ring. The new console operator interface will need a high-level graphics toolkit for its implementation. During the conversion to the new consoles it will also probably be necessary to write a package to emulate the current operator interfaces at the software level. This paper describes a project to evaluate the appropriateness of VI Corporation's Data Views graphics package for use in the LAMPF control-system environment by using it to write an emulation of the LAMPF touch-panel interface to a large LAMPF control-system application program. A secondary objective of this project was to explore any productivity increases that might be realized by using an object-oriented graphics package and graphics editor. (orig.)

  10. Smart windows based on cholesteric liquid crystals (Conference Presentation)

    Science.gov (United States)

    Khandelwal, Hitesh; Debije, Michael G.; Schenning, Albert P. H. J.

    2017-02-01

    With increase in global warming, use of active cooling and heating devices are continuously increasing to maintain interior temperature of built environment, greenhouses and cars. To reduce the consumption of tremendous amount of energy on cooling and heating devices we need an improved control of transparent features (i.e. windows). In this respect, smart window which is capable for reflecting solar infrared energy without interfering with the visible light would be very attractive. Most of the technologies developed so far are to control the visible light. These technologies block visual contact to the outside world which cause negative effects on human health. An appealing method to selectively control infrared transmission is via utilizing the reflection properties of cholesteric liquid crystals. In our research, we have fabricated a smart window which is capable of reflecting different amount of solar infrared energy depending on the specific climate conditions. The reflection bandwidth can be tuned from 120 nm to 1100 nm in the infrared region without interfering with the visible solar radiations. Calculations reveal that between 8% and 45% of incident solar infrared light can be reflected with a single cell. Simulation studies predicted that more than 12% of the energy spent on heating, cooling and lighting in the built environment can be saved by using the fabricated smart window compared to standard double glazing window.

  11. Multi-Scale Peak and Trough Detection Optimised for Periodic and Quasi-Periodic Neuroscience Data.

    Science.gov (United States)

    Bishop, Steven M; Ercole, Ari

    2018-01-01

    The reliable detection of peaks and troughs in physiological signals is essential to many investigative techniques in medicine and computational biology. Analysis of the intracranial pressure (ICP) waveform is a particular challenge due to multi-scale features, a changing morphology over time and signal-to-noise limitations. Here we present an efficient peak and trough detection algorithm that extends the scalogram approach of Scholkmann et al., and results in greatly improved algorithm runtime performance. Our improved algorithm (modified Scholkmann) was developed and analysed in MATLAB R2015b. Synthesised waveforms (periodic, quasi-periodic and chirp sinusoids) were degraded with white Gaussian noise to achieve signal-to-noise ratios down to 5 dB and were used to compare the performance of the original Scholkmann and modified Scholkmann algorithms. The modified Scholkmann algorithm has false-positive (0%) and false-negative (0%) detection rates identical to the original Scholkmann when applied to our test suite. Actual compute time for a 200-run Monte Carlo simulation over a multicomponent noisy test signal was 40.96 ± 0.020 s (mean ± 95%CI) for the original Scholkmann and 1.81 ± 0.003 s (mean ± 95%CI) for the modified Scholkmann, demonstrating the expected improvement in runtime complexity from [Formula: see text] to [Formula: see text]. The accurate interpretation of waveform data to identify peaks and troughs is crucial in signal parameterisation, feature extraction and waveform identification tasks. Modification of a standard scalogram technique has produced a robust algorithm with linear computational complexity that is particularly suited to the challenges presented by large, noisy physiological datasets. The algorithm is optimised through a single parameter and can identify sub-waveform features with minimal additional overhead, and is easily adapted to run in real time on commodity hardware.

  12. Revisiting the Correlations of Peak Luminosity with Spectral Lag and Peak Energy of the Observed Gamma-ray Bursts

    Directory of Open Access Journals (Sweden)

    Yun-A Jo

    2016-12-01

    Full Text Available An analysis of light curves and spectra of observed gamma-ray bursts in gamma-ray ranges is frequently demanded because the prompt emission contains immediate details regarding the central engine of gamma-ray bursts (GRBs. We have revisited the relationship between the collimation-corrected peak luminosity and the spectral lag, investigating the lag-luminosity relationships in great detail by focusing on spectral lags resulting from all possible combinations of channels. Firstly, we compiled the opening angle data and demonstrated that the distribution of opening angles of 205 long GRBs is represented by a double Gaussian function having maxima at ~ 0.1 and ~ 0.3 radians. We confirmed that the peak luminosity and the spectral lag are anti-correlated, both in the observer frame and in the source frame. We found that, in agreement with our previous conclusion, the correlation coefficient improves significantly in the source frame. It should be noted that spectral lags involving channel 2 (25-50 keV yield high correlation coefficients, where Swift/Burst Alert Telescope (BAT has four energy channels (channel 1: 15-25 keV, channel 2: 25-50 keV, channel 3: 50-100 keV, channel 4: 100-200 keV. We also found that peak luminosity is positively correlated with peak energy.

  13. Hurricane Mitch: Peak Discharge for Selected River Reachesin Honduras

    Science.gov (United States)

    Smith, Mark E.; Phillips, Jeffrey V.; Spahr, Norman E.

    2002-01-01

    Hurricane Mitch began as a tropical depression in the Caribbean Sea on 22 October 1998. By 26 October, Mitch had strengthened to a Category 5 storm as defined by the Saffir-Simpson Hurricane Scale (National Climate Data Center, 1999a), and on 27 October was threatening the northern coast of Honduras (fig. 1). After making landfall 2 days later (29 October), the storm drifted south and west across Honduras, wreaking destruction throughout the country before reaching the Guatemalan border on 31 October. According to the National Climate Data Center of the National Oceanic and Atmospheric Administration (National Climate Data Center, 1999b), Hurricane Mitch ranks among the five strongest storms on record in the Atlantic Basin in terms of its sustained winds, barometric pressure, and duration. Hurricane Mitch also was one of the worst Atlantic storms in terms of loss of life and property. The regionwide death toll was estimated to be more than 9,000; thousands of people were reported missing. Economic losses in the region were more than $7.5 billion (U.S. Agency for International Development, 1999). Honduras suffered the most widespread devastation during the storm. More than 5,000 deaths, and economic losses of more than $4 billion, were reported by the Government of Honduras. Honduran officials estimated that Hurricane Mitch destroyed 50 years of economic development. In addition to the human and economic losses, intense flooding and landslides scarred the Honduran landscape - hydrologic and geomorphologic processes throughout the country likely will be affected for many years. As part of the U.S. Government's response to the disaster, the U.S. Geological Survey (USGS) conducted post-flood measurements of peak discharge at 16 river sites throughout Honduras (fig. 2). Such measurements, termed 'indirect' measurements, are used to determine peak flows when direct measurements (using current meters or dye studies, for example) cannot be made. Indirect measurements of

  14. Ionoacoustic characterization of the proton Bragg peak with submillimeter accuracy

    Energy Technology Data Exchange (ETDEWEB)

    Assmann, W., E-mail: walter.assmann@lmu.de; Reinhardt, S.; Lehrack, S.; Edlich, A.; Thirolf, P. G.; Parodi, K. [Department for Medical Physics, Ludwig-Maximilians-Universität München, Am Coulombwall 1, Garching 85748 (Germany); Kellnberger, S.; Omar, M.; Ntziachristos, V. [Institute for Biological and Medical Imaging, Technische Universität München and Helmholtz Zentrum München, Ingolstädter Landstrasse 1, Neuherberg 85764 (Germany); Moser, M.; Dollinger, G. [Institute for Applied Physics and Measurement Technology, Universität der Bundeswehr, Werner-Heisenberg-Weg 39, Neubiberg 85577 (Germany)

    2015-02-15

    Purpose: Range verification in ion beam therapy relies to date on nuclear imaging techniques which require complex and costly detector systems. A different approach is the detection of thermoacoustic signals that are generated due to localized energy loss of ion beams in tissue (ionoacoustics). Aim of this work was to study experimentally the achievable position resolution of ionoacoustics under idealized conditions using high frequency ultrasonic transducers and a specifically selected probing beam. Methods: A water phantom was irradiated by a pulsed 20 MeV proton beam with varying pulse intensity and length. The acoustic signal of single proton pulses was measured by different PZT-based ultrasound detectors (3.5 and 10 MHz central frequencies). The proton dose distribution in water was calculated by Geant4 and used as input for simulation of the generated acoustic wave by the matlab toolbox k-WAVE. Results: In measurements from this study, a clear signal of the Bragg peak was observed for an energy deposition as low as 10{sup 12} eV. The signal amplitude showed a linear increase with particle number per pulse and thus, dose. Bragg peak position measurements were reproducible within ±30 μm and agreed with Geant4 simulations to better than 100 μm. The ionoacoustic signal pattern allowed for a detailed analysis of the Bragg peak and could be well reproduced by k-WAVE simulations. Conclusions: The authors have studied the ionoacoustic signal of the Bragg peak in experiments using a 20 MeV proton beam with its correspondingly localized energy deposition, demonstrating submillimeter position resolution and providing a deep insight in the correlation between the acoustic signal and Bragg peak shape. These results, together with earlier experiments and new simulations (including the results in this study) at higher energies, suggest ionoacoustics as a technique for range verification in particle therapy at locations, where the tumor can be localized by ultrasound

  15. Determination of the diagnostic x-ray tube practical peak voltage (PPV) from average or average peak voltage measurements

    Energy Technology Data Exchange (ETDEWEB)

    Hourdakis, C J, E-mail: khour@gaec.gr [Ionizing Radiation Calibration Laboratory-Greek Atomic Energy Commission, PO Box 60092, 15310 Agia Paraskevi, Athens, Attiki (Greece)

    2011-04-07

    The practical peak voltage (PPV) has been adopted as the reference measuring quantity for the x-ray tube voltage. However, the majority of commercial kV-meter models measure the average peak, U-bar{sub P}, the average, U-bar, the effective, U{sub eff} or the maximum peak, U{sub P} tube voltage. This work proposed a method for determination of the PPV from measurements with a kV-meter that measures the average U-bar or the average peak, U-bar{sub p} voltage. The kV-meter reading can be converted to the PPV by applying appropriate calibration coefficients and conversion factors. The average peak k{sub PPV,kVp} and the average k{sub PPV,Uav} conversion factors were calculated from virtual voltage waveforms for conventional diagnostic radiology (50-150 kV) and mammography (22-35 kV) tube voltages and for voltage ripples from 0% to 100%. Regression equation and coefficients provide the appropriate conversion factors at any given tube voltage and ripple. The influence of voltage waveform irregularities, like 'spikes' and pulse amplitude variations, on the conversion factors was investigated and discussed. The proposed method and the conversion factors were tested using six commercial kV-meters at several x-ray units. The deviations between the reference and the calculated - according to the proposed method - PPV values were less than 2%. Practical aspects on the voltage ripple measurement were addressed and discussed. The proposed method provides a rigorous base to determine the PPV with kV-meters from U-bar{sub p} and U-bar measurement. Users can benefit, since all kV-meters, irrespective of their measuring quantity, can be used to determine the PPV, complying with the IEC standard requirements.

  16. How does economic theory explain the Hubbert peak oil model?

    International Nuclear Information System (INIS)

    Reynes, F.; Okullo, S.; Hofkes, M.

    2010-01-01

    The aim of this paper is to provide an economic foundation for bell shaped oil extraction trajectories, consistent with Hubbert's peak oil model. There are several reasons why it is important to get insight into the economic foundations of peak oil. As production decisions are expected to depend on economic factors, a better comprehension of the economic foundations of oil extraction behaviour is fundamental to predict production and price over the coming years. The investigation made in this paper helps us to get a better understanding of the different mechanisms that may be at work in the case of OPEC and non-OPEC producers. We show that profitability is the main driver behind production plans. Changes in profitability due to divergent trajectories between costs and oil price may give rise to a Hubbert production curve. For this result we do not need to introduce a demand or an exploration effect as is generally assumed in the literature.

  17. Hydrocarbon isotope detection by elastic peak electron spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Kostanovskiy, I.A., E-mail: kostanovskiyia@gmail.com [National Research University MPEI, Krasnokazarmennaya 14, 111250 Moscow (Russian Federation); Afanas’ev, V.P. [National Research University MPEI, Krasnokazarmennaya 14, 111250 Moscow (Russian Federation); Naujoks, D. [Max-Planck-Institut für Plasmaphysik, Teilinstitut Greifswald, Wendelsteinstraße 1, D-17491 Greifswald (Germany); Mayer, M. [Max-Planck-Institut für Plasmaphysik, D-85748 Garching (Germany)

    2015-07-15

    Highlights: • PCVD hydrocarbon coatings containing protium or deuterium are analyzed via NRA, ERD, XPS and EPES. • EPES analysis with modern electron energy analyzer SPECS Phoibos 225 shows a clear signal from the hydrogen isotopes. • Different primary energies and scattering angles help to quantify isotope content from EPES spectra. - Abstract: Experimental results on the hydrocarbon isotope analysis by elastic peak electron spectroscopy are presented. Amorphous hydrocarbon samples (a-C:H, a-C:D) are prepared by PCVD and analyzed by nuclear reaction analysis (NRA), elastic recoil detection analysis (ERD), X-ray photoelectron spectroscopy (XPS) and elastic peak electron spectroscopy (EPES). Electron energy spectra show a clear signal from the hydrogen isotopes deuterium and protium. Different incident energies and scattering geometries help to resolve plasmon and elastic energy losses.

  18. Hydrocarbon isotope detection by elastic peak electron spectroscopy

    International Nuclear Information System (INIS)

    Kostanovskiy, I.A.; Afanas’ev, V.P.; Naujoks, D.; Mayer, M.

    2015-01-01

    Highlights: • PCVD hydrocarbon coatings containing protium or deuterium are analyzed via NRA, ERD, XPS and EPES. • EPES analysis with modern electron energy analyzer SPECS Phoibos 225 shows a clear signal from the hydrogen isotopes. • Different primary energies and scattering angles help to quantify isotope content from EPES spectra. - Abstract: Experimental results on the hydrocarbon isotope analysis by elastic peak electron spectroscopy are presented. Amorphous hydrocarbon samples (a-C:H, a-C:D) are prepared by PCVD and analyzed by nuclear reaction analysis (NRA), elastic recoil detection analysis (ERD), X-ray photoelectron spectroscopy (XPS) and elastic peak electron spectroscopy (EPES). Electron energy spectra show a clear signal from the hydrogen isotopes deuterium and protium. Different incident energies and scattering geometries help to resolve plasmon and elastic energy losses

  19. Kinematic evidence for downdip movement on the Mormon Peak detachment

    Science.gov (United States)

    Walker, Christopher D.; Anders, Mark H.; Christie-Blick, Nicholas

    2007-03-01

    The Mormon Peak detachment is considered to be one of the best examples of a rooted upper crustal detachment fault that propagated through the brittle crust at a low angle. The hanging wall of the detachment today consists of a number of isolated blocks that have been interpreted as remnants of a once-contiguous extensional allochthon. Here we present the results of a new study of directional indicators from the basal surfaces beneath these blocks. These measurements do not agree with the long-standing interpretation of a S75°W movement direction for the detachment hanging wall. Instead, the most recent movement on each section of the detachment took place approximately parallel to the present downdip direction. We conclude that the Mormon Peak detachment is best explained as the basal surfaces to a series of rootless gravity slides.

  20. Evaluation of peaking factors uncertainty for CASMO-3

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Kang Suk; Song, Jae Seung; Kim, Yong Rae; Ji, Seong Kyun [Korea Atomic Energy Research Institute, Taejon (Korea, Republic of)

    1996-02-01

    This document evaluates the pin-to-box factor uncertainty based on using the CASMO-3 with 40-group J-library. Five CE criticals performed by Westinghouse, two by B and W and four RPI criticals were analyzed, using cross sections by CASMO-3. DOT was used for the core calculation. THis is one hof series of efforts to verify ADONIS procedure which is a new core design package under development by KAERI. The expected outcome of this analysis is CASMO-3 pin peak uncertainty applicable to CE type fuel assembly design. The evaluated uncertainty of peaking factors for CASMO-3 was 1.863%. 21 tabs., 23 figs., 12 refs. (Author) .new.

  1. What is the peak stress in ceramic bar impacts?

    International Nuclear Information System (INIS)

    Simha, C. Hari Manoj; Bless, S.J.; Bedford, A.

    2000-01-01

    The bar impact experiment has been extensively used to characterize the high strain rate properties of high strength ceramics. In particular, alumina AD-99.5 has been widely studied; both stress gauge and VISAR bar impact data are available for this material. We have performed plate-on-bar impact experiments using this material in some novel configurations. An interface was introduced in the target bar (by cutting it) in the zone where the material fails by axial splitting. Such experiments resulted in a dramatic drop in the peak stress measured in the experiment, when compared to experiments with no interface. We show that the damage kinetics in tension influence these measurements. Since the peak stress is dependent on the damage kinetics we conclude that the measurement cannot be correlated to some intrinsic strength of the ceramic

  2. Maximizing utilization of sport halls during peak hours

    DEFF Research Database (Denmark)

    Iversen, Evald Bundgård; Forsberg, Peter

    the number of participants 7.5 persons higher pr. activity compared to club activities. This implies that clubs during peak hours could include more participants. Another possibility to increase utilization is if the management of sport facilities forced sport clubs and other organisers to adapt...... their activities to a smaller amount of floor space, which would make it possible to have more than one activity on the floor at the same time. Hence, to achieve better utilization during prime time, further analysis and research could focus on how activities in sport halls can be adapted to include more......BACKGROUNDDuring peak hours (4.30pm-8pm) demand for timeslots in sport halls in Denmark are high and there are few timeslots available. Further, focus on how public resources are spent most efficient is increasing (Iversen, 2013). This makes it interesting to analyse how utilization could...

  3. RELIABILITY OF THE DETECTION OF THE BARYON ACOUSTIC PEAK

    International Nuclear Information System (INIS)

    MartInez, Vicent J.; Arnalte-Mur, Pablo; De la Cruz, Pablo; Saar, Enn; Tempel, Elmo; Pons-BorderIa, MarIa Jesus; Paredes, Silvestre; Fernandez-Soto, Alberto

    2009-01-01

    The correlation function of the distribution of matter in the universe shows, at large scales, baryon acoustic oscillations, which were imprinted prior to recombination. This feature was first detected in the correlation function of the luminous red galaxies of the Sloan Digital Sky Survey (SDSS). Recently, the final release (DR7) of the SDSS has been made available, and the useful volume is about two times bigger than in the old sample. We present here, for the first time, the redshift-space correlation function of this sample at large scales together with that for one shallower, but denser volume-limited subsample drawn from the Two-Degree Field Redshift Survey. We test the reliability of the detection of the acoustic peak at about 100 h -1 Mpc and the behavior of the correlation function at larger scales by means of careful estimation of errors. We confirm the presence of the peak in the latest data although broader than in previous detections.

  4. In vivo dissolution measurement with indium-111 summation peak ratios

    International Nuclear Information System (INIS)

    Jay, M.; Woodward, M.A.; Brouwer, K.R.

    1985-01-01

    Dissolution of [ 111 In]labeled tablets was measured in vivo in a totally noninvasive manner by using a modification of the perturbed angular correlation technique known as the summation peak ratio method. This method, which requires the incorporation of only 10-12 microCi into the dosage form, provided reliable dissolution data after oral administration of [ 111 In]lactose tablets. These results were supported by in vitro experiments which demonstrated that the dissolution rate as measured by the summation peak ratio method was in close agreement with the dissolution rate of salicylic acid in a [ 111 In]salicylic acid tablet. The method has the advantages of using only one detector, thereby avoiding the need for complex coincidence counting systems, requiring less radioactivity, and being potentially applicable to a gamma camera imaging system

  5. China's "Exported Carbon" Peak: Patterns, Drivers, and Implications

    Science.gov (United States)

    Mi, Zhifu; Meng, Jing; Green, Fergus; Coffman, D'Maris; Guan, Dabo

    2018-05-01

    Over the past decade, China has entered a "new normal" phase in economic development, with its role in global trade flows changing significantly. This study estimates the driving forces of Chinese export-embodied carbon emissions in the new normal phase, based on environmentally extended multiregional input-output modeling and structural decomposition analysis. We find that Chinese export-embodied CO2 emissions peaked in 2008 at a level of 1,657 million tones. The subsequent decline in CO2 emissions was mainly due to the changing structure of Chinese production. The peak in Chinese export-embodied emissions is encouraging from the perspective of global climate change mitigation, as it implies downward pressure on global CO2 emissions. However, more attention should focus on ensuring that countries that may partly replace China as major production bases increase their exports using low-carbon inputs.

  6. Can double-peaked lines indicate merging effects in AGNs?

    Directory of Open Access Journals (Sweden)

    Popović L.Č.

    2000-01-01

    Full Text Available The influence of merging effects in the central part of an Active Galactic Nucleus (AGN on the emission spectral line shapes are discussed. We present a model of close binary Broad Line Region. The numerical experiments show that the merging effects can explain double peaked lines. The merging effects may also be present in the center of AGNs, although they emit slightly asymmetric as well as symmetric and relatively stable (in profile shape spectral lines. Depending on the black hole masses and their orbit elements such model may explain some of the line profile shapes observed in AGNs. This work shows that if one is looking for the merging effects in the central region as well as in the wide field structure of AGNs, he should first pay attention to objects which have double peaked lines.

  7. Power peak in vicinity of WWER-440 control rod

    International Nuclear Information System (INIS)

    Mikus, J.

    2003-01-01

    The measurements of axial power (fission density) distribution have been performed by means of gamma activity determination (gamma scanning method) of the irradiated fuel pins detecting gamma quanta in the La peak area - 1596.5 keV of their selected parts having 20 mm length in the axial coordinates range 50-950 mm with a 10 mm step using a rectangular collimator (dimensions 20x10 mm). Two NaI(Tl) scintillation crystals (one as a monitor) with diameter of 40 mm were used, each of them in Pb shielding (thickness 150 mm). The obtained results enlarge the available 'power peaking database' and enable validation of the codes also in important case of zero-boron concentration that corresponds to the end of WWER-440 fuel cycle. This validation can improve the reliability of the calculation results of the power distribution in WWER-440 cores, re-loading schemes etc

  8. Comparison of System Identification Methods using Ambient Bridge Test Data

    DEFF Research Database (Denmark)

    Andersen, P.; Brincker, Rune; Peeters, B.

    1999-01-01

    In this paper the performance of four different system identification methods is compared using operational data obtained from an ambient vibration test of the Swiss Z24 highway bridge. The four methods are the frequency domain based peak-picking methods, the polyreference LSCE method, the stocha......In this paper the performance of four different system identification methods is compared using operational data obtained from an ambient vibration test of the Swiss Z24 highway bridge. The four methods are the frequency domain based peak-picking methods, the polyreference LSCE method...

  9. Implementing peak load reduction algorithms for household electrical appliances

    International Nuclear Information System (INIS)

    Dlamini, Ndumiso G.; Cromieres, Fabien

    2012-01-01

    Considering household appliance automation for reduction of household peak power demand, this study explored aspects of the interaction between household automation technology and human behaviour. Given a programmable household appliance switching system, and user-reported appliance use times, we simulated the load reduction effectiveness of three types of algorithms, which were applied at both the single household level and across all 30 households. All three algorithms effected significant load reductions, while the least-to-highest potential user inconvenience ranking was: coordinating the timing of frequent intermittent loads (algorithm 2); moving period-of-day time-flexible loads to off-peak times (algorithm 1); and applying short-term time delays to avoid high peaks (algorithm 3) (least accommodating). Peak reduction was facilitated by load interruptibility, time of use flexibility and the willingness of users to forgo impulsive appliance use. We conclude that a general factor determining the ability to shift the load due to a particular appliance is the time-buffering between the service delivered and the power demand of an appliance. Time-buffering can be ‘technologically inherent’, due to human habits, or realised by managing user expectations. There are implications for the design of appliances and home automation systems. - Highlights: ► We explored the interaction between appliance automation and human behaviour. ► There is potential for considerable load shifting of household appliances. ► Load shifting for load reduction is eased with increased time buffering. ► Design, human habits and user expectations all influence time buffering. ► Certain automation and appliance design features can facilitate load shifting.

  10. On intrinsic and extrinsic origin of plasmon peaks

    International Nuclear Information System (INIS)

    Takayama, Shoichi; Kawai, Jun

    2008-01-01

    The origin of the plasmon loss peaks in X-ray photoelectron spectra are discussed based on the (1) intrinsic, (2) extrinsic, (3) quantum interference between (1) and (2), and (4) mixture of (1) and (2). It was believed that the major part of plasmon was due to the extrinsic, the present analysis concludes the major part is intrinsic, depending the excitation energy. This analysis is based on the electron reflection spectra, but valid for X-ray photoelectron spectra. (author)

  11. The need for standardisation of peak flow charts

    OpenAIRE

    Reddel, H; Vincent, S; Civitico, J

    2005-01-01

    Peak expiratory flow (PEF) monitoring is recommended in asthma guidelines as a tool for assessing severity, monitoring response to treatment, detecting exacerbations, identifying triggers, and providing objective justification for treatment to the patient, but some clinicians have expressed concerns about its relevance in the management of asthma. We have identified a sevenfold variation in the scale of existing PEF charts, with resulting wide variation in the appearance of the same PEF date ...

  12. Problems of peak demands in the gas industry

    Energy Technology Data Exchange (ETDEWEB)

    Haeberlin, A

    1979-01-01

    After a brief explanation of the demands made on gas supply enterprises, a discussion of the possibilities of optimization for meeting the demand follows. There are in principle two possibilities for this: the interruption of deliveries which should be made legal in a contract and the use of peak supply plants, especially in the form of gas storages. The procedure is chosen according to the special situation of each gas supply enterprise.

  13. PeakForce Tapping resolves individual microvilli on living cells.

    Science.gov (United States)

    Schillers, Hermann; Medalsy, Izhar; Hu, Shuiqing; Slade, Andrea L; Shaw, James E

    2016-02-01

    Microvilli are a common structure found on epithelial cells that increase the apical surface thus enhancing the transmembrane transport capacity and also serve as one of the cell's mechanosensors. These structures are composed of microfilaments and cytoplasm, covered by plasma membrane. Epithelial cell function is usually coupled to the density of microvilli and its individual size illustrated by diseases, in which microvilli degradation causes malabsorption and diarrhea. Atomic force microscopy (AFM) has been widely used to study the topography and morphology of living cells. Visualizing soft and flexible structures such as microvilli on the apical surface of a live cell has been very challenging because the native microvilli structures are displaced and deformed by the interaction with the probe. PeakForce Tapping® is an AFM imaging mode, which allows reducing tip-sample interactions in time (microseconds) and controlling force in the low pico-Newton range. Data acquisition of this mode was optimized by using a newly developed PeakForce QNM-Live Cell probe, having a short cantilever with a 17-µm-long tip that minimizes hydrodynamic effects between the cantilever and the sample surface. In this paper, we have demonstrated for the first time the visualization of the microvilli on living kidney cells with AFM using PeakForce Tapping. The structures observed display a force dependence representing either the whole microvilli or just the tips of the microvilli layer. Together, PeakForce Tapping allows force control in the low pico-Newton range and enables the visualization of very soft and flexible structures on living cells under physiological conditions. © 2015 The Authors Journal of Molecular Recognition Published by John Wiley & Sons Ltd.

  14. Genetic and Dynamic Analyses of Murine Peak Bone Density

    Science.gov (United States)

    1999-10-01

    bone density in mice. Femurs from young adult B6, C3H, and CAST females at 4 months of age were measured by pQCT (XCT-960M, Norland Med Sys., Ft...progenitor strains - B6, C3H, and CAST - showed that adult skeletal peak BMD was established at 4 months. Therefore, F2 mice were necropsied at 4...calcium depletion causes hypocalcemia , which leads to secondary hyperparathyroidism, subsequently resulting in increased bone resorption. Conversely

  15. BENEFITS OF WILDERNESS EXPANSION WITH EXCESS DEMAND FOR INDIAN PEAKS

    OpenAIRE

    Walsh, Richard G.; Gilliam, Lynde O.

    1982-01-01

    The contingent valuation approach was applied to the problem of estimating the recreation benefits from alleviating congestion at Indian Peaks wilderness area, Colorado. A random sample of 126 individuals were interviewed while hiking and backpacking at the study site in 1979. The results provide an empirical test and confirmation of the Cesario and Freeman proposals that under conditions of excess recreational demand for existing sites, enhanced opportunities to substitute newly designated s...

  16. Peak-counts blood flow model-errors and limitations

    International Nuclear Information System (INIS)

    Mullani, N.A.; Marani, S.K.; Ekas, R.D.; Gould, K.L.

    1984-01-01

    The peak-counts model has several advantages, but its use may be limited due to the condition that the venous egress may not be negligible at the time of peak-counts. Consequently, blood flow measurements by the peak-counts model will depend on the bolus size, bolus duration, and the minimum transit time of the bolus through the region of interest. The effect of bolus size on the measurement of extraction fraction and blood flow was evaluated by injecting 1 to 30ml of rubidium chloride in the femoral vein of a dog and measuring the myocardial activity with a beta probe over the heart. Regional blood flow measurements were not found to vary with bolus sizes up to 30ml. The effect of bolus duration was studied by injecting a 10cc bolus of tracer at different speeds in the femoral vein of a dog. All intravenous injections undergo a broadening of the bolus duration due to the transit time of the tracer through the lungs and the heart. This transit time was found to range from 4-6 second FWHM and dominates the duration of the bolus to the myocardium for up to 3 second injections. A computer simulation has been carried out in which the different parameters of delay time, extraction fraction, and bolus duration can be changed to assess the errors in the peak-counts model. The results of the simulations show that the error will be greatest for short transit time delays and for low extraction fractions

  17. Degradation of the Bragg peak due to inhomogeneities.

    Science.gov (United States)

    Urie, M; Goitein, M; Holley, W R; Chen, G T

    1986-01-01

    The rapid fall-off of dose at the end of range of heavy charged particle beams has the potential in therapeutic applications of sparing critical structures just distal to the target volume. Here we explored the effects of highly inhomogeneous regions on this desirable depth-dose characteristic. The proton depth-dose distribution behind a lucite-air interface parallel to the beam was bimodal, indicating the presence of two groups of protons with different residual ranges, creating a step-like depth-dose distribution at the end of range. The residual ranges became more spread out as the interface was angled at 3 degrees, and still more at 6 degrees, to the direction of the beam. A second experiment showed little significant effect on the distal depth-dose of protons having passed through a mosaic of teflon and lucite. Anatomic studies demonstrated significant effects of complex fine inhomogeneities on the end of range characteristics. Monoenergetic protons passing through the petrous ridges and mastoid air cells in the base of skull showed a dramatic degradation of the distal Bragg peak. In beams with spread out Bragg peaks passing through regions of the base of skull, the distal fall-off from 90 to 20% dose was increased from its nominal 6 to well over 32 mm. Heavy ions showed a corresponding degradation in their ends of range. In the worst case in the base of skull region, a monoenergetic neon beam showed a broadening of the full width at half maximum of the Bragg peak to over 15 mm (compared with 4 mm in a homogeneous unit density medium). A similar effect was found with carbon ions in the abdomen, where the full width at half maximum of the Bragg peak (nominally 5.5 mm) was found to be greater than 25 mm behind gas-soft-tissue interfaces. We address the implications of these data for dose computation with heavy charged particles.

  18. Specific gas turbines for extreme peak-load

    International Nuclear Information System (INIS)

    Bellot, C.

    1992-12-01

    As with other European countries, in France peak consumption of electricity occurs during winter. Due to the increasing use of electricity for domestic heating, outside temperature greatly influences consumption (1 200 MW for a drop of 1 deg C). To meet requirements during cold spells, EDF has sought to determine which special facilities are best suited for extreme peak load conditions (i.e. offering short lifespan and minimum capital cost) and has studied the possibility of installing generation means in transformer substations (20 kV). This solution does not require extension of networks since these means are scattered near consumption areas. An experiment conducted on 3 Diesel generators of 800 kWe each at Senlis revealed some of the disadvantages of Diesel (maintenance requirements, polluting emissions and noise). EDF then examined, for this same application, the use of gas turbines, for which these drawbacks are significantly less. A study carried out under an EDF contract by the French manufacturer TURBOMECA showed that it is possible to design a small capacity gas turbine that can compete with Diesel generators, and that capital costs could be minimized by simplifying the machine, adapting its lifespan to extreme peak load needs, and taking advantage of lower cost provided by mass production. TURBOMECA defined the machine's characteristics (2 MW, 6 000 hours lifespan) and aerodynamic flow. It also estimated the cost of packaging. In terms of overall cost (including initial investment, maintenance and fuel) the gas turbine appears cheaper than Diesel generators for annual operation times of less than one hundred hours, which corresponds closely with extreme peak load use. The lower maintenance costs and the better availability counterbalance the higher capital cost (+6%) and the greater consumption (+50%). (author). 7 figs

  19. EMPIRICALLY DERIVED INTEGRATED STELLAR YIELDS OF Fe-PEAK ELEMENTS

    International Nuclear Information System (INIS)

    Henry, R. B. C.; Cowan, John J.; Sobeck, Jennifer

    2010-01-01

    We present here the initial results of a new study of massive star yields of Fe-peak elements. We have compiled from the literature a database of carefully determined solar neighborhood stellar abundances of seven iron-peak elements, Ti, V, Cr, Mn, Fe, Co, and Ni, and then plotted [X/Fe] versus [Fe/H] to study the trends as functions of metallicity. Chemical evolution models were then employed to force a fit to the observed trends by adjusting the input massive star metallicity-sensitive yields of Kobayashi et al. Our results suggest that yields of Ti, V, and Co are generally larger as well as anticorrelated with metallicity, in contrast to the Kobayashi et al. predictions. We also find the yields of Cr and Mn to be generally smaller and directly correlated with metallicity compared to the theoretical results. Our results for Ni are consistent with theory, although our model suggests that all Ni yields should be scaled up slightly. The outcome of this exercise is the computation of a set of integrated yields, i.e., stellar yields weighted by a slightly flattened time-independent Salpeter initial mass function and integrated over stellar mass, for each of the above elements at several metallicity points spanned by the broad range of observations. These results are designed to be used as empirical constraints on future iron-peak yield predictions by stellar evolution modelers. Special attention is paid to the interesting behavior of [Cr/Co] with metallicity-these two elements have opposite slopes-as well as the indirect correlation of [Ti/Fe] with [Fe/H]. These particular trends, as well as those exhibited by the inferred integrated yields of all iron-peak elements with metallicity, are discussed in terms of both supernova nucleosynthesis and atomic physics.

  20. Automatic acquisition and shape analysis of metastable peaks

    International Nuclear Information System (INIS)

    Maendli, H.; Robbiani, R.; Kuster, Th.; Seibl, J.

    1979-01-01

    A method for automatic acquisition and evaluation of metastable peaks due to transitions in the first field-free region of a double focussing mass spectrometer is presented. The data are acquired by computer-controlled repetitive scanning of the accelerating voltage and concomitant accumulation, the evaluation made by a mathematical derivatization of the resulting curve. Examples for application of the method are given. (Auth.)

  1. Bulk power system performance issues affecting utility peaking capacity additions

    Energy Technology Data Exchange (ETDEWEB)

    Garrity, T.F. [GE Power Sytems, Schenectady, NY (United States)

    1994-12-31

    This paper presents a discussion of transmission system constraints and problems that affect the siting and rating of peaking capacity additions. Techniques for addressing and modifying these concerns are presented. Particular attention is paid to techniques that have been successfully used by utilities to improve power transfer and system loadability, while avoiding the construction of additional transmission lines. Proven techniques for dealing with thermal, short-circuit level and stability issues are presented.

  2. Medium Term Economic Effects of Peak Oil Today

    OpenAIRE

    Dr. Ulrike Lehr; Dr. Christian Lutz; Kirsten Wiebe

    2011-01-01

    The paper at hand presents results of a model-based scenario analysis on the economic implications in the next decade of an oil peak today and significantly decreasing oil production in the coming years. For that the extraction paths of oil and other fossil fuels given in LBST (2010) are implemented in the global macroeconomic model GINFORS. Additionally, the scenarios incorporate different technological potentials for energy efficiency and renewable energy, which cannot be forecast using eco...

  3. Cranial Indicators Identified for Peak Incidence of Otitis Media.

    Science.gov (United States)

    Pagano, Anthony S; Wang, Eugene; Yuan, Derek; Fischer, Daniel; Bluestone, Charles; Marquez, Samuel; Laitman, Jeffrey

    2017-10-01

    Acute otitis media (AOM) is one of the most common pediatric conditions worldwide. Peak age of occurrence for AOM has been identified within the first postnatal year and it remains frequent until approximately six postnatal years. Morphological differences between adults and infants in the cartilaginous Eustachian tube (CET) and associated structures may be responsible for development of this disease yet few have investigated normal growth trajectories. We tested hypotheses on coincidence of skeletal growth changes and known ages of peak AOM occurrence. Growth was divided into five dental eruption stages ranging from edentulous neonates (Stage 1) to adults with erupted third maxillary molars (Stage 5). A total of 32 three-dimensional landmarks were used and Generalized Procrustes Analysis was performed. Next, we performed principal components analysis and calculated univariate measures. It was found that growth change in Stage 1 was the most rapid and comprised the largest amount of overall growth in upper respiratory tract proportions (where time is represented by the natural logarithmic transformation of centroid size). The analysis of univariate measures showed that Stage 1 humans did indeed possess the relatively shortest and most horizontally oriented CET's with the greatest amount of growth change occurring at the transition to Stage 2 (eruption of deciduous dentition at five postnatal months, commencing peak AOM incidence) and ceasing by Stage 3 (approximately six postnatal years). Skeletal indicators appear related to peak ages of AOM incidence and may contribute to understanding of a nearly ubiquitous human disease. Anat Rec, 2017. © 2017 Wiley Periodicals, Inc. Anat Rec, 300:1721-1740, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  4. Analytical solutions for peak and residual uplift resistance of pipelines

    Energy Technology Data Exchange (ETDEWEB)

    Nixon, J.F. [Nixon Geotech Ltd., Calgary, AB (Canada); Oswell, J.M. [Naviq Consulting Inc., Calgary, AB (Canada)

    2010-07-01

    Frost heave can occur on cold pipelines that traverse unfrozen, non permafrost terrain. The stresses experienced by the pipeline are partly a function of the strength of the soil on the non heaving side of the frozen-unfrozen interface. This paper proposed three analytical solutions to estimate the soil uplift resistance by considering the pipeline and soil to act similar to a strip footing, a punching shear failure, and by considering the formation of horizontal crack emanating from the spring line of the pipe. Peak uplift resistance and residual uplift resistance were discussed. Results for full scale pipe and for laboratory scale model pipes were presented, with particular reference to cover depth, temperature and crack width; and limits to residual uplift resistance. It was concluded that the peak uplift resistance and the residual uplift resistance are generally independent and controlled by different factors. The peak resistance is related directly to pipe diameter, and less strongly dependent on springline depth. It is also strongly dependent on soil temperature. However, the residual uplift resistance is strongly dependent on burial depth, weakly dependent on pipe displacement rate and also on soil temperature. 15 refs., 19 figs.

  5. High peak power tubes and gate effect Klystrons

    International Nuclear Information System (INIS)

    Gerbelot, N.; Bres, M.; Faillon, G.; Buzzi, J.M.

    1993-01-01

    The conventional microwave tubes such as TWTs, Magnetrons, Klystrons... deliver the very high peak powers which are required by radar transmitters but more especially by many particle accelerators. In the range of a few hundred MHz to about 10 GHz, some dozen of MWs per unit are currently obtained and commercially available, according to the frequency and the pulse lengths. But peak power requirements are ever increasing, especially for the expected new linear particle acceleratores, where several hundred MWs per tube would be necessary. Also some special military transmitters begin to request GW pulses, with short pulse lengths - of course - but at nonnegligible repetition rates. Therefore several laboratories and microwave vacuum tube manufacturers have engaged - for several years - studies and development in the field of very high peak microwave power (HPM) toward two main directions: extended operation and extrapolation of the conventional tubes and devices; development of new concepts, among which the most promising are likely the high-current relativistic klystrons - that are also referred to as gate effect klystrons

  6. Mineral Resources: Reserves, Peak Production and the Future

    Directory of Open Access Journals (Sweden)

    Lawrence D. Meinert

    2016-02-01

    Full Text Available The adequacy of mineral resources in light of population growth and rising standards of living has been a concern since the time of Malthus (1798, but many studies erroneously forecast impending peak production or exhaustion because they confuse reserves with “all there is”. Reserves are formally defined as a subset of resources, and even current and potential resources are only a small subset of “all there is”. Peak production or exhaustion cannot be modeled accurately from reserves. Using copper as an example, identified resources are twice as large as the amount projected to be needed through 2050. Estimates of yet-to-be discovered copper resources are up to 40-times more than currently-identified resources, amounts that could last for many centuries. Thus, forecasts of imminent peak production due to resource exhaustion in the next 20–30 years are not valid. Short-term supply problems may arise, however, and supply-chain disruptions are possible at any time due to natural disasters (earthquakes, tsunamis, hurricanes or political complications. Needed to resolve these problems are education and exploration technology development, access to prospective terrain, better recycling and better accounting of externalities associated with production (pollution, loss of ecosystem services and water and energy use.

  7. MERGERS IN DOUBLE-PEAKED [O III] ACTIVE GALACTIC NUCLEI

    International Nuclear Information System (INIS)

    Fu Hai; Djorgovski, S. G.; Myers, Adam D.; Yan Lin

    2011-01-01

    As a natural consequence of galaxy mergers, binary active galactic nuclei (AGNs) should be commonplace. Nevertheless, observational confirmations are rare, especially for binaries with separations less than 10 kpc. Such a system may show two sets of narrow emission lines in a single spectrum owing to the orbital motion of the binary. We have obtained high-resolution near-infrared images of 50 double-peaked [O III]λ5007 AGNs with the Keck II laser guide star adaptive optics system. The Sloan Digital Sky Survey sample is compiled from the literature and consists of 17 type-1 AGNs between 0.18 BH -σ * relation because of overestimated stellar velocity dispersions, illustrating the importance of removing mergers from the samples defining the M BH -σ * relations. Finally, we find that the emission-line properties are indistinguishable for spatially resolved and unresolved sources, emphasizing that scenarios involving a single AGN can produce the same double-peaked line profiles and they account for at least 70% of the double-peaked [O III] AGNs.

  8. Martial arts striking hand peak acceleration, accuracy and consistency.

    Science.gov (United States)

    Neto, Osmar Pinto; Marzullo, Ana Carolina De Miranda; Bolander, Richard P; Bir, Cynthia A

    2013-01-01

    The goal of this paper was to investigate the possible trade-off between peak hand acceleration and accuracy and consistency of hand strikes performed by martial artists of different training experiences. Ten male martial artists with training experience ranging from one to nine years volunteered to participate in the experiment. Each participant performed 12 maximum effort goal-directed strikes. Hand acceleration during the strikes was obtained using a tri-axial accelerometer block. A pressure sensor matrix was used to determine the accuracy and consistency of the strikes. Accuracy was estimated by the radial distance between the centroid of each subject's 12 strikes and the target, whereas consistency was estimated by the square root of the 12 strikes mean squared distance from their centroid. We found that training experience was significantly correlated to hand peak acceleration prior to impact (r(2)=0.456, p =0.032) and accuracy (r(2)=0. 621, p=0.012). These correlations suggest that more experienced participants exhibited higher hand peak accelerations and at the same time were more accurate. Training experience, however, was not correlated to consistency (r(2)=0.085, p=0.413). Overall, our results suggest that martial arts training may lead practitioners to achieve higher striking hand accelerations with better accuracy and no change in striking consistency.

  9. The bias of weighted dark matter halos from peak theory

    CERN Document Server

    Verde, Licia; Simpson, Fergus; Alvarez-Gaume, Luis; Heavens, Alan; Matarrese, Sabino

    2014-01-01

    We give an analytical form for the weighted correlation function of peaks in a Gaussian random field. In a cosmological context, this approach strictly describes the formation bias and is the main result here. Nevertheless, we show its validity and applicability to the evolved cosmological density field and halo field, using Gaussian random field realisations and dark matter N-body numerical simulations. Using this result from peak theory we compute the bias of peaks (and dark matter halos) and show that it reproduces results from the simulations at the ${\\mathcal O}(10\\%)$ level. Our analytical formula for the bias predicts a scale-dependent bias with two characteristics: a broad band shape which, however, is most affected by the choice of weighting scheme and evolution bias, and a more robust, narrow feature localised at the BAO scale, an effect that is confirmed in simulations. This scale-dependent bias smooths the BAO feature but, conveniently, does not move it. We provide a simple analytic formula to des...

  10. Predictors of the peak width for networks with exponential links

    Science.gov (United States)

    Troutman, B.M.; Karlinger, M.R.

    1989-01-01

    We investigate optimal predictors of the peak (S) and distance to peak (T) of the width function of drainage networks under the assumption that the networks are topologically random with independent and exponentially distributed link lengths. Analytical results are derived using the fact that, under these assumptions, the width function is a homogeneous Markov birth-death process. In particular, exact expressions are derived for the asymptotic conditional expectations of S and T given network magnitude N and given mainstream length H. In addition, a simulation study is performed to examine various predictors of S and T, including N, H, and basin morphometric properties; non-asymptotic conditional expectations and variances are estimated. The best single predictor of S is N, of T is H, and of the scaled peak (S divided by the area under the width function) is H. Finally, expressions tested on a set of drainage basins from the state of Wyoming perform reasonably well in predicting S and T despite probable violations of the original assumptions. ?? 1989 Springer-Verlag.

  11. A new record peak luminosity for the LHC

    CERN Multimedia

    CERN Bulletin

    2010-01-01

    Two weeks of dedicated machine development paid off last weekend when the LHC ran for physics with three nominal intensity (∼1011 protons) bunches in each beam.   This brought a new record peak luminosity of around 8×1029 cm-2 s-1, and allowed the LHC to double the integrated luminosity delivered to the experiments since 30 March from 16 to 32 inverse nanobarns over the weekend. After a few more fills in this configuration, the number of bunches will be raised to six per beam, which will in turn allow the peak luminosity to break the 1030 cm-2 s-1 barrier for the first time, well on the way to achieving the 2010 objective of 1032 cm-2 s-1. This peak luminosity goal requires 800 nominal bunches per beam squeezed to a beta of 3.5 metres. The plan for 2011 is to run the LHC in this configuration over about 10 months, thus achieving the objective of recording one inverse femtobarn of data in total. The machine development period also allowed the TOTEM detectors to be set up with 45...

  12. Peak reduction for commercial buildings using energy storage

    Science.gov (United States)

    Chua, K. H.; Lim, Y. S.; Morris, S.

    2017-11-01

    Battery-based energy storage has emerged as a cost-effective solution for peak reduction due to the decrement of battery’s price. In this study, a battery-based energy storage system is developed and implemented to achieve an optimal peak reduction for commercial customers with the limited energy capacity of the energy storage. The energy storage system is formed by three bi-directional power converter rated at 5 kVA and a battery bank with capacity of 64 kWh. Three control algorithms, namely fixed-threshold, adaptive-threshold, and fuzzy-based control algorithms have been developed and implemented into the energy storage system in a campus building. The control algorithms are evaluated and compared under different load conditions. The overall experimental results show that the fuzzy-based controller is the most effective algorithm among the three controllers in peak reduction. The fuzzy-based control algorithm is capable of incorporating a priori qualitative knowledge and expertise about the load characteristic of the buildings as well as the useable energy without over-discharging the batteries.

  13. Noise distribution of a peak track and hold circuit

    International Nuclear Information System (INIS)

    Seller, Paul; Hardie, Alec L.; Morrissey, Quentin

    2012-01-01

    Noise in linear electronic circuits is well characterised in terms of power spectral density in the frequency domain and the Normal probability density function in the time domain. For instance a charge preamplifier followed by a simple time independent pulse shaping circuit produces an output with a predictable, easily calculated Normal density function. By the Ergodic Principle this is true if the signal is sampled randomly in time or the experiment is run many times and measured at a fixed time after the circuit is released from reset. Apart from well defined cases, the time of the sample after release of reset does not affect the density function. If this signal is then passed through a peak track-and-hold circuit the situation is very different. The probability density function of the sampled signal is no longer Normal and the function changes with the time of the sample after release of reset. This density function can be classified by the Gumbel probability density function which characterises the Extreme Value Distribution of a defined number of Normally distributed values. The number of peaks in the signal is an important factor in the analysis. This issue is analysed theoretically and compared with a time domain noise simulation programme. This is then related to a real electronic circuit used for low-noise X-ray measurements and shows how the low-energy resolution of this system is significantly degraded when using a peak track-and-hold.

  14. The GRB variability/peak luminosity correlation: new results

    International Nuclear Information System (INIS)

    Guidorzi, C.; Rossi, F.; Hurley, K.; Mundell, C.G.

    2005-01-01

    We test the correlation between time variability and isotropic-equivalent peak luminosity found by Reichart et al. (ApJ, 552 (2001) 57) using a set of 26 Gamma-Ray Bursts (GRBs) with known redshift. We confirm the correlation, thought with a larger spread around the best-fit power-law obtained by Reichart et al. which in turn does not provide an acceptable description any longer. In addiction, we find no evidence for correlation between variability and beaming-corrected peak luminosity for a subset of 14 GRBs whose beaming angles have been taken from Ghirlanda et al. (ApJ, 616 (2004) 331). Finally, we investigate the possible connection for some GRBs between the location in the variability/peak luminosity space and some afterglow properties, such as the detectability in the optical band, by adding some GRBs whose redshifts, unknown from direct measurements, have been derived assuming the Amati at al. (AeA, 390 (2002) 81) relationship

  15. Physical performance and peak aerobic power at different body temperatures.

    Science.gov (United States)

    Bergh, U; Ekblom, B

    1979-05-01

    In eight male subjects we studied the effect of different core (esophageal, (Tes 34.9--38.4 degrees C) and muscle (Tm 35.1--39.3 degrees C) temperature on 1) physical performance (time to exhaustion at a standard maximal rate of work, WT), 2) aerobic power (VO2), 3) heart rate (HR), and 4) blood lactate (LA) concentration during exhaustive combined arm and leg exercise. In three subjects the effects at different mean skin temperatures (Tsk 27 and 31 degrees C, respectively) were also studied. Peak VO2 was positively correlated to both Tes (r = 0.88) and Tm (r = 0.91). None of the subjects attained control VO2max at Tes and Tm lower than 37.5 and 38.0 degrees C, respectively. HR was correlated to both Tes (r = 0.97) and Tm (r = 0.95). Different Tsk did not affect peak VO2 and HR at subnormal body temperatures. Pulmonary ventilation was independent of Tes and Tm in all experimental situations. LA was significantly higher at Tes 37.5 degrees C compared to both Tes 34.9 and 38.5 degrees C, respectively. At Tes less than 37.5 degrees C and Tm less than 38.0 degrees C, there was a linear reduction in WT (20%.degrees C-1), peak VO2 (5--6%.degrees C-1), and HR (8 beats.min-1.degrees C-1) with lowered Tes and Tm.

  16. Climate change and peak demand for electricity: Evaluating policies for reducing peak demand under different climate change scenarios

    Science.gov (United States)

    Anthony, Abigail Walker

    This research focuses on the relative advantages and disadvantages of using price-based and quantity-based controls for electricity markets. It also presents a detailed analysis of one specific approach to quantity based controls: the SmartAC program implemented in Stockton, California. Finally, the research forecasts electricity demand under various climate scenarios, and estimates potential cost savings that could result from a direct quantity control program over the next 50 years in each scenario. The traditional approach to dealing with the problem of peak demand for electricity is to invest in a large stock of excess capital that is rarely used, thereby greatly increasing production costs. Because this approach has proved so expensive, there has been a focus on identifying alternative approaches for dealing with peak demand problems. This research focuses on two approaches: price based approaches, such as real time pricing, and quantity based approaches, whereby the utility directly controls at least some elements of electricity used by consumers. This research suggests that well-designed policies for reducing peak demand might include both price and quantity controls. In theory, sufficiently high peak prices occurring during periods of peak demand and/or low supply can cause the quantity of electricity demanded to decline until demand is in balance with system capacity, potentially reducing the total amount of generation capacity needed to meet demand and helping meet electricity demand at the lowest cost. However, consumers need to be well informed about real-time prices for the pricing strategy to work as well as theory suggests. While this might be an appropriate assumption for large industrial and commercial users who have potentially large economic incentives, there is not yet enough research on whether households will fully understand and respond to real-time prices. Thus, while real-time pricing can be an effective tool for addressing the peak load

  17. Automated Critical Peak Pricing Field Tests: Program Descriptionand Results

    Energy Technology Data Exchange (ETDEWEB)

    Piette, Mary Ann; Watson, David; Motegi, Naoya; Kiliccote, Sila; Xu, Peng

    2006-04-06

    California utilities have been exploring the use of critical peak prices (CPP) to help reduce needle peaks in customer end-use loads. CPP is a form of price-responsive demand response (DR). Recent experience has shown that customers have limited knowledge of how to operate their facilities in order to reduce their electricity costs under CPP (Quantum 2004). While the lack of knowledge about how to develop and implement DR control strategies is a barrier to participation in DR programs like CPP, another barrier is the lack of automation of DR systems. During 2003 and 2004, the PIER Demand Response Research Center (DRRC) conducted a series of tests of fully automated electric demand response (Auto-DR) at 18 facilities. Overall, the average of the site-specific average coincident demand reductions was 8% from a variety of building types and facilities. Many electricity customers have suggested that automation will help them institutionalize their electric demand savings and improve their overall response and DR repeatability. This report focuses on and discusses the specific results of the Automated Critical Peak Pricing (Auto-CPP, a specific type of Auto-DR) tests that took place during 2005, which build on the automated demand response (Auto-DR) research conducted through PIER and the DRRC in 2003 and 2004. The long-term goal of this project is to understand the technical opportunities of automating demand response and to remove technical and market impediments to large-scale implementation of automated demand response (Auto-DR) in buildings and industry. A second goal of this research is to understand and identify best practices for DR strategies and opportunities. The specific objectives of the Automated Critical Peak Pricing test were as follows: (1) Demonstrate how an automated notification system for critical peak pricing can be used in large commercial facilities for demand response (DR). (2) Evaluate effectiveness of such a system. (3) Determine how customers

  18. Bayesian statistical evaluation of peak area measurements in gamma spectrometry

    International Nuclear Information System (INIS)

    Silva, L.; Turkman, A.; Paulino, C.D.

    2010-01-01

    We analyze results from determinations of peak areas for a radioactive source containing several radionuclides. The statistical analysis was performed using Bayesian methods based on the usual Poisson model for observed counts. This model does not appear to be a very good assumption for the counting system under investigation, even though it is not questioned as a whole by the inferential procedures adopted. We conclude that, in order to avoid incorrect inferences on relevant quantities, one must proceed to a further study that allows us to include missing influence parameters and to select a model explaining the observed data much better.

  19. Periodic permanent magnet focusing system with high peak field

    International Nuclear Information System (INIS)

    Zhang Hong; Liu Weiwei; Bai Shuxin; Chen Ke

    2008-01-01

    In this study, hybrid periodic permanent magnet (PPM) system is studied, which has high axial magnetic field and low magnetic leakage. By simulation computation, some laws of magnetic field distribution vs. structure dimensions were obtained. A hybrid PPM is designed and constructed whose peak field reaches 0.6 T. The factors inducing discrepancies between computational results and practical measurements are analyzed. The magnetic field distribution is very sensitive to the variations of constructional parameters. Construction accuracy greatly influences the magnetic field distribution. Research results obtained here are potentially valuable for future work

  20. Numerical simulation of meteorological conditions for peak pollution in Paris

    Energy Technology Data Exchange (ETDEWEB)

    Carissimo, B. [Electricite de France (EDF), 78 - Chatou (France). Direction des Etudes et Recherches

    1997-06-01

    Results obtained on the simulation of meteorological conditions during two episodes of peak pollution in Paris are presented, one in the winter, the other in the summer. The A3UR air quality modelling system is first described followed by the MERCURE mesoscale meteorological model. The conditions of simulation are described. The results obtained on these two causes show satisfactory agreement, for example on the magnitude of the urban heat island which is correctly reproduced. In this study, several areas of progress have been identified: improvement of the altitude measurement network around cities, the simulation of light wind conditions and the simulation of formation and dissipation of fog. (author) 24 refs.

  1. Kinetic energy storage of off-peak electricity

    International Nuclear Information System (INIS)

    Simpson, L.A.; Oldaker, I.E.; Stermscheg, J.

    1975-09-01

    The concept of using large flywheels to store off-peak electricity has been considered. The development of high strength composite materials has made possible improvements in the energy storage capacity of such devices. The problems involved in designing large flywheels and their economic advantages over alternative means of energy storage are discussed. The economic arguments are based on the present or near future capabilities and costs of structural composite materials. The flywheel costs turn out to be considerably higher than for many alternative schemes including advanced batteries, gas turbine generators and pumped storage schemes. (author)

  2. Ultrafast, ultrahigh-peak power Ti:sapphire laser system

    Energy Technology Data Exchange (ETDEWEB)

    Yamakawa, Koichi; Aoyama, Makoto; Matsuoka, Shinichi; Akahane, Yutaka; Kase, Teiji; Nakano, Fumihiko; Sagisaka, Akito [Advanced Photon Research Center, Kansai Research Establishment, Japan Atomic Energy Research Inst., Kizu, Kyoto (Japan)

    2001-01-01

    We review progress in the generation of multiterawatt optical pulses in the 10-fs range. We describe a design, performance and characterization of a Ti:sapphire laser system based on chirped-pulse amplification, which has produced a peak power in excess of 100-TW with sub-20-fs pulse durations and an average power of 19-W at a 10-Hz repetition rate. We also discuss extension of this system to the petawatt power level and potential applications in the relativistic, ultrahigh intensity regimes. (author)

  3. Transverse Polarization for Energy Calibration at the Z peak

    CERN Document Server

    Koratzinos, M

    2015-01-01

    In this paper we deal with aspects of transverse polarization for the purpose of energy calibration of proposed circular colliders like the FCC-ee and the CEPC. The main issues of such a measurement will be discussed. The possibility of using this method to accurately determine the energy at the WW threshold as well as the Z peak will be addressed. The use of wigglers for reducing long polarization times will be discussed and a possible strategy will be presented for minimising the energy uncertainty error in these large machines.

  4. Power peak in vicinity of WWER-440 control assembly

    International Nuclear Information System (INIS)

    Mikus, J.

    2002-01-01

    This paper presents information concerning the WWER-440 local power peaking problem induced by a control assembly and corresponding investigation possibilities on the light-water zero-power reactor LR-O at the Nuclear Research Institute Rez plc. Brief description of the disposable CA model, experimental arrangement and conditions on the LR-O reactor, preparation of the relevant measurements in the WWER-440 type cores with CA model, as well as some preliminary results of the fission density distribution obtained in a core without boron and with fuel assemblies having profiled enrichment are mentioned too (Author)

  5. FAST MUSIC SPECTRUM PEAK SEARCH VIA METROPOLIS-HASTINGS SAMPLER

    Institute of Scientific and Technical Information of China (English)

    Guo Qinghua; Liao Guisheng

    2005-01-01

    A fast MUltiple SIgnal Classification (MUSIC) spectrum peak search algorithm is devised, which regards the power of the MUSIC spectrum function as target distribution up to a constant of proportionality, and uses Metropolis-Hastings (MH) sampler, one of the most popular Markov Chain Monte Carlo (MCMC) techniques, to sample from it. The proposed method reduces greatly the tremendous computation and storage costs in conventional MUSIC techniques i.e., about two and four orders of magnitude in computation and storage costs under the conditions of the experiment in the paper respectively.

  6. Simultaneous EEG and EMG biofeedback for peak performance in musicians.

    Science.gov (United States)

    Markovska-Simoska, Silvana; Pop-Jordanova, Nada; Georgiev, Dejan

    2008-07-01

    The aim of this study was to determine the effects of alpha neurofeedback and EMG biofeedback protocols for improvement of musical performance in violinists. The sample consisted of 12 music students (10 violinists and 2 viola players) from the Faculty of Music, Skopje (3 males, mean age of 20 +/- 0 and 9 females, mean age = 20.89 +/- 2.98). Six of them had a low alpha peak frequency (APF) ( 10 Hz). The sample was randomized in two groups. The students from the experimental group participated in 20 sessions of biofeedback (alpha/EMG), combined with music practice, while the students from the control group did only music practice. Average absolute power, interhemispheric coherence in the alpha band, alpha peak frequency (APF), individual alpha band width (IABW), amount of alpha suppression (AAS) and surface forehead integrated EMG power (IEMG), as well as a score on musical performance and inventories measuring anxiety, were assessed. Alpha-EEG/EMG-biofeedback was associated with a significant increase in average alpha power, APF and IABW in all the participants and with decreases in IEMG only in high-APF musicians. The biofeedback training success was positively correlated with the alpha power, IcoH, APF, IABW and baseline level of APF and IABW. Alpha-EEG/EMG biofeedback is capable of increasing voluntary self-regulation and the quality of musical performance. The efficiency of biofeedback training depends on the baseline EEG alpha activity status, in particular the APF.

  7. Gas inventory charges and peak-load reliability

    International Nuclear Information System (INIS)

    Lyon, T.P.; Hackett, S.C.

    1990-01-01

    The natural gas industry has historically been organized through a vertical sequence of long-term contracts, the first between wellhead producer and pipeline, and the second between pipeline and local distribution company (LDC). These long-term contracts contained provisions, variously called take-or-pay (TOP) clauses or minimum bills, that required buyers to pay for a minimum level of supply in all later time periods, regardless of the buyers' actual demand requirements. As a result, the pipeline's purchase obligation was typically offset by the distributor's purchase obligation, so that the pipeline essentially passed the minimum purchase requirement directly from producer to distributor. The authors focus on the role GICs (Gas Inventory Charges) can play in the provision of peak-load reliability, and the effects of GICs and their treatment by regulators on pipeline system design. In particular, they compare the various options available to local distribution companies (LDCs) for providing peak-load reliability, emphasizing the alternative downstream storage. They find that the ratemaking decisions of state regulators may distort LDC choices between different gas supply options, inducing what may be an inefficient demand for new storage facilities. GICs, when competitively prices, offer state regulators a means of circumventing these distortions

  8. Turbulence Hazard Metric Based on Peak Accelerations for Jetliner Passengers

    Science.gov (United States)

    Stewart, Eric C.

    2005-01-01

    Calculations are made of the approximate hazard due to peak normal accelerations of an airplane flying through a simulated vertical wind field associated with a convective frontal system. The calculations are based on a hazard metric developed from a systematic application of a generic math model to 1-cosine discrete gusts of various amplitudes and gust lengths. The math model simulates the three degree-of- freedom longitudinal rigid body motion to vertical gusts and includes (1) fuselage flexibility, (2) the lag in the downwash from the wing to the tail, (3) gradual lift effects, (4) a simplified autopilot, and (5) motion of an unrestrained passenger in the rear cabin. Airplane and passenger response contours are calculated for a matrix of gust amplitudes and gust lengths. The airplane response contours are used to develop an approximate hazard metric of peak normal accelerations as a function of gust amplitude and gust length. The hazard metric is then applied to a two-dimensional simulated vertical wind field of a convective frontal system. The variations of the hazard metric with gust length and airplane heading are demonstrated.

  9. Dating human DNA with the 14C bomb peak

    Energy Technology Data Exchange (ETDEWEB)

    Kutschera, Walter; Liebl, Jakob; Steier, Peter [VERA Laboratory, University of Vienna, Vienna (Austria)

    2013-07-01

    In 1963 the limited nuclear test ban treaty stopped nuclear weapons testing in the atmosphere. By then the addition from bomb-produced {sup 14}C had doubled the {sup 14}C content of the atmosphere. Through the CO{sub 2} cycle this excess exchanged with the hydrosphere and biosphere leading to a rapidly decreasing {sup 14}C level in the atmosphere. Today we are almost back to the pre-nuclear level. As a consequence all people on Earth who lived during the second half of the 20th century were exposed to this rapidly changing {sup 14}C signal. A few years ago, a group at the Department of Cell and Molecular Biology of the Karolinska Institute in Stockholm started to use the {sup 14}C bomb peak signal in DNA to determine retrospectively the age of cells from various parts of the human body (brain, heart, fat). In a collaboration with this group, we have studied the age of olfactory bulb neurons in the human brain. For this investigation, {sup 14}C AMS measurements were developed at VERA for very small carbon samples in the range from 2 to 4 micrograms. In the presentation the general concept of {sup 14}C bomb peak dating of human DNA and several applications are discussed.

  10. Using Energy Peaks to Measure New Particle Masses

    CERN Document Server

    Agashe, Kaustubh; Kim, Doojin

    2014-01-01

    We discussed in arXiv:1209.0772 that the laboratory frame distribution of the energy of a massless particle from a two-body decay at a hadron collider has a peak whose location is identical to the value of this daughter's (fixed) energy in the rest frame of the corresponding mother particle. For that result to hold we assumed that the mother is unpolarized and has a generic boost distribution in the laboratory frame. In this work we discuss how this observation can be applied for determination of masses of new particles, without requiring a full reconstruction of their decay chains or information about the rest of the event. We focus on a two-step cascade decay of a massive particle that has one invisible particle in the final state: C -> Bb -> Aab, where C, B and A are new particles of which A is invisible and a, b are visible particles. Combining the measurements of the peaks of energy distributions of a and b with that of the edge in their invariant mass distribution, we demonstrate that it is in principle...

  11. Acetaminophen overdose associated with double serum concentration peaks

    Directory of Open Access Journals (Sweden)

    Cristian Papazoglu

    2015-12-01

    Full Text Available Acetaminophen is the most commonly used analgesic–antipyretic medication in the United States. Acetaminophen overdose, a frequent cause of drug toxicity, has been recognized as the leading cause of fatal and non-fatal hepatic necrosis. N-Acetylcysteine is the recommended antidote for acetaminophen poisoning. Despite evidence on the efficacy of N-acetylcysteine for prevention of hepatic injury, controversy persists about the optimal duration of the therapy. Here, we describe the case of a 65-year-old male with acetaminophen overdose and opioid co-ingestion who developed a second peak in acetaminophen serum levels after completing the recommended 21-hour intravenous N-acetylcysteine protocol and when the standard criteria for monitoring drug levels was achieved. Prolongation of N-acetylcysteine infusion beyond the standard protocol, despite a significant gap in treatment, was critical for successful avoidance of hepatotoxicity. Delay in acetaminophen absorption may be associated with a second peak in serum concentration following an initial declining trend, especially in cases of concomitant ingestion of opioids. In patients with acetaminophen toxicity who co-ingest other medications that may potentially delay gastric emptying or in those with risk factors for delayed absorption of acetaminophen, we recommend close monitoring of aminotransferase enzyme levels, as well as trending acetaminophen concentrations until undetectable before discontinuing the antidote therapy.

  12. Peaking for optimal performance: Research limitations and future directions.

    Science.gov (United States)

    Pyne, David B; Mujika, Iñigo; Reilly, Thomas

    2009-02-01

    A key element of the physical preparation of athletes is the taper period in the weeks immediately preceding competition. Existing research has defined the taper, identified various forms used in contemporary sport, and examined the prescription of training volume, load, intensity, duration, and type (progressive or step). Current limitations include: the lack of studies on team, combative, racquet, and precision (target) sports; the relatively small number of randomized controlled trials; the narrow focus on a single competition (single peak) compared with multiple peaking for weekly, multi-day or multiple events; and limited understanding of the physiological, neuromuscular, and biomechanical basis of the taper. Future research should address these limitations, together with the influence of prior training on optimal tapering strategies, and the interactions between the taper and long-haul travel, heat, and altitude. Practitioners seek information on how to prescribe tapers from season to season during an athlete's career, or a team's progression through a domestic league season, or multi-year Olympic or World Cup cycle. Practical guidelines for planning effective tapers for the Vancouver 2010 and London 2012 Olympics will evolve from both experimental investigations and modelling of successful tapers currently employed in a wide range of sports.

  13. Effective climate-energy solutions, escape routes and peak oil

    International Nuclear Information System (INIS)

    Bergh, Jeroen C.J.M. van den

    2012-01-01

    Many well-intended climate-energy strategies are ineffective in the absence of serious environmental regulation. This holds, among others, for direct support of clean energy, voluntary energy conservation, technical standards on a limited set of products, unilateral stringent carbon pricing, and awaiting peak oil as a climate strategy. All of these suffer from “escape routes” that indirectly increase CO 2 emissions and thus make the original strategy ineffective. On the other hand, environmental regulation alone may lead to a myopia-bias, stimulating early dominance of cost-effective technologies and a focus on incremental innovations associated with such technologies rather than on radical innovations. Although adopting a partial viewpoint keeps the analysis simple, we urgently need a more inclusive systems perspective on climate solutions. This will allow the formulation of an effective climate policy package that addresses the various escape routes. - Highlights: ► Many well-intended climate-energy strategies are ineffective because of escape routes. ► In this context the relationship between peak oil and climate policy receives attention. ► Environmental regulation alone creates myopia-bias, the resolution of which requires technology-specific policies. ► To formulate an effective climate policy package an inclusive systems perspective is needed.

  14. GRB physics and cosmology with peak energy-intensity correlations

    Energy Technology Data Exchange (ETDEWEB)

    Sawant, Disha, E-mail: sawant@fe.infn.it [University of Ferrara, Via Saragat-1, Block C, Ferrara 44122 (Italy); University of Nice, 28 Avenue Valrose, Nice 06103 (France); IRAP Erasmus PhD Program, European Union and INAF - IASF Bologna, Via P. Gobetti 101, Bologna 41125 (Italy); Amati, Lorenzo, E-mail: amati@iasfbo.inaf.it [INAF - IASF Bologna, Via P. Gobetti 101, Bologna 41125 (Italy); ICRANet, Piazzale Aldo Moro-5, Rome 00185 (Italy)

    2015-12-17

    Gamma Ray Bursts (GRBs) are immensely energetic explosions radiating up to 10{sup 54} erg of energy isotropically (E{sub iso}) and they are observed within a wide range of redshift (from ∼ 0.01 up to ∼ 9). Such enormous power and high redshift point at these phenomena being highly favorable to investigate the history and evolution of our universe. The major obstacle in their application as cosmological study-tools is to find a way to standardize the GRBs, for instance similar to SNe Ia. With respect to this goal, the correlation between spectral peak energy (E{sub p,i}) and the “intensity” is a positively useful and investigated criterion. Moreover, it has been demonstrated that, through the E{sub p,i} – E{sub iso} correlation, the current data set of GRBs can already contribute to the independent evidence of the matter density Ω{sub M} being ∼ 0.3 for a flat universe scenario. We try to inspect and compare the correlations of E{sub p,i} with different intensity indicators (e.g., radiated energy, average and peak luminosity, bolometric vs. monochromatic quantities, etc.) both in terms of intrinsic dispersion and precise estimation of Ω{sub M}. The outcome of such studies are further analyzed in verifying the reliability of the correlations for both GRB physics and their standardization for cosmology.

  15. Power Peaking Effect of OTTO Fuel Scheme Pebble Bed Reactor

    Science.gov (United States)

    Setiadipura, T.; Suwoto; Zuhair; Bakhri, S.; Sunaryo, G. R.

    2018-02-01

    Pebble Bed Reactor (PBR) type of Hight Temperature Gas-cooled Reactor (HTGR) is a very interesting nuclear reactor design to fulfill the growing electricity and heat demand with a superior passive safety features. Effort to introduce the PBR design to the market can be strengthen by simplifying its system with the Once-through-then-out (OTTO) cycle PBR in which the pebble fuel only pass the core once. Important challenge in the OTTO fuel scheme is the power peaking effect which limit the maximum nominal power or burnup of the design. Parametric survey is perform in this study to investigate the contribution of different design parameters to power peaking effect of OTTO cycle PBR. PEBBED code is utilized in this study to perform the equilibrium PBR core analysis for different design parameter and fuel scheme. The parameters include its core diameter, height-per-diameter (H/D), power density, and core nominal power. Results of this study show that diameter and H/D effectsare stronger compare to the power density and nominal core power. Results of this study might become an importance guidance for design optimization of OTTO fuel scheme PBR.

  16. Steam generator deposit control program assessment at Comanche Peak

    International Nuclear Information System (INIS)

    Stevens, J.; Fellers, B.; Orbon, S.

    2002-01-01

    Comanche Peak has employed a variety of methods to assess the effectiveness of the deposit control program. These include typical methods such as an extensive visual inspection program and detailed corrosion product analysis and trending. In addition, a recently pioneered technique, low frequency eddy current profile analysis (LFEC) has been utilized. LFEC provides a visual mapping of the magnetite deposit profile of the steam generator. Analysis of the LFEC results not only provides general area deposition rates, but can also provide local deposition patterns, which is indicative of steam generator performance. Other techniques utilized include trending of steam pressure, steam generator hideout-return, and flow assisted corrosion (FAC) results. The sum of this information provides a comprehensive assessment of the deposit control program effectiveness and the condition of the steam generator. It also provides important diagnostic and predictive information relative to steam generator life management and mitigative strategies, such as special cleaning procedures. This paper discusses the techniques employed by Comanche Peak Chemistry to monitor the effectiveness of the deposit control program and describes how this information is used in strategic planning. (authors)

  17. Changes in Peak Flow Value during Immunotherapy Administration

    International Nuclear Information System (INIS)

    Saporta, D.

    2012-01-01

    Nasal allergies are prevalent affecting a large percentage of the population. Not only the upper respiratory tract but the whole body is involved. Allergies produce morbidity (and even occasional mortality) as they can lead to asthma development, and increased number of accidents. Immunotherapy results can be evaluated by following symptom scores, medication use, and objective measurements. Using a Peak Flow Meter (Pf) to evaluate immunotherapy results, it became evident that patients with and without asthma exhibited an improvement in the Peak Flow (PF) value, suggesting that lower airway involvement in allergic patients could be more prevalent than assumed. A consecutive chart review was performed including patients of any age with nasal allergies (with or without asthma) treated with immunotherapy for at least 6 months that had at least 2 complete evaluations. When immunotherapy was successful, most patients exhibited an increase in the PF value regardless of asthma status. A very significant finding was that most allergy sufferers may have lower airway inflammation. The use of the PF value to assess immunotherapy results and the potential failure to diagnose asthma in allergy sufferers are discussed. A better diagnosis of lower airway inflammation could be substantial in the management of these patients pulmonary function

  18. Expert system based radionuclide identification

    International Nuclear Information System (INIS)

    Aarnio, P.A.; Ala-Heikkil, J.J.; Hakulinen, T.T.; Nikkinen, M.T.

    1998-01-01

    An expert system coupled with the gamma spectrum analysis system SAMPO has been developed for automating the qualitative identification of radionuclides as well as for determining the quantitative parameters of the spectrum components. The program is written in C-language and runs in various environments ranging from PCs to UNIX workstations. The expert system utilizes a complete gamma library with over 2600 nuclides and 80,000 lines, and a rule base of about fifty criteria including energies, relative peak intensities, genesis modes, half lives, parent-daughter relationships, etc. The rule base is furthermore extensible by the user. This is not an original contribution but a somewhat updated version of papers and reports previously published elsewhere. (author)

  19. Empirical methods for controlling false positives and estimating confidence in ChIP-Seq peaks

    Directory of Open Access Journals (Sweden)

    Courdy Samir J

    2008-12-01

    Full Text Available Abstract Background High throughput signature sequencing holds many promises, one of which is the ready identification of in vivo transcription factor binding sites, histone modifications, changes in chromatin structure and patterns of DNA methylation across entire genomes. In these experiments, chromatin immunoprecipitation is used to enrich for particular DNA sequences of interest and signature sequencing is used to map the regions to the genome (ChIP-Seq. Elucidation of these sites of DNA-protein binding/modification are proving instrumental in reconstructing networks of gene regulation and chromatin remodelling that direct development, response to cellular perturbation, and neoplastic transformation. Results Here we present a package of algorithms and software that makes use of control input data to reduce false positives and estimate confidence in ChIP-Seq peaks. Several different methods were compared using two simulated spike-in datasets. Use of control input data and a normalized difference score were found to more than double the recovery of ChIP-Seq peaks at a 5% false discovery rate (FDR. Moreover, both a binomial p-value/q-value and an empirical FDR were found to predict the true FDR within 2–3 fold and are more reliable estimators of confidence than a global Poisson p-value. These methods were then used to reanalyze Johnson et al.'s neuron-restrictive silencer factor (NRSF ChIP-Seq data without relying on extensive qPCR validated NRSF sites and the presence of NRSF binding motifs for setting thresholds. Conclusion The methods developed and tested here show considerable promise for reducing false positives and estimating confidence in ChIP-Seq data without any prior knowledge of the chIP target. They are part of a larger open source package freely available from http://useq.sourceforge.net/.

  20. Muon identification in JADE

    International Nuclear Information System (INIS)

    Allison, J.; Armitage, J.C.M.; Baines, J.T.M.; Ball, A.H.; Bamford, G.; Barlow, R.J.; Bowdery, C.K.; Chrin, J.T.M.; Duerdoth, I.P.; Glendinning, I.; Greenshaw, T.; Hassard, J.F.; Hill, P.; King, B.T.; Loebinger, F.K.; Macbeth, A.A.; McCann, H.; Mercer, D.; Mills, H.E.; Murphy, P.G.; Prosper, H.B.; Rowe, P.; Stephens, K.

    1985-01-01

    The method of identification of high energy muons in the JADE detector is described in detail. The performance of the procedure is discussed in detail for the case of prompt identification in multihadronic final states. (orig.)

  1. Identification for Control

    DEFF Research Database (Denmark)

    Tøffner-Clausen, S.

    1995-01-01

    Identification of model error bounds for robust control design has recently achieved much attention.......Identification of model error bounds for robust control design has recently achieved much attention....

  2. Derivative Technology of DNA Barcoding (Nucleotide Signature and SNP Double Peak Methods) Detects Adulterants and Substitution in Chinese Patent Medicines.

    Science.gov (United States)

    Gao, Zitong; Liu, Yang; Wang, Xiaoyue; Song, Jingyuan; Chen, Shilin; Ragupathy, Subramanyam; Han, Jianping; Newmaster, Steven G

    2017-07-19

    Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5' CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3') was developed derived from ITS2 region of Eucommiae Folium based on unique motifs. Mixtures of powdered Lonicerae japonicae Flos and Lonicerae Flos resulted in double peaks at the expected SNP (Single Nucleotide Polymorphisms) positions, of which the height of the peaks were roughly indicative of the species' ratio in the mixed powder. Subsequently we tested 20 extracts and 47 CPMs labelled as containing some species of Lonicera. The results revealed only 17% of the extracts and 22% of the CPMs were authentic, others exist substitution or adulterant; 7% were shown to contain both of two adulterants Eucommiae Folium and Lonicerae Flos. The methods developed in this study will widely broaden the application of DNA barcode in quality assurance of natural health products.

  3. Face identification with frequency domain matched filtering in mobile environments

    Science.gov (United States)

    Lee, Dong-Su; Woo, Yong-Hyun; Yeom, Seokwon; Kim, Shin-Hwan

    2012-06-01

    Face identification at a distance is very challenging since captured images are often degraded by blur and noise. Furthermore, the computational resources and memory are often limited in the mobile environments. Thus, it is very challenging to develop a real-time face identification system on the mobile device. This paper discusses face identification based on frequency domain matched filtering in the mobile environments. Face identification is performed by the linear or phase-only matched filter and sequential verification stages. The candidate window regions are decided by the major peaks of the linear or phase-only matched filtering outputs. The sequential stages comprise a skin-color test and an edge mask filtering test, which verify color and shape information of the candidate regions in order to remove false alarms. All algorithms are built on the mobile device using Android platform. The preliminary results show that face identification of East Asian people can be performed successfully in the mobile environments.

  4. Technical Potential for Peak Load Management Programs in New Jersey

    Energy Technology Data Exchange (ETDEWEB)

    Kirby, B.J.

    2002-12-13

    Restructuring is attempting to bring the economic efficiency of competitive markets to the electric power industry. To at least some extent it is succeeding. New generation is being built in most areas of the country reversing the decades-long trend of declining reserve margins. Competition among generators is typically robust, holding down wholesale energy prices. Generators have shown that they are very responsive to price signals in both the short and long term. But a market that is responsive only on the supply side is only half a market. Demand response (elasticity) is necessary to gain the full economic advantages that restructuring can offer. Electricity is a form of energy that is difficult to store economically in large quantities. However, loads often have some ability to (1) conveniently store thermal energy and (2) defer electricity consumption. These inherent storage and control capabilities can be exploited to help reduce peak electric system consumption. In some cases they can also be used to provide system reliability reserves. Fortunately too, technology is helping. Advances in communications and control technologies are making it possible for loads ranging from residential through commercial and industrial to respond to economic signals. When we buy bananas, we don't simply take a dozen and wait a month to find out what the price was. We always ask about the price before we decide how many bananas we want. Technology is beginning to allow at least some customers to think about their electricity consumption the same way they think about most of their other purchases. And power system operators and regulators are beginning to understand that customers need to remain in control of their own destinies. Many customers (residential through industrial) are willing to respond to price signals. Most customers are not able to commit to specific responses months or years in advance. Electricity is a fluid market commodity with a volatile value to both

  5. Peak bone mass density among residents of Metro Manila

    International Nuclear Information System (INIS)

    Lim-Abrahan, M.A.B.; Guanzon, M.L.V.V.; Balderas, J.A.J.; Villaruel, C.M.; Santos, F.

    1996-01-01

    To determine the peak bone mass density among residents of Metro Manila using dual x-ray absorptiometry (DEXA).The design used is cross-sectional study. The study include 23 females and 22 males, with 3 to 4 subjects for each age range of 5. The methods used was bone mass density measurements on the lumbar spine and the femur using dual x-ray absorptiometry (DPXI lunar) were taken. The values were also age-matched and matched with that of a young adult based on programmed Caucasian norm provided by Lunar Co. The values were then scattered against age for each sex. Ten (10) cc of blood was also extracted from the patients, with 5 cc of blood separated for future studies. Patients were also interviewed as to their lifestyle, diet, use of contraceptive pill or hormonal replacement treatment, using a Filipino version of the revised questionnaire on the WHO Study on osteoporosis. The mean bone mass density at the L21.4 level for females was 1.12±0.11 g/cm 2 and 0,91±0.11 g/cm 2 at the femur. The highest BMD in both the lumbar spine femoral neck measurements among females was achieved between the ages 30-35 years of age with the lowest BMD occurring between 15-20 yrs. old and incidentally in 2 subjects with ages between 40-44. There seems to be little bone loss among beyond the age 35, unlike in the females. Bone mass density among a sample Metro Manila residents was determined using DEXA and the measurements on the lumbar spine and femoral neck. These were age-matched with that of young adult based on Caucasian norm provided by the Lunar Co. Peak bone mass density in the L2L4 level among the females is reached between the ages 30-35 years old, after which there is progressive bone loss with values in the 45-50 years old approximating the values in the 15-19 years old age range. A similar pattern is seen in the measurements taken at the femoral neck. Among males, the peak BMD is reached during the 30-35 years old, but there seems to be no rapid decline or rapid bone

  6. MYCOBACTERIUM COMPLEX IDENTIFICATION BY HIGH PERFORMANCE LIQUID CHROMATOGRAPHY

    Directory of Open Access Journals (Sweden)

    S.A HAWAII

    2001-12-01

    Full Text Available Introduction: There are different ways for identification of Mycobacteria. One of the most sensitive method is HPLC of phenacyl esters of mycolic acids of Mycobacteria for rapid identification of them after their primary cultures. This study uses HPLC for rapid identification and dissociation of Mycobacterium tuberculosis complex. Methods: In this study we use HPLC patterns of mycolic acids for identification three important species of mycobacteria (M. tuberculosis, M. bovis, M. bovis BCG from other mycobacterial species. All the strains were obtained from Tuberculosis and Pulmonary Diseases Research Center. HPLC conditions was as follows: HPLC: Model 1200 Cecil, Column: URP C-18 25X4.6 mm, Detector: U.V variable wave length at 254 nm, Elution: Gradient of methanol/chloroform. Flow rate: 2.5 ml/min. Results: HPLC leads to obtaining chromatograms which on its X-axis retention times (of different peaks which exist in the sample and on its Y-axis U.V absorbance (of these peaks were drown. These chromatograms in M. bovis and M. tuberculosis samples are similar with each other but differs from BCG ones. Discussion: On the basis of different retention times and numbers of the peaks which present in each chromatogram, we can differentiate between M. bovis, M. tuberculosis and BCG from other Mycobacteria. Also, with this method we can identify BCG from M. bovis and M. tuberculosis (because BCG has 9 and M. bovis and M. tuberculosis has 7 characteristic peaks in their chromatograms.

  7. Development of a portable equipment for identification of radionuclides

    International Nuclear Information System (INIS)

    Farias, Marcos Santana; Carvalho, Paulo Victor R. de; Nedjah, Nadia; Mourelle, Luiza de Macedo

    2014-01-01

    The rapid and automatic identification of radionuclides present in a radioactive sample detected in the field, is information that helps in decision making. In areas of high traffic of people and materials, such as ports and airports as well as at major events, radiation monitoring, together with the identification of the radionuclide, it is advisable within protective standards to the public. The correct identification of radionuclides depends on the ability to determine whether specific peaks energy sources are present in the spectrum of gamma radiation sources. Radionuclides can be identified by these energy characteristics in the sense that the energy value associated with these peaks in the spectrum corresponds to the radiation sources present in the sample. There are many methods that can be used for automatic identification of radionuclides. Most of them are based on software algorithms for the detection of peaks in the energy spectrum. Processing time of these tasks can be very long for applications requiring quick responses, as in equipment portable. A dedicated digital hardware offers better performance for tasks with high processing demand like this. This work shows the development of a handle Portable radionuclides based on a digital hardware solution using a FPGA (Field Programmable Gate Array) for implementing a clustering algorithm for the detection of energy peaks. (author)

  8. Relationships among peak power output, peak bar velocity, and mechanomyographic amplitude during the free-weight bench press exercise.

    Science.gov (United States)

    Stock, Matt S; Beck, Travis W; Defreitas, Jason M; Dillon, Michael A

    2010-10-01

    The purpose of this study was to examine the relationships among mechanomyographic (MMG) amplitude, power output, and bar velocity during the free-weight bench press exercise. Twenty-one resistance-trained men [one-repetition maximum (1-RM) bench press = 125.4+18.4 kg] performed bench press muscle actions as explosively as possible from 10% to 90% of the 1-RM while peak power output and peak bar velocity were assessed with a TENDO Weightlifting Analyzer. During each muscle action, surface MMG signals were detected from the right and left pectoralis major and triceps brachii, and the concentric portion of the range of motion was selected for analysis. Results indicated that power output increased from 10% to 50% 1-RM, followed by decreases from 50% to 90% 1-RM, but MMG amplitude for each of the muscles increased from 10 to 80% 1-RM. The results of this study indicate that during the free-weight bench press exercise, MMG amplitude was not related to power output, but was inversely related to bar velocity and directly related to the external load being lifted. In future research, coaches and sport scientists may be able to estimate force/torque production from individual muscles during multi-joint, dynamic constant external resistance muscle actions.

  9. The cost of electrolytic hydrogen from off-peak power

    International Nuclear Information System (INIS)

    Stucki, S.

    1991-01-01

    The cost of electrolytic hydrogen depends on the capacity factor of the plant and the cost of electricity. Both these parameters are correlated if off-peak power is to be used for hydrogen production. Based on assumptions regarding the correlation between the electricity price and the availability of electric power, optimizations were run using a simple cost model for the electrolysis plant. The current density at which the electrolysis plant would be run is taken as a variable for optimization as well as the annual time of availability of electric power. The results of the optimizations show for a number of hypothetical electrolyser types that the optimum operation time or electricity price do not depend much on the technology used. Production cost of electrolytic hydrogen can, however, be cut by 30% by using advanced electrolysis technology. (author)

  10. Mean and peak wind load reduction on heliostats

    Energy Technology Data Exchange (ETDEWEB)

    Peterka, J.A.; Tan, L.; Bienkiewcz, B.; Cermak, J.E.

    1987-09-01

    This report presents the results of wind-tunnel tests supported through the Solar Energy Research Institute (SERI) by the Office of Solar Thermal Technology of the US Department of Energy as part of the SERI research effort on innovative concentrators. As gravity loads on drive mechanisms are reduced through stretched-membrane technology, the wind-load contribution of the required drive capacity increases in percentage. Reduction of wind loads can provide economy in support structure and heliostat drive. Wind-tunnel tests have been directed at finding methods to reduce wind loads on heliostats. The tests investigated both mean and peak forces, and moments. A significant increase in ability to predict heliostat wind loads and their reduction within a heliostat field was achieved. In addition, a preliminary review of wind loads on parabolic dish collectors was conducted, resulting in a recommended research program for these type collectors. 42 refs., 38 figs., 1 tab.

  11. Energy solutions for CO2 emission peak and subsequent decline

    DEFF Research Database (Denmark)

    Risø International Energy Conference 2009 took place 14 – 16 September 2009. The conference focused on: • Future global energy development options Scenario and policy issues • Measures to achieve CO2 emission peak in 2015 – 2020 and subsequent decline • Renewable energy supply technologies...... such as bioenergy, wind and solar • Centralized energy technologies such as clean coal technologies • Energy conversion, energy carriers and energy storage, including fuel cells and hydrogen technologies • Providing renewable energy for the transport sector • Systems aspects for the various regions throughout...... the world • End-use technologies, efficiency improvements in supply and end use • Energy savings The proceedings are prepared from papers presented at the conference and received with corrections, if any, until the final deadline on 3 August 2009....

  12. Elastic-wave generation in the evolution of displacement peaks

    International Nuclear Information System (INIS)

    Zhukov, V.P.; Boldin, A.A.

    1988-01-01

    This paper investigated the character of elastic shock wave generation and damping in irradiated materials along with the possibility of their long-range influence on the structure of the irradiated materials. Dispersion at the elastoplastic stage of atomic displacement peak development was taken into account. The three-dimensional nonlinear wave was described by an equation in the approximation of weak nonlinearity and weak spatial dispersion. Numerical modeling of the propagation of a plane shock wave in a crystal lattice was conducted. The distribution of the density and mass velocity of the material at the instant of complete damping of the plastic shock-wave component was determined. The appearance of solitary waves (solitons) at large amplitudes, localized in space, which propagate without distortion to arbitrary distances and retain their amplitude and form in interacting with one another, was investigated. Some physical consequences of the influence of solitary waves on the irradiated materials were considered

  13. Logistic curves, extraction costs and effective peak oil

    International Nuclear Information System (INIS)

    Brecha, Robert J.

    2012-01-01

    Debates about the possibility of a near-term maximum in world oil production have become increasingly prominent over the past decade, with the focus often being on the quantification of geologically available and technologically recoverable amounts of oil in the ground. Economically, the important parameter is not a physical limit to resources in the ground, but whether market price signals and costs of extraction will indicate the efficiency of extracting conventional or nonconventional resources as opposed to making substitutions over time for other fuels and technologies. We present a hybrid approach to the peak-oil question with two models in which the use of logistic curves for cumulative production are supplemented with data on projected extraction costs and historical rates of capacity increase. While not denying the presence of large quantities of oil in the ground, even with foresight, rates of production of new nonconventional resources are unlikely to be sufficient to make up for declines in availability of conventional oil. Furthermore we show how the logistic-curve approach helps to naturally explain high oil prices even when there are significant quantities of low-cost oil yet to be extracted. - Highlights: ► Extraction cost information together with logistic curves to model oil extraction. ► Two models of extraction sequence for different oil resources. ► Importance of time-delay and extraction rate limits for new resources. ► Model results qualitatively reproduce observed extraction cost dynamics. ► Confirmation of “effective” peak oil, even though resources are in ground.

  14. Extrasolar Planet Transits Observed at Kitt Peak National Observatory

    Science.gov (United States)

    Sada, Pedro V.; Jennings, Donald E.; Deming, Drake; Jennings, Donald E.; Jackson, Brian; Hamilton, Catrina M.; Fraine, Jonathan; Peterson, Steven W.; Haase, Flynn; Bays, Kevin; hide

    2012-01-01

    We obtained J-, H-, and JH-band photometry of known extrasolar planet transiting systems at the 2.1 m Kitt Peak National Observatory Telescope using the FLAMINGOS infrared camera between 2008 October and 2011 October. From the derived light curves we have extracted the midtransit times, transit depths and transit durations for these events. The precise midtransit times obtained help improve the orbital periods and also constrain transit-time variations of the systems. For most cases the published system parameters successfully accounted for our observed light curves, but in some instances we derive improved planetary radii and orbital periods. We complemented our 2.1 m infrared observations using CCD z0-band and B-band photometry (plus two H(alpha) filter observations) obtained with the Kitt Peak Visitor Center Telescope, and with four H-band transits observed in 2007 October with the NSO's 1.6 m McMath-Pierce Solar Telescope. The principal highlights of our results are (1) Our ensemble of J-band planetary radii agree with optical radii, with the best-fit relation being RpRJ0:0017 0:979RpRvis. (2) We observe starspot crossings during the transit of WASP-11HAT-P-10. (3) We detect starspot crossings by HAT-P-11b (Kepler-3b), thus confirming that the magnetic evolution of the stellar active regions can be monitored even after the Kepler mission has ended. (4) We confirm a grazing transit for HAT-P-27WASP-40. In total, we present 57 individual transits of 32 known exoplanet systems.

  15. THE LATE PEAKING AFTERGLOW OF GRB 100418A

    International Nuclear Information System (INIS)

    Marshall, F. E.; Holland, S. T.; Sakamoto, T.; Antonelli, L. A.; Burrows, D. N.; Siegel, M. H.; Covino, S.; Fugazza, D.; De Pasquale, M.; Oates, S. R.; Evans, P. A.; O'Brien, P. T.; Osborne, J. P.; Pagani, C.; Liang, E. W.; Wu, X. F.; Zhang, B.

    2011-01-01

    GRB 100418A is a long gamma-ray burst (GRB) at redshift z = 0.6235 discovered with the Swift Gamma-ray Burst Explorer with unusual optical and X-ray light curves. After an initial short-lived, rapid decline in X-rays, the optical and X-ray light curves observed with Swift are approximately flat or rising slightly out to at least ∼7 x 10 3 s after the trigger, peak at ∼5 x 10 4 s, and then follow an approximately power-law decay. Such a long optical plateau and late peaking is rarely seen in GRB afterglows. Observations with Rapid Eye Mount during a gap in the Swift coverage indicate a bright optical flare at ∼2.5 x 10 4 s. The long plateau phase of the afterglow is interpreted using either a model with continuous injection of energy into the forward shock of the burst or a model in which the jet of the burst is viewed off-axis. In both models the isotropic kinetic energy in the late afterglow after the plateau phase is ≥10 2 times the 10 51 erg of the prompt isotropic gamma-ray energy release. The energy injection model is favored because the off-axis jet model would require the intrinsic T 90 for the GRB jet viewed on-axis to be very short, ∼10 ms, and the intrinsic isotropic gamma-ray energy release and the true jet energy to be much higher than the typical values of known short GRBs. The non-detection of a jet break up to t ∼ 2 x 10 6 s indicates a jet half-opening angle of at least ∼14 0 , and a relatively high-collimation-corrected jet energy of E jet ≥ 10 52 erg.

  16. Modeling the peak of emergence in systems: Design and katachi.

    Science.gov (United States)

    Cardier, Beth; Goranson, H T; Casas, Niccolo; Lundberg, Patric; Erioli, Alessio; Takaki, Ryuji; Nagy, Dénes; Ciavarra, Richard; Sanford, Larry D

    2017-12-01

    It is difficult to model emergence in biological systems using reductionist paradigms. A requirement for computational modeling is that individual entities can be recorded parametrically and related logically, but their transformation into whole systems cannot be captured this way. The problem stems from an inability to formally represent the implicit influences that inform emergent organization, such as context, shifts in causal agency or scale, and self-reference. This lack hampers biological systems modeling and its computational counterpart, indicating a need for new fundamental abstraction frameworks that support system-level characteristics. We develop an approach that formally captures these characteristics, focusing on the way they come together to enable transformation at the 'peak' of the emergent process. An example from virology is presented, in which two seemingly antagonistic systems - the herpes cold sore virus and its host - are capable of altering their basic biological objectives to achieve a new equilibrium. The usual barriers to modeling this process are overcome by incorporating mechanisms from practices centered on its emergent peak: design and katachi. In the Japanese science of form, katachi refers to the emergence of intrinsic structure from real situations, where an optimal balance between implicit influences is achieved. Design indicates how such optimization is guided by principles of flow. These practices leverage qualities of situated abstraction, which we understand through the intuitive method of physicist Kôdi Husimi. Early results indicate that this approach can capture the functional transformations of biological emergence, whilst being reasonably computable. Due to its geometric foundations and narrative-based extension to logic, the method will also generate speculative predictions. This research forms the foundations of a new biomedical modeling platform, which is discussed. Copyright © 2017. Published by Elsevier Ltd.

  17. Analysis of Subway Interior Noise at Peak Commuter Time.

    Science.gov (United States)

    Lee, Donguk; Kim, Gibbeum; Han, Woojae

    2017-07-01

    Although mass transit systems are convenient and efficient for urban people, little attention has been paid to the potential hearing hazard from their noise. The purpose of the current study was to measure and analyze levels of subway interior noise at peak commuter times and to provide information about commuters' daily dose of noise exposure. To measure the subway interior noise, nine subway lines inside Seoul (i.e., lines 1-9) and six lines surrounding the capital city area (i.e., Central, Bundang, Sinbundang, Incheon, Gyeongui, and Gyeongchun) were chosen. The noise was measured and recorded by a sound level meter for two-hour periods in the morning and evening. 1) In the LZeq analysis, the average noise level of all 15 lines was 72.78 dB; the maximum and minimum noise levels were 78.34 and 62.46 dB, respectively. The average noise level of the nine lines inside Seoul was 73.45 dB, which was 1.68-dB louder than that of the six lines surrounding the capital city area. 2) Based on the LZeq analysis of 33 measured frequencies, 12.5 Hz was the highest frequency and 20,000 Hz was the lowest. 3) There was no remarkable difference in the level of subway interior noise between morning and evening peak commuter times. We concluded that the level of subway interior noise was not loud enough for commuters to incur noise-induced hearing loss. Regardless, environmental noise control efforts in the subway system might be needed for commuters who take a subway every day.

  18. Examining controls on peak annual streamflow and floods in the Fraser River Basin of British Columbia

    Directory of Open Access Journals (Sweden)

    C. L. Curry

    2018-04-01

    ENSO and PDO indices (ρ ^   =  −0.40; −0.41 and (ρ ^   =  −0.35; −0.38, respectively, and rate of warming subsequent to the date of SWEmax (ρ ^   =  0.26; 0.38, are the most influential predictors of APF magnitude in the FRB and its subbasins. The identification of these controls on annual peak flows in the region may be of use in understanding seasonal predictions or future projected streamflow changes.

  19. Examining controls on peak annual streamflow and floods in the Fraser River Basin of British Columbia

    Science.gov (United States)

    Curry, Charles L.; Zwiers, Francis W.

    2018-04-01

    ^ = -0.35; -0.38), respectively, and rate of warming subsequent to the date of SWEmax (ρ ^ = 0.26; 0.38), are the most influential predictors of APF magnitude in the FRB and its subbasins. The identification of these controls on annual peak flows in the region may be of use in understanding seasonal predictions or future projected streamflow changes.

  20. Multi-analytical strategy for unassigned peaks using physical/mathematical separation, fragmental rules and retention index prediction: An example of sesquiterpene metabolites characterization in Cyperus rotundus.

    Science.gov (United States)

    He, Min; Yan, Pan; Yang, Zhiyu; Ye, Ying; Cao, Dongsheng; Hong, Liang; Yang, Tianbiao; Pei, Rui

    2018-05-30

    Comprehensive two-dimensional gas chromatography- mass spectrometry (GC × GC-qMS) can provide powerful physical separation, signal enhancement, and spectral identification for analytes in complex samples. Unassigned peaks are commonly presented in the untargeted profile after a single run with EI-MS spectral matching and retention index (RI) confirmation. The procedure proposed in this work can be applied as a general method for suggesting or narrowing down the candidates of unassigned GC × GC-qMS peaks. To begin, peak purity detection and chemometric resolution are employed to acquire pure mass spectra. In addition, the fragmental rules and in-silico spectra from structures are available for annotating certain unassigned peaks with reference spectra that are not observed in commercial databases. Furthermore, the procedure proposed in this work allows for in silico RI calculation by means of random forest (RF) analysis based on the retention data under the same chromatographic conditions. The calculated RIs can aid in analysis when the RI information of peaks of interest is not available in retention data libraries. Using the proposed strategy, certain unassigned peaks can be attributed to sesquiterpene metabolites in an in-house database for Cyperus rotundus. Copyright © 2018 Elsevier B.V. All rights reserved.

  1. Detailed Investigation and Comparison of the XCMS and MZmine 2 Chromatogram Construction and Chromatographic Peak Detection Methods for Preprocessing Mass Spectrometry Metabolomics Data.

    Science.gov (United States)

    Myers, Owen D; Sumner, Susan J; Li, Shuzhao; Barnes, Stephen; Du, Xiuxia

    2017-09-05

    XCMS and MZmine 2 are two widely used software packages for preprocessing untargeted LC/MS metabolomics data. Both construct extracted ion chromatograms (EICs) and detect peaks from the EICs, the first two steps in the data preprocessing workflow. While both packages have performed admirably in peak picking, they also detect a problematic number of false positive EIC peaks and can also fail to detect real EIC peaks. The former and latter translate downstream into spurious and missing compounds and present significant limitations with most existing software packages that preprocess untargeted mass spectrometry metabolomics data. We seek to understand the specific reasons why XCMS and MZmine 2 find the false positive EIC peaks that they do and in what ways they fail to detect real compounds. We investigate differences of EIC construction methods in XCMS and MZmine 2 and find several problems in the XCMS centWave peak detection algorithm which we show are partly responsible for the false positive and false negative compound identifications. In addition, we find a problem with MZmine 2's use of centWave. We hope that a detailed understanding of the XCMS and MZmine 2 algorithms will allow users to work with them more effectively and will also help with future algorithmic development.

  2. Peak Bagging of red giant stars observed by Kepler: first results with a new method based on Bayesian nested sampling

    Science.gov (United States)

    Corsaro, Enrico; De Ridder, Joris

    2015-09-01

    The peak bagging analysis, namely the fitting and identification of single oscillation modes in stars' power spectra, coupled to the very high-quality light curves of red giant stars observed by Kepler, can play a crucial role for studying stellar oscillations of different flavor with an unprecedented level of detail. A thorough study of stellar oscillations would thus allow for deeper testing of stellar structure models and new insights in stellar evolution theory. However, peak bagging inferences are in general very challenging problems due to the large number of observed oscillation modes, hence of free parameters that can be involved in the fitting models. Efficiency and robustness in performing the analysis is what may be needed to proceed further. For this purpose, we developed a new code implementing the Nested Sampling Monte Carlo (NSMC) algorithm, a powerful statistical method well suited for Bayesian analyses of complex problems. In this talk we show the peak bagging of a sample of high signal-to-noise red giant stars by exploiting recent Kepler datasets and a new criterion for the detection of an oscillation mode based on the computation of the Bayesian evidence. Preliminary results for frequencies and lifetimes for single oscillation modes, together with acoustic glitches, are therefore presented.

  3. Peak Bagging of red giant stars observed by Kepler: first results with a new method based on Bayesian nested sampling

    Directory of Open Access Journals (Sweden)

    Corsaro Enrico

    2015-01-01

    Full Text Available The peak bagging analysis, namely the fitting and identification of single oscillation modes in stars’ power spectra, coupled to the very high-quality light curves of red giant stars observed by Kepler, can play a crucial role for studying stellar oscillations of different flavor with an unprecedented level of detail. A thorough study of stellar oscillations would thus allow for deeper testing of stellar structure models and new insights in stellar evolution theory. However, peak bagging inferences are in general very challenging problems due to the large number of observed oscillation modes, hence of free parameters that can be involved in the fitting models. Efficiency and robustness in performing the analysis is what may be needed to proceed further. For this purpose, we developed a new code implementing the Nested Sampling Monte Carlo (NSMC algorithm, a powerful statistical method well suited for Bayesian analyses of complex problems. In this talk we show the peak bagging of a sample of high signal-to-noise red giant stars by exploiting recent Kepler datasets and a new criterion for the detection of an oscillation mode based on the computation of the Bayesian evidence. Preliminary results for frequencies and lifetimes for single oscillation modes, together with acoustic glitches, are therefore presented.

  4. Application of direct peak analysis to energy dispersive x-ray fluorescence spectra

    International Nuclear Information System (INIS)

    Nielson, K.K.

    1977-07-01

    A modified Covell method for direct peak analysis has been applied to energy dispersive x-ray fluorescence spectra. The method is background independent and is well-suited to computerized data reduction. It provides acceptable precision, minimizes errors from instrumental gain shift, and permits peak overlap correction. Peak overlap errors exhibit both positive and negative nodes as a function of peak separation distance, and are corrected using concentration ratios determined from thin, single-element standards. Peak precisions and overlaps are evaluated as a function of window width to aid in width selection. Least-square polynomial smoothing prior to peak analysis significantly improves peak area precisions without significantly affecting their accuracies

  5. [An automatic peak detection method for LIBS spectrum based on continuous wavelet transform].

    Science.gov (United States)

    Chen, Peng-Fei; Tian, Di; Qiao, Shu-Jun; Yang, Guang

    2014-07-01

    Spectrum peak detection in the laser-induced breakdown spectroscopy (LIBS) is an essential step, but the presence of background and noise seriously disturb the accuracy of peak position. The present paper proposed a method applied to automatic peak detection for LIBS spectrum in order to enhance the ability of overlapping peaks searching and adaptivity. We introduced the ridge peak detection method based on continuous wavelet transform to LIBS, and discussed the choice of the mother wavelet and optimized the scale factor and the shift factor. This method also improved the ridge peak detection method with a correcting ridge method. The experimental results show that compared with other peak detection methods (the direct comparison method, derivative method and ridge peak search method), our method had a significant advantage on the ability to distinguish overlapping peaks and the precision of peak detection, and could be be applied to data processing in LIBS.

  6. Concentration and size dependence of peak wavelength shift on quantum dots in colloidal suspension

    Science.gov (United States)

    Rinehart, Benjamin S.; Cao, Caroline G. L.

    2016-08-01

    Quantum dots (QDs) are semiconductor nanocrystals that have significant advantages over organic fluorophores, including their extremely narrow Gaussian emission bands and broad absorption bands. Thus, QDs have a wide range of potential applications, such as in quantum computing, photovoltaic cells, biological sensing, and electronics. For these applications, aliasing provides a detrimental effect on signal identification efficiency. This can be avoided through characterization of the QD fluorescence signals. Characterization of the emissivity of CdTe QDs as a function of concentration (1 to 10 mg/ml aqueous) was conducted on 12 commercially available CdTe QDs (emission peaks 550 to 730 nm). The samples were excited by a 50-mW 405-nm laser with emission collected via a free-space CCD spectrometer. All QDs showed a redshift effect as concentration increased. On average, the CdTe QDs exhibited a maximum shift of +35.6 nm at 10 mg/ml and a minimum shift of +27.24 nm at 1 mg/ml, indicating a concentration dependence for shift magnitude. The concentration-dependent redshift function can be used to predict emission response as QD concentration is changed in a complex system.

  7. Lessons learned while implementing a safety parameter display system at the Comanche Peak steam electric station

    International Nuclear Information System (INIS)

    Hagar, B.

    1987-01-01

    With the completion of site Verification and Validation tests, the Safety Parameter Display System (SPDS) will be fully operational at the Comanche Peak Steam Electric Station. Implementation of the SPDS, which began in 1982, included: modifying generic Safety Assessment System Software; developing site-specific displays and features; installing and integrating system equipment into the plant; modifying station heating, ventilation, and air conditioning systems to provide necessary cooling; installing an additional uninterruptible power supply system to provide necessary power; and training station personnel in the operation and use of the system. Lessons learned during this project can be discussed in terms of an ideal SPDS implementation project. Such a project would design and implement an SPDS for a plant that is already under construction or operating, and would progress through a sequence of activities that includes: (1) developing and documenting the system design bases, and including all major design influences; (2) developing a database description and system functional specifications to clarify specific system requirements; (3) developing detailed system hardware and software design specifications to fully describe the system, and to enable identification of necessary site design changes early in the project; (4) implementing the system design; (5) configuring and extensively testing the system prior to routine system operation; and (6) tuning the system after the completion of system installation. The ideal project would include future system users in design development and system testing, and would use Verification and Validation techniques throughout the project to ensure that each sequential step is appropriate and correct

  8. Decreased peak expiratory flow in pediatric passive smokers

    Directory of Open Access Journals (Sweden)

    Fitri Yanti

    2011-08-01

    Full Text Available Background Indonesia ranks fifth among countries with the highest aggregate levels of tobacco consumption in the world. Infants and children exposed to environmental tobacco smoke have increased rates of asthma, respiratory and ear infections, as well as reduced lung function. The effects of tobacco smoke exposure on lung function in children have been reported to be dependent on the source of smoke and the length and dose of exposure. Lung function may also be affected by a child’s gender and asthma status. Objective To compare peak expiratory flow (PEF in pediatric passive smokers to that of children not exposed to second hand smoke, and to define factors that may affect PEF in passive smokers. Methods In August 2009 we conducted a cross-sectional study at an elementary school in the Langkat district. Subjects were aged 6 to 12 years, and divided into two groups: passive smokers and those not exposed to secondhand smoke. Subjects’ PEFs were measured with a Mini-Wright peak flow meter. Measurements were performed in triplicate with the highest value recorded as the PEF. Demographic data including age, sex, weight, height, family income, parental education levels and occupations were obtained through questionnaires. Results Of the 170 participants, 100 were passive smokers and 70 were not exposed to secondhand smoke. Age distribution, weight and height were similar in both groups. We observed a significant difference in PEFs between the group of passive smokers and the group not exposed to secondhand smoke, 211.3 L/minute (SD 61.08 and 242.7 L/minute (SD 77.09, respectively (P < 0.005. The number of years of exposure to smoke (P = 0.079 and the number of cigarettes smoked daily in the household (P = 0.098 did not significantly influence PEF. Conclusion The PEF in pediatric passive smokers was significantly lower than that of children not exposed to secondhand smoke. PEF in passive smokers was not influenced by the number of years of smoke

  9. Peak systolic pressure-volume relationships in man

    International Nuclear Information System (INIS)

    Adachi, Haruhiko; Sugihara, Hiroki; Nakagawa, Hiroaki; Katsume, Hiroshi; Ochiai, Masakazu; Ijichi, Hamao

    1985-01-01

    We determined the relationship between left ventricular (LV) peak systolic pressure (PSP) and end-systolic volume, non-invasively using cuff sphygmomanometry and radionuclide angiocardiography (RNA). Systolic blood pressure (SBP) measured in the arm was substituted for PSP. LV enddiastolic volume (EDV), end-systolic volume (ESV) and ejection fraction (EF) were determined by a non-geometric method of gated RNA and recorded in three different hemodynamic states: at rest (basal state), during increased SBP after angiotensin administration (initial dose, 1-2 μg/min) and during decreased SBP after nitrate (sublingual nitroglycerin, 0.3-0.6 mg, or intravenous isosorbide dinitrate, 0.5-1.0 mg/min). The reproducibility of this method, tested in six subjects, proved to be good. Fifty-five subjects were divided into four groups based on EF at rest. The EDV and ESV were increased by angiotensin, and decreased by nitrate in all groups. EF was decreased by angiotensin and increased by nitrate. In contrast, the changes in PSP/ESVI due to these drugs remained in a narrow range in all groups. The regression lines of the PSP/ESVI relationship were almost linear and were steeper in the group with higher EF. Esub(max), the slope of the lines, was 5.75 +- 3.48 mmHg/ml/m 2 in group 1 (EF>50%), 3.16 +- 1.83 mmHg/ml/m 2 in group 2 (EF 49-40%), 2.27 +- 0.86 mmHg/ml/m 2 in group 3 (EF 39-30%) and 0.59 +- 0.50 mmHg/ml/m 2 in group 4 (EF<29%). The theoretical volume at zero pressure (VoI) did not meet in a definite value and was not related to EF at rest. Thus, the left ventricular peak systolic pressure-end-systolic volume relationship can be assessed non-invasively from radionuclide angiocardiography, which can be widely used for the evaluation of ventricular contractility, even in patients with asynergic ventricular contraction for whom echocardiography is unsuitable in measuring ventricular volume. (author)

  10. Transport aloft drives peak ozone in the Mojave Desert

    Science.gov (United States)

    VanCuren, Richard

    2015-05-01

    Transport of anthropogenic pollution eastward out of the Los Angeles megacity region in California has been periodically observed to reach the Colorado River and the Colorado Plateau region beyond. In the 1980s, anthropogenic halocarbon tracers measured in and near the Las Angeles urban area and at a mountain-top site near the Colorado River, 400 km downwind, were shown to have a correlated seven-day cycle explainable by transport from the urban area with a time lag of 1-2 days. Recent short term springtime intensive studies using aircraft observations and regional modeling of long range transport of ozone from the Southern California megacity region showed frequent and persistent ozone impacts at surface sites across the Colorado Plateau and Southern Rocky Mountain region, at distances up to 1500 km, also with time lags of 1-2 days. However, the timing of ozone peaks at low altitude monitoring sites within the Mojave Desert, at distances from 100 to 400 km from the South Coast and San Joaquin Valley ozone source regions, does not show the expected time-lag behavior seen in the larger transport studies. This discrepancy is explained by recognizing ozone transport across the Mojave Desert to occur in a persistent layer of polluted air in the lower free troposphere with a base level at approximately 1 km MSL. This layer impacts elevated downwind sites directly, but only influences low altitude surface ozone maxima through deep afternoon mixing. Pollutants in this elevated layer derive from California source regions (the Los Angeles megacity region and the intensive agricultural region of the San Joaquin Valley), from long-range transport from Asia, and stratospheric down-mixing. Recognition of the role of afternoon mixing during spring and summer over the Mojave explains and expands the significance of previously published reports of ozone and other pollutants observed in and over the Mojave Desert, and resolves an apparent paradox in the timing of ozone peaks due to

  11. Development of guide thimble stress peaking factor calculation methodology

    International Nuclear Information System (INIS)

    Lee, Seong Ki; Jeon, Sang Youn; Kim, Jae Ik; Jeon, Kyeong Lak; Kim, Kyu Tae

    2004-01-01

    The Nuclear Fuel Assembly for light water reactor which provides for 236 fuel rods consists of guide tubes, spacer grids, top/bottom nozzles. The guide tubes form the main structural components in conjunction with the grids, act as the main load carrying members of fuel assembly and serve as a support structure and a guide path for the control element, neutron sources and incore instruments after they are secured to upper and lower end areas. Top/bottom nozzles make the end parts of fuel assembly. And the spacer girds maintain the fuel rod array by providing positive lateral restraint to the fuel rod to the fuel rod but only frictional restraint to axial fuel rod motion. When the fuel assembly is in reactor, the tensional and compressional forces are applied to guide thimble through the top nozzle. The stresses vary with the location of guide thimble on the top nozzle plate since the different flow plate thickness between center and outer areas causes a different flexibility. The relative stress shall be considered during designing this kind of structure. And it is useful to know a coefficient to represent this relative stress difference and this value is called stress peaking factor

  12. Earthquake hazard zonation using peak ground acceleration (PGA) approach

    International Nuclear Information System (INIS)

    Irwansyah, E; Winarko, E; Rasjid, Z E; Bekti, R D

    2013-01-01

    The objective of this research is to develop seismic hazard area zones in the building infrastructure of the Banda Aceh City Indonesia using peak ground acceleration (PGA) measured using global and local attenuation function. PGA is calculated using attenuation function that describes the correlation between the local ground movement intensity the earthquake magnitude and the distance from the earthquake's epicentre. The data used comes from the earthquake damage catalogue available from the Indonesia meteorology, climatology and geophysics agency (BMKG) with range from year 1973 – 2011. The research methodology consists of six steps, which is developing the grid, calculation of the distance from the epicentre to the centroid of the grid, calculation of PGA values, developing the computer application, plotting the PGA values to the centroid grid, and developing the earthquake hazard zones using kriging algorithm. The conclusion of this research is that the global attenuation function that was developed by [20] can be applied to calculate the PGA values in the city of Banda Aceh. Banda Aceh city in micro scale can be divided into three hazard zones which is low hazard zone with PGA value of 0.8767 gals up to 0.8780 gals, medium hazard zone with PGA values of 0.8781 up to 0.8793 gals and high hazard zone with PGA values of 0.8794 up to 0.8806 gals.

  13. Peak provoked craving: an alternative to smoking cue-reactivity.

    Science.gov (United States)

    Sayette, Michael A; Tiffany, Stephen T

    2013-06-01

    Smoking cue-exposure research has provided a powerful tool for examining cravings in the laboratory. A key attraction of this method is that tightly controlled experimental procedures can model craving experiences that are presumed to relate to addiction. Despite its appeal, key assumptions underlying the clinical relevance of smoking cue-reactivity studies have been questioned recently. For both conceptual and methodological reasons it may be difficult to tease apart cue-based and abstinence-based cravings. Moreover, conventional cue-reactivity procedures typically generate levels of craving with only minimal clinical relevance. We argue here that sometimes it is unfeasible-and in some instances conceptually misguided-to disentangle abstinence-based and cued components of cigarette cravings. In light of the challenges associated with cue-reactivity research, we offer an alternative approach to smoking cue-exposure experimental research focusing on peak provoked craving (PPC) states. The PPC approach uses nicotine-deprived smokers and focuses on urges during smoking cue-exposure without subtracting out urge ratings during control cue or baseline assessments. This design relies on two factors found in many cue-exposure studies-nicotine deprivation and exposure to explicit smoking cues-which, when combined, can create powerful craving states. The PPC approach retains key aspects of the cue-exposure method, and in many circumstances may be a viable design for studies examining robust laboratory-induced cravings. © 2012 The Authors, Addiction © 2012 Society for the Study of Addiction.

  14. MASKED AREAS IN SHEAR PEAK STATISTICS: A FORWARD MODELING APPROACH

    International Nuclear Information System (INIS)

    Bard, D.; Kratochvil, J. M.; Dawson, W.

    2016-01-01

    The statistics of shear peaks have been shown to provide valuable cosmological information beyond the power spectrum, and will be an important constraint of models of cosmology in forthcoming astronomical surveys. Surveys include masked areas due to bright stars, bad pixels etc., which must be accounted for in producing constraints on cosmology from shear maps. We advocate a forward-modeling approach, where the impacts of masking and other survey artifacts are accounted for in the theoretical prediction of cosmological parameters, rather than correcting survey data to remove them. We use masks based on the Deep Lens Survey, and explore the impact of up to 37% of the survey area being masked on LSST and DES-scale surveys. By reconstructing maps of aperture mass the masking effect is smoothed out, resulting in up to 14% smaller statistical uncertainties compared to simply reducing the survey area by the masked area. We show that, even in the presence of large survey masks, the bias in cosmological parameter estimation produced in the forward-modeling process is ≈1%, dominated by bias caused by limited simulation volume. We also explore how this potential bias scales with survey area and evaluate how much small survey areas are impacted by the differences in cosmological structure in the data and simulated volumes, due to cosmic variance

  15. Detection of the relationship between peak temperature and extreme precipitation

    Science.gov (United States)

    Yu, Y.; Liu, J.; Zhiyong, Y.

    2017-12-01

    Under the background of climate change and human activities, the characteristics and pattern of precipitation have changed significantly in many regions. As the political and cultural center of China, the structure and character of precipitation in Jingjinji District has varied dramatically in recent years. In this paper, the daily precipitation data throughout the period 1960-2013 are selected for analyzing the spatial-temporal variability of precipitation. The results indicate that the frequency and intensity of precipitation presents an increasing trend. Based on the precipitation data, the maximum, minimum and mean precipitation in different temporal and spatial scales is calculated respectively. The temporal and spatial variation of temperature is obtained by using statistical methods. The relationship between temperature and precipitation in different range is analyzed. The curve relates daily precipitation extremes with local temperatures has a peak structure, increasing at the low-medium range of temperature variations but decreasing at high temperatures. The relationship between extreme precipitation is stronger in downtown than that in suburbs.

  16. Gigahertz-peaked Spectra Pulsars and Thermal Absorption Model

    Energy Technology Data Exchange (ETDEWEB)

    Kijak, J.; Basu, R.; Lewandowski, W.; Rożko, K. [Janusz Gil Institute of Astronomy, University of Zielona Góra, ul. Z. Szafrana 2, PL-65-516 Zielona Góra (Poland); Dembska, M., E-mail: jkijak@astro.ia.uz.zgora.pl [DLR Institute of Space Systems, Robert-Hooke-Str. 7 D-28359 Bremen (Germany)

    2017-05-10

    We present the results of our radio interferometric observations of pulsars at 325 and 610 MHz using the Giant Metrewave Radio Telescope. We used the imaging method to estimate the flux densities of several pulsars at these radio frequencies. The analysis of the shapes of the pulsar spectra allowed us to identify five new gigahertz-peaked spectra (GPS) pulsars. Using the hypothesis that the spectral turnovers are caused by thermal free–free absorption in the interstellar medium, we modeled the spectra of all known objects of this kind. Using the model, we were able to put some observational constraints on the physical parameters of the absorbing matter, which allows us to distinguish between the possible sources of absorption. We also discuss the possible effects of the existence of GPS pulsars on future search surveys, showing that the optimal frequency range for finding such objects would be from a few GHz (for regular GPS sources) to possibly 10 GHz for pulsars and radio magnetars exhibiting very strong absorption.

  17. Quantifying the cepstral peak prominence, a measure of dysphonia.

    Science.gov (United States)

    Heman-Ackah, Yolanda D; Sataloff, Robert T; Laureyns, Griet; Lurie, Deborah; Michael, Deirdre D; Heuer, Reinhardt; Rubin, Adam; Eller, Robert; Chandran, Swapna; Abaza, Mona; Lyons, Karen; Divi, Venu; Lott, Joanna; Johnson, Jennifer; Hillenbrand, James

    2014-11-01

    The purpose of this study is to establish normative values for the smoothed cepstral peak prominence (CPPS) and its sensitivity and specificity as a measure of dysphonia. Prospective cohort study. Voice samples of running speech were obtained from 835 patients and 50 volunteers. Eight laryngologists and four speech-language pathologists performed perceptual ratings of the voice samples on the degree of dysphonia/normality using an analog scale. The mean of their perceptual ratings was used as the gold standard for the detection of the presence or absence of dysphonia. CPPS was measured using the CPPS algorithm of Hillenbrand, and the cut-off value for positivity that has the highest sensitivity and specificity for discriminating between normal and severely dysphonia voices was determined based on ROC-curve analysis. The cut-off value for normal for CPPS was set at 4.0 or higher, which gave a sensitivity of 92.4%, a specificity of 79%, a positive predictive value of 82.5%, and a negative predictive value of 90.8%. The area under the receiver operating characteristic (ROC) curve was 0.937 (P dysphonia, with the normal value of CPPS (Hillenbrand algorithm) of a running speech sample being defined as a value of 4.0 or higher. Copyright © 2014 The Voice Foundation. All rights reserved.

  18. Residential implementation of critical-peak pricing of electricity

    International Nuclear Information System (INIS)

    Herter, Karen

    2007-01-01

    This paper investigates how critical-peak pricing (CPP) affects households with different usage and income levels, with the goal of informing policy makers who are considering the implementation of CPP tariffs in the residential sector. Using a subset of data from the California Statewide Pricing Pilot of 2003-04, average load change during summer events, annual percent bill change, and post-experiment satisfaction ratings are calculated across six customer segments, categorized by historical usage and income levels. Findings show that high-use customers respond significantly more in kW reduction than do low-use customers, while low-use customers save significantly more in percentage reduction of annual electricity bills than do high-use customers-results that challenge the strategy of targeting only high-use customers for CPP tariffs. Across income levels, average load and bill changes were statistically indistinguishable, as were satisfaction rates-results that are compatible with a strategy of full-scale implementation of CPP rates in the residential sector. Finally, the high-use customers earning less than $50,000 annually were the most likely of the groups to see bill increases-about 5% saw bill increases of 10% or more-suggesting that any residential CPP implementation might consider targeting this customer group for increased energy efficiency efforts

  19. Textural Poaching Twin Peaks: The Audrey Horne Sweater Girl GIFs

    Directory of Open Access Journals (Sweden)

    Jennifer Gillan

    2016-12-01

    Full Text Available This article aims to widen the lens of analysis of participatory culture inspired by long-arc serials like Twin Peaks. It considers GIF creation as a form of textural poaching, a new reception practice involving skimming off and repurposing top-of-the-mind content: the most arresting elements of costuming, set design, and dialogue. This behavior has become more popular as more series rely on textural storytelling and are filled with moments of excess that feel separate from the story. After an introduction to GIFs and GIF creation, it contrasts the impression of the character and series conveyed by Audrey Horne GIFs and the actual dynamics in the “Audrey’s Dance” scene. It establishes that Audrey’s look is most visually aligned with the Sweater Girl type, but as an allusive characterization it creates excess and calls attention to itself. Part of the “cool pop” reputation of the series may stem from the wider circulation of iconic moments of excess especially given that the GIFs detach the images from the series’ uneven storytelling and its challenging surrealist sensibility.

  20. Individual Alpha Peak Frequency in Ice Hockey Shooting Performance

    Directory of Open Access Journals (Sweden)

    Sommer Christie

    2017-05-01

    Full Text Available There are several important inter- and intra-individual variations in individual alpha peak frequency (IAPF in the cognitive domain. The rationale for the present study was to extend the research on IAPF in the cognitive domain to IAPF in the sport domain. Specifically, the purpose of the present study was twofold: (a to explore whether baseline IAPF is related to performance in an ice hockey shooting task and (b to explore whether a shooting task has an effect on IAPF variability. The present investigation is one of the first studies to examine links between IAPF and sport performance. Study results did not show significant changes in IAPF when comparing baseline IAPF and pre- to post-task IAPF across three performance levels. The findings support previous literature in the cognitive domain suggesting that IAPF is a stable neurophysiological marker. Future research should consider the following methodological suggestions: (a measuring IAPF during sport performance instead of at a resting state, (b changing the pre-performance resting baseline instructions to take into account sport-specific mental preparation, (c exploring an expert-novice paradigm to accentuate performance ability differences between groups (d comparing tasks with different levels of complexity, and (e analyzing the possible correlation between IAPF and performance on different days.

  1. Survey of elemental specificity in positron annihilation peak shapes

    Science.gov (United States)

    Myler, U.; Simpson, P. J.

    1997-12-01

    Recently the detailed interpretation of positron-annihilation γ-ray peak shapes has proven to be of interest with respect to their chemical specificity. In this contribution, we show highly resolved spectra for a number of different elements. To this purpose, annihilation spectra with strongly reduced background intensities were recorded in the two detector geometry, using a variable-energy positron beam. Division of the subsequently normalized spectra by a standard spectrum (in our case the spectrum of pure silicon) yields quotient spectra, which display features characteristic of the sample material. First we ascertain that the specific spectrum of an element is conserved in different chemical compounds, demonstrated here by identical oxygen spectra obtained from both SiO2/Si and MgO/Mg. Second, we show highly resolved spectra for a number of different elements (Fe...Zn, Ag, Ir...Au). We show that the characteristic features in these spectra vary in a systematic fashion with the atomic number of the element and can be tentatively identified with particular orbitals. Finally, for 26 different elements we compare the maximum intensity in the quotient spectra with the relative atomic density in the corresponding element. To our knowledge, this is the most comprehensive survey of such data made to date.

  2. Density limit in ASDEX discharges with peaked density profiles

    International Nuclear Information System (INIS)

    Staebler, A.; Niedermeyer, H.; Loch, R.; Mertens, V.; Mueller, E.R.; Soeldner, F.X.; Wagner, F.

    1989-01-01

    Results concerning the density limit in OH and NI-heated ASDEX discharges with the usually observed broad density profiles have been reported earlier: In ohmic discharges with high q a (q-cylindrical is used throughout this paper) the Murakami parameter (n e R/B t ) is a good scaling parameter. At the high densities edge cooling is observed causing the plasma to shrink until an m=2-instability terminates the discharge. When approaching q a =2 the density limit is no longer proportional to I p ; a minimum exists in n e,max (q a ) at q a ∼2.15. With NI-heating the density limit increases less than proportional to the heating power; the behaviour during the pre-disruptive phase is rather similar to the one of OH discharges. There are specific operating regimes on ASDEX leading to discharges with strongly peaked density profiles: the improved ohmic confinement regime, counter neutral injection, and multipellet injection. These regimes are characterized by enhanced energy and particle confinement. The operational limit in density for these discharges is, therefore, of great interest having furthermore in mind that high central densities are favourable in achieving high fusion yields. In addition, further insight into the mechanisms of the density limit observed in tokamaks may be obtained by comparing plasmas with rather different density profiles at their maximum attainable densities. 7 refs., 2 figs

  3. Residential implementation of critical-peak pricing ofelectricity

    Energy Technology Data Exchange (ETDEWEB)

    Herter, Karen

    2006-06-29

    This paper investigates how critical-peak pricing (CPP)affects households with different usage and income levels, with the goalof informing policy makers who are considering the implementation of CPPtariffs in the residential sector. Using a subset of data from theCalifornia Statewide Pricing Pilot of 2003-2004, average load changeduring summer events, annual percent bill change, and post-experimentsatisfaction ratings are calculated across six customer segments,categorized by historical usage and income levels. Findings show thathigh-use customers respond significantly more in kW reduction than dolow-use customers, while low-use customers save significantly more inpercentage reduction of annual electricity bills than do high-usecustomers results that challenge the strategy of targeting only high-usecustomers for CPP tariffs. Across income levels, average load and billchanges were statistically indistinguishable, as were satisfaction ratesresults that are compatible with a strategy of full-scale implementationof CPP rates in the residential sector. Finally, the high-use customersearning less than $50,000 annually were the most likely of the groups tosee bill increases about 5 percent saw bill increases of 10 percent ormore suggesting that any residential CPP implementation might considertargeting this customer group for increased energy efficiencyefforts.

  4. Gigahertz-peaked spectra pulsars in Pulsar Wind Nebulae

    Science.gov (United States)

    Basu, R.; RoŻko, K.; Kijak, J.; Lewandowski, W.

    2018-04-01

    We have carried out a detailed study of the spectral nature of six pulsars surrounded by pulsar wind nebulae (PWNe). The pulsar flux density was estimated using the interferometric imaging technique of the Giant Metrewave Radio Telescope at three frequencies 325, 610, and 1280 MHz. The spectra showed a turnover around gigahertz frequency in four out of six pulsars. It has been suggested that the gigahertz-peaked spectrum (GPS) in pulsars arises due to thermal absorption of the pulsar emission in surrounding medium like PWNe, H II regions, supernova remnants, etc. The relatively high incidence of GPS behaviour in pulsars surrounded by PWNe imparts further credence to this view. The pulsar J1747-2958 associated with the well-known Mouse nebula was also observed in our sample and exhibited GPS behaviour. The pulsar was detected as a point source in the high-resolution images. However, the pulsed emission was not seen in the phased-array mode. It is possible that the pulsed emission was affected by extreme scattering causing considerable smearing of the emission at low radio frequencies. The GPS spectra were modelled using the thermal free-free absorption and the estimated absorber properties were largely consistent with PWNe. The spatial resolution of the images made it unlikely that the point source associated with J1747-2958 was the compact head of the PWNe, but the synchrotron self-absorption seen in such sources was a better fit to the estimated spectral shape.

  5. Chemometric Strategies for Peak Detection and Profiling from Multidimensional Chromatography.

    Science.gov (United States)

    Navarro-Reig, Meritxell; Bedia, Carmen; Tauler, Romà; Jaumot, Joaquim

    2018-04-03

    The increasing complexity of omics research has encouraged the development of new instrumental technologies able to deal with these challenging samples. In this way, the rise of multidimensional separations should be highlighted due to the massive amounts of information that provide with an enhanced analyte determination. Both proteomics and metabolomics benefit from this higher separation capacity achieved when different chromatographic dimensions are combined, either in LC or GC. However, this vast quantity of experimental information requires the application of chemometric data analysis strategies to retrieve this hidden knowledge, especially in the case of nontargeted studies. In this work, the most common chemometric tools and approaches for the analysis of this multidimensional chromatographic data are reviewed. First, different options for data preprocessing and enhancement of the instrumental signal are introduced. Next, the most used chemometric methods for the detection of chromatographic peaks and the resolution of chromatographic and spectral contributions (profiling) are presented. The description of these data analysis approaches is complemented with enlightening examples from omics fields that demonstrate the exceptional potential of the combination of multidimensional separation techniques and chemometric tools of data analysis. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Coda Spectral Peaking for Nevada Nuclear Test Site Explosions

    Energy Technology Data Exchange (ETDEWEB)

    Murphy, K R; Mayeda, K; Walter, W R

    2007-09-10

    We have applied the regional S-wave coda calibration technique of Mayeda et al. (2003) to earthquake data in and around the Nevada Test Site (NTS) using 4 regional broadband stations from the LLNL seismic network. We applied the same path and site corrections to tamped nuclear explosion data and averaged the source spectra over the four stations. Narrowband coda amplitudes from the spectra were then regressed against inferred yield based on the regional m{sub b}(Pn) magnitude of Denny et al. (1987), along with the yield formulation of Vergino and Mensing (1990). We find the following: (1) The coda-derived spectra show a peak which is dependent upon emplacement depth, not event size; (2) Source size estimates are stable for the coda and show a dependence upon the near-source strength and gas porosity; (3) For explosions with the same m{sub b}(Pn) or inferred yield, those in weaker material have lower coda amplitudes at 1-3 Hz.

  7. A method for estimating peak and time of peak streamflow from excess rainfall for 10- to 640-acre watersheds in the Houston, Texas, metropolitan area

    Science.gov (United States)

    Asquith, William H.; Cleveland, Theodore G.; Roussel, Meghan C.

    2011-01-01

    Estimates of peak and time of peak streamflow for small watersheds (less than about 640 acres) in a suburban to urban, low-slope setting are needed for drainage design that is cost-effective and risk-mitigated. During 2007-10, the U.S. Geological Survey (USGS), in cooperation with the Harris County Flood Control District and the Texas Department of Transportation, developed a method to estimate peak and time of peak streamflow from excess rainfall for 10- to 640-acre watersheds in the Houston, Texas, metropolitan area. To develop the method, 24 watersheds in the study area with drainage areas less than about 3.5 square miles (2,240 acres) and with concomitant rainfall and runoff data were selected. The method is based on conjunctive analysis of rainfall and runoff data in the context of the unit hydrograph method and the rational method. For the unit hydrograph analysis, a gamma distribution model of unit hydrograph shape (a gamma unit hydrograph) was chosen and parameters estimated through matching of modeled peak and time of peak streamflow to observed values on a storm-by-storm basis. Watershed mean or watershed-specific values of peak and time to peak ("time to peak" is a parameter of the gamma unit hydrograph and is distinct from "time of peak") of the gamma unit hydrograph were computed. Two regression equations to estimate peak and time to peak of the gamma unit hydrograph that are based on watershed characteristics of drainage area and basin-development factor (BDF) were developed. For the rational method analysis, a lag time (time-R), volumetric runoff coefficient, and runoff coefficient were computed on a storm-by-storm basis. Watershed-specific values of these three metrics were computed. A regression equation to estimate time-R based on drainage area and BDF was developed. Overall arithmetic means of volumetric runoff coefficient (0.41 dimensionless) and runoff coefficient (0.25 dimensionless) for the 24 watersheds were used to express the rational

  8. Development of the modified sum-peak method and its application

    International Nuclear Information System (INIS)

    Ogata, Y.; Miyahara, H.; Ishihara, M.; Ishigure, N.; Yamamoto, S.; Kojima, S.

    2016-01-01

    As the sum-peak method requires the total count rate as well as the peak count rates and the sum peak count rate, this meets difficulties when a sample contains other radionuclides than the one to be measured. To solve the problem, a new method using solely the peak and the sum peak count rates was developed. The method was theoretically and experimentally confirmed using "6"0Co, "2"2Na and "1"3"4Cs. We demonstrate that the modified sum-peak method is quite simple and practical and is useful to measure multiple nuclides. - Highlights: • A modified sum-peak method for simple radioactivity measurement was developed. • The method solely requires the peak count rates and the sum peak count rate. • The method is applicable to multiple radionuclides.

  9. Peak bone mass density among residents of Metro Manila

    International Nuclear Information System (INIS)

    Lim-Abrahan, Mary Anne V.; Gacutan-Liwag, Aretha Ann C.; Balderas, Jubilia Araceli J.; Guanzon, Ma. Vicenta Luz; Guzman, Angel de

    2002-01-01

    Study Objectives: To determine the peak bone mass density among residents of Metro Manila using dual energy X-ray absorptiometry and to correlate factors such as age, height, weight, body mass index, total caloric, protein and calcium intake to bone mass density. Design: Cross sectional study Setting: Philippine General Hospital and St Luke's Medical Center, tertiary government and private owned hospitals, respectively. Subjects: Two hundred twenty-eight 228) healthy randomly chosen subjects from amongst hospital companion, aged 15-52 years old, distributed at 25 subjects per group of five per sex. Methods: Bone mass density measurements were done on lumbar spine and femoral neck using dual energy x-ray absorptiometry (Lunar DPXL). Ten (10) cc of blood was extracted on one hundred fourteen (114) patients; 5 cc of which was used for biochemical studies while the rest of the sample was stored for fixture studies. One hundred fourteen (114) patients were then interviewed using the Filipino version of the WHO questionnaire for the Study of Osteoporosis, and their nutritional intake was assessed using a previous day food recall. Results: At present, there are a total of 228 patients recruited. The mean weight and height were 57-43±11.17 kg and 158.16±8.44 cm, respectively, and the mean BMI was 22.99±4.11. The mean daily calcium intake was 501.17±357.79 gms/day (n=64). The mean BMD at the L2-L4 spine for females was 1.14±0.15 gm/cm 2 and 1.12±0.21 gm/cm 2 for the males. The highest BMD was 1.23±0.20 gm/cm 2 in the 35-39 year old age group for the females and 1.26±0.31 gm/cm 2 in the 30-34 age group for the males. The mean femoral neck BMD was 0.91±0.12 gm/cm 2 for the females and 1.00±0.13 gm/cm 2 for the males. The highest femoral neck BMD was 0.931±0.12 gm/cm 2 in the 20-24 females and 1.03±0.18 gm/cm 2 in the 20-24 age group for the males. Calcium intake and weight was significantly correlated in the lumbar spine. Height and sex was correlated with both

  10. Peak Ground Velocities for Seismic Events at Yucca Mountain, Nevada

    International Nuclear Information System (INIS)

    K. Coppersmith; R. Quittmeyer

    2005-01-01

    This report describes a scientific analysis to bound credible horizontal peak ground velocities (PGV) for the repository waste emplacement level at Yucca Mountain. Results are presented as a probability distribution for horizontal PGV to represent uncertainties in the analysis. The analysis also combines the bound to horizontal PGV with results of ground motion site-response modeling (BSC 2004 [DIRS 170027]) to develop a composite hazard curve for horizontal PGV at the waste emplacement level. This result provides input to an abstraction of seismic consequences (BSC 2004 [DIRS 169183]). The seismic consequence abstraction, in turn, defines the input data and computational algorithms for the seismic scenario class of the total system performance assessment (TSPA). Planning for the analysis is documented in Technical Work Plan TWP-MGR-GS-000001 (BSC 2004 [DIRS 171850]). The bound on horizontal PGV at the repository waste emplacement level developed in this analysis complements ground motions developed on the basis of PSHA results. In the PSHA, ground motion experts characterized the epistemic uncertainty and aleatory variability in their ground motion interpretations. To characterize the aleatory variability they used unbounded lognormal distributions. As a consequence of these characterizations, as seismic hazard calculations are extended to lower and lower annual frequencies of being exceeded, the ground motion level increases without bound, eventually reaching levels that are not credible (Corradini 2003 [DIRS 171191]). To provide credible seismic inputs for TSPA, in accordance with 10 Code of Federal Regulations (CFR) 63.102(j) [DIRS 156605], this complementary analysis is carried out to determine reasonable bounding values of horizontal PGV at the waste emplacement level for annual frequencies of exceedance as low as 10 -8 . For each realization of the TSPA seismic scenario, the results of this analysis provide a constraint on the values sampled from the

  11. Hubbert's Peak, The Coal Question, and Climate Change

    Science.gov (United States)

    Rutledge, D.

    2008-12-01

    The United Nations Intergovernmental Panel on Climate Change (IPCC) makes projections in terms of scenarios that include estimates of oil, gas, and coal production. These scenarios are defined in the Special Report on Emissions Scenarios or SRES (Nakicenovic et al., 2000). It is striking how different these scenarios are. For example, total oil production from 2005 to 2100 in the scenarios varies by 5:1 (Appendix SRES Version 1.1). Because production in some of the scenarios has not peaked by 2100, this ratio would be comparable to 10:1 if the years after 2100 were considered. The IPCC says "... the resultant 40 SRES scenarios together encompass the current range of uncertainties of future GHG [greenhouse gas] emissions arising from different characteristics of these models ..." (Nakicenovic et al., 2000, Summary for Policy Makers). This uncertainty is important for climate modeling, because it is larger than the likely range for the temperature sensitivity, which the IPCC gives as 2.3:1 (Gerard Meehl et al., 2007, the Fourth Assessment Report, Chapter 10, Global Climate Projections, p. 799). The uncertainty indicates that we could improve climate modeling if we could make a better estimate of future oil, gas, and coal production. We start by considering the two major fossil-fuel regions with substantial exhaustion, US oil and British coal. It turns out that simple normal and logistic curve fits to the cumulative production for these regions give quite stable projections for the ultimate production. By ultimate production, we mean total production, past and future. For US oil, the range for the fits for the ultimate is 1.15:1 (225- 258 billion barrels) for the period starting in 1956, when King Hubbert made his prediction of the peak year of US oil production. For UK coal, the range is 1.26:1 for the period starting in 1905, at the time of a Royal Commission on coal supplies. We extend this approach to find fits for world oil and gas production, and by a regional

  12. Memory effects and peak effect in type II superconductors

    International Nuclear Information System (INIS)

    Pasquini, G.; Luna, D.; Eismann, B.; Bettachini, V.; Bekeris, V.

    2007-01-01

    A large amount of experimental and theoretical work has been devoted to understand memory effects (ME) in the solid vortex lattice (VL) but has remained, however, controversial until now. In the vicinity of the anomaly known as the peak effect (PE) both the VL mobility and the measured critical current density are found to be dependent of the dynamical history of the sample, in both low T c (LTS) and high T c (HTS) superconductors. Experiments in YBa 2 Cu 3 O 7 (YBCO) crystals have shown that the mobility of the VL increases after assisting the system with a symmetric AC field (or current) of moderated amplitude. On the other hand, after an asymmetric AC field assists vortices, the VL becomes less mobile. These features indicate that ME in these samples cannot be ascribed to an equilibration process, but probably are related to the organization of the lattice after nearest neighbor re-accommodation or induced plastic VL deformation. Recently, we have shown evidence that in YBCO the PE is a dynamic anomaly observed in the non-linear response, and is absent in the Labusch constant derived from the linear Campbell regime. However, this behavior seems not to be extensive to other systems as the traditional LTS NbSe 2 . In this work, the AC response in the PE region of NbSe 2 and YBCO samples are presented and compared. Very salient differences both in the linear and non-linear response as well as in the ME characteristics indicate that a different physics governs the PE phenomena in each case

  13. Secondary ozone peaks in the troposphere over the Himalayas

    Directory of Open Access Journals (Sweden)

    N. Ojha

    2017-06-01

    Full Text Available Layers with strongly enhanced ozone concentrations in the middle–upper troposphere, referred to as secondary ozone peaks (SOPs, have been observed in different regions of the world. Here we use the global ECHAM5/MESSy atmospheric chemistry model (EMAC to (i investigate the processes causing SOPs, (ii explore both their frequency of occurrence and seasonality, and (iii assess their effects on the tropospheric ozone budget over the Himalayas. The vertical profiles of potential vorticity (PV and a stratospheric ozone tracer (O3s in EMAC simulations, in conjunction with the structure of SOPs, suggest that SOPs over the Himalayas are formed by stratosphere-to-troposphere transport (STT of ozone. The spatial distribution of O3s further shows that such effects are in general most pronounced in the northern part of India. Model simulated ozone distributions and backward air trajectories show that ozone rich air masses, associated with STT, originate as far as northern Africa and the North Atlantic Ocean, the Middle East, as well as in nearby regions in Afghanistan and Pakistan, and are rapidly (within 2–3 days transported to the Himalayas. Analysis of a 15-year (2000–2014 EMAC simulation shows that the frequency of SOPs is highest during the pre-monsoon season (e.g. 11 % of the time in May, while no intense SOP events are found during the July–October period. The SOPs are estimated to enhance the tropospheric column ozone (TCO over the central Himalayas by up to 21 %.

  14. Forecasting the peak of the present solar activity cycle 24

    Science.gov (United States)

    Hamid, R. H.; Marzouk, B. A.

    2018-06-01

    Solar forecasting of the level of sun Activity is very important subject for all space programs. Most predictions are based on the physical conditions prevailing at or before the solar cycle minimum preceding the maximum in question. Our aim is to predict the maximum peak of cycle 24 using precursor techniques in particular those using spotless event, geomagnetic aamin. index and solar flux F10.7. Also prediction of exact date of the maximum (Tr) is taken in consideration. A study of variation over previous spotless event for cycles 7-23 and that for even cycles (8-22) are carried out for the prediction. Linear correlation between maximum of solar cycles (RM) and spotless event around the preceding minimum gives R24t = 88.4 with rise time Tr = 4.6 years. For the even cycles R24E = 77.9 with rise time Tr = 4.5 y's. Based on the average aamin. index for cycles (12-23), we estimate the expected amplitude for cycle 24 to be Raamin = 99.4 and 98.1 with time rise of Traamin = 4.04 & 4.3 years for both the total and even cycles in consecutive. The application of the data of solar flux F10.7 which cover only cycles (19-23) was taken in consideration and gives predicted maximum amplitude R24 10.7 = 126 with rise time Tr107 = 3.7 years, which are over estimation. Our result indicating to somewhat weaker of cycle 24 as compared to cycles 21-23.

  15. Modified echo peak correction for radial acquisition regime (RADAR).

    Science.gov (United States)

    Takizawa, Masahiro; Ito, Taeko; Itagaki, Hiroyuki; Takahashi, Tetsuhiko; Shimizu, Kanichirou; Harada, Junta

    2009-01-01

    Because radial sampling imposes many limitations on magnetic resonance (MR) imaging hardware, such as on the accuracy of the gradient magnetic field or the homogeneity of B(0), some correction of the echo signal is usually needed before image reconstruction. In our previous study, we developed an echo-peak-shift correction (EPSC) algorithm not easily affected by hardware performance. However, some artifacts remained in lung imaging, where tissue is almost absent, or in cardiac imaging, which is affected by blood flow. In this study, we modified the EPSC algorithm to improve the image quality of the radial aquisition regime (RADAR) and expand its application sequences. We assumed the artifacts were mainly caused by errors in the phase map for EPSC and used a phantom on a 1.5-tesla (T) MR scanner to investigate whether to modify the EPSC algorithm. To evaluate the effectiveness of EPSC, we compared results from T(1)- and T(2)-weighted images of a volunteer's lung region using the current and modified EPSC. We then applied the modified EPSC to RADAR spin echo (SE) and RADAR balanced steady-state acquisition with rewound gradient echo (BASG) sequence. The modified EPSC reduced phase discontinuity in the reference data used for EPSC and improved visualization of blood vessels in the lungs. Motion and blood flow caused no visible artifacts in the resulting images in either RADAR SE or RADAR BASG sequence. Use of the modified EPSC eliminated artifacts caused by signal loss in the reference data for EPSC. In addition, the modified EPSC was applied to RADAR SE and RADAR BASG sequences.

  16. Modified echo peak correction for radial acquisition regime (RADAR)

    International Nuclear Information System (INIS)

    Takizawa, Masahiro; Ito, Taeko; Itagaki, Hiroyuki; Takahashi, Tetsuhiko; Shimizu, Kanichirou; Harada, Junta

    2009-01-01

    Because radial sampling imposes many limitations on magnetic resonance (MR) imaging hardware, such as on the accuracy of the gradient magnetic field or the homogeneity of B 0 , some correction of the echo signal is usually needed before image reconstruction. In our previous study, we developed an echo-peak-shift correction (EPSC) algorithm not easily affected by hardware performance. However, some artifacts remained in lung imaging, where tissue is almost absent, or in cardiac imaging, which is affected by blood flow. In this study, we modified the EPSC algorithm to improve the image quality of the radial acquisition regime (RADAR) and expand its application sequences. We assumed the artifacts were mainly caused by errors in the phase map for EPSC and used a phantom on a 1.5-tesla (T) MR scanner to investigate whether to modify the EPSC algorithm. To evaluate the effectiveness of EPSC, we compared results from T 1 -and T 2 -weighted images of a volunteer's lung region using the current and modified EPSC. We then applied the modified EPSC to RADAR spin echo (SE) and RADAR balanced steady-state acquisition with rewound gradient echo (BASG) sequence. The modified EPSC reduced phase discontinuity in the reference data used for EPSC and improved visualization of blood vessels in the lungs. Motion and blood flow caused no visible artifacts in the resulting images in either RADAR SE or RADAR BASG sequence. Use of the modified EPSC eliminated artifacts caused by signal loss in the reference data for EPSC. In addition, the modified EPSC was applied to RADAR SE and RADAR BASG sequences. (author)

  17. Estuarine abandoned channel sedimentation rates record peak fluvial discharge magnitudes

    Science.gov (United States)

    Gray, A. B.; Pasternack, G. B.; Watson, E. B.

    2018-04-01

    Fluvial sediment deposits can provide useful records of integrated watershed expressions including flood event magnitudes. However, floodplain and estuarine sediment deposits evolve through the interaction of watershed/marine sediment supply and transport characteristics with the local depositional environment. Thus extraction of watershed scale signals depends upon accounting for local scale effects on sediment deposition rates and character. This study presents an examination of the balance of fluvial sediment dynamics and local scale hydro-geomorphic controls on alluviation of an abandoned channel in the Salinas River Lagoon, CA. A set of three sediment cores contained discrete flood deposits that corresponded to the largest flood events over the period of accretion from 1969 to 2007. Sedimentation rates scaled with peak flood discharge and event scale sediment flux, but were not influenced by longer scale hydro-meteorological activities such as annual precipitation and water yield. Furthermore, the particle size distributions of flood deposits showed no relationship to event magnitudes. Both the responsiveness of sedimentation and unresponsiveness of particle size distributions to hydro-sedimentological event magnitudes appear to be controlled by aspects of local geomorphology that influence the connectivity of the abandoned channel to the Salinas River mainstem. Well-developed upstream plug bar formation precluded the entrainment of coarser bedload into the abandoned channel, while Salinas River mouth conditions (open/closed) in conjunction with tidal and storm surge conditions may play a role in influencing the delivery of coarser suspended load fractions. Channel adjacent sediment deposition can be valuable records of hydro-meteorological and sedimentological regimes, but local depositional settings may dominate the character of short term (interdecadal) signatures.

  18. Relating Solar Energetic Particle Event Fluences to Peak Intensities

    Science.gov (United States)

    Kahler, Stephen W.; Ling, Alan G.

    2018-02-01

    Recently we (Kahler and Ling, Solar Phys. 292, 59, 2017: KL) have shown that time-intensity profiles [I(t)] of 14 large solar energetic particle (SEP) events can be fitted with a simple two-parameter fit, the modified Weibull function, which is characterized by shape and scaling parameters [α and β]. We now look for a simple correlation between an event peak energy intensity [Ip] and the time integral of I(t) over the event duration: the fluence [F]. We first ask how the ratio of F/Ip varies for the fits of the 14 KL events and then examine that ratio for three separate published statistical studies of SEP events in which both F and Ip were measured for comparisons of those parameters with various solar-flare and coronal mass ejection (CME) parameters. The three studies included SEP energies from a 4 - 13 MeV band to E > 100 MeV. Within each group of SEP events, we find a very robust correlation (CC > 0.90) in log-log plots of F versus Ip over four decades of Ip. The ratio increases from western to eastern longitudes. From the value of Ip for a given event, F can be estimated to within a standard deviation of a factor of {≤} 2. Log-log plots of two studies are consistent with slopes of unity, but the third study shows plot slopes of { 10 MeV to {>} 100 MeV. This difference is not explained.

  19. FAST CONTRACTION OF CORONAL LOOPS AT THE FLARE PEAK

    International Nuclear Information System (INIS)

    Liu Rui; Wang Haimin

    2010-01-01

    On 2005 September 8, a coronal loop overlying the active region NOAA 10808 was observed in TRACE 171 A to contract at ∼100 km s -1 at the peak of an X5.4-2B flare at 21:05 UT. Prior to the fast contraction, the loop underwent a much slower contraction at ∼6 km s -1 for about 8 minutes, initiating during the flare preheating phase. The sudden switch to fast contraction is presumably corresponding to the onset of the impulsive phase. The contraction resulted in the oscillation of a group of loops located below, with the period of about 10 minutes. Meanwhile, the contracting loop exhibited a similar oscillatory pattern superimposed on the dominant downward motion. We suggest that the fast contraction reflects a suddenly reduced magnetic pressure underneath due either to (1) the eruption of magnetic structures located at lower altitudes or to (2) the rapid conversion of magnetic free energy in the flare core region. Electrons accelerated in the shrinking trap formed by the contracting loop can theoretically contribute to a late-phase hard X-ray burst, which is associated with Type IV radio emission. To complement the X5.4 flare which was probably confined, a similar event observed in SOHO/EIT 195 A on 2004 July 20 in an eruptive, M8.6 flare is briefly described, in which the contraction was followed by the expansion of the same loop leading up to a halo coronal mass ejection. These observations further substantiate the conjecture of coronal implosion and suggest coronal implosion as a new exciter mechanism for coronal loop oscillations.

  20. Comprehensive two-dimensional gas chromatography/time-of-flight mass spectrometry peak sorting algorithm.

    Science.gov (United States)

    Oh, Cheolhwan; Huang, Xiaodong; Regnier, Fred E; Buck, Charles; Zhang, Xiang

    2008-02-01

    We report a novel peak sorting method for the two-dimensional gas chromatography/time-of-flight mass spectrometry (GC x GC/TOF-MS) system. The objective of peak sorting is to recognize peaks from the same metabolite occurring in different samples from thousands of peaks detected in the analytical procedure. The developed algorithm is based on the fact that the chromatographic peaks for a given analyte have similar retention times in all of the chromatograms. Raw instrument data are first processed by ChromaTOF (Leco) software to provide the peak tables. Our algorithm achieves peak sorting by utilizing the first- and second-dimension retention times in the peak tables and the mass spectra generated during the process of electron impact ionization. The algorithm searches the peak tables for the peaks generated by the same type of metabolite using several search criteria. Our software also includes options to eliminate non-target peaks from the sorting results, e.g., peaks of contaminants. The developed software package has been tested using a mixture of standard metabolites and another mixture of standard metabolites spiked into human serum. Manual validation demonstrates high accuracy of peak sorting with this algorithm.

  1. Anomalous evolution of the near-side jet peak shape in Pb-Pb collisions at $\\sqrt{s_{\\mathrm{NN}}}$ = 2.76 TeV

    CERN Document Server

    Adam, Jaroslav; Aggarwal, Madan Mohan; Aglieri Rinella, Gianluca; Agnello, Michelangelo; Agrawal, Neelima; Ahammed, Zubayer; Ahmad, Shakeel; Ahn, Sang Un; Aiola, Salvatore; Akindinov, Alexander; Alam, Sk Noor; Silva De Albuquerque, Danilo; Aleksandrov, Dmitry; Alessandro, Bruno; Alexandre, Didier; Alfaro Molina, Jose Ruben; Alici, Andrea; Alkin, Anton; Alme, Johan; Alt, Torsten; Altinpinar, Sedat; Altsybeev, Igor; Alves Garcia Prado, Caio; An, Mangmang; Andrei, Cristian; Andrews, Harry Arthur; Andronic, Anton; Anguelov, Venelin; Anson, Christopher Daniel; Anticic, Tome; Antinori, Federico; Antonioli, Pietro; Anwar, Rafay; Aphecetche, Laurent Bernard; Appelshaeuser, Harald; Arcelli, Silvia; Arnaldi, Roberta; Arnold, Oliver Werner; Arsene, Ionut Cristian; Arslandok, Mesut; Audurier, Benjamin; Augustinus, Andre; Averbeck, Ralf Peter; Azmi, Mohd Danish; Badala, Angela; Baek, Yong Wook; Bagnasco, Stefano; Bailhache, Raphaelle Marie; Bala, Renu; Balasubramanian, Supraja; Baldisseri, Alberto; Baral, Rama Chandra; Barbano, Anastasia Maria; Barbera, Roberto; Barile, Francesco; Barnafoldi, Gergely Gabor; Barnby, Lee Stuart; Ramillien Barret, Valerie; Bartalini, Paolo; Barth, Klaus; Bartke, Jerzy Gustaw; Bartsch, Esther; Basile, Maurizio; Bastid, Nicole; Basu, Sumit; Bathen, Bastian; Batigne, Guillaume; Batista Camejo, Arianna; Batyunya, Boris; Batzing, Paul Christoph; Bearden, Ian Gardner; Beck, Hans; Bedda, Cristina; Behera, Nirbhay Kumar; Belikov, Iouri; Bellini, Francesca; Bello Martinez, Hector; Bellwied, Rene; Espinoza Beltran, Lucina Gabriela; Belyaev, Vladimir; Bencedi, Gyula; Beole, Stefania; Bercuci, Alexandru; Berdnikov, Yaroslav; Berenyi, Daniel; Bertens, Redmer Alexander; Berzano, Dario; Betev, Latchezar; Bhasin, Anju; Bhat, Inayat Rasool; Bhati, Ashok Kumar; Bhattacharjee, Buddhadeb; Bhom, Jihyun; Bianchi, Livio; Bianchi, Nicola; Bianchin, Chiara; Bielcik, Jaroslav; Bielcikova, Jana; Bilandzic, Ante; Biro, Gabor; Biswas, Rathijit; Biswas, Saikat; Bjelogrlic, Sandro; Blair, Justin Thomas; Blau, Dmitry; Blume, Christoph; Bock, Friederike; Bogdanov, Alexey; Boldizsar, Laszlo; Bombara, Marek; Bonora, Matthias; Book, Julian Heinz; Borel, Herve; Borissov, Alexander; Borri, Marcello; Botta, Elena; Bourjau, Christian; Braun-munzinger, Peter; Bregant, Marco; Broker, Theo Alexander; Browning, Tyler Allen; Broz, Michal; Brucken, Erik Jens; Bruna, Elena; Bruno, Giuseppe Eugenio; Budnikov, Dmitry; Buesching, Henner; Bufalino, Stefania; Buhler, Paul; Iga Buitron, Sergio Arturo; Buncic, Predrag; Busch, Oliver; Buthelezi, Edith Zinhle; Bashir Butt, Jamila; Buxton, Jesse Thomas; Cabala, Jan; Caffarri, Davide; Caines, Helen Louise; Caliva, Alberto; Calvo Villar, Ernesto; Camerini, Paolo; Carena, Francesco; Carena, Wisla; Carnesecchi, Francesca; Castillo Castellanos, Javier Ernesto; Castro, Andrew John; Casula, Ester Anna Rita; Ceballos Sanchez, Cesar; Cepila, Jan; Cerello, Piergiorgio; Cerkala, Jakub; Chang, Beomsu; Chapeland, Sylvain; Chartier, Marielle; Charvet, Jean-luc Fernand; Chattopadhyay, Subhasis; Chattopadhyay, Sukalyan; Chauvin, Alex; Chelnokov, Volodymyr; Cherney, Michael Gerard; Cheshkov, Cvetan Valeriev; Cheynis, Brigitte; Chibante Barroso, Vasco Miguel; Dobrigkeit Chinellato, David; Cho, Soyeon; Chochula, Peter; Choi, Kyungeon; Chojnacki, Marek; Choudhury, Subikash; Christakoglou, Panagiotis; Christensen, Christian Holm; Christiansen, Peter; Chujo, Tatsuya; Chung, Suh-urk; Cicalo, Corrado; Cifarelli, Luisa; Cindolo, Federico; Cleymans, Jean Willy Andre; Colamaria, Fabio Filippo; Colella, Domenico; Collu, Alberto; Colocci, Manuel; Conesa Balbastre, Gustavo; Conesa Del Valle, Zaida; Connors, Megan Elizabeth; Contreras Nuno, Jesus Guillermo; Cormier, Thomas Michael; Corrales Morales, Yasser; Cortes Maldonado, Ismael; Cortese, Pietro; Cosentino, Mauro Rogerio; Costa, Filippo; Crkovska, Jana; Crochet, Philippe; Cruz Albino, Rigoberto; Cuautle Flores, Eleazar; Cunqueiro Mendez, Leticia; Dahms, Torsten; Dainese, Andrea; Danisch, Meike Charlotte; Danu, Andrea; Das, Debasish; Das, Indranil; Das, Supriya; Dash, Ajay Kumar; Dash, Sadhana; De, Sudipan; De Caro, Annalisa; De Cataldo, Giacinto; De Conti, Camila; De Cuveland, Jan; De Falco, Alessandro; De Gruttola, Daniele; De Marco, Nora; De Pasquale, Salvatore; Derradi De Souza, Rafael; Deisting, Alexander; Deloff, Andrzej; Deplano, Caterina; Dhankher, Preeti; Di Bari, Domenico; Di Mauro, Antonio; Di Nezza, Pasquale; Di Ruzza, Benedetto; Diaz Corchero, Miguel Angel; Dietel, Thomas; Dillenseger, Pascal; Divia, Roberto; Djuvsland, Oeystein; Dobrin, Alexandru Florin; Domenicis Gimenez, Diogenes; Donigus, Benjamin; Dordic, Olja; Drozhzhova, Tatiana; Dubey, Anand Kumar; Dubla, Andrea; Ducroux, Laurent; Duggal, Ashpreet Kaur; Dupieux, Pascal; Ehlers Iii, Raymond James; Elia, Domenico; Endress, Eric; Engel, Heiko; Epple, Eliane; Erazmus, Barbara Ewa; Erhardt, Filip; Espagnon, Bruno; Esumi, Shinichi; Eulisse, Giulio; Eum, Jongsik; Evans, David; Evdokimov, Sergey; Eyyubova, Gyulnara; Fabbietti, Laura; Fabris, Daniela; Faivre, Julien; Fantoni, Alessandra; Fasel, Markus; Feldkamp, Linus; Feliciello, Alessandro; Feofilov, Grigorii; Ferencei, Jozef; Fernandez Tellez, Arturo; Gonzalez Ferreiro, Elena; Ferretti, Alessandro; Festanti, Andrea; Feuillard, Victor Jose Gaston; Figiel, Jan; Araujo Silva Figueredo, Marcel; Filchagin, Sergey; Finogeev, Dmitry; Fionda, Fiorella; Fiore, Enrichetta Maria; Floris, Michele; Foertsch, Siegfried Valentin; Foka, Panagiota; Fokin, Sergey; Fragiacomo, Enrico; Francescon, Andrea; Francisco, Audrey; Frankenfeld, Ulrich Michael; Fronze, Gabriele Gaetano; Fuchs, Ulrich; Furget, Christophe; Furs, Artur; Fusco Girard, Mario; Gaardhoeje, Jens Joergen; Gagliardi, Martino; Gago Medina, Alberto Martin; Gajdosova, Katarina; Gallio, Mauro; Duarte Galvan, Carlos; Gangadharan, Dhevan Raja; Ganoti, Paraskevi; Gao, Chaosong; Garabatos Cuadrado, Jose; Garcia-solis, Edmundo Javier; Garg, Kunal; Garg, Prakhar; Gargiulo, Corrado; Gasik, Piotr Jan; Gauger, Erin Frances; De Leone Gay, Maria Beatriz; Germain, Marie; Ghosh, Premomoy; Ghosh, Sanjay Kumar; Gianotti, Paola; Giubellino, Paolo; Giubilato, Piero; Gladysz-dziadus, Ewa; Glassel, Peter; Gomez Coral, Diego Mauricio; Gomez Ramirez, Andres; Sanchez Gonzalez, Andres; Gonzalez, Victor; Gonzalez Zamora, Pedro; Gorbunov, Sergey; Gorlich, Lidia Maria; Gotovac, Sven; Grabski, Varlen; Graczykowski, Lukasz Kamil; Graham, Katie Leanne; Greiner, Leo Clifford; Grelli, Alessandro; Grigoras, Costin; Grigoryev, Vladislav; Grigoryan, Ara; Grigoryan, Smbat; Grion, Nevio; Gronefeld, Julius Maximilian; Grosse-oetringhaus, Jan Fiete; Grosso, Raffaele; Gruber, Lukas; Guber, Fedor; Guernane, Rachid; Guerzoni, Barbara; Gulbrandsen, Kristjan Herlache; Gunji, Taku; Gupta, Anik; Gupta, Ramni; Bautista Guzman, Irais; Haake, Rudiger; Hadjidakis, Cynthia Marie; Hamagaki, Hideki; Hamar, Gergoe; Hamon, Julien Charles; Harris, John William; Harton, Austin Vincent; Hatzifotiadou, Despina; Hayashi, Shinichi; Heckel, Stefan Thomas; Hellbar, Ernst; Helstrup, Haavard; Herghelegiu, Andrei Ionut; Herrera Corral, Gerardo Antonio; Herrmann, Florian; Hess, Benjamin Andreas; Hetland, Kristin Fanebust; Hillemanns, Hartmut; Hippolyte, Boris; Hladky, Jan; Horak, David; Hosokawa, Ritsuya; Hristov, Peter Zahariev; Hughes, Charles; Humanic, Thomas; Hussain, Nur; Hussain, Tahir; Hutter, Dirk; Hwang, Dae Sung; Ilkaev, Radiy; Inaba, Motoi; Ippolitov, Mikhail; Irfan, Muhammad; Isakov, Vladimir; Islam, Md Samsul; Ivanov, Marian; Ivanov, Vladimir; Izucheev, Vladimir; Jacak, Barbara; Jacazio, Nicolo; Jacobs, Peter Martin; Jadhav, Manoj Bhanudas; Jadlovska, Slavka; Jadlovsky, Jan; Jahnke, Cristiane; Jakubowska, Monika Joanna; Janik, Malgorzata Anna; Pahula Hewage, Sandun; Jena, Chitrasen; Jena, Satyajit; Jimenez Bustamante, Raul Tonatiuh; Jones, Peter Graham; Jusko, Anton; Kalinak, Peter; Kalweit, Alexander Philipp; Kang, Ju Hwan; Kaplin, Vladimir; Kar, Somnath; Karasu Uysal, Ayben; Karavichev, Oleg; Karavicheva, Tatiana; Karayan, Lilit; Karpechev, Evgeny; Kebschull, Udo Wolfgang; Keidel, Ralf; Keijdener, Darius Laurens; Keil, Markus; Khan, Mohammed Mohisin; Khan, Palash; Khan, Shuaib Ahmad; Khanzadeev, Alexei; Kharlov, Yury; Khatun, Anisa; Khuntia, Arvind; Kileng, Bjarte; Kim, Do Won; Kim, Dong Jo; Kim, Daehyeok; Kim, Hyeonjoong; Kim, Jinsook; Kim, Jiyoung; Kim, Minjung; Kim, Minwoo; Kim, Se Yong; Kim, Taesoo; Kirsch, Stefan; Kisel, Ivan; Kiselev, Sergey; Kisiel, Adam Ryszard; Kiss, Gabor; Klay, Jennifer Lynn; Klein, Carsten; Klein, Jochen; Klein-boesing, Christian; Klewin, Sebastian; Kluge, Alexander; Knichel, Michael Linus; Knospe, Anders Garritt; Kobdaj, Chinorat; Kofarago, Monika; Kollegger, Thorsten; Kolozhvari, Anatoly; Kondratev, Valerii; Kondratyeva, Natalia; Kondratyuk, Evgeny; Konevskikh, Artem; Kopcik, Michal; Kour, Mandeep; Kouzinopoulos, Charalampos; Kovalenko, Oleksandr; Kovalenko, Vladimir; Kowalski, Marek; Koyithatta Meethaleveedu, Greeshma; Kralik, Ivan; Kravcakova, Adela; Krivda, Marian; Krizek, Filip; Kryshen, Evgeny; Krzewicki, Mikolaj; Kubera, Andrew Michael; Kucera, Vit; Kuhn, Christian Claude; Kuijer, Paulus Gerardus; Kumar, Ajay; Kumar, Jitendra; Kumar, Lokesh; Kumar, Shyam; Kundu, Sourav; Kurashvili, Podist; Kurepin, Alexander; Kurepin, Alexey; Kuryakin, Alexey; Kushpil, Svetlana; Kweon, Min Jung; Kwon, Youngil; La Pointe, Sarah Louise; La Rocca, Paola; Lagana Fernandes, Caio; Lakomov, Igor; Langoy, Rune; Lapidus, Kirill; Lara Martinez, Camilo Ernesto; Lardeux, Antoine Xavier; Lattuca, Alessandra; Laudi, Elisa; Lazaridis, Lazaros; Lea, Ramona; Leardini, Lucia; Lee, Seongjoo; Lehas, Fatiha; Lehner, Sebastian; Lehrbach, Johannes; Lemmon, Roy Crawford; Lenti, Vito; Leogrande, Emilia; Leon Monzon, Ildefonso; Levai, Peter; Li, Shuang; Li, Xiaomei; Lien, Jorgen Andre; Lietava, Roman; Lindal, Svein; Lindenstruth, Volker; Lippmann, Christian; Lisa, Michael Annan; Ljunggren, Hans Martin; Llope, William; Lodato, Davide Francesco; Lonne, Per-ivar; Loginov, Vitaly; Loizides, Constantinos; Lopez, Xavier Bernard; Lopez Torres, Ernesto; Lowe, Andrew John; Luettig, Philipp Johannes; Lunardon, Marcello; Luparello, Grazia; Lupi, Matteo; Lutz, Tyler Harrison; Maevskaya, Alla; Mager, Magnus; Mahajan, Sanjay; Mahmood, Sohail Musa; Maire, Antonin; Majka, Richard Daniel; Malaev, Mikhail; Maldonado Cervantes, Ivonne Alicia; Malinina, Liudmila; Mal'kevich, Dmitry; Malzacher, Peter; Mamonov, Alexander; Manko, Vladislav; Manso, Franck; Manzari, Vito; Mao, Yaxian; Marchisone, Massimiliano; Mares, Jiri; Margagliotti, Giacomo Vito; Margotti, Anselmo; Margutti, Jacopo; Marin, Ana Maria; Markert, Christina; Marquard, Marco; Martin, Nicole Alice; Martinengo, Paolo; Martinez Hernandez, Mario Ivan; Martinez-garcia, Gines; Martinez Pedreira, Miguel; Mas, Alexis Jean-michel; Masciocchi, Silvia; Masera, Massimo; Masoni, Alberto; Mastroserio, Annalisa; Matyja, Adam Tomasz; Mayer, Christoph; Mazer, Joel Anthony; Mazzilli, Marianna; Mazzoni, Alessandra Maria; Meddi, Franco; Melikyan, Yuri; Menchaca-rocha, Arturo Alejandro; Meninno, Elisa; Mercado-perez, Jorge; Meres, Michal; Mhlanga, Sibaliso; Miake, Yasuo; Mieskolainen, Matti Mikael; Mikhaylov, Konstantin; Milano, Leonardo; Milosevic, Jovan; Mischke, Andre; Mishra, Aditya Nath; Mishra, Tribeni; Miskowiec, Dariusz Czeslaw; Mitra, Jubin; Mitu, Ciprian Mihai; Mohammadi, Naghmeh; Mohanty, Bedangadas; Molnar, Levente; Montes Prado, Esther; Moreira De Godoy, Denise Aparecida; Perez Moreno, Luis Alberto; Moretto, Sandra; Morreale, Astrid; Morsch, Andreas; Muccifora, Valeria; Mudnic, Eugen; Muhlheim, Daniel Michael; Muhuri, Sanjib; Mukherjee, Maitreyee; Mulligan, James Declan; Gameiro Munhoz, Marcelo; Munning, Konstantin; Munzer, Robert Helmut; Murakami, Hikari; Murray, Sean; Musa, Luciano; Musinsky, Jan; Myers, Corey James; Naik, Bharati; Nair, Rahul; Nandi, Basanta Kumar; Nania, Rosario; Nappi, Eugenio; Naru, Muhammad Umair; Ferreira Natal Da Luz, Pedro Hugo; Nattrass, Christine; Rosado Navarro, Sebastian; Nayak, Kishora; Nayak, Ranjit; Nayak, Tapan Kumar; Nazarenko, Sergey; Nedosekin, Alexander; Negrao De Oliveira, Renato Aparecido; Nellen, Lukas; Ng, Fabian; Nicassio, Maria; Niculescu, Mihai; Niedziela, Jeremi; Nielsen, Borge Svane; Nikolaev, Sergey; Nikulin, Sergey; Nikulin, Vladimir; Noferini, Francesco; Nomokonov, Petr; Nooren, Gerardus; Cabanillas Noris, Juan Carlos; Norman, Jaime; Nyanin, Alexander; Nystrand, Joakim Ingemar; Oeschler, Helmut Oskar; Oh, Saehanseul; Ohlson, Alice Elisabeth; Okubo, Tsubasa; Olah, Laszlo; Oleniacz, Janusz; Oliveira Da Silva, Antonio Carlos; Oliver, Michael Henry; Onderwaater, Jacobus; Oppedisano, Chiara; Orava, Risto; Oravec, Matej; Ortiz Velasquez, Antonio; Oskarsson, Anders Nils Erik; Otwinowski, Jacek Tomasz; Oyama, Ken; Ozdemir, Mahmut; Pachmayer, Yvonne Chiara; Pacik, Vojtech; Pagano, Davide; Pagano, Paola; Paic, Guy; Pal, Susanta Kumar; Palni, Prabhakar; Pan, Jinjin; Pandey, Ashutosh Kumar; Papikyan, Vardanush; Pappalardo, Giuseppe; Pareek, Pooja; Park, Jonghan; Park, Woojin; Parmar, Sonia; Passfeld, Annika; Paticchio, Vincenzo; Patra, Rajendra Nath; Paul, Biswarup; Pei, Hua; Peitzmann, Thomas; Peng, Xinye; Pereira Da Costa, Hugo Denis Antonio; Peresunko, Dmitry Yurevich; Perez Lezama, Edgar; Peskov, Vladimir; Pestov, Yury; Petracek, Vojtech; Petrov, Viacheslav; Petrovici, Mihai; Petta, Catia; Piano, Stefano; Pikna, Miroslav; Pillot, Philippe; Ozelin De Lima Pimentel, Lais; Pinazza, Ombretta; Pinsky, Lawrence; Piyarathna, Danthasinghe; Ploskon, Mateusz Andrzej; Planinic, Mirko; Pluta, Jan Marian; Pochybova, Sona; Podesta Lerma, Pedro Luis Manuel; Poghosyan, Martin; Polishchuk, Boris; Poljak, Nikola; Poonsawat, Wanchaloem; Pop, Amalia; Poppenborg, Hendrik; Porteboeuf, Sarah Julie; Porter, R Jefferson; Pospisil, Jan; Prasad, Sidharth Kumar; Preghenella, Roberto; Prino, Francesco; Pruneau, Claude Andre; Pshenichnov, Igor; Puccio, Maximiliano; Puddu, Giovanna; Pujahari, Prabhat Ranjan; Punin, Valery; Putschke, Jorn Henning; Qvigstad, Henrik; Rachevski, Alexandre; Raha, Sibaji; Rajput, Sonia; Rak, Jan; Rakotozafindrabe, Andry Malala; Ramello, Luciano; Rami, Fouad; Rana, Dhan Bahadur; Raniwala, Rashmi; Raniwala, Sudhir; Rasanen, Sami Sakari; Rascanu, Bogdan Theodor; Rathee, Deepika; Ratza, Viktor; Ravasenga, Ivan; Read, Kenneth Francis; Redlich, Krzysztof; Rehman, Attiq Ur; Reichelt, Patrick Simon; Reidt, Felix; Ren, Xiaowen; Renfordt, Rainer Arno Ernst; Reolon, Anna Rita; Reshetin, Andrey; Reygers, Klaus Johannes; Riabov, Viktor; Ricci, Renato Angelo; Richert, Tuva Ora Herenui; Richter, Matthias Rudolph; Riedler, Petra; Riegler, Werner; Riggi, Francesco; Ristea, Catalin-lucian; Rodriguez Cahuantzi, Mario; Roeed, Ketil; Rogochaya, Elena; Rohr, David Michael; Roehrich, Dieter; Ronchetti, Federico; Ronflette, Lucile; Rosnet, Philippe; Rossi, Andrea; Roukoutakis, Filimon; Roy, Ankhi; Roy, Christelle Sophie; Roy, Pradip Kumar; Rubio Montero, Antonio Juan; Rui, Rinaldo; Russo, Riccardo; Ryabinkin, Evgeny; Ryabov, Yury; Rybicki, Andrzej; Saarinen, Sampo; Sadhu, Samrangy; Sadovskiy, Sergey; Safarik, Karel; Sahlmuller, Baldo; Sahoo, Baidyanath; Sahoo, Pragati; Sahoo, Raghunath; Sahoo, Sarita; Sahu, Pradip Kumar; Saini, Jogender; Sakai, Shingo; Saleh, Mohammad Ahmad; Salzwedel, Jai Samuel Nielsen; Sambyal, Sanjeev Singh; Samsonov, Vladimir; Sandoval, Andres; Sano, Masato; Sarkar, Debojit; Sarkar, Nachiketa; Sarma, Pranjal; Sas, Mike Henry Petrus; Scapparone, Eugenio; Scarlassara, Fernando; Scharenberg, Rolf Paul; Schiaua, Claudiu Cornel; Schicker, Rainer Martin; Schmidt, Christian Joachim; Schmidt, Hans Rudolf; Schmidt, Martin; Schukraft, Jurgen; Schutz, Yves Roland; Schwarz, Kilian Eberhard; Schweda, Kai Oliver; Scioli, Gilda; Scomparin, Enrico; Scott, Rebecca Michelle; Sefcik, Michal; Seger, Janet Elizabeth; Sekiguchi, Yuko; Sekihata, Daiki; Selyuzhenkov, Ilya; Senosi, Kgotlaesele; Senyukov, Serhiy; Serradilla Rodriguez, Eulogio; Sett, Priyanka; Sevcenco, Adrian; Shabanov, Arseniy; Shabetai, Alexandre; Shadura, Oksana; Shahoyan, Ruben; Shangaraev, Artem; Sharma, Ankita; Sharma, Anjali; Sharma, Mona; Sharma, Monika; Sharma, Natasha; Sheikh, Ashik Ikbal; Shigaki, Kenta; Shou, Qiye; Shtejer Diaz, Katherin; Sibiryak, Yury; Siddhanta, Sabyasachi; Sielewicz, Krzysztof Marek; Siemiarczuk, Teodor; Silvermyr, David Olle Rickard; Silvestre, Catherine Micaela; Simatovic, Goran; Simonetti, Giuseppe; Singaraju, Rama Narayana; Singh, Ranbir; Singhal, Vikas; Sarkar - Sinha, Tinku; Sitar, Branislav; Sitta, Mario; Skaali, Bernhard; Slupecki, Maciej; Smirnov, Nikolai; Snellings, Raimond; Snellman, Tomas Wilhelm; Song, Jihye; Song, Myunggeun; Song, Zixuan; Soramel, Francesca; Sorensen, Soren Pontoppidan; Sozzi, Federica; Spiriti, Eleuterio; Sputowska, Iwona Anna; Srivastava, Brijesh Kumar; Stachel, Johanna; Stan, Ionel; Stankus, Paul; Stenlund, Evert Anders; Steyn, Gideon Francois; Stiller, Johannes Hendrik; Stocco, Diego; Strmen, Peter; Alarcon Do Passo Suaide, Alexandre; Sugitate, Toru; Suire, Christophe Pierre; Suleymanov, Mais Kazim Oglu; Suljic, Miljenko; Sultanov, Rishat; Sumbera, Michal; Sumowidagdo, Suharyo; Suzuki, Ken; Swain, Sagarika; Szabo, Alexander; Szarka, Imrich; Szczepankiewicz, Adam; Szymanski, Maciej Pawel; Tabassam, Uzma; Takahashi, Jun; Tambave, Ganesh Jagannath; Tanaka, Naoto; Tarhini, Mohamad; Tariq, Mohammad; Tarzila, Madalina-gabriela; Tauro, Arturo; Tejeda Munoz, Guillermo; Telesca, Adriana; Terasaki, Kohei; Terrevoli, Cristina; Teyssier, Boris; Thakur, Dhananjaya; Thomas, Deepa; Tieulent, Raphael Noel; Tikhonov, Anatoly; Timmins, Anthony Robert; Toia, Alberica; Tripathy, Sushanta; Trogolo, Stefano; Trombetta, Giuseppe; Trubnikov, Victor; Trzaska, Wladyslaw Henryk; Tsuji, Tomoya; Tumkin, Alexandr; Turrisi, Rosario; Tveter, Trine Spedstad; Ullaland, Kjetil; Umaka, Ejiro Naomi; Uras, Antonio; Usai, Gianluca; Utrobicic, Antonija; Vala, Martin; Van Der Maarel, Jasper; Van Hoorne, Jacobus Willem; Van Leeuwen, Marco; Vanat, Tomas; Vande Vyvre, Pierre; Varga, Dezso; Diozcora Vargas Trevino, Aurora; Vargyas, Marton; Varma, Raghava; Vasileiou, Maria; Vasiliev, Andrey; Vauthier, Astrid; Vazquez Doce, Oton; Vechernin, Vladimir; Veen, Annelies Marianne; Velure, Arild; Vercellin, Ermanno; Vergara Limon, Sergio; Vernet, Renaud; Vertesi, Robert; Vickovic, Linda; Vigolo, Sonia; Viinikainen, Jussi Samuli; Vilakazi, Zabulon; Villalobos Baillie, Orlando; Villatoro Tello, Abraham; Vinogradov, Alexander; Vinogradov, Leonid; Virgili, Tiziano; Vislavicius, Vytautas; Vodopyanov, Alexander; Volkl, Martin Andreas; Voloshin, Kirill; Voloshin, Sergey; Volpe, Giacomo; Von Haller, Barthelemy; Vorobyev, Ivan; Voscek, Dominik; Vranic, Danilo; Vrlakova, Janka; Wagner, Boris; Wagner, Jan; Wang, Hongkai; Wang, Mengliang; Watanabe, Daisuke; Watanabe, Yosuke; Weber, Michael; Weber, Steffen Georg; Weiser, Dennis Franz; Wessels, Johannes Peter; Westerhoff, Uwe; Whitehead, Andile Mothegi; Wiechula, Jens; Wikne, Jon; Wilk, Grzegorz Andrzej; Wilkinson, Jeremy John; Willems, Guido Alexander; Williams, Crispin; Windelband, Bernd Stefan; Winn, Michael Andreas; Yalcin, Serpil; Yang, Ping; Yano, Satoshi; Yin, Zhongbao; Yokoyama, Hiroki; Yoo, In-kwon; Yoon, Jin Hee; Yurchenko, Volodymyr; Zaccolo, Valentina; Zaman, Ali; Zampolli, Chiara; Correia Zanoli, Henrique Jose; Zaporozhets, Sergey; Zardoshti, Nima; Zarochentsev, Andrey; Zavada, Petr; Zavyalov, Nikolay; Zbroszczyk, Hanna Paulina; Zhalov, Mikhail; Zhang, Haitao; Zhang, Xiaoming; Zhang, Yonghong; Chunhui, Zhang; Zhang, Zuman; Zhao, Chengxin; Zhigareva, Natalia; Zhou, Daicui; Zhou, You; Zhou, Zhuo; Zhu, Hongsheng; Zhu, Jianhui; Zichichi, Antonino; Zimmermann, Alice; Zimmermann, Markus Bernhard; Zinovjev, Gennady; Zmeskal, Johann

    2017-09-08

    The measurement of two-particle angular correlations is a powerful tool to study jet quenching in a $p_{\\mathrm{T}}$ region inaccessible by direct jet identification. In these measurements pseudorapidity ($\\Delta\\eta$) and azimuthal differences ($\\Delta\\varphi$) are used to extract the shape of the near-side peak formed by particles associated to a higher $p_{\\mathrm{T}}$ trigger particle ($1 < p_{\\mathrm{T, trig}} <$ 8 GeV/c). A combined fit of the near-side peak and long-range correlations is applied to the data allowing the extraction of the centrality evolution of the peak shape in Pb--Pb collisions at $\\sqrt{s_{\\mathrm{NN}}}$ = 2.76 TeV. A significant broadening of the peak in the $\\Delta\\eta$ direction at low $p_{\\mathrm{T}}$ is found from peripheral to central collisions, which vanishes above 4 GeV/c, while in the $\\Delta\\varphi$ direction the peak is almost independent of centrality. For the 10\\% most central collisions and $1 < p_{\\mathrm{T, assoc}} <$ 2 GeV/c, $1 < p_{\\mathrm{T, trig}...

  2. Experiences of Vulnerable Residential Customer Subpopulations with Critical Peak Pricing

    Energy Technology Data Exchange (ETDEWEB)

    Cappers, Peter [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Spurlock, C. Anna [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Todd, Annika [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Jin, Ling [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States)

    2017-04-13

    DOE decided to co-fund ten utilities to undertake eleven experimentally-designed Consumer Behavior Studies (CBS) that proposed to examine a wide range of the topics of interest to the electric utility industry. Each chosen utility was to design, implement and evaluate their own study in order to address questions of interest both to itself and to its applicable regulatory authority, whose approval was generally necessary for the study to proceed. The DOE Office of Energy Delivery and Electricity Reliability (OE), however, did set guidelines, both in the FOA and subsequently during the contracting period, for what would constitute an acceptable study under the Grant. To assist in ensuring these guidelines were adhered to, OE requested that LBNL act as project manager for these Consumer Behavior Studies to achieve consistency of experimental design and adherence to data collection and reporting protocols across the ten utilities. As part of its role, LBNL formed technical advisory groups (TAG) to separately assist each of the utilities by providing technical assistance in all aspects of the design, implementation and evaluation of their studies. LBNL was also given a unique opportunity to perform a comprehensive, cross-study analysis that uses the customer-level interval meter and demographic data made available by these utilities due to SGIG-imposed reporting requirements, in order to analyze critical policy issues associated with AMI-enabled rates and control/information technology. LBNL will publish the results of these analyses in a series of research reports, of which this is one, that attempt to address critical policy issues relating to a variety of topics including customer acceptance, retention and load response to time-based rates and various forms of enabling control and information technologies. This report extends the existing empirical literature on the experiences of low-income customers exposed to critical peak pricing, and provides the first glimpses

  3. Calcium Isotope Analysis with "Peak Cut" Method on Column Chemistry

    Science.gov (United States)

    Zhu, H.; Zhang, Z.; Liu, F.; Li, X.

    2017-12-01

    To eliminate isobaric interferences from elemental and molecular isobars (e.g., 40K+, 48Ti+, 88Sr2+, 24Mg16O+, 27Al16O+) on Ca isotopes during mass determination, samples should be purified through ion-exchange column chemistry before analysis. However, large Ca isotopic fractionation has been observed during column chemistry (Russell and Papanastassiou, 1978; Zhu et al., 2016). Therefore, full recovery during column chemistry is greatly needed, otherwise uncertainties would be caused by poor recovery (Zhu et al., 2016). Generally, matrix effects could be enhanced by full recovery, as other elements might overlap with Ca cut during column chemistry. Matrix effects and full recovery are difficult to balance and both need to be considered for high-precision analysis of stable Ca isotopes. Here, we investigate the influence of poor recovery on δ44/40Ca using TIMS with the double spike technique. The δ44/40Ca values of IAPSO seawater, ML3B-G and BHVO-2 in different Ca subcats (e.g., 0-20, 20-40, 40-60, 60-80, 80-100%) with 20% Ca recovery on column chemistry display limited variation after correction by the 42Ca-43Ca double spike technique with the exponential law. Notably, δ44/40Ca of each Ca subcut is quite consistent with δ44/40Ca of Ca cut with full recovery within error. Our results indicate that the 42Ca-43Ca double spike technique can simultaneously correct both of the Ca isotopic fractionation that occurred during column chemistry and thermal ionization mass spectrometry (TIMS) determination properly, because both of the isotopic fractionation occurred during analysis follow the exponential law well. Therefore, we propose the "peak cut" method on Ca column chemistry for samples with complex matrix effects. Briefly, for samples with low Ca contents, we can add the double spike before column chemistry, and only collect the middle of the Ca eluate and abandon the both sides of Ca eluate that might overlap with other elements (e.g., K, Sr). This method would

  4. Seafloor characterisation using echo peak amplitudes of multibeam hydrosweep system - A preliminary study at Arabian Sea

    Digital Repository Service at National Institute of Oceanography (India)

    Chakraborty, B.; Sudhakar, T.

    In this paper an interface to acquire 59-beams echo peak amplitudes of the Hydrosweep Multibeam system is established. The echo peak amplitude values collected at varying seabed provinces of Arabian sea are presented. The study reveals...

  5. Determination of the full energy peak efficiency of NaI(Tl) detectors

    International Nuclear Information System (INIS)

    Cesana, A.; Terrani, M.

    1978-01-01

    A simple procedure for the accurate evaluation of the full energy peak efficiency of NaI(Tl) crystals is described. Particular attention is given to the peak to total ratio determination for which a new method is proposed. (author)

  6. Comparison of public peak detection algorithms for MALDI mass spectrometry data analysis.

    Science.gov (United States)

    Yang, Chao; He, Zengyou; Yu, Weichuan

    2009-01-06

    In mass spectrometry (MS) based proteomic data analysis, peak detection is an essential step for subsequent analysis. Recently, there has been significant progress in the development of various peak detection algorithms. However, neither a comprehensive survey nor an experimental comparison of these algorithms is yet available. The main objective of this paper is to provide such a survey and to compare the performance of single spectrum based peak detection methods. In general, we can decompose a peak detection procedure into three consequent parts: smoothing, baseline correction and peak finding. We first categorize existing peak detection algorithms according to the techniques used in different phases. Such a categorization reveals the differences and similarities among existing peak detection algorithms. Then, we choose five typical peak detection algorithms to conduct a comprehensive experimental study using both simulation data and real MALDI MS data. The results of comparison show that the continuous wavelet-based algorithm provides the best average performance.

  7. Reproducibility of peak filling and peak emptying rate determined by cardiovascular magnetic resonance imaging for assessment of biventricular systolic and diastolic dysfunction in patients with pulmonary arterial hypertension

    DEFF Research Database (Denmark)

    Göransson, Christoffer; Vejlstrup, Niels; Carlsen, Jørn

    2018-01-01

    Right ventricular (RV) and left ventricular (LV) diastolic stiffness may be independent contributors to disease progression in pulmonary arterial hypertension (PAH). The aims of this study are to assess reproducibility of peak emptying rate (PER) and early diastolic peak filling rate (PFR) for both...

  8. CERPI and CEREL, two computer codes for the automatic identification and determination of gamma emitters in thermal neutron activated samples

    International Nuclear Information System (INIS)

    Giannini, M.; Oliva, P.R.; Ramorino, C.

    1978-01-01

    A description is given of a computer code which automatically analyses gamma-ray spectra obtained with Ge(Li) detectors. The program contains features as automatic peak location and fitting, determination of peak energies and intensities, nuclide identification and calculation of masses and errors. Finally the results obtained with our computer code for a lunar sample are reported and briefly discussed

  9. The origin of a peak in the reststrahlen region of SiC

    International Nuclear Information System (INIS)

    Engelbrecht, J.A.A.; Rooyen, I.J. van; Henry, A.; Janzén, E.; Olivier, E.J.

    2012-01-01

    A peak in the reststrahlen region of SiC is analyzed in order to establish the origin of this peak. The peak can be associated with a thin damaged layer on the SiC wafers, and a relation is found between surface roughness and the height of this peak, by modeling the damaged layer as an additional layer when simulating the reflectivity from the wafers.

  10. The origin of a peak in the reststrahlen region of SiC

    Energy Technology Data Exchange (ETDEWEB)

    Engelbrecht, J.A.A., E-mail: Japie.Engelbrecht@nmmu.ac.za [Physics Department, Nelson Mandela Metropolitan University, PO Box 77000, Port Elizabeth 6031 (South Africa); Rooyen, I.J. van [Physics Department, Nelson Mandela Metropolitan University, PO Box 77000, Port Elizabeth 6031 (South Africa); Henry, A.; Janzen, E. [Department of Physics, Chemistry and Biology, Linkoeping University, SE-581 83 Linkoeping (Sweden); Olivier, E.J. [Physics Department, Nelson Mandela Metropolitan University, PO Box 77000, Port Elizabeth 6031 (South Africa)

    2012-05-15

    A peak in the reststrahlen region of SiC is analyzed in order to establish the origin of this peak. The peak can be associated with a thin damaged layer on the SiC wafers, and a relation is found between surface roughness and the height of this peak, by modeling the damaged layer as an additional layer when simulating the reflectivity from the wafers.

  11. Technology for computer-stabilized peak of NaI(Tl) gamma spectrum

    International Nuclear Information System (INIS)

    Chen Jianzhen; Guo Lanying; Ling Qiu; Qu Guopu; Zhao Lihong; Hu Chuangye

    2005-01-01

    An improved technology for spectrum stabilization of NaI(Tl) gamma spectrum was introduced. This technology is based on the system using a reference peak, which is equivalent gamma peak of 241 Am source. The computer seeks peak's position deviation and computes adjust value of programmable amplifier and controls programmable amplifier to stabilize spectrum by digital PID. This is a technology of spectrum stabilizing with 'hardware + reference-peak + software' and has high stability and fast speed of spectrum stabilizing. (author)

  12. Similarities in the dynamical behavior across the classical peak effect and the second magnetization peak in single crystals of 2H-NbSe2

    International Nuclear Information System (INIS)

    Thakur, A.D.; Ramakrishnan, S.; Grover, A.K.; Chandrasekhar Rao, T.V.; Uji, S.; Terashima, T.; Higgins, M.J.

    2005-01-01

    The classical peak effect (CPE) and the second magnetization peak (SMP) are two distinct anomalies in critical current of superconductors. A nascent pinned single crystal sample of 2HNbSe 2 (T c (0) ∼7.2 K) shows only the sharp CPE. In a moderately pinned sample (T c (0) ∼6 K), the sharp CPE broadens with the addition of characteristic structure (stepwise amorphization) between the onset and the peak positions of the CPE. Also, there emerges another anomalous peak akin to SMP prior to the CPE. We have looked at samples of 2H-NbSe 2 with intermediate levels of quenched random pinning (T c (0) ∼ 7.1 K) and successfully explored the two peaks down to 50 mK. (author)

  13. RICKI, Interactive Gamma Spectra Unfolding with Isotope Identification

    International Nuclear Information System (INIS)

    Proctor, A.E.

    1990-01-01

    1 - Description of program or function: RICKI is an interactive program for analysis of gamma spectra containing one or more peaks with possible multiplets. Algorithms are incorporated for peak fitting, analysis, and nuclide identification. Comprehensive output keeps the user informed of the analysis as it proceeds and presents the results. User-selectable options for plotting and neutron activation analysis are available to control this analysis. RICKI was developed to analyze spectra from examinations of severe fuel damage specimens. Two features included to streamline the analysis of Three Mile Island (TMI) core bore data are the edit of averaged activities and the output file created for generating a spreadsheet. Activity editing allows the user to select which gamma lines are used for a specific nuclide in average activity calculations. Contributions from peak areas which result from overlapping lines of two or more nuclides may be removed. For each averaged activity an edited activity file record is written containing the nuclide name, averaged activity, activity standard deviation, scan start position, and scan end position. 2 - Method of solution: The peak search algorithm utilizes an optimized second derivative filter for efficient and reliable determination of peak location. A linear Gaussian fitting technique, which is a modified version of Mukoyama's linear least squares fitting method in which the centroid, sigma, and peak height are free parameters, is used to calculate peak areas. An estimated background is computed for each peak using Gunnink's method. Nuclide activities are computed by matching centroids with nuclide library entries and averaging the activity calculated for each matching peak. 3 - Restrictions on the complexity of the problem - Maxima of: 500 gamma library entries, 80 peaks/spectrum

  14. Opportunity identification competence

    NARCIS (Netherlands)

    Baggen, Yvette

    2017-01-01

    Opportunities and their identification are of significant importance for competitiveness in today’s complex and turbulent business environment because they serve as a key influencing factor for new value-creation. Opportunity identification (OI) is interesting not only from the perspective of new

  15. Peak groundwater depletion in the High Plains Aquifer, projections from 1930 to 2110

    Science.gov (United States)

    Peak groundwater depletion from overtapping aquifers beyond recharge rates occurs as the depletion rate increases until a peak occurs followed by a decreasing trend as pumping equilibrates towards available recharge. The logistic equation of Hubbert’s study of peak oil is used to project measurement...

  16. Improved simulation of peak flows under climate change: post-processing or composite opjective calibration?

    NARCIS (Netherlands)

    Zhang, Xujie; Booij, Martijn J.; Xu, YuePing

    2015-01-01

    Climate change is expected to have large impacts on peak flows. However, there may be bias in the simulation of peak flows by hydrological models. This study aims to improve the simulation of peak flows under climate change in Lanjiang catchment, east China, by comparing two approaches:

  17. Improved Palmprint Identification System

    Directory of Open Access Journals (Sweden)

    Harshala C. Salave

    2015-03-01

    Full Text Available Abstract Generally private information is provided by using passwords or Personal Identification Numbers which is easy to implement but it is very easily stolen or forgotten or hack. In Biometrics for individuals identification uses human physiological which are constant throughout life like palm face DNA iris etc. or behavioral characteristicswhich is not constant in life like voice signature keystroke etc.. But mostly gain more attention to palmprint identification and is becoming more popular technique using for identification and promising alternatives to the traditional password or PIN based authentication techniques. In this paper propose palmprint identification using veins on the palm and fingers. Here use fusion of techniques such as Discrete Wavelet transformDWT Canny Edge Detector Gaussian Filter Principle Component AnalysisPCA.

  18. Remote spectroscopic identification of bloodstains

    NARCIS (Netherlands)

    Bremmer, Rolf H.; Edelman, Gerda; Vegter, Tessa Dijn; Bijvoets, Ted; Aalders, Maurice C. G.

    2011-01-01

    Blood detection and identification at crime scenes are crucial for harvesting forensic evidence. Unfortunately, most tests for the identification of blood are destructive and time consuming. We present a fast and nondestructive identification test for blood, using noncontact reflectance

  19. A Robust Formant Extraction Algorithm Combining Spectral Peak Picking and Root Polishing

    Directory of Open Access Journals (Sweden)

    Seo Kwang-deok

    2006-01-01

    Full Text Available We propose a robust formant extraction algorithm that combines the spectral peak picking, formants location examining for peak merger checking, and the root extraction methods. The spectral peak picking method is employed to locate the formant candidates, and the root extraction is used for solving the peak merger problem. The location and the distance between the extracted formants are also utilized to efficiently find out suspected peak mergers. The proposed algorithm does not require much computation, and is shown to be superior to previous formant extraction algorithms through extensive tests using TIMIT speech database.

  20. KiDS-450: cosmological constraints from weak-lensing peak statistics - II: Inference from shear peaks using N-body simulations

    Science.gov (United States)

    Martinet, Nicolas; Schneider, Peter; Hildebrandt, Hendrik; Shan, HuanYuan; Asgari, Marika; Dietrich, Jörg P.; Harnois-Déraps, Joachim; Erben, Thomas; Grado, Aniello; Heymans, Catherine; Hoekstra, Henk; Klaes, Dominik; Kuijken, Konrad; Merten, Julian; Nakajima, Reiko

    2018-02-01

    We study the statistics of peaks in a weak-lensing reconstructed mass map of the first 450 deg2 of the Kilo Degree Survey (KiDS-450). The map is computed with aperture masses directly applied to the shear field with an NFW-like compensated filter. We compare the peak statistics in the observations with that of simulations for various cosmologies to constrain the cosmological parameter S_8 = σ _8 √{Ω _m/0.3}, which probes the (Ωm, σ8) plane perpendicularly to its main degeneracy. We estimate S8 = 0.750 ± 0.059, using peaks in the signal-to-noise range 0 ≤ S/N ≤ 4, and accounting for various systematics, such as multiplicative shear bias, mean redshift bias, baryon feedback, intrinsic alignment, and shear-position coupling. These constraints are ˜ 25 per cent tighter than the constraints from the high significance peaks alone (3 ≤ S/N ≤ 4) which typically trace single-massive haloes. This demonstrates the gain of information from low-S/N peaks. However, we find that including S/N KiDS-450. Combining shear peaks with non-tomographic measurements of the shear two-point correlation functions yields a ˜20 per cent improvement in the uncertainty on S8 compared to the shear two-point correlation functions alone, highlighting the great potential of peaks as a cosmological probe.